U.S. patent application number 10/002244 was filed with the patent office on 2003-07-31 for use of heterologous transcription factors in gene therapy.
This patent application is currently assigned to ARIAD Gene Therapeutics, Inc.. Invention is credited to Gilman, Michael Z., Natesan, Sridaran.
Application Number | 20030143731 10/002244 |
Document ID | / |
Family ID | 27356686 |
Filed Date | 2003-07-31 |
United States Patent
Application |
20030143731 |
Kind Code |
A1 |
Gilman, Michael Z. ; et
al. |
July 31, 2003 |
Use of heterologous transcription factors in gene therapy
Abstract
This invention provides novel materials and methods involving
the heterologous expression of transcription factors which are
useful for effecting transcription of target genes in genetically
engineered cells or organisms containing them. Target gene
constructs and other materials useful for practicing the invention
are also disclosed.
Inventors: |
Gilman, Michael Z.; (Newton,
MA) ; Natesan, Sridaran; (Chestnut Hill, MA) |
Correspondence
Address: |
ARIAD Gene Therapeutics, Inc.
26 Landsdowne Street
Cambridge
MA
02139
US
|
Assignee: |
ARIAD Gene Therapeutics,
Inc.
|
Family ID: |
27356686 |
Appl. No.: |
10/002244 |
Filed: |
October 23, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10002244 |
Oct 23, 2001 |
|
|
|
08672213 |
Jun 27, 1996 |
|
|
|
10002244 |
Oct 23, 2001 |
|
|
|
09407402 |
Sep 28, 1999 |
|
|
|
09407402 |
Sep 28, 1999 |
|
|
|
09262721 |
Mar 4, 1999 |
|
|
|
09262721 |
Mar 4, 1999 |
|
|
|
09096732 |
Jun 11, 1998 |
|
|
|
60000553 |
Jun 27, 1995 |
|
|
|
60019614 |
Dec 29, 1995 |
|
|
|
Current U.S.
Class: |
435/325 ;
435/320.1; 435/455; 514/44R |
Current CPC
Class: |
C07K 2319/00 20130101;
C07K 14/4702 20130101; C07K 14/005 20130101; C12N 2710/16622
20130101 |
Class at
Publication: |
435/325 ;
435/320.1; 435/455; 514/44 |
International
Class: |
A61K 048/00; C12N
005/06; C12N 015/87 |
Claims
1. A method for expressing a target gene in a cell within a host
organism which comprises introducing into the organism cells
containing: (a) a transcription factor construct containing a first
heterologous DNA sequence encoding and capable of expressing a
transcription factor capable of activating transcription of a gene
linked to a transcription control sequence responsive to the
transcription factor, and (b) a target gene construct containing a
second heterologous DNA sequence comprising a target gene operably
linked to a transcription control sequence comprising a DNA
promoter sequence and one or more copies of a DNA recognition
sequence permitting gene transcription responsive to the presence
of the transcription factor.
2. A method of claim 1 in which the cell is of human origin.
3. A method of claim 1 in which the host organism is a human.
4. A method of claim 1 in which the transcription factor comprises
one or more domains having a peptide sequence derived from a
naturally occurring human peptide sequence.
5. A method of claim 1 in which the transcription factor comprises
peptide sequence derived from a DNA-binding protein of human
origin.
6. A method of claim 1 in which the transcription factor comprises
a composite DNA-binding domain.
7. A method of claim 1 in which the transcription factor comprises
peptide sequence derived from a transcription activating protein of
human origin.
8. A method of claim 7 in which the transcription factor contains
one or more copies of peptide sequence comprising all or part of
the peptide sequence spanning positions 361 through 550 of human
NF-kB p65, or a peptide sequence derived therefrom.
9. A method of claim 7 or 8 in which the transcription factor
contains one or more copies of peptide sequence comprising all or
part of the peptide sequence spanning positions 361 through 450 of
human NF-kB p65, or a peptide sequence derived therefrom.
10. A method of claim 9 in which the transcription factor contains
one or more copies of the peptide sequence p65(361-550), or peptide
sequence derived therefrom.
11. A method of claim 8 in which the transcription factor comprises
a composite transcription activation domain.
12. A method of claim 11 in which the composite transcription
activation domain comprises: (a) one or more copies of a peptide
sequence comprising all or a portion of the peptide sequence
spanning positions 361-450 of human NF-kB p65, or peptide sequence
derived therefrom, and (b) one or more copies of a heterologous
peptide sequence which potentiates the transcription activation
potency of the transcription factor
13. A method of claim 12 in which the heterologous peptide sequence
is selected or derived from peptide sequence within the sequence of
VP16 V8, VP16 C, HSF, or CTF.
14. A method of claim 1 in which the DNA sequence encoding the
transcription factor and the DNA sequence encoding the target gene
are both operably linked to transcription control sequences
permitting gene expression responsive to the presence of the
transcription factor.
15. A method of claim 1 in which the DNAs are introduced into the
cell by calcium phosphate precipitation, DEAE dextran-DNA
complexation, fusion, electroporation, biolistics, transfection, or
lipofection.
16. A method of claim 15 in which the DNAs are present in one or
more viral vectors.
17. A method of claim 1 in which the cells are encapsulated within
a semipermeable membrane.
18. A method for expressing a target gene in a cell within a host
organism which comprises introducing into the organism, under
conditions permitting DNA uptake by one or more cells within the
organism: (a) a transcription factor construct containing a first
heterologous DNA sequence encoding and capable of expressing a
transcription factor capable of activating transcription of a gene
linked to a transcription control sequence responsive to the
transcription factor, and (b) a target gene construct containing a
second heterologous DNA sequence comprising a target gene operably
linked to a transcription control sequence comprising a DNA
promoter sequence and one or more copies of a DNA recognition
sequence permitting gene transcription responsive to the presence
of the transcription factor.
19. A method of claim 18 in which the host organism is
mammalian.
20. A method of claim 19 in which the host organism is a human
subject.
21. A method of claim 20 in which the transcription factor
comprises one or more domains having a peptide sequence derived
from a naturally occurring human peptide sequence.
22. A method of claim 20 in which the transcription factor
comprises peptide sequence derived from a DNA-binding protein of
human origin.
23. A method of claim 20 in which the transcription factor
comprises a composite DNA-binding domain.
24. A method of claim 20 in which the transcription factor
comprises peptide sequence derived from a transcription activating
protein of human origin.
25. A method of claim 24 in which the transcription factor contains
one or more copies of peptide sequence comprising all or part of
the peptide sequence spanning positions 361 through 550 of human
NF-kB p65, or a peptide sequence derived therefrom.
26. A method of claim 25 in which the transcription factor contains
one or more copies of peptide sequence comprising all or part of
the peptide sequence spanning positions 361 through 450 of human
NF-kB p65, or a peptide sequence derived therefrom.
27. A method of claim 26 in which the transcription factor contains
one or more copies of the peptide sequence p65(361-550), or peptide
sequence derived therefrom.
28. A method of claim 25 in which the transcription factor
comprises a composite transcription activation domain.
29. A method of claim 28 in which the composite transcription
activation domain comprises: (a) one or more copies of a peptide
sequence comprising all or a portion of the peptide sequence
spanning positions 361-450 of human NF-kB p65, or peptide sequence
derived therefrom, and (b) one or more copies of a heterologous
peptide sequence which potentiates the transcription activation
potency of the transcription factor
30. A method of claim 29 in which the heterologous peptide sequence
is selected or derived from peptide sequence within the sequence of
VP16 V8, VP16 C, HSF, or CTF.
31. A method of claim 20 in which the DNA sequence encoding the
transcription factor and the DNA sequence encoding the target gene
are both operably linked to transcription control sequences
permitting gene expression responsive to the presence of the
transcription factor.
32. A method of claim 20 in which the two DNA constructs are
present in one or more viral vectors.
33. A recombinant DNA sequence encoding a chimeric transcription
factor containing one or more copies of peptide sequence comprising
all or part of the peptide sequence spanning positions 361 through
550 of human NF-kB p65, or a peptide sequence derived therefrom,
and peptide sequence heterologous thereto.
34. A recombinant DNA sequence of claim 33 in which the p65 peptide
sequence comprises peptide sequence selected or derived from the
p65 sequence spanning positions 361 through 450.
35. A recombinant DNA sequence of claim 33 in which the
transcription factor contains one or more copies of a heterologous
peptide sequence which potentiates the transcription activation
potency of the transcription factor.
36. A recombinant DNA sequence of claim 35 in which the
heterologous peptide sequence is selected or derived from peptide
sequence within the sequence of VP16 V8, VP16 C, HSF, or CTF.
37. A cell containing a recombinant DNA sequence of any of claims
33 through 36.
Description
INTRODUCTION
[0001] A large number of biological and clinical protocols, among
others, gene therapy, production of biological materials, and
biological research, depend on the ability to elicit specific and
high-level expression of genes encoding RNAs or proteins of
therapeutic, commercial, or experimental value. Achieving a
sufficiently high level of expression for clinical or other utility
in genetically engineered cells within whole organisms has often
been a limiting problem. Various approaches for addressing this
problem, including the search for stronger transcriptional
promoters or higher transfection efficiencies, have in many cases
not met with success. Meanwhile, in various lines of research with
transcription factors, promising results in transient transfection
models have not been borne out with chromosomally integrated
reporter gene constructs. Furthermore, overexpression of
transcription factors is commonly associated with toxicity to the
host cell. Despite those precedents, this invention takes a novel
approach to the challenge of optimizing heterolgous gene expression
through new uses of, and new designs for, transcription factor
proteins which are expressed within the engineered cells containing
the target gene. The invention provides improved methods and
materials for achieving high-level expression of a target gene in
genetically engineered cells, including genetically engineered
cells within whole organisms.
SUMMARY OF THE INVENTION
[0002] This invention involves protein transcription factors, DNA
sequences encoding such proteins, transcription control sequences
responsive to the transcription factors, target gene constructs
containing a target gene operably linked to such a transcription
control sequence, cells engineered to contain a target gene
construct and to express such the transcription factor, organisms
containing such cells and the use of these materials in gene
therapy, production of biological materials, and biological
research. In order to achieve constitutive expression of a target
gene in a cell, preferably a cell within a host organism, one
introduces into the organism cells which contain (a) a
transcription factor construct containing a first heterologous DNA
sequence encoding and capable of expressing a transcription factor
capable of activating transcription of a gene linked to a
transcription control sequence responsive to the transcription
factor, and (b) a target gene construct containing a second
heterologous DNA sequence comprising a target gene operably linked
to a transcription control sequence comprising a DNA promoter
sequence and one or more copies of a DNA recognition sequence
permitting gene transcription responsive to the presence of the
transcription factor.
[0003] Generally the cells are animal cells, preferably syngeneic
to the host organism into which the cells are introduced. Host
organisms of particular interest are mammals, i.e.,
post-implantation embryos and especially post-natal mammals. The
invention is considered to be of particular significance to the
practice of gene therapy with human subjects. In human gene therapy
applications the engineered cells will typically be of mammalian
origin, preferably human and in some cases autologous to the
host.
[0004] The transcription factor may be a naturally occurring
protein, especially if it is heterologous to the cell type to be
engineered. Currently preferred embodiments, however, involve the
use of a chimeric transcription factor containing at least two
mutually heterologous peptide sequences. The transcription factor
will contain one or more DNA-binding domains and one or more
transcription activation domains, each of which containing peptide
sequence often derived from naturally occurring transcription
factors. For example, a fusion protein containing the well-known
Herpes simplex virus transcription activation domain, VP16, linked
to the bacterial DNA binding domain, GAL4, constitutes such a
chimeric transcription factor. Preferably, however, the peptide
sequence of each of the domains will be derived from a naturally
occurring human peptide sequence. In some embodiments the
DNA-binding domain and/or the transcription activation domain
comprises a composite domain containing mutually-heterologous
and/or reiterated subdomains.
[0005] The peptide sequence spanning positions 450 through 550 of
human NF-kB p65, for instance, constitutes a transcription
activation domain of human origin which may be used in
transcription factors of this invention. In some embodiments, a
novel, extended p65 sequence, spanning residues 361 through 550, is
used. That peptide sequence is referred to herein as
"p65(361-550)". In various embodiments the transcription factor
contains multiple copies of the transcription activation domain
and/or a plurality of different transcription activation domains,
subdomains or potentiating motifs. Transcription activation domains
comprising a plurality of different and/or reiterated peptide
sequences constitute composite transcription activation domains.
One illustrative class of composite transcription activation
domains comprise one or more copies of (a) the full sequence of
p65(361-550), (b) one or more portions of that sequence, or (c) a
combination of (a) and (c), together with one or more copies of one
or more transcription activation potentiating motifs. Such motifs
may be selected or derived from the so-called "proline-rich",
"glutamine-rich" and "acidic" activation motifs such as the VP16 V8
motif (DFDLDMLG, SEQ ID NO 1), the related "V9" motif (DFDLDMLGG,
SEQ ID NO 2) or a human activation motif such as the 14 amino acid
acidic motif of human heat shock factor.
[0006] Various DNA binding domains may be incorporated into the
design of the transcription factor so long as a corresponding DNA
"recognition" sequence is known or can be identified to which the
domain is capable of binding. One or more copies of the recognition
sequence are incorporated into the transcription control sequence
of the target gene construct. Again, peptide sequence of human
origin is preferred for the DNA binding domain(s). Composite DNA
binding domains provide a means for achieving novel sequence
specificity for the protein-DNA binding interaction. An
illustrative composite DNA binding domain containing component
peptide sequences of human origin is ZFHD-1 which is described in
detail below. Individual DNA-binding domains may be further
modified by mutagenesis to decrease, increase, or change the
recognition specificity of DNA binding. These modifications could
be achieved by rational design of substitutions in positions known
to contribute to DNA recognition (often based on homology to
related proteins for which explicit structural data are available).
For example, in the case of a homeodomain, substitutions can be
made in amino acids in the N-terminal arm, first loop, second
helix, and third helix known to contact DNA. In zinc fingers,
substitutions can be made at selected positions in the DNA
recognition helix. Alternatively, random methods, such as selection
from a phage display library could be used to identify altered
domains with increased affinity or altered specificity. Individual
DNA-binding domains may be further modified by mutagenesis to
decrease, increase, or change the recognition specificity of DNA
binding. These modifications could be achieved by rational design
of substitutions in positions known to contribute to DNA
recognition (often based on homology to related proteins for which
explicit structural data are available). For example, in the case
of a homeodomain, substitutions can be made in amino acids in the
N-terminal arm, first loop, second helix, and third helix known to
contact DNA. In zinc fingers, substitutions can be made at selected
positions in the DNA recognition helix. Alternatively, random
methods, such as selection from a phage display library could be
used to identify altered domains with increased affinity or altered
specificity.
[0007] In one embodiment, the DNA sequence encoding the
transcription factor and the DNA sequence encoding the target gene
are both operably linked to transcription control sequences
containing one or more copies of a common DNA recognition sequence
permitting gene expression responsive to the presence of the
transcription factor. The two transcription control sequences may
contain the same or different promoter sequences.
[0008] The cells containing the components mentioned above are
prepared by introduction of the desired DNA constructs, linked or
unlinked to each other, using any methods and materials permitting
introduction of heterologous DNA into cells. For instance, the
constructs may be introduced into the cell by calcium phosphate
precipitation, DEAE dextran-DNA complexation, fusion,
electroporation, biolistics, transfection, lipofection etc. Various
types of DNA vectors are known which may be used, including
retroviral, adenoviral, adenoassociated viral, BPV, etc. The
engineered cells may be cultured and the introduced DNA may be
permitted to integrate into the host cell's chromosomal material.
The engineered cells may be characterized as desired and may be
encapsulated within a variety of semipermeable materials prior to
introduction into the host organism using known methods.
[0009] As an alternative to the introduction of genetically
engineered cells into the whole organism, the various DNA
constructs may be introduced directly into the host organism using
materials, methods and conditions permitting DNA uptake by one or
more cells within the organsim, e.g. using direct injection,
liposomes, or DNA vectors including viral vectors such as
retroviral vectors, adenoviral vectors, or AAV vectors.
[0010] Some of the materials invented for use in this invention
have significant utility even beyond the scope of constitutive gene
therapy and may be used in regulated gene therapy and in other
methods and materials relevant to heterologous transcription of a
desired gene. Such materials include recombinant DNA molecules
encoding chimeric transcription factors containing one or more
copies of peptide sequence from within p65(361-450) or containing
one or more copies of p65-derived sequence together with one or
more copies of one or more heterologous activation motifs. Other
broadly useful materials include recombinant DNA molecules
containing a target gene operably linked to a minimal IL-2
promoter.
BRIEF DESCRIPTION OF THE FIGURES
[0011] FIG. 1 demonstrates that in vivo administration of a
dimerizing agent to animals into which engineered cells had been
transplanted led to regulated gene expression and the production
and secretion of the gene product. HT1080 cells were transfected
with DNA constructs encoding regulatable transcription factor
components as described in the examples below. Transfected HT1080
cells (2.times.10.sup.6 total per animal, in four different sites)
were injected intramuscularly into male nu/nu mice. Approximately
one hour later, animals received the indicated concentration of
intravenous rapamycin. Blood samples were collected 17 hours after
rapamycin adminsitration and assayed for hGH concentration.
Rapamcyin treatment produced a dose-dependent increase in serum hGH
(X.+-.SEM; n=at least 5 at each dose). * represent statistical
significance from each lower rapamycin dose and .dagger. represents
statistical significance from rapamycin doses which are 10-fold and
more lower (p<0.05, one-way analysis of variance and
Tukey-Kramer multiple comparison testing).
[0012] FIGS. 2 through 7 present comparative data on a
representative collection of chimeric transcription factors assayed
in cell lines into which target gene constructs (SEAP) had been
stably integrated as described in the examples which follow
below.
DETAILED DESCRIPTION OF THE INVENTION
[0013] Definitions
[0014] The definitions and orienting information below will be
helpful for a full understanding of the present disclosure.
[0015] "Minimal promoter" as that phrase is used herein means a DNA
sequence which is derived from a regulatory region upstream of a
gene, contains a TATA box flanked upstream by about 20-30 base
pairs and on its 3' end by .about.100-300 bp, and which has little
or no basal promoter activity, i.e., less than about 1% of the
promoter activity observed with the full length regulatory region
as determined by any measure of transcriptional activity.
[0016] "Derived from" as that phrase is used herein indicates a
peptide or nucleotide sequence selected from within a given
sequence. A peptide or nucleotide sequence derived from a named
sequence may contain a small number of modifications relative to
the parent sequence, in most cases representing deletion,
replacement or insertion of less than about 15%, preferably less
than about 10%, and in many cases less than about 5%, of amino acid
residues or base pairs present in the parent sequence. In the case
of DNAs, one DNA molecule is also considered to be derived from
another if the two are capable of selectively hybridizing to one
another.
[0017] The terms "chimeric", "fusion", "recombinant", and
"composite" are used to denote a protein, peptide domain or
nucleotide sequence or molecule containing at least two component
portions which are mutually heterologous in the sense that they do
not occur together in the same arrangement in nature. More
specifically, the component portions are not found in the same
continuous polypeptide or gene in nature, at least not in the same
order or orientation or with the same spacing present in the
chimeric protein or composite domain. Such materials contain
components derived from at least two different proteins or genes or
from at least two non-adjacent portions of the same protein or
gene. Composite proteins, and DNA sequences which encode them, are
recombinant in the sense that they contain at least two consituent
portions which are not otherwise found directly linked (covalently)
together in nature.
[0018] "DNA recognition sequence" as that phrase is used herein
means a DNA sequence which is capable of binding to one or more
DNA-binding domains of a transcription factor.
[0019] "Transcription activation motifs" as that phrase is used
herein means a peptide motif of at least about 6 amino acid
residues associated with a transcription activation domain,
including the well-known "acidic", "glutamine-rich" and
"proline-rich" motifs such as the K13 motif from p65, the OCT2 Q
domain and the OCT2 P domain, respectively.
[0020] Components of the System
[0021] The system, as employed in cells, comprises: (1) a DNA
construct encoding and directing the expression of a transcription
factor protein, typically containing at least one DNA-binding
domain and one or more transcriptional activation domains; and, (2)
a DNA construct containing a target gene and a transcription
control sequence permitting transcription of the target gene under
the direction of the transcription factor. The transcription
control sequence comprises a DNA promoter sequence and one or more
copies of a DNA recognition sequence to which the transcription
factor is capable of binding.
[0022] The transcription factor may be a naturally occurring
transcription factor, preferably heterologous with respect to the
cells to be engineered. In embodiments of particular interest, the
transcription factor is a chimeric protein designed such that it
contains at least one DNA binding domain and at least one
transcription activation domain which is heterologous with respect
to the DNA binding domain. One such hybrid transcription factor
contains a GAL4 binding domain fused to a VP16 transcriptional
activation domain. It will often be generally preferred that
component domains of the transcription factor be derived from
proteins endogenous to the cells to be engineered, as described
below. This is especially true in the case of gene therapy in human
subjects. Well known human transcription factors include p65, p53
and SP1. In the case of the DNA binding domains, however, it is
preferable to use a domain which is heterologous with respect to
the cells to be engineered. Heterologous DNA binding domains
include those which occur naturally in cell types other than the
cells to be engineered as well as composite DNA binding domains
containing component portions which are not found in the same
continuous polypeptide or gene in nature, at least not in the same
order or orientation or with the same spacing present in the
composite domain. In the case of composite DNA binding domains,
component peptide portions which are endogenous to the cells or
organism to be engineered are generally preferred.
[0023] 1. DNA-binding domains. Transcription factors of this
invention contain one or more DNA binding domains which may be
selected from peptide sequences of naturally occurring DNA-binding
proteins such as the yeast GAL4 DNA-binding domain, may be derived
from such sequences or may comprise a composite DNA-binding region.
A composite DNA-binding region consists of a continuous polypeptide
region containing two or more component heterologous polypeptide
portions which are individually capable of recognizing (i.e.,
binding to) specific nucleotide sequences. The component
polypeptide domains comprise peptide sequence derived from
different proteins, peptide sequences from at least two
non-adjacent portions of the same protein, polypeptide sequences
which are not found so linked in nature (including reiterated
copies of a polypeptide sequence) or non-naturally occurring
peptide sequence. Preferably the DNA-binding domain or component
peptide sequences thereof are selected or derived from peptide
sequences endogenous to the cells or organism to be engineered. The
individual component portions may be separated by a linker
comprising one or more amino acid residues intended to permit the
simultaneous contact of each component polypeptide portion with the
DNA target. The combined action of the composite DNA-binding region
formed by the component DNA-binding modules is thought to result in
the addition of the free energy decrement of each set of
interactions. The effect is to achieve a DNA-protein interaction of
very high affinity, preferably with dissociation constant below
10.sup.-9 M, more preferably below 10.sup.-10 M, even more
preferably below 10.sup.-11 M. This goal is often best achieved by
combining component polypeptide regions that bind DNA poorly on
their own, that is with low affinity, insufficient for functional
recognition of DNA under typical conditions in a mammalian cell.
Because the hybrid protein exhibits affinity for the composite site
several orders of magnitude higher than the affinities of the
individual sub-domains for their subsites, the protein
preferentially (preferably exclusively) occupies the "composite"
site which typically comprises a nucleotide sequence spanning the
individual DNA sequence recognized by the individual component
polypeptide portions of the composite DNA-binding region.
[0024] Suitable component DNA-binding polypeptides for
incorporation into a composite region have one or more, preferably
more, of the following properties. They bind DNA as monomers,
although dimers can be accommodated. They should have modest
affinities for DNA, with dissociation constants preferably in the
range of 10.sup.-6 to 10.sup.-9 M. They should optimally belong to
a class of DNA-binding domains whose structure and interaction with
DNA are well understood and therefore amenable to manipulation. For
gene therapy applications, they are preferably derived from human
proteins.
[0025] A structure-based strategy of fusing known DNA-binding
modules has been used to design transcription factors with novel
DNA-binding specificities. In order to visualize how certain
DNA-binding domains might be fused to other DNA-binding domains,
computer modeling studies have been used to superimpose and align
various protein-DNA complexes.
[0026] Two criteria suggest which alignments of DNA-binding domains
have potential for combination into a composite DNA-binding region
(1) lack of collision between domains, and (2) consistent
positioning of the carboxyl- and amino-terminal regions of the
domains, i.e., the domains must be oriented such that the
carboxyl-terminal region of one polypeptide can be joined to the
amino-terminal region of the next polypeptide, either directly or
by a linker (indirectly). Domains positioned such that only the two
amino-terminal regions are adjacent to each other or only the two
carboxyl-terminal regions are adjacent to each other are not
suitable for inclusion in the chimeric proteins of the present
invention. When detailed structural information about the
protein-DNA complexes is not available, it may be necessary to
experiment with various endpoints, and more biochemical work may be
necessary to characterize the DNA-binding properties of the
chimeric proteins. This optimization can be performed using known
techniques. Virtually any domains satisfying the above-described
criteria are candidates for inclusion in the chimeric protein.
Alternatively, non-computer modeling may also be used.
[0027] 2. Examples of suitable component DNA-binding domains.
DNA-binding domains with appropriate DNA binding properties may be
selected from several different types of natural DNA-binding
proteins. One class comprises proteins that normally bind DNA only
in conjunction with auxiliary DNA-binding proteins, usually in a
cooperative fashion, where both proteins contact DNA and each
protein contacts the other. Examples of this class include the
homeodomain proteins, many of which bind DNA with low affinity and
poor specificity, but act with high levels of specificity in vivo
due to interactions with partner DNA-binding proteins. One
well-characterized example is the yeast alpha2 protein, which binds
DNA only in cooperation with another yeast protein Mcm1. Another
example is the human homeodomain protein Phox1, which interacts
cooperatively with the human transcription factor, serum response
factor (SRF).
[0028] The homeodomain is a highly conserved DNA-binding domain
which has been found in hundreds of transcription factors (Scott et
al., Biochim. Biophys. Acta 989:25-48 (1989) and Rosenfeld, Genes
Dev. 5:897-907 (1991)). The regulatory function of a homeodomain
protein derives from the specificity of its interactions with DNA
and presumably with components of the basic transcriptional
machinery, such as RNA polymerase or accessory transcription
factors (Laughon, Biochemistry 30(48):11357 (1991)). A typical
homeodomain comprises an approximately 61-amino acid residue
polypeptide chain, folded into three alhpha helices which binds to
DNA.
[0029] A second class comprises proteins in which the DNA-binding
domain is comprised of multiple reiterated modules that cooperate
to achieve high-affinity binding of DNA. An example is the C2H2
class of zinc-finger proteins, which typically contain a tandem
array of from two or three to dozens of zinc-finger modules. Each
module contains an alpha-helix capable of contacting a three
base-pair stretch of DNA. Typically, at least three zinc-fingers
are required for high-affinity DNA binding. Therefore, one or two
zinc-fingers constitute a low-affinity DNA-binding domain with
suitable properties for use as a component in this invention.
Examples of proteins of the C2H2 class include TFIIIA, Zif268, Gli,
and SRE-ZBP. (These and other proteins and DNA sequences referred
to herein are well known in the art. Their sources and sequences
are known.)
[0030] The zinc finger motif, of the type first discovered in
transcription factor IIIA (Miller et al., EMBO J. 4:1609 (1985)),
offers an attractive framework for studies of transcription factors
with novel DNA-binding specificities. The zinc finger is one of the
most common eukaryotic DNA-binding motifs (Jacobs, EMBO J. 11:4507
(1992)), and this family of proteins can recognize a diverse set of
DNA sequences (Pavletich and Pabo, Science 261:1701 (1993)).
Crystallographic studies of the Zif268-DNA complex and other zinc
finger-DNA complexes show that residues at four positions within
each finger make most of the base contacts, and there has been some
discussion about rules that may explain zinc finger-DNA recognition
(Desjarlais and Berg, PNAS 89:7345 (1992) and Klevit, Science
253:1367 (1991)). However, studies have also shown that zinc
fingers can dock against DNA in a variety of ways (Pavletich and
Pabo (1993) and Fairall et al., Nature 366:483 (1993)).
[0031] A third general class comprises proteins that themselves
contain multiple independent DNA-binding domains. Often, any one of
these domains is insufficient to mediate high-affinity DNA
recognition, and cooperation with a covalently linked partner
domain is required. Examples include the POU class, such as Oct-1,
Oct-2 and Pit-1, which contain both a homeodomain and a
POU-specific domain; HNF1, which is organized similarly to the POU
proteins; certain Pax proteins (examples: Pax-3, Pax-6), which
contain both a homeodomain and a paired box/domain; and XXX, which
contains a homeodomain and multiple zinc-fingers of the C2H2
class.
[0032] From a structural perspective, DNA-binding proteins
containing domains suitable for use as polypeptide components of a
composite DNA-binding region may be classified as DNA-binding
proteins with a helix-turn-helix structural design, including, but
not limited to, MAT a1, MAT a2, MAT a1, Antennapedia,
Ultrabithorax, Engrailed, Paired, Fushi tarazu, HOX, Unc86, and the
previously noted Oct1, Oct2 and Pit; zinc finger proteins, such as
Zif268, SWI5, Kruppel and Hunchback; steroid receptors; DNA-binding
proteins with the helix-loop-helix structural design, such as
Daughterless, Achaete-scute (T3), MyoD, E12 and E47; and other
helical motifs like the leucine-zipper, which includes GCN4, C/EBP,
c-Fos/c-Jun and JunB. The amino acid sequences of the component
DNA-binding domains may be naturally-occurring or
non-naturally-occurring (or modified).
[0033] The choice of component DNA-binding domains may be
influenced by a number of considerations, including the species,
system and cell type which is targeted; the feasibility of
incorporation into a chimeric protein, as may be shown by modeling;
and the desired application or utility. The choice of DNA-binding
domains may also be influenced by the individual DNA sequence
specificity of the domain and the ability of the domain to interact
with other proteins or to be influenced by a particular cellular
regulatory pathway. Preferably, the distance between domain termini
is relatively short to facilitate use of the shortest possible
linker or no linker. The DNA-binding domains can be isolated from a
naturally-occurring protein, or may be a synthetic molecule based
in whole or in part on a naturally-occurring domain.
[0034] An additional strategy for obtaining component DNA-binding
domains with properties suitable for this invention is to modify an
existing DNA-binding domain to reduce its affinity for DNA into the
appropriate range. For example, a homeodomain such as that derived
from the human transcription factor Phox1, may be modified by
substitution of the glutamine residue at position 50 of the
homeodomain. Substitutions at this position remove or change an
important point of contact between the protein and one or two base
pairs of the 6-bp DNA sequence recognized by the protein. Thus,
such substitutions reduce the free energy of binding and the
affinity of the interaction with this sequence and may or may not
simultaneously increase the affinity for other sequences. Such a
reduction in affinity is sufficient to effectively eliminate
occupancy of the natural target site by this protein when produced
at typical levels in mammalian cells. But it would allow this
domain to contribute binding energy to and therefore cooperate with
a second linked DNA-binding domain. Other domains that amenable to
this type of manipulation include the paired box, the zinc-finger
class represented by steroid hormone receptors, the myb domain, and
the ets domain.
[0035] Illustrating the class of chimeric proteins of this
invention which contain a composite DNA-binding domain comprising
at least one homeodomain and at least one zinc finger domain are a
set of chimeric proteins in which the composite DNA-binding region
comprises an Oct-1 homeodomain and zinc fingers 1 and 2 of Zif268,
referred to herein as "ZFHD1". Proteins comprising the ZFHD1
composite DNA-binding region have been produced and shown to bind a
composite DNA sequence,
1 5' TAATTANGGGNG 3' SEQ ID NO 3 3' ATTAATNCCCNC 5'
[0036] which includes the nucleic acid sequences bound by the
relevant portion of the two component DNA-binding proteins.
[0037] 3. Design of linker sequence for covalently linked composite
DNA-binding domains. The continuous polypeptide span of a composite
DNA-binding domain may contain the component polypeptide modules
linked directly end-to-end or linked indirectly via an intervening
amino acid or peptide linker. A linker moiety may be designed or
selected empirically to permit the independent interaction of each
component DNA-binding domain with DNA without steric interference.
A linker may also be selected or designed so as to impose specific
spacing and orientation on the DNA-binding domains. The linker
amino acids may be derived from endogenous flanking peptide
sequence of the component domains or may comprise one or more
heterologous amino acids. Linkers may be designed by modeling or
identified by experimental trial.
[0038] The linker may be any amino acid sequence that results in
linkage of the component domains such that they retain the ability
to bind their respective nucleotide sequences. In some embodiments
it is preferable that the design involve an arrangement of domains
which requires the linker to span a relatively short distance,
preferably less than about 10 .ANG.. However, in certain
embodiments, depending upon the selected DNA-binding domains and
the configuration, the linker may span a distance of up to about 50
.ANG.. For instance, the ZFHD1 protein contains a
glycine-glycine-arginine-arginine linker which joins the
carboxyl-terminal region of zinc finger 2 to the amino-terminal
region of the Oct-1 homeodomain.
[0039] Within the linker, the amino acid sequence may be varied
based on the preferred characteristics of the linker as determined
empirically or as revealed by modeling. For instance, in addition
to a desired length, modeling studies may show that side groups of
certain nucleotides or amino acids may interfere with binding of
the protein. The primary criterion is that the linker join the
DNA-binding domains in such a manner that they retain their ability
to bind their respective DNA sequences, and thus a linker which
interferes with this ability is undesirable. A desirable linker
should also be able to constrain the relative three-dimensional
positioning of the domains so that only certain composite sites are
recognized by the chimeric protein. Other considerations in
choosing the linker include flexibility of the linker, charge of
the linker and selected binding domains, and presence of some amino
acids of the linker in the naturally-occurring domains. The linker
can also be designed such that residues in the linker contact DNA,
thereby influencing binding affinity or specificity, or to interact
with other proteins. For example, a linker may contain an amino
acid sequence which can be recognized by a protease so that the
activity of the chimeric protein could be regulated by cleavage. In
some cases, particularly when it is necessary to span a longer
distance between the two DNA-binding domains or when the domains
must be held in a particular configuration, the linker may
optionally contain an additional folded domain.
[0040] 4. Optimization and Engineering of composite DNA-binding
regions. The useful range of composite DNA binding regions is not
limited to the specifities that can be obtained by linking two
naturally occurring DNA binding subdomains. A variety of
mutagenesis methods can be used to alter the binding specificity.
These include use of the crystal or NMR structures (3D) of
complexes of a DNA-binding domain with DNA to rationally predict
(an) amino acid substitution(s) that will alter the nucleotide
sequence specificity of DNA binding, in combination with
computational modeling approaches. Candidate mutants can then be
engineered and expressed and their DNA binding specificity
identified using oligonucleotide site selection and DNA sequencing,
as described earlier.
[0041] An alternative approach to generating novel sequence
specificities is to use databases of known homologs of the
DNA-binding domain to predict amino acid substitutions that will
alter binding. For example, analysis of databases of zinc finger
sequences has been used to alter the binding specificity of a zinc
finger (Desjarlais and Berg (1993) Proc. Natl. Acad. Sci. USA 90,
2256-2260).
[0042] A further and powerful approach is random mutaganesis of
amino acid residues which may contact the DNA, followed by
screening or selection for the desired novel specificity.
Preferably, the libraries are surveyed using phage display so that
mutants can be directly selected. For example, phage display of the
three fingers of Zif268 (including the two incorporated into ZFHD1)
has been described, and random mutagenesis and selection has been
used to alter the specificity and affinity of the fingers (Rebar
and Pabo (1994) Science 263, 671-673; Jamieson et al, (1994)
Biochemistry 33, 5689-5695; Choo and Klug (1994) Proc. Natl. Acad.
Sci. USA 91, 11163-11167; Choo and Klug (1994) Proc. Natl. Acad.
Sci. USA 91, 11168-11172; Choo et al (1994) Nature 372, 642-645; Wu
et al (1995) Proc. Natl. Acad. Sci USA 92, 344-348). These mutants
can be incorporated into ZFHD1 to provide new composite DNA binding
regions with novel nucleotide sequence specificities. Other
DNA-binding domains may be similarly altered. If structural
information is not available, general mutagenesis strategies can be
used to scan the entire domain for desirable mutations: for example
alanine-scanning mutagenesis (Cunningham and Wells (1989) Science
244, 1081-1085), PCR misincorporation mutagenesis (see eg. Cadwell
and Joyce (1992) PCR Meth. Applic. 2, 28-33), and `DNA shuffling`
(Stemmer (1994) Nature 370, 389-391). These techniques produce
libraries of random mutants, or sets of single mutants, that can
then be readily searched by screening or selection approaches such
as phage display.
[0043] In all these approaches, mutagenesis can be carried out
directly on the composite DNA binding region, or on the individual
subdomain of interest in its natural or other protein context. In
the latter case, the engineered component domain with new
nucleotide sequence specificity may be subsequently incorporated
into the composite DNA binding region in place of the starting
component. The new DNA binding specificity may be wholly or
partially different from that of the initial protein: for example,
if the desired binding specificity contains (a) subsite(s) for
known DNA binding subdomains, other subdomains can be mutated to
recognize adjacent sequences and then combined with the natural
domain to yield a composite DNA binding region with the desired
specificity.
[0044] Randomization and selection strategies may be used to
incorporate other desirable properties into the composite DNA
binding regions in addition to altered nucleotide recognition
specificity, by imposing an appropriate in vitro selective pressure
(for review see Clackson and Wells (1994) Trends Biotech. 12,
173-184). These include improved affinity, improved stability and
improved resistance to proteolytic degradation.
[0045] Overall, in designing or optimizing chimeric proteins of
this invention it should be appreciated that immunogenicity of a
polypeptide sequence is thought to require the binding of peptides
by MHC proteins and the recognition of the presented peptides as
foreign by endogenous T-cell receptors. It may be preferable, at
least in gene therapy applications, to alter a given foreign
peptide sequence to minimize the probability of its being presented
in humans. For example, peptide binding to human MHC class I
molecules has strict requirements for certain residues at key
`anchor` positions in the bound peptide: eg. HLA-A2 requires
leucine, methionine or isoleucine at position 2 and leucine or
valine at the C-terminus (for review see Stern and Wiley (1994)
Structure 2, 145-251). Thus in engineered proteins, this
periodicity of those residues could be avoided.
[0046] 5. Transcriptional Activation Domains. Transcription factors
of this invention also contain one or more transcription activation
domains which may be selected from peptide sequences of naturally
occurring transcription factors such as the widely used
transcription activation domain of Herpes Simplex Virus VP16, may
be derived from such sequences or may comprise a composite
transcription activation region. A composite transcription
activation region consists of a continuous polypeptide region
containing two or more reiterated or mutually heterologous
component polypeptide portions. The component polypeptide portions
comprise polypeptide sequences derived from at least two different
proteins, polypeptide sequences from at least two non-adjacent
portions of the same protein, polypeptide sequences which are not
found so linked in nature (including reiterated copies of a
polypeptide sequence) or non-naturally occurring peptide sequence.
Preferably the activation domain or component peptide sequences
thereof are selected or derived from peptide sequences endogenous
to the cells or organism to be engineered.
[0047] One particularly important source of transcription
activation domains which are featured in a number of embodiments of
the invention is human NF-kB p65. In one embodiment the
transcription factor contains one or more copies of a peptide
sequence comprising all or part of the p65 sequence spanning
residues 450-550, or a peptide sequence derived therefrom, together
with peptide sequence heterologous thereto. That heterologous
sequence includes one or more DNA binding domains as discussed
elsewhere and may further include, inter alia, additional
activation domains. p65(450-550) is a known transcription
activation domain although methods and materials for using it as
described herein have not been previously reported. We have found
that extending the p65 peptide sequence to include sequence
spanning p65 residues 361-450 leads to an unexpected increase in
transcription activation. Moreover, a peptide sequence comprising
all or a portion of p65(361-550), or peptide sequence derived
therefrom, in combination with heterologous activation motifs, can
yield surprising additional increases in the level of transcription
activation. p65-based activation domains function across a broad
range of promoters and have yielded increases in transcription
levels six-fold, eight-fold and even 14-15-fold higher than
obtained with tandem copies of VP16 which itself is widely
recognized as a very potent activation domain.
[0048] While the resultant increases in activation potency are
dramatic, p65-based transcription factors possess additional and
unexpected characteristics. For instance, unlike VP16, our
p65-based activators do not appear to be toxic to the engineered
cells. This is clearly of profound practical significance in many
applications. It is expected that recombinant DNA molecules
encoding chimeric proteins which contain a peptide sequence
comprising all or a portion of p65(361-550), especially containing
one or more portions of the sequence spanning residues 361 and 450,
or peptide sequence derived therefrom, will provide significant
advantages for heterologous gene expression in its various
contexts, including constitutive systems such as described herein,
as well as in regulated systems such as described in International
patent applications PCT/US94/01617, PCT/US95/10591, PCT/US96/(Atty
docket ARIAD 345-B-PCT, entitled "filed Jun. 7, 1996) and the like,
as well as in other heterologous transcription systems such as
those involving tetracylin-based regulation reported by Bujard et
al. and those involving steroid or other hormone-based
regulation.
[0049] One class of p65-based transcription factors contain more
than one copy of a p65-derived domain. Such proteins will typically
contain two to about six copies of a peptide sequence comprising
all or a portion of p65(361-550), or peptide sequence derived
therefrom. Such transcription factors may contain one or more
DNA-binding domains, a ligand-binding domain to provide for
regulation e.g. by any of the previously mentioned systems.
[0050] Transcription factors of this invention may contain, in
addition to one or more copies of a primary activation domain such
as described above, one or more copies of one or more heterologous
peptide sequences which potentiate the transcription activation
potency of the transcription factor, as measured by any means.
Inclusion of such motifs, including the so-called "glutamine-rich",
"proline-rich" and "acidic" transcription activation motifs, in
combination with a primary activation domain can result in
extremely high levels of transcription.
[0051] Illustrative activation domains and motifs of human origin
include the activation domain of human CTF, the 18 amino acid
(NFLQLPQQTQGALLTSQP, SEQ ID NO 4) glutamine rich region of Oct-2,
the N-terminal 72 aminoacids of p53, the SYGQQS (SEQ ID NO 5)
repeat in Ewing sarcoma gene and an 11 amino acid (535-545) acidic
rich region of ReI A protein.
[0052] Illustrating the class of chimeric proteins of this
invention which contain a composite DNA-binding domain and at least
one transcription activation domain are chimeric proteins
containing the ZFHD1 composite DNA-binding region and the Herpes
Simplex Virus VP16 activation domain, which has been produced and
shown to activate transcription selectively in vivo of a gene (the
luciferase gene) linked to an iterated ZFHD1 binding site. Another
chimeric protein containing ZFHD1 and an NF-kB p65(450-550)
activation domain has also been produced and shown to activate
transcription in vivo of a gene (secreted alkaline phosphatase)
linked to iterated ZFHD1 binding sites. Various additional
activation domains, motifs and chimeric transcription factors are
provided in the examples which follow.
[0053] 6. Additional domains. Additional domains may be included in
chimeric proteins of this invention. For example, the chimeric
proteins may contain a nuclear localization sequence which provides
for the protein to be translocated to the nucleus. Typically a
nuclear localization sequence has a plurality of basic amino acids,
referred to as a bipartite basic repeat (reviewed in Garcia-Bustos
et al, Biochimica et Biophysica Acta (1991) 1071, 83-101). This
sequence can appear in any portion of the molecule internal or
proximal to the N- or C-terminus and results in the chimeric
protein being localized inside the nucleus.
[0054] The chimeric proteins may include domains that facilitate
their purification, e.g. "histidine tags" or a
glutathione-S-transferase domain. They may include "epitope tags"
encoding peptides recognized by known monoclonal antibodies for the
detection of proteins within cells or the capture of proteins by
antibodies in vitro.
[0055] Transcription factors can be tested for activity in vivo
using a simple assay (F. M. Ausubel et al., Eds., CURRENT PROTOCOLS
IN MOLECULAR BIOLOGY (John Wiley & Sons, New York, 1994); de
Wet et al., Mol. Cell Biol. 7:725 (1987)). The in vivo assay
requires a plasmid containing and capable of directing the
expression of a recombinant DNA sequence encoding the transcription
factor. The assay also requires a plasmid containing a reporter
gene, e.g., the luciferase gene, the chloramphenicol acetyl
transferase (CAT) gene, secreted alkaline phosphatase or the human
growth hormone (hGH) gene, linked to a binding site for the
transcription factor. The two plasmids are introduced into host
cells which normally do not produce interfering levels of the
reporter gene product. A second group of cells, which also lack
both the gene encoding the transcription factor and the reporter
gene, serves as the control group and receives a plasmid containing
the gene encoding the transcription factor and a plasmid containing
the test gene without the binding site for the transcription
factor.
[0056] The production of mRNA or protein encoded by the reporter
gene is measured. An increase in reporter gene expression not seen
in the controls indicates that the transcription factor is a
positive regulator of transcription. If reporter gene expression is
less than that of the control, the transcription factor is a
negative regulator of transcription.
[0057] Optionally, the assay may include a transfection efficiency
control plasmid. This plasmid expresses a gene product independent
of the test gene, and the amount of this gene product indicates
roughly how many cells are taking up the plasmids and how
efficiently the DNA is being introduced into the cells. Additional
guidance on evaluating chimeric proteins of this invention is
provided below.
[0058] 7. Transcription factors, additional comments. In
engineering cells for or in whole animals in accordance with this
invention, it will often be preferred, and in some cases required,
that the various domains or subdomains of the chimeric
transcription factors be derived from proteins of the same species
as the host cell. Thus, for genetic engineering of human cells, it
is often preferred that component peptide sequences of human origin
be used in some or all cases, rather than of bacterial, yeast or
other non-human source. Transcription factor constructs generally
contain (1) a promoter region consisting minimally of a TATA box
and initiator sequence but optionally including other transcription
factor binding sites; (2) DNA sequence encoding the desired
transcription factor, including sequences that promote the
initiation and termination of translation, if appropriate; (3) an
optional sequence consisting of a splice donor, splice acceptor,
and intervening intron DNA; and (4) a sequence directing cleavage
and polyadenylation of the resulting RNA transcript. The
practitioner may select a conventional promoter such as the widely
used hCMV promoter region.
[0059] It will be preferred in certain embodiments, especially
where DNA is introduced into an animal for uptake by cells in situ,
that the transcription factors be expressed in a cell-specific or
tissue-specific manner. Such specificity of expression may be
achieved by operably linking one or more of the DNA sequences
encoding the chimeric protein(s) to a cell-type specific
transcriptional regulatory sequence (e.g. promoter/enhancer).
Numerous cell-type specific transcriptional regulatory sequences
are known. Others may be obtained from genes which are expressed in
a cell-specific manner. See e.g. PCT/US95/10591, especially pp.
36-37.
[0060] For example, constructs for expressing the chimeric proteins
may contain regulatory sequence derived from known genes for
specific expression in selected tissues. Representative examples
are tabulated below:
2 Tissue Gene Reference lens g2-crystallin Breitman, M. L.,
Clapoff, S., Rossant, J., Tsui, L.C., Golde, Maxwell, I. H.,
Bernstin, A. (1987) Genetic Ablation: targ expression of a toxin
gene causes microphthalmia in trans Science 238: 1563-1565
aA-crystallin Landel, C. P., Zhao, J., Bok, D., Evans, G. A. (1988)
Lens- expression of a recombinant ricin induces developemental d
the eyes of transgenic mice. Genes Dev. 2: 1168-1178 Kaur, S., key,
B., Stock, J., McNeish, J. D., Akeson, R., Po (1989) Targeted
ablation of alpha-crystallin-synthesizir produces lens-deficient
eyes in transgenic mice. Developi 613-619 pituitary- Growth hormone
Behringer, R. R., Mathews, L. S., Palmiter, R. D., Brinster,
somatrophic (1988) Dwarf mice produced by genetic ablation of grow
hormone-expressing cells. Genes Dev. 2: 453-461 pancreas Insulin-
Ornitz, D. M., Palmiter, R. D., Hammer, R. E., Brinster, R. G. H.,
MacDonald, R. J. (1985) Specific expression of an el Elatase-acinar
human growth fusion in pancreatic acinar cells of transger specific
Nature 131: 600-603 Palmiter, R. D., Behringer, R. R., Quaife, C.
J., Maxwell, F. I. H., Brinster, R. L. (1987) Cell lineage ablation
in transg by cell-specific expression of toxic gene. Cell 50: 435 T
cells Ick promoter Chaffin, K. E., Beals, C. R., Wilkie, T. M.,
Forbush, K. A., Sin Perlmutter, R. M. (1990) EMBO Journal 9:
3821-3829 B cells Immunoglobulin k Borelli, E., Heyman, R., Hsi,
M., Evans, R. M. (1988) Targ chain inducible toxic phenotype in
animal cells. Proc. Natl. Acad 85: 7572-7576 Heyman, R. A.,
Borrelli, E., Lesley, J., Anderson, D., Richn Baird, S. M., Hyman,
R., Evans, R. M. (1989) Thymidine ki obliteration: creation of
transgenic mice with controlled immunodeficiencies. Proc. Natl.
Acad. Sci. USA 86: 2698 Schwann cells P.sub.0 promoter Messing, A.,
Behringer, R. R., Hammang, J. P. Palmiter, RD Brinster, RL, Lemke,
G., P.sub.0 promoter directs espression and toxin genes to Schwann
cells of transgenic mice. Neur 520 1992 Myelin basic pro Miskimins,
R. Knapp, L., Dewey, MJ, Zhang, X. Cell and ti specific expression
of a heterologous gene under control o basic protein gene promoter
in trangenic mice. Brain Res Res 1992 Vol 65: 217-21 spermatids
protamine Breitman, M. L., Rombola, H., Maxwell, I. H., Klintworth,
G Bernstein, A. (1990) Genetic ablation in transgenic mice
attenuated diphtheria toxin A gene. Mol. Cell. Biol. 10: 4 lung
Lung surfacant ge Ornitz, D. M., Palmiter, R. D., Hammer, R. E.,
Brinster, R. G. H., MacDonald, R. J. (1985) Specific expression of
an el human growth fusion in pancreatic acinar cells of transger
Nature 131: 600-603 adipocyte P2 Ross, S. R, Braves, RA,
Spiegelman, BM Targeted expressio toxin gene to adipose tissue:
transgenic mice resistant to o Genes and Dev 7: 1318-24 1993 muscle
myosin light chai Lee, KJ, Ross, RS, Rockman, HA, Harris, AN,
O'Brien, TX. Bilsen, M., Shubeita, HE, Kandolf, R., Brem, G.,
Prices et Chem. 1992 Aug. 5, 267: 15875-85 Alpha actin Muscat, GE.,
Perry, S. , Prentice, H. Kedes, L. The human alpha-actin gene is
regulated by a muscle-specific enhanc binds three nuclear factors.
Gene Expression 2, 111-26, neurons neurofilament pr Reeben, M.
Halmekyto, M. Alhonen, L. Sinervirta, R. Saarr Janne, J.
Tissue-specific expression of rat light neurofila promoter-driven
reporter gene in transgenic mice. BBR 192: 465-70 liver tyrosine
aminotra albumin, apolipoproteins
[0061] 8. Target gene constructs. A DNA construct that enables
transcription of a target gene to be regulated by a transcription
factor in accordance with this invention comprises a DNA molecule
which includes a synthetic transcription unit typically consisting
of: (1) one copy or multiple copies of a DNA sequence recognized
with high-affinity by the transcription factor or one or more of
its component DNA binding domains; (2) a promoter sequence
consisting minimally of a TATA box and initiator sequence but
optionally including other transcription factor binding sites; (3)
sequence encoding the desired product, including sequences that
promote the initiation and termination of translation, if
appropriate; (4) an optional sequence consisting of a splice donor,
splice acceptor, and intervening intron DNA; and (5) a sequence
directing cleavage and polyadenylation of the resulting RNA
transcript. Typically the gene construct contains a copy of the
target gene to be expressed, operably linked to a transcription
control sequence comprising a minimal promoter and one or more
copies of a DNA recognition sequence responsive to the
transcription factor.
[0062] (a) Target genes. A wide variety of genes can be employed as
the target gene, including genes that encode a therapeutic protein,
antisense sequence or ribozyme of interest. The target gene can be
any sequence of interest which provides a desired phenotype. It can
encode a surface membrane protein, a secreted protein, a
cytoplasmic protein, or there can be a plurality of target genes
encoding different products. The target gene may be an antisense
sequence which can modulate a particular pathway by inhibiting a
transcriptional regulation protein or turn on a particular pathway
by inhibiting the translation of an inhibitor of the pathway. The
target gene can encode a ribozyme which may modulate a particular
pathway by interfering, at the RNA level, with the expression of a
relevant transcriptional regulator or with the expression of an
inhibitor of a particular pathway. The proteins which are
expressed, singly or in combination, can involve homing,
cytotoxicity, proliferation, immune response, inflammatory
response, clotting or dissolving of clots, hormonal regulation,
etc. The proteins expressed may be naturally-occurring proteins,
mutants of naturally-occurring proteins, unique sequences, or
combinations thereof.
[0063] Various secreted products include hormones, such as insulin,
human growth hormone, glucagon, pituitary releasing factor, ACTH,
melanotropin, relaxin, etc.; growth factors, such as EGF, IGF-1,
TGF-a, -b, PDGF, G-CSF, M-CSF, GM-CSF, FGF, erythropoietin,
thrombopoietin, megakaryocytic stimulating and growth factors,
etc.; interleukins, such as IL-1 to -13; TNF-a and -b, etc.; and
enzymes and other factors, such as tissue plasminogen activator,
members of the complement cascade, performs, superoxide dismutase,
coagulation factors, antithrombin-III, Factor VIIIc, Factor VIIIvW,
Factor IX, a-anti-trypsin, protein C, protein S, endorphins,
dynorphin, bone morphogenetic protein, CFTR, etc.
[0064] The gene can encode a naturally-occurring surface membrane
protein or a protein made so by introduction of an appropriate
signal peptide and transmembrane sequence. Various such proteins
include homing receptors, e.g. L-selectin (Mel-14), blood-related
proteins, particularly having a kringle structure, e.g. Factor
VIIIc, Factor VIIvW, hematopoietic cell markers, e.g. CD3, CD4,
CD8, B cell receptor, TCR subunits a, b, g , d , CD10, CD19, CD28,
CD33, CD38, CD41, etc., receptors, such as the interleukin
receptors IL-2R, IL-4R, etc., channel proteins, for influx or
efflux of ions, e.g. H.sup.+, Ca.sup.+2, K.sup.+, Na.sup.+,
Cl.sup.-, etc., and the like; CFTR, tyrosine activation motif,
zap-70, etc.
[0065] Proteins may be modified for transport to a vesicle for
exocytosis. By adding the sequence from a protein which is directed
to vesicles, where the sequence is modified proximal to one or the
other terminus, or situated in an analogous position to the protein
source, the modified protein will be directed to the Golgi
apparatus for packaging in a vesicle. This process in conjunction
with the presence of the chimeric proteins for exocytosis allows
for rapid transfer of the proteins to the extracellular medium and
a relatively high localized concentration.
[0066] Also, intracellular proteins can be of interest, such as
proteins in metabolic pathways, regulatory proteins, steroid
receptors, transcription factors, etc., depending upon the nature
of the host cell. Some of the proteins indicated above can also
serve as intracellular proteins.
[0067] By way of further illustration, in T-cells, one may wish to
introduce genes encoding one or both chains of a T-cell receptor.
For B-cells, one could provide the heavy and light chains for an
immunoglobulin for secretion. For cutaneous cells, e.g.
keratinocytes, particularly stem cells keratinocytes, one could
provide for protection against infection, by secreting a-, b- or -g
interferon, antichemotactic factors, proteases specific for
bacterial cell wall proteins, etc.
[0068] In addition to providing for expression of a gene having
therapeutic value, there will be many situations where one may wish
to direct a cell to a particular site. The site can include
anatomical sites, such as lymph nodes, mucosal tissue, skin,
synovium, lung or other internal organs or functional sites, such
as clots, injured sites, sites of surgical manipulation,
inflammation, infection, etc. By providing for expression of
surface membrane proteins which will direct the host cell to the
particular site by providing for binding at the host target site to
a naturally-occurring epitope, localized concentrations of a
secreted product can be achieved. Proteins of interest include
homing receptors, e.g. L-selectin, GMP140, CLAM-1, etc., or
addressins, e.g. ELAM-1, PNAd, LNAd, etc., clot binding proteins,
or cell surface proteins that respond to localized gradients of
chemotactic factors. There are numerous situations where one would
wish to direct cells to a particular site, where release of a
therapeutic product could be of great value.
[0069] (b) Minimal Promoters. Minimal promoters may be selected
from a wide variety of known sequences, including promoter regions
from fos, hCMV, SV40 and IL-2, among many others. Illustrative
examples are provided which use a minimal CMV promoter or a minimal
IL2 gene promoter (-72 to +45 with respect to the start site;
Siebenlist et al., MCB 6:3042-3049, 1986).
[0070] (c) DNA recognition sequences. Recognition sequences for a
wide variety of DNA-binding domains are known. DNA recognition
sequences for other DNA binding domains may be determined
experimentally. In the case of a composite DNA binding domain, DNA
recognition sequences can be determined experimentally, as
described below, or the proteins can be manipulated to direct their
specificity toward a desired sequence. A desirable nucleic acid
recognition sequence for a composite DNA binding domain consists of
a nucleotide sequence spanning at least ten, preferably eleven, and
more preferably twelve or more bases. The component binding
portions (putative or demonstrated) within the nucleotide sequence
need not be fully contiguous; they may be interspersed with
"spacer" base pairs that need not be directly contacted by the
chimeric protein but rather impose proper spacing between the
nucleic acid subsites recognized by each module. These sequences
should not impart expression to linked genes when introduced into
cells in the absence of the engineered DNA-binding protein.
[0071] To identify a nucleotide sequence that is recognized by a
chimeric protein containing a DNA-binding region, preferably
recognized with high affinity (dissociation constant 10.sup.-11 M
or lower are especially preferred), several methods can be used. If
high-affinity binding sites for individual subdomains of a
composite DNA-binding region are already known, then these
sequences can be joined with various spacing and orientation and
the optimum configuration determined experimentally (see below for
methods for determining affinities). Alternatively, high-affinity
binding sites for the protein or protein complex can be selected
from a large pool of random DNA sequences by adaptation of
published methods (Pollock, R. and Treisman, R., 1990, A sensitive
method for the determination of protein-DNA binding specificities.
Nucl. Acids Res. 18, 6197-6204). Bound sequences are cloned into a
plasmid and their precise sequence and affinity for the proteins
are determined. From this collection of sequences, individual
sequences with desirable characteristics (i.e., maximal affinity
for composite protein, minimal affinity for individual subdomains)
are selected for use. Alternatively, the collection of sequences is
used to derive a consensus sequence that carries the favored base
pairs at each position. Such a consensus sequence is synthesized
and tested to confirm that it has an appropriate level of affinity
and specificity.
[0072] The target gene constructs may contain multiple copies of a
DNA recognition sequence. For instance, the constructs may contain
5, 8, 10 or 12 recognition sequences for GAL4 or for ZFHD1.
[0073] (d) Determination of binding affinity. A number of
well-characterized assays are available for determining the binding
affinity, usually expressed as dissociation constant, for
DNA-binding proteins and the cognate DNA sequences to which they
bind. These assays usually require the preparation of purified
protein and binding site (usually a synthetic oligonucleotide) of
known concentration and specific activity. Examples include
electrophoretic mobility-shift assays, DNaseI protection or
"footprinting", and filter-binding. These assays can also be used
to get rough estimates of association and dissociation rate
constants. These values may be determined with greater precision
using a BIAcore instrument. In this assay, the synthetic
oligonucleotide is bound to the assay "chip," and purified
DNA-binding protein is passed through the flow-cell. Binding of the
protein to the DNA immobilized on the chip is measured as an
increase in refractive index. Once protein is bound at equilibrium,
buffer without protein is passed over the chip, and the
dissociation of the protein results in a return of the refractive
index to baseline value. The rates of association and dissociation
are calculated from these curves, and the affinity or dissociation
constant is calculated from these rates. Binding rates and
affinities for the high affinity composite site may be compared
with the values obtained for subsites recognized by each subdomain
of the protein. As noted above, the difference in these
dissociation constants should be at least two orders of magnitude
and preferably three or greater.
[0074] (e) Testing for function in vivo. Several tests of
increasing stringency may be used to confirm the satisfactory
performance of a DNA-binding protein designed according to this
invention. All share essentially the same components: (1) (a) an
expression plasmid directing the production of a chimeric protein
comprising the DNA-binding region and a transcriptional activation
domain or (b) one or more expression plasmids directing the
production of a pair of chimeric proteins of this invention which
are capable of dimerizing in the presence of a corresponding
dimerizing agent, and thus forming a protein complex containing a
DNA-binding region on one protein and a transcription activation
domain on the other; and (2) a reporter plasmid directing the
expression of a reporter gene, preferably identical in design to
the target gene described above (i.e., multiple binding sites for
the DNA-binding domain, a minimal promoter element, and a gene
body) but encoding any conveniently measured protein.
[0075] In a transient transfection assay, the above-mentioned
plasmids are introduced together into tissue culture cells by any
conventional transfection procedure, including for example calcium
phosphate coprecipitation, electroporation, and lipofection. After
an appropriate time period, usually 24-48 hr, the cells are
harvested and assayed for production of the reporter protein. In
embodiments requiring dimerization of chimeric proteins for
activation of transcription, the assay is conducted in the presence
of the dimerizing agent. In an appropriately designed system, the
reporter gene should exhibit little activity above background in
the absence of any co-transfected plasmid for the composite
transcription factor (or in the absence of dimerizing agent in
embodiments under dimerizer control). In contrast, reporter gene
expression should be elevated in a dose-dependent fashion by the
inclusion of the plasmid encoding the composite transcription
factor (or plasmids encoding the multimerizable chimeras, following
addition of multimerizing agent). This result indicates that there
are few natural transcription factors in the recipient cell with
the potential to recognize the tested binding site and activate
transcription and that the engineered DNA-binding domain is capable
of binding to this site inside living cells.
[0076] The transient transfection assay is not an extremely
stringent test in most cases, because the high concentrations of
plasmid DNA in the transfected cells lead to unusually high
concentrations of the DNA-binding protein and its recognition site,
allowing functional recognition even with relative low affinity
interactions. A more stringent test of the system is a transfection
that results in the integration of the introduced DNAs at near
single-copy. Thus, both the protein concentration and the ratio of
specific to non-specific DNA sites would be very low; only very
high affinity interactions would be expected to be productive. This
scenario is most readily achieved by stable transfection in which
the plasmids are transfected together with another DNA encoding an
unrelated selectable marker (e.g., G418-resistance). Transfected
cell clones selected for drug resistance typically contain copy
numbers of the nonselected plasmids ranging from zero to a few
dozen. A set of clones covering that range of copy numbers can be
used to obtain a reasonably clear estimate of the efficiency of the
system.
[0077] Perhaps the most stringent test involves the use of a viral
vector, typically a retrovirus, that incorporates both the reporter
gene and the gene encoding the composite transcription factor or
multimerizable components thereof. Virus stocks derived from such a
construction will generally lead to single-copy transduction of the
genes.
[0078] If the ultimate application is gene therapy, it may be
preferred to construct transgenic animals carrying similar DNAs to
determine whether the protein is functional in an animal.
[0079] Design and Assembly of the DNA Constructs
[0080] Constructs may be assembled in accordance with the design
principles, and using materials and methods, disclosed in the cited
patent documents and scientific literature, each of which is
incorporated herein by reference, with modifications as described
herein. In the case of DNA constructs encoding chimeric
transcription factors, DNA sequences encoding individual domains,
sub-domains and linkers, if any, are joined such that they
constitute a single open reading frame encoding a chimeric protein
capable of being translated in cells or cell lysates into a single
polypeptide harboring all component domains. The DNA construct
encoding the chimeric protein is then placed into a conventional
plasmid vector that directs the expression of the protein in the
appropriate cell type. For testing of proteins and determination of
binding specificity and affinity, it may be desirable to construct
plasmids that direct the expression of the protein in bacteria or
in reticulocyte-lysate systems. For use in the production of
proteins in mammalian cells, the protein-encoding sequence is
introduced into an expression vector that directs expression in
these cells. Expression vectors suitable for such uses are well
known in the art. Various sorts of such vectors are commercially
available.
[0081] Introduction of Constructs into Cells
[0082] This invention is particularly useful for the engineering of
animal cells and in applications involving the use of such
engineered animal cells. The animal cells may be insect, worm or
mammalian cells. While various mammalian cells may be used,
including, by way of example, equine, bovine, ovine, canine,
feline, murine, and non-human primate cells, human cells are of
particular interest. Among the various species, various types of
cells may be used, such as hematopoietic, neural, glial,
mesenchymal, cutaneous, mucosal, stromal, muscle (including smooth
muscle cells), spleen, reticuloendothelial, epithelial,
endothelial, hepatic, kidney, gastrointestinal, pulmonary,
fibroblast, and other cell types. Of particular interest are
hematopoietic cells, which may include any of the nucleated cells
which may be involved with the erythroid, lymphoid or
myelomonocytic lineages, as well as myoblasts and fibroblasts. Also
of interest are stem and progenitor cells, such as hematopoietic,
neural, stromal, muscle, hepatic, pulmonary, gastrointestinal and
mesenchymal stem cells.
[0083] The cells may be autologous cells, syngeneic cells,
allogeneic cells and even in some cases, xenogeneic cells with
respect to an intended host organism. The cells may be modified by
changing the major histocompatibility complex ("MHC") profile, by
inactivating beta.sub.2-microglobulin to prevent the formation of
functional Class I MHC molecules, inactivation of Class II
molecules, providing for expression of one or more MHC molecules,
enhancing or inactivating cytotoxic capabilities by enhancing or
inhibiting the expression of genes associated with the cytotoxic
activity, or the like.
[0084] In some instances specific clones or oligoclonal cells may
be of interest, where the cells have a particular specificity, such
as T cells and B cells having a specific antigen specificity or
homing target site specificity.
[0085] Constructs encoding the transcription factor and target gene
construct of this invention can be introduced into the cells as one
or more DNA molecules or constructs, in many cases in association
with one or more markers to allow for selection of host cells which
contain the construct(s). The constructs can be prepared in
conventional ways, where the coding sequences and regulatory
regions may be isolated, as appropriate, ligated, cloned in an
appropriate cloning host, analyzed by restriction or sequencing, or
other convenient means. Particularly, using PCR, individual
fragments including all or portions of a functional unit may be
isolated, where one or more mutations may be introduced using
"primer repair", ligation, in vitro mutagenesis, etc. as
appropriate. The construct(s) once completed and demonstrated to
have the appropriate sequences may then be introduced into a host
cell by any convenient means. The constructs may be incorporated
into vectors capable of episomal replication (e.g. BPV or EBV
vectors) or into vectors designed for integration into the host
cells' chromosomes. The constructs may be integrated and packaged
into non-replicating, defective viral genomes like Adenovirus,
Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or
others, including retroviral vectors, for infection or transduction
into cells. Alternatively, the construct may be introduced by
protoplast fusion, electroporation, biolistics, calcium phosphate
transfection, lipofection, microinjection of DNA or the like. The
host cells will in some cases be grown and expanded in culture
before introduction of the construct(s), followed by the
appropriate treatment for introduction of the construct(s) and
integration of the construct(s). The cells will then be expanded
and screened by virtue of a marker present in the constructs.
Various markers which may be used successfully include hprt,
neomycin resistance, thymidine kinase, hygromycin resistance, etc.,
and various cell-surface markers such as Tac, CD8, CD3, Thy1 and
the NGF receptor.
[0086] In some instances, one may have a target site for homologous
recombination, where it is desired that a construct be integrated
at a particular locus. For example, one can delete and/or replace
an endogenous gene (at the same locus or elsewhere) with a
recombinant target construct of this invention. For homologous
recombination, one may generally use either Omega or O-vectors.
See, for example, Thomas and Capecchi, Cell (1987) 51, 503-512;
Mansour, et al., Nature (1988) 336, 348-352; and Joyner, et al.,
Nature (1989) 338, 153-156.
[0087] The constructs may be introduced as a single DNA molecule
encoding all of the genes, or different DNA molecules having one or
more genes. The constructs may be introduced simultaneously or
consecutively, each with the same or different markers.
[0088] Vectors containing useful elements such as bacterial or
yeast origins of replication, selectable and/or amplifiable
markers, promoter/enhancer elements for expression in procaryotes
or eucaryotes, and mammalian expression control elements, etc.
which may be used to prepare stocks of construct DNAs and for
carrying out transfections are well known in the art, and many are
commercially available.
[0089] Introduction of Constructs into Animals
[0090] Cells which have been modified ex vivo with the DNA
constructs may be grown in culture under selective conditions and
cells which are selected as having the desired construct(s) may
then be expanded and further analyzed, using, for example, the
polymerase chain reaction for determining the presence of the
construct in the host cells and/or assays for the production of the
desired gene product(s). Once modified host cells have been
identified, they may then be used as planned, e.g. grown in culture
or introduced into a host organism.
[0091] Depending upon the nature of the cells, the cells may be
introduced into a host organism, e.g. a mammal, in a wide variety
of ways. Hematopoietic cells may be administered by injection into
the vascular system, there being usually at least about 10.sup.4
cells and generally not more than about 10.sup.10 cells. The number
of cells which are employed will depend upon a number of
circumstances, the purpose for the introduction, the lifetime of
the cells, the protocol to be used, for example, the number of
administrations, the ability of the cells to multiply, the
stability of the therapeutic agent, the physiologic need for the
therapeutic agent, and the like. Generally, for myoblasts or
fibroblasts for example, the number of cells will be at least about
10.sup.4 and not more than about 10.sup.9 and may be applied as a
dispersion, generally being injected at or near the site of
interest. The cells will usually be in a physiologically-acceptable
medium.
[0092] Cells engineered in accordance with this invention may also
be encapsulated, e.g. using conventional biocompatible materials
and methods, prior to implantation into the host organism or
patient for the production of a therapeutic protein. See e.g.
Hguyen et al, Tissue Implant Systems and Methods for Sustaining
viable High Cell Densities within a Host, U.S. Pat. No. 5,314,471
(Baxter International, Inc.); Uludag and Sefton, 1993, J Biomed.
Mater. Res. 27(10):1213-24 (HepG2 cells/hydroxyethyl
methacrylate-methyl methacrylate membranes); Chang et al, 1993, Hum
Gene Ther 4(4):433-40 (mouse Ltk-cells expressing
hGH/immunoprotective perm-selective alginate microcapsules; Reddy
et al, 1993, J Infect Dis 168(4):1082-3 (alginate); Tai and Sun,
1993, FASEB J 7(11):1061-9 (mouse fibroblasts expressing
hGH/alginate-poly-L-lysine-alg- inate membrane); Ao et al, 1995,
Transplanataion Proc. 27(6):3349, 3350 (alginate); Rajotte et al,
1995, Transplantation Proc. 27(6):3389 (alginate); Lakey et al,
1995, Transplantation Proc. 27(6):3266 (alginate); Korbutt et al,
1995, Transplantation Proc. 27(6):3212 (alginate); Dorian et al,
U.S. Pat. No. 5,429,821 (alginate); Emerich et al, 1993, Exp Neurol
122(1):37-47 (polymer-encapsulated PC12 cells); Sagen et al, 1993,
J Neurosci 13(6):2415-23 (bovine chromaffin cells encapsulated in
semipermeable polymer membrane and implanted into rat spinal
subarachnoid space); Aebischer et al, 1994, Exp Neurol 126(2):151-8
(polymer-encapsulated rat PC12 cells implanted into monkeys; see
also Aebischer, WO 92/19595); Savelkoul et al, 1994, J Immunol
Methods 170(2):185-96 (encapsulated hybridomas producing
antibodies; encapsulated transfected cell lines expressing various
cytokines); Winn et al, 1994, PNAS USA 91(6):2324-8 (engineered BHK
cells expressing human nerve growth factor encapsulated in an
immunoisolation polymeric device and transplanted into rats);
Emerich et al, 1994, Prog Neuropsychopharmacol Biol Psychiatry
18(5):935-46 (polymer-encapsulated PC12 cells implanted into rats);
Kordower et al, 1994, PNAS USA 91(23):10898-902
(polymer-encapsulated engineered BHK cells expressing hNGF
implanted into monkeys) and Butler et al WO 95/04521 (encapsulated
device). The cells may then be introduced in encapsulated form into
an animal host, preferably a mammal and more preferably a human
subject in need thereof. Preferably the encapsulating material is
semipermeable, permitting release into the host of secreted
proteins produced by the encapsulated cells. In many embodiments
the semipermeable encapsulation renders the encapsulated cells
immunologically isolated from the host organism in which the
encapsulated cells are introduced. In those embodiments the cells
to be encapsulated may express one or more chimeric proteins
containing component domains derived from proteins of the host
species and/or from viral proteins or proteins from species other
than the host species. For example in such cases the chimeras may
contain elements derived from GAL4 and VP16. The cells may be
derived from one or more individuals other than the recipient and
may be derived from a species other than that of the recipient
organism or patient.
[0093] Instead of ex vivo modification of the cells, in many
situations one may wish to modify cells in vivo. For this purpose,
various techniques have been developed for modification of target
tissue and cells in vivo. A number of viral vectors have been
developed, such as adenovirus, adeno-associated virus, and
retroviruses, which allow for transfection and, in some cases,
integration of the virus into the host. See, for example, Dubensky
et al. (1984) Proc. Natl. Acad. Sci. USA 81, 7529-7533; Kaneda et
al., (1989) Science 243,375-378; Hiebert et al. (1989) Proc. Natl.
Acad. Sci. USA 86, 3594-3598; Hatzoglu et al. (1990) J. Biol. Chem.
265, 17285-17293 and Ferry, et al. (1991) Proc. Natl. Acad. Sci.
USA 88, 8377-8381. The vector may be administered by injection,
e.g. intravascularly or intramuscularly, inhalation, or other
parenteral mode. Non-viral delivery methods such as administration
of the DNA via complexes with liposomes or by injection, catheter
or biolistics may also be used.
[0094] In accordance with in vivo genetic modification, the manner
of the modification will depend on the nature of the tissue, the
efficiency of cellular modification required, the number of
opportunities to modify the particular cells, the accessibility of
the tissue to the DNA composition to be introduced, and the like.
By employing an attenuated or modified retrovirus carrying a target
transcriptional initiation region, if desired, one can activate the
virus using one of the subject transcription factor constructs, so
that the virus may be produced and transfect adjacent cells.
[0095] The DNA introduction need not result in integration in every
case. In some situations, transient maintenance of the DNA
introduced may be sufficient. In this way, one could have a short
term effect, where cells could be introduced into the host and then
turned on after a predetermined time, for example, after the cells
have been able to home to a particular site.
[0096] Applications
[0097] This invention is applicable to any situation that calls for
expression of an exogenously-introduced gene embedded within a
large genome. The desired expression level could be preset very
high or very low. The system may be further engineered to achieve
regulated or titratable expression. See e.g. PCT/US93/01617. In
most cases, the inadvertant activation of unrelated cellular genes
is undesirable.
[0098] 1. Constitutive high-level gene expression in gene therapy.
Gene therapy often requires controlled high-level expression of a
therapeutic gene, sometimes in a cell-type specific pattern. By
supplying the therapeutic gene with saturating amounts of an
activating transcription factor in accordance with this invention,
considerably higher levels of gene expression can be obtained
relative to natural promoters or enhancers, which are dependent on
endogenous transcription factors. Thus, one application of this
invention to gene therapy is the delivery of a
two-transcription-unit cassette (which may reside on one or two
plasmid molecules, depending on the delivery vector) consisting of
(1) a transcription unit encoding a transcription factor, whether
naturally occurring or designed as described above, for instance
comprising a composite DNA-binding domain and a strong
transcription activation domain (e.g., derived from the VP16
protein or a human transcription factor) and (2) a transcription
unit consisting of the target gene linked to and under the control
of a minimal promoter carrying one, and preferably several, binding
sites for the composite DNA-binding domain. Cointroduction of the
two transcription units into a cell results in the production of
the hybrid transcription factor which in turn activates the
therapeutic gene to high level. This strategy essentially
incorporates an amplification step, because the promoter that would
be used to produce the therapeutic gene product in conventional
gene therapy is used instead to produce the activating
transcription factor. Each transcription factor has the potential
to direct the production of multiple copies of the therapeutic
protein.
[0099] This method may be employed to increase the efficacy of many
gene therapy strategies by substantially elevating the expression
of a therapeutic target gene, allowing expression to reach
therapeutically effective levels. Examples of therapeutic genes
that would benefit from this strategy are genes that encode
secreted therapeutic proteins, such as cytokines (e.g., IL-2, IL-4,
IL-12), CFTR (see e.g. Grubb et al, 1994, Nature 371:802-6), growth
factors (e.g., VEGF), antibodies, and soluble receptors. Other
candidate therapeutic genes are disclosed in PCT/US93/01617. This
strategy may also be used to increase the efficacy of
"intracellular immunization" agents, molecules like ribozymes,
antisense RNA, and dominant-negative proteins, that act either
stoichiometrically or by competition. Examples include agents that
block infection by or production of HIV or hepatitis virus and
agents that antagonize the production of oncogenic proteins in
tumors.
[0100] It should be appreciated that in practice, the system is
subject to many variables, such as the efficiency of expression
and, as appropriate, the level of secretion, the activity of the
expression product, the particular need of the patient, which may
vary with time and circumstances, the rate of loss of the cellular
activity as a result of loss of cells or expression activity of
individual cells, and the like. Therefore, it is expected that for
each individual patient, even if there were universal cells which
could be administered to the population at large, each patient
would be monitored for the proper dosage for the individual.
[0101] 2. Production of recombinant proteins. Production of
recombinant therapeutic proteins for commercial and investigational
purposes is often achieved through the use of mammalian cell lines
engineered to express the protein at high level. The use of
mammalian cells, rather than bacteria or yeast, is indicated where
the proper function of the protein requires post-translational
modifications not generally performed by heterologous cells.
Examples of proteins produced commercially this way include
erythropoietin, tissue plasminogen activator, clotting factors such
as Factor VIII:c, antibodies, etc. The cost of producing proteins
in this fashion is directly related to the level of expression
achieved in the engineered cells. Thus, because the constitutive
two-transcription-unit system described above can achieve
considerably higher expression levels than conventional expression
systems, it may greatly reduce the cost of protein production.
[0102] 3. Biological research. This invention is applicable to a
wide range of biological experiments in which precise control over
a target gene is desired. These include: (1) expression of a
protein or RNA of interest for biochemical purification; (2) tissue
or organ specific expression of a protein or RNA of interest in
transgenic animals for the purposes of evaluating its biological
function. Transgenic animal models and other applications for which
this invention may be used include those disclosed in U.S. patent
application Ser. Nos. 08/292,595 and 08/292,596 (filed Aug. 18,
1994).
[0103] This invention further provides kits useful for the
foregoing applications. Such kits contain a first DNA sequence
encoding a transcription factor and a second DNA sequence
containing a target gene linked to a DNA element to which the
transcription factor is capable of binding. Alternatively, the
second DNA sequence may contain a cloning site for insertion of a
desired target gene by the practitioner.
[0104] The following examples contain important additional
information, exemplification and guidance which can be adapted to
the practice of this invention in its various embodiments and the
equivalents thereof. The examples are offered by way illustration
and not by way limitation.
EXAMPLES
[0105] I. Individual DNA-binding and Transcription Activating
Components are Modular, may be Incorporated into Fusion Proteins
with Various Other Domains and Function as Intended in Cell Culture
and in Animals
[0106] A. ZFHD1 and p65 Work Well Individually in Cell Culture and
in Whole Animals in Drug-dependent (Regulatable) Transcription
Systems
[0107] 1. Constructs Encoding Chimeric Transcription Factors
[0108] (a) Unless otherwise stated, all DNA manipulations described
in this and other examples were performed using standard procedures
(See e.g., F. M. Ausubel et al., Eds., Current Protocols in
Molecular Biology (John Wiley & Sons, New York, 1994).
[0109] (b) Plasmids
[0110] Constructs encoding fusions of human FKBP12 (hereafter
`FKBP`) with the yeast GAL4 DNA binding domain, the HSV VP16
activation domain, human T cell CD3 zeta chain intracellular domain
or the intracellular domain of human FAS are disclosed in
PCT/US94/01617.
[0111] Additional DNA vectors for directing the expression of
fusion proteins relevant to this invention were derived from the
mammalian expression vector pCGNN (Attar, R. M. and Gilman, M. Z.
1992. MCB 12: 2432-2443). Inserts cloned as XbaI-BamHI fragments
into pCGNN are transcribed under the control of the human CMV
promoter and enhancer sequences (nucleotides -522 to +72 relative
to the cap site), and are expressed with an optional epitope tag (a
16 amino acid portion of the H. influenzae hemaglutinin gene that
is recognized by the monoclonal antibody 12CA5) and, in the case of
transcription factor domains, with an N-terminal nuclear
localization sequence (NLS; from SV40 T antigen).
[0112] Except where stated, all fragments cloned into pCGNN were
inserted as XbaI-BamHI fragments that included a SpeI site just
upstream of the BamHI site. As XbaI and SpeI produce compatible
ends, this allowed further XbaI-BamHI fragments to be inserted
downstream of the initial insert and facilitated stepwise assembly
of proteins comprising multiple components. A stop codon was
interposed between the SpeI and BamHI sites. For initial
constructs, the vector pCGNN-GAL4 was additionally used, in which
codons 1-94 of the GAL4 DNA binding domain gene were cloned into
the XbaI site of pCGNN such that a XbaI site is regenerated only at
the 3' end of the fragment. Thus XbaI-BamHI fragments could be
cloned into this vector to generate GAL4 fusions, and subsequently
recovered.
[0113] (c) Constructs Encoding GAL4 DNA Binding Domain--FRAP
Fusions
[0114] To obtain portions of the human FRAP gene, human thymus
total RNA (Clontech #64028-1) was reverse transcribed using MMLV
reverse transcriptase and random hexamer primer (Clontech 1st
strand synthesis kit). This cDNA was used directly in a PCR
reaction containing primers 1 and 2 and Pfu polymerase
(Stratagene). The primers were designed to amplify the coding
sequence for amino acids 2025-2113 inclusive of human FRAP: an 89
amino acid region essentially corresponding to the minimal `FRB`
domain identified by Chen et al. (Proc. Natl. Acad. Sci. USA (1995)
92, 4947-4951) as necessary and sufficient for FKBP-rapamycin
binding (hereafter named FRB). The appropriately-sized band was
purified, digested with XbaI and SpeI, and ligated into XbaI-SpeI
digested pCGNN-GAL4. This construct was confirmed by restriction
analysis (to verify the correct orientation) and DNA sequencing and
designated pCGNN-GAL4-1 FRB.
[0115] Constructs encoding FRB multimers were obtained by isolating
the FRB XbaI-BamHI fragment, and then ligating it back into
pCGNN-GAL4-1FRB digested with SpeI and BamHI to generate
pCGNN-GAL4-2FRB, which was confirmed by restriction analysis. This
procedure was repeated analogously on the new construct to yield
pCGNN-GAL4-3FRB and pCGNN-GAL4-4FRB.
[0116] Vectors were also constructed that encode larger fragments
of FRAP, encompassing the minimal FRB domain (amino acids
2025-2113) but extending beyond it. PCR primers were designed that
amplify various regions of FRAP flanked by 5' XbaI and 3' SpeI
sites as indicated below.
3 Designation amino acids 5' primer 3' primer FRAP.sub.a 2012-2127
6 7 FRAP.sub.b 1995-2141 5 8 FRAP.sub.c 1945-2113 3 2 FRAP.sub.d
1995-2113 5 2 FRAP.sub.e 2012-2113 6 2 FRAP.sub.f 2025-2127 1 7
FRAP.sub.g 2025-2141 1 8 FRAP.sub.h 2025-2174 1 4 FRAP.sub.i
1945-2174 3 4
[0117] Initially, fragment FRAP.sub.i was amplified by RT-PCR as
described above, digested with XbaI and SpeI, and ligated into
XbaI-SpeI digested pCGNN-GAL4. This construct,
pCGNN-GAL4-FRAP.sub.i, was analyzed by PCR to confirm insert
orientation and verified by DNA sequencing. It was then used as a
PCR substrate to amplify the other fragments using the primers
listed. The new fragments were cloned as GAL4 fusions as described
above to yield the constructs pCGNN-GAL4-FRAP.sub.a,
pCGNN-GAL4-FRAP.sub.b etc, which were confirmed by DNA
sequencing.
[0118] Vectors encoding concatenates of two of the larger FRAP
fragments, FRAP.sub.d and FRAP.sub.e, were generated by analogous
methods to those used earlier. XbaI-BamHI fragments encoding
FRAP.sub.d and FRAP.sub.e were isolated from pCGNN-GAL4-FRAP.sub.d
and pCGNN-GAL4-FRAP.sub.e and ligated back into the same vectors
digested with SpeI and BamHI to generate pCGNN-GAL4-2FRAP.sub.d and
pCGNN-GAL4-2FRAP.sub.e. This procedure was repeated analogously on
the new constructs to yield pCGNN-GAL4-3FRAP.sub.d,
pCGNN-GAL4-3FRAP.sub.e, pCGNN-GAL4-4FRAP.sub.d and
pCGNN-GAL4-4FRAP.sub.e. All constructs were verified by restriction
analysis.
[0119] (d) Constructs Encoding FRAP-VP16 Activation Domain
Fusions
[0120] To generate N-terminal fusions of FRB domain(s) with the
activation domain of the Herpes Simplex Virus protein VP16, the
XbaI-BamHI fragments encoding 1, 2, 3 and 4 copies of FRB were
recovered from the GAL4 fusion vectors and ligated into XbaI-BamHI
digested pCGNN to yield pCGNN-1FRB, pCGNN-2FRB etc. These vectors
were then digested with SpeI and BamHI. An XbaI-BamHI fragment
encoding amino acids 414-490 of VP16 was isolated from plasmid
pCG-Gal4-VP16 (Das, G., Hinkley, C. S. and Herr, W. (1995) Nature
374, 657-660) and ligated into the SpeI-BamHI digested vectors to
generate pCGNN-1FRB-VP16, pCGNN-2FRB-VP16, etc. The constructs were
verified by restriction analysis and/or DNA sequencing.
[0121] (e) Constructs Encoding ZFHD1 DNA Binding Domain--FRAP
Fusions
[0122] An expression vector for directing the expression of ZFHD1
coding sequence in mammalian cells was prepared as follows. Zif268
sequences were amplified from a cDNA clone by PCR using primers
5'Xba/Zif and 3'Zif+G. Oct1 homeodomain sequences were amplified
from a cDNA clone by PCR using primers 5'Not Oct HD and Spe/Bam
3'Oct. The Zif268 PCR fragment was cut with XbaI and NotI. The Oct1
PCR fragment was cut with NotI and BamHI. Both fragments were
ligated in a 3-way ligation between the XbaI and BamHI sites of
pCGNN (Attar and Gilman, 1992) to make pCGNNZFHD1 in which the cDNA
insert is under the transcriptional control of human CMV promoter
and enhancer sequences and is linked to the nuclear localization
sequence from SV40 T antigen. The plasmid pCGNN also contains a
gene for ampicillin resistance which can serve as a selectable
marker. (Derivatives, pCGNNZFHD1-FKBPx1 and pCGNNZFHD1-FKBPx3, were
prepared containing one or three tandem repeats of human FKBP12
ligated as an XbaI-BamHI fragment between the Spe1 and BamHI sites
of pCGNNZFHD1. A sample of pCGNNZFHD1-FKBPx3 has been deposited
with the American Type Culture Collection under ATCC Accession No.
97399.)
4 Primers: 5'Xba/Zif 5'ATGCTCTAGAGAACGCCCATATGCTTGCCCT SEQ ID NO 6
3'Zif+G 5'ATGCGCGGCCGCCGCCTGTGTGGGTGCGGATGTG SEQ ID NO 7 5'Not
OctHD 5'ATGCGCGGCCGCAGGAGGAAGAAACGCACCA- GC SEQ ID NO 8 Spe/Bam
3'Oct 5'GCATGGATCCGATTCAACTAGTGTTGA- TTCTTTTTTCTTTCTGGCGGCG SEQ ID
NO 9
[0123] To generate C-terminal fusions of FRB domain(s) with the
chimeric DNA binding protein ZFHD1, the XbaI-BamHI fragments
encoding 1, 2, 3 and 4 copies of FRB were recovered from the GAL4
fusion vectors and ligated into Spe-BamHI digested pCGNN-ZFHD1 to
yield pCGNN-ZFHD1-1FRB, pCGNN-ZFHD1-2FRB etc. Constructs were
verified by restriction analysis and/or DNA sequencing.
[0124] To examine the effect of introducing additional `linker`
polypeptide between ZFHD1 and a C-terminal FRB domain, FRAP
fragments encoding extra sequence N-terminal to FRB were cloned as
ZFHD1 fusions. XbaI-BamHI fragments encoding FRAP.sub.a,
FRAP.sub.b, FRAP.sub.c, FRAP.sub.d and FRAP.sub.e were excised from
the vectors pCGNN-GAL4-FRAP.sub.a, pCGNN-GAL4-FRAP.sub.b etc and
ligated into SpeI-BamHI digested pCGNN-ZFHD1 to yield the vectors
pCGNN-ZFHD1-FRAP.sub.a, pCGNN-ZFHD1-FRAP.sub.b, etc. Vectors
encoding fusions of ZFHD1 to 2, 3 and 4 C-terminal copies of
FRAP.sub.e were also constructed by isolating XbaI-BamHI fragments
encoding 2FRAP.sub.e, 3FRAP.sub.e and 4FRAP.sub.e from
pCGNN-GAL4-2FRAP.sub.e, pCGNN-GAL4-3FRAP.sub.e and
pCGNN-GAL4-4FRAP.sub.e and ligating them into SpeI-BamHI digested
pCGNN-ZFHD1 to yield the vectors pCGNN-ZFHD1-2FRAP.sub.e,
pCGNN-ZFHD1-3FRAP.sub.e and pCGNN-ZFHD1-4FRAP.sub.e. All constructs
were verified by restriction analysis.
[0125] Vectors were also constructed that encode N-terminal fusions
of FRB domain(s) with ZFHD1. XbaI-BamHI fragments encoding 1, 2, 3
and 4 copies of FRAP.sub.e were isolated from
pCGNN-GAL4-1FRAP.sub.e, pCGNN-GAL4-2FRAP.sub.e etc and ligated into
XbaI-BamHI digested pCGNN to yield the plasmids pCGNN-1FRAP.sub.e,
pCGNN-2FRAP.sub.e etc. These vectors were then digested with SpeI
and BamHI, and an XbaI-BamHI fragment encoding ZFHD1 (isolated from
pCGNN-ZFHD1) ligated in to yield the constructs
pCGNN-1FRAP.sub.e-ZFHD1, pCGNN-2FRAP.sub.e-ZFHD1 etc, which were
verified by restriction analysis.
[0126] (f) Constructs Encoding FRAP-p65 Activation Domain
Fusions
[0127] To generate fusions of FRB domain(s) with the activation
domain of the human NF-kB p65 subunit (hereafter designated p65),
two fragments were amplified by PCR from the plasmid pCG-p65.
Primers 9 (p65/5' Xba) and 11 (p65 3' Spe/Bam) amplify the coding
sequence for amino acids 450-550, and primers 10 (p65/361 Xba) and
11 amplify the coding sequence for amino acids 361-550, both
flanked by 5' XbaI and 3' SpeI/BamHI sites. PCR products were
digested with XbaI and BamHI and cloned into XbaI-BamHI digested
pCGNN to yield pCGNN-p65(450-550) and pCGNN-p65(361-550). The
constructs were verified by restriction analysis and DNA
sequencing.
[0128] The 100 amino acid P65 transcription activation sequence is
encoded by the following linear sequence:
5
CTGGGGGCCTTGCTTGGCAACAGCACAGACCCAGCTGTGTTCACAGACCTGGCATCCGTCGACAA-
CTCCGAGTTT SEQ ID NO 10 CAGGAGCTGCTGAACCAGGGCATACCTGTGGCC-
CCCCACACAACTGAGCCCATGCTGATGGAGTACCCTGAGGCT
ATAACTCGCCTAGTGACAGGGGCCCAGAGGCCCCCCGACCCAGCTCCTGCTCCACTGGGGGCCCCGGGGCTCC-
CC AATGGCCTCCTTTCAGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCT-
CAGCCCTGCTGAGTCAGATC AGCTCC
[0129] The more extended p65 transcription activation domain
(351-550) is encoded by the following linear sequence:
6
GATGAGTTTCCCACCATGGTGTTTCCTTCTGGGCAGATCAGCCAGGCCTCGGCCTTGGCCCCGGC-
CCCTCCCCAA SEQ ID NO 11 GTCCTGCCCCAGGCTCCAGCCCCTGCCCCTGCT-
CCAGCCATGGTATCAGCTCTGGCCCAGGCCCCAGCCCCTGTC
CCAGTCCTAGCCCCAGGCCCTCCTCAGGCTGTGGCCCCACCTGCCCCCAAGCCCACCCAGGCTGGGGAAGGAA-
CG CTGTCAGAGGCCCTGCTGCAGCTGCAGTTTGATGATGAAGACCTGGGGGCCTTGC-
TTGGCAACAGCACAGACCCA GCTGTGTTCACAGACCTGGCATCCGTCGACAACTCCG-
AGTTTCAGCAGCTGCTGAACCAGGGCATACCTGTGGCC
CCCCACACAACTGAGCCCATGCTGATGGAGTACCCTGAGGCTATAACTCGCCTAGTGACAGCCCAGAGGCCCC-
CC GACCCAGCTCCTGCTCCACTGGGGGCCCCGGGGCTCCCCAATGGCCTCCTTTCAG-
GAGATGAAGACTTCTCCTCC ATTGCGGACATGGACTTCTCAGCCCTGCTGAGTCAGA-
TCAGCTCCTAA
[0130] To generate N-terminal fusions of FRB domain(s) with
portions of the p65 activation domain, plasmids pCGNN-1FRB,
pCGNN-2FRB etc were digested with SpeI and BamHI. An XbaI-BamHI
fragment encoding p65 (450-550) was isolated from
pCGNN-p65(450-550) and ligated into the SpeI-BamHI digested vectors
to yield the plasmids pCGNN-1FRB-p65(450-550)- ,
pCGNN-2FRB-p65(450-550) etc. The construct pCGNN-1FRB-p65(361-550)
was made similarly using an XbaI-BamHI fragment isolated from
pCGNN-p65(361-550). These constructs were verified by restriction
analysis.
[0131] To examine the effect of introducing additional `linker`
polypeptide between the p65 activation domain and an N-terminal FRB
domain, FRAP fragments encoding extra sequence C-terminal to FRB
were cloned as p65 fusions. XbaI-BamHI fragments encoding
FRAP.sub.a, FRAP.sub.b, FRAP.sub.f, FRAP.sub.g and FRAP.sub.h were
excised from the vectors pCGNN-GAL4-FRAP.sub.a,
pCGNN-GAL4-FRAP.sub.b etc and ligated into XbaI-BamHI digested
pCGNN to yield the vectors pCGNN-FRAP.sub.a, pCGNN-FRAP.sub.b, etc.
These plasmids were then digested with SpeI and BamHI, and a
XbaI-BamHI fragment encoding p65 (amino acids 450-550) ligated in
to yield the five vectors pCGNN-FRAP.sub.a-p65,
pCGNN-FRAP.sub.b-p65, etc, which were verified by restriction
analysis.
[0132] Vectors encoding fusions of p65 to 1 and 3 N-terminal copies
of FRAP.sub.e were also prepared by digesting pCGNN-1FRAP.sub.e and
pCGNN-3FRAP.sub.e with SpeI and BamHI. XbaI-BamHI fragments
encoding p65(450-550) and p65(361-550) (isolated from
pCGNN-p65(450-550) and pCGNN-p65(361-550)) were then ligated in to
yield the vectors pCGNN-1FRAP.sub.e-p65(450-550),
pCGNN-3FRAP.sub.e-p65(450-550), pCGNN-1 FRAP.sub.e-p65(361-550) and
pCGNN-3FRAP.sub.e-p65(361-550). All constructs were verified by
restriction analysis.
[0133] Vectors were also constructed that encode C-terminal fusions
of FRB domain(s) with portions of the p65 activation domain.
Plasmids pCGNN-p65(450-550) and pCGNN-p65(361-550) were digested
with SpeI and BamHI, and XbaI-BamHI fragments encoding 1 and 3
copies of FRAP.sub.e (isolated from pCGNN-GAL4-1FRAP.sub.e and
pCGNN-GAL4-3FRAP.sub.e) and 1 copy of FRB (isolated from
pCGNN-GAL4-1FRB) ligated in to yield the plasmids
pCGNN-p65(450-550)-1FRAP.sub.e, pCGNN-p65(450-550)-3FRAP.sub.e,
pCGNN-p65(361-550)-1 FRAP.sub.e, pCGNN-p65(361-550)-3FRAP.sub.e,
pCGNN-p65(450-550)-1FRB and pCGNN-p65(361-550)-1FRB. All constructs
were verified by restriction analysis.
[0134] (g) Further Constructs
[0135] Other constructs can be made analogously with the above
procedures, but using alternative portions of the FRAP sequence.
For example, primers 12 and 13 are used to amplify the entire
coding region of FRAP. Primers 1 and 13, 6 and 13, and 5 and 13,
are used to amplify three fragments encompassing the FRB domain and
extending through to the C-terminal end of the protein (including
the lipid kinase homology domain). These fragments differ by
encoding different portions of the protein N-terminal to the FRB
domain. In each case, RT-PCR is used as described above to amplify
the regions from human thymus RNA, the PCR products are purified,
digested with XbaI and SpeI, ligated into XbaI-SpeI digested pCGNN,
and verified by restriction analysis and DNA sequencing.
7 (h) Primer sequences 1 5'GCATGTCTAGAGAGATGTGGCATGAAGGCCTGGAAG SEQ
ID NO 12 2 5'GCATCACTAGTCTTTGAGATTCGTCGGAACACATG SEQ ID NO 13 3
5'GCACATTCTAGAATTGATACGCCCAGACCCTTG SEQ ID NO 14 4
5'CGATCAACTAGTAAGTGTCAATTTCCGGGGCCT SEQ ID NO 15 5
5'GCACTATCTAGACTGAAGAACATGTGTGAGCACAGC SEQ ID NO 16 6
5'GCACTATCTAGAGTGAGCGAGGAGCTGATCCGAGTG SEQ ID NO 17 7
5'CGATCAACTAGTGGAAACATATTGCAGCTCTAAGGA SEQ ID NO 18 8
5'CGATCAACTAGTTGGCACAGCCAATTCAAGGTCCCG SEQ ID NO 19 9
5'ATGCTCTAGACTGGGGGCCTTGCTTGGCAAC SEQ ID NO 20 10
5'ATGCTCTAGAGATGAGTTTCCCACCATGGTG SEQ ID NO 21 11
5'GCATGGATCCGCTCAACTAGTGGAGCTGATCTGACTCAG SEQ ID NO 22 12
5'ATGCTCTAGACTTGGAACCGGACCTGCCGCC SEQ ID NO 23 13
5'GCATCACTAGTCCAGAAAGGGCACCAGCCAATAT SEQ ID NO 24
[0136] Restriction sites are underlined (XbaI=TCTAGA, SpeI=ACGAGT,
BamHI=GGATCC).
[0137] (i) DNA Sequence of Representative Final Construct:
pCGNN-ZFHD1-1FRB
8 12CA5 epitope M A S S Y P Y D V P D SEQ ID NO 25 5' gtagaagcgcgt
ATG GCT TCT AGC TAT CCT TAT GAC GTG CCT GAC SEQ ID NO 26 SV40 T NLS
Y A S L G G P S S P K K K R K TAT GCC AGC CTG GGA GGA CCT TCT AGT
CCT AAG AAG AAG AGA AAG (X/S) ZFHD1(5') V S R E R P Y A C P V F S C
D... GTG TCT AGA GAA CGC CCA TAT GCT TGC CCT GTC GAG TCC TGC GA...
XbaI ZFHD1(3') FRB(5') ... R I N T R E M W H E G I E E... SEQ ID NO
27 ...AGA ATC AAC ACT AGA GAG ATG TGG CAT GAA GGC CTG GAA GA... SEQ
ID NO 28 (S/X) FRB (3') R I S K T S Y * CGA ATC TCA AAG ACT AGT TAT
TAG ggatcctgag SpeI BamHI
[0138] Non-coding nucleotides are indicated in lower case
[0139] (S/X) and (X/S) indicate the result of a ligation event
between the compatible products of digestion with XbaI and SpeI, to
produce a sequence that is cleavable by neither enzyme * indicates
a stop codon
[0140] (j) Bicistronic Constructs
[0141] The internal ribosome entry sequence (IRES) from the
encephalomyocarditis virus was amplified by PCR from pWZL-BIeo. The
resulting fragment, which was cloned into pBS-SK+ (Stratagene),
contains an XbaI site and a stop codon upstream of the IRES
sequence and downstream of it, an NcoI site encompassing the ATG
followed by SpeI and BamHI sites. To facilitate cloning, the
sequence around the initiating ATG of pCGNN-ZFHD1-3FKBP was mutated
to an NcoI site and the XbaI site was mutated to a NheI site using
the oligonucleotides
9 5'-GAATTCCTAGAAGCGACCATGGCTTCTAGC-3' SEQ ID NO 29 and
5'-GAAGAGAAAGGTGGCTAGCGAACGCCCATAT-3' SEQ ID NO 30
[0142] respectively. An NcoI-BamHI fragment containing ZFHD1-3FKBP
was then cloned downstream of pBS-IRES to create
pBS-IRES-ZFHD1-3FKBP. The XbaI-BamHI fragment from this plasmid was
next cloned into SpeI/BamHI-cut pCGNN-1FRB-p65(361-550) to create
pCGNN-1FRB-p65(361-550)-IRES-ZFHD1-3FKB- P.
[0143] 2. Retroviral Vectors for the Expression of Chimeric
Proteins
[0144] Retroviral vectors used to express transcription factor
fusion proteins from stably integrated, low copy genes were derived
from pSRaMSVtkNeo (Muller et al., MCB 11:1785-92, 1991) and
pSRaMSV(XbaI) (Sawyers et al., J. Exp. Med. 181:307-313, 1995).
Unique BamHI sites in both vectors were removed by digesting with
BamHI, filling in with Klenow and religating to produce pSMTN2 and
pSMTX2, respectively. pSMTN2 expresses the Neo gene from an
internal thymidine kinase promoter. A Zeocin gene (Invitrogen) will
be cloned as a NheI fragment into a unique XbaI site downstream of
an internal thymidine kinase promoter in pSMTX2 to yield pSNTZ.
This Zeocin fragment was generated by mutagenizing pZeo/SV
(Invitrogen) using the following primers to introduce NheI sites
flanking the zeocin coding sequence.
10 Primer 1 5'-GCCATGGTGGCTAGCCTATAGTGAG SEQ ID NO 31 Primer 2
5'-GGCGGTGTTGGCTAGCGTCGGTCAG SEQ ID NO 32
[0145] pSMTN2 contains unique EcoRI and HindIII sites downstream of
the LTR. To facilitate cloning of transcription factor fusion
proteins synthesized as XbaI-BamHI fragments the following sequence
was inserted between the EcoRI and HindIII sites to create
pSMTN3:
11 12CA5 epitope M A S S Y P Y D V P D SEQ ID N0 33 5'
gaattccagaagcgcgt ATG GCT TCT AGC TAT CCT TAT GAC GTG CCT GAC SEQ
ID NO 34 EcoRI SV40 T NLS Y A S L G G P S S P K K K R K TAT GCC AGC
CTG GGA GGA CCT TCT AGT CCT AAG AAG AAG AGA AAG V GTG TCT AGA TAT
CGA GGA TCC CAA GCT T XbaI BamHI HindIII
[0146] The equivalent fragment is inserted into a unique EcoRI site
of pSMTZ to create pSMTZ3 with the only difference being that the
3' HindIII site is replaced by an EcoRI site.
[0147] pSMTN3 and pSMTZ3 permit chimeric transcription factors to
be cloned downstream of the 5' viral LTR as XbaI-BamHI fragments
and allow selection for stable integrants by virtue of their
ability to confer resistance to the antibiotics G418 or Zeocin
respectively.
[0148] To generate the retroviral vector SMTN-ZFHD1-3FKBP,
pCGNN-ZFHD1-3FKBP was first mutated to add an EcoRI site upstream
of the first amino acid of the fusion protein. An EcoRI-BamHI
(blunted) fragment was then cloned into EcoRI-HindIII(blunted)
pSRaMSVtkNeo (ref. 51) so that ZFHD1-3FKBP was expressed from the
retroviral LTR.
[0149] 3. Rapamycin-dependent Transcriptional Activation
[0150] Our previous experiments showed that three copies of FKBP
fused either to a Gal4 DNA binding domain or a transcription
activation domain activated both the stably integrated or
transiently transfected reporter gene more strongly than
corresponding fusion proteins containing only one or two FKBP
domains. To evaluate this parameter with FRB fusion proteins,
effector plasmids containing Gal4 DNA binding domain fused to one
or more copies of an FRB domain were co-transfected with a plasmid
encoding three FKBP domains and a p65 activation domain
(3.times.FKBP-p65) by transient transfection. The results indicate
that in this system, four copies of the FRB domain fused to the
Gal4 DNA binding domain activated the stably integrated reporter
gene more strongly than other corresponding fusion proteins with
fewer FRB domains.
[0151] Method: HT1080 B cells were grown in MEM supplemented with
10% Bovine Calf Serum. Approximately 4.times.10.sup.5 cells/well in
a 6 well plate (Falcon) were transiently transfected by Lipofection
procedure as recommended by the supplier (GIBCO, BRL). The DNA:
Lipofectamine ratio used in this experiment correspond to 1:6.
Cells in each well received 500 ng of pCGNN F3-p65, 1.9 ug of PUC
118 plasmid as carrier and 100 ng of one of the following plasmids:
pCGNN Gal4-1FRB, pCGNN Gal4-2FRB, pCGNN Gal4-3FRB or pCGNN
Gal4-4FRB. Following transfection, 2 ml fresh media was added and
supplemented with Rapamycin to the indicated concentration. After
24 hrs, 100 ul of the media was assayed for SEAP activity as
described (Spencer et al, 1993).
[0152] To test whether multiple FRB domains fused to a p65
activation domain results in increased transcriptional activation
of the reporter gene, we co-transfected HT1080 B cells with
plasmids expressing Gal4-3.times.FKBP and 1, 2, 3 or 4 copies of
FRB fused to p65 activation domain. Surprisingly, unlike the DNA
binding domain-FRB fusions, a single copy of FRB fused to p65
activation domain activated the reporter gene significantly more
strongly than corresponding fusion proteins containing 2 or more
copies of FRB.
[0153] Method: HT1080 B cells were grown in MEM supplemented with
10% Bovine Calf Serum. Approximately 4.times.10.sup.5 cells/well in
a 6 well plate were transiently transfected by Lipofection
procedure as recommended by GIBCO, BRL. The DNA: Lipofectamine
ratio used correspond to 1:6. Cells in each well received 1.9 ug of
PUC 118 plasmid as carrier, 100 ng of pCGNNGal4F3 and 500 ng one of
the following plasmids:pCGNN1, 2, 3 or 4 FRB-p65. Following
transfection, 2 ml fresh media was added and supplemented with
Rapamycin to the indicated concentration. After 24 hrs, 100 ul of
the media was assayed for SEAP activity as described (Spencer et
al, 1993).
[0154] Similar experiments were also conducted using another stable
cell line (HT1080 B14) containing the 5.times.Gal4-12-SEAP reporter
gene and DNA sequences encoding a fusion protein containing a Gal4
DNA binding domain and 3 copies of FKBP stably integrated. These
cells were transiently transfected with effector plasmids
expressing p65 activation domain fused to 1 or more copies of an
FRB domain. Similar to our observations with HT1080 B cells,
effector plasmids expressing a single copy of FRB-p65 activation
domain fusion protein activated the reporter gene more strongly
than others with 2 or more copies of FRB.
[0155] 4. Rapamycin-dependent Transcriptional Activation in
Transiently Transfected Cells: ZFHD1 and p65 Fusions
[0156] Human fibrosarcoma cells transiently transfected with a SEAP
target gene and plasmids encoding representative ZFHD-FKBP- and
FRB-p65-containing fusion proteins exhibited rapamycin-dependent
and dose-responsive secretion of SEAP into the cell culture medium.
SEAP production was not detected in cells in which one or both of
the transcription factor fusion plasmids was omitted, nor was it
detected in the absence of added rapamycin. When all components
were present, however, SEAP secretion was detectable at rapamycin
concentrations as low as 0.5 nM. Peak SEAP secretion was observed
at 5 nM. Similar results have been obtained when the same
transcription factors were used to drive rapamycin-dependent
activation of an hGH reporter gene or a stably integrated version
of the SEAP reporter gene made by infection with a retroviral
vector. It is difficult to determine the fold activation in
response to rapamycin since levels of SEAP secretion in the absence
of drug are undetectable, but it is clear that in this system there
is at least a 1000-fold enhancement over background levels in the
absence of rapamycin. Thus, this system exhibits undetectable
background activity and high dynamic range.
[0157] Several different configurations for transcription factor
fusion proteins were explored. When various numbers of copies of
FKBP domains were fused to ZFHD1 and various numbers of copies of
FRBs to p65, optimal levels of rapamycin-induced activation
occurred when there were multiple FKBPs fused to ZFHD1 and fewer
FRBs fused to p65. The preference for multiple drug-binding domains
on the DNA-binding protein may reflect the capacity of these
proteins to recruit multiple activation domains and therefore to
elicit higher levels of promoter activity. The presence of only 1
drug-binding domain on the activation domain should allow each FKBP
on ZFHD to recruit one p65. Any increase in the number of FRBs on
p65 would increase the chance that fewer activation domains would
be recruited to ZFHD, each one linked my multiple FRB-FKBP
interactions.
[0158] Methods:
[0159] HT1080 cells (ATCC CCL-121), derived from a human
fibrosarcoma, were grown in MEM supplemented with non-essential
amino acids and 10% Fetal Bovine Serum. Cells plated in 24-well
dishes (Falcon, 6.times.10.sup.4 cells/well) were transfected using
Lipofectamine under conditions recommended by the manufacturer
(GIBCO/BRL). A total of 300 ng of the following DNA was transfected
into each well: 100 ng ZFHD.times.12-CMV-SEAP reporter gene, 2.5 ng
pCGNN-ZFHD1-3FKBP or other DNA binding domain fusion, 5 ng
pCGNN-1FRB-p65(361-550) or other activation domain fusion and 192.5
ng pUC118. In cases where the DNA binding domain or activation
domain were omitted an equivalent amount of empty pCGNN expression
vector was substituted. Following lipofection (for 5 hours) 500
.mu.l medium containing the indicated amounts of rapamycin was
added to each well. After 24 hours, medium was removed and assayed
for SEAP activity as described (Spencer et al, Science 262:1019-24,
1993) using a Luminescence Spectrometer (Perkin Elmer) at 350 nm
excitation and 450 nm emission. Background SEAP activity, measured
from mock-transfected cells, was subtracted from each value.
[0160] To prepare transiently transfected HT1080 cells for
injection into mice (See below), cells in 100 mm dishes
(2.times.10.sup.6 cells/dish) were transfected by calcium phosphate
precipitation for 16 hours (Gatz, C., Kaiser, A. & Wendenburg,
R. , 1991,Mol. Gen. Genet. 227, 229-237) with the following DNAs:
10 mg of ZHWT.times.12-CMV-hGH, 1 mg pCGNN-ZFHD1-3FKBP, 2 mg
pCGNN-1FRB-p65(361-550) and 7 mg pUC118. Transfected cells were
rinsed 2 times with phosphate buffered saline (PBS) and given fresh
medium for 5 hours. To harvest for injection, cells were removed
from the dish in Hepes Buffered Saline Solution containing 10 mM
EDTA, washed with PBS/0.1% BSA/0.1% glucose and resuspended in the
same at a concentration of 2.times.10.sup.7 cells/ml.
[0161] Plasmids:
[0162] Construction of the transcription factor fusion plasmids is
described above.
[0163] pZHWT.times.12-CMV-SEAP
[0164] This reporter gene, containing 12 tandem copies of a ZFHD1
binding site (Pomerantz et al., 1995) and a basal promoter from the
immediate early gene of human cytomegalovirus (Boshart et. al.,
1985) driving expression of a gene encoding secreted alkaline
phosphatase (SEAP), was prepared by replacing the NheI-HindIII
fragment of pSEAP Promoter (Clontech) with the following NheI-XbaI
fragment containing 12 ZFHD binding sites:
12
GCTAGCTAATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGCTCGAGTAAT-
GATGGGCGTCT SEQ ID NO 35 0 AGCTAATGATGGGCGCTCGAGTAATGATGGG-
CGTGCGACTAATGATGGGCGCTCGAGTAATGATGGGCGTCTAGC 0
TAATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGCTCGAGTAATGATGGGCGTCTAGA
0 (the ZFHD1 binding sites are underlined),
[0165] and the following XbaI-HindIII fragment containing a minimal
CMV promoter (-54 to +45):
13
TCTAGAACGCGAATTCCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGT-
GAACCGTCAGA SEQ ID NO 36 TCGCCTGGAGACGCCATCCACGCTGTTTTGAC-
CTCCATAGAAGCTT (the CMV minimal promoter is underlined).
[0166] pZHWT.times.12-CMV-hGH
[0167] Activation of this reporter gene leads to the production of
hGH. It was constructed by replacing the HindIII-BamHI (blunted)
fragment of pZHWT.times.12-CMV-SEAP (containing the SEAP coding
sequence) with a HindIII (blunted) -EcoRI fragment from pOGH
(containing an hGH genomic clone; Selden et al., MCB 6:3171-3179,
1986; the BamHI and EcoRI sites were blunted together).
[0168] pZHWT.times.12-IL2-SEAP
[0169] This reporter gene is identical to pZHWT.times.12-CMV-SEAP
except the XbaI-HindIII fragment containing the minimal CMV
promoter was replaced with the following XbaI-HindIII fragment
containing a minimal IL2 gene promoter (-72 to +45 with respect to
the start site; Siebenlist et al., MCB 6:3042-3049, 1986):
14 TCTAGAACGCGAATTCAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACA-
GTATAAATTGCATCTCTTG SEQ ID NO 37 TTCAAGAGTTCCCTATCACTCTCTT-
TAATCACTACTCACAGTAACCTCAACTCCTGCCACAAGCTT (the IL2 minimal promoter
is underlined).
[0170] pLH
[0171] To facilitate the stable integration of a single, or few,
copies of reporter gene the following retroviral vector was
constructed. pLH (LTR-hph), which contains the hygromycin B
resistance gene driven by the Moloney murine leukemia virus LTR and
a unique internal ClaI site, was constructed as follows: The hph
gene was cloned as a HindIII-ClaI fragment from pBabe Hygro
(Morganstern and Land, NAR 18:3587-96, 1990) into BamHI-ClaI cut
pBabe BIeo (resulting in the loss of the bleo gene; the BamHI and
HindIII sites were blunted together).
[0172] pLH-ZHWT.times.12-IL2-SEAP
[0173] To clone a copy of the reporter gene containing 12 tandem
copies of the ZFHD1 binding site and a basal promoter from the IL2
gene driving expression of the SEAP gene into the pLH retroviral
vector, the MluI-ClaI fragment from pZHWT.times.12-IL2-SEAP (with
ClaI linkers added) was cloned into the ClaI site of pLH. It was
oriented such that the directions of transcription from the viral
LTR and the internal ZFHD-IL2 promoters were the same.
[0174] pLH-G5-IL2-SEAP
[0175] To construct a retroviral vector containing 5 Gal4 sites
embedded in a minimal IL2 promoter driving expression of the SEAP
gene, a ClaI-BstBI fragment consisting of the following was
inserted into the ClaI site of pLH such that the directions of
transcription from the viral LTR and the internal Gal4-IL2
promoters were the same: A ClaI-HindIII fragment containing 5 Gal4
sites (underlined) and regions -324 to -294 (bold) and -72 to +45
of the IL2 gene (italics)
15 5' ATCGATGTTTTCTGAGTTACTTTTGTATCCCCACCCCCCCTCGAGCTTGCATGCCTG SEQ
ID NO 38 CAGGTCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGA-
GTACTGTCCTCCGAGCG GAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGCA-
GACTCTAGAGGATCCGAGAACATT TTGACACCCCCATAATATTTTTCCAGAATTAAC-
AGTATAAATTGCATCTCTTGTTCAAGAGTTC CCTATCACTCTCTTTAATCACTACTC-
ACAGTAACCTCAACTCCTGCCACAAGCTT.
[0176] and a HindIII-BstBI fragment containing the SEAP gene coding
sequence (Berger et al., Gene 66:1-10, 1988) mutagenized to add the
following sequence (containing a BstB1 site) immediately after the
stop codon:
[0177] 5'-CCGTGGTCOCGCGTTGCTTCGAT SEQ ID NO 39
[0178] 5. Rapamycin-dependent Transcriptional Activation in Stably
Transfected Cells
[0179] We conducted the following experiments to confirm that this
system exhibits similar properties in stably transfected cells. We
generated stable cell lines by sequential transfection of a SEAP
target gene and expression vectors for ZFHD1-3FKBP and 1FRB-p65,
respectively. A pool of several dozen stable clones resulting from
the final transfection exhibited rapamycin-dependent SEAP
production. From this pool, we characterized several individual
clones, many of which produced high levels of SEAP in response to
rapamycin. One such clone produced SEAP at levels approximately
forty times higher than the pool and significantly higher than
transiently transfected cells. In an attempt to rigorously
quantitate background SEAP production and induction ratio in this
clone, we performed a second set of assays in which the length of
the SEAP assay was increased by a factor of approximately 50 to
detect any SEAP activity in untreated cells. Under these
conditions, mock transfected cells produced 47 arbitrary
fluorescence units, while the transfected clone produced 54 units
in the absence of rapamycin and over 90,000 units at 100 nM
rapamycin. Thus, in this stable cell line, background gene
expression was negligible and the induction ratio (7 units to
90,000 units) was greater than four orders of magnitude.
[0180] To simplify the task of stable transfection, we used a
bicistronic expression vector that directs the production of both
ZFHD1-3FKBP and 1FRB-p65 through the use of an internal ribosome
entry sequence (IRES). This expression plasmid was cotransfected,
together with a zeocin-resistance marker plasmid, into a cell line
carrying a retrovirally-transduced SEAP reporter gene, and a pool
of approximately fifty drug-resistant clones was selected and
expanded. This pool of clones also exhibited rapamycin-dependent
SEAP production with no detectable background and a very similar
dose-response curve to that observed in transiently transfected
cells. Our results indicate that rapamycin-responsive gene
expression can be readily obtained in both transiently and stably
transfected cells. In both cases, regulation is characterized by
very low background and high induction ratios. Stable cell lines.
Helper-free retroviruses containing the reporter gene or DNA
binding domain fusion were generated by transient co-transfection
of 293T cells (Pear, W. S., Nolan, G. P., Scott, M. L. &
Baltimore D., 1993, Production of high-titer helper-free
retroviruses by transient transfection. Proc. Natl. Acad. Sci. USA
90, 8392-8396) with a Psi(-) amphotropic packaging vectorand the
retroviral vectors pLH-ZHWT.times.12-IL2-SEAP or SMTN-ZFHD1-3FKBP,
respectively. To generate a clonal cell line containing the
reporter gene stably integrated, HT1080 cells infected with
retroviral stock were diluted and selected in the presence of 300
mg/ml Hygromycin B. Individual clones from this and other cell
lines described below were screened by transient transfection of
the missing components followed by the addition of rapamycin as
described above. All 12 clones analyzed were inducible and had
little or no basal activity. The most responsive clone, HT1080L,
was selected for further study.
[0181] HT20-6 cells, which contain the pLH-ZHWT.times.12-IL2-SEAP
reporter gene, ZFHD1-3FKBP DNA binding domain and 1FRB-p65(361-550)
activation domain stably integrated, were generated by first
infecting HT1080L cells with SMTN-ZFHD1-3FKBP-packaged retrovirus
and selecting in medium containing 500 mg/ml G418. A strongly
responsive clone, HT1080L3, was then transfected with linearized
pCGNN-1FRB-p65(361-550) and pZeoSV (Invitrogen) and selected in
medium containing 250 mg/ml Zeocin. Individual clones were first
tested for the presence of 1FRB-p65(361-550) by western. Eight
positive clones were analyzed by addition of rapamycin. All eight
had low basal activity and in six of them, gene expression was
induced by at least two orders of magnitude. The clone that gave
the strongest response, HT20-6, was selected for further
analysis.
[0182] HT23 cells were generated by co-transfecting HT1080L cells
with linearized pCGNN-1FRB-p65(361-550)-IRES-ZFHD1-3FKBP and pZeoSV
and selecting in medium containing 250 mg/ml Zeocin. Approximately
50 clones were pooled for analysis.
[0183] For analysis, cells were plated in 96-well dishes
(1.5.times.10.sup.4 cells/well) and 200 .mu.l medium containing the
indicated amounts of rapamycin (or vehicle) was added to each well.
After 18 hours, medium was removed and assayed for SEAP activity.
In some cases, medium was diluted before analysis and relative SEAP
units obtained multiplied by the fold-dilution. Background SEAP
activity, measured from untransfected HT1080 cells, was subtracted
from each value.
[0184] 6. Rapamycin-dependent Production of hGH in Mice
[0185] In Vivo Methods: Animals, husbandry, and general procedures.
Male nu/nu mice were obtained from Charles River Laboratories
(Wilmington, Mass.) and allowed to acclimate for five days prior to
experimentation. They were housed under sterile conditions, were
allowed free access to sterile food and sterile water throughout
the entire experiment, and were handled with sterile techniques
throughout. No immunocompromised animal demonstrated outward
infection or appeared ill as a result of housing, husbandry
techniques, or experimental techniques.
[0186] To transplant transiently transfected cells into mice,
2.times.10.sup.6 transfected HT1080 cells, were suspended in 100 ml
PBS/0.1% BSA/0.1% glucose buffer, and administered into four
intramuscular sites (approximately 25 ml per site) on the haunches
and flanks of the animals. Control mice received equivalent volume
injections of buffer alone.
[0187] Rapamycin was formulated for in vivo administration by
dissolution in equal parts of N,N-dimethylacetamide and a 9:1 (v:v)
mixture of polyethylene glycol (average molecular weight of 400)
and polyoxyethylene sorbitan monooleate. Concentrations of
rapamycin, in the completed formulation, were sufficient to allow
for in vivo administration of the appropriate dose in a 2.0 ml/kg
injection volume. The accuracy of the dosing solutions was
confirmed by HPLC analysis prior to intravenous administration into
the tail veins. Some control mice, bearing no transfected HT1080
cells, received 10.0 mg/kg rapamycin. In addition, other control
mice, bearing transfected cells, received only the rapamycin
vehicle.
[0188] Blood was collected by either anesthetizing or sacrificing
mice via CO.sub.2 inhalation. Anesthetized mice were used to
collect 100 ml of blood by cardiac puncture. The mice were revived
and allowed to recover for subsequent blood collections. Sacrificed
mice were immediately exsanguinated. Blood samples were allowed to
clot for 24 hours, at 4.degree. C., and sera were collected
following centrifugation at 1000.times.g for 15 minutes. Serum hGH
was measured by the Boehringer Mannheim non-isotopic sandwich ELISA
(Cat No. 1 585 878). The assay had a lower detection limit of
0.0125 ng/ml and a dynamic range that extended to 0.4 ng/ml.
Recommended assay instructions were followed. Absorbance was read
at 405 nm with a 490 nm reference wavelength on a Molecular Devices
microtiter plate reader. The antibody reagents in the ELISA
demonstrate no cross reactivity with endogenous, murine hGH in
diluent sera or native samples.
[0189] hGH expression In Vivo. For the assessment of dose-dependent
rapamycin-induced stimulation of hGH expression, rapamycin was
administered to mice approximately one hour following injection of
HT1080 cells. Rapamycin doses were either 0.01, 0.03, 0.1, 0.3,
1.0, 3.0, or 10.0 mg/kg. Seventeen hours following rapamycin
administration, the mice were sacrificed for blood collection.
[0190] To address the time course of in vivo hGH expression, mice
received 10.0 mg/kg of rapamycin one hour following injection of
the cells. Mice were sacrificed at 4, 8, 17, 24, and 42 hours
following rapamycin administration.
[0191] The ability of rapamycin to induce sustained expression of
hGH from transplanted HT1080 cells was tested by repeatedly
administering rapamycin. Mice were administered transfected HT1080
cells as described above. Approximately one hour following
injection of the cells, mice received the first of five intravenous
10.0 mg/kg doses of rapamycin. The four remaining doses were given
under anesthesia, immediately subsequent to blood collection, at
16, 32, 48, and 64 hours. Additional blood collections were also
performed at 72, 80, 88, and 96 hours following the first rapamycin
dose. Control mice were administered cells, but received only
vehicle at the various times of administration of rapamycin.
Experimental animals and their control counterparts were each
assigned to one of two groups. Each of the two experimental groups
and two control groups received identical drug or vehicle
treatments, respectively. The groups differed in that blood
collection times were alternated between the two groups to reduce
the frequency of blood collection for each animal.
[0192] Results
[0193] Rapamycin elicited dose-responsive production of hGH in
these animals (FIG. 1). hGH concentrations in the rapamycin-treated
animals compared favorably with normal circulating levels in humans
(0.2-0.3 ng/ml). No plateau in hGH production was observed in these
experiments, suggesting that the maximal capacity of the
transfected cells for hGH production was not reached. Control
animals--those that received transfected cells but no rapamycin and
those that received rapamycin but no cells--exhibited no detectable
serum hGH. Thus, the production of hGH in these animals was
absolutely dependent upon the presence of both engineered cells and
rapamycin.
[0194] The presence of significant levels of hGH in the serum 17
hours after rapamycin administration was noteworthy, because hGH is
cleared from the circulation with a half-life of less than four
minutes in these animals. This observation suggested that the
engineered cells continued to secrete hGH for many hours following
rapamycin treatment. To examine the kinetics of rapamycin control
of hGH production, we treated animals with a single dose of
rapamycin and then measured hGH levels at different times
thereafter. Serum hGH was observed within four hours of rapamycin
treatment, peaked at eight hours (at over one hundred times the
sensitivity limit of the hGH ELISA), and remained detectable 42
hours after treatment. hGH concentration decayed from its peak with
a half-life of approximately 11 hours. This half-life is several
hundredfold longer than the half-life of hGH itself and
approximately twice the half-life of rapamycin (4.6 hr) in these
animals. The slower decay of serum hGH relative to rapamycin could
reflect the presence of higher tissue concentrations of rapamycin
in the vicinity of the implanted cells. Alternatively, persistence
of hGH production from the engineered cells may be enhanced by the
stability of hGH mRNA.
[0195] Interestingly, administration of a second dose of rapamycin
to these animals at 42 hr resulted in a second peak of serum hGH,
which decayed with similar kinetics indicating that the engineered
cells retained the ability to respond to rapamycin for at least two
days. Therefore, to ascertain the ability of this system to elevate
and maintain circulating hGH concentrations, we performed an
experiment in which animals received multiple doses of rapamycin at
16-hour intervals. This interval corresponds to the time required
for hGH levels to peak and then decline approximately half-way.
According to this regimen, rapamycin concentration is predicted to
approach a steady-state trough concentration of 1.7 .mu.g/ml after
two doses. hGH levels should also approach a steady state trough
concentration following the second dose. Indeed, treated animals
held relatively stable levels of circulating hGH in response to
repeated doses of rapamycin. After the final dose, hGH levels
remained constant for 16 hours and then declined with a similar
half-life as rapamycin (6.8 hours for hGH versus 4.6 hours for
rapamycin). These data suggest that upon multiple dosing,
circulating rapamycin imparts tight control over the secretion of
hGH from transfected cells in vivo. In particular, it is apparent
that protein production is rapidly terminated upon withdrawal of
drug.
[0196] Discussion
[0197] These experiments demonstrate that the transcription factor
component modules function appropriately with corresponding target
gene constructs in cell culture and in whole animals in a
regulatable system.
[0198] B. Hybrid Transcription Factors Containing such Modular
Components Work Well in Constitutive Expression
[0199] Plasmids
[0200] pCGNNZFHD1
[0201] An expression vector for directing the expression of ZFHD1
coding sequence in mammalian cells was prepared as follows. Zif268
sequences were amplified from a cDNA clone by PCR using primers
5'Xba/Zif and 3'Zif+G. Oct1 homeodomain sequences were amplified
from a cDNA clone by PCR using primers 5'Not Oct HD and Spe/Bam
3'Oct. The Zif268 PCR fragment was cut with XbaI and NotI. The Oct1
PCR fragment was cut with NotI and BamHI. Both fragments were
ligated in a 3-way ligation between the XbaI and BamHI sites of
pCGNN (Attar and Gilman, 1992) to make pCGNNZFHD1 in which the cDNA
insert is under the transcriptional control of human CMV promoter
and enhancer sequences and is linked to the nuclear localization
sequence from SV40 T antigen. The plasmid pCGNN also contains a
gene for ampicillin resistance which can serve as a selectable
marker.
[0202] pCGNNZFHD1-p65
[0203] An expression vector for directing the expression in
mammalian cells of a chimeric transcription factor containing the
composite DNA-binding domain, ZFHD1, and a transcription activation
domain from p65 (human) was prepared as follows. The sequence
encoding the C-terminal region of p65 containing the activation
domain (amino acid residues 450-550) was amplified from pCGN-p65
using primers p65 5' Xba and p65 3' Spe/Bam. The PCR fragment was
digested with XbaI and BamH1 and ligated between the Spe1 and BamHI
sites of pCGNN ZFHD1 to form pCGNN ZFHD-p65AD.
[0204] The P65 transcription activation sequence contains the
following linear sequence:
16 CTGGGGGCCTTGCTTGGCAACAGCACAGACCCAGCTGTGTTCACAGACCTGGCATCCGT SEQ
ID NO 40 CGACAACTCCGAGTTTCAGCAGCTGCTGAACCAGGGCATACCTGTGG-
CCCCCCACACAA CTGAGCCCATGCTGATGGAGTACCCTGAGGCTATAACTCGCCTAG-
TGACAGGGGCCCAG AGGCCCCCCGACCCAGCTCCTGCTCCACTGGGGGCCCCGGGGC-
TCCCCAATGGCCTCCT TTCAGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACT-
TCTCAGCCCTGCTGAGTC AGATCAGCTCC
[0205] pCGNNZFHD1-FKBP.times.3
[0206] An expression vector for directing the expression of ZFHD1
linked to three tandem repeats of human FKBP was prepared as
follows. Three tandem repeats of human FKBP were isolated as an
XbaI-BamHI fragment from pCGNNF3 and ligated between the Spe1 and
BamHI sites of pCGNNZFHD1 to make pCGNNZFHD1-FKBP.times.3 (ATCC
Accession No. 97399).
[0207] pZHWT.times.8SVSEAP
[0208] A reporter gene construct containing eight tandem copies of
a ZFHD1 binding site (Pomerantz et al., 1995) and a gene encoding
secreted alkaline phosphatase (SEAP) was prepared by ligating the
tandem ZFHD1 binding sites between the Nhe1 and BgIII sites of
pSEAP-Promoter Vector (Clontech) to form pZHWT.times.8SVSEAP. The
ZHWT.times.8SEAP reporter contains two copies of the following
sequence in tandem:
[0209]
CTAGCTAATGATGGGCGCTOGAGTAATGATGGGCGGTOGACTAATGATGGGCGCTOGAGTAATGATG-
GGOCT SEQ ID NO 41
[0210] The ZFHD1 binding sites are underlined.
[0211] pCGNN F1 and F2
[0212] One or two copies of FKBP12 were amplified from pNF3VE using
primers FKBP 5' Xba and FKBP 3' Spe/Bam. The PCR fragments were
digested with Xba1 and BamH1 and ligated between the Xba1 and BamH1
sites of pCGNN vector to make pCGNN F1 or pPCGNN F2.
pCGNNZFHD1-FKBP.times.3 can serve as an alternate source of the
FKBP cDNA.
[0213] pCGNN F3
[0214] A fragment containing two tandem copies of FKBP was excised
from pCGNN F2 by digesting with Xba1 and BamH1 . This fragment was
ligated between the SpeI and BamHI sites of pCGNN F1.
[0215] pCGNN F3VP16
[0216] The C-terminal region of the Herpes Simplex Virus protein,
VP16 (AA 418-490) containing the activation domain was amplified
from pCG-Gal4-VP16 using primers VP16 5' Xba and VP16 3' Spe/Bam.
The PCR fragment was digested with Xba1 and BamH1 and ligated
between the Spe1 and BamH1 sites of pCGNN F3 plasmid.
[0217] pCGNN F3p65
[0218] The Xba1 and BamH1 fragment of p65 containing the activation
domain was prepared as described above. This fragment was ligated
between the Spe1 and BamH1 sites of pCGNN F3.
17 Primers 5'Xba/Zif 5'ATGCTCTAGAGAACGCCCATATGCTTGCCCT SEQ ID NO 42
3'Zif+G 5'ATGCGCGGCCGCAGGAGGAAGAAACGCACCAGC SEQ ID NO 43 5'Not
OctHD 5'ATGCGCGGCCGCAGGAGGAAGAAACGCACCAGC SEQ ID NO 44 Spe/Bam
3'Oct 5'GCATGGATCCGATTCAACTAGTGTTGATTCTTTTTTCTTTCTGGCGGCG SEQ ID NO
45 FKBP 5'Xba 5'TCAGTCTAGAGGAGTGCAGGTGGAAACCAT SEQ ID NO 46 FKBP 3'
Spe/Bam 5'GCATGGATCCGATTCAACTAGTCCCACCGTACT- CGTCAATTCC SEQ ID NO
47 VP16 5' Xba 5'ACTGTCTAGAGTCAGCCTGGGGGACGAG SEQ ID NO 48 VP16 3'
Spe/Bam 5'GCATGGATCCGATTCAACTAGTCCCACCGTACTCGTCAATTCC SEQ ID NO 49
P65 5' Xba 5'ATGCTCTAGACTGGGGGCCTTGCTTGGCAAC SEQ ID NO 50 p65 3'
Spe/Bam 5'GCATGGATCCGCTCAACTAGTGGAGCTGATCTGACTCAG SEQ ID NO 51
[0219] References
[0220] 1. Attar, R. M., and M. Z. Gilman 1992. Mol. Cell. Biol.
12:2432-2443
[0221] 2. Ausubel, F. M. et al., Eds., 1994. CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY (Wiley, N.Y.)
[0222] 3. Pomerantz, J. L., et al. 1995. Science. 267:93-96.
[0223] 4. Spencer, D. M., et al. 1993. Science. 262:1019-1024.
[0224] II. Evaluation of Representative Illustrative Chimeric
Transcription Factors
[0225] Constructs
[0226] Constructs encoding the following GAL-4-based chimeric
transcription factors, among others, were prepared and tested in
human cell lines containing stably integrated SEAP reporter
constructs containing GAL4 or ZFHD1 recognition sequences, as
appropriate:
18 chimeric factor data shown in Figure G-K G-KK G-KKK G-KKKK
G-KKKKK G-KKKKKK G-(V8.times.2) G-(V8.times.2).sub.2
G-(V8.times.2).sub.3 G-(V8.times.2).sub.4 G-(V8.times.2).sub.5
G-(V8.times.2).sub.6 G-D G-DD G-DDD G-DDDD G-DDDDD G-DDDDDD Z-VP16
Z-k Z-kkk Z-K Z-KKK G-KKK-(V8 .times. 2)4 G-KKK-DDDDD G-(V8 .times.
2)4-DDDDD G-KKK-(V8 .times. 2)4-DDDDD G-K G-KKK G-HSF-HSF
G-HSF-HSF-HSF-HSF G-K-HSF-HSF-HSF-HSF G-KKK-HSF-HSF-HSF-HSF
abbreviations: G = GAL4 residues 1-94 K = p65(361-550) = "N361" in
FIG. 6 k = p65(450-550) = "N450" in FIG. 6 V8 .times. 2 = tandem
repeat of VP16 V8 sequence with an intervening SerArg resulting
from ligation; (V8.times.2)4 = "8V8" in FIG. 6 D = VP16 C terminal
SRDFDLDMLG (SEQ ID NO 52) containing an initial SerArg resulting
from ligation = "Vc" in FIG. 6 Z = ZFHD1 ("ZH" in FIG. 5) HSF = 14
mer (see table below)
[0227] Plasmid constructions: PCG-Gal4 vector containing Gal4 DNA
binding domain coding sequences between amino acids 1-94 was
digested with Xba1 and BamH1 . The p65 activation domain sequences
between amino acids 361-550 was generated by PCR using the
following oligonuleotides:
19 5'-atgctctagagatgagtttcccaccatggtg-3' SEQ ID NO 53 and
5'-gcatggatccgctcaactagtggagctgatctgactcag-3'. SEQ ID NO 54
[0228] This fragment was digested with Xba1 and BamH1 and cloned
into PCG-Gal4 vector to make PCG-Gal4-p65 (361-550), here after
will be referred as PCG-GK. To make PCG-GK2 plasmid, the p65
activation domain containing PCR fragment described above was
digested with Xba1 and BamH1 and cloned into Spe1 and BamH1
digested PCG-GK vector. PCG-GK3, 4, 5, 6 were all generated
following the same approach.
[0229] Plasmid PCG-Gal 4 plasmids containing reiterated copies of
V8 domain were generated by the following method. The
oligonucleotides 5'-ctagagacttcgacttggacatgct-3' (SEQ ID NO 55);
5'agtcccccagcatgtccaagtcg- aagtct-3'(SEQ ID NO 56);
5'-gggggacttcgacttggacatgctgactagttgag-3' (SEQ ID NO 57) and
5'-gatcctcaactagtcagcatgtccaagtcga-3' (SEQ ID NO 58) were
phosphorylated and the first and last pair of oligos were annealed
separately. Together these oligonucleotides make two tandem V8
coding sequences. These annealed oligos were then ligated into Xba1
and BamH1 digested PCG-Gal4 vector. The resulting vector, PCG-GV2
containing two copies of V8 sequences was digested with Spe1 and
BamH1. V8.times.2 oliogos made as described above was cloned into
this vector to make PCG-GV4. Same approach was taken to generate
PCG-GV6, 8, 10 and 12 plasmids.
[0230] PCG-Gal4 plasmids containing reiterated copies of VP16
C-terminus, hereafter referred as D activation domain were
constructed as follows. The VP16 C-terminus region was PCR
amplified using the following primers:
5'-atgctctagagacggggaftccccggggccg-3' (SEQ ID NO 59) and
5'gcatggatcctcattaactagtcccaccgtactcgtcaattcc-3' (SEQ ID NO 60).
The PCR fragments were digested with Xba1 and BamH1 and cloned into
PCG-Gal4 vector previously digested with Xba1 and BamH1. The
resulting plasmid was designated as PCG-GD. To make PCG-GD2, PCG-GD
was digested with Spe1 and BamH1 and ligated with Xba1 and BamH1
digested D fragment described above. PCG-GD3, 4, 5 and 6 were
constructed using the same approach. Plasmids PCG-GK3V8 and
PCG-GK3D5 were made by digesting PCG-GV8 and PGG-D5 plasmids with
Xba1 and BamH1 and cloning the fragments containing V8 and D5
sequences respectively into PCG-GK3 digested with Spe1 and BamH1.
Similarly, Xba1/BamH1 fragment from PCG-GD5 containing D5 sequences
was cloned into Spe1/BamH1 digested PCG-GV8 plasmid to construct
PCG-V8D5 plasmid. The V8D5 fragment was excised from this plasmid
by digesting it with Xba1 and BamH1 and the fragment was cloned
into Spe1/BamH1 digested PCG-K3 to make PCG-K3V8D5 plasmid.
[0231] PCGNN-ZFHD-p65(450-550) and PCGNN-ZFHD-p65(361-550) are
described above. PCGNN-p65(450-550)x3 and PCGNN-ZFHD-p65(361-550)
were made as follows: PCG-Gal4-p65(450-550)x3 and
PCG-Gal4-p65(361-550) were digested with Xba1 and BamH1 and the
p65(450-550).times.3 and p65(361-550) were excised. These fragments
were cloned into Spe1/BamH1 digested PCGNN-ZFHD to generate
PCGNN-ZFHD-p65(450-550) and PCGNN-ZFHD-p56(361-550).
[0232] PCG-Gal4-HSFX2 containing two copies of HSF14 activation
domain was made by phosphorylating and ligating the following
oligonucleotides to Xba1 and BamH1 digested PCG-Gal4 plasmid:
20 5'-ctagagacaccagtgccctgctggacctgttcagcccctcg-3'; SEQ ID NO 61
5'-ggtcaccgaggggctgaacaggtccagcagggcactggtgtct-3'; SEQ ID NO 62
5'-gtgaccgtgcccgacatgagcctgcctgaccttgacagcag-3' and SEQ ID NO 63
5'-gatcctgctgtcaaggtcaggcaggctcatgtcgggcac-3- '. SEQ ID NO 64
[0233] Two additional copies of HSF activation domain were added to
Spe1/BamH1 digested PCG-Gal4-HSFX2 plasmid by the same method to
generate PCG-Gal4-HSFX4 plasmid. A fragment containing four copies
of HSF14 activation domain was excised from PCG-Gal4-HSFX4 by Xba1
and BamH1 digestion. The resulting fragment was cloned into Spe1
and BamH1 digested PCG-Gal4KX1 and PCG-Gal4KX3 to make
PCG-Gal4-K+HSFX4 or PCG-Gal4-K3+HSFX4 plasmids.
[0234] Reporter Cell Lines
[0235] Human 1080 cells were engineered by the stable introduction
of a secreted alkaline phosphatatse (SEAP) target gene construct.
The target gene construct contained a gene encoding SEAP operably
linked to a transcription control sequence containing five copies
of a DNA recognitions sequence for GAL4 and a minimal IL-2
promoter. The resultant cells may be used in experiments such as
described in Example 3 in which the cells are further transfected
with DNA constructs encoding various transcription factors
containing one or more DNA binding domains recognized by the target
gene construct.
[0236] Plasmid Constructions: pLH-G5-IL2-SEAP (as Previously
Described)
[0237] cell culture: HT1080 cells (ATCC CCL-121), derived from a
human fibrosarcoma, were grown in MEM supplemented with
non-essential amino acids and 10% Fetal Bovine Serum. Helper-free
retroviruses containing the 5.times.GAL4-IL2-SEAP reporter gene
were generated by transient co-transfection of 293T cells (Pear, W.
S., Nolan, G. P., Scott, M. L. & Baltimore, D. Production of
high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad Sci. USA 90, 8392-8396 (1993) with a Psi(-)
amphotropic packaging vector and the retroviral vector
pLH-5.times.GAL4-IL2-SEAP. To generate a clonal cell line
containing the SEAP reporter gene stably integrated, HT1080 cells
infected with retroviral stock were diluted and selected in the
presence of 300 mg/ml Hygromycin B. Individual clones were screened
for the presence of integrated reporter gene by transient
transfection of a plasmid encoding a chimeric transcription factor
containing a GAL4 DNA binding domain. The most responsive clone,
HT1080B, was used for subsequent analysis.
[0238] Analysis of Chimeric Transcription Factors
[0239] Transfection: HT1080 B cells were grown in MEM supplemented
with 10% Bovine Calf Serum. Approximately 2.times.105 cells/well in
a 12 well plate were transiently transfected by Lipofectamine
procedure as recommended by GIBCO, BRL. The DNA:Lipofectamine ratio
used correspond to 1:6. Cells in each well received indicated
amounts of effector plasmids and total DNA concentration in each
well was adjusted to 1.25 ug with PUC118 DNA. Following
transfection, 1 ml fresh media was added to each well. After 24
hrs, 100 ul of the media was assayed for SEAP activity as
described.
[0240] Representative results:
21 number of transcription activation activation chimeric
transcription factor domains (IL 2 promoter) GAL4-p65(361-550) 1 to
6 ++++ GAL4-p65(450-550) 1 to 6 +++ GAL4-p65(361-450) 1 to 6 --
GAL4-K13 (SRDFADMDFDALL*, derived from p65) 1 to 6 +++ GAL4-Oct2 Q
domain (aa95-160) 1 to 6 -- GAL4-Oct2 P domain (aa438-479) 1 to 6
-- GAL4-HSF (aa 409-444) 1 to 4 +++ GAL4-HSF14 (DFDSSLASIQELLS)** 1
to 4 ++ GAL4-EWS11 (SRSYGQQGSGS)*** 1 to 8 -- GAL4-V8.times.2
(DFDLDMLGDFDLDMLGSR)***- * 1 to 12 ++ GAL4-D (VP16 aa 459-490) 1 to
6 +++ GAL4-VP16 (VP16 aa 411-490) 1 to 4 ++ * SEQ ID NO 65 ** SEQ
ID NO 66 *** SEQ ID NO 67 **** SEQ ID NO 68
* * * * *