U.S. patent application number 10/299052 was filed with the patent office on 2003-08-07 for protein production and protein delivery.
This patent application is currently assigned to Transkaryotic Therapies, Inc. a Delaware corporation. Invention is credited to Heartlein, Michael W., Selden, Richard F., Treco, Douglas.
Application Number | 20030147868 10/299052 |
Document ID | / |
Family ID | 27505771 |
Filed Date | 2003-08-07 |
United States Patent
Application |
20030147868 |
Kind Code |
A1 |
Treco, Douglas ; et
al. |
August 7, 2003 |
Protein production and protein delivery
Abstract
The present invention relates to transfected primary, secondary,
and immortalized cells of vertebrate origin particularly mammalian
origin, transfected with exogenous genetic material (DNA) which
encodes a desired (e.g., a therapeutic) product or is itself a
desired (e.g., therapeutic) product, methods by which primary,
secondary and immortalized cells are transfected to include
exogenous genetic material, including DNA targeting by homologous
recombination, methods for the activation and amplification of
endogenous cellular genes, methods by which cells useful for
large-scale protein production can be obtained, methods of
producing clonal cell strains or heterogenous cell strains, and
methods of gene therapy in which transfected primary, secondary or
immortalized cells are used. The present invention includes
primary, secondary, and immortalized cells, such as fibroblasts,
keratinocytes, epithelial cells, endothelial cells, glial cells,
neural cells, formed elements of the blood, muscle cells, and other
cells which can be cultured.
Inventors: |
Treco, Douglas; (Arlington,
MA) ; Heartlein, Michael W.; (Boxborough, MA)
; Selden, Richard F.; (Wellesley, MA) |
Correspondence
Address: |
LISA N. GELLER, PH.D., J.D.
Fish & Richardson P.C.
225 Franklin Street
Boston
MA
02110-2804
US
|
Assignee: |
Transkaryotic Therapies, Inc. a
Delaware corporation
|
Family ID: |
27505771 |
Appl. No.: |
10/299052 |
Filed: |
November 18, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10299052 |
Nov 18, 2002 |
|
|
|
09312245 |
May 14, 1999 |
|
|
|
6565844 |
|
|
|
|
09312245 |
May 14, 1999 |
|
|
|
08451894 |
May 26, 1995 |
|
|
|
5968502 |
|
|
|
|
08451894 |
May 26, 1995 |
|
|
|
07985586 |
Dec 3, 1992 |
|
|
|
07985586 |
Dec 3, 1992 |
|
|
|
07789188 |
Nov 5, 1991 |
|
|
|
07985586 |
Dec 3, 1992 |
|
|
|
07911533 |
Jul 10, 1992 |
|
|
|
07985586 |
Dec 3, 1992 |
|
|
|
07787840 |
Nov 5, 1991 |
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/372; 435/455 |
Current CPC
Class: |
A61K 48/0066 20130101;
A61K 38/00 20130101; C07H 21/04 20130101; C07K 2319/00 20130101;
C12N 2830/00 20130101; C12N 2830/702 20130101; C12N 2830/002
20130101; A61K 48/00 20130101; C12N 15/67 20130101; C12N 15/85
20130101; A61K 35/12 20130101; C12N 2830/85 20130101; C12N 2840/44
20130101; C12N 15/907 20130101; C07K 14/505 20130101; C12N 2830/42
20130101; C12N 2510/02 20130101; C12N 2800/108 20130101; A01K
2217/05 20130101; C12N 2840/20 20130101; C12N 2830/55 20130101;
C07K 14/605 20130101; C07K 2319/02 20130101; C07K 14/61
20130101 |
Class at
Publication: |
424/93.21 ;
435/372; 435/455 |
International
Class: |
A61K 048/00; C12N
005/08; C12N 015/85 |
Claims
1. A method of activating expression of and amplifying an
endogenous gene in genomic DNA of a vertebrate cell which is not
expressed in the cell as obtained or is not expressed at
significant levels in the cell as obtained, comprising the steps
of: a) transfecting cells with DNA sequences comprising: 1)
exogenous DNA selected from the group consisting of: a) DNA
sequences which repair, alter, delete or replace a sequence present
in the cell; or b) DNA sequences which are regulatory sequences not
normally functionally linked to the endogenous gene in the cell as
obtained; 2) DNA sequences homologous with genomic DNA sequences at
a preselected site in the cells; and 3) amplifiable DNA encoding a
selectable marker, thereby producing cells containing the DNA
sequences; b) maintaining the cells produced in (a) under
conditions appropriate for homologous recombination to occur
between DNA sequences homologous with genomic DNA sequences and
genomic DNA sequences, thereby producing homologously recombinant
cells of vertebrate origin having the DNA sequences of (a)(1),
(a)(2) and (a)(3) integrated into genomic DNA and exogenous DNA of
(a)(1) functionally linked to the endogenous gene; and c) culturing
the homologously recombinant cells produced in (b) under conditions
which select for amplification of the amplifiable DNA encoding a
selectable marker, whereby the amplifiable DNA encoding a
selectable marker and the endogenous gene functionally linked to
exogenous DNA of (a)(1) are coamplified, thereby producing
homologously recombinant cells containing amplified DNA encoding a
selectable marker and a coamplified endogenous gene functionally
linked to DNA sequences of (a)(1), in which the coamplified gene is
expressed.
2. The method of claim 1 wherein the vertebrate cell is a primary
or secondary cell.
3. The method of claim 2 wherein the primary or secondary cell is a
mammalian cell.
4. The method of claim 2 wherein the primary or secondary cell is a
human cell.
5. The method of claim 1 wherein the vertebrate cell is an
immortalized cell.
6. The method of claim 5 wherein the immortalized cell is of
mammalian origin.
7. The method of claim 5 wherein the immortalized cell is of human
origin.
8. Homologously recombinant cells produced by the method of claim
2.
9. Homologously recombinant cells produced by the method of claim
3.
10. Homologously recombinant cells produced by the method of claim
4.
11. Homologously recombinant cells produced by the method of claim
5.
12. Homologously recombinant cells produced by the method of claim
6.
13. Homologously recombinant cells produced by the method of claim
7.
14. The method of claim 1 wherein the gene to be expressed encodes
a product selected from the group consisting of: hormones,
cytokines, antigens, antibodies, enzymes, clotting factors,
transport proteins, receptors, regulatory proteins, structural
proteins, transcription factors, antisense RNA and ribozymes, and
proteins or nucleic acids which do not occur in nature.
15. The method of claim 14 wherein the endogenous gene encodes a
therapeutic product selected from the group consisting of human
growth hormone, human insulin, human insulinotropin, and human
erythropoietin.
16. The method of claim 1 wherein the amplifiable DNA encoding a
selectable marker encodes a selectable marker selected from the
group consisting of: dihydrofolate reductase, adenosine deaminase,
and CAD.
17. The method of claim 1 in which the DNA construct further
comprises an additional positive selection marker.
18. The method of claim 1 in which the DNA construct further
comprises a negative selection marker.
19. The method of claim 17 in which the additional positive
selection marker is neo.
20. The method of claim 18 in which the positive selection marker
is neo and the negative selection marker is gpt.
21. The method of claim 18 in which the positive selection marker
is neo and the negative selection marker is the HSV-TK gene.
22. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 2, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary cells from
growing outside of the barrier device and prevents the rejection of
the cells by the mammal's immune system.
23. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 3, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary mammalian cells
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
24. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 4, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary human cells of
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
25. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 5, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells from growing
outside of the barrier device and prevents the rejection of the
cells by the mammal's immune system.
26. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 6, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells of mammalian
origin from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
27. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 7, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells of human origin
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
28. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 3.
29. A method of providing an effective amount of a therapeutic
product to a human comprising introducing into the human cells
produced by the method of claim 4.
30. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 2 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 2.
31. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 3 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 3.
32. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 4 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 4.
33. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 5 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 5.
34. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 6 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 6.
35. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 7 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic protein is
expressed by the cells of claim 7.
36. A method of targeting DNA sequences into genomic DNA of a cell
of vertebrate origin, comprising the steps of: a) providing a DNA
construct comprising: 1) exogenous DNA encoding a product to be
expressed in cells of vertebrate origin; and 2) DNA sequences
homologous with genomic DNA sequences in the cell of vertebrate
origin; and 3) amplifiable DNA sequences encoding a marker for
which selection of amplified copies of the marker can be performed;
b) introducing into cells the DNA construct provided in (a),
thereby producing cells containing the DNA construct provided in
(a); c) maintaining cells produced in (b) under conditions
appropriate for homologous recombination to occur between DNA
sequences homologous with genomic DNA sequences and genomic DNA
sequences, thereby producing homologously recombinant cells of
vertebrate origin having the DNA construct of (a) integrated into
genomic DNA of the cells; and d) culturing the homologously
recombinant cells produced in (b) under conditions which select for
amplification of the amplifiable DNA encoding a selectable marker,
whereby the amplifiable DNA encoding a selectable marker and the
endogenous gene functionally linked to exogenous DNA of (a)(1) are
coamplified, thereby producing homologously recombinant cells
containing amplified DNA encoding a selectable marker and a
coamplified endogenous gene functionally linked to DNA sequences of
(a)(1), wherein the cells are capable of expressing the coamplified
endogenous gene.
37. The method of claim 36 wherein the vertebrate cell is a primary
or secondary cell.
38. The method of claim 37 wherein the primary or secondary cell is
a mammalian cell.
39. The method of claim 37 wherein the primary or secondary cell is
a human cell.
40. The method of claim 36 wherein the vertebrate cell is an
immortalized cell.
41. The method of claim 40 wherein the immortalized cells is of
mammalian origin.
42. The method of claim 40 wherein the immortalized cell is of
human origin.
43. Homologously recombinant cells produced by the method of claim
37.
44. Homologously recombinant cells produced by the method of claim
38.
45. Homologously recombinant cells produced by the method of claim
39.
46. Homologously recombinant cells produced by the method of claim
40.
47. Homologously recombinant cells produced by the method of claim
41.
48. Homologously recombinant cells produced by the method of claim
42.
49. The method of claim 36 wherein the gene to be expressed encodes
a product selected from the group consisting of: hormones,
cytokines, antigens, antibodies, enzymes, clotting factors,
transport proteins, receptors, regulatory proteins, structural
proteins, transcription factors, antisense RNA and ribozymes, and
proteins or nucleic acids which do not occur in nature.
50. The method of claim 49 wherein the endogenous gene encodes a
therapeutic product selected from the group consisting of human
growth hormone, human insulin, human insulinotropin, and human
erythropoietin.
51. The method of claim 36 wherein the amplifiable DNA encoding a
selectable marker encodes a selectable marker selected from the
group consisting of: dihydrofolate reductase, adenosine deaminase,
and CAD.
52. The method of claim 36 in which the DNA construct further
comprises an additional positive selection marker.
53. The method of claim 36 in which the DNA construct further
comprises a negative selection marker.
54. The method of claim 52 in which the additional positive
selection marker is neo.
55. The method of claim 53 in which the positive selection marker
is neo and the negative selection marker is gpt.
56. The method of claim 53 in which the positive selection marker
is neo and the negative selection marker is the HSV-TK gene.
57. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 37, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary vertebrate
cells from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
58. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 38, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary mammalian cells
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
59. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 39, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the primary or secondary human cells
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
60. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 40, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells from growing
outside of the barrier device and prevents the rejection of the
cells by the mammal's immune system.
61. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 41, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells of mammalian
origin from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
62. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 42, in which the cells are
introduced into the mammal enclosed within a barrier device,
wherein the barrier device is made of a material which permits
passage of the therapeutic product into the circulation or tissues
of the mammal and prevents the immortalized cells of human origin
from growing outside of the barrier device and prevents the
rejection of the cells by the mammal's immune system.
63. A method of providing an effective amount of a therapeutic
product to a mammal comprising introducing into the mammal cells
produced by the method of claim 38.
64. A method of providing an effective amount of a therapeutic
product to a human comprising introducing into the human cells
produced by the method of claim 39.
65. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 37 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 37.
66. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 38 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 38.
67. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 39 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 39.
68. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 40 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 40.
69. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 41 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 41.
70. A method for the in vitro production of a therapeutic protein
comprising culturing the homologously recombinant cells produced by
the method of claim 42 under conditions suitable for the expression
of the therapeutic protein, whereby the therapeutic product is
expressed by the cells of claim 42.
71. A method for the in vitro production of a therapeutic protein
using a microbial cell containing an intronless copy of a human
gene encoding a therapeutic protein, comprising the steps of: a)
introducing into human cells a DNA construct comprising: 1) a
retroviral LTR; 2) a gene encoding a marker for selection in
microbial cells; 3) regulatory sequences capable of promoting
expression of the therapeutic protein in microbial cells; 4) DNA
encoding a leader peptide capable of promoting secretion of the
therapeutic protein from microbial cells; and 5) sequences
sufficient to direct homologous recombination of the DNA construct
with human genomic DNA sequences adjacent to and upstream of DNA
encoding the first amino acid in the therapeutic protein, thereby
producing cells containing the DNA construct; b) maintaining the
cells produced in (a) under conditions appropriate for homologous
recombination to occur between DNA sequences homologous with
genomic DNA sequences and genomic DNA sequences, thereby producing
homologously recombinant cells having the DNA construct of (a)
integrated into genomic DNA adjacent to and upstream of and
functionally linked to the gene encoding the therapeutic protein;
c) introducing into the homologously recombinant cells produced in
(b) a DNA construct comprising: 1) DNA sequences capable of
directing transcription termination in a microbial cell; 2) DNA
sequences capable of directing DNA replication in a microbial cell;
3) a retroviral LTR; 4) sequences sufficient to direct homologous
recombination of the DNA construct with human genomic DNA sequences
downstream of the stop codon of the therapeutic protein, thereby
producing homologously recombinant cells having integrated the DNA
construct of (a) into the genomic DNA, and containing the DNA
construct of (c); d) maintaining the cells produced in (c) under
conditions appropriate for homologous recombination to occur
between DNA sequences homologous with genomic DNA sequences and
genomic DNA sequences, thereby producing homologously recombinant
cells having the DNA construct of (a) integrated into genomic DNA
upstream of and functionally linked to the gene encoding the
therapeutic protein, and also having the DNA construct (c)
integrated downstream of and functionally linked to the gene
encoding the therapeutic protein; e) culturing the cells produced
in (d) under conditions appropriate for retroviral LTR directed
transcription, processing and reverse transcription of the RNA
product of the DNA sequences between the LTRs introduced in (a) and
(c), thereby producing a DNA sequence comprising an intronless DNA
copy of the gene encoding the therapeutic protein operatively
linked to the DNA sequences comprising the DNA construct described
in (a) and operatively linked to the DNA sequences comprising the
DNA construct described in (c), this sequence herein referred to as
the intronless DNA sequence; f) separating the intronless DNA
sequence produced in (e) from the cells; g) introducing the DNA
separated in (f) into microbial cells, thereby producing microbial
cells containing the DNA produced in (e); h) culturing the
microbial cells produced in (g) in the presence of a selective
agent which selects for the selectable marker present in the DNA
construct described in (a); i) culturing the cells produced in (h)
under conditions appropriate for expression and secretion of the
therapeutic protein in microbial cells, thereby producing the
therapeutic protein in the microbial cells and secreting the
protein therefrom; and j) separating the therapeutic protein
produced in (i) from the microbial cells.
72. The method of claim 71 wherein the microbial cell is
Saccharomyces cerevisiae.
73. The method of claim 71 wherein the microbial cell is
Escherichia coli.
74. A method of turning on expression of a gene to be expressed
which is present in a cell but is not expressed in the cell as
obtained or is not expressed at significant levels in the cell as
obtained, comprising introducing into the cell a DNA construct
comprising a regulatory region under conditions appropriate for
homologous recombination, whereby the regulatory region is inserted
into or replaces all or a portion of the regulatory region of the
gene to be expressed, and is functionally linked to the gene to be
expressed, thereby producing homologously recombinant cells which
express the gene.
75. The method of claim 74 wherein the cell as obtained is an
immortalized cell.
Description
RELATED APPLICATION
[0001] This application is a Continuation-In Part of U.S. patent
application, Ser. No. 07/789,188, filed on Nov. 5, 1991 and is also
a Continuation-In-Part of U.S. patent application, Ser. No.
07/911,533, filed on Jul. 10, 1992 and is also a
Continuation-In-Part of U.S. patent application, Ser. No.
07/787,840, filed on Nov. 5, 1991, all of which are incorporated
herein by reference.
BACKGROUND OF THE INVENTION
[0002] Current approaches to treating disease by administering
therapeutic proteins include in vitro production of therapeutic
proteins for conventional pharmaceutical delivery (e.g.
intravenous, subcutaneous, or intramuscular injection) and, more
recently, gene therapy.
[0003] Proteins of therapeutic interest are generally produced by
introducing exogenous DNA encoding the protein of therapeutic
interest into appropriate cells. Presently-available approaches to
gene therapy make use of infectious vectors, such as retroviral
vectors, which include the genetic material to be expressed. Such
approaches have limitations, such as the potential of generating
replication-competent virus during vector production; recombination
between the therapeutic virus and endogenous retroviral genomes,
potentially generating infectious agents with novel cell
specificities, host ranges, or increased virulence and
cytotoxicity; independent integration into large numbers of cells,
increasing the risk of a tumorigenic insertional event; limited
cloning capacity in the retrovirus (which restricts therapeutic
applicability) and short-lived in vivo expression of the product of
interest. A better approach to providing gene products,
particularly one which avoids the risks associated with presently
available methods and provides long-term treatment, would be
valuable.
SUMMARY OF THE INVENTION
[0004] The present invention relates to improved methods for both
the in vitro production of therapeutic proteins and for the
production and delivery of therapeutic proteins by gene therapy.
The present method describes an approach which activates expression
of endogenous cellular genes, and further allows amplification of
the activated endogenous cellular genes, which does not require in
vitro manipulation and transfection of exogenous DNA encoding
proteins of therapeutic interest.
[0005] The present invention relates to transfected cells, both
transfected primary or secondary cells (i.e., non-immortalized
cells) and transfected immortalized cells, useful for producing
proteins, particularly therapeutic proteins, methods of making such
cells, methods of using the cells for in vitro protein production
and methods of gene therapy. Cells of the present invention are of
vertebrate origin, particularly of mammalian origin and even more
particularly of human origin. Cells produced by the method of the
present invention contain exogenous DNA which encodes a therapeutic
product, exogenous DNA which is itself a therapeutic product and/or
exogenous DNA which causes the transfected cells to express a gene
at a higher level or with a pattern of regulation or induction that
is different than occurs in the corresponding nontransfected
cell.
[0006] The present invention also relates to methods by which
primary, secondary, and immortalized cells are transfected to
include exogenous genetic material, methods of producing clonal
cell strains or heterogenous cell strains, and methods of
immunizing animals, or producing antibodies in immunized animals,
using the transfected primary, secondary, or immortalized
cells.
[0007] The present invention relates particularly to a method of
gene targeting or homologous recombination in cells of vertebrate,
particularly mammalian, origin. That is, it relates to a method of
introducing DNA into primary, secondary, or immortalized cells of
vertebrate origin through homologous recombination, such that the
DNA is introduced into genomic DNA of the primary, secondary, or
immortalized cells at a preselected site. The targeting sequences
used are determined by (selected with reference to) the site into
which the exogenous DNA is to be inserted. The present invention
further relates to homologously recombinant primary, secondary, or
immortalized cells, referred to as homologously recombinant (HR)
primary, secondary or immortalized cells, produced by the present
method and to uses of the HR primary, secondary, or immortalized
cells.
[0008] The present invention also relates to a method of activating
(i.e., turning on) a gene present in primary, secondary, or
immortalized cells of vertebrate origin, which is normally not
expressed in the cells or is not expressed at physiologically
significant levels in the cells as obtained. According to the
present method, homologous recombination is used to replace or
disable the regulatory region normally associated with the gene in
cells as obtained with a regulatory sequence which causes the gene
to be expressed at levels higher than evident in the corresponding
nontransfected cell, or to display a pattern of regulation or
induction that is different than evident in the corresponding
nontransfected cell. The present invention, therefore, relates to a
method of making proteins by turning on or activating an endogenous
gene which encodes the desired product in transfected primary,
secondary, or immortalized cells.
[0009] In one embodiment, the activated gene can be further
amplified by the inclusion of a selectable marker gene which has
the property that cells containing amplified copies of the
selectable marker gene can be selected for by culturing the cells
in the presence of the appropriate selectable agent. The activated
endogenous gene which is near or linked to the amplified selectable
marker gene will also be amplified in cells containing the
amplified selectable marker gene. Cells containing many copies of
the activated endogenous gene are useful for in vitro protein
production and gene therapy.
[0010] Gene targeting and amplification as disclosed in the present
invention are particularly useful for turning on the expression of
genes which form transcription units which are sufficiently large
that they, are difficult to isolate and express, or for turning on
genes for which the entire protein coding region is unavailable or
has not been cloned. The present invention also describes a method
by which homologous recombination is used to convert a gene into a
cDNA copy, devoid of introns, for transfer into yeast or bacteria
for in vitro protein production.
[0011] Transfected cells of the present invention are useful in a
number of applications in humans and animals. In one embodiment,
the cells can be implanted into a human or an animal for protein
delivery in the human or animal. For example, human growth hormone
(hGH), human EPO (hEPO), human insulinotropin and other proteins
can be delivered systemically or locally in humans for therapeutic
benefits. Barrier devices, which contain transfected cells which
express a therapeutic product and through which the therapeutic
product is freely permeable, can be used to retain cells in a fixed
position in vivo or to protect and isolate the cells from the
host's immune system. Barrier devices are particularly useful and
allow transfected immortalized cells, transfected cells from
another species (transfected xenogeneic cells), or cells from a
nonhistocompatibility-matched donor (transfected allogeneic cells)
to be implanted for treatment of human or animal conditions or for
agricultural uses (e.g., meat and dairy production). Barrier
devices also allow convenient short-term (i.e., transient) therapy
by providing ready access to the cells for removal when the
treatment regimen is to be halted for any reason. Transfected
xenogeneic and allogeneic cells may be used for short-term gene
therapy, such that the gene product produced by the cells will be
delivered in vivo until the cells are rejected by the host's immune
system.
[0012] Transfected cells of the present invention are also useful
for eliciting antibody production or for immunizing humans and
animals against pathogenic agents. Implanted transfected cells can
be used to deliver immunizing antigens that result in stimulation
of the host's cellular and humoral immune responses. These immune
responses can be designed for protection of the host from future
infectious agents (i.e., for vaccination), to stimulate and augment
the disease-fighting capabilities directed against an ongoing
infection, or to produce antibodies directed against the antigen
produced in vivo by the transfected cells that can be useful for
therapeutic or diagnostic purposes. Removable barrier devices can
be used to allow a simple means of terminating exposure to the
antigen. Alternatively, the use of cells that will ultimately be
rejected (xenogeneic or allogeneic transfected cells) can be used
to limit exposure to the antigen, since antigen production will
cease when the cells have been rejected.
[0013] The methods of the present invention can be used to produce
primary, secondary, or immortalized cells producing a wide variety
of therapeutically useful products, including (but not limited to):
hormones, cytokines, antigens, antibodies, enzymes, clotting
factors, transport proteins, receptors, regulatory proteins,
structural proteins, transcription factors, or anti-sense RNA.
Additionally, the methods of the present invention can be used to
produce cells which produce non-naturally occurring ribozymes,
proteins, or nucleic acids which are useful for in vitro production
of a therapeutic product or for gene therapy.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 is a schematic representation of plasmid pXGH5, which
includes the human growth hormone (hGH) gene under the control of
the mouse metallothionein promoter.
[0015] FIG. 2 is a schematic representation of plasmid pcDNEO,
which includes the neo coding region (BamHI-BglII fragment) from
plasmid pSV2neo inserted into the BamHI site of plasmid pcD; the
Amp-R and pBR322Ori sequences from pBR322; and the polyA, 16S
splice junctions and early promoter regions from SV40.
[0016] FIG. 3 is a schematic representation of plasmid pXEPO1. The
solid black arc represents the pUC12 backbone and the arrow denotes
the direction of transcription of the ampicillin resistance gene.
The stippled arc represents the mouse metallothionein promoter
(pmMT1). The unfilled arc interrupted by black boxes represents the
human erythropoietin EPO gene (the black boxes denote exons and the
arrow indicates the direction hEPO transcription). The relative
positions of restriction endonuclease recognition sites are
indicated.
[0017] FIG. 4 is a schematic representation of plasmid pE3neoEPO.
The positions of the human erythropoietin gene and the neo and amp
resistance genes are indicated. Arrows indicate the directions of
transcription of the various genes. pmMT1 denotes the mouse
metallothionein promoter (driving hEPO expression) and pTK denotes
the Herpes Simplex Virus thymidine kinase promoter (driving neo
expression). The dotted regions of the map mark the positions of
human HPRT sequences. The relative positions of restriction
endonuclease recognition sites are indicated.
[0018] FIG. 5 is a schematic diagram of a strategy for
transcriptionally activating the hEPO gene; the thin lines
represent hEPO sequences; thick lines, mouse metallothionein I
promoter; stippled box, 5' untranslated region of hGH; solid box,
hGH exon 1; open boxes, hEPO coding sequences; HIII, HindIII
site.
[0019] FIG. 6 is a schematic diagram of a strategy for
transcriptionally activating the hEPO gene; the thin lines
represent hEPO sequences; thick lines, mouse metallothionein I
promoter; stippled box, 5' untranslated region of hGH; solid box,
hGH exon 1; striped box, 10 bp linker from hEPO intron 1;
cross-hatched box, 5' untranslated region of hEPO; and open boxes,
hEPO coding sequences; HIII, HindIII site.
DETAILED DESCRIPTION OF THE INVENTION
[0020] Overview of the Invention
[0021] The present invention and the methods described in the
applications incorporated herein by reference relate to transfected
primary, secondary, and immortalized cells of vertebrate origin,
particularly mammalian origin, transfected with exogenous genetic
material (DNA or RNA) which encodes a clinically useful product,
methods by which primary, secondary, and immortalized cells are
transfected to include exogenous genetic material, methods of
producing clonal cell strains or heterogenous cell strains which
express exogenous genetic material, a method of providing
clinically useful products in physiologically useful quantities to
an individual in need thereof through the use of transfected cells
of the present invention, methods of vaccinating animals for
protection against pathogenic viruses or microbial agents
expressing epitopes antigenically related to products expressed by
the transfected cells and methods of producing antibodies directed
against a product made by the transfected primary, secondary, or
immortalized cells. Clinically useful products can be produced in
vitro, by purification from the transfected cells, or produced in
vivo, by implantation into a non-human animal or human (i.e., gene
therapy). Whether produced in vitro or in vivo, the clinically
useful products can include hormones, cytokines, antigens,
antibodies, enzymes, clotting factors, transport proteins,
receptors, regulatory proteins, structural proteins, transcription
factors, anti-sense RNA. Additionally, the methods of the present
invention can be used to produce cells which produce non-naturally
occurring ribozymes, proteins, or nucleic acids.
[0022] In one embodiment, the present invention relates to a method
of gene or DNA targeting in cells of vertebrate, particularly
mammalian, origin. That is, it relates to a method of introducing
DNA into primary, secondary, or immortalized cells of vertebrate
origin through homologous recombination or targeting of the DNA,
which is introduced into genomic DNA of the primary, secondary, or
immortalized cells at a preselected site. The targeting sequences
used are determined by (selected with reference to) the site into
which the exogenous DNA is to be inserted. The present invention
further relates to homologously recombinant primary, secondary or
immortalized cells, referred to as homologously recombinant (HR)
primary, secondary or immortalized cells, produced by the present
method and to uses of the HR primary, secondary, or immortalized
cells.
[0023] The present invention also relates to a method of activating
a gene which is present in primary cells, secondary cells or
immortalized cells of vertebrate origin, but is normally not
expressed in the cells or is not expressed at significant levels in
the cells. Homologous recombination or targeting is used to replace
or disable the regulatory region normally associated with the gene
with a regulatory sequence which causes the gene to be expressed at
levels higher than evident in the corresponding nontransfected
cell, or causes the gene to display a pattern of regulation or
induction that is different than evident in the corresponding
nontransfected cell. The present invention, therefore, relates to a
method of making proteins by activating an endogenous gene which
encodes the desired product in transfected primary, secondary or
immortalized cells.
[0024] Several embodiments in which exogenous DNA undergoes
homologous recombination with genomic DNA of transfected
(recipient) cells can be practiced according to the present
invention. In one embodiment, introduction of the exogenous DNA
results in the activation of a gene that is normally not expressed
or expressed in levels too low to be useful for in vitro protein
production or gene therapy. In a second embodiment, sequences
encoding a product of therapeutic utility are directed to integrate
into the recipient cell genome via homologous recombination at a
preselected site in the recipient cell's genome, such that the site
of integration is precisely known and the site can be chosen for
its favorable properties (e.g., the site allows for high levels of
expression of exogenous DNA).
[0025] In a third embodiment, the present invention describes a
method of activating (i.e turning on) and amplifying an endogenous
gene encoding a desired product in a transfected, primary,
secondary, or immortalized cell. That is, it relates to a method of
introducing, by homologous recombination with genomic DNA, DNA
sequences which are not normally functionally linked to the
endogenous gene and (1) which, when inserted into the host genome
at or near the endogenous gene, serve to alter (e.g., activate) the
expression of the endogenous gene, and further (2) allow for
selection of cells in which the activated endogenous gene is
amplified. Amplifiable DNA sequences useful in the present
invention include, but are not limited to, sequences which encode
the selectable markers dihydrofolate reductase, adenosine
deaminase, and the CAD gene (encoding the trifunctional protein
carbamyl phosphate synthase, aspartate transcarbamylase, and
dihydro-orotase). Improved versions of these sequences and other
amplifiable sequences can also be used. According to the present
method, the amplifiable DNA sequences encoding a selectable marker
and the DNA sequences which alter the regulation of expression of
the endogenous gene are introduced into the primary, secondary, or
immortalized cell in association with DNA sequences homologous to
genomic DNA sequences at a preselected site in the cell's genome.
This site will generally be within or upstream of a gene encoding a
therapeutic product or at a site that affects the desired gene's
function. The DNA sequences which alter the expression of the
endogenous gene, the amplifiable sequences which encode a
selectable marker, and the sequences which are homologous to a
preselected site in genomic DNA can be introduced into the primary,
secondary, or immortalized cell as a single DNA construct, or as
separate DNA sequences which become physically linked in the genome
of a transfected cell. Further, the DNA can be introduced as
linear, double stranded DNA, with or without single stranded
regions at one or both ends, or the DNA can be introduced as
circular DNA. After the exogenous DNA is introduced into the cell,
the cell is maintained under conditions appropriate for homologous
recombination to occur between the genomic DNA and a portion of the
introduced DNA. Homologous recombination between the genomic DNA
and the introduced DNA results in a homologously recombinant
primary, secondary, or immortalized cell in which sequences which
alter the expression of an endogenous gene, and the amplifiable
sequences encoding a selectable marker, are operatively linked to
an endogenous gene encoding a therapeutic product. Culturing the
resulting homologously recombinant cell under conditions which
select for amplification of the amplifiable DNA encoding a
selectable marker results in a cell containing an amplified
selectable marker and a coamplified endogenous gene whose
expression has been altered. Cells produced by this method can be
cultured under conditions suitable for the expression of the
therapeutic protein, thereby producing the therapeutic protein in
vitro, or the cells can be used for in vivo delivery of a
therapeutic protein (i.e., gene therapy).
[0026] Additional embodiments are possible. The targeting event can
be a simple insertion of a regulatory sequence, placing the
endogenous gene under the control of the new regulatory sequence
(for example, by insertion of either a promoter or an enhancer, or
both, upstream of an endogenous gene). The targeting event can be a
simple deletion of a regulatory element, such as the deletion of a
tissue-specific negative regulatory element. The targeting event
can replace an existing element; for example, a tissue-specific
enhancer can be replaced by an enhancer that has broader or
different cell-type specificity than the naturally-occurring
elements, or displays a pattern of regulation or induction that is
different from the corresponding nontransfected cell. In this
embodiment the naturally occurring sequences are deleted and new
sequences are added. In all cases, the identification of the
targeting event can be facilitated by the use of one or more
selectable marker genes that are physically associated with the
targeting DNA, allowing for the selection of cells in which the
exogenous DNA has integrated into the host cell genome. The
identification of the targeting event can also be facilitated by
the use of one or more marker genes exhibiting the property of
negative selection, such that the negatively selectable marker is
linked to the exogenous DNA, but configured such that the
negatively selectable marker flanks the targeting sequence, and
such that a correct homologous recombination event with sequences
in the host cell genome does not result in the stable integration
of the negatively selectable marker. Markers useful for this
purpose include the Herpes Simplex Virus thymidine kinase (TK) gene
or the bacterial xanthine-guanine phosphoribosyl-transferase (gpt)
gene.
[0027] The present invention also relates to a method by which
homologous recombination is used to convert a gene into a cDNA copy
(a gene copy devoid of introns). The cDNA copy can be transferred
into yeast or bacteria for in vitro protein production, or the cDNA
copy can be inserted into a mammalian cell for protein production.
If the cDNA is to be transferred to microbial cells, two DNA
constructs containing targeting sequences are introduced by
homologous recombination, one construct upstream of and one
construct downstream of a human gene encoding a therapeutic
protein. The sequences introduced upstream include DNA sequences
homologous to genomic DNA sequences at or upstream of the DNA
encoding the first amino acid of a mature, processed therapeutic
protein; a retroviral LTR; sequences encoding a marker for
selection in microbial cells; a regulatory element that functions
in microbial cells; and DNA encoding a leader peptide that promotes
secretion from microbial cells. The sequences introduced upstream
are introduced near to and upstream of genomic DNA encoding the
first amino acid of a mature, processed therapeutic protein. The
sequences introduced downstream include DNA sequences homologous to
genomic DNA sequences at or downstream of the DNA encoding the last
amino acid of a mature, processed protein; a microbial
transcriptional termination sequence; sequences capable of
directing DNA replication in microbial cells; and a retroviral LTR.
The sequences introduced downstream are introduced adjacent to and
downstream of the DNA encoding the stop codon of the mature,
processed therapeutic protein. After introducing into the cells
each of the two DNA constructs, the cells are maintained under
conditions appropriate for homologous recombination between the
introduced DNA and genomic DNA, thereby producing homologously
recombinant cells. Optionally, one or both of the DNA constructs
can encode one or more markers for either positive or negative
selection of cells containing the DNA construct, and a selection
step can be added to the method after one or both of the DNA
constructs have been introduced into the cells. Alternatively, the
sequences encoding the marker for selection in microbial cells and
the sequences capable of directing DNA replication in microbial
cells can both be present in either the upstream or the downstream
targeting construct, or the marker for selection in microbial cells
can be present in the downstream targeting construct and the
sequences capable of directing DNA replication in microbial cells
can be present in the upstream targeting construct. The
homologously recombinant cells are then cultured under conditions
appropriate for LTR directed transcription, processing and reverse
transcription of the RNA product of the gene encoding the
therapeutic protein. The product of reverse transcription is a DNA
construct comprising an intronless DNA copy encoding the
therapeutic protein, operatively linked to DNA sequences comprising
the two exogenous DNA constructs described above. The intronless
DNA construct produced by the present method is then introduced
into a microbial cell. The microbial cell is then cultured under
conditions appropriate for expression and secretion of the
therapeutic protein.
[0028] Transfected Cells
[0029] As used herein, the term primary cell includes cells present
in a suspension of cells isolated from a vertebrate tissue source
(prior to their being plated, i.e., attached to a tissue culture
substrate such as a dish or flask), cells present in an explant
derived from tissue, both of the previous types of cells plated for
the first time, and cell suspensions derived from these plated
cells. The term secondary cell or cell strain refers to cells at
all subsequent steps in culturing. That is, the first time a plated
primary cell is removed from the culture substrate and replated
(passaged), it is referred to herein as a secondary cell, as are
all cells in subsequent passages. Secondary cells are cell strains
which consist of secondary cells which have been passaged one or
more times. A cell strain consists of secondary cells that: 1) have
been passaged one or more times; 2) exhibit a finite number of mean
population doublings in culture; 3) exhibit the properties of
contact-inhibited, anchorage dependent growth (anchorage-dependence
does not apply to cells that are propagated in suspension culture);
and 4) are not immortalized.
[0030] Cells transfected by the subject method fall into four types
or categories: 1) cells which do not, as obtained, make or contain
the therapeutic product, 2) cells which make or contain the
therapeutic product but in smaller quantities than normal (in
quantities less than the physiologically normal lower level) or in
defective form, 3) cells which make the therapeutic product at
physiologically normal levels, but are to be augmented or enhanced
in their content or production, and 4) cells in which it is
desirable to change the pattern of regulation or induction of a
gene encoding a therapeutic product.
[0031] Primary and secondary cells to be transfected by the present
method can be obtained from a variety of tissues and include all
cell types which can be maintained in culture. For example, primary
and secondary cells which can be transfected by the present method
include fibroblasts, keratinocytes, epithelial cells (e.g., mammary
epithelial cells, intestinal epithelial cells), endothelial cells,
glial cells, neural cells, formed elements of the blood (e.g.,
lymphocytes, bone marrow cells), muscle cells and precursors of
these somatic cell types. Primary cells are preferably obtained
from the individual to whom the transfected primary or secondary
cells are administered. However, primary cells can be obtained from
a donor (other than the recipient) of the same species or another
species (e.g., mouse, rat, rabbit, cat, dog, pig, cow, bird, sheep,
goat, horse).
[0032] Transfected primary and secondary cells have been produced,
with or without phenotypic selection, as described in the copending
U.S. patent applications Ser. Nos. 07/787,840 and 07/911,533 and
shown to express exogenous DNA encoding a therapeutic product
including, for example, hGH, EPO and insulinotropin.
[0033] Immortalized cells can also be transfected by the present
method and used for either protein production or gene therapy.
Examples of immortalized human cell lines useful for protein
production or gene therapy by the present method include, but are
not limited to, HT1080, HeLa, MCF-7 breast cancer cells, K-562
leukemia cells, KB carcinoma cells and 2780AD ovarian carcinoma
cells. Immortalized cells from other species (e.g., chinese hamster
ovary (CHO) cells or mouse L cells) can be used for in vitro
protein production or gene therapy. In addition, primary or
secondary human cells, as well as primary or secondary cells from
other species which display the properties of gene amplification in
vitro can be used for in vitro protein production or gene
therapy.
[0034] Exogenous DNA
[0035] Exogenous DNA incorporated into primary, secondary or
immortalized cells by the present method is: 1) DNA which encodes a
translation or transcription product whose expression in cells is
desired, or a portion of a translation or transcription product,
such as a protein product or RNA product useful to treat an
existing condition or prevent it from occurring (eg., hGH, EPO or
insulinotropin); or 2) DNA which does not encode a gene product but
is itself useful, such as a transcriptional regulatory sequence or
DNA useful to treat an existing condition or prevent it from
occurring.
[0036] DNA transfected into primary, secondary or immortalized
cells can encode an entire desired product, or can encode, for
example, the active or functional portion(s) of the product. The
product can be, for example, a hormone, a cytokine, an antigen, an
antibody, an enzyme, a clotting factor, a transport protein, a
receptor, a regulatory protein, a structural protein, a
transcription factor, an anti-sense RNA, or a ribozyme.
Additionally, the product can be a protein or a nucleic acid which
does not occur in nature (i.e., a novel protein or novel nucleic
acid). The DNA can be obtained from a source in which it occurs in
nature or can be produced, using genetic engineering techniques or
synthetic processes. The DNA can encode one or more therapeutic
products. After transfection, the exogenous DNA is stably
incorporated into the recipient cell's genome (along with any
additional sequences present in the DNA construct used), from which
it is expressed or otherwise functions. Alternatively, the
exogenous DNA can be used to target to DNA that exists episomally
within cells.
[0037] DNA encoding the desired product can be introduced into
cells under the control of an inducible promoter, with the result
that cells as produced or as introduced into an individual do not
express the product but can be induced to do so (i.e., production
is induced after the transfected cells are produced but before
implantation or after implantation). DNA encoding the desired
product can, of course, be introduced into cells in such a manner
that it is expressed upon introduction (i.e., without
induction).
[0038] As taught herein, gene targeting can be used to replace a
gene's existing regulatory region with a regulatory sequence
isolated from a different gene or a novel regulatory sequence
synthesized by genetic engineering methods. Such regulatory
sequences can be comprised of promoters, enhancers,
scaffold-attachment regions, negative regulatory elements,
transcriptional initiation sites, regulatory protein binding sites
or combinations of said sequences. (Alternatively, sequences which
affect the structure or stability of the RNA or protein produced
can be replaced, removed, added, or otherwise modified by
targeting, these sequences including polyadenylation signals, mRNA
stability elements, splice sites, leader sequences for enhancing or
modifying transport or secretion properties of the protein, or
other sequences which alter or improve the function or stability of
protein or RNA molecules). According to this method, introduction
of the exogenous DNA results in disablement of the endogenous
sequences which control expression of the endogenous gene, either
by replacing all or a portion of the endogenous (genomic) sequence
or otherwise disrupting the function of the endogenous sequence. In
the situation where targeting is used to replace a protein coding
domain, chimeric, multifunctional proteins can be produced which
combine structural, enzymatic, or ligand or receptor binding
properties from two or more proteins into one polypeptide.
[0039] Selectable Markers
[0040] A variety of selectable markers can be incorporated into
primary, secondary or immortalized cells. For example, a selectable
marker which confers a selectable phenotype such as drug
resistance, nutritional auxotrophy, resistance to a cytotoxic agent
or expression of a surface protein, can be used. Selectable marker
genes which can be used include neo, gpt, dhfr, ada, pac, hyg, CAD,
and hisD. The selectable phenotype conferred makes it possible to
identify and isolate recipient cells. Amplifiable genes encoding
selectable markers (e.g., ada, dhfr and the multifunctional CAD
gene which encodes carbamyl phosphate synthase, aspartate
transcarbamylase, and dihydro-orotase) have the added
characteristic that they enable the selection of cells containing
amplified copies of the selectable marker inserted into the genome.
This feature provides a mechanism for significantly increasing the
copy number of an adjacent or linked gene for which amplification
is desirable.
[0041] Selectable markers can be divided into two categories:
positively selectable and negatively selectable (in other words,
markers for either positive selection or negative selection). In
positive selection, cells expressing the positively selectable
marker are capable of surviving treatment with a selective agent
(such as neo, gpt, dhfr, ada, pac, hyg, mdrl and hisD). In negative
selection, cells expressing the negatively selectable marker are
destroyed in the presence of the selective agent (e.g., tk,
gpt).
[0042] DNA Constructs
[0043] DNA constructs, which include exogenous DNA and, optionally,
DNA encoding a selectable marker, along with additional sequences
necessary for expression of the exogenous DNA in recipient cells,
are used to transfect primary, secondary or immortalized cells in
which the encoded product is to be produced. The DNA construct can
also include targeting sequences for homologous recombination with
host cell DNA. DNA constructs which include exogenous DNA sequences
which do not encode a gene product (and are the therapeutic
product) and, optionally, include DNA encoding a selectable marker,
can be used to transfect primary, secondary or immortalized cells.
The DNA constructs may be introduced into cells by a variety of
methods, including electroporation, microinjection, calcium
phosphate precipitation, and liposome-polybrene- or DEAE
dextran-mediated transfection. Alternatively, infectious vectors,
such as retroviral, herpes, adenovirus, adenovirus-associated,
mumps and poliovirus vectors, can be used to introduce the DNA.
[0044] In one embodiment, the DNA construct includes exogenous DNA
and one or more targeting sequences, generally located at both ends
of the exogenous DNA sequence. Targeting sequences are DNA
sequences normally present in the genome of the cells as obtained
(e.g., an essential gene, a nonessential gene or noncoding DNA, or
sequences present in the genome through a previous modification).
Such a construct is useful to integrate exogenous DNA (at a
preselected cite in a recipient cell is genome) encoding a
therapeutic product, such as a hormone, a cytokine, an antigen, an
antibody, an enzyme, a clotting factor, a transport protein, a
receptor, a regulatory protein, a structural protein, an anti-sense
RNA, a ribozyme or a protein or a nucleic acid which does not occur
in nature. In particular, exogenous DNA can encode one of the
following: Factor VIII, Factor IX, erythropoietin, alpha-1
antitrypsin, calcitonin, glucocerebrosidase, growth hormone, low
density lipoprotein (LDL) receptor, apolipoproteins (e.g.
apolipoprotein E or apolipoprotein A-I), IL-2 receptor and its
antagonists, insulin, globin, immunoglobulins, catalytic
antibodies, the interleukins, insulin-like growth factors,
superoxide dismutase, immune responder modifiers, parathyroid
hormone, interferons, nerve growth factors, tissue plasminogen
activators, and colony stimulating factors, and variants of these
proteins which have improved or novel biological properties or more
desirable half-life or turnover times in vivo. Such a construct is
also useful to integrate exogenous DNA (at a preselected site in a
recipient cell's genome) which is a therapeutic product, such as
DNA sequences sufficient for sequestration of a protein or nucleic
acid in the transfected primary or secondary cell, DNA sequences
which bind to a cellular regulatory protein, DNA sequences which
alter the secondary or tertiary chromosomal structure and DNA
sequences which are transcriptional regulatory elements into
genomic DNA of primary or secondary cells.
[0045] The exogenous DNA, targeting sequences and selectable marker
can be introduced into cells on a single DNA construct or on
separate constructs. The total length of the DNA construct will
vary according to the number of components (exogenous DNA,
targeting sequences, selectable marker gene) and the length of
each. The entire construct length will generally be at least 20
nucleotides. In a construct in which the exogenous DNA has
sufficient homology with genomic DNA to undergo homologous
recombination, the construct will include a single component, the
exogenous DNA. In this embodiment, the exogenous DNA, because of
its homology, serves also to target integration into genomic DNA
and additional targeting sequences are unnecessary. Such a
construct is useful to knock out, replace or repair a resident DNA
sequence, such as an entire gene, a gene portion, a regulatory
element or portion thereof or regions of DNA which, when removed,
place regulatory and structural sequences in functional proximity.
It is also useful when the exogenous DNA contains a marker useful
for selection or amplification of linked sequences.
[0046] In a second embodiment, the DNA construct includes exogenous
DNA, targeting DNA sequences and DNA encoding at least one
selectable marker. In this second embodiment, the order of
construct components can be: targeting sequences-exogenous DNA-DNA
encoding a selectable marker(s)-targeting sequences. In this
embodiment, one or more selectable markers are included in the
construct, which makes selection based on a selectable phenotype
possible. Cells that stably integrate the construct will survive
treatment with the selective agent; a subset of the stably
transfected cells will be HR cells, which can be identified by a
variety of techniques, including PCR, Southern hybridization and
phenotypic screening.
[0047] In a third embodiment, the order of components in the DNA
construct can be: targeting sequence-selectable marker 1--targeting
sequence-selectable marker 2. In this embodiment selectable marker
2 displays the property of negative selection. That is, the gene
product of selectable marker 2 can be selected against by growth in
an appropriate media formulation containing an agent (typically a
drug or metabolite analog) which kills cells expressing selectable
marker 2. Recombination between the targeting sequences flanking
selectable marker 1 with homologous sequences in the host cell
genome results in the targeted integration of selectable marker 1,
while selectable marker 2 is not integrated. Such recombination
events generate cells which are stably transfected with selectable
marker 1 but not stably transfected with selectable marker 2, and
such cells can be selected for by growth in the media containing
the selective agent which selects for selectable marker 1 and the
selective agent which selects against selectable marker 2.
[0048] A DNA construct can include an inducible promoter which
controls expression of the exogenous DNA, making inducible
expression possible. Optionally, the DNA construct can include a
bacterial origin of replication and bacterial antibiotic resistance
markers, which allow for large-scale plasmid propagation in
bacteria. A DNA construct which includes DNA encoding a selectable
marker, along with additional sequences, such as a promoter,
poly-adenylation site and splice junctions, can be used to confer a
selectable phenotype upon transfected primary or secondary cells
(e.g., plasmid pcDNEO, schematically represented in FIG. 2). Such a
DNA construct can be co-transfected into primary or secondary
cells, along with a targeting DNA sequence, using methods described
herein.
[0049] In all embodiments of the DNA construct, exogenous DNA can
encode one or more products, can be one or more therapeutic
products or one or more of each, thus making it possible to deliver
multiple products.
[0050] Uses of Transfected Cells
[0051] Cells produced using the methods and DNA constructs
described herein can be used for a wide variety of purposes.
Primary, secondary, or immortalized cells of vertebrate origin can
be produced in which 1) DNA already present in a recipient cell is
repaired, altered, deleted, or replaced; 2) a gene or DNA sequence
which encodes a therapeutic product (or other desired product) or
is itself a therapeutic product is introduced into the genome of a
recipient cell at a preselected site (i.e gene targeting); 3)
regulatory sequences present in the primary, secondary or
immortalized cell recipients have been repaired, altered, deleted
or replaced; or 4) an entire gene or gene portion has been
repaired, altered, deleted, or replaced. Homologous recombination
can also be used to produce universal donor cells, in which cell
surface markers involved in histocompatibility have been altered,
deleted or replaced, or in which the expression of such markers is
altered, impaired, or eliminated.
[0052] The cells of the present invention are useful for in vitro
production of therapeutic products which can be purified and
delivered by conventional pharmaceutic routes. For example,
primary, secondary, or immortalized human cells can be transfected
with exogenous DNA containing a regulatory region which, upon
homologous recombination with genomic DNA sequences, results in the
replacement of an endogenous target gene's regulatory region with a
regulatory region that allows novel expression and/or regulation of
the target gene and, ultimately, production of a therapeutically
useful product by the transfected cell. The activated endogenous
target gene can further be amplified if an appropriate selectable
marker gene is included in the targeting DNA. With or without
amplification, these cells can be subject to large-scale
cultivation for harvest of intracellular or extracellular protein
products.
[0053] Transfected cells of the present invention are useful, as
populations of transfected primary cells, transfected clonal cell
strains, transfected heterogenous cell strains, and as cell
mixtures in which at least one representative cell of one of the
three preceding categories of transfected cells is present, as a
delivery system for treating an individual with an abnormal or
undesirable condition which responds to delivery of a therapeutic
product, which is either: 1) a therapeutic protein (e.g., a protein
which is absent, underproduced relative to the individual's
physiologic needs, defective or inefficiently or inappropriately
utilized in the individual; a protein with novel functions, such as
enzymatic or transport functions) or 2) a therapeutic nucleic acid
(e.g., DNA which binds to or sequesters a regulatory protein, RNA
which inhibits gene expression or has intrinsic enzymatic
activity). In the method of the present invention of providing a
therapeutic protein or nucleic acid, transfected primary cells,
clonal cell strains or heterogenous cell strains are administered
to an individual in whom the abnormal or undesirable condition is
to be treated or prevented, in sufficient quantity and by an
appropriate route, to express or make available the exogenous DNA
at physiologically relevant levels. A physiologically relevant
level is one which either approximates the level at which the
product is produced in the body or results in improvement of the
abnormal or undesirable condition. Cells administered in the
present method are cells transfected with exogenous DNA which
encodes a therapeutic product, exogenous DNA which is itself a
therapeutic product or exogenous DNA, such as a regulatory
sequence, which is introduced into a preselected site in genomic
DNA through homologous recombination and functions to cause
recipient cells to produce a product which is normally not
expressed in the cells or to produce the product of a higher level
than occurs in the corresponding nontransfected cell. In the
embodiment in which a regulatory sequence (e.g., a promoter) is
introduced, it replaces or disables a regulatory sequence normally
associated with a gene, and results in expression of the gene at a
higher level than occurs in the corresponding nontransfected cell
or allows a pattern of regulation or induction that is different
from the corresponding nontransfected cell.
[0054] Immortalized cells which produce a therapeutic protein
produced by the methods described herein and in the related U.S.
patent applications Ser. Nos. 07/789,188, 07,911,533 and 07,787,840
(incorporated herein by reference), can be used in gene therapy
whether made by cells produced by: 1) random integration of the
therapeutic protein, 2) homologous recombination to target the
therapeutic protein into a cell's genome, 3) homologous
recombination to activate or turn on a gene of therapeutic
interest, or 4) gene amplification in conjunction with one of the
three preceding methods. According to the invention described
herein, the immortalized cells are enclosed in one of a number of
semipermeable barrier devices. The permeability properties of the
device are such that the cells are prevented from leaving the
device upon implantation into an animal, but the therapeutic
product is freely permeable and can leave the barrier device and
enter the local space surrounding the implant or enter the systemic
circulation. A number of filtration membranes can be used for this
purpose, including, but not limited to, cellulose, cellulose
acetate, nitrocellulose, polysulfone, polyvinylidene difluoride,
polyvinyl chloride polymers and polymers of polyvinyl chloride
derivatives. Alternatively, barrier devices can be utilized to
allow primary, secondary, or immortalized cells from another
species to be used for gene therapy in humans. The use of cells
from other species can be desirable in cases where the non-human
cells are advantageous for protein production purposes or in cases
where the non-human protein is therapeutically useful, for example,
the use of cells derived from salmon for the production of salmon
calcitonin and the use of cells derived from pigs for the
production of porcine insulin.
[0055] Cells from non-human species can also be used for in vitro
protein production. These cells can be immortalized, primary, or
secondary cells which produce a therapeutic protein produced by the
methods described here and in the U.S. patent applications
incorporated herein by reference, whether made by cells produced
by: 1) random integration of the therapeutic protein, 2) homologous
recombination to target the therapeutic protein into a cell's
genome, 3) homologous recombination to activate or turn on a gene
of therapeutic interest, or 4) gene amplification in conjunction
with one of the three preceding methods. The use of cells from
other species may be desirable in cases where the non-human cells
are advantageous for protein production purposes (for example CHO
cells) or in cases where the non-human protein is therapeutically
or commercially useful, for example, the use of cells derived from
salmon for the production of salmon calcitonin, the use of cells
derived from pigs for the production of porcine insulin, and the
use of bovine cells for the production of bovine growth
hormone.
[0056] Transfected cells of the present invention are useful in a
number of applications in humans and animals. In one embodiment,
the cells can be implanted into a human or an animal for protein
delivery in the human or animal. For example, human growth hormone
(hGH), human EPO (hEPO), or human insulinotropin can be delivered
systemically in humans for therapeutic benefits. Barrier devices,
through which the therapeutic product is freely permeable, can be
used to retain cells in a fixed position in vivo or to protect and
isolate the cells from the host's immune system. Barrier devices
are particularly useful and allow transfected immortalized cells,
transfected cells from another species (transfected xenogeneic
cells), or cells from a nonhistocompatibility-mat- ched donor
(transfected allogeneic cells) to be implanted for treatment of
human or animal conditions or for agricultural uses (i.e., meat and
dairy production). Barrier devices also allow convenient short-term
(i.e., transient) therapy by providing ready access to the cells
for removal when the treatment regimen is to be halted for any
reason.
[0057] Transfected cells of the present invention are also useful
for eliciting antibody production or for immunizing humans and
animals against pathogenic agents. Implanted transfected cells can
be used to deliver immunizing antigens that result in stimulation
of the host's cellular and humoral immune responses. These immune
responses can be designed for protection of the host from future
infectious agents (i.e., for vaccination), to stimulate and augment
the disease-fighting capabilities directed against an ongoing
infection, or to produce antibodies directed against the antigen
produced in vivo by the transfected cells that can be useful for
therapeutic or diagnostic purposes. Removable barrier devices can
be used to allow a simple means of terminating exposure to the
antigen. Alternatively, the use of cells that will ultimately be
rejected (xenogeneic or allogeneic transfected cells) can be used
to limit exposure to the antigen since antigen production will
cease when the cells have been rejected.
[0058] Explanation of the Examples
[0059] As described herein, Applicants have demonstrated that DNA
can be introduced into primary, secondary or immortalized
vertebrate cells and integrated into the genome of the transfected
primary or secondary cells by homologous recombination. That is,
they have demonstrated gene targeting in primary, secondary and
immortalized mammalian cells. They have further demonstrated that
the exogenous DNA has the desired function in the homologously
recombinant (HR) cells and that correctly targeted cells can be
identified on the basis of a detectable phenotype conferred by the
properly targeted DNA.
[0060] In addition, the present invention relates to a method of
protein production using transfected primary, secondary or
immortalized cells. The method involves transfecting primary cells,
secondary cells or immortalized cells with exogenous DNA which
encodes a therapeutic product or with DNA which is sufficient to
target to and activate an endogenous gene which encodes a
therapeutic product. For example, Examples 1g, 1j, 2, 3 and 4
describe protein production by targeting and activation of a
selected endogenous gene.
[0061] The applicants also describe DNA constructs and methods for
amplifying an endogenous cellular gene that has been activated by
gene targeting (Examples 1f-1k and Example 3) and further describe
methods by which a gene can be inserted at a preselected site in
the genome of a primary, secondary, or immortalized cell by gene
targeting (Example 1d).
[0062] Applicants describe construction of a plasmid useful for
targeting to a particular locus (the HPRT locus) in the human
genome and selection based upon a drug resistant phenotype (Example
1a). This plasmid is designated pE3Neo and its integration into the
cellular genomes at the HPRT locus produces cells which have an
hprt.sup.-, 6-TG resistant phenotype and are also G418 resistant.
As described, they have shown that pE3Neo functions properly in
gene targeting in an established human fibroblast cell line
(Example 1b), by demonstrating localization of the DNA introduced
into established cells within exon 3 of the HPRT gene.
[0063] In addition, Applicants demonstrate gene targeting in
primary and secondary human skin fibroblasts using pE3Neo (Example
1c). The subject application further demonstrates that modification
of DNA termini enhances targeting of DNA into genomic DNA (Examples
1c and 1e).
[0064] Examples 1f-1h and 2 illustrate embodiments in which the
normal regulatory sequences upstream of the human EPO gene are
altered to allow expression of hEPO in primary or secondary
fibroblast strains which do not express EPO in detectable
quantities in their untransfected state. In one embodiment the
product of targeting leaves the normal EPO protein intact, but
under the control of the mouse metallothionein promoter. Examples
1i and 1j demonstrate the use of similar targeting constructs to
activate the endogenous growth hormone gene in primary or secondary
human fibroblasts. In other embodiments described for activating
EPO expression in human fibroblasts, the products of targeting
events are chimeric transcription units, in which the first exon of
the human growth hormone gene is positioned upstream of EPO exons
2-5. The product of transcription (controlled by the mouse
metallothionein promoter), splicing, and translation is a protein
in which amino acids 1-4 of the hEPO signal peptide are replaced
with amino acid residues 1-3 of hGH. The chimeric portion of this
protein, the signal peptide, is removed prior to secretion from
cells. Example 5 describes targeting constructs and methods for
producing cells which will convert a gene (with introns) into an
expressible cDNA copy of that gene (without introns) and the
recovery of such expressible cDNA molecules in microbial (e.g.,
yeast or bacterial) cells.
[0065] The Examples provide methods for activating or for
activating and amplifying endogenous genes by gene targeting which
do not require manipulation or other uses of the target genes'
protein coding regions. By these methods, normally inactive genes
can be activated in cells that have properties desirable for in
vitro protein production (e.g., pharmaceutics) or in vivo protein
delivery methods (e.g. gene therapy). FIGS. 5 and 6 illustrate two
strategies for transcriptionally activating the hEPO gene.
[0066] Using the methods and DNA constructs or plasmids taught
herein or modifications thereof which are apparent to one of
ordinary skill in the art, exogenous DNA which encodes a
therapeutic product (e.g., protein, ribozyme, nucleic acid) can be
inserted at preselected sites in the genome of vertebrate (e.g.,
mammalian, both human and nonhuman) primary or secondary cells.
[0067] The present invention will now be illustrated by the
following examples, which are not intended to be limiting in any
way.
EXAMPLES
Example 1
[0068] Production of Transfected Cell Strains by Gene Targeting
[0069] Gene targeting occurs when transfecting DNA either
integrates into or partially replaces chromosomal DNA sequences
through a homologous recombinant event. While such events can occur
in the course of any given transfection experiment, they are
usually masked by a vast excess of events in which plasmid DNA
integrates by nonhomologous, or illegitimate, recombination.
[0070] Examples 1a, 1b, 1e, 1f and 1i are reproduced from U.S.
patent application Ser. No. 07/789,188, filed on Nov. 5, 1991, and
incorporated herein by reference. These examples are presented here
for background information.
[0071] a. Generation of a Construct Useful for Selection of Gene
Targeting Events in Human Cells
[0072] One approach to selecting the targeted events is by genetic
selection for the loss of a gene function due to the integration of
transfecting DNA. The human HPRT locus encodes the enzyme
hypoxanthine-phosphoribosyl transferase. hprt.sup.- cells can be
selected for by growth in medium containing the nucleoside analog
6-thioguanine (6-TG): cells with the wild-type (HPRT+) allele are
killed by 6-TG, while cells with mutant (hprt.sup.-) alleles can
survive. Cells harboring targeted events which disrupt HPRT gene
function are therefore selectable in 6-TG medium.
[0073] To construct a plasmid for targeting to the HPRT locus, the
6.9 kb HindIII fragment extending from positions 11,960-18,869 in
the HPRT sequence (Genebank name HUMHPRTB; Edwards, A. et al.,
Genomics 6:593-608 (1990)) and including exons 2 and 3 of the HPRT
gene, is subcloned into the HindIII site of pUC12. The resulting
clone is cleaved at the unique XhoI site in exon 3 of the HPRT gene
fragment and the 1.1 kb SalI-XhoI fragment containing the neo gene
from pMC1Neo (Stratagene) is inserted, disrupting the coding
sequence of exon 3. One orientation, with the direction of neo
transcription opposite that of HPRT transcription was chosen and
designated pE3Neo. The replacement of the normal HPRT exon 3 with
the neo-disrupted version will result in an hprt.sup.-, 6-TG
resistant phenotype. Such cells will also be G418 resistant.
[0074] b. Gene Targeting in an Established Human Fibroblast Cell
Line
[0075] As a demonstration of targeting in immortalized cell lines,
and to establish that pE3Neo functions properly in gene targeting,
the human fibrosarcoma cell line HT1080 (ATCC CCL 121) was
transfected with pE3Neo by electroporation.
[0076] HT1080 cells were maintained in HAT
(hypoxanthine/aminopterin/xanth- ine) supplemented DMEM with 15%
calf serum (Hyclone) prior to electroporation. Two days before
electroporation, the cells are switched to the same medium without
aminopterin. Exponentially growing cells were trypsinized and
diluted in DMEM/15% calf serum, centrifuged, and resuspended in PBS
(phosphate buffered saline) at a final cell volume of 13.3 million
cells per ml. pE3Neo is digested with HindIII, separating the 8 kb
HPRT-neo fragment from the pUC12 backbone, purified by phenol
extraction and ethanol precipitation, and resuspended at a
concentration of 600 .mu.g/ml. 50 .mu.l (30 .mu.g) was added to the
electroporation cuvette (0.4 cm electrode gap; Bio-Rad
Laboratories), along with 750 .mu.l of the cell suspension (10
million cells). Electroporation was at 450 volts, 250 .mu.Farads
(Bio-Rad Gene Pulser; Bio-Rad Laboratories). The contents of the
cuvette were immediately added to DMEM with 15% calf serum to yield
a cell suspension of 1 million cells per 25 ml media. 25 ml of the
treated cell suspension was plated onto 150 mm diameter tissue
culture dishes and incubated at 37.degree. C., 5% CO.sub.2. 24 hrs
later, a G418 solution was added directly to the plates to yield a
final concentration of 800 .mu.g/ml G418. Five days later the media
was replaced with DMEM/15% calf serum/800 .mu.g/ml G418. Nine days
after electroporation, the media was replaced with DMEM/15% calf
serum/800 .mu.g/ml G418 and 10 .mu.M 6-thioguanine. Colonies
resistant to G418 and 6-TG were picked using cloning cylinders
14-16 days after the dual selection was initiated.
[0077] The results of five representative targeting experiments in
HT1080 cells are shown in Table 1.
1TABLE 1 Number of Number of G418.sup.r Transfection Treated Cells
6-TG.sup.r Clones 1 1 .times. 10.sup.7 32 2 1 .times. 10.sup.7 28 3
1 .times. 10.sup.7 24 4 1 .times. 10.sup.7 32 5 1 .times. 10.sup.7
66
[0078] For transfection 5, control plates designed to determine the
overall yield of G418.sup.r colonies indicated that 33,700
G418.sup.r colonies could be generated from the initial
1.times.10.sup.7 treated cells. Thus, the ratio of targeted to
non-targeted events is 66/33,700, or 1 to 510. In the five
experiments combined, targeted events arise at a frequency of
3.6.times.10.sup.6, or 0.00036% of treated cells.
[0079] Restriction enzyme and Southern hybridization experiments
using probes derived from the neo and HPRT genes localized the neo
gene to the HPRT locus at the predicted site within HPRT exon
3.
[0080] c. Gene Targeting in Primary and Secondary Human Skin
Fibroblasts
[0081] pE3Neo is digested with HindIII, separating the 8 kb
HPRT-neo fragment from the pUC12 backbone, and purified by phenol
extraction and ethanol precipitation. DNA was resuspended at 2
mg/ml. Three million secondary human foreskin fibroblasts cells in
a volume of 0.5 ml were electroporated at 250 volts and 960
.mu.Farads, with 100 .mu.g of HindIII pE3Neo (50 .mu.l). Three
separate transfections were performed, for a total of 9 million
treated cells. Cells are processed and selected for G418
resistance. 500,000 cells per 150 mm culture dish were plated for
G418 selection. After 10 days under selection, the culture medium
is replaced with human fibroblast nutrient medium containing 400
.mu.g/ml G418 and 10 .mu.M 6-TG. Selection with the two drug
combination is continued for 10 additional days. Plates are scanned
microscopically to localize human fibroblast colonies resistant to
both drugs. The fraction of G418.sup.r t-TG.sup.r colonies is 4 per
9 million treated cells. These colonies constitute 0.0001% (or 1 in
a million) of all cells capable of forming colonies. Control plates
designed to determine the overall yield of G418.sup.r colonies
indicated that 2,850 G418.sup.r colonies could be generated from
the initial 9.times.10.sup.6 treated cells. Thus, the ratio of
targeted to non-targeted events is 4/2,850, or 1 to 712.
Restriction enzyme and Southern hybridization experiments using
probes derived from the neo and HPRT genes were used to localize
the neo gene to the HPRT locus at the predicted site within HPRT
exon 3 and demonstrate that targeting had occurred in these four
clonal cell strains. Colonies resistant to both drugs have also
been isolated by transfecting primary cells
(1/3.0.times.10.sup.7).
[0082] The results of several pE3Neo targeting experiments are
summarized in Table 2. HindIII digested pE3Neo was either
transfected directly or treated with exonuclease III to generate 5'
single-stranded overhangs prior to transfection (see Example 1c).
DNA preparations with single-stranded regions ranging from 175 to
930 base pairs in length were tested. Using pE3neo digested with
HindIII alone, 1/799 G418-resistant colonies were identified by
restriction enzyme and Southern hybridization analysis as having a
targeted insertion of the neo gene at the HPRT locus (a total of 24
targeted clones were isolated). Targeting was maximally stimulated
(approximately 10-fold stimulation) when overhangs of 175 bp were
used, with 1/80 G418.sup.r colonies displaying restriction
fragments that are diagnostic for targeting at HPRT (a total of 9
targeted clones were isolated). Thus, using the conditions and
recombinant DNA constructs described here, targeting is readily
observed in normal human fibroblasts and the overall targeting
frequency (the number of targeted clones divided by the total
number of clones stably transfected to G418-resistance) can be
stimulated by transfection with targeting constructs containing
single-stranded overhanging tails, by the method as described in
Example 1e.
2TABLE 2 TARGETING TO THE HPRT LOCUS IN HUMAN FIBROBLASTS pE3neo
Number of Number Targeted Total Number of Treatment Experiments Per
G418.sup.r Colony Targeted Clone HindIII digest 6 1/799 24 175 bp
overhang 1 1/80 9 350 bp overhang 3 1/117 20 930 bp overhang 1
1/144 1
[0083] d. Generation of a Construct for Targeted Insertion of a
Gene of Therapeutic Interest into the Human Genome and its Use in
Gene Targeting
[0084] A variant of pE3Neo, in which a gene of therapeutic interest
is inserted within the HPRT coding region, adjacent to or near the
neo gene, can be used to target a gene of therapeutic interest to a
specific position in a recipient primary or secondary cell genome.
Such a variant of pE3Neo can be constructed for targeting the hGH
gene to the HPRT locus.
[0085] pXGH5 (schematically presented in FIG. 1) is digested with
EcoRI and the 4.1 kb fragment containing the hGH gene and linked
mouse metallothionein (mMT) promoter is isolated. The EcoRI
overhangs are filled in with the Klenow fragment from E. coli DNA
polymerase. Separately, pE3Neo is digested with XhoI, which cuts at
the junction of the neo fragment and HPRT exon 3 (the 3' junction
of the insertion into exon 3). The XhoI overhanging ends of the
linearized plasmid are filled in with the Klenow fragment from E.
coli DNA polymerase, and the resulting fragment is ligated to the
4.1 kb blunt-ended hGH-mMT fragment. Bacterial colonies derived
from the ligation mixture are screened by restriction enzyme
analysis for a single copy insertion of the hGH-mMT fragment and
one orientation, the hGH gene transcribed in the same direction as
the neo gene, is chosen and designated pE3Neo/hGH. pE3Neo/hGH is
digested with HindIII, releasing the 12.1 kb fragment containing
HPRT, neo and mMT-hGH sequences. Digested DNA is treated and
transfected into primary or secondary human fibroblasts as
described in Example 1c. G418.sup.r TG.sup.r colonies are selected
and analyzed for targeted insertion of the mMT-hGH and neo
sequences into the HPRT gene as described in Example 1c. Individual
colonies are assayed for hGH expression using a commercially
available immunoassay (Nichols Institute).
[0086] Secondary human fibroblasts were transfected with pE3Neo/hGH
and thioguanine-resistant colonies were analyzed for stable hGH
expression and by restriction enzyme and Southern hybridization
analysis. Of thirteen TG.sup.r colonies analyzed, eight colonies
were identified with an insertion of the hGH gene into the
endogenous HPRT locus. All eight strains stably expressed
significant quantities of hGH, with an average expression level of
22.7 .mu.g/10.sup.6 cells/24 hours. Alternatively, plasmid
pE3neoEPO, FIG. 4, may be used to target EPO to the human HPRT
locus.
[0087] The use of homologous recombination to target a gene of
therapeutic interest to a specific position in a cell's genomic DNA
can be expanded upon and made more useful for producing products
for therapeutic purposes (e.g., pharmaceutics, gene therapy) by the
insertion of a gene through which cells containing amplified copies
of the gene can be selected for by exposure of the cells to an
appropriate drug selection regimen. For example, pE3neo/hGH
(Example 1d) can be modified by inserting the dhfr, ada, or CAD
gene at a position immediately adjacent to the hGH or neo genes in
pE3neo/hGH. Primary, secondary, or immortalized cells are
transfected with such a plasmid and correctly targeted events are
identified. These cells are further treated with increasing
concentrations of drugs appropriate for the selection of cells
containing amplified genes (for dhfr, the selective agent is
methotrexate, for CAD the selective agent is
N-(phosphonacetyl)-L-aspartate (PALA), and for ada the selective
agent is an adenine nucleoside (e.g., alanosine). In this manner
the integration of the gene of therapeutic interest will be
coamplified along with the gene for which amplified copies are
selected. Thus, the genetic engineering of cells to produce genes
for therapeutic uses can be readily controlled by preselecting the
site at which the targeting construct integrates and at which the
amplified copies reside in the amplified cells.
[0088] e. Modification of DNA Termini to Enhance Targeting
[0089] Several lines of evidence suggest that 3'-overhanging ends
are involved in certain homologous recombination pathways of E.
coli, bacteriophage, S. cerevisiae and Xenopus laevis. In Xenopus
laevis oocytes, molecules with 3'-overhanging ends of several
hundred base pairs in length underwent recombination with similarly
treated molecules much more rapidly after microinjection than
molecules with very short overhangs (4 bp) generated by restriction
enzyme digestion. In yeast, the generation of 3'-overhanging ends
several hundred base pairs in length appears to be a rate limiting
step in meiotic recombination. No evidence for an involvement of
3'-overhanging ends in recombination in human cells has been
reported, and in no case have modified DNA substrates of any sort
been shown to promote targeting (one form of homologous
recombination) in any species. In human cells, the effect of
3'-overhanging ends on targeting is untested. The experiment
described in the following example and Example 1c suggests that
5'-overhanging ends are effective for stimulating targeting in
primary, secondary and immortalized human fibroblasts.
[0090] There have been no reports on the enhancement of targeting
by modifying the ends of the transfecting DNA molecules. This
example serves to illustrate that modification of the ends of
linear DNA molecules, by conversion of the molecules' termini from
a double-stranded form to a single-stranded form, can stimulate
targeting into the genome of primary and secondary human
fibroblasts.
[0091] 1100 .mu.g of plasmid pE3Neo (Example 1a) is digested with
HindIII. This DNA can be used directly after phenol extraction and
ethanol precipitation, or the 8 kb HindIII fragment containing only
HPRT and the neo gene can be separated away from the pUC12 vector
sequences by gel electrophoresis. ExoIII digestion of the HindIII
digested DNA results in extensive exonucleolytic digestion at each
end, initiating at each free 3' end, and leaving 5'-overhanging
ends. The extent of exonucleolytic action and, hence, the length of
the resulting 5'-overhangs, can be controlled by varying the time
of ExoIII digestion. ExoIII digestion of 100 .mu.g of HindIII
digested pE3Neo is carried out according to the supplier's
recommended conditions, for times of 30 sec, 1 min, 1.5 min, 2 min,
2.5 min, 3 min, 3.5 min, 4 min, 4.5 min, and 5 min. To monitor the
extent of digestion an aliquot from each time point, containing 1
.mu.g of ExoIII treated DNA, is treated with mung bean nuclease
(Promega), under conditions recommended by the supplier, and the
samples fractionated by gel electrophoresis. The difference in size
between non-treated, HindIII digested pE3Neo and the same molecules
treated with ExoIII and mung bean nuclease is measured. This size
difference divided by two gives the average length of the
5'-overhang at each end of the molecule. Using the time points
described above and digestion at 30.degree., the 5'-overhangs
produced should range from 100 to 1,000 bases.
[0092] 60 .mu.g of ExoIII treated DNA (total HindIII digest of
pE3Neo) from each time point is purified and electroporated into
primary, secondary, or immortalized human fibroblasts under the
conditions described in Example 1c. The degree to which targeting
is enhanced by each ExoIII treated preparation is quantified by
counting the number of G418.sup.r 6-TG.sup.r colonies and comparing
these numbers to targeting with HindIII digested pE3Neo that was
not treated with ExoIII.
[0093] The effect of 3'-overhanging ends can also be quantified
using an analogous system. In this case HindIII digested pE3Neo is
treated with bacteriophage T7 gene 6 exonuclease (United States
Biochemicals) for varying time intervals under the supplier's
recommended conditions. Determination of the extent of digestion
(average length of 3'-overhang produced per end) and
electroporation conditions are as described for ExoIII treated DNA.
The degree to which targeting is enhanced by each T7 gene 6
exonuclease treated preparation is quantified by counting the
number of G418.sup.r 6-TG.sup.r colonies and comparing these
numbers to targeting with HindIII digested pE3Neo that was not
treated with T7 gene 6 exonuclease.
[0094] Other methods for generating 5' and 3' overhanging ends are
possible, for example, denaturation and annealing of two linear
molecules that partially overlap with each other will generate a
mixture of molecules, each molecule having 3'-overhangs at both
ends or 5'-overhangs at both ends, as well as reannealed fragments
indistinguishable from the starting linear molecules. The length of
the overhangs is determined by the length of DNA that is not in
common between the two DNA fragments.
[0095] f. Construction of Targeting Plasmids for Placing the Human
Erythropoietin Gene under the Control of the Mouse Metallothionein
Promoter in Primary, Secondary and immortalized Human
Fibroblasts
[0096] The following serves to illustrate one embodiment of the
present invention, in which the normal positive and negative
regulatory sequences upstream of the human erythropoietin (EPO)
gene are altered to allow expression of human erythropoietin in
primary, secondary or immortalized human fibroblasts, which do not
express EPO in significant quantities as obtained.
[0097] A region lying exclusively upstream of the human EPO coding
region can be amplified by PCR. Three sets of primers useful for
this purpose were designed after analysis of the published human
EPO [Genbank designation HUMERPA; Lin, F-K., et al., Proc. Natl.
Acad. Sci., USA 82:7580-7584 (1985)]. These primer pairs can
amplify fragments of 609, 603, or 590 bp.
3TABLE 3 HUMERPA Fragment Primer Coordinate Sequence Size F1 2
.fwdarw. 20 5' AGCTTCTGGGCTTCCAGAC (SEQ ID NO 1) R2 610 .fwdarw.
595 5' GGGGTCCCTCAGCGAC 609 bp (SEQ ID NO 2) F2 8 .fwdarw. 24 5'
TGGGCTTCCAGACCCAG (SEQ ID NO 3) R2 610 .fwdarw. 595 5'
GGGGTCCCTCAGCGAC 603 bp F3 21 .fwdarw. 40 5' CCAGCTACTTTGCGGAACTC
(SEQ ID NO 4) R2 610 .fwdarw. 595 5' GGGGTCCCTCAGCGAC 590 bp
[0098] The three fragments overlap substantially and are
interchangeable for the present purposes. The 609 bp fragment,
extending from -623 to -14 relative to the translation start site
(HUMERPA nucleotide positions 2 to 610), is ligated at both ends
with ClaI linkers. The resulting ClaI-linked fragment is digested
with ClaI and inserted into the ClaI site of pBluescriptIISK/+
(Stratagene), with the orientation such that HUMERPA nucleotide
position 610 is adjacent to the SalI site in the plasmid
polylinker). This plasmid, p5'EPO, can be cleaved, separately, at
the unique FspI or SfiI sites in the EPO upstream fragment (HUMERPA
nucleotide positions 150 and 405, respectively) and ligated to the
mouse metallotheionein promoter. Typically, the 1.8 kb EcoRI-BglII
from the mMT-I gene [containing no mMT coding sequences; Hamer, D.
H. and Walling M., J. Mol. Appl. Gen. 1:273 288 (1982); this
fragment can also be isolated by known methods from mouse genomic
DNA using PCR primers designed from analysis of mMT sequences
available from Genbank; i.e., MUSMTI, MUSMTIP, MUSMTIPRM] is made
blunt-ended by known methods and ligated with SfiI digested (also
made blunt-ended) or FspI digested p5'EPO. The orientations of
resulting clones are analyzed and those in which the former mMT
BglII site is proximal to the SalI site in the plasmid polylinker
are used for targeting primary and secondary human fibroblasts.
This orientation directs mMT transcription towards HUMERPA
nucleotide position 610 in the final construct. The resulting
plasmids are designated p5'EPO-mMTF and p5'EPO-mMTS for the mMT
insertions in the FspI and SfiI sites, respectively.
[0099] Additional upstream sequences are useful in cases where it
is desirable to modify, delete and/or replace negative regulatory
elements or enhancers that lie upstream of the initial target
sequence. In the case of EPO, a negative regulatory element that
inhibits EPO expression in extrahepatic and extrarenal tissues
[Semenza, G. L. et al., Mol. Cell. Biol. 10:930-938 (1990)] can be
deleted. A series of deletions within the 6 kb fragment are
prepared. The deleted regions can be replaced with an enhancer with
broad host-cell activity [e.g. an enhancer from the Cytomegalovirus
(CKV)].
[0100] The orientation of the 609 bp 5'EPO fragment in the
pBluescriptIISK/+ vector was chosen since the HUMERPA sequences are
preceded on their 5' end by a BamHI (distal) and HindIII site
(proximal). Thus, a 6 kb BamHI-HindIII fragment normally lying
upstream of the 609 bp fragment [Semenza, G. L. et al., Mol. Cell.
Biol. 10:930-938 (1990)] can be isolated from genomic DNA by known
methods. For example, a bacteriophage, cosmid, or yeast artificial
chromosome library could be screened with the 609 bp PCR amplified
fragment as a probe. The desired clone will have a 6 kb
BamHI-HindIII fragment and its identity can be confirmed by
comparing its restriction map from a restriction map around the
human EPO gene determined by known methods. Alternatively,
constructing a restriction map of the human genome upstream of the
EPO gene using the 609 bp fragment as a probe can identify enzymes
which generate a fragment originating between HUMERPA coordinates 2
and 609 and extending past the upstream BamHI site; this fragment
can be isolated by gel electrophoresis from the appropriate digest
of human genomic DNA and ligated into a bacterial or yeast cloning
vector. The correct clone will hybridize to the 609 bp 5'EPO probe
and contain a 6 kb BamHI-HindIII fragment. The isolated 6 kb
fragment is inserted in the proper orientation into p5'EPO,
p5'EPO-mMTF, or p5'EPO-mMTS (such that the HindIII site is adjacent
to HUMERPA nucleotide position 2). Additional upstream sequences
can be isolated by known methods, using chromosome walking
techniques or by isolation of yeast artificial chromosomes
hybridizing to the 609 bp 5'EPO probe.
[0101] The cloning strategies described above allow sequences
upstream of EPO to be modified in vitro for subsequent targeted
transfection of primary, secondary or immortalized human
fibroblasts. The strategies describe simple insertions of the mMT
promoter, as well as deletion of the negative regulatory region,
and deletion of the negative regulatory region and replacement with
an enhancer with broad host-cell activity.
[0102] g. Targeting to Sequences Flanking the Human EPO Gene and
Isolation of Targeted Primary, Secondary and Immortalized Human
Fibroblasts by Screening
[0103] For targeting, the plasmids are cut with restriction enzymes
that free the insert away from the plasmid backbone. In the case of
p5'EPO-mMTS, HindIII and SalI digestion releases a targeting
fragment of 2.4 kb, comprised of the 1.8 kb mMT promoter flanked on
the 5' and 3' sides by 405 bp and 204 base pairs, respectively, of
DNA for targeting this construct to the regulatory region of the
EPO gene. This DNA or the 2.4 kb targeting fragment alone is
purified by phenol extraction and ethanol precipitation and
transfected into primary or secondary human fibroblasts under the
conditions described in Example 1c. Transfected cells are plated
onto 150 mm dishes in human fibroblast nutrient medium. 48 hours
later the cells are plated into 24 well dishes at a density of
10,000 cells/cm.sup.2 [approximately 20,000 cells per well; if
targeting occurs at a rate of 1 event per 10.sup.6 clonable cells
(Example 1c, then about 50 wells would need to be assayed to
isolate a single expressing colony]. Cells in which the
transfecting DNA has targeted to the homologous region upstream of
EPO will express EPO under the control of the mMT promoter. After
10 days, whole well supernatants are assayed for EPO expression
using a commercially available immunoassay kit (Amgen). Clones from
wells displaying EPO synthesis are isolated using known methods,
typically by assaying fractions of the heterogenous populations of
cells separated into individual wells or plates, assaying fractions
of these positive wells, and repeating as needed, ultimately
isolating the targeted colony by screening 96-well microtiter
plates seeded at one cell per well. DNA from entire plate lysates
can also be analyzed by PCR for amplification of a fragment using a
mMT specific primer in conjunction with a primer lying upstream of
HUMERPA nucleotide position 1. This primer pair should amplify a
DNA fragment of a size precisely predicted based on the DNA
sequence. Positive plates are trypsinized and replated at
successively lower dilutions, and the DNA preparation and PCR steps
repeated as needed to isolate targeted cells.
[0104] The targeting schemes herein described can also be used to
activate hGH expression in immortalized human cells (for example,
HT1080 fibroblasts, HeLa cells, MCF-7 breast cancer cells, K-562
leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma
cells) for the purposes of producing hGH for conventional
pharmaceutic delivery.
[0105] h. Targeting to Sequences Flanking the Human EPO Gene and
Isolation of Targting Primary, Secondary and Immortalized Human
Fibroblasts by a Positive or a Combined Positive/Negative Selection
System
[0106] The strategy for constructing p5'EPO-mMTF, p5'EPO-mMTS, and
derivatives of such with the additional upstream 6 kb BamHI-HindIII
fragment can be followed with the additional step of inserting the
neo gene adjacent to the mMT promoter. In addition, a negative
selection marker, for example, gpt [from pMSG (Pharmacia) or
another suitable source], can be inserted adjacent to the HUMERPA
sequences in the pBluescriptIISK/+ polylinker. In the former case,
G418.sup.r colonies are isolated and screened by PCR amplification
or restriction enzyme and Southern hybridization analysis of DNA
prepared from pools of colonies to identify targeted colonies. In
the latter case, G418.sup.r colonies are placed in medium
containing 6-thioxanthine to select against the integration of the
gpt gene [Besnard, C. et al., Mol. Cell. Biol. 7:4139-4141 (1987)].
In addition, the HSV-TK gene can be placed on the opposite side of
the insert as gpt, allowing selection for neo and against both gpt
and TK by growing cells in human fibroblast nutrient medium
containing 400 .mu.g/ml G418, 100 .mu.M 6-thioxanthine, and 25
.mu.g/ml gancyclovir. The double negative selection should provide
a nearly absolute selection for true targeted events and Southern
blot analysis provides an ultimate confirmation.
[0107] The targeting schemes herein described can also be used to
activate hEPO expression in immortalized human cells (for example,
HT1080 fibroblasts, HeLa cells, MCF-7 breast cancer cells, K-562
leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma
cells) for the purposes of producing hEPO for conventional
pharmaceutic delivery.
[0108] i. Construction of Targeting Plasmids for Placing the Human
Growth Hormone Gene Under the Control of the Mouse Metallothionein
Promoter in primary, Secondary or Immortalized Human
Fibroblasts
[0109] The following example serves to illustrate one embodiment of
the present invention, in which the normal regulatory sequences
upstream of the human growth hormone gene are altered to allow
expression of human growth hormone in primary, secondary or
immortalized human fibroblasts.
[0110] Targeting molecules similar to those described in Example 1f
for targeting to the EPO gene regulatory region are generated using
cloned DNA fragments derived from the 5' end of the human growth
hormone N gene. An approximately 1.8 kb fragment spanning HUMGHCSA
(Genbank Entry) nucleotide positions 3787-5432 (the positions of
two EcoNI sites which generate a convenient sized fragment for
cloning or for diagnostic digestion of subclones involving this
fragment) is amplified by PCR primers designed by analysis of the
HUMGHCSA sequence in this region. This region extends from the
middle of hGH gene N intron 1 to an upstream position approximately
1.4 kb 5' to the translational start site. pUC12 is digested with
EcoRI and BamHI, treated with Klenow to generate blunt ends, and
recircularized under dilute conditions, resulting in plasmids which
have lost the EcoRI and BamHI sites. This plasmid is designated
pUC12XEB. HindIII linkers are ligated onto the amplified hGH
fragment and the resulting fragment is digested with HindIII and
ligated to HindIII digested pUC12XEB. The resulting plasmid,
pUC12XEB-5'hGH, is digested with EcoRI and BamHI, to remove a 0.5
kb fragment lying immediately upstream of the hGH transcriptional
initiation site. The digested DNA is ligated to the 1.8 kb
EcoRI-BglII from the mMT-I gene [containing no mMT coding
sequences; Hamer, D. H. and Walling, M., J. Mol. Appl. Gen.
1:273-288 (1982); the fragment can also be isolated by known
methods from mouse genomic DNA using PCR primers designed from
analysis of mMT sequences available from Genbank; i.e., MUSMTI,
MUSMTIP, MUSMTIPRM]. This plasmid p5'hGH-mMT has the mMT promoter
flanked on both sides by upstream hGH sequences.
[0111] The cloning strategies described above allow sequences
upstream of hGH to be modified in vitro for subsequent targeted
transfection of primary, secondary or immortalized human
fibroblasts. The strategy described a simple insertion of the mMT
promoter. Other strategies can be envisioned, for example, in which
an enhancer with broad host-cell specificity is inserted upstream
of the inserted mMT sequence.
[0112] j. Targeting to Sequences Flanking the Human hGH Gene and
Isolation of Targeted Primary, Secondary and Immortalized Human
Fibroblasts by Screening
[0113] For targeting, the plasmids are cut with restriction enzymes
that free the insert away from the plasmid backbone. In the case of
p5'hGH-mMT, HindIII digestion releases a targeting fragment of 2.9
kb, comprised of the 1.8 kb mMT promoter flanked on the 5' end 3'
sides by DNA for targeting this construct to the regulatory region
of the hGH gene. This DNA or the 2.9 kb targeting fragment alone is
purified by phenol extraction and ethanol precipitation and
transfected into primary or secondary human fibroblasts under the
conditions previously described in related U.S. patent application,
Ser. Nos. 07/787,840 and 07/911,533. Transfected cells are plated
onto 150 mm dishes in human fibroblast nutrient medium. 48 hours
later the cells are plated into 24 well dishes at a density of
10,000 cells/cm.sup.2 [approximately 20,000 cells per well; if
targeting occurs at a rate of 1 event per 10.sup.6 clonable cells
(Example 1c), then about 50 wells would need to be assayed to
isolate a single expressing colony]. Cells in which the
transfecting DNA has targeted to the homologous region upstream of
hGH will express hGH under the control of the mMT promoter. After
10 days, whole well supernatants are assayed for hGH expression
using a commercially available immunoassay kit (Nichols). Clones
from wells displaying hGH synthesis are isolated using known
methods, typically by assaying fractions of the heterogenous
populations of cells separated into individual wells or plates,
assaying fractions of these positive wells, and repeating as
needed, ultimately isolated the targeted colony by screening
96-well microtiter plates seeded at one cell per well. DNA from
entire plate lysates can also be analyzed by PCR for amplification
of a fragment using a mMT specific primer in conjunction with a
primer lying downstream of HUMGHCSA nucleotide position 5,432. This
primer pair should amplify a DNA fragment of a size precisely
predicted based on the DNA sequence. Positive plates are
trypsinized and replated at successively lower dilutions, and the
DNA preparation and PCR steps repeated as needed to isolate
targeted cells.
[0114] The targeting schemes herein described can also be used to
activate hGH expression in immortalized human cells (for example,
HT1080 fibroblasts, HeLa cells, MCF-7 breast cancer cells, K-562
leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma
cells) for the purposes of producing hGH for conventional
pharmaceutic delivery.
[0115] k. Targeting to Sequences Flanking the Human hGH Gene and
Isolation of Targeted Primary, Secondary and Immortalized Human
Fibroblasts by a Positive or a Combined Positive/Negative Selection
System
[0116] The strategy for constructing p5'hGH-mMT can be followed
with the additional step of inserting the neo gene adjacent to the
mMT promoter. In addition, a negative selection marker, for
example, gpt [from pMSG (Pharmacia) or another suitable source],
can be inserted adjacent to the HUMGHCSA sequences in the pUC12
poly-linker. In the former case, G418.sup.r colonies are isolated
and screened by PCR amplification or restriction enzyme and
Southern hybridization analysis of DNA prepared from pools of
colonies to identify targeted colonies. In the latter case,
G418.sup.r colonies are placed in medium containing thioxanthine to
select against the integration of the gpt gene (Besnard, C. et al.,
Mol. Cell. Biol. 7: 4139-4141 (1987)). In addition, the HSV-TK gene
can be placed on the opposite side of the insert as gpt, allowing
selection for neo and against both gpt and TK by growing cells in
human fibroblast nutrient medium containing 400 .mu.g/ml G418, 100
.mu.M 6-thioxanthine, and 25 .mu.g/ml gancyclovir. The double
negative selection should provide a nearly absolute selection for
true targeted events. Southern hybridization analysis is
confirmatory.
[0117] The targeting schemes herein described can also be used to
activate hGH expression in immortalized human cells (for example,
HT1080 fibroblasts, HeLa cells, MCF-7 breast cancer cells, K-562
leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma
cells) for the purposes of producing hGH for conventional
pharmaceutic delivery.
[0118] The targeting constructs described in Examples 1f and 1i,
and used in Examples 1g, 1h, 1j and 1k can be modified to include
an amplifiable selectable marker (e.g., ada, dhfr, or CAD) which is
useful for selecting cells in which the activated endogenous gene,
and the amplifiable selectable marker, are amplified. Such cells,
expressing or capable of expressing the endogenous gene encoding a
therapeutic product can be used to produce proteins (e.g., hGH and
hEPO) for conventional pharmaceutic delivery or for gene
therapy.
Example 2
[0119] Construction of Targeting Plasmids which Result in Chimeric
Transcription Units in which Human Growth Hormone and
Erythropoietin Sequences are Fused
[0120] The following serves to illustrate two further embodiments
of the present invention, in which the normal regulatory sequences
upstream of the human EPO gene are altered to allow expression of
hEPO in primary or secondary fibroblast strains which do not
express EPO in detectable quantities in their untransfected state
as obtained. In these embodiments, the products of the targeting
events are chimeric transcription units in which the first exon of
the human growth hormone gene is positioned upstream of EPO exons
2-5. The product of transcription, splicing and translation is a
protein in which amino acids 1-4 of the hEPO signal peptide are
replaced with amino acid residues 1-3 of hGH. The two embodiments
differ with respect to both the relative positions of the foreign
regulatory sequences that are inserted and the specific pattern of
splicing that needs to occur to produce the final, processed
transcript.
[0121] Plasmid pXEPO-10 is designed to replace exon 1 of hEPO with
exon 1 of hGH by gene targeting to the endogenous hEPO gene on
human chromosome 7. Plasmid pXEPO-10 is constructed as follows.
First, the intermediate plasmid pT163 is constructed by inserting
the 6 kb HindIII-BamHI fragment (see Example 1f) lying upstream of
the hEPO coding region into HindIII-BamHI digested pBluescriptII
SK+ (Stratagene, LaJolla, Calif.). The product of this ligation is
digested with XhoI and HindIII and ligated to the 1.1 kb
HindIII-XhoI fragment from pMClneoPolyA [Thomas, K. R. and
Capecchi, M. R. Cell 51: 503-512 (1987) available from Strategene,
LaJolla, Calif.] to create pT163. Oligonucleotides 13.1-13.4 are
utilized in polymerase chain reactions to generate a fusion
fragment in which the mouse metallothionein 1 (mMT-I) promoter-hGH
exon 1 sequences are additionally fused to hEPO intron 1 sequences.
First, oligonucleotides 13.1 and 13.2 are used to amplify the
approximately 0.73 kb mMT-I promoter-hGH exon 1 fragment from pXGH5
(FIG. 1). Next, oligonucleotides 13.3 and 13.4 are used to amplify
the approximately 0.57 kb fragment comprised predominantly of hEPO
intron 1 from human genomic DNA. Finally, the two amplified
fragments are mixed and further amplified with oligonucleotides
13.1 and 13.4 to generate the final fusion fragment (fusion
fragment 3) flanked by a SalI site at the 5' side of the mMT-I
moiety and an XhoI site at the 3' side of the hEPO intron 1
sequence. Fusion fragment 3 is digested with XhoI and SalI and
ligated to XhoI digested pT163. The ligation mixture is transformed
into E. coli and a clone containing a single insert of fusion
fragment 3 in which the XhoI site is regenerated at the 3' side of
hEPO intron 1 sequences is identified and designated pXEPO-10.
4 (SEQ ID NO 5) 13.1 5' AAAAGTCGAC GGTACCTTGG TTTTTAAAAC CAGCCTGGAG
SalI KpnI (SEQ ID NO 6) 13.2 5' CCTAGCGGCA ATGGCTACAG GTGAGTACTC
GCGGGCTGGG CG (SEQ ID NO 7) 13.3 5' CGCCCAGCCC GCGAGTACTC
ACCTGTAGCC ATTGCCGCTA GG (SEQ ID NO 8) 13.4 5' TTTTCTCGAGCTAGAACAGA
TAGCCAGGCT GAGAG XhoI
[0122] The non-boldface region of oligo 13.1 is identical to the
mMT-I promoter, with the natural KpnI site as its 5' boundary. The
boldface type denotes a SalI site tail to convert the 5' boundary
to a SalI site. The boldface region of oligos 13.2 and 13.3 denote
hGH sequences, while the non-boldface regions are intron 1
sequences from the hEPO gene. The non-boldface region of oligo 13.4
is identical to last 25 bases of hEPO intron 1. The boldface region
includes an XhoI site tail to convert the 3' boundary of the
amplified fragment to an XhoI site.
[0123] Plasmid pXEPO-11 is designed to place, by gene targeting,
the IMT-I promoter and exon 1 of hGH upstream of the hEPO
structural gene and promoter region at the endogenous hEPO locus on
human chromosome 7. Plasmid pXEPO-11 is constructed as follows.
Oligonucleotides 13.1 and 13.5-13.7 are utilized in polymerase
chain reactions to generate a fusion fragment in which the mouse
metallothionein I (mMT-I) promoter-hGH exon 1 sequences are
additionally fused to hEPO sequences from -1 to -630 relative to
the hEPO coding region. First, oligonucleotides 13.1 and 13.5 are
used to amplify the approximately 0.73 kb mMT-I promoter-hGH exon 1
fragment from pXGH5 (FIG. 1). Next, oligonucleotides 13.6 and 13.7
are used to amplify, from human genomic DNA, the approximately 0.62
kb fragment comprised predominantly of hEPO sequences from -1 to
-620 relative to the hEPO coding region. Both oligos 13.5 and 13.6
contain a 10 bp linker sequence located at the hGH intron 1-hEPO
promoter region, which corresponds to the natural hEPO intron 1
splice donor site. Finally, the two amplified fragments are mixed
and further amplified with oligonucleotides 13.1 and 13.7 to
generate the final fusion fragment (fusion fragment 6) flanked by a
SalI site at the 5' side of the mMT-I moiety and an XhoI site at
the 3' side of the hEPO promoter region. Fusion fragment 6 is
digested with XhoI and SalI and ligated to XhoI digested pT163. The
ligation mixture is transformed into E. coli and a clone containing
a single insert of fusion fragment 6 in which the XhoI site is
regenerated at the 3' side of hEPO promoter sequences is identified
and designated pXEPO-11.
5 13.5 5' CCTAGCGGCA ATGGCTACAG GTGAGTACTC AAGCTTCTGG GCTTCCAGAC
CCAG (SEQ ID NO 9) HindIII 13.6 5' CTGGGTCTGG AAGCCCAGAA GCTTGAGTAC
TCACCTGTAG CCATTGCCGC TAGG (SEQ ID NO 10) HindIII 13.7 5'
TTTTCTCGAG CTCCGCGCCT GGCCGGGGTC CCTC (SEQ ID NO 11) XhoI
[0124] The boldface regions of oligos 13.5 and 13.6 denote hGH
sequences. The italicized regions correspond to the first 10 base
pairs of hEPO intron 1. The remainder of the oligos correspond to
hEPO sequences from -620 to -597 relative to the hEPO coding
region. The non-boldface region of oligo 13.7 is identical to bases
-1 to -24 relative to the hEPO coding region. The boldface region
includes an XhoI site tail to convert the 3' boundary of the
amplified fragment to an XhoI site.
[0125] Plasmid pXEPO-10 can be used for gene targeting by digestion
with BamHI and XhoI to release the 7.3 kb fragment containing the
mMT-I/hGH fusion flanked on both sides by hEPO sequences. This
fragment (targeting fragment 1) contains no hEPO coding sequences,
having only sequences lying between -620 and approximately -6620
upstream of the hEPO coding region and hEPO intron 1 sequences to
direct targeting to the human EPO locus. Targeting fragment 1 is
transfected into primary or secondary human skin fibroblasts using
conditions similar to those described in Example 1c. G418-resistant
colonies are picked into individual wells of 96-well plates and
screened for EPO expression by an ELISA assay (R&D Systems,
Minneapolis Minn.). Cells in which the transfecting DNA integrates
randomly into the human genome cannot produce EPO. Cells in which
the transfecting DNA has undergone homologous recombination with
the endogenous hEPO intron 1 and hEPO upstream sequences contain a
chimeric gene in which the mMT-I promoter and non-transcribed
sequences and the hGH 5' untranslated sequences and hGH exon 1
replace the normal hEPO promoter and hEPO exon 1 (see FIG. 5).
Non-hEPO sequences in targeting fragment 1 are joined to hEPO
sequences downstream of hEPO intron 1. The replacement of the
normal hEPO regulatory region with the mMT-I promoter will activate
the EPO gene in fibroblasts, which do not normally express EPO. The
replacement of hEPO exon 1 with hGH exon 1 results in a protein in
which the first 4 amino acids of the hEPO signal peptide are
replaced with amino acids 1-3 of hGH, creating a functional,
chimeric signal peptide which is removed by post-translation
processing from the mature protein and is secreted from the
expressing cells.
[0126] Plasmid pXEPO-11 can be used for gene targeting by digestion
with BamHI and XhoI to release the 7.4 kb fragment containing the
mT-I/hGH fusion flanked on both sides by hEPO sequences. This
fragment (targeting fragment 2) contains no hEPO coding sequences,
having only sequences lying between -1 and approximately -6620
upstream of the hEPO coding region to direct targeting to the human
EPO locus. Targeting fragment 2 is transfected into primary or
secondary human skin fibroblasts using conditions similar to those
described in Example 1g. G418-resistant colonies are picked into
individual wells of 96-well plates and screened for EPO expression
by an ELISA assay (R&D Systems, Minneapolis, Minn.). Cells in
which the transfecting DNA integrates randomly into the human
genome cannot produce EPO. Cells in which the transfecting DNA has
undergone homologous recombination with the endogenous hEPO
promoter and upstream sequences contain a chimeric gene in which
the MMT-I promoter and non-transcribed sequences, hGH 5'
untranslated sequences and hGh exon 1, and a 10 base pair linker
comprised of the first 10 bases of hEPO intron 1 are inserted at
the HindIII site lying at position -620 relative to the hEPO coding
region (see FIG. 6). The localization of the mMT-I promoter
upstream of the normally silent hEPO promoter will direct the
synthesis, in primary or secondary skin fibroblasts, of a message
reading (5' to 3') non-translated metallothionein and hGH
sequences, hGH exon 1, 10 bases of DNA identical to the first 10
base pairs of hEPO intron 1, and the normal hEPO promoter and hEPO
exon 1 (-620 to +13 relative to the EPO coding sequence). The 10
base pair linker sequence from hEPO intron 1 acts as a splice donor
site to fuse hGH exon 1 to the next downstream splice acceptor
site, that lying immediately upstream of hEPO exon 2. Processing of
the resulting transcript will therefore splice out the hEPO
promoter, exon 1, and intron 1 sequences. The replacement of hEPO
exon 1 with hGH exon 1 results in a protein in which the first 4
amino acids of the hEPO signal peptide are replaced with amino
acids 1-3 of hGH, creating a functional, chimeric signal peptide
which is removed by post-translation processing from the mature
protein and is secreted from the expressing cells.
[0127] A series of constructs related to pXEPO-10 and pXEPO-11 can
be constructed, using known methods. In these constructs, the
relative positions of the mMT-I promoter and hGH sequences, as well
as the position at which the mMT-I/hGH sequences are inserted into
hEPO upstream sequences, are varied to create alternative chimeric
transcription units that facilitate gene targeting, result in more
efficient expression of the fusion transcripts, or have other
desirable properties. Such constructs will give similar results,
such that an hGH-hEPO fusion gene is placed under the control of an
exogenous promoter by gene targeting to the normal hEPO locus. For
example, the 6 kb HindIII-BamHI fragment upstream of the hEPO gene
(See Example 1f) has numerous restriction enzyme recognition
sequences that can be utilized as sites for insertion of the neo
gene and the mMT-I promoter/hGH fusion fragment. One such site, a
BglII site lying approximately 1.3 kb upstream of the HindIII site,
is unique in this region and can be used for insertion of one or
more selectable markers and a regulatory region derived from
another gene that will serve to activate EPO expression in primary,
secondary, or immortalized human cells.
[0128] First, the intermediate plasmid pT164 is constructed by
inserting the 6 kb HindIII-BamHI fragment (Example 1f) lying
upstream of the hEPO coding region into HindIII-BamHI digested
pBluescriptII SK+ (Stratagene, LaJolla, Calif.). Plasmid
pMC1neoPolyA [Thomas, K. R. and Capecchi, M. R. Cell 51:503-512
(1987); available from Stratagene, LaJolla, Calif.] is digested
with BamHI and XhoI, made blunt-ended by treatment with the Klenow
fragment of E. coli DNA polymerase, and the resulting 1.1 kb
fragment is purified. pT164 is digested with BglII and made
blunt-ended by treatment with the Klenow fragment of E. coli DNA
polymerase. The two preceding blunt-ended fragments are ligated
together and transformed into competent E. coli. Clones with a
single insert of the 1.1 kb neo fragment are isolated and analyzed
by restriction enzyme analysis to identify those in which the BglII
site recreated by the fusion of the blunt XhoI and BglII sites is
localized 1.3 kb away from the unique HindIII site present in
plasmid pT164. The resulting plasmid, pT165, can now be cleaved at
the unique BglII site flanking the 5' side of the neo transcription
unit.
[0129] Oligonucleotides 13.8 and 13.9 are utilized in polymerase
chain reactions to generate a fragment in which the mouse
metallothionein I (mMT-I) promoter-hGH exon 1 sequences are
additionally fused to a 10 base pair fragment comprising a splice
donor site. The splice donor site chosen corresponds to the natural
hEPO intron 1 splice donor site, although a larger number of splice
donor sites or consensus splice donor sites can be used. The
oligonucleotides (13.8 and 13.9) are used to amplify the
approximately 0.73 kb mMT-I promoter-hGH exon 1 fragment from pXGH5
(FIG. 1). The amplified fragment (fragment 7) is digested with
BglII and ligated to BglII digested pT165. The ligation mixture is
transformed into E. coli and a clone, containing a single insert of
fragment 7 in which the KpnI site in the mMT-I promoter is adjacent
to the 5' end of the neo gene and the mMT-I promoter is oriented
such that transcription is directed towards the unique HindIII
site, is identified and designated pXEPO-12.
[0130] 13.8 5' AAAAAGATCT GGTACCTTGG TTTTTAAAAC CAGCCTGGAG BglII
KpnI (SEQ ID NO 12)
[0131] The non-boldface region of oligo 13.8 is identical to the
MMT-I promoter, with the natural KpnI site as its 5' boundary. The
boldface type denotes a BglII site tail to convert the 5' boundary
to a BglII site.
[0132] 13.9 5' TTTTAGATCT GAGTACTCAC CTGTAGCCAT TGCCGCTAGG BglII
(SEQ ID NO 13)
[0133] The boldface region of oligos 13.9 denote hGH sequences. The
italicized region corresponds to the first 10 base pairs of hEPO
intron 1. The underlined BglII site is added for plasmid
construction purposes.
[0134] Plasmid pXEPO-12 can be used for gene targeting by digestion
with BamHI and HindIII to release the 7.9 kb fragment containing
the neo gene and the mMT-I/hGH fusion flanked on both sided by hEPO
sequences. This fragment (targeting fragment 3) contains no hEPO
coding sequences, having only sequences lying between approximately
-620 and approximately -6620 upstream of the hEPO coding region to
direct targeting upstream of the human EPO locus. Targeting
fragment 3 is transfected into primary, secondary, or immortalized
human skin fibroblasts using conditions -similar to those described
in Examples 1b and 1c. G418-resistant colonies are picked into
individual wells of 96-well plates and screened for EPO expression
by an ELISA assay (R&D Systems, Minneapolis Minn.). Cells in
which the transfecting DNA integrates randomly into the human
genome cannot produce EPO. Cells in which the transfecting DNA has
undergone homologous recombination with the endogenous hEPO
promoter and upstream sequences contain a chimeric gene in which
the KMT-I promoter and non-transcribed sequences, hGH 5'
untranslated sequences, and hGH exon 1, and a 10 base pair linker
comprised of the first 10 bases of hEPO intron 1 are inserted at
the BglII site lying at position approximately -1920 relative to
the hEPO coding region. The localization of the mMT-I promoter
upstream of the normally silent hEPO promoter will direct the
synthesis, in primary, secondary, or immortalized human fibroblasts
(or other human cells), of a message reading: (5' to 3')
nontranslated metallothionein and hGH sequences, hGH exon 1, 10
bases of DNA identical to the first 10 base pairs of hEPO intron 1,
and hEPO upstream region and hEPO exon 1 (from approximately -1920
to +13 relative to the EPO coding sequence). The 10 base pair
linker sequence from hEPO intron 1 acts as a splice donor site to
fuse hGH exon 1 to a downstream splice acceptor site, that lying
immediately upstream of hEPO exon 2. Processing of the resulting
transcript will therefore splice out the hEPO upstream sequences,
promoter region, exon 1, and intron 1 sequences. When using
pXEPO-10, -11 and -12, post-transcriptional processing of the
message can be improved by using in vitro mutagenesis to eliminate
splice acceptor sites lying in hEPO upstream sequences between the
mMT-I promoter and hEPO exon 1, which reduce level of productive
splicing events needed create the desired message. The replacement
of hEPO exon 1 with hGH exon 1 results in a protein in which the
first 4 amino acids of the hEPO signal peptide are replaced with
amino acids 1-3 of hGH, creating a functional, chimeric signal
peptide which is removed by post-translation processing from the
mature protein and is secreted from the expressing cells.
Example 3
[0135] Targeted Modification of Sequences Upstream and
Amplification of the Targeted Gene
[0136] Human cells in which the EPO gene has been activated by the
methods previously described (in copending U.S. patent applications
Ser. Nos. 07/787,840 and 07/911,533) can be induced to amplify the
neo/mMT-1/EPO transcription unit if the targeting plasmid contains
a marker gene that can confer resistance to a high level of a
cytotoxic agent by the phenomenon of gene amplification. Selectable
marker genes such as dihydrofolate reductase (dhfr, selective agent
is methotrexate), the multifunctional CAD gene [encoding carbamyl
phosphate synthase, aspartate transcarbamylase, and
dihydro-orotase; selective agent is N-(phosphonoacetyl)-L-aspartate
(PALA)], and adenosine deaminase (ada; selective agent is an
adenine nucleoside), have been documented, among other genes, to be
amplifiable in immortalized human cell lines (Wright, J. A. et al.
Proc. Natl. Acad. Sci. USA 87:1791-1795 (1990)). In these studies,
gene amplification has been documented to occur in a number of
immortalized human cell lines. HT1080, HeLa, MCF-7 breast cancer
cells, K-562 leukemia cells, KB carcinoma cells, or 2780AD ovarian
carcinoma cells all display amplification under appropriate
selection conditions.
[0137] Plasmids pXEPO-10 and pXEPO-11 can be modified by the
insertion of a normal or mutant dhfr gene into the unique HindIII
sites of these plasmids. After transfection of HT1080 cells with
the appropriate DNA, selection for G418-resistance (conferred by
the neo gene), and identification of cells in which the hEPO gene
has been activated by gene targeting of the neo, dhfr, and mMT-1
sequences to the correct position upstream of the hEPO gene, these
cells can be exposed to stepwise selection in methotrexate (MTX) in
order to select for amplification of dhfr and co-amplification of
the linked neo, mMT-1, and hEPO sequences (Kaufman, R. J. Technique
2:221-236 (1990)). A stepwise selection scheme in which cells are
first exposed to low levels of MTX (0.01 to 0.08 .mu.M), followed
by successive exposure to incremental increases in MTX
concentrations up to 250 .mu.M MTX or higher is employed. Linear
incremental steps of 0.04 to 0.08 .mu.M MTX and successive 2-fold
increases in MTX concentration will be effective in selecting for
amplified transfected cell lines, although a variety of relatively
shallow increments will also be effective. Amplification is
monitored by increases in dhfr gene copy number and confirmed by
measuring in vitro hEPO expression. By this strategy, substantial
overexpression of hEPO can be attained by targeted modification of
sequences lying completely outside of the hEPO coding region.
[0138] Constructs similar to those described (Examples 1i and 1k)
to activate hGH expression in human cells can also be further
modified to include the dhfr gene for the purpose of obtaining
cells that overexpress the hGH gene by gene targeting to non-coding
sequences and subsequent amplification.
Example 4
[0139] Targeting and Activation of the Human EPO Locus in an
Immortalized Human Fibroblast Line
[0140] The targeting construct pXEPO-13 was made to test the
hypothesis that the endogenous hEPO gene could be activated in a
human fibroblast cell. First, plasmid pT22.1 was constructed,
containing 63 bp of genomic hEPO sequence upstream of the first
codon of the hEPO gene fused to the mouse metallothionein-1
promoter (mMT-I). oligonucleotides 22.1 to 22.4 were used in PCR to
fuse mMT-I and hEPO sequences. The properties of these primers are
as follows: 22.1 is a 21 base oligonucleotide homologous to a
segment of the mMT-I promoter beginning 28 bp upstream of the mMT-I
KpnI site; 22.2 and 22.3 are 58 nucleotide complementary primers
which define the fusion of hEPO and IMT-I sequences such that the
fusion contains 28 bp of hEPO sequence beginning 35 bases upstream
of the first codon of the hEPO gene, and mMT-I sequences beginning
at base 29 of oligonucleotide 22.2, comprising the natural BglII
site of mMT-I and extending 30 bases into MMT-I sequence; 22.4 is
21 nucleotides in length and is homologous to hEPO sequences
beginning 725 bp downstream of the first codon of the hEPO gene.
These primers were used to amplify a 1.4 kb DNA fragment comprising
a fusion of mMT-I and hEPO sequences as described above. The
resulting fragment was digested with KpnI (the PCR fragment
contained two KpnI sites: a single natural KpnI site in the MMT-I
promoter region and a single natural KpnI site in the hEPO
sequence), and purified. The plasmid pXEPO1 (FIG. 3) was also
digested with KpnI, releasing a 1.4 kb fragment and a 6.4 kb
fragment. The 6.4 kb fragment was purified and ligated to the 1.4
kb KpnI PCR fusion fragment. The resulting construct was called
pT22.1. A second intermediate, pT22.2, was constructed by ligating
the approximately 6 kb HindIII-BamHI fragment lying upstream of the
hEPO structural gene (see Example 1f) to BamHI and HindIII digested
pBSIISK+ (Stratagene, LaJolla, Calif.). A third intermediate,
pT22.3, was constructed by first excising a 1.1 kb XhoI/BamHI
fragment from pMCINEOpolyA (Stratagene,, LaJolla, Calif.)
containing the neomycin phosphotransferase gene. The fragment was
then made blunt-ended with the Klenow fragment of DNA polymerase I
(New England Biolabs). This fragment was then ligated to the HincII
site of pBSIISK+ (similarly made blunt with DNA polymerase I) to
produce pT22.3. A fourth intermediate, pT22.4, was made by
purifying a 1.1 kb XhoI/HindIII fragment comprising the neo gene
from pT22.3 and ligating this fragment to XhoI and HindIII digested
pT22.2. pT22.4 thus contains the neo gene adjacent to the HindIII
side of the BamHI-HindIII upstream hEPO fragment. Finally, pXEPO-13
was generated by first excising a 2.0 kb EcoRI/AccI fragment from
pT22.1. The EcoRI site of this fragment defines the 5' boundary of
the MMT-I promoter, while the AccI site of this fragment lies
within hEPO exon 5. Thus, the AccI/EcoRI fragment contains a nearly
complete hEPO expression unit, missing only a part of exon 5 and
the natural polyadenylation site. This 2.0 kb EcoRI/AccI fragment
was purified, made blunt-ended by treatment with the Klenow
fragment of DNA polymerase I, and ligated to XhoI digested,
blunt-ended, pT22.4.
[0141] HT1080 cells were transfected with PvuI-BamHI digested
pXEPO-13. pXEPO-13 digested in this way generates three fragments;
a 1 kb vector fragment including a portion of the amp gene, a 1.7
kb fragment of remaining vector sequences and an approximately 10
kb fragment containing hEPO, neo and mMT-I sequences. This
approximately 10 kb BamHI/PvuI fragment contained the following
sequences in order from the BamHI site: an approximately 6.0 kb of
upstream hEPO genomic sequence, the 1.1 kb neo transcription unit,
the 0.7 kb mMT-I promoter and the 2.0 kb fragment containing hEPO
coding sequence truncated within exon 5. 45 .mu.g of pEXPO-13
digested in this way was used in an electroporation of 12 million
cells (electroporation conditions were described in Example 1b).
This electroporation was repeated a total of eight times, resulting
in electroporation of a total of 96 million cells. Cells were mixed
with media to provide a cell density of 1 million cells per ml and
1 ml aliquots were dispensed into a total of 96, 150 mm tissue
culture plates (Falcon) each containing a minimum of 35 ml of
DMEM/15% calf serum. The following day, the media was aspirated and
replaced with fresh medium containing 0.8 mg/ml G418 (Gibco). After
10 days of incubation, the media of each plate was sampled for hEPO
by ELISA analysis (R & D Systems). Six of the 96 plates
contained at least 10 mU/ml hEPO. One of these plates, number 18,
was selected for purification of hEPO expressing colonies. each of
the 96, 150 mm plates contained approximately 600 G418 resistant
colonies (an estimated total of 57,600 G418 resistant colonies on
all 96 plates). The approximately 600 colonies on plate number 18
were trypsinized and replated at 50 cells/ml into 364 well plates
(Sterilin). After one week of incubation, single colonies were
visible at approximately 10 colonies per large well of the 364 well
plates (these plates are comprised of 16 small wells within each of
the 24 large wells). Each well was screened for hEPO expression at
this time. Two of the large wells contained media with at least 20
mU/ml hEPO. Well number A2 was found to contain 15 colonies
distributed among the 16 small wells. The contents of each of these
small wells were trypsinized and transferred to 16 individual wells
of a 96 well plate. following 7 days of incubation the media from
each of these wells was sampled for hEPO ELISA analysis. Only a
single well, well number 10, contained hEPO. This cell strain was
designated HT165-18A2-10 and was expanded in culture for
quantitative hEPO analysis, RNA isolation and DNA isolation.
Quantitative measurement of hEPO production resulted in a value of
2,500 milliunits/million cells/24 hours.
[0142] A 0.2 kb DNA probe extending from the AccI site in hEPO exon
5 to the BglII site in the 3' untranslated region was used to probe
RNA isolated from HT165-18A2-10 cells. The targeting construct,
pXEPO-13, truncated at the AccI site in exon 5 does not contain
these AccI/BglII sequences and, therefore, is diagnostic for
targeting at the hEPO locus. Only cell strains that have recombined
in a homologous manner with natural hEPO sequences would produce an
hEPO mRNA containing sequence homologous to the AccI/BglII
sequences. HT165-18A2-10 was found to express an mRNA of the
predicted size hybridizing with the 32-P labeled AccI/BglII hEPO
probe on Northern blots. Restriction enzyme and Southern blot
analysis confirmed that the neo gene and mMT-I promoter were
targeted to one of the two hEPO alleles in HT165-18A2-10 cells.
[0143] These results demonstrate that homologous recombination can
be used to target a regulatory region to a gene that is normally
silent in human fibroblasts, resulting in the functional activation
of that gene.
6 22.1 5' CACCTAAAAT GATCTCTCTG G (SEQ ID NO 14) 22.2 5' CGCGCCGGGT
GACCACACCG GGGGCCCTAG ATCTGGTGAA GCTGGAGCTA CGGAGTAA (SEQ ID NO 15)
22.3 5' TTACTCCGTA GCTCCAGCTT CACCAGATCT AGGGCCCCCG GTGTGGTCAC
CCGGCGCG (SEQ ID NO 16) 22.4 5' GTCTCACCGT GATATTCTCG G (SEQ ID NO
17)
Example 5
[0144] Production of Intronless Genes
[0145] Gene targeting can also be used to produce a processed gene,
devoid of introns, for transfer into yeast or bacteria for gene
expression and in vitro protein production. For example, hGH can by
produced in yeast by the approach described below.
[0146] Two separate targeting constructs are generated. Targeting
construct 1 (TC1) includes a retroviral LTR sequence, for example
the LTR from the Moloney Murine Leukemia Virus (MoMLV), a marker
for selection in human cells (e.g., the neo gene from Tn5), a
marker for selection in yeast (e.g., the yeast URA3 gene), a
regulatory region capable of directing gene expression in yeast
(e.g., the GAL4 promoter), and optionally, a sequence that, when
fused to the hGH gene, will allow secretion of hGH from yeast cells
(leader sequence). The vector can also include a DNA sequence that
permits retroviral packaging in human cells. The construct is
organized such that the above sequences are flanked, on both sides,
by hGH genomic sequences which, upon homologous recombination with
genomic hGH gene N sequences, will integrate the exogenous
sequences in TC1 immediately upstream of hGH gene N codon 1
(corresponding to amino acid position 1 in the mature, processed
protein). The order of DNA sequences upon integration is: hGH
upstream and regulatory sequences, neo gene, LTR, URA3 gene, GAL4
promoter, yeast leader sequence, hGH sequences including and
downstream of amino acid 1 of the mature protein. Targeting
Construct 2 (TC2) includes sequences sufficient for plasmid
replication in yeast (e.g., 2-micron circle or ARS sequences), a
yeast transcriptional termination sequence, a viral LTR, and a
marker gene for selection in human cells (e.g., the bacterial gpt
gene). The construct is organized such that the above sequences are
flanked on both sides by hGH genomic sequences which, upon
homologous recombination with genomic hGH gene N sequences, will
integrate the exogenous sequences in TC2 immediately downstream of
the hGH gene N stop codon. The order of DNA sequences upon
integration is: hGH exon 5 sequences, yeast transcription
termination sequences, yeast plasmid replication sequences, LTR,
gpt gene, hGH 3' non-translated sequences.
[0147] Linear fragments derived from TC1 and TC2 are sequentially
targeted to their respective positions flanking the hGH gene. After
superinfection of these cells with helper retrovirus, LTR directed
transcription through this region will result in an RNA with LTR
sequences on both ends. Splicing of this RNA will generate a
molecule in which the normal hGH introns are removed. Reverse
transcription of the processed transcript will result in the
accumulation of double-stranded DNA copies of the processed hGH
fusion gene. DNA is isolated from the doubly-targeted,
retrovirally-infected cells, and digested with an enzyme that
cleaves the transcription unit once within the LTR. The digested
material is ligated under conditions that promote circularization,
introduced into yeast cells, and the cells are subsequently exposed
to selection for the URA3 gene. Only cells which have taken up the
URA3 gene (linked to the sequences introduced by TC1 and TC2 and
the processed hGH gene) can grow. These cells contain a plasmid
which will express the hGH protein upon galactose induction and
secrete the hGH protein from cells by virtue of the fused yeast
leader peptide sequence which is cleaved away upon secretion to
produce the mature, biologically active, hGH molecule.
[0148] Expression in bacterial cells is accomplished by simply
replacing, in TC1 and TC2, the ampicillin-resistance gene from
pBR322 for the yeast URA3 gene, the tac promoter (deBoer et al.,
Proc. Natl. Acad. Sci. 80:21-25 (1983)) for the yeast GAL4
promoter, a bacterial leader sequence for the yeast leader
sequence, the pBR322 origin of replication for the 2-micron circle
or ARS sequence, and a bacterial transcriptional termination (e.g.,
trpA transcription terminator; Christie, G. E. et al., Proc. Natl.
Acad. Sci. 78:4180-4184 (1981)) sequence for the yeast
transcriptional termination sequence. Similarly, hEPO can be
expressed in yeast and bacteria by simple replacing the hGH
targeting sequences with hEPO targeting sequences, such that the
yeast or bacterial leader sequence is positioned immediately
upstream of hEPO codon 1 (corresponding to amino acid position 1 in
the mature processed protein).
[0149] Equivalents
[0150] Those skilled in the art will recognize, or be able to
ascertain using not more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
* * * * *