U.S. patent application number 10/200242 was filed with the patent office on 2003-07-31 for cd40-ligand lacking native-pattern glycosylation.
Invention is credited to Armitage, Richard J., Fanslow, William C. III, Spriggs, Melanie K..
Application Number | 20030144182 10/200242 |
Document ID | / |
Family ID | 30769523 |
Filed Date | 2003-07-31 |
United States Patent
Application |
20030144182 |
Kind Code |
A1 |
Armitage, Richard J. ; et
al. |
July 31, 2003 |
CD40-Ligand lacking native-pattern glycosylation
Abstract
There is disclosed a polypeptide (CD40-L) and DNA sequences,
vectors and transformed host cells useful in providing CD40-L
polypeptides. More particularly, this invention provides isolated
human and murine CD40-L polypeptides that bind to the extracellular
binding region of a CD40 receptor and lack native-pattern
glycosylation.
Inventors: |
Armitage, Richard J.;
(Bainbridge Island, WA) ; Fanslow, William C. III;
(Normandy Park, WA) ; Spriggs, Melanie K.;
(Seattle, WA) |
Correspondence
Address: |
IMMUNEX CORPORATION
LAW DEPARTMENT
51 UNIVERSITY STREET
SEATTLE
WA
98101
|
Family ID: |
30769523 |
Appl. No.: |
10/200242 |
Filed: |
July 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10200242 |
Jul 19, 2002 |
|
|
|
09392618 |
Sep 9, 1999 |
|
|
|
09392618 |
Sep 9, 1999 |
|
|
|
08249189 |
May 24, 1994 |
|
|
|
5961974 |
|
|
|
|
08249189 |
May 24, 1994 |
|
|
|
07969703 |
Oct 23, 1992 |
|
|
|
07969703 |
Oct 23, 1992 |
|
|
|
07805723 |
Dec 5, 1991 |
|
|
|
07805723 |
Dec 5, 1991 |
|
|
|
07783707 |
Oct 25, 1991 |
|
|
|
Current U.S.
Class: |
530/350 ;
435/320.1; 435/325; 435/69.1; 514/20.9; 536/23.5 |
Current CPC
Class: |
C07K 2319/75 20130101;
C07K 2319/30 20130101; C07K 2319/02 20130101; C07K 2319/32
20130101; C12N 15/62 20130101; C07K 2319/03 20130101; A61K 38/00
20130101; C07K 16/2875 20130101; C07K 14/70575 20130101; C07K
2319/73 20130101; C07K 2319/00 20130101; C07K 2319/74 20130101 |
Class at
Publication: |
514/8 ; 530/350;
536/23.5; 435/69.1; 435/320.1; 435/325 |
International
Class: |
A61K 038/17; C07K
014/705; C12P 021/02; C12N 005/06; C07H 021/04 |
Claims
What is claimed is:
1. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40L polypeptide, wherein said nucleic
acid hybridizes to a polynucleotide selected from the group
consisting of (a)-(f), or its complement, under moderately
stringent conditions (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polynucleotide comprising
nucleotides 46 through 828 of SEQ ID NO:11; (b) a polynucleotide
comprising nucleotides 184 through 828 of SEQ ID NO:11; (c) a
polynucleotide comprising nucleotides 196 through 828 of SEQ ID
NO:11; (d) a polynucleotide comprising nucleotides 403 through 828
of SEQ ID NO:11; (e) a polynucleotide comprising nucleotides 382
through 828 of SEQ ID NO:11; and (f) a polynucleotide comprising
nucleotides 379 through 828 of SEQ ID NO:11, with the proviso that
the CD40-L lacks native-pattern glycosylation.
2. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40L polypeptide, wherein said nucleic
acid hybridizes to a polynucleotide selected from the group
consisting of (a)-(f), or its complement, under moderately
stringent conditions (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polynucleotide comprising
nucleotides 46 through 828 of SEQ ID NO:11; (b) a polynucleotide
comprising nucleotides 184 through 828 of SEQ ID NO:11; (c) a
polynucleotide comprising nucleotides 196 through 828 of SEQ ID
NO:11; (d) a polynucleotidecomprising nucleotides 403 through 828
of SEQ ID NO:11; (e) a polynucleotide comprising nucleotides 382
through 828 of SEQ ID NO:11; and (f) a polynucleotide comprising
nucleotides 379 through 828 of SEQ ID NO:11, with the provisos that
the nucleotides encoding cysteine at nucleotides 625 to 627 of SEQ
ID NO: 11 are substituted with DNA encoding tryptophan and that the
CD40-L lacks native-pattern glycosylation.
3. The isolated polypeptide of claim 1, further comprising a
nucleic acid molecule that encodes a leucine zipper as set forth in
SEQ ID NO:17.
4. The isolated polypeptide of claim 2, further comprising a
nucleic acid molecule that encodes a leucine zipper as set forth in
SEQ ID NO:17.
5. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid that encodes the CD40-L polypeptide, comprising
nucleotides 379 through 828 of SEQ ID NO:11 wherein the DNA
encoding cysteine at nucleotides 625 to 627 of SEQ ID NO:11 is
substituted with DNA encoding tryptophan, and further comprising a
DNA molecule encoding a leucine zipper as set forth in SEQ ID
NO:17, with the proviso that the CD40-L lacks native-pattern
glycosylation.
6. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(f), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 1 through 261 of SEQ ID NO:12; (b) a polypeptide comprising
amino acids 47 through 261 of SEQ ID NO:12; (c) a polypeptide
comprising amino acids 51 through 261 of SEQ ID NO:12; (d) a
polypeptide comprising amino acids 120 through 261 of SEQ ID NO:12;
(e) a polypeptide comprising amino acids 113 through 261 of SEQ ID
NO:12; and (f) a polypeptide comprising amino acids 112 through 261
of SEQ ID NO:12, with the proviso that the CD40-L lacks
native-pattern glycosylation.
7. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 1 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 1 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
8. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 47 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 47 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
9. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 51 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 51 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
10. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 120 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 120 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
11. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 113 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 113 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
12. An isolated CD40-L polypeptide that binds CD40, comprising a
nucleic acid encoding the CD40-L polypeptide, wherein the nucleic
acid hybridizes to the complement of a nucleic acid that encodes a
CD40L polypeptide selected from the group consisting of
polypeptides (a)-(b), and wherein the hybridization conditions are
moderately stringent (prewashing solution of 5.times.SSC, 0.5% SDS,
1.0 mM EDTA, (pH 8.0) and hybridization conditions of 50.degree.
C., 5.times.SSC, overnight): (a) a polypeptide comprising amino
acids 112 through 261 of SEQ ID NO:12; and (b) a polypeptide
comprising amino acids 112 through 261 of SEQ ID NO:12, with the
provisos that the cysteine at amino acid 194 is substituted with
tyrptophan and that the CD40-L polypeptide lacks native-pattern
glycosylation.
13. The isolated polynucleotide according to claim 6, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
14. The isolated polynucleotide according to claim 7, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
15. The isolated polynucleotide according to claim 8, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
16. The isolated polynucleotide according to claim 9, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
17. The isolated polynucleotide according to claim 10, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
18. The isolated polynucleotide according to claim 11, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
19. The isolated polynucleotide according to claim 12, further
comprising a nucleic acid molecule encoding a leucine zipper as set
forth in SEQ ID NO:17.
20. The isolated polynucleotide according to claim 13, wherein the
leucine zipper of SEQ ID NO:17 has a mutation selected from the
group consisting of substitution of Asn for lie at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for Ile amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for lie at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
21. The isolated polynucleotide according to claim 14, wherein the
leucine zipper of SEQ ID NO:17 has a mutation selected from the
group consisting of substitution of Asn for lie at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for Ile amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for lie at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
22. The isolated polynucleotide according to claim 15, wherein the
leucine zipper of SEQ ID NO:17 has a mutation selected from the
group consisting of substitution of Asn for Ile at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for le amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for Ile at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
23. The isolated polynucleotide according to claim 16, wherein the
leucine zipper of SEQ ID NO:17 has a mutation selected from the
group consisting of substitution of Asn for Ile at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for le amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for Ile at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
24. The isolated polynucleotide according to claim 17, wherein the
leucine zipper of SEQ ID NO: 17 has a mutation selected from the
group consisting of substitution of Asn for Ile at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for Ile amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for Ile at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
25. The isolated polynucleotide according to claim 18, wherein the
leucine zipper of SEQ ID NO: 17 has a mutation selected from the
group consisting of substitution of Asn for Ile at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for Ile amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for Ile at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for lie at amino acid 12.
26. The isolated polynucleotide according to claim 19, wherein the
leucine zipper of SEQ ID NO:17 has a mutation selected from the
group consisting of substitution of Asn for Ile at amino acid 12,
substitution of Pro for Leu at amino acid 13, substitution of Met
for Ile amino acid 5, substitution of Thr for Ile at amino acid 16,
substitution of Asn for Ile at amino acid 16, substitution of Asn
for Ile at amino acid 9, substitution of Arg for Lys at amino acid
27, and substitution of Val for Ile at amino acid 12.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part application of
U.S. patent application Ser. No. 09/392,618, filed Sep. 9, 1999,
which is a continuation-in-part application of U.S. patent
application Ser. No. 08/249,189, filed May 24, 1994, allowed as
U.S. Pat. No. 5,961,974, which is a continuation-in-part of U.S.
patent application Ser. No. 07/969,703, filed Oct. 23, 1992, now
abandoned, which is a continuation-in-part of U.S. patent
application Ser. No. 07/805,723, filed on Dec. 5, 1991, now
abandoned, which is a continuation-in-part of U.S. patent
application Ser. No. 07/783,707, filed on Oct. 25, 1991, now
abandoned.
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates to CD40-Ligand (CD40-L). More
specifically, the present invention relates to CD40-L molecules
lacking native-pattern glycosylation.
BACKGROUND OF THE INVENTION
[0003] Cytokines that have an "Interleukin" designation are those
protein factors that influence immune effector cells. Cytokines
designated interleukin-1 through interleukin-12 have been reported
and named as an interleukin. Other known cytokines include tumor
necrosis factor (TNF), granulocyte-macrophage colony stimulating
factor (GM-CSF), granulocyte colony stimulating factor (G-CSF),
mast cell growth factor (MGF), epidermal growth factor (EGF),
platelet-derived growth factor (PDGF), nerve growth factor (NGF),
erythropoietin (EPO), .gamma.-interferon (.gamma.-IFN) and
others.
[0004] DNAs for two different TNF receptors (Type I and Type II)
have been cloned (Smith et al., Science 248:1019, 1990; and Schall
et al., Cell 61:361, 1990). Both forms of TNF receptor are related
to each other and belong to a family of receptors whose members
include nerve growth factor receptor (Johnson et al., Cell 47:545,
1986), B cell antigen CD40 (Stamenkovic et al., EMBO J. 8:1403,
1989), T cell antigen OX40 (Mallett et al., EMBO J. 9:1063, 1990),
human Fas antigen (Itoh et al., Cell 66:233, 1991) and murine 4-1BB
receptor (Kwon et al., Cell. Immunol. 121:414, 1989 [Kwon et al. I]
and Kwon et al., Proc. Natl. Acad. Sci. USA 86:1963, 1989 [Kwon et
al. II]).
[0005] Human CD40 protein (CD40) is a peptide of 277 amino acids
having a molecular weight of 30,600, and a 19 amino acid secretory
signal peptide comprising predominantly hydrophobic amino acids
(Stamenkovic et al.). The molecular weight (exclusive of
glycosylation) of the mature human CD40 protein is 28,300. A cDNA
encoding human CD40 was isolated from a cDNA library prepared from
Burkitt lymphoma cell line Raji. The putative protein encoded by
the CD40 cDNA contains a putative leader sequence, trans-membrane
domain and a number of other features common to membrane-bound
receptor proteins. CD40 has been found to be expressed on B
lymphocytes, epithelial cells and some carcinoma cell lines.
[0006] A monoclonal antibody (mAb) directed against CD40 has been
shown to mediate various functional effects of human B cells. These
effects include: (a) homotypic adhesions (Gordon et al., J.
Immunol. 140:1425, 1988 [Gordon et al. I]); (b) increased cell size
(Gordon et al. I and Valle et al., Eur. J. Immunol. 19:1463, 1989);
(c) proliferation of B cells activated with anti-IgM, anti-CD20
mAb, phorbol ester alone (Clark et al., Proc. Natl. Acad. Sci. USA
83:4494, 1986; and Paulie et al., J. Immunol. 142:590, 1989), or
phorbol ester combined with interleukin-4 (Gordon et al., Eur. J.
Immunol. 17:1535, 1987 [Gordon et al. II]; and (d) production of
IgE (Jabara et al., J. Exp. Med. 172:1861, 1990; Zhang et al., J.
Immunol. 146:1836, 1991) and IgM (Gascan et al., J. Immunol. 147:8,
1991) from interleukin-4 (IL-4) stimulated T-depleted cultures.
[0007] One such antibody, called mAb 89 by Banchereau et al., Clin.
Immunol. Spectrum 3:8, 1991 [Banchereau et al. I], was found to
induce human B cell proliferation at a relatively low antibody
concentration (30 ng/ml or about 10.sup.-10 M). Proliferation
lasted two to three weeks and resulted. in a ten-fold expansion of
the human B cell population. Optimal stimulation of the B cells
occurred when CD40 surface molecule was cross-linked by IgM. Fab
fragments of another anti-CD40 mAb induced only a weak
proliferative response. Further, Banchereau et al., Science 251:70,
1991 [Banchereau et al. II] reported that resting human B cells
entered a state of sustained proliferation when incubated with both
a murine fibroblastic Ltk.sup.- cell line that was transfected with
human Fc receptor and with a monoclonal antibody specific for human
CD40. Banchereau et al. II found that cross-linking CD40 is
necessary for clonal expansion of B cells.
[0008] CD23 is a low affinity IgE receptor that has been found to
be expressed on most IgM.sup.-/IgD.sup.- mature B cells, but not T
cells. CD23 has been sequenced and its sequence was described in
Kikutani et al., Cell 47:657, 1986. Soluble CD23 (sCD23) was found
to induce a pyrogenic reaction in rabbits and this reaction was
abrogated by administration of human IgE (Ghaderi et al.,
Immunology 73:510, 1991). Therefore, CD23 may be an appropriate
marker for soluble CD40 or CD40-L effects.
[0009] Prior to the present invention, a ligand for CD40 was
unknown. Accordingly, there is a need in the art to identify and
characterize a CD40 ligand (CD40-L).
SUMMARY OF THE INVENTION
[0010] A novel cytokine, hereafter referred to as "CD40-L," has
been isolated and characterized. The nucleotide sequence and
deduced amino acid sequence of representative murine CD40-L cDNA is
disclosed in SEQ ID NO:1 and FIGS. 1A and B, and the amino acid
sequence is also listed in SEQ ID NO:2. The nucleotide sequence and
deduced amino acid sequence of representative human CD40-L cDNA is
disclosed in SEQ ID NO:11 and FIGS. 2A and B, and the amino acid
sequence is also listed in SEQ ID NO:12. The present invention
further comprises other CD40-L polypeptides encoded by nucleotide
sequences that hybridize, under moderate or severe stringency
conditions, to probes defined by SEQ ID NO:11 (the coding region of
human CD40-L), fragments of the sequence extending from nucleotide
46 to nucleotide 828 of SEQ ID NO:11, or to DNA or RNA sequences
complementary to FIGS. 2A and B (SEQ ID NO:11) or fragments
thereof. The invention further comprises nucleic acid sequences
which, due to the degeneracy of the genetic code, encode
polypeptides substantially identical or substantially similar to
polypeptides encoded by the nucleic acid sequences described above,
and sequences complementary to them.
[0011] CD40-L is a type II membrane polypeptide having an
extracellular region at its C-terminus, a transmembrane region and
an intracellular region at its N-terminus. A soluble version of
murine CD40-L has been found in supernatants from EL-4 cells and
EL-4 cells sorted on the basis of a biotinylated CD40/Fc fusion
protein described herein. Soluble CD40-L comprises an extracellular
region of CD40-L or a fragment thereof. The protein sequence of
murine CD40-L is described in FIGS. 1A and B and SEQ ID NO:2, and
human CD40-L in FIGS. 2A and B and SEQ ID NO:12. The extracellular
region of murine CD40-L extends from amino acid 47 to amino acid
260 in FIGS. 1A and B and SEQ ID NO:2, and of human CD40-L from
amino acid 47 to amino acid 261 in FIGS. 2A and B and SEQ ID NO:12.
CD40-L biological activity is mediated by binding of this cytokine
with CD40 and includes B cell proliferation and induction of
antibody secretion, including IgE secretion.
[0012] The present invention further provides antisense or sense
oligonucleotides (deoxyribonucleotides or ribonucleotides) that
correspond to a sequence of at least about 12 nucleotides selected
from the nucleotide sequence of CD40-L or DNA or RNA sequences
complementary to the nucleotide sequence of CD40-L as described in
SEQ ID NO:1 and SEQ ID NO:11 and in FIGS. 1A, 1B, 2A and 2B. Such
antisense or sense oligonucleotides prevent transcription or
translation of CD40-L mRNA or polypeptides.
[0013] The present invention further provides antisense or sense
oligonucleotides (deoxyribonucleotides or ribonucleotides) that
correspond to a sequence of at least about 12 nucleotides selected
from the nucleotide sequence of CD40-L or DNA or RNA sequences
complementary to the nucleotide sequence of CD40-L as described in
SEQ ID NO:1 and SEQ ID NO:11 and in FIGS. 1 and 2. Such antisense
or sense oligonucleotides prevent transcription or translation of
CD40-L mRNA or polypeptides.
[0014] Further still, the present invention provides CD40-L peptide
fragments that correspond to a protein sequence of at least 10
amino acids selected from the amino acid sequence encoded by SEQ ID
NO:1 or SEQ ID NO:11 that can act as immunogens to generate
antibodies specific to the CD40-L immunogens. Such CD40-L immunogen
fragments can serve as antigenic determinants in providing
monoclonal antibodies specific for CD40-L.
[0015] The invention also provides a human CD40/Fc fusion protein
and a soluble CD40 protein (sCD40) comprising the extracellular
region of human CD40. Both sCD40 and CD40/Fc fusion protein can
inhibit CD40-L or anti-CD40 mAb induced B cell stimulation,
1L-4-induced IgE stimulation and IL-4 induced CD23 induction in B
cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIGS. 1A and B illustrate nucleotide and amino acid
sequences corresponding to murine CD40-L. This protein is a type II
polypeptide having its N-terminus as its intracellular domain,
followed by a transmembrane region, and an extracellular domain at
the C-terminus of the polypeptide. The extracellular domain, which
is longer than either the intracellular domain or the transmembrane
region, contains one potential N-linked glycosylation site and two
potential disulfide bonds in view of four cysteine (Cys)
residues.
[0017] FIGS. 2A and B illustrate nucleotide and amino acid
sequences corresponding to human CD40-L. This protein is a type II
polypeptide having its N-terminus as its intracellular domain,
followed by a transmembrane region, and an extracellular domain at
the C-terminus of the polypeptide. The extracellular domain, which
is longer than either the intracellular domain or the transmembrane
region, contains 1 potential N-linked glycosylation site and
2-potential disulfide bonds in view of 5 cysteine (Cys)
residues.
[0018] FIG. 3 illustrates a comparison of protein sequences of
human and murine CD40-L showing 77.7% homology at the amino acid
level.
[0019] FIG. 4 illustrates proliferation of T cell depleted human
peripheral blood mononuclear cells (PBMC) caused by incubation with
CV1 cells transfected with full length murine CD40-L cDNA (SEQ ID
NO: 1) and expressing bound CD40-L (CD40-L+CV1 cells) when compared
with CV1 cells transfected with empty vector (HAVEO) and not
expressing bound murine CD40-L. The day 7 proliferation results
show that CD40-L+CV1 cells significantly increase proliferation of
T-cell depleted PBMC in the presence or absence of interleukin-4
(IL-4).
[0020] FIG. 5 illustrates a second determination of T cell depleted
PBMC proliferation with addition of bound murine CD40-L and 10
ng/ml of IL-4. These data show no co-mitogenic effect of IL-4 but
continued strong mitogenic effect of bound CD40-L.
[0021] FIG. 6 illustrates that bound CD40-L augments IgE
secretion.
[0022] FIG. 7 illustrates that membrane-bound CD40-L stimulates
CD23 shedding in the presence of IL-4.
[0023] FIG. 8 illustrates proliferation of murine splenic B cells
caused by membrane-bound murine CD40-L or 7A1 cells, which is a
helper T cell clone.
[0024] FIG. 9 illustrates a comparison of murine EMAO.9 cells, a
sorted cell line that was sorted on the basis of expression of
murine CD40-L and T cells 7A1 for induction of an antigen-specific
response indicated by plaque forming cells (PFC) by anti-sheep red
blood cells (SCBC).
[0025] FIG. 10 illustrates a comparison of B cell proliferative
activity of membrane-bound CD40-L and other cell types transfected
with different cDNAs. Membrane-bound CD40-L showed significantly
more B cell proliferative activity than a helper T cell clone or
other control cells.
[0026] FIG. 11 illustrates that 7C2 cells (a helper T cell clone)
and CV1 cells transfected with murine CD40-L cDNA induce anti SRBC
plaque forming cells.
[0027] FIG. 12 illustrates a comparison of two helper T cell clones
with cells expressing membrane-bound CD40-L for inducing murine B
cell proliferation.
[0028] FIG. 13 illustrates induction of antigen-specific plaque
forming cells by membrane-bound CD40-L and a helper T cell clone in
the presence or absence of added interleukin-2 (IL-2).
[0029] FIG. 14 shows effects of membrane-bound CD40-L stimulating B
cell proliferation and IgE secretion. The effects of membrane-bound
CD40-L were inhibited by CD40 receptor but not by TNF receptor.
[0030] FIG. 15 shows representative FACS profiles of peripheral
blood T cells stimulated for 16 hours with 10 ng/ml PMA and 500
ng/ml ionomycin, and stained with 5 .mu.g/ml CD40/Fc, a control Fc
protein, IL-4 receptor/Fc, murine IgGi, and a CD40-L monoclonal
antibody referred to as M90.
[0031] FIG. 16 illustrates the ability of monoclonal antibodies M90
and M91 to inhibit binding of 2 .mu.g/ml CD40/Fc to peripheral
blood T cells activated as described for FIG. 15.
[0032] FIG. 17 demonstrates the ability of anti-CD40-L monoclonal
antibodies to bind trimeric CD40-L and inhibit the ability of
CD40-L to induce B cell proliferation. Purified tonsil B cells were
cultured with 5 .mu.g/ml immobilized rabbit anti-human IgM and
recombinant soluble human CD40-L. M90, M91 or an isotype control
antibody were titrated into the cultures; incorporation of
tritiated thymidine was used as a measure of proliferation.
[0033] FIG. 18 presents the binding of trimeric human and murine
CD40-L and dimeric human and murine CD40-L to C40/Fc as determined
in a biosensor assay.
[0034] FIG. 19 illustrates the binding of trimeric human CD40-L and
two preparations of monomeric human CD40-L to C40/Fc as determined
in a biosensor assay.
DETAILED DESCRIPTION OF THE INVENTION
[0035] Novel polypeptides that can act as a ligand for murine and
human CD40 have been isolated and sequenced. More particularly,
cDNAs encoding these ligands have been cloned and sequenced.
Further provided are methods for expression of recombinant CD40-L
polypeptides. CD40-L polypeptide include other forms of mammalian
CD40-L, such as derivatives or analogs of human or murine CD40-L.
Murine and human CD40-L comprise a 214 and 215, respectively amino
acid extracellular region at the C-terminus of full length,
membrane-bound polypeptide. The extracellular region contains the
domain that binds to CD40. Murine and human CD40-L further comprise
a homologous hydrophobic 24 amino acid transmembrane region
delineated by charged amino acids on either side and a 22 amino
acid intracellular region at their N-termini. The present invention
further comprises full length CD40-L polypeptides or fragments
thereof comprising all or part of the extracellular region or
derivatives of the extracellular region and mammalian cells
transfected with a cDNA encoding murine or human CD40-L and
expressing human or murine CD40-L as a membrane-bound protein.
[0036] The present invention comprises isolated DNA sequences
encoding CD40-L polypeptides and DNA or RNA sequences complementary
to such isolated DNA sequences. The isolated DNA sequences and
their complements are selected from the group consisting of (a)
nucleotides 184 through 828, 193 through 828, 193 through 762, or
403 through 762 of the DNA sequence set forth in FIGS. 2A and B
(SEQ ID NO:11) and their complements, (b) DNA sequences which
hybridize to the DNA sequences of (a) or their complements under
conditions of moderate stringency and which encode a CD40-L
polypeptide, analogs or derivatives thereof, and (c) DNA sequences
which, due to the degeneracy of the genetic code, encode CD40-L
polypeptides encoded by any of the foregoing DNA sequences and
their complements. In addition, the present invention includes
vectors comprising DNA sequences encoding CD40-L polypeptides and
analogs, and host cells transfected with such vectors. The novel
cytokine disclosed herein is a ligand for CD40, a receptor that is
a member of the TNF receptor super family. Therefore, CD40-L is
likely to be responsible for transducing signal via CD40, which is
known to be expressed, for example, by B lymphocytes. Full-length
CD40-L is a membrane-bound polypeptide with an extracellular region
at its C terminus, a transmembrane region, and an intracellular
region at its N-terminus. A soluble version of CD40-L can be made
from the extracellular region or a fragment thereof and a soluble
CD40-L has been found in culture supernatants from cells that
express a membrane-bound version of CD40-L. The protein sequence of
the extracellular region of murine CD40-L extends from amino acid
47 to amino acid 260 in FIGS. 1A and B and SEQ ID NO:2. The protein
sequence of the extracellular region of human CD40-L extends from
amino acid 47 to amino acid 261 in FIGS. 2A and B and SEQ ID NO:
12. The biological activity of CD40-L is mediated by binding to
CD40 or a species-specific homolog thereof and comprises
proliferation of B cells and induction of immunoglobulin secretion
from activated B cells. CD40-L (including soluble monomeric and
oligomeric forms, as well as membrane-bound forms) can effect B
cell proliferation and immunoglobulin secretion (except IgE
secretion) without the presence of added IL-4, in contrast to
anti-CD40 antibodies, which require IL-4 and cross-linking to
mediate activity.
[0037] CD40-L refers to a genus of polypeptides which are capable
of binding CD40, or mammalian homologs of CD40. As used herein, the
term "CD40-L" includes soluble CD40-L polypeptides lacking
transmembrane and intracellular regions, mammalian homologs of
human CD40-L, analogs of human or murine CD40-L or derivatives of
human or murine CD40-L.
[0038] CD40-L may also be obtained by mutations of nucleotide
sequences coding for a CD40-L polypeptide. A CD40-L analog, as
referred to herein, is a polypeptide substantially homologous to a
sequence of human or murine CD40-L but which has an amino acid
sequence different from native sequence CD40-L (human or murine
species) polypeptide because of one or a plurality of deletions,
insertions or substitutions. Analogs of CD40-L can be synthesized
from DNA constructs prepared by oligonucleotide synthesis and
ligation or by site-specific mutagenesis techniques.
[0039] Generally, substitutions should be made conservatively;
i.e., the most preferred substitute amino acids are those which do
not affect the ability of the inventive proteins to bind their
receptors in a manner substantially equivalent to that of native
CD40-L. Examples of conservative substitutions include substitution
of amino acids outside of the binding domain(s), and substitution
of amino acids that do not alter the secondary and/or tertiary
structure of CD40-L. Additional examples include substituting one
aliphatic residue for another, such as Ile, Val, Leu, or Ala for
one another, or substitutions of one polar residue for another,
such as between Lys and Arg; Glu and Asp; or Gln and Asn. Other
such conservative substitutions, for example, substitutions of
entire regions having similar hydrophobicity characteristics, are
well known.
[0040] Similarly, when a deletion or insertion strategy is adopted,
the potential effect of the deletion or insertion on biological
activity should be considered. Subunits of viral proteins may be
constructed by deleting terminal or internal residues or sequences
to form fragments. Additional guidance as to the types of mutations
that can be made is provided by a comparison of the sequence of
CD40-L to the sequences and structures of other TNF family
members.
[0041] The primary amino acid structure of human or murine CD40-L
may be modified to create CD40-L derivatives by forming covalent or
aggregative conjugates with other chemical moieties, such as
glycosyl groups, lipids, phosphate, acetyl groups and the like, or
by creating amino acid sequence mutants. Covalent derivatives of
CD40-L are prepared by linking particular functional groups to
CD40-L amino acid side chains or at the N-terminus or C-terminus of
a CD40-L polypeptide or the extracellular domain thereof. Other
derivatives of CD40-L within the scope of this invention include
covalent or aggregative conjugates of CD40-L or its fragments with
other proteins or polypeptides, such as by synthesis in recombinant
culture as N-terminal or C-terminal fusions. For example, the
conjugate may comprise a signal or leader polypeptide sequence at
the N-terminal region or C-terminal region of a CD40-L polypeptide
which co-translationally or post-translationally directs transfer
of the conjugate from its site of synthesis to a site inside or
outside of the cell membrane or cell wall (e.g. the a-factor leader
of Saccharomyces).
[0042] CD40-L polypeptide fusions can comprise polypeptides added
to facilitate purification and identification of CD40-L (e.g.
poly-His), or fusions with other cytokines to provide novel
polyfunctional entities. Other cytokines include, for example, any
of interleukins-1 through 13, TNF (tumor necrosis factor), GM-CSF
(granulocyte macrophage-colony stimulating factor), G-CSF
(granulocyte-colony stimulating factor), MGF (mast cell growth
factor), EGF (epidermal growth factor), PDGF (platelet-derived
growth factor), NGF (nerve growth factor), EPO (erythropoietin),
.gamma.-IFN (gamma interferon), 4-1BB-L (4-1BB ligand) and other
cytokines that affect immune cell growth, differentiation or
function.
[0043] Nucleic acid sequences within the scope of the present
invention include DNA and/or RNA sequences that, hybridize to the
nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:11 or the
complementary strands, under conditions of moderate or severe
stringency. Moderate stringency hybridization conditions refer to
conditions described in, for example, Sambrook et al. Molecular
Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold
Spring Harbor Laboratory Press, (1989). Conditions of moderate
stringency, as defined by Sambrook et al., include use of a
prewashing solution of 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0)
and hybridization conditions of 50.degree. C., 5.times.SSC,
overnight. Conditions of severe stringency include higher
temperatures of hybridization and washing (for example,
hybridization in 6.times.SSC at 63.degree. C. overnight; washing in
3.times.SSC at 55.degree. C.).
[0044] Biological activity of CD40-L may be determined, for
example, by competition for binding to the ligand binding domain of
CD40 (i.e. competitive binding assays). Both murine CD40-L and
human CD40-L bind to human CD40. The binding affinity of murine
CD40-L (expressed on sorted murine EL-40.9 cells) for human CD40
was approximately 1.74.times.10.sup.9 M.sup.-1. Similarly, the
binding affinity of murine CD40-L (expressed on unsorted murine
EL-46.1 cells) for human CD40 was approximately 2.3.times.10.sup.9
M.sup.-1. Both binding affinity measurements are within a range
typical of cytokine/cytokine receptor binding.
[0045] One configuration of a competitive binding assay for CD40-L
polypeptide uses a radiolabeled, soluble murine CD40-L according to
FIGS. 1A and B (SEQ ID NO:1) or human CD40-L according to FIGS. 2A
and B (SEQ ID NO:11), and intact cells expressing CD40 (e.g., human
B cells). Instead of intact cells, one could substitute soluble
CD40 (such as a CD40/Fc fusion protein) bound to a solid phase
through a Protein A or Protein G interaction with the Fc region of
the fusion protein. A second configuration of a competitive binding
assay utilizes radiolabeled soluble CD40 such as a CD40/Fc fusion
protein, and intact cells expressing CD40-L. Alternatively, soluble
CD40-L could be bound to a solid phase.
[0046] Competitive binding assays can be performed using standard
methodology. For example, radiolabeled murine CD40-L can be used to
compete with a putative CD40-L homolog to assay for binding
activity against surface-bound CD40. Qualitative results can be
obtained by competitive autoradiographic plate binding assays, or
Scatchard plots may be utilized to generate quantitative
results.
[0047] Competitive binding assays with intact cells expressing CD40
can be performed by two methods. In a first method, B cells are
grown either in suspension or by adherence to tissue culture
plates. Adherent cells can be removed by treatment with 5 mM EDTA
treatment for ten minutes at 37.degree. C. In a second method,
transfected COS cells expressing membrane-bound CD40 can be used.
COS cells or another mammalian cell can be transfected with human
CD40 cDNA in an appropriate vector to express full length CD40 with
an extracellular region exterior to the cell.
[0048] Alternatively, soluble CD40 can be bound to a solid phase
such as a column chromatography matrix, or a tube or similar
substrate suitable for analysis for the presence of a detectable
moiety such as .sup.125I. Binding to a solid phase can be
accomplished, for example, by obtaining a CD40/Fc fusion protein
and binding it to a protein A or protein G surface.
[0049] Another means to measure the biological activity of CD40-L
and homologs thereof is to utilize conjugated, soluble CD40 (for
example, .sup.1251-CD40/Fc) in competition assays similar to those
described above. In this case, however, intact cells expressing
CD40-L, or soluble CD40-L bound to a solid substrate, are used to
measure competition for binding of conjugated, soluble CD40 to
CD40-L by a sample containing a putative CD40 homolog.
[0050] CD40-L may also be assayed by measuring biological activity
in a B cell proliferation assay. Human B cells may be obtained from
human tonsils by purification by negative selection and Percoll
density sedimentation, as described by Defrance et al., J. Immunol.
139:1135, 1987. Burkitt lymphoma cell lines may be used to measure
cell proliferation in response to CD40-L. Examples of Burkitt
lymphoma cell lines include, for example, Raji (ATCC CCL 86), Daudi
(ATCC CCL 213) and Namalwa (ATCC CRL 1432). Membrane-bound CD40-L
stimulated B cell proliferation. Oligomeric, preferably dimeric,
CD40-L can stimulate B cell proliferation. CD40 (receptor)
antagonizes CD40-L proliferation of B cells.
[0051] Yet another assay for determining CD40-L biological activity
is to measure immunoglobulin produced by B cells in response to
activation by CD40-L or a derivative or analog thereof. Polyclonal
immunoglobulin secretion can be measured, for example, by
incubating with 5.times.10.sup.5 B cells/ml in culture for at least
seven days. Immunoglobulin (Ig) production can be measured by an
ELISA assay such as one described in Maliszewski et al., J.
Immunol. 144:3028, 1990 [Maliszewski et al. I] or Maliszewski et
al., Eur J. Immunol. 20:1735, 1990 [Maliszewski et al. II]. Murine
B cells can be obtained, for example, from mice and cultured
according to procedures described in Grabstein et al., J. Exp. Med.
163:1405, 1986 [Grabstein et al. I], Maliszewski et al. I, and
Maliszewski et al. II.
[0052] CD40-L can be used in a binding assay to detect cells
expressing CD40. For example, murine CD40-L according to FIGS. 1A
and B (SEQ ID NO:1) or human CD40-L according to FIGS. 2A and B
(SEQ ID NO:11), or an extracellular domain or a fragment thereof,
can be conjugated to a detectable moiety such as .sup.125I.
Radiolabeling with .sup.125I can be performed by any of several
standard methodologies that yield a functional .sup.125I-CD40-L
molecule labeled to high specific activity. Alternatively, another
detectable moiety such as an enzyme that can catalyze a
calorimetric or fluorometric reaction, biotin or avidin may be
used. Cells expressing CD40 can be contacted with conjugated
CD40-L. After incubation, unbound conjugated CD40-L is removed and
binding is measured using the detectable moiety. CD40-L
polypeptides may exist as oligomers, such as dimers or trimers.
Oligomers are linked by disulfide bonds formed between cysteine
residues on different CD40-L polypeptides. Alternatively, one can
link two soluble CD40-L domains with a Gly.sub.4SerGly.sub.5Ser
linker sequence, or other linker sequence described in U.S. Pat.
No. 5,073,627, which is incorporated by reference herein. CD40-L
polypeptides may also be created by fusion of the C terminal of
soluble CD40-L (extracellular domain) to the Fe region of IgG1 (for
example, SEQ ID NO:3) as described for the CD40/Fc fusion protein.
CD40-L/Fc fusion proteins are allowed to assemble much like heavy
chains of an antibody molecule to form divalent CD40-L. If fusion
proteins are made with both heavy and light chains of an antibody,
it is possible to form a CD40-L oligomer with as many as four
CD40-L extracellular regions.
[0053] Fusion proteins can be prepared using conventional
techniques of enzyme cutting and ligation of fragments from desired
sequences. PCR techniques employing synthetic oligonucleotides may
be used to prepare and/or amplify the desired fragments.
Overlapping synthetic oligonucleotides representing the desired
sequences can also be used to prepare DNA constructs encoding
fusion proteins. Fusion proteins can also comprise CD40-L and two
or more additional sequences, including a leader (or signal
peptide) sequence, Fe region, linker sequence, and sequences
encoding highly antigenic moieties that provide a means for facile
purification or rapid detection of a fusion protein.
[0054] Signal peptides facilitate secretion of proteins from cells.
An exemplary signal peptide is the amino terminal 25 amino acids of
the leader sequence of human interleukin-7 (IL-7; Goodwin et al.,
Proc. Natl. Acad. Sci. U.S.A. 86:302, 1989; FIG. 2B). Other signal
peptides may also be employed. For example, certain nucleotides in
the IL-7 leader sequence can be altered without altering the amino
acid sequence. Additionally, amino acid changes that do not affect
the ability of the IL-7 sequence to act as a leader sequence can be
made.
[0055] The Flag.TM. octapeptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)
(SEQ ID NO:25) does not alter the biological activity of fusion
proteins, is highly antigenic and provides an epitope reversibly
bound by a specific monoclonal antibody, enabling rapid detection
and facile purification of the expressed fusion protein. The
Flag.TM. sequence is also specifically cleaved by bovine mucosal
enterokinase at the residue immediately following the Asp-Lys
pairing, fusion proteins capped with this peptide may also be
resistant to intracellular degradation in E. coli. A murine
monoclonal antibody that binds the Flag.TM. sequence has been
deposited with the ATCC under accession number HB 9259; methods of
using the antibody in purification of fusion proteins comprising
the Flag.TM. sequence are described in U.S. Pat. No. 5,011,912,
which is incorporated by reference herein.
[0056] Suitable Fc regions are defined as Fc regions that can bind
to protein A or protein G, or alternatively, are recognized by an
antibody that can be used in purification or detection of a fusion
protein comprising the Fc region. Preferable Fc regions include the
Fc region of human IgG.sub.1 or murine IgG.sub.1. One example is
the human IgG.sub.1 Fc region shown in SEQ ID NO:3; another example
is an Fc region encoded by cDNA obtained by PCR from
oligonucleotide primers from SEQ ID NO:9 and SEQ ID NO:10 with
human cDNA as a template. Portions of a suitable Fc region may also
be used, for example, an Fc region of human IgG.sub.1 from which
has been deleted a sequence of amino acids responsible for binding
to protein A, such that the resultant Fc region binds to protein G
but not protein A.
[0057] The [Gly.sub.4Ser].sub.3 repeat sequence provides a linker
sequence that separates the extracellular region of the CD40-L from
the Fc portion of the fusion protein by a distance sufficient to
ensure that the CD40-L properly folds into its secondary and
tertiary structures. Suitable linker sequences (1) will adopt a
flexible extended conformation, (2) will not exhibit a propensity
for developing an ordered secondary structure which could interact
with the functional domains of fusion proteins, and (3) will have
minimal hydrophobic or charged character which could promote
interaction with the functional protein domains. Typical surface
amino acids in flexible protein regions include Gly, Asn and Ser.
Virtually any permutation of amino acid sequences containing Gly,
Asn and Ser would be expected to satisfy the above criteria for a
linker sequence. Other near neutral amino acids, such as Thr and
Ala, may also be used in the linker sequence. The length of the
linker sequence may vary without significantly affecting the
biological activity of the fusion protein. Linker sequences are
unnecessary where the proteins being fused have non-essential N- or
C-terminal amino acid regions which can be used to separate the
functional domains and prevent steric interference.
[0058] CD40-L polypeptides may exist as soluble polypeptides
comprising the extracellular domain of CD40-L as shown in FIGS. 1A
and B (SEQ ID NO:1) and FIGS. 2A and B (SEQ ID NO:11) or as
membrane-bound polypeptides comprising the extracellular domain, a
transmembrane region and a short intracellular domain, as shown in
FIGS. 1A and B (SEQ ID NO:1) and FIGS. 2A and B (SEQ ID NO:11) for
the murine and human sequences, respectively. Moreover, the present
invention comprises oligomers of CD40-L extracellular domains or
fragments thereof, linked by disulfide interactions, or expressed
as fusion polymers with or without spacer amino acid linking
groups. For example, a dimer CD40-L molecule can be linked by an
IgG Fc region linking group.
[0059] Without being bound by theory, membrane-bound CD40-L and
oligomeric CD40-L can achieve activity stimulating Ig formation and
proliferation of B cells previously only achieved by cross-linked
anti-CD40 antibody in the presence of IL-4. It further appears
likely that monomeric soluble CD40-L, comprising only the
extracellular domain of CD40-L and capable of binding to CD40
receptor, will serve to antagonize the activity of membrane-bound
and oligomeric CD40-L and/or cross-linked anti-CD40 antibodies. It
further appears likely that the interaction of membrane-bound
CD40-L with CD40 is the principal molecular interaction responsible
for T cell contact dependent induction of B cell growth and
differentiation to both antigen specific antibody production and
polyclonal Ig secretion. In this regard, a mammalian cell
transfected with a cDNA encoding full length CD40-L (i.e., being
membrane-bound and having an intracellular domain, a transmembrane
region and an extracellular domain or a fragment thereof) can mimic
T cells in their ability to induce B cell growth, differentiation
and stimulation of antigen-specific antibody production. It appears
that activities of oligomeric soluble CD40-L, preferably an
oligomer of extracellular regions, can mimic the biological
activities of membrane-bound CD40-L. Moreover, soluble monomeric
CD40-L (comprising the extracellular domain or a fragment thereof)
can bind to CD40 receptor to prevent T cell interaction with B
cells and therefor have activity similar to CD40 (receptor)
extracellular domain which itself may be in monomeric or in
oligomeric form. Alternatively, CD40-L can be oligomeric to act as
a soluble factor capable of inducing B cell growth, differentiation
and stimulation of antigen-specific antibody production.
Accordingly, it appears that membrane-bound CD40-L and oligomeric
CD40-L act as CD40 agonists, while soluble (monomeric) CD40-L and
soluble CD40 act as CD40 antagonists by blocking CD40 receptor
sites without significantly transducing signal or by preventing
CD40-L binding to CD40 sites on B cells and other target cells.
[0060] Both CD40 agonists and CD40 antagonists will have useful
therapeutic activity. For example, CD40 agonists (i.e.,
membrane-bound CD40-L and oligomeric CD40-L) are useful as vaccine
adjuvants and for stimulating mAb production from hybridoma cells.
CD40 antagonists (i.e., CD40 receptor, CD40/Fc and possibly
soluble, monomeric CD40-L) are useful for treating autoimmune
diseases characterized by presence of high levels of
antigen-antibody complexes, such as allergy, systemic lupus
erythematosis, rheumatoid arthritis, insulin dependent diabetes
mellitus (IDDM), graft versus host disease (GVHD) and others.
[0061] IgE secretion from human B cells can be induced by IL-4 in
the presence of T cells (Vercelli et al., J. Exp. Med. 169:1295,
1989). Further, IgE production can be induced from T cell depleted
PBM (peripheral blood mononuclear cells) by addition of an
anti-CD40 mAb (Jabara et al., J. Exp. Med. 172:1861, 1990 and Zhang
et al., J. Immunol. 146:1836, 1991). The present invention further
includes a method for inhibiting IgE production from activated B
cells, activated by IL-4 in the presence of T cells or by CD40-L
(preferably, membrane-bound CD40-L), comprising administering an
effective amount of a CD40/Fc fusion protein, as described herein,
or a soluble CD40 encoded by the cDNA sequence described in SEQ ID
NO. 3. Similarly, CD40 receptors and possibly soluble CD40-L
(monomer only) can also block secretion of other antibody
isotypes.
[0062] CD40 can be expressed, for example, by hematopoietic cells
and ovarian cancer cells. Gallagher et al. (2002), Mol. Pathol.
55(2): 110-20. Epidermal growth factor receptor (EGFR) can also be
expressed by ovarian cancer cells. Nicholson et al. (2001), Eur. J.
Cancer 37(Suppl. 4): S9-15. Ligation of CD40 by adding to ovarian
cancer cells a soluble version of CD40 ligand (CD40L), which is a
CD40 agonist, leads to growth inhibition of these cells. Gallagher
et al., supra. Similar effects of CD40 agonists have been observed
in some other cancer cells. However, in normal B cells, a CD40
agonist provides an anti-apoptotic and proliferative stimulus,
indicating that responses to CD40 agonists vary. Gallagher et al.,
supra.
[0063] Accordingly, the invention provides a method for reducing
tumor burden, tumor size, the number of tumor sites, and/or the
number of cancer cells comprising administering a CD40 agonist to a
patient suffering from a cancer in which the cancer cells express
EGFR. The cancer can be a hematologic cancer or an ovarian cancer,
and the cancer cells can also express CD40.
[0064] CD40 agonists can include: polypeptides comprising all or
part of the CD40 ligand (CD40L) or substantially similar
polypeptides that can serve as agonists of CD40; part or all of an
antibody or a substantially similar polypeptide that can
specifically bind to CD40 and serve as an agonist of CD40, such as
those described in U.S. Pat. Nos. 5,801,227, 5,677,165, or
5,874,082, among others; part or all of a polypeptide selected for
CD40 binding in vitro or a substantially similar polypeptide that
can serve as an agonist to CD40; CD40 antibodies, agonists, and
binding proteins described in U.S. Pat. Nos. 5,801,227 and
5,674,492; and small molecules that can serve as CD40 agonists. In
vitro selection schemes to obtain binding proteins are described in
e.g. He and Taussig ((1997), Nucleic Acids. Res. 25(24):
5132-5134), Hanes and Pluckthun ((1997), Proc. Natl. Acad. Sci. 94:
4937-4942), Roberts and Szostak ((1997), Proc. Natl. Acad. Sci. 94:
12297-12302), Lohse and Wright ((2001), Curr. Opin. Drug Discov.
Devel. 4(2): 198-204), Kurz et al. ((2000), Nucleic Acids Res.
28(18): E83), Liu et al. ((2000), Methods Enzymol. 318: 268-93),
Nemoto et al. ((1997), FEBS Lett. 414(2): 405-08), U.S. Pat. No.
6,261,804, WO 00/32823, WO 00/34784, Parmley and Smith ((1989),
Adv. Exp. Med. Biol. 251: 215-218), Luzzago et al. ((1995),
Biotechnol. Annu. Rev. 1: 149-83), and Lu et al. ((1995),
Biotechnology (NY) 13(4): 366-372). The sequences of CD40 and CD40L
are known in the art. See Stamenkovic et al. (1989), EMBO J. 8:
1403-10; Spriggs et al. (1992), J. Exp. Med. 176: 1543-50. Methods
for making antibodies are also known in the art. A variety of
standard assays have been described for assessing whether a
particular molecule can agonize CD40. Several assays for apoptosis,
which CD40L prevents in osteoclasfs, are described in WO 01/16180
and in Gallagher et al., supra. Assays for cell proliferation, such
as cell counting and optical density measurements, are well known
in the art. Assays for expression of specific genes (as described
in Gallagher et al. supra) can also be indicative of agonism of
CD40.
[0065] The present invention further includes CD40-L polypeptides
with or without associated native-pattern glycosylation. CD40-L
expressed in yeast or mammalian expression systems (e.g., COS-7
cells) may be similar to or significantly different from a native
CD40-L polypeptide in molecular weight and glycosylation pattern,
depending upon the choice of expression system. Expression of
CD40-L polypeptides in bacterial expression systems, such as E.
coli, provides non-glycosylated molecules.
[0066] DNA constructs that encode various additions or
substitutions of amino acid residues or sequences, or deletions of
terminal or internal residues or sequences not needed for
biological activity or binding can be prepared. For example, the
extracellular CD40-L N-glycosylation site can be modified to
preclude glycosylation while allowing expression of a homogeneous,
reduced carbohydrate analog using yeast expression systems.
N-glycosylation sites in eukaryotic polypeptides are characterized
by an amino acid triplet Asn-X-Y, wherein X is any amino acid
except Pro and Y is Ser or Thr. Appropriate modifications to the
nucleotide sequence encoding this triplet will result in
substitutions, additions or deletions that prevent attachment of
carbohydrate residues at the Asn side chain. In another example,
sequences encoding Cys residues can be altered to cause the Cys
residues to be deleted or replaced with other amino acids,
preventing formation of incorrect intramolecular disulfide bridges
upon renaturation. Human CD40-L comprises five Cys residues in its
extracellular domain. Thus, at least one of the five Cys residues
can be replaced with another amino acid or deleted without
effecting protein tertiary structure or disulfide bond
formation.
[0067] Other approaches to mutagenesis involve modification of
sequences encoding dibasic amino acid residues to enhance
expression in yeast systems in which KEX2 protease activity is
present. Sub-units of a CD40-L polypeptide may be constructed by
deleting sequences encoding terminal or internal residues or
sequences. Moreover, other analyses may be performed to assist the
skilled artisan in selecting sites for mutagenesis. For example,
PCT/US92/03743 (the disclosure of which is hereby incorporated by
reference) discusses methods of selecting ligand agonists and
antagonists.
[0068] CD40-L polypeptides are encoded by multi-exon genes. The
present invention further includes alternative mRNA constructs
which can be attributed to different mRNA splicing events following
transcriptioff and which share regions of identity or similarity
with the cDNAs disclosed herein.
[0069] Antisense or sense oligonucleotides comprise a
single-stranded nucleic acid sequence (either RNA or DNA) capable
of binding to target CD40-L mRNA (sense) or CD40-L DNA (antisense)
sequences. Antisense or sense oligonucleotides, according to the
present invention, comprise a fragment of SEQ ID NO:1 or SEQ ID
NO:11, or a DNA or RNA complement of SEQ ID NO:1 or SEQ ID NO:11.
Such a fragment comprises at least about 14 nucleotides.
Preferably, such a fragment comprises from about 14 to about 30
nucleotides. The ability to create an antisense or a sense
oligonucleotide, based upon a cDNA sequence for CD40-L is described
in, for example, Stein and Cohen, Cancer Res. 48:2659, 1988 and van
der Krol et al., Bio Techniques 6:958, 1988.
[0070] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes that
block translation (RNA) or transcription (DNA) by one of several
means, including enhanced degradation of the duplexes, premature
termination of transcription or translation, or by other means.
Suitable polymerase promotors include promoters for any RNA
polymerase, or promoters for any DNA polymerase. Antisense or sense
oligonucleotides further comprise oligonucleotides having modified
sugar-phosphodiester backbones (or other sugar linkages, such as
those described in WO91/06629) and wherein such sugar linkages are
resistant to endogenous nucleases. Such oligonucleotides with
resistant sugar linkages are stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to
be able to bind to target nucleotide sequences. Other examples of
sense or antisense oligonucleotides include those oligonucleotides
which are covalently linked to organic moieties, such as those
described in WO 90/10448, and other moieties that increases
affinity of the oligonucleotide for a target nucleic acid sequence,
such as poly-(L-lysine). Further still, intercalating agents, such
as ellipticine, and alkylating agents or metal complexes may be
attached to sense or antisense oligonucleotides to modify binding
specificities of the antisense or sense oligonucleotide for the
target nucleotide sequence. Antisense or sense oligonucleotides may
be introduced into a cell containing the target nucleic acid
sequence by any gene transfer method, including, for example,
CaPO.sub.4-mediated DNA transfection, electroporation, or other
gene transfer vectors such as Epstein-Barr virus. Antisense or
sense oligonucleotides are preferably introduced into a cell
containing the target nucleic acid sequence by insertion of the
antisense or sense oligonucleotide into a suitable retroviral
vector, then contacting the cell with the retrovirus vector
containing the inserted sequence, either in vivo or ex vivo.
Suitable retroviral vectors include, but are not limited to, the
murine retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or
or the double copy vectors designated DCT5A, DCT5B and DCT5C (see
PCT Application US 90/02656). Alternatively, other promotor
sequences may be used to express the oligonucleotide.
[0071] Sense or antisense oligonucleotides may also be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not
substantially interfere with the ability of the ligand binding
molecule to bind to its corresponding molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0072] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0073] The sequence of murine CD40-L cDNA was obtained by direct
expression techniques. The sequence of human CD40-L was obtained by
cross-species hybridization techniques using the murine CD40-L cDNA
as a probe.
[0074] We cloned murine CD40-L by first obtaining a clone of the
extracellular region of human CD40 (the receptor) by polymerase
chain reaction (PCR) techniques using primers based upon a sequence
published in Stamenkovic et al. (SEQ ID NO:4). An upstream
oligonucleotide primer 5'-CCGTCGACCACCATGGTTCGTCTGCC-3' (SEQ ID
NO:5) introduces a Sal 1 site upstream from an initiator methionine
of CD40 and a downstream oligonucleotide primer
5'-CCGTCGACGTCTAGAGCCGATCCTGGGG-3' (SEQ ID NO:6) inserts a
termination codon after amino acid 192 of CD40, followed by Xba 1
and Sal 1 sites. The amplified cDNA was digested with Sal 1 and
cloned into pDC406 (McMahan et al., EMBO J. 10:2821, 1991) to
construct pDC406/s CD40.
[0075] A second CD40 receptor fragment (SEQ ID NO:4) was obtained
by PCR techniques for fusion to the Fc domain of human IgG1 (SEQ ID
NO:3). Briefly, The upstream oligonucleotide primer (SEQ ID NO:5)
and fusion template (SEQ ID NO:4) were the same as before. The
downstream oligonucleotide primer was
5'-ACAAGATCTGGGCTCTACGTATCTCAGCCGATCCTGGGGAC-3- ' (SEQ ID NO:7)
that inserts amino acids Tyr Val Glu Pro Arg (SEQ ID NO:8) after
amino acid 193 of CD40. Glu and Pro are the first two amino acids
of a hinge region of human IgG1, and are followed by a Bgl II
restriction site. The Bgl II restriction site was used to fuse the
extracellular domain of CD40 to the remainder of human IgG1 Fc
region.
[0076] Other fusion proteins comprising ligand binding domains from
other receptors can be made by obtaining a DNA sequence for the
ligand binding domain of a receptor and fusing this sequence to a
DNA sequence encoding an Fc region of an antibody molecule that
binds to protein A or protein G, or another polypeptide that is
capable of affinity purification, for example, avidin or
streptavidin. The resultant gene construct can be introduced into
mammalian cells to transiently express a fusion protein.
Receptor/Fc fusion proteins can be purified by protein A or protein
G affinity purification. Receptor/avidin fusion proteins can be
purified by biotin affinity chromatography. The fusion protein can
later be removed from the column by eluting with a high salt
solution or another appropriate buffer.
[0077] We obtained a cDNA encoding human IgG1 Fc region by PCR
amplification using cDNA from human cells as a template and an
upstream oligonucleotide primer
5'-TATTAATCATTCAGTAGGGCCCAGATCTTGTGACAAAACTCAC-3' (SEQ ID NO:9) and
a downstream oligonucleotide primer
5'-GCCAGCTTAACTAGTTCATTTACCCGGAGACAGGGAGA-3" (SEQ ID NO:10). The
PCR amplified cDNA introduced a Bgl II site near the beginning of
the hinge region, which was used to ligate CD40 extracellular
domain to construct a s CD40/Fc fusion cDNA, which was ligated into
pDC406 to construct pDC406/CD40/Fc. Other suitable Fc regions are
defined as any region that can bind with high affinity to protein A
or protein G, and includes the Fc region of human IgG1 or murine
IgG1. One example is the human IgG1 Fc region shown in SEQ ID NO:3
or the cDNA obtained by PCR from oligonucleotide primers from SEQ
ID NO:9 and SEQ ID NO:10 with human cDNA as a template.
[0078] Receptor/Fc fusion molecules preferably are synthesized in
recombinant mammalian cell culture because they are generally too
large and complex to be synthesized by prokaryotic expression
methods. Examples of suitable mammalian cells for expressing a
receptor/Fc fusion protein include CV-1 cells (ATCC CCL 70) and
COS-7 cells (ATCC CRL 1651), both derived from monkey kidney.
[0079] The DNA construct pDC406/CD40/Fc was transfected into the
monkey kidney cell line CV-1/EBNA (ATCC CRL 10478). The pDC406
plasmid includes regulatory sequences derived from SV40, human
immunodeficiency virus (HIV), and Epstein-Barr virus (EBV). The
CV-1/EBNA cell line was derived by transfection of the CV-1 cell
line with a gene encoding Epstein-Barr virus nuclear antigen-i
(EBNA-1) and constitutively express EBNA-1 driven from human CMV
immediate-early enhancer/promoter. An EBNA-1 gene allows for
episomal replication of expression vectors, such as pDC406, that
contain the EBV origin of replication.
[0080] Transfectants expressing CD40/Fc fusion protein are
initially identified using dot blots or Western blots. The
supernatants are then subjected to dot blot or gel electrophoresis
followed by transfer of the electrophoresed proteins for binding to
G28-5 mAb (an antibody that binds to human CD40 receptor). The
blotted proteins were then incubated with radiolabeled with
.sup.125I-protein A, washed to remove unbound label, and examined
for expression of Fc. Monoclonal antibody G28-5 was produced
according to Clark et al., supra.
[0081] Once cells expressing the fusion construct were identified,
large scale cultures of transfected cells were grown to accumulate
supernatant from cells expressing CD40/Fc. CD40/Fc fusion protein
in supernatant fluid was purified by affinity purification.
Briefly, one liter of culture supernatant containing CD40/Fc fusion
protein was purified by filtering mammalian cell supernatants
(e.g., in a 0.45.mu.filter) and applying filtrate to a protein A/G
antibody affinity column (Schleicher and Schuell, Keene, N.H.) at
4.degree. C. at a flow rate of 80 ml/hr for a 1.5 cm.times.12.0 cm
column. The column was washed with 0.5 M NaCl in PBS until free
protein could not be detected in wash buffer. Finally, the column
was washed with PBS. Bound fusion protein was eluted from the
column with 25 mM citrate buffer, pH 2.8, and brought to pH 7 with
500 mM Hepes buffer, pH 9.1. Silver-stained SDS gels of the eluted
CD40/Fc fusion protein showed it to be >98% pure.
[0082] Soluble CD40 (sCD40) and CD40/Fc fusion proteins were made
as described herein. The supernatants were purified through a G28-5
(anti-CD40 mAb) affinity column to affinity purify sCD40 expressed
by the transfected CV-1/EBNA cells. Protein-containing fractions
were pooled and aliquots removed for G28-5 binding assays and
analysis by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel
electrophoresis) in the presence of 1 mM dithiothreitol as a
reducing agent. A single band was seen of molecular weight 28,100
daltons. In the absence of a reducing agent, SDS-PAGE analysis of
sCD40 revealed two bands, a major band of molecular weight 56,000
and a minor band of molecular weight 28,000. The banding pattern
indicates that the majority of sCD40 exists as a disulfide-linked
homodimer in solution. The 28,000 band is free monomer.
[0083] CD40 proteins were visualized by silver staining. Sample
protein concentrations were determined using a micro-BCA assay
(Pierce) with ultrapure bovine serum albumin as standard. Soluble
CD40 purity and protein concentration were confirmed by amino acid
analysis. Purified soluble CD40 was absorbed to PVDF paper and the
paper subjected to automated Edman degradation on an Applied
Biosystems model 477A protein sequencer according to manufacturers
instructions for N-terminal protein sequencing. This procedure
checked the protein sequence of sCD40.
[0084] Soluble CD40 and CD40/Fc fusion protein were able to
modulate human B cell responses in the absence of anti-CD40 mAb
(G28-5). Purified tonsillar B cells were cultured with anti-IgM and
human IL-4 and either sCD40 or CD40/Fc fusion protein was added.
Neither form of CD40 had an inhibitory effect on B cell
proliferation (as measured by tritiated thymidine incorporation).
IL-4 receptor, by contrast, inhibited IL-4-induced B cell
proliferation in a concentration-dependent manner.
[0085] Soluble CD40 and CD40/Fc were tested for their ability to
inhibit IL-4 induced IgE secretion in a 2-donor MLC (mixed
lymphocyte culture) system. In three experiments, the level of IgE
production was reduced as the concentration of CD40 was increased.
Soluble CD40, added at a concentration of 10 .mu.g/ml, was able to
completely inhibit IgE secretion in this model of allergy. Further,
CD40/Fc had similar effects as its soluble counterpart. However,
addition of an IL-7 receptor-Fc fusion protein (made by similar
procedures with a published IL-7 receptor sequence) did not affect
secretion of IgE in this model.
[0086] Levels of CD23 were also measured in the same MLC in
response to sCD40 or CD40/Fc fusion proteins. Soluble CD40 produced
a small, but reproducible decrease in sCD23 level at day 6 compared
to cultures stimulated with IL-4 alone, however a stronger
inhibitory effect was pronounced at day 12 in the same cultures.
Soluble CD23 induction by IL-4-stimulated T-depleted PBM
(peripheral blood macrophages) E.sup.- cells was similarly affected
by addition of sCD40, causing a small decrease in sCD23 levels at
day 6 and a more pronounced inhibition at day 12. In each culture
system, the results with CD40/Fc fusion protein were substantially
the same as with sCD40.
[0087] In an effort to isolate a cDNA for a CD40-L, purified
CD40/Fc fusion protein was radioiodinated with .sup.125I using a
commercially available solid phase agent (IODO-GEN, Pierce). In
this procedure, 5 .mu.g of IODO-GEN were plated at the bottom of a
10.times.75 mm glass tube and incubated for twenty minutes at
4.degree. C. with 75 .mu.l of 0.1 M sodium phosphate, pH 7.4 and 20
.mu.l (2 mCi) Na.sup.125I. The solution was then transferred to a
second glass tube containing 5 .mu.g of CD40/Fc in 45 .mu.l PBS
(phosphate buffered saline) and this reaction mixture was incubated
for twenty minutes at 4.degree. C. The reaction mixture was
fractionated by gel filtration on a 2 ml bed volume of
Sephadex.RTM. G-25 (Sigma), and then equilibrated in RPMI 1640
medium containing 2.5% (v/v) bovine serum albumin (BSA), 0.2% (v/v)
sodium azide and 20 mM Hepes, pH 7.4 binding medium. The final pool
of .sup.125I CD40/Fc was diluted to a working stock solution of
1.times.10.sup.-7 M in binding medium and stored for up to one
month at 4.degree. C. without detectable loss of receptor binding
activity.
[0088] A cDNA library was prepared from a EL4 cell line sorted by
FACS (fluorescence activated cell sorting) on the basis of binding
of a biotinylated CD40/Fc fusion protein. Cells were sorted five
times until there was a significant shift in fluorescence intensity
based upon expression of a ligand for CD40 by the sorted EL-4
cells. The five-times sorted cells were called EL-40.5 cells and
these cells were cultured for the purposes of creating a cDNA
library from EL-40.5 mRNA. Briefly, cDNA was synthesized, inserted
into empty pDC406 vector and transformed into E. coli.
Transformants were pooled, and the DNA from the pools was isolated
and transfected into CV1-EBNA cells to create an expression cloning
library. Transfected CV1-EBNA cells were cultured on slides for
three days to permit transient expression of CD40-L. The slides
containing the transfected cells were then incubated with
radioiodinated CD40/Fc, washed to remove unbound CD40/Fc, and fixed
with gluteraldehyde. The fixed slides were dipped in liquid
photographic emulsion and exposed in the dark. After developing the
slides, they were individually examined with a microscope and cells
expressing CD40-L were identified by the presence of
autoradiographic silver grains against a light background.
[0089] The expression cloning library from EL-40.5 cells was
screened and one pool, containing approximately 2000 individual
clones, was identified as positive for binding .sup.125I labeled
CD40/Fc fusion protein. This pool was broken down into smaller
pools of approximately 200 colonies. The smaller pools were
screened as described above. One of the smaller pools was positive
for CD40-L.
[0090] A single clone was isolated and sequenced by standard
techniques, to provide the cDNA sequence and deduced amino acid
sequence of murine CD40-L as shown in FIGS. 1A and B and SEQ ID
NO:1.
[0091] The human homolog CD40-L cDNA was found by cross species
hybridization techniques. Briefly, a human peripheral blood
lymphocyte (PBL) cDNA library was made from peripheral blood
lymphocytes treated with OKT3 antibody (ATCC, Rockville Md.) that
binds to CD3 (10 ng/ml) and interleukin-2 (IL-2, 10 ng/ml) for six
days. The PBL cells were washed and then stimulated for 4 hours
with 10 ng/ml PMA (phorbol myristate acetate, Sigma St Louis) and
500 ng/ml ionomycin (Calbiochem). Messenger RNA was isolated from
stimulated PBL cells, cDNA formed and cDNA was ligated into Eco R1
linkers. Ligated cDNA was inserted into the Eco RI site of
.lambda.gt10 phage cloning vehicle (Gigapak.RTM. Stratagene, San
Diego, Calif.) according to manufacturer's instructions. Phage were
amplified, plated at densities of approximately 20,000 phage per 15
cm plate and phage lifts were performed, as described in Maniatis
et al., Molecular Biology: A Laboratory Manual, Cold Spring Harbor
Laboratory, NY, 1982, pages 316-328. A murine probe was constructed
corresponding to the coding region of murine CD40-L from nucleotide
13 to nucleotide 793 of SEQ ID NO:1 and FIGS. 1A and B. This probe
was hybridized to to the PBL library phage lifts under conditions
of moderate to severe stringency. Briefly, hybridization conditions
were 6.times.SSC, 1.times. Denhart's solution, 2 mM EDTA, 0.5% NP40
(NONIDET.TM. P-40 detergent; Octylphenylpolyethylene glycol; Shell
Chemicals) at 63.degree. overnight. This was followed by washing in
3.times.SSC, 0.1% SDS for three hours at 55.degree. C., followed by
overnight exposure to X-Ray film. Positive plaques were identified
at a frequency of approximately 1 per 1000 plaques. Positive
plaques were purified twice and cDNA was prepared from amplified
cultures.
[0092] One can utilize the murine or human CD40-L cDNA sequences
disclosed herein to obtain cDNAs encoding other mammalian homologs
of murine or human CD40-L by cross-species hybridization
techniques. Briefly, an oligonucleotide probe is created from the
nucleotide sequence of the extracellular region of murine CD40-L as
described in FIGS. 1A and B (SEQ ID NO:1) or human CD40-L as
described in FIGS. 2A and B (SEQ ID NO:11). This probe can be made
by standard techniques, such as those described in Maniatis et al.
supra. The murine or human probe is used to screen a mammalian cDNA
library or genomic library under moderate stringency conditions.
Examples of mammalian cDNA or genomic libraries include, for cDNA,
a library made from the mammal's peripheral blood lymphocytes.
Alternatively, various cDNA libraries or mRNAs isolated from
various cell lines can be screened by Northern hybridization to
determine a suitable source of mammalian CD40-L DNA or mRNA.
[0093] Recombinant expression vectors for expression of CD40-L by
recombinant DNA techniques include a CD40-L DNA sequence comprising
a synthetic or cDNA-derived DNA fragment encoding a CD40-L
polypeptide, operably linked to a suitable transcriptional or
translational regulatory nucleotide sequence, such as one derived
from a mammalian, microbial, viral, or insect gene. Examples of
regulatory sequences include sequences having a regulatory role in
gene expression (e.g., a transcriptional promoter or enhancer),
optionally an operator sequence to control transcription, a
sequence encoding an mRNA ribosomal binding site, and appropriate
sequences which control transcription and translation initiation
and termination. Nucleotide sequences are operably linked when the
regulatory sequence functionally relates to the CD40-L DNA
sequence. Thus, a promoter nucleotide sequence is operably linked
to a CD40-L DNA sequence if the promoter nucleotide sequence
controls the transcription of the CD40-L DNA sequence. Still
further, a ribosome binding site may be operably linked to a
sequence for a CD40-L polypeptide if the ribosome binding site is
positioned within the vector to encourage translation. In addition,
sequences encoding signal peptides can be incorporated into
expression vectors. For example, a DNA sequence for a signal
peptide (secretory leader) may be operably linked to a CD40-L DNA
sequence. The signal peptide is expressed as a precursor amino acid
sequence which enables improved extracellular secretion of
translated fusion polypeptide by a yeast host cell.
[0094] Suitable host cells for expression of CD40-L polypeptides
include prokaryotes, yeast or higher eukaryotic cells. Prokaryotes
include gram negative or gram positive organisms, for example, E.
coli or Bacilli. Suitable prokaryotic host cells for transformation
include, for example, E. coli, Bacillus subtilis, Salmonella
typhimurium, and various other species within the genera
Pseudomonas, Streptomyces, and Staphylococcus. Higher eukaryotic
cells include established cell lines of mammalian origin. Cell-free
translation systems could also be employed to produce CD40-L
polypeptides using RNAs derived from DNA constructs disclosed
herein. Appropriate cloning and expression vectors for use with
bacterial, fungal, yeast, and mammalian cellular hosts are
described, for example, in Pouwels et al. Cloning Vectors: A
Laboratory Manual, Elsevier, N.Y., (1985).
[0095] In a prokaryotic host cell, such as E. coli, a CD40-L
polypeptide or analog may include an N-terminal methionine residue
to facilitate expression of the recombinant polypeptide in the
prokaryotic host cell. The N-terminal Met may be cleaved from the
expressed recombinant CD40-L polypeptide. Prokaryotic host cells
may be used for expression of CD40-L polypeptides that do not
require extensive proteolytic or disulfide processing.
[0096] The expression vectors carrying the recombinant CD40-L DNA
sequence are transfected or transformed into a substantially
homogeneous culture of a suitable host microorganism or mammalian
cell line. Transformed host cells are cells which have been
transformed or transfected with nucleotide sequences encoding
CD40-L polypeptides and express CD40-L polypeptides. Expressed
CD40-L polypeptides will be located within the host cell and/or
secreted into culture supernatant fluid, depending upon the nature
of the host cell and the gene construct inserted into the host
cell.
[0097] Expression vectors transfected into prokaryotic host cells
generally comprise one or more phenotypic selectable markers. A
phenotypic selectable marker is, for example, a gene encoding a
protein that confers antibiotic resistance or that supplies an
autotrophic requirement, and an origin of replication recognized by
the host to ensure amplification within the host. Other useful
expression vectors for prokaryotic host cells include a selectable
marker of bacterial origin derived from commercially available
plasmids. This selectable marker can comprise genetic elements of
the cloning vector pBR322 (ATCC 37017). pBR322 contains genes for
ampicillin and tetracycline resistance and thus provides simple
means for identifying transformed cells. The pBR322 "backbone"
sections are combined with an appropriate promoter and a CD40-L DNA
sequence. Other commercially vectors include, for example, pKK223-3
(Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega
Biotec, Madison, Wis., USA).
[0098] Promoter sequences are commonly used for recombinant
prokaryotic host cell expression vectors. Common promoter sequences
include .beta.-lactamase (penicillinase), lactose promoter system
(Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature
281:544, 1979), tryptophan (trp) promoter system (Goeddel et al.,
Nucl. Acids Res. 8:4057, 1980; and EP-A-36776) and tac promoter
(Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory, p. 412, 1982). A particularly useful prokaryotic
host cell expression system employs a phage .lambda. P.sub.L
promoter and a cI857ts thermolabile repressor sequence. Plasmid
vectors available from the American Type Culture Collection which
incorporate derivatives of the .lambda. P.sub.L promoter include
plasmid pHUB2 (resident in E. coli strain JMB9 (ATCC 37092)) and
pPLc28 (resident in E. coli RR1 (ATCC 53082)).
[0099] CD40-L may be expressed in yeast host cells, preferably from
the Saccharomyces genus (e.g., S. cerevisiae). Other genera of
yeast, such as Pichia or Kluyveromyces, may also be employed. Yeast
vectors will often contain an origin of replication sequence from a
2.mu. yeast plasmid, an autonomously replicating sequence (ARS), a
promoter region, sequences for polyadenylation, and sequences for
transcription termination. Preferably, yeast vectors include an
origin of replication sequence and selectable marker. Suitable
promoter sequences for yeast vectors include promoters for
metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J.
Biol. Chem. 255:2073, 1980) or other glycolytic enzymes (Hess et
al., J. Adv. Enzyme Reg. 7:149, 1968; and Holland et al., Biochem.
17:4900, 1978), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. Other
suitable vectors and promoters for use in yeast expression are
further described in Hitzeman, EPA-73,657.
[0100] Yeast vectors can be assembled, for example, using DNA
sequences from pBR322 for selection and replication in E. coli
(Amp.sup.r gene and origin of replication). Other yeast DNA
sequences that can be included in a yeast expression construct
include a glucose-repressible ADH2 promoter and .alpha.-factor
secretion leader. The ADH2 promoter has been described by Russell
et al. (J. Biol. Chem. 258:2674, 1982) and Beier et al. (Nature
300:724, 1982). The yeast .alpha.-factor leader sequence directs
secretion of heterologous polypeptides. The .alpha.-factor leader
sequence is often inserted between the promoter sequence and the
structural gene sequence. See, e.g., Kurjan et al., Cell 30:933,
1982 and Bitter et al., Proc. Natl. Acad. Sci. USA 81:5330, 1984.
Other leader sequences suitable for facilitating secretion of
recombinant polypeptides from yeast hosts are known to those of
skill in the art. A leader sequence may be modified near its 3' end
to contain one or more restriction sites. This will facilitate
fusion of the leader sequence to the structural gene.
[0101] Yeast transformation protocols are known to those of skill
in the art. One such protocol is described by Hinnen et al., Proc.
Natl. Acad. Sci. USA 75:1929, 1978. The Hinnen et al. protocol
selects for Trp.sup.+ transformants in a selective medium, wherein
the selective medium consists of 0.67% yeast nitrogen base, 0.5%
casamino acids, 2% glucose, 10 .mu.g/ml adenine and 20 .mu.g/ml
uracil.
[0102] Yeast host cells transformed by vectors containing ADH2
promoter sequence may be grown for inducing expression in a "rich"
medium. An example of a rich medium is one consisting of 1% yeast
extract, 2% peptone, and 1% glucose supplemented with 80 .mu.g/ml
adenine and 80 .mu.g/ml uracil. Derepression of the ADH2 promoter
occurs when glucose is exhausted from the medium.
[0103] Mammalian or insect host cell culture systems could also be
employed to express recombinant CD40-L polypeptides. Examples of
suitable mammalian host cell lines include the COS-7 line of monkey
kidney cells (ATCC CRL 1651) (Gluzman et al., Cell 23:175, 1981), L
cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary
(CHO) cells, HeLa cells, and BHK (ATCC CRL 10) cell lines. Suitable
mammalian expression vectors include nontranscribed elements such
as an origin of replication, a promoter sequence, an enhancer
linked to the structural gene, other 5' or 3' flanking
nontranscribed sequences, such as ribosome binding sites, a
polyadenylation site, splice donor and acceptor sites, and
transcriptional termination sequences.
[0104] Transcriptional and translational control sequences for
mammalian host cell expression vectors may be excised from viral
genomes. For example, commonly used mammalian cell promoter
sequences and enhancer sequences are derived from Polyoma virus,
Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus.
DNA sequences derived from the SV40 viral genome, for example, SV40
origin, early and late promoter, enhancer, splice, and
polyadenylation sites may be used to provide the other genetic
elements required for expression of a structural gene sequence in a
mammalian host cell. Viral early and late promoters are
particularly useful because both are easily obtained from a viral
genome as a fragment which may also contain a viral origin of
replication (Fiers et al., Nature 273:113, 1978). Smaller or larger
SV40 fragments may also be used, provided the approximately 250 bp
sequence extending from the Hind III site toward the Bgl I site
located in the SV40 viral origin of replication site is
included.
[0105] Exemplary mammalian expression vectors can be constructed as
disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280, 1983). A
useful high expression vector, PMLSV N1/N4, described by Cosman et
al., Nature 312:768, 1984 has been deposited as ATCC 39890.
Additional useful mammalian expression vectors are described in
EP-A-0367566, and in U.S. patent application Ser. No. 07/701,415,
filed May 16, 1991, incorporated by reference herein. For
expression of a type II protein extracellular region, such as
CD40-L, a heteroldgous signal sequence should be added, such as the
signal sequence for interleukin-7 (IL-7) described in U.S. Pat. No.
4,965,195, or the signal sequence for interleukin-2 receptor
described in United States Patent Application 06/626,667 filed on
Jul. 2, 1984.
[0106] Human or murine CD40-L can be made in membrane-bound form
when an intracellular and transmembrane regions are included or in
soluble form with only the extracellular domain. We expressed full
length murine CD40-L in mammalian cells to yield cells expressing
membrane-bound murine CD40-L. CV1 cells were transfected with a
cDNA shown in FIGS. 1A and B (SEQ ID NO:1) in HAVEO vector or CV1
cells were transfected with HAVEO empty vector using techniques
described in Example 6 herein. This yielded transfected CV1 cells
expressing membrane-bound murine CD40-L. These cells were used as a
source of membrane-bound murine CD40-L for the series of
experiments reported in Examples 10-13 reported below.
[0107] Purification of Recombinant CD40-L Polypeptides
[0108] CD40-L polypeptides may be prepared by culturing transformed
host cells under culture conditions necessary to express CD40-L
polypeptides. The resulting expressed polypeptides may then be
purified from culture media or cell extracts. A CD40-L polypeptide,
if desired, may be concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. Following the concentration step,
the concentrate can be applied to a purification matrix such as a
gel filtration medium. Alternatively, an anion exchange resin can
be employed, for example, a matrix or substrate having pendant
diethylaminoethyl (DEAE) groups. The matrices can be acrylamide,
agarose, dextran, cellulose or other types commonly employed in
protein purification. Alternatively, a cation exchange step can be
employed. Suitable cation exchangers include various insoluble
matrices comprising sulfopropyl or carboxymethyl groups.
Sulfopropyl groups are preferred.
[0109] Finally, one or more reverse-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
(e.g., silica gel having pendant methyl or other aliphatic groups)
can be employed to further purify CD40-L. Some or all of the
foregoing purification steps, in various combinations, can also be
employed to provide a substantially homogeneous recombinant
protein.
[0110] It is also possible to utilize an affinity column comprising
CD40 ligand binding domain to affinity-purify expressed CD40-L
polypeptides. CD40-L polypeptides can be removed from an affinity
column in a high salt elution buffer and then dialyzed into a lower
salt buffer for use.
[0111] Recombinant protein produced in bacterial culture is usually
isolated by initial disruption of the host cells, centrifugation,
extraction from cell pellets if an insoluble polypeptide, or from
the supernatant fluid if a soluble polypeptide, followed by one or
more concentration, salting-out, ion exchange, affinity
purification or size exclusion chromatography steps. Finally,
RP-HPLC can be employed for final purification steps. Microbial
cells can be disrupted by any convenient method, including
freeze-thaw cycling, sonication, mechanical disruption, or use of
cell lysing agents.
[0112] Transformed yeast host cells are preferably employed to
express CD40-L as a secreted polypeptide. This simplifies
purification. Secreted recombinant polypeptide from a yeast host
cell fermentation can be purified by methods analogous to those
disclosed by Urdal et al. (J. Chromatog. 296:171, 1984). Urdal et
al. describe two sequential, reversed-phase HPLC steps for
purification of recombinant human IL-2 on a preparative HPLC
column.
[0113] Administration of CD40-L Compositions
[0114] The present invention provides therapeutic compositions
comprising an effective amount of CD40-L in a suitable diluent or
carrier and methods of treating mammals using the compositions. For
therapeutic use, purified CD40-L or a biologically active analog
thereof is administered to a patient, preferably a human, for
treatment in a manner appropriate to the indication. Thus, for
example, CD40-L pharmaceutical compositions (for example, in the
form of a soluble extracellular domain, or a fragment thereof)
which is administered to achieve a desired therapeutic effect can
be given by bolus injection, continuous infusion, sustained release
from implants, or other suitable technique. Typically, a CD40-L
therapeutic agent will be administered in the form of a
pharmaceutical composition comprising purified CD40-L polypeptide
in conjunction with physiologically acceptable carriers, excipients
or diluents. Such carriers will be nontoxic to patients at the
dosages and concentrations employed. Ordinarily, the preparation of
such compositions entails combining a CD40-L polypeptide with
buffers, antioxidants such as ascorbic acid, low molecular weight
(less than about 10 residues) polypeptides, proteins, amino acids,
carbohydrates including glucose, sucrose or dextrans, chelating
agents such as EDTA, glutathione and other stabilizers and
excipients. Neutral buffered saline or saline mixed with
conspecific serum albumin are exemplary appropriate diluents.
CD40-L sense or antisense oligonucleotides may be administered in
vivo by administering an effective amount of a vector containing a
nucleic acid sequence that encodes and effective antisense or sense
oligonucleotide. Additionally, CD40-L sense or antisense
oligonucleotides may be administered ex vivo by removing cells
containing CD40-L DNA or mRNA from an individual, incorporating an
antisense or sense oligonucleotide into the cells using gene
transfer techniques, and re-infusing the cells into the
individual.
[0115] The following examples are intended to illustrate particular
embodiments and not limit the scope of the invention.
EXAMPLE 1
[0116] This example describes construction of a CD40/Fc DNA
construct to express a soluble CD40/Fc fusion protein for use in
detecting cDNA clones encoding a CD40 ligand. The cDNA sequence of
the extracellular region or ligand binding domain of complete CD40
human receptor sequence was obtained using polymerase chain
reaction (PCR) techniques, and is based upon the sequence published
in Stamenkovic et al., supra. A CD40 plasmid (CDM8) was used as a
template for PCR amplification. CDM8 is described in Stamenkovic et
al. and was obtained from the authors. A PCR technique (Sarki et
al., Science 239:487, 1988) was employed using 5' (upstream) and 3'
(downstream) oligonucleotide primers to amplify the DNA sequences
encoding CD40 extracellular ligand binding domain. Upstream
oligonucleotide primer 5'-CCGTCGACCACCATGGTTCGTCTGCC-3' (SEQ ID
NO:5) introduces a Sal 1 site upstream from an initiator methionine
of CD40 and a downstream oligonucleotide primer
5'-ACAAGATCTGGGCTCTACGTATCTCAGCCGATCC- TGGGGAC-3' (SEQ ID NO:7)
that inserts amino acids Tyr Val Glu Pro Arg (SEQ ID NO:8) after
amino acid 193 of CD40. Glu and Pro are the first two amino acids
of a hinge region of human IgG1, and are followed by a Bgl II
restriction site that was used to fuse the extracellular domain of
CD40 to the remained of human IgG1 Fc region.
[0117] The DNA construct pDC406/CD40/Fc was transfected into the
monkey kidney cell line CV-1/EBNA (ATCC CRL 10478). The pDC406
plasmid includes regulatory sequences derived from SV40, human
immunodeficiency virus (FHV), and Epstein-Barr virus (EBV). The
CV-1/EBNA cell line was derived by transfection of the CV-1 cell
line with a gene encoding Epstein-Barr virus nuclear antigen-i
(EBNA-1) that constitutively expresses EBNA-1 driven from the human
CMV intermediate-early enhancer/promoter. The EBNA-1 gene allows
for episomal replication of expression vectors, such as pDC406,
that contain the EBV origin of replication.
[0118] Once cells expressing the fusion construct were identified,
large scale cultures of transfected cells were grown to accumulate
supernatant from cells expressing CD40/Fc. The CD40/Fc fusion
protein in supernatant fluid was purified by affinity purification.
Briefly, one liter of culture supernatant containing the CD40/Fc
fusion protein was purified by filtering mammalian cell
supernatants (e.g., in a 0.45.mu. filter) and applying filtrate to
a protein A/G antibody affinity column (Schleicher and Schuell,
Keene, N.H.) at 4.degree. C. at a flow rate of 80 ml/hr for a 1.5
cm.times.12.0 cm column. The column was washed with 0.5 M NaCl in
PBS (phosphate buffered saline) until free protein could not be
detected in wash buffer. Finally, the column was washed with PBS.
Bound fusion protein was eluted from the column with 25 mM citrate
buffer, pH 2.8, and brought to pH 7 with 500 mM Hepes buffer, pH
9.1. Silver-stained SDS gels of the eluted CD40/Fc fusion protein
showed it to be >98% pure.
[0119] Purified CD40/Fc fusion protein was iodinated with .sup.125I
using a commercially available solid phase agent (IODO-GEN,
Pierce). In this procedure, 5 .mu.g of IODO-GEN were plated at the
bottom of a 10.times.75 mm glass tube and incubated for twenty
minutes at 4.degree. C with 75 .mu.l of 0.1 M sodium phosphate, pH
7.4 and 20 .mu.l (2 mCi) Na.sup.125I. The solution was then
transferred to a second glass tube containing 5 .mu.g of CD40/Fc in
45 .mu.l PBS and this reaction mixture was incubated for twenty
minutes at 4.degree. C. The reaction mixture was fractionated by
gel filtration on a 2 ml bed volume of Sephadex.RTM. G-25 (Sigma),
and then equilibrated in RPMI 1640 medium containing 2.5% (v/v)
bovine serum albumin (BSA), 0.2% (v/v) sodium azide and 20 mM
Hepes, pH 7.4 binding medium. The final pool of .sup.125I CD40/Fc
was diluted to a working stock solution of 1.times.10.sup.-7 M in
binding medium and stored for up to one month at 4.degree. C.
without detectable loss of receptor binding activity.
[0120] Approximately 50%-60% label incorporation was observed.
Radioiodination yielded specific activities in the range of
1.times.10.sup.15 to 5.times.10.sup.15 cpm/nmole (0.42-2.0 atoms of
radioactive iodine per molecule of protein). SDS polyacrylamide gel
electrophoresis (SDS-PAGE) revealed a single labeled polypeptide
consistent with expected values. The labeled fusion protein was
greater than 98% trichloroacetic acid (TCA) precipitable,
indicating that the .sup.125I was covalently bound to the
protein.
EXAMPLE 2
[0121] This example describes selection of a cell line putatively
expressing CD40-L. Several cell lines were screened using the
radioiodinated CD40/Fc fusion protein described in Example 1.
Briefly, quantitative binding studies were performed according to
standard methodology, and Scatchard plots were derived for the
various cell lines. A clonal cell line (EL4, ATCC Catalog TIP 39) a
murine thymoma cell line was identified and sorted. Prior to
sorting, EL-4 cells were found to express approximately 450
molecules of CD40-L per cell. The seventh sort cells were called
EL-40.7 and were grown and found to express approximately 10,000
molecules of CD40-L per cell. Lastly, the ninth sort cells were
called EL-40.9 and were grown and found to express approximately
15,000 molecules of CD40-L per cell.
EXAMPLE 3
[0122] This example describes preparation of a cDNA library for
expression cloning of murine CD40-L. The library was prepared from
a fifth sorted clone of a mouse thymoma cell line EL-4 (ATCC TIB
39), called EL-40.5. EL-40.5 cells were EL4 cells sorted five times
with biotinylated CD40/Fc fusion protein in a FACS (fluorescence
activated cell sorter). A cDNA library was made from RNA obtained
from EL-40.5 cells essentially as described in U.S. Pat. No.
4,968,607, the disclosure of which is incorporated by reference
herein. Briefly, a cDNA library was constructed by reverse
transcription of poly (A).sup.+ mRNA isolated from the total RNA
extracted from the EL-40.5 cell line. The library construction
technique was substantially similar to that described by Ausubel et
al., eds., Current Protocols In Molecular Biology, Vol. 1, (1987).
Poly (A).sup.+ mRNA was isolated by oligo dT cellulose
chromatography and double-stranded cDNA was made substantially as
described by Gubler et al., Gene 25:263, 1983. Poly(A).sup.+ mRNA
fragments were converted to RNA-cDNA hybrids by reverse
transcriptase using random hexanucleotides as primers. The RNA-cDNA
hybrids were then converted into double-stranded cDNA fragments
using RNAase H in combination with DNA polymerase I. The resulting
double-stranded cDNA was blunt-ended with T4 DNA polymerase.
[0123] Sal I adaptors
[0124] 5'-TCG ACT GGA ACG AGA CGA CCT GCT-3'
[0125] GA CCT TGC TCT GCT GGA CGA-5'
[0126] were ligated to 5' ends of resulting blunt-ended cDNA, as
described in Haymerle et al., Nucleic Acids Res. 14:8615, 1986.
Non-ligated adaptors were removed by gel filtration chromatography
at 68.degree. C. This left 24 nucleotide non-self-complementary
overhangs on cDNA. The same procedure was used to convert 5' Sal I
ends of the mammalian expression vector pDC406 to 24 nucleotide
overhangs complementary to those added to cDNA. Optimal proportions
of adaptored vector and cDNA were ligated in the presence of T4
polynucleotide kinase. Dialyzed ligation mixtures were
electroporated into E. coli strain DH5.alpha. and transformants
selected on ampicillin plates.
[0127] Plasmid DNA was isolated from pools consisting of
approximately 2,000 clones of transformed E. coli per pool. The
isolated DNA was transfected into a sub-confluent layer of CV1-EBNA
cells using DEAE-dextran followed by chloroquine treatment
substantially according to the procedures described in Luthman et
al., Nucl. Acids Res. 11:1295, 1983 and McCutchan et al., J. Natl.
Cancer Inst. 41:351, 1986.
[0128] CV1-EBNA cells were maintained in complete medium
(Dulbecco's modified Eagles' media containing 10% (v/v fetal calf
serum, 50 U/ml penicillin, 50 U/ml streptomycin, and 2 mM
L-glutamine) and were plated to a density of approximately
2.times.10.sup.5 cells/well in single-well chambered slides
(Lab-Tek). The slides were pre-treated with 1 ml human fibronectin
(10 .mu.g/ml PBS) for 30 minutes followed by a single washing with
PBS. Media was removed from adherent cells growing in a layer and
replaced with 1.5 ml complete medium containing 66.6 .mu.M
chloroquine sulfate. About 0.2 ml of a DNA solution (2 .mu.g DNA,
0.5 mg/ml DEAE-dextran in complete medium containing chloroquine)
was added to the cells and the mixture was incubated at 37.degree.
C. for about five hours. Following incubation, media was removed
and the cells were shocked by addition of complete medium
containing 10% DMSO (dimethylsulfoxide) for 2.5-20 minutes.
Shocking was followed by replacement of the solution with fresh
complete medium. The cells were grown in culture for two to three
days to permit transient expression of the inserted DNA sequences.
These conditions led to a 30% to 80% transfection frequency in
surviving CV1-EBNA cells.
EXAMIPLE 4
[0129] This example describes screening of the expression cloning
library made in Example 3 with a labeled CD40/Fc fusion protein
made in Example 1. After 48-72 hours, transfected monolayers of
CV1-EBNA cells made in Example 3 were assayed by slide
autoradiography for expression of CD40-L using radioiodinated
CD40/Fc fusion protein as prepared in Example 1. Transfected
CV1-EBNA cells were washed once with binding medium (RPMI 1640
containing 25 mg/ml bovine serum albumin (BSA), 2 mg/ml sodium
azide, 20 mM Hepes pH 7.2, and 50 mg/ml nonfat dry milk) and
incubated for 2 hours at 4.degree. C. ml in binding medium
containing 1.times.10.sup.-9 M .sup.125I-CD40/Fc fusion protein.
After incubation, cells in the chambered slides were washed three
times with binding buffer, followed by two washes with PBS, (pH
7.3) to remove unbound radiolabeled fusion protein.
[0130] The cells were fixed by incubating in 10% gluteraldehyde in
PBS (30 minutes at room temperature), washed twice in PBS and
air-dried. The slides were dipped in Kodak GTNB-2 photographic
emulsion (6.times.dilution in water) and exposed in the dark for
two to four days days at room temperature in a light-proof box. The
slides were developed in Kodak D19 developer, rinsed in water and
fixed in Agfa G433C fixer. The slides were individually examined
under a microscope at 25-40.times. magnification. Positive slides
showing cells expressing CD40-L were identified by the presence of
autoradiographic silver grains against a light background.
[0131] One pool containing approximately 2000 individual clones was
identified as potentially positive for binding the CD40/Fc fusion
protein. The pool was titered and plated to provide plates
containing approximately 200 colonies each. Each plate was scraped
to provide pooled plasmid DNA for transfection into CV1-EBNA cells
according to the same procedure described above. The smaller pools
were screened by slide autoradiography as described previously. One
of the smaller pools contained clones that were positive for CD40-L
as indicated by the presence of an expressed gene product capable
of binding to the CD40/Fc fusion protein.
[0132] The positive smaller pool was titered and plated to obtain
individual colonies. Approximately 400 individual colonies were
picked and inoculated into culture medium in individual wells of
96-well plates. Cultures were mixed by pooling rows and columns and
the mixed cultures were used to prepare DNA for a final round of
transfection and screening. An intersection of a positive row and a
positive column indicated a potential positive colony. Ten
potential positive colonies (i.e., candidate clones) were
identified. DNA was isolated from each candidate clone,
retransfected and rescreened. Five candidate clones were positive
by binding to CD40/Fc. All five positive candidate clones contained
a cDNA insert of 1468 nucleotides, as determined by
dideoxynucleotide sequencing. The cDNA coding region of the CD40-L
clone corresponds to the sequence of FIGS. 1A and B and SEQ ID
NO:1.
[0133] A cloning vector containing, murine CD40-L sequence,
designated pDC406-mCD40-L, was deposited with the American Type
Culture Collection, Rockville, Md. (ATCC) on Dec. 6, 1991, under
accession number 68872. The nucleotide sequence and predicted amino
acid sequence of this clone are illustrated in SEQ ID NO: 1 and in
FIGS. 1A and B.
EXAMEPLE 5
[0134] This example illustrates a cross-species hybridization
technique which was used to isolate a human CD40-L homolog using a
probe designed from the sequence of murine CD40-L. A murine CD40-L
probe was produced by excising the coding region from murine CD40-L
clone pDC406-CD40-L (nucleotide 13 through 793) and
.sup.32P-labeling the fragment using random primers
(Boehringer-Mannheim).
[0135] A human peripheral blood lymphocyte (PBL) cDNA library was
constructed in a .lambda. phage vector using .lambda.gt10 arms and
packaged in vitro using a commercially available kit (Gigapak.RTM.
Stratagene, San Diego, Calif.) according to the manufacturer's
instructions. The PBL cells were obtained from normal human
volunteers and treated with 10 ng/ml of OKT3 (an anti-CD3
antibody), and 10 ng/ml of human IL-2 (Immunex, Seattle, Wash.) for
six days. The PBL cells were washed and stimulated with 500 ng/ml
ionomycin (Calbiochem) and 10 ng/ml PMA (phorbol myrsitate acetate;
Sigma, St. Louis, Mo.) for four hours. Messenger RNA and cDNA were
obtained from the stimulated PBL cells and packaged into
.lambda.gt10 phage vectors (Gigapak.RTM. Stratagene) according to
manufacturer's instructions.
[0136] The murine probe was hybridized to phage cDNA in 6.times.SSC
(15 mM trisodium citrate, and 165 mM sodium chloride), 1.times.
Denhardt's solution, 2 mM EDTA, 0.5% Np40 at 63.degree. C.
overnight. Hybridization was followed by extensive washing in
3.times.SSC, 0.1% SDS at approximately 55.degree. C. for three
hours. Specific bands were visualized by autoradiography.
[0137] A cloning vector containing human CD40-L sequence,
designated hCD40-L, was deposited with the American Type Culture
Collection, Rockville, Md. (ATCC) on Dec. 6, 1991, under accession
number 68873. The nucleotide sequence and predicted amino acid
sequence of this clone are illustrated SEQ ID NO:11 and in FIGS. 2A
and B.
EXAMPLE 6
[0138] This example illustrates the expression of membrane-bound
murine CD40-L in CV1-EBNA cells. Murine CD40-L cDNA in HAVEO vector
or empty HAVEO vector were transfected into CV1 EBNA cells using
standard techniques, such as those described in McMahan et al. et
al. EMBO J. 10:2821, 1991 and in Example 3 herein. Briefly, CV1
EBNA cells were plated at a density of 2.times.10.sup.6 cells per
10 cm dish in 10 ml of Dulbecco's Minimal Essential Medium
supplemented with 10% fetal calf serum (Medium). The cells were
allowed to adhere overnight at 37.degree. C. The Medium was
replaced with 1.5 ml of Medium containing 66.7 .mu.M chloroquine
and a DNA mixture containing 5 .mu.l of cDNA encoding mCD40-L.
Medium containing 175 .mu.l, and 25 .mu.l of DEAE dextran (4 mg/ml
in PBS) was also added to the cells. The cells and cDNA were
incubated at 37.degree. C. for 5 hours. The cDNA mixture was
removed and the cells were shocked with 1 ml of fresh Medium
containing 10% DMSO for 2.5 min. The Medium was replaced with fresh
Medium and the cells were grown for at least 3 days.
EXAMPLE 7
[0139] This example illustrates the preparation of monoclonal
antibodies to CD40-L. Preparations of purified murine CD40-L or
human CD40-L are prepared by COS cell expression and CD40/Fc
affinity purification as described herein. Purified CD40-L or
transfected cells expressing membrane-bound CD40-L can generate
monoclonal antibodies against CD40-L using conventional techniques,
for example, those techniques described in U.S. Pat. No. 4,411,993.
Briefly, mice are immunized with human CD40-L as an immunogen
emulsified in complete Freund's adjuvant or another suitable
adjuvant such as incomplete Freund's adjuvant or Ribi adjuvant R700
(Ribi, Hamilton, Mont.) or another suitable adjuvant, and injected
in amounts ranging from 10-100 .mu.g subcutaneously or
intraperitoneally. Rats (i.e. Lewis rats) are immunized with murine
CD40-L as an immunogen in a similar manner. Ten days to three weeks
later, the immunized animals are boosted with additional CD40-L
emulsified in incomplete Freund's adjuvant. Mice are periodically
boosted thereafter on a weekly, bi-weekly or every third week
immunization schedule. Serum samples are periodically taken by
retro-orbital bleeding or tail-tip excision for testing by dot blot
assay, ELISA (Enzyme-Linked Immunosorbent Assay), or FACS analysis,
for CD40-L antibodies.
[0140] Following detection of an appropriate antibody titer,
positive animals are provided one last intravenous injection of
CD40-L in saline. Three to four days later, the animals are
sacrificed, spleen cells harvested, and spleen cells are fused to a
murine myeloma cell line (e.g., NS1 or Ag 8.653). Fusions generate
hybridoma cells, which are plated in multiple microtiter plates in
a selective medium containing HAT (hypoxanthine, aminopterin and
thymidine) to inhibit proliferation of non-fused cells,
myeloma-myeloma hybrids, and spleen cell-spleen cell hybrids.
[0141] The hybridoma cells are screened by ELISA for reactivity
against purified CD40-L by adaptations of the techniques disclosed
in Engvall et al., Immunochem. 8:871, 1971 and in U.S. Pat. No.
4,703,004, or by or FACS as described herein. Positive hybridoma
cells can be cloned in soft agar or another, similar medium, or by
limiting dilution, to insure that a final cell population is
derived from a single hybridoma cell. The cloned hybridoma cells
are injected intraperitoneally into syngeneic mice (or rats) to
produce ascites containing high concentrations of anti-CD40-L
monoclonal antibodies. Alternatively, hybridoma cells can be grown
in vitro in flasks or roller bottles by various techniques.
Monoclonal antibodies produced in mouse ascites can be purified by
ammonium sulfate precipitation, followed by gel exclusion
chromatography. Alternatively, affinity chromatography based upon
binding of antibody to protein A or protein G can also be used, as
can affinity chromatography based upon binding to CD40-L.
EXAMPLE 8
[0142] This example illustrates anti-allergy therapeutic effects of
sCD40 and CD40/Fc fusion protein. Soluble CD40 and CD40/Fc were
tested for their ability to inhibit IL-4 (5 ng/ml) induced IgE
secretion in a two donor MLC system The data from three experiments
are presented in Table 1.
1TABLE 1 IgE (ng/ml) Addition Exp. 1 Exp. 2 Exp. 3 medium <0.1
<0.1 <0.1 IL-4 24 47 54 IL-4 + sCD40 (0.1 .mu.g/ml) 19 nd 38
IL-4 + sCD40 (0.3 .mu.g/ml) 14 29 24 IL-4 + sCD40 (1 .mu.g/ml) 10
24 8 IL-4 + sCD40 (3 .mu.g/ml) 7 19 2 IL-4 + IL-7R/Fc (10 .mu.g/ml)
21 nd 58
[0143] IgE levels were measured after 12 days in culture by an
ELISA procedure. Briefly, flat-bottomed 96-well microtiter plates
(Corning) were coated with mouse mAb anti-human IgE (Zymed) at
1:500 dilution in PBS (phosphate buffered saline). After washing
3.times., a blocking step was performed using 5% non-fat dried
milk, followed by titration of human IgE standards or test
supernatants. After washing 3.times., biotinylated goat anti-human
IgE (Kirkegaard and Perry) was added at a 1:500 dilution. This was
followed by further washing and then addition of streptavidin-HRP
(Zymed) at a 1:500 dilution. After further washing, the reaction
was developed using TMB substrate (Kirkegaard and Perry) and
absorbance measured at 520 nm. All washing steps were carried out
in PBS plus 0.05% Tween. All incubation steps were performed at
volumes of 100 .mu.l/well for one hour at room temperature. The
sensitivity of this assay is 100 pg/ml.
EXAMPLE 9
[0144] This example illustrates the effects of sCD40 and CD40/Fc
fusion protein to inhibit soluble CD23 shedding from IL-4 (5 ng/ml)
stimulated B cells. Soluble CD40 and CD40/Fc were tested for their
ability to inhibit IL-4-induced sCD23 shedding in a two donor MLC
system The data from three experiments are presented in Table
2.
2TABLE 2 sCD23 (ng/ml) Exp. 1 Exp. 2 Exp. 3 Addition day 6 day 12
day 6 day 12 day 6 day 12 E.sup.- + medium 55 <0.5 24 10 10 5
+IL-4 115 55 96 62 44 27 +IL-4 + sCD40 (1 .mu.g/ml) nd nd 88 36 38
9 +IL-4 + sCD40 (3 .mu.g/ml) 97 4 82 31 40 4 +IL-4 + sCD40 (10
.mu.g/ml) nd nd 72 28 nd nd +IL-4 + IL-7R/Fc (3 .mu.g/ml) 111 48
103 67 40 22 PBM + medium 12 <0.5 15 5 3 10 +IL-4 39 255 47 22
48 26 +IL-4 + sCD40 (1 .mu.g/ml) nd nd 44 18 46 18 +IL-4 + sCD40 (3
.mu.g/ml) 24 6 37 11 45 12 +IL-4 + sCD40 (10 .mu.g/ml) nd nd 28 5
nd nd +IL-4 + IL-7R/Fc (3 .mu.g/ml) 35 26 43 20 50 23
[0145] Soluble CD23 levels were measured after 6 and 12 days in
culture by a commercial sCD23 ELISA detection kit (Binding Site,
San Diego, Calif.). The sensitivity limit was 500 pg/ml.
Approximately 1.times.10.sup.5 cells per well were cultured in
triplicate in round-bottomed 96-well microtiter plates
(Intermountain Scientific, Bountiful Utah) for the indicated time
in the presence or absence of additives as indicated in Table 2.
The results show anti-allergy effects of sCD40. Similar studies
were run with CD40/Fc (data not shown) instead of sCD40, and
similar results were obtained. Accordingly, these data in Examples
8 and 9 illustrate an anti-allergy property for CD40.
EXAMPLE 10
[0146] This example illustrates B cell proliferative activity of
membrane-bound murine CD40-L for human B cells. Human peripheral
blood mononuclear cells (PBMC) were isolated from peripheral blood
from normal volunteers by density gradient centrifugation over
Histopaque.RTM. (Sigma, St. Louis, Mo.) T cell-depleted
preparations of cells (E.sup.-) were obtained by removing T cells
by rosetting with 2-aminoethylisothiouronium bromide-treated SRBC
(sheep red blood cells) and further density gradient centrifugation
over Histopaque.RTM.. B cell proliferation assays were conducted
with E.sup.- preparations in RPMI media with added 10%
heat-inactivated fetal bovine serum (FBS) at 37.degree. C. in a 10%
CO.sub.2 atmosphere. Approximately 1.times.10.sup.5 E.sup.- cells
per well were cultured in triplicate in flat-bottomed 96-well
microtiter plates (Corning) for 7 days in the presence of
transfected CV1 EBNA cells (described in Example 6). The CV1 EBNA
cells were transfected with murine CD40-L cDNA or empty vector. The
cells were pulsed with 1 .mu.Ci/well of tritiated thymidine (25
Ci/nmole Amersham, Arlington Heights, Ill.) for the final eight
hours of culture. Cells were harvested onto glass fiber discs with
an automated cell harvester and incorporated cpm were measured by
liquid scintillation spectrometry.
[0147] FIG. 4a shows a comparison of human B cell proliferation of
CV1 EBNA cells transfected with empty vector (HAVEO) or with murine
CD40-L cDNA in HAVEO vector. These data show that membrane-bound
CD40-L stimulates human B cell proliferation in the absence of a
co-mitogen. FIG. 4b shows a similar experiment, except that 10
ng/ml of human I-4 was added to the cultures. In this experiment,
IL-4 slightly enhances the B cell mitogenic activity of
membrane-bound murine CD40-L. FIG. 5 is a repeat of the experiment
shown in FIG. 4b. However, when the experiment was repeated, there
was no evidence of IL-4 co-mitogenic activity. There was repeated
evidence of CD40-L mitogenic activity. Accordingly, membrane-bound
CD40-L stimulates proliferation of human B cells.
EXAMPLE 11
[0148] This example illustrates the effect of membrane-bound murine
CD40-L to stimulate IgE production and CD23 shedding from E.sup.-
cells isolated in Example 10. Approximately 1.times.10.sup.5
cells/well were cultured in triplicate round bottomed 96-well Nunc
microtiter plates (Intermountain Scientific, Bountiful Utah) in
Iscove's Modified Dulbecco's Medium (IMDM) plus 10% FCS in a
humidified atmosphere of 10% CO.sub.2. Medium was supplemented with
50 .mu.g/ml human transferrin (Sigma), 0.5% bovine serum albumin
(Sigma) and 1 .mu.g/ml of each of oleic, linoleic and palmitic
acids (Sigma). The E.sup.- cells were cultured for 10 days in the
presence of 5 ng/ml human IL-4. A titration of CV1 EBNA cells
transfected with murine CD40-L or empty vector were added. After
ten days, culture supernatants were assayed for IgE by the ELISA
procedure described in Example 8 or for CD23 shedding by the
procedure described in Example 9.
[0149] FIG. 6 shows a comparison of IgE production in the
supernatants (in ng/ml) for cultures of E.sup.- cells and CV1 EBNA
cells transfected with empty vector (HAVEO) or with CD40-L. No
differences were noted with up to 3000 CV1 EBNA cells, however
significant IgE production resulted with the addition of 10000 or
30000 CD40-L transfected CV1 EBNA cells. As a comparison, when
E.sup.- cells were incubated with medium alone, 5 ng/ml IL-4 or 5
ng/ml IL-4 plus 500 ng/ml G28-5 antibody, IgE production was 4.7,
2.9 and >600 ng/ml, respectively. When CD23 shedding was
measured in FIG. 7, 10000 and 30000 CV1 EBNA cells transfected with
CD40-L showed increased CD23 shedding when compared to empty vector
control CV1 EBNA cells. As a comparison, when E.sup.- cells were
incubated with medium alone, 5 ng/ml IL-4 or 5 ng/ml IL-4 plus 500
ng/ml G28-5 antibody, CD23 shedding was <0.1, 2.4 and 11.2
ng/ml, respectively. These data show that IgE production and CD23
shedding are both biological activities associated with
membrane-bound CD40-L.
EXAMPLE 12
[0150] This example illustrates B cell proliferative activity,
polyclonal immunoglobulin (Ig) production, antigen-specific
antibody formation and various method for using membrane-bound and
soluble CD40-L in clinical applications. We obtained murine splenic
B cells according to procedures described in Grabstein et al. I
supra, Maliszewski et al. I supra and Maliszewski et al. II supra.
Briefly, the mixed culture of cells was purified by T cell
depletion using T cell antiserum and complement, and adherent cell
depletion by passage of Sephadex.RTM. G10 columns and by B cell
positive selection by panning on petri dishes coated with goat
anti-mouse IgM. Purified B cells were cultured in RPMI, fetal calf
serum (5% for B cell proliferation assays and 20% for plaque
forming cell assays or polyclonal antibody assays),
2-mercaptoethanol, antibiotics, amino acids and pyruvate. B cell
proliferation was measured according to the assay described in
Example 10 and in Grabstein et al. I supra, Maliszewski et al. I
supra and Maliszewski et al. II supra. Antigen-specific antibody
formation was measured by the procedure described in Grabstein et
al., J. Mol. Cell. Imnmunol. 2:199, 1986 [Grabstein et al. II].
Briefly, antigen specific antibody formation used sheep red blood
cells (SRBC) as antigen (0.03% v/v) in 2.0 ml cultures of
1.times.10.sup.6 murine B cells per culture. The B cell cultures
were incubated for 5 days and plaque forming cells were determined
by Jerne hemolytic plaque assay as described in Grabstein et al. II
supra. Cell counts were determined in a coulter counter. Polyclonal
Ig secretion was determined by isotype-specific ELISA assays in
seven day cultures of 1.times.10.sup.6 B cells per 2.0 ml culture
as described in Maliszewski et al. I supra and Maliszewski et al.
II supra.
[0151] The results of B cell proliferation by CV1 EBNA cells
transfected with CD40-L or empty vector or 7A1 cells (a T cell
helper clone) are shown in FIGS. 8, 10 and 12. These data show that
the greatest B cell proliferation was caused by CD40-L. T cell
helper cells 7A1 and 7C2 had a minimal effect on B cell
proliferation.
[0152] The effects of various cells upon antigen specific antibody
formation are shown in FIGS. 9 and 11. FIG. 9 shows a comparison of
plaque forming cells comparing T cell helper clone 7A1 and murine
EL40.9 cells which secrete a soluble CD40-L. The EM40.9 cells seem
to have an inhibitory effect upon antigen specific antibody
formation. FIG. 11 shows PFC (plaque forming cells) for T cell
helper cells 7C2 and CV1 EBNA cells transfected with either empty
vector or CD40-L. Both 7C2 cells and membrane-bound CD40-L
stimulated antigen specific antibody formation (PFC). FIG. 13
compares antigen specific antibody formation of CD40-L and 7A1
cells in the presence or absence of 10 ng/ml interleukin-2 (IL-2).
IL-2 increased PFC for 7A1 cells but did not increase PFC caused by
membrane-bound CD40-L.
[0153] Polyclonal Ig production by murine B cells was compared for
stimulation or inhibition with membrane-bound CD40-L, control CV1
EBNA cells and helper T cells 7A1 in the presence of cytokines IL-4
(10 ng/ml) and IL-5 (1:40 dilution of COS cell supernatants) or
without added cytokines.The amount of IgA, IgG3, IgE, IgG2b, IgM
and IgG1 are shown in Tables 3-8, respectively.
3TABLE 3 IgA, ng/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 666.275 .+-. 174.444 64.639 .+-. 51.780 1 .times. 10(5)
288.085 .+-. 20.773 291.831 .+-. 10.673 1 .times. 10(4) 53.750 .+-.
36.531 910.072 .+-. 62.713 HAVEO 2 .times. 10(5) 0 628.190 .+-.
42.907 1 .times. 10(5) 0 477.755 .+-. 57.478 1 .times. 10(4) 0
295.640 .+-. 12.736 7A1 (2C11) 1 .times. 10(6) 0 2177.549 .+-.
377.052 2 .times. 10(5) 0 646.898 .+-. 86.325 1 .times. 10(5) 0
480.671 .+-. 40.011 MEDIA 0 458.152 .+-. 77.258 LPS 88.531 .+-.
31.248 132.336 .+-. 51.356
[0154]
4TABLE 4 IgG3, ng/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 108.427 .+-. 14.359 0 1 .times. 10(5) 118.079 .+-. 8.021
46.535 .+-. 9.899 1 .times. 10(4) 127.591 .+-. 6.268 467.023 .+-.
78.276 HAVEO 2 .times. 10(5) 0 29.773 .+-. 5.224 1 .times. 10(5)
11.205 .+-. 4.434 66.323 .+-. 8.673 1 .times. 10(4) 26.389 .+-.
10.221 34.671 .+-. 12.975 7A1 (2C11) 1 .times. 10(6) 33.420 .+-.
9.972 820.856 .+-. 39.442 2 .times. 10(5) 0 436.074 .+-. 59.332 1
.times. 10(5) 0 239.760 .+-. 45.978 MEDIA 21.808 .+-. 7.107 64.773
.+-. 13.924 LPS 816.697 .+-. 43.553 103.720 .+-. 11.883
[0155]
5TABLE 5 IgE, ng/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 0 64.144 .+-. 4.979 1 .times. 10(5) 0 83.493 .+-. 9.093 1
.times. 10(4) 0 461.155 .+-. 60.514 HAVEO 2 .times. 10(5) 0 0 1
.times. 10(5) 0 4.208 .+-. .527 1 .times. 10(4) 0 0 7A1 (2C11) 1
.times. 10(6) 0 208.091 .+-. 8.090 2 .times. 10(5) 0 32.530 .+-.
0.723 1 .times. 10(5) 0 15.889 .+-. 2.947 MEDIA 0 12.602 .+-. 1.460
LPS 0 408.355 .+-. 9.764
[0156]
6TABLE 6 IgG2b, ng/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 0 0 1 .times. 10(5) 0 6.230 .+-. .285 1 .times. 10(4) 0
47.414 .+-. .241 HAVEO 2 .times. 10(5) 0 7.001 .+-. 2.358 1 .times.
10(5) 0 6.230 .+-. 2.285 1 .times. 10(4) 0 9.620 .+-. 2.650 7A1
(2C11) 1 .times. 10(6) 0 189.343 .+-. 2.837 2 .times. 10(5) 0
22.431 .+-. 6.835 1 .times. 10(5) 0 7.207 .+-. 1.580 MEDIA 0 7.422
.+-. 1.602 LPS 0 33.291 .+-. 3.183
[0157]
7TABLE 7 IgM, .mu.g/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 1.805 .+-. 0.639 0.439 .+-. 0.184 1 .times. 10(5) 2.237 .+-.
0.583 5.878 .+-. 0.858 1 .times. 10(4) 2.293 .+-. 0.595 96.730 .+-.
13.009 HAVEO 2 .times. 10(5) 0 10.890 .+-. 2.126 1 .times. 10(5) 0
13.303 .+-. 0.993 1 .times. 10(4) 0.624 .+-. 0.178 22.538 .+-.
2.304 7A1 (2C11) 1 .times. 10(6) 0.769 .+-. 0.124 104.857 .+-.
17.463 2 .times. 10(5) 0.142 .+-. 0.052 27.016 .+-. 1.706 1 .times.
10(5) 0.126 .+-. 0.048 13.070 .+-. 0.600 MEDIA 0.231 .+-. 0.057
36.809 .+-. 2.860 LPS 53.302 .+-. 9.668 41.974 .+-. 6.158
[0158]
8TABLE 8 IgG1, ng/ml # CELLS MEDIA +IL-4 + IL-5 CD40-L 2 .times.
10(5) 0 130.185 .+-. 24.547 1 .times. 10(5) 0 310.588 .+-. 1.261 1
.times. 10(4) 0 270.727 .+-. 17.511 HAVEO 2 .times. 10(5) 0 187.668
.+-. 57.730 1 .times. 10(5) 0 43.320 .+-. 49.770 1 .times. 10(4) 0
1363.464 .+-. 45.841 7A1 (2C11) 1 .times. 10(6) 0 145.652 .+-.
136.070 2 .times. 10(5) 0 365.563 .+-. 24.276 1 .times. 10(5) 0
449.475 .+-. 101.012 MEDIA 0 133.660 .+-. 386.231 LPS 0 246.213
.+-. 21.526
[0159] These data indicate that the interaction of CD40 with its
ligand is the principal molecular interaction responsible for T
cell contact dependent induction of B cell growth and
differentiation to both antigen-specific antibody production and
polyclonal Ig secretion. As such, these data suggest that
antagonists of this interaction, by soluble CD40, CD40/Fc fusion
protein and possibly soluble CD40-L (monomeric), will significantly
interfere with development of antibody responses. Therefore
clinical situations where CD40, CD40/Fc fusion proteins and soluble
CD40-L are suitable include allergy, lupus, rheumatoid arthritis,
insulin dependent diabetes mellitus, and any other diseases where
autoimmune antibody or antigen/antibody complexes are responsible
for clinical pathology of the disease. Moreover, membrane-bound
CD40-L or oligomeric soluble CD40-L will be useful to stimulate B
cell proliferation and antibody production. As such, these forms of
CD40-L are most useful for vaccine adjuvants and as a stimulating
agent for mAb secretion from hybridoma cells.
EXAMPLE 13
[0160] This example illustrates the effect of membrane-bound CD40-L
upon proliferation of and IgE secretion from peripheral blood
mononuclear cells (E.sup.-). E.sup.- cells were obtained according
to the procedure described in Example 10 and incubated for 7 or 10
days in the presence of CV1 EBNA cells transfected with empty
vector or mCD40-L cDNA. Additionally, CD40/Fc fusion protein
(described in Example 1) or TNF Receptor/Fc fusion protein
(described in WO 91/03553) was added to some of, the preparations
as indicated in FIG. 14. IgE secretion was measured according to
the procedure described in Example 8 and B cell proliferation was
measured according to the procedure described in Example 10.
[0161] The results for B cell proliferation and IgE secretion are
shown in FIG. 14 for five different concentrations of transfected
CV1 EBNA cells. Both B cell proliferation and IgE secretion were
increased in the presence of membrane-bound CD40-L. Addition of
CD40/Fc fusion protein ablated both B cell proliferation and IgE
secretion. The TNF Receptor/Fe fusion protein had no effect. As a
comparison for IgE secretion, addition of IL-4 as a control agent
(without transfected CV1 EBNA cells) produced no IgE in this assay
and addition of IL-4 plus G28-5 anti-CD40 mAb resulted in 29.7
ng/ml IgE in this assay.
EXAMPLE 14
[0162] This example describes construction of a CD40-L/Fc DNA
construct to express a soluble CD40-L/Fc fusion protein referred to
as CD40-L/FC2 construct. DNA encoding CD40-L/FC2 comprises
sequences encoding a leader (or signal) peptide, an eight amino
acid hydrophilic sequence described by Hopp et al. (Hopp et al.,
Bio/Technology 6:1204,1988; referred to as Flag.RTM.), a suitable
Fc region of an immunoglobulin, a [Gly.sub.4Ser].sub.3 repeat
sequence (described in U.S. Pat. No. 5,073,627, which is
incorporated by reference herein) or other suitable linker
sequence, and the extracellular region of human CD40-L from amino
acid 50 to amino acid 261 (SEQ ID NO:11). A pDC406 expression
vector containing a leader sequence, Flag.RTM., and human IgG.sub.1
Fc is prepared using conventional techniques of enzyme cutting and
ligation of fragments encoding a leader sequence, Flag.RTM., and
human IgG.sub.1 Fc, and restricted with Nsi 1 and Not 1.
[0163] A PCR technique (Saiki et al., Science 239:487, 1988) was
employed using 5' (upstream) and 3' (downstream) oligonucleotide
primers to amplify the DNA sequences encoding CD40 extracellular
ligand binding domain from a cloning vector containing human CD40-L
(ATCC 68873; SEQ ID NO:11) to form a PCR fragment. The upstream
oligonucleotide primer (SEQ ID NO:13) introduced a Nsi 1 site
upstream from a linker sequence ([Gly.sub.4Ser].sub.3SerSer), which
was followed by 21 nucleotides of the extracellular domain of
CD40-L (amino acids 51 through 57 of SEQ ID NO:11). A downstream
oligonucleotide primer (SEQ ID NO:14) introduced a Not 1 site just
downstream of the termination codon of the CD40-L. The PCR fragment
was then ligated into the pDC406 expression vector containing a
leader sequence, Flag.RTM., and human IgG.sub.1 Fc. The nucleotide
and predicted amino acid sequence of CD40-L/FC2 are presented in
SEQ ID) NO: 15 and SEQ ID NO:16. The resultant DNA construct
(CD40-L/FC2) was transfected into the monkey kidney cell line
CV-1/EBNA (ATCC CRL 10478). The construct encoded a soluble CD40-L
capable of binding CD40, as evidenced by binding observed in
fluorescence-activated cell sorting (FACS) analysis using cells
that express CD40.
[0164] Large scale cultures of human embryonic kidney 293 cells
(ATCC CRL 1573) transfected with the construct encoding CD40-L/FC2
were grown to accumulate supernatant containing CD40-L/FC2. The 293
cell line, a permanent line of primary human embryonal kidney
transformed by human adenovirus 5 DNA, permits expression of
recombinant proteins ligated into the pCD406 vector. The CD40-L/FC2
fusion protein in supernatant fluid was purified by affinity
purification. Briefly, culture supernatant containing the
CD40-L/FC2 fusion protein was purified by filtering mammalian cell
supernatants (e.g., in a 0.45.mu. filter) and applying filtrate to
an antibody affinity column comprising biotinylated goat anti-human
IgG (Jackson Imnunoresearch Laboratories, Inc., Westgrove, Pa.,
USA) coupled to Streptavidin-agarose (Pierce Chemical, Rockford,
Ill., USA) at 4.degree. C., at a flow rate of approximately 60 to
80 ml/hr for a 1.5 cm.times.12.0 cm column. The column was washed
with approximately 20 column volumes of PBS (phosphate buffered
saline), until free protein could not be detected in wash buffer.
Bound fusion protein was eluted from the column with 12.5 mM
citrate buffer, 75 mM NaCl, pH 2.8, and brought to pH 7 with 500 mM
Hepes buffer, pH 9.1. The purified, oligomeric CD40-L/FC2 peptide
induced human B cell proliferation in the absence of any
co-stimuli, and (in conjunction with the appropriate cytokine)
resulted in the production of IgG, IgE, IgA and IgM, as described
in Example 12 for membrane-bound CD40-L.
EXAMPLE 15
[0165] This example describes construction of a CD40-L DNA
construct to express a soluble CD40-L fusion protein referred to as
trimeric CD40-L. Trimeric CD40-L contains a leader sequence, a 33
amino acid sequence referred to as a "leucine zipper" or
oligomerizing zipper (SEQ ID NO:17), and an eight amino acid
hydrophilic sequence described by Hopp et al. (Hopp et al.,
Bio/Technology 6:1204,1988; referred to as Flag.RTM.), followed by
the extracellular region of human CD40-L from amino acid 50 to
amino acid 261 (SEQ ID NO:11). The utility of the leader and the
Flag.RTM. sequences have been described in the Detailed
Description. The 33 amino acid sequence presented in SEQ ID NO:17
trimerizes spontaneously in solution. Fusion proteins comprising
this 33 amino acid sequence are thus expected to form trimers or
multimers spontaneously.
[0166] The construct is prepared by synthesizing oligonucleotides
representing a leader sequence, the 33 amino acid sequence
described above, and the Flag.RTM. sequence, then ligating the
final product to a DNA fragment encoding amino acids 51 through 261
of SEQ ID NO:11, prepared as described in Example 14.
[0167] The resulting ligation product in expression vector pDC406
was transfected into the monkey kidney cell line CV-1/EBNA (ATCC
CRL 10478). The pDC406 plasmid includes regulatory sequences
derived from SV40, human immunodeficiency virus (HIV), and
Epstein-Barr virus (EBV). The CV-1/EBNA cell line was derived by
transfection of the CV-1 cell line with a gene encoding
Epstein-Barr virus nuclear antigen-1 (EBNA-1) that constitutively
expresses EBNA-1 driven from the human CMV intermediate-early
enhancer/promoter. The EBNA-1 gene allows for episomal replication
of expression vectors, such as pDC406, that contain the EBV origin
of replication.
[0168] Once cells expressing the fusion construct are identified,
large scale cultures of transfected cells are grown to accumulate
supernatant from cells expressing trimeric CD40-L. The trimeric
CD40-L fusion protein in supernatant fluid is purified by affinity
purification substantially as described in U.S. Pat. No. 5,011,912.
Silver-stained SDS gels of the eluted CD40-L fusion protein can be
prepared to determine purity.
EXAMPLE 16
[0169] This example describes two solid-phase binding assays, the
first of which, (a), can be used to asses the ability of trimeric
CD40-L to bind CD40, and the second of which, (b), is used to
detect the presence of CD40-L.
[0170] (a) Quantitative CD40-L ELISA
[0171] CD40/Fc is prepared and purified as described Example 1, and
used to coat 96-well plates (Coming EasyWash ELISA plates, Corning,
N.Y., USA). The plates are coated with 2.5 .mu.g/well of CD40/Fc in
PBS overnight at 4.degree. C., and blocked with 1% non-fat milk in
PBS for 1 hour at room temperature. Samples to be tested are
diluted in 10% normal goat serum in PBS, and 50 .mu.l is added per
well. A titration of unknown samples is run in duplicate, and a
titration of reference standard of CD40-L is run to generate a
standard curve. The plates are incubated with the samples and
controls for 45 minutes at room temperature, then washed four times
with PBS. Second step reagent, rabbit anti-oligomerizing zipper, is
added (50 .mu.l/well, concentration approximately 2.5 .mu.g/ml),
and the plates are incubated at room temperature for 45 minutes.
The plates are again washed as previously described, and goat
F(ab')2 anti-rabbit IgG conjugated to horseradish peroxidase (Tago,
Burlingame, Calif., USA) is added. Plates are incubated for 45
minutes at room temperature, washed as described, and the presence
of CD40-L is detected by the addition of chromogen, tetramethyl
benzidene (TMB; 100 .mu.l/well) for 15 minutes at room temperature.
The chromogenic reaction is stopped by the addition of 100
.mu.l/well 2N H.sub.2SO.sub.4, and the OD.sub.450-OD.sub.562 of the
wells determined. The quantity of trimeric CD40-L can be determined
by comparing the OD values obtained with the unknown samples to the
values generated for the standard curve. Values are expressed as
the number of binding units per ml. A binding unit is roughly one
ng of protein as estimated using a purified Fc fusion protein of
the ligand as a standard. In this manner, the concentration and
specific activity of several different batches of trimeric CD40-L
purified as described in Example 19 have been determined.
[0172] (b) Qualitative Dot Blot
[0173] CD40-L trimer (1 .mu.l of crude supernatant or column
fractions) is adsorbed to dry BA85/21 nitrocellulose membranes
(Schleicher and Schuell, Keene, N.H.) and allowed to dry. The
membranes are incubated in tissue culture dishes for one hour in
Tris (0.05 M) buffered saline (0.15 M) pH 7.5 containing 1% w/v BSA
to block nonspecific binding sites. At the end of this time, the
membranes are washed three times in PBS, and rabbit
anti-oligomerizing zipper antibody is added at an approximate
concentration of 10 .mu.g/ml in PBS containing 1% BSA, following
which the membranes are incubated for one hour at room temperature.
The membranes are again washed as described, and a horseradish
peroxidase (HRP)-labeled antibody (such as goat anti-rabbit Ig;
Southern Biotech, Birmingham, Ala.) at an approximate dilution of
1:1000 in PBS containing 1% BSA is added. After incubating for one
hour at room temperature, the membranes are washed and chromogen
(i.e. 4-chloronaphthol reagent, Kirkegard and Perry, Gaithersburg,
Md.) is added. Color is allowed to develop for ten minutes at room
temperature, and the reaction is stopped by rinsing the membranes
with water. The membranes are washed, and the presence of CD40-L is
determined by analyzing for the presence of a blue-black color.
This assay was used to determine the presence or absence of
trimeric CD40-L in cell culture supernatant fluids and in
purification column fractions. The assay further provides a
semi-quantitative method of determining relative amounts of
trimeric CD40-L by comparing the intensity of the color in unknown
samples to theiintensity of known quantities of controls.
EXAMPLE 17
[0174] This example describes construction of a human CD40-L DNA
construct to express trimeric CD40-L in Chinese hamster ovary (CHO)
cells. As described in Example 15, trimeric CD40-L contains a
leader sequence, and a 33 amino acid sequence referred to as an
oligomerizing zipper (SEQ ID NO:17), followed by the extracellular
region of human CD40-L from amino acid 51 to amino acid 261 (SEQ ID
NO:11). The construct was prepared by cutting the appropriate DNA
from the a plasmid containing human CD40-L (derived from the
plasmid described in Example 15), and ligating the DNA into the
expression vector pCAVDHFR. The resultant construct was referred to
as CAV/DHFR-CD40LT. pCAVDHFR includes regulatory sequences derived
from cytomegalovirus, SV40, and Adenovirus 2, along with the gene
for dihydrofolate reductase (DHFR), and allows random integration
of a desired gene into host cell chromosomes. Expression of DHFR
enables the DHFR-host cells to grow in media lacking glycine,
hypoxanthine, and thymidine (GHT). A similar construct was also
made for expression of murine CD40-L timer in CHO cells. In
addition to the leader and oligomerizing zipper sequences, the
murine construct also contained a sequence encoding the octapeptide
referred to as Flag.RTM. (described previously) between the
trimerization domain ("leucine zipper" or oligomerizing zipper) and
the extracellular region of murine CD40-L. The nucleotide and amino
acid sequence of the human and murine trimeric CD40-L-encoding DNAs
are shown in SEQ ID NOs 20 and 22 respectively. Additional
constructs can be prepared using standard methods. For example,
vectors which incorporates dual promoters such as those described
in U.S. Pat. No. 4,656,134, or vectors employing enhancer sequences
such as those described in U.S. Pat. No. 4,937,190 or in Kaufman et
al., Nucl. Acids Res. 19:4485, 1991, are also useful in preparing
constructs for expression of CD40-L in CHO cells.
[0175] The resulting ligation product was transfected into CHO
cells using either Lipofectin.RTM. Reagent or Lipofectamine.TM.
Reagent (Gibco BRL, Gaithersburg, Md.). Both of these reagents are
commercially available reagents used to form lipid-nucleic acid
complexes (or liposomes) which, when applied to cultured cells,
facilitate uptake of the nucleic acid into the cells. Cells which
were transfected with the pCAVDHFR-CD40LT construct were selected
in DMEM:F12 medium in the absence of GHT. Cells which were able to
grow in the absence of GHT were tested for production of CD40-L
using a solid phase binding assay as described in Example 16.
Results indicated that in this transfection system,
Lipofectamine.TM. Reagent gave higher rates of successful
transfection.
[0176] Approximately 160 clones were screened and two positive
clones were identified and expanded for further study. Cells were
passaged in GHT-free DMEM:F12 medium, and monitored for stability
by assessing production of trimeric CD40-L in the solid-phase
binding assay described above. Based on these results, one clone
was chosen which appeared to be stabley transfected with the CD40-L
DNA, and which produced and secreted approximately 1 .mu.g/10.sup.6
cells/day of CD40-L trimer. Additional constructs comprising other
vectors and all or a portion of the DNA sequences described in this
example can be used to prepare additional stably transfected cell
lines, substantially as described herein. For example, constructs
encoding monomeric CD40-L similar to those described in Example 18
can be prepared, as can plasmids encoding any of the previously
described constructs.
[0177] Once such stably transfected cells were identified, large
scale cultures of transfected cells were grown to accumulate
supernatant containing trimeric CD40-L. Suitable large-scale
culture conditions include the use of bioreactors, as described
below in Example 19. Similar procedures were followed to produce
CHO cell lines that secreted a trimeric murine CD40-L at
approximately 0.05 .mu.g/10.sup.6 cells/day. CHO cells stably
transfected with either the human or murine CD40-L construct,
having acquired a DHFR gene from the pCAVDHFR plasmid, are
resistant to methotrexate. Methotrexate can be added to the culture
medium to amplify the number of copies of the CD40-L trimer DNA in
order to increase production of CD40-L trimer.
EXAMPLE 18
[0178] This example describes construction of a murine CD40-L DNA
construct to express a soluble CD40-L protein referred to as
monomeric CD40-L. Monomeric CD40-L contains a leader sequence, an
eight amino acid sequence referred to as Flag.RTM. (amino acids 1-8
of SEQ ID NO:16), followed by the amino terminal truncated region
of CD40-L encompassing the extracellular B-sheet forming region of
the CD40 molecule from amino acid 119 to 260 of SEQ ID NO:1
(corresponding to amino acids 120 through 261 of human CD40-L, SEQ
ID NO:12). A 68 amino acid stretch of the extracellular spacer
region of the CD40-L molecule (amino acids 51-118 of SEQ ID NO:1)
has been deleted in this construct, as has the transmembrane region
(amino acids 1-50 of SEQ ID NO:1).
[0179] A PCR technique using 5' (upstream) and 3' (downstream)
oligonucleotide primers was used to amplify the DNA sequences
encoding the CD40-L truncated extracellular domain from a cloning
vector containing murine CD40-L. The upstream oligonucleotide
primer (ATATGAATTCGACTACAAAGATGACGATGATAAACCTCAAATTGCAGCACACGTT;
SEQ ID NO:18) appended an EcoRI site and the Flag coding sequence
upstream from CD40 nucleotide 355. The downstream oligonucleotide
primer (CCTTCGCGGCCGCGTTCAGAGTTT GAGTAAGCCAA, SEQ ID NO: 19)
introduced a Not 1 site downstream of the authentic termination
codon of the CD40L.
[0180] The PCR fragment was ligated into the multiple cloning site
(EcoRI/NotI) of the baculovirus expression vector pAcGP67A
(PharMingen, San Diego, Calif.) which contains the signal sequence
for a glycoprotein of the Autographica californica nuclear
polyhedrosis virus under the control of the viral polyhedrin
promoter. The resultant DNA construct was cotransfected with
Autographica californica viral DNA into Spodoptera frugiperda cells
(SF21), and the resultant recombinant virus was plaque
purified.
[0181] The CD40-L protein encoded by this construct was purified by
Flag.RTM. affinity chromatography from serum free culture of
recombinant virus infected cells. Purified protein had an apparent
molecular weight of 21 Kd when run in a reducing PAGE and stained
with Coomasie Blue. Both crude infected cell supernatants
containing CD40-L and affinity purified CD40-L protein showed
receptor binding activity in a solid phase assay utilizing the
CD40Fc recombinant receptor. Mock infected controls had no
activity.
[0182] A similar CD40-L construct was made without an amino
terminal Flag.RTM. sequence. This construct utilized an existing
Bam HI site at nucleotide 351 in the CD40-L sequence and the
downstream PCR oligonucleotide primer described above (SEQ ID
NO:19). After amplification of the CD40 sequence with a 5' upstream
oligonucleotide homologous to CD40-L nucleotides 324-346, and the
downstream primer which introduced a Not I site, the PCR product
was cut with Bam HI and Not I and ligated into pAcGP67A cut with
Bam HI and NotI. This construct was cotransfected into SF21 cells
along with viral DNA as previously described, and recombinant virus
was plaque purified, expanded and used to infect insect cells to
produce serum free conditioned supernatants. CD40-L was detectable
in these crude supernatants by both CD40Fc receptor binding assay
and by detection of an 18 Kd band on a Coomassie Blue-stained PAGE.
Similar copnstructs were also prepared for human CD40-L.
EXAMPLE 19
[0183] This example describes purification of trimeric murine CD40L
from supernatant fluid from transfected CHO cells. A CHO cell line
expressing muCD40LT was maintained in suspension in spinner-flask
cultures. For production, the cells were centrifuged and
resuspended into a controlled 3 liter bioreactor in serum-free
medium. Oxygen, agitation and pH were controlled for at 40%
dissolved O.sub.2 (relative to air saturation), 150 RPM and 7.2,
respectively. The culture was harvested after nine days. A total
volume of approximately 160 ml of supernatant fluid from the
bioreactor was dialyzed overnight at 4.degree. C. against 4 L of 20
mM Tris pH 7.5 buffer containing 150 mM NaCl, and then adjusted to
1M (N).sub.2SO.sub.4 by the addition of solid
(NH.sub.4).sub.2SO.sub.4. Dialysis accomplished the removal of
low-molecular weight contaminants; other techniques will also be
useful for this purpose, for example, constant volume
diafiltration.
[0184] The dialyzed supernatant was initially purified by
hydrophobic interaction chromatography. The supernatant was applied
to a 1.6.times.13 cm (26 ml) Phenyl Sepharose.RTM. CL-4B column
(Pharmacia, Uppsala, Sweden) previously equilibrated with 10 mM
Tris pH 8.0/1M (NH.sub.4).sub.2SO.sub.4 (Buffer A). The column was
washed with 60 mL Buffer A, and bound proteins were eluted at 2
mL/min with a decreasing (NH.sub.4).sub.2SO.sub.4 gradient using
Buffer A and 10 mM Tris pH 8.0 (Buffer B). The gradient conditions
were 0 to 60% Buffer B in 20 ml, hold at 60% Buffer B for 60 ml, 60
to 100% Buffer B in 20 ml, and hold at 100% Buffer B for 60 ml. A
total of 53 3 ml fractions were collected during the elution
process. The elution of protein was monitored by absorbance at 280
nm. The presence of active trimeric CD40L was determined by an
ELISA as described in Example 16. A peak of activity eluted in
fractions 8-20. In a subsequent purification run, highsub and
lowsub Phenyl Sepharose 6 Fast Flow.RTM.P (Pharmacia, Uppsala,
Sweden) were used for the hydrophobic interaction step; the highsub
Phenyl Sepharose.RTM. column was found to give equivalent results
to those obtained with Phenyl Sepharose.RTM. CL-4B.
[0185] Peak fractions from the Phenyl Sepharose.RTM. CL-4B column
were pooled, and glycerol was added to a final concentration of 10%
(v/v). The pool was then concentrated to a volume of approximately
4.5 ml using Amicon CENTRIPREPTM 10 concentrators with a 10,000
molecular weight cutoff, and chromatographed over a sizing column
(SUPERDEX 200.RTM. 26/60; Pharmacia, Uppsala, Sweden; 2.6.times.60
cm). The concentrated pool was loaded, and eluted with 20 mM Tris
pH 7.5/150 mM NaCl/10% glycerol (v/v), at a flow rate of 2.0
ml/min. Protein elution was monitored at 280 nm; and eighty 2 ml
fractions were collected. Activity was determined as described
above; a peak of activity eluted in fractions 36-48. Purity was
evaluated by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) under reducing conditions on 10%
acrylamide gels (Novex). The gels were stained by silver stain
substantially as described by Oakley et al., Anal. Biochem. 105:361
(1980). The silver-stained gels showed several proteins present in
the fractions.
[0186] Fractions from the peak of activity from the SUPERDEX
200.RTM. column were pooled, concentrated as described above to
approximately 2.0 ml, diluted 1:2 in 20 mM Bis Tris Propane pH
6.5/10% glycerol (v/v), and further purified by anion exchange
chromatography. The concentrated pooled material was applied at 1
mL/min to a MONO Q.RTM. column (Pharmacia, 0.5.times.5 cm)
equilibrated with 20 mM Bis Tris Propane pH 6.5/10% glycerol (v/v)
(Buffer A). The column was washed with 16 mL Buffer A and eluted
with a salt gradient using Buffer A and 20 mM Bis Tris Propane pH
6.5/500 mM NaCl/10% glycerol (v/v) (Buffer B). The column elution
conditions were 0 to 60% Buffer B in 20 ml, 60 to 100% Buffer B in
1.0 ml, and hold at 100% Buffer B for 10 ml. A total of 30 1 ml
fractions were collected during the elution process. Activity and
A.sub.280 were monitored as described previously. A peak of
activity eluted in fractions 15-23. The fractions were evaluated by
SDS-PAGE and silver stain as described above. Fractions 20-22 were
estimated to contain about 80% trimeric murine CD40L, and were
pooled. In a subsequent run, a HIGH PERFORMANCE Q.RTM. resin
(Pharmacia, Uppsala, Sweden) was used and found to give equivalent
results. Table 9 below summarizes the results of the procedure used
to purify trimeric murine CD40L.
9TABLE 9 Purification of Trimeric Murine CD40-L Volume Total #
Total Protein Specific Step (ml) Binding Units (mg) Activity * 1.
Supernatant fluid 160 5.2 .times. 10.sup.6 280 1.9 .times. 10.sup.4
2. Dialyzed 169 6.4 .times. 10.sup.6 106 6.0 .times. 10.sup.4
Supernatant 3. Phenyl Sepharose 37 2.3 .times. 10.sup.6 8.0 2.9
.times. 10.sup.5 pool 4. Superdex 200 24 2.3 .times. 10.sup.6 1.4
1.6 .times. 10.sup.5 pool 5. MONO Q pool 7 6.4 .times. 10.sup.5
0.91 7.0 .times. 10.sup.5 * Specific activity is defined as the
number of binding units of CD40-L per mg protein. One binding unit
of CD40L is defined as 0.5 ng of purified CD40-L, as determined in
a quantitative, enzyme-based binding assay. Protein concentration
was determined using the BCA Protein Assay Reagent (Pierce); bovine
serum albumen was used as the standard.
EXAMPLE 20
[0187] This example describes the effect of CD40-L trimer (CD40LT)
on primary antibody response to a T-dependent antigen. On day 0, 6
BALB/c mice were injected subcutaneoulsy with 200 .mu.l of a
suspension containing 10 .mu.g of ovalbumen (OVA), in the presence
of Freund's incomplete adjuvant (IFA). Three of the mice also
received 200 .mu.l of PBS containing a total of 1.5 .mu.g CD40LT,
while the remaining mice received a similar amount of a control
protein (murine serum immunoglobulin; msIgG). The mice were again
treated with 1.5 .mu.g of CD40LT or control protein on day 6.
[0188] Serum samples were taken on days 7 and 14, and analyzed for
elevated levels of antigen-specific IgG or IgM using an OVA ELISA.
Briefly, 96-well plates were coated with 10 .mu.g/well of OVA at
4.degree. C. overnight, then blocked with non-fat milk. Serial
two-fold dilutions of serum samples were prepared in PBS containing
10% normal goat serum, and 50 .mu.l of each dilution was added to a
well. Plates were incubated for one hour at room temperature, and
washed with PBS. The presence of antigen-specific IgG or IgM was
detected using goat anti mouse IgG or IgM (Southern Biotech)
conjugated to horseradish peroxidase for one hour at room
temperature, followed by a wash step and the addition of substrate
(TMB, Kirkegard and Perry). Color development proceeded for ten
minutes at room temperature, and was stopped by the addition of
H.sub.2SO.sub.4. The maximal dilution of serum dilution containing
IgG or IgM anti-OVA activity was determined by plotting the
OD.sub.450-OD.sub.562 of the diluted mouse sera, and comparing the
OD values obtained with OD values from pre-immune sera. Results are
presented in Table 10 below.
10TABLE 10 Effect of Trimeric Murine CD40-L on Primary Immune
Response Total IgG.sup.a Relative Ab levels.sup.b Endpoint titer %
over non- (est.sup.c) immune.sub.max Treatment: Day 7 Day 14 Day 7
Day 14 msIgG (#1) <50 400 <25 216 msIgG (#2) <50 >400
<25 285 msIgG (#3) <50 200 <25 212 CD40LT (#1) 400 200 279
240 CD40LT (#2) 800 >400 379 339 CD40LT (#3) 200 200 178 228
.sup.aAntigen-specific IgM titers were low at both day 7 and day 14
in both groups. .sup.b(OD.sub.max of treated mouse/OD.sub.max of
pre-immune control) .times. 100 .sup.cEstimated.
[0189] The mice treated with CD40LT exhibited greater levels of
OVA-specific IgG as compared to control mice, indicating that
CD40LT was able to boost a primary immune response to a T-dependent
antigen, both enhancing the level of antigen-specific antibody and
isotype switching from IgM to IgG.
[0190] A second experiment was carried out using different lots of
reagents and varying the concentrations of the CD40-L. A
significant difference between the control mice and the mice
treated with CD40 ligand was not observed at day 7, however, CD40-L
did enhance the day 14 response. Additional experiments to address
the use of CD40-L will include an analysis of different antigens as
well as the use of different adjuvants and delivery systems.
EXAMPLE 21
[0191] This example illustrates the activities of monoclonal
antibodies to CD40-L. Supernatants from 264 hybridomas prepared as
described in Example 7 were screened for anti-CD40-L activity by
FACS analysis using human peripheral blood T cells stimulated with
PMA and ionomycin for 16 hours. Under these conditions, four of the
tested hybridoma supernatants gave a FACS profile similar to that
obtained with CD40/Fc; an exemplary FACS profile is shown in FIG.
15. Six additional hybridoma supernatants gave weak positive
results, and the remainder did not appear to bind activated T
cells.
[0192] The ten hybridoma supernatants that gave positive or weak
positive results were then tested in another FACS assay using
CV-1/EBNA cells transfected with vector alone or with vector
encoding human CD40-L, as well as being reevaluated against
activated T cells. Several of the supernatants appeared to be
non-specifically reactive, however, three supernatants specifically
stained CD40-L expressing CV-1/EBNA cells, and were selected for
cloning and further evaluation.
[0193] The three anti-CD40-L secreting clones were expanded and
supernatant fluids were evaluated for ability to bind CD40-L and
inhibit (or block) binding of CD40-L to CD40. In a FACS assay using
activated human T cells (prepared as described above), the
monoclonal antibody secreted by three of the clones blocked the
binding of CD40/Fc to CD40-L, whereas the fourth did not.
Representative results are shown in FIG. 16. Several of the
monoclonal antibodies were also tested for the ability to inhibit B
cell proliferation in an assay substantially as described in
Example 13 herein, using CD40-L-containing supernatant fluid from
COS cells transfected with a vector encoding CD40-L. As shown in
FIG. 17, the monoclonal antibodies that were able to inhibit
binding of CD40/Fc to CD40-L by FACS analysis also inhibited the
ability of trimeric CD40-L plus anti-IgMto induce proliferation of
peripheral blood B cells.
[0194] The monoclonal antibodies were also evaluated in a solid
phase ELISA in which plates were coated with a rabbit antibody to
the oligomerizing zipper domain of trimeric CD40-L. Trimeric CD40-L
was then added to the plates, followed by (after appropriate
incubation and washing steps) supernatant fluids containing the
monoclonal antibodies. The presence of antibodies to the CD40-L
trimer was detected using enzyme labeled anti-mouse immunoglobulin
followed by the appropriate substrate. The three monoclonal
antibodies that inhibited the binding of CD40/c to CD40-L
expressing T cells by FACS also bound to the CD40-L trimer used in
the solid phase ELISA. Two of the hybridoma cell lines (designated
huCD40L-M90 and huCD40L-M91) were selected for further expansion.
These hybridoma cell have been deposited with the American Type
Cutlture Collection, Rockville, Md. under terms of the Budapest
treaty on Feb. 23, 1996, and given accession numberHB-12055
(huCD40L-M90) and HB-12056 (huCD40L-M91).
EXAMPLE 22
[0195] This example illustrates the binding affinities of several
different CD40-L constructs. Affinity experiments were conducted by
biospecific interaction analysis (BIA) using a biosensor, an
instrument that combines a biological recognition mechanism with a
sensing device or transducer. An exemplary biosensor is
BIAcore.TM., from Pharmacia Biosensor AB (Uppsala, Sweden; see
Faigerstam L. G., Techniques in Protein Chemistry II, ed. J. J.
Villafranca, Acad. Press, NY, 1991). BIAcore.TM. uses the optical
phenomenon surface plasmon resonance (Kretschmann and Raether, Z.
Naturforschung, Teil. A 23:2135, 1968) to monitor the interaction
of two biological molecules. Molecule pairs having affinity
constants in the range 10.sup.5 to 10.sup.10 M.sup.-1, and
association rate constants in the range of 10.sup.3 to 10.sup.6
M.sup.-1s.sup.-1, are suitable for characterization with
BIAcore.TM..
[0196] The biosensor chips were coated with goat anti-human
IgG.sub.1 Fc, which was used to bind CD40/Fc (prepared as described
in Example 1) to the chip. The different constructs of CD40-L were
then added at increasing concentrations; the chip was regenerated
between the different constructs by the addition of sodium
hydroxide. Two separate experiments were performed. In the first,
the binding of a dimeric human CD40-L (Example 14), trimeric human
CD40-L (Example 15), dimeric murine CD40-L (prepared substantially
as described in Example 14 for human CD40-LIFC) and trimeric murine
CD40-L (prepared substantially as described for the human CD40-L in
Example 15) were compared. In the second experiment, the binding of
trimeric human CD40-L was compared to the binding of two different
preparations of monomeric human CD40-L prepared as described in
Example 18. The resultant data were analyzed to determine the
affinity and association rate constants of the different CD40-L
constructs. Results are shown in Table 12 below, and in FIGS. 18
and 19.
11TABLE 12 Binding of CD40-L to CD40/Fc Site 1 Site2 (mol/mol
K.sub.1 (mol/mol K.sub.2 CD40/Fc) (M.sup.-1) CD40/Fc) (M.sup.-1)
Human Trimer 0.04 .+-. 0.02 5 .+-. 3 .times. 10.sup.9 0.68 .+-.
0.07 7.5 .+-. 2.5 .times. 10.sup.7 Human Dimer 0.013 .+-. 0.002 1.6
.+-. 0.7 .times. 10.sup.11 0.049 .+-. 0.004 7.0 .+-. 2.1 .times.
10.sup.8 Murine Trimer 0.02 .+-. 0.003 6 .+-. 3 .times. 10.sup.10
0.44 .+-. 0.02 1.6 .+-. 0.2 .times. 10.sup.8 Murine Dimer 0.05 .+-.
0.02 7 .+-. 4 .times. 10.sup.9 0.14 .+-. 0.23 4.0 .+-. 1.0 .times.
10.sup.7 Human Trimer 0.26 6.6 .times. 10.sup.8 0.41 2.6 .times.
10.sup.7 Monomer #1 Not Detected Not Detected 1.20 4.6 .times.
10.sup.7 Monomer #2 Not Detected Not Detected 1.27 1.1 .times.
10.sup.7
[0197] Analysis of the data indicated that a CD40-L monomer
comprising solely the portion of the extracellular domain most
homologous to TNF was capable of binding CD40, although with
somewhat lower affinity than oligomeric CD40-L. An analysis of the
ratio of binding in the second experiment demonstrated that there
are twice as many CD40-L monomer units bound per CD40/Fc molecule
as trimeric CD40-L, confirming that two monomers of CD40-L bind one
CD40/Fc dimer and one trimeric CD40-L binds one CD40/Fc dimer.
EXAMPLE 23
[0198] This example demonstrates that CD40-L enhances the
generation of cytotoxic T lymphocytes (CTL) in mixed lymphocyte
cultures (MLC). A 4-hour .sup.51Cr release assay was used to assess
the cytolytic activity of human T cells essentially as described in
Alderson et al., J. Exp. Med. 172:577 (1990). Briefly, freshly
isolated peripheral blood mononuclear cells from one donor were
cultured in MLC (mixed lymphocyte culture) with irradiated,
allogeneic stimulating cells (target cells), either in the presence
or absence of membrane-bound CD40-L. .sup.51Cr-labeled target cells
were prepared by incubating tumor cell lines, or three day PHA
blasts from a second donor, with 100 .mu.Ci of .sup.51Cr for one
hour at 37.degree. C.
[0199] Cell cultures to be assessed for cytolytic activity were
washed twice in culture medium and serially diluted in 96-well
V-bottom plates (Costar). .sup.51Cr-labeled target cells
(2.times.10.sup.3) were added to each well (total volume of 200
.mu.l/well), and the plates were incubated for four hours at
37.degree. C. After incubation, the plates were centrifuged at 150
g for five minutes, and harvested using a Skatron SCS harvesting
system (Skatron, Sterling, Va.). .sup.51Cr content of the
supernatants was determined using a Micromedic ME Plus gamma
scintillation counter (Micromedic, Huntsville, Tenn.). Percent
specific .sup.51Cr release was calculated according to the
formula100.times.(exper- imental cpm-spontaneous cpm)/(maximum
cpm/spontaneous cpm) where spontaneous cpm=cpm released in the
absence of effector cells and maximum cpm=cpm released in the
presence of 1N HCl. The results of this experiment indicated that
membrane-bound CD40-L enhanced CTL. generation. A polyclonal
anti-IL-2 antiserum capable of neutralizing 10 ng/ml of IL-2 at a
1:500 dilution was used to demonstrate that CD40-L enhancement of
CTL had both IL-2 dependent and IL-2 independent components.
[0200] Similar experiments were performed to analyze the phenotype
of the responding cells. T cells were purified by rosetting with
2-aminoethylisothiouronium bromide hydrobromide-treated sheep red
blood cells. CD4+ and CD8+ populations were further purified using
immunomagnetic selection using a MACS.TM. (Milenyi Biotec,
Sunnyvale, Calif.) according to the manufacturer's protocol.
Whereas IL-2 enhanced CTL generation by PBMC, purified T cells and
CD8+ T cells, CD40-L enhanced CTL generation by PBMC and purified T
cells, but not by CD8+ T cells. Analysis of cytokine secretion
using a CTLL assay for IL-2 or an ELISA for IFN-.gamma. indicated
that CD4+ cells costimulated with CD40-L produced 5 to 10-fold more
IFN-.gamma. and IL-2 than CD8+ cells. Moreover, CD40-L stimulated
CD4+ cells were induced to become cytolytic in a lectin-mediated
killing assay, whereas IL-2 costimulated both CD8+ and CD4+ cells
to become cytolytic.
[0201] These data demonstrate that, in addition to accessory
molecules expressed by antigen presenting cells, membrane proteins
may be important in T-T cell interactions. The function of CD40-L
may be to enhance the expansion of activated T cells within a
proliferating T cell clone in a paracrine fashion.
EXAMPLE 24
[0202] This example illustrates preparation of a number of muteins
of a CD40 ligand/zipper domain fusion protein. Mutations for
constructs to be expressed in yeast (mutants 14, 18, 32, 41, 43,
10PP and 18PP) were generated by PCR misincorporation (Mulrad et al
Yeast 8:79, 1992), and selected based on an apparent increase in
secretion as improved secretion mutants.
[0203] Mutants 14, 18, 32, 41, and 43 were isolated in S.
cerevisiae. Mutants 10PP and 18PP were isolated in P. pastoris.
Mutations for constructs to be expressed in mammalian cells
(FL194.W, 194.W, LZ12V, 215.T, 255.F, and 194.S) were also prepared
using PCR, and were either the result of site-directed mutagenesis
or were the random product of PCR. The types of mutations obtained
and their effect on activity (ability to bind CD40 in a solid phase
binding assay substantially as described in Example 16) are shown
in Table 13 below.
12TABLE 13 Mutations present in the CD40 ligand/zipper domain
fusion protein Zipper Mutant Domain No: Mutation.sup.a CD40L Domain
Mutations.sup.b Activity Type of Mutant 14 I12N K260N + random
mutant 18 L13P A130P, R181Q + random mutant 32 I12N Q121P + random
mutant 41 I5M, I16T NA + random mutant 43 I16N T134S, K164I, Q186L,
N210S + random mutant 10PP I9N, K27R NA.sup.d + random mutant 18PP
L13P NA + random mutant LZ12.V I12V Deletion of aa 1-112 + PCR;
random 215.T NA Deletion of aa 1-112; A215T + PCR; random 255.F NA
Deletion of aa 1-112; S215F - PCR; site-directed FL194W NA C194W +
PCR; site-directed 194.W NA Deletion of aa 1-112; C194W + PCR;
site-directed 194.S NA Deletion of aa 1-112; C194S ND.sup.e PCR;
site-directed 194.A NA Deletion of aa 1-112; C194A ND.sup.e PCR;
site-directed 194.D NA Deletion of aa 1-112; C194D ND.sup.e PCR;
site-directed 194.K NA Deletion of aa 1-112; C194K ND.sup.e PCR;
site-directed .sup.aMutations are given as the residue present in
the native peptide, the residue number, and the residue present in
the mutein. Residue numbers for zipper domain mutations are
relative to SEQ ID NO:17. .sup.bResidue numbers for mutations in
the CD40L domain are relative to SEQ ID NO:12. .sup.cMutant 10PP
also contained mutations in regions other than CD40L domain or the
zipper domain (T-4S, D-2P, relative to SEQ ID NO:21). .sup.dNot
applicable .sup.eNot done
[0204] Mutant 18PP had only a single mutation in the molecule,
which was sufficient to affect secretion in yeast. Mutant 41 had
two mutations, both of which were in the isoleucine residues of the
zipper domain. The mutations in the zipper improve secretion from
yeast without apparent effect on activity. Mutant 194.W was
expressed in yeast cells and purified either by a combination of
ion exchange chromatography steps (194.W (c)) or by affinity
chromatography (194.W (a)) using a monoclonal antibody that binds
the oligomerizing zipper moiety. oligomerizing zipper moiety. The
yeast-expressed mutant (194.W) exhibited greater affinity for CD40
in a biosensor assay performed substantially as described in
Example 22, and exhibited greater biological activity than wild
type CD40 ligand/zipper domain fusion protein (WT) expressed in
yeast, in a B cell proliferation assay. These results are shown in
Table 14.
13TABLE 14 Comparison of WT and 194.W for Receptor Binding and
B-cell Proliferation B-cell proliferation (U/.mu.g.sup.a) Affinity
Experiment Experiment K.sub.a (M.sup.-1) 1 2.sup.d WT 7.7 .times.
10.sup.7 77.sup.b 15 194.W (c) 1.8 .times. 10.sup.9 171 116 194.W
(a) ND.sup.c ND 161 .sup.aA unit (U) is the concentration that
induces half-maximal proliferation .sup.bAverage from two
independent preparations .sup.cNot done .sup.dAverage of two
assays
[0205] Moreover, FL194W expresssed in mammalian cells also
demonstrated higher binding that WT CD40-L in a semi-quantitative
western blot analysis.
[0206] Additional constructs were prepared by substituting the lung
surfactant protein D (SPD) trimerization domain (SEQ ID NO:24;
Hoppe, et al., FEBS Letters 344:191, 1994) in place of the
trimer-forming zipper of SEQ ID NO:17. This construct is expressed
in S. cerevisiae and in mammalian cells at low levels. Activity is
determined as described previously; various mutants based on such
constructs can also be prepared to optimize secretion or other
product characteristics, as described above.
Sequence CWU 1
1
25 1 783 DNA Mus sp. CDS (1)..(783) 1 atg ata gaa aca tac agc caa
cct tcc ccc aga tcc gtg gca act gga 48 Met Ile Glu Thr Tyr Ser Gln
Pro Ser Pro Arg Ser Val Ala Thr Gly 1 5 10 15 ctt cca gcg agc atg
aag att ttt atg tat tta ctt act gtt ttc ctt 96 Leu Pro Ala Ser Met
Lys Ile Phe Met Tyr Leu Leu Thr Val Phe Leu 20 25 30 atc acc caa
atg att gga tct gtg ctt ttt gct gtg tat ctt cat aga 144 Ile Thr Gln
Met Ile Gly Ser Val Leu Phe Ala Val Tyr Leu His Arg 35 40 45 aga
ttg gat aag gtc gaa gag gaa gta aac ctt cat gaa gat ttt gta 192 Arg
Leu Asp Lys Val Glu Glu Glu Val Asn Leu His Glu Asp Phe Val 50 55
60 ttc ata aaa aag cta aag aga tgc aac aaa gga gaa gga tct tta tcc
240 Phe Ile Lys Lys Leu Lys Arg Cys Asn Lys Gly Glu Gly Ser Leu Ser
65 70 75 80 ttg ctg aac tgt gag gag atg aga agg caa ttt gaa gac ctt
gtc aag 288 Leu Leu Asn Cys Glu Glu Met Arg Arg Gln Phe Glu Asp Leu
Val Lys 85 90 95 gat ata acg tta aac aaa gaa gag aaa aaa gaa aac
agc ttt gaa atg 336 Asp Ile Thr Leu Asn Lys Glu Glu Lys Lys Glu Asn
Ser Phe Glu Met 100 105 110 caa aga ggt gat gag gat cct caa att gca
gca cac gtt gta agc gaa 384 Gln Arg Gly Asp Glu Asp Pro Gln Ile Ala
Ala His Val Val Ser Glu 115 120 125 gcc aac agt aat gca gca tcc gtt
cta cag tgg gcc aag aaa gga tat 432 Ala Asn Ser Asn Ala Ala Ser Val
Leu Gln Trp Ala Lys Lys Gly Tyr 130 135 140 tat acc atg aaa agc aac
ttg gta atg ctt gaa aat ggg aaa cag ctg 480 Tyr Thr Met Lys Ser Asn
Leu Val Met Leu Glu Asn Gly Lys Gln Leu 145 150 155 160 acg gtt aaa
aga gaa gga ctc tat tat gtc tac act caa gtc acc ttc 528 Thr Val Lys
Arg Glu Gly Leu Tyr Tyr Val Tyr Thr Gln Val Thr Phe 165 170 175 tgc
tct aat cgg gag cct tcg agt caa cgc cca ttc atc gtc ggc ctc 576 Cys
Ser Asn Arg Glu Pro Ser Ser Gln Arg Pro Phe Ile Val Gly Leu 180 185
190 tgg ctg aag ccc agc agt gga tct gag aga atc tta ctc aag gcg gca
624 Trp Leu Lys Pro Ser Ser Gly Ser Glu Arg Ile Leu Leu Lys Ala Ala
195 200 205 aat acc cac agt tcc tcc cag ctt tgc gag cag cag tct gtt
cac ttg 672 Asn Thr His Ser Ser Ser Gln Leu Cys Glu Gln Gln Ser Val
His Leu 210 215 220 ggc gga gtg ttt gaa tta caa gct ggt gct tct gtg
ttt gtc aac gtg 720 Gly Gly Val Phe Glu Leu Gln Ala Gly Ala Ser Val
Phe Val Asn Val 225 230 235 240 act gaa gca agc caa gtg atc cac aga
gtt ggc ttc tca tct ttt ggc 768 Thr Glu Ala Ser Gln Val Ile His Arg
Val Gly Phe Ser Ser Phe Gly 245 250 255 tta ctc aaa ctc tga 783 Leu
Leu Lys Leu 260 2 260 PRT Mus sp. 2 Met Ile Glu Thr Tyr Ser Gln Pro
Ser Pro Arg Ser Val Ala Thr Gly 1 5 10 15 Leu Pro Ala Ser Met Lys
Ile Phe Met Tyr Leu Leu Thr Val Phe Leu 20 25 30 Ile Thr Gln Met
Ile Gly Ser Val Leu Phe Ala Val Tyr Leu His Arg 35 40 45 Arg Leu
Asp Lys Val Glu Glu Glu Val Asn Leu His Glu Asp Phe Val 50 55 60
Phe Ile Lys Lys Leu Lys Arg Cys Asn Lys Gly Glu Gly Ser Leu Ser 65
70 75 80 Leu Leu Asn Cys Glu Glu Met Arg Arg Gln Phe Glu Asp Leu
Val Lys 85 90 95 Asp Ile Thr Leu Asn Lys Glu Glu Lys Lys Glu Asn
Ser Phe Glu Met 100 105 110 Gln Arg Gly Asp Glu Asp Pro Gln Ile Ala
Ala His Val Val Ser Glu 115 120 125 Ala Asn Ser Asn Ala Ala Ser Val
Leu Gln Trp Ala Lys Lys Gly Tyr 130 135 140 Tyr Thr Met Lys Ser Asn
Leu Val Met Leu Glu Asn Gly Lys Gln Leu 145 150 155 160 Thr Val Lys
Arg Glu Gly Leu Tyr Tyr Val Tyr Thr Gln Val Thr Phe 165 170 175 Cys
Ser Asn Arg Glu Pro Ser Ser Gln Arg Pro Phe Ile Val Gly Leu 180 185
190 Trp Leu Lys Pro Ser Ser Gly Ser Glu Arg Ile Leu Leu Lys Ala Ala
195 200 205 Asn Thr His Ser Ser Ser Gln Leu Cys Glu Gln Gln Ser Val
His Leu 210 215 220 Gly Gly Val Phe Glu Leu Gln Ala Gly Ala Ser Val
Phe Val Asn Val 225 230 235 240 Thr Glu Ala Ser Gln Val Ile His Arg
Val Gly Phe Ser Ser Phe Gly 245 250 255 Leu Leu Lys Leu 260 3 740
DNA Homo sapien 3 cggtaccgct agcgtcgaca ggcctaggat atcgatacgt
agagcccaga tcttgtgaca 60 aaactcacac atgcccaccg tgcccagcac
ctgaactcct ggggggaccg tcagtcttcc 120 tcttcccccc aaaacccaag
gacaccctca tgatctcccg gacccctgag gtcacatgcg 180 tggtggtgga
cgtgagccac gaagaccctg aggtcaagtt caactggtac gtggacggcg 240
tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc acgtaccggg
300 tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggac
tacaagtgca 360 aggtctccaa caaagccctc ccagccccca tgcagaaaac
catctccaaa gccaaagggc 420 agccccgaga accacaggtg tacaccctgc
ccccatcccg ggatgagctg accaagaacc 480 aggtcagcct gacctgcctg
gtcaaaggct tctatcccag gcacatcgcc gtggagtggg 540 agagcaatgg
gcagccggag aacaactaca agaccacgcc tcccgtgctg gactccgacg 600
gctccttctt cctctacagc aagctcaccg tggacaagag caggtggcag caggggaacg
660 tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag
aagagcctct 720 ccctgtctcc gggtaaatga 740 4 519 DNA Homo sapien 4
cagaaccacc cactgcatgc agagaaaaac agtacctaat aaacagtcag tgctgttctt
60 tgtgccagcc aggacagaaa ctggtgagtg actgcacaga gttcactgaa
acggaatgcc 120 ttccttgcgg tgaaagcgaa ttcctagaca cctggaacag
agagacacac tgccaccagc 180 acaaatactg cgaccccaac ctagggcttc
gggtccagca gaagggcacc tcagaaacag 240 acaccatctg cacctgtgaa
gaaggctggc actgtacgag tgaggcctgt gagagctgtg 300 tcctgcaccg
ctcatgctcg cccggctttg gggtcaagca gattgctaca ggggtttctg 360
ataccatctg cgagccctgc ccagtcggct tcttctccaa tgtgtcatct gctttcgaaa
420 aatgtcaccc ttggacaagc tgtgagacca aagacctggt tgtgcaacag
gcaggcacaa 480 acaagactga tgttgtctgt ggtccccagg atcggctga 519 5 26
DNA Artificial Sequence PCR Primer 5 ccgtcgacca ccatggttcg tctgcc
26 6 28 DNA Artificial sequence PCR Primer 6 ccgtcgacgt ctagagccga
tcctgggg 28 7 40 DNA Artificial sequence PCR primer 7 acaagatctg
ggctctacgt actcagccga tcctggggac 40 8 5 PRT Artificial sequence
Translated PCR Primer 8 Tyr Val Gly Pro Arg 1 5 9 43 DNA Artificial
sequence PCR Primer 9 tattaatcat tcagtagggc ccagatcttg tgacaaaact
cac 43 10 38 DNA Artificial sequence PCR Primer 10 gccagcttaa
ctagttcatt tacccggaga cagggaga 38 11 840 DNA Homo sapiens CDS
(46)..(831) 11 tgccaccttc tctgccagaa gataccattt caactttaac acagc
atg atc gaa aca 57 Met Ile Glu Thr 1 tac aac caa act tct ccc cga
tct gcg gcc act gga ctg ccc atc agc 105 Tyr Asn Gln Thr Ser Pro Arg
Ser Ala Ala Thr Gly Leu Pro Ile Ser 5 10 15 20 atg aaa att ttt atg
tat tta ctt act gtt ttt ctt atc acc cag atg 153 Met Lys Ile Phe Met
Tyr Leu Leu Thr Val Phe Leu Ile Thr Gln Met 25 30 35 att ggg tca
gca ctt ttt gct gtg tat ctt cat aga agg ttg gac aag 201 Ile Gly Ser
Ala Leu Phe Ala Val Tyr Leu His Arg Arg Leu Asp Lys 40 45 50 ata
gaa gat gaa agg aat ctt cat gaa gat ttt gta ttc atg aaa acg 249 Ile
Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val Phe Met Lys Thr 55 60
65 ata cag aga tgc aac aca gga gaa aga tcc tta tcc tta ctg aac tgt
297 Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu Ser Leu Leu Asn Cys
70 75 80 gag gag att aaa agc cag ttt gaa ggc ttt gtg aag gat ata
atg tta 345 Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe Val Lys Asp Ile
Met Leu 85 90 95 100 aac aaa gag gag acg aag aaa gaa aac agc ttt
gaa atg caa aaa ggt 393 Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser Phe
Glu Met Gln Lys Gly 105 110 115 gat cag aat cct caa att gcg gca cat
gtc ata agt gag gcc agc agt 441 Asp Gln Asn Pro Gln Ile Ala Ala His
Val Ile Ser Glu Ala Ser Ser 120 125 130 aaa aca aca tct gtg tta cag
tgg gct gaa aaa gga tac tac acc atg 489 Lys Thr Thr Ser Val Leu Gln
Trp Ala Glu Lys Gly Tyr Tyr Thr Met 135 140 145 agc aac aac ttg gta
acc ctg gaa aat ggg aaa cag ctg acc gtt aaa 537 Ser Asn Asn Leu Val
Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys 150 155 160 aga caa gga
ctc tat tat atc tat gcc caa gtc acc ttc tgt tcc aat 585 Arg Gln Gly
Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn 165 170 175 180
cgg gaa gct tcg agt caa gct cca ttt ata gcc agc ctc tgc cta aag 633
Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser Leu Cys Leu Lys 185
190 195 tcc ccc ggt aga ttc gag aga atc tta ctc aga gct gca aat acc
cac 681 Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr
His 200 205 210 agt tcc gcc aaa cct tgc ggg caa caa tcc att cac ttg
gga gga gta 729 Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile His Leu
Gly Gly Val 215 220 225 ttt gaa ttg caa cca ggt gct tcg gtg ttt gtc
aat gtg act gat cca 777 Phe Glu Leu Gln Pro Gly Ala Ser Val Phe Val
Asn Val Thr Asp Pro 230 235 240 agc caa gtg agc cat ggc act ggc ttc
acg tcc ttt ggc tta ctc aaa 825 Ser Gln Val Ser His Gly Thr Gly Phe
Thr Ser Phe Gly Leu Leu Lys 245 250 255 260 ctc tga acagtgtca 840
Leu 12 261 PRT Homo sapiens 12 Met Ile Glu Thr Tyr Asn Gln Thr Ser
Pro Arg Ser Ala Ala Thr Gly 1 5 10 15 Leu Pro Ile Ser Met Lys Ile
Phe Met Tyr Leu Leu Thr Val Phe Leu 20 25 30 Ile Thr Gln Met Ile
Gly Ser Ala Leu Phe Ala Val Tyr Leu His Arg 35 40 45 Arg Leu Asp
Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val 50 55 60 Phe
Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu Ser 65 70
75 80 Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe Val
Lys 85 90 95 Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn
Ser Phe Glu 100 105 110 Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala
Ala His Val Ile Ser 115 120 125 Glu Ala Ser Ser Lys Thr Thr Ser Val
Leu Gln Trp Ala Glu Lys Gly 130 135 140 Tyr Tyr Thr Met Ser Asn Asn
Leu Val Thr Leu Glu Asn Gly Lys Gln 145 150 155 160 Leu Thr Val Lys
Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr 165 170 175 Phe Cys
Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser 180 185 190
Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala 195
200 205 Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile
His 210 215 220 Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val
Phe Val Asn 225 230 235 240 Val Thr Asp Pro Ser Gln Val Ser His Gly
Thr Gly Phe Thr Ser Phe 245 250 255 Gly Leu Leu Lys Leu 260 13 73
DNA Artificial sequence PCR Primer 13 tggtggcgga gggtcaggcg
gaggtgggtc cggaggcggg ggttcaagtt ctgacaagat 60 agaagatgaa agg 73 14
21 DNA Artificial sequence PCR Primer 14 ggccgctcag agtttgagta a 21
15 1425 DNA Homo sapiens CDS (4)..(1422) 15 tat atg ttc cat gtt tct
ttt aga tat atc ttt gga att cct cca ctg 48 Met Phe His Val Ser Phe
Arg Tyr Ile Phe Gly Ile Pro Pro Leu -25 -20 -15 atc ctt gtt ctg ctg
cct gtc act agc tct gac tac aaa gat gac gat 96 Ile Leu Val Leu Leu
Pro Val Thr Ser Ser Asp Tyr Lys Asp Asp Asp -10 -5 -1 1 5 gat aaa
aga tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca 144 Asp Lys
Arg Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 10 15 20
cct gaa ctc ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa ccc 192
Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 25
30 35 aag gac acc ctc atg atc tcc cgg acc cct gag gtc aca tgc gtg
gtg 240 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val
Val 40 45 50 gtg gac gtg agc cac gaa gac cct gag gtc aag ttc aac
tgg tac gtg 288 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp Tyr Val 55 60 65 70 gac ggc gtg gag gtg cat aat gcc aag aca aag
ccg cgg gag gag cag 336 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys
Pro Arg Glu Glu Gln 75 80 85 tac aac agc acg tac cgg gtg gtc agc
gtc ctc acc gtc ctg cac cag 384 Tyr Asn Ser Thr Tyr Arg Val Val Ser
Val Leu Thr Val Leu His Gln 90 95 100 gac tgg ctg aat ggc aag gag
tac aag tgc aag gtc tcc aac aaa gcc 432 Asp Trp Leu Asn Gly Lys Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala 105 110 115 ctc cca gcc ccc atc
gag aaa acc atc tcc aaa gcc aaa ggg cag ccc 480 Leu Pro Ala Pro Ile
Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 120 125 130 cga gaa cca
cag gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc 528 Arg Glu Pro
Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 135 140 145 150
aag aac cag gtc agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc 576
Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 155
160 165 gac atc gcc gtg gag tgg gag agc aat ggg cag ccg gag aac aac
tac 624 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn
Tyr 170 175 180 aag acc acg cct ccc gtg ctg gac tcc gac ggc tcc ttc
ttc ctc tac 672 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr 185 190 195 agc aag ctc acc gtg gac aag agc agg tgg cag
cag ggg aac gtc ttc 720 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe 200 205 210 tca tgc tcc gtg atg cat ggt ggc gga
ggg tca ggc gga ggt ggg tcc 768 Ser Cys Ser Val Met His Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser 215 220 225 230 gga ggc ggg ggt tca agt
tct gac aag ata gaa gat gaa agg aat ctt 816 Gly Gly Gly Gly Ser Ser
Ser Asp Lys Ile Glu Asp Glu Arg Asn Leu 235 240 245 cat gaa gat ttt
gta ttc atg aaa acg ata cag aga tgc aac aca gga 864 His Glu Asp Phe
Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly 250 255 260 gaa aga
tcc tta tcc tta ctg aac tgt gag gag att aaa agc cag ttt 912 Glu Arg
Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe 265 270 275
gaa ggc ttt gtg aag gat ata atg tta aac aaa gag gag acg aag aaa 960
Glu Gly Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys 280
285 290 gaa aac agc ttt gaa atg caa aaa ggt gat cag aat cct caa att
gcg 1008 Glu Asn Ser Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln
Ile Ala 295 300 305 310 gca cat gtc ata agt gag gcc agc agt aaa aca
aca tct gtg tta cag 1056 Ala His Val Ile Ser Glu Ala Ser Ser Lys
Thr Thr Ser Val Leu Gln 315 320 325 tgg gct gaa aaa gga tac tac acc
atg agc aac aac ttg gta acc ctg 1104 Trp Ala Glu Lys Gly Tyr Tyr
Thr Met Ser Asn Asn Leu Val Thr Leu 330 335 340 gaa aat ggg aaa cag
ctg acc gtt aaa aga caa gga ctc tat tat atc 1152 Glu Asn Gly Lys
Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile 345 350 355 tat gcc
caa gtc acc ttc tgt tcc aat cgg gaa gct tcg agt caa gct 1200 Tyr
Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala 360 365
370 cca ttt ata gcc agc ctc tgc cta aag tcc ccc ggt aga ttc gag aga
1248 Pro Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu
Arg 375 380 385 390 atc tta ctc aga gct gca aat acc cac agt
tcc gcc aaa cct tgc ggg 1296 Ile Leu Leu Arg Ala Ala Asn Thr His
Ser Ser Ala Lys Pro Cys Gly 395 400 405 caa caa tcc att cac ttg gga
gga gta ttt gaa ttg caa cca ggt gct 1344 Gln Gln Ser Ile His Leu
Gly Gly Val Phe Glu Leu Gln Pro Gly Ala 410 415 420 tcg gtg ttt gtc
aat gtg act gat cca agc caa gtg agc cat ggc act 1392 Ser Val Phe
Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr 425 430 435 ggc
ttc acg tcc ttt ggc tta ctc aaa ctc tga 1425 Gly Phe Thr Ser Phe
Gly Leu Leu Lys Leu 440 445 16 473 PRT Homo sapiens 16 Met Phe His
Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile -25 -20 -15 -10
Leu Val Leu Leu Pro Val Thr Ser Ser Asp Tyr Lys Asp Asp Asp Asp -5
-1 1 5 Lys Arg Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro 10 15 20 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
Lys Pro Lys 25 30 35 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys Val Val Val 40 45 50 55 Asp Val Ser His Glu Asp Pro Glu Val
Lys Phe Asn Trp Tyr Val Asp 60 65 70 Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr 75 80 85 Asn Ser Thr Tyr Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp 90 95 100 Trp Leu Asn
Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 105 110 115 Pro
Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 120 125
130 135 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr
Lys 140 145 150 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr
Pro Ser Asp 155 160 165 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro
Glu Asn Asn Tyr Lys 170 175 180 Thr Thr Pro Pro Val Leu Asp Ser Asp
Gly Ser Phe Phe Leu Tyr Ser 185 190 195 Lys Leu Thr Val Asp Lys Ser
Arg Trp Gln Gln Gly Asn Val Phe Ser 200 205 210 215 Cys Ser Val Met
His Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 220 225 230 Gly Gly
Gly Ser Ser Ser Asp Lys Ile Glu Asp Glu Arg Asn Leu His 235 240 245
Glu Asp Phe Val Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu 250
255 260 Arg Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe
Glu 265 270 275 Gly Phe Val Lys Asp Ile Met Leu Asn Lys Glu Glu Thr
Lys Lys Glu 280 285 290 295 Asn Ser Phe Glu Met Gln Lys Gly Asp Gln
Asn Pro Gln Ile Ala Ala 300 305 310 His Val Ile Ser Glu Ala Ser Ser
Lys Thr Thr Ser Val Leu Gln Trp 315 320 325 Ala Glu Lys Gly Tyr Tyr
Thr Met Ser Asn Asn Leu Val Thr Leu Glu 330 335 340 Asn Gly Lys Gln
Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr 345 350 355 Ala Gln
Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro 360 365 370
375 Phe Ile Ala Ser Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile
380 385 390 Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys
Gly Gln 395 400 405 Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln
Pro Gly Ala Ser 410 415 420 Val Phe Val Asn Val Thr Asp Pro Ser Gln
Val Ser His Gly Thr Gly 425 430 435 Phe Thr Ser Phe Gly Leu Leu Lys
Leu 440 445 17 33 PRT Artificial sequence Oligiomerizing Zipper 17
Arg Met Lys Gln Ile Glu Asp Lys Ile Glu Glu Ile Leu Ser Lys Ile 1 5
10 15 Tyr His Ile Glu Asn Glu Ile Ala Arg Ile Lys Lys Leu Ile Gly
Glu 20 25 30 Arg 18 55 DNA Artificial sequence PCR Primer 18
atatgaattc gactacaaag atgacgatga taaacctcaa attgcagcac acgtt 55 19
35 DNA Artificial sequence PCR Primer 19 ccttcgcggc cgcgttcaga
gtttgagtaa gccaa 35 20 929 DNA Homo sapiens CDS (65)..(883) 20
tgagcgagtc cgcatcgacg gatcggaaaa cctctccgag gtacctatcc cggggatccc
60 cacc atg ttc cat gtt tct ttt aga tat atc ttt gga att cct cca ctg
109 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu -25
-20 -15 atc ctt gtt ctg ctg cct gtc act agt tct gac cgt atg aaa cag
ata 157 Ile Leu Val Leu Leu Pro Val Thr Ser Ser Asp Arg Met Lys Gln
Ile -10 -5 -1 1 5 gag gat aag atc gaa gag atc cta agt aag att tat
cat ata gag aat 205 Glu Asp Lys Ile Glu Glu Ile Leu Ser Lys Ile Tyr
His Ile Glu Asn 10 15 20 gaa atc gcc cgt atc aaa aag ctg att ggc
gag cgg act agt tct gac 253 Glu Ile Ala Arg Ile Lys Lys Leu Ile Gly
Glu Arg Thr Ser Ser Asp 25 30 35 aag ata gaa gat gaa agg aat ctt
cat gaa gat ttt gta ttc atg aaa 301 Lys Ile Glu Asp Glu Arg Asn Leu
His Glu Asp Phe Val Phe Met Lys 40 45 50 acg ata cag aga tgc aac
aca gga gaa aga tcc tta tcc tta ctg aac 349 Thr Ile Gln Arg Cys Asn
Thr Gly Glu Arg Ser Leu Ser Leu Leu Asn 55 60 65 tgt gag gag att
aaa agc cag ttt gaa ggc ttt gtg aag gat ata atg 397 Cys Glu Glu Ile
Lys Ser Gln Phe Glu Gly Phe Val Lys Asp Ile Met 70 75 80 85 tta aac
aaa gag gag acg aag aaa gaa aac agc ttt gaa atg caa aaa 445 Leu Asn
Lys Glu Glu Thr Lys Lys Glu Asn Ser Phe Glu Met Gln Lys 90 95 100
ggt gat cag aat cct caa att gcg gca cat gtc ata agt gag gcc agc 493
Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser 105
110 115 agt aaa aca aca tct gtg tta cag tgg gct gaa aaa gga tac tac
acc 541 Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr
Thr 120 125 130 atg agc aac aac ttg gta acc ctg gaa aat ggg aaa cag
ctg acc gtt 589 Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln
Leu Thr Val 135 140 145 aaa aga caa gga ctc tat tat atc tat gcc caa
gtc acc ttc tgt tcc 637 Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln
Val Thr Phe Cys Ser 150 155 160 165 aat cgg gaa gct tcg agt caa gct
cca ttt ata gcc agc ctc tgc cta 685 Asn Arg Glu Ala Ser Ser Gln Ala
Pro Phe Ile Ala Ser Leu Cys Leu 170 175 180 aag tcc ccc ggt aga ttc
gag aga atc tta ctc aga gct gca aat acc 733 Lys Ser Pro Gly Arg Phe
Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr 185 190 195 cac agt tcc gcc
aaa cct tgc ggg caa caa tcc att cac ttg gga gga 781 His Ser Ser Ala
Lys Pro Cys Gly Gln Gln Ser Ile His Leu Gly Gly 200 205 210 gta ttt
gaa ttg caa cca ggt gct tcg gtg ttt gtc aat gtg act gat 829 Val Phe
Glu Leu Gln Pro Gly Ala Ser Val Phe Val Asn Val Thr Asp 215 220 225
cca agc caa gtg agc cat ggc act ggc ttc acg tcc ttt ggc tta ctc 877
Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu 230
235 240 245 aaa ctc tgagcggccg ctacagatga ataataagca tgtttggatt
cctcaa 929 Lys Leu 21 273 PRT Homo sapiens 21 Met Phe His Val Ser
Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile -25 -20 -15 Leu Val Leu
Leu Pro Val Thr Ser Ser Asp Arg Met Lys Gln Ile Glu -10 -5 -1 1 5
Asp Lys Ile Glu Glu Ile Leu Ser Lys Ile Tyr His Ile Glu Asn Glu 10
15 20 Ile Ala Arg Ile Lys Lys Leu Ile Gly Glu Arg Thr Ser Ser Asp
Lys 25 30 35 Ile Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val Phe
Met Lys Thr 40 45 50 Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu
Ser Leu Leu Asn Cys 55 60 65 70 Glu Glu Ile Lys Ser Gln Phe Glu Gly
Phe Val Lys Asp Ile Met Leu 75 80 85 Asn Lys Glu Glu Thr Lys Lys
Glu Asn Ser Phe Glu Met Gln Lys Gly 90 95 100 Asp Gln Asn Pro Gln
Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser 105 110 115 Lys Thr Thr
Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met 120 125 130 Ser
Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys 135 140
145 150 Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser
Asn 155 160 165 Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser Leu
Cys Leu Lys 170 175 180 Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg
Ala Ala Asn Thr His 185 190 195 Ser Ser Ala Lys Pro Cys Gly Gln Gln
Ser Ile His Leu Gly Gly Val 200 205 210 Phe Glu Leu Gln Pro Gly Ala
Ser Val Phe Val Asn Val Thr Asp Pro 215 220 225 230 Ser Gln Val Ser
His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys 235 240 245 Leu 22
878 DNA Mus sp. CDS (15)..(854) 22 ctcgaggtac cgcc atg ttc cat gtt
tct ttt aga tat atc ttt gga att 50 Met Phe His Val Ser Phe Arg Tyr
Ile Phe Gly Ile -25 -20 -15 cct cca ctg atc ctt gtt ctg ctg cct gtc
act agt tct gac cgt atg 98 Pro Pro Leu Ile Leu Val Leu Leu Pro Val
Thr Ser Ser Asp Arg Met -10 -5 -1 1 aaa cag ata gag gat aag atc gaa
gag atc cta agt aag att tat cat 146 Lys Gln Ile Glu Asp Lys Ile Glu
Glu Ile Leu Ser Lys Ile Tyr His 5 10 15 ata gag aat gaa atc gcc cgt
atc aaa aag ctg att ggc gag cgg act 194 Ile Glu Asn Glu Ile Ala Arg
Ile Lys Lys Leu Ile Gly Glu Arg Thr 20 25 30 agt tct gac tac aaa
gat gac gat gat aaa gat aag gtc gaa gag gaa 242 Ser Ser Asp Tyr Lys
Asp Asp Asp Asp Lys Asp Lys Val Glu Glu Glu 35 40 45 50 gta aac ctt
cat gaa gat ttt gta ttc ata aaa aag cta aag aga tgc 290 Val Asn Leu
His Glu Asp Phe Val Phe Ile Lys Lys Leu Lys Arg Cys 55 60 65 aac
aaa gga gaa gga tct tta tcc ttg ctg aac tgt gag gag atg aga 338 Asn
Lys Gly Glu Gly Ser Leu Ser Leu Leu Asn Cys Glu Glu Met Arg 70 75
80 agg caa ttt gaa gac ctt gtc aag gat ata acg tta aac aaa gaa gag
386 Arg Gln Phe Glu Asp Leu Val Lys Asp Ile Thr Leu Asn Lys Glu Glu
85 90 95 aaa aaa gaa aac agc ttt gaa atg caa aga ggt gat gag gat
cct caa 434 Lys Lys Glu Asn Ser Phe Glu Met Gln Arg Gly Asp Glu Asp
Pro Gln 100 105 110 att gca gca cac gtt gta agc gaa gcc aac agt aat
gca gca tcc gtt 482 Ile Ala Ala His Val Val Ser Glu Ala Asn Ser Asn
Ala Ala Ser Val 115 120 125 130 cta cag tgg gcc aag aaa gga tat tat
acc atg aaa agc aac ttg gta 530 Leu Gln Trp Ala Lys Lys Gly Tyr Tyr
Thr Met Lys Ser Asn Leu Val 135 140 145 atg ctt gaa aat ggg aaa cag
ctg acg gtt aaa aga gaa gga ctc tat 578 Met Leu Glu Asn Gly Lys Gln
Leu Thr Val Lys Arg Glu Gly Leu Tyr 150 155 160 tat gtc tac act caa
gtc acc ttc tgc tct aat cgg gag cct tcg agt 626 Tyr Val Tyr Thr Gln
Val Thr Phe Cys Ser Asn Arg Glu Pro Ser Ser 165 170 175 caa cgc cca
ttc atc gtc ggc ctc tgg ctg aag ccc agc agt gga tct 674 Gln Arg Pro
Phe Ile Val Gly Leu Trp Leu Lys Pro Ser Ser Gly Ser 180 185 190 gag
aga atc tta ctc aag gcg gca aat acc cac agt tcc tcc cag ctt 722 Glu
Arg Ile Leu Leu Lys Ala Ala Asn Thr His Ser Ser Ser Gln Leu 195 200
205 210 tgc gag cag cag tct gtt cac ttg ggc gga gtg ttt gaa tta caa
gct 770 Cys Glu Gln Gln Ser Val His Leu Gly Gly Val Phe Glu Leu Gln
Ala 215 220 225 ggt gct tct gtg ttt gtc aac gtg act gaa gca agc caa
gtg atc cac 818 Gly Ala Ser Val Phe Val Asn Val Thr Glu Ala Ser Gln
Val Ile His 230 235 240 aga gtt ggc ttc tca tct ttt ggc tta ctc aaa
ctc tgaacgcggc 864 Arg Val Gly Phe Ser Ser Phe Gly Leu Leu Lys Leu
245 250 cgctacagat ctac 878 23 280 PRT Mus sp. 23 Met Phe His Val
Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile -25 -20 -15 Leu Val
Leu Leu Pro Val Thr Ser Ser Asp Arg Met Lys Gln Ile Glu -10 -5 -1 1
5 Asp Lys Ile Glu Glu Ile Leu Ser Lys Ile Tyr His Ile Glu Asn Glu
10 15 20 Ile Ala Arg Ile Lys Lys Leu Ile Gly Glu Arg Thr Ser Ser
Asp Tyr 25 30 35 Lys Asp Asp Asp Asp Lys Asp Lys Val Glu Glu Glu
Val Asn Leu His 40 45 50 Glu Asp Phe Val Phe Ile Lys Lys Leu Lys
Arg Cys Asn Lys Gly Glu 55 60 65 70 Gly Ser Leu Ser Leu Leu Asn Cys
Glu Glu Met Arg Arg Gln Phe Glu 75 80 85 Asp Leu Val Lys Asp Ile
Thr Leu Asn Lys Glu Glu Lys Lys Glu Asn 90 95 100 Ser Phe Glu Met
Gln Arg Gly Asp Glu Asp Pro Gln Ile Ala Ala His 105 110 115 Val Val
Ser Glu Ala Asn Ser Asn Ala Ala Ser Val Leu Gln Trp Ala 120 125 130
Lys Lys Gly Tyr Tyr Thr Met Lys Ser Asn Leu Val Met Leu Glu Asn 135
140 145 150 Gly Lys Gln Leu Thr Val Lys Arg Glu Gly Leu Tyr Tyr Val
Tyr Thr 155 160 165 Gln Val Thr Phe Cys Ser Asn Arg Glu Pro Ser Ser
Gln Arg Pro Phe 170 175 180 Ile Val Gly Leu Trp Leu Lys Pro Ser Ser
Gly Ser Glu Arg Ile Leu 185 190 195 Leu Lys Ala Ala Asn Thr His Ser
Ser Ser Gln Leu Cys Glu Gln Gln 200 205 210 Ser Val His Leu Gly Gly
Val Phe Glu Leu Gln Ala Gly Ala Ser Val 215 220 225 230 Phe Val Asn
Val Thr Glu Ala Ser Gln Val Ile His Arg Val Gly Phe 235 240 245 Ser
Ser Phe Gly Leu Leu Lys Leu 250 24 27 PRT Homo sapiens 24 Pro Asp
Val Ala Ser Leu Arg Gln Gln Val Glu Ala Leu Gln Gly Gln 1 5 10 15
Val Gln His Leu Gln Ala Ala Phe Ser Gln Tyr 20 25 25 8 PRT
Artificial sequence FLAG Peptide 25 Asp Tyr Lys Asp Asp Asp Asp Lys
1 5
* * * * *