U.S. patent application number 10/191676 was filed with the patent office on 2003-07-24 for macular degeneration diagnostics and therapeutics.
This patent application is currently assigned to University of Iowa Research Foundation. Invention is credited to Sheffield, Val C., Stone, Edwin M..
Application Number | 20030138798 10/191676 |
Document ID | / |
Family ID | 22940547 |
Filed Date | 2003-07-24 |
United States Patent
Application |
20030138798 |
Kind Code |
A1 |
Stone, Edwin M. ; et
al. |
July 24, 2003 |
Macular degeneration diagnostics and therapeutics
Abstract
Therapeutics and diagnostics based on the identification of
genetic mutations, which cause Macular Degeneration (MD) is
disclosed.
Inventors: |
Stone, Edwin M.; (Iowa City,
IA) ; Sheffield, Val C.; (Coralville, IA) |
Correspondence
Address: |
NEEDLE & ROSENBERG P C
127 PEACHTREE STREET N E
ATLANTA
GA
30303-1811
US
|
Assignee: |
University of Iowa Research
Foundation
|
Family ID: |
22940547 |
Appl. No.: |
10/191676 |
Filed: |
July 8, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10191676 |
Jul 8, 2002 |
|
|
|
09248757 |
Feb 12, 1999 |
|
|
|
6417342 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/7.21 |
Current CPC
Class: |
C12Q 2600/136 20130101;
C12Q 1/6883 20130101; C12Q 2600/156 20130101; C12Q 2600/158
20130101; A61P 43/00 20180101; C12Q 2600/172 20130101 |
Class at
Publication: |
435/6 ;
435/7.21 |
International
Class: |
C12Q 001/68; G01N
033/567 |
Claims
1. A method for identifying a compound that modulates a FBNL
bioactivity, comprising the steps of: (a) contacting an appropriate
amount of the compound with a cell or cellular extract, which
expresses an FBNL gene; and (b) determining the resulting FBNL
bioactivity, wherein an increase or decrease in the FBNL
bioactivity in the presence of the compound as compared to the
bioactivity in the absence of the compound indicates that the
compound is a modulator of an FBNL bioactivity.
2. A method of claim 1, wherein the FBNL gene is a human FBNL
gene.
3. A method of claim 1, wherein the FBNL gene is a wildtype
gene.
4. A method of claim 1, wherein the FBNL gene is a mutant gene.
5. A method of claim 1, wherein the modulator is an agonist of an
FBNL bioactivity.
6. A method of claim 1, wherein the modulator is an antagonist of
an FBNL bioactivity.
7. A method of claim 1, wherein in step (b), the FBNL bioactivity
is determined by determining the expression level of an FBNL
gene.
8. A method of claim 7, wherein the expression level is determined
by detecting the amount of mRNA transcribed from an FBNL gene.
9. A method of claim 7, wherein the expression level is determined
by detecting the amount of FBNL gene product produced.
10. A method of claim 9, wherein the expression level is determined
using an anti-FBNL antibody in an immunodetection assay.
11. A method of claim 1, which additionally comprises the step of
preparing a pharmaceutical composition from the compound.
12. A method of claim 1, wherein said cell is contained in an
animal.
13. A method of claim 12, wherein the animal is transgenic.
14. A method of claim 13, wherein the transgenic animal contains a
human FBNL gene.
15. A compound identified by the method of claim 1.
16. A compound of claim 15, which is selected from the group
consisting of: a small molecule, a polypeptide, a nucleic acid and
a peptidomimetic.
17. A compound of claim 16, wherein the nucleic acid is selected
from the group consisting of: an antisense molecule, a ribozyme and
a triplex nucleic acid.
18. A compound of claim 16, wherein the polypeptide is a FBNL
polypeptide.
19. A method for identifying whether a test molecule is an FBNL
binding partner or measuring the strength of an interaction between
an FBNL polypeptide and said FBNL binding partner comprising: (a)
allowing (i) a first molecule comprising a FBNL polypeptide
operably linked to a heterologous DNA binding domain to interact
with (ii) a second molecule comprising a test molecule operably
linked to a polypeptide transcriptional activation domain and (iii)
a hybrid reporter gene comprising a nucleic acid encoding a
reporter operably linked to a DNA sequence comprising a binding
site for said heterologous DNA binding domain; and (b) detecting or
measuring the expression of the hybrid reporter gene as an
indication of the existence or strength of an interaction between
the first molecule and the second molecule wherein high levels of
hybrid reporter expression indicate a strong interaction between
FBNL and said test molecule thereby identifying a test molecule
which is an FBNL binding partner.
20. A method of claim 19, wherein said second molecule is encoded
by a nucleic acid and comprises a test polypeptide operably linked
to a polypeptide transcriptional activation domain, and which
further comprises the step of isolating the nucleic acid encoding
said second molecule from a cell expressing the hybrid reporter
gene.
21. A method for identifying a molecule which is a downstream or an
upstream component of an FBNL biochemical pathway or for measuring
the strength of the interaction between a FBNL biochemical pathway
component and a FBNL binding partner comprising: (a) allowing (i) a
first molecule comprising a FBNL binding partner polypeptide
operably linked to a heterologous DNA binding domain to interact
with (ii) a second molecule comprising a test molecule operably
linked to a polypeptide transcriptional activation domain and (iii)
a hybrid reporter gene comprising a nucleic acid encoding a
reporter operably linked to a DNA sequence comprising a binding
site for said heterologous DNA binding domain; and (b) detecting or
measuring the expression of the hybrid reporter gene as an
indication of the existence or strength of an interaction between
the first molecule and the second molecule wherein high levels of
hybrid reporter expression indicate a strong interaction between a
FBNL binding partner and said test molecule thereby identifying a
test molecule which is a downstream or an upstream component of the
FBNL biochemical pathway.
22. A method of claim 21, wherein said second molecule is encoded
by a nucleic acid and comprises a test polypeptide operably linked
to a polypeptide transcriptional activation domain, and which
further comprises the step of isolating the nucleic acid encoding
said second molecule from a cell expressing the hybrid reporter
gene.
23. A method for identifying a compound, which interacts with a
FBNL polypeptide or FBNL binding partner, comprising the steps of:
(a) contacting an appropriate amount of the compound with a FBNL
polypeptide and a FBNL binding partner under conditions wherein,
but for the test compound, the FBNL polypeptide and FBNL binding
partner are able to interact; and (b) detecting the extent to which
a FBNL polypeptide/FBNL binding partner complex is formed in the
presence of the compound, wherein an increase or decrease in the
amount of complex formed in the presence of the compound relative
to in the absence of the compound indicates that the compound
interacts with a FBNL polypeptide or FBNL binding partner.
24. A method of claim 23, wherein the FBNL polypeptide is a human
FBNL polypeptide.
25. A method of claim 23, wherein the FBNL polypeptide is a
wildtype polypeptide.
26. A method of claim 23, wherein the FBNL polypeptide is a mutant
polypeptide.
27. A method of claim 23, wherein the compound, which interacts
with a FBNL polypeptide or FBNL binding partner is a FBNL
agonist.
28. A method of claim 23, wherein the compound, which interacts
with a FBNL polypeptide or FBNL binding partner is a FBNL
antagonist.
29. A method of claim 23, which additionally comprises the step of
preparing a pharmaceutical composition from the compound.
30. A compound identified by the method of claim 29.
31. A compound of claim 30, which is selected from the group
consisting of: a small molecule, a polypeptide, a nucleic acid and
a peptidomimetic.
32. An isolated FBNL nucleic acid which is operably linked to a
FBNL transcriptional regulatory sequence.
33. A nucleic acid of claim 32, wherein the FBNL transcriptional
regulatory sequence is selected from the group consisting of. a
FBNL enhancer, a FBNL promoter, and a FBNL initiator element.
34. An isolated nucleic acid of claim 32, wherein the FBNL nucleic
acid is functionally fused to a heterologous gene.
35. An isolated nucleic acid of claim 34, wherein said heterologous
gene encodes a protein selected from the group consisting of: a
positive selectable marker, a negative selectable marker and a
reporter gene.
36. An isolated nucleic acid of claim 35, wherein the coding
sequence of FBNL is disrupted by a positive selectable marker.
37. An isolated nucleic acid of claim 36, wherein said nucleic acid
is further flanked by a negative selectable marker or markers.
38. An isolated nucleic acid of claim 37, wherein the reporter gene
is selected from the group consisting of: beta-galactosidase and
luciferase.
39. A cell line comprising an isolated nucleic acid of claim
39.
40. An animal comprising an isolated nucleic acid of claim 39.
41. An animal of claim 40, which is transgenic.
42. An animal of claim 41, which contains a human FBNL gene.
43. An isolated nucleic acid comprising a FBNL responsive
regulatory sequence operably linked to a reporter gene.
44. An isolated nucleic acid of claim 43, wherein the reporter gene
is selected from the group consisting of: beta-galactosidase and
luciferase.
45. A cell line comprising an isolated nucleic acid of claim
43.
46. An animal comprising an isolated nucleic acid of claim 43.
47. An animal of claim 46, which contains a human FBNL gene.
48. A cell in which the biological activity of one or more FBNL
proteins is altered by a chromosomally incorporated transgene.
49. A cell of claim 48, wherein said transgene disrupts at least a
portion of a genomic FBNL gene.
50. A cell of claim 48, wherein said transgene deletes all or a
portion of the genomic FBNL gene by replacement recombination.
51. A cell of claim 48, wherein said transgene comprises: (i) at
least a portion of the genomic FBNL gene, and (ii) a marker
sequence which provides a detectable signal for identifying the
presence of the transgene in a cell.
52. A transgenic animal comprised of a cell of claim 48.
Description
BACKGROUND OF THE INVENTION
[0001] Macular degeneration is a clinical term that is used to
describe a variety of diseases that are all characterized by a
progressive loss of central vision associated with abnormalities of
Bruch's membrane and the retinal pigment epithelium. These
disorders include very common conditions that affect older patients
(age related macular degeneration or AMD) as well as rarer,
earlier-onset dystrophies that in some cases can be detected in the
first decade of life.sup.1-18. The genes associated with some of
these dystrophies have been mapped,.sup.5-14 and in three cases,
blue-cone monochromasy,.sup.15 pattern dystrophy,.sup.16-17 and
Sorsby fundus dystrophy,.sup.18 actually identified. However, none
of the latter genes has been found to be responsible for a
significant fraction of typical late-onset macular
degeneration.
[0002] In developed countries, AMD is the most common cause of
legal blindness in older patients..sup.19 The hallmark of this
condition is the presence of drusen, which are ophthalmoscopically
visible, yellow-white hyaline excrescences of Bruch's membrane. In
some families, drusen are heritable in an autosomal dominant
fashion.
[0003] In 1875, Hutchinson and Tay published a paper entitled
"Symmetrical Central Choroido-Retinal Disease Occurring in Senile
Persons"..sup.20 This paper includes one of the first descriptions
of the constellation of clinical findings now known as age related
macular degeneration (AMD). Specifically, three of the ten patients
in the report were sisters affected with whitish spots (now
referred to as drusen) in the macula. In 1899, Doyne.sup.21
reported a similar disorder in which the abnormal spots were nearly
confluent such that the macula had a "honeycomb" appearance.
Histopathologic examination of one of Doyne's patients.sup.22
revealed the abnormalities to be hyaline thickenings of Bruch's
membrane. In 1925 Vogt.sup.23 published the first description of
the ophthalmoscopic appearance of a form of familial drusen that
had been observed in patients living in the Leventine valley in the
Ticino canton of southern Switzerland. Klainguti.sup.24 fully
characterized this condition in 1932 and demonstrated its autosomal
dominant inheritance This disorder eventually became known as
malattia leventinese (i.e., Leventine disease). In 1948,
Waardenburg.sup.25 stated that there was little reason to make a
distinction between malattia leventinese and the condition
described by Doyne. This position was strengthened when Forni and
Babel.sup.26 found that the histopathologic features of malattia
leventinese were indistinguishable from those of Doyne's honeycomb
choroiditis. Piguet, Haimovici and Bird.sup.27 recently reviewed
the history of these conditions and also pointed out that the
drusen in families with malattia leventinese are frequently
distributed in a radical pattern (see also FIGS. 2 and 3).
Choroidal neovascularization is uncommon in patients with radial
drusen but does occur ..sup.27 Although originally recognized in
Switzerland, families affected with autosomal dominant radial
drusen have been identified in Czechoslovakia,.sup.28, 29 and the
United States..sup.30
[0004] Currently, there is no therapy that is capable of
significantly slowing the degenerative progression of AMD, and
treatment is limited to laser photocoagulation of the subretinal
neovascular membranes that occur in 10-15% of affected
patients.
SUMMARY OF THE INVENTION
[0005] In one aspect the invention features methods for diagnosing
a subject with macular degeneration or with a predisposition for
developing, macular degeneration. In a preferred embodiment, the
diagnostic methods utilize a set of primers and/or probes for
amplifying and/or detecting regions of the macular degeneration
causing gene, and means for analyzing the macular degeneration
causing gene for differences (mutations) from the normal coding
sequence. For example, the MD causative mutation can be detected by
any of a variety of available techniques, including: 1) performing
a hybridization reaction between a nucleic acid sample and a probe
that is capable of hybridizing to the allele; 2) sequencing at
least a portion of the allele; or 3) determining the
electrophoretic mobility of the allele or fragments thereof (e.g.,
fragments generated by endonuclease digestion). The allele can
optionally be subjected to an amplification step prior to
performance of the detection step. Preferred amplification methods
are selected from the group consisting of: the polymerase chain
reaction (PCR), the ligase chain reaction (LCR), strand
displacement amplification (SDA), cloning, and variations of the
above (e.g. RT-PCR and allele specific amplification).
Oligonucleotides necessary for amplification may be selected from
anywhere in the IL-1 gene loci, either flanking the marker of
interest (as required for PCR amplification) or directly
overlapping the marker (as in ASO hybridization). The DNA in the
human IL-1 region has been mapped, and oligonucleotides for primers
can easily be selected with a commercially available primer
selection program. In a particularly preferred embodiment, the
sample is hybridized with a set of primers, which hybridize 5' and
3' in a sense or antisense sequence to the mutation, and is
subjected to a PCR amplification. In a preferred embodiment, the MD
causative mutation results in the following amino acid
substitutions to the FBNL protein: 345Arg>Trp and 362
Arg>Gln.
[0006] In another embodiment, the diagnostic methods employ
antibodies to a macular degeneration causing protein (i.e. a
protein encoded by the macular degeneration gene) in an immunoassay
procedure to detect the presence of a macular degeneration causing
protein in a subject's bodily fluid (e.g. tears).
[0007] In another aspect, the invention features kits for
performing the above-described assays. The kit can include sample
collection means and a means for determining, whether a subject
carries an MD causative mutation. The kit may also comprise control
samples, either negative or positive, or standards.
[0008] Information obtained using the assays and kits described
herein is useful, for example, for identifying presymptomatic
individuals, who are at risk for developing MD, e.g. based on
family history. If the diagnosis is negative, the individual will
not need to worry about the potential development of the disease
over time. If the diagnosis is positive, steps may be taken to
prevent or ameliorate the effects of the disease before damage,
such as loss of vision, occurs. In addition, the information can
allow a more customized approach to prolonging the onset or
treating the symptoms associated with MD. For example, this
information can enable a doctor to: 1) more effectively prescribe a
drug that will address the molecular basis of MD in the subject;
and/or 2) better determine the appropriate drug and dosage of a
particular drug for the particular subject.
[0009] In yet a further aspect, the invention features methods for
treating or preventing the development of MD in a subject by
administering to the subject, a pharmaceutically effective amount
of an MD therapeutic of the invention. In one embodiment, the MD
therapeutic is a macular degeneration correcting gene or protein
(i.e. a "normal" FBNL or related gene or protein (e.g. fibulin 1 or
fibulin 2), which corresponds to a mutated gene or defective
protein that causes the development of macular degeneration). In
another embodiment, the MD therapeutic is an antagonist of the
mutant protein activity or an agonist of the wildtype protein
activity.
[0010] The instant disclosed MD therapeutics correct the
biochemical defect resulting in disease. Therefore the instant
disclosed therapies offer a major advance over current treatments
(e.g. laser photocoagulation of the subretinal neovascular
membranes that only occur in 10-15% of affected patients.
[0011] In still another aspect, the invention provides in vitro and
assays for screening test compounds to identify MD therapeutics. In
another embodiment, the invention features transgenic non-human
animals and their use, for example in identifying MD
therapeutics.
[0012] Other features and advantages will be readily apparent from
the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 is a graphic representation of the family pedigrees
involved in the studies described in Example 1. Individuals found
to be clinically affected With radial drusen are represented by
black symbols while unaffected individuals are depicted with open
symbols. Individuals that are deceased are marked with a slash. All
living affected patients shown were included in the linkage
analysis except those marked with an asterisk. The affection status
of the deceased patients and of the patients marked with an
asterisk was obtained historically.
[0014] FIG. 2 is a graph plotting the decline of visual acuity of
macular degeneration patients with age. Each open symbol represents
the visual acuity of an affected eye at one point in time. The
acuity is expressed in decimal notation (20/20=1.0; 20/200=0.1).
Each heavy closed symbol represents the median visual acuity for
all eyes in a single decade of life. These median acuities are
plotted at the centers of the relevant decades (e.g., 25 for the
decade from age 20 through 29).
[0015] FIG. 3 shows two point linkage data and analysis of
recombinant individuals. Eighteen genetic markers from the short
arm of chromosome 2 are listed on the left of the figure with the
most centromeric marker at the bottom. Dots indicate markers that
could be positioned on the map in an order that was greater than
10.sup.8 times more likely than the next most likely order. Bold
type (without a dot) indicates that a marker could be ordered with
greater than 1000:1 odds while plain type indicates less than
1000:1 odds for the marker order. The maximum lod score (Zmax) for
all four families combined is given for each marker as well as the
recombination frequency at which Zmax occurred (theta hat). Each
vertical group of boxes depicts the haplotypic data from a
clinically affected individual who exhibits a recombination event
near the linked interval. The family designations and pedigree
numbers correspond to those in FIG. 1. A black box indicates that
during the meiosis that gave rise to the individual, an informative
recombination event occurred between the marker and the disease
gene. A white box indicates that the meiosis is informative (at
least with respect to the affected parent) and that no
recombination occurred between the disease gene and the marker. A
gray box indicates that the meiosis is uninformative at that
marker. The recombination events summarized in this figure suggest
that the disease-causing mutations lie within the interval bounded
by D2S1761 and D2S4444.
[0016] FIG. 4 shows the results of an analysis of twenty Swiss
Malattia Leventinese families, which has haplotypically narrowed
the interval to approximately 1 cM defined by markers
D2S2352-D2S1364.
DETAILED DESCRIPTION
[0017] 4.1 Definitions
[0018] For convenience, the meaning of certain terms and phrases
employed in the specification, examples, and appended claims are
provided below.
[0019] The term "an aberrant activity", as applied to an activity
of a polypeptide such as FBNL, refers to an activity which differs
from the activity of the wild-type or native polypeptide or which
differs from the activity of the polypeptide in a healthy subject.
An activity of a polypeptide can be aberrant because it is stronger
than the activity of its native counterpart. Alternatively, an
activity can be aberrant because it is weaker or absent relative to
the activity of its native counterpart. An aberrant activity can
also be a change in an activity. For example an aberrant
polypeptide can interact with a different target peptide or
polypeptide. A cell can have an aberrant FBNL activity due to
overexpression or underexpression of a wild-type or mutant FBNL
polypeptide.
[0020] "Biological activity" or "bioactivity" or "activity" or
"biological function", which are used interchangeably, for the
purposes herein means an effector or antigenic function that is
directly or indirectly performed by an FBNL polypeptide (whether in
its native or denatured conformation), bioactivity can be modulated
by directly affecting the binding between an FBNL and an FBNL
binding partner. Alternatively, an IL-1 bioactivity can be
modulated by modulating the level of an FBNL polypeptide, such as
by modulating expression of an FBNL gene.
[0021] As used herein the term "bioactive fragment of an FBNL
polypeptide" refers to a fragment of a full-length FBNL
polypeptide, wherein the fragment specifically mimics or
antagonizes the activity of a wild-type FBNL polypeptide. The
bioactive fragment preferably is a fragment capable of interacting
with an FBNL binding partner.
[0022] "Cells," "host cells" or "recombinant host cells" are terms
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0023] A "chimeric protein" or "fusion protein" is a fusion of a
first amino acid sequence encoding one of the subject polypeptides
with a second amino acid sequence defining a domain (e.g.
polypeptide portion) foreign to and not substantially homologous
with any domain of one of the polypeptides. A chimeric protein may
present a foreign domain which is found (albeit in a different
protein) in an organism which also expresses the first protein, or
it may be an "interspecies", "intergenic", etc. fusion of protein
structures expressed by different kinds of organisms.
[0024] "Complementary" sequences as used herein refer to sequences
which have sufficient complementarily to be able to hybridize,
forming a stable duplex.
[0025] The terms "control" or "control sample" refer to any sample
appropriate to the detection technique employed. The control sample
may contain the products of the allele detection technique employed
or the material to be tested. Further, the controls may be positive
or negative controls. By way of example, where the allele detection
technique is PCR amplification, followed by size fractionation, the
control sample may comprise DNA fragments of an appropriate size.
Likewise, where the allele detection technique involves detection
of a mutated protein, the control sample may comprise a sample of a
mutant protein. However, it is preferred that the control sample
comprises the material to be tested.
[0026] The phrases "disruption of the gene" and "targeted
disruption" or any similar phrase refers to the site specific
interruption of a native DNA sequence so as to prevent expression
of that gene in the cell as compared to the wild-type copy of the
gene. The interruption may be caused by deletions, insertions or
modifications to the gene, or any combination thereof.
[0027] A "delivery complex" shall mean a targeting means (e.g. a
molecule that results in higher affinity binding of a gene,
protein, polypeptide or peptide to a target cell surface and/or
increased cellular uptake by a target cell). Examples of targeting
means include: sterols (e.g. cholesterol), lipids (e.g. a cationic
lipid, virosome or liposome), viruses (e.g. adenovirus,
adeno-associated virus, and retrovirus) or target cell specific
binding agents (e.g. ligands recognized by target cell specific
receptors). Preferred complexes are sufficiently stable in vivo to
prevent significant uncoupling prior to internalization by the
target cell. However, the complex is cleavable under appropriate
conditions within the cell so that the gene, protein, polypeptide
or peptide is released in a functional form.
[0028] As is well known, genes for a particular polypeptide may
exist in single or multiple copies within the genome of an
individual. Such duplicate genes may be identical or may have
certain modifications, including nucleotide substitutions,
additions or deletions, which all still code for polypeptides
having substantially the same activity. The term "DNA sequence
encoding a polypeptide" may thus refer to one or more genes within
a particular individual. Moreover, certain differences in
nucleotide sequences may exist between individual organisms, which
are called alleles. Such allelic differences may or may not result
in differences in amino acid sequence of the encoded polypeptide
yet still encode a protein with the same biological activity.
[0029] An "FBNL" gene or protein refers to a "fibrillin like" gene
or protein that encodes an extracellular matrix protein. cDNA
encoding a portion of the protein is posted in GenBank under
accession number UO3877. FBNL includes genes, proteins and portions
thereof, which are substantially homologous in structure and
function, including fibulin (1 and 2), Fibrillin, nidogen, notch,
protein S and Factor IX.
[0030] As used herein, the term "gene" or "recombinant gene" refers
to a nucleic acid molecule comprising an open reading frame
encoding one of the polypeptides of the present invention,
including both exon and (optionally) intron sequences. A
"recombinant gene" refers to nucleic acid molecule encoding a
polypeptide and comprising protein-encoding exon sequences, though
it may optionally include intron sequences which are derived from a
chromosomal gene. Exemplary recombinant genes encoding the subject
polypeptides are represented in the appended Sequence Listing. The
term "intron" refers to a DNA sequence present in a given gene
which is not translated into protein and is generally found between
exons.
[0031] "Homology" or "identity" or "similarity" refers to sequence
similarity between two peptides or between two nucleic acid
molecules. Homology can be determined by comparing a position in
each sequence which may be aligned for purposes of comparison. When
a position in the compared sequence is occupied by the same base or
amino acid, then the molecules are homologous at that position. A
degree of homology between sequences is a function of the number of
matching or homologous positions shared by the sequences. An
"unrelated" or "non-homologous" sequence shares less than 40%
identity, though preferably less than 25% identity, with one of the
sequences of the present invention.
[0032] "Increased risk" refers to a statistically higher frequency
of occurrence of the disease or condition in an individual carrying
a particular polymorphic allele in comparison to the frequency of
occurrence of the disease or condition in a member of a population
that does not carry the particular polymorphic allele.
[0033] The term "interact" as used herein is meant to include
detectable interactions between molecules, such as can be detected
using, for example, a yeast two hybrid coimmunoprecipitation assay.
The term interact is also meant to include "binding" interactions
between molecules. Interactions may be protein-protein or
protein-nucleic acid in nature.
[0034] The term "isolated" as used herein with respect to nucleic
acids, such as DNA or RNA, refers to molecules separated from other
DNAs or RNAs, respectively, that are present in the natural source
of the macromolecule. For example, an isolated nucleic acid
encoding one of the subject polypeptides preferably includes no
more than 10 kilobases (kb) of nucleic acid sequence which
naturally immediately flanks the gene in genomic DNA, more
preferably no more than 5 kb of such naturally occurring flanking
sequences, and most preferably less than 1.5 kb of such naturally
occurring flanking sequence. The term isolated as used herein also
refers to a nucleic acid or peptide that is substantially free of
cellular material, viral material, or culture medium when produced
by recombinant DNA techniques, or chemical precursors or other
chemicals when chemically synthesized. Moreover, an "isolated
nucleic acid" is meant to include nucleic acid fragments which are
not naturally occurring as fragments and would not be found in the
natural state. The term "isolated" is also used herein to refer to
polypeptides which are isolated from other cellular proteins and is
meant to encompass both purified and recombinant polypeptides. A
"knock-in" transgenic animal refers to an animal that has had a
modified gene introduced into its genome and the modified gene can
be of exogenous or endogenous origin.
[0035] A "knock-out" transgenic animal refers to an animal in which
there is partial or complete suppression of the expression of an
endogenous gene (e.g., based on deletion of at least a portion of
the gene, replacement of at least a portion of the gene with a
second sequence, introduction of stop codons, the mutation of bases
encoding critical amino acids, or the removal of an intron
junction, etc.).
[0036] A "knock-out construct" refers to a nucleic acid sequence
that can be used to decrease or suppress expression of a protein
encoded by endogenous DNA sequences in a cell.
[0037] "Linkage disequilibrium" refers to co-inheritance of two
alleles at frequencies greater than would be expected from the
separate frequencies of occurrence of each allele in a given
control population. The expected frequency of occurrence of two
alleles that are inherited independently is the frequency of the
first allele multiplied by the frequency of the second allele. As
used herein, the term "linkage disequilibrium" also refers to
linked sequences. Alleles that co-occur at expected frequencies are
said to be in "linkage equilibrium" or "not linked". When referring
to allelic patterns that are comprised of more than one allele, a
first allelic pattern is in linkage disequilibrium with a second
allelic pattern if all the alleles that comprise the first allelic
pattern are in linkage disequilibrium with at least one of the
alleles of the second allelic pattern.
[0038] "MD" or "Macular Degeneration" is a clinical term that is
used to describe a variety of diseases that are all characterized
by a progressive loss of central vision associated with
abnormalities of Bruch's membrane and the retinal pigment
epithelium. These disorders include very common conditions that
affect older patients (age related macular degeneration or AMD) as
well as rarer, earlier-onset dystrophies that in some cases can be
detected in the first decade of life. Examples include Malattia
Leventinese and Doyne's Macular Dystrophy.
[0039] An "MD therapeutic" refers to an agent that is useful in
treating or preventing the development of a Macular Degeneration.
Examples include genes, proteins (e.g. glycosylated or
unglycosylated protein, polypeptide or protein) or other organic or
inorganic molecules (e.g. small molecules) that interfere with or
compensate for the biochemical events that are causative of MD.
[0040] A "mutated gene" or "mutation" or "functional mutation"
refers to an allelic form of a gene, which is capable of altering
the phenotype of a subject having the mutated gene relat a subject
which does not have the mutated gene. The altered phenotype caused
by a mutation can be corrected or compensated for by certain
agents. If a subject must be homozygous for this mutation to have
an altered phenotype, the mutation is said to be recessive. If one
copy of the mutated gene is sufficient to alter the phenotype of
the subject, the mutation is said to be dominant. If a subject has
one copy of the mutated gene and has a phenotype that is
intermediate between that of a homozygous and that of a
heterozygous subject (for that gene), the mutation is said to be
co-dominant.
[0041] The "non-human animals" of the invention include mammalians
such as rodents, non-human primates, sheep, dog, cow, chickens,
amphibians, reptiles, etc. Preferred non-human animals are selected
from the rodent family including rat and mouse, most preferably
mouse. The term "chimeric animal" is used herein to refer to
animals in which the recombinant gene is found, or in which the
recombinant is expressed in some but not all cells of the animal.
The term "tissue-specific chimeric animal" indicates that one of
the recombinant genes is present and/or expressed or disrupted in
some tissues but not others.
[0042] As used herein, the term "nucleic acid" refers to
polynucleotides such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as equivalents, analogs of either RNA or DNA
made from nucleotide analogs, and, as applicable to the embodiment
being described, single (sense or antisense) and double-stranded
polynucleotides.
[0043] As used herein, the term "promoter" means a DNA sequence
that regulates expression of a selected DNA sequence operably
linked to the promoter, and which effects expression of the
selected DNA sequence in cells. The term encompasses "tissue
specific" promoters, i.e. promoters, which effect expression of the
selected DNA sequence only in specific cells (e.g. cells of a
specific tissue). The term also covers so-called "leaky" promoters,
which regulate expression of a selected DNA primarily in one
tissue, but cause expression in other tissues as well. The term
also encompasses non-tissue specific promoters and promoters that
constitutively express or that are inducible (i.e. expression
levels can be controlled).
[0044] The terms "protein", "polypeptide" and "peptide" are used
interchangeably herein when referring to a gene product.
[0045] The term "recombinant protein" refers to a polypeptide of
the present invention which is produced by recombinant DNA
techniques, wherein generally, DNA encoding a polypeptide is
inserted into a suitable expression vector which is in turn used to
transform a host cell to produce the heterologous protein.
Moreover, the phrase "derived from", with respect to a recombinant
gene, is meant to include within the meaning of "recombinant
protein" those proteins having an amino acid sequence of a native
protein, or an amino acid sequence similar thereto which is
generated by mutations including substitutions and deletions
(including truncation) of a naturally occurring form of the
protein.
[0046] "Small molecule" as used herein, is meant to refer to a
composition, which has a molecular weight of less than about 5 kD
and most preferably less than about 4 kD. Small molecules can be
nucleic acids, peptides, peptidomimetics, carbohydrates, lipids or
other organic or inorganic molecules.
[0047] As used herein, the term "specifically hybridizes" or
"specifically detects" refers to the ability of a nucleic acid
molecule of the invention to hybridize to at least approximately 6,
12, 20, 30, 50, 100, 150, 200, 300, 350, 400 or 425 consecutive
nucleotides.
[0048] "Transcriptional regulatory sequence" is a generic term used
throughout the specification to refer to DNA sequences, such as
initiation signals, enhancers, and promoters, which induce or
control transcription of protein coding sequences with which they
are operably linked. In preferred embodiments, transcription of one
of the recombinant genes is under the control of a promoter
sequence (or other transcriptional regulatory sequence) which
controls the expression of the recombinant gene in a cell-type in
which expression is intended. It will also be understood that the
recombinant gene can be under the control of transcriptional
regulatory sequences which are the same or which are different from
those sequences which control transcription of the
naturally-occurring forms of proteins.
[0049] As used herein, the term "transfection" means the
introduction of a nucleic acid, e.g., an expression vector, into a
recipient cell by nucleic acid-mediated gene transfer.
"Transformation", as used herein, refers to a process in which a
cell's genotype is changed as a result of the cellular uptake of
exogenous DNA or RNA, and, for example, the transformed cell
expresses a recombinant form of a polypeptide or, in the case of
anti-sense expression from the transferred gene, the expression of
a naturally-occurring form of the protein is disrupted.
[0050] As used herein, the term "transgene" means a nucleic acid
sequence encoding, e.g., one of the polypeptides, or an antisense
transcript thereto, which is partly or entirely heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is
introduced, or, is homologous to an endogenous gene of the
transgenic animal or cell into which it is introduced, but which is
designed to be inserted, or is inserted, into the animal's genome
in such a way as to alter the genome of the cell into which it is
inserted (e.g., it is inserted at a location which differs from
that of the natural gene or its insertion results in a knockout). A
transgene can include one or more transcriptional regulatory
sequences and any other nucleic acid, (e.g. as intron), that may be
necessary for optimal expression of a selected nucleic acid.
[0051] A "transgenic animal" refers to any animal, preferably a
non-human mammal, bird or an amphibian, in which one or more of the
cells of the animal contain heterologous nucleic acid introduced by
way of human intervention, such as by transgenic techniques well
known in the art. The nucleic acid is introduced into the cell,
directly or indirectly by introduction into a precursor of the
cell, by way of deliberate genetic manipulation, such as by
microinjection or by infection with a recombinant virus. The term
genetic manipulation does not include classical cross-breeding, or
in vitro fertilization, but rather is directed to the introduction
of a recombinant DNA molecule. This molecule may be integrated
within a chromosome, or it may be extrachromosomally replicating
DNA. In the typical transgenic animals described herein, the
transgene causes cells to express a recombinant form of one of the
proteins, e.g. either agonistic or antagonistic forms. However,
transgenic animals in which the recombinant gene is silent are also
contemplated, as for example, the FLP or CRE recombinase dependent
constructs described below. Moreover, "transgenic animal" also
includes those recombinant animals in which gene disruption of one
or more genes is caused by human intervention, including both
recombination and antisense techniques.
[0052] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of preferred vector is an episome, i.e.,
a nucleic acid capable of extra-chromosomal replication. Preferred
vectors are those capable of autonomous replication and/expression
of nucleic acids to which they are linked. Vectors capable of
directing the expression of genes to which they are operatively
linked are referred to herein as "expression vectors". In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of "plasmids" which refer generally to circular
double stranded DNA loops which, in their vector form are not bound
to the chromosome. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
[0053] The term "treating" as used herein is intended to encompass
curing as well as ameliorating at least one symptom of a condition
or disease.
[0054] The term "wild-type allele" refers to an allele of a gene
which, when present in two copies in a subject results in a
wild-type phenotype. There can be several different wild-type
alleles of a specific gene, since certain nucleotide changes in a
gene may not affect the phenotype of a subject having two copies of
the gene with the nucleotide changes.
[0055] 4.2 General
[0056] The instant invention is based on linkage studies that have
mapped a macular degeneration causing gene to a region of human
chromosome 2 and on sequencing studies that have identified
mutations in the FBNL gene within the mapped region. As described
in detail in the attached Example 1, linkage has been determined
based on studies performed on eighty-six members of four families
affected with radial drusen. One family was of American origin,
while the other three originated in the Leventine valley of
Switzerland. The pedigrees of these families are shown in FIG.
1.
[0057] As reported in the following Example 1, the gene responsible
for macular degeneration maps on the short arm of chromosome 2.
When mutated, the gene is capable of causing the development of
autosomal dominant radial drusen (malattia leventinese or Doyne's
honeycomb retinal dystrophy). All four families investigated have
very similar clinical features and all four have positive lod
scores (with no recombinants) with the most tightly linked
markers.
[0058] Multipoint analysis revealed a peak lod score of 12 centered
on marker GATA26H10. The lod-1 confidence interval was 8cM.sup.40.
The more conservative estimate of the diseased interval (defined by
observed recombinations) is 14 cM extending from marker D2S1761
(centromeric) to D2S444 telomeric.
[0059] The interval has been haplotypically narrowed by analysis of
the twenty Swiss Malattia Leventinese families. The haplotypic
interval is defined by markers D2S2352-D2S1364 (approximately 1
cM). The American Malattia Leventinese families also share
haplotypic identity with the Swiss families from markers CA-133 to
D2S1364<1 cM.
[0060] Genes that fall in the haplotypically identical Swiss
interval are set forth in the following Table 1:
1TABLE 1 Gen Bank Expression Marker Accession Number (from Unigene)
Description SGC35022 H72600 fetal liver/spleen dual specificity
protein kinase WI-11560 R08151 fetal liver/spleen SGC32447 RO9316
brain SGC34889 M66771 fetal liver/spleen WI-6704 Z38691 infant
brain, fetal heart WI6613 embryo retina, infant brain, fetal
liver/spleen WI12526 similar to spectrin B-g chain B-fodrin brain
WI-11791 R28010 placenta, fetal liver/spleen, melanocytes WI-11399
T87762 fetal liver/spleen (Physical and genetic mapping for each
marker information can be obtained from the Whitehead Institute for
Genome Research (http://www-genome.wi.mit.edu).)
[0061] As described in Example 2, a genetic interval containing the
mutated gene was developed by linkage and haplotype analysis of 36
nuclear families with MD from the United States, Switzerland and
Australia. A list of candidate genes was developed. A sequence
variation was detected in a candidate gene (FBNL) that altered an
amino acid in a non-conservative way. Specifically, this change
alter the first nucleotide of codon 345 from a C to a T thereby
changing the predicted amino acid at this position from an arginine
to a tryptophan. Since different transcription start sites are
possible for this gene, for clarity, the involved nucleotide is
specified as being nucleotide 952 in the cDNA sequence posted as
GenBank accession no. UO3877 (Seq. Id. No. 1). All 36 ML families
(111 157 affected patients)share the same sequence variation. None
of the 494 AMD patients (from the United States, Australia and
Switzerland and the United States) exhibit this change. In
addition, as described in Example 3, the sequence of a Swiss
patient was found to contain a different amino acid change in exon
10: 362 Arg>Gln.
[0062] It is not surprising that mutations in the FBNL gene have
been identified as causing MD. This gene encodes an extracellular
matrix protein which is the single most likely class of molecule to
cause the accumulation of lipofuscin under the retinal pigment
epithelium known as drusen (the hallmark of MD). In addition, its
location is within the genetically defined disease interval.
Thirdly, it has been found to be upregulated in patients with a
genetic form of premature ageing (Werner' syndrome).
[0063] The finding that mutations in FBNL cause macular
degeneration, makes macular degeneration testing a reality.
Diagnostic testing can now be performed on presymptomatic
individuals, who are at risk of developing macular degeneration
based on family history. In addition, tests can be performed on
postsymptomatic individuals diagnosed with macular degeneration
based on an ophthalmologic examination.
[0064] In addition to being used diagnostically, identification of
the involvement of mutations in the FBNL gene in the development of
macular degenerations allows the production of cell-free and
cell-based screening assays and transgenic animals for use in
further studies of the disorder and to identify safe and effective
MD therapeutics.
[0065] The identification of a single gene known to be responsible
for AMD can also improve understanding of the types and classes of
genes that can cause related disorders. In addition, the
identification of one gene product causing a disorder can make it
possible to identify other genes which can cause a similar
phenotype. For example, the identification of the dystrophin gene
has led to the isolation of dystrophin related glycoproteins, at
least one of which plays a role in other forms of muscular
dystrophy. Also, a gene capable of causing a Mendelian disorder,
may contribute to the inheritance of a multifactorial form of the
disorder. A striking example of this has been the identification of
genes involved in various forms of cancer (e g. colon cancer) by
studying familial forms of cancer (e.g. hereditary nonpolyposis
colon cancer and familial adenomatous polyposis). Groden, J. A. et
al.,(1991) Cell 66:589-600; Aaltonen, L. A. (1993) Science
260:812-816). For example, as shown herein, AMD appears to be
allelic to Doyne's macular dystrophy.
[0066] 4.3 Predictive Medicine
[0067] 4.3.1. MD Caussative Mutations
[0068] The invention is based, at least in part, on the
identification of mutations that cause Macular Degeneration (MD).
Because the particular MD mutations may be in linkage
disequilibrium with other alleles, the detection of such other
alleles can also indicate a predisposition to developing MD in a
subject.
[0069] 4.3.2. Detection of Alleles
[0070] Many methods are available for detecting specific alleles at
human polymorphic loci. The preferred method for detecting a
specific polymorphic allele may depend, in part, upon the molecular
nature of the polymorphism. For example, detection of specific
alleles may be nucleic acid techniques based on hybridization,
size, or sequence, such as restriction fragment length polymorphism
(RFLP), nucleic acid sequencing, and allele specific
oligonucleotide (ASO) hybridization. In one embodiment, the methods
comprise detecting in a sample of DNA obtained from a subject the
existence of an allele associated with MD. For example, a nucleic
acid composition comprising a nucleic acid probe including a region
of nucleotide sequence which is capable of hybridizing to a sense
or antisense sequence to an allele associated with MD can be used
as follows: the nucleic acid in a sample is rendered accessible for
hybridization, the probe is contacted with the nucleic acid of the
sample, and the hybridization of the probe to the sample nucleic
acid is detected. Such technique can be used to detect alterations
or allelic variants at either the genomic or mRNA level as well as
to determine mRNA transcript levels, when appropriate.
[0071] A preferred detection method is ASO hybridization using
probes overlapping an allele associated with MD and has about 5,
10, 20, 25, or 30 nucleotides around the mutation or polymorphic
region. In a preferred embodiment of the invention, several probes
capable of hybridizing specifically to other allelic variants
involved in MD are attached to a solid phase support, e.g., a
"chip" (which can hold up to about 250,000 oligonucleotides).
Oligonucleotides can be bound to a solid support by a variety of
processes, including lithography. Mutation detection analysis using
these chips comprising oligonucleotides, also termed "DNA probe
arrays" is described e.g., in Cronin et al., Human Mutation 7:244,
1996. In one embodiment, a chip comprises all the allelic variants
of at least one polymorphic region of a gene. The solid phase
support is then contacted with a test nucleic acid and
hybridization to the specific probes is detected. Accordingly, the
identity of numerous allelic variants of one or more genes can be
identified in a simple hybridization experiment.
[0072] These techniques may also comprise the step of amplifying
the nucleic acid before analysis. Amplification techniques are
known to those of skill in the art and include, but are not limited
to cloning, polymerase chain reaction (PCR), polymerase chain
reaction of specific alleles (ASA), ligase chain reaction (LCR),
nested polymerase chain reaction, self sustained sequence
replication (Guatelli, J. C. et al., Proc. Natl. Acad. Sci. USA
87:1874-78, 1990), transcriptional amplification system (Kwoh, D.
Y. et al., Proc. Natl. Acad. Sci. USA, 86: 1173-77, 1989), and
Q-Beta Replicase (Lizardi, P. M. et al., Bio/Technology 6:1197,
1988).
[0073] Amplification products may be assayed in a variety of ways,
including size analysis, restriction digestion followed by size
analysis, detecting specific tagged oligonucleotide primers in the
reaction products, ASO hybridization, allele specific 5'
exonuclease detection, sequencing, hybridization, and the like.
[0074] PCR based detection means can include multiplex
amplification of a plurality of markers simultaneously. For
example, it is well known in the art to select PCR primers to
generate PCR products that do not overlap in size and can be
analyzed simultaneously. Alternatively, it is possible to amplify
different markers with primers that have detectable labels that are
different and thus can each be differentially detected. Of course,
hybridization based detection means allow the differential
detection of multiple PCR products in a sample. Other techniques
are known in the art to allow multiplex analyses of a plurality of
markers.
[0075] In a merely illustrative embodiment, the method includes the
steps of (i) collecting a sample of cells from a patient, (ii)
isolating nucleic acid (e.g., genomic, mRNA or both) from the cells
of the sample, (iii) contacting the nucleic acid sample with one or
more primers which specifically hybridize to an allele associated
with MD, under conditions such that hybridization and amplification
of the desired marker occurs, and (iv) detecting the amplification
product. These detection schemes are especially useful for the
detection of nucleic acid molecules if such molecules are present
in very low numbers.
[0076] An allele associated with MD can also be identified by
alterations in restriction enzyme cleavage patterns through RFLP
analysis. For example, sample and control DNA is isolated,
amplified (optionally), digested with one or more restriction
endonucleases, and fragment length sizes are determined by gel
electrophoresis through size fractionization.
[0077] In yet another embodiment, any of a variety of sequencing
reactions known in the art can be used to directly sequence a
polymorphic site having at least one allele associated with MD.
Exemplary sequencing reactions include those based on techniques
developed by Maxim and Gilbert (Proc. Natl. Acad. Sci. USA 74:560,
1977) or Sanger (Sanger et al., Proc. Nat. Acad. Sci. USA 74:5463,
1977). It is also contemplated that any of a variety of automated
sequencing procedures may be utilized when performing the subject
assays (Biotechniques 19:448, 1995), including sequencing by mass
spectrometry (see, for example PCT publication WO 94/16101; Cohen
et al., Adv. Chromatogr. 36:127-62, 1996; and Griffin et al., Appl.
Biochem. Biotechnol. 38:147-59, 1993). It will be evident to one
skilled in the art that, for certain embodiments, the occurrence of
only one, two or three of the nucleic acid bases need be determined
in the sequencing reaction. For instance A-track or the like, e.g.,
where only one nucleic acid is detected, can be carried out.
[0078] In a further embodiment, protection from cleavage agents
(such as a nuclease, hydroxylamine or osmium tetroxide and with
piperidine) can be used to detect mismatched bases in RNA/RNA or
RNA/DNA or DNA/DNA heteroduplexes (Myers et al., Science 230:1242,
1985). In general the art technique of "mismatch cleavage" starts
by providing heteroduplexes formed by hybridizing (labelled) RNA or
DNA containing the wild-type allele with the sample. The
double-stranded duplexes are treated with an agent which cleaves
single-stranded regions of the duplex such as which will exist due
to base pair mismatches between the control and sample strands. For
instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA
hybrids treated with S1 nuclease to enzymatically digest the
mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA
duplexes can be treated with hydroxylamine or osmium tetroxide and
with piperidine in order to digest mismatched regions. After
digestion of the mismatched regions, the resulting material is then
separated by size on denaturing polyacrylamide gels to determine
the site of mutation. (See, for example, Cotton et al., Proc. Natl.
Acad. Sci. USA 85:4397, 1988; Saleeba et al., Methods Enzymol.
217:286-95, 1992) In a preferred embodiment, the control DNA or RNA
can have a detectable label.
[0079] In still another embodiment, the mismatch cleavage reaction
employs one or more proteins that recognize mismatched base pairs
in double-stranded DNA (so called "DNA mismatch repair" enzymes).
For example, the mutY enzyme of E. coli cleaves A at G/A mismatches
and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T
mismatches (Hsu et al., Carcinogenesis 15:1657-62, 1994). According
to an exemplary embodiment, an appropriate probe is hybridized to a
cDNA or other DNA product from a test cell(s). The duplex is
treated with a DNA mismatch repair enzyme, and the cleavage
products, if any, can be detected from electrophoresis protocols or
the like. (See, for example, U.S. Pat. No. 5,459,039.)
[0080] In other embodiments, alterations in electrophoretic
mobility will be used to identify an allele associated with MD. For
example, single strand conformation polymorphism (SSCP) may be used
to detect differences in electrophoretic mobility between mutant
and wild type nucleic acids (Orita et al., Proc. Natl. Acad. Sci.
USA 86:2766, 1989, see also Cotton, Mutant Res. 285:125-44, 1993;
and Hayashi, Genet. Anal. Tech. Appl. 9:73-79, 1992.
Single-stranded DNA fragments of sample and control are denatured
and allowed to renature. The secondary structure of single-stranded
nucleic acids varies according to sequence, the resulting
alteration in electrophoretic mobility enables the detection of
even a single base change. The DNA fragments may be labeled or
detected with labeled probes, such as primers with a detectable
label. The sensitivity of the assay may be enhanced by using RNA
(rather than DNA), in which the secondary structure is more
sensitive to a change in sequence. In a preferred embodiment, the
subject method utilizes heteroduplex analysis to separate double
stranded heteroduplex molecules on the basis of changes in
electrophoretic mobility (Keen et al., Trends Genet. 7:5,
1991).
[0081] In yet another embodiment, the movement of an allele
associated with MD in polyacrylamide gels containing a gradient of
denaturant is assayed using denaturing gradient gel electrophoresis
(DGGE) (Myers et al., Nature 313:495, 1985). When DGGE is used as
the method of analysis, DNA will be modified to insure that it does
not completely denature, for example by adding a GC clamp of
approximately 40 bp of high-melting GC-rich DNA by PCR. In a
further embodiment, a temperature gradient is used in place of a
denaturing agent gradient to identify differences in the mobility
of control and sample DNA (Rosenbaum and Reissner, Biophys. Chem.
265:12753, 1987).
[0082] Examples of other techniques for detecting alleles
associated with MD include, but are not limited to, selective
oligonucleotide hybridization, selective amplification, or
selective primer extension. For example, oligonucleotide primers
may be prepared in which the known mutation or nucleotide
difference (e.g., in allelic variants) is placed centrally and then
hybridized to target DNA under conditions which permit
hybridization only if a perfect match is found (Saiki et al.,
Nature 324:163, 1986); Saiki et al., Proc. Natl. Acad. Sci. USA
86:6230, 1989). Such ASO hybridization techniques may be used to
test one mutation or polymorphic region per reaction when
oligonucleotides are hybridized to PCR amplified target DNA or a
number of different mutations or polymorphic regions when the
oligonucleotides are attached to the hybridizing membrane and
hybridized with labelled target DNA.
[0083] Alternatively, allele specific amplification technology
which depends on selective PCR amplification may be used in
conjunction with the instant invention. Oligonucleotides used as
primers for specific amplification may carry the mutation or
polymorphic region of interest in the center of the molecule (so
that amplification depends on differential hybridization) (Gibbs et
al., Nucleic Acids Res. 17:2437-2448, 1989) or at the extreme 3'
end of one primer where, under appropriate conditions, mismatch can
prevent, or reduce polymerase extension (Prossner, Tibtech 11:238,
1993. In addition it may be desirable to introduce a novel
restriction site in the region of the mutation to create
cleavage-based detection (Gasparini et al., Mol. Cell Probes 6:1,
1992). It is anticipated that in certain embodiments amplification
may also be performed using Taq ligase for amplification (Barany,
Proc. Natl. Acad. Sci USA 88:189, 1991). In such cases, ligation
will occur only if there is a perfect match at the 3' end of the 5'
sequence making it possible to detect the presence of a know
mutation at a specific site by looking for the presence or absence
of amplification.
[0084] In another embodiment, identification of the allelic variant
is carried out using an oligonucleotide ligation assay (OLA), as
described, e g., in U.S. Pat. No. 4,998,617 and in Landegren et al,
Science 241:1077-80, 1988. The OLA protocol uses two
oligonucleotides which are designed to be capable of hybridizing to
abutting sequences of a single strand of a target. One of the
oligonucleotides is linked to a separation marker, e.g.,
biotinylated, and the other has a detectable label. If the precise
complementary sequence is found in a target molecule, the
oligonucleotides will hybridize such that their termini abut, and
create a ligation substrate. Ligation then permits the labeled
oligonucleotide to be recovered using avidin, or another biotin
ligand. Nickerson, D. A. et al. have described a nucleic acid
detection assay that combines attributes of PCR and OLA (Nickerson
et al., Proc. Natl. Acad. Sci. USA 87:8923-27, 1990. In this
method, PCR is used to achieve the exponential amplification of
target DNA, which is then detected using OLA.
[0085] Several techniques based on this OLA method have been
developed and can be used to detect alleles associated with MD. For
example, U.S. Pat. No. 5,593,826 discloses an OLA using an
oligonucleotide having 3'-amino group and a 5'-phosphorylated
oligonucleotide to form a conjugate having a phosphoramidate
linkage. In another variation of OLA described in Tobe et al.,
Nucleic Acids Res. 24:3728, 1996, OLA combined with PCR permits
typing of two alleles in a single microtiter well. By marking each
of the allele-specific primers with a unique hapten, i.e.
digoxigenin and fluorescein, each OLA reaction can be detected by
using hapten specific antibodies that are labeled with different
enzyme reporters, alkaline phosphatase or horseradish peroxidase.
This system permits the detection of the two alleles using a high
throughput format that leads to the production of two different
colors.
[0086] Several methods have been developed to facilitate analysis
of single nucleotide polymorphisms. In one embodiment, the single
base polymorphism can be detected by using a specialized
exonuclease-resistant nucleotide, as disclosed, e.g., in U.S. Pat.
No. 4,656,127 (Mundy et al.). According to the method, a primer
complementary to the allelic sequence immediately 3' to the
polymorphic site is permitted to hybridize to a target molecule
obtained from a particular animal or human. If the polymorphic site
on the target molecule contains a nucleotide that is complementary
to the particular exonuclease-resistant nucleotide derivative
present, then that derivative will be incorporated onto the end of
the hybridized primer. Such incorporation renders the primer
resistant to exonuclease, and thereby permits its detection. Since
the identity of the exonuclease-resistant derivative of the sample
is known, a finding that the primer has become resistant to
exonucleases reveals that the nucleotide present in the polymorphic
site of the target molecule was complementary to that of the
nucleotide derivative used in the reaction. This method has the
advantage that it does not require the determination of large
amounts of extraneous sequence data.
[0087] In another embodiment of the invention, a solution-based
method is used for determining the identity of the nucleotide of a
polymorphic site. French Patent 2,650,840; PCT Appln. No.
WO91/02087. As in the Mundy method of U.S. Pat. No. 4,656,127, a
primer is employed that is complementary to allelic sequences
immediately 3' to a polymorphic site. The method determines the
identity of the nucleotide of that site using labeled
dideoxynucleotide derivatives, which, if complementary to the
nucleotide of the polymorphic site will become incorporated onto
the terminus of the primer.
[0088] An alternative method, known as Genetic Bit Analysis or
GBA.TM. is described by Goelet et al. in PCT Appln. No. 92/15712.
The method of Goelet et al. uses mixtures of labeled terminators
and a primer that is complementary to the sequence 3' to a
polymorphic site. The labeled terminator that is incorporated is
thus determined by, and complementary to, the nucleotide present in
the polymorphic site of the target molecule being evaluated. In
contrast to the method of Cohen et al., French Patent 2,650,840 and
PCT Appln. No. WO91/02087, the method of Goelet et al. is
preferably a heterogeneous phase assay, in which the primer or the
target molecule is immobilized to a solid phase.
[0089] Recently, several primer-guided nucleotide incorporation
procedures for assaying polymorphic sites in DNA have been
described (Komher et al., Nucleic Acids Res. 17:7779-84, 1989;
Sokolov, Nucleic Acids Res. 18:3671, 1990; Syvanen et al., Genomics
8:684-92, 1990; Kuppuswamy et al., Proc. Natl. Acad. Sci. USA
88:1143-47, 1991; Prezant et al., Hum. Mutat. 1:159-64, 1992;
Ugozzoli et al., GATA 9:107-12, 1992; Nyren et al., Anal. Biochem.
208:171-75, 1993). These methods differ from GBA.TM. in that they
all rely on the incorporation of labeled deoxynucleotides to
discriminate between bases at a polymorphic site. In such a format,
since the signal is proportional to the number of deoxynucleotides
incorporated, polymorphisms that occur in runs of the same
nucleotide can result in signals that are proportional to the
length of the run (Syvanen, et al., Amer. J. Hum. Genet. 52:46-59,
1993).
[0090] For mutations that produce premature termination of protein
translation, the protein truncation test (PTT) offers an efficient
diagnostic approach (Roest et. al., Hum. Mol. Genet. 2:1719-21,
1993; van der Luijt et. al., Genomics 20:1-4, 1994). For PTT, RNA
is initially isolated from available tissue and
reverse-transcribed, and the segment of interest is amplified by
PCR. The products of reverse transcription PCR are then used as a
template for nested PCR amplification with a primer that contains
an RNA polymerase promoter and a sequence for initiating eukaryotic
translation. After amplification of the region of interest, the
unique motifs incorporated into the primer permit sequential in
vitro transcription and translation of the PCR products. Upon
sodium dodecyl sulfate-polyacrylamide gel electrophoresis of
translation products, the appearance of truncated polypeptides
signals the presence of a mutation that causes premature
termination of translation. In a variation of this technique, DNA
(as opposed to RNA) is used as a PCR template when the target
region of interest is derived from a single exon.
[0091] In still another method known as Dynamic Allele Specific
Hybridization (DASH), a target sequence is amplified by PCR in
which one primer is biotinylated. The biotinylated product strand
is bound to a streptavidin or avidin coated microtiter plate well,
and the non-biotinylated strand is rinsed away with alkali. An
oligonucleotide probe, specific for one allele, is hybridized to
the target at low temperature. This forms a duplex DNA region that
interacts with a double strand-specific intercalating dye. Upon
excitation, the dye emits fluorescence proportional to the amount
of double stranded DNA (probe-target duplex) present. The sample is
then steadily heated while fluorescence is continually monitored. A
rapid fall in fluorescence indicates the denaturing (or "melting")
temperature of the probe-target duplex. When performed under
appropriate buffer and dye conditions, a single-base mismatch
between the probe and the target results in a dramatic lowering of
melting temperature (Tm) that can be easily detected (Howell, W. M.
et al., (1999) Nature Biotechnology 17:)87-88.
[0092] Any cell type or tissue may be utilized in the diagnostics
described herein. In a preferred embodiment the DNA sample is
obtained from a bodily fluid obtained by known techniques.
Alternatively, nucleic acid tests can be performed on dry samples
(e.g. hair or skin).
[0093] Diagnostic procedures may also be performed in situ directly
upon tissue sections (fixed and/or frozen) of patient tissue
obtained from biopsies or resections, such that no nucleic acid
purification is necessary. Nucleic acid reagents may be used as
probes and/or primers for such in situ procedures (see, for
example, Nuovo, PCR in situ Hybridization: Protocols and
Applications (Raven Press, N.Y. 1992)).
[0094] In addition to methods which focus primarily on the
detection of one nucleic acid sequence, profiles may also be
assessed in such detection schemes. Fingerprint profiles may be
generated, for example, by utilizing a differential display
procedure, Northern analysis and/or RT-PCR.
[0095] Another embodiment of the invention is directed to kits.
This kit may contain one or more oligonucleotides, including 5' and
3' oligonucleotides that hybridize 5' and 3' to a polymorphic site
having as allele associated with MD or detection oligonucleotides
that hybridize directly to an allele associate with MD. The kit may
also contain one or more oligonucleotides capable of hybridizing
near or at other alleles that are in linkage disequilibrium with an
MD causing allele (mutation). PCR amplification oligonucleotides
should hybridize between 25 and 2500 base pairs apart, preferably
between about 100 and about 500 bases apart, in order to produce a
PCR product of convenient size for subsequent analysis.
[0096] For use in a kit, oligonucleotides may be any of a variety
of natural and/or synthetic compositions such as synthetic
oligonucleotides, restriction fragments, cDNAs, synthetic peptide
nucleic acids (PNAs), and the like. The assay kit and method may
also employ oligonucleotides having detectable labels to allow ease
of identification in the assays. Examples of labels which may be
employed include radio-labels, enzymes, fluorescent compounds,
streptavidin, avidin, biotin, magnetic moieties, metal binding
moieties, antigen or antibody moieties, and the like.
Oligonucleotides useful in kits as well as other aspects of the
present invention are selected from the group consisting of any
oligonucleotides that overlap or are contained in SEQ. ID. Nos. 3
and 4.
[0097] One of skill in the art can readily determine additional
useful oligonucleotide sequences based on the sequences provided
herein.
[0098] The kit may, optionally, also include DNA sampling means;
DNA purification reagents such as Nucleon.TM. kits, lysis bluffers,
proteinase solutions and the like; PCR reagents, such as 10.times.
reaction buffers, thermostable polymerase, dNTPs, and the like; and
DNA detection means such as appropriate restriction enzymes, allele
specific oligonucleotides, degenerate oligonucleotide primers for
nested PCR.
[0099] 4.3.3. Pharmacogenomics
[0100] Knowledge of the particular MD associated mutations, alone
or in conjunction with information on other genetic defects
contributing to MD (the genetic profile of MD) allows a
customization of the therapy to the individual's genetic profile,
the goal of "pharmacogenomics". Thus, comparison of a subject's
particular genetic profile to the genetic profile of MD, permits
the selection or design of drugs that are expected to be safe and
efficacious for a particular patient or patient population (i.e., a
group of patients having the same genetic alteration).
[0101] The ability to target populations expected to show the
highest clinical benefit, based on genetic profile, can enable: 1)
the repositioning of marketed drugs with disappointing market
results; 2) the rescue of drug candidates whose clinical
development has been discontinued as a result of safety or efficacy
limitations, which are patient subgroup-specific; and 3) an
accelerated and less costly development for drug candidates and
more optimal drug labeling (e.g. since measuring the effect of
various doses of an agent on an MD causative mutation is useful for
optimizing effective dose).
[0102] Cells of a subject may also be obtained before and after
administration of a candidate MD therapeutic to detect the level of
expression of genes other than FBNL, to verify that the therapeutic
does not increase or decrease the expression of genes which could
be deleterious. This can be done, e.g., by using the method of
transcriptional profiling. Thus, mRNA from cells exposed in vivo to
a therapeutic and mRNA from the same type of cells that were not
exposed to the therapeutic could be reverse transcribed and
hybridized to a chip containing DNA from numerous genes) to thereby
compare the expression of genes in cells treated and not treated
with the therapeutic.
[0103] 4.4. MD Therapeutics
[0104] 4.4.1 MD Therapeutics
[0105] Agents that are useful in treating or preventing the
development of a Macular Degeneration can comprise nucleic acids
(e.g. genes, fragments thereof, antisense molecule, proteins (e.g.
glycosylated or unglycosylated protein, polypeptide or protein) or
other organic or inorganic molecules (e.g. small molecules) that
interfere with or compensate for the biochemical events that are
causative of MD. The following describes in vitro and in vivo
assays for identifying and/or testing candidate MD
therapeutics.
[0106] 4.4.2. Cell Based and Cell Free Assays for Identifying MD
Therapeutics
[0107] In many drug screening programs which test libraries of
compounds and natural extracts, high throughput assays are
desirable in order to maximize the number of compounds surveyed in
a given period of time. Assays which are performed in cell-free
systems, such as may be derived with purified or semi-purified
proteins, are often preferred as "primary" screens in that they can
be generated to permit rapid development and relatively easy
detection of an alteration in a molecular target which is mediated
by a test compound. Moreover, the effects of cellular toxicity
and/or bioavailability of the test compound can be generally
ignored in the in vitro system, the assay instead being focused
primarily on the effect of the drug on the molecular target as may
be manifest in an alteration of binding affinity with upstream or
downstream elements.
[0108] Accordingly, in an exemplary screening assay of the present
invention, the compound of interest is contacted with a protein
which may function upstream (including both activators (enhancers)
and repressors of its activity) or to proteins and/or nucleic acids
(e.g. promoter) which may function downstream of the FBNL
polypeptide, whether they are positively or negatively regulated by
it. To the mixture of the compound and the upstream or downstream
element is then added a composition containing an FBNL polypeptide.
Detection and quantification of complexes of FBNL with it's
upstream or downstream elements provide a means for determining a
compound's efficacy at antagonizing (inhibiting) or agonizing
(potentiating) complex formation between an FBNL protein and an
FBNL binding element (e.g. protein or nucleic acid). The efficacy
of the compound can be assessed by generating dose response curves
from data obtained using various concentrations of the test
compound. Moreover, a control assay can also be performed to
provide a baseline for comparison. In the control assay, isolated
and purified FBNL polypeptide is added to a composition containing
the FBNL binding element, and the formation of a complex is
quantitated in the absence of the test compound.
[0109] Complex formation between the FBNL polypeptide and a binding
element may be detected by a variety of techniques. Modulation of
the formation of complexes can be quantitated using, for example,
detectably labeled proteins such as radiolabeled, fluorescently
labeled, or enzymatically labeled FBNL polypeptides, by
immunoassay, or by chromatographic detection.
[0110] Typically, it will be desirable to immobilize either FBNL
protein or its binding protein to facilitate separation of
complexes from uncomplexed forms of one or both of the proteins, as
well as to accommodate automation of the assay. Binding of FBNL to
an upstream or downstream element, in the presence or absence of a
candidate agent, can be accomplished in any vessel suitable for
containing the reactants. Examples include microtitre plates, test
tubes, and micro-centrifuge tubes. In one embodiment, a fusion
protein can be provided which adds a domain that allows the protein
to be bound to a matrix. For example,
glutathione-S-transferase/FBNL (GST/FBNL) fusion proteins can be
adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
Louis, Mo.) or glutathione derivatized microtitre plates, which are
then combined with the cell lysates, e.g. an .sup.35S-labeled, and
the test compound, and the mixture incubated under conditions
conducive to complex formation, e.g. at physiological conditions
for salt and pH, though slightly more stringent conditions may be
desired. Following incubation, the beads are washed to remove any
unbound label, and the matrix immobilized and radiolabel determined
directly (e.g. beads placed in scintillant), or in the supernatant
after the complexes are subsequently dissociated. Alternatively,
the complexes can be dissociated from the matrix, separated by
SDS-PAGE, and the level of FBNL-binding protein found in the bead
fraction quantitated from the gel using standard electrophoretic
techniques .
[0111] Other techniques for immobilizing proteins on matrices are
also available for use in the subject assay. For instance, an FBNL
protein or its cognate binding protein can be immobilized utilizing
conjugation of biotin and streptavidin. For instance, biotinylated
molecules can be prepared from biotin-NHS (N-hydroxy-succinimide)
using techniques well known in the art (e.g., biotinylation kit,
Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96 well plates (Pierce Chemical).
Alternatively, antibodies reactive with FBNL or with a protein
encoded by a gene that is up- or down- regulated by FBNL can be
derivatized to the wells of the plate, and protein trapped in the
wells by antibody conjugation. As above, preparations of a binding
protein and a test compound are incubated in the protein presenting
wells of the plate, and the amount of complex trapped in the well
can be quantitated. Exemplary methods for detecting such complexes,
in addition to those described above for the GST-immobilized
complexes, include immunodetection of complexes using antibodies
reactive with the protein binding element, or which are reactive
with the FBNL protein; as well as enzyme-linked assays which rely
on detecting an enzymatic activity associated with the binding
element, either intrinsic or extrinsic activity. In the instance of
the latter, the enzyme can be chemically conjugated or provided as
a fusion protein with the binding partner. To illustrate, the
binding partner can be chemically cross-linked or genetically fused
with horseradish peroxidase, and the amount of polypeptide trapped
in the complex can be assessed with a chromogenic substrate of the
enzyme, e.g. 3,3'-diamino-benzadine terahydrochloride or
4-chloro-1-napthol. Likewise, a fusion protein comprising the
polypeptide and glutathione-S-transferase can be provided, and
complex formation quantitated by detecting the GST activity using
1-chloro-2,4-dinitrobenze- ne (Habig et al. (1974) J Biol Chem
249:7130).
[0112] For processes which rely on immunodetection for quantitating
one of the proteins trapped in the complex, antibodies against the
protein can be used. Alternatively, the protein to be detected in
the complex can be "epitope tagged" in the form of a fusion protein
which includes, in addition to the FBNL sequence, a second
polypeptide for which antibodies are readily available (e.g. from
commercial sources). For instance, the GST fusion proteins
described above can also be used for quantification of binding
using antibodies against the GST moiety. Other useful epitope tags
include myc-epitopes (e.g., see Ellison et al. (1991) J Biol Chem
266:21150-21157) which includes a 10-residue sequence from c-myc,
as well as the pFLAG system (International Biotechnologies, Inc.)
or the pEZZ-protein A system (Pharamacia, N.J.). Transcription
factor-DNA binding assays are described in U.S. Pat. No. 5,563,036,
which is owned by Tularik and is specifically incorporated by
reference herein.
[0113] Further, an in vitro assays can be used to detect compounds
which can be used for treatment of MD. For example, cells can be
engineered to express an FBNL gene (wildtype or mutant) in
operative linkage with a reporter gene construct, such as
luciferase or chloramphenicol acetyl transferase, or other reporter
gene known in the art. Cells can then be contacted with test
compounds and the rate or level of FBNL expression can be assayed
to identify agonists or antagonists.
[0114] Also, a DNA footprinting assay can be used to detect
compounds which alter the binding of an FBNL protein to nucleic
acids (see for example, Zhong et al. 1994 Mol. Cell Biol. 14:7276).
Further, FBNL may be transitionally or post-transitionally modified
by processes such as mRNA editing or protein truncation. Assays to
specifically monitor these processes can be performed according to
protocols, which are well-known in the art.
[0115] In addition to cell-free assays, such as described above,
the FBNL proteins provided by the present invention also
facilitates the generation of cell-based assays for identifying
small molecule agonists/antagonists and the like. For example,
cells can be caused to overexpress a recombinant FBNL protein in
the presence and absence of a test agent of interest, with the
assay scoring for modulation in FBNL responses by the target cell
mediated by the test agent. As with the cell-free assays, agents
which produce a statistically significant change in FBNL-dependent
responses (either inhibition or potentiation) can be
identified.
[0116] Exemplary cell lines may include retinal pigment epithelial
cell lines. Further, the transgenic animals discussed herein may be
used to generate cell lines, containing one or more cell types
involved in MD, that can be used as cell culture models for this
disorder. While primary cultures may be utilized, the generation of
continuous cell lines is preferred. For examples of techniques
which may be used to derive a continuous cell line from the
transgenic animals, see Small et al., 1985, Mol. Cell Biol.
5:642-648.
[0117] For example, the effect of a test compound on a variety of
end points could be tested. Similarly, epithelial cells can be
treated with test compounds or transfected with genetically
engineered FBNL genes. Monitoring the influence of compounds on
cells may be applied not only in basic drug screening, but also in
clinical trials. In such clinical trials, the expression of a panel
of genes may be used as a "read out" of a particular drug's
therapeutic effect.
[0118] In yet another aspect of the invention, the subject FBNL
polypeptides can be used in a "two hybrid" assay (see, for example,
U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232;
Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al.
(1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene
8:1693-1696; and Brent WO94/10300), for isolating coding sequences
for other cellular proteins which bind to or interact with an
FBNL(e.g., FBNL binding proteins" or "FBNLbp").
[0119] Briefly, the two hybrid assay relies on reconstituting in
vivo a functional transcriptional activator protein from two
separate fusion proteins. In particular, the method makes use of
chimeric genes which express hybrid proteins. To illustrate, a
first hybrid gene comprises the coding sequence for a DNA-binding
domain of a transcriptional activator fused in frame to the coding
sequence for an FBNL polypeptide. The second hybrid protein encodes
a transcriptional activation domain fused in frame to a sample gene
from a cDNA library. If the bait and sample hybrid proteins are
able to interact, e.g., form an FBNL dependent complex, they bring
into close proximity the two domains of the transcriptional
activator. This proximity is sufficient to cause transcription of a
reporter gene which is operably linked to a transcriptional
regulator) site responsive to the transcriptional activator, and
expression of the reporter gene can be detected and used to score
for the interaction of the FBNL and sample proteins.
[0120] 4.4.3 Transgenic Animals for Identifying MD Therapeutics
[0121] Transgenic animals can also be made to identify MD
therapeutics, to confirm the safety and efficacy of a candidate
therapeutic or to study drusen formation. Transgenic animals of the
invention can include non-human animals containing an MD causative
mutation under the control of an appropriate homologous or
heterologous promoter.
[0122] Methods for obtaining transgenic non-human animals are well
known in the art. In preferred embodiments, the expression of an MD
causative mutation is restricted to specific subsets of cells,
tissues or developmental stages utilizing, for example, cis-acting
sequences that control expression in the desired pattern. In the
present invention, such mosaic expression can be essential for many
forms of lineage analysis and can additionally provide a means to
assess the effects of, for example, expression level which might
grossly alter development in small patches of tissue within an
otherwise normal embryo. Toward this end, tissue-specific
regulatory sequences and conditional regulatory sequences can be
used to control expression of the mutation in certain spatial
patterns. Moreover, temporal patterns of expression can be provided
by, for example, conditional recombination systems or prokaryotic
transcriptional regulatory sequences. Genetic techniques, which
allow for the expression of the mutation can be regulated via
site-specific genetic manipulation in vivo, are known to those
skilled in the art.
[0123] The transgenic animals of the present invention all include
within a plurality of their cells an MD causative mutation
transgene of the present invention, which transgene alters the
phenotype of the "host cell". In an illustrative embodiment, either
the crelloxP recombinase system of bacteriophage P1 (Lakso et al.
(1992) PNAS 89:6232-6236; Orban et al. (1992) PNAS 89:6861-6865) or
the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et
al. (1991) Science 251:1351-1355; PCT publication WO 92/15694) can
be used to generate in vivo site-specific genetic recombination
systems. Cre recombinase catalyzes the site-specific recombination
of an intervening target sequence located between loxP sequences.
loxP sequences are 34 base pair nucleotide repeat sequences to
which the Cre recombinase binds and are required for Cre
recombinase mediated genetic recombination. The orientation of loxP
sequences determines whether the intervening target sequence is
excised or inverted when Cre recombinase is present (Abremski et
al. (1984) J. Biol. Chem. 259:1509-1514); catalyzing the excision
of the target sequence when the loxP sequences are oriented as
direct repeats and catalyzes inversion of the target sequence when
loxP sequences are oriented as inverted repeats.
[0124] Accordingly, genetic recombination of the target sequence is
dependent on expression of the Cre recombinase. Expression of the
recombinase can be regulated by promoter elements which are subject
to regulatory control, e.g., tissue-specific, developmental
stage-specific, inducible or repressible by externally added
agents. This regulated control will result in genetic recombination
of the target sequence only in cells where recombinase expression
is mediated by the promoter element. Thus, the activation of
expression of a mutation containing transgene can be regulated via
control of recombinase expression.
[0125] Use of the crelloxP recombinase system to regulate
expression of a mutation containing transgene requires the
construction of a transgenic animal containing transgenes encoding
both the Cre recombinase and the subject protein. Animals
containing both the Cre recombinase and the mutation transgene can
be provided through the constriction of "double" transgenic
animals. A convenient method for providing such animals is to mate
two transgenic animals each containing a transgene.
[0126] Similar conditional transgenes can be provided using
prokaryotic promoter sequences which require prokaryotic proteins
to be simultaneous expressed in order to facilitate expression of
the transgene. Exemplary promoters and the corresponding
trans-activating prokaryotic proteins are given in U.S. Pat. No.
4,833,080.
[0127] Moreover, expression of the conditional transgenes can be
induced by gene therapy-like methods wherein a gene encoding the
transactivating protein, e.g. a recombinase or a prokaryotic
protein, is delivered to the tissue and caused to be expressed,
such as in a cell-type specific manner. By this method, the
transgene could remain silent into adulthood until "turned on" by
the introduction of the transactivator.
[0128] In an exemplary embodiment, the "transgenic non-human
animals" of the invention are produced by introducing transgenes
into the germline of the non-human animal. Embryonal target cells
at various developmental stages can be used to introduce
transgenes. Different methods are used depending on the stage of
development of the embryonal target cell, The specific line(s) of
any animal used to practice this invention are selected for general
good health, good embryo yields, good pronuclear visibility in the
embryo, and good reproductive fitness. In addition, the haplotype
is a significant factor. For example, when transgenic mice are to
be produced, strains such as C57BL/6 or FVB lines are often used
(Jackson Laboratory, Bar Harbor, Me.). Preferred strains are those
with H-2.sup.b, H-2.sub.d or H-2.sup.q haplotypes such as C57BL/6
or DBA/1. The line(s) used to practice this invention may
themselves be transgenics, and/or may be knockouts (i.e., obtained
from animals which have one or more genes partially or completely
suppressed) . In one embodiment, the transgene construct is
introduced into a single stage embryo. The zygote is the best
target for microinjection. In the mouse, the male pronucleus
reaches the size of approximately 20 micrometers in diameter Which
allows reproducible injection of 1-2 pl of DNA solution. The use of
zygotes as a target for gene transfer has a major advantage in that
in most cases the injected DNA will be incorporated into the host
gene before the first cleavage (Brinster et al. (1985) PNAS
82:4438-4442). As a consequence, all cells of the transgenic animal
will carry the incorporated transgene. This will in general also be
reflected in the efficient transmission of the transgene to
offspring of the founder since 50% of the germ cells will harbor
the transgene.
[0129] Normally, fertilized embryos are incubated in suitable media
until the pronuclei appear. At about this time, the nucleotide
sequence comprising the transgene is introduced into the female or
male pronucleus as described below. In some species such as mice,
the male pronucleus is preferred. It is most preferred that the
exogenous genetic material be added to the male DNA complement of
the zygote prior to its being processed by the ovum nucleus or the
zygote female pronucleus. It is thought that the ovum nucleus or
female pronucleus release molecules which affect the male DNA
complement, perhaps by replacing the protamines of the male DNA
with histones, thereby facilitating the combination of the female
and male DNA complements to form the diploid zygote.
[0130] Thus, it is preferred that the exogenous genetic material be
added to the male complement of DNA or any other complement of DNA
prior to its being affected by the female pronucleus. For example,
the exogenous genetic material is added to the early male
pronucleus, as soon as possible after the formation of the male
pronucleus, which is when the male and female pronuclei are well
separated and both are located close to the cell membrane.
Alternatively, the exogenous genetic material could be added to the
nucleus of the sperm after it has been induced to undergo
decondensation. Sperm containing the exogenous genetic material can
then be added to the ovum or the decondensed sperm could be added
to the ovum with the transgene constructs being added as soon as
possible thereafter.
[0131] Introduction of the transgene nucleotide sequence into the
embryo may be accomplished by any means known in the art such as,
for example, microinjection, electroporation, or lipofection.
Following introduction of the transgene nucleotide sequence into
the embryo, the embryo may be incubated in vitro for varying
amounts of time, or reimplanted into the surrogate host, or both.
In vitro incubation to maturity is within the scope of this
invention. One common method in to incubate the embryos in vitro
for about 1-7 days, depending on the species, and then reimplant
them into the surrogate host.
[0132] For the purposes of this invention a zygote is essentially
the formation of a diploid cell which is capable of developing into
a complete organism. Generally, the zygote will be comprised of an
egg containing a nucleus formed, either naturally or artificially,
by the fusion of two haploid nuclei from a gamete or gametes. Thus,
the gamete nuclei must be ones which are naturally compatible,
i.e., ones which result in a viable zygote capable of undergoing
differentiation and developing into a functioning organism.
Generally, a euploid zygote is preferred. If an aneuploid zygote is
obtained, then the number of chromosomes should not vary by more
than one with respect to the euploid number of the organism from
which either gamete originated.
[0133] In addition to similar biological considerations, physical
ones also govern the amount (e.g., volume) of exogenous genetic
material which can be added to the nucleus of the zygote or to the
genetic material which forms a part of the zygote nucleus. If no
genetic material is removed, then the amount of exogenous genetic
material which can be added is limited by the amount which will be
absorbed without being physically disruptive. Generally, the volume
of exogenous genetic material inserted will not exceed about 10
picoliters The physical effects of addition must not be so great as
to physically destroy the viability of the zygote. The biological
limit of the number and variety of DNA sequences will vary
depending upon the particular zygote and functions of the exogenous
genetic material and will be readily apparent to one skilled in the
art, because the genetic material, including the exogenous genetic
material, of the resulting zygote must be biologically capable of
initiating and maintaining the differentiation and development of
the zygote into a functional organism.
[0134] The number of copies of the transgene constructs which are
added to the zygote is dependent upon the total amount of exogenous
genetic material added and will be the amount which enables the
genetic transformation to occur. Theoretically only one copy is
required; however, generally, numerous copies are utilized, for
example, 1,000-20,000 copies of the transgene construct, in order
to insure that one copy is functional. As regards the present
invention, there will often be an advantage to having more than one
functioning copy of each of the inserted exogenous DNA sequences to
enhance the phenotypic expression of the exogenous DNA
sequences.
[0135] Any technique which allows for the addition of the exogenous
genetic material into nucleic genetic material can be utilized so
long as it is not destructive to the cell, nuclear membrane or
other existing cellular or genetic structures. The exogenous
genetic material is preferentially inserted into the nucleic
genetic material by microinjection. Microinjection of cells and
cellular structures is known and is used in the art.
[0136] Reimplantation is accomplished using standard methods.
Usually, the surrogate host is anesthetized, and the embryos are
inserted into the oviduct. The number of embryos implanted into a
particular host will vary by species, but will usually be
comparable to the number of off spring the species naturally
produces.
[0137] Transgenic offspring of the surrogate host may be screened
for the presence and/or expression of the transgene by any suitable
method. Screening is often accomplished by Southern blot or
Northern blot analysis, using a probe that is complementary to at
least a portion of the transgene. Western blot analysis using an
antibody against the protein encoded by the transgene may be
employed as an alternative or additional method for screening for
the presence of the transgene product. Typically, DNA is prepared
from tail tissue and analyzed by Southern analysis or PCR for the
transgene. Alternatively, the tissues or cells believed to express
the transgene at the highest levels are tested for the presence and
expression of the transgene using Southern analysis or PCR,
although any tissues or cell types may be used for this
analysis.
[0138] Alternative or additional methods for evaluating the
presence of the transgene include, without limitation, suitable
biochemical assays such as enzyme and/or immunological assays,
histological stains for particular marker or enzyme activities,
flow cytometric analysis, and the like. Analysis of the blood may
also be useful to detect the presence of the transgene product in
the blood, as well as to evaluate the effect of the transgene on
the levels of various types of blood cells and other blood
constituents.
[0139] Progeny of the transgenic animals may be obtained by mating
the transgenic animal with a suitable partner, or by in vitro
fertilization of eggs and/or sperm obtained from the transgenic
animal. Where mating with a partner is to be performed, the partner
may or may not be transgenic and/or a knockout; where it is
transgenic, it may contain the same or a different transgene, or
both. Alternatively, the partner may be a parental line. Where in
vitro fertilization is used, the fertilized embryo may be implanted
into a surrogate host or incubated in vitro, or both. Using either
method, the progeny may be evaluated for the presence of the
transgene using methods described above, or other appropriate
methods.
[0140] The transgenic animals produced in accordance with the
present invention will include exogenous genetic material. Further,
in such embodiments the sequence will be attached to a
transcriptional control element, e.g., a promoter, which preferably
allows the expression of the transgene product in a specific type
of cell.
[0141] Retroviral infection can also be used to introduce the
transgene into a non-human animal. The developing non-human embryo
can be cultured in vitro to the blastocyst stage. During this time,
the blastomeres can be targets for retroviral infection (Jaenich,
R. (1976) PNAS 73:1260-1264). Efficient infection of the
blastomeres is obtained by enzymatic treatment to remove the zona
pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral
vector system used to introduce the transgene is typically a
replication-defective retrovirus carrying the transgene (Jahner et
al. (1985) PNAS 82:6927-6931; Van der Putten et at. (1985) PNAS
82:6148-6152). Transfection is easily and efficiently obtained by
culturing the blastomeres on a monolayer of virus-producing cells
(Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388).
Alternatively, infection can be performed at a later stage. Virus
or virus-producing cells can be injected into the blastocoele
(Jahner et al. (1982) Nature 298:623-628). Most of the founders
will be mosaic for the transgene since incorporation occurs only in
a subset of the cells which formed the transgenic non-human animal.
Further, the founder may contain various retroviral insertions of
the transgene at different positions in the genome which generally
will segregate in the offspring. In addition, it is also possible
to introduce transgenes into the germ line by intrauterine
retroviral infection of the midgestation embryo (Jahner et al.
(1982) supra).
[0142] A third type of target cell for transgene introduction is
the embryonal stem cell (ES). ES cells are obtained from
pre-implantation embryos cultured in vitro and fused with embryos
(Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984)
Nature 309:255-258; Gossler et al. (1986) PNAS 83: 9065-9069; and
Robertson et al. (1986) Nature 322:445-448). Transgenes can be
efficiently introduced into the ES cells by DNA transfection or by
retrovirus-mediated transduction. Such transformed ES cells can
thereafter be combined with blastocysts from a non-human animal.
The ES cells thereafter colonize the embryo and contribute to the
germ line of the resulting chimeric animal. For review see
Jaenisch, R. (1988) Science 240:1468-1474.
[0143] 4.5 Methods of Treatment
[0144] 4.5.1. Effective Dose
[0145] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining The LD.sub.50 (the
dose lethal to 50% of the population) and the Ed.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds
which exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects may be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissues in order to minimize potential damage
to uninfected cells and, thereby, reduce side effects.
[0146] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED.sub.50 with
little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose may be formulated in
animal models to achieve a circulating plasma concentration range
that includes the IC.sub.50 (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of symptoms) as
determined in cell culture. Such information can be used to more
accurately determine useful doses in humans. Levels in plasma may
be measured, for example, by high performance liquid
chromatography.
[0147] 4.5.2. Formulation and Use
[0148] Pharmaceutical compositions for use in accordance with the
present invention may be formulated in a conventional manner using
one or more physiologically acceptable carriers or excipients.
Thus, the compounds and their physiologically acceptable salts and
solvates may be formulated for administration by, for example,
injection, inhalation or insufflation (either through the mouth or
the nose) or oral, buccal, parenteral or rectal administration.
[0149] For such therapy, the compounds of the invention can be
formulated for a variety of loads of administration, including
systemic and topical or localized administration. Techniques and
formulations generally may be found in Remmington's Pharmaceutical
Sciences, Meade Publishing Co., Easton, Pa. For systemic
administration, injection is preferred, including intramuscular,
intravenous, intraperitoneal, and subcutaneous. For injection, the
compounds of the invention can be formulated in liquid solutions,
preferably in physiologically compatible buffers such as Hank's
solution or Ringer's solution. In addition, the compounds may be
formulated in solid form and redissolved or suspended immediately
prior to use. Lyophilized forms are also included.
[0150] For oral administration, the pharmaceutical compositions may
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulfate). The tablets may be
coated by methods well known in the art. Liquid preparations for
oral administration may take the form of, for example, solutions,
syrups or suspensions, or they may be presented as a dry product
for constitution with water or other suitable vehicle before use.
Such liquid preparations may be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., ationd oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations may
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0151] Preparations for oral administration may be suitably
formulated to give controlled release of the active compound. For
buccal administration the compositions may take the form of tablets
or lozenges formulated in conventional manner. For administration
by inhalation, the compounds for use according to the present
invention are conveniently delivered in the form of an aerosol
spray presentation from pressurized packs or a nebuliser, with the
use of a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethan- e, carbon dioxide
or other suitable gas. In the case of a pressurized aerosol the
dosage unit may be determined by providing a valve to deliver a
metered amount. Capsules and cartridges of e.g., gelatin for use in
an inhaler or insufflator may be formulated containing a powder mix
of the compound and a suitable powder base such as lactose or
starch.
[0152] The compounds may be formulated for parenteral
administration by injection, e g., by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form, e.g., in ampoules or in multi-dose containers, with an
added preservative. The compositions may take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient may
be in powder form for constitution with a suitable vehicle, e.g.,
sterile pyrogen-free water, before use.
[0153] The compounds may also be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing
conventional suppository bases such as cocoa butter or other
glycerides.
[0154] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds may be formulated with
suitable polymeric or hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt. Other suitable delivery systems include microspheres which
offer the possibility of local noninvasive delivery of drugs over
an extended period of time. This technology utilizes microspheres
of precapillary size which can be injected via a coronary catheter
into any selected part of the e.g. heart or other organs without
causing inflammation or ischemia. The administered therapeutic is
slowly released from these microspheres and taken tip by
surrounding tissue cells (e.g. endothelial cells).
[0155] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration bile
salts and fusidic acid derivatives. In addition, detergents may be
used to facilitate permeation. Transmucosal administration may be
through nasal sprays or using suppositories. For topical
administration, the oligomers of the invention are formulated into
ointments, salves, gels, or creams as generally known in the art. A
wash solution can be used locally to treat an injury or
inflammation to accelerate healing.
[0156] The compositions may, if desired, be presented in a pack or
dispenser device which may contain one or more unit dosage forms
containing the active ingredient. The pack may for example comprise
metal or plastic foil, such as a blister pack. The pack or
dispenser device may be accompanied by instructions for
administration.
[0157] The present invention is further illustrated by the
following examples which should not be construed as limiting in any
way. The contents of all cited references (including literature
references, issued patents, published patent applications as cited
throughout this application) are hereby expressly incorporated by
reference.
[0158] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques that are within the
skill of the art. Such techniques are explained fully in the
literature. See, for example, Molecular Cloning A Laboratory
Manual, (2nd ed., Sambrook, Fritsch and Maniatis, eds., Cold Spring
Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D.
N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed.,
1984)
EXAMPLE 1
Genetic Linkage of a Macular Degeneration Causing Gene to the Short
Arm of Human Chromosome 2
[0159] A total of 86 family members at 50% risk for autosomal
dominant radial drusen were studied (FIG. 1). These individuals
belonged to four families that were known to be related.
Genealogical investigation revealed that family A has lived in the
United States since at least the late 1700's. The two branches of
this family (A1 and A2) were found to be connected by a sibship
that lived in West Virginia in the 1790's. Families B-D all
originated from the Leventine valley of southern Switzerland.
Members of family B have been the subjects of previous reports by
Vogt,.sup.23 Klainguti,.sup.24 Forni and Babel,.sup.26 and
Scarpatetti, Forni, and Niemeyer..sup.31
[0160] Informed consent was obtained from study participants.
Seventy-one patients had complete eye examinations (visual acuity,
slit lamp examination, indirect ophthalmoscopy and retinal
biomicroscopy). The medical records and fundus photographs of 15
additional patients were reviewed. Throughout the study, the
clinicians remained masked to the evolving genotypic data. Patients
were judged to be affected if: 1) they were found to have
unmistakable evidence of radial drusen on clinical examination; or,
2) if they were found to have large disciform scars but had
children affected with radial drusen. Blood samples were obtained
from all of the affected family members as well as 19 spouses of
affected patients with children. Seven to ten milliliters of blood
were obtained from each patient in EDTA-containing glass tubes. DNA
was prepared from the blood using a non-organic method..sup.32
Oligonucleotide primers complementary to sequences flanking 380
short tandem repeat polymorphisms (STRPs) distributed across the
entire autosomal genome were obtained from Research Genetics
(Marker Sets 6 and 6A). The majority of these STRPs were
tetranucleotide repeat polymorphisms developed by the Cooperative
Human Linkage Center (CHLC)..sup.33 Fifty nanograms of each
patient's DNA were used as template in a 8.35 .mu.l polymerase
chain reaction (PCR) containing 1.25 .mu.l 10-.lambda. buffer (100
mM Tris-HCL pH 8.8, 500 mM KCl, 15 mM MgCl 2, 0.01% w/v gelatin,
200 .mu.m of each dCTP, dATP, dGTP and dTTP, 1 pmole of each primer
and 0.25U Taq polymerase (Perkin-Elmer Cetus). Samples were
incubated in a DNA thermocycler (Omnigene) for 35 cycles under the
following conditions: 94.degree. C. for 30 sec, 55.degree. C. for
30 sec, 72.degree. for 30 sec. After amplification, 5 .mu.l of stop
solution (95% formamide, 10 mM NaOH, 0.05% Bromophenol Blue, 0.05%
Xylene Cyanol) were added to each sample. Amplification products
were then denatured and electrophoresed on 6% polyacrylamide gels
at 60W for approximately 3 hours. Following electrophoresis, gels
were silver stained as previously described..sup.34, 35 Permanent
records were created by placing a sheet of Silver Sequence film
(Promega) against the dried gel and placing it on a light box for
5-9 sec. The film was then processed in Dektol developer.
[0161] Because of the variable expressivity of the disease, only
affected patients and informative spouses were included in the
linkage analysis. Pairwise linkage analysis was performed with the
MLINK and LODSCORE programs as implemented in the FASTLINK (v2.3)
version.sup.36, 37 of the LINKAGE program package..sup.38
Multipoint linkage of three markers (D2S337, D2S378 and D2S 119)
and the disease locus was performed with the fast version of
LINKMAP from FASTLINK (v2.3). The distances between the three
markers were held fixed while the disease locus was moved through
the map. The genetic maps used for the multipoint analysis and
analysis of recombinants were constructed in the following manner.
Genotypic data from the CEPH reference panel were obtained
electronically from two primary sources: CEPH (ftp.cephb.fr) and
CHLC (ftp.chlc.org). The potential informativeness of each marker
in the CEPH reference panel was estimated by conducting pairwise
linkage analysis of each marker against itself using the CLODSCORE
module of the LINKAGE (v5.1) package. The two most informative
markers were used as the ordered loci for a CRI-MAP BUILD run
(CRI-MAP v2.2)..sup.39 Markers were then incorporated into the map
in decreasing order of informativeness. The map building process
continued until no further markers could be placed into the map
while retaining a predetermined level of significance over the next
most likely order. To obtain an order with a high level of
confidence for the multipoint analysis of the disease locus, odds
of at least 10.sup.8 to 1 were required. The map used to place the
recombination events within the families was constructed with odds
of 10.sup.3 to 1. Markers that could not be incorporated into the
map with at least 10 to 1 odds were placed into the map in a
location most consistent with the observed recombinants For the
data given in FIG. 3, the allele frequencies were assumed to be
equal for each marker. The true population allele frequencies for
each marker could not be reliably estimated from the small number
of spouses in the families. In order to show that the assumption of
the equal allele frequencies would not significantly affect the
linkage results, the lod scores were calculated using allele
frequencies for the "affected" allele of two of the most tightly
linked markers (GATA26H01 and D2S378) ranging from 0.01 to 0.5. In
family A alone, the Zmax remained greater than 4 for each of these
markers for all allele frequencies in this range. In the six
spouses of family A that were studied, the frequency of the
"affected" allele of GATA26H01 was 16% and for D2S378 was 0%.
[0162] Results
[0163] Fifty-six patients were found to have fundus abnormalities
consistent with the diagnosis of autosomal dominant radial drusen.
The affected patients ranged in age from 15 to 85 years. Most were
asymptomatic until the fourth or fifth decade, at which point they
began experiencing a variety of symptoms including decreased visual
acuity (especially after moving from a brightly lit room to a dim
one), paracentral scotomas, photophobia and metamorphopsia. The
visual acuity of most patients declined steadily between the ages
of 50 and 80 such that the median visual acuity in affected
patients between 70 and 79 years of age was less than 20/200 (FIG.
2).
[0164] Linkage of radial drusen of 2 p was first suspected when all
29 affected individuals from family A were found to share a common
allele of marker D2S1352. Genotyping of all 4 families with 18
different STRPs that map to 2 p revealed significant linkage
(lod>3.0) in family A with 14 different markers and in family B
with two different markers (D2S391 and GATA26H10). The maximum lod
score observed in a single family was 7.0 (theta=0) and was
obtained with marker D2S378 in family A. The maximum lod score
obtained by combining all 4 families was 10.5 (theta=0) and was
obtained with marker D2S378. The lod scores obtained with 18
different chromosome 2 markers are given in FIG. 3. The analysis of
patients who exhibited recombination events near the linked
interval is also shown in FIG. 3. These recombination events show
the disease-causing gene to lie within the 14cM interval between
markers D2S1761 (telomeric) and D2S444 (centromeric).
[0165] Multipoint analysis was performed with the genotypic data
from three markers D2S337, D2S378 and D2S119) pooled from all four
families. This analysis revealed a peak lod score of 12, centered
on marker D2S378. The lod-1 confidence interval.sup.40 was 8
cM.
[0166] Table 2 shows the set of marker alleles (haplotype) linked
to the disease phenotype in each of the four families. For all nine
markers in the linked interval, the two main branches of family A
were found to have the same allele linked to the disease phenotype.
In contrast, none of the three Swiss families (B-D) showed this
degree of haplotypic similarity with each other, or with family
A.
2TABLE 2 Alleles* linked to disease phenotype Families Marker A1 A2
B C D (alleles)** D2S391 (5) 2 2 1 2 2 D2S123 (6) 6 6 5 6 1 D2S1352
(4) 3 3 4 3 3 GATA26H10 4 4 7 7 3 (10) D2S378 (7) 3 3 4 3 4 D2S1364
(5) 5 5 5 5 5 D2S357 (7) 5 5 2 5 5 D2S370 (6) 4 4 3 3 4 *For each
marker, the allele with the greatest number of repeats is
designated as allele 1. **The number in parentheses is the total
number of different alleles observed in the four families in this
study.
[0167] Analysis of observed recombination events in affected
individuals has refined the interval containing the disease gene to
the genomic segment between markers D2S2153 and D2S357 (see FIG.
1). This interval has been further narrowed by the identification
of a segment of the genome that is shared between a set of malattia
leventinese families that live in the Leventine Valley of
Switzerland. This analysis is capable of identifying recombination
events that occurred many years ago in the common ancestors that
link these families. This shared segment analysis suggests that the
disease gene lies within the interval bounded by markers D2S2153
and D2S378 (see FIG. 1).
[0168] Within the candidate integral noted above, a group of genes
exist that have some additional reason or reasons to implicate them
as the disease-causing gene in malattia leventinese patients. These
genes include: WI-16857, Wi-12526 (B-fodrin), WI-15186, WI-8771 (S
1-5), WI-6704, WI-6613, WI-6241, SGC-34452, stSG-42480, WI-18292,
SGC-31346, WI-11399.
EXAMPLE 2
Identification of WI-8771 (S1-5) (FBNL) as the Macular Degeneration
Causing Gene
[0169] The Assay
[0170] A limitation to the assay of the above genes for mutations
has been the paucity of available information about the genomic
structure and genomic sequence of these genes. Thus, many assays
have been limited to selected regions of the coding sequence 20 or
more base pairs away from intron-exon boundaries Because of these
limitations, negative screening results have been difficult to
interpret (because true disease-causing mutations could be located
in the unscreened regions of the genes).
[0171] Work was thus directed to identifying the genomic structure
and genomic sequence of the most promising candidate genes, so that
more complete assays could be developed. It was found that a
portion of the s1-5 (FBNL) gene (Genebank Accession U03877--SEQ.
ID. No. 1). The relevant portion is exon 10 inclusive of previously
unpublished intronic sequence (SEQ. ID. No. 2). The availability of
this new intronic sequence permitted the design of specific primers
(SEQ. ID. Nos. 3 and 4) for amplification and mutation screening,
of the entire coding sequence of exon 10 of this gene.
[0172] The Gene (S1-5 Also Known as FBNL)
[0173] Lecka-Czernik et al (1995) isolated an overexpressed cDNA
sequence (S1-5) from human fibroblasts from a patient with Werner
syndrome. They noted S1-5 codes for a novel protein containing
epidermal growth factor like domains (EGF). They matched the
consensus sequences with several known extracellular domains that
play a role in cell growth, development and cell signalling. They
found 5-6 EGF domains present depending on translational start
site. There is significant similarity between this gene and
transforming growth factor beta 1 binding protein as well as the
following extracellular matrix proteins: Fibulin, Fibrillin,
Nidogen, Notch (in Drosophila homologs in human), Protein S, and
Factor IX. All of these proteins are secreted into the
extracellular space or bind to the plasma membrane and interact
with other proteins. S1-5 has a signal peptide, EGF domains, and an
N glycosylation site suggesting it is an extracellular factor
involved in cell proliferation.
[0174] Ikegawa et al (1996) determined the genomic organization of
S1-5. They showed that it spans 18 kb of genomic DNA and maps to
2p16. They demonstrated abundant expression in all tissues studied
except brain and peripheral lymphocytes.
[0175] They showed that this gene is highly homologous to
fibrillin, and in fact the approved symbol for S1-5 is now FBNL
(fibrillin like). The gene has 12 exons but the first 3 exons are
in the 5' UTR. Ikegawa et al did define the intron exon boundaries
but did not provide enough intronic sequence to make primers for
screening the entire coding sequence of the exons.
[0176] Mutation Screening
[0177] The exon 10 screening assay was used to screen 34 unrelated
nuclear families (113 affected patients) affected with malattia
leventinese for mutations in exon 10 of the s 1-5 gene. Twenty-one
of these families were known by haplotype analysis to be related to
one another (the Swiss group), and as were two additional families
from the United States. Thirteen of the families had no geographic
or haplotypic information to link them. Screening of exon 10 of the
S1-5 gene in these families revealed the same heterozygous sequence
variation in every affected member of every family in our
collection (all 113 patients). This sequence variation altered the
first nucleotide of codon 345 from a C to a T and would be expected
to change the amino acid at this position from arginine to
tryptophan (a basic to an uncharged amino acid).
[0178] Screening of 383 control patients (190 from Iowa, 93 from
Australia and 93 from Switzerland) revealed only a single
heterozygous occurrence of this change and that was in a patient
from the Italian-speaking region of Switzerland near the Leventine
valley.
[0179] Screening of 500 unrelated age-related macular degeneration
patients for mutations in this exon revealed only a single patient
with this sequence change.
[0180] Interpretation
[0181] This Arg345Trp mutation in the S1-5 gene on chromosome 2p is
therefor likely to be the cause of the specific form of human
macular degeneration known as malattia leventinese or "radial
drusen" and potentially other macular degenerations.
[0182] Significance
[0183] Only a portion of the S1-5 gene has been screened in human
macular degeneration patients at this time--and it is possible that
other mutations elsewhere in this gene will prove to be responsible
for a subset of typical age related macular degeneration. The S1-5
gene is a member of a gene family with at least 2 other members
(i.e. fibulin 1 and fibulin 2). Mutations in these other genes
therefore are likely to cause a subset of macular degeneration. The
specific Arg345Trp mutation is in a domain of the molecule with
homology to epidermal growth factor and this observation may
contribute to the elucidation of the mechanism of drusen formation.
At the very least, knowledge of this specific drusen-causing
mutation will allow an animal model of human macular degeneration
to be developed with transgenic technology as described herein.
EXAMPLE 3
Identification of an Additional Mutation in WI-8771 (S1-5)
(FBNL)
[0184] As described above, all 37 families (162 affected patients)
studied had an exon 10 shift on SSCP that looked identical. All of
the families were then sequenced to make sure that it was all the
same mutation. All of the families sequenced had the Arg345Trp
mutation found in the original patients. However, the sequence of
one Swiss patient came back and had a different amino acid changing
mutation in exon 10: namely, Arg362Gln. This mutation, therefore,
could be responsible for Doyne's dystrophy, while the Arg345Trp
mutation is responsible for the malatia leventinese form of age
related macular degeneration.
3 S1-5 Sequence from GeneBank (Accession U03877) Seq Id. No. 1
CAATGCACTG ACGGATATGA GTGGGATCCT GTGAGACAGC AATGCAAAGA TATTGATGAA
TGTGACATTG TCCCAGACGC TTGTAAAGGT GGAATGAAGT GTGTCAACCA CTATGGAGGA
TACCTCTGCC TTCCGAAAAC AGCCCAGATT ATTGTCAATA ATGAACAGCC TCAGCAGGAA
ACACAACCAG CAGAAGGAAC CTCAGGGGCA ACCACCGGGG TTGTAGCTGC CAGCAGCATG
GCAACCAGTG GAGTGTTGCC CGGGGGTGGT TTTGTGGCCA GTGCTGCTGC AGTCGCAGGC
CCTGAAATGC AGACTGGCCG AAATAACTTT GTCATCCGGC GGAACCCAGC TGACCCTCAG
CGCATTCCCT CCAACCCTTC CCACCGTATC CAGTGTGCAG CAGGCTACGA GCAAAGTGAA
CACAACGTGT GCCAAGACAT AGACGAGTGC ACTGCAGGGA CGCACAACTG TAGAGCAGAC
CAAGTGTGCA TCAATTTACG GGGATCCTTT GCATGTCAGT GCCCTCCTGG ATATCAGAAG
CGAGGGGAGC AGTGCGTAGA CATAGATGAA TGTACCATCC CTCCATATTG CCACCAAAGA
TGCGTGAATA CACCAGGCTC ATTTTATTGC CAGTGCAGTC CTGGGTTTCA ATTGGCAGCA
AACAACTATA CCTGCGTAGA TATAAATGAA TGTGATGCCA GCAATCAATG TGCTCAGCAG
TGCTACAACA TTCTTGGTTC ATTCATCTGT CAGTGCAATC AAGGATATGA GCTAAGCAGT
GACAGGCTCA ACTGTGAAGA CATTGATGAA TGCAGAACCT CAAGCTACCT GTGTCAATAT
CAATGTGTCA ATGAACCTGG GAAATTCTCA TGTATGTGCC CCCAGGGATA CCAAGTGGTG
AGAAGTAGAA CATGTCAAGA TATAAATGAG TGTGAGACCA CAAATGAATG CCGGGAGGAT
GAAATGTGTT GGAATTATCA TGGCGGCTTC CGTTGTTATC CACGAAATCC TTGTCAAGAT
CCCTACATTC TAACACCAGA GAACCGATGT GTTTGCCCAG TCTCAAATGC CATGTGCCGA
GAACTGCCCC AGTCAATAGT CTACAAATAC ATGAGCATCC GATCTGATAG GTCTGTGCCA
TCAGACATCT TCCAGATACA GGCCACAACT ATTTATGCCA ACACCATCAA TACTTTTCGG
ATTAAATCTG GAAATGAAAA TGGAGAGTTC TACCTACGAC AAACAAGTCC TGTAAGTGCA
ATGCTTGTGC TCGTGAAGTC ATTATCAGGA CCAAGAGAAC ATATCGTGGA CCTGGAGATG
CTGACAGTCA GCAGTATAGG GACCTTCCGC ACAAGCTCTG TGTTAAGATT GACAATAATA
GTGGGGCCAT TTTCATTTTA GTCTTTTCTA AGAGTCAACC ACAGGCATTT AAGTCAGCCA
AAGAATATTG TTACCTTAAA GCACTATTTT ATTTATAGAT ATATCTAGTG CATCTACATC
TCTATACTGT ACACTCACCC ATAACAAACA ATTACACCAT GGTATAAAGT GGGCATTTAA
TATGTAAAGA TTCAAAGTTT GTCTTTATTA CTATATGTAA ATTAGACATT AATCCACTAA
ACTGGTCTTC TTCAAGAGAG CTAAGTATAC ACTATCTGGT GAAACTTGGA TTCTTTCCTA
TAAAAGTGGG ACCAAGCAAT GATGATCTTC TGTGGTGCTT AAGGAAACTT ACTAGAGCTC
CACTAACAGT CTCATAAGGA GGCAGCCATC ATAACCATTG AATAGCATGC AAGGGTAAGA
ATGAGTTTTT AACTGCTTTG TAAGAAAATG GAAAAGGTCA ATAAAGATAT ATTTCTTTAG
AAAATGGGGA TCTGCCATAT TTGTGTTGGT TTTTATTTTC ATATCCAGCC TAAAGGTGGT
TGTTTATTAT ATAGTAATAA ATCATTGCTG TACAACATGC TGGTTTCTGT AGGGTATTTT
TAATTTTGTC AGAAATTTTA GATTGTGAAT ATTTTGTAAA AAACAGTAAG CAAAATTTTC
CAGAATTCCC AAAATGAACC AGATACCCCC TAGAAAATTA TACTATTGAG AAATCTATGG
GGAGCATATG AGAAAATAAA TTCCTTCTAA ACCACATTGG AACTGACCTG AAGAAGCAAA
CTCGGAAAAT ATAATAACAT CCCTGAATTC AGGCATTCAC AAGATGCAGA ACAAAATGGA
TAAAAGGTAT TTCACTGGAG AAGTTTTAAT TTCTAAGTAA AATTTAAATC CTAACACTTC
ACTAATTTAT AACTAAAATT TCTCATCTTC GTACTTGATG CTCACAGAGG AAGAAAATGA
TGATGGTTTT TATTCCTGGC ATCCAGAGTG ACAGTGAACT TAAGCAAATT ACCCTCCTAC
CCAATTCTAT GGAATATTTT ATACGTCTCC TTGTTTAAAA TCTGACTGCT TTACTTTGAT
GTATCATATT TTTAAATAAA AATAAATATT CCTTTAGAAG ATCACTCTAA AASequence
2
[0185]
4 Exon 10 with a portion of Intron 10 (Seq. Id. No. 2) ATATAAATGA
GTGTGAGACC ACAAATGAAT GCCGGGAGGA TGAAATGTGT TGGAATTATC ATGGCGGCTT
CCGTTGTTAT CCACGAAATC CTTGTCAAGAT CCCTACATT CTAACACCAG
AGAAGTAAGAAAAATCAGAACTTTTGAAAGTGAGGATTTTCTG
GTCTTACCAAGCCAAACTGCTGAATACTTTTGTTTGTCTCTGG AG
[0186] Exon 10 primers
[0187] 10 Forward
[0188] 5'AAATGAGTGTGAGACCACAAA3' (SEQ ID No. 3)
[0189] 10 Reverse
[0190] 5'ATTCAGCAGTTTGGCTTGGT3' (SEQ ID No. 4).
[0191] Equivalents
[0192] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
References
[0193] 1) Best F. Uber eine hereditare maculaaffektion: Bietrage
zur vererbungslehre. Z Augenheilkd. (1905); Vol. 13: pp.
199-212.
[0194] 2) Sorsby A, Joll Mason M E, Gardener N. A fundus dystrophy
with unusual features. Br J. Opthalmol. (1949); Vol. 33: pp.
67-97.
[0195] 3) Stargardt K. Ueber familiare, progressive degeneration in
der maktilagegend des auges Albrecht Von Graefes Arch Klin Exp
Opthalmol. (1909); Vol. 71, pp. 534-550.
[0196] 4) Ferrell R E, Mintz-Hittner H., Antoszyk J H. Linkage of
atypical vitelliform macular dystrophy (VDM-1) to the soluble
glutamate pyruvate transaminase (GPT1) locus. Am J. Hum Genet.
(1983); Vol. 35; pp 78-84.
[0197] 5) Jacobson D M, Thompson H S, Bartley J A. X-linked
progressive cone dystrophy. Ophthalmology, (1989); Vol. 96; pp.
885-895.
[0198] 6) Small K W, Weber J L, Roses A, et al. North Carolina
macular dystrophy is assigned to chromosome 6. Genomics (1992) Vol.
13; pp. 681-685.
[0199] 7) Stone E M, Nichols B E, Streb L M, Kimura A E, Sheffield
V C. Genetic linkage of vitelliform macular degeneration (Best's
disease) to chromosome 11q13. Nature Genet. (1992); Vol. 1: pp.
246-250.
[0200] 8) Forsman K, Graff C, Nordstrom S, et al. The gene for
Best's macular dystrophy is located in 11q13 in a Swedish family.
Clin Genet. (1992); Vol. 42: pp. 156-159.
[0201] 9) Kaplan J S, Gerber S, Lavget-Piet D, et al. A gene for
Stargardt's disease (fundus flavimaculatus) maps to the short arm
of chromosome 1, Nature Genet. (1993) Vol. 5: pp. 308-311.
[0202] 10) Stone E M, Nichols B E, Kimura A E, et al. Clinical
features of a Stargardt-like dominant progressive macular dystrophy
with genetic linkage to chromosome 6q. Arch Opthalmol. (1994); Vol.
112: pp. 763-772.
[0203] 11) Zhang K, Bither P P, Park R, et al. A dominant
Stargardt's macular dystrophy locus maps to chromosome 13q34. Arch
Opthalmol. (1994); Vol. 112: pp. 759-764.
[0204] 12) Evans K, Fryer A, Ingelhearn C, et al. Genetic linkage
of cone-rod retinal dystropy to chromosome 19q and evidence for
segregation distortion. Nature Genet. (1994); Vol. 6: pp.
210-213.
[0205] 13) Kremer H, Pinckers A, vandenHelm B, et al. Localization
of the gene for dominant cystoid macular dystrophy on chromosome
7p. Hum Mol Genet, (1994); Vol. 3: pp. 299-302.
[0206] 14) Kelsell R E, Godley B F, Evans K, et al. Localization of
the gene for progressive bifocal chorioretinal atrophy (PBCRA) to
chromosome 6q. Hum Mol Genet. (1995); Vol 4: pp. 1653-1656.
[0207] 15) Nathans J, Davenport C M, Maumenee I H, et al. Molecular
genetics of human blue cone monochromacy. Science. (1989); Vol 245:
pp. 831-838.
[0208] 16) Wells J, Wroblewski J., Keen J. Mutations in the human
retinal degeneration slow (RDS) gene can cause either retinitis
pigmentosa or macular dystrophy. Nature Genet. (1993); Vol. 3: pp.
213-218.
[0209] 17) Nichols B E, Sheffield V C, Vandenburgh K.
Butterfly-shaped pigment dystrophy of the fovea is caused by a
point mutation in codon 167 of the RDS gene. Nature Genet. (1993a);
Vol. 3: pp. 202-207.
[0210] 18) Weber B H F, Vogt G, Pruett R C, Stohr H, Felbor U.
Mutations in the tissue inhibitor of metalloproteinases-3 (TIMP3)
in patients with Sorsby's fundus dystrophy. Nature Genet. (1994):
Vol. 8: pp. 352-355
[0211] 19) Leibowitz H., Krueger D E, Maunder L R, et al. The
Framingham Eye Study Monograph; an ophthalmological and
epidemiological study of cataract, macular degeneration, diabetic
retinopathy, macular degeneration and visual acuity in a general
population of 2,631 adults, (1973-75) Survey of Opthalmol. (1980);
Vol. 24: (Suppl.): pp. 335-610.
[0212] 20) Hutchinson J, Tay W. Symmetrical central choroidoretinal
disease occurring in senile persons. R. London Opthalmol Hosp. Rep.
(1875) Vol. 8: pp. 231-244.
[0213] 21) Doyne R W. Pecliar condition of choroiditis occurring in
several members of the same family. Trans. Opthal. Soc. U.K (1899);
Vol.19: p. 71.
[0214] 22) Collins T. A pathological report upon a case of Doyne's
chorioditis ("honeycomb" or "family choroiditis") Ophthaltmoscope
(1913); Vol 11: pp.537-538.
[0215] 23) Vogt A. Die Opthalmoskopie im rotreien Licht. Graefe
Saemisch Handb. d. Ges. Augenheilkd, 3d ed. Berlin, Springer,
(1925); Vol. 3: pp. 1-118
[0216] 24) Klainguti, R. Die tapeto-retinale Degeneration im Kanton
Tessin (Schweiz. Opthal. Ges 25/26-6-1932, Biel.); ref.: Z.
Augenheilkd, 82-83, 1932; Klin. Monattsbl. Augenheilkd. (1932);
Vol. 107: pp. 361-372.
[0217] 25) Waardenburg P. J. On macula-degeneration.
Opthalmologica. (1948); Vol. 115: pp. 115-116.
[0218] 26) Forni S, Babel J._tude clinique et histologique de la
malattia leventinse. Affection apparetnant au groupe des
d_g_n_rescences hyalines du p_le post_rieur. Opthalmologica.
(1962); Vol. 143: pp. 313-322.
[0219] 27) Piguet B, Haimovici R, Bird A C. Dominantly inherited
drusen represent more than one disorder: a historical review. Eye
(1995); Vol. 9: pp. 34-41.
[0220] 28) Streicher T, Kremery K. Das fluoreszenzangiographische
Bild der heredit_ren Drusen. Klin. Monatsbl. Augenheilkd. (1976);
Vol. 169: pp. 22-30.
[0221] 29) Dusek J, Streicher T, Schmidt K. Heredit_re Drusen der
Bruchschen Membran I. Klinische und lichtmikroskopische
Beobachtungen. Klin. Monatsbl. Augenheilkd. (1982); Vol. 181: pp.
27-31.
[0222] 30) Gass J DM. Diseases causing choroidal exudative and
hemorrahagic localized (disciform) detachment of the retina and
pigment epithelium. Stereoscopic Atlas of Macular Diseases, C. V.
Mosby Co., St. Louis. (1987); Vol. 3: pp. 96-97.
[0223] 31) Scarpatetti A., Forni S., Neimeyer G. Die
Netzhautfunktion bei Malattia leventinese (dominant drusen).
Klimsche Monatsblatter fur Augenheilkunde. (1978); Vol. 4: pp.
590-7.
[0224] 32) Buffone G J, Darlington G J. Isolation of DNA from
biological specimens without extraction with phenol. Clin. Chem.
(1985); Vol. 31: pp.164-165.
[0225] 33) Sheffield, V. C., Weber, J. L., Buetow, K. L., et al., A
Collection of tri and tetranucleotide repeat markers used to
generate high quality, high resolution human genome-wide linkage
maps, Human Molecular Genetics, in press.
[0226] 34) Bassam B J, Caetano-Anolles G., Gresshoff P M. Fast and
sensitive silver staining of DNA in polyacrylamide gels. Anal
Biochem. (1991); Vol. 196: pp. 80-83.
[0227] 35) Nichols B E, Bascomi R., Litt M., et al. Refining the
locus for Best's vitelliform macular dystrophy and mutation
analysis of the candidate gene ROM1. Am J. Hum. Genet. (1994); Vol.
54: pp. 95-103.
[0228] 36) Cottingham Jr. R W, Idury R M, Schaffer A A. Faster
sequential genetic linkage computations. Am. J. Hum Genet. (1993);
Vol 53: pp. 252-263.
[0229] 37) Schaffer A A, Gupta S K, Shriram K, Cottingham Jr. R W.
Avoiding recomputation in genetic linkage analysis. Hum Hered.
(1994); Vol. 44: pp. 225-237.
[0230] 38) Lathrop G M, Lalouel J M. Easy calculations of lod
scores and genetic risks on small computers. Am. J Hum. Genet.
(1984); Vol. 36: pp 460-465.
[0231] 39) Donis-Keller H, Green P., Helms C. et al. A Genetic
linkage map of the human genome. Cell. (1987); Vol. 51: pp.
319-337.
[0232] 40) Conneally P. M., Edwards J. H., Kidd K K, et al. Report
of the committee on methods of linkage analysis and reporting.
Cytogenet. Cell Genet. (1985); Vol. 40: pp. 356-359.
[0233] 41) Gass J D M. Drusen and disciform macular detachment and
degeneration. Arch Opthalmol. (1973); Vol. 90: pp. 206-217.
[0234] 42) Hyman L G, Lilienfeld A M, Ferris F L, Fine S L. Senile
macular degeneration: A case-control study. Am J. Epidemiol.
(1983); Vol. 118: pp. 213-227.
[0235] 43) Heiba I M, Elston R C, Klein B E K, Klein R. Sibling
correlations and segregation analysis of age-related maculopathy:
the Beaver Dam Eye Study. Genet. Epidemiol. (1994); Vol. 11: pp.
51-67.
[0236] 44) Hu R J, Watanabe M, Bennett V. Characterization of human
brain cDNA encoding the general insoform of B-spectrin. J. Biolog.
Chem. (1992); Vol. 267: pp. 18715-18722.
[0237] 45) Chang J G, Scarpa A, Eddy R L, et al. Cloning of a
portion of the chromosomal gene and cDNA for human B-fordin, the
nonerythroid form of B-spectrin. Genomics, (1993); Vol. 17: pp.
287-293.
[0238] 46) Travis G, Sutcliffe J, Bok D. The retinal digeneration
slow (rds) gene product is a photoreceptor disc membrane-associated
glycoprotein. Neuron (1991); Vol. 6: pp. 61-70.
[0239] 47) Bascom R A, Schappert K, McInnes R R. Cloning of the
human and murine ROM 1 genes: genomic organization and sequence
conservation. Hum Molec Genet. (1993); Vol. 2: pp. 385-391.
Sequence CWU 1
1
4 1 2512 DNA Homo sapiens 1 caatgcactg acggatatga gtgggatcct
gtgagacagc aatgcaaaga tattgatgaa 60 tgtgacattg tcccagacgc
ttgtaaaggt ggaatgaagt gtgtcaacca ctatggagga 120 tacctctgcc
ttccgaaaac agcccagatt attgtcaata atgaacagcc tcagcaggaa 180
acacaaccag cagaaggaac ctcaggggca accaccgggg ttgtagctgc cagcagcatg
240 gcaaccagtg gagtgttgcc cgggggtggt tttgtggcca gtgctgctgc
agtcgcaggc 300 cctgaaatgc agactggccg aaataacttt gtcatccggc
ggaacccagc tgaccctcag 360 cgcattccct ccaacccttc ccaccgtatc
cagtgtgcag caggctacga gcaaagtgaa 420 cacaacgtgt gccaagacat
agacgagtgc actgcaggga cgcacaactg tagagcagac 480 caagtgtgca
tcaatttacg gggatccttt gcatgtcagt gccctcctgg atatcagaag 540
cgaggggagc agtgcgtaga catagatgaa tgtaccatcc ctccatattg ccaccaaaga
600 tgcgtgaata caccaggctc attttattgc cagtgcagtc ctgggtttca
attggcagca 660 aacaactata cctgcgtaga tataaatgaa tgtgatgcca
gcaatcaatg tgctcagcag 720 tgctacaaca ttcttggttc attcatctgt
cagtgcaatc aaggatatga gctaagcagt 780 gacaggctca actgtgaaga
cattgatgaa tgcagaacct caagctacct gtgtcaatat 840 caatgtgtca
atgaacctgg gaaattctca tgtatgtgcc cccagggata ccaagtggtg 900
agaagtagaa catgtcaaga tataaatgag tgtgagacca caaatgaatg ccgggaggat
960 gaaatgtgtt ggaattatca tggcggcttc cgttgttatc cacgaaatcc
ttgtcaagat 1020 ccctacattc taacaccaga gaaccgatgt gtttgcccag
tctcaaatgc catgtgccga 1080 gaactgcccc agtcaatagt ctacaaatac
atgagcatcc gatctgatag gtctgtgcca 1140 tcagacatct tccagataca
ggccacaact atttatgcca acaccatcaa tacttttcgg 1200 attaaatctg
gaaatgaaaa tggagagttc tacctacgac aaacaagtcc tgtaagtgca 1260
atgcttgtgc tcgtgaagtc attatcagga ccaagagaac atatcgtgga cctggagatg
1320 ctgacagtca gcagtatagg gaccttccgc acaagctctg tgttaagatt
gacaataata 1380 gtggggccat tttcatttta gtcttttcta agagtcaacc
acaggcattt aagtcagcca 1440 aagaatattg ttaccttaaa gcactatttt
atttatagat atatctagtg catctacatc 1500 tctatactgt acactcaccc
ataacaaaca attacaccat ggtataaagt gggcatttaa 1560 tatgtaaaga
ttcaaagttt gtctttatta ctatatgtaa attagacatt aatccactaa 1620
actggtcttc ttcaagagag ctaagtatac actatctggt gaaacttgga ttctttccta
1680 taaaagtggg accaagcaat gatgatcttc tgtggtgctt aaggaaactt
actagagctc 1740 cactaacagt ctcataagga ggcagccatc ataaccattg
aatagcatgc aagggtaaga 1800 atgagttttt aactgctttg taagaaaatg
gaaaaggtca ataaagatat atttctttag 1860 aaaatgggga tctgccatat
ttgtgttggt ttttattttc atatccagcc taaaggtggt 1920 tgtttattat
atagtaataa atcattgctg tacaacatgc tggtttctgt agggtatttt 1980
taattttgtc agaaatttta gattgtgaat attttgtaaa aaacagtaag caaaattttc
2040 cagaattccc aaaatgaacc agataccccc tagaaaatta tactattgag
aaatctatgg 2100 ggaggatatg agaaaataaa ttccttctaa accacattgg
aactgacctg aagaagcaaa 2160 ctcggaaaat ataataacat ccctgaattc
aggcattcac aagatgcaga acaaaatgga 2220 taaaaggtat ttcactggag
aagttttaat ttctaagtaa aatttaaatc ctaacacttc 2280 actaatttat
aactaaaatt tctcatcttc gtacttgatg ctcacagagg aagaaaatga 2340
tgatggtttt tattcctggc atccagagtg acagtgaact taagcaaatt accctcctac
2400 ccaattctat ggaatatttt atacgtctcc ttgtttaaaa tctgactgct
ttactttgat 2460 gtatcatatt tttaaataaa aataaatatt cctttagaag
atcactctaa aa 2512 2 208 DNA Homo sapiens 2 atataaatga gtgtgagacc
acaaatgaat gccgggagga tgaaatgtgt tggaattatc 60 atggcggctt
ccgttgttat ccacgaaatc cttgtcaaga tccctacatt ctaacaccag 120
agaagtaaga aaaatcagaa cttttgaaag tgaggatttt ctggtcttac caagccaaac
180 tgctgaatac ttttgtttgt ctctgcag 208 3 21 DNA Artificial Sequence
Description of Artificial Sequence Primer 3 aaatgagtgt gagaccacaa a
21 4 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 4 attcagcagt ttggcttggt 20
* * * * *
References