U.S. patent application number 08/469583 was filed with the patent office on 2003-07-31 for multimeric forms of human rhinovirus receptor protein.
Invention is credited to GREVE, JEFFREY M., MCCLELLAND, ALAN.
Application Number | 20030143236 08/469583 |
Document ID | / |
Family ID | 27415713 |
Filed Date | 2003-07-31 |
United States Patent
Application |
20030143236 |
Kind Code |
A1 |
GREVE, JEFFREY M. ; et
al. |
July 31, 2003 |
MULTIMERIC FORMS OF HUMAN RHINOVIRUS RECEPTOR PROTEIN
Abstract
The present invention relates to novel forms and configurations
of intercellular adhesion molecule (ICAM) including multimeric
configurations that effectively bind to human rhinovirus and can
effectively reduce HRV infectivity. When in a multimeric
configuration, preferably as dimers, these proteins display
enhanced binding of HRV and are able to reduce HRV infectivity as
well as the infectivity of other viruses known to bind to the
"major" group human rhinovirus receptor (HRR). The multimerized
proteins may also be used to block tICAM interaction with
lymphocyte function-associated antigen-1 (LFA-1).
Inventors: |
GREVE, JEFFREY M.;
(WOODBRIDGE, CT) ; MCCLELLAND, ALAN;
(GAITHERSBURG, MD) |
Correspondence
Address: |
PAMELA A SIMONTON
DIRECTOR PATENTS AND LICENSING
BAYER CORPORATION
400 MORGAN LANE
WEST HAVEN
CT
06516
|
Family ID: |
27415713 |
Appl. No.: |
08/469583 |
Filed: |
June 5, 1995 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08469583 |
Jun 5, 1995 |
|
|
|
08227496 |
Apr 14, 1994 |
|
|
|
6130202 |
|
|
|
|
08227496 |
Apr 14, 1994 |
|
|
|
07903069 |
Jun 22, 1992 |
|
|
|
07903069 |
Jun 22, 1992 |
|
|
|
07704984 |
May 24, 1991 |
|
|
|
07704984 |
May 24, 1991 |
|
|
|
07556238 |
Jul 20, 1990 |
|
|
|
Current U.S.
Class: |
424/185.1 ;
424/193.1; 530/395; 530/402; 530/403 |
Current CPC
Class: |
A61K 38/1774
20130101 |
Class at
Publication: |
424/185.1 ;
424/193.1; 530/395; 530/402; 530/403 |
International
Class: |
A61K 039/395; A61K
039/385; A61K 039/00; C07K 017/00; C07K 014/00; C07K 016/00; C07K
001/00; C08H 001/00 |
Claims
What is claimed is:
1. Multimeric ICAM.
2. The multimeric ICAM of claim 1 wherein said ICAM is
non-transmembrane ICAM.
3. The multimeric ICAM of claim 2 wherein said non-transmembrane
ICAM is substantially without the carboxyl intracellular domain and
without the hydrophobic membrane domain.
4. The multimeric ICAM according to claim 2 wherein said
non-transmembrane ICAM is a member selected from the group
consisting of tICAM(453), tICAM(185), tICAM(88), tICAM(283), and
tICAMs comprising one or more sequences selected from
tICAM(89-185), tICAM186-283, tICAM(284-385), tICAM(386-453),
tICAM(75-77), tICAM(70-72), tICAM(64-66), tICAM(40-43),
tICAM(36-38), tICAM(30-33), and tICAM(26-29).
5. The multimeric ICAM of claim 1 wherein said ICAM is multimerized
by adsorption to a support.
6. The multimeric ICAM of claim 5 wherein said support is an inert
polymer and is a member selected from the group consisting of
nitrocellulose, PVDF, DEAE, lipid polymer, and amino dextran.
7. The multimeric ICAM of claim 1 wherein said multimeric ICAM is
multimerized by coupling to a member.
8. The multimeric ICAM of claim 7 wherein said ICAM is modified
with at least one reactive amino acid to provide at least one site
to facilitate coupling.
9. The multimeric ICAM of claim 8 wherein said reactive amino acid
is a member selected from the group consisting of lysine and
cysteine.
10. The multimeric ICAM of claim 7 wherein said member is a member
selected from the group consisting of an antibody and a protein
carrier.
11. The multimeric ICAM of claim 10 wherein said antibody is
anti-ICAM antibody CL 203.
12. The multimeric ICAM of claim 10 wherein said protein carrier is
a member selected from the group consisting of albumin and
proteoglycans.
13. The multimeric ICAM of claim 1 wherein said ICAM is modified at
either terminus to comprise a lipid capable of promoting formation
of oligomer micelles.
14. The multimeric ICAM of claim 1 comprising two or more ICAMs,
which may be the same or different, linked to each other.
15. The multimeric ICAM of claim 14 wherein said ICAMs are directly
linked to each other without a linker.
16. The multimeric ICAM of claim 15 wherein said ICAMs are linked
to each other via at least one disulfide bridge.
17. The multimeric ICAM of claim 16 wherein said ICAMs ate
crosslinked via a cysteine disulfide bridge at position 307 on each
ICAM.
18. The multimeric ICAM of claim 16 wherein said ICAMs are
crosslinked via a cysteine disulfide bridge at position 309 on each
ICAM.
19. The multimeric ICAM of claim 14 wherein said ICAMs are
indirectly linked via a cross-linking agent.
20. The multimeric ICAM of claim 19 wherein said cross-linking
agent is selected from the group consisting of heterobifunctional
and homobifunctional cross-linking reagents.
21. The multimeric ICAM of claim 20 wherein said cross-linking
reagent is a member selected from the group consisting of
bifunctional N-hydroxysuccinimide esters, imidoesters and
bis-maleimido-hexanes.
22. The multimeric ICAM of claim 1 wherein said ICAM is a member
selected from the group consisting of fully glycosylated ICAM,
partially glycosylated ICAM, or non-glycosylated ICAM.
23. In a method for enhancing the binding of ICAM to a ligand, the
improvement comprising the steps of: presenting said ICAM in a
multimeric configuration.
24. The method according to claim 23 wherein said ICAM is
tICAM.
25. The method according to claim 24 wherein said ICAM is a member
selected from the group consisting of tICAM(453), tICAM(185),
tICAM(88), tICAM(283), and tICAMs comprising one or more sequences
selected from tICAM(89-185), tICAM186-283, tICAM(284-385),
tICAM(386-453), tICAM(75-77), tICAM(70-72), tICAM(64-66),
tICAM(40-43), tICAM(6-38), tICAM(30-33), and tICAM(26-29).
26. The method according to claim 23 wherein said ICAM is modified
with at least one reactive amino acid to provide at least one site
to facilitate coupling.
27. The method according to claim 26 wherein said reactive amino
acid is selected from the group consisting of lysine and
cysteine.
28. The method according to claim 23 wherein said ICAM is modified
at either terminus to comprise a lipid capable of promoting
formation of oligomer micelles.
29. The method according to claim 23 wherein said multimeric
configuration comprises a first ICAM cross-linked to a second
ICAM.
30. The method according to claim 29 wherein said first and second
ICAM are each muteinized to contain a cysteine residue at position
307, and said first and second ICAM are cross-linked via a
disulfide bridge between said cysteines at position 307.
31. The method according to claim 29 wherein said first and second
ICAM are each muteinized to contain a cysteine residue at position
309, and said first and second ICAM are cross-linked via a
disulfide bridge between said cysteines at position 309.
32. The method according to claim 23 wherein said multimeric
configuration comprises ICAM adsorbed to a support.
33. The method according to claim 32 wherein said support comprises
a member selected from the group consisting of high molecular
weight and substantially inert polymers.
34. The method according to claim 33 wherein said polymer is an
inert polymer and is a member selected from the group consisting of
nitrocellulose, PVDF, DEAE, lipid polymers, and amino dextran.
35. The method according to claim 33 wherein said multimeric ICAM
is multimerized by coupling to a member.
36. The method according to claim 35 wherein said member is a
member selected from the group consisting of an antibody and a
protein carrier.
37. The method according to claim 29 wherein said cross-linking
reagent is a member selected from the group consisting of
heterobifunctional and homobifunctional cross-linking reagents.
38. The method according to claim 37 wherein said protein carrier
is a member selected from the group consisting of albumin and
proteoglycans.
39. The method according to claim 36 wherein said antibody is
anti-ICAM antibody CL 203.
40. The method according to claim 23, wherein said ligand is a
member selected from the group consisting of human rhinovirus,
major group receptor virus, lymphocyte-associated antigen-1 (LFA-1)
and Plasmodium falciparum.
41. A pharmaceutical composition comprising a pharmaceutically
acceptable solvent, diluent, adjuvant or a carrier, and, as the
active ingredient, an effective amount of a polypeptide according
to claim 1.
42. A method for inducing irreversible uncoating of human
rhinovirus, said method comprising contacting said human rhinovirus
with ICAM-1 or a tICAM fragment thereof.
43. A method of irreversibly inhibiting infectivity of a mammalian
cell by a human rhinovirus, said method comprising contacting said
human rhinovirus with ICAM-1 or a tICAM fragment thereof under
conditions which allow the ICAM-1 or tICAM to bind to said
rhinovirus; thereby stimulating irreversible uncoating of said
rhinovirus.
Description
BACKGROUND OF THE INVENTION
[0001] This application is a continuation-in-part of copending
application U.S. Ser. No. 07/704,984 (filed May 24, 1991), which in
turn is a continuation-in-part of copending application U.S. Ser.
No. 07/556,238 (filed Jul. 20, 1990).
[0002] The present invention relates to novel forms and multimeric
configurations of intercellular adhesion molecule (ICAM), including
both full-length and truncated forms of these proteins, that
effectively bind to human rhinovirus and can effectively reduce HRV
infectivity, and to methods of making and using same.
[0003] Full-length ICAM, also known as human rhinovirus receptor
(HRR), is termed transmembrane ICAM (tmICAM-1); non-transmembrane
ICAM forms, also known as truncated ICAM (tICAM), are less than
full length. When in a multimeric configuration, preferably as
dimers, these proteins display enhanced binding of human rhinovirus
(HRV) and are able to reduce HRV infectivity. In addition, these
multimerized proteins may also be used to reduce infectivity of
other viruses that are known to bind to the `major` group human
rhinovirus receptor (HRR), such as Coxsackie A virus, and may also
be used to block transmembrane intercellular adhesion molecule
(tmICAM) interaction with lymphocyte function-associated antigen-1
(LFA-1), which is critical to many cell adhesion processes involved
in the immunological response. Lastly, these multimerized proteins
may be used to study the ICAM-1/HRV interaction especially with
respect to designing other drugs directed at affecting this
interaction.
[0004] Human rhinoviruses are the major causative agent of the
common cold. They belong to the picornavirus family and can be
classified based on the host cell receptor to which they bind.
Tomassini, et al., J. Virol., 58: 290 (1986) reported the isolation
of a receptor protein involved in the cell attachment of human
rhinovirus. Approximately 90% of the more than 115 serotypes of
rhinoviruses, as well as several types of Coxsackie A virus, bind
to a single common receptor termed the "major" human rhinovirus
receptor (HRR); the remaining 10% bind to one or more other cell
receptors.
[0005] Recently, Greve, J. et al., Cell, 56:839 (1989), co-authored
by the co-inventors herein, identified the major HRR as a
glycoprotein with an apparent molecular mass of 95,000 daltons and
having an amino acid sequence essentially identical to that deduced
from the nucleotide sequence of a previously described cell surface
protein named intercellular adhesion molecule (ICAM-1) [see FIG. 1;
Simmons, D. et al., Nature, 331:624 (1988); Staunton, et al., Cell,
52:925-933 (1988)]. Subsequently, Staunton, D. E., et al., Cell,
56:849 (1989), confirmed that ICAM-1 is the major surface receptor
for HRV. See also, Staunton, et al., Cell, 61:243-254 (1990).
[0006] ICAM-1 is an integral membrane protein 505 amino acids long
and has: i) five immunoglobulin-like extracellular domains at the
amino-terminal end (amino acid residues 1-453), ii) a hydrophobic
transmembrane domain (454-477), and iii) a short cytoplasmic domain
at the carboxy-terminal end (478-505). See FIG. 2. ICAM-1 is a
member of the immunoglobulin supergene family and functions as a
ligand for the leukocyte molecule, lymphocyte function associated
molecule-1 (LFA-1), a member of the integrin family. Heterotypic
binding of LFA-1 to ICAM-1 mediates cellular adhesion of diverse
cell types and is important in a broad range of immune
interactions; induction of ICAM-1 expression by cytokines during
the inflammatory response may regulate leukocyte localization to
inflammatory sites. The primary structure of ICAM-1 has been found
to be homologous to two cellular adhesion molecules, i.e., neural
cell adhesion molecule (NCAM) and myelin-associated glycoprotein
(MAG).
[0007] Several approaches to decreasing infectivity of viruses in
general, and of rhinovirus in particular, have been pursued
including: i) developing antibody to the cell surface receptor for
use in blocking viral binding to the cell, ii) using interferon to
promote an anti-viral state in host cells; iii) developing various
agents to inhibit viral replication; iv) developing antibodies to
viral capsid proteins/peptides; and v) blocking viral infection
with isolated cell surface receptor protein that specifically
blocks the viral binding domain of the cell surface receptor.
[0008] Using this last approach, Greve, et al., Cell, 56:879
(1989), supra, reported that purified tmICAM-1 could bind to
rhinovirus HRV3 in vitro. Unpublished results with HRV2, HRV3, and
HRV14 demonstrate a positive correlation between the ability to
bind to rhinovirus and the ability to neutralize rhinovirus
particularly if the binding studies are carried out under
conditions where ICAM-1 is presented in a particular form and
configuration as discussed further, infra. Results (unpublished)
using HRV14 and HRV2 demonstrate a positive correlation between the
receptor class of the virus and the ability to bind to tmICAM-1 in
vitro. That is, ICAM-1, being the major receptor, can bind to HRV3,
HRV14, and other "major" receptor serotypes and neutralize them,
while it does not bind or neutralize HRV2, a "minor" receptor
serotype. Further studies (unpublished), using purified tmICAM-1,
demonstrate that it effectively inhibits rhinovirus infectivity in
a plaque-reduction assay when the rhinovirus is pretreated with
tmICAM-1 (50% reduction of titer at 10 nM receptor and one log
reduction of titer at 100 nM receptor protein). These data were
consistent with the affinity of rhinovirus for ICAM-1 of Hela
cells, which had an apparent dissociation constant of 10 nM, and
indicated a direct relationship between the ability of the receptor
to bind to the virus and to neutralize the virus.
[0009] Because large-scale production of tmICAM-1 is not presently
economically feasible, and because maintenance of tmICAM-1 in an
active form requires the use of detergents, alternate means of
producing a receptor protein for use as a rhinovirus inhibitor are
desirable. Forms of the tmICAM-1 cDNA gene have been developed (as
well as cell lines that produce the expression products; U.S. Ser.
No. 07/390,662) that have been genetically altered to produce
truncated ICAM-1 molecules. See FIG. 2. These truncated forms of
ICAM-1 (tICAM(453) and tICAM(185)) lack the transmembrane region
and are secreted into the cell culture medium. They bind to
rhinovirus in the assay described in Greve, et al., Cell, 56:879
(1989), supra, although at substantially reduced levels relative to
tmICAM-1 . Thus, their effectiveness as inhibitors of rhinoviral
infectivity appeared to be less than that of tmICAM-1 . See
generally co-pending applications U.S. Ser. Nos. 07/239,571;
07/262,428; 07/678,909; 07/631,313; 07/301,192; 07/449,356;
07/798,267; 07/556,238; 07/704,996; and 07/704,984.
[0010] U.S. Ser. No. 07/239,571 filed Sep. 1, 1988, and its CIP
applications U.S. Ser. Nos. 07/262,428, 07/390,662 (abandoned in
favor of continuation U.S. Ser. Nos. 07/678,909), 07/631,313, and
07/704,996 are directed to the use of transmembrane rhinovirus
receptor as an inhibitor of rhinovirus infectivity using non-ionic
detergent to maintain the transmembrane protein in solution, and
directed to truncated intercellular adhesion molecules (tICAM)
comprising one or more of the extracellular domains I, II, III, IV,
and V of tmICAM, which truncated forms do not require the presence
of non-ionic detergent for solubilization (see FIG. 2).
[0011] U.S. Ser. No. 07/130,378 filed Dec. 8, 1987 (abandoned in
favor of continuation application U.S. Ser. No. 07/798,267), and
CIP application U.S. Ser. No. 07/262,570 (now abandoned) are
directed to transfected non-human mammalian cell lines which
express the major rhinovirus receptor (HRR) and to the
identification of HRR as intercellular adhesion molecule.
[0012] U.S. Ser. No. 07/301,192, filed Jan. 24, 1989, and its CIP
application U.S. Ser. No. 07/449,356 are directed to a
naturally-occurring soluble ICAM (sICAM) related to but distinct
from tmICAM in that this sICAM lacks the amino acids spanning the
transmembrane region and the cytoplasmic region; in addition this
sICAM has a novel sequence of 11 amino acids at the C-terminus.
[0013] Subsequently, Marlin, S.D., et al., Nature, 344:70 (1990),
reported the construction and purification of a truncated soluble
form of the normally membrane-bound ICAM-1 molecule which they
termed sICAM-1. It has both the transmembrane domain and the
cytoplasmic domain of the protein deleted and differs from the
wild-type amino acid sequence by a single conservative substitution
at its carboxyl end. It is composed of residues 1-452 of ICAM-1
plus a novel phenylalanine residue at the C-terminus. These workers
demonstrated that sICAM-1 was required at levels >50 .mu.g/ml to
prevent the binding of HRV14 virus to cells. However, they also
found that sICAM-1 at 1 .mu.g/ml (18 nM), when continually present
in the culture medium, was able to inhibit by 50% the progression
of an infection by HRV54. The inhibitory activity was correlated
with the receptor class of the virus, in that Coxsackie A13 but not
poliovirus or HRV2 was inhibited; infectivity data for HRV14 was
not reported, however. Thus, they did not demonstrate a direct
correlation between binding and inhibition of infectivity. Further,
as discussed in greater detail, infra, attempts to reproduce the
results obtained by Marlin, et al. have not been successful.
[0014] To date, no one has been able to demonstrate an agent that
binds to and effectively reduces infectivity of human rhinovirus
(by blocking viral infection with isolated cell surface receptor
protein) as effectively as tmICAM-1; accordingly there continues to
exist a need in the art for a form of ICAM-1 that can effectively
bind to human rhinovirus and can effectively reduce HRV
infectivity.
BRIEF SUMMARY OF THE INVENTION
[0015] Provided by the invention are multimeric configurations of
transmembrane ICAM (tmICAM-1) and multimeric configurations of
non-transmembrane ICAMs (tICAMs), having improved rhinovirus
binding and inhibition activity.
[0016] As noted, supra, tmICAM-1 isolated from mammalian cells has
the capacity to neutralize human rhinoviruses belonging to the
major receptor group, but only if maintained in solution with
detergent. Certain soluble fragments of ICAM-1 have been found to
have a reduced capacity for binding virus and do not reduce
infectivity as effectively as tmICAM-1. To date, no one has been
able to ascertain the reason for this reduced capacity.
[0017] It has been proposed by others that the rhinovirus receptor
exists on cells in a pentameric form [Tomassini, J., and Colonno,
R., J. Virol., 58:290-295 (1986)]. However, quantitation
(unpublished results of the co-inventors herein) of the rhinovirus
and anti-ICAM-1 monoclonal antibody (Mab) binding to HeLa cells has
revealed a maximum of 30,000 virions bound per cell (determined by
the binding of [.sup.35S]methionine-labeled HRV) and 50,000-60,000
ICAM-1 molecules per cell (determined by the binding of
radio-labeled Mab to ICAM-1). These results prompted further
studies to examine the possibility that rather than five, only
between one and two ICAM-1 molecules on the surface of cells are
bound per HRV particle bound to the cell.
[0018] Genetically engineered forms of truncated ICAM-1 that lack
the C-terminal transmembrane domain are secreted into the culture
medium of mammalian cells transfected with the recombinant gene.
The purification of such secreted ICAM molecules from spent culture
medium of cells stably transfected with the genes therefor is
described herein. In a solution-HRV binding assay and in an HRV
neutralization assay, it was found that the monomeric forms tend to
have substantially reduced avidity for HRV relative to tmICAM-1.
However, it has now been discovered that when such tICAMs are
presented in multimeric form and then incubated with HRV, the
virus-binding activity of the multimeric tICAMs becomes comparable
to that of tmICAM-1. This binding of multimeric tICAMs to HRV has
the same properties as the binding of HRV to ICAM-1 on HeLa cells:
it is inhibited by anti-ICAM-1 Mabs, it is specific for
rhinoviruses of the major receptor group, and has the same
temperature dependence as the binding of rhinovirus to cells (i.e.,
binds well at 37.degree. C. and undetectably at 4.degree. C.). It
is postulated that tmICAM exists in nature in a multimeric,
possibly dimeric form, and that such constructs more closely
resemble the native configuration, with its attendant high avidity
for the human rhinovirus. Such dimerization may conveniently be
achieved in vitro by, e.g., crosslinking two ICAM monomers by
chemical means or by crosslinking with appropriate antibodies, or
by binding monomers to appropriate inert substrates.
Multimerization can also be achieved in vivo by modification of the
gene sequence coding for the select ICAM to provide appropriate
binding sites in the corresponding peptide sequence. For example,
muteins can be engineered which contain appropriate cysteine
residues to allow in vivo multimerization via interchain disulfide
bonding. Alternatively, a DNA sequence coding for an ICAM may be
fused with a DNA sequence coding for an appropriate immunoglobulin
or fragment thereof, such that the fusion gene product possesses at
least one site suitable for interchain bonding. The resulting
fusion peptide monomer can then be expressed by the cell in
multimeric form. Under certain circumstances, the benefits of
multimerization may also be achieved by construction of ICAM
muteins containing multiple rhinovirus binding sites.
[0019] Also provided by the invention are methods for enhancing
binding of ICAM and functional derivatives thereof to a ligand,
i.e., human rhinovirus, and "major" group receptor viruses,
lymphocyte function-associated antigen-1 (LFA-1), Plasmodium
falciparum (malaria) and the like, wherein the ICAM is presented in
a multimeric configuration to the ligand to facilitate binding of
the ICAM to the ligand.
[0020] The invention further comprises a method for inducing
irreversible uncoating of human rhinovirus, said method comprising
contacting said human rhinovirus with ICAM-1 or a fragment
thereof.
[0021] This invention also provides a novel method of irreversibly
inhibiting infectivity of a mammalian cell by a human rhinovirus,
said method comprising contacting said human rhinovirus with ICAM-1
or a fragment thereof under conditions which allow the ICAM-1 or
fragment thereof to bind to said rhinovirus, thereby stimulating
irreversible uncoating of said rhinovirus.
[0022] Also provided by the invention are novel pharmaceutical
compositions comprising a pharmaceutically acceptable solvent.
diluent, adjuvant or carrier, and as the active ingredient, an
effective amount of a polypeptide characterized by having human
rhinovirus binding activity and reduction of virus infectivity.
Dimeric configurations of ICAM and fragments thereof are presently
preferred.
[0023] Other aspects and advantages of the present invention will
be apparent upon consideration of the following detailed
description thereof which includes numerous illustrative examples
of the practice of the invention.
DESCRIPTION OF THE FIGURES
[0024] FIG. 1 shows the protein sequences of tmICAM-1.
[0025] FIG. 2 is a schematic rendition of a) tmICAM-1, b)
tICAM(453), c) tICAM(283), d) tICAM(185), and e) tICAM(88).
[0026] FIG. 3 is a schematic diagram of the constructs of Example
12: a) the heavy chain of human IgG; b) the fragment of the heavy
chain used in making the immunoadhesin; c) the fragment of ICAM; d)
the completed IgG/ICAM immunoadhesin.
[0027] FIGS. 4 shows crosslinking of tICAM(453) into diners by
water-soluble carbodiimide/N-hydroxysuccinimide. tICAM(453) at the
indicated concentrations was crosslinked with 100 mM EDC/5 mM NHS
at pH 7.5 for 18 hr at 20 C. The samples were analyzed by SDS-PAGE
followed by western blotting with anti-ICAM-1 antisera. a) Western
blot of crosslinked ICAM(453) showing monomer and timer species; b)
dependence of crosslinking upon tICAM(453) concentration; c) the
crosslinking of tICAM(453) is not inhibited by an excess of
third-party proteins.
[0028] FIG. 5 is a schematic showing construction of
tICAM(1-451)/LFA-3(210-237) chimera: a) tmICAM-1; b) tICAM(1-451);
c) LFA-3; d) LFA-3(210-237); e) tICAM(1-451)/ LFA-3(210-237)
chimera; structure of tmICAM-1 shown for comparison.
[0029] FIG. 6 shows uncoating of HRV by tICAM(453) over 24 hours.
a) shift from native 148S form to uncoated 42S form by tICAM(453);
b) shift from native 148S to uncoated 42S form by tICAM(185);
c)SDS-PAGE of [.sup.35S]-methionine-labelled HRV-3 showing loss of
VP4; d) dot-blot hybridization of RNA recovered from HRV3 species
with an oligonucleotide probe for HRV. 50 ng of purified HRV3 RNA
and RNA extracted from 8 ng of HRV3 species were applied to the
blot.
[0030] FIG. 7 shows the predicted alignment of ICAM-1 amino acid
sequence in domains IV and V onto the immunoglobulin fold motif.
Arrows indicate beta strands, pointing from the N- to the
C-terminus; italicized letters in bold indicate the beta strands,
and numbered residues indicate cysteine residues with disulfide
bonds indicated by lines. The dotted line divides the "B" and "F"
faces of the domains. Residues indicated with an * are among those
replaced with cysteine residues.
DETAILED DESCRIPTION OF THE INVENTION
[0031] As used herein, the following abbreviations and terms
include, but are not necessarily limited to, the following
definitions.
1 Abbreviation Definition ICAM Intercellular adhesion molecule -
may be used to denote both full length (trans- membrane) and
truncated (non-trans- membrane) forms of the protein. ICAM-1
Intercellular adhesion molecule-1, also known as tmICAM-1 and HRR;
denoting the full-length transmembrane protein tmICAM-1
Transmembrane intercellular adhesion molecule-1, also known as
ICAM-1 and HRR; requires, e.g., detergent conditions to be
solubilized HRR Human rhinovirus receptor, also known as ICAM-1 and
tmICAM-1 sICAM-1 A naturally-occurring soluble truncated form of
ICAM-1 having both the hydrophobic transmembrane domain and the
carboxy-terminal cytoplasmic domain of ICAM-1 deleted; consists of
amino acids 1-442 of ICAM-1 plus 11 novel amino acids;
distinguishable from Staunton, et al. tICAM453 which consists of
amino acids 1-453 with the terminal tyrosine replaced with
phenylalanine. tICAMs Truncated intercellular adhesion molecules;
soluble non-transmembrane ICAMs lacking the hydrophobic trans-
membrane domain and the carboxyl- terminal cytoplasmic domain of
ICAM-1. tICAM(1-453) Truncated form of ICAM comprising the
tICAM-453 entire extracellular amino-terminal tICAM(453) domain of
tmICAM (domains I-V, amino acid residues 1-453) tICAM(1-283)
Truncated form of ICAM comprising domains tICAM-283 I, II, and III
(amino acid residues 1- tICAM(283) 283 tICAM(1-185) Truncated form
of ICAM comprising domains tICAM-185 I and II (amino acid residues
1-185) tICAM(185) tICAM(1-88) Truncated form of ICAM comprising
domain tICAM-88 I (amino acid residues 1-88) tICAM(88)
tICAM(89-185) Truncated form of ICAM comprising domain II (amino
acid residues 89-185) tICAM(186-283) Truncated form of ICAM
comprising domain III (amino acid residues 186-283) tICAM(284-385)
Truncated form of ICAM comprising domain IV (amino acid residues
284-385) tICAM(386-453) Truncated form of ICAM comprising domain V
(amino acid residues 386-453) tICAM(75-77) Truncated form of ICAM
comprising amino acid residues 75-77) tICAM(70-72) Truncated form
of ICAM comprising amino acid residues 70-72 tICAM(64-66) Truncated
form of ICAM comprising amino acid residues 64-66 tICAM(40-43)
Truncated form of ICAM comprising amino acid residues 40-43
tICAM(36-38) Truncated form of ICAM comprising amino acid residues
36-38) tICAM(30-33) Truncated form of ICAM comprising amino acid
residues 30-33) tICAM(26-29) Truncated form of ICAM comprising
amino acid residues 26-29
[0032] The foregoing terms defining specific fragments are intended
to include functional derivatives and analogs thereof. Persons
skilled in the art will understand that the given boundaries may
vary by a few amino acid residues without affecting the function of
the given fragment.
[0033] "Multimerization" and "multimeric" include, but are not
limited to dimerization and dimeric, and include any multimeric
configuration of the ICAM-1 molecule, or fragment thereof, that is
effective in reducing viral binding and infectivity.
[0034] "Transmembrane" generally means forms of the ICAM-1 protein
molecule which possess a hydrophobic membrane-spanning sequence and
which are membrane-bound.
[0035] "Non-transmembrane" generally means soluble forms of the
ICAM-1 protein including truncated forms of the protein that,
rather than being membrane-bound, are secreted into the cell
culture medium as soluble proteins, as well as transmembrane forms
that have been solubilized from cell membranes by lysing cells in
non-ionic detergent.
[0036] "Truncated" generally includes any protein form that is less
than the full length transmembrane form of ICAM.
[0037] "Immunoadhesin" means a construct comprising all or a part
of a protein or peptide fused to an immunoglobulin fragment,
preferably a fragment comprising at least one constant region of an
immunoglobulin heavy chain.
[0038] "Form" is generally used herein to distinguish among full
length and partial length ICAM forms; whereas "configuration" is
generally used to distinguish among monomeric, dimeric, and
multimeric configurations of possible ICAM forms.
[0039] All forms and configurations of the ICAM-1 molecule, whether
full length or a fragment thereof, including muteins and
immunoadhesins, whether monomeric or multimeric, may be fully or
partially glycosylated, or completely unglycosylated, as long as
the molecule remains effective in reducing viral binding and
infectivity.
[0040] "Ligand" is generally used herein to include anything
capable of binding to at least one of any of the forms and
configurations of ICAM and includes, but is not limited to, human
rhinovirus, other viruses that bind to the "major" group human
rhinovirus receptor, lymphocyte function-associated antigen-1, and
Plasmodium falciparum (malaria).
[0041] "Human rhinovirus" generally includes all human serotypes of
human rhinovirus as catalogued in Hamparian, V., et al., Virol.,
159:191-192 (1987).
[0042] The sequence of amino acid residues in a peptide is
designated in accordance with standard nomenclature such as that
given in Lehninger's Biochemistry (Worth Publishers, New York,
1970).
[0043] Fall-length ICAM-1, also known as human rhinovirus receptor
(HRR), is termed transmembrane ICAM(tmICAM-1). Non-transmembrane
ICAMs are also known as truncated ICAMs, i.e, ICAMs substantially
without the carboxyl intracellular domain and without the
hydrophobic membrane domain of tmICAM, which are soluble without
the addition of detergent. tICAMs may conveniently comprise one or
more domains selected substantially from domains I, II, III, IV,
and V of the extracellular region of tmICAM. tICAMs may also
comprise functional analogs of tmICAM or fragments thereof, and may
also comprise one or more fragments of tmICAM spliced together,
with or without intervening non-tmICAM lining sequences, and not
necessarily in the same order found in native tmICAM. Presently
preferred tICAMs include but are not limited to forms tICAM(453),
tICAM(185), tICAM(88), tICAM(283), and tICAMs comprising one or
more sequences selected from tICAM(89-185), tICAM(186-283),
tICAM(284-385), tICAM(386-453), tICAM(75-77), tICAM(70-72),
tICAM(64-66), tICAM(40-43), tICAM(36-38), tICAM(30-33), and
tICAM(26-29). See U.S. Ser. Nos. 07/631,313, 07/678,909, and
07/704,996. Non-transmembrane forms of ICAM can include functional
derivatives of ICAM, mutein forms of tICAM to facilitate coupling,
and tICAM immunoadhesins. When the tICAMs are in a multimeric
configuration, preferably as dimers, they display enhanced binding
of human rhinovirus and are able to reduce viral infectivity.
[0044] Multimerization can be achieved by crosslinking a first ICAM
to a second ICAM, using suitable crosslinking agents, e.g.
heterobifunctional and homobifunctional cross-linking reagents such
as bifunctional N-hydroxysuccinimide esters, imidoesters, or
bis-maleimidohexanes.
[0045] The different forms of ICAM, transmembrane and
non-transmembrane, can be multimerized by adsorption to a support.
This support can be made of materials such as nitrocellulose, PVDF,
DEAE, lipid polymers, as well as amino dextran, or a variety of
inert polymers that can adsorb or can be coupled to ICAM, either
with or without a spacer or linker.
[0046] Multimeric ICAM can also be multimerized by coupling the
ICAM to a member, e.g., an antibody that does not interfere with
HRV binding, or fragments thereof; or to a protein carrier. An
example of an antibody includes anti-ICAM antibody CL 203 or a
fragment thereof; suitable protein carriers include albumin and
proteoglycans.
[0047] To facilitate coupling, the ICAM can be modified with at
least one reactive amino acid residue such as lysine, cysteine, or
other amino acid residue(s) to provide a site(s) to facilitate
coupling. These types of modified ICAM are referred to as muteins.
The nucleotide sequence for the ICAM of the method can be contained
in a vector, such as a plasmid, and the vector can be introduced
into a host cell, for example eukaryotic or prokaryotic cells. The
preferred eukaryotic cell is a mammalian cell, e.g. Chinese hamster
ovary cells or HEK293S cells; the preferred prokaryotic cell is E.
coli. In addition, the ICAM can be modified at either terminus to
comprise a lipid capable of promoting formation of oligomer
micelles. The ICAM comprising the multimeric ICAM can be either
fully glycosylated, partially glycosylated, or
non-glycosylated.
[0048] A preferred manner of making multimeric forms of ICAM-1 is
by engineering of cysteine residues into the tICAM sequence
(tICAM(453) is particularly preferred) in a position at or close to
the natural site of self-association on ICAM-1 monomers. Muteins
with cysteine residues placed at appropriate positions form
covalent bonds (disulfide bonds) that stabilize an interaction
which is noncovalent in vivo. Such muteins are assembled
intracellularly and are expressed as a disulfide-linked dimer;
alternatively, monomeric muteins may be crosslinked in vitro by
incubation at high protein concentration in mildly reducing
conditions to encourage disulfide exchange, or by crosslinking with
bifunctional chemical crosslinking reagents which react with free
sulfhydryl groups. Another advantage of such proteins is that any
novel amino acids engineered into ICAM-1 are hidden on the dimer
interface and would be less likely to be immunogenic.
[0049] In another preferred embodiment, ICAM can also be
multimerized by fusion with fragments of immunoglobulins to form
ICAM immunoadhesins. For example, an ICAM or fragment thereof can
be fused with a heavy or light chain immunoglobulin or fragment
thereof, in particula with the constant region of the heavy chain
of IgG, IgA, or IgM. Preferably, the constant region contains the
hinge region and one or more of CH2 and CH3, but does not contain
CH1. The variable region (Fab) of the immunoglobulin is thus
replaced by the ICAM or fragment thereof. Such constructs are
conveniently produced by construction and expression of a suitable
fusion gene in a suitable expression system [see, e.g., Bebbington,
C. R. and C. C. G. Hentschel, "The use of vectors based on gene
amplification for the expression of cloned genes in mammalian
cells," in DNA Cloning. Vol. III, D. Glover, ed.(1987)] and are
secreted in a dimerized configuration.
[0050] Also provided by the invention are methods for enhancing
binding of ICAM and functional derivatives thereof to a ligand,
i.e., human rhinovirus, and "major" group receptor viruses,
lymphocyte function-associated antigen-1 (LFA-1), Plasmodium
falciparum (malaria) and the like, wherein the ICAM is presented in
a multimeric configuration to the ligand to facilitate binding of
the ICAM to the ligand.
[0051] The invention further comprises a method for inducing
irreversible uncoating of human rhinovirus, said method comprising
contacting said human rhinovirus with ICAM-1 or a fragment thereof,
e.g. a tICAM as defined above.
[0052] This invention also provides a novel method of irreversibly
inhibiting infectivity of a mammalian cell by a human rhinovirus,
said method comprising contacting said human rhinovirus with ICAM-1
or a fragment thereof under conditions which allow the ICAM-1 or
fragment thereof (e.g. a tICAM as defined above) to bind to said
rhinovirus; thereby stimulating irreversible uncoating of said
rhinovirus.
[0053] Also provided by the invention are novel pharmaceutical
compositions comprising a pharmaceutically acceptable solvent,
diluent, adjuvant or carrier, and as the active ingredient, an
effective amount of a polypeptide characterized by having human
rhinovirus binding activity and reduction of virus infectivity.
Dimeric configurations of ICAM and fragments thereof are presently
preferred.
[0054] The following examples illustrate practice of the
invention.
[0055] Example 1 relates to growth, purification and assay of
rhinoviruses;
[0056] Example 2 relates to production and isolation of monoclonal
antibodies to ICAM-1;
[0057] Example 3 relates to construction of non-transmembrane
truncated forms of ICAM cDNA from full length ICAM-1 cDNA;
[0058] Example 4 relates to transfection of mammalian-cells and
expression of non-transmembrane truncated forms of ICAM cDNA;
[0059] Example 5 relates to isolation and purification of
non-transmembrane truncated forms of ICAM-1;
[0060] Example 6 relates to radioactive labeling of tmICAM-1,
tICAM(185), and tICAM(453) and demonstration of retained capacity
for binding to monoclonal antibodies;
[0061] Example 7 relates to human rhinovirus binding assays of
transmembrane and of non-transmembrane truncated forms of
ICAM-1;
[0062] Example 8 relates to CL203 IgG antibody-mediated
cross-linking of tICAM(453);
[0063] Example 9 relates to multimerization of trans-membrane and
of non-transmembrane truncated forms of ICAM-1;
[0064] Example 10 relates to infectivity-neutralization assay of
multimeric transmembrane and of multimeric non-transmembrane
truncated forms of ICAM-1; and
[0065] Example 11 relates to use of multimeric forms of
transmembrane and truncated forms of ICAM-1, as effective
inhibitors of ICAM/LFA-1 interaction.
[0066] Example 12 relates to construction of tICAM(185)/IgG and
tICAM(453)/IgG immunoadhesins.
[0067] Example 13 relates to rhinovirus binding and neutralization
by a tICAM/IgG immunoadhesins.
[0068] Example 14 relates to in vitro dimerization of ICAM-1.
[0069] Example 15 relates to a tICAM(1-451)/LFA-3(210-237)
chimera.
[0070] Example 16 relates to irreversible inactivation of HRV by
ICAM.
[0071] Example 17 relates to cysteine muteins.
EXAMPLE 1
Growth, Purification and Assay of Rhinoviruses
[0072] Rhinoviruses were grown, purified, and assayed essentially
as described in Abraham, G., et al., J. Virol., 51:340 (1984, and
Greve, et al., Cell, 56:839 (1989). The serotypes chosen for these
studies include HRV14, the standard in the field, and HRV3, which
has an approximately 10-fold higher affinity for ICAM than does
HRV14. HRV2, which binds to the "minor" receptor rather than the
"major" receptor, was used as a negative control.
[0073] Rhinoviruses HRV2, HRV3, and HRV14 were obtained from the
American Type Culture Collection, plaque purified, and isolated
from lysates of infected HeLa-53 cells. Purified rhinovirus was
prepared by polyethylene glycol precipitation and sucrose gradient
sedimentation. Viral purity was assessed by SDS-PAGE analysis of
capsid proteins and by electron microscopy. Infectivity was
quantitated by a limiting dilution infectivity assay scoring for
cytopathic effect, essentially as described by Minor, P. D.,
Growth, assay and purification of picornaviruses, in Virology:A
Practical Approach, B. W. J. Mahy, ed (Oxford:IRL Press), pp.
25-41.
EXAMPLE 2
Production and Isolation of Monoclonal Antibodies to ICAM-1
[0074] BALB/cByJ female mice were immunized by intraperitoneal
injection of 107 intact HeLa cells in 0.5 ml of phosphate-buffered
saline (PBS) three times at 3-week intervals. Two weeks later the
mice were bled and aliquots of serum were tested for protective
effects against HRV14 infection of HeLa cells. Positive mice were
boosted by a final injection of 10.sup.7 HeLa cells, and 3 days
later spleen cells were fused to P3X63-Ag8.653 myeloma cells
(Galfre, et al., Nature, 266:550-552 (1977)) to produce a total of
approximately 700 hybridoma-containing wells. Each well was tested
by incubating 3.times.10.sup.4 HeLa cells in 96-well plates with
100 .mu.l of supernatant for 1 hr at 37 C.; the cells were then
washed with PBS, and a sufficient amount of HRV14 was added to give
complete cytopathic effect in 24-36 hr. Wells that were positive
(protected from infection) were scored at 36 hr.
[0075] Cells were removed from wells which scored positive in the
first screen and cloned by limiting dilution in 96-well microtiter
plates. Supernatants from these wells were tested in the cell
protection assay and positive wells were again identified. Further
clonings were performed until all of the hybridoma containing wells
were positive indicating a clonal population had been obtained.
Four cloned cell lines, and their corresponding antibodies, were
obtained and were designated c78.1A, c78.2A, c78.4A, c78.5A, c92.1A
and c92.5A, respectively.
[0076] C92.1A was deposited on Nov. 19, 1987 with the American Type
Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 and
was designated HB 9594.
EXAMPLE 3
Construction of tICAM cDNAs From Full Length ICAM-1 cDNA
[0077] A. Preparation of ICAM-1 cDNA
[0078] Randomly-primed cDNA was synthesized from poly A+ RNA from
HE1 cells using an Amersham(TM) cDNA synthesis kit under conditions
recommended by the supplier. PCR amplification was performed using
100 ng of cDNA for 25 cycles using primers PCR 5.1:
(ggaattcATGGCTCCCAGCAGCCCCCG- GCCC) and PCR 3.1:
(ggaattcTCAGGGAGGCGTGGCTTGTGTGTT). Amplification cycles consisted
of 94 C. 1 min, 55 C. 2 min, and 72 C. 4 min. The product of the
PCR reaction was digested with EcoR1 and cloned with EcoR1 digested
phage vector lambdaGT10 (Stratagene(TM)). Recombinant phage clones
were screened by plaque hybridization using ICAM-1 specific
oligonucleotides GAGGTGTTCTCAAACAGCTCCAGCCCTTGGGGCCGCAGGTCCAGTTC
(ICAM1) and CGCTGGCAGGACAAAGGTCTGGAGCTGGTAGGGGGCCGAGGTGTTCT
(ICAM3).
[0079] A positive clone designated lambdaHRR4 was selected and
purified. The insert was removed by EcoR1 digestion and subcloned
into the EcoR1 site of Bluescript KS+. This clone was designated
pHRR2. The entire insert was sequenced and found to contain the
entire ICAM-1 coding sequence beginning with the initiator ATG
codon and ending with the TGA stop codon as specified by the PCR
ICAM-1 sequence (Simmons, et al., Nature, 331:624 (1988); Staunton,
et al., Cell, 52:925-933 (1988)) by a single substitution of
Ala-1462 for Gly. This same change was identified in several
independent clones and thus represents a polymorphism of the ICAM-1
gene.
[0080] B. Construction of tICAM(453) and tICAM(185)
[0081] Modified forms of the ICAM-1 cDNA were created by PCR
amplification reactions (Saiki, et al., Science, 230:1350-1354
(1985)) using the full length ICAM-1 cDNA clone pHRR-2 as template.
The plasmid DNA was digested with EcoR1 to excise the ICAM-1 insert
and treated with alkaline phosphatase to prevent re-circularization
of the vector in subsequent ligation steps. Ten ng of template DNA
was subjected to 10 cycles of PCR amplification using
oligonucleotide primers PCR5.5 and PCR3.3 for tICAM-453 and PCR5.5
and 3.10 for tICAM-185 under the following conditions:
2 Temperature (.degree. C.) Time (mins) 94 1 55 2 72 1.5 71 4
(final extension)
[0082] PCR5.5 has the sequence: GGAATTCAAGCTTCTCAGCCTCGCTATGG
CTCCCAGCAGCCCCCGGCCC which consists of EcoR1 and HindIII sites, 12
bp ICAM-1 5' untranslated sequence, and the first 24 bp encoding
the signal peptide.
[0083] PCR3.3 has the sequence: GGAATTCCTGCAGTCACTCATACCGGGGG
GAGAGCACATT which consists of EcoR1 and Pst1 sites, a stop codon,
and 24 bp complementary to the bases encoding the last 8
extracellular amino acids of ICAM-1 (residues 446-453).
[0084] PCR3.10 has the sequence: TTCTAGAGGATCCTCAAAAGGTCTGGAG
CTGGTAGGGGG which consists of Xba1 and BamH1 sites, a stop codon,
and 24 bp complementary to the bases encoding residues 178-185 of
ICAM-1.
[0085] The PCR reaction products were digested with EcoR1
(tICAM(453)) or EcoR1 and BamH1 (tICAM(185)) and cloned into the
polylinker site of Bluescript SK+ (Stratagene). Clones containing
the desired inserts were verified by restriction analysis and DNA
sequencing. The inserts were excised from Bluescript by digestion
with HindIII and XbaI and inserted into the expression vector CDM8
(Seed, Nature, 239:840 (1987) at the HindIII and XbaI sites. A
clone containing the tICAM(453) insert designated pHRR-8.2 and a
clone containing the tICAM(185) insert designated pHRR23-13 were
selected and subjected to extensive sequence analysis. This
verified the existence of the desired stop codons, and the
integrity of the selected regions of ICAM-1 coding sequence.
[0086] These plasmids were transfected into COS cells using the
DEAE-dextran techniques and the cells were cultured 72 hr. before
assay. Surface expression was monitored by FACS using indirect
immunofluorescence and a monoclonal antibody specific for ICAM-1 .
Transient expression in COS cells and immunoprecipitation of
metabolically labelled ([.sup.35S]cysteine) cell supernatants with
c78.4A Mab (monoclonal antibody) demonstrated the production of
soluble ICAM-1 fragments of 45 kd and 80 kd from pHRR23-13 and
pHRR8.2, respectively. The preparation of stable Chinese hamster
ovary cell transfectants is described below in Example 4.
[0087] C. Modified Non-glycosylated tICAM-1
[0088] A modified full length ICAM-1 was made by simultaneous
mutagenesis of Asn at positions 103, 118, 156 and 173 each to Gln.
This removes all four Asn-linked glycosylation sites from
extracellular domain II of the ICAM-1 molecule. The resultant
molecule, referred to as non-glycosylated transmembrane ICAM, was
expressed on the surface of COS cells and was able to bind
radio-labeled HRV3 at levels comparable to unmodified ICAM-1. This
result demonstrated that glycosylation of domain II (the first 185
amino acids) is not required for virus binding to ICAM-1 .
[0089] It is expected that non-transmembrane ICAM can be similarly
modified to yield modified non-glycosylated non-transmembrane
ICAM-1 molecules.
[0090] D. Construction of Genetically Engineered Forms of tICAM
Containing Reactive Residues Suitable for Cross-Linking to
[0091] Form Multimers
[0092] A molecule consisting of the 453 amino acid extracellular
domain of ICAM-1 with the addition of a novel lysine residue at the
C-terminus was constructed by PCR modification of the pHRR-2 cDNA
described in Example 3B. The primers used were PCR5.5 (Example 3B)
and PCR 3.19 which has the sequence:
TTCTAGAGGATCCTCCTTCTCATACCGGGGGGAGAGCACATT and consists of XbaI and
BamHI sites, a stop codon, a Lys codon, and 24 bases complementary
to the sequence encoding amino acid residues 446 to 453. Following
cloning into the CDM8 vector, production of tICAM having a Lys at
position 453 was confirmed by transient expression in COS cells.
Stable CHO cell lines were generated by co-transfection with
pSV2-DHFR as described in Example 4. The same strategy was used to
add a Lys residue to the C-terminus of tICAM(185) using PCR5.5 and
PCR3.20 which has the sequence:
TTCTAGAGGATCCTCACTTAAAGGTCTGGAGCTGGTAGGGGGC and consists of XbaI
and BamHI sites, a stop codon, a Lys codon, and 24 bases
complementary to the sequence encoding residues 178 to 185.
Transient COS cell expression confirmed the production of tICAM-185
and stable CHO cell lines were derived as described in Example
4.
[0093] Three modified forms of tICAM(452) that each contain an
additional Cys residue were constructed by site-directed
mutagenesis of the full-length ICAM-1 cDNA. In each construct a
stop codon was introduced by changing the Glu residue at position
453 from GAG to TAG. The C-terminus is thus Tyr-452. Residues
Asn-338, Thr-360, and Gln-387 were each separately mutated to Cys
using a second site directed mutagenesis. The presence of the
desired mutations were confirmed by DNA sequencing.
[0094] The residues selected for mutation to Cys were selected
based on a computer generated plot of surface probability which
predicts surface exposure of these regions. Also, Thr-360 is in
close proximity to Asn-358 which is a site of potential Asn-linked
glycosylation. Each of the three Cys mutants was expressed and
secreted into the medium of transfected COS cells. Examination of
the proteins under reducing and non-reducing conditions showed no
indication of the presence of dimers. It is anticipated that
cross-linking reagents reactive with sulfhydryl groups can be used
to cross-link the Cys-modified tICAM forms to obtain multimeric
forms.
EXAMPLE 4
A. Transfection of Cells and Expression of tICAM cDNA
[0095] A. Transfection of Eukaryotic Cells
[0096] Chinese hamster ovary (CHO) cells deficient in dihydrofolate
reductase (DHFR) were obtained from Cutter Labs (Berkeley, Calif.).
DHFR- cells cannot synthesize nucleosides and therefore requi e a
nucleoside-supplemented medium. The cells were co-transfected with
the plasmid pSV2-DHFR which contains the mouse dihydrofolate
reductase (DHFR) gene under control of the SV40 promoter, and with
tICAM(453), or tICAM(184) constructs in the CDM8 vector (Seed and
Aruffo, PNAS, 84:3365-3369 (1987)).
[0097] Transfections were done using both electroporation and
calcium phosphate methods. Bebbington, supra. Transfected
DHFR-positive cells were selected by growth on nucleoside-free
media, and pools of transfectants were cloned by limiting
dilution.
[0098] Cell lines that secrete tICAM were identified by testing
culture supernatants with a two-site radioimmune assay (RIA) for
ICAM using Mabs c78.4A and c78.5A as follows. A monoclonal antibody
against one epitope on ICAM (for example, Mab c78.4A) was adsorbed
to plastic 96-well plates (Immunlon plates, Dynatech Inc.), excess
binding sites on the plates were blocked with bovine serum albumin
(BSA), and then culture supernatants were incubated with the
plates. The plates were washed and incubated with
[.sup.125I]-Mab(directed against a second epitope on ICAM, e.g.
c78.5A), and, after washing, the amount of bound
[.sup.125]I-IgGdetermined. The concentration of tICAM was
determined by comparing RIA data from unknowns against a standard
curve of tmICAM at known concentrations. Positive clones were
expanded and expression of tICAM forms was confirmed by
immunoprecipitation of metabolically labeled cell supernatants with
Mab c78.4A.
[0099] Cell lines CT.2A (tICAM(453)) and CD12.1A (tICAM(185)) were
selected for further study and were subjected to gene amplification
in methotrexate containing media as described by Bebbington, et
al., supra. A clone derived from CT.2A resistant to 100 nM
methotrexate and a CD12.1A clone resistant to 1 82 M methotrexate
were used for purification of soluble truncated ICAM-1
proteins.
[0100] B. Transfection of Prokaryotic Cells
[0101] Because glycosylation of the viral binding domain of ICAM is
not required to retain viral binding (as demonstrated in Example
3C), it is anticipated that prokaryotic cells, such as E. coli, can
be successfully transfected to produce functional proteins.
EXAMPLE 5
Isolation and Purification of tICAM-1
[0102] Monoclonal antibody affinity chromatography with
c78.4A-Sepharose (TM) has been previously described in co-pending
U.S. Ser. No. 07/130,378 and Greve, et al., Cell, 56:839-847
(1989). tICAM secreted into serum-containing media required
additional purification steps due to the high level of
contaminating protein in the serum. Before elution from the
Mab-affinity column, the column was washed with 1 M NaCl to remove
loosely-bound proteins. For tICAM(453), the partially purified
tICAM(453) eluted from the c78.4-Sepharose(TM) column was dialyzed
into 10 mM Tris (pH 6.0), absorbed onto a mono-Q(TM) column
(Pharmacia), and eluted with a 0-0.3 M NaCl gradient. tICAM184 was
further purified by gel filtration on a Superose-12(TM) column.
[0103] It is also recognized that non-transmembrane truncated forms
of ICAM-1 may be purified using standard ion exchange methodology
without using monoclonal antibody affinity chromatography.
EXAMPLE 6
Radioactive Labeling of tmICAM-1, tICAM(185), and tICAM(453) and
Demonstration of Retained Capacity for Binding to
MONOCLONAL ANTIBODIES
[0104] The epitopes reactive with monoclonal antibodies c78.4A and
c78.5A are conformationally-dependent epitopes and thus can be used
as analytical probes for confirming retention of the native ICAM
structure. Known amounts of purified ICAM were incubated with
c78.4A or c78.5A IgG-Sepharose(TM) and the fraction of the
radioactivity bound determined. These experiments showed that the
purified tmICAM-1 , tICAM(185), and tICAM(453) completely retained
the ability to bind to these monoclonal antibodies.
[0105] Transfectants were metabolically labeled with
[.sup.35S]cysteine, and cell lysates (for transmembrane ICAM) or
culture supernatants (for truncated ICAM) were prepared and
incubated with c78.4A IgG-Sepharose(TM) beads. The beads were
washed and adsorbed proteins were eluted with sodium dodecyl
sulfate (SDS) and analysed by SDS-PAGE; see Greve, et al., Cell,
56:839-847 (1989)). It was found that the isolated proteins were
quantitatively bound to the c78.4A and c78.5A Nabs.
[0106] Accordingly, the tICAM(185) and tICAM(453) both have
retained native ICAM structure.
EXAMPLE 7
Human Rhinovirus Binding Assays of tmICAM and tICAMs
[0107] Described below are three binding assays used to assess
binding activity of the various forms of ICAM.
[0108] A. Pelleting Assay [.sup.35S]cysteine-labeled tmICAM-1 or
tICAM was mixed with HRV3 in 100 .mu.l of 10 mM HEPES (pH 7.5), 150
mM NaCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.1% Triton X-100. The
mixture was incubated for 30 min. at 37 C., cooled on ice, layered
on top of a cushion of 200 .mu.l of 10% glycerol, 0.2 M
triethanolamine (pH 7.5), and centrifuged in a Beckman air-driven
centrifuge at 134,000.times.g for 30 min. at 4 C. The top 275 .mu.l
was removed, and the pellet was analyzed by SDS-PAGE and
scintillation counting. Silver-staining of SDS gels of control
experiments indicated that essentially all of the HRV3 is pelleted
under these conditions and essentially all of the ICAM remains in
the supernatant. The results are shown in Table 1.
3 TABLE 1 ICAM % ICAM Pelleted* tmICAM-1 11.6% tICAM(453) 1.0%
tICAM(185) 4.3% *average of 4 experiments; these numbers cannot be
directly converted into relative affinities
[0109] These data show that both truncated forms of ICAM bind to
rhinovirus, but at substantially reduced levels relative to
tmICAM
[0110] B. Solution Binding Assay
[0111] To obtain quantitative information on the relative affinity
of tmICAM and tICAM fragments in solution, a solution competition
assay was developed in which soluble tmICAM or soluble tICAM
fragments were used to inhibit the binding of [.sup.35S]HRV3 to
previously immobilized ICAM-1; nonionic detergent (Triton X-100)
was included in the buffers so that the different proteins could be
compared under identical conditions. First, tmICAM-1 (isolated in
the presence of 0.1% octylglucoside instead of Triton X-100) was
diluted 10-fold into a Tris/NaCl buffer and allowed to adsorb to
the walls of a microtiter plate (Immunlon-4, Dynatech) overnight.
Nonspecific binding sites on the plate were then blocked with 10
mg/ml BSA and binding experiments performed in 0.1% Triton X-100/1
mg/ml BSA/10 mM Tris/200 mM NaCl. Approximately 20,000 cpm of
[.sup.35S]HRV3 were mixed with varying amounts of ICAM [tmICAM,
tICAM(453) or tICAM(185)], incubated for 1 hour at 37 C., and then
added to wells of the microtiter plates and incubated for 3 hr at
37 C. The plates were washed and the bound radioactivity
determined.
[0112] As shown in Table 2, tmICAM-1 inhibits virus binding
half-maximally at low concentrations (0.008 .mu.M) while tICAM(453)
and tICAM(185) inhibit at much higher concentrations (2.8 .mu.M and
7.9 .mu.M, respectively; or 350 to almost 1000-fold higher than
tmICAM.
4 TABLE 2 ICAM IC50* tmICAM 8.0 .+-. 3.3 nM (N = 3) tICAM(453) 2.8
.+-. 0.6 .mu.M (N = 3) tICAM(185) 7.9 .+-. 2.8 .mu.M (N = 3) *IC50
is the concentration of soluble ICAM needed to inhibit HRV3 binding
by 50%.
[0113] These data confirm and extend the earlier observations that
tICAM(453) and tICAM(185) do bind to rhinovirus but with lower
affinities than does tmICAM-1 and provide evidence that the virus
binding site is encompassed within the two N-terminal domains (185
residues) of ICAM-1.
[0114] Subsequent experiments performed at 34 C. (the temperature
at which rhinovirus normally replicates) have yielded similar
results.
[0115] C. Dot-Blot Assay
[0116] An alternative method of measuring binding activity was
utilized in which tmICAM-1 , tICAM(453), or tICAM(185) was adsorbed
to nitrocellulose filters, the non-specific binding sites on the
filters blocked with 10 mg/ml bovine serum albumin (BSA), and
radioactive virus or [.sup.125I]Mab to ICAM-1 incubated with the
filter for 60 min at 37 C. The filters were washed with buffer and
the filters exposed to X-ray film.
[0117] The amount of radioactivity bound to the filters was
determined by densitometry of the autoradiograms, and the data is
expressed as HRV3 binding (in arbitrary units) normalized to the
amount of ICAM bound to the blot by a parallel determination of the
amount of [.sup.125I]Mab c78.4A or c78.5A bound to the ICAM (bound
to the blot). The results are shown in Table 3.
5TABLE 3 Binding of [.sup.35S]HRV3 to Immobilized ICAM* ICAM
tICAM(453) ratio ICAM/tICAM453 1.2 .+-. 1.1 0.52 .+-. 0.45 2.3
*Average of 5 experiments. Data is expressed in arbitrary
densitometric units of [.sup.35S]HRV3 binding/[.sup.125]Ianti-ICAM
Mab binding.
[0118] Additional studies with tICAM 185 have been performed.
Binding experiments have demonstrated equivocal results. It is
anticipated that steric hindrance may play a role. The size of the
virus is approximately 30 nanometers. The length of tICAM(185) is
less than 10 nanometers. The use of a spacer or linker would
provide better accessibility for binding.
[0119] The results from this experiment indicate that under these
assay conditions tICAM(453) is capable of binding rhinovirus at
levels comparable to those of tmICAM-1 when the amount of virus
bound was normalized to the amount of [.sup.125I]MAb bound.
Further, these results indicate that the tICAM forms are capable of
binding to rhinovirus, but that the binding avidity is dependent
upon the configuration of the tICAM. tmICAM-1 is believed to be a
small multimer (probably a dimer) and presentation of tICAM in a
multimeric form mimics this multimeric configuration.
[0120] Evidence supporting this hypothesis comes from quantitative
binding studies (unpublished), in which the ratio of the maximum
number of rhinovirus particles and the maximum number of antibody
molecules that can be bound to cells is approximately 1.5, as
discussed supra. This is in contrast to the earlier work of
Tomassini, J., et al., J. Virol., 58:290 (1986), which suggested a
complex of five molecules needed for binding. Their conclusion was
based on an erroneous interpretation of gel filtration data that
failed to take into account bound detergent molecules.
EXAMPLE 8
CL203 IgG Antibody-Mediated Cross-Linking of tICAM(453)
[0121] To provide additional evidence that the higher relative
binding activity of tmICAM-1 is due to a multimeric form of the
protein, the tICAM(453) protein was pre-incubated with CL203, a
monoclonal antibody to ICAM-1 that does not inhibit virus binding
to ICAM-1 and binds to a site C-terminal to residue 184 (Staunton,
et al., Cell, 56:849 (1989) and Cell, 61:243 (1990)). Thus, the
antibody can effectively "cross-link" two molecules of tICAM(453),
to create "dimers" of tICAM(453), yet without blocking the
virus-binding site on each of the two molecules of tICAM(453). When
a mixture of CL203 IgG and tICAM(453) at a 4:1 weight ratio was
tested in the competition assay, it was found that the antibody
cross-linked tICAM(453) inhibited HRV3 binding at a concentration
7.4-fold lower than tICAM(453) alone consistent with the idea that
tmICAM-1 binds with higher affinity to rhinovirus because it is a
diner or a small multimer.
[0122] To create alternative multimeric forms of tICAM, several
further modified truncated forms of ICAM were constructed as
described, supra, in Example 3.
[0123] These forms can then be multimerized as described in Example
9, below.
EXAMPLE 9
Multimerization of tmICAM and tICAMs
[0124] There are several ways that tICAM can be converted to a
multimeric form having enhanced viral binding and neutralization
activity over the monomeric form. For example, a first tICAM can be
coupled to a second tICAM(which may be the same or different), or
to an inert polymer, such as amino-dextran (MW 40,000), using
homobifunctional (such as N-hydroxysuccinimide (NHS) esters) or
heterobifunctional (such as those containing NHS-ester and
photoactivatable or sulfhydryl-reactive groups) cross-linking
reagents utilizing the amino group on the amino-dextran and an
amino or other group on the tICAM. A number of examples of
appropriate cross-linking reagents can be found in the Pierce
Chemical Company catalog (Rockford, Ill.). Similarly, the tICAMs
can also be bound to other suitable inert polymers, such as
nitrocellulose, PVDF, DEAE, lipid polymer, and other inert polymers
that can adsorb or be coupled to tICAM with or without a spacer or
linker.
[0125] As tICAM is poorly reactive with NHS-ester-based compounds,
a tICAM with a genetically-engineered C-terminal lysine residue
(see Example 3) would have improved coupling efficiency to supports
with homobifunctional reagents whereas genetically-engineered
C-terminal cysteine residues would facilitate coupling by
heterobifunctional reagents, such as
sulfo-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS).
[0126] ICAMs can also be multimerized by coupling with an antibody
(e.g. CL203) or fragment thereof, or with a suitable protein
carrier, e.g. albumin or proteoglycan.
[0127] ICAMs may also be multimerized by fusion with fragments of
immunoglobulins to form ICAM immunoadhesins.
[0128] Alternatively, soluble tICAM multimers can be created by
genetically engineering reactive residues into tICAM. For example,
free cysteine residues can be created in relatively hydrophilic
sequences in the C-terminal region of tICAM (which would have a
greater tendency to be solvent-exposed). This will allow the
creation of dimers in situ; alternatively, monomers can be purified
and dimers created in vitro by disulfide bonding, either directly
or via suitable linkers.
[0129] Another approach requires the placement of lysine residues
at similar positions and cross-linking purified protein in vitro
with homobifunctional NHS-esters. Examples of such lysine residues
are residues 338, 360, 387. See FIG. 1.
[0130] Crosslinking cysteine residues to each other can be
accomplished by reaction of tICAM with free cysteine groups with
bis-maleimidohexane (Pierce Chemical Co.) or other
bis-maleimido-analogs. Cross-linking free cysteine residues on
tICAM to amino groups on carrier molecules can be accomplished by
reaction with m-maleimidobenzoyl-N-hydroxy- succinimide ester.
[0131] Crosslinking amino groups on tICAM molecules can be
accomplished with homobifunctional N-hydroxysuccinimide esters (for
examples, see Pierce Chemical Co. catalog). Alternatively, the
carbohydrate groups on tICAM can be oxidized to aldehydes and
coupled to hydrazine-activated amino groups on a carrier
molecule.
EXAMPLE 10
Infectivity-Neutralization Assay of tmICAM and tICAMs
[0132] Three different assays for virus infectivity have been used.
These different assays take into account the differences in
transmembrane ICAM and non-transmembrane solubilities.
[0133] A. Plaque-reduction Assay in the Presence of Deterrent
[0134] The results of this assay indicate the highest dilution of
virus that will still be effective in killing cells. Virus is
pre-incubated with transmembrane ICAM protein in the presence of
0.1% Triton X100, serially diluted into culture medium, incubated
for 30 min with HeLa cells at 10 cells/ml, diluted 10-fold, and
plated out into multiple wells of a 96-well microtiter plate having
varying dilutions of virus.
[0135] 0.1% Triton X100 was used as positive control. After 5 days,
the wells are scored as either being infected or not by the
presence of cytopathic effect (CPE) and the titer expressed as
plaque-forming units/ml (PFU/ml) of the original virus. This assay
was described in U.S. Ser. No. 07/239,571 and was used to
demonstrate the antiviral activity of tmICAM-1 (which required the
presence of detergent to remain in solution). The concentration of
ICAM protein used is the initial concentration in the
pre-incubation mixture; however, the ICAM protein is not present
continually during the infection in that the protein is serially
diluted. While the presence of detergent is required to solubilize
the tmICAM, detergent kills the cells: thus, the need for the
serial dilutions of the tmICAM-1/detergent to permit infection of
cells.
[0136] B. Plaque-reduction Assay in the Absence of Detergent
[0137] In this plaque-reduction assay, a more traditional assay,
HeLa cells are infected with serial dilution of rhinovirus as
above, but detergent is not present; thus, this assay cannot be
used to assay tmICAM. In this assay the tICAM is present
continually in the culture medium at the indicated concentration.
tmICAM-1 (which requires the presence of detergent) cannot be
assayed in this system because the addition of the required
detergent would kill the HeLa cells.
[0138] C. Plaque-reduction Assay in Continual Presence of Virus and
ICAM
[0139] This assay is similar to that utilized by Marlin, et al.
(Nature 1990) in which a culture of HeLa cells is infected with 100
PFU of virus in the presence or absence of ICAM protein and
cultured approximately 4 days until cytopathic effect (CPE) is
apparent. The cultures are then scored for CPE visually. The assay
conditions were the same as Marlin, supra. Scoring was done
visually rather than by a staining procedure using crystal
violet.
[0140] In this assay, there is no detergent present, the ICAM is
present continually, and this assay measures a reduction in virus
replication/propagation at an arbitrary point in time.
[0141] The data from these three different assays for virus
infectivity is summarized in Table 4.
6 TABLE 4 IC50% (.mu.M)* ICAM Assay: A B C tmICAM-1 0.03 ND
tICAM(453) >20 0.2 0.2 tICAM(185) >20 8 ND *IC50% is defined
as the concentration of ICAM protein needed to inhibit HRV3
infectivity by 50%.
[0142] These data indicate that tmICAM-1 is significantly more
active in reducing viral infectivity than the truncated ICAM
proteins, even when compared in different assay systems. The
differences in neutralization activity of tICAM(453) in assay (A)
and assay (B) indicate that the neutralization mediated by
tICAM(453) requires the continual presence of tICAM(453) in the
culture medium and is reversible. That the neutralization is
reversible is indicated by the lack of significant neutralization
observed in assay (A). In contrast, the neutralization activity of
tmICAM-1 is >667-fold higher than tICAM(453) and than tICAM(185)
in assay (A) and could be even greater in assay (B) if it were
possible to have the tmICAM-1 present continually in the culture
medium in the absence of detergent. The conditions in assays B-D
more closely reflect the in vivo situation in which soluble ICAM
could be used as an antiviral agent.
[0143] To compare these results with those of Marlin et al., an
attempt was made to reproduce their assay conditions. As shown in
Table 4, there is a good correlation between the results in assay
(B) and assay (C), although the IC50% for tICAM(453) is 10-fold
greater than that seen by Marlin et al. To determine if this is due
to a difference in the serotype of rhinovirus used, the assay was
repeated with HRV14 and HRV54 (the serotype used by Marlin, et
al.). The IC50% for both of these serotypes was 0.2 .mu.M
tICAM(453), indicating that there is no difference in serotype
sensitivity between HRV14, HRV54, and HRV3.
[0144] To attempt to resolve this discrepancy, the same buffers
that Marlin, et al. used were used to see if they affected the
infectivity of rhinovirus in assay (C). Marlin, et al. prepared
their sICAM-1 protein in a buffer containing 50 mM triethanolamine
(TEA)/20 mM Tris. When this buffer alone was added to control
infections ({fraction (1/10)}th volume, final concentration 5 mM
TEA/2 mM Tris) of HRV3 and HRV14, virtually complete inhibition of
CPE was observed. Thus, it is possible that there could be buffer
effects on virus replication unrelated to the presence of any form
of ICAM.
[0145] However, subsequent assays using a broad panel of HRV
serotypes indicates that the IC50% for HRV54 may in fact be
significantly lower than for other HRV serotypes, e.g. HRV3.
EXAMPLE 11
Use of Multimeric Forms of tmICAM and tICAMs as Effective
Inhibitors of ICAM/LFA-1 Interaction
[0146] The normal function of ICAM-1 is to serve as a ligand of the
leukocyte integrin LFA-1; interaction between these two molecules
leads to adhesion between leukocytes and a variety of other cells.
The ability of tICAMs to inhibit adhesion between ICAM-1 and LFA-1
on cells was examined as follows. ICAM-1 was adsorbed to microtiter
plates as described in Example 7C. JY cells, which express LFA-1,
adhere to ICAM-expressing cells or to ICAM-1-coated culture dishes
(Staunton, et al., JCB). JY cells (10.sup.7 cell/ml in 10 mM HEPES
pH 7.5/150 mM NaCl/1 mM CaCl.sub.2/1 mM MgCl.sub.2 containing 1
mg/ml BSA) labeled with 10 .mu.Ci/ml [.sup.36S]-cysteine for 18
hours) were pre-incubated in the presence or absence of tICAM(453)
or tICAM(185) for 30 min at 37 C., and then added to the
ICAM-1-coated plates and incubated for 60 min at 37 C. The
microtiter plates were then washed three times with media, and the
number of cells bound to the plates were quantified by
scintillation counting.
[0147] As shown in Table 5, tICAM(185) and tICAM(453) both
inhibited JY cell binding at identical concentrations of between 5
and 20 .mu.M.
7TABLE 5 % JY Cell Binding .mu.M ICAM-1 tICAM(453) tICAM(185) 20
100 6 5 2 47 50 0.6 83 72 0.02 86 80 0.006 89 97 *Binding to
ICAM-1-coated microtiter plates; 10 .mu.g/ml anti-LFA-1 or
anti-ICAM-1 MAb inhibited binding to <1%.
EXAMPLE 12
Construction of tICAM/IgG Immunoadhesins
[0148] A soluble derivative of ICAM-1 was constructed by a cDNA
fusion which linked the first two domains of ICAM-1 (residues
1-185) to a segment of human immunoglobulin heavy chain cDNA. This
approach has been described previously for the CD4 molecule
[Zettlmeissl, G., J-P Gregersen, J. M. Duport, S. Mehdi, G. Reiner,
and B. Seed, "Expression and Characterization of Human CD4:
Immunoglobulin Fusion Proteins", DNA and Cell Biology (1990)
9(5):347-353; Capon, D. J., S. M. Chamow, J. Mordenti, S. A.
Marsters, T. Gregory, H. Mitsuya, R. A. Bryn, C. Lucas, F. M. Wurm,
J. E. Groopman, S. Broder, and D. H. Smith, "Designing CD4
immunoadhesins for AIDS therapy", Nature (1989) 337:525-531;
Traunecker, A. J. Schneider, H. Kiefer and K. Rarjalainen, "Highly
efficient neutralization of HIV with recombinant CD4-immunoglobulin
molecules", Nature (1989) 339:68-70] and resulted in the expression
of disulfide-linked dimers.
[0149] The cDNA fusion was accomplished by a two-stage polymerase
chain reaction (PCR) strategy. (See, e.g., Horton, R. M., Z. Cai,
S. N. Ho, and L. R. Pease, "Gene Splicing by Overlap Extension:
Tailor-Made Genes Using the Polymerase Chain Reaction",
BioTechniques (1990) 8(5):528-535]. The first step involved the
separate amplification of a fragment coding for residues 1-185 of
ICAM-1 and an IgG heavy chain fragment beginning at residue 216 in
the hinge region and ending at the C-terminus of the molecule (see
FIG. 3). The PCR primer used at the 3' end of the ICAM-1 fragment
contained an additional 24 bases complementary to the first 24
bases of the IgG fragment: CGG TGG GCA TGT GTG AGT TTT GTC AAA GGT
CTG GAG CTG GTA GGG GGC. The 5' ICAM-1 primer (5' noncoding and
signal sequence) had the sequence:
8 HindIII GGA ATT CAA GCT TCT CAG CCT CGC TAT GGC TCC CAG CAG CCC
CCG GCC C
[0150] The 5' IgG primer had the following sequence: GAC AAA ACT
CAC ACA TGC CCA CGG; the 3' primer from the end of the IgG coding
sequence was:
9 XbaI G GGA TTC TCT AGA TCA TTT ACC CGG AGA CAG GGA GAG GCT
[0151] Amplifications were performed using 10 ng of cloned ICAM-1
or IgG1 heavy chain cDNA for 10 cycles with 1 min at 94 C., 2 min
at 55 C. and 1.5 min extensions at 72 C. The resulting amplified
fragments were mixed in approximately equimolar amounts and used as
template for the second step PCR reaction. This reaction used the
5' ICAM primer and the 3' IgG primer above. Amplification for 25
cycles under the same conditions as in the first step produced a
predominant band of approximately 1200 bp consistent with the
desired product (see FIG. 3). The fragment was digested with
HindIII and XbaI (restriction sites incorporated into the 5' and 3'
primers respectively), purified and ligated into
HindIII/XbaI-cleaved CDM8 vector.
[0152] Clones containing the desired insert were identified by
restriction analysis and two clones designated pHRR72 and pHRR73
were selected for sequence analysis. Sequencing of the junction
region between ICAM-1 and the IgG hinge confirmed that both clones
had the correct structure. The plasmids were transfected into COS
cells which were labelled with [.sup.35S]cysteine overnight at 48
hours post-transfection as in Example 6. The supernatants were
immunoprecipitated with anti-ICAM-1 monoclonal antibody c78.4A and
analyzed by SDS gel electrophoresis as in Example 6. Under reducing
conditions a band with an apparent molecular weight of 68 kD was
specifically immunoprecipitated, corresponding to the ICAM-1/IgG
fusion. Expression of clone pHRR72 was consistently higher than
pHRR73 so this clone was selected for further study.
[0153] COS cells were transfected with pHRR72 according to the
method of Example 3 and at 48 hours after transfection the media
was replaced with serum-free media containing [.sup.35S]cysteine
and the cells were labelled overnight as above. The supernatants
were incubated with protein A- Sepharose beads, and bound protein
was eluted with 0.1 M acetic acid, neutralized and analyzed by gel
electrophoresis under reducing and non-reducing conditions. A
control was performed in which plasmids expressing heavy and light
chains of a functional antibody were co-transfected. This
experiment showed that the protein produced by pHRR72 is capable of
binding protein A, showing that the pHRR72 protein contains the IgG
constant region, and that the 68 kD band seen under reducing
conditions shifts to a high molecular weight dimeric form under
non-reducing conditions. Thus since only dimeric IgG binds protein
A, and since the mobility under non-reducing conditions is at least
twice that of the monomer, we conclude that the tICAM(185)/IgG
immunoadhesin is a dimer. Correct folding of the ICAM-1 region is
indicated by the specific immunoprecipitation with c78.4A as in
Example 6, and by the quantitative detection of the fusion protein
using two ICAM-1-specific antibodies in a radioimmune assay (RIA)
as in Example 4.
[0154] pHRR72 was co-transfected with pSV2-DHFR into CHO cells by
the calcium phosphate method of Example 4 and DHFR+ cells were
selected in nucleoside-free medium. Individual colonies were
picked, expanded and tested by RIA for expression. The three
highest-expressing colonies were selected for further study and
were recloned by limiting dilution. Analysis of labelled cell
supernatants by protein A binding and gel electrophoresis confirmed
the expression of tICAM(185)/IgG dimers.
[0155] In a similar manner, domains I-V of ICAM-1 (residues 1-453)
were linked to a segment of human immunoglobulin heavy chain cDNA.
A fragment coding for residues 1-453 of ICAM-1 and a fragment
coding for IgG heavy chain beginning at residue 216 in the hinge
region and ending at the C-terminus of the molecule were each
separately amplified. The PCR primer used at the 3' end of the
ICAM-1 fragment contained an additional 24 bases complementary to
the first 24 bases of the IgG fragment: CGG TGG GCA TGT GTG AGT TTT
GTC CTC ATA CCG GGG GGA GAG CAC ATT. The 5' ICAM-1 primer, 5' IgG
primer, and 3' primer from the end of the IgG coding sequence were
the same as for the tICAM(185)IgG fusion above. After PCR
amplification, a band of approximately 2000 bp consistent with a
tICAM(453)/IgG fusion was produced.
[0156] Clones containing the desired insert were identified by
restriction analysis and the clone designated pHRR 95-9 was
selected for sequence analysis. The cDNA sequence is as
follows:
10 CAGACATCTG TGTCCCCCTC AAAAGTCATC CTGCCCCGGG GAGGCTCCGT 51
GCTGGTGACA TGCAGCACCT CCTGTGACCA GCCCAAGTTG TTGGGCATAG 101
AGACCCCGTT GCCTAAAAAG GAGTTGCTCC TGCCTGGGAA CAACCGGAAG 151
GTGTATGAAC TGAGCAATGT GCAAGAAGAT AGCCAACCAA TGTGCTATTC 201
AAACTGCCCT GATGGGCAGT CAACAGCTAA AACCTTCCTC ACCGTGTACT 251
GGACTCCAGA ACGGGTGGAA CTGGCACCCC TCCCCTCTTG GCAGCCAGTG 301
GGCAAGAACC TTACCCTACG CTGCCAGGTG GAGGGTGGGG CACCCCGGGC 351
CAACCTCACC GTGGTGCTGC TCCGTGGGGA GAAGGAGCTG AAACGGGAGC 401
CAGCTGTGGG GGAGCCCGCT GAGGTCACGA CCACGGTGCT GGTGAGGAGA 451
GATCACCATG GAGCCAATTT CTCGTGCCGC ACTGAACTGG ACCTGCGGCC 501
CCAAGGGCTG GAGCTGTTTG AGAACACCTC GGCCCCCTAC CAGCTCCAGA 551
CCTTTGTCCT GCCAGCGACT CCCCCACAAC TTGTCAGCCC CCGGGTCCTA 601
GAGGTGGACA CGCAGGGGAC CGTGGTCTGT TCCCTGGACG GGCTGTTCCC 651
AGTCTCGGAG GCCCAGGTCC ACCTGGCACT GGGGGACCAG AGGTTGAACC 701
CCACAGTCAC CTATGGCAAC GACTCCTTCT CGGCCAAGGC CTCAGTCAGT 751
GTGACCGCAG AGGACGAGGG CACCCAGCGG CTGACGTGTG CAGTAATACT 801
GGGGAACCAG AGCCAGGAGA CACTGCAGAC AGTGACCATC TACAGCTTTC 851
CGGCGCCCAA CGTGATTCTG ACGAAGCCAG AGGTCTCAGA AGGGACCGAG 901
GTGACAGTGA AGTGTGAGGC CCACCCTAGA GCCAAGGTGA CGCTGAATGG 951
GGTTCCAGCC CAGCCACTGG GCCCGAGGGC CCAGCTCCTG CTGAAGGCCA 1001
CCCCAGAGGA CAACGGGCGC AGCTTCTCCT GCTCTGCAAC CCTGGAGGTG 1051
GCCGGCCAGC TTATACACAA GAACCAGACC CGGGAGCTTC GTGTCCTGTA 1101
TGGCCCCCGA CTGGACGAGA GGGATTGTCC GGGAAACTGG ACGTGGCCAG 1151
AAAATTCCCA GCAGACTCCA ATGTGCCAGG CTTGGGGGAA CCCATTGCCC 1201
GAGCTCAAGT GTCTAAAGGA TGGCACTTTC CCACTGCCCA TCGGGGAATC 1251
AGTGACTGTC ACTCGAGATC TTGAGGGCAC CTACCTCTGT CGGGCCAGGA 1301
GCACTCAAGG GGAGGTCACC CGCAAGGTGA CCGTGAATGT GCTCTCCCCC 1351
CGGTATGAG g acaaaactca cacatgccca ccgtgcccag cacctgaact 1401
cctgggggga ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc 1451
tcatgatctc ccggacccct gaggtcacat gcgtggtggt ggacgtgagc 1501
cacgaagacc ctgaggtcaa gttcaactgg tacgtggacg gcgtggaggt 1551
gcataatgcc aagacaaagc cgcgggagga gcagtacaac agcacgtacc 1601
gggtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 1651
gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa 1701
aaccatctcc aaagccaaag ggcagccccg agaaccacag gtgtacaccc 1751
tgcccccatc ccgggatgag ctgaccaaga accaggtcag cctgacctgc 1801
ctggtcaaag gcttctatcc cagcgacatc gccgtggagt gggagagcaa 1851
tgggcagccg gagaacaact acaagaccac gcctcccgtg ctggactccg 1901
acggctcctt cttcctctac agcaagctca ccgtggacaa gagcaggtgg 1951
cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa 2001
ccactacacg cagaagagcc tctccctgtc tccgggtaaa tga
[0157] (wherein UPPERCASE indicates nucleotides coding for amino
acid residues 1-453 of ICAM-1, and lowercase , indicates
nucleotides coding for amino acid residues 216-442 of human heavy
chain IgG1)
[0158] The corresponding amino acid sequence of the mature fusion
polypeptide is as follows:
11 1 QTSVSPSKVI LPRGGSVLVT CSTSCDQPKL LGIETPLPKK ELLLPGNNRK 51
VYELSNVQED SQPMCYSNCP DGQSTAKTFL TVTWTPERVE LAPLPSWQPV 101
GKNLTLRCQV EGGAPRANLT VVLLRGEKEL KREPAVGEPA EVTTTVLVRR 151
DHHGANFSCR TELDLRPQGL ELFENTSAPY QLQTFVLPAT PPQLVSPRVL 201
EVDTQGTVVC SLDGLFPVSE AQVHLALGDQ RLNPTVTYGN DSFSAKASVS 251
VTAEDEGTQR LTCAVILGNQ SQETLQTVTI YSPPAPNVIL TKPEVSEGTE 301
VTVKCEAHPR AKVTLNGVPA ZPLGPRAQLL LKATPEDNGR SFSCSATLEV 351
AGQLIHKNQT RELRVLYGPR LDERDCPGNW TWPENSQQTP MCQAWGNPLP 401
ELKCLKDGTF PLPIGESVTV TRDLEGTYLC RARSTQGEVT RKVTVNVLSP 451
RYEDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMISRTP EVTCVVVDVS 501
HEDPEVKPNW YVDGVEVHNA KTKPREEQYN STYRVVSVLT VLHQDWLNGK 551
EYKCKVSNKA LPAPIEKTIS KAKGQPREPQ VYTLPPSRDE LTKNQVSLTC 601
LVKGFYPSDI AVEWESNGQP ENNYKTTPPY LDSDGSFELY SKLTVDKSRW 651
QQGNVFSCSV MHEALHNHYT QKSLSLSPGK *
[0159] The plasmids were transfected into COS cells which were
labelled with [.sup.35S]cysteine overnight at 48 hours
post-transfection as in Example 6. The fusion polypeptide is
expressed as a soluble secreted disulfide-linked dimer which binds
protein A. The supernatants were immunoprecipitated with
anti-ICAM-1 monoclonal antibody c78.4A and analyzed by SDS gel
electrophoresis as in Example 6. Under reducing conditions a band
with an apparent molecular weight of 100 kD was specifically
immunoprecipitated, corresponding to the ICAM-1/IgG fusion, while
under non-reducing conditions it migrates as a 200 kD dimer.
EXAMPLE 13
Rhinovirus Binding and Neutralization by tICAM/IgG
Immunoadhesins
[0160] The tICAM(185)/IgG immunoadhesin of Example 12 consists of
residues 1-185 of ICAM-1 fused to residue 216 in the hinge region
of an IgG1 heavy chain. The molecule is a disulfide-linked dimer
containing two rhinovirus binding sites. A CHO cell line CHO72.2
secreting the immunoadhesin was grown overnight in serum-free media
containing [.sup.35S]cysteine and the fusion protein was purified
on protein A beads. The labelled protein was tested for rhinovirus
binding in the pelleting assay as described in Example 7(A). The
samples consisted of tICAM(185)/IgG (no virus),
tICAM(185)/IgG+HRV3, tICAM(185)/IgG+HRV3+c78.4A, and
tICAM(185)/IgG+HRV3+irrelevant antibody. Pelleting of labelled
protein indicative of virus binding was seen with virus and virus+
irrelevant antibody by analysis on SDS gels. No pelleting was seen
in the absence of virus and significantly reduced pelleting was
seen in the sample containing c78.4A. This result indicates that
the tICAM(185)/IgG binds rhinovirus with a significantly higher
affinity than the soluble monomers tICAM(185) and tICAM(453), which
do not show levels of binding readily detectable under these
conditions. See Example 7(A). While approximately 10% of tmICAM-1
pellets under these conditions, only 1% of tICAM(453) pellets,
presumably because tmICAM-1 is in a dimeric state. The result with
tICAM(185)/IgG is similar to that seen in this assay with tmICAM-1,
suggesting that the two forms of ICAM may have similar affinities
for the virus, and providing further evidence that tmICAM-1 is a
dimer.
[0161] Cell supernatant from CHO72.2 cells containing unpurified
tICAM(185)/IgG was tested for rhinovirus neutralization in a virus
infectivity assay according to the method of Example 10(B). Serial
dilutions of HRV3 were made in media containing 50% IgG supernatant
or control supernatant from untransfected CHO cells. The virus
dilutions were mixed with HeLa cells and plated in wells of a
96-well microtiter plate (10 wells per dilution). Virus titers were
determined by scoring the number of infected wells at each dilution
after 6 days. In addition a quantitative assessment of cytopathic
effect at high virus input was made 2 days after infection. In
experiment A the concentration of tICAM(185)/IgG estimated by RIA
was 150 ng/ml and in experiment (B) the concentration was 325
ng/ml.
12 TABLE 6 Experiment A Experiment B HRV3 1 .times. 10.sup.7 PFU/ml
4 .times. 10.sup.6 PFU/ml HRV3 + 6 .times. 10.sup.5 PFU/ml 5
.times. 10.sup.5 PFU/ml tICAM(185)/IgG
[0162] Both experiments resulted in a ten-fold reduction in viral
titer at a concentration of approximately 1 nM in experiment A and
2 nM in experiment B. For comparison, monomeric tICAM(453) in the
same assay results in a 50% reduction in titer at 0.38 .mu.M or 30
.mu.g/ml. Thus the increase in activity resulting from dimerization
of the rhinovirus binding site is at least 200-fold and probably
greater.
[0163] Cell supernatant from CHO72.2 at a concentration of 650
ng/ml (4 nM) was also tested in a competitive binding assay
measuring the binding of [.sup.35S]HRV3 to ICAM-1 -coated plastic
microtiter wells. Specific binding is determined by comparing
counts bound with or without pre-incubation of the ICAM-1 in the
well with Mab c78.4A.
13 TABLE 7 cpm bound* % binding HRV3 4945 +/- 58 100 HRV3 + CHO
supernatant 5358 +/- 51 108 HRV3 + CHO72.2 supernatant 3187 +/- 206
64 *Mean values determined from triplicate wells. Standard errors
were less than 10% of the mean.
[0164] The level of binding in the presence of tICAM(185)/IgG was
65% of the normal control binding and 54% of control binding in the
presence of CHO cell supernatant, indicating close to a 50%
inhibition of binding. For comparison, soluble monomeric tICAM(453)
inhibits HRV3 binding by 50% in the same assay at 240 .mu.g/ml or
3.1 .mu.M. On a molar basis the ICAM-1 IgG immunoadhesin was thus
almost a 1000-fold better competitor than the monomer. The above
experiments were done with supernatants. Subsequent attempts to
reproduce these results with highly purified tICAM(185)/IgG were
unsuccessful
[0165] The tICAM(453)/IgG immunoadhesin of Example 12 consists of
residues 1-453 of ICAM-1 fused to residue 216 in the hinge region
of an IgG1 heavy chain. The molecule is a disulfide-linked dimer
containing two rhinovirus binding sites. The fusion polypeptide was
expressed in HeLa cells using the vaccinia/T7 system and purified
from the supernatant by affinity chromatography using an
anti-ICAM-1 monoclonal antibody. The activity of the protein was
examined in a competitive binding assay which measures the binding
of [.sup.35S]-labelled HRV to plates coated with purified tmICAM-1.
For comparison, soluble monomeric tICAM-453 was included in a
parallel assay as a positive control. The binding values are
documented in Table 8 below:
14 TABLE 8 IC.sub.50* tICAM(453) 44 nM t(453)/IgG Experiment 1 11
nM Experiment 2 10 nM *IC.sub.50 is the concentration required to
inhibit binding by 50%
[0166] These values are per mol of tICAM(453) determined by RIA.
Since each fusion polypeptide contains two tICAM(453) polypeptides,
the values for the fusion polypeptide expressed per mol of dimer
are 5.5 nM and 5 nM for Experiments 1 and 2, respectively.
Therefore on a molar basis the activity of the fusion polypeptide
in the competitive binding assay is ten-fold greater than the
tICAM(453) monomer. In subsequent experiments the relative activity
was 2- to 4-fold greater.
EXAMPLE 14
In Vitro Dimerization of ICAM-1
[0167] Several lines of evidence indicate that tmICAM-1 exists as a
noncovalent dimer at the cell surface: (i) the stoichiometry of
HRV/ICAM-1 binding sites at the cell surface is approximately 2;
(ii) tICAM(453), despite being properly folded, has a approximately
100-fold lower affinity for HRV than purified tmICAM-1, and (iii)
tICAM(453) and tmICAM-1 absorbed to nitrocellulose filters at a
high density bind rhinovirus at equivalent levels. See Example 7.
In addition, Staunton et al. (Cell 61:243-254 (1990)) have reported
that some mutants of ICAM-1 form covalent dimers at the cell
surface, indicating that this protein has the capability to
self-associate in vivo. Attempts to directly demonstrate the
existence of dimers by chemical cross-linking with water-soluble
carbodiimide/NHS, which is a heterobifunctional crosslinker which
forms a covalent bond between a primary amine and a carboxyl group,
did result in crosslinking of tICAM(453) into a 180 kD species,
whose size is consistent with a dimer (FIG. 4A). This crosslinking
is directly dependent upon the concentration of tICAM(453), with
50% crosslinking at 7 .mu.M protein (FIG. 4B). This concentration
is consistent with the relatively high concentration of tmICAM-1 at
the surface of a HeLa cell, which is approximately 2.5 .mu.M or 135
.mu.g/ml. The self-association detected by this crosslinking is
specific, since it is not affected by high concentrations of
third-party proteins (FIG. 4C). tICAM(185) appears to be poorly
crosslinked under the same conditions, indicating that domains 3-5
are involved in self-association. Because of the extensive
modification of the protein by this crosslinking procedure, the
protein had no virus-binding activity. However, this data shows
that soluble ICAM can self-associate in solution, and that this
self-association is concentration-dependent and -specific.
EXAMPLE 15
A tICAM(1-451)/LFA-3(210-237) Chimera
[0168] In order to examine the role of the transmembrane and
cytoplasmic domains of tmICAM-1 in high-affinity rhinovirus
binding, we constructed a chimeric ICAM-1 which is anchored on the
cell surface by a phospholipid tail and lacks these domains (see
FIG. 5). This experiment was designed to test whether the
cytoplasmic and transmembrane domains are necessary for the
formation of dimeric ICAM-1 on the cell surface, which results in
the high affinity binding of rhinovirus. In order to modify the
ICAM-1 cDNA to express a phospholipid-anchored form, we first used
site-directed mutagenesis to create a unique SacII site at residues
450/451 close to the end of the extracellular region. This allowed
the isolation of a cDNA fragment coding for residues 1-451 of
ICAM-1, by digestion of the modified plasmid with HindIII and
SacII. We used PCR to generate a fragment coding for the C-terminal
28 amino acids of the phospholipid-anchored form of LFA-3 (Seed,
B., Nature (1987) 329:840-842). By including a SacIl site in the 5'
primer this fragment was ligated to the ICAM-1 extracellular domain
and cloned into the expression vector CDM8, resulting in the
plasmid pHRR 70-19. This plasmid contains a cDNA coding for
residues 1-451 of ICAM-1 fused to residues 210-237 of LFA-1, which
should result in the expression of a phosphoplipid-anchored
molecule containing the ICAM-1 extracellular region. See FIG.
5.
[0169] Transfection of COS cells with pHRR 70-19 according to the
method of Example 4 and FACS analysis with anti-ICAM-1 antibodies
confirmed the cell surface expression of the fusion protein. The
binding of [.sup.35S]-labelled cells to COS cells transfected with
the fusion protein was determined.
15TABLE 9 ICAM-1 cpm bound % virus input % control tmICAM-1 2130
+/- 278 9.4 100 tICAM(1-185)/ 2382 +/- 293 11.2 119 LFA-3(210-237)
chimera
[0170] This result shows that there is no significant difference
between the ability of tmICAM-1 and the tICAM(1-451)/LFA-3(210-237)
chimera to bind HRV. It can therefore be concluded that the
transmembrane and cytoplasmic domains are not required for HRV
binding, and that dimerization must depend on interactions between
extracellular regions of the molecule.
[0171] Additional evidence that a form of ICAM-1 lacking the
cytoplasmic and transmembrane domains functions efficiently as a
receptor for rhinoviruses was obtained by transfection of the
tICAM(1-451)/LFA-3(210-2- 37) chimeric gene into HeLa 229 cells. We
have determined that these cells do not express ICAM-1 on the
surface and are resistant to HRV infection. Transfection of either
tmICAM-1 or the tICAM(1-451)/LFA-3 (210-237) chimera results in
cells which are readily infectable with rhinovirus and produce
virus at levels comparable to normal HeLa cells.
EXAMPLE 16
Irreversible Inactivation of HRV by ICAM
[0172] We have demonstrated that tICAM(453) can, in addition to
blocking the binding of HRV to cells, irreversibly inactivate HRV.
Incubation of HRV with tICAM(453) at 34 C. results in conversion of
a fraction of the virus from the native 148S form to a 42S form
(FIG. 5). The 42S form is non-infectious, lacks the viral subunit
VP4, and lacks the RNA genome (empty capsid). This can be shown by
SDS-PAGE analysis of [.sup.35 S]methionine-labelled viral particles
and by quantitation of viral RNA content by hybridization with a
[.sup.32 P]oligonucleotide probe for rhinovirus
(5'-GCATTCAGGGGCCGGAG-3') (SEQ ID NO:16). Thus, tICAM(453) can
uncoat rhinovirus, an event that normally occurs intracellularly
during the course of infection. The uncoating is a slow process,
occurring with a t1/2 of 6 hours at 34 C., in contrast with the
inhibition of binding, which occurs with a t1/2 of <30 minutes.
The uncoating is highly temperature-dependent, occurring 10 times
faster at 37 C. than at 34 C., the optimal temperature of
rhinovirus growth. Enhancement of this uncoating activity by
soluble forms of ICAM- 1 including multimeric configurations of
ICAM-1 will lead to improvement of antiviral activity by making
neutralization irreversible.
EXAMPLE 17
Cysteine Muteins
[0173] To identify the correct site to place cysteine residues for
multimerization of ICAM-1, the region of the protein surface
involved in self-association must be identified. Domains IV and V
have been chosen because they are distal to the viral binding sites
(domain I) and because domains II-V are implicated in
self-association (see Example 14). Since the structure of ICAM-1 is
not certain, we have attempted to align the sequence of domains IV
and V at the C-terminus of the extracellular domain of ICAM-1 onto
the immunoglobulin fold, as ICAM-1 has homology to numbers of the
immunoglobulin supergene family. This alignment is shown
diagrammatically in FIG. 7. Then, to identify probable sites
involved in self-association, we have examined the
three-dimensional structures of several members of the
immunoglobulin supergene family, IgG and MHC1/beta-2 microglobulin.
Immunoglobulin domains have two broad faces of beta sheet
structure, here designated the "B" face and the "F" face.
Inspection of the above structures revealed that different
immunoglobulin-like domains interacted via one or the other of
these faces of the domain. IgG variable regions associated via
their F face, while IgG constant regions (CH1, CH2, and CH3) and
MHC1/beta-2 microglobulin all interact via their B faces.
[0174] ICAM-1 domains have highest homology to constant region-like
domains. Thus, the most likely sites of interaction are on the B
face of the domains; the most likely sites on the B face to place
cysteine residues are close to the center of the B face (adjacent
to the cysteine on the B strand that forms the intrachain disulfide
bond), where IgG CH3 domains self-associate, or on the N-terminal
end of the B face, where IgG CH2 domains and MHC1/beta-2
microglobulin self-associate.
[0175] A number of mutants were prepared to identify appropriate
sites of interaction. These mutants were prepared by standard
site-directed mutagenesis methodology to mutate selected residues
to cysteine on tICAM(453) and tmICAM. These cDNAs in the vector
CDM8 were then transfected into cos cells and dimer formation
accessed by biosynthetic labelling of ICAM-1 with
[.sup.35S]cysteine followed by immunoprecipitation and non-reducing
SDS-PAGE analysis. As shown in Table 10, of 13 mutants tested, two
have been found to form dimers at a small (about 5%) but
significant level:
16 TABLE 10 Position of Cysteine Dimer Formation (tmICAM-1) 304 -
306 - 307 + 309 + 375 - 377 - 378 - 380 - 382 - 429 - (tICAM(453))
338 - 360 - 378 -
[0176] These two muteins, Cys-307 and Cys-309, are both located on
the N-terminal end of the B face of domain IV. The relatively low
level of dimerization may reflect the low concentration or ICAM-1
on the cell surface (low expression), or imperfect orientation of
the cysteine residues relative to the site of Interaction. These
data Indicate that this region of the domain is a likely site of
Interaction. Other residues adjacent to residues 307 and 309, e.g.
His-308, Arg-310, Glu-294, Arg-326, Gln-328, are likely to increase
the efficiency of the dimer formation. Mutations that load to dimer
formation of tmICAM-1 are then be placed on tICAM(453) for the
secretion of soluble ICAM-1 dimers.
[0177] A tICAM(452) cysteine mutant was prepared by substituting a
cysteine for an alanine at position 307 In the ICAM-1 amino acid
sequence and inserting a stop codon after amino acid residue 452.
The mutein was constructed by site-directed mutagenesis using a
full-length ICAM-1 cDNA and has the following DNA sequence:
17 CAGACATCTG TGTCCCCCTC AAAAGTCATC CTGCCCCGGG GAGGCTCCGT 51
GCTGGTGACA TGCAGCACCT CCTGTGACCA GCCCAAGTTG TTGGGCATAG 101
AGACCCCGTT GCCTAAAAAG GAGTTGCTCC TGCCTGGGAA CAACCGGAAG 151
GTGTATGAAC TGAGCAATGT GCAAGAAGAT AGCCAACCAA TGTGCTATTC 201
AAACTGCCCT GATGGGCAGT CAACAGCTAA AACCTTCCTC ACCGTGTACT 251
GGACTCCAGA ACGGGTGGAA CTGGCACCCC TCCCCTCTTG GCAGCCAGTG 301
GGCAAGAACC TTACCCTACG CTGCCAGGTG GAGGGTGGGG CACCCCGGGC 351
CAACCTCACC GTGGTGCTGC TCCGTGGGGA GAAGGAGCTG AAACGGGAGC 401
CAGCTGTGGG GGAGCCCGCT GAGGTCACGA CCACGGTGCT GGTGAGGAGA 451
GATCACCATG GAGCCAATTT CTCGTGCCGC ACTGAACTGG ACCTGCGGCC 501
CCAAGGGCTG GAGCTGTTTG AGAACACCTC GGCCCCCTAC CAGCTCCAGA 551
CCTTTGTCCT GCCAGCGACT CCCCCACAAC TTGTCAGCCC CCGGGTCCTA 601
GAGGTGGACA CGCAGGGGAC CGTGGTCTGT TCCCTGGACG GGCTGTTCCC 651
AGTCTCGGAG GCCCAGGTCC ACCTGGCACT GGGGGACCAG AGGTTGAACC 701
CCACAGTCAC CTATGGCAAC GACTCCTTCT CGGCCAAGGC CTCAGTCAGT 751
GTGACCGCAG AGGACGAGGG CACCCAGCGG CTGACGTGTG CAGTAATACT 801
GGGGAACCAG AGCCAGGAGA CACTGCAGAC AGTGACCATC TACAGCTTTC 851
CGGCGCCCAA CGTGATTCTG ACGAAGCCAG AGGTCTCAGA AGGGACCGAG 901
GTGACAGTGA AGTGTGAGtg CCACccgcgg GCCAAGGTGA CGCTGAATGG 951
GGTTCCAGCC CAGCCACTGG GCCCGAGGGC CCAGCTCCTG CTGAAGGCCA 1001
CCCCAGAGGA CAACGGGCGC AGCTTCTCCT GCTCTGCAAC CCTGGAGGTG 1051
GCCGGCCAGC TTATACACAA GAACCAGACC CGGGAGCTTC GTGTCCTGTA 1101
TGGCCCCCGA CTGGACGAGA GGGATTGTCC GGGAAACTGG ACGTGGCCAG 1151
AAAATTCCCA GCAGACTCCA ATGTGCCAGG CTTGGGGGAA CCCATTGCCC 1201
GAGCTCAAGT GTCTAAAGGA TGGCACTTTC CCACTGCCCA TCGGGGAATC 1251
AGTGACTGTC ACTCGAGATC TTGAGGGCAC CTACCTCTGT CGGGCCAGGA 1301
GCACTCAAGG GGAGGTCACC CGCAAGGTGA CCGTGAATGT GCTCTCCCCC 1351
CGGTATTAG
[0178] The foregoing examples describe the creation of soluble,
multimeric forms of tICAM that substantially increase tICAM binding
and neutralizing activity.
[0179] While the present invention has been described in terms of
specific methods and compositions, it is understood that variations
and modifications will occur to those skilled in the art upon
consideration of the present invention.
[0180] For example, it is anticipated that smaller protein
fragments and peptides derived from ICAM-1 that still contain the
virus-binding site would also be effective in a multimeric
configuration. It is also anticipated that multimeric ICAM may be
effective inhibitors of the ICAM-1/LFA-1 interaction, as the
affinity between these two molecules is quite low and the cell-cell
binding mediated by these two molecules is highly cooperative.
[0181] Although the preferred form and configuration is a
non-transmembrane (truncated) ICAM in dimeric configuration, it is
not intended to preclude other forms and configurations effective
in binding virus and effective in neutralizing viral activity from
being included in the scope of the present invention.
[0182] Further, it is anticipated that the general method of the
invention of preparing soluble protein forms from insoluble,
normally membrane bound receptor proteins can be used to prepare
soluble multimeric forms of other receptor proteins useful for
binding to and decreasing infectivity of viruses other than those
that bind to the "major group" receptor. Such other viruses include
polio, Herpes simplex, and Epstein-Barr virus.
[0183] Numerous modifications and variations in the invention as
described in the above illustrative examples are expected to occur
to those skilled in the art and consequently only such limitations
as appear in the appended claims should be placed thereon.
[0184] Accordingly it is intended in the appended claims to cover
all such equivalent variations which come within the scope of the
invention as claimed.
* * * * *