U.S. patent application number 10/365062 was filed with the patent office on 2003-07-31 for transgenic animals expressing human p25.
This patent application is currently assigned to Pfizer Inc.. Invention is credited to Ahlijanian, Michael K., McNeish, John D..
Application Number | 20030145343 10/365062 |
Document ID | / |
Family ID | 27616124 |
Filed Date | 2003-07-31 |
United States Patent
Application |
20030145343 |
Kind Code |
A1 |
McNeish, John D. ; et
al. |
July 31, 2003 |
Transgenic animals expressing human p25
Abstract
The invention provides transgenic, non-human animals and
transgenic non-human mammalian cells harboring a transgene encoding
a p25 (activator of the protein kinase cdk 5) polypeptide. The two
neuropathological lesions associated with Alzheimer's disease (AD)
are amyloid plaques and neurofibrillary tangles (NFTs), composed
predominantly of amyloid .beta. peptides and hyperphosphorylated
tau, respectively. While animal models for plaque formation exist,
there is no animal model that recapitulates the formation of NFTs.
This invention provides transgenic mice that overexpress human p25,
an activator of cdk5, resulting in tau that is hyperphosphorylated
at AD-relevant epitopes. Deposition of tau is detected in the
amygdala, thalamus and cortex. Increased phosphorylated
neurofilament, silver-positive neurons and neuronal death are also
observed in these regions. We conclude that the overexpression of
p25, an activator of cdk5, is sufficient to produce
hyperphosphorylation of tau and neuronal death. The p25 transgenic
mouse represents the first model for tau pathology in AD.
Inventors: |
McNeish, John D.; (Mystic,
CT) ; Ahlijanian, Michael K.; (Mystic, CT) |
Correspondence
Address: |
PFIZER INC.
PATENT DEPARTMENT, MS8260-1611
EASTERN POINT ROAD
GROTON
CT
06340
US
|
Assignee: |
Pfizer Inc.
|
Family ID: |
27616124 |
Appl. No.: |
10/365062 |
Filed: |
February 11, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10365062 |
Feb 11, 2003 |
|
|
|
09496445 |
Feb 2, 2000 |
|
|
|
60118478 |
Feb 3, 1999 |
|
|
|
Current U.S.
Class: |
800/18 ; 435/233;
435/320.1; 435/354; 536/23.2 |
Current CPC
Class: |
A01K 2207/15 20130101;
A01K 67/0275 20130101; C12N 15/8509 20130101; A01K 67/0278
20130101; A01K 2217/05 20130101; A01K 2267/0312 20130101; A01K
2217/00 20130101; C07K 14/4738 20130101; A01K 2267/0318 20130101;
A01K 2227/105 20130101; C12N 2830/008 20130101 |
Class at
Publication: |
800/18 ; 435/354;
435/320.1; 536/23.2; 435/233 |
International
Class: |
A01K 067/027; C07H
021/04; C12N 009/90; C12N 005/06 |
Claims
1. Recombinant DNA comprising a rat neuron specific enolase
promoter operably linked to a p25 encoding sequence of the human
cdk5 gene encoding sequence.
2. Recombinant DNA according to claim 1 wherein said sequence
encoding said p25 fragment has the characteristics of genomic
DNA.
3. Recombinant DNA according to claim 1 wherein said sequence
encoding said p25 fragment has the characteristics of cDNA.
4. Recombinant DNA according to claim 1 wherein said sequence is
that of SEQ ID NO: 4
5. A vector comprising recombinant DNA according to claim 1.
6. A vector comprising recombinant DNA according to claim 2.
7. A vector comprising recombinant DNA according to claim 3.
8. An eukaryotic cell line comprising recombinant DNA according to
claim 1.
9. An eukaryotic cell line comprising recombinant DNA according to
claim 2.
10. An eukaryotic cell line comprising recombinant DNA according to
claim 3.
11. A transgenic non-human mammal, and progeny thereof whose germ
cells and somatic cell express recombinant DNA according to claim
1.
12. A transgenic non-human animal, or progeny, thereof, whose germ
cells and somatic cells express recombinant DNA according to claim
2.
13. A transgenic non-human animal, or progeny thereof, whose germ
cells and somatic cells express recombinant DNA according to claim
3.
14. A transgenic non-human animal, or a progeny thereof, according
to claim 12 which is a mouse.
15. A transgenic non-human animal, or a progeny thereof, according
to claim 13 which is a mouse.
16. A transgenic non-human animal, or a progeny thereof, according
to claim 14 which is a mouse.
17. A method for treating an animal having a disease characterized
by the expression of a p25 fragment of a human cdK5 gene comprising
administering a therapeutically effective amount of an inhibitor of
said p25 fragment.
18. A method for determining the ability of a compound to inhibit
the expression of a p25 fragment of a human cdk5 gene comprising
the steps of: a. creating a transgenic non-human animal by stably
incorporating into the embryonic stem cells of said animal the
recombinant DNA of claim 1; b. growing said embryonic stem cells
into a mature transgenic non human animal; c. administering to said
transgenic non-human animal the compound of interest; d. measuring
the inhibition of said p25 fragment by said compound.
19. A method for generating data to determing the ability of a
compound to inhibit the expression of a p25 fragment of a human
cdk5 gene comprising the steps of: a. creating a transgenic
non-human animal by stably incorporating into the embryonic stem
cells of said animal the recombinant DNA of claim 1; b. growing
said embryonic stem cells into a mature transgenic non human
animal; c. administering to said transgenic non-human animal the
compound of interest; d. measuring the inhibition of said p25
fragment by said compound. e. using the data derived from said
inhibition to synthesize compounds capable of inhibiting said p25
fragment.
Description
TECHNICAL FIELD
[0001] The invention provides transgenic, non-human animals and
transgenic non-human mammalian cells harboring a transgene encoding
a p25 polypeptide, an activator of the protein kinase cdk5. The
invention also provides non-human animals and cells comprising a
transgene encoding a p25 polypeptide and further comprising
functional overexpression of p25, the p25 transgene and targeting
constructs used to produce such transgenic cells and animals,
transgenes encoding human p25 polypeptide sequences and methods for
using the transgenic animals in pharmaceutical screening and as
commercial research animals for modeling neurodegenerative disease
such as Alzheimer's disease and p25/cdk5 biochemistry in vivo.
BACKGROUND OF THE INVENTION
[0002] Throughout the specification, a number of publications are
cited. These publications are incorporated by reference in their
entirety. A complete listing of the publications appears later in
the specification.
[0003] Alzheimer's disease (AD) is a progressive, neurodegenerative
disorder characterized by loss of cognitive function. The primary
neuropathological lesions in AD are amyloid plaques and
neurofibrillary tangles (NFTs). Amyloid plaques are composed
primarily of amyloid beta (Ab) peptides, varying in length from
39-42 amino acids, which are derived from amyloid precursor protein
(APP) (reviewed in 1). NFTs are composed of the microtubule binding
protein tau that is hyperphosphorylated at epitopes which exist in
a predominantly unphosphorylated state in disease-free brain (2-4).
The respective roles that these lesions play in the neuronal loss
and dementia observed in patients with AD remain controversial.
[0004] The precise mechanism of NFT formation is not clear but work
from many laboratories suggests that hyperphosphorylation of tau
may be an important event. The paired helical filament (PHF) is the
fundamental unit of the NFT. Hyperphosporylation of tau at serine
or threonine residues followed by proline (SP or TP), epitopes
which are concentrated at the amino and carboxy termini of tau,
results in loss of affinity for microtubules, and a presumed
concomittant increase in the concentration of cytoplasmic tau
(5-8). However, phosphorylation of tau at serine 262, which is not
followed by proline, can also reduce the affinity of tau for
microtubules (9). In vitro experiments with purified tau show that
in the presence of endogenous cations (e.g., mRNA, heparin sulfate
proteoglycan), tau polymerizes to form structures indistinguishable
from the PHF seen in AD brain (10,11). The cation-dependent
formation of PHF in vitro is independent of the phosphorylation
state of tau, suggesting that the key permissive event in
initiating PHF formation may be an increase in the cytoplasmic
concentration of tau. In support of this hypothesis, recent
evidence (12-14) indicates that the mutations in the tau gene
associated with susceptibility to a form of inherited dementia
called frontotemporal dementia and Parkinsonism linked to
chromosome 17 (FTDP-17), reduce the affinity of tau for
microtubules (15). Therefore these mutations, like
hyperphosphorylation, may result in an increase in cytoplasmic tau
concentrations. In the presence of endogenous cations, this
increase is presumed to permit PHF formation followed by NFT
assembly and, ultimately, neuronal death.
[0005] As with other phosphoproteins, the phosphorylation state of
tau is the sum of protein kinase and protein phosphatase activity.
Thus hyperphosphorylation of tau in AD may be due to an increase in
kinase activity or a decrease in phosphatase activity. While many
protein kinases phosphorylate tau at AD-relevant epitopes in vitro
(reviewed in 16,17), only two have been co-purified with
microtubules from mammalian brain, GSK3b and cdk5 (18). To our
knowledge, only these two kinases will phosphorylate tau when
transfected heterologously into mammalian cells (19,24). We chose
to focus on cdk5 vs. GSK3b as the latter plays a role in energy
metabolism and is expressed in an active form in all cells, while
cdk5 is only active in neurons (vide infra).
[0006] The kinase cdk5 is a member of the cyclin-dependent protein
kinase family and is expressed in nearly all cells (reviewed in
25,26). Unlike other members of the cdk family, there is no known
cyclin which activates cdk5. Rather, the positive allosteric
regulators of cdk5 are p35 (27), amino terminal proteolytic
fragments of p35, e.g, p25, p23 or p21 (28,29) and p39 (30). These
proteins share minimal amino acid sequence homology to cyclins
(27-29) but computer modeling and biochemical experiments suggests
that the mechanism of activation of cdk5 by p25/35 may be similar
to that of cyclin A activation of cdk2 (31-33). The protein p25/35
is expressed predominantly in neurons implying that most cdk5
activity is concentrated in neuronal structures (27,28). The
protein p35 has a relatively short half life within cells and is
rapidly ubiquitinated, suggesting tight regulation of cdk5 activity
in neurons (34). The kinase cdk5 plays a pivotal role in neuronal
development as evidenced by the abnormal corticogenesis and
perinatal lethality of cdk5 knockout mice (35) and the disturbances
in neuronal migration and early death in p35 knock-out mice (36).
In developmental studies in rodents, the peak catalytic activity of
cdk5 occurs at E11 or 12, lending further support for the role of
cdk5 in neurogenesis (37,38). Furthermore, in primary cultured
neurons, cdk5/p35 is localized to growth cones suggesting a role in
neurite outgrowth (39). Recently, evidence of signaling pathways
which may modulate cdk5 activity have emerged. For example, it has
been demonstrated that cdk5/p35 interacts with Rac and modulates
PAK activity (40), and that laminin-enhanced outgrowth of
cerebellar neurons is disrupted by suppression of p35 expression
(41). A few substrates for cdk5 have been identified and are
consistent with the presumed role in neurite outgrowth and plasma
membrane dynamics. These include cytoskeletal proteins such as tau
(42-45) and neurofilament (46-48), synaptic vesicle proteins such
as synapsin and Munc-18 (49,50) and the retinoblastoma protein
(51). Nevertheless, neither a clear picture of a signal
transduction pathway(s) which regulates cdk5/p35 activity nor the
role of both cdk5/p35 in mature brain have been elucidated.
[0007] A clear picture of the protein kinases responsible for the
hyperphosphorylation of tau in AD is also lacking. However,
evidence that cdk5 may a play a pathological role is accumulating.
For example, in in vitro studies, cdk5 will phosphorylate up to
eight different epitopes of tau, including those associated with AD
and known to decrease the affinity of tau for microtubules (42-45).
Additionally, heterologous co-transfection of cdk5/p25 with tau
into mammalian cells also results in phosphorylation of several of
these epitopes (24). Finally, immunohistochemical evidence suggests
that cdk5 is proximal to NFTs in AD brain (52,53).
[0008] The development of experimental models of Alzheimer's
disease that can be used to define further the underlying
biochemical events involved in AD pathogenesis would be highly
desirable. Such models could be employed, in one application, to
screen for agents that alter the degenerative course of AD. For
example, a model system of AD could be used to screen for
environmental factors that induce or accelerate the pathogenesis of
AD. Alternatively, an experimental model could be used to screen
for agents that inhibit, prevent, or reverse the progression of AD.
Such models could be employed to develop pharmaceuticals that are
effective in preventing, arresting or reversing AD. Only humans and
aged non-human primates develop any of the pathological features of
AD. The expense and difficulty of using primates and the length of
time required for developing the AD pathology makes extensive
research on such animals prohibitive. Rodents do not develop AD,
even at an extreme age. Despite various reports that certain
treatments result in hyperphosphorylation of tau and/or neuronal
death associated with the phosphorylation of tau, there is a need
in the art for transgenic non-human animals which can produce
hyperphosphorylation of tau and associated neuronal death.
[0009] Based on the above, it is clear that a need exists for
nonhuman cells and nonhuman animals which produce
hyperphosphorylation of tau and neuronal cell death. Thus, it is an
object of the invention herein to provide methods and compositions
for transferring transgenes and homologous recombination constructs
into mammalian cells, especially into embryonic stem cells. It is
also an object of the invention to provide transgenic non-human
cells and transgenic nonhuman animals harboring transgenes
resulting in the increased expression of p25, an activator of cdk5.
Of further interest to the present invention are the application of
such transgenic animals as in vivo systems for screening test
compounds for the ability to inhibit or prevent the production of
hyperphosphorylated tau and associated neuronal death. It is
desirable to provide methods and systems for screening test
compounds for the ability to inhibit or prevent the phosphorylation
of tau and associated neuronal death. In particular, it is be
desirable to base such methods and systems on inhibition of
cdk5/p25, where the test compound blocks phosphorylation of tau
mediated by cdk5/p25, the test compound also blocks neuronal death.
Such methods and transgenic animals should provide a rapid,
economical and suitable way for screening large numbers of test
compounds.
[0010] We overexpressed human p25 in the brains of mice to
determine if an increase in cdk5 activity would result in the
hyperphosphorylation of tau at AD-relevant epitopes, and if this
hyperphosphorylation would lead to neuronal death. In the brains of
p25 transgenic mice, both tau and neurofilament are
hyperphosphorylated, and many silver-positive neurons with
tangle-like inclusions are present. The silver-positive neurons
suggest ongoing neuronal death. These results demonstrate that
overexpression of an activator of cdk5 is sufficient to produce tau
and neurofilament phosphorylation and silver-positive neurons which
are very similar to those seen in AD. The p25 transgenic mouse may
serve as a model for the neurofibrillary pathology and neuronal
death seen in AD.
SUMMARY OF THE INVENTION
[0011] In one embodiment, the present invention is directed to
recombinant DNA comprising a rat neuron specific enolase promoter
operably linked to a p25 encoding sequence of the human cdk5 gene
encoding sequence.
[0012] In a preferred embodiment, the present invention is directed
to recombinant DNA wherein said sequence encoding said p25 fragment
is genomic DNA.
[0013] In another preferred embodiment, the present invention is
directed to recombinant DNA wherein said sequence encoding said p25
fragment is cDNA.
[0014] In still another preferred embodiment, the present invention
is directed to recombinant DNA wherein said sequence is that of SEQ
ID NO: 4
[0015] In yet another embodiment, the present invention is directed
to a vector comprising recombinant DNA according to the present
invention.
[0016] In another embodiment, the present invention is directed to
eukaryotic cell lines comprising recombinant DNA according to the
present invention.
[0017] In another embodiment, the present invention is directed to
a transgenic non-human animal, or progeny thereof, whose germ cells
and somatic cells express recombinant DNA according to the present
invention.
[0018] In a preferred embodiment, the present invention is directed
to a transgenic non-human animal, or progeny thereof, which is a
mouse.
[0019] In a further embodiment, the present invention is directed
to a method for treating an animal having a disease characterized
by the expression of a p25 fragment of a human cdK5 gene comprising
administering a therapeutically effective amount of an inhibitor of
said p25 fragment.
[0020] In another embodiment, the present invention is directed to
a method for determining the ability of a compound to inhibit the
expression of a p25 fragment of a human cdk5 gene comprising the
steps of:
[0021] a. creating a transgenic non-human animal by stably
incorporating into the embryonic stem cells of said animal the
recombinant DNA of claim 1;
[0022] b. growing said embryonic stem cells into a mature
transgenic non human animal;
[0023] c. administering to said transgenic non-human animal the
compound of interest;
[0024] d. measuring the inhibition of said p25 fragment by said
compound.
[0025] In still another embodiment, the present invention is
directed to a method for generating data to determining the ability
of a compound to inhibit the expression of a p25 fragment of a
human cdk5 gene comprising the steps of:
[0026] a. creating a transgenic non-human animal by stably
incorporating into the embryonic stem cells of said animal the
recombinant DNA of claim 1;
[0027] b. growing said embryonic stem cells into a mature
transgenic non human animal;
[0028] c. administering to said transgenic non-human animal the
compound of interest;
[0029] d. measuring the inhibition of said p25 fragment by said
compound.
[0030] e. using the data derived from said inhibition to synthesize
compounds capable of inhibiting said p25 fragment.
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIG. 1A. Western blots of the amygdala (1), thalamus (2) and
cortex (3) from 3 wild type mice were probed with an antibody
specific for p25 and p35/39 (generous gift of L.-H. Tsai, Harvard
Medical School Cambridge, Mass.).
[0032] FIG. 1B, Western blots of the amygdala (1), thalamus (2) and
cortex (3) from 3 p25 transgenic mice were probed with the same
antibody as in FIG. 1A.
[0033] Expression of the transgene, p25, is apparent in the
transgenic but not wild type mice.
[0034] FIG. 2 displays a four month old transgenic mouse brain
immunopositive for AT-8 (a commercially available antibody which
specifically recognizes phopho-serine 202/205 of tau) specific in
the rostral portion of the amygdala. Neuronal cell bodies with
accompanying axons (arrows) are positive. Several dark-brown
positive cells are seen in this field.
[0035] FIG. 3 shows a four month old wild-type mouse brain
minimally positive for AT-8 in the rostral portion of the amygdala.
A cell body exhibits non-specific positivity (arrow) due to the
secondary antibody.
[0036] FIG. 4 shows a four month old transgenic mouse brain
demonstrating PHF-13 (an antibody which recognizes phospho-serine
396/404 of tau; (gift from Dr. V. Lee, U. of Pennsylvania)
immunopositivity in the rostral portion of the amygdala. Neuronal
cell body with a thickened axon (arrow) is positive. Positive
neuronal cell body (arrow head) with possible swollen/atrophied
axon.
[0037] FIG. 5 shows a four month old wild-type mouse brain
minimally positive for PHF-13 in the rostral portion of the
amygdala. Cell bodies exhibit non-specific positivity (arrows) due
to the secondary antibody.
[0038] FIG. 6 shows a four month old transgenic mouse brain
immunopositive for total tau (an antibody which recongnizes total
tau commercially available from Accurate Chemical and Scientific
Corp Westbury, N.Y.) in several cell bodies of the rostral amygdala
(examples marked by arrows).
[0039] FIG. 7 shows a four month old wild-type mouse brain
immunopositive for tau in axons (arrow heads) of the rostral
amygdala.
[0040] FIG. 8 shows a four month old transgenic mouse brain reacted
with SMI-34 (a commercially available antibody which recognizes
phosphorylated neurofilament H protein). Positive cells (arrows)
are seen in the rostral amygdala.
[0041] FIG. 9 shows minimal SMI-34 axonal positivity in the rostral
amygdala of a four month old wild-type mouse brain.
[0042] FIG. 10 shows silver-positive (an indication of disrupted
cytoskeleton and neuronal cell death) cell bodies (arrows) in the
rostral amygdala of a four month old transgenic mouse brain.
[0043] FIG. 11 shows minimal silver positivity of axons in the
rostral amygdala of a four month old wild type mouse.
[0044] FIG. 12 shows several dilated axons (arrows) that exhibit
silver positivity in the spinal cord of a five month old transgenic
mouse.
[0045] FIG. 13 shows several dilated axons (arrows) that exhibit
SMI-34 positivity in the spinal cord of a five month old transgenic
mouse.
[0046] FIG. 14 shows that normal axons in the spinal cord of a six
month old wild-type mouse are negative for SMI-34.
DETAILED DESCRIPTION
[0047] Generally, the nomenclature used herein and the laboratory
procedures in cell culture, molecular genetics, nucleic acid
chemistry and hybridization, biochemistry, histology and
immunocytochemistry described below are those well known and
commonly described in the art. Standard techniques are used for
recombinant nucleic acid methods, polynucleotide synthesis, cell
culture, transgene incorporation, Western blotting,
immunocytochemistry and histological techniques such as silver
staining. The techniques and procedures are generally performed
according to conventional methods in the art and various general
references which are provided throughout this specification. The
procedures therein are well known in the art and are provided for
the convenience of the reader. All the information contained
therein is incorporated herein by reference.
[0048] In accordance with the foregoing objects, in one aspect of
the invention are provided nonhuman animals harboring at least one
copy of a transgene comprising a polynucleotide sequence that
encodes a heterologous protein operably linked to regulatory
elements that are capable of expressing the heterologous protein in
the transgenic nonhuman animal. Said heterologous polypeptide is a
truncated portion of the p35 cyclin dependent kinase 5 (cdk5)
regulatory protein (27,28). The truncated heterologous polypeptide
has the first 98 N-terminal amino acids removed and has a molecular
weight of approximately 25,000 daltons. This novel polypeptide will
be referred to as p25. Typically, the nonhuman transgenic animal is
a mouse and the heterologous gene is the human p25 sequence.
Transgenes are typically cDNA sequences that have been operably
linked to cis-acting regulatory sequences that direct expression in
the host transgenic mammal in cell-type specific manner, typically
in neurons. Typically, the transgene will be incorporated into the
host chromosomes in random, non-targeted fashion. The invention
further provides that the nonhuman, transgenic animal harboring at
least one copy of the heterologous p25 sequence transgene or gene
targeting vector of the invention either non-homologously or
homologously integrated into the chromosomal location express the
p25 truncated polypeptide. Transgenic animals are typically
produced by introduction of a transgene by microinjection into
pronuclei of one-cell embryos or a targeting vector into the host
by electroporation, lipofection, or viral transfection of embryonic
stem (ES) cells. The transgenic animals that express the p25
polypeptide are suitable for use as models of disease and screening
of potential therapeutic compounds including small molecules,
proteins and polynucleotides. The invention also provides nonhuman
or human cell lines to be derived by transformation of established
cell lines or primary cell lines established directly from the
nonhuman transgenic animal, for example neurons. It is obvious that
the transgenic nonhuman animal can have additional genetic
modifications by transgenic art or through traditional matings with
other transgenic or naturally occurring animals to produce novel
animals that serve as alternative disease models, drug screens or
other applications. This includes the inactivation of the murine
endogenous p35 gene through gene targeting in ES cells and
resultant murine p35-deficient mice that becomes the preferred host
for expression of the human p25 heterologous polypeptide. Such
heterologous transgenes may be integrated in nonhomologous
chromosomal locations in the transgenic animal, typically derived
by pronuclear injection or may be integrated by gene targeting in
ES cells by methods to inactivate the murine p35 gene and add
linked sequences to direct expression of the heterologous human p25
sequences.
[0049] In general, the invention encompasses methods for the
generation and characterization of transgenic animals that express
the human p25 polypeptide, a proteolytic fragment of p35, both of
which are an allosteric activators of cyclin dependent kinase 5
(cdk5). The transgenic animals express this human protein in the
presence of the endogenous homologue. The techniques and procedures
are performed according to established protocols that are generally
considered to be routine methods in the art and references are
provided within this specification. The protein kinase cdk5 when
associated with an allosteric activator, e.g., p35 or p25 is
reported in the literature to phosphorylate tau in vitro and in
whole cells (see Background of the Invention). The transgenic mice
thus produced establish the role of the human p25 in the formation
of hyperphosphorylated tau in neurodegenerative conditions
including Alzheimer's disease, Parkinson's disease, amyelolateral
sclerosis, Huntington's chorea, stroke, traumatic brain injury,
Pick's disease, neuraxonal dystrophy, multiple sclerosis, motor
neuron disease, and spinocerebellar degeneration and other
neurodegenerative diseases. It is apparent that the preparation of
other transgenic animals that express the human p25 protein is
easily accomplished including rats, hamsters, guinea pigs and
rabbits. The transgenic animals that express the human p25 protein
can be monitored for the level of expression and tau
phosphorylation. It will be appreciated that under different
conditions the level of expression and degree of tau
phosphorylation will be inhibited in such an animal model. In
particular, the screening of therapeutic agents that inhibit the
activity of the human p25 protein will be greatly facilitated in
animal models. It is apparent that the development of cell lines
from the affected transgenic animals, (e.g., neurons) will improve
the throughput in which biochemical and pharmacological analysis of
the human p25 protein can be assessed.
[0050] Particularly preferred animal models for p25 overexpression
are transgenic anmals which express p25 as described above. Such
transgenic animals, particularly transgenic mice according to this
invention, produce high quantities of p25 and hyperphosphorylated
tau and neuronal death which may be detected according to the
methods of the present invention. In accordance to this invention
particular, the overexpression of p25 will be equal to or greater
than endogenous p25 expression in such animals. Further, this level
of p25 overexpression results in tau hyperphosphorylation which is
minimal in wild type animals. With such elevated levels of p25,
monitoring of hyperphosphorylation of tau and neuronal death is
greatly facilitated. In particular, screening for compounds and
other therapies for inhibiting tau phosphorylation are greatly
simplified in animals overexpressing p25 according to this
invention.
[0051] Agents are administered to test animals, such as test mice,
which are transgenic and which overexpress p25. Particular
techniques for producing transgenic mice which overexpress p25 are
described below. It will be appreciated that the preparation of
other transgenic animals overexpressing p25 may easily be
accomplished, including rats, hamsters, guinea pigs, rabbits, and
the like. In light of this disclosure, the effect of test compounds
on the hyperphosphorylation of tau in the test animals may be
measured in various specimens from the test animals.
[0052] The effect of test agents on hyperphosphorylation of tau may
be measured in various specimens from the test animals. In all
cases, it will be necessary to obtain a control value which is
characteristic of the level of tau phosphorylation and neuronal
death in the test animal in the absence of the test compound(s). In
cases where the animal is sacrificed, it will be necessary to base
such control values on an average or a typical value from other
test animals which have been transgenically modified to overexpress
p25 but which have not received the administration of any test
compounds or any other substances expected to affect the level of
tau phosphorylation or neuronal death. Once such control level is
determined, test compounds can be administered to additonal test
animals, where deviation from the average control value indicates
that the test compound had an effect on the tau phosphorylation or
neuronal death in the animal. Test substances considered positive,
i.e., likely to be beneficial in the treament of AD or other
neurodegenerative diseases, will be those which are able to reduce
the level of tau phosphorylation or neuronal death preferably by at
least 20% and most preferably by 80%. In addition there may be
paired helical or straight filament formation in transgenic animals
which overexpress p25 and display tau hyperphosphorylation. In
these cases, test compounds can be administered to test animals and
the reduction of filament formation monitored as a result of
exposure to the compound. In addition, there may be behavioral
alterations in the transgenic animals which overexpress p25 and
display tau hyperphosphorylation. In these cases it will be
necessary to obtain a control value from live animals performing a
behavioral task (e.g., the measurement of locomotor activity) in
the test animal in the absence of test compound(s). Such a control
will also be determined in non-transgenic, wild type mice. The
difference between the wild type and transgenic mice will serve as
the outcome measure for the effects of compounds. Once such control
levels are determined, test compounds can be administered to
additional test animals, where reduction in or reversal of the
difference between the wild type and transgenic mice indicates that
test compound has an effect on the behavioral test being measured.
Test substances considered positive, i.e., likely to be beneficial
in the treament of AD or other neurodegenerative diseases,
preferably will be those which are able to reverse or,
substantially reverse, or favorably modify the behavioral
abnormality in the transgenic animal to the level found in wild
type mice.
[0053] Test agents will be defined as any small molecule, protein,
polysaccharides, deoxy or ribomucleotides, or any combination
thereof that when added to the cell culture or animal will not
adversely interfere with the cell or animal viability. Agents that
alter the level of human p25 expression and tau phosphorylation
will be considered as candidates for further evaluation as
potential therapeutics. The test compound will typically be
administered to transgenic animals at a dosage of from 1 ng/kg to
100 mg/kg, usually from 10 ug/kg to 32 mg/kg.
[0054] Test compounds which are able to inhibit phosphorylation of
tau are considered as candidates for further determinations of the
ability to block tau phosphorylation in animals and humans.
Inhibition of tau phosphorylation indicates that cdk5/p25 activity
has been at least partly blocked, reducing the amount of cdk5/p25
available to phosphorylate tau.
[0055] The present invention further comprises pharmaceutical
compositions incorporating a compound selected by the
above-described method and including a pharmaceutically acceptable
carrier. Such pharmaceutical compositions should contain a
therapeutic or prophylactic amount of at least one compound
identified by the method of the present invention. The
pharmaceutically acceptable carrier can be any compatible,
non-toxic substance suitable to deliver the compound or compounds
to an intended host. Sterile water, alcohol, fats, waxes and inert
solids may be used as the carrier. Pharmaceutically acceptable
adjuvants, buffering agents, dispersing agents, and the like may
also be incorporated into the pharmaceutical compositions.
Preparation of pharmaceutical compositions incorporating active
agents is well described in the medical and scientific literature.
See, for example, Remington's Pharmaceutical Sciences, Mack
Publishing Company, Easton, Pa., 16.sup.th Ed., 1982, the
disclosure of which is incorporated herein by reference.
[0056] The pharmaceutical compositions just described are suitable
for systemic administration to the host, including both parenteral,
topical, and oral administration. The pharmaceutical compositions
may be administered parenterally, i.e., subcutaneously,
intramuscularly or intravenously. Thus, the present invention
provides compositions for administration to a host where the
compositions comprise a pharmaceutically acceptable solution of the
identified compound in an acceptable carrier, as described
above.
Commercial Research and Screening Uses
[0057] Non-human animals comprising transgenes which encode p25 can
be used commercially to screen for agents having the effect of
preventing or reducing the phosphorylation of tau and neuronal
death. Such agents can be developed as pharmaceuticals for treating
hyperphosphorylation of tau and AD amongst other neurodegenerative
diseases. For example, the p53 knockout mice of Donehower et al.
(54) have found wide acceptance as commercial prouducts for
carcinogen screening and the like. The transgenic animals of the
present invention exhibit abnormal tau phosphorylation and can be
used for pharmaceutical screening and as disease models for
neurodegenerative diseases and cdk5/p25 and tau biochemistry. Such
animals have many uses including but not limited to identifying
compounds that affect tau hyperphosphorylation; in one variation,
the agents are thereby identified as candidate pharmaceutical
agents. The transgenic animals can also be used to develop agents
that modulate cdk5 or p25 expression and or stability; such agents
can serve as therapeutic agents to treat neurodenerative diseases.
The p25 overexpressing mice of the invention can also serve as
disease models for investigating tau-related pathologies (e.g., AD,
Pick's disease, Parkinson's disease, frontal temporal lobe dementia
associated with chromosome 17, stroke, traumatic brain injury, mild
cognitive impairment and the like). Such transgenic animals can be
commercially marketed to researchers, among other uses.
[0058] Having described the invention in general terms, reference
is now made to specific examples. It is to be understood that these
examples are not meant to limit the present invention, the scope of
which is to be determined by the appended claims.
EXPERIMENTAL EXAMPLES
The Plasmids
[0059] The plasmid pNSE-p25 (rat neuron specific enolase promoter,
human p25 transgene) contains DNA from 4 different sources: the rat
neuron specific enolase promoter; the human cDNA for the p25
catalytic fragment of the p35 protein; the SV40 polyadenylation
signal sequence and a commercially available plasmid vector. The
transgene is isolated by BamH1 restriction enzyme digestion of
pNSE-p25. This restriction digest releases the NSE-p25 transgene
(3212 bp) from the plasmid cloning vector pSP72 (2462 bp) (Promega,
Madison, Wis.). The rat Neuron Specific Enolase (NSE) promoter
sequence is 1826 bp (SEQ ID NO: 1) and has been demonstrated to
efficiently express DNA coding sequences in neurons of transgenic
mice (55). The coding region for the human p25 sequence is 633 bp.
(SEQ ID NO: 2). The 3-prime untranslated and SV40 polyadenylation
sequence are 688 bp (SEQ ID NO: 3). The microinjected NSE-p25
transgene is 3212 bp (SEQ ID NO: 4). Enzymatic reactions of
recombinant DNA, including ligations, restriction, endonuclease
digestions, DNA synthesis reactions, single strand fill-in
reactions, and bacterial transformations performed are well
established procedures as described by Sambrook, J., Fritsch, E. F.
and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd
edition, Cold Spring Harbor Press, New York, 1989.
[0060] The SV 40 polyadenylation sequence (SEQ ID NO: 3) was cloned
into the commercially available plasmid pSP72 (SEQ ID NO: 5) at
Xba1 and BstX1 sites. This plasmid, designated pSP-SVpA, served as
the backbone vector for the construction of the NSE-p25 transgene
plasmid. The cDNA for the human p25 catalytic fragment was derived
using polymerase chain reaction (PCR). The human p35 full length
cDNA was used as the template for amplification of the p25 insert.
We received the p35 template DNA from Dr. David Auperin of Pfizer;
the human p35 sequence was cloned into the EcoR1 site of the
pFastBac1, baculoviral expression vector (Gibco-BRL, Gaithersburg,
Md.). The PCR primers were designed to have Not1 restriction sites
outside the coding sequence to facilitate transgene construction.
The forward primer also introduced a new ATG start codon adjacent
to the GCC (Ala codon at position 99 of the human p35 sequence).
The primers (submitted in 5-prime to 3-prime orientation) were
p25-forward: GCGGCCGCATGGCCCAGCCCCCACCGGCCCAGCCGCCTGCA (SEQ ID NO:
6) and p25-reverse: CTCCTCCTAGGCCTGGAATCGGTGAGGCGGCCGC (SEQ ID NO:
7). The ATG is introduced start codon, the TGA is the stop codon
and the GCGGCCGC are the Not1 restriction sites added to the PCR
primers. The resulting PCR product is 648 bp containing the entire
633 bp human p25 cDNA sequence with engineered ATG start site (SEQ
ID NO: 2) and an additional 15 bp from addition of the Not 1
cloning sites. The 648 bp fragment was subcloned into the pCR2.1
(Invitrogen, Carlsbad, Calif.) vector for verification of sequence
prior to use as insert in the final transgene. The confirmed 648 bp
Not 1 fragment was ligated into the Not 1 restriction site of
pSP-SVpA producing the plasmid pSP-SVpA:p25. The rat Neuron
Specific Enolase (NSE) promoter was isolated from the plasmid
pNSE-lacZ obtained from Dr. J. G. Sutcliffe of the Research
Institute of Scripps Clinic (LaJolla, Calif.). The rat NSE promoter
sequence (SEQ ID NO: 1) was isolated by EcoR1 and Hind III
restriction digestion of the pNSE-lacZ plasmid. The 1.8 kb fragment
was extracted by agarose gel electrophoresis and purified. The
5-prime single strand overhangs generated by the restriction
enzymes were filled by Klenow reaction to produce the rat NSE
promoter fragment with double stranded blunt ends. The 1826 bp rat
NSE blunt end promoter fragment was blunt end ligated into the Sma
1 restriction site of pSP-SVpA:p25. The correct orientation of the
rat NSE promoter within the pSP-SVpA:p25 was verified by double
restriction digests of BamH1 and Xho1. Plasmids with the correct
orientation were assigned the designation as pNSE-p25. The entire
sequence of the 3212 bp NSE-p25 transgene (SEQ ID NO: 4) was
analyzed and verified by automated sequencing on ABI 373 sequencer
(Foster City, Calif.) using the standard dye-terminator chemistry
protocol outlined by ABI. All plasmids were grown in DH5alpha
bacterial cells (Gibco BRL Gaithersburg Md.).
Production of Transgenic Mice Overexpressing Human p25
[0061] The 3212 bp NSE-p25 transgene DNA fragment was excised from
the pNSE-p25 plasmid by BamH1 restriction endonuclease reaction.
The 3.2 kbp fragment was isolated by electroelution (50V, 3 hrs)
after electrophoresis in 1% agarose gel (FMC Bioproducts, Rockland
Me.). The fragment was further purified by on a Schleicher and
Schuell (Keene, N.H.) Elutip-d column following protocols
established by the manufacturer for DNA purification prior to
murine embryo microinjection.
[0062] Production of transgenic mice by pronuclear microinjection
was carried out by published procedures as outlined in Hogan, B. et
al Manipulating the Mouse Embryo: A Laboratory Manual 2nd edition,
Cold Spring Harbor Laboratories, New York, 1994. Pronuclear stage
embryos from F1 females mice of the strain FVB/N (Charles River
Labs, Wilmington, Mass.) were obtained after superovulation with 5
international units (IU) of follicle stimulating hormone from
pregnant mare serum (Sigma St Louis, Mo.) and 2.5 I.U. human
chorionic gonadotropin (Sigma). The actual microinjection procedure
was performed as described by Wagner, T. et al. (56) except that
the embryos were transferred immediately to pseudopregnant CD-1
recipient females (Charles River Laboratories, Wilmington, Mass.)
for development of embryos to term. Mice resulting from the
reimplantation events were tested for the presence of the NSE-p25
transgene by PCR analysis of genomic DNA isolated from tail
biopsies at 3 weeks of age. The mice that demonstrated positive for
the presence of the NSE-p25 transgene were mated with wild type
FVB/N mice (Charles River Laboratories, Wilmington, Mass.) of the
opposite sex. Offspring of these matings were tested for germline
transmission by PCR analysis or Southern blot analysis of genomic
DNA isolated from tail biopsies at 3 weeks of age. Transgenic lines
were produced from 7 founder transgenic mice and were maintained by
breeding to wild type FVB/N mice and PCR genotyping for the
presence of the NSE-p25 transgene.
[0063] The experiments described below were done in mice
heterozygous for the inserted transgene. These mice were derived by
breeding mice positive for the transgene insert with FVB/N
wild-type animals and screening offspring by PCR for presence of
the NSE-p25 transgene sequences.
Detection of Overexpression of p25 Protein
[0064] Western Blot
[0065] Whole brains from 1 or 4 month old transgenic (Tg) and wild
type (wt) mice were removed and snap frozen in liquid nitrogen.
Amygdala, thalamus and cortex were dissected and homogenized in 1
ml of lysis buffer (as described in 37). The samples were boiled
for 10 minutes and then centrifuged at 13,000 rpm. Protein
concentrations of the resulting supernatants were determined by the
Pierce BCA method (BCA micro protein assay, catalog #23225, Pierce,
Rockford Ill.). Ten micrograms of each sample were electrophoresed
on an SDS polyacrylamide gel (57) and transferred to ProBlott
protein paper for western blot analysis [Western blotting
protocols, ECL detection, Amersham Life Science Arlington Heights,
Ill. (1995)]. Non specific sites were blocked by incubating the
blots in 5% nonfat milk in tris-buffered saline (20 mM Tris Base,
127 mM NACl, 3.8 mM HCl pH 7.6, Sigma) included 0.1% tween-20
(TBS-T). Primary antibodies were diluted in 5% nonfat
milk.backslash.TBS-T. The blots were placed in the diluted antibody
solutions and rotated for 1 hr at 23.degree. C. The western blots
were then washed for 30 min in TBS-T. Secondary horseradish
peroxidase linked antibodies were diluted in 5% nonfat
milk.backslash.TBS-T. The blots were incubated with the secondary
antibody solution and rotated for 45 min at 23.degree. C. The blots
were then washed for 30 min in TBS-T. Equal volumes of Amersham's
ECL developing solutions A and B were mixed together. The Western
blots were incubated for 1 min in the developing solution. The
blots were wrapped in Saran.RTM. wrap and then exposed to imaging
film (Kodak Rochester N.Y. X-OMAT AR, catalog #165 1454).
[0066] Western blots of the amygdala (1), thalamus (2) and cortex
(3) from 3 mice were probed with an antibody specific for p25 and
p35/39 (gift of L.-H. Tsai, Harvard Medical School, FIG. 1A). While
detection of p35/39 is apparent, no p25 is detected in wild type
mice. When the same analysis is performed in the transgenic mice
(FIG. 1B), robust expression of p25 in addition to the constitutive
expression of p35 is detected. These results confirm that
expression of the transgene is robust in the p25 transgenic
animals.
Silver Stain & SMI 34 Immunohistochemistry
[0067] Tissues collected from scheduled sacrifice mice were
perfusion-fixed in situ with 10% neutral-buffered formalin or 4%
paraformaldehyde, whereas tissues collected from mice found dead
were immersion fixed in formalin. Following fixation, trimmed
tissues were dehydrated through graded alcohols and embedded in
paraffin. Standard cross sections of brain were identified by
analogy to figures in The Mouse Brain in Stereotaxic Coordinates
(Franklin and Paxinos, 1997). Paraffin sections (8 .mu.m thick)
were stained with modified Bielschowsky silver stain and,
immunohistochemically, with an antibody directed against
phosphorylated neurofilament (SMI 34, commercially available from
Sternberger Monoclonals, Inc Lutherville, Md.).
Immunohistochemistry
[0068] For immunohistochemical studies, transgenic and wild type
mice were deeply anesthetized with sodium pentobarbital (60 mg/kg,
i.p.) and perfused through the ascending aorta with 20 ml of 0.1M
NaPO.sub.4 containing 0.9% NaCl (PBS, 7.4) followed by 30 ml of
fixative containing 4% paraformaldehyde in 0.1M NaPO.sub.4 (PB,
7.4) buffer. The brains were removed, cryoprotected for 48 hr in
PBS containing 20% sucrose, frozen in a bed of pulverized dry ice,
and then cut into 35 micron sections on a sliding microtome.
Consecutive 1 in 18 series of sections were collected in 0.1M PB
and processed for immunohistochemistry as described below.
[0069] For immunohistochemistry, sections were incubated for 1 hr
in 50 mM Tris buffer, ph 7.4 containing 0.9% NaCl (TBS) and 0.1%
Triton X-100. The sections were then washed in TBS and incubated
for 1 hr in antibody vehicle (4% goat or horse serum, 0.1% Triton
X-100 in TBS). After additional washes in TBS, sections were
incubated overnight at 4.degree. C. in vehicle containing the
primary antibody.
[0070] Following overnight incubation in the primary antibody,
sections were washed in TBS, incubated for 1 hr in vehicle
containing biotinylated horse anti-mouse or goat anti-rabbit
antibody (as per manufacturer, Vector Labs, Burlingame, Calif.),
washed in TBS, and then incubated for 1 hr in TBS containing
ABC/horseradish peroxidase reagent (Vector Labs, Burlingame,
Calif.).
[0071] After additional washes in TBS, immunolocalization products
were visualized by developing sections for 3-5 min in 50 mM Tris
buffer (pH 7.6) containing 0.04% diaminobenzdine (DAB) and 0.003%
H.sub.2O.sub.2. Sections were subsequently washed in the Tris
buffer, mounted onto slides and dehydrated and coverslipped using
DPX (Fluka, Ronkokoma, N.Y.).
[0072] Antibodies
[0073] AT-8:
[0074] Used at 1:1,000 (200 ng/ml), mouse monoclonal which
recognizes ser 202 and thr 205 of human phosphorylated tau.
(Innogenetics, Inc. Zwij+ndrecht (Belgium))
[0075] PHF-13:
[0076] Used at 1:20,000, mouse monoclonal which recognizes ser 396
and thr 404 of human phosphorylated tau. (Gift from V. Lee,
University of Pennsylvania)
[0077] anti-TAU:
[0078] Used at 1:7,000, rabbit polyclonal which recognizes total
tau. (Accurate Chemical and Scientific Corp Westbury, N.Y.).
[0079] SMI 34:
[0080] Used at 1:1000, mouse monoclonal which recognizes
phosphorylated neurofilament.H (Sternberger Monoclonals, Inc.,
Lutherville Md.)
[0081] Brains from four month old transgenic and wild type mice
were compared for the presence of tau and neurofilament
phosphoepitopes by immunohistochemistry. AT-8 and PHF-13,
monoclonal antibodies which recognize phosphorylated Ser-202 and
Thr-205, and Ser-396,404, respectively, labeled neurons in amygdala
(FIGS. 2 and 4, respectively), thalamus/hypothalamus and cortex
adjacent to external capsule (not shown) of transgenic animals but
not in corresponding regions of wild-type animals (FIGS. 3 and 5).
In addition, staining for total tau revealed numerous cell bodies
in p25 transgenic animals (FIG. 6) while mostly axons and very few
cell bodies were labeled in wild type mice (FIG. 7). A monoclonal
antibody (SMI34) recognizing phosphorylated neurofilament H also
showed increased immunostaining in these three brain regions and
spinal cord of transgenic mice (amygdala is depicted in FIG. 8),
but not in wild type (FIG. 9). All three of these markers are known
to be increased in Alzheimer brain relative to age-matched
control.
[0082] In Alzheimer's brain, pathological changes in neurons
containing altered tau proteins have classically been identified
using silver-based staining methods. We found that, in the
transgenic mice of this invention, neurons in the same three brain
regions described above and spinal cord show positive labelling
using the modified Bielschowsky silver stain (amygdala, FIG. 10).
This staining was once again absent in wild-type control animals
(FIG. 11). We also detected increases in silver staining and
phosphorylated neurofilament H in obviously enlarged axons in the
spinal cord of transgenic mice (FIGS. 12 and 13, respectively),
while in wild type mice, axons were of the expected diameter and
neurofilament staining was normal (FIG. 14).
[0083] With regard to AT-8 immunoreactivity, most labelled neurons
in the amygdala exhibited well-defined, densely staining soma,
often with a swollen, dystrophic hillock and contorted axon (FIG.
2). Less commonly, diffuse labelling of unidentified cells was
seen, and occasionally cells having astroglial or microglial
morphology were labelled. In cortex adjacent to external capsule,
the majority of AT-8 staining was found in intensely-labelled
neuronal cell bodies, often accompanied by axons when present in
the plane of the section. Thalamic/hypothalamic staining was more
diverse, including both neuronal staining as seen in other
sections.
[0084] Histologic examination of brain and spinal cord from p25 Tg
mice revealed changes in neurons and axons of brain or spinal cord
(n=19) but not in these tissues from 10 age-matched, wild-type
controls. Axonal changes were most pronounced in the spinal cord
(cervical and thoracic) and consisted of marked dilation of
axoplasm to diameters of 20 to 50 .mu.m. Dilated axons were filled
with both silver staining and phosphorylated neurofilament H (FIGS.
12, 13). A given cross section of affected cord generally contained
between 10 and 100 overtly dilated axons distributed among all
funiculi of white matter. Luxol fast blue staining illustrated
dissolution of the internal portion of myelin sheath of affected
axoris (not shown).
OTHER PUBLICATIONS
[0085] (45) Baumann, K., E. M. Mandelkow, et al. (1993). "Abnormal
Alzheimer-like phosphorylation of tau-protein by cyclin-dependent
kinases cdk2 and cdk5." FEBS Letters 336(3): 417-24.
[0086] (32) Bazan, J. F. (1996). "Helical fold prediction for the
cyclin box." Proteins 24(1): 1-17.
[0087] (9) Biernat, J., N. Gustke, et al. (1993). "Phosphorylation
of Ser262 strongly reduces binding of tau to microtubules:
distinction between PHF-like immunoreactivity and microtubule
binding." Neuron 11 (1): 153-63.
[0088] (6) Biernat, J., E. M. Mandelkow, et al. (1992). "The switch
of tau protein to an Alzheimer-like state includes the
phosphorylation of two serine-proline motifs upstream of the
microtubule binding region." EMBO Journal 11 (4): 1593-7.
[0089] (17) Billingsley, M. L. and R. L. Kincaid (1997). "Regulated
phosphorylation and dephosphorylation of tau protein: effects on
microtubule interaction, intracellular trafficking and
neurodegeneration." Biochemical Journal 323(Pt 3): 577-91.
[0090] (7) Bramblett, G. T., M. Goedert, et al. (1993). "Abnormal
tau phosphorylation at Ser396 in Alzheimer's disease recapitulates
development and contributes to reduced microtubule binding." Neuron
10(6): 1089-99.
[0091] (31) Brown, N. R., M. E. Noble, et al. (1995) "The crystal
structure of cyclin A." Structure 3(11): 1235-47.
[0092] (36) Chae, T., Y. T. Kwon, et al. (1997). "Mice lacking p35,
a neuronal specific activator of Cdk5, display cortical lamination
defects, seizures, and adult lethality." Neuron 18(1): 29-42.
[0093] (54) Donehower, L. A., M. Harvey, et al. (1992). "Mice
deficient for p53 are developmentally normal but susceptible to
spontaneous tumours." Nature 356(6366): 215-21.
[0094] (55) Forss-Petter, S., P. E. Danielson, et al. (1990).
"Transgenic mice expressing beta-galactosidase in mature neurons
under neuron-specific enolase promoter control." Neuron 5(2):
187-97.
[0095] Franklin and Paxinos, "The Mouse Brain in Stereotaxic
Coordinates", 1997.
[0096] (11) Goedert, M., R. Jakes et al. (1996) "Assenbly of
microtubule-associated protein tau into Alzheimer-like filaments
induced by sulphated glycosaminoglycans." Nature 383:550-553.
[0097] (2) Goedert, M. (1997). "The Neurofibrillary Pathology of
Alzheimer's Disease." The Neuroscientist 3(2): 131-141.
[0098] (3) Goedert, M., R. A. Crowther, et al. (1998). "Tau
mutations cause frontotemporal dementias." Neuron 21(5):
955-958.
[0099] (5) Gustke, N., B. Steiner, et al. (1992). "The
Alzheimer-like phosphorylation of tau protein reduces microtubule
binding and involves Ser-Pro and Thr-Pro motifs." FEBS Letters
307(2): 199-205.
[0100] (44) Hasegawa, M., R. A. Crowther, et al. (1997).
"Alzheimer-like changes in microtubule-associated protein Tau
induced by sulfated glycosaminoglycans. Inhibition of microtubule
binding, stimulation of phosphorylation, and filament assembly
depend on the degree of sulfation." Journal of Biological Chemistry
272(52): 33118-24.
[0101] Hogan, B. et al. "Manipulating the Mouse Embryo: A
Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratories, New
York, 1994.
[0102] (22) Hong, M., D. C. Chen, et al. (1997). "Lithium reduces
tau phosphorylation by inhibition of glycogen synthase kinase-3."
Journal of Biological Chemistry 272(40): 25326-32.
[0103] (15) Hong, M., V. Zhukareva, et al. (1998).
"Mutation-Specific Functional Impairments in Distinct Tau Isoforms
of Hereditary FTDP-17." Science 282: 1914-1917.
[0104] (14) Hutton, M., C. L. Lendon, et al. (1998). "Association
of missense and 5'-splice-site mutations in tau with the inherited
dementia FTDP-17." Nature 393(6686): 702-5.
[0105] (16) Imahori, K. and T. Uchida (1997). "Physiology and
pathology of tau protein kinases in relation to Alzheimer's
disease." Journal of Biochemistry 121(2): 179-88.
[0106] (18) Ishiguro, K., M. Takamatsu et al. (1992). "Tau protein
kinase I converts normal tau protein into A68-like component of
paired helical filaments." Journal of Biological Chemistry
267:10897-901.
[0107] (10) Kampers, T., P. Friedhoff, et al. (1996). "RNA
stimulates aggregation of microtubule-associated protein tau into
Alzheimer-like paired helical filaments." FEBS Letters 399(3):
344-9.
[0108] (57) Laemmli, U. K. (1970). "Cleavage of structural proteins
during the assembly of the head of bacteriophage T4." Nature
227(259): 680-5.
[0109] (51) Lee, K. Y., C. C. Helbing, et al. (1997). "Neuronal
Cdc2-like kinase (Nclk) binds and phosphorylates the retinoblastoma
protein." Journal of Biological Chemistry 272(9): 5622-6.
[0110] (28) Lew, J., Q. Q. Huang, et al. (1994). "A brain-specific
activator of cyclin-dependent kinase 5." Nature 371(6496):
423-6.
[0111] (46) Lew, J., R. J. Winkfein, et al. (1992). "Brain
proline-directed protein kinase is a neurofilament kinase which
displays high sequence homology to p34cdc2." Journal of Biological
Chemistry 267(36): 25922-6.
[0112] (20) Lovestone, S., C. L. Hartley, et al. (1996).
"Phosphorylation of tau by glycogen synthase kinase-3 beta in
intact mammalian cells: the effects on the organization and
stability of microtubules." Neuroscience 73(4): 1145-57.
[0113] (8) Mandelkow, E. M., J. Biernat, et al. (1995). "Tau
domains, phosphorylation, and interactions with microtubules."
Neurobiology of Aging 16(3): 355-62; discussion 362-3.
[0114] (49) Matsubara, M., M. Kusubata, et al. (1996).
"Site-specific phosphorylation of synapsin I by mitogen-activated
protein kinase and Cdk5 and its effects on physiological
functions." Journal of Biological Chemistry 271(35): 21108-13.
[0115] (23) Michel, G., M. Mercken, et al. (1998).
"Characterization of tau phosphorylation in glycogen synthase
kinase-3beta and cyclin dependent kinase-5 activator (p23)
transfected cells." Biochimica et Biophysica Acta 1380(2):
177-82.
[0116] (40) Nikolic, M., M. M. Chou, et al. (1998). "The p35/Cdk5
kinase is a neuron-specific Rac effector that inhibits Pak1
activity." Nature 395(6698): 194-8.
[0117] (39) Nikolic, M., H. Dudek, et al. (1996). "The cdk5/p35
kinase is essential for neurite outgrowth during neuronal
differentiation." Genes & Development 10(7): 816-25.
[0118] (35) Ohshima, T., J. M. Ward, et al. (1996). "Targeted
disruption of the cyclin-dependent kinase 5 gene results in
abnormal corticogenesis, neuronal pathology and perinatal death."
Proceedings of the National Academy of Sciences of the United
States of America 93(20): 11173-8.
[0119] (41) Paglini, G., G. Pigino, et al. (1998). "Evidence for
the participation of the neuron-specific cdk5 activator p35 during
laminin-enhanced axonal growth." Journal of Neurscience
18:9858-69.
[0120] (48) Pant, A. C., Veeranna, et al. (1997). "Phosphorylation
of human high molecular weight neurofilament protein (hNF-H) by
neuronal cyclin-dependent kinase 5 (cdk5)." Brain Research 765(2):
259-66.
[0121] (34) Patrick, G. N., P. Zhou, et al. (1998). "p35, the
neuronal-specific activator of cyclin-dependent kinase 5 (Cdk5) is
degraded by the ubiquitin-proteasome pathway." Journal of
Biological Chemistry 273(37): 24057-64.
[0122] (43) Paudel, H. K. (1997). "Phosphorylation by neuronal
cdc2-like protein kinase promotes dimerization of Tau protein in
vitro." Journal of Biological Chemistry 272(45): 28328-34.
[0123] (42) Paudel, H. K., J. Lew, et al. (1993). "Brain
proline-directed protein kinase phosphorylates tau on sites that
are abnormally phosphorylated in tau associated with Alzheimer's
paired helical filaments." Journal of Biological Chemistry 268(31):
23512-8.
[0124] (53) Pei, J. J., I. Grundke-Iqbal, et al. (1998).
"Accumulation of cyclin-dependent kinase 5 (cdk5) in neurons with
early stages of Alzheimer's disease neurofibrillary degeneration."
Brain Research 797(2): 267-77.
[0125] (12) Poorkaj, P., T. D. Bird, et al. (1998). "Tau is a
candidate gene for chromosome 17 frontotemporal dementia." Annals
of Neurology 43(6): 815-25.
[0126] (29) Qi, Z., Q. Q. Huang, et al. (1995). "Reconstitution of
neuronal Cdc2-like kinase from bacteria-expressed Cdk5 and an
active fragment of the brain-specific activator. Kinase activation
in the absence of Cdk5 phosphorylation." Journal of Biological
Chemistry 270(18): 10847-54.
[0127] Remington's Pharmaceutical Sciences, Mack Publishing
Company, Easton, Pa., 16th ed., 1982
[0128] Sambrook, J., E. F. Fritsch et al. "Molecular Cloning: A
Laboratory Manual". 2nd ed., Cold Spring Harbor Press, New York,
1989
[0129] (1) Selkoe, D. (1998) "The cell biology of beta-amyloid
precursor protein and presenilin in Alzheimer's disease." Trends in
Cell Biology 8: 447-53.
[0130] (50) Shuang, R., L. Zhang, et al. (1998). "Regulation of
Munc-18/syntaxin 1A interaction by cyclin-dependent kinase 5 in
nerve endings." Journal of Biological Chemistry 273(9):
4957-66.
[0131] (19) Sperber, B. R., S. Leight, et al. (1995). "Glycogen
synthase kinase-3 beta phosphorylates tau protein at multiple sites
in intact cells." Neuroscience Letters 197(2): 149-53.
[0132] (4) Spillantini, M. G. and M. Goedert (1998). "Tau protein
pathology in neurodegenerative diseases." Trends in Neurosciences
21(10): 428-433.
[0133] (13) Spillantini, M. G., J. R. Murrell, et al. (1998).
"Mutation in the tau gene in familial multiple system tauopathy
with presenile dementia." Proceedings of the National Academy of
Sciences of the United States of America 95(13): 7737-41.
[0134] (47) Sun, D., C. L. Leung, et al. (1996). "Phosphorylation
of the high molecular weight neurofilament protein (NF-H) by Cdk5
and p35." Journal of Biological Chemistry 271(24): 14245-51.
[0135] (33) Tang, D., A. C. S. Chun, et al. (1997).
"Cyclin-dependent kinase 5 (Cdk5) activation domain of neuronal
Cdk5 activator. Evidence of the existence of cyclin fold in
neuronal Cdk5a activator." Journal of Biological Chemistry 272(19):
12318-27.
[0136] (25) Tang, D., K. Y. Lee, et al. (1996). "Neuronal Cdc2-like
kinase: from cell cycle to neuronal function." Biochemistry &
Cell Biology 74(4): 419-29.
[0137] (26) Tang, D. and J. H. Wang (1996). "Cyclin-dependent
kinase 5 (Cdk5) and neuron-specific Cdk5 activators." Progress in
Cell Cycle Research 2: 205-16.
[0138] (30) Tang, D., J. Yeung, et al. (1995). "An isoform of the
neuronal cyclin-dependent kinase 5 (Cdk5) activator." Journal of
Biological Chemistry 270(45): 26897-903.
[0139] (38) Tomizawa, K., H. Matsui, et al. (1996). "Localization
and developmental changes in the neuron-specific cyclin-dependent
kinase 5 activator (p35nck5a) in the rat brain." Neuroscience
74(2): 519-29.
[0140] (27) Tsai, L. H., I. Delalle, et al. (1994). "p35 is a
neural-specific regulatory subunit of cyclin-dependent kinase 5."
Nature 371(6496): 419-23.
[0141] (37) Tsai, L. H., T. Takahashi, et al. (1993). "Activity and
expression pattern of cyclin-dependent kinase 5 in the embryonic
mouse nervous system." Development 119(4): 1029-40.
[0142] (56) Wagner, T. E., P. C. Hoppe, et al. (1981).
"Microinjection of a rabbit beta-globin gene into zygotes and its
subsequent expression in adult mice and their offspring."
Proceedings of the National Academy of Sciences of the United
States of America 78(10): 6376-80.
[0143] (24) Wagner, U., J. Brownlees, et al. (1997).
"Overexpression of the mouse dishevelled-1 protein inhibits
GSK-3beta-mediated phosphorylation of tau in transfected mammalian
cells." FEBS Letters 411(2-3): 369-72.
[0144] (21) Wagner, U., M. Utton, et al. (1996). "Cellular
phosphorylation of tau by GSK-3 beta influences tau binding to
microtubules and microtubule organisation." Journal of Cell Science
109(Pt 6): 1537-43.
[0145] (52) Yamaguchi, H., K. Ishiguro, et al. (1996).
"Preferential labeling of Alzheimer neurofibrillary tangles with
antisera for tau protein kinase (TPK) I/glycogen synthase kinase-3
beta and cyclin-dependent kinase 5, a component of TPK II." Acta
Neuropathologica 92(3): 232-41.
Sequence CWU 1
1
7 1 1867 DNA Rattus rattus 1 ggatccccaa ttcgagctcc tcctctgctc
gcccaatcct tccaaccccc tatggtggta 60 tggctgacac agaaaatgtc
tgctcctgta tgggacattt gcccctcttc tccaaatata 120 agacaggatg
aggcctagct tttgctgctc caaagtttta aaagaacaca ttgcacggca 180
tttagggact ctaaagggtg gaggaggaat gagggaattg catcatgcca aggctggtcc
240 tcatccatca ctgcttccag ggcccagagt ggcttccagg aggtattctt
acaaaggaag 300 cccgatctgt agctaacact cagagcccat tttcctgcgt
taacccctcc cgacctcata 360 tacaggagta acatgatcag tgacctgggg
gagctggcca aactgcggga cctgcccaag 420 ctgagggcct tggtgctgct
ggacaacccc tgtgccgatg agactgacta ccgccaggag 480 gccctggtgc
agatggcaca cctagagcgc ctagacaaag agtactatga ggacgaggac 540
cgggcagaag ctgaggagat ccgacagagg ctgaaggagg aacaggagca agaactcgac
600 ccggaccaag acatggaacc gtacctcccg ccaacttagt ggctcctcta
gcctgcaggg 660 acagtaaagg tgatggcagg aaggcagccc ccggaggtca
aaggctgggc acgcgggagg 720 agaggccaga gtcagaggct gcgggtatct
cagatatgaa ggaaagatga gagaggctca 780 ggaagaggta agaaaagaca
caagagacca gagaagggag aagaattaga gagggaggca 840 gaggaccgct
gtctctacag acatagctgg tagagactgg gaggaaggga tgaaccctga 900
gcgcatgaag ggaaggaggt ggctggtggt atatggagga tgtagctggg ccagggaaaa
960 gatcctgcac taaaaatctg aagctaaaaa taacaggaca cggggtggag
aggcgaaagg 1020 agggcagatt gaggcagaga gactgagagg cctggggatg
tgggcattcc ggtagggcac 1080 acagttcact tgtcttctct ttttccagga
ggccaaagat gctgacctca agaactcata 1140 ataccccagt ggggaccacc
gcattcatag ccctgttaca agaagtggga gatgttcctt 1200 tttgtcccag
actggaaatc cattacatcc cgaggctcag gttctgtggt ggtcatctct 1260
gtgtggcttg ttctgtgggc ctacctaaag tcctaagcac agctctcaag cagatccgag
1320 gcgactaaga tgctagtagg ggttgtctgg agagaagagc cgaggaggtg
ggctgtgatg 1380 gatcagttca gctttcaaat aaaaaggcgt ttttatattc
tgtgtcgagt tcgtgaaccc 1440 ctgtggtggg cttctccatc tgtctgggtt
agtacctgcc actatactgg aataagggga 1500 cgcctgcttc cctcgagttg
gctggacaag gttatgagca tccgtgtact tatggggttg 1560 ccagcttggt
cctggatcgc ccgggccctt cccccacccg ttcggttccc caccaccacc 1620
cgcgctcgta cgtgcgtctc cgcctgcagc tcttgactca tcggggcccc cgggtcacat
1680 gcgctcgctc ggctctatag gcgccgcccc ctgcccaccc cccgcccgcg
ctgggagccg 1740 cagccgccgc cactcctgct ctctctgcgc cgccgccgtc
accaccgcca ccgccaccgg 1800 ctgagtctgc agtcctcgac ctgcaggcat
gcaagctggg taccgagctc gaattggtcg 1860 cggccgc 1867 2 650 DNA Homo
sapiens 2 gcggccgcat ggcccagccc ccaccggccc agccgcctgc acccccggcc
agccagctct 60 cgggttccca gaccgggggc tcctcctcag tcaagaaagc
ccctcaccct gccgtcacct 120 ccgcagggac gcccaaacgg gtcatcgtcc
aggcgtccac cagtgagctg cttcgctgcc 180 tgggtgagtt tctctgccgc
cggtgctacc gcctgaagca cctgtccccc acggaccccg 240 tgctctggct
gcgcagcgtg gaccgctcgc tgcttctgca gggctggcag gaccagggct 300
tcatcacgcc ggccaacgtg gtcttcctct acatgctctg cagggatgtt atctcctccg
360 aggtgggctc ggatcacgag ctccaggccg tcctgctgac atgcctgtac
ctctcctact 420 cctacatggg caacgagatc tcctacccgc tcaagccctt
cctggtggag agctgcaagg 480 aggccttttg ggaccgttgc ctctctgtca
tcaacctcat gagctcaaag atgctgcaga 540 taaatgccga cccacactac
ttcacacagg tcttctccga cctgaagaac gagagcggcc 600 aggaggacaa
gaagcggctc ctcctaggcc tggatcggtg aggcggccgc 650 3 717 DNA Rous
sarcoma virus 3 gcggccgcga ctctagagga tctttgtgaa ggaaccttac
ttctgtggtg tgacataatt 60 ggacaaacta cctacagaga tttaaagctc
taaggtaaat ataaaatttt taagtgtata 120 atgtgttaaa ctactgattc
taattgtttg tgtattttag attccaacct atggaactga 180 tgaatgggag
cagtggtgga atgcctttaa tgaggaaaac ctgttttgct cagaagaaat 240
gccatctagt gatgatgagg ctactgctga ctctcaacat tctactcctc caaaaaagaa
300 gagaaaggta gaagacccca aggactttcc ttcagaattg ctaagttttt
tgagtcatgc 360 tgtgtttagt aatagaactc ttgcttgctt tgctatttac
accacaaagg aaaaagctgc 420 actgctatac aagaaaatta tggaaaaata
tttgatgtat agtgccttga ctagagatca 480 taatcagcca taccacattt
gtagaggttt tacttgcttt aaaaaacctc ccacacctcc 540 ccctgaacct
gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 600
ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac
660 tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggatcc
717 4 3218 DNA Multi organism source 4 ggatccccaa ttcgagctcc
tcctctgctc gcccaatcct tccaaccccc tatggtggta 60 tggctgacac
agaaaatgtc tgctcctgta tgggacattt gcccctcttc tccaaatata 120
agacaggatg aggcctagct tttgctgctc caaagtttta aaagaacaca ttgcacggca
180 tttagggact ctaaagggtg gaggaggaat gagggaattg catcatgcca
aggctggtcc 240 tcatccatca ctgcttccag ggcccagagt ggcttccagg
aggtattctt acaaaggaag 300 cccgatctgt agctaacact cagagcccat
tttcctgcgt taacccctcc cgacctcata 360 tacaggagta acatgatcag
tgacctgggg gagctggcca aactgcggga cctgcccaag 420 ctgagggcct
tggtgctgct ggacaacccc tgtgccgatg agactgacta ccgccaggag 480
gccctggtgc agatggcaca cctagagcgc ctagacaaag agtactatga ggacgaggac
540 cgggcagaag ctgaggagat ccgacagagg ctgaaggagg aacaggagca
agaactcgac 600 ccggaccaag acatggaacc gtacctcccg ccaacttagt
ggctcctcta gcctgcaggg 660 acagtaaagg tgatggcagg aaggcagccc
ccggaggtca aaggctgggc acgcgggagg 720 agaggccaga gtcagaggct
gcgggtatct cagatatgaa ggaaagatga gagaggctca 780 ggaagaggta
agaaaagaca caagagacca gagaagggag aagaattaga gagggaggca 840
gaggaccgct gtctctacag acatagctgg tagagactgg gaggaaggga tgaaccctga
900 gcgcatgaag ggaaggaggt ggctggtggt atatggagga tgtagctggg
ccagggaaaa 960 gatcctgcac taaaaatctg aagctaaaaa taacaggaca
cggggtggag aggcgaaagg 1020 agggcagatt gaggcagaga gactgagagg
cctggggatg tgggcattcc ggtagggcac 1080 acagttcact tgtcttctct
ttttccagga ggccaaagat gctgacctca agaactcata 1140 ataccccagt
ggggaccacc gcattcatag ccctgttaca agaagtggga gatgttcctt 1200
tttgtcccag actggaaatc cattacatcc cgaggctcag gttctgtggt ggtcatctct
1260 gtgtggcttg ttctgtgggc ctacctaaag tcctaagcac agctctcaag
cagatccgag 1320 gcgactaaga tgctagtagg ggttgtctgg agagaagagc
cgaggaggtg ggctgtgatg 1380 gatcagttca gctttcaaat aaaaaggcgt
ttttatattc tgtgtcgagt tcgtgaaccc 1440 ctgtggtggg cttctccatc
tgtctgggtt agtacctgcc actatactgg aataagggga 1500 cgcctgcttc
cctcgagttg gctggacaag gttatgagca tccgtgtact tatggggttg 1560
ccagcttggt cctggatcgc ccgggccctt cccccacccg ttcggttccc caccaccacc
1620 cgcgctcgta cgtgcgtctc cgcctgcagc tcttgactca tcggggcccc
cgggtcacat 1680 gcgctcgctc ggctctatag gcgccgcccc ctgcccaccc
cccgcccgcg ctgggagccg 1740 cagccgccgc cactcctgct ctctctgcgc
cgccgccgtc accaccgcca ccgccaccgg 1800 ctgagtctgc agtcctcgac
ctgcaggcat gcaagctggg taccgagctc gaattggtcg 1860 cggccgcatg
gcccagcccc caccggccca gccgcctgca cccccggcca gccagctctc 1920
gggttcccag accgggggct cctcctcagt caagaaagcc cctcaccctg ccgtcacctc
1980 cgcagggacg cccaaacggg tcatcgtcca ggcgtccacc agtgagctgc
ttcgctgcct 2040 gggtgagttt ctctgccgcc ggtgctaccg cctgaagcac
ctgtccccca cggaccccgt 2100 gctctggctg cgcagcgtgg accgctcgct
gcttctgcag ggctggcagg accagggctt 2160 catcacgccg gccaacgtgg
tcttcctcta catgctctgc agggatgtta tctcctccga 2220 ggtgggctcg
gatcacgagc tccaggccgt cctgctgaca tgcctgtacc tctcctactc 2280
ctacatgggc aacgagatct cctacccgct caagcccttc ctggtggaga gctgcaagga
2340 ggccttttgg gaccgttgcc tctctgtcat caacctcatg agctcaaaga
tgctgcagat 2400 aaatgccgac ccacactact tcacacaggt cttctccgac
ctgaagaacg agagcggcca 2460 ggaggacaag aagcggctcc tcctaggcct
ggatcggtga ggcggccgcg actctagagg 2520 atctttgtga aggaacctta
cttctgtggt gtgacataat tggacaaact acctacagag 2580 atttaaagct
ctaaggtaaa tataaaattt ttaagtgtat aatgtgttaa actactgatt 2640
ctaattgttt gtgtatttta gattccaacc tatggaactg atgaatggga gcagtggtgg
2700 aatgccttta atgaggaaaa cctgttttgc tcagaagaaa tgccatctag
tgatgatgag 2760 gctactgctg actctcaaca ttctactcct ccaaaaaaga
agagaaaggt agaagacccc 2820 aaggactttc cttcagaatt gctaagtttt
ttgagtcatg ctgtgtttag taatagaact 2880 cttgcttgct ttgctattta
caccacaaag gaaaaagctg cactgctata caagaaaatt 2940 atggaaaaat
atttgatgta tagtgccttg actagagatc ataatcagcc ataccacatt 3000
tgtagaggtt ttacttgctt taaaaaacct cccacacctc cccctgaacc tgaaacataa
3060 aatgaatgca attgttgttg ttaacttgtt tattgcagct tataatggtt
acaaataaag 3120 caatagcatc acaaatttca caaataaagc atttttttca
ctgcattcta gttgtggttt 3180 gtccaaactc atcaatgtat cttatcatgt
ctggatcc 3218 5 2462 DNA Escherichia coli 5 gaactcgagc agctgaagct
tgcatgcctg caggtcgact ctagaggatc cccgggtacc 60 gagctcgaat
tcatcgatga tatcagatct gccggtctcc ctatagtgag tcgtattaat 120
ttcgataagc caggttaacc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt
180 gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg
tcgttcggct 240 gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg
ttatccacag aatcagggga 300 taacgcagga aagaacatgt gagcaaaagg
ccagcaaaag gccaggaacc gtaaaaaggc 360 cgcgttgctg gcgtttttcc
ataggctccg cccccctgac gagcatcaca aaaatcgacg 420 ctcaagtcag
aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 480
aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt
540 tctcccttcg ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc
tcagttcggt 600 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc
cccgttcagc ccgaccgctg 660 cgccttatcc ggtaactatc gtcttgagtc
caacccggta agacacgact tatcgccact 720 ggcagcagcc actggtaaca
ggattagcag agcgaggtat gtaggcggtg ctacagagtt 780 cttgaagtgg
tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct 840
gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac
900 cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa
aaaaaggatc 960 tcaagaagat cctttgatct tttctacggg gtctgacgct
cagtggaacg aaaactcacg 1020 ttaagggatt ttggtcatga gattatcaaa
aaggatcttc acctagatcc ttttaaatta 1080 aaaatgaagt tttaaatcaa
tctaaagtat atatgagtaa acttggtctg acagttacca 1140 atgcttaatc
agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 1200
ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc
1260 tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa
taaaccagcc 1320 agccggaagg gccgagcgca gaagtggtcc tgcaacttta
tccgcctcca tccagtctat 1380 taattgttgc cgggaagcta gagtaagtag
ttcgccagtt aatagtttgc gcaacgttgt 1440 tgccattgct acaggcatcg
tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 1500 cggttcccaa
cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag 1560
ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt
1620 tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct
tttctgtgac 1680 tggtgagtac tcaaccaagt cattctgaga atagtgtatg
cggcgaccga gttgctcttg 1740 cccggcgtca atacgggata ataccgcgcc
acatagcaga actttaaaag tgctcatcat 1800 tggaaaacgt tcttcggggc
gaaaactctc aaggatctta ccgctgttga gatccagttc 1860 gatgtaaccc
actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 1920
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa
1980 atgttgaata ctcatactct tcctttttca atattattga agcatttatc
agggttattg 2040 tctcatgagc ggatacatat ttgaatgtat ttagaaaaat
aaacaaatag gggttccgcg 2100 cacatttccc cgaaaagtgc cacctgacgt
ctaagaaacc attattatca tgacattaac 2160 ctataaaaat aggcgtatca
cgaggccctt tcgtctcgcg cgtttcggtg atgacggtga 2220 aaacctctga
cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg 2280
gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gctggcttaa
2340 ctatgcggca tcagagcaga ttgtactgag agtgcaccat atggacatat
tgtcgttaga 2400 acgcggctac aattaataca taaccttatg tatcatacac
atacgattta ggtgacacta 2460 ta 2462 6 41 DNA Homo sapiens 6
gcggccgcat ggcccagccc ccaccggccc agccgcctgc a 41 7 34 DNA Homo
sapiens 7 ctcctcctag gcctggaatc ggtgaggcgg ccgc 34
* * * * *