U.S. patent application number 09/867947 was filed with the patent office on 2003-08-07 for retroviral vectors.
Invention is credited to Carroll, Miles William, Kim, Narry, Kingsman, Alan John, Mitrophanous, Kyriacos, Rohll, Jonathan.
Application Number | 20030147907 09/867947 |
Document ID | / |
Family ID | 26312829 |
Filed Date | 2003-08-07 |
United States Patent
Application |
20030147907 |
Kind Code |
A1 |
Kingsman, Alan John ; et
al. |
August 7, 2003 |
Retroviral vectors
Abstract
A retroviral vector derived from a non-primate lentivirus genome
comprising a deleted gag gene wherein the deletion in gag removes
one or more nucleotides downstream of nucleotide 350 of the gag
coding sequence.
Inventors: |
Kingsman, Alan John; (Oxon,
GB) ; Carroll, Miles William; (Oxon, GB) ;
Rohll, Jonathan; (Berkshire, GB) ; Mitrophanous,
Kyriacos; (Oxford, GB) ; Kim, Narry; (Seoul,
KR) |
Correspondence
Address: |
FROMMER LAWRENCE & HAUG
745 FIFTH AVENUE- 10TH FL.
NEW YORK
NY
10151
US
|
Family ID: |
26312829 |
Appl. No.: |
09/867947 |
Filed: |
May 29, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09867947 |
May 29, 2001 |
|
|
|
09238356 |
Jan 27, 1999 |
|
|
|
6312683 |
|
|
|
|
09238356 |
Jan 27, 1999 |
|
|
|
PCT/GB98/03876 |
Dec 22, 1998 |
|
|
|
Current U.S.
Class: |
424/187.1 ;
424/93.2; 435/320.1; 435/456 |
Current CPC
Class: |
C12N 2740/15043
20130101; C12N 7/00 20130101; C12N 2710/24143 20130101; C12N
2810/6081 20130101; C12N 2740/15062 20130101; C12N 2740/15052
20130101; A61K 48/00 20130101; C12N 15/86 20130101; C12N 2710/24144
20130101 |
Class at
Publication: |
424/187.1 ;
424/93.2; 435/456; 435/320.1 |
International
Class: |
A61K 048/00; A61K
039/21; C12N 015/867 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 22, 1997 |
GB |
9727135.7 |
May 22, 1998 |
GB |
9811037.2 |
Claims
1. A retroviral vector derived from a non-primate lentivirus genome
comprising a deleted gag gene wherein the deletion in gag removes
one or more nucleotides downstream of nucleotide 350 of the gag
coding sequence.
2. A retroviral vector according to claim 1 wherein the deletion
extends from nucleotide 350 to at least the C-terminus of the
gag-pol coding region.
3. A retroviral vector according to claim 1 or claim 2 wherein the
deletion additionally removes nucleotide 300 of the gag coding
region.
4. A retroviral vector according to claim 1 wherein the deletion
retains the first 150 nucleotides of the gag coding region.
5. A retroviral vector according to claim 1 wherein the deletion
retains the first 109 nucleotides of the gag coding region.
6. A retroviral vector according to claim 1 wherein the deletion
retains only the first 2 nucleotides of the gag coding region.
7. A retroviral vector derived from a non-primate lentivirus genome
wherein one or more accessory genes are absent from the non-primate
lentivirus genome.
8. A retroviral vector according to claim 7 wherein the accessory
genes are selected from dUTPase, S2, env and tat.
9. A retroviral vector derived from a lentivirus genome wherein the
non-primate lentivirus genome lacks the tat gene but includes the
leader sequences between the end of the 5' LTR and the ATG of
gag.
10. A retroviral vector according to any preceding claim which
comprises at least one component from an equinine lentivirus.
11. A retroviral vector according to claim 10 wherein the equinine
lentivirus is EIAV.
12. A retroviral vector according to claim 11 wherein the
retroviral vector is substantially derived from EIAV.
13. A retroviral vector production system for producing the
retroviral vector of any preceding claim comprising a packaging
cell comprising a gag-pol gene from a non-primate lentivirus and an
envelope gene.
14. A retroviral vector produced by the production system of claim
13.
15. A hybrid viral vector system comprising a primary viral vector
derived from a poxvirus and a second viral vector derived from a
retrovirus.
16. A retroviral particle obtainable from the retroviral vector of
any one of claims 1 to 12 or claim 14 or 15.
17. A cell transfected or transduced with a retroviral vector
according to any one of claims 1 to 12 or claim 14 or 15 or a
retroviral particle of claim 16.
18. A retroviral vector according to any one of claims 1 to 12 or
claim 14 or 15 or a retroviral particle of claim 16 or a cell
according to claim 17 for use in medicine.
19. Use of a retroviral vector according to any one of claims 1 to
12 or claim 14 or 15 or a retroviral particle of claim 16 or a cell
according to claim 17 for the manufacture of a pharmaceutical
composition to deliver an NOI to a target site in need of same.
20. A method comprising transfecting or transducing a cell with a
retroviral vector according to any one of claims 1 to 12 or claim
14 or 15 or a retroviral particle of claim 16 or by use of a cell
according to claim 17.
21. A delivery system in the form of a retroviral vector according
to any one of claims 1 to 12 or claim 14 or 15 or a retroviral
particle of claim 16 or a cell according to claim 17.
22. A delivery system for a retroviral vector according to any one
of claims 1 to 12 or claim 14 or 15 or a retroviral particle of
claim 16 or a cell according to claim 17 wherein the delivery
system comprises a non-retroviral expression vector, an adenovirus
and/or a plasmid.
23. A retroviral vector substantially as hereinbefore described
with reference to the accompanying Figures.
24. A retroviral vector production system substantially as
hereinbefore described with reference to the accompanying
Figures.
25. A retroviral particle substantially as hereinbefore described
with reference to the accompanying Figures.
26. A cell transfected or transduced with a retroviral vector
substantially as hereinbefore described with reference to the
accompanying Figures.
27. Use of a retroviral vector substantially as hereinbefore
described with reference to the accompanying Figures.
28. A method comprising transfecting or transducing a cell with a
retroviral vector substantially as hereinbefore described with
reference to the accompanying Figures.
29. A delivery system in the form of a retroviral vector
substantially as hereinbefore described with reference to the
accompanying Figures.
Description
[0001] This invention relates to a retroviral vector. In
particular, but not exclusively, it relates to retroviral vectors
capable of transferring genetic material to non-dividing or
slowly-dividing cells derived from non-primate lentiviruses.
[0002] There has been considerable interest, for some time, in the
development of retroviral vector systems based on lentiviruses, a
small subgroup of the retroviruses. This interest arises firstly
from the notion of using HIV-based vectors to target anti-HIV
therapeutic genes to HIV susceptible cells and secondly from the
prediction that, because lentiviruses are able to infect
non-dividing cells (Lewis & Emerman 1993 J. Virol. 68, 510),
vector systems based on these viruses would be able to transduce
non-dividing cells (e.g. Vile & Russel 1995 Brit. Med. Bull.
51, 12). Vector systems based on HIV have been produced
(Buchschacher & Panganiban 1992 J. Virol. 66, 2731) and they
have been used to transduce CD4+cells and, as anticipated,
non-diving cells (Naldini et al, 1996 Science 272, 263). In
addition lentiviral vectors enable very stable long-term expression
of the gene of interest. This has been shown to be at least three
months for transduced rat neuronal cells. The MLV based vectors
were only able to express the gene of interest for six weeks.
[0003] HIV-based vectors produced to date result in an integrated
provirus in the transduced cell that has HIV LTRs at its ends. This
limits the use of these vectors as the LTRs have to be used as
expression signals for any inserted gene unless an internal
promoter is used. The use of internal promoters has significant
disadvantages. The unpredictable outcome of placing additional
promoters within the retroviral LTR transcription unit is well
documented (Bowtell et al, 1988 J. Virol. 62, 2464; Correll et al,
1994 Blood 84, 1812; Emerman and Temin 1984 Cell 39, 459; Ghattas
et al, 1991 Mol. Cell. Biol. 11, 5848; Hantzopoulos et al, 1989
PNAS 86, 3519; Hatzoglou et al, 1991 J. Biol. Chem 266, 8416;
Hatzoglou et al, 1988 J. Biol. Chem 263, 17798; Li et al, 1992 Hum.
Gen. Ther. 3, 381; McLaichlin et al, 1993 Virol. 195, 1; Overell et
al, 1988 Mol. Cell Biol. 8, 1803; Scharfman et al, 1991 PNAS 88,
4626; Vile et al, 1994 Gene Ther 1, 307; Xu et al, 1989 Virol. 171,
331; Yee et al, 1987 PNAS 84, 5197). The factors involved appear to
include the relative position and orientation of the two promoters,
the nature of the promoters and the expressed genes and any
selection procedures that may be adopted. The presence of internal
promoters can affect both the transduction titers attainable from a
packaging cell line and the stability of the integrated vector.
[0004] HIV and other lentiviral LTRs have virus-specific
requirements for gene expression. For example, the HIV LTR is not
active in the absence of the viral Tat protein (Cullen 1995 AIDS 9,
S19). It is desirable, therefore, to modify the LTRs in such a way
as to change the requirements for gene expression. In particular
tissue specific gene expression signals may be required for some
gene therapy applications.
[0005] HIV vectors have a number of significant disadvantages which
may limit their therapeutic application to certain diseases. HIV-1
has the disadvantage of being a human pathogen carrying potentially
oncogenic proteins and sequences. There is the risk that
introduction of vector particles produced in packaging cells which
express HIV gag-pol will introduce these proteins into the patient
leading to seroconversion. For these reasons, there is a need to
develop lentiviral-based vectors which do not introduce HIV
proteins into patients.
[0006] We have now found it possible to provide an improved
lentiviral vector which overcomes the limitations of HIV-based
vectors. It is important in the development of any retroviral
vector system to remove sequences from the retroviral genome which
may inhibit the capacity of the vector to transfer heterologous
genes or which may transfer disadavantageous protein coding
sequences to the target cell. Retroviruses are limited in the
length of RNA sequences which can be packaged efficiently and so
the existence of long regions of the retroviral genome severely
limits the coding capacity of the vector for heterologous coding
RNA.
[0007] We have also found it possible to provide a lentiviral
vector based on a non-primate lentivirus which has a high coding
capacity for heterologous coding sequences and which has a reduced
capacity to transfer retroviral components to the target cell.
[0008] It has surprisingly been found that the amount of vector
genomic sequence required from a non-primate lentivirus to produce
an efficient cloning vector is substantially less than has been
described for an HIV-based vector.
[0009] The sequence requirements for packaging HIV vector genomes
are complex. The HIV-1 packaging signal encompasses the splice
donor site and contains a portion of the 5'-untranslated region of
the gag gene which has a putative secondary structure containing 4
short stem-loops. Additional sequences elsewhere in the genome are
also known to be important for efficient encapsidation of HV. For
example the first 350 bps of the gag protein coding sequence may
contribute to efficient packaging and ill defined regions of env
are also implicated. For the construction of HIV-vectors capable of
expressing heterologous genes, a packaging signal extending to 350
bps of the gag protein-coding region has been used. We have
surprisingly found that the structure of the packaging signal in
non-primate lentiviruses is entirely different from that of HIV.
Instead of a short sequence of 4 stem loops followed by an ill
defined region of gag and env sequences, we have discovered that a
shorter region of the gag gene suffices for efficient packaging.
Indeed deletion of larger regions of the gag gene in EIAV vectors
is advantageous and leads to higher titre viral vector being
produced. This information can be used to provide improved vectors
constructed from non-primate lentivirus sequences which have high
titre and advantageous features compared to HV vectors.
[0010] In a first aspect of the invention, there is provided a
retroviral vector genome containing a deleted gag gene from a
non-primate lentivirus wherein the deletion in gag removes one or
more nucleotides downstream of nucleotide 350 of the gag coding
sequence. Preferably the deletion extends from nucleotide 350 to at
least the C-terminus of the gagpol coding region. More preferably
the deletion additionally removes nucleotide 300 of the gag coding
region and most preferably the deletion retains only the first 150
nucleotides of the gag coding region. However even larger deletions
of gag can also be used, for example the gag coding region contains
the first 109 nucleotides of the gag coding region. It may also be
possible for the gag coding region to contain only the first 2
nucleotides of the gag coding region.
[0011] Additional features of the lentiviral genome are included in
the vector genome which are necessary for transduction of the
target cell; replication; reverse transcription and integration.
These are, at least, a portion of an LTR containing sequence from
the R-region and U5 region, sequences from the 3' LTR which contain
a polypurine tract (PT) and a 3' LTR from the non-primate
lentivirus or a hybrid LTR containing sequences from the
non-primate lentivirus and other elements. Optionally, the
retroviral genome may contain accessory genes derived from a
retrovirus, such as, but not limited to, a rev gene, a tat gene, a
vif gene, a nef gene, a vpr gene or an S2 gene. Additional
components may be added such as introns, splice-donor sites, a rev
responsive element (RRE), cloning sites and selectable marker
genes.
[0012] Moreover, we have now surprisingly demonstrated that a
non-primate lentivirus minimal vector system can be constructed
which requires neither S2, Tat, env nor dUTPase for either vector
production or for transduction of dividing and non-dividing
cells.
[0013] Thus according to another aspect the non-primate lentivirus
genome from which the vector is derived lacks one or more accessory
genes.
[0014] The deletion of accessory genes is highly advantageous.
Firstly, it permits vectors to be produced without the genes
normally associated with disease in lentiviral (e.g. HIV)
infections. In particular, tat and env are associated with disease.
Secondly, the deletion of accessory genes permits the vector to
package more heterologous DNA. Thirdly, genes whose function is
unknown, such as dUTPase and S2, may be omitted, thus reducing the
risk of causing undesired effects.
[0015] In addition, we have shown that the leader sequence of the
non-primate lentivirus genome is essential for high protein
expression of gag and gagpol.
[0016] Therefore in a further aspect the non-primate lentivirus
genome from which the vector is derived lacks the tat gene but
includes the leader sequence between the end of the 5' LTR and the
ATG of gag.
[0017] These data further define a minimal essential set of
functional components for an optimal lentiviral vector. A vector is
provided with maximal genetic capacity and high titre, but without
accessory genes that are either of unknown function (S2, UTPase),
and therefore may present risk, or are analogues of HIV proteins
that may be associated with AIDS (tat, env).
[0018] It will be appreciated that the present invention provides a
retroviral vector derived from a non-primate lentivirus genome (1)
comprising a deleted gag gene wherein the deletion in gag removes
one or more nucleotides downstream of nucleotide 350 of the gag
coding sequence; (2) wherein one or more accessory genes are absent
from the non-primate lentivirus genome; (3) wherein the non-primate
lentivirus genome lacks the tat gene but includes the leader
sequence between the end of the 5.zeta. LTR and the ATG of gag; and
combinations of (1), (2) and (3). In a preferred embodiment the
retroviral vector comprises all of features (1) and (2) and
(3).
[0019] A "non-primate" vector, as used herein, refers to a vector
derived from a virus which does not primarily infect primates,
especially humans. Thus, non-primate virus vectors include vectors
which infect non-primate mammals, such as dogs, sheep and horses,
reptiles, birds and insects.
[0020] A lentiviral or lentivirus vector, as used herein, is a
vector which comprises at least one component part derived from a
lentivirus. Preferably, that component part is involved in the
biological mechanisms by which the vector infects cells, expresses
genes or is replicated.
[0021] The non-primate lentivirus may be any member of the family
of lentiviridae which does not naturally infect a primate and may
include a feline immunodeficiency virus (F1v), a bovine
immunodeficiency virus (BIV), a caprine arthritis encephalitis
virus (CAEV), a Maedi visna virus (MVV) or an equine infectious
anaemia virus (EIAV). Preferably the lentivirus is an EIAV. Equine
infectious anaemia virus infects all equidae resulting in plasma
viremia and thrombocytopenia (Clabough, et al. 1991. J Virol.
65:6242-51). Virus replication is thought to be controlled by the
process of maturation of monocytes into macrophages.
[0022] EIAV has the simplest genomic structure of the lentiviruses.
In addition to the gag, pol and env genes EIAV encodes three other
genes: tat, rev, and S2. Tat acts as a transcriptional activator of
the viral LTR (Derse and Newboldl993 Virology. 194:530-6; Maury, et
al 1994 Virology. 200:632-42.) and Rev regulates and coordinates
the expression of viral genes through rev-response elements (RRE)
(Martarano et al 1994 J Virol. 68:3102-11.). The mechanisms of
action of these two proteins are thought to be broadly similar to
the analogous mechanisms in the primate viruses (Martano et al
ibid). The function of S2 is unknown. In addition, an EIAV protein,
Ttm, has been identified that is encoded by the first exon of tat
spliced to the env coding sequence at the start of the
transmembrane protein.
[0023] In addition to protease, reverse transcriptase and integrase
non-primate lentiviruses contain a fourth pol gene product which
codes for a dUTPase. This may play a role in the ability of these
lentiviruses to infect certain non-dividing cell types.
[0024] The viral RNA in the first aspect of the invention is
transcribed from a promoter, which may be of viral or non-viral
origin, but which is capable of directing expression in a
eukaryotic cell such as a mammalian cell. Optionally an enhancer is
added, either upstream of the promoter or downstream. The RNA
transcript is terminated at a polyadenylation site which may be the
one provided in the lentiviral 3.zeta. LTR or a different
polyadenylation signal.
[0025] Thus the present invention provides a DNA transcription unit
comprising a promoter and optionally an enhancer capable of
directing expression of a retroviral vector genome.
[0026] Transcription units as described herein comprise regions of
nucleic acid containing sequences capable of being transcribed.
Thus, sequences encoding MRNA, tRNA and rRNA are included within
this definition. The sequences may be in the sense or antisense
orientation with respect to the promoter. Antisense constructs can
be used to inhibit the expression of a gene in a cell according to
well-known techniques. Nucleic acids may be, for example,
ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or analogues
thereof. Sequences encoding mRNA will optionally include some or
all of 5' and/or 3' transcribed but untranslated flanking sequences
naturally, or otherwise, associated with the translated coding
sequence. It may optionally further include the associated
transcriptional control sequences normally associated with the
transcribed sequences, for example transcriptional stop signals,
polyadenylation sites and downstream enhancer elements. Nucleic
acids may comprise cDNA or genomic DNA (which may contain
introns).
[0027] The term "promoter" is used in the normal sense of the art,
e.g. an RNA polymerase binding site in the Jacob-Monod theory of
gene expression.
[0028] The term "enhancer" includes a DNA sequence which binds to
other protein components of the transcription initiation complex
and thus facilitates the initiation of transcription directed by
its associated promoter.
[0029] The promoter and enhancer of the transcription units
encoding the first viral vector component are preferably strongly
active, or capable of being strongly induced, in the producer cell
under conditions for production of the retroviral vector of the
present invention and/or in primary target cells under conditions
for production of the secondary viral vector. The promoter and
enhancer of the transcription units encoding the second viral
vector component are preferably strongly active, or capable of
being strongly induced, in the target cells. The promoter and/or
enhancer may be constitutively efficient, or may be tissue or
temporally restricted in their activity. Examples of suitable
tissue restricted promoters/enhancers are those which are highly
active in tumour cells such as a promoter/enhancer from a MUC1
gene, a CEA gene or a 5T4 antigen gene. Examples of temporally
restricted promoters/enhancers are those which are responsive to
ischaemia and/or hypoxia, such as hypoxia response elements or the
promoter/enhancer of a grp78 or a grp94 gene. One preferred
promoter-enhancer combination is a human cytomegalovirus (hCMV)
major immediate early (MIE) promoter/enhancer combination.
[0030] The LTRs may be altered in, for example, U3 (such as to
obtain strong constitutive expression, inducible expression or
tissue specific expression); R (such as to remove TAR stem loops);
or U5 (such as to use enhanced non-U5 based polyadenylation
signals, for example from the bovine growth hormone gene).
[0031] In one configuration the internal promoter cassette is
reversed and a polyadenylation signal is placed downstream of the
cassette.
[0032] In another embodiment the polyadenylation signal which is
used contains at least one intron.
[0033] The vector of the present invention may make use of
self-inactivating strategies. Self-inactivating retroviral vectors
have been constructed by deleting the transcriptional enhancers or
the enhancers and promoters in the U3 region of the 3' LTR. After
one round of vector replication, these changes are copied into both
the 5' and the 3' LTRs producing an inactive provirus. However, any
promoters internal to the LTRs in such vectors will still be
active. This strategy has been employed to eliminate effects of the
enhancers and promoters in the viral LTRs on transcription from
internally placed genes. Such effects include increased
transcription or suppression of transcription. This strategy can
also be used to eliminate downstream transcription from the 3' LTR
into genomic DNA. This is of particular concern in human gene
therapy where it is of critical importance to prevent any
activation of an endogenous oncogene.
[0034] Another type of self-inactivating vector has been
constructed that has direct repeats flanking the packaging signal
such that the packaging signal is frequently deleted during reverse
transcription, producing virus defective for packaging. With
sufficiently long direct repeats, a majority of resultant
proviruses lose their packaging sequences. The rate of deletion
could be increased to 100% by designing the vector so that
packaging signal deletion reconstituted the neo marker nad be
selecting the vector-infected cells in G418. This strategy may be
particularly useful for gene therapy applications where any spread
of the vector following gene transfer is undesirable.
[0035] In a further preferred embodiment of the first aspect of the
invention, one or more nucleotides of interest (NOI) is introduced
into the vector at the cloning site. Such therapeutic genes may be
expressed from a promoter placed in the retroviral LTR or may be
expressed from an internal promoter introduced at the cloning
site.
[0036] Suitable NOI coding sequences include those that are of
therapeutic and/or diagnostic application such as, but are not
limited to: sequences encoding cytokines, chemokines, hormones,
antibodies, engineered immunoglobulin-like molecules, a single
chain antibody, fusion proteins, enzymes, immune co-stimulatory
molecules, immunomodulatory molecules, anti-sense RNA, a
transdominant negative mutant of a target protein, a toxin, a
conditional toxin, an antigen, a tumour suppressor protein and
growth factors, membrane proteins, vasoactive proteins and
peptides, anti-viral proteins and ribozymes, and derivatives therof
(such as with an associated reporter group). When included, such
coding sequences may be typically operatively linked to a suitable
promoter, which may be a promoter driving expression of a
ribozyme(s), or a different promoter or promoters.
[0037] The NOI coding sequence may encode a fusion protein or a
segment of a coding sequence.
[0038] The retroviral vector of the present invention may be used
to deliver a NOI such as a pro-drug activating enzyme to a tumour
site for the treatment of a cancer. In each case, a suitable
pro-drug is used in the treatment of the individual (such as a
patient) in combination with the appropriate pro-drug activating
enzyme. An appropriate pro-drug is administered in conjunction with
the vector. Examples of pro-drugs include: etoposide phosphate
(with alkaline phosphatase, Senter et al 1988 Proc Natl Acad Sci
85: 4842-4846); 5-fluorocytosine (with cytosine deaminase, Mullen
et al 1994 Cancer Res 54: 1503-1506);
Doxorubicin-N-p-hydroxyphenoxyacetamide (with Penicillin-V-Amidase,
Kerr et al 1990 Cancer Immunol Immunother 31: 202-206);
Para-N-bis(2-chloroethyl) aminobenzoyl glutamate (with
carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates
(with .beta.-lactamase); SR4233 (with P450 Reducase); Ganciclovir
(with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci
85: 7572-7576); mustard pro-drugs with nitroreductase (Friedlos et
al 1997 J Med Chem 40: 1270-1275) and Cyclophosphamide (with P450
Chen et al 1996 Cancer Res 56: 1331-1340).
[0039] The vector of the present invention may be delivered to a
target site by a viral or a non-viral vector.
[0040] As it is well known in the art, a vector is a tool that
allows or faciliates the transfer of an entity from one environment
to another. By way of example, some vectors used in recombinant DNA
techniques allow entities, such as a segment of DNA (such as a
heterologous DNA segment, such as a heterologous cDNA segment), to
be transferred into a target cell. Optionally, once within the
target cell, the vector may then serve to maintain the heterologous
DNA within the cell or may act as a unit of DNA replication.
Examples of vectors used in recombinant DNA techniques include
plasmids, chromosomes, artificial chromosomes or viruses.
[0041] Non-viral delivery systems include but are not limted to DNA
transfection methods. Here, transfection includes a process using a
non-viral vector to deliver a gene to a target mammalian cell.
[0042] Typical transfection methods include electroporation, DNA
biolistics, lipid-mediated transfection, compacted DNA-mediated
transfection, liposomes, immunoliposomes, lipofectin, cationic
agent-mediated, cationic facial amphiphiles (CFAs) (Nature
Biotechnology 1996 14; 556), and combinations thereof.
[0043] Viral delivery systems include but are not limited to
adenovirus vector, an adeno-associated viral (AAV) vector, a herpes
viral vector, retroviral vector, lentiviral vector, baculoviral
vector. Other examples of vectors include ex vivo delivery systems,
which include but are not limited to DNA transfection methods such
as electroporation, DNA biolistics, lipid-mediated transfection,
compacted DNA-mediated transfection.
[0044] The term "retroviral vector particle" refers to the packaged
retroviral vector, that is preferably capable of binding to and
entering target cells. The components of the particle, as already
discussed for the vector, may be modified with respect to the wild
type retrovirus. For example, the Env proteins in the proteinaceous
coat of the particle may be genetically modified in order to alter
their targeting specificity or achieve some other desired
function.
[0045] Preferably, the viral vector preferentially transduces a
certain cell type or cell types.
[0046] More preferably, the viral vector is a targeted vector, that
is it has a tissue tropism which is altered compared to the native
virus, so that the vector is targeted to particular cells.
[0047] For retroviral vectors, this may be achieved by modifying
the Env protein. The Env protein of the retroviral secondary vector
needs to be a non-toxic envelope or an envelope which may be
produced in non-toxic amounts within the primary target cell, such
as for example a MMLV amphotropic envelope or a modified
amphotropic envelope. The safety feature in such a case is
preferably the deletion of regions or sequence homology between
retroviral components.
[0048] Preferably the envelope is one which allows transduction of
human cells. Examples of suitable env genes include, but are not
limited to, VSV-G, a MLV amphotropic env such as the 4070A env,
the-RD114 feline leukaemia virus env or haemagglutinin (HA) from an
influenza virus. The Env protein may be one which is capable of
binding to a receptor on a limited number of human cell types and
may be an engineered envelope containing targeting moieties. The
env and gag-pol coding sequences are transcribed from a promoter
and optionally an enhancer active in the chosen packaging cell line
and the transcription unit is terminated by a polyadenylation
signal. For example, if the packaging cell is a human cell, a
suitable promoter-enhancer combination is that from the human
cytomegalovirus major immediate early (hCMV-MIE) gene and a
polyadenylation signal from SV40 virus may be used. Other suitable
promoters and polyadenylation signals are known in the art.
[0049] The packaging cell may be an in vivo packaging cell in the
body of an individual to be treated-orit may be a cell cultured in
vitro such as a tissue culture cell line. Suitable cell lines
include mammalian cells such as murine fibroblast derived cell
lines or human cell lines. Preferably the packaging cell line is a
human cell line, such as for example: 293 cell line, HEK293, 293-T,
TE671, HT1080.
[0050] Alternatively, the packaging cell may be a cell derived from
the individual to be treated such as a monocyte, macrophage, stem
cells, blood cell or fibroblast. The cell may be isolated from an
individual and the packaging and vector components administered ex
vivo followed by re-administration of the autologous packaging
cells. Alternatively the packaging and vector components may be
administered to the packaging cell in vivo. Methods for introducing
retroviral packaging and vector components into cells of an
individual are known in the art. For example, one approach is to
introduce the different DNA sequences that are required to produce
a retroviral vector particle e.g. the env coding sequence, the
gag-pol coding sequence and the defective retroviral genome into
the cell simultaneously by transient triple transfection (Landau
& Littman 1992 J. Virol. 66, 5110; Soneoka et al 1995 Nucleic
Acids Res 23:628-633).
[0051] In one embodiment the vector configurations of the present
invention use as their production system, three transcription units
expressing a genome, the gag-pol components and an envelope. The
envelope expression cassette may include one of a number of
envelopes such as VSV-G or various murine retrovirus envelopes such
as 4070A.
[0052] Conventionally these three cassettes would be expressed from
three plasmids transiently transfected into an appropriate cell
line such as 293T or from integrated copies in a stable producer
cell line. An alternative approach is to use another virus as an
expression system for the three cassettes, for example baculovirus
or adenovirus. These are both nuclear expression systems. To date
the use of a poxvirus to express all of the components of a
retroviral or lentiviral vector system has not been described. In
particular, given the unusual codon usage of lentiviruses and their
requirement for RNA handling systems such as the rev/RRE system it
has not been clear whether incorporation of all three cassettes and
their subsequent expression in a vector that expresses in the
cytoplasm rather than the nucleus is feasible. Until now the
possibility remained that key nuclear factors and nuclear RNA
handling pathways would be required for expression of the vector
components and their function in the gene delivery vehicle. Here we
describe such a system and show that lentiviral components can be
made in the cytoplasm and that they assemble into functional gene
delivery systems. The advantage of this system is the ease with
which poxviruses can be handled, the high expression levels and the
ability to retain introns in the vector genomes.
[0053] According to another aspect therefore there is provided a
hybrid viral vector system for in vivo gene delivery, which system
comprises a primary viral vector which is obtainable from or is
based on a poxvirus and a second viral vector which is obtainable
from or is based on a vectroviral vector, preferably a lentiviral
vector, even more preferably a non-primate lentiviral vector.
[0054] The secondary vector may be produced from expression of
essential genes for retroviral vector production encoded in the DNA
of the primary vector. Such genes may include a gag-pol from a
retrovirus, an env gene from an enveloped virus and a defective
retroviral vector containing one or more therapeutic or diagnostic
NOI(s). The defective retroviral vector contains in general terms
sequences to enable reverse transcription, at least part of a 5'
long terminal repeat (LTR), at least part of a 3'LTR and a
packaging signal.
[0055] If it is desired to render the secondary vector replication
defective, that secondary vector may be encoded by a plurality of
transcription units, which may be located in a single or in two or
more adenoviral or other primary vectors.
[0056] In some therapeutic or experimental situations it may be
desirable to obviate the need to make EAIV derived from MVA in
vitro. MVA-EIAV hybrids are delivered directly into the
patient/animal e.g. MVA-EIAV is injected intravenously into the
tail vein of a mouse and this recombinant virus infects a variety
of murine tissues e.g. lung, spleen etc. Infected cells express
transduction competent EIAV containing a therapeutic gene for gene
therapy for example. EIAV vector particles bud from these cells and
transduce neighbouring cells. The transduced cell then contains an
integrated copy of the EIAV vector genome and expresses the
therapeutic gene product or other gene product of interest. If
expression of the therapeutic gene product is potentially toxic to
the host it may be regulated by a specific promoter, e.g. the
hypoxic response element (HRE), which will restrict expression to
those cells in a hypoxic environment. For gene therapy of
lung/trachea epithelium cells e.g to treat cystic fibrosis MVA-EIAV
may be given as an aerosol delivered intranasally. Alternatively,
macrophages can be transduced in vitro and then reintroduced to
create macrophage factories for EIAV-based vectors. Furthermore,
because MVA is replication incompetent MVA-EIAV hybrids could also
be used to treat immuno-suppressed hosts.
[0057] Vaccinia virus, the prototypic member of the orthopox genus
within the family poxviridae, was the first virus used for
expression of recombinant exogenous proteins (Mackett et al 1982,
Paoletti & Panicalli 1982). Vaccinia virus has a large DNA
genome of greater than 180 kb and reports indicate that it can
accommodate over 25 kb of foreign DNA (Merchlinsky & Moss
1992). Several other strains of poxviruses have been adapted as
recombinant expression vectors (for review see Carroll and Moss
1997) e.g. fowlpox (Taylor & Paoletti 1988), canarypox (Taylor
et al 1991), swinepox (van der Leek et al 1994) and entomopox (Li
et al 1997). Additionally, due to safety concerns, several highly
attenuated strains of vaccinia virus have been developed that are
compromised in human and other mammalian cells e.g. modified
vaccinia virus Ankara (MVA) (Mayr 1978, Sutter 1992), NYVAC
(Paoletti et al 1994), vaccinia virus deficient in a DNA
replication enzyme (Holzer et al 1997). These may all be used in
the present invention.
[0058] MVA was derived from a replication competent vaccinia
smallpox vaccine strain, Ankara. After >500 passages in chick
embryo fibroblast cells the virus isolate was shown to be highly
attenuated in a number of animal models including mice that were
immune deficient (Mayr et al 1978). The attenuated isolate, MVA,
was used to vaccinate over 120,000 people, many of which were
immunocompromised (Mahnel 1994) without adverse effects. Studies
illustrate that MVA can infect a wide range of mammalian cells but
productive infection has only been observed in Hamster kidney cell
BHK-21 (Carroll 1997). In all other tested mammalian cell lines
early expression, DNA replication and late expression are observed
leading to the production of non-infectious immature virus
particles (Carroll 1997, Meyer 1991). Virus replication studies
show that a minority of mammalian cells can support very low level
production of infectious virus i.e. BS-C-1 cells in which 1
infectious MVA particle is produced per cell (Carroll and Moss
1997). Late gene expression usually give rise to >10 fold more
protein that those genes under early promoters (Chakrabarti et al
1997, Wyatt et al 1996). In all other attenuated poxvirus strains
late gene expression is rarely observed in mammalian cells.
[0059] Production of retrovirus vector systems e.g. MLV-HIV and
lentivirus vector systems requires the construction of producer
lines that express the virus genome and essential structural
proteins to make transduction competent virus. Generally, this is a
relatively inefficient process which is further complicated when
the virus is pseudotyped with toxic envelope proteins such as
VSV-G. Expression of a functional genome and the required
structural proteins from within a recombinant poxvirus may obviate
many of the current inefficient retrovirus and lentivirus vector
production technologies. Additionally, such recombinant poxviruses
may be directly injected into patients to give rise to in vivo
production of retrovirus or lentivirus.
[0060] MVA is a particularly suitable poxvirus for the construction
of a pox-retrovirus or pox-lentivirus hybrid due to its
non-replicating phenotype and its ability to perform both early and
strong late expression for the production of high titre vector
preparations.
[0061] In order to produce a functional retrovirus or lentivirus
vector genome it is essential that the 5' of the RNA genome should
be exact (Cannon et al. 1996). This is a challenge in a
vaccinia-based production system as many of the vaccinia promoter
comprise downstream determinants of transcription efficiency
(Davison 1989b, Moss 1996). However, we show that thereare several
ways to solve this problem:
[0062] a. Use of a T7 promoter and T7 termination sequence.
[0063] b. Use of early promoters (in which sequences downstream of
the RNA start site are not highly conserved), (Davison 1989a).
[0064] c. Use of intermediate and late promoters of vaccinia which
require additional sequences downstream of the initiation site in
conjunction with strategies to generate an authentic 5' end or
which place the additional downstream sequences into both R
regions. There is a requirement for specific sequences of 4
nucleotides downstream of the initiation of transcription in the
late promoter (Davison 1989b, Moss 1996). In the first case a
ribozyme is placed downstream of the promoter and upstream of the R
region. The ribozyme is designed to cleave the RNA in cis to
generate the correct 5' end. In the second the approach is to
modify the R regions to incorporate the extra sequences. This must
be done in both the 5' and the 3' LTR R regions.
[0065] The advantage of having a T7 dependent system is that it
would require the infection of the cell by two recombinant vaccinia
viruses to produce transducing EIAV viral particles. For example,
one MVA could carry the vector genome, under the control of the T7
promoter and the gag/pol and the env sequences under the control of
the vaccinia promoters. The other MVA would carry the T7 polymerase
gene under the control of a vaccinia promoter (Wyatt et al
1995).
[0066] The retroviral vector particle according to the invention
will also be capable of transducing cells which are
slowly-dividing, and which non-lentiviruses such as MLV would not
be able to efficiently transduce. Slowly-dividing cells divide once
in about every three to four days including certain tumour cells.
Although tumours contain rapidly dividing cells, some tumour cells
especially those in the centre of the tumour, divide infrequently.
Alternatively the target cell may be a growth-arrested cell capable
of undergoing cell division such as a cell in a central portion of
a tumour mass or a stem cell such as a haematopoietic stem cell or
a CD34-positive cell. As a further alternative, the target cell may
be a precursor of a differentiated cell such as a monocyte
precursor, a CD33-positive cell, or a myeloid precursor. As a
further alternative, the target cell may be a differentiated cell
such as a neuron, astrocyte, glial cell, microglial cell,
macrophage, monocyte, epithelial cell, endothelial cell or
hepatocyte. Target cells may be transduced either in vitro after
isolation from a human individual or may be transduced directly in
vivo.
[0067] The delivery of one or more therapeutic genes by a vector
system according to the present invention may be used alone or in
combination with other treatments or components of the
treatment.
[0068] For example, the retroviral vector of the present invention
may be used to deliver one or more NOI(s) useful in the treatment
of the disorders listed in WO-A-98/05635. For ease of reference,
part of that list is now provided: cancer, inflammation or
inflammatory disease, dermatological disorders, fever,
cardiovascular effects, haemorrhage, coagulation and acute phase
response, cachexia, anorexia, acute infection, HIV infection, shock
states, graft-versus-host reactions, autoimmune disease,
reperfusion injury, meningitis, migraine and aspirin-dependent
anti-thrombosis; tumour growth, invasion and spread, angiogenesis,
metastases, malignant, ascites and malignant pleural effusion;
cerebral ischaemia, ischaemic heart disease, osteoarthritis,
rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis,
neurodegeneration, Alzheimer's disease, atherosclerosis, stroke,
vasculitis, Crohn's disease and ulcerative colitis; periodontitis,
gingivitis; psoriasis, atopic dermatitis, chronic ulcers,
epidermolysis bullosa; corneal ulceration, retinopathy and surgical
wound healing; rhinitis, allergic conjunctivitis, eczema,
anaphylaxis; restenosis, congestive heart failure, endometriosis,
atherosclerosis or endosclerosis.
[0069] In addition, or in the alternative, the retroviral vector of
the present invention may be used to deliver one or more NOI(s)
useful in the treatment of disorders listed in WO-A-98/07859. For
ease of reference, part of that list is now provided: cytokine and
cell proliferation/differentiation activity; immunosuppressant or
immunostimulant activity (e.g. for treating immune deficiency,
including infection with human immune deficiency virus; regulation
of lymphocyte growth; treating cancer and many autoimmune diseases,
and to prevent transplant rejection or induce tumour immunity);
regulation of haematopoiesis, e.g. treatment of myeloid or lymphoid
diseases; promoting growth of bone, cartilage, tendon, ligament and
nerve tissue, e.g. for healing wounds, treatment of burns, ulcers
and periodontal disease and neurodegeneration; inhibition or
activation of follicle-stimulating hormone (modulation of
fertility); chemotactic/chemokinetic activity (e.g. for mobilising
specific cell types to sites of injury or infection); haemostatic
and thrombolytic activity (e.g. for treating haemophilia and
stroke); antiinflammatory activity (for treating e.g. septic shock
or Crohn's disease); as antimicrobials; modulators of e.g.
metabolism or behaviour; as analgesics; treating specific
deficiency disorders; in treatment of e.g. psoriasis, in human or
veterinary medicine.
[0070] In addition, or in the alternative, the retroviral vector of
the present invention may be used to deliver one or more NOI(s)
useful in the treatment of disorders listed in WO-A-98/09985. For
ease of reference, part of that list is now provided: macrophage
inhibitory and/or T cell inhibitory activity and thus,
anti-inflammatory activity; anti-immune activity, i.e. inhibitory
effects against a cellular and/or humoral immune response,
including a response not associated with inflammation; inhibit the
ability of macrophages and T cells to adhere to extracellular
matrix components and fibronectin, as well as up-regulated fas
receptor expression in T cells; inhibit unwanted immune reaction
and inflammation including arthritis, including rheumatoid
arthritis, inflammation associated with hypersensitivity, allergic
reactions, asthma, systemic lupus erythematosus, collagen diseases
and other autoimmune diseases, inflammation associated with
atherosclerosis, arteriosclerosis, atherosclerotic heart disease,
reperfusion injury, cardiac arrest, myocardial infarction, vascular
inflammatory disorders, respiratory distress syndrome or other
cardiopulmonary diseases, inflammation associated with peptic
ulcer, ulcerative colitis and other diseases of the
gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other
hepatic diseases, thyroiditis or other glandular diseases,
glomerulonephritis or other renal and urologic diseases, otitis or
other oto-rhino-laryngological diseases, dermatitis or other dermal
diseases, periodontal diseases or other dental diseases, orchitis
or epididimo-orchitis, infertility, orchidal trauma or other
immune-related testicular diseases, placental dysfunction,
placental insufficiency, habitual abortion, eclampsia,
pre-eclampsia and other immune and/or inflammatory-related
gynaecological diseases, posterior uveitis, intermediate uveitis,
anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis,
optic neuritis, intraocular inflammation, e.g. retinitis or cystoid
macular oedema, sympathetic ophthalmia, scleritis, retinitis
pigmentosa, immune and inflammatory components of degenerative
fondus disease, inflammatory components of ocular trauma, ocular
inflammation caused by infection, proliferative
vitreo-retinopathies, acute ischaemic optic neuropathy, excessive
scarring, e.g. following glaucoma filtration operation, immune
and/or inflammation reaction against ocular implants and other
immune and inflammatory-related ophthalmic diseases, inflammation
associated with autoimmune diseases or conditions or disorders
where, both in the central nervous system (CNS) or in any other
organ, immune and/or inflammation suppression would be beneficial,
Parkinson's disease, complication and/or side effects from
treatment of Parkinson's disease, AIDS-related dementia complex
HIV-related encephalopathy, Devic's disease, Sydenham chorea,
Alzheimer's disease and other degenerative diseases, conditions or
disorders of the CNS, inflammatory components of stokes, post-polio
syndrome, immune and inflammatory components of psychiatric
disorders, myelitis, encephalitis, subacute sclerosing
pan-encephalitis, encephalomyelitis, acute neuropathy, subacute
neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham
chora, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome,
Huntington's disease, amyotrophic lateral sclerosis, inflammatory
components of CNS compression or CNS trauma or infections of the
CNS, inflammatory components of muscular atrophies and dystrophies,
and immune and inflammatory related diseases, conditions or
disorders of the central and peripheral nervous systems,
post-traumatic inflammation, septic shock, infectious diseases,
inflammatory complications or side effects of surgery, bone marrow
transplantation or other transplantation complications and/or side
effects, inflammatory and/or immune complications and side effects
of gene therapy, e.g. due to infection with a viral carrier, or
inflammation associated with AIDS, to suppress or inhibit a humoral
and/or cellular immune response, to treat or ameliorate monocyte or
leukocyte proliferative diseases, e.g. leukaemia, by reducing the
amount of monocytes or lymphocytes, for the prevention and/or
treatment of graft rejection in cases of transplantation of natural
or artificial cells, tissue and organs such as cornea, bone marrow,
organs, lenses, pacemakers, natural or artificial skin tissue.
[0071] The present invention also provides a pharmaceutical
composition for treating an individual by gene therapy, wherein the
composition comprises a therapeutically effective amount of the
retroviral vector of the present invention comprising one or more
deliverable therapeutic and/or diagnostic NOI(s) or a viral
particle produced by or obtained from same. The pharmaceutical
composition may be for human or animal usage. Typically, a
physician will determine the actual dosage which will be most
suitable for an individual subject and it will vary with the age,
weight and response of the particular individual.
[0072] The composition may optionally comprise a pharmaceutically
acceptable carrier, diluent, excipient or adjuvant. The choice of
pharmaceutical carrier, excipient or diluent can be selected with
regard to the intended route of administration and standard
pharmaceutical practice. The pharmaceutical compositions may
comprise as--or in addition to--the carrier, excipient or diluent
any suitable binder(s), lubricant(s), suspending agent(s), coating
agent(s), solubilising agent(s), and other carrier agents that may
aid or increase the viral entry into the target site (such as for
example a lipid delivery system).
[0073] Where appropriate, the pharmaceutical compositions can be
administered by any one or more of: inhalation, in the form of a
suppository or pessary, topically in the form of a lotion,
solution, cream, ointment or dusting powder, by use of a skin
patch, orally in the form of tablets containing excipients such as
starch or lactose, or in capsules or ovules either alone or in
admixture with excipients, or in the form of elixirs, solutions or
suspensions containing flavouring or colouring agents, or they can
be injected parenterally, for example intracavemosally,
intravenously, intramuscularly or subcutaneously. For parenteral
administration, the compositions may be best used in the form of a
sterile aqueous solution which may contain other substances, for
example enough salts or monosaccharides to make the solution
isotonic with blood. For buccal or sublingual administration the
compositions may be administered in the form of tablets or lozenges
which can be formulated in a conventional manner.
[0074] The delivery of one or more therapeutic genes by a vector
system according to the invention may be used alone or in
combination with other treatments or components of the treatment.
Diseases which may be treated include, but are not limited to:
cancer, neurological diseases, inherited diseases, heart disease,
stroke, arthritis, viral infections and diseases of the immune
system. Suitable therapeutic genes include those coding for tumour
suppressor proteins, enzymes, pro-drug activating enzymes,
immunomodulatory molecules, antibodies, engineered
immunoglobulin-like molecules, fusion proteins, hormones, membrane
proteins, vasoactive proteins or peptides, cytokines, chemokines,
anti-viral proteins, antisense RNA and ribozymes.
[0075] In a preferred embodiment of a method of treatment according
to the invention, a gene encoding a pro-drug activating enzyme is
delivered to a tumour using the vector system of the invention and
the individual is subsequently treated with an appropriate
pro-drug. Examples of pro-drugs include etoposide phosphate (used
with alkaline phosphatase Senter et al., 1988 Proc. Natl. Acad.
Sci. 85: 4842-4846); 5-fluorocytosine (with Cytosine deaminase
Mullen et al. 1994 Cancer Res. 54: 1503-1506);
Doxorubicin-N-p-hydroxyphenoxyacetamide (with Penicillin-V-Amidase
(Kerr et al. 1990 Cancer Immunol. Immunother. 31: 202-206);
Para-N-bis(2-chloroethyl) aminobenzoyl glutamate (with
Carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates
(with b-lactamase); SR4233 (with P450 Reducase); Ganciclovir (with
HSV thymidine kinase, Borrelli et al. 1988 Proc. Natl. Acad. Sci.
85: 7572-7576) mustard pro-drugs with nitroreductase (Friedlos et
al. 1997J Med Chem 40: 1270-1275) and Cyclophosphamide or
Ifosfamide (with a cytochrome P450 Chen et al. 1996 Cancer Res 56:
1331-1340).
[0076] In accordance with the invention, standard molecular biology
techniques may be used which are within the level of skill in the
art. Such techniques are fully described in the literature. See for
example; Sambrook et al (1989) Molecular Cloning; a laboratory
manual; Hames and Glover (1985-1997) DNA Cloning: a practical
approach, Volumes I-IV (second edition); Methods for the
engineering of immunoglobulin genes are given in McCafferty et al
(1996) "Antibody Engineering: A Practical Approach".
[0077] The invention will now be further described by way of
example in which reference is made to the following Figures in
which:
[0078] FIG. 1--shows the structure of transcription units from
plasmids pESP, pONY3 and pONY2.lnlsLacZ.
[0079] FIG. 2--shows a PCR analysis of integrated EIAV vector. PCR
was performed with either genomic DNA from EIAV vector transduced
cells (lanes 1 and 5) or mock transduced cells (lanes 2 and 6).
pONY2.lnlsLacZ (lanes 3 and 7) and pONY3 (lanes 4 and 8) were used
as controls. A. PCR detection of EIAV LTRs. B. PCR detection of
pol.
[0080] FIG. 3--shows the structure of vector transcription units in
deletion plasmids used to identify the packaging requirements for
an EIAV vector.
[0081] FIG. 4--shows a secondary structure prediction for the RNA
derived from the gag-transcription unit present in
pONY2.13LacZ.
[0082] FIG. 5 is a representation of vectors derived from the EIAV
genome.
[0083] FIG. 6 is a representation of gagpol constructs derived from
EIAV.
[0084] FIG. 7 is a representation of an EIAV vector comprising an
S2 deletion
[0085] FIG. 8 is a representation of EIAV gagpol constructs having
deleted S2 and dUTPase genes.
[0086] FIG. 9 is a representation of an EIAV minimal vector.
[0087] FIG. 10 illustrates a gel showing an analysis of EIAV gagpol
constructs according to the invention.
[0088] FIG. 11 shows examples of the pONY4 vectors.
[0089] FIG. 12 shows two SIN vectors.
[0090] FIG. 13 is a representation of a vector with a split polyA
signal.
[0091] FIG. 14 is a representation of a vector with a split polyA
signal.
[0092] FIG. 15 is a representation of a vector with a split polyA
signal.
[0093] FIG. 16 shows construction of pONY4-GFP with a split polyA
signal.
[0094] FIG. 17 shows construction of a MLV/EIAV vector.
[0095] FIG. 18 shows primers for construction of MLV/EIAV
vectors.
[0096] FIG. 19 shows complete sequence of pONY-mouse.
[0097] FIGS. 20 and 21 give PCR priming.
[0098] FIG. 22 shows pEMVA4 (after PCR with primers EMVA 1-8).
[0099] FIG. 23 shows pEMVA4.
[0100] FIG. 24 shows pEMVA5.
[0101] FIGS. 25 and 26 show an example of hammer-head strategy for
5' end formation.
[0102] FIG. 27 shows pEMVA6.
[0103] FIG. 28 shows pEMVA7 and pSyn pONY4.1.
[0104] FIG. 29 shows EMVA 10/11.
[0105] FIG. 30 shows pEMVA9.
[0106] FIG. 31 shows pEMVA10.
[0107] FIG. 32 shows pLWHORSE3.1.
[0108] FIG. 33 shows pMCRev.
[0109] FIG. 34 shows pYFVSVG.
[0110] FIG. 35 shows pYFAmpho.
[0111] FIG. 36 shows recombinant MVA constructs.
[0112] FIG. 37 shows the complete sequence of pSC65.
[0113] FIG. 38 shows the complete sequence of pLW22
[0114] In more detail, FIG. 1. Plasmids used in this study. The
genomic organization of EIAV is indicated including splice donor
(d1, d2 and d3) and splice acceptor sites (a1, a2 and a3). The
positions of gag, pol, env, tat, rev, S2 and the viral LTRs are
also shown. Plasmid pESP is an EIAV vector genome containing the
SV40 promoter and the puromycin resistance gene. Plasmid pONY3 is
an EIAV gagpol expression plasmid. pONY2.lnlslacZ is an EIAV vector
genome containing a HCMV IE enhancer/promoter and
.beta.-galactosidase gene (nlslacZ).
[0115] FIG. 2 shows PCR analysis of integrated EIAV vector. PCR was
performed with either genomic DNA from EIAV vector transduced cells
(lanes 1 and 5) or mock transduced cells (lanes 2 and 6).
pONY2.lnlsLacZ (lanes 3 and 7) and pONY3 (lanes 4 and 8) were used
as controls. A. PCR detection of EIAV LTRs. B. PCR detection of
pol.
[0116] TABLE 2. Transduction of dividing and non-dividing cells.
293T cells were treated with (open columns) or without (shaded
columns) aphidicolin according to the method of Lewis et al.
(Lewis, P. F., and M. Emerman. 1994. J Virol. 68:510-6.) and then
transduced with either EIAV vector PONY2.lnlsLacZ or MLV vector
HIT111 (Soneoka et al 1995 Nucl. Acids Res. 23:628-633). 48 hours
later the cells were stained with X-gal. Titers were averaged from
two independent experiments and calculated as lac Z colony forming
units per ml. There was no more than 10% variation between
experiments.
[0117] FIG. 10 shows analysis of gagpol expression constructs.
30%lg of total cellular protein was separated by SDS/Page
electrophoresis, transferred to nitro-cellulose and probed with
anti-EIAV antibodies. The secondary antibody was anti-Horse HRP
(Sigma). Titres were averaged from three independent experiments
and calulated as lacZ forming units per ml. There was no more than
10% variation between experiments. pONY2.lnlslacZ and the envelope
expression plasmids were co-transfected with the EIAV gagpol.
EXAMPLE 1
Construction of EIAV Vectors Containing Deleted Gag Genes
[0118] In order to construct a replication incompetent EIAV vector
system we have used, as a starting point, an infectious proviral
clone pSPEIAV19 (accession number: U01866), described by Payne et
al. (1994, J Gen Virol. 75:425-9). An initial EIAV based vector was
constructed by simply deleting part of env by removing a Hind
III/Hind III fragment corresponding to coordinates 5835/6571
according to the numbering system of Payne et al. (ibid.). This
fragment was replaced with the puromycin resistance gene under the
control of the SV40 early promoter from pTIN500 (Cannon et al 1996
J. Virol. 70:8234-8240) to create pESP (FIG. 1). Viral stocks were
produced by calcium phosphate transfection of 293T cells (Soneoka
et al 1995 Nucl. Acids Res. 23:628-633) with pESP and pRV67 (Kim et
al 1998 J. Virol. 72(1):811-6) a plasmid in which the vesicular
stomatitis virus glycoprotein (VSV-G) is expressed from the HCMV-IE
enhancer/promoter. Alternatively other VSV-G expression plasmids
can be used eg Yee, et al 1994 PNAS 91:9564-9568. The resulting
supernatant was used to transduce human kidney (293T) and canine
osteosarcoma cells (D17) as follows. 48 hours post-transfection
tissue culture fluid was collected and filtered through 0.45 cm
filters. Ten-fold dilutions were made in culture medium containing
polybrene at 8 .mu.g/ml and then 500 .mu.l aliquots placed on D17
cells seeded at 1.6.times.10.sup.5/well in 12 well plates on the
previous day. Two hours later 1 ml of culture media was added. Two
days later puromycin was added to a final concentration of 4 ug/ml
and incubation was continued for a further 7 days. As a positive
control, a Murine leukaemia virus (MLV) based vector (pTIN500)
containing the puromycin resistance gene under the control of the
SV40 early promoter was used in conjunction with pHIT60 (MLV
gagpol) and pRV67 (Cannon et al 1996 J. Virol. 70:8234-8240). No
resistance colonies were detected on either cell type after 7 days
of puromycin selection with the EIAV vector. The MLV vector
produced 5.0.times.10.sup.4 c.f.u./ml on 293T cells and
1.0.times.10.sup.4 c.f.u./ml on D17 cells.
[0119] The likely explanation for this result is that the EIAV LTR
is not functional in human cells in the absence of tat and so
insufficient amounts of the critical components such as gag-pol and
tat are produced.
[0120] A further vector system was therefore constructed comprising
three transcription units to produce the following: 1) vector
genome RNA; 2) env and 3) gag-pol. In order to ensure that
sufficient of each component is produced, the env and gag-pol
transcription units are transcribed from a promoter-enhancer active
in the chosen human packaging cell line. In this way, sufficient
gag-pol and, most likely tat, are produced to ensure efficient
production of transduction-competent vector particles.
[0121] The vector genome was constructed which has the reporter
gene within the pol region of the genome as follows. The plasmid
designated pONYl was constructed by inserting the EIAV LTR,
amplified by PCR from pSPEIAV19, into pBluescript II
KS+(Stratagene). The 5' LTR of EIAV clone pSPEIAV19 was PCR
amplified using pfu polymerase with the following primers:
[0122] 5' GCATGGACCTGTGGGGTTTTTATGAGG
[0123] 3' GCATGAGCTCTGTAGGATCTCGAACAGAC
[0124] The amplicon was blunt ended by 5' overhang fill-in and
inserted into pBluescript II KS+cut with Bss HII which had been
blunt ended by 3' overhand removal using T4 DNA polymerase. This
construct was called pONY1 and the orientation was 5' to 3' in
relation to .beta.-galactosidase of pBluescript II KS+. Sequencing
of pONY1 revealed no mutations.
[0125] Vector genome pSPEIAV19DH was cut with Mlu I (216/8124) and
inserted into pONY1 Mlu I cut (216) to make pONY2. A Bss HII digest
(619/792) of pBluescript II KS+ was carried out to obtain the
multiple cloning site. This was blunt ended by 5' overhang fill-in
and ligated to pONY2 cut with Bgl II and Nco I (1901/4949) and
blunt ended by 5' overhang fill-in. The orientation was 3' to 5' in
relation to the EIAV sequence. This was called pONY2.1. pSPCMV was
created by inserting pLNCX (Accession number: M28246) (Pst I/Hind
III) into pSP72 (Promega). The .beta.-galactosidase gene was
inserted from pTIN414 (Cannon PM et al J. Virol. 70, 8234-8240)
into pSP72 (Xho I/Sph I) to make pSPlacZ. The 5' end to the
.beta.-galactosidase gene was replaced by the SV40 T antigen
nuclear localization signal from pAD.RSVbgal (J. Clin. Invet.
90:626-630, 1992). pAD.RSVbgal was cut with Xho I/Cla I and
inserted into Xho I/Cla I pSPlacZ to make pSPnlslacZ. The CMV
nuclear localizing and non nuclear localizing .beta.-galactosidase
from pSPlacZ and pSPnlslacZ was cut out with Pst I and inserted
into the Pst I site of pONY2.1 in the 5' to 3' orientation of EIAV.
These were called pONY2. lnlslacZ and pONY2.1lacZ.
[0126] An EIAV gagpol expression plasmid (pONY3) was then made by
inserting Mlu I/Mlu I fragment from pONY.sup.2.DELTA.H into the
mammalian expression plasmid pCl-neo (Promega) such that the
gag-pol gene is expressed from the hCMV-MIE promoter-enhancer. In
particular, gagpol pSPEIAV19DH was cut with Mlu I (216/8124) and
inserted into pCI-Neo (Promega) Mlu I cut (216) to make pONY3.
Plasmid pONY3 should not produce a functional genome because it
lacks the appropriate LTR sequences. Virus was produced by
transient three plasmid cotransfection of 293T cells with pRV67,
pONY3 and pONY2.10nlsLacZ as described for MLV-based vectors
(Soneoka et al 1995 Nucl. Acids Res. 23:628-633) and then used to
transduce 293T cells and D17 cells as follows. 48 hours
post-transfection tissue culture fluid was collected and filtered
through 0.45,um filters. Ten-fold dilutions were made in culture
medium containing polybrene at 8 .mu.g/ml and then 500 ul aliquots
placed on D17 cells seeded at 1.6.times.10.sup.5/well in 12 well
plates on the previous day. Two hours later 1 ml of culture media
was added and incubation continued for 48 hours prior to assessment
of LacZ gene expression using the X-gal staining procedure. for E
coli .beta.-galactosidase (macGregor et al 1991 Methods in
Molecular Biology Vol 7 ed EJ Murray p217-235). In both cases the
virus transduced the cells at frequencies of about 10.sup.5
LacZ-transducing cell--forming--unit (i.f.u.)/ml which was about
10-fold less than with the MLV-based vector produced from pH111.
These data showed that we had produced an EIAV-based vector system
and also suggested that replacement of the Hind III/Hind III
fragment in env with foreign DNA may disrupt the function of the
genome.
[0127] We next characterized the ability of the EIAV vector
particles to be pseudotyped with envelope proteins from other
viruses. pONY2.10nlsLacZ and pONY3 were cotranfected with envelope
expression plasmids producing MLV amphotropic (pHIT456) and MLV
ecotropic (pHIT123) envelopes (Soneoka et al 1995 Nucl. Acids Res.
23:628-633) as well as VSV-G (pRV67) (Table 1). pHIT111 (MLV vector
genome) and pHIT60 (MLV gagpol expression plasmid) were
cotransfected with the envelope plasmids as positive controls
(Table 1). The viral supernatants were used to transduce a variety
of cell lines including human kidney (293T), murine embryo (NIH3T3)
and canine osteosarcoma (D17). As expected the cell tropism of the
virus was largely determined by the envelope. EIAV could be
pseudotyped with amphotropic envelope, but transduction
efficiencies varied. The amphotropic pseudotyped virus gave titres
of about 102 on D17 cells, 103 on NIH3T3 cells and 104 on 293T
cells. The reason for these differences was not pursued. EIAV could
also be pseudotyped with the MLV ecotropic envelope and these
viruses transduced NIH3T3 cells at titres of 104 l.f.u./ml. EIAV,
pseudotyped with VSV-G envelope, transduced all the cell lines
tested. The titer varied between the different envelopes and cell
types but overall efficiencies were relatively high for the
non-murine cells, but still lower than with a murine vector system.
Taken together, these data show that the EIAV vector system is not
dependent on the EIAV envelope and can be effectively pseudotyped
with three envelopes conferring broad host range. This makes this
system as generally useful as current MLV-based systems.
[0128] EIAV vectors can also be pseudotyped in the same manner
using the RD114 envelope, for instance using pRDF (Cosset et al
1995 J. Virol. 69: 7430-7436).
[0129] In order to characterize the transduction events further we
carried out a PCR analysis of 293T cells transduced by the EIAV
vector pseudotyped with VSV-G. In particular we asked if the vector
genome, as opposed to a recombinant with the gagpol expression
plasmid, pONY3, had been the transduction vehicle for the
.beta.-galactosidase gene. PCR amplification using primers specific
for the EIAV LTR gave the expected PCR product of 310 bp when
genomic DNA isolated from transduced cells was used (FIG. 2A, lane
1). No PCR product was detected when mock transduced 293T cell DNA
was used as template (FIG. 2A, lane 2). pONY2.10nlsLacZ was used as
a positive control (FIG. 2A, lane 3). No PCR product was detected
when pONY3 was used as a template (FIG. 2A, lane 4). The lack of a
PCR product, when using pol specific primers, (FIG. 2B) confirmed
that no gagpol sequences from pONY3 had integrated into the host
chromosomes. Taken together these data show that the authentic
vector genome had transduced the cells.
[0130] In order to determine if the EIAV vector retained the
ability to transduce non-dividing cells, 293T cells were arrested
in G1/S phase by treatment with aphidicolin according to published
procedures (Lewis and Emerman 1994) and then transduced with
EIAV-based and MLV-based vectors pseudotyped with VSV-G. The
transduction efficiency of the MLV vector was lower by four orders
of magnitude in aphidicolin treated cells as compared to untreated
cells. The incomplete block to cell transduction by MLV was
probably due to a small population of dividing cells. In contrast,
no significant difference was observed in the case of the
EIAV-based vector. This demonstrates that the EIAV vector, like HIV
vectors, can efficiently transduce non-dividing cells. The vector
genome pONY2.10lacZ contains 1377 nt of gag. RNA secondary
structure prediction ("http://www.ibc.wustl.edu/.about.zuker/rna/")
was used to identify possible stem-loop structures within the
leader and the 5' end of gag. Based on these predictions four
deletions were made within the gag region of pONY2.10lacZ (FIG. 1).
Deletions were made by PCR mutagenesis using standard
techniques.
[0131] pONY2.1lacZ contains 1377 nt of gag (deleted from position
1901 nt)
[0132] pONY2.11lacZ contains 354 nt of gag (deleted from position
878 nt)
[0133] pONY2.12lacZ contains 184 nt of gag (deleted from position
708 nt)
[0134] pONY2.13lacZ contains 109 nt of gag (deleted from position
633 nt)
[0135] pONY2.14lacZ contains 2 nt of gag (deleted from position 526
nt)
[0136] These vectors were used in a three plasmid cotransfection as
described for MLV-based vectors (Soneoka et al 1995 Nucl. Acids
Res. 23:628-633) and the virus generated was titred on 293T and D17
cells.
[0137] It was found that the first 109 nt of gag coding sequence
were needed for maximal packaging in addition to the un-translated
region; pONY2.13lacz (Table 2). Similar titres were found on D17
cells. The predicted secondary structure of the gag sequence
derived RNA in pONY2.13lacZ is shown in FIG. 4.
[0138] Based on the secondary structure prediction in FIG. 4, four
further deletions were made within the area upstream and downstream
of the major splice donor codon in pONY2.13lacZ.
[0139] pONY2.2lacZ contains deleted between position 409 to 421
nt
[0140] pONY2.22lacZ contains deleted between position 424 to 463
nt
[0141] pONY2.23lacZ contains deleted between position 470 to 524
nt
[0142] pONY2.24lacZ contains deleted between position 529 to 582
nt
[0143] pONY2.25lacZ contains deleted between position 584 to 645
nt
[0144] pONY2.26lacZ contains deleted between position 409 to 421 nt
and between position 470 to 542 nt.
[0145] These vectors were used in a three plasmid co-transfection
as described above and the virus generated was titred on D17 cells.
It was found that deletions within this region severely affected
the titre of the virus (Table 3). Constructs pONY2.23 and 2.26 gave
the lowest titre. These both contained the deletion between
position 470 to 524 nt. The least severe deletion was the one
between position 409 to 421 nt. Based on this information the
region around the major splice donor is useful for optimal
packaging.
[0146] Similar secondary structure predictions and deletion
analysis may be used to identify the packaging signal in other
non-primate lentiviruses.
1TABLE 1 Transduction efficiency of viral vectors. Titer
(l.f.u./ml).sup.a Vector Envelope D17 NIH3T3 293T pONY2.1nlslacZ
Mock <1 <1 <1 pONY2.1nlslacZ pHIT456 1.0 .times. 10.sup.2
8.4 .times. 10.sup.2 2.0 .times. 10.sup.4 (MLVamp) pONY2.1nlslacZ
pHIT123 <1 1.5 .times. 10.sup.4 <1 (MLVeco) pONY2.1nlslacZ
pRV67 (VSVG) 1.0 .times. 10.sup.5 3.6 .times. 10.sup.3 2.0 .times.
10.sup.5 pHIT111 Mock <1 <1 <1 pHIT111 pHIT456 1.3 .times.
10.sup.5 2.6 .times. 10.sup.6 2.0 .times. 10.sup.7 (MLVamp) pHIT111
pHIT123 <1 2.8 .times. 10.sup.6 <1 (MLVeco) pHIT111 pRV67
(VSVG) 3.0 .times. 10.sup.6 2.0 .times. 10.sup.5 5.0 .times.
10.sup.6 .sup.aEach cell type was transduced and stained for
.beta.-galactosidase activity 48 hours after transduction of the
target cells. Titers were averaged from three independent
experiments and calculated as lac Z forming units per ml. There was
no more than 10% variation between experiments. pONY2.1nlsLacZ and
the envelope expression plasmids were contransfected with the EIAV
gagpol expression plasmid (pONY3). pHIT111 and the envelope
expression plasmids were cotransfected with the MLV gagpol
expression plasmid (pHIT60).
[0147]
2 TABLE 2 Vector Titre Genome (l.f.u/ml) PONY2.10 3.30E + 04
PONY2.11 1.60E + 05 PONY2.12 1.40E + 05 PONY2.13 1.70E + 05
PONY2.14 5.40E + 02 Mock 1.0E + 01
[0148]
3 TABLE 3 Vector Titre Genome (l.f.u/ml) 2.21 1.20E + 04 2.22 3.80E
+ 03 2.23 1.20E + 02 2.24 5.20E + 02 2.25 5.60E + 02 2.26 1.00E +
02 2.13 4.00E + 04
EXAMPLE 2
Construction of pEGASUS-1
[0149] An EIAV--based vector was made (pEGASUS-1) that contains
only 759 nt of EIAV sequences (268 nt-675 nt and 7942 nt-8292 nt)
as follows.
[0150] Sequences encompassing the EIAV polypurine tract (PPT) and
the 3'LTR were obtained by PCR amplification from pONY2.10LacZ
using primers PPTEIAV+(Y8198): GACTACGACTAGTGTATGTTTAGAAAAACAAGG,
and 3'NEGSpeI (Y8199):CTAGGCTACTAGTACTGTAGGATCTCGAACAG. The product
was purified, digested with SpeI (ACTAGT) and ligated into pBS II
KS+ which had been prepared by digestion with SpeI and treatment
with alkaline phosphatase. Colonies obtained following
transformation into E. coli, XL-1Blue were screened for the
presence of the 3'LTR in the orientation in which the U5 region of
the 3'LTR was proximal to the NotI site of the pBS II KS+linker.
The sequence of the cloned insert was determined and showed that it
contained only one change from the EIAV clone pSPEIAV19 (AC:
U01866). This was a `C` insertion between bases 3 and 4 of the R
region. The same change was found in the template used in the PCR
reaction. The clone was termed pBS.3'LTR.
[0151] Next the reporter gene cassette, CMV promoter/LacZ, was
introduced into the PstI site of pBS.3'-LIR. The CMV/LacZ cassette
was obtained as a PstI fragment from pONY2.10LacZ (see above). The
ligation reaction to join the above fragments was transformed into
E. coli, XL-1Blue. A number of clones in which the CMV/LacZ insert
was orientated so that the LacZ gene was proximal to the 3'LTR were
assessed for activity of the CMV/LacZ cassette by transfection into
the cell line 293T using standard procedures. A clone which gave
blue cells at 48 hours post-transfection following development with
X-gal was selected for further use and termed pBS
CMVLacZ.3'LTR.
[0152] The 5'region of the EIAV vector was constructed in the
expression vector pCIEneo which is a derivative of pCIneo (Promega)
modified by the inclusion of approximately 400 base pairs derived
from the 5'end of the full CMV promoter as defined previously. This
400 base pair fragment was obtained by PCR amplifcation using
primers VSAT1 (GGGCTATATGAGATCTTGAATAA- TAAAATGTGT) and VSAT2
(TATTAATAACTAGT) and pHFT60 as template. The product was digested
with BglII and SpeI and ligated into pCIneo which had been digested
similarly.
[0153] A fragment of the EIAV genome running from the R region to
nt 150 of the gag coding region (nt 268--to 675) was amplified with
primers CMV5'EIAV2
(Z0591)(GCTACGCAGAGCTCGTTTAGTGAACCGGGCACTCAGATTCTG: and 3'PSI.NEG
(GCTGAGCTCTAGAGTCCTTTTCTTTTACAAAGTTGG) using as template DNA. The
5'region of the primer CMV5'EIAV2 contains the sequences
immediately upstream of the CMV promoter transcriptional start site
and can be cut with SacI. 3'PSI.NEG binds 3' of the EIAV packaging
sequences as defined by deletion analysis (above) and contains an
XbaI site. The PCR product was trimmed with SacI and XbaI and
ligated into pCIEneo which had been prepared for ligation by
digestion with the same enzymes. This manipulation places the start
of the EIAV R region at the transcriptional start point of the CMV
promoter and transcripts produced thus start at the genuine start
position used by EIAV and extend to the 3'-side of the packaging
signal. Clones which appeared to be correct as assessed by
restriction analysis were sequenced. A clone termed pCIEneo.5'EIAV
was selected for further work.
[0154] In the next step the CMVLacZ and 3'LTR cassette in
pBS.CMVLacZ.3'LTR was introduced into pCIEneo.5'EIAV.
pBS.CMVLacZ.3'LTR was digested with ApaI, the 3' overhangs removed
with T4 DNA polymerase, then digested with NotI. The fragment
containing the CMVLacZ.3'LTR was purified by standard molecular
biology techniques. The vector for ligation with this fragment was
prepared from pCIEneo.5'EIAV by digestion with SalI, followed by
filling-in of the 5' overhangs using T4 DNA polymerase. The DNA was
then digested with NotI and purified prior to use in ligation
reactions. Following transformation into E. coli, XL-1Blue colonies
were screened for the presence of the insert by restriction
analysis to identify the required clone, designated pEGASUS-1.
[0155] The function of the pEGASUS-1 EIAV vector was compared to
pONY2.10LacZ using the three plasmid co-transfection system as
described in Example 1. Comparable titres were obtained from both
vectors indicating that pEGASUS-1 contains all the sequences
required for packaging with good efficiency.
EXAMPLE 3
Introduction of RRE's into EIAV Vectors
[0156] Further improvements to the EIAV vector pEGASUS-1 may be
made by introduction of additional elements to improve titre. A
convenient site for the introduction of such elements is the SalI
site which lies between the XbaI to the 3' of the packaging signal
and upstream of the CMV/LacZ cassette of pEGASUS-1. For example the
RRE from HV or EIAV can be inserted at this site.
[0157] The HIV-1 RRE was obtained from the HIV-1 molecular clone
pWI3 (Kimpton and Emerman 1992 (J. Virol. 66: 2232-2239) by PCR
amplification using primers RRE(+) GTCGCTGAGGTCGACAAGGCAAAGAGAAGAG
and RRE(-) GACCGGTACCGTCGACAAGGCACAGCAGTGG. The fragment of DNA and
pEGASUS-1 were digested with SalI and following ligation,
transformed into E. coli, XL-1 Blue. Colonies were screened for the
presence of the HIV RRE and two clones, with the HIV RRE in either
the positive or negative orientation, used for further work These
vectors, pEGASUS-2.HIV RRE(+) or pEGASUS-2.HIV RRE(-) can be tested
in 293T cells by carrying out a four plasmid co-transfection in
which the plasmid pCIneoHIVrev, expressing the rev protein from
HIV-1 is co-transfected with vector, pONY3 and pRV67 plasmids
[0158] The EIAV RRE as defined previously (Martarano et al 1994)
was obtained by PCR amplification as follows. Using pONY2.10LacZ as
template 2 amplifications were performed to obtain the two parts of
the EIAV RRE. The 5'-element was obtained using primers ERRE1
(TTCTGTCGACGAATCCCAGGGGGA- ATCTCAAC) and ERRE2
(GTCACCTTCCAGAGGGCCCTGGCTAAGCATAACAG) and the 3'element with ERRE3
(CTGTTATGCTTAGCCAGGGCCCTCTGGAAGGTGAC) and ERRE4
(AATTGCTGACCCCCAAAATAGCCATAAG). These products will anneal to each
other hence can be used in second PCR reaction to obtain a DNA
which `encodes` the EIAV RRE. The PCR amplification is set up with
out primers ERRE1 and ERRE4 for the first 10 cycles and then these
primers are added to the reaction and a further 10 cycles of
amplification carried out. The resulting PCR product and pEGASUS-1
were digested with SalI, ligated and transformed into E. coli
XL-1Blue. Clones in which the EIAV RRE was in either the positive
or negative orientations were selected for further work. The
activity of these vectors was assessed in 4-way co-transfectioand
pEGASUS-1 were digested with SalI, ligated and transformed into E.
coli XL-1Blue. Clones in which the EIAV RRE was in either the
positive or negative orientations were selected for further work.
The activity of these vectors was assessed in three palsmid
co-transfections, (EIAV rev being supplied by pONY3) or in
4-plasmid co-transfection experiments as described above, but using
pCIneo.EIAV Rev to supply additional EIAV rev.
[0159] For construction of pCIneo EIAV REV the EIAV REV encoding
sequences were derived by PCR amplification. The EIAV REV sequences
were obtained using a two step `overlapping` PCR amplification
procedure as described above for the EIAV RRE. Template for the two
reactions was pONY3 and primers for the 5'fragment were EIAV REV
REV 5'O(CCATGCACGTCTGCAGCCAGCATG- GCAGAATCGAAG) and EAIV REV IN
(CCTGAGGATCTATTTTCCACCAGTCATTTC) and for the 3'product EIAV REV IP
(GTGGAAAATAGATCCTCAGGGCCCTCTGG) and EIAV.REV3'O
(GCAGTGCCGGATCCTCATAAATGTTTCCTCCTTCG). The second PCR amplification
was carried out with primers EIAV REV5'O and EIAV REV3'O being
added after 10 cycles. The resulting product was ligated with the
PCR fragment `TA` cloning vector pCR2.1 (Invitrogen) the
orientation of the EIAV REV insert was assessed by restriction
enzyme analysis and the presence of the correct EIAV REV sequence
confirmed. The construct was called pTopoRevpos. The EIAV REV
insert was excised from pTopoRevpos by digestion with SpeI and NotI
and ligated into pCIneo which had been digested with NheI and
NotI.
EXAMPLE 4
Transduction of Human Macrophages
[0160] Primary human monocytes were obtained from
leukocyte-enriched blood (from the National Blood Transfusion
Service, Southmead Rd Bristol, UK) as follows. Peripheral blood
mononuclear cells (PBMC) were enriched by centrifugation above a
Ficoll discontinuous gradient (Pharmacia) according to the
manufacturer's instructions Macrophages were obtained from this
cell population by adherence to tissue culture plastic over 7 days
in RPM! 1640 medium (Dutch modified; Sigma) containing 2%
heat-inactivated human AB serum (Sigma) or 10% FCS (Sigma).
Non-adherent cells were removed by extensive washing of the plates
with medium.
[0161] Virus for transduction experiments was obtained by three
plasmid co-transfection into 293T cells. The vector for the
experiments was a pONY2.13 derivative in which the CMV/LacZ
reporter cassette had been replaced with CMV/green fluorescent
protein (GFP).
[0162] Vector pONY2.13GFP was made as follows. The sequence
encoding the red-shifted GFP and eukaryotic translation signals was
cut out of pEGFP-N1 (Clontech "http://www.clontech.com/") with
BglII and XbaI and ligated into the general cloning vector pSP72
(Promega) which had been prepared by digestion with the same
enzymes. The GFP-encoding sequences were then excised using XhoI
and ligated into pONY2.13 which had been cut with XhoI (thereby
releasing the LacZ coding region). Following transformation into E.
coli, XL-1Blue clones in which the orientation of the GFP insert
with respect to the CMV promoter was such that expression would be
expected were determined restriction analysis and expression of GFP
confirmed by transfection of DNA into 293T cells.
[0163] Vector was recovered by three plasmid co-transfection into
293T cells and harvested at 42-48 hours post-transfection: tissue
culture fluid was 0.45(m-filtered and virus was then pelleted by
centrifugation at 50,000 g (20 Krpm), for 90 minutes at 4(C in a
SW40Ti rotor. Virus was resupended in 50-100(1 of complete media
for 2 hours and then used in transduction experiments.
Transductions with pONY2.13GFP vector were carried out as follows.
Macrophages, seeded at 5.times.10.sup.5 per well of 48-well plates
were washed once with medium and then 300 (l of medium was put back
on the cells. Virus was added to the medium and gently pipetted up
2-3 times to ensure mixing. Transduction efficiency was assessed at
3-5 days post-transduction. The number of transduced macrophages
was determined using a fluorescence microscope. Expression of GFP
can be monitored for extended periods, e.g., up to several weeks.
Alternatively, transductions can be carried out with vectors
carrying the LacZ marker. In such experiments the transduction
frequency is assessed by detecting the presence of
.beta.-galactosidase using immunological procedures.
EXAMPLE 5
Introduction of EIAV Vectors in vivo in Rat Brain
[0164] Adult Wistar rats were anaesthetised with a solution
containing 1 part Nembutal (0.1 ml/35 gm body weight) 1 part
Novetal (0.1 ml/35 gm body weight) and 2 parts dH2O, and placed
into a stereotaxic apparatus. A midline incision was made along the
rostral-to-caudal length of the scalp and the skin deflected back
to expose the skull. Using stereotaxic coordinates (measured from
Bregma) of 3.00 mm posterior and 3.00 lateral, a 1 mm diameter hole
was drilled into the skull. Unilateral intracortical injections of
EIAV vectors were then made using a 10 .mu.l Hamilton syringe or a
1.0 .mu.l fine glass capillary to various depths from the surface
of the brain. The syringe was left in place an additional 5 min to
prevent reflux. Control animals receive a single 10 .mu.l
intracortical injection of saline with the Hamilton or 1.0 .mu.l
with the fine glass capillary. Animals were then sutured and left
to recover. Forty-eight hours later, these animals were deeply
anesthetized as described above and perfused through the heart with
200 ml of phosphate-buffered saline (PBS). The brains were then
dissected out, frozen into dry-ice cooled isopentane (-30.degree.
C.) and cut coronally at 10 .mu.m with a cryostat. Every 5th
section through the injection site and 2 mm rostral and caudal are
collected onto Super-Frost slides, fixed and either X-gal or
immunostained or stained with Cresyl Violet.
EXAMPLE 6
Transduction of Bronchial Cells Differentiated in Culture
[0165] Epithelial cells can be differentiated to form
epithelia-like monolayers which display (>1000 .OMEGA. cm.sup.3)
electrical resistance and a cuboidal morphology. There are various
wasys to do this for example Fuller et al 1984.This creates
polarized cells. This polarity is functional and mimics epithelial
cells in vivo. Thus EIAV vectors can be used to transduce these
cells either through the basolateral surface or the apical surface
using vectors and preparations as described in Examples 1-3.
EXAMPLE 7
A Minimal EIAV System
[0166] In order to eliminate the risk of accessory genes or coding
sequences having deleterious effects in therapeutic applications,
vector systems lacking tat, S2 and the dUTPase are constructed.
[0167] Construction of S2 Mutants
[0168] A) Vector Genome
[0169] pONY2.13lacZ contains 109 nt of gag (deleted from nucleotide
positions 633 to 4949) (pONY2.13lacZ is described above). This
vector is used to make an EIAV vector genome from which S2
expression is eliminated by deletion from nucleotide positions 5345
to 5397. This removes the ATG start codon of S2 and the start codon
of env. To make the deletion within S2, PCR is carried out with
SY2/SY5 and SY3/SY4 using pONY2.13 DNA as template. The two PCR
products are pooled and PCR is carried out with primers SY5 and
SY3. The 10.1 kb product is ligated into pGEMT-easy (Promega) to
make pGEMS2 and sequenced to confirm the deletion. pONY2.13lacZDS2
is made by cutting out the 1.1 kb S2 region from pGEMS2 with Cel II
and ligating it into pONY2.13lacZ.
[0170] B) Gagpol Construct
[0171] The same region of S2 is deleted in pONY3 to prevent
recombination between pONY3DS2 and pONY2.13DS2 reconstituting the
S2 gene. pONY3DS2 is made by PCR amplification with SY1/SY2 and
SY3/SY4 using pONY3 DNA as template. The two PCR products are
pooled and PCR is carried out with primers SY1 and SY3. The 0.7 kb
product is ligated into pGEMT-easy (Promega) to make pGEMS22 and
sequenced to confirm the deletion. The 0.7 kb S2 coding region is
excised of pGEMS22 with Not I and inserted into pBluescript
KS+(Stratagene) to make pBPCRS2. The Eco RV and Nco I fragment from
pONY3 (2.2 kb) is inserted into pBPCRS2 cut with Eco RV and Nco I
to make pBpONYS2. This is then cut with Eco RV and Cel II (2.9 kb
fragment) and inserted into pONY3 cut with Eco RV and Cel II to
thereby making pONY3DS2.
[0172] Construction of dUTPase Mutant
[0173] pONY3DdUTPase is made by site directed mutagenesis of
nucleotide 4176 from a T to an A residue (Payne et al., Virology,
210:302-313). This mutates the aspartic acid to a glutamic acid.
This is done by PCR amplification using PCR primers dUTPaseF and
dUTPaseR. The template DNA is pONY.sup.3. The PCR product is
inserted into pGEMT-easy and sequenced to confirm the mutation.
This is called pGDdUTPase. pONY3 is cut with Not I and Eco RV (4.6
kb) and inserted into pBluescript KS+(Stratagene) to make pBEV. The
pGDdUTase is cut with Pac I and Pst I and the 0.4 kb band inserted
into pBEV cut with Pac I and Pst I. This is called pONY3pBDUTPase.
This is then inserted into pONY3 via N{overscore (o)}t I and Eco RV
(4.6 kb) to make pONY3DdUTPase.
[0174] Construction of the S2 and dUTPase Double Mutant
[0175] To make the double mutant of pONY3 the construct pBpONYS2 is
used. pGDdUTPase is cut with Pac I and Pst I and the fragment
inserted into pBpONYS2 cut with Pac I and Pst I to make construct
pS2DdUTPase. This is then cut with Eco RV and Cel II and inserted
into pONY3 cut with Eco RV and Cel II to make pONY3DS2DdUTPase.
[0176] Analysis of S2 and dUTPase Mutants
[0177] pONY2.13lacZDS2, pONY3DdUTPase and pONY3DS2DdUTPase vectors
are used in a number of combinations in three plasmid
co-transfections to generate virus as described for MLV-based
vectors (Soneoka et al 1995 Nucl. Acids Res. 23:628-633) and the
virus generated is titred on 293T and D17 cells, in either dividing
or non-dividing states. Cells are arrested in G.sub.1/S phase by
treatment with aphidicolin (9) and then transduced with EIAV-based
and MLV-based vectors pseudotyped with VSV-G (Table 4). The
transduction efficiency of the MLV vector is lower by four orders
of magnitude in aphidicolin treated cells as compared to untreated
cells. The incomplete block to cell transduction by MLV is probably
due to a small population of dividing cells. In contrast, no
significant difference is observed in the case of the EIAV-based
vectors. This demonstrates that the EIAV-based system does not
require S2 or dUTPase either for production or transduction. Payne
et al., (Payne et al., Virology, 210:302-313) and others have shown
that EIAV dUTPase is required for the infection of horse
macrophages. This may represent a restriction in infection of
macrophages by EIAV.
[0178] The properties of the S2 and dUTPase mutants are tested by
transduction of hippocampal embryonic day 14 neuronal cells
cultured in minimal media for 7 days. No significant difference is
found between the various EIAV vectors. However a much reduced
transduction efficiency is seen for the MLV vector. This indicates
that S2 and dUTPase is not required for the transduction of
physiologically non-dividing cells.
[0179] In summary we can conclude that tat, S2 and dUTPase are not
required in any part of the vector system for vector production or
transduction.
EXAMPLE 8
Addition of Rev/RRE
[0180] The construction of pEGASUS-1 has been described above. This
vector contains 759 bp of EIAV sequence. The introduction of the
EIAV RRE (0.7 kb) into pEGASUS-1 to produce pEGASUS/RRE resulted in
a four-fold increase in the titre when Rev is provided in trans
(Table 2). This vector now contains 1.47 kb of EIAV.
Example 9
Construction of Improved Gagpol Expression Plasmids
[0181] In pONY3 there is an extended 5' untranslated region before
the start of the gagpol coding sequence. It is likely that this
unusually long sequence would compromise expression of the gagpol
cassette. To improve gagpol expression pONY3 is modified to remove
the remaining 5' LTR. This is done by cutting pONY3 with Nar I and
Eco RV. The 2.4 kb fragment is inserted into pBluescript
KS+(Stratagene) at Cla I and Eco RV sites to make construct
pBSpONY3.0. pBSpONY3.0 is cut with Xho I and Eco RV. The 2.4 kb
fragment is inserted into pONY3 at Xho I and Eco RV to make
pONY3.1.
[0182] This manipulation removes the 5' LTR up to the Nar I site
within the primer binding region (386 nt). This construct gives a
two fold increase in titre and increased protein expression (FIG.
10).
[0183] pONY3.1 like pONY3 encodes gag, gagpol, Tat, S2 and Rev.
Since the S2 mutation experiments showed that S2 is not required
either in the production system or in the EIAV vector genome it is
possible to design a gagpol expression constructs without S2. Two
such constructs, pHORSE and pHORSE3.1, are produced.
[0184] pHORSE is made by PCR amplification with
EGAGP5'OUTERIEGAGPINNER3 and EGAGP3'OUTER/EGAGPINNER5 using pONY3
as template DNA. The two PCR products are purified pooled and
re-amplified using primers EGAGP5'OUTER/EGAGP3'OUTER. This product
is inserted into the Xho I and Sal I sites of pSP72 to make
pSP72EIAVgagpolO'lap. pONY 3 is cut with Pvu II and Nco I and the
4.3 kb fragment is inserted into pSP72EIAVgagpolO'lap cut with Pvu
II and Nco I to make pSPEGP. This is cut with Xho I and Sal I (4.7
kb) and inserted into pCI-Neo at the Xho I and Sal I sites. This
construct is called pCIEGP. The RRE is cut out from pEGASUS with
Sal I (0.7 kb) and inserted into pCIEGP construct at the Sal I site
to make pHORSE.
[0185] When this construct is assayed for protein expression in the
presence or absence of pCI-Rev (a construct expressing the EIAV Rev
open reading frame, see above) it is found to be Rev dependent as
expected. However, protein expression is much lower than from
pONY3.1. In addition when used in virus production the titre is
found to be 100 fold lower than that from pONY3.1.
[0186] Unexpectedly when the leader sequence (comprising sequences
from the end of U5 of the 5' LTR to the ATG start of gag 383-524
nt) of pONY3.1 is inserted into pHORSE, to make pHORSE3.1, protein
expression and virus production improved. pHORSE3.1 is made by
replacing the 1.5 kb Xho IXba I of pHORSE with the 1.6 kb Xho I/Xba
I of pONY3.1. Titres obtained with pHORSE3.1 are similar to that of
pONY3.1. The reason for the slightly lower titre of pHORSE3.1
compared to pONY3.1 may be due the requirement for a four plasmid
co-transfection with pHORSE3.1 (due to the Rev dependence of this
system). We can conclude therefore that a minimal EIAV vector
system should have this leader for maximum gagpol expression.
[0187] When pHORSE3.1, pRV67, pCIRev and pEGASUS/RRE are used in a
four plasmid co-transfection (Table 6) virus is produced at a high
titre (2.0.times.10.sup.4 l.f u./ml). This system lacks the second
exon of Tat which is responsible for Tat transactivation (Southgate
et al., J. Virology, 1995, 69:2605-2610). This demonstrates that
the Tat is not required for the EIAV-based vector system.
[0188] By engineering the backbone of pHORSE3.1 to express Rev
(replacing the Neo open reading frame with that of EIAV Rev) the
requirement of a four plasmid co-transfection was eliminated. This
was done by cutting pCI-Neo with Stu I and Bst XI and filling in
the 5' overhangs with T4 DNA polymerase. This produced a vector
fragment of 4.6 kb into which the Rev open reading frame from
pTopoRevpos (cut with Sac I and Xba I giving a 0.6 kb band in which
the 5' overhangs were filled in using T4 DNA polymerase) was
inserted. This was called pCREV. The EIAV gagpol reading frame
including the RRE and leader was cut from pHORSE3.1 with Xho I and
Not I (5.5 kb) and inserted into pCREV at the Xho I and Not I sites
to make pEGPR3.1.
[0189] Codon optimisation of the EIAV gagpol should eliminate the
dependence of gagpol protein expression on the RRE/Rev system. The
need of pEGASUS-1 for Rev/RRE can also be eliminated by using a
heterologous RNA export system such as the constitutive transport
element (CTE) from Mason-Pfizer Monkey virus (MPMV) (Bray et al.,
PNAS, 1994, 91:1256-1260, Kim et al., 1998)
4TABLE 4 Titre on Ratio D17 cells (Non- (l.f.u./ml) Non- dividing/
Vector gagpol Dividing dividing dividing) S2+ S2+, dUTPase+ 2.2
.times. 10.sup.5 1.1 .times. 10.sup.5 0.5 S2- S2+, dUTPase+ 1.5
.times. 10.sup.5 1.3 .times. 10.sup.5 0.9 S2- S2-, dUTPase+ 1.0
.times. 10.sup.5 1.2 .times. 10.sup.5 1.2 S2- S2-, dUTPase- 1.5
.times. 10.sup.5 1.6 .times. 10.sup.5 1.1 S2+ S2-, dUTPase+ 2.2
.times. 10.sup.5 2.3 .times. 10.sup.5 1.0 S2+ S2-, dUTPase- 1.5
.times. 10.sup.5 1.4 .times. 10.sup.5 1.0 S2+ S2+, dUTPase- 1.5
.times. 10.sup.5 1.4 .times. 10.sup.5 1.0 MLV Vector 1.2 .times.
10.sup.7 6.7 .times. 10.sup.3 0.0006 Mock <1 <1 1
[0190]
5TABLE 5 Comparison of pONY2.10LacZ and pEGASUS +/- EIAV RRE. Titre
Vector Genome Gagpol (l.f.u./ml) pONY2.10LacZ pONY3.0 7 .times.
10.sup.4 pEGASUS pONY3.0 2.2 .times. 10.sup.4 pEGASUS/RRE pONY3.0
8.6 .times. 10.sup.4
[0191] Titres with Rev are higher for pEGASUS-1 even though it has
no RRE. Possibly the effect of REV is via enhanced expression of
gagpol.
6 TABLE 6 Titre Vector Genome Gagpol (l.f.u./ml) pONY2.11lacZ
pONY3.1 1.7 .times. 10.sup.5 pONY2.11lacZ pHORSE3.1 9.0 .times.
10.sup.4 pEGASUS/RRE pONY3.1 8.0 .times. 10.sup.4 pEGASUS/RRE
pHORSE3.1 2.0 .times. 10.sup.4
[0192] Transfections were carried out in 293T cells with pCI-Rev
and pRV67. The virus was titred on D17 cells
7 Primers 1 2 3
EXAMPLE 10
pONY4 Series of Vectors
[0193] In order to eliminate the use of Tat for the transcription
of the EIAV genome and increase the amount of full length
transcript the EIAV U3 (5' LTR) was replaced with the HCMV
enhancer/promoter as in the case of the pEGASUS vectors (Example
2).
[0194] Plasmid Construction.
[0195] pONY2.1lacZ contains a deletion in gag such that only 373 bp
of the gag ORF remains. pONY4 was made by replacing the 5' LTR with
the CMV LTR from pEGASUS-1. pEGASUS-1 was cut with Bgl II/Xho I
releasing a 3.2 kb fragment (containing the CMV LTR) which was
inserted into pSP72 cut with Bgl I/Xho L This construct was named
pSPPEG213. This was cut with Hpa I/Nar I and the 1.3 kb fragment
(encompassing the CMV LTR) was inserted into pONY2.11lacZ cut with
Nae I/Nar L pONY4.1 contains a deletion (20.1 kb) downstream of the
lacZ gene (between the Sfu I and Sal I sites) such that tat, S2,
env, rev and RRE, are either missing or severely truncated (FIG.
11c). pONY4.1 was made by cutting it with Sfi I/Sal I, blunt-ended
by Klenow polymerase and religated. pONY4G was made by replacing
the lacZ gene of pONY4 (Sac II/Kpn I and then blunting with Klenow
polymerase) with that of GFP from pEGFP-N1 (Clontech) (Bam HI/Xba I
and then blunting with Klenow polymerase) as a blunt fragment.
[0196] Production and Assay of Vectors.
[0197] Vector stocks were generated by calcium-phosphate
transfection of human kidney 293T cells plated on 10 cm dishes with
16 .mu.g of vector plasmid, 16 .mu.g of gag-pol plasmid and 8 ug of
envelope plasmid. 36-48 h after transfection, supernatants were
filtered (0.45,um) aliquoted and stored at -70.degree. C.
Concentrated vector preparations were made by ultracentrifugation
of at 20 000 rpm (SW40Ti rotor) for 90 min, at 4.degree. C. The
virus was resuspended in PBS for 3-4 h aliquoted and stored at
-70.degree. C. Transduction was carried out in the presence of
polybrene (8 .mu.g/ml). It was consistently observed that pONY2.11
lacZ gave about 2 to 4 fold higher titres than the less deleted
pONY2.10lacZ. When U3 in the 5' LTR was replaced with the CMV
enhancer/promoter as in pONY4 then titres increase a further 5 to
10 fold.
EXAMPLE 11
EIAV `Self-Inactivating` Vectors (SIN-Vectors)
[0198] The expression of the transgene from EIAV vectors in
particular cell types may be influenced by elements in the LTR's.
To remove such elements SIN (Self Inactivating) vectors can be
constructed however the precise configuration of the vector may be
influenced by the requirement to maintain certain sequences
necessary for efficient production of the vector (Mol Cell Biol
1996 Sep; 16(9):4942-51. RNA structure is a determinant of poly(A)
site recognition by cleavage and polyadenylation specificity
factor. Graveley B R, Fleming E S, Gilmartin G M) (J Virol 1996
Mar; 70(3):1612-7. A common mechanism for the enhancement of mRNA
3' processing by U3 sequences in two distantly related
lentiviruses. Graveley B R, Gilmartin G M). In addition SIN vectors
provide a way for eliminating the production of full length
transcripts in transduced cells.
[0199] Two SIN vectors were made: one containing the putatively
important sequences (for polyadenylation), located between the Mlu
I and Mun I sites and one in which these sequences were deleted.
The 5' border of the deletions was 112 bases from the 5' end of the
U3 region of the 3'LTR. The structure of two SIN vectors is shown
in FIG. 12.
[0200] Deletions present in pONY4G.SIN-MLU and pONY4G.SIN-MUN
vectors are indicated in dashed lines. Primers are shown in
italic.
[0201] DNA sequences between nucleotides 7300 and 8079 (numbered
according to EIAV clone pSPEAIV19, Accession No. U01866) were
obtained using polymerase chain reaction amplification using pONY4G
as template. The positive sense primer was ERRE3 and the negative
primers for amplification were SIN-MLU (C7143:
GTCGAGCACGCGTTTGCCTAGCAACATGAGCTAG (MluI site in bold) or SIN-MUN
(C7142: GTCGAGCCAATTGTTGCCTAGC AACATGAGCTAG (MunI site in bold)
where the underlined sequences are complimentary to nucleotides
8058 to 8079 (of pSPEIAV19). The PCR products were digested with
NspV and either MuI or MunI respectively. These were then ligated
into pONY4G prepared for ligation by digestion with NspV(SfuI) and
either MluI (partial digestion) or MunI respectively.
EXAMPLE 12
EIAV Vectors with Reverse Configuration Internal Promoter-Reporter
Cassettes
[0202] In EIAV vectors such as pONY4Z or pONY4G the internal
CMV-reporter cassette is orientated so that transcription from the
5'LTR and the internal promoter are co-directional and the
polyadenylation signal in the 3'LTR is used for transcripts from
both promoters. An alternative configuration is achieved by
reversing the internal promoter-reporter cassette, however a
polyadenylation signal must be placed downstream of the
cassette.
[0203] An example of this `reverse orientation` vector was made as
follows. pONY4Z was digested with PstI and the overhanging termini
trimmed back with T4 DNA polymerase. This was then used as the
`vector` fragment in a ligation with the MluI to AseI fragment from
pEGFP-C1 which contains sequences including the CMV-GFP-SV40 early
mRNA polyA signal cassette. Prior to ligation this fragment was
flush-ended with T4 DNA polymerase. The vector encoding plasmid was
called pONY4Greverse.
[0204] Vector particles were recovered from pONY4Greverse by
co-transfection with pONY3.1 and pRV67, which express EIAV gag/pol
and VSV-G protein respectively. The titre on D17 canine cells from
pONY4Greverse was 13-fold lower than from pONY4G vector recovered
in parallel.
[0205] The lower titre of pONY4Greverse was probably due to
interference between the CMV promoters which drive transcription of
the genome and the GFP towards each other however truncation of the
genomic RNA by the SV40-derived polyadenylation signal present in
the inserted CMV-GFP-polyA cassette could also have been a factor.
An improved vector was made by replacing the polyadenylation signal
of pONY4Greverse with the bovine growth hormone polyadenylation
(BGHpA) signal. To make this improvement pONY4Greverse was digested
with BstAPI and the ends flushed with T4 DNA polymerase, then cut
with PstI. This `vector` fragment was then ligated to a DNA
fragment representing the BGHpA which was prepared from pcDNA3.1+
(Invitrogen) by digestion with SphI, and then the ends blunted with
T4 DNA polymerase, then digested with PstI.
EXAMPLE 13
Construction and use of poly.A Signals Containing Introns
[0206] In the pONY vectors described here the polyadenylation
signal used is that from EIAV. This is found in the 3' LTR at the
border of R and U5. This signal may not be optimal because it is
not of a consensus sequence (see Whitelaw and Proudfoot 1986 EMBO
5; 2915-2922 and Levitt et al 1989 Gen. and Dev. 3; 1019-1025 for
description of consensus polyadenylation signal).
[0207] One method of improving the viral polyadenylation is to
replace the 3' LTR poly A signal with that of a consensus/strong
polyadenylation signal. By such a method the signal would now be
optimal in the producer cell. However upon transduction this signal
is lost because during replication, the 5' LTR is the source of the
poly A signal (see Retroviruses 1998 CSH press (Ed. J. Coffin) for
review of retroviral life cycle). One novel way of overcoming the
problem (of no strong polyadenylation signal upon transduction) is
to include the poly A signal in a manner as will now be outlined:
The method is to use a `split poly-A signal` where by an intron
splits the aataaa motif from that of the essential g/u box. Such a
signal has previously been used by Liu et al (1993 N.A.R
21;5256-5263) to demonstrate both that large gaps between the
aataaa and the g/u box will disable the poly A signal and that the
polyadenylation process preceeds splicing. By placing a split-polyA
signal within the retroviral vector such a signal will not be
functional until transduction of target cells. This is because
polyadenylation preceeds splicing and as such the upstream
split-polyA signal will not be used during vector expression within
the producer cell. Outlined in FIG. 13 is a schematic
representation of how such a retroviral vector, containing a split
polyA signal, would function--both in producer and in transduced
cells. First this Figure demonstrates that although there exists an
upstream consensus polyadenylation signal, the initial vector
transcripts are still polyadenylated at the usual 3' LTR using
either a viral or other poly A signal as so desired. This is
because although the upstream poly A signal is functional in the
final vector genome, this signal is not read by the polyadenylation
machinery because it is created only during intron removal and thus
not present in the primary RNA transcript. Second, this figure
demonstrates that upon transduction the-resulting vector
transcripts are now polyadenylated at the first signal; this being
now a normal strong polyadenylation signal with no introns to
distance the essential aataaa and g/u box.
[0208] There are a number of advantages to inclusion of such a
split-poly A signal within a retroviral vector; these include the
following:
[0209] (1) The use of strong non-viral based polyadenylation signal
within the transduced cell will enhance gene expression within such
cells.
[0210] (2) The use of such poly A signals upstream of the natural
LTR (see FIG. 13) based signals will, upon transduction, generate
shorter RNA transcripts that contain less viral sequence at their
3' end and as such will not be able to undergo subsequent
retroviral reverse transcription. Indeed if the desired gene is
expressed from an internal promoter such as the CMV, rather than an
LTR; the resulting transcript expressed in the transduced cell
could be designed to contain no viral sequence at all (see FIG.
3A).
[0211] (3) Inclusion of such a signal upstream of the 3'LTR will
mean expression of the RNA downstream to the split poly A signal
will be limited only to the producer cell because such RNA will not
be transcribed in the transduced cell. This will therefore restrict
certain sequence expression (for example IRESneo; see FIG. 14B) to
producer cells.
[0212] (4) The presence of an intron within the producer cell will
help with nuclear export of vector RNA from the nucleus.
[0213] (5) Because upon transduction their now exists an internal
functional poly A signal, the viral poly A signal in the 5' LTR
(the one copied to the 3' position during reverse transcription)
can be removed/deleted if desired. This is of use for preventing
the process of promoter-proximal polydenylation from the 5' LTR in
the producer cell (see Scott and Imperiale 1997 (Mol. Cell. Biol.
17;2127-35) and thus encourage full length transcript production of
the virus.
EXAMPLE
[0214] To demonstrate the use of such a signal in a retrovirus; the
"split poly A signal" cassette is constructed as described in FIG.
15; with the intronic sequence being derived from pCI (Promega).
Once made this cassette is cloned into the pONY 4 GFP vector using
the PstI compatible unique sse8387 site of pONY4-GFP (see FIG. 16).
Upon transduction the resulting vector will now polyadenylate prior
to the 3'LTR and consequently no viral RNA 3' to lacZ will be
transcribed (see FIG. 16).
EXAMPLE 14
Construction of MLV/EIAV Vectors
[0215] By replacing the EIAV LTR sequences with the MLV
equivalents, the pONY vectors will no longer possess functional tar
elements within the repeat regions (R) and as a consequence the U3
promoter will function without the requirement of Tat in the
transduced cell.
[0216] Outlined in FIG. 17 is how such a vector is made by
overlapping PCR with primers described in FIG. 18. Primers Mel and
Me2 are used to amplify a PCR product from the MLV vector pHIT111
(Soneoka et al 1995 NAR 23;628-633) whilst Me3 and Me4 are used to
amplify a product from pONY4 lacZ. The resulting two products are
then combined in a primerless PCR reaction to overlap them
(homology between the two products is shaded in FIG. 17). The final
full length product is cut BglII and Xbal and used to replace the
BglII-Xbal fragment of pONY4 lacZ (containing the CMV/R/U5) to make
pONY4-5'MLV. The resulting vector now has the CMV/R/U5 sequence
from MLV linked to the EIAV U5 sequence (sequence required for
genome recognition by intergrase prior to intergration). The next
step involves PCR amplification with primers Me5 and Me6 from pONY4
LacZ template and PCR amplification with Me7 and Me8 from pLXSN
template (Miller and Rosman 1989 Biotechniques 7:980-990). These
two PCR products are then overlapped by primerless PCR (homology
between primers shown as hatched box) and the resulting fragment
cut with NspV and MunI and inserted into the NspV/MunI sites of
pONY4-5'MLV; thus replacing the 3'EIAV LTR with a 3'MLV LTR fused
to the 3'UTR/ppt/U3 intergrase binding site of pONY 4 lacZ. The
resulting plasmid, named pONY-MOUSE (see FIG. 19 for complete DNA
sequence), titres at 10.sup.4-5 per ml when combined with pONY3.1
and pRV67 in the HIT system.
EXAMPLE 15
Early Promoter Driving Lentiviral Vector Genome
[0217] In this example an EIAV genome is expressed from a vaccinia
early promoter P7.5E (Davison 1989a). The promoter has been
engineered to produce an EIAV genome with the correct 5' RNA end.
In addition the vaccinia early termination sequence has been
inserted downstream of the EIAV genome. This is inserted into the
transfer plasmid pSC65, which can homologously recombine into the
TK region of the MVA genome. Recombinant viruses can be selected by
their lack of sensitivity to BudR (Earl et al. 1998).
[0218] FIG. 11 is a schematic representation of the EIAV genome
vectors pONY4.0 and pONY4.1 which have been described in Example 10
and the vaccinia transfer vector pSC65 (Chakrabarti et al 1997).
The P7.5E sequence is AAAAGTAGAAAATATATTCTAATTTATT. The Early
termination sequence for the early promoters is TTTTTNT (N=any
nucleotide) (Fields).
[0219] The DNA manipulations are as follows and FIGS. 20 and 21
give the sequence of the PCR primers. PCR with primers EMVA1/2
produces the 5' LTR with the U3 region replaced by the P7.5E
promoter. This is inserted into the plasmid pSP72 (Promega) using
the Hind III/Pst I sites to make pEMVA1. EIAV U3 contains a
sequence matching the criteria for vaccinia early termination
(TTTTTAT). Using primers EMVA3/4 and EMVA5/6 and overlapping PCR
this region is mutated to TTTCCAT in order to prevent early
termination. This PCR product is inserted into the pEMVA1 using the
Bgl II/Pst I sites to generate pEMVA2. A termination sequence
(TTTTTTTTT) is inserted downstream of the 3' LTR R region using
primers EMVA7/8 . This PCR product is inserted into pEMVA2 using
the Mun I/Bgl II sites making pEMVA3. Into this plasmid the rest of
the EIAV vector genome (pONY4) is inserted via the Nar I/Nsp V
sites making pEMVA4 (FIG. 22). This is then cut with Pac I/Bgl II
and inserted into pSC65 cut with Pac I/Bam HI to make pEPONY4 (Bgl
II and Bam HI are compatible) (FIG. 23). This removes the two
vaccinia promoters and the lacZ coding cassette from pSC65.
[0220] In order to make the minimal EIAV genome version of this
construct that is analogous to pONY4.1, pEMVA4 is cut with Sal
I/Nsp V blunt ended and religated to make pEMVA5 (FIG. 24). This
removes much of the sequence between the end of the lac Z gene and
the end envelope region, hence this vector is Tat, Rev, S2 and Env
minus. This is described in Example 10. This is then cut with Pac
I/Bgl II and inserted into pSC65 cut with Pac I/Bam HI to make
pEPONY4.1 (Bgl II and Bam HI are compatible) (FIG. 24). This
removes the two vaccinia promoters and the lacZ coding cassette
from pSC65.
[0221] Both pEPONY4.0 and pEPONY4.1 are suitable for inserting the
genome expression cassettes into the TK region of the MVA genome
(Carroll MW and Moss B Virology Nov. 24, 1997;238(2):198-211) using
a BHK TK-ve cell line (ECACC 85011423) and standard procedures for
the construction of recombinant poxviruses (Earl et al 1998a &
1998b)
EXAMPLE 16
Synthetic Early/Late Promoter Driving Lentiviral Vector Genome
[0222] The synthetic early/late promoter of vaccinia has a
requirement for sequences downstream of the RNA initiation site
(Davison 1989b). For this promoter to be used to generate a
retroviral genome either the R regions have to be modified or a
ribozyme is used to make the correct 5' end. Modifying the R
regions is problematic as the initiation site has not been
conclusively identified and varies with the sequence (Davison
1989b). Below is described the generation of a transfer plasmid
that expresses the EIAV genome from the synthetic early/late
promoter (Psyn). Downstream of this promoter is inserted a ribozyme
that ensures the creation of the correct 5' end of the RNA. This
construct also contains the early termination sequence.
[0223] The DNA manipulations are as follows: PCR with primers
EMVA9/1 produces the 5' LTR with the U3 region replaced by the Psyn
promoter and a hammerhead ribozyme (FIGS. 25 and 26). This is
inserted into the plasmid pEMVA4 (Example 15) using the Pac I/Nar I
sites to make pEMVA6 (FIG. 27). This is then cut with Pac I/Bgl II
and inserted into pSC65 cut with Pac I/Bam HI to make pSynPONY4
(Bgl II and Bam HI are compatible) (FIG. 27). This removes the two
vaccinia promoters and the lacZ coding cassette from pSC65. In
order to make the minimal ELAV genome version of this construct
that is analogous to pONY4.1, pEMVA6 is cut with Sal I/Nsp V blunt
ended and religated to make pEMVA7 (FIG. 28). This is then cut with
Pac I/Bgl 11 and inserted into pSC65 (a vaccinia transfer vector)
cut with Pac I/Bam HI to make pSynPONY4.1 (Bgl II and Bam HI are
compatible) (FIG. 28). This removes the two vaccinia promoters and
the lacZ coding cassette from pSC65.
[0224] Both pSynPONY4.0 and pSynPONY4.1 are suitable for inserting
the genome expression cassettes into the TK region of the MVA
genome (Carroll MW and Moss B Virology Nov. 24, 1997;238(2):198-21
1) using standard procedures for the construction of recombinant
poxviruses (Earl et al 1998a & 1998b)
EXAMPLE 17
T7 Promoter Driving Lentiviral Vector Genome
[0225] The T7 promoter can be used to generate a retroviral genome
which can make the correct 5' end. Below is described the
generation of a transfer plasmid that expresses the EIAV genome
from the T7 promoter (T7). Downstream of this promoter is inserted
a T7 termination sequence. This is inserted into the transfer
plasmid pSC65, which can homologously recombine into the TK region
of the MVA genome. The T7 promoter requires the T7 polymerase. MVA
viruses are available which express T7 polymerase from Vaccinia
promoters (Wyatt et al 1995).
[0226] The T7 promoter has the sequence (-)TAATACGACTCACTATAGG(+2)
with transcription beginning after A with preferably a run of Gs.
The T7 termination sequence is
CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG. The T7 promoter
and terminator sequences are as those described in the plasmid
pCITE-4a(+) (Novagen).
[0227] The DNA manipulations are as follows. PCR with primers
EMVA10/11 (FIG. 29) produces the 5' LTR with the U3 region replaced
by the T7 promoter. This is inserted into the plasmid pEMVA4 using
the Pac liNar I sites to make pEMVA8 (FIG. 30). PCR with primers
EMVA 1/7 produces part of the 3' LTR with a T7 termination
sequence. This is inserted into pEMVA8 using the Mun I/Bgl II sites
to make pEMVA9. This is then cut with Pac I/Bgl II and inserted
into pSC65 (a vaccinia transfer vector) cut with Pac I/Bam HI to
make pT7PONY4 (Bgl II and Bam HI are compatible) (FIG. 30). This
removes the two vaccinia promoters and the lacZ coding cassette
from pSC65.
[0228] To make the minimal EIAV genome version of this construct
(pONY4.1) pEMVA9 is cut with Sal I/Nsp V blunt ended and religated
to make pEMVA10 (FIG. 31). This is then cut with Pac I/Bgl II and
inserted into pSC65 (a vaccinia transfer vector) cut with Pac I/Bam
HI to make pT7PONY4.1 (Bgl II and Bam HI are compatible) (FIG. 31).
This removes the two vaccinia promoters and the lacZ coding
cassette from pSC65.
[0229] Both pT7PONY4.0 and pT7PONY4.1 are suitable for inserting
the genome expression cassettes into into the TK region of the MVA
genome (Carroll MW and Moss B Virology 1997) using standard
procedures for the construction of recombinant poxviruses (Earl et
al 1998a & 1998b).
EXAMPLE 18
Construction of an EIAV Gagpol Cassette for Expression in
Vaccinia
[0230] Normally EIAV gag/pol requires Rev/RRE for expression as Rev
enables the unspliced transcript to be exported out of the nucleus.
As Pox viruses are cytoplasmic, EIAV viral RNA export should not be
a problem. But if Rev has other functions such as RNA stability or
acts as a translation enhancer it can be expressed in a similar way
to EIAV gag/pol (Martarano 1994). Alternatively the EIAV gag/pol
sequence can be codon optimised to overcome the Rev/RRE requirement
for export and enhance RNA stability. Below is described the
creation of a vector that expresses EIAV gag/pol from a synthetic
early/late promoter (Psyn). This is inserted into the transfer
plasmid pLW-22 (Wyatt and Moss Appendix 1, Earl et al 1998a &
b), which can homologously recombine into the Del II region of the
MVA genome. Recombinant viruses can be selected by their expression
of lac Z.
[0231] EIAV gag/pol including the leader the gag/pol open reading
frame and the RRE can be obtained from cutting pHORSE3.1 (Example
9) with Aho LINot I to give a 5.5 kb band (FIG. 32). This is then
inserted into the vaccinia transfer vector pLW-22 cut with Sal
I/Not I (Sal I and Xho I are compatible) to make pLWHORSE3.1 (FIG.
32).
EXAMPLE 19
Construction of an EIAV Rev Cassette for Expression in Vaccinia
[0232] In the event that Rev is required for EIAV viral vector
production from a poxvirus it can be expressed from a synthetic
early/late promoter. This construct is inserted into the transfer
plasmid pMC03, which can homologously recombine into the Del III
region of the MVA genome. Recombinant viruses can be selected by
their expression of GUS (Carroll et al. 1995).
[0233] The DNA manipulations are as follows. Plasmid pCIRev is
described in Example 9. It is an EIAV Rev expression plasmid. This
is cut with Afl II/Not I (0.6 kb), blunt ended by T4 DNA polymerase
and inserted into pMC03 (Carroll et al. 1995) cut with Pme I to
make pMCRev (FIG. 33).
EXAMPLE 20
Construction of Heterologous Envelope Cassettes for Expression in
Vaccinia
[0234] EIAV can be pseudotyped with a number of envelopes such as
VSV-G and amphotropic MLV envelope. Below is described the creation
of a MVA transfer vector that expresses the amphotropic envelope or
VSV-G envelope from the P7.5 early/late promoter. The transfer
vector is pYF6 which can homologously recombine into the HA region
of MVA. Recombinant viruses can be selected by direct live
immunostaining for expression of the env.
[0235] In order to produce a transfer vector containing a VSV-G
cassette, the VSV-G expression plasmid pRV67 (Kim et al. 1998) is
cut with Sma I/Eco RV(1.7 kb) and the resulting fragment inserted
into pYF6 cut with Sma I to make pYFVSVG (FIG. 34). Similarly, to
produce an analogous amphotropic envelope construct pHIT456
(Soneoka 1995) is cut with Xba I and the 2.2 kb band blunt ended by
T4 DNA polymerase and inserted into pYF6 cut with Sma Imaking
pYFAmpho (FIG. 35).
[0236] Both pYFAmpho and pYFVSVG are suitable for inserting the
genome expression cassettes into into the HA region of the MVA
genome using standard procedures for the construction of
recombinant poxviruses (Earl et al 1998a & b, Flexner et al
1987)
EXAMPLE 21
Construction and Amplification of MVA-Lenti Recombinants
[0237] The recombinant vaccinia viruses containing multiple inserts
encoding the components of the EIAV vectors (FIG. 25) are
constructed by sequential recombination with the relevant transfer
plasmids. The construction of v.MEeG-Or (FIG. 36) is used as an
example:
[0238] 1. A plasmid carrying gag-pol (pLWHORSE3.1) is transfected
into BHK-21 or CEF cells, that have been previously infected with
MVA (as described in Carroll and Moss 1997, Earl et al 1998a &
b).
[0239] 2. After two days of infection recombinant MVA virus is
assayed on BHK-21/CEF and cells are over-layed with agar medium
containing the substrate for the colour marker P-galactosidase
(Chakrabarti et al 1985) which is expressed from within pLW22.
[0240] 3. Blue plaques are picked and plaque purified until a
homogeneous recombinant virus population is obtained.
[0241] 4. Recombinant virus is then used to recombine with transfer
plasmids containing the other recombinant genes: pMCRev in which
selection is based on GUS expression (Carroll & Moss 1995), the
genome (pEPONY4.0) in which selection is based on a TK negative
phenotype using BudR (Carroll & Moss 1997, Earl et al 1998a
& b) and VSVG (PYFVSVG) in which recombinants are identified by
direct immunostaining of VSV G (Earl et al 1998a & b).
[0242] Recombinant viruses may be amplified in BHK-21 or CEF cells
as described below:
[0243] Propagation of Vaccinia Virus
[0244] The highly attenuated strain MVA is derived from the
replication competent strain Ankara and has endured over 570
passages in primary chick embryo fibroblast cells. MVA replication
was initially thought to be restricted to CEF cells as only minimal
replication in mammalian cells was reported. However, further
analysis has shown that Baby Hamster Kidney cells (BHK-21) are able
to support high titre production of MVA. MVA may thus be grown on
BHK-21 or primary CEF cells (Carroll & Moss (1997) Virology
238:198-211).
[0245] To prepare CEF cells, 10 day old chick embryos are gutted
and limbs and head are removed before being minced and trypsinised
in a solution of 0.25% trypsin and incubation at 37.degree. C. The
cell suspension is filtered through a course filter mesh and cells
are washed and concentrated by centrifugation at 2000 rpm in a
Sorvall RC-3B at 1500 rpm for 5 mins. Cells are suspended in MEM
containing 10% FCS, aliquotted into 175 cm flasks and incubated at
37.degree. C. in a CO.sub.2 incubator. When monolayers are 95%
confluent they are trypsinised and used to seed additional flasks
or six well plates. Alternatively, primary cultures are transferred
to a 31.degree. C. incubator for later use (Sutter and Moss (1992)
Proc Natl Acad Sci U S A 89:10847-10851).
[0246] Preparation of Crude, Semi-Purified and Purified Virus
Stocks
[0247] Crude virus stocks are prepared for initial recombinant
virus analysis or as viral stocks used for subsequent high titre
virus preparations. Vaccinia virus preparations can be
semi-purified by centrifuging out cell membranes and nuclei or by
additional steps involving sucrose centrifugation to prevent
contamination by pre-expressed recombinant protein products and
cellular organelles. Methods used are a modification of those
described by Earl et al., 1998a & b; Earl and Moss, ibid, pp.
16.17.1-16.17.16; Earl and Moss, ibid, pp. 16.18.1-16.18.10; and
Bronte et al., (1997) Proc Natl Acad Sci U S A 94(7):3183-3188.
[0248] Crude Virus
[0249] MVA is grown in either CEF or BHK-21 (obtained from the
ATCC) and WR is grown in HeLa or BS-C-1 (ATCC) in 175 cm.sup.2
tissue culture flasks. Briefly, confluent monolayers are infected
with an moi of approx. 1 pfu with MVA or WR. Virus is suspended in
10 ml MEM containing 2% FCS and added to 175 cm.sup.2 flasks
containing confluent cell monolayers. After inoculation for 1 hour
at 37.degree. C. an additional 20 ml MEM containing 2% FCS is
added. After 48-72 hours infected cells are scraped into the medium
and pelleted at 1500 g for 5 mins. For crude virus preparations
cells are resuspended 2 ml MEM (2%) per 175 cm.sup.2 flask. Cells
are freeze thawed three times, sonicated and aliquotted into 1 ml
freezing tubes. A representative aliquot is freeze thawed and
titred to determine virus concentration. Virus stocks are stored
below -20.degree. C.
[0250] Semi-Pure Preparations
[0251] Infected cells are harvested as described previously (Earl
et al a & b; Earl and Moss; 1991). After centrifugation cells
are resuspended in PBS (2 ml/175 cm.sup.2 flask) and homogenised by
30-40 strokes in a tight fitting glass dounce homogeniser, on ice.
Cell breakage is checked by microscopy. Nuclei, cellular organelles
and membranes are removed by a centrifugation at 300 g for 5 mins
(4.degree. C.), keep supernatant. The cell pellet is resuspended in
1 ml/175 cm.sup.2 flask and centrifugation repeated. The
supernatants are pooled, aliquoted and stored.
[0252] Purified Preparation
[0253] Infected cells are harvested as previously described (Earl
et al.a & b; Earl and Moss; 1991) and resuspended in 10 mM
Tris.Cl, pH 9.0 (2 ml/flask), keeping samples on ice from this
point of the procedure. Homogenise as described previously using 10
mM Tris. The lysate is sonicated (on ice) using an XL 2015
sonicating cup (Misonics, USA) at maximum output (500 W) for 1 min.
The sample is placed on ice for 1 min and the sonication repeated
up to 3 times. A maximum of 5 ml is sonicated at a time, and ice is
replenished during sonication. The lysate is gently layered onto a
cushion of 17 ml of 36% sucrose (in 10 mM Tris.Cl, pH 9.0) in a
SW-27 centrifuge tube. Lyates are centrifuged for 80 mins in an
SW-27 rotor at 13 500 rpm (32,900.times.g), 4.degree. C. The
supernatant is discarded and the viral pellet resuspended in
sterile PBS and sonicated in a cup sonicator for 1 min (on ice).
Concentrated virus is aliquoted and stored at below -20.degree.
C.
EXAMPLE 22
Production of EIAV Vector Particles from MVA-EIAV Hybrids
[0254] As described above large scale preparations of recombinant
MVA-EIAV are made. These preparations are used to infect mammalian
cells that are non-permissive for MVA, such that the resulting
supernatant will only contain EIAV and not infectious MVA (Meyer et
al 1991, Carroll and Moss 1997). A suitable cell line is MRC5
(ATCC). Cells are infected at an MOI of 3. Infections are allowed
to run for approximately 48 hours before supernatants are harvested
and EIAV vector particles either used directly or
concentrated/purified by ultracentrifugation or cross-flow methods.
To produce large scale preparations, are grown in suspension or on
microcarriers or in roller bottles. EIAV vectors carrying gene of
interest prepared in these ways are used to transduce target cells
in vivo or in vitro.
REFERENCES
[0255] Blomer, U., Naldini, L., Kafri, T., Trono, D., Verma, I. M.,
and Gage, F. H. (1997). Highly efficient and sustained gene
transfer in adult neurons with a lentivirus vector. J Virol 71,
6641-6649.
[0256] Blomer, U., Naldini, L., Verma, I. M., Trono, D., and Gage,
F. H. (1996). Applications of gene therapy to the CNS. Hum Mol
Genet 5 Spec No, 1397-404.
[0257] Clever, J., Sassetti, C., and Parslow, T. G. (1995). RNA
secondary structure and binding sites for gag gene products in the
5' packaging signal of human immunodeficiency virus type 1. J Virol
69, 2101-9.
[0258] Clever, J. L., and Parslow, T. G. (1997). Mutant human
immunodeficiency virus type 1 genomes with defects in RNA
dimerization or encapsidation. J Virol 71, 3407-14.
[0259] Fields, B. N., Knipe, D. M., and Howley, P. M. (1996).
Fields Virology, R. M. Chanock, J. L. Melnick, T. P. Monath, B.
Roizman and S. E. Straus, eds. (Philadelphia. New York:
Lippincott--Raven Publishers).
[0260] Fuller S, von Bonsdorff CH, Simons K. Vesicular stomatitis
virus infects and matures only through the basolateral surface of
the polarized epithelial cell line, MDCK. Cell 1984
Aug;38(1):65-77
[0261] Harrison, G. S., Long, C. J., Maxwell, F., Glode, L. M., and
Maxwell, I. H. (1992). Inhibition of HIV production in cells
containing an integrated, HIV-regulated diphtheria toxin A chain
Gene. AIDs Research and Human Retrovirus 8, 39-45.
[0262] Hayashi T, Shioda T, Iwakura Y, Shibuta H. RNA packaging
signal of human immunodeficiency virus type 1. Virology 1992
June;188(2):590-599
[0263] Kim V. N., Mitrophanous K., Kingsman S. M., Kingsman A. J.
1998. Minimal Requirement for a Lentiviral Vector Based on Human
Immunodeficiency Virus Type 1. J. Virol. 1998 72:811-6.
[0264] Kim, S. Y., R. Byrn, J. Groopman, and D. Baltimore. 1989.
Temporal aspects of DNA and RNA synthesis during human
immunodeficiency virus infection: evidence for differential gene
expression. J. Virol. 63:3708-3713.
[0265] Lewis, P. F., and M. Emerman. 1994. Passage through mitosis
is required for oncoretroviruses but-not for the human
immunodeficiency virus. J Virol. 68:510-6.
[0266] Mann R, Mulligan RC, Baltimore D. Construction of a
retrovirus packaging mutant and its use to produce helper-free
defective retrovirus. Cell 1983 May;33(1):153-159
[0267] Martarano, L., Stephens, R., Rice, N., and Derse, D. (1994).
Equine infectious anemia virus trans-regulatory protein Rev
controls viral mRNA stability, accumulation, and alternative
splicing. J Virol 68, 3102-11.
[0268] Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma,
I. M. (1996). Efficient transfer, integration, and sustained
long-term expression of the transgene in adult rat brains injected
with a lentiviral vector. Proc Natl Acad Sci U S A 93,
11382-11388.
[0269] Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R.,
Gage, F. H., Verma, I. M., and Trono, D (1996). In vivo gene
delivery and stable transduction of nondividing cells by a
lentiviral vector [see comments]. Science 272, 263-7.
[0270] Payne, S. L., Rausch, J., Rushlow, K., Montelaro, R. C.,
Issel, C., Flaherty, M., Perry, S., Sellon, D., and Fuller, F.
(1994). Characterization of infectious molecular clones of equine
infectious anaemia virus. J Gen Virol 75, 425-9.
[0271] Yee, J.-K., M. Atsushi, P. LaPorte, K. Bouic, J. C. Bums,
and T. Friedmann (1994) A general method for th generation of
high-titer, pantropic retroviral vectors: Highly efficient
infection of primary hepatocytes. Proc. Natl. Acad. Sci. USA
91:9564-9568.
[0272] Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and
Trono, D. (1997). Multiply attenuated lentiviral vector achieves
efficient gene delivery in vivo. Nat Biotechnol 15, 871-875.
[0273] Cannon 1996 J Virol 1996 70:8234-40. Murine leukemia
virus-based Tat-inducible long terminal repeat replacement vectors:
a new system for anti-human immunodeficiency virus gene therapy.
Cannon P M, Kim N, Kingsman S M, Kingsman A J.
[0274] Carroll M W, Moss B E. coli beta-glucuronidase (GUS) as a
marker for recombinant vaccinia viruses. Biotechniques 1995
19:352-4
[0275] Carroll MW, Moss B Host range and cytopathogenicity of the
highly attenuated MVA strain of vaccinia virus: propagation and
generation of recombinant viruses in a non-human mammalian cell
line. Virology 1997 238:198-211
[0276] Chakrabarti S, Brechling K, Moss B Vaccinia virus expression
vector: coexpression of beta-galactosidase provides visual
screening of recombinant virus plaques. Mol Cell Biol 1985
12:3403-9
[0277] Chakrabarti S, Sisler J R, Moss B Biotechniques 1997
6:1094-7 Compact, synthetic, vaccinia virus early/late promoter for
protein expression. Davison 1989a J Mol Biol 1989 20;210(4):749-69.
Structure of vaccinia virus early promoters. Davison A J, Moss
B
[0278] Davison 1989b J Mol Biol 1989 210(4):771-84. Structure of
vaccinia virus late promoters. Davison A J, Moss B
[0279] P L. Earl (a), N. Cooper, L S Wyatt, B. Moss & M. W.
Carroll 1998 Preparation of Cell Cultures and Vaccinia Virus
Stocks. Current Protocols in Molecular Biology Supplement 43 Unit
16.16. John Wiley and Sons Inc.
[0280] P L. Earl (b), B. Moss L. S. Wyatt, & M. W. Carroll 1998
Generation of Recombinant Vaccinia Viruses. Current Protocols in
Molecular Biology. Supplement 43 Unit 16.17. Current Protocols in
Molecular Biology. John Wiley and Sons Inc.
[0281] Flexner C, Hugin A, Moss B Nature 1987 330(6145):259-62
Prevention of vaccinia virus infection in immunodeficient mice by
vector-directed IL-2 expression.
[0282] Holzer G W, Falkner F G Construction of a vaccinia virus
deficient in the essential DNA repair enzyme uracil DNA glycosylase
by a complementing cell line. J Virol 1997 71:4997-5002
[0283] Kim V N, Mitrophanous K, Kingsman S M, Kingsman A J Minimal
requirement for a lentivirus vector based on human immunodeficiency
virus type 1. J Virol 1998 72:811-6
[0284] Mackett M, Smith G L, Moss B Vaccinia virus: a selectable
eukaryotic cloning and expression vector. Proc Natl Acad Sci U S A
1982 7923:7415-9
[0285] Mahnel H, Mayr A Berl Munch Tierarztl Wochenschr 1994
Aug;107(8):253-6 [Experiences with immunization against orthopox
viruses of humans and animals using vaccine strain MVA].[Article in
German] Zentralbl Bakteriol [B] 1978 Dec; 167(5-6):375-90
[0286] Martarano L, Stephens R, Rice N, Derse D Equine infectious
anemia virus trans-regulatory protein Rev controls viral mRNA
stability, accumulation, and alternative splicing. J Virol 1994
May;68(5):3102-11
[0287] Mayr A, Stickl H, Muller H K, Danner K, Singer H [The
smallpox vaccination strain MVA: marker, genetic structure,
experience gained with the parenteral vaccination and behavior in
organisms with a debilitated defence mechanism]. Zentralbl
Bakteriol [B]. 1978 Dec;167(5-6):375-90. German.
[0288] Meyer H, Sutter G, Mayr A Mapping of deletions in the genome
of the highly attenuated vaccinia virus MVA and their influence on
virulence. J Gen Virol 1991 72:1031-8
[0289] Moss B Poxviridae: The viruses and their replication Chapter
83. p2637-2672. In Fields, B. N., Knipe, D. M. & Howley, P.M.
Fields Virology. Third Edition edn Vol. 2 eds Chanock, R. M.,
Melnick, J. L., Monath, T. P., Roizman, B. & Straus, S. E.
Lippincott--Raven Publishers, Philadelphia. New York, 1996
[0290] Moss B, Carroll M W, Wyatt L S, Bennink J R, Hirsch V M,
Goldstein S, Elkins W R, Fuerst T R, Lifson J D, Piatak M, Restifo
N P, Overwijk W, Chamberlain R, Rosenberg S A, Sutter G Host range
restricted, non-replicating vaccinia virus vectors as vaccine
candidates. Adv Exp Med Biol 1996;397:7-13
[0291] Panicali D, Paoletti E Construction of poxviruses as cloning
vectors: insertion of the thymidine kinase gene from herpes simplex
virus into the DNA of infectious vaccinia virus. Proc Natl Acad Sci
U S A 1982 79:4927-31
[0292] Soneoka Y, Cannon P M, Ramsdale E E, Griffiths J C, Romano
G, Kingsman SM, Kingsman A J 1995 Nucleic Acids Res 1995 23628-33.
A transient three-plasmid expression system for the production of
high titer retroviral vectors.
[0293] Sutter G, Moss B Nonreplicating vaccinia vector efficiently
expresses recombinant genes. Proc Natl Acad Sci U S A Nov. 15,
1992;89(22):10847-51
[0294] Taylor J, Weinberg R, Tartaglia J, Richardson C, Alkhatib G,
Briedis D, Appel M, Norton E, Paoletti E Nonreplicating viral
vectors as potential vaccines: recombinant canarypox virus
expressing measles virus fusion (F) and hemagglutinin (HA)
glycoproteins. Virology 1992 Mar;187(1):321-8
[0295] Paoletti E, Tartaglia J, Taylor J Safe and effective
poxvirus vectors--NYVAC and ALVAC. Dev Biol Stand 1994;82:65-9
[0296] Wyatt L S, Moss B, Rozenblatt S Replication-deficient
vaccinia virus encoding bacteriophage T7 RNA polymerase for
transient gene expression in mammalian cells. Virology Jun. 20,
1995;210(1):202-5
[0297] Wyatt L S, Carroll M W, Czerny C P, Merchlinsky M, Sisler J
R, Moss B Marker rescue of the host range restriction defects of
modified vaccinia virus Ankara. Virology 1998 251:334-42
[0298] Wyatt L S, Shors S T, Murphy B R, Moss B Development of a
replication-deficient recombinant vaccinia virus vaccine effective
against parainfluenza virus 3 infection in an animal model. Vaccine
1996 Oct; 14(15):1451-8
Sequence CWU 1
1
64 1 381 RNA Equine infectious anemia virus 1 augauaccgg gcacucagau
ucugcggucu gagucccuuc ucugcugggc ugaaaaggcc 60 uuuguauaaa
uauaauucuc uacucagucc cugucucuag uuugucuguu cgagauccua 120
caguuggcgc ccgaacaggg accugagggg gcgcagaccc uaccuguuga accuggcuga
180 ucguaggauc cccgggacag cagaggagaa cuuacagaag ucuucuggag
guguuccugg 240 ggagaacaca ggaggacagg uaagauggga gacccuuuga
cauggagcaa ggcgcucaag 300 aaguuaagaa ggugacggua caagggucuc
aguuaacucu gguaacugua auugggcgcu 360 aagucuaggu agacuuauuu c 381 2
41 DNA Artificial Sequence misc_feature (1)..(41) sequence showing
part of split polyA signal 2 tcgctgcagc ggaataaagg gcaggtaagt
atcaaggtta c 41 3 60 DNA Artificial Sequence, primer misc_feature
(1)..(60) sequence showing the part of split polyA signal 3
tcgctgcagc ggacacacaa aaaaccaaca cacagaactg ggaagtggac acctgtggag
60 4 63 DNA Artificial Sequence misc_feature (1)..(63) sequence
showing both the parts of polyA signal 4 aataaagggc aggtaagctc
cacaggtgtc cactccagtt ctgtgtgttg gttttttgtg 60 tgt 63 5 50 DNA
Artificial Sequence polyA_signal (1)..(50) sequence of the polyA
signal 5 aataaagggc aggtgtccac tccagttctg tgtgttggtt ttttgtgtgt 50
6 33 DNA Artificial Sequence, primer misc_feature (1)..(33) primer
6 tcgatagatc tgagtccgtt acataactta cgg 33 7 57 DNA Artificial
Sequence,primer misc_feature (1)..(57) primer 7 gatctcgaac
agacaaacta gagacaggga ctgcaaacag caagaggctt tattggg 57 8 30 DNA
Artificial Sequence,primer misc_feature (1)..(30) primer 8
gtccctgtct ctagtttgtc tgttcgagat 30 9 27 DNA Artificial
Sequence,primer misc_feature (1)..(27) primer 9 ggggatccac
tagttctaga gatattc 27 10 27 DNA Artificial Sequence,primer
misc_feature (1)..(27) primer 10 ccttagacct ggagattcga agcgaag 27
11 53 DNA Artificial Sequence,primer misc_feature (1)..(53) primer
11 ccaaacctac aggtggggtc tttcatttac aaggttatga gagcatcagc aac 53 12
27 DNA Artificial Sequence,primer misc_feature (1)..(27) primer 12
aatgaaagac cccacctgta ggtttgg 27 13 41 DNA Artificial
Sequence,primer misc_feature (1)..(41) primer 13 gtagagtgcc
caattgccag tatacactcc gctatcgcta c 41 14 11299 DNA Artificial
Sequence misc_feature (1)..(11299) plasmid 14 ctaaattgta agcgttaata
ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac
caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120
gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc
180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg
aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta
aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc
aacctggctt atcgaaatta atacgactca 360 ctatagggag accggcagat
ctgagtccgt tacataactt acggtaaatg gcccgcctgg 420 ctgaccgccc
aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac 480
gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt
540 ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca
atgacggtaa 600 atggcccgcc tggcattatg cccagtacat gaccttatgg
gactttccta cttggcagta 660 catctacgta ttagtcatcg ctattaccat
ggtgatgcgg ttttggcagt acatcaatgg 720 gcgtggatag cggtttgact
cacggggatt tccaagtctc caccccattg acgtcaatgg 780 gagtttgttt
tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 840
attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctcgttt
900 agtgaaccgc gccagtcttc cgatagactg cgtcgcccgg gtacccgtat
tcccaataaa 960 gcctcttgct gtttgcatcc gaatcgtggt ctcgctgttc
cttgggaggg tctcctctga 1020 gtgattgact acccacgacg ggggtctttc
atttctctag tttgtctgtt cgagatccta 1080 cagttggcgc ccgaacaggg
acctgagagg ggcgcagacc ctacctgttg aacctggctg 1140 atcgtaggat
ccccgggaca gcagaggaga acttacagaa gtcttctgga ggtgttcctg 1200
gccagaacac aggaggacag gtaagatggg agaccctttg acatggagca aggcgctcaa
1260 gaagttagag aaggtgacgg tacaagggtc tcagaaatta actactggta
actgtaattg 1320 ggcgctaagt ctagtagact tatttcatga taccaacttt
gtaaaagaaa aggactggca 1380 gctgagggat gtcattccat tgctggaaga
tgtaactcag acgctgtcag gacaagaaag 1440 agaggccttt gaaagaacat
ggtgggcaat ttctgctgta aagatgggcc tccagattaa 1500 taatgtagta
gatggaaagg catcattcca gctcctaaga gcgaaatatg aaaagaagac 1560
tgctaataaa aagcagtctg agccctctga agaatatctc tagagtgtga ttttaagggc
1620 gaattctgca ggagtgggga ggcacgatgg ccgctttggt cgaggcggat
ccggccatta 1680 gccatattat tcattggtta tatagcataa atcaatattg
gctattggcc attgcatacg 1740 ttgtatccat atcataatat gtacatttat
attggctcat gtccaacatt accgccatgt 1800 tgacattgat tattgactag
ttattaatag taatcaatta cggggtcatt agttcatagc 1860 ccatatatgg
agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc 1920
aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg
1980 actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt
ggcagtacat 2040 caagtgtatc atatgccaag tacgccccct attgacgtca
atgacggtaa atggcccgcc 2100 tggcattatg cccagtacat gaccttatgg
gactttccta cttggcagta catctacgta 2160 ttagtcatcg ctattaccat
ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag 2220 cggtttgact
cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt 2280
tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa
2340 atgggcggta ggcatgtacg gtgggaggtc tatataagca gagctcgttt
agtgaaccgt 2400 cagatcgcct ggagacgcca tccacgctgt tttgacctcc
atagaagaca ccgggaccga 2460 tccagcctcc gcggccccaa gcttcagctg
ctcgaggatc tgcggatccg gggaattccc 2520 cagtctcagg atccaccatg
ggggatcccg tcgttttaca acgtcgtgac tgggaaaacc 2580 ctggcgttac
ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata 2640
gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatggc
2700 gctttgcctg gtttccggca ccagaagcgg tgccggaaag ctggctggag
tgcgatcttc 2760 ctgaggccga tactgtcgtc gtcccctcaa actggcagat
gcacggttac gatgcgccca 2820 tctacaccaa cgtaacctat cccattacgg
tcaatccgcc gtttgttccc acggagaatc 2880 cgacgggttg ttactcgctc
acatttaatg ttgatgaaag ctggctacag gaaggccaga 2940 cgcgaattat
ttttgatggc gttaactcgg cgtttcatct gtggtgcaac gggcgctggg 3000
tcggttacgg ccaggacagt cgtttgccgt ctgaatttga cctgagcgca tttttacgcg
3060 ccggagaaaa ccgcctcgcg gtgatggtgc tgcgttggag tgacggcagt
tatctggaag 3120 atcaggatat gtggcggatg agcggcattt tccgtgacgt
ctcgttgctg cataaaccga 3180 ctacacaaat cagcgatttc catgttgcca
ctcgctttaa tgatgatttc agccgcgctg 3240 tactggaggc tgaagttcag
atgtgcggcg agttgcgtga ctacctacgg gtaacagttt 3300 ctttatggca
gggtgaaacg caggtcgcca gcggcaccgc gcctttcggc ggtgaaatta 3360
tcgatgagcg tggtggttat gccgatcgcg tcacactacg tctgaacgtc gaaaacccga
3420 aactgtggag cgccgaaatc ccgaatctct atcgtgcggt ggttgaactg
cacaccgccg 3480 acggcacgct gattgaagca gaagcctgcg atgtcggttt
ccgcgaggtg cggattgaaa 3540 atggtctgct gctgctgaac ggcaagccgt
tgctgattcg aggcgttaac cgtcacgagc 3600 atcatcctct gcatggtcag
gtcatggatg agcagacgat ggtgcaggat atcctgctga 3660 tgaagcagaa
caactttaac gccgtgcgct gttcgcatta tccgaaccat ccgctgtggt 3720
acacgctgtg cgaccgctac ggcctgtatg tggtggatga agccaatatt gaaacccacg
3780 gcatggtgcc aatgaatcgt ctgaccgatg atccgcgctg gctaccggcg
atgagcgaac 3840 gcgtaacgcg aatggtgcag cgcgatcgta atcacccgag
tgtgatcatc tggtcgctgg 3900 ggaatgaatc aggccacggc gctaatcacg
acgcgctgta tcgctggatc aaatctgtcg 3960 atccttcccg cccggtgcag
tatgaaggcg gcggagccga caccacggcc accgatatta 4020 tttgcccgat
gtacgcgcgc gtggatgaag accagccctt cccggctgtg ccgaaatggt 4080
ccatcaaaaa atggctttcg ctacctggag agacgcgccc gctgatcctt tgcgaatacg
4140 cccacgcgat gggtaacagt cttggcggtt tcgctaaata ctggcaggcg
tttcgtcagt 4200 atccccgttt acagggcggc ttcgtctggg actgggtgga
tcagtcgctg attaaatatg 4260 atgaaaacgg caacccgtgg tcggcttacg
gcggtgattt tggcgatacg ccgaacgatc 4320 gccagttctg tatgaacggt
ctggtctttg ccgaccgcac gccgcatcca gcgctgacgg 4380 aagcaaaaca
ccagcagcag tttttccagt tccgtttatc cgggcaaacc atcgaagtga 4440
ccagcgaata cctgttccgt catagcgata acgagctcct gcactggatg gtggcgctgg
4500 atggtaagcc gctggcaagc ggtgaagtgc ctctggatgt cgctccacaa
ggtaaacagt 4560 tgattgaact gcctgaacta ccgcagccgg agagcgccgg
gcaactctgg ctcacagtac 4620 gcgtagtgca accgaacgcg accgcatggt
cagaagccgg gcacatcagc gcctggcagc 4680 agtggcgtct ggcggaaaac
ctcagtgtga cgctccccgc cgcgtcccac gccatcccgc 4740 atctgaccac
cagcgaaatg gatttttgca tcgagctggg taataagcgt tggcaattta 4800
accgccagtc aggctttctt tcacagatgt ggattggcga taaaaaacaa ctgctgacgc
4860 cgctgcgcga tcagttcacc cgtgcaccgc tggataacga cattggcgta
agtgaagcga 4920 cccgcattga ccctaacgcc tgggtcgaac gctggaaggc
ggcgggccat taccaggccg 4980 aagcagcgtt gttgcagtgc acggcagata
cacttgctga tgcggtgctg attacgaccg 5040 ctcacgcgtg gcagcatcag
gggaaaacct tatttatcag ccggaaaacc taccggattg 5100 atggtagtgg
tcaaatggcg attaccgttg atgttgaagt ggcgagcgat acaccgcatc 5160
cggcgcggat tggcctgaac tgccagctgg cgcaggtagc agagcgggta aactggctcg
5220 gattagggcc gcaagaaaac tatcccgacc gccttactgc cgcctgtttt
gaccgctggg 5280 atctgccatt gtcagacatg tataccccgt acgtcttccc
gagcgaaaac ggtctgcgct 5340 gcgggacgcg cgaattgaat tatggcccac
accagtggcg cggcgacttc cagttcaaca 5400 tcagccgcta cagtcaacag
caactgatgg aaaccagcca tcgccatctg ctgcacgcgg 5460 aagaaggcac
atggctgaat atcgacggtt tccatatggg gattggtggc gacgactcct 5520
ggagcccgtc agtatcggcg gaattccagc tgagcgccgg tcgctaccat taccagttgg
5580 tctggtgtca aaaataataa taaccgggca ggggggatcc gcagatccgg
ctgtggaatg 5640 tgtgtcagtt agggtgtgga aagtccccag gctccccagc
aggcagaagt atgcaaagca 5700 tgcctgcagg aattcgatat caagcttatc
gataccgtcg acctcgaggg ggggcccggt 5760 acccagcttt tgttcccttt
agtgagggtt aattgcgcgg gaagtattta tcactaatca 5820 agcacaagta
atacatgaga aacttttact acagcaagca caatcctcca aaaaattttg 5880
tttttacaaa atccctggtg aacatgattg gaagggacct actagggtgc tgtggaaggg
5940 tgatggtgca gtagtagtta atgatgaagg aaagggaata attgctgtac
cattaaccag 6000 gactaagtta ctaataaaac caaattgagt attgttgcag
gaagcaagac ccaactacca 6060 ttgtcagctg tgtttcctga ggtctctagg
aattgattac ctcgatgctt cattaaggaa 6120 gaagaataaa caaagactga
aggcaatcca acaaggaaga caacctcaat atttgttata 6180 aggtttgata
tatgggagta tttggtaaag gggtaacatg gtcagcatcg cattctatgg 6240
gggaatccca gggggaatct caacccctat tacccaacag tcagaaaaat ctaagtgtga
6300 ggagaacaca atgtttcaac cttattgtta taataatgac agtaagaaca
gcatggcaga 6360 atcgaaggaa gcaagagacc aagaaatgaa cctgaaagaa
gaatctaaag aagaaaaaag 6420 aagaaatgac tggtggaaaa taggtatgtt
tctgttatgc ttagcaggaa ctactggagg 6480 aatactttgg tggtatgaag
gactcccaca gcaacattat atagggttgg tggcgatagg 6540 gggaagatta
aacggatctg gccaatcaaa tgctatagaa tgctggggtt ccttcccggg 6600
gtgtagacca tttcaaaatt acttcagtta tgagaccaat agaagcatgc atatggataa
6660 taatactgct acattattag aagctttaac caatataact gctctataaa
taacaaaaca 6720 gaattagaaa catggaagtt agtaaagact tctggcataa
ctcctttacc tatttcttct 6780 gaagctaaca ctggactaat tagacataag
agagattttg gtataagtgc aatagtggca 6840 gctattgtag ccgctactgc
tattgctgct agcgctacta tgtcttatgt tgctctaact 6900 gaggttaaca
aaataatgga agtacaaaat catacttttg aggtagaaaa tagtactcta 6960
aatggtatgg atttaataga acgacaaata aagatattat atgctatgat tcttcaaaca
7020 catgcagatg ttcaactgtt aaaggaaaga caacaggtag aggagacatt
taatttaatt 7080 ggatgtatag aaagaacaca tgtattttgt catactggtc
atccctggaa tatgtcatgg 7140 ggacatttaa atgagtcaac acaatgggat
gactgggtaa gcaaaatgga agatttaaat 7200 caagagatac taactacact
tcatggagcc aggaacaatt tggcacaatc catgataaca 7260 ttcaatacac
cagatagtat agctcaattt ggaaaagacc tttggagtca tattggaaat 7320
tggattcctg gattgggagc ttccattata aaatatatag tgatgttttt gcttatttat
7380 ttgttactaa cctcttcgcc taagatcctc agggccctct ggaaggtgac
cagtggtgca 7440 gggtcctccg gcagtcgtta cctgaagaaa aaattccatc
acaaacatgc atcgcgagaa 7500 gacacctggg accaggccca acacaacata
cacctagcag gcgtgaccgg tggatcaggg 7560 gacaaatact acaagcagaa
gtactccagg aacgactgga atggagaatc agaggagtac 7620 aacaggcggc
caaagagctg ggtgaagtca atcgaggcat ttggagagag ctatatttcc 7680
gagaagacca aaggggagat ttctcagcct ggggcggcta tcaacgagca caagaacggc
7740 tctgggggga acaatcctca ccaagggtcc ttagacctgg agattcgaag
cgaaggagga 7800 aacatttatg actgttgcat taaagcccaa gaaggaactc
tcgctatccc ttgctgtgga 7860 tttcccttat ggctattttg gggactagta
attatagtag gacgcatagc aggctatgga 7920 ttacgtggac tcgctgttat
aataaggatt tgtattagag gcttaaattt gatatttgaa 7980 ataatcagaa
aaatgcttga ttatattgga agagctttaa atcctggcac atctcatgta 8040
tcaatgcctc agtatgttta gaaaaacaag gggggaactg tggggttttt atgaggggtt
8100 ttataaatga ttataagagt aaaaagaaag ttgctgatgc tctcataacc
ttgtaaatga 8160 aagaccccac ctgtaggttt ggcaagctag cttaagtaac
gccattttgc aaggcatgga 8220 aaaatacata actgagaata gagaagttca
gatcaaggtc aggaacagat ggaacagctg 8280 aatatgggcc aaacaggata
tctgtggtaa gcagttcctg ccccggctca gggccaagaa 8340 cagatggaac
agctgaatat gggccaaaca ggatatctgt ggtaagcagt tcctgccccg 8400
gctcagggcc aagaacagat ggtccccaga tgcggtccag ccctcagcag tttctagaga
8460 accatcagat gtttccaggg tgccccaagg acctgaaatg accctgtgcc
ttatttgaac 8520 taaccaatca gttcgcttct cgcttctgtt cgcgcgcttc
tgctccccga gctcaataaa 8580 agagcccaca acccctcact cggggcgcca
gtcctccgat tgactgagtc gcccgggtac 8640 ccgtgtatcc aataaaccct
cttgcagttg catccgactt gtggtctcgc tgttccttgg 8700 gagggtctcc
tctgagtgat tgactacccg tcagcggggg tctttcattt gggggctcgt 8760
ccgggatcgg gagacccctg cccagggacc accgacccac caccgggagg taagctggct
8820 gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc
ccggagacgg 8880 tcacagcttg tctgtaagcg gatgccggga gcagacaagc
ccgtcagggc gcgtcagcgg 8940 gtgttggcgg gtgtcggggc gcagccatga
cccagtcacg tagcgatagc ggagtgtata 9000 ctggcaattg ggcactcaga
ttctgcggtc tgagtccctt ctctgctggg ctgaaaaggc 9060 ctttgtaata
aatataattc tctactcagt ccctgtctct agtttgtctg ttcgagatcc 9120
tacagagctc atgccttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat
9180 ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc
ctggggtgcc 9240 taatgagtga gctaactcac attaattgcg ttgcgctcac
tgcccgcttt ccagtcggga 9300 aacctgtcgt gccagctgca ttaatgaatc
ggccaacgcg cggggagagg cggtttgcgt 9360 attgggcgct cttccgcttc
ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 9420 cgagcggtat
cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 9480
gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg
9540 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
tcgacgctca 9600 agtcagaggt ggcgaaaccc gacaggacta taaagatacc
aggcgtttcc ccctggaagc 9660 tccctcgtgc gctctcctgt tccgaccctg
ccgcttaccg gatacctgtc cgcctttctc 9720 ccttcgggaa gcgtggcgct
ttctcatagc tcacgctgta ggtatctcag ttcggtgtag 9780 gtcgttcgct
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 9840
ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca
9900 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
agagttcttg 9960 aagtggtggc ctaactacgg ctacactaga aggacagtat
ttggtatctg cgctctgctg 10020 aagccagtta ccttcggaaa aagagttggt
agctcttgat ccggcaaaca aaccaccgct 10080 ggtagcggtg gtttttttgt
ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 10140 gaagatcctt
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 10200
gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa
10260 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag
ttaccaatgc 10320 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc
gttcatccat agttgcctga 10380 ctccccgtcg tgtagataac tacgatacgg
gagggcttac catctggccc cagtgctgca 10440 atgataccgc gagacccacg
ctcaccggct ccagatttat cagcaataaa ccagccagcc 10500 ggaagggccg
agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 10560
tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc
10620 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
cagctccggt 10680 tcccaacgat caaggcgagt tacatgatcc cccatgttgt
gcaaaaaagc ggttagctcc 10740 ttcggtcctc cgatcgttgt cagaagtaag
ttggccgcag tgttatcact catggttatg 10800 gcagcactgc ataattctct
tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 10860 gagtactcaa
ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 10920
gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga
10980 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc
cagttcgatg 11040 taacccactc gtgcacccaa ctgatcttca gcatctttta
ctttcaccag cgtttctggg 11100 tgagcaaaaa caggaaggca aaatgccgca
aaaaagggaa taagggcgac acggaaatgt 11160 tgaatactca tactcttcct
ttttcaatat tattgaagca tttatcaggg ttattgtctc 11220 atgagcggat
acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 11280
tttccccgaa aagtgccac 11299 15 66 DNA Artificial Sequence,primer
misc_feature (1)..(66) primer 15 atcgaagctt aattaaaagt agaaaatata
ttctaattta ttgggcactc agttctgcgg 60 tctgag 66 16 35 DNA Artificial
Sequence,primer misc_feature (1)..(35) primer 16 tcagctgcag
ttcgggcgcc aactgtagga tctcg 35 17 33 DNA Artificial Sequence,primer
misc_feature (1)..(33) primer 17 actgctgcag agattcgaag cgaaggagga
aac 33 18 31 DNA Artificial Sequence,primer misc_feature (1)..(31)
primer 18 tgtggggttt ccatgagggg ttttataaat g 31 19 30 DNA
Artificial Sequence,primer misc_feature (1)..(30) primer 19
ccctcatgga aaccccacgt tccccccttg 30 20 33 DNA Artificial
Sequence,primer misc_feature (1)..(33) primer 20 ctgaagatct
gaatctgagt gcccaattgt cag 33 21 23 DNA Artificial Sequence,primer
misc_feature (1)..(23) primer 21 ctgacaattg ggcactcaga ttc 23 22 44
DNA Artificial Sequence,primer misc_feature (1)..(44) primer 22
catgagatct taaaaaaaaa tgatgagaga attatattta ttac 44 23 21 DNA
Equine infectious anemia virus misc_feature (1)..(21) 23 gggcactcag
attctgcggt c 21 24 77 DNA Equine infectious anemia virus 24
cuagugauuc ugagugcccc ugaugagcgg ccgaaaggcc gcgaaaccug cguacgacac
60 gcaggucggg cactcag 77 25 50 DNA Artificial Sequence promoter
(13)..(29) T7 promoter 25 atcgttaatt aataatacga ctcactatag
ggcactcaga ttctgcggtc 50 26 82 DNA Artificial Sequence terminator
(11)..(59) T7 termination sequence 26 catgagatct caaaaaaccc
ctcaagaccc gtttagaggc cccaaggggt tatgctagtg 60 atgagagaat
tatatttatt
ac 82 27 7252 DNA Artificial Sequence, plasmid misc_feature
(1)..(7252) plasmid vector 27 agcttttgcg atcaataaat ggatcacaac
cagtatctct taacgatgtt cttcgcagat 60 gatgattcat tttttaagta
tttggctagt caagatgatg aaatcttcat tatctgatat 120 attgcaaatc
actcaatatc tagactttct gttattatta ttgatccaat caaaaaataa 180
attagaagcc gtgggtcatt gttatgaatc tctttcagag gaatacagac aattgacaaa
240 attcacagac tttcaagatt ttaaaaaact gtttaacaag gtccctattg
ttacagatgg 300 aagggtcaaa cttaataaag gatatttgtt cgactttgtg
attagtttga tgcgattcaa 360 aaaagaatcc tctctagcta ccaccgcaat
agatcctgtt agatacatag atcctcgtcg 420 caatatcgca ttttctaacg
tgatggatat attaaagtcg aataaagtga acaataatta 480 attctttatt
gtcatcatga acggcggaca tattcagttg ataatcggcc ccatgttttc 540
aggtaaaagt acagaattaa ttagacgagt tagacgttat caaatagctc aatataaatg
600 cgtgactata aaatattcta acgataatag atacggaacg ggactatgga
cgcatgataa 660 gaataatttt gaagcattgg aagcaactaa actatgtgat
ctcttggaat caattacaga 720 tttctccgtg ataggtatcg atgaaggaca
gttctttcca gacattgttg aattagatcg 780 ataaaaatta attaattacc
cgggtaccag gcctagatct gtcgacttcg agcttattta 840 tattccaaaa
aaaaaaaata aaatttcaat ttttaagctt tcactaattc caaacccacc 900
cgctttttat agtaagtttt tcacccataa ataataaata caataattaa tttctcgtaa
960 aagtagaaaa tatattctaa tttattgcac ggtaaggaag tagatcataa
ctcgagcatg 1020 ggagatcccg tcgttttaca acgtcgtgac tgggaaaacc
ctggcgttac ccaacttaat 1080 cgccttgcag cacatccccc tttcgccagc
tggcgtaata gcgaagaggc ccgcaccgat 1140 cgcccttccc aacagttgcg
cagcctgaat ggcgaatggc gctttgcctg gtttccggca 1200 ccagaagcgg
tgccggaaag ctggctggag tgcgatcttc ctgaggccga tactgtcgtc 1260
gtcccctcaa actggcagat gcacggttac gatgcgccca tctacaccaa cgtaacctat
1320 cccattacgg tcaatccgcc gtttgttccc acggagaatc cgacgggttg
ttactcgctc 1380 acatttaatg ttgatgaaag ctggctacag gaaggccaga
cgcgaattat ttttgatggc 1440 gttaactcgg cgtttcatct gtggtgcaac
gggcgctggg tcggttacgg ccaggacagt 1500 cgtttgccgt ctgaatttga
cctgagcgca tttttacgcg ccggagaaaa ccgcctcgcg 1560 gtgatggtgc
tgcgttggag tgacggcagt tatctggaag atcaggatat gtggcggatg 1620
agcggcattt tccgtgacgt ctcgttgctg cataaaccga ctacacaaat cagcgatttc
1680 catgttgcca ctcgctttaa tgatgatttc agccgcgctg tactggaggc
tgaagttcag 1740 atgtgcggcg agttgcgtga ctacctacgg gtaacagttt
ctttatggca gggtgaaacg 1800 caggtcgcca gcggcaccgc gcctttcggc
ggtgaaatta tcgatgagcg tggtggttat 1860 gccgatcgcg tcacactacg
tctcaacgtc gaaaacccga aactgtggag cgccgaaatc 1920 ccgaatctct
atcgtgcggt ggttgaactg cacaccgccg acggcacgct gattgaagca 1980
gaagcctgcg atgtcggttt ccgcgaggtg cggattgaaa atggtctgct gctgctgaac
2040 ggcaagccgt tgctgattcg aggcgttaac cgtcacgagc atcatcctct
gcatggtcag 2100 gtcatggatg agcagacgat ggtgcaggat atcctgctga
tgaagcagaa caactttaac 2160 gccgtgcgct gttcgcatta tccgaaccat
ccgctgtggt acacgctgtg cgaccgctac 2220 ggcctgtatg tggtggatga
agccaatatt gaaacccacg gcatggtgcc aatgaatcgt 2280 ctgaccgatg
atccgcgctg gctaccggcg atgagcgaac gcgtaacgcg aatggtgcag 2340
cgcgatcgta atcacccgag tgtgatcatc tggtcgctgg ggaatgaatc aggccacggc
2400 gctaatcacg acgcgctgta tcgctggatc aaatctgtcg atccttcccg
cccggtgcag 2460 tatgaaggcg gcggagccga caccacggcc accgatatta
tttgcccgat gtacgcgcgc 2520 gtggatgaag accagccctt cccggctgtg
ccgaaatggt ccatcaaaaa atggctttcg 2580 ctacctggag agacgcgccc
gctgatcctt tgcgaatacg cccacgcgat gggtaacagt 2640 cttggcggtt
tcgctaaata ctggcaggcg tttcgtcagt atccccgttt acagggcggc 2700
ttcgtctggg actgggtgga tcagtcgctg attaaatatg atgaaaacgg caacccgtgg
2760 tcggcttacg gcggtgattt tggcgatacg ccgaacgatc gccagttctg
tatgaacggt 2820 ctggtctttg ccgaccgcac gccgcatcca gcgctgacgg
aagcaaaaca ccagcagcag 2880 tttttccagt tccgtttatc cgggcaaacc
atcgaagtga ccagcgaata cctgttccgt 2940 catagcgata acgagctcct
gcactggatg gtggcgctgg atggtaagcc gctggcaagc 3000 ggtgaagtgc
ctctggatgt cgctccacaa ggtaaacagt tgattgaact gcctgaacta 3060
ccgcagccgg agagcgccgg gcaactctgg ctcacagtac gcgtagtgca accgaacgcg
3120 accgcatggt cagaagccgg gcacatcagc gcctggcagc agtggcgtct
ggcggaaaac 3180 ctcagtgtga cgctccccgc cgcgtcccac gccatcccgc
atctgaccac cagcgaaatg 3240 gatttttgca tcgagctggg taataagcgt
tggcaattta accgccagtc aggctttctt 3300 tcacagatgt ggattggcga
taaaaaacaa ctgctgacgc cgctgcgcga tcagttcacc 3360 cgtgcaccgc
tggataacga cattggcgta agtgaagcga cccgcattga ccctaacgcc 3420
tgggtcgaac gctggaaggc ggcgggccat taccaggccg aagcagcgtt gttgcagtgc
3480 acggcagata cacttgctga tgcggtgctg attacgaccg ctcacgcgtg
gcagcatcag 3540 gggaaaacct tatttatcag ccggaaaacc taccggattg
atggtagtgg tcaaatggcg 3600 attaccgttg atgttgaagt ggcgagcgat
acaccgcatc cggcgcggat tggcctgaac 3660 tgccagctgg cgcaggtagc
agagcgggta aactggctcg gattagggcc gcaagaaaac 3720 tatcccgacc
gccttactgc cgcctgtttt gaccgctggg atctgccatt gtcagacatg 3780
tataccccgt acgtcttccc gagcgaaaac ggtctgcgct gcgggacgcg cgaattgaat
3840 tatggcccac accagtggcg cggcgacttc cagttcaaca tcagccgcta
cagtcaacag 3900 caactgatgg aaaccagcca tcgccatctg ctgcacgcgg
aagaaggcac atggctgaat 3960 atcgacggtt tccatatggg gattggtggc
gacgactcct ggagcccgtc agtatcggcg 4020 gaattcagct gagcgccggt
cgctaccatt accagttggt ctggtgtcaa aaataataat 4080 aaccgggcag
gggggatcct tctgtgagcg tatggcaaac gaaggaaaaa tagttatagt 4140
agccgcactc gatgggacat ttcaacgtaa accgtttaat aatattttga atcttattcc
4200 attatctgaa atggtggtaa aactaactgc tgtgtgtatg aaatgcttta
aggaggcttc 4260 cttttctaaa cgattgggtg aggaaaccga gatagaaata
ataggaggta atgatatgta 4320 tcaatcggtg tgtagaaagt gttacatcga
ctcataatat tatatttttt atctaaaaaa 4380 ctaaaaataa acattgatta
aattttaata taatacttaa aaatggatgt tgtgtcgtta 4440 gataaaccgt
ttatgtattt tgaggaaatt gataatgagt tagattacga accagaaagt 4500
gcaaatgagg tcgcaaaaaa actgccgtat caaggacagt taaaactatt actaggagaa
4560 ttattttttc ttagtaagtt acagcgacac ggtatattag atggtgccac
cgtagtgtat 4620 ataggatctg ctcccggtac acatatacgt tatttgagag
atcatttcta taatttagga 4680 gtgatcatca aatggatgct aattgacggc
cgccatcatg atcctatttt aaatggattg 4740 cgtgatgtga ctctagtgac
tcggttcgtt gatgaggaat atctacgatc catcaaaaaa 4800 caactgcatc
cttctaagat tattttaatt tctgatgtga gatccaaacg aggaggaaat 4860
gaacctagta cggcggattt actaagtaat tacgctctac aaaatgtcat gattagtatt
4920 ttaaaccccg tggcgtctag tcttaaatgg agatgcccgt ttccagatca
atggatcaag 4980 gacttttata tcccacacgg taataaaatg ttacaacctt
ttgctccttc atattcagct 5040 gaaatgagat tattaagtat ttataccggt
gagaacatga gactgactcg ggccgcgttg 5100 ctggcgtttt tccataggct
ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 5160 cagaggtggc
gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 5220
ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
5280 tcgggaagcg tggcgctttc tcaatgctca cgctgtaggt atctcagttc
ggtgtaggtc 5340 gttcgctcca agctgggctg tgtgcacgaa ccccccgttc
agcccgaccg ctgcgcctta 5400 tccggtaact atcgtcttga gtccaacccg
gtaagacacg acttatcgcc actggcagca 5460 gccactggta acaggattag
cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 5520 tggtggccta
actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag 5580
ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
5640 agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
atctcaagaa 5700 gatcctttga tcttttctac ggggtctgac gctcagtgga
acgaaaactc acgttaaggg 5760 attttggtca tgagattatc aaaaaggatc
ttcacctaga tccttttaaa ttaaaaatga 5820 agttttaaat caatctaaag
tatatatgag taaacttggt ctgacagtta ccaatgctta 5880 atcagtgagg
cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 5940
cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg
6000 ataccgcgag acccacgctc accggctcca gatttatcag caataaacca
gccagccgga 6060 agggccgagc gcagaagtgg tcctgcaact ttatccgcct
ccatccagtc tattaattgt 6120 tgccgggaag ctagagtaag tagttcgcca
gttaatagtt tgcgcaacgt tgttgccatt 6180 gctgcaggca tcgtggtgtc
acgctcgtcg tttggtatgg cttcattcag ctccggttcc 6240 caacgatcaa
ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc 6300
ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca
6360 gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt
gactggtgag 6420 tactcaacca agtcattctg agaatagtgt atgcggcgac
cgagttgctc ttgcccggcg 6480 tcaacacggg ataataccgc gccacatagc
agaactttaa aagtgctcat cattggaaaa 6540 cgttcttcgg ggcgaaaact
ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa 6600 cccactcgtg
cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga 6660
gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga
6720 atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta
ttgtctcatg 6780 agcggataca tatttgaatg tatttagaaa aataaacaaa
taggggttcc gcgcacattt 6840 ccccgaaaag tgccacctga cgtctaagaa
accattatta tcatgacatt aacctataaa 6900 aataggcgta tcacgaggcc
ctttcgtctt cgaataaata cctgtgacgg aagatcactt 6960 cgcagaataa
ataaatcctg gtgtccctgt tgataccggg aagccctggg ccaacttttg 7020
gcgaaaatga gacgttgatc ggcacgtaag aggttccaac tttcaccata atgaaataag
7080 atcactaccg ggcgtatttt ttgagttatc gagattttca ggagctaagg
aagctaaaat 7140 ggagaaaaaa atcactggat ataccaccgt tgatatatcc
caatggcatc gtaaagaaca 7200 ttttgaggca tttcagtcag ttgctcaatg
tacctataac cagaccgttc ag 7252 28 7387 DNA Artificial Sequence,
primer misc_feature (1)..(7387) plasmid vector 28 cctcctgaaa
aactggaatt taatacacca tttgtgttca tcatcagaca tgatattact 60
ggatttatat tgtttatggg taaggtagaa tctccttaat atgggtacgg tgtaaggaat
120 cattatttta tttatattga tgggtacgtg aaatctgaat tttcttaata
aatattattt 180 ttattaaatg tgtatatgtt gttttgcgat agccatgtat
ctactaatca gatctattag 240 agatattatt aattctggtg caatatgaca
aaaattatac actaattagc gtctcgtttc 300 agacatggat ctgtcacgaa
ttaatacttg gaagtctaag cagctgaaaa gctttctctc 360 tagcaaagat
gcatttaagg cggatgtcca tggacatagt gccttgtatt atgcaatagc 420
tgataataac gtgcgtctag tatgtacgtt gttgaacgct ggagcattga aaaatcttct
480 agagaatgaa tttccattac atcaggcagc cacattggaa gataccaaaa
tagtaaagat 540 tttggctatt cagtggactg gatgattcga ggtacccgat
cccccctgcc cggttattat 600 tatttttgac accagaccaa ctggtaatgg
tagcgaccgg cgctcagctg aattccgccg 660 atactgacgg gctccaggag
tcgtcgccac caatccccat atggaaaccg tcgatattca 720 gccatgtgcc
ttcttccgcg tgcagcagat ggcgatggct ggtttccatc agttgctgtt 780
gactgtagcg gctgatgttg aactggaagt cgccgcgcca ctggtgtggg ccataattca
840 attcgcgcgt cccgcagcgc agaccgtttt cgctcgggaa gacgtacggg
gtatacatgt 900 ctgacaatgg cagatcccag cggtcaaaac aggcggcagt
aaggcggtcg ggatagtttt 960 cttgcggccc taatccgagc cagtttaccc
gctctgctac ctgcgccagc tggcagttca 1020 ggccaatccg cgccggatgc
ggtgtatcgc tcgccacttc aacatcaacg gtaatcgcca 1080 tttgaccact
accatcaatc cggtaggttt tccggctgat aaataaggtt ttcccctgat 1140
gctgccacgc gtgagcggtc gtaatcagca ccgcatcagc aagtgtatct gccgtgcact
1200 gcaacaacgc tgcttcggcc tggtaatggc ccgccgcctt ccagcgttcg
acccaggcgt 1260 tagggtcaat gcgggtcgct tcacttacgc caatgtcgtt
atccagcggt gcacgggtga 1320 actgatcgcg cagcggcgtc agcagttgtt
ttttatcgcc aatccacatc tgtgaaagaa 1380 agcctgactg gcggttaaat
tgccaacgct tattacccag ctcgatgcaa aaatccattt 1440 cgctggtggt
cagatgcggg atggcgtggg acgcggcggg gagcgtcaca ctgaggtttt 1500
ccgccagacg ccactgctgc caggcgctga tgtgcccggc ttctgaccat gcggtcgcgt
1560 tcggttgcac tacgcgtact gtgagccaga gttgcccggc gctctccggc
tgcggtagtt 1620 caggcagttc aatcaactgt ttaccttgtg gagcgacatc
cagaggcact tcaccgcttg 1680 ccagcggctt accatccagc gccaccatcc
agtgcaggag ctcgttatcg ctatgacgga 1740 acaggtattc gctggtcact
tcgatggttt gcccggataa acggaactgg aaaaactgct 1800 gctggtgttt
tgcttccgtc agcgctggat gcggcgtgcg gtcggcaaag accagaccgt 1860
tcatacagaa ctggcgatcg ttcggcgtat cgccaaaatc accgccgtaa gccgaccacg
1920 ggttgccgtt ttcatcatat ttaatcagcg actgatccac ccagtcccag
acgaagccgc 1980 cctgtaaacg gggatactga cgaaacgcct gccagtattt
agcgaaaccg ccaagactgt 2040 tacccatcgc gtgggcgtat tcgcaaagga
tcagcgggcg cgtctctcca ggtagcgaaa 2100 gccatttttt gatggaccat
ttcggcacag ccgggaaggg ctggtcttca tccacgcgcg 2160 cgtacatcgg
gcaaataata tcggtggccg tggtgtcggc tccgccgcct tcatactgca 2220
ccgggcggga aggatcgaca gatttgatcc agcgatacag cgcgtcgtga ttagcgccgt
2280 ggcctgattc attccccagc gaccagatga tcacactcgg gtgattacga
tcgcgctgca 2340 ccattcgcgt tacgcgttcg ctcatcgccg gtagccagcg
cggatcatcg gtcagacgat 2400 tcattggcac catgccgtgg gtttcaatat
tggcttcatc caccacatac aggccgtagc 2460 ggtcgcacag cgtgtaccac
agcggatggt tcggataatg cgaacagcgc acggcgttaa 2520 agttgttctg
cttcatcagc aggatatcct gcaccatcgt ctgctcatcc atgacctgac 2580
catgcagagg atgatgctcg tgacggttaa cgcctcgaat cagcaacggc ttgccgttca
2640 gcagcagcag accattttca atccgcacct cgcggaaacc gacatcgcag
gcttctgctt 2700 caatcagcgt gccgtcggcg gtgtgcagtt caaccaccgc
acgatagaga ttcgggattt 2760 cggcgctcca cagtttcggg ttttcgacgt
tgagacgtag tgtgacgcga tcggcataac 2820 caccacgctc atcgataatt
tcaccgccga aaggcgcggt gccgctggcg acctgcgttt 2880 caccctgcca
taaagaaact gttacccgta ggtagtcacg caactcgccg cacatctgaa 2940
cttcagcctc cagtacagcg cggctgaaat catcattaaa gcgagtggca acatggaaat
3000 cgctgatttg tgtagtcggt ttatgcagca acgagacgtc acggaaaatg
ccgctcatcc 3060 gccacatatc ctgatcttcc agataactgc cgtcactcca
acgcagcacc atcaccgcga 3120 ggcggttttc tccggcgcgt aaaaatgcgc
tcaggtcaaa ttcagacggc aaacgactgt 3180 cctggccgta accgacccag
cgcccgttgc accacagatg aaacgccgag ttaacgccat 3240 caaaaataat
tcgcgtctgg ccttcctgta gccagctttc atcaacatta aatgtgagcg 3300
agtaacaacc cgtcggattc tccgtgggaa caaacggcgg attgaccgta atgggatagg
3360 ttacgttggt gtagatgggc gcatcgtaac cgtgcatctg ccagtttgag
gggacgacga 3420 cagtatcggc ctcaggaaga tcgcactcca gccagctttc
cggcaccgct tctggtgccg 3480 gaaaccaggc aaagcgccat tcgccattca
ggctgcgcaa ctgttgggaa gggcgatcgg 3540 tgcgggcctc ttcgctatta
cgccagctgg cgaaaggggg atgtgctgca aggcgattaa 3600 gttgggtaac
gccagggttt tcccagtcac gacgttgtaa aacgacggga tctcccatgc 3660
tcgagttatg atctacttcc ttaccgtgca ataaattaga atatattttc tacttttacg
3720 agaaattaat tattgtattt attatttatg ggtgaaaaac ttactataaa
aagcgggtgg 3780 gtttggaatt agtgaaagct gggagatctg gcgcgcctgc
agagaattcg tttaaacgga 3840 tcccgagctt atttatattc caaaaaaaaa
aaataaaatt tcaattttta agctggggat 3900 cctctagagt cgacctgcag
gcatgctcga gcggccgcca gtgtgatgga tatctgcaga 3960 attcggcttg
gggggctgca ggtggatgcg atcatgacgt cctctgcaat ggataacaat 4020
gaacctaaag tactagaaat ggtatatgat gctacaattt tacccgaagg tagtagcatg
4080 gattgtataa acagacacat caatatgtgt atacaacgca cctatagttc
tagtataatt 4140 gccatattgg atagattcct aatgatgaac aaggatgaac
taaataatac acagtgtcat 4200 ataattaaag aatttatgac atacgaacaa
atggcgattg accattatgg agaatatgta 4260 aacgctattc tatatcaaat
tcgtaaaaga cctaatcaac atcacaccat taatctgttt 4320 aaaaaaataa
aaagaacccg gtatgacact tttaaagtgg atcccgtaga attcgtaaaa 4380
aaagttatcg gatttgtatc tatcttgaac aaatataaac cggtttatag ttacgtcctg
4440 tacgagaacg tcctgtacga tgagttcaaa tgtttcattg actacgtgga
aactaagtat 4500 ttctaaaatt aatgatgcat taatttttgt attgattctc
aatcctaaaa actaaaatat 4560 gaataagtat taaacatagc ggtgtactaa
ttgatttaac ataaaaaata gttgttaact 4620 aatcatgagg actctactta
ttagatatat tctttggaga aatgacaacg atcaaaccgg 4680 gcatgcaagc
ttgtctccct atagtgagtc gtattagagc ttggcgtaat catggtcata 4740
gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag
4800 cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa
ttgcgttgcg 4860 ctcactgccc gctttcgagt cgggaaacct gtcgtgccag
ctgcattaat gaatcggcca 4920 acgcgcgggg agaggcggtt tgcgtattgg
gcgctcttcc gcttcctcgc tcactgactc 4980 gctgcgctcg gtcgttcggc
tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 5040 gttatccaca
gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 5100
ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc gataggctcc gcccccctga
5160 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
gactataaag 5220 ataccaggcg tttccccctg gaagctccct cgtgcgctct
cctgttccga ccctgccgct 5280 taccggatac ctgtccgcct ttctcccttc
gggaagcgtg gcgctttctc atagctcacg 5340 ctgtaggtat ctcagttcgg
tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 5400 ccccgttcag
cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 5460
aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta
5520 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
ctagaaggac 5580 agtatttggt atctgcgctc tgctgaagcc agttaccttc
ggaaaaagag ttggtagctc 5640 ttgatccggc aaacaaacca ccgctggtag
cggtggtttt tttgtttgca agcagcagat 5700 tacgcgcaga aaaaaaggat
ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 5760 tcagtggaac
gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 5820
cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta
5880 aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
cgatctgtct 5940 atttcgttca tccatagttg cctgactccc cgtcgtgtag
ataactacga tacgggaggg 6000 cttaccatct ggccccagtg ctgcaatgat
accgcgagac ccacgctcac cggctccaga 6060 tttatcagca ataaaccagc
cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 6120 atccgcctcc
atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 6180
taatagtttg cgcaacgttg ttggcattgc tacaggcatc gtggtgtcac gctcgtcgtt
6240 tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
gatcccccat 6300 gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc
gttgtcagaa gtaagttggc 6360 cgcagtgtta tcactcatgg ttatggcagc
actgcataat tctcttactg tcatgccatc 6420 cgtaagatgc ttttctgtga
ctggtgagta ctcaaccaag tcattctgag aatagtgtat 6480 gcggcgaccg
agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 6540
aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt
6600 accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
cttcagcatc 6660 ttttactttc accagcgttt ctgggtgagc aaaaacagga
aggcaaaatg ccgcaaaaaa 6720 gggaataagg gcgacacgga aatgttgaat
actcatactc ttcctttttc aatattattg 6780 aagcatttat cagggttatt
gtctcatgag cggatacata tttgaatgta tttagaaaaa 6840 taaacaaata
ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac 6900
cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc
6960 gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga
cggtcacagc 7020 ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag
ggcgcgtcag cgggtgttgg 7080 cgggtgtcgg ggctggctta actatgcggc
atcagagcag attgtactga gagtgcacca 7140 tatgcggtgt gaaataccgc
acagatgcgt aaggagaaaa taccgcatca ggcgccattc 7200 gccattcagg
ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg 7260
ccagctggcg aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc
7320 ccagtcacga cgttgtaaaa cgacggccag tgaattggat ttaggtgaca
ctatagaata 7380 cgaattc 7387 29 27 DNA Artificial Sequence, primer
misc_feature (1)..(27) primer 29 gcatggacct gtggggtttt tatgagg 27
30 29 DNA Artificial Sequence, primer misc_feature (1)..(29) primer
30
gcatgagctc tgtaggatct cgaacagac 29 31 33 DNA Artificial Sequence,
primer misc_feature (1)..(33) primer 31 gactacgact agtgtatgtt
tagaaaaaca agg 33 32 32 DNA Artificial Sequence misc_feature
(1)..(32) primer 32 ctaggctact agtactgtag gatctcgaac ag 32 33 33
DNA Artificial Sequence, primer misc_feature (1)..(33) primer 33
gggctatatg agatcttgaa taataaaatg tgt 33 34 14 DNA Artificial
Sequence, primer misc_feature (1)..(14) primer 34 tattaataac tagt
14 35 42 DNA Artificial Sequence, primer misc_feature (1)..(42)
primer 35 gctacgcaga gctcgtttag tgaaccgggc actcagattc tg 42 36 36
DNA Artificial Sequence, primer misc_feature (1)..(36) primer 36
gctgagctct agagtccttt tcttttacaa agttgg 36 37 31 DNA Artificial
Sequence, primer misc_feature (1)..(31) primer 37 gtcgctgagg
tcgacaaggc aaagagaaga g 31 38 31 DNA Artificial Sequence, primer
misc_feature (1)..(31) primer 38 gaccggtacc gtcgacaagg cacagcagtg g
31 39 32 DNA Artificial Sequence, primer misc_feature (1)..(32)
primer 39 ttctgtcgac gaatcccagg gggaatctca ac 32 40 35 DNA
Artificial Sequence, primer misc_feature (1)..(35) primer 40
gtcaccttcc agagggccct ggctaagcat aacag 35 41 35 DNA Artificial
Sequence, primer misc_feature (1)..(35) primer 41 ctgttatgct
tagccagggc cctctggaag gtgac 35 42 28 DNA Artificial Sequence,
primer misc_feature (1)..(28) primer 42 aattgctgac ccccaaaata
gccataag 28 43 36 DNA Artificial Sequence, primer misc_feature
(1)..(36) primer 43 ccatgcacgt ctgcagccag catggcagaa tcgaag 36 44
30 DNA Artificial Sequence, primer misc_feature (1)..(30) primer 44
cctgaggatc tattttccac cagtcatttc 30 45 29 DNA Artificial Sequence,
primer misc_feature (1)..(29) primer 45 gtggaaaata gatcctcagg
gccctctgg 29 46 34 DNA Artificial Sequence, primer misc_feature
(1)..(34) primer 46 gcagtgccgg atcctcataa atgtttcctc cttc 34 47 24
DNA Artificial Sequence, primer misc_feature (1)..(24) primer 47
gacaccatgg gaagtattta tcac 24 48 35 DNA Artificial Sequence, primer
misc_feature (1)..(35) primer 48 cctgggattc atatcaaacc ttataacaaa
tattg 35 49 22 DNA Artificial Sequence, primer misc_feature
(1)..(22) primer 49 tcctgctaag cataacagaa ac 22 50 29 DNA
Artificial Sequence, primer misc_feature (1)..(29) primer 50
ggtttgatat gaatcccagg gggaatctc 29 51 22 DNA Artificial Sequence,
primer misc_feature (1)..(22) primer 51 accccgtacg tcttcccgag cg 22
52 39 DNA Artificial Sequence, primer misc_feature (1)..(39) primer
52 gttattaatt aatggaggaa taattgaaga aggatatac 39 53 31 DNA
Artificial Sequence, primer misc_feature (1)..(31) primer 53
tcttctgcag gtcctgatcc ttgcttagtg c 31 54 41 DNA Artificial
Sequence, primer misc_feature (1)..(41) primer 54 gaccatgtta
cccctttacc attaactccc taatatcaaa c 41 55 44 DNA Artificial
Sequence, primer misc_feature (1)..(44) primer 55 gtaaaggggt
aacatggtca gcatcgcatt ctacggggga atcc 44 56 38 DNA Artificial
Sequence, primer misc_feature (1)..(38) primer 56 ccatgcacgt
ctcgagccag catgggagac cctttgac 38 57 37 DNA Artificial Sequence,
primer misc_feature (1)..(37) primer 57 cgagctagag gtcgactcaa
tttggtttat tagtaac 37 58 32 DNA Artificial Sequence, primer
misc_feature (1)..(32) primer 58 gcaatggaat gacatccctc agctgccagt
cc 32 59 42 DNA Artificial Sequence, primer misc_feature (1)..(42)
primer 59 gggatgtcat tccattgcca ccatgggaag tatttatcac ta 42 60 34
DNA Artificial Sequence, primer misc_feature (1)..(34) primer 60
gtcgagcacg cgtttgccta gcaacatgag ctag 34 61 34 DNA Artificial
Sequence, primer misc_feature (1)..(34) primer 61 gtcgagccaa
ttgttgccta gcaacatgag ctag 34 62 28 DNA Artificial Sequence
misc_feature (1)..(28) P7.5E sequence 62 aaaagtagaa aatatattct
aatttatt 28 63 19 DNA Artificial Sequence promoter (1)..(19) T7
promter 63 taatacgact cactatagg 19 64 48 DNA Artificial Sequence
terminator (1)..(48) T7 terminator 64 ctagcataac cccttggggc
ctctaaacgg gtcttgaggg gttttttg 48
* * * * *
References