U.S. patent application number 09/297576 was filed with the patent office on 2003-07-10 for dna diagnostics based on mass spectrometry.
Invention is credited to KOSTER, HUBERT, LOUGH, DAVID M., XIANG, GOUBING.
Application Number | 20030129589 09/297576 |
Document ID | / |
Family ID | 27575521 |
Filed Date | 2003-07-10 |
United States Patent
Application |
20030129589 |
Kind Code |
A1 |
KOSTER, HUBERT ; et
al. |
July 10, 2003 |
DNA DIAGNOSTICS BASED ON MASS SPECTROMETRY
Abstract
Fast and highly accurate mass spectrometry-based processes for
detecting a particular nucleic acid sequence in a biological sample
are provided. Depending on the sequence to be detected, the
processes can be used, for example, to diagnose a genetic disease
or chromosomal abnormality; a predisposition to a disease or
condition, infection by a pathogenic organism, or for determining
identity or heredity.
Inventors: |
KOSTER, HUBERT; (LA JOLLA,
CA) ; LOUGH, DAVID M.; (BERWICKSHIRE, GB) ;
XIANG, GOUBING; (SAN DIEGO, CA) |
Correspondence
Address: |
STEPHANIE L SEIDMAN
HELLER EHRMAN WHITE & MCAULIFFE
4350 LA JOLLA VILLAGE DRIVE
6TH FLOOR
SAN DIEGO
CA
92037
US
|
Family ID: |
27575521 |
Appl. No.: |
09/297576 |
Filed: |
June 28, 1999 |
PCT Filed: |
November 6, 1997 |
PCT NO: |
PCT/US97/20444 |
Current U.S.
Class: |
435/6.11 ;
422/68.1 |
Current CPC
Class: |
C12Q 1/6837 20130101;
B01J 2219/00315 20130101; B01J 2219/00605 20130101; C40B 40/10
20130101; C40B 60/14 20130101; C07F 9/2408 20130101; B01J
2219/00612 20130101; C07H 21/00 20130101; C07F 9/2429 20130101;
G01N 2035/00237 20130101; G01N 2035/1037 20130101; C12Q 1/6858
20130101; B01J 2219/0061 20130101; C12Q 1/6872 20130101; C12Q
1/6872 20130101; B01J 2219/00585 20130101; B01J 2219/0052 20130101;
B01J 2219/00707 20130101; B01J 2219/00722 20130101; C12Q 2523/10
20130101; G01N 35/1074 20130101; C12Q 2565/507 20130101; C12Q
2531/113 20130101; C12Q 2565/627 20130101; C12Q 2565/518 20130101;
C12Q 2565/627 20130101; C12Q 2523/10 20130101; C12Q 2565/537
20130101; C12Q 2535/101 20130101; B01J 2219/00504 20130101; C12Q
2525/197 20130101; B01J 2219/0063 20130101; B01J 2219/00387
20130101; B01L 3/0268 20130101; B01J 19/0046 20130101; B01J
2219/00626 20130101; C12Q 1/6865 20130101; G01N 2035/1069 20130101;
C12Q 1/6837 20130101; B01J 2219/00527 20130101; B01J 2219/00317
20130101; B01J 2219/00648 20130101; C12Q 1/6837 20130101; C12Q
1/6865 20130101; B01J 2219/0072 20130101; H01J 49/00 20130101; C07B
2200/11 20130101; C40B 40/06 20130101; B01J 2219/00725 20130101;
B01J 2219/00497 20130101; B01J 2219/005 20130101; B01J 2219/00641
20130101; C12Q 1/6837 20130101; B01J 2219/00596 20130101; B01J
2219/00511 20130101; G01N 35/1067 20130101; B01J 2219/00659
20130101; B01J 2219/00637 20130101; B01J 2219/00468 20130101 |
Class at
Publication: |
435/6 ;
422/68.1 |
International
Class: |
C12Q 001/68; G01N
015/06 |
Claims
1. A process for determining the order of base specifically
terminated nucleic acid fragments of a target nucleic acid
molecule, comprising the steps of: a) obtaining a nucleic acid
molecule, comprising the target nucleic acid sequence and, at one
end, a tag; b) generating base specifically terminated nucleic acid
fragments from the target nucleic acid; and c) analyzing the
fragments by a mass spectrometry format, thereby determining the
order of the base specifically terminated nucleic acid fragments in
the target nucleic acid molecule.
2. A process of claim 1, wherein in step b), a nuclease is
contacted with the target nucleic acid to generate the base
specifically terminated nucleic acid fragments.
3. A process of claim 2, wherein the nuclease is a restriction
enzyme that can recognize and cleave at least one restriction site
in the target nucleic acid.
4. A process of claim 2, wherein the target nucleic acid is a
deoxyribonucleic acid and the nuclease is a deoxyribonuclease.
5. A process of claim 2, wherein the target nucleic acid is a
ribonucleic acid and the nuclease is a ribonuclease.
6. A process of claim 5, wherein the ribonuclease is selected from
the group consisting of: the G-specific T.sub.1 ribonuclease, the
A-specific U.sub.2 ribonuclease, the AIU specific PhyM
ribonuclease, the U/C specific ribonuclease A, the C-specific
chicken liver ribonuclease and crisavitin.
7. A process of claim 1, wherein in step b), the base specifically
terminated nucleic acid fragments are generated by performance of a
combined amplification and base-specific termination reaction.
8. A process of claim 7, wherein the combined amplification and
base-specific termination reaction is performed using a first
polymerase, which has a relatively low affinity towards at least
one chain terminating nucleotide, and a second polymerase, which
has a relatively high affinity towards at least one chain
terminating nucleotide.
9. A process of claim 8, wherein the first and second polymerases
are thermostable DNA polymerases.
10. A process of claim 9, wherein the thermostable DNA polymerases
are selected from the group consisting of: Taq DNA polymerase,
AmpliTaq FS DNA polymerase, Deep Vent (exo-) DNA polymerase, Vent
DNA polymerase, Vent (exo-) DNA polymerase, Vent DNA polymerase,
Vent (exo-) DNA polymerase, Deep Vent DNA polymerase, Thermo
Sequenase, exo(-) Pseudococcus furiosus (Pfu) DNA polymerase,
AmpliTaq, Ultman, 9 degree Nm, Tth, Hot Tub, Pyrococcus furiosvs
(Pfu) and Pyrococcus woesei (Pwo) DNA polymerase.
11. A process of claim 1, wherein the base specifically terminated
nucleic acid fragments generated in step b) include mass modified
nucleotides.
12. A process of claim 1, wherein the tag comprises a 3' tag.
13. A process of claim 1, wherein the tag comprises a 5' tag.
14. A process of claim 12 or 13, wherein the tag is a non-natural
tag.
15. A process of claim 14, wherein the non-natural tag is selected
from the group consisting of: an affinity tag and a mass
marker.
16. A process of claim 15, wherein the affinity tag facilitates
immobilization of the nucleic acid to a solid support.
17. A process of claim 16, wherein the affinity tag is biotin or a
nucleic acid sequence that is capable of binding to a capture
nucleic acid sequence that is bound to a solid support.
18. A process for detecting a target nucleic acid present in a
biological sample, comprising the steps of: a) performing on a
nucleic acid obtained from a biological sample; a first polymerase
chain reaction using a first set of primers, which are capable of
amplifying a portion of the nucleic acid containing the target
nucleic acid, thereby producing an amplification product, wherein
the nucleic acid or a primer in the first set of primers is
immobilized to a solid support through a photocleavable linker of
any of claims 92-103; and b) detecting an amplification product by
mass spectrometry, wherein detection of the amplification product
indicates that the target nucleic acid is present in the biological
sample.
19. A process for detecting a target nucleic acid present in a
biological sample, comprising the steps of: a) performing on a
nucleic acid obtained from a biological sample; a first polymerase
chain reaction using a first set of primers, which are capable of
amplifying a portion of the nucleic acid containing the target
nucleic acid, thereby producing a first amplification product; b)
performing on the first amplification product a second polymerase
chain reaction using a second set of primers, which are capable of
amplifying at least a portion of the first amplification product,
which contains the target nucleic acid, thereby producing a second
amplification product; wherein the nucleic acid or a primer in the
first set of primers or a primer in the second set of primers is
immobilized to a solid support through a photocleavable linker of
any of claims 92-103; and c) detecting the second amplification
product by mass spectrometry, wherein detection of the second
amplification product indicates that the target nucleic acid is
present in the biological sample.
20. A process of claim 18 or 19, wherein the target nucleic acid is
immobilized to the solid support, and wherein the immobilized
nucleic acid is cleaved from the support during mass
spectrometry.
21. A process of claim 18 or 19, wherein the solid support is
selected from the group consisting of: beads, flat surfaces, chips,
capillaries, pins, combs and wafers.
22. A process of claim 18 or 19, wherein prior to mass
spectrometry, the target nucleic acid is purified.
23. A process of claim 18 or 19, wherein a primer or an
amplification product is conditioned.
24. A process of claim 23, wherein the primer or the amplification
product is conditioned by phosphodiester backbone modification.
25. A process of claim 24, wherein the phosphodiester backbone
modification is a cation exchange.
26. A process of claim 23, wherein the primer or the amplification
product is conditioned by contact with an alkylating agent or
trialkylsilyl chloride.
27. A process of claim 23, wherein conditioning is effected by
including at least one nucleotide that reduces sensitivity for
depurination in the primer or first or second amplification
product.
28. A process of claim 27, wherein the nucleotide is an
N7-deazapurine nucleotide, a N9-deazapurine nucleotide or a
2'-fluoro-2'-deoxynucteotide- .
29. A method for detecting neoplasia/malagnancies in a tissue or
cell sample, comprising detecting telomerase activity, mutation of
a proto-oncogene, or expression of a tumor specific gene in the
sample by detecting nucleic acids that encode the telomerass, that
are specific for the mutation or that encode the tumor-specific by
mass spectometry.
30. The method of claim 29 that is a method for detecting a
neoplasia/malignancy in a tissue or cell sample, comprising: a)
isolating telomerase from the sample and adding a synthetic DNA
primer, which is optionally immobilized, complementary to a
telomeric repeat, and all four deoxynucleotide triphosphates under
conditions that result in telomerase specific exetension of the
synthetic DNA; b) amplifying the telomerase extended DNA product;
and c) detecting the DNA product by mass spectrometry, wherein
telomerase-specific extension is indicative of
neoplasialmalignancy.
31. The method of claim 30, wherein the primer contains a linker
moiety for immobilization on a support; and the amplified primers
are isolated by conjugating the linker portion to a solid
support.
32. A process for detecting telomerase activity in a biological
sample, comprising the steps of: a) incubating the biological
sample; a substrate primer, which can be extended by telomerase
activity; and a complete set of deoxynucleoside triphosphates; and
b) detecting a telomerase extended substrate primer by mass
spectrometry, thereby detecting telomerase activity in the
biological sample.
33. The process of claim 32, wherein the substrate primer is
immobilized to a solid support.
34. The process of claim 33, wherein the substrate primer is
immobilized in an array on the solid support.
35. The process of claim 32, further comprising amplifying the
tetomerase extended substrate primer prior to mass
spectrometry.
36. The method of claim 29 that is a method for identifying cells
or tissues transformed by a mutant proto-oncogene, comprising: a)
in a cell or tissue sample, amplifying a portion of a
proto-oncogene that includes a codon indicative of transformation,
wherein one primer comprises a linker moiety for immobilization; b)
immobilizing DNA via the linker moiety to a solid support,
optionally in the form of an array; c) hybridizing a primer
complementary to the proto-oncogene sequence that is upstream from
the codon d) adding 3dNTPs/1 ddNTP and DNA polymerase and extending
the hybridized primer to the next ddNTP location; e)
ionizing/volatizing the sample; and f) detecting the mass of an
extended DNA indicative of a mutant proto-oncogene, thereby
identifying cells or tissues transformed by a mutant
proto-oncogene.
37. The method of claim 36, wherein the proto-oncogene is the RET
proto-oncogene.
38. The method of claim 37, wherein the codon indicative of
transformation is codon 634 of the RET proto-oncogene.
39. The method of claim 29 that is a method for detecting
expression of a tumor-specific gene, comprising: a) isolating polyA
RNA from the sample; b) preparing a cDNA library using reverse
transcription; c) amplifying a cDNA product, or portion thereof, of
the tumor-specific gene with a set of primers, wherein one primer
of the set of primers comprises a linker moiety; d) isolating the
amplified product by immobilizing the DNA to a solid support via
the linker moiety; e) optionally conditioning the DNA; and f)
ionizing/volatizing sample and detecting the presence of a DNA peak
that is indicative of expression of the gene.
40. The method of claim 39, wherein the calls are bone marrow
cells, the gene is the tyrosine hydroxylase gene, and expression of
the gene is indicative of neuroblastoma.
41. A method for directly detecting a double-stranded nucleic acid
using matrix-assisted laser desorption/ionization time-of-flight
(MALDI-TOF) mass spectrometry, comprising: a) isolating a
double-stranded DNA fragment from a cell or tissue sample; b)
preparing the double-stranded DNA for analysis under conditions
that increase the ratio of dsDNA:ssDNA, wherein the conditions
include one or both of the following: preparing samples for
analysis at a temperature of about 4.degree. C. or less, and using
a high concentration of DNA in the matrix to drive duplex
formation; c) ionizing/volatizing the DNA of step b). using a low
acceleration voltage: and d) detecting the presence of the
double-stranded DNA by MALDI-TOF mass spectrometry.
42. A method for comparing DNA samples to discern relatedness or to
detect mutations, comprising: a) obtaining a plurality of
biological samples; b) amplifying a region of DNA from each sample
that contains two or more microsatellite DNA repeat sequences; c)
detecting the presence of the amplified DNA from each sample by
mass spectrometry and comparing the molecular weights of the
amplified DNA, wherein different sizes are indicative of
non-identity or mutations between or among the samples.
43. The method of claim 42, wherein non-identity is indicative of
the presence of a mutation in the DNA in one sample, of
non-relatedness, or of non-HLA compatibility between or among the
individuals from whom the samples were obtained.
44. The method of claim 42 or 43, wherein a plurality of markers
are examined simultaneously.
45. A method for identifying a target nucleotide in a nucleic acid
sequence, comprising: a) amplifying at least a portion of the
nucleic acid sequence comprising the target nucleotide using; (i) a
first primer, wherein: the 5'-end of the primer shares identity to
a portion of the nucleic acid sequence immediately downstream from
the target nucleotide followed by a sequence encoding a unique
restriction endonuclease site, and the 3'-end of the primer is
self-complementary: and (ii) a second downstream primer that
contains a linker moiety, thereby producing an amplified double
stranded nucleic acid comprising at least a portion of the nucleic
acid sequence comprising the target nucleotide; b) immobilizing the
amplified double-stranded nucleic acid to a solid support via the
linker moiety; c) denaturing the immobilized nucleic acid and
isolating the non-immobilized strand; d) annealing the
intracomplementary sequences in the 3'-end of the isolated
non-immobilized strand, such that the 3'-end is extendable by a
polymerase, thereby producing a self-annealed nucleic acid; f)
extending the self-annealed nucleic acid by incubation witn a
polymerase, 3 dNTPs and 1 ddNTP, which corresponds to the missing
dNTP, thereby producing an extended nucleic acid; g) cleaving the
extended nucleic acid with a restriction endonuciease specific for
the unique restriction endonuclease site; and h) identifying the
target nucleotide.
46. The method of claim 45, wherein identifying the target
nucleotide is indicative of a mutation in the nucleic acid
sequence.
47. The method of claim 45, wherein the target nucleotide is
identified based on the mass of the extended nucleic acid.
48. The method of claim 46, wherein the mass of the extended
nucleic acid is determined by mass spectrometry.
49. A method for detecting a target nucleic acid in a biological
sample using RNA amplification, comprising: a) amplifying a target
nucleic acid using a primer comprising a sequence that is
complementary to the target sequence, or a complement thereof, and
a sequence that encodes an RNA polymerase promoter; b) synthesizing
RNA using an RNA polymerase that recognizes the promoter; and c)
detecting the resulting RNA using mass spectrometry, thereby
detecting the presence of the target nucleic acid sequence in the
biological sample.
50. A process of detecting the presence of a target nucleic acid
sequence, comprising the steps of: a) incubating in a reaction
mixture i) an RNA polymerese, ii) nucleoside triphosphates, and
iii) a nucleic acid molecule comprising the target nucleic acid
sequence, or a complement thereof, and a promoter for the RNA
polymerase, thereby producing an RNA molecule comprising the target
nucleic acid sequence, or a complement thereof; and b) detecting
the RNA molecule by mass spectrometry, thereby detecting the
presence of the target nucleic acid sequence.
51. The process of claim 50, wherein the nucleic acid molecule
comprising the target nucleic acid sequence is DNA and the RNA
polymerase is a DNA dependent RNA polymerase.
52. The process of claim 51, further comprising, following step a)
and prior to step b), inactivating the RNA polymerase; and
digesting the DNA using RNAse-free DNAse I.
53. The process of claim 50, further comprising: hybridizing a
detector oligonucleotide to the RNA molecule comprising the target
nucleic acid sequence, wherein the detector oligonucleotide is
complementary to a portion of the target nucleic acid sequence; and
removing unhybridized detector oligonucleotide; wherein, in step
b), the RNA molecule comprising the target nucleic acid sequence is
detected by detecting hybridized detector oligonucleotide.
54. A method for detecting the presence of a target nucleic acid
sequence, comprising: a) amplifying the target nucleic acid
sequence using a primer comprising a sequence that is complementary
to at least a portion of the target sequence, or a complement
thereof, and a sequence that encodes an RNA polymerase promoter,
thereby producing an amplified nucleic acid molecule comprising the
target nucleic acid, or complement thereof, and an RNA polymerase
promoter; b) incubating the amplified nucleic acid molecule with
nucleoside triphosphates and an RNA polymerase that recognizes the
promoter, thereby producing an RNA corresponding to the target
nucleic acid sequence; and c) detecting the RNA using mass
spectrometry, thereby detecting the presence of the target nucleic
acid sequence.
55. A process for detecting a target nucleic acid sequence present
in a biological sample, comprising the steps of: a) obtaining a
nucleic acid molecule containing a target nucleic acid sequence
from a biological sample. b) immobilizing the target nucleic acid
sequence on a solid support via thiol linkages, whereby the target
nucleic acid sequence is present at a sufficient density to detect
it using mass spectrometry; c) hybridizing a detector
oligonucleotide with the target nucleic acid sequence; d) removing
unhybridized detector oligonucleotide; e) ionizing and volatizing
the product of step c); and f) detecting the detector
oligonucleotide by mass spectrometry, wherein detection of the
detector oligonucleotide indicates the presence of the target
nucleic acid sequence in the biological sample.
56. The process of claim 55, wherein the target nucleic acid
sequence is amplified prior to immobilization.
57. The process of claim 55 or 56, wherein at least one of the
detector oligonucleotide or the target nucleic acid sequence has
been conditioned.
58. A process of any of claims 55-57, wherein the solid support is
selected from the group consisting of: beads, flat surfaces, pins
and combs.
59. A process of any of claims 55-58, wherein the target nucleic
acid is immobilized in the form of an array.
60. A process of any of claims 55-59, wherein the support is a
silicon wafer.
61. A process of any of claims 55-60, wherein the target nucleic
acid sequence is amplified by an amplification procedure selected
from the group consisting of cloning, transcription, the polymerase
chain reaction, the ligase chain reaction, and strand displacement
amplification.
62. A process of any of claims 55-61, wherein the mass spectrometer
is selected from the group consisting of: Matrix-Assisted Laser
Desorption/Ionization Time-of-Flight, Electrospray, Ion Cyclotron
Resonance, and Fourier Transform.
63. A process of any of claims 55-62, wherein the sample is
conditioned by mass differentiating at least two detector
oligonucleotides or oligonucleotide mimetics to detect and
distinguish at least two target nucleic acid sequences
simultaneously.
64. A process of claim 63, wherein the mass differentiation is
achieved by differences in the length or sequence of the at least
two oligonucleotides.
65. A process of claim 64, wherein the mass differentiation is
achieved by the introduction of mass modifying functionalities in
the base, sugar or phosphate moiety of the detector
oligonucleotides.
66. A process of claim 63, wherein the mass differentiation is
achieved by exchange of cations at the phosphodiester bond.
67. A process of any of claims 55-66, wherein the nucleic acid
molecule obtained from a biological sample is amplified into DNA
using mass modified dideoxynucleoside triphosphates and DNA
dependent DNA polymerase prior to mass spectrometric detection.
68. A process of any of claims 55-67, wherein the nucleic acid
molecule obtained from a biological sample is amplified into RNA
using mass modified ribonucleoside triphosphates and DNA dependent
RNA polymerase prior to mass spectrometric detection.
69. A process of any of claims 55-68, wherein the target nucleic
acid sequence is indicative of a disease or condition selected from
the group consisting of a genetic disease, a chromosomal
abnormality, a genetic predisposition, a viral infection, a fungal
infection and a bacterial infection.
70. A process of any of claims 50-69, wherein the detector
oligonucleotide is a peptide nucleic acid.
71. A method of determining a sequence of a nucleic acid,
comprising the steps of: a) obtaining multiple copies of the
nucleic acid to be sequenced; b) cleaving the multiple copies from
a first end to a second end with an exonuclease to sequentially
release individual nucleotides; c) identifying each of the
sequentially released nucleotides by mass spectrometry; and d)
determining the sequence of the nucleic acid from the identified
nucleotides, wherein the nucleic acid is immobilized by covalent
attachment to a solid support via a photocleavable linker of any of
claims 92-103.
72. A method of determining a sequence of a nucleic acid,
comprising the steps of: a) obtaining multiple copies of the
nucleic acid to be sequenced; b) cleaving the multiple copies from
a first end to a second end with an exonuclease to produce multiple
sets of nested nucleic acid fragments; c) determining the molecular
weight value of each one of the sets of nucleic acid fragments by
mass spectrometry; and d) determining the sequence of the nucleic
acid from the molecular weight values of the sets of nucleic acid
fragments, wherein the nucleic acid is immobilized by covalent
attachment to a solid support via a photocleavable linker of any of
claims 92-103.
73. The process of claim 71 or 72, wherein the nucleic acids are
covalently bound to a surface of the support at a density of at
least 20 fmol/mm.sup.2.
74. The method of claim 71-73, wherein the the covalent linkage is
mediated via N-succinimidyl (4-iodoacetyl) aminobenzoate.
75. The method of claim 71 or 72, wherein the nucleic acid is a
2'-deoxyribonucleic acid (DNA).
76. The method of claim 71 or 72, wherein the nucleic acid is a
ribonucleic acid (RNA).
77. The method of any of claims 71-76, wherein the exonuclease is
selected from the group consisting of snake venom
phosphodiesterase, spleen phosphodiesterase, BaI-31 nuclease, E.
coli exonuclease 1, E. exonucleass VII, Mung Bean Nuclease, S1
Nuclease, an exonuclease activity of E. coli DNA polymerase 1, an
exonuclease activity of a Klenow fragment of DNA polymerase 1, an
exonuclease activity of T4 DNA polymerase, an exonuclease activity
of T7 DNA polymerase, an exonuclease activity of Taq DNA
polymerase, an exonuclease activity of DEEP VENT DNA polymerase, E
coli exonuclease III, lambda exonuclease and an exonuclease
activity of VENT.sub.RDNA polymerase.
78. The method of any of claims 71-77, wherein the nucleic acid
comprises mass-modified nucleotides.
79. The method of claim 78, wherein the mass-modified nucleotides
modulate the rate of the exonuclease activity.
80. The method of claim 78, wherein the sequentially released
nucleotides are mass-modified subsequent to exonuclease release and
prior to mass spectrometric identification.
81. The method of claim 80, wherein the sequentially released
nucleotides are mass-modified by contact with an alkaline
phosphatase.
82. A method of any of claims 71-81, wherein the mass spectrometry
format is matrix assisted laser desorption mass spectrometry or
electrospray mass spectrometry.
83. A method of any of claims 71-82, wherein immobilization is
effected by a method, comprising: at reacting the surface of the
substrate with a solution of 3-aminopropyltriethoxysilane to
produce a uniform layer of primary amines an the surface of the
substrate; and b) derivatizing the surface of a substrate with
iodoacetamido functionalities by reacting the uniform layer of
primary amines with a solution of N-succinimidyl (4-iodoacetyl)
aminobenzoate.
84. A primer, comprising at least about 20, preferably about 16,
bases of any of the sequence of nucleotides sequences set forth in
SEQ ID NOs. 32-38, 41-86, 89, 92, 95, 98, 101-110, 112-123, 126,
128 and 129.
85. A primer, comprising at least about 20, preferably about 16,
bases of any of the sequence of nucleotides sequences set forth in
SEQ ID NOs. 1-22, 24, and 27-32.
86. A primer of claim 84 or 85 that is unlabeled, and optionally
includes a mass modifying moiety, which is preferably attached to
the 5' end.
87. The method of any of claims 1-17 and 29-69, wherein a nucleic
acid is immobilized to a solid support via a selectively cleavable
linker.
88. The method of claim 87, wherein the linker is thermocleavable,
enzymatically cleavable, photocleavable or chemically
cleavable.
89. The method of claim 87, wherein the linker is a trityl
linker.
90. The method of claim 89, wherein the linker is selected from the
group consisting of
1-(2-nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)-phenyl)-1
-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane and
1-(4(3-O-4,4'-dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)-1-O
-((2-cyanoethoxy)-diisopropylaminophosphino)ethane.
91. A process of any of claims 1 to 90, wherein a primer is a
peptide nucleic acid.
92. A photolabile linker, comprising a compound of formula:
7wherein: R.sup.20 is selected from the group consisting of
.omega.-(4,4'-dimethoxy- trityloxy)alkyl and .omega.-hydroxyalkyl;
R.sup.21 is selected from the group consisting of hydrogen, alkyl,
aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R.sup.22 is
selected from the group consisting of hydrogen and
(dialkylamino)(.omega.-cyanoalkoxy)P--; t is 0-3; and R.sup.50 is
selected from the group consisting of alkyl, alkoxy, aryl and
aryloxy.
93. The photocleavable linker of claim 92, wherein the linkers are
of formula II: 8wherein: R.sup.20 is selected from the group
consisting of .omega.-(4,4'-dimethoxytrityloxy)alkyl,
.omega.-hydroxyalkyl and alkyl; R.sup.21 is selected from the group
consisting of hydrogen, alkyl, aryl, alkoxycarbonyl,
arytoxycarbonyl and carboxy; R.sup.22 is selected from the group
consisting of hydrogen and (dialkylamino)(.omega.-cyanoalkoxy)P-
--; and X.sup.20 is selected from the group consisting of hydrogen,
alkyl or OR.sup.20.
94. The photocleavable linker of claim 93, wherein: R.sup.20 is
selected from the group consisting of 3-(4, 4'-d imethoxytrityloxy)
propyl, 3-hydroxypropyl and methyl; R.sup.21 is selected from the
group consisting of hydrogen, methyl and carboxy; R.sup.22 is
selected from the group consisting of hydrogen and
(diisopropyiamino)(2-cyanoethoxy)P--: and X.sup.20 is selected from
the group consisting of hydrogen, methyl or OR.sup.20.
95. The photocleavable linker of claim 93, wherein: R.sup.20 is
3-(4,4'-dimethoxytrityloxy)propyl; R.sup.21 is methyl; R.sup.22 is
(diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is hydrogen.
96. The photocleavable linker of claim 93, wherein: R.sup.20 is
methyl; R.sup.21 is methyl: R.sup.22 is
(diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is
3-(4,4'-dimethoxytrityloxy)propoxy.
97. A photocleavable linker, comprising a compound of formula III:
9wherein: R.sup.23 is selected from the group consisting of
hydrogen and (dialkylamino)(.omega.-cyanoalkoxy)P--; R.sup.24 is
selected from .omega.-hydroxyalkoxy,
.omega.-(4,4'-dimethoxytrityloxy)alkoxy, .omega.-hydroxyalkyl and
.omega.-(4,4'-dimethoxytrityloxy)alkyl, and is unsubstituted or
substituted on the alkyl or alkoxy chain with one or more alkyl
groups; r and a are each independently 0-4; and R.sup.50 is alkyl,
alkoxy, aryl or aryloxy.
98. The photocleavable linker of claim 97, wherein; R.sup.24 is
.omega.-hydroxyalkyl or .omega.-(4,4'-dimethoxytrityloxy)alkyl, and
is substituted on the alkyl chain with a methyl group.
99. The photocleavable linker of claim 97, wherein: R.sup.23 is
selected from the group consisting of hydrogen and
(diisopropylamino) (2-cyanoethoxy)P--; and R.sup.24 is selected
from the group consisting of 3-hydroxypropoxy,
3-(4,4'-dimethoxytrityloxy) propoxy, 4-hydroxybutyl,
3-hydroxy-1-propyl, 1-hydroxy-2-propyl,
3-hydroxy-2-methyl-1-propyl, 2-hydroxyethyl, hydroxymethyl, 4-(4,
4'-dimethoxytrityloxy) butyl, 3-(4,
4'-dimethoxytrityloxy)-1-propyl, 2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy)-2-propyl,
3-(4,4'-dimethoxytrityloxy)-2-methy- l-1-propyl and
4,4'-dimethyoxytrityloxymethyl.
100. The photocleavable linker of claim 99, wherein r and S are
both 0.
101. The photocleavable linker of claim 100, wherein: R.sup.23 is
(diisopropylamino) (2-cyanoethoxy)P--; and R.sup.24 is selected
from the group consisting of 3-(4,4'-dimethoxytrityloxy)propoxy,
4-(4,4'-dimethoxytrityloxy)butyl,
3-(4,4'-dimethoxytrityloxy)propyl,
2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy)-2-propyl,
3-(4,4'-dimethoxytriyloxy)-2-methyl-1-propyl and
4,4'-dimethyoxytrityloxy- methyl.
102. The photocleavable linker of claim 101, wherein: R.sup.24 is
3-(4,4'-dimethoxytrityloxy)propoxy.
103. The photocleavable linker of claim 102, where in the linker is
selected from the group consisting of
1-(2-nitro-5-(3-O-4,4'-dimethoxytri-
tylpropoxy)phenyl)-1-O-((2-cyancethoxy)-diisopropylaminophosphino)-ethane
and 1-(4-(3-O-4,4'-dimethoxytritylpropoxy
)-3-methoxy-6-nitro-phenyl)-1-O-
-((2-cyancethoxy)-diisopropylaminophosphino)ethane.
Description
RELATED APPLICATIONS
[0001] For U.S. National Stage purposes, this application is a
continuation-in-part of U.S. application Ser. No. 08/744,481, filed
Nov. 6, 1996, to Koster, entitled "DNA DIAGNOSTICS BASED ON MASS
SPECTROMETRY". This application is also a continuation-in-part of
U.S. application Ser. Nos. 081744,590, 08/746,036, 08/746,055,
08/786,988, 08/787,639, 08/933,792 and U.S. application Ser. No.
atty dkt. no. 7352-2001 B, filed Oct. 8, 1997, which is a
continuation-in-part of U.S. application Ser. Nos. 08/746,055,
08/786,988 and 08/787,639. For international purposes, benefit of
priority is claimed to each of these applications.
[0002] This application is related to U.S. patent application Ser.
No. 08/617,256 filed on Mar. 18, 1996, which is a
continuation-in-part of U.S. application Ser. No. 08/406,193, filed
Mar. 17, 1995, now U.S. Pat. No. 5,605,798, and is also related
U.S. Pat. Nos. 5,547,835 and 5,622,824.
[0003] Where permitted the subject matter of each of the
above-noted patent applications and the patent is herein
incorporated in its entirety.
BACKGROUND OF THE INVENTION
[0004] Detection of Mutations
[0005] The genetic information of all living organisms (e.g.,
animals, plants and microorganisms) is encoded in deoxyribonucleic
acid (DNA). In humans, the complete genome is contains of about
100,000 genes located on 24 chromosomes (The Human Genome, T.
Strachan, BIOS Scientific Publishers, 1992). Each gene codes for a
specific protein, which after its expression via transcription and
translation, fulfills a specific biochemical function within a
living cell. Changes in a DNA sequence are known as mutations and
can result in proteins with altered or in some cases even lost
biochemical activities; this in turn can cause genetic disease.
Mutations include nucleotide deletions, insertions or alterations
(i.e. point mutations). Point mutations can be either "missense",
resulting in a change in the amino acid sequence of a protein or
"nonsense" coding for a stop codon and thereby leading to a
truncated protein.
[0006] More than 3000 genetic diseases are currently known (Human
Genome Mutations, D. N. Cooper and M. Krawczak, BIOS Publishers,
1993), including hemophilias, thalassemias, Duchenne Muscular
Dystrophy (DMD), Huntington's Disease (HD), Alzheimer's Disease and
Cystic Fibrosis (CF). In addition to mutated genes, which result in
genetic disease, certain birth defects are the result of
chromosomal abnormalities such as Trisomy 21 (Down's Syndrome),
Trisomy 13 (Patau Syndrome), Trisomy 18 (Edward's Syndrome),
Monosomy X (Turner's Syndrome) and other sex chromosome
aneuploidies such as Klienfelter's Syndrome (XXY). Further, there
is growing evidence that certain DNA sequences may predispose an
individual to any of a number of diseases such as diabetes,
arteriosclerosis, obesity, various autoimmune diseases and cancer
(e.g., colorectal, breast, ovarian, lung).
[0007] Viruses, bacteria, fungi and other infectious organisms
contain distinct nucleic acid sequences, which are different from
the sequences contained in the host cell. Therefore, infectious
organisms can also be detected and identified based on their
specific DNA sequences.
[0008] Since the sequence of about 16 nucleotides is specific on
statistical grounds even for the size of the human genome,
relatively short nucleic acid sequences can be used to detect
normal and defective genes in higher organisms and to detect
infectious microorganisms (e.g., bacteria, fungi, protists and
yeast) and viruses. DNA sequences can even serve as a fingerprint
for detection of different individuals within the same species
(see, Thompson, J. S. and M. W. Thompson, eds., Genetics in
Medicine, W.B. Saunders Co., Philadelphia, Pa. (1991)).
[0009] Several methods for detecting DNA are currently being used.
For example, nucleic acid sequences can be identified by comparing
the mobility of an amplified nucleic acid fragment with a known
standard by gel electrophoresis, or by hybridization with a probe,
which is complementary to the sequence to be identified.
Identification, however, can only be accomplished if the nucleic
acid fragment is labeled with a sensitive reporter function (e.g.,
radioactive (.sup.32P, .sup.35S) fluorescent or chemiluminescent).
Radioactive labels can be hazardous and the signals they produce
decay over time. Non-isotopic labels (e.g., fluorescent) suffer
from a lack of sensitivity and fading of the signal when high
intensity lasers are being used. Additionally, performing labeling,
electrophoresis and subsequent detection are laborious,
time-consuming and error-prone procedures. Electrophoresis is
particularly error-prone, since the size or the molecular weight of
the nucleic acid cannot be directly correlated to the mobility in
the gel matrix. It is known that sequence specific effects,
secondary structure and interactions with the gel matrix are
causing artefacts.
[0010] Use of Mass Spectrometry for Detection and Identification of
Nucleic Acids
[0011] Mass spectrometry provides a means of "weighing" individual
molecules by ionizing the molecules in vaccuo and making them "fly"
by volatilization. Under the influence of combinations of electric
and magnetic fields, the ions follow trajectories depending on
their individual mass (m) and charge (z). In the range of molecules
with low molecular weight, mass spectrometry has long been part of
the routine physical-organic repertoire for analysis and
characterization of organic molecules by the determination of the
mass of the parent molecular ion. In addition, by arranging
collisions of this parent molecular ion with other particles (e.g.,
argon atoms), the molecular ion is fragmented forming secondary
ions by the so-called collision induced dissociation (CID). The
fragmentation pattern/pathway very often allows the derivation of
detailed structural information. Many applications of mass
spectrometric methods are known in the art, particularly in
biosciences (see, e.g., Methods in Enzymol., Vol. 193: "Mass
Spectrometry" (J. A. McCloskey, editor), 1990, Academic Press, New
York).
[0012] Because of the apparent analytical advantages of mass
spectrometry in providing high detection sensitivity, accuracy of
mass measurements, detailed structural information by CID in
conjunction with an MS/MS configuration and speed, as well as
on-line data transfer to a computer, there has been interest in the
use of mass spectrometry for the structural analysis of nucleic
acids. Recent reviews summarizing this field include K. H. Schram,
"Mass Spectrometry of Nucleic Acid Components, Biomedical
Applications of Mass Spectrometry" 34, 203-287 (1990); and P. F.
Crain, "Mass Spectrometric Techniques in Nucleic Acid Research,"
Mass Spectrometry Reviews 9, 505-554 (1990); see, also U.S. Pat.
No. 5,547,835 and U.S. Pat. No. 5,622,824).
[0013] Nucleic acids, however, are very polar biopolymers that are
very difficult to volatilize. Consequently, mass spectrometric
detection has been limited to low molecular weight synthetic
oligonucleotides for confirming an already known oligonucleotide
sequence by determining the mass of the parent molecular ion, or
alternatively, confirming a known sequence through the generation
of secondary ions (fragment ions) via CID in an MS/MS configuration
using, in particular, for the ionization and volatilization, the
method of fast atomic bombardment (FAB mass spectrometry) or plasma
desorption (PD mass spectrometry). As an example, the application
of FAB to the analysis of protected dimeric blocks for chemical
synthesis of oligodeoxynucleotides has been described (Koster et
al. (1987) Biomed. Environ. Mass Spectrometry 14, 111-116).
[0014] Other ionization/desorption techniques include
electrospray/ion-spray (ES) and matrix-assisted laser
desorption/ionization (MALDI). ES mass spectrometry has been
introduced by Fenn et al. (J. Phys. Chem. 88:4451-59 (1984); PCT
Application No. WO 90/14148) and current applications are
summarized in review articles (see, e.g., Smith et al. (1990) Anal.
Chem. 62:882-89 and Ardrey (1992) Electrospray Mass Spectrometry,
Spectroscopy Europe 4:10-18). The molecular weights of a
tetradecanucleotide (see, Covey et al. (1988) The "Determination of
Protein, Oligonucleotide and Peptide Molecular Weights by Ionspray
Mass Spectrometry," Rapid Commun. in Mass Spectrometry 2:249-256),
and of a 21-mer (Methods in Enzymol., 193, "Mass Spectrometry"
(McCloskey, editor), p. 425, 1990, Academic Press, New York) have
been published. As a mass analyzer, a quadrupole is most frequently
used. Because of the presence of multiple ion peaks that all could
be used for the mass calculation, the determination of molecular
weights in femtomole amounts of sample is very accurate.
[0015] MALDI mass spectrometry, in contrast, can be attractive when
a time-of-flight (TOF) configuration (see, Hillenkamp et al. (1990)
pp 49-60 in "Matrix Assisted UV-Laser Desorption/Ionization: A New
Approach to Mass Spectrometry of Large Biomolecules," Biological
Mass Spectrometry, Burlingame and McCloskey, editors, Elsevier
Science Publishers, Amsterdam) is used as a mass analyzer. Since,
in most cases, no multiple molecular ion peaks are produced with
this technique, the mass spectra, in principle, look simpler
compared to ES mass spectrometry.
[0016] Although DNA molecules up to a molecular weight of 410,000
daltons have been desorbed and volatilized (Williams et al.,
"Volatilization of High Molecular Weight DNA by Pulsed Laser
Ablation of Frozen Aqueous Solutions," Science 246, 1585-87
(1989)), this technique had only shown very low resolution
(oligothymidylic acids up to 18 nucleotides, Huth-Fehre et al.
Rapid Commun. in Mass Spectrom., 6, 209-13 (1992); DNA fragments up
to 500 nucleotides in length K. Tang et al., Rapid Commun. in Mass
Spectrom., 8, 727-730 (1994); and a double-stranded DNA of 28 base
pairs (Williams et al., "Time-of-Flight Mass Spectrometry of
Nucleic Acids by Laser Ablation and Ionization from a Frozen
Aqueous Matrix," Rapid Commun. in Mass Spectrom., 4, 348-351
(1990)). Japanese Patent No. 59-131909 describes an instrument,
which detects nucleic acid fragments separated either by
electrophoresis, liquid chromatography or high speed gel
filtration. Mass spectrometric detection is achieved by
incorporating into the nucleic acids, atoms, such as S, Br, I or
Ag, Au, Pt, Os, Hg, that normally do not occur in DNA.
[0017] Co-owned U.S. Pat. No. 5,622,824 describes methods for DNA
sequencing based on mass spectrometric detection. To achieve this,
the DNA is by means of protection, specificity of enzymatic
activity, or immobilization, unilaterally degraded in a stepwise
manner via exonuclease digestion and the nucleotides or derivatives
detected by mass spectrometry. Prior to the enzymatic degradation,
sets of ordered deletions that span a cloned DNA fragment can be
created. In this manner, mass-modified nucleotides can be
incorporated using a combination of exonuclease and DNA/RNA
polymerase. This permits either multiplex mass spectrometric
detection, or modulation of the activity of the exonuclease so as
to synchronize the degradative process. Co-owned U.S. Pat. Nos.
5,605,798 and 5,547,835 provide methods for detecting a particular
nucleic acid sequence in a biological sample. Depending on the
sequence to be detected, the processes can be used, for example, in
methods of diagnosis. These methods, while broadly useful and
applicable to numerous embodiments, represent the first disclosure
of such applications and can be improved upon.
[0018] Therefore, it is an object herein to provided improved
methods for sequencing and detecting DNA molecules in biological
samples. It is also an object herein to provided improved methods
for diagnosis of genetic diseases, predispositions to cetain
diseases, cancers, and infections.
SUMMARY OF THE INVENTION
[0019] Methods of diagnosis by detecting and/or determing sequences
of nucleic acids that are based on mass spectrometry are provided
herein. Methods are provided for detecting double-stranded DNA,
detecting mutations and other diagnostic markers using MS analysis.
In particular, methods for diagnosing neuroblastoma, detecting
heredity relationships, HLA compatibility, genetic fingerprinting,
detecting teleromase activity for cancer diagnosis are
provided.
[0020] In certain embodiments the DNA is immobilized on a solid
support either directly or via a linker and/or bead. Three
permutions of the methods for DNA detection in which immobilized
DNA is used are exemplified. These include: (1) immobilization of a
template; hybridization of the primer; extension of the primer, or
extension of the primer (single ddNTP) for sequencing or
diagnostics or extension of the primer and Endonuclease degradation
(sequencing); (2) immobilization of a primer; hybridization of a
single stranded template; and extension of the primer, or extension
of the primer (single ddNTP) for sequencing or diagnostics or
extension of the primer and Endonuclease degradation (sequencing);
(3) immobilization of the primer; hybridization of a double
stranded template; extension of the primer, or extension of the
primer (single ddNTP) for sequencing or diagnostics or extension of
the primer and Endonuclease degradation (sequencing).
[0021] In certain embodiments the DNA is immobilized on the support
via a selectively cleavable linker. Selectively cleavable linkers
include, buta are not limited to photocleavable linkers, chemically
cleavable linkers and an enzymatically (such as a restriction site
(nucleic acid linker), a protease site) cleavable linkers.
Inclusion of a selectively cleavable linker expands the
capabilities of the MALDI-TOF MS analysis because it allows for all
of the permutations of immobilization of DNA for MALDI-TOF MS, the
DNA linkage to the support through the 3'- or 5'-end of a nucleic
acid; allows the amplified DNA or the target primer to be extended
by DNA synthesis; and further allows for the mass of the extended
product (or degraded product via exonuclease degradation) to be of
a size that is appropriate for MALDI-TOF MS analysis (i.e., the
isolated or synthesized DNA can be large and a small primer or a
large primer sequence can be used and a small restriction fragment
of a gene or single strand thereof hybridized thereto).
[0022] In a preferred embodiment, the selectively cleavable linker
is a chemical or photocleavable linker that is cleaved during the
ionizing step of mass spectrometry. Exemplary linkers include
linkers containing, a disulfide group, a leuvinyl group, an
acid-labile trityl group and a hydrophobic trityl group. In other
embodiments, the enzymatically cleavable linker can be a nucleic
acid that is an RNA nucleotide or that encodes a restriction
endonuclease site. Other enzymatically cleavable linkers include
linkers that contain a pyrophosphate group, an arginine-arginine
group and a lysine-lysine group. Other linkers are exemplified
herein.
[0023] Methods for sequencing long fragments of DNA are provided.
To perform such sequencing, specific base terminated fragments are
generated from a target nucleic acid. The analysis of fragments
rather than the full length nucleic acid shifts the mass of the
ions to be determined into a lower mass range, which is generally
more amenable to mass spectometric detection. For example, the
shift to smaller masses increases mass resolution, mass accuracy
and, in particular, the sensitivity for detection. Hybridization
events and the actual molecular weights of the fragments as
determined by mass spectrometry provide sequence information (e.g.,
the presence and/or identity of a mutation). In a preferred
embodiment, the fragments are captured on a solid support prior to
hybridization and/or mass spectrometry detection. In another
preferred embodiment, the fragments generated are ordered to
provide the sequence of the larger nucleic acid.
[0024] One preferred method for generating base specifically
terminated fragments from a nucleic acid is effected by contacting
an appropriate amount of a target nucleic acid with an appropriate
amount of a specific endonuclease, thereby resulting in partial or
complete digestion of the target nucleic acid. Endonucleases will
typically degrade a sequence into pieces of no more than about
50-70 nucleotides, even if the reaction is not run to full
completion. In a preferred embodiment, the nucleic acid is a
ribonucleic acid and the endonuclease is a ribonuclease (RNase)
selected from among: the G-specific RNase T.sub.1, the A-specific
RNase U.sub.2, the A/U specific RNase PhyM, U/C specific RNase A, C
specific chicken liver RNase (RNase CL3) or crisavitin. In another
preferred embodiment, the endonuclease is a restriction enzyme that
cleaves at least one site contained within the target nucleic acid.
Another preferred method for generating base specifically
terminated fragments includes performing a combined amplification
and base-specific termination reaction (e.g., using an appropriate
amount of a first DNA polymerase, which has a relatively low
affinity towards the chain-terminating nucleotides resulting in an
exponential amplification of the target; and a polymerase with a
relatively high affinity for the chain terminating nucleotide
resulting in base-specific termination of the polymerization.
Inclusion of a tag at the 5' and/or 3' end of a target nucleic acid
can facilitates the ordering of fragments.
[0025] Methods for determining the sequence of an unknown nucleic
acid in which the 5' and/or 3' end of the target nucleic acid can
include a tag are provided. Inclusion of a non-natural tag on the
3' end is also useful for ruling out or compensating for the
influence of 3' heterogeneity, premature termination and
nonspecific elongation. In a preferred embodiment, the tag is an
affinity tag (e.g., biotin or a nucleic acid that hybridizes to a
capture nucleic acid). Most preferably the affinity tag facilitates
binding of the nucleic acid to a solid support. In another
preferred embodiment, the tag is a mass marker (i.e. a marker of a
mass that does not correspond to the mass of any of the four
nucleotides). In a further embodiment, the tag is a natural tag,
such as a polyA tail or the natural 3' heterogeneity that can
result, for example, from a transcription reaction.
[0026] Methods of sequence analysis in which nucleic acids have
been replicated from a nucleic acid molecule obtained from a
biological sample are specifically digested using one or more
nucleases (deoxyribonucleases for DNA, and ribonucleases for RNA)
are provided. The fragments captured on a solid support carrying
the corresponding complementary sequences. Hybridization events and
the actual molecular weights of the captured target sequences
provide information on mutations in the gene. The array can be
analyzed spot-by-spot using mass spectrometry. Further, the
fragments generated can be ordered to provide the sequence of the
larger target fragment.
[0027] In another embodiment, at least one primer with a
3'-terminal base is hybridized to the target nucleic acid near a
site where possible mutations are to be detected. An appropriate
polymerase and a set of three nucleoside triphosphates (NTPs) and
the fourth added as a terminator are reacted. The extension
reaction products are measured by mass spectrometry and are
indicative of the presence and the nature of a mutation. The set of
three NTPs and one dd-NTP (or three NTPs and one 3'-deoxy NTP),
will be varied to be able to discriminate between several mutations
(including compound heterozygotes) in the target nucleic acid
sequence.
[0028] Methods for detecting and diagnosing neoplasia/malagnancies
in a tissue or cell sample are provided. The methods rely on a
telomeric repeat amplification protocol (TRAP)-MS assay and include
the steps of:
[0029] a) obtaining a tissue or a cell sample, such as a clinical
isolate or culture of suspected cells;
[0030] b) isolating/extracting/purifying telomerase from the
sample;
[0031] c) adding the telomerase extract to a composition containing
a synthetic DNA primer, which is optionally immobilized,
complementary to the telomeric repeat, and all four dNTPs under
conditions that result in telomerase specific extension of the
synthetic DNA;
[0032] d) amplifying the telomerase extended DNA products,
preferably using a primer that contains a "linker moiety", such as
a moiety based on thiol chemistry or streptavidin;
[0033] e) isolating linker-amplified primers, such as by using a
complementary binding partner immobilized on a solid support;
[0034] f) optionally conditioning the DNA for crystal formation;
and
[0035] g) performing MS by ionizing/volatizing the sample to detect
the DNA product.
[0036] Telomerase-specific extension is indicative of
neoplaisa/malignancy. This method can be used to detect ect
specific malignancies. The use of MS to detect the DNA product
permits identification the extended product, which is indicative of
telomerase activity in the sample. If desired, the synthetic DNA
can be in the form an array.
[0037] Methods for detecting mutations are provided and the use
thereof oncogenes and to thereby screen for transformed cells,
which are indicative of neoplasia. Detection of mutations present
in oncogenes are indicative of transformation. This method includes
the steps of:
[0038] a) obtaining a biological sample;
[0039] b) amplifying a portion of the selected proto-oncogene that
includes a codon indicative of transformation, where one primer has
a linker moiety for immobilization;
[0040] c) immobilizing DNA via the linker moiety to a solid
support, optionally in the form of an array;
[0041] d) hybridizing a primer complementary to the proto oncogene
sequence that is upstream from the codon
[0042] e) adding 3dNTPs/1 ddNTP and DNA polymerase and extending
the hybridized primer to the next ddNTP location;
[0043] f) ionizing/volatizing the sample; and
[0044] g) detecting the mass of the extended DNA, whereby mass
indicates the presence of wild-type or mutant alleles. The presence
of a mutant allele at the codon is diagnostic for neoplasia.
[0045] In an exemplary embodiment, extension-MS analysis is used
detect the presence of a mutated codon 634 in the retrovirus
(RET)-proto oncogene.
[0046] In another embodiment, methods for diagnosing diseases using
reverse transcription and amplification of a gene expressed in
transformed cells. In particular, a method for diagnosis of
neuroblastoma using reverse transcriptase (RT)-MS of tyrosine
hydroxylase, which is a catecholamine biosynthetic enzyme that
expressed in tumor cells, but not in normal cells, such as normal
bone marrow cells is provided. The method includes the steps
of:
[0047] a) obtaining a tissue sample,
[0048] b) isolating polyA RNA from the sample;
[0049] c) preparing a cDNA library using reverse transcription;
[0050] d) amplifing a cDNA product, or portion thereof, of the
selected genes where one oligo primer has a linker moiety;
[0051] e) isolating the amplified product by immobilizing the DNA
to solid support via the linker moiety:
[0052] f) optionally conditioning the DNA:
[0053] g) ionizing/volatizing sample and detecting the presence of
a DNA peak that is indicative of expression of the selected gene
gene.
[0054] For example, expression of the tyrosine hydroxylase gene is
indicative of neuroblastoma.
[0055] Also provided are methods of directly detecting a
double-stranded nucleic acid using MALDI-TOF MS. These methods
include the steps of:
[0056] a) isolating a double stranded DNA of an appropriate size
for MS via amplification methods or formed by hybridization of
single-stranded DNA fragment;
[0057] b) preparing the double-stranded DNA for analysis under
conditions that increase the ratio of dsDNA:ssDNA in which the
conditions include one or all of the following: preparing samples
for analysis at reduced temperatures (i.e. 4.degree. C.), and using
of higher DNA concentrations in the matrix to drive duplex
formation
[0058] c) ionizing/volatizing the sample of step b), where this
step uses low acceleration voltage of the ions to assist in
maintaining duplex DNA by, for example, adjusting laser power to
just above threshold irradiation for ionization, and
[0059] d) detecting the presence of the dsDNA of the appropriate
mass.
[0060] In preferred embodiments, the matrix includes
3-hydroxypicolinic acid. The detected DNA can be indicative of a
genetic disorder, genetic disease, genetic predisposition to a
disease chromosomal abnormalities. In other embodiments, the mass
of the double stranded DNA is indicative of the deletion,
insertion, mutation.
[0061] A method designated primer oligo base extension (PROBE) is
provided. This method uses a single detection primer followed by an
oligonucleotide extension step to give products, which can be
readily resolved by MALDI-TOF mass spectrometry. The products
differ in length by a number of bases specific for a number of
repeat units or for second site mutations within the repeated
region. The method is exemplified using as a model system the
AluVpA polymorphism in intron 5 of the interferon-.alpha. receptor
gene located on human chromosome 21, and the poly T tract of the
splice acceptor site of intron 8 from the CFTR gene located on
human chromosome 7. The method is advantageously used for example,
for determining identity, identifying mutations, familial
relationship, HLA compatability and other such markers, using
PROBE-MS analysis of microsatellite DNA. In a preferred embodiment,
the method includes the steps of:
[0062] a) obtaining a biological sample from two individuals;
[0063] b) amplifying a region of DNA from each individual that
contains two or more microsatellite DNA repeat sequences
[0064] c) ionizing/volatizing the amplified DNA;
[0065] d) detecting the presence of the amplified DNA and comparing
the molecular weight of the amplified DNA. Different sizes are
indicative of non-identity (i.e. wild-type versus mutation),
non-heredity or non-compatibility; similar size fragments indicate
the possibility identity, of familial relationship, or HLA
compatibility.
[0066] More than one marker may be examined simulataneoulsy,
primers with different linker moieties are used for
immobilization.
[0067] Another method loop-primer oligo base extension, designated
LOOP-PROBE, for detection of mutations especially predominant
disease causing mutations or common polymorphisms is provided. In a
particular embodiment, this method for detecting target nucleic
acid in a sample, includes the steps of:
[0068] a) amplifying a target nucleic acid sequence, such as,
.beta.-globin, in a sample, using (i) a first primer whose 5'-end
shares identity to a portion of the target DNA immediately
downstream from the targeted codon followed by a sequence that
introduces a unique restriction endonuclease site, such as CfoI in
the case of .beta.-globin, into the amplicon and whose 3'-end
primer is self-complementary; and (ii) a second downstream primer
that contains a tag, such as biotin, for immobilizing the DNA to a
solid support, such as streptavidin beads;
[0069] c) immobilizing the double-stranded amplified DNA to a solid
support via the linker moiety;
[0070] d) denaturing the immobilized DNA and isolating the
non-immobilized DNA strand;
[0071] e) annealing the intracomplementary sequences in the 3'-end
of the isolated non-immobilzed DNA strand, such that the 3'-end is
extendable by a polymerase, which annealing can be performed, for
example, by heating then and cooling to about 37.degree. C., or
other suitable method;
[0072] f) extending the annealed DNA by adding DNA polymerase, 3
dNTPs/1 ddNTP, whereby the 3'-end of the DNA strand is extended by
the DNA polymerase to the position of the next ddNTP location
(i.e., to the mutation location);
[0073] g) cleaving the extended double stranded stem loop DNA with
the unique restriction endonuclease and removing the cleaved stem
loop DNA
[0074] i) (optionally adding a matrix) ionizing/volatizing the
extended product; and
[0075] j) detecting the presence of the extended target nucleic
acid, whereby the presence of a DNA fragment of a mass different
from wild-type is indicative of a mutation at the target
codon(s).
[0076] This method eliminates one specific reagent for mutation
detection compared other methods of MS mutational analyses, thereby
simplifying the process and rendering it amenable to automation.
Also, the specific extended product that is analyzed is cleaved
from the primer and is therefore shorter compared to the other
methods. In addition, the annealing efficiency is higher compared
to annealing of an added primer and should therefore generate more
product. The process is compatible with multiplexing and various
detection schemes (e.g., single base extension, oligo base
extension and sequencing). For example, the extension of the
loop-primer can be used for generation of short diagnostic
sequencing ladders within highly polymorphic regions to perform,
for example, HLA typing or resistance as well as species
typing.
[0077] In another emodiment, a methods of detecting a target
nucleic acid in a biological sample using RNA amplification is
provided. In the method, the target is amplified the target nucleic
acid, using a primer that shares a region complementary to the
target sequence and upstream encodes a promoter, such as the T7
promoter. A DNA-dependent RNA polymerase and appropriate
ribonucleotides are added to synthesize RNA, which is analyzed by
MS.
[0078] Improved methods of sequencing DNA using MS are provided. In
these methods thermocycling for amplification is used prior to MS
analysis, thereby increasing the signal.
[0079] Also provide are primers for use in MS analyses. In
particular, primers, comprising all or, for longer
oligonucleotides, at least about 20, preferably about 16, bases of
any of the sequence of nucleotides sequences set forth in SEQ ID
NOs. 1-22, 24, 27-38, 41-86, 89, 92, 95, 98, 101-110, 112-123, 126,
128, 129, and primers set forth in SEQ ID Nos. 280-287. The primers
are unlabeled, and optionally include a mass modifying moiety,
which is preferably attached to the 5' end.
[0080] Other features and advantages of the methods provided herein
will be further described with reference to the following Figures,
Detailed Description and claims.
BRIEF DESCRIPTION OF THE FIGURES
[0081] FIG. 1A is a diagram showing a process for performing mass
spectrometric analysis on one target detection site (TDS) contained
within a target nucleic acid molecule (T), which has been obtained
from a biological sample. A specific capture sequence (C) is
attached to a solid support (SS) via a spacer (S). The capture
sequence is chosen to specifically hybridize with a complementary
sequence on the target nucleic acid molecule (T), known as the
target capture site (TCS). The spacer (S) facilitates unhindered
hybridization. A detector nucleic acid sequence (D), which is
complementary to the TDS is then contacted with the TDS.
Hybridization between D and the TDS can be detected by mass
spectrometry.
[0082] FIG. 1B is a diagram showing a process for performing mass
spectrometric analysis on at least one target detection site (here
TDS 1 and TDS 2) via direct linkage to a solid support. The target
sequence (T) containing the target detection site (TDS 1 and TDS 2)
is immobilized to a solid support via the formation of a reversible
or irreversible bond formed between an appropriate functionality
(L') on the target nucleic acid molecule (T) and an appropriate
functionality (L) on the solid support. Detector nucleic acid
sequences (here D1 and D2), which are complementary to a target
detection site (TDS 1 or TDS 2) are then contacted with the TDS.
Hybridization between TDS 1 and D1 and/or TDS 2 and D2 can be
detected and distinguished based on molecular weight
differences.
[0083] FIG. 1C is a diagram showing a process for detecting a
wildtype (D.sup.wt) and/or a mutant (D.sup.mut) sequence in a
target (T) nucleic acid molecule. As in FIG. 1A, a specific capture
sequence (C) is attached to a solid support (SS) via a spacer (S).
In addition, the capture sequence is chosen to specifically
interact with a complementary sequence on the target sequence (T),
the target capture site (TCS) to be detected through hybridization.
If the target detection site (TDS) includes a mutation, X, etection
sites can be distinguished from wildtype by mass spectrometry.
Preferably, the detector nucleic acid molecule (D) is designed so
that the mutation is in the middle of the molecule and therefore
would not lead to a stable hybrid if the wildtype detector
oligonucleotide (D.sup.wt) is contacted with the target detector
sequence, e.g., as a control. The mutation can also be detected if
the mutated detector oligonucleotide (D.sup.mut) with the matching
base at the mutated position is used for hybridization. If a
nucleic acid molecule obtained from a biological sample is
heterozygous for the particular sequence (i.e. contain D.sup.wt and
D.sup.mut), D.sup.wt and D.sup.mut will be bound to the app and
D.sup.mut to be detected simultaneously.
[0084] FIG. 2 is a diagram showing a process in which several
mutations are simultaneously detected on one target sequence
molecular weight differences between the detector oligonucleotides
D1, D2 and D3 must be large enough so that simultaneous detection
(multiplexing) is possible. This can be achieved either by the
sequence itself (composition or length) or by the introduction of
mass-modifying functionalities M1-M3 into the detector
oligonucleotide.
[0085] FIG. 3 is a diagram showing still another multiplex
detection format. In this embodiment, differentiation is
accomplished by employing different specific capture sequences
which are position-specifically immobilized on a flat surface
(e.g., a `chip array`). If different target sequences T1-Tn are
present, their target capture sites TCS1-TCSn will interact with
complementary immobilized capture sequences C1-Cn. Detection is
achieved by employing appropriately mass differentiated detector
oligonucleotides D1-Dn, which are mass differentiated either by
their sequences or by mass modifying functionalities M1-Mn.
[0086] FIG. 4 is a diagram showing a format wherein a predesigned
target capture site (TCS) is incorporated into the target sequence
using nucleic acid (i.e., PCR) amplification. Only one strand is
captured, the other is removed (e.g., based on the interaction
between biotin and streptavidin coated magnetic beads). If the
biotin is attached to primer 1 the other strand can be
appropriately marked by a TCS. Detection is as described above
through the interaction of a specific detector oligonucleotide D
with the corresponding target detection site TDS via mass
spectrometry.
[0087] FIG. 5 is a diagram showing how amplification (here ligase
chain reaction (LCR)) products can be prepared and detected by mass
spectrometry. Mass differentiation can be achieved by the mass
modifying functionalities (M1 and M2) attached to primers (P1 and
P4 respectively). Detection by mass spectrometry can be
accomplished directly (i.e. without employing immobilization and
target capturing sites (TCS)). Multiple LCR reactions can be
performed in parallel by providing an ordered array of capturing
sequences (C). This format allows separation of the ligation
products and spot by spot identification via mass spectrometry or
multiplexing if mass differentiation is sufficient.
[0088] FIG. 6A is a diagram showing mass spectrometric analysis of
a nucleic acid molecule, which has been amplified by a
transcription amplification procedure. An RNA sequence is captured
via its TCS sequence, so that wildtype and mutated target detection
sites can be detected as above by employing appropriate detector
oligonucleotides
[0089] FIG. 6B is a diagram showing multiplexing to detect two
different (mutated) sites on the same RNA in a simultaneous fashion
using mass-modified detector oligonucleotides M1-D1 and M2-D2.
[0090] FIG. 6C is a diagram of a different multiplexing procedure
for detection of specific mutations by employing mass modified
dideoxynucleoside or 3'-deoxynucleoside triphosphates and an RNA
dependent DNA polymerase. Alternatively, DNA dependent RNA
polymerase and ribonucleotide phosphates can be employed. This
format allows for simultaneous detection of all four base
possibilities at the site of a mutation (X).
[0091] FIG. 7A is a diagram showing a process for performing mass
spectrometric analysis on one target detection site (TDS) contained
within a target nucleic acid molecule (T), which has been obtained
from a biological sample. A specific capture sequence (C) is
attached to a solid support (SS) via a spacer (S). The capture
sequence is chosen to specifically hybridize with a complementary
sequence on T known as the target capture site (TCS). A nucleic
acid molecule that is complementary to a portion of the TDS is
hybridized to the TDS 5' of the site of a mutation (X) within the
TDS. The addition of a complete set of dideoxynucleosides or
3'-deoxynucleoside triphosphates (e.g., pppAdd, pppTdd, pppCdd and
pppGdd) and a DNA dependent DNA or RNA polymerase allows for the
addition only of the one dideoxynucleoside or 3'-deoxynucleoside
triphosphate that is complementary to X.
[0092] FIG. 7B is a diagram showing a process for performing mass
spectrometric analysis to determine the presence of a mutation at a
potential mutation site (M) within a nucleic acid molecule. This
format allows for simultaneous analysis of alleles (A) and (B) of a
double stranded target nucleic acid molecule, so that a diagnosis
of homozygous normal, homozygous mutant or heterozygous can be
provided. Allele A and B are each hybridized with complementary
oligonucleotides ((C) and (D) respectively), that hybridize to A
and B within a region that includes M. Each heteroduplex is then
contacted with a single strand specific endonuclease, so that a
mismatch at M, indicating the presence of a mutation, results in
the cleavage of (C) and/or (D), which can then be detected by mass
spectrometry.
[0093] FIG. 8 is a diagram showing how both strands of a target DNA
can be prepared for detection using transcription vectors having
two different promoters at opposite locations (e.g., the SP6 and T7
promoter). This format is particularly useful for detecting
heterozygous target detections sites (TDS). Employing the SP6 or
the T7 RNA polymerase both strands could be transcribed separately
or simultaneously. The transcribed RNA molecules can be
specifically captured and simultaneously detected using
appropriately mass-differentiated detector oligonucleotides. This
can be accomplished either directly in solution or by parallel
processing of many target sequences on an ordered array of
specifically immobilized capturing sequences.
[0094] FIG. 9 is a diagram showing how RNA prepared as described in
FIGS. 6, 7 and 8 can be specifically digested using one or more
ribonucleases and the fragments captured on a solid support
carrying the corresponding complementary sequences. Hybridization
events and the actual molecular weights of the captured target
sequences provide information on whether and where mutations in the
gene are present. The array can be analyzed spot by spot using mass
spectrometry. DNA can be similarly digested using a cocktail of
nucleases including restriction endonucleases. Mutations can be
detected by different molecular weights of specific, individual
fragments compared to the molecular weights of the wildtype
fragments.
[0095] FIG. 10A shows UV spectra resulting from the experiment
described in the following Example 1. Panel i) shows the absorbance
of the 26-mer before hybridization. Panel ii) shows the filtrate of
the centrifugation after hybridization. Panel iii) shows the
results after the first wash with 50 mM ammonium citrate. Panel iv)
shows the results after the second wash with 50 mM ammonium
citrate.
[0096] FIG. 10B shows a mass spectrum resulting from the experiment
described in the following Example 1 after three
washing/centrifugation steps.
[0097] FIG. 10C shows a mass spectrum resulting from the experiment
described in the following Example 1 showing the successful
desorption of the hybridized 26-mer off of beads in accordance with
the format depicted schematically in FIG. 1B.
[0098] FIG. 11 shows a mass spectrum resulting from the experiment
described in the following Example 1 showing the giving proof of an
experiment as schematically depicted in FIG. 1B successful
desorption of the hybridized 40-mer. The efficiency of detection
suggests that fragments much longer than 40-mers can also be
desorbed.
[0099] FIG. 12 shows a mass spectrum resulting from the experiment
described in the following Example 2 showing the successful
desorption and differentiation of an 18-mer and 19-mer by
electrospray mass spectrometry, the mixture (top), peaks resulting
from 18-mer emphasized (middle) and peaks resulting from 19-mer
emphasized (bottom)
[0100] FIG. 13 is a graphic representation of the process for
detecting the Cystic Fibrosis mutation .DELTA.F508 as described in
Example 3.
[0101] FIG. 14 is a mass spectrum of the DNA extension product of a
.DELTA.F508 homozygous normal of Example 3.
[0102] FIG. 15 is a mass spectrum of the DNA extension product of a
.DELTA.F508 heterozygous mutant of Example 3.
[0103] FIG. 16 is a mass spectrum of the DNA extension product of a
.DELTA.F508 homozygous normal of Example 3.
[0104] FIG. 17 is a mass spectrum of the DNA extension product of a
.DELTA.F508 homozygous mutant of Example 3.
[0105] FIG. 18 is a mass spectrum of the DNA extension product of a
.DELTA.F508 heterozygous mutant of Example 3.
[0106] FIG. 19 is a graphic representation of various processes for
performing apolipoprotein E genotyping of Example 4.
[0107] FIG. 20 shows the nucleic acid sequence of normal
apolipoprotein E (encoded by the E3 allele, FIG. 20B) and other
isotypes encoded by the E2 and E4 alleles (FIG. 20A).
[0108] FIG. 21A shows a composite restriction pattern for various
genotypes of apolipoprotein E using the CfoI restriction
endonuclease.
[0109] FIG. 21B shows the restriction pattern obtained in a 3.5%
MetPhor Agarose Gel for various genotypes of apolipoprotein E.
[0110] FIG. 21C shows the restriction pattern obtained in a 12%
polyacrylamide gel for various genotypes of apolipoprotein E.
[0111] FIG. 22A is a chart showing the molecular weights of the 91,
83, 72, 48 and 35 base pair fragments obtained by restriction
enzyme cleavage of the E2, E3 and E4 alleles of apolipoprotein
E.
[0112] FIG. 22B is the mass spectrum of the restriction product of
a homozygous E4 apolipoprotein E genotype.
[0113] FIG. 23A is the mass spectrum of the restriction product of
a homozygous E3 apolipoprotein E genotype.
[0114] FIG. 23B is the mass spectrum of the restriction product of
a E3/E4 apolipoprotein E genotype.
[0115] FIG. 24 is an autoradiograph of Example 5 of a 7.5%
polyacrylamide gel in which 10% (5 .mu.l) of each amplified sample
was loaded: sample M: pBR322 Alul digested; sample 1: HBV positive
in serological analysis; sample 2: also HBV positive; sample 3:
without serological analysis but with an increased level of
transaminases, indicating liver disease; sample 4: HBV negative
containing HCV; sample 5: HBV posit -) negative control; (+)
positive control). Staining was done with ethidium bromide.
[0116] FIG. 25A is a mass spectrum of sample 1, which is HBV
positive. The signal at 20754 Da represents the HBV related
amplification product (67 nucleotides, calculated mass: 20735 Da).
The mass signal at 10390 Da represents the [M +2H.sup.2+ ]molecule
ion (calculated: 10378 Da).
[0117] FIG. 25B is a mass spectrum of sample 3, which is HBV
negative corresponding to nucleic acid (i.e., PCR), serological and
dot blot based assays. The amplified product is generated only in
trace amounts. Nevertheless it is unambiguously detected at 20751
Da (calculated mass: 20735 Da). The mass signal at 10397 Da
represents the [M+2H].sup.2+ molecule ion (calculated: 10376
Da).
[0118] FIG. 25C is a mass spectrum of sample 4, which is HBV
negative, but HCV positive. No HBV specific signals were
observed.
[0119] FIG. 26 shows a part of the E. coli lacI gene with binding
sites of the complementary oligonucelotides used in the ligase
chain reaction (LCR) of Example 6. Here the wildtype sequence is
displayed. The mutant contains a point mutation at bp 191 which is
also the site of ligation (bold). The mutation is a C to T
transition (G to A, respectively). This leads to a T-G mismatch
with oligo B (and A-C mismatch with oligo C, respectively).
[0120] FIG. 27 is a 7.15% polyacrylamide gel of Example 6 stained
with ethidium bromide. M: chain length standard (pUC19DNA, MspI
digested). Lane 1: LCR with wildtype template. Lane 2: LCR with
mutant template. Lane 3: (control) LCR without template. The
ligation product (50 bp) was only generated in the positive
reaction containing wildtype template.
[0121] FIG. 28 is an HPLC chromatogram of two pooled positive
LCRs.
[0122] FIG. 29 shows an HPLC chromatogram the same conditions but
mutant template were used. The small signal of the ligation product
is due to either template-free ligation of the educts or to a
ligation at a (G-T, A-C) mismatch. The `false positive` signal is
significantly lower than the signal of ligation product with
wildtype template depicted in FIG. 28. The analysis of ligation
educts leads to `double-peaks` because two of the oligonucleotides
are 5'-phosphorylated.
[0123] FIG. 30 In (b) the complex signal pattern obtained by
MALDI-TOF-MS analysis of Pfu DNA-ligase solution of Example 6 is
depicted. In (a) a MALDI-TOF-spectrum of an unpurified LCR is
shown. The mass signal 67569 Da probably represents the Pfu DNA
ligase.
[0124] FIG. 31 shows a MALDI-TOF spectrum of two pooled positive
LCRs (a). The signal at 7523 Da represents unligated oligo A
(calculated: 7521 Da) whereas the signal at 15449 Da represents the
ligation product (calculated: 15450 Da). The signal at 3774 Da is
the [M+2H].sup.2+ signal of oligo A. The signals in the mass range
lower than 2000 Da are due to the matrix ions. The spectrum
corresponds to lane 1 in FIG. 27 and the chromatogram in FIG. 28.
In (b) a spectrum of two pooled negative LCRs (mutant template) is
shown. The signal at 7517 Da represents oligo A (calculated: 7521
Da).
[0125] FIG. 32 shows a spectrum of two pooled control reactions
(with salmon sperm DNA as template). The signals in the mass range
around 2000 Da are due to Tween20, only oligo A could be detected,
as expected.
[0126] FIG. 33 shows a spectrum of two pooled positive LCRs (a).
The purification was done with a combination of ultrafiltration and
streptavidin DynaBeads as described in the text. The signal at
15448 Da represents the ligation product (calculated: 15450 Da).
The signal at 7527 represents oligo A (calculated: 7521 Da). The
signals at 3761 Da is the [M+2H].sup.2+ signal of oligo A, whereas
the signal at 5140 Da is the [M+3H].sup.2+ signal of the ligation
product. In (b) a spectrum of two pooled negative LCRs (without
template) is shown. The signal at 7514 Da represents oligo A
(calculated: 7521 Da).
[0127] FIG. 34 is a schematic presentation of the oligo base
extension of the mutation detection primer as described in Example
7, using ddTTP (A) or ddCTP (B) in the reaction mix, respectively.
The theoretical mass calculation is given in parenthesis. The
sequence shown is part of the exon 10 of the CFTR gene that bears
the most common cystic fibrosis mutation .DELTA.F508 and more rare
mutations .DELTA.I507 as well as Ile506Ser.
[0128] FIG. 35 is a MALDI-TOF-MS spectrum recorded directly from
precipitated oligo base extended primers for mutation detection.
The spectrum in (A) and (B), respectively show the annealed primer
(CF508) without further extension reaction. Panel C displays the
MALDI-TOF spectrum of the wild type by using pppTdd in the
extension reaction and D a heterozygotic extension products
carrying the 506S mutation when using pppCdd as terminator. Panels
E and F show a heterozygote with .DELTA.F508 mutation with pppTdd
and pppCdd as terminators in the extension reaction. Panels G and H
represent a homozygous .DELTA.F508 mutation with either pppTdd or
pppCdd as terminators. The template of diagnosis is pointed out
below each spectrum and the observed/expected molecular mass are
written in parenthesis.
[0129] FIG. 36 shows the portion of the sequence of pRFc1 DNA,
which was used as template for nucleic acid amplification in
Example 8 of unmodified and 7-deazapurine containing 99-mer and
200-mer nucleic acids as well as the sequences of the 19-mer
forward primer and the two 18-mer reverse primers.
[0130] FIG. 37 shows the portion of the nucleotide sequence of
M13mp18 RFI DNA, which was used in Example 8 for nucleic acid
amplification of unmodified and 7-deazapurine containing 103-mer
nucleic acids. Also shown are nucleotide sequences of the 17-mer
primers used in the nucleic acid amplification reaction.
[0131] FIG. 38 shows the result of a polyacrylamide gel
electrophoresis of amplified products described in Example 8
purified and concentrated for MALDI-TOF MS analysis. M: chain
length marker, lane 1: 7-deazapurine containing 99-mer amplified
product, lane 2: unmodified 99-mer, lane 3: 7-deazapurine
containing 103-mer and lane 4: unmodified 103-mer amplified
product.
[0132] FIG. 39: an autoradiogram of polyacrylamide gel
electrophoresis of nucleic acid (i.e., PCR) reactions carried out
with 5'-[.sup.32P]-labeled primers 1 and 4. Lanes 1 and 2:
unmodified and 7-deazapurine modified 103-mer amplified product
(53321 and 23520 counts), lanes 3 and 4: unmodified and
7-deazapurine modified 200-mer (71123 and 39582 counts) and lanes 5
and 6: unmodified and 7-deazapurine modified 99-mer (173216 and
94400 counts).
[0133] FIG. 40 a) MALDI-TOF mass spectrum of the unmodified 103-mer
amplified products (sum of twelve single shot spectra). The mean
value of the masses calculated for the two single strands (31768 u
and 31759 u) is 31763 u. Mass resolution: 18. b) MALDI-TOF mass
spectrum of 7-deazapurine containing 103-mer amplified product (sum
of three single shot spectra). The mean value of the masses
calculated for the two single strands (31727 u and 31719 u) is
31723 u. Mass resolution: 67.
[0134] FIG. 41: a) MALDI-TOF mass spectrum of the unmodified 99-mer
amplified product (sum of twenty single shot spectra). Values of
the masses calculated for the two single strands: 30261 u and 30794
u. b) MALDI-TOF mass spectrum of 7-deazapurine containing 99-mer
amplified product (sum of twelve single shot spectra). Values of
the masses calculated for the two single strands: 30224 u and 30750
u.
[0135] FIG. 42: a) MALDI-TOF mass spectrum of the unmodified
200-mer amplified product (sum of 30 single shot spectra). The mean
value of the masses calculated for the two single strands (61873 u
and 61595 u) is 61734 u. Mass resolution: 28. b) MALDI-TOF mass
spectrum of 7-deazapurine containing 200-mer amplified product (sum
of 30 single shot spectra). The mean value of the masses calculated
for the two single strands (61772 u and 61714 u) is 61643 u. Mass
resolution: 39.
[0136] FIG. 43: a) MALDI-TOF mass spectrum of 7-deazapurine
containing 100-mer amplified product with ribomodified primers. The
mean value of the masses calculated for the two single strands
(30529 u and 31095 u) is 30812 u. b) MALDI-TOF mass spectrum of the
amplified product after hydrolytic primer-cleavage. The mean value
of the masses calculated for the two single strands (25104 u and
25229 u) is 25167 u. The mean value of the cleaved primers (5437 u
and 5918 u) is 5677 u.
[0137] FIG. 44 A-D shows the MALDI-TOF mass spectrum of the four
sequencing ladders obtained from a 39-mer template (SEQ ID No. 23),
which was immobilized to streptavidin beads via a 3' biotinylation.
A 14-mer primer (SEQ ID NO. 24) was used in the sequencing
according to Example 9.
[0138] FIG. 45 shows a MALDI-TOF mass spectrum of a solid phase
sequencing of a 78-mer template (SEQ ID No. 25), which was
immobilized to streptavidin beads via a 3' biotinylation. A 18-mer
primer (SEQ ID No. 26) and ddGTP were used in the sequencing.
[0139] FIG. 46 shows a scheme in which duplex DNA probes with
single-stranded overhang capture specific DNA templates and also
serve as primers for solid phase sequencing.
[0140] FIG. 47 A-D shows MALDI-TOF mass spectra obtained from a
sequencing reaction using 5' fluorescent labeled 23-mer (SEQ ID No.
29) annealed to a 3' biotinylated 18-mer (SEQ ID No. 30), leaving a
5-base overhang, which captured a 15-mer template (SEQ ID No. 31)
as described in Example 9.
[0141] FIG. 48 shows a stacking fluorogram of the same products
obtained from the reaction described in FIG. 47, but run on a
conventional DNA sequencer.
[0142] FIG. 49 shows a MALDI-TOF mass spectrum of the sequencing
ladder using cycle sequencing as described in Example 1 generated
from a biological amplified product as template and a 12mer (5'-TGC
ACC TGA CTC-3' (SEQ ID NO. 34)) sequencing primer. The peaks
resulting from depurinations and peaks which are not related to the
sequence are marked by an asterisk. MALDI-TOF MS measurements were
taken on a reflectron TOF MS. A.) Sequencing ladder stopped with
ddATP; B.) Sequencing ladder stopped with ddCTP; C.) Sequencing
ladder stopped with ddGTP; D.) Sequencing ladder stopped with
ddTTP.
[0143] FIG. 50 shows a schematic representation of the sequencing
ladder generated in FIG. 49 with the corresponding calculated
molecular masses up to 40 bases after the primer. For the
calculation, the following masses were used: 3581.4 Da for the
primer, 312.2 Da for 7-deaza-dATP, 304.2 Da for dTTP, 289.2 Da for
dCTP and 328.2 Da for 7-deaza-dGTP.
[0144] FIG. 51 shows the sequence of the amplified 209 bp amplified
product within the .beta.-globin gene, which was used as a template
for sequencing. The sequences of the appropriate amplification
primer and the location of the 12mer sequencing primer is also
shown. This sequence represents a homozygote mutant at the position
4 bases after the primer. In a wildtype sequence this T would be
replaced by an A.
[0145] FIG. 52 shows a sequence which is part of the intron 5 of
the interferon-receptor gene that bears the AluVpA polymorphism as
further described in Example 11. The scheme presents the primer
oligo base extension (PROBE) using ddGTP, ddCTP, or both for
termination, respectively. The polymorphism detection primer (IFN)
is underlined, the termination nucleotides are marked in bold
letters. The theoretical mass values from the alleles found in 28
unrelated individuals and a five member family are given in the
table. Both second site mutations found in most 13 units allele,
but not all, are indicated.
[0146] FIG. 53 shows the MALDI-TOF-MS spectra recorded directly
form precipitated extended cyclePROBE reaction products. Family
study using AluVpA polymorphism in intron 5 of the
interferon-.alpha. receptor gene (Example 11).
[0147] FIG. 54 shows the mass spectra from PROBE products using ddC
as termination nucleotide in the reaction mix. The allele with the
molecular mass of approximately 11650 da from the DNA of the mother
and child 2 is a hint to a second site mutation within one of the
repeat units.
[0148] FIG. 55 shows a schematic presentation of the PROBE method
for detection of different alleles in the polyT tract at the 3'-end
of intron 8 of the CFTR gene with pppCdd as terminator (Example
11).
[0149] FIG. 56 shows the MALDI-TOF-MS spectra recorded directly
from the precipitated extended PROBE reaction products. Detection
of all three common alleles of the polyT tract at the 3' end of
Intron 8 of the CFTR gene. (a) T5/T9 heterozygous, (b) T7/T9
heterozygous (Example 11).
[0150] FIG. 57 shows a mass spectrum of the digestion of a 252-mer
ApoE gene amplified product (.epsilon.3/.epsilon.3 genotype) as
described in Example 12 using a) CfoI alone and b) CfoI plus RsaI.
Asterisks: depurination peaks.
[0151] FIG. 58 shows a mass spectrum of the ApoE gene amplified
product (.epsilon.3/.epsilon.3 genotype) digested by CfoI and
purified by a) single and b) double ethanol/glycogen and c) double
isopropyl alcohol/glycogen precipitations.
[0152] FIG. 59 shows a mass spectrum of the CfoI/RsaI digest
products from a) .epsilon.2/.epsilon.3, b) .epsilon.3/.epsilon.3,
c) .epsilon.3/.epsilon.4, and d) .epsilon.4/.epsilon.4 genotypes.
Dashed lines are drawn through diagnostic fragments.
[0153] FIG. 60 shows a scheme for rapid identification of unknown
ApoE genotypes following simultaneous digestion of a 252-mer apo E
gene amplified product by the restriction enzymes CfoI and
RsaI.
[0154] FIG. 61 shows the multiplex (codons 112 and 158) mass
spectrum PROBE results for a) .epsilon.2/.epsilon.3, b)
.epsilon.3/.epsilon.3, c) .epsilon.3/.epsilon.4, and d)
.epsilon.4/.epsilon.4 genotypes. E: extension products; P:
unextended primer. Top: codon 112 and 158 regions, with polymorphic
sites bold and primer sequences underlined.
[0155] FIG. 62 shows a mass spectrum of a TRAP assay to detect
telomerase activity (Example 13). The spectrum shows two of the
primer signals of the amplified product TS primer at 5,497.3 Da
(calc. 5523 Da) and the biotinylated bioCX primer at 7,537.6 Da
(calc. 7,537 Da) and the first telomerase-specific assay product
containing three telomeric repeats at 12,775.8 Da (calc. 12,452 Da)
its mass is larger by one dA nucleotide (12,765 Da) due to
extendase activity of Taq DNA polymerase.
[0156] FIG. 63 depicts the higher mass range of FIG. 62, i.e. the
peak at 12,775.6 Da represents the products with these telomeric
repeats. The peaks at 20,322.1 Da is the result of a telomerase
activity to form seven telomeric repeats (calc. 20,395 Da including
the extension by one dA nucleotide). The peaks marked 1, 2, 3 and 4
contain a four telomeric repeats at 14,674 Da as well as secondary
ion product.
[0157] FIG. 64 displays a MALDI-TOF spectrum of the RT-amplified
product of the human tyrosine hydroxylase mRNA indicating the
presence of neuroblastoma cells (Example 14). The signal at
18,763.8 Da represents the non-biotinylated single-stranded 61 mer
of the nested amplified product (calc. 18,758.2 Da).
[0158] FIG. 65(a) shows a schematic representation of a PROBE
reaction for the RET proto-oncogene with a mixture of dATP, dCTP,
dGTP, and ddTTP (Example 15). B represents biotin, through which
the sense template strand is bound through streptavidin to a solid
support.
[0159] FIG. 65(b) shows the expected PROBE products for ddT and ddA
reactions for wildtype, C.fwdarw.T, and C.fwdarw.A antisense
strands.
[0160] FIG. 66 shows the PROBE product mass spectra for (a)
negative control, (b) Patient 1 being heterozygote (Wt/C.fwdarw.T)
and (c) Patient 2 being heterozygote (Wt/C.fwdarw.A), reporting
average M.sub.r values.
[0161] FIG. 67 shows the MALDI-FTMS spectra for synthetic analogs
representing ribo-cleaved RET proto-oncogene amplified products
from (a) wildtype, (b) G.fwdarw.A, and (c) G.fwdarw.T homozygotes,
and (d) wildtype/G.fwdarw.A, (e) wildtype/G.fwdarw.T, and (f)
G.fwdarw.A/G.fwdarw.T heterozygotes, reporting masses of most
abundant isotope peaks.
[0162] FIG. 68 is a schematic representation of nucleic acid
immobilization via covalent bifunctional trityl linkers.
[0163] FIG. 69 is a schematic representation of nucleic acid
immobilization via hydrophobic trityl linkers.
[0164] FIG. 70 shows a MALDI-TOF mass spectrum of a supernatant of
the matrix treated Dynabeads containing bound oligo
(5'-iminobiotin--TGCACCTG- ACTC, SEQ ID NO. 56). An internal
standard (CTGTGGTCGTGC, SEQ ID NO. 57) was included in the
matrix.
[0165] FIG. 71 shows a MALDI-TOF mass spectrum of a supernatant of
the matrix treated Dynabeads containing bound oligo
(5'-iminobiotin--TGCACCTG- ACTC, SEQ ID NO. 56). An internal
standard (CTGTGGTCGTGC, SEQ ID NO. 57) was included in the
matrix.
[0166] FIG. 72 schematically depicts the steps involved with the
Loop-primer oligo base extension (Loop-probe) reaction.
[0167] FIG. 73A shows a MALDI-TOF mass spectrum of a supernatant
after CfoI digest of a stem loop.
[0168] FIGS. 73B-D show MALDI-TOF mass spectrum of different
genotypes: HbA the wildtype genotype (74B), HbC, a mutation of
codon 6 of the .beta.-globin gene which causes sickle cell disease
(74C), and HbS, a different mutation of codon 6 of the
.beta.-globin gene which causes sickle cell disease (74D).
[0169] FIG. 74 shows the nucleic acid sequence of the amplified
region of CKR-5. The underlined sequence corresponds to the region
homologous to the amplification primers. The dotted region
corresponds to the 32 bp deletion.
[0170] FIG. 75 shows the sense primer ckrT7f. Being designed to
facilitate binding of T7-RNA polymerase and amplification of the
CKR-5 region to be analyzed, it starts with a randomly chosen
sequence of 24 bases, the T7 promoter sequence of 18 bases and the
sequence homologous to CKR-5 of 19 bases.
[0171] FIG. 76 is a MALDI-TOF mass spectrum of the CKR-5
amplification product, which was generated as described in the
following Example 21.
[0172] FIG. 77 is a positive ion UV-MALDI mass spectra of a
synthetic RNA 25-mer (5'-UCCGGUCUGAUGAGUCCGUGAGGAC-3' SEQ ID NO.
62) digested with selected RNAses. For each enzyme 0.6 .mu.l
aliquots of teh 4.5 .mu.l assay containing a total of ca. 20 pmol
of the RNA were fixed with 1.5 .mu.l matrix (3-HPA) for analysis.
Fragments with retained 5'-terminus are marked by different arrows,
specific for the different RNAses, (Hahner et al., Proceedings of
the 44.sup.th ASMS Conference on Mass Spectrometry and Allied
Topics, p. 983 (1996)).
[0173] FIG. 78 is an investigation of the specificity of the RNAses
CL.sub.3 and Cusativin by positive ion UV-MALDI mass spectra of a
synthetic RNA 20-mer. Expected and/or observed cleavage sites are
indicated by arrows. A, B, C indicate correct cleavage sites and
corresponding singly cleaved fragments. Missing cleavages are
designated by a question mark (?), unspecific cleavages by an
X.
[0174] FIG. 79 shows the separation of a mixture of DNA molecules
(12-mer, 5'-biot. 19-mer, 22-mer and 5'-biot. 27-mer) with
streptavidin-coated magnetic beads. a) positive ion UV-MALDI mass
spectrum of 0.6 .mu.l of a mixture containing ca. 2-4 pmol of each
species mixed with 1.5 .mu.l matrix (3-HPA). b) same as a) but
incubation of the mixture with magnetic beads and subsequent
release of the captured fragments.
[0175] FIG. 80 Elution of immobilized 5' biotinylated 49 nt in
vitro transcript from the streptavidin-coated magnetic beads.
Positive UV-MALDI mass spectrum of the transcript prior to
incubation with the magnetic beads (a). Spectra of the immobilized
RNA transcript after elution with 95% formamide alone (b) and with
various additives such as 10 mM EDTA (c), 10 mM CDTA (d) and 25%
ammonium hydroxide (e); EDTA and CDTA were adjusted with 25%
ammonium hydroxide to a pH of 8.
[0176] FIG. 81 Positive UV-MALDI mass spectra of the 5'
biotinylated 49 nt in vitro transcript after RNAse U.sub.2 digest
for 15 minutes. a) Spectrum of the 25 ul assay containing ca. 100
pmol of the target RNA before separation; b) spectrum after
isolation of the 5'-biotinylated fragments with magnetic beads.
Captured fragments were released by a solution of 95% formamide
containing 10 mM CDTA. 1 ul aliquots of the samples were mixed with
1.5 ul matrix (3-HPA) in both cases.
[0177] FIG. 82 schematically depicts detection of putative
mutations in the human .beta.-globin gene at codon 5 and 6 and at
codon 30, and the IVS-1 donor site, respectively, done in
parallel.
[0178] FIG. 82A shows amplification of genomic DNA using the
primers .beta.2 and .beta.11. The location of the primers and
identification tags as well as an indication of the wild type and
mutant sequences are shown.
[0179] FIG. 82B shows analysis of both sites in a simple Primer
Reaction Oligo Base Extension (PROBE) using primers .beta.-TAG1
(which binds upstream of codon 5 and 6) and .beta.-TAG2 (which
binds upstream of codon 30 and the IVS-1 donor site). Reaction
products are captured using streptavidin-coated paramagnetic
particle bound biotinylated capture primers (cap-tag-1 and
cap-tag-2, respectively), that have 6 bases at the 5' end that are
complementary to the 5' end of .beta.-TAG1 and .beta.-TAG2,
respectively, and a portion which binds to a universal primer.
[0180] FIG. 83 shows a mass spectrum of the PROBE products of a DNA
sample from one individual analyzed as described schematically in
FIG. 82.
[0181] FIG. 84 shows a mass spectrum of the sequence bound to
cap-tag-2.
[0182] FIG. 85 shows a mass spectrum obtained by using the
.beta.-TAG1 and .beta.-TAG 2 primers in one sequencing reaction
using ddATP for termination and then sorting according to the
method depicted in FIG. 82.
[0183] FIG. 86 shows a mass spectrum obtained by using the
.beta.-TAG1 and .beta.-TAG2 primers in one sequencing reaction
using ddCTP for termination and then sorting according to the
method depicted in FIG. 82.
[0184] FIG. 87A shows the wildtype sequence of a fragment of the
chemokine receptor CKR-5 gene with primers (bold) used for
amplification. The 32 base pair (bp) deletion in the CKR-5 allele
is underlined; and the stop nucleotides are in italic.
[0185] In FIG. 87B, the wildtype strands are depicted with and
without an added Adenosine, their length and molecular masses are
indicated.
[0186] FIG. 87C indicates the same for the 32 bp deletion.
[0187] FIG. 87D shows the PROBE products for the wildtype gene
and
[0188] FIG. 87E shows the mutated allele.
[0189] FIG. 88 shows the amplification products of different
unrelated individuals as analyzed by native polyacrylamide gel
electrophoreses (15%) and silver stain. The band corresponding to a
wildtype CKR-5 runs at 75 bp and the band from the gene with the
deletion at 43 bp. Bands bigger than 75 bp are due to unspecific
amplification.
[0190] FIG. 89A shows a spectrograph of DNA derived from a
heterozygous individual: the peak with a mass of 23319 Da
corresponds to the wildtype CKR-5 and the peaks with masses of
13137 Da and 13451 Da to the deletion allele with and without an
extra Adenosine, respectively.
[0191] FIG. 89B shows a spectrograph of DNA obtained from the same
individual as in FIG. 89A, but the DNA was treated with T4 DNA
polymerase to remove the added Adenosine.
[0192] FIGS. 89C and 89D are spectrographs derived from homozygous
individuals and in
[0193] FIG. 89D, the Adenosine has been removed. All peaks with
masses lower than 13000 Da are due to multiple charged
molecules.
[0194] FIG. 90A shows the mass spectrum of the results of a PROBE
reaction performed on DNA obtained from a heterozygous
individual.
[0195] FIG. 90B shows a mass spectrum of the results of a PROBE
reaction on a homozygous individual. The peaks with masses of 6604
Da and 6607 Da, respectively correspond to the wildtype allele, and
the peak with a mass of 6275 Da to the deletion allele. The primer
is detected with a mass of 5673 and 5676 Da, respectively.
[0196] FIG. 91 shows a MALDI-TOF MS spectra of a thermocycling
primer Oligo Base Extension (tc-PROBE) reaction as described in
Example 24 using three different templates and 5 different PROBE
primers simultaneously in one reaction.
[0197] FIG. 92 schematically depicts a single tube process for
amplifying and sequencing exons 5-8 of the p53 gene as described in
Example 25. The mass spectrum is the A reaction of FIG. 93.
[0198] FIG. 93 shows a superposition plot of four separate
reactions for sequencing a portion of exon 7 of the p53 gene as
described in Example 25.
[0199] FIG. 94 shows the mass spectrum obtained from the A reaction
for sequencing a portion of exon 7 of the p53 gene as described in
Example 25.
[0200] FIG. 95 shows the mass spectrum of a p53 sequencing ladder
for which 5 nL of each reaction were transferred to wells of a chip
and measured by MALDI-TOF.
[0201] FIG. 96A shows a MALDI-TOF mass spectra of a synthetic
50-mer (15.34 kDa) mixed with 27-mer.sub.nc (non-complementary,
8.30 kDa).
[0202] FIG. 96B shows a MALDI-TOF mass spectra of a synthetic
50-mer (15.34 kDa) mixed with a 27-mer.sub.c (complementary, 8.34
kDa). The final concentration of each oligonucleotide was 10 .mu.M.
The signal at 23.68 kDa in FIG. 96B corresponds to WC-specific
dsDNA.
[0203] FIG. 97A shows a MALDI-TOF mass spectrum of CfoI/RsaI digest
products of a region of exon 4 of the apolipoprotein E gene (E3
genotype), using sample preparation as in FIG. 96.
[0204] FIG. 97B is the same as FIG. 97A, except with samples
prepared for MALDI-TOF analysis at 4.degree. C.
[0205] FIG. 98 shows a MALDI-TOF mass spectrum of CfoI/RsaI
simultaneously double digest products of a 252 base pair region of
exon 4 of the apolipoprotein E gene (e4 genotype), with samples
prepared at 4.degree. C.
[0206] FIG. 99 shows the mass spectra obatined on a small
population study of 15 patients with a 16 element array of
diagnostic products transferred to a MALDI target using a pintool
microdispenser.
[0207] FIG. 100 is a MALDI mass spectrum of an aliquot sampled
after a T.sub.1 digest of a synthetic 20-mer RNA.
DETAILED DESCRIPTION OF THE INVENTION
[0208] Definitions
[0209] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which this invention belongs. Where
permitted the subject matter of each of the co-pending patent
applications and the patent is herein incorporated in its
entirety.
[0210] As used herein, the term "biological sample" refers to any
material obtained from any living source (e.g., human, animal,
plant, bacteria, fungi, protist, virus). For purposes herein, the
biological sample will typically contain a nucleic acid molecule.
Examples of appropriate biological samples include, but are not
limited to: solid materials (e.g., tissue, cell pellets, biopsies)
and biological fluids (e.g., urine, blood, saliva, amniotic fluid,
mouth wash, cerebral spinal fluid and other body fluids).
[0211] As used herein, the phrases "chain-elongating nucleotides"
and "chain-terminating nucleotides" are used in accordance with
their art recognized meaning. For example, for DNA,
chain-elongating nucleotides include 2'deoxyribonucleotides (e.g.,
dATP, dCTP, dGTP and dTTP) and chain-terminating nucleotides
include 2', 3'-dideoxyribonucleotides (e.g., ddATP, ddCTP, ddGTP,
ddTTP). For RNA, chain-elongating nucleotides include
ribonucleotides (e.g., ATJP, CTP, GTP and UTP) and
chain-terminating nucleotides include 3'-deoxyribonucleotides
(e.g., 3'dA, 3'dC, 3'dG and 3'dU). A complete set of chain
elongating nucleotides refers to dATP, dCTP, dGTP and dTTP. The
term "nucleotide" is also well known in the art.
[0212] As used herein, nucleotides include nucleoside mono-, di-,
and triphosphates. Nucleotides also include modified nucleotides
such as phosphorothioate nucleotides and deazapurine nucleotides. A
complete set of chain-elongating nucleotides refers to four
different nucleotides that can hybridize to each of the four
different bases comprising the DNA template.
[0213] As used herein, the superscript 0-i designates i+1 mass
differentiated nucleotides, primers or tags. In some instances, the
superscript 0 can designate an unmodified species of a particular
reactant, and the superscript i can designate the i-th
mass-modified species of that reactant. If, for example, more than
one species of nucleic acids are to be concurrently detected, then
i+1 different mass-modified detector oligonucleotides (D.sup.0,
D.sup.1, . . . D.sup.i) can be used to distinguish each species of
mass modified detector oligonucleotides (D) from the others by mass
spectrometry.
[0214] As used herein, "multiplexing" refers to the simultaneously
detection of more than one analyte, such as more than one (mutated)
loci on a particular captured nucleic acid fragment (on one spot of
an array).
[0215] As used herein, the term "nucleic acid" refers to
single-stranded and/or double-stranded polynucleotides such as
deoxyribonucleic acid (DNA), and ribonucleic acid (RNA) as well as
analogs or derivatives of either RNA or DNA. Also included in the
term "nucleic acid" are analogs of nucleic acids such as peptide
nucleic acid (PNA), phosphorothioate DNA, and other such analogs
and derivatives.
[0216] As used herein, the term "conjugated" refers stable
attachment, preferably ionic or covalent attachment. Among
preferred conjugation means are: streptavidin- or avidin- to biotin
interaction; hydrophobic interaction; magnetic interaction (e.g.,
using functionalized magnetic beads, such as DYNABEADS, which are
streptavidin-coated magnetic beads sold by Dynal, Inc. Great Neck,
N.Y. and Oslo Norway); polar interactions, such as "wetting"
associations between two polar surfaces or between
oligo/polyethylene glycol; formation of a covalent bond, such as an
amide bond, disulfide bond, thioether bond, or via crosslinking
agents; and via an acid-labile or photocleavable linker.
[0217] As used herein equivalent, when referring to two sequences
of nucleic acids means that the two sequences in question encode
the same sequence of amino acids or equivalent proteins. When
"equivalent" is used in referring to two proteins or peptides, it
means that the two proteins or peptides have substantially the same
amino acid sequence with only conservative amino acid substitutions
that do not substantially alter the activity or function of the
protein or peptide. When "equivalent" refers to a property, the
property does not need to be present to the same extent [e.g., two
peptides can exhibit different rates of the same type of enzymatic
activity], but the activities are preferably substantially the
same. "Complementary," when referring to two nucleotide sequences,
means that the two sequences of nucleotides are capable of
hybridizing, preferably with less than 25%, more preferably with
less than 15%, even more preferably with less than 5%, most
preferably with no mismatches between opposed nucleotides.
Preferably the two molecules will hybridize under conditions of
high stringency.
[0218] As used herein: stringency of hybridization in determining
percentage mismatch are those conditions understood by those of
skill in the art and typically are substantially equivalent to the
following:
[0219] 1) high stringency: 0.1.times. SSPE, 0.1% SDS, 65.degree.
C.
[0220] 2) medium stringency: 0.2.times. SSPE, 0.1% SDS, 50.degree.
C.
[0221] 3) low stringency: 1.0.times. SSPE, 0.1% SDS, 50.degree.
C.
[0222] It is understood that equivalent stringencies may be
achieved using alternative buffers, salts and temperatures.
[0223] As used herein, a primer when set forth in the claims refers
to a primer suitable for mass spectrometric methods requiring
immobilizing, hybridizing, strand displacement, sequencing mass
spectrometry refers to a nucleic acid must be of low enough mass,
typically about 70 nucleotides or less than 70, and of sufficient
size to be useful in the mass spectrometric methods described
herein that rely on mass spectrometric detection. These methods
include primers for detection and seequening of nucleic acids,
which require a sufficient number nucleotides to from a stable
duplex, typically about 6-30, preferably about 10-25, more
preferably about 12-20. Thus, for purposes herein a primer will be
a sequence of nucleotides comprising about 6-70, more preferably a
12-70, more preferably greater than about 14 to an upper limit of
70, depending upon sequence and application of the primer. The
primers herein, for example for mutational analyses, are selected
to be upstream of loci useful for diagnosis such that when
performing using sequencing up to or through the site of interest,
the resulting fragment is of a mass that sufficient and not too
large to be detected by mass spectrometry. For mass spectrometric
methods, mass tags or modifier are preferably included at the
5'-end, and the primer is otherwise unlabeled.
[0224] As used herein, "conditioning" of a nucleic acid refers to
modification of the phosphodiester backbone of the nucleic acid
molecule (e.g., cation exchange) for the purpose of eliminating
peak broadening due to a heterogeneity in the cations bound per
nucleotide unit. Contacting a nucleic acid molecule with an
alkylating agent such as akyliodide, iodoacetamide,
.beta.-iodoethanol, or 2,3-epoxy-1-propanol, the monothio
phosphodiester bonds of a nucleic acid molecule can be transformed
into a phosphotriester bond. Likewise, phosphodiester bonds may be
transformed to uncharged derivatives employing trialkylsilyl
chlorides. Further conditioning involves incorporating nucleotides
that reduce sensitivity for depurination (fragmentation during MS)
e.g., a purine analog such as N7- or N9-deazapurine nucleotides, or
RNA building blocks or using oligonucleotide triesters or
incorporating phosphorothioate functions that are alkylated or
employing oligonucleotide mimetics such as peptide nucleic acid
(PNA).
[0225] As used herein, substrate refers to an insoluble support
onto which a sample is deposited according to the materials
described herein. Examples of appropriate substrates include beads
(e.g., silica gel, controlled pore glass, magnetic, agaroase gele
and crosslinked dextroses (i.e. Sepharose and Sephadex, cellulose
and other materials known by those of skill in the art to serve as
solid support matrices. For examples substrates may be formed from
any or combitions of: silica gel, glass, magnet, polystyrene/1%
divinylbenzene resins, such as Wang resins, which are Fmoc-amino
acid-4-(hydroxymethyl)phenoxymethyl-copoly(styrene-1- %
divinylbenzene (DVD)) resin, chlorotrityl (2-chlorotritylchloride
copolystyrene-DVB resin) resin, Merrifield (chloromethylated
copolystyrene-DVB) resin metal, plastic, cellulose, cross-linked
dextrans, such as those sold under the tradename Sephadex
(Pharmacia) and agarose gel, such as gels sold under the tradename
Sepharose (Pharmacia), which is a hydrogen bonded
polysaccharide-type agarose gel, and other such resins and solid
phase supports known to those of skill in the art. The support
matrices may be in any shape or form, including, but not limited
to: capillaries, flat supports such as glass fiber filters, glass
surfaces, metal surfaces (steel, gold, silver, aluminum, copper and
silicon), plastic materials including multiwell plates or membranes
(e.g., of polyethylene, polypropylene, polyamide,
polyvinylidenedifluorid- e), pins (e.g., arrays of pins suitable
for combinatorial synthesis or analysis or beads in pits of flat
surfaces such as wafers (e.g., silicon wafers) with or without
plates, and beads.
[0226] As used herein, a selectively cleavable linker is a linker
that is cleaved under selected conditions, such as a photocleavable
linker, a chemically cleavable linker and an enzymatically
cleavable linker (i.e., a restriction endonuclease site or a
ribonucleotide/RNase digestion). The linker is interposed between
the support and immobilized DNA.
[0227] Isolation of Nucleic Acids Molecules
[0228] Nucleic acid molecules can be isolated from a particular
biological sample using any of a number of procedures, which are
well-known in the art, the particular isolation procedure chosen
being appropriate for the particular biological sample. For
example, freeze-thaw and alkaline lysis procedures can be useful
for obtaining nucleic acid molecules from solid materials; heat and
alkaline lysis procedures can be useful for obtaining nucleic acid
molecules from urine; and proteinase K extraction can be used to
obtain nucleic acid from blood (see, e.g., Rolff et al. (1994) PCR:
Clinical Diagnostics and Research, Springer).
[0229] To obtain an appropriate quantity of a nucleic acid
molecules on which to perform mass spectrometry, amplification may
be necessary. Examples of appropriate amplification procedures for
use herein include: cloning (Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989),
polymerase chain reaction (PCR) (C. R. Newton and A. Graham, PCR,
BIOS Publishers, 1994), ligase chain reaction (LCR) (see, e.g.,
Weidmann et al. (1994) PCR Methods Appl. Vol. 3, Pp. 57-64; F.
Barany (1991) Proc. Natl. Acad. Sci. U.S.A. 88:189-93), strand
displacement amplification (SDA) (see, e., Walker et al. (1994)
Nucleic Acids Res. 22:2670-77) and variations such as RT-PCR (see,
e.g., Higuchi et al. (1993) Bio/Technology 11:1026-1030),
allele-specific amplification (ASA) and transcription based
processes.
[0230] Immobilization of Nucleic Acid Molecules to Solid
Supports
[0231] To facilitate mass spectrometric analysis, a nucleic acid
molecule containing a nucleic acid sequence to be detected can be
immobilized to an insoluble (i.e., a solid) support. Examples of
appropriate solid supports include beads (e.g., silica gel,
controlled pore glass, magnetic, Sephadex/Sepharose, cellulose),
capillaries, flat supports such as glass fiber filters, glass
surfaces, metal surfaces (steel, gold, silver, aluminum, copper and
silicon), plastic materials including multiwell plates or membranes
(e.g., of polyethylene, polypropylene, polyamide,
polyvinylidenedifluoride), pins (e.g., arrays of pins suitable for
combinatorial synthesis or analysis or beads in pits of flat
surfaces such as wafers (e.g., silicon wafers) with or without
filter plates.
[0232] Samples containing target nucleic acids can be transferred
to solid supports by any of a variety of methods known to those of
skill in the art. For example, nucleic acid samples can be
transferred to individual wells of a substrate, e.g., silicon chip,
manually or using a pintool microdispenser apparatus as described
herein. Alternatively, a piezoelectric pipette apparatus can be
used to transfer small nanoliter samples to a substrate permitting
the performance of high throughput miniaturized diagnostics on a
chip.
[0233] Immobilization can be accomplished, for example, based on
hybridization between a capture nucleic acid sequence, which has
already been immobilized to the support and a complementary nucleic
acid sequence, which is also contained within the nucleic acid
molecule containing the nucleic acid sequence to be detected (FIG.
1A). So that hybridization between the complementary nucleic acid
molecules is not hindered by the support, the capture nucleic acid
can include an e.g., spacer region of at least about five
nucleotides in length between the solid support and the capture
nucleic acid sequence. The duplex formed will be cleaved under the
influence of the laser pulse and desorption can be initiated. The
solid support-bound nucleic acid molecule can be presented through
natural oligoribo- or oligodeoxyribonucleotide as well as analogs
(e.g., thio-modified phosphodiester or phosphotriester backbone) or
employing oligonucleotide mimetics such as PNA analogs (see, e.,
Nielsen et al., Science 254:1497 (1991)) which render the base
sequence less susceptible to enzymatic degradation and bound
capture base sequence.
[0234] Linkers
[0235] A target detection site can be directly linked to a solid
support via a reversible or irreversible bond between an
appropriate functionality (L') on the target nucleic acid molecule
(T) and an appropriate functionality (L) on the capture molecule
(FIG. 1B). A reversible linkage can be such that it is cleaved
under the conditions of mass spectrometry (i.e., a photocleavable
bond such as a charge transfer complex or a labile bond being
formed between relatively stable organic radicals).
[0236] Photocleavable linkers are linkers that are cleaved upon
exposure to light (see, e.g. Goldmacher et al. (1992) Bioconj.
Chem. 3:104-107), thereby releasing the targeted agent upon
exposure to light. Photocleavable linkers that are cleaved upon
exposure to light are known (see, e., Hazum et al. (1981) in Pept.,
Proc. Eur. Pept. Symp. 16th, Brunfeldt, K (Ed), pp. 105-110, which
describes the use of a nitrobenzyl group as a photocleavable
protective group for cysteine; Yen et al. (1989) Makromol. Chem
190:69-82, which describes water soluble photocleavable copolymers,
including hydroxypropylmethacrylamide copolymer, glycine copolymer,
fluorescein copolymer and methylrhodamine copolymer; Goldmacher et
al. (1992) Bioconj. Chem. 3:104-107, which describes a cross-linker
and reagent that undergoes photolytic degradation upon exposure to
near UV light (350 nm); and Senter et al. (1985) Photochem.
Photobiol 42:231-237, which describes nitrobenzyloxycarbonyl
chloride cross linking reagents that produce photocleavable
linkages), thereby releasing the targeted agent upon exposure to
light. In preferred embodiments, the nucleic acid is immobilized
using the photocleavable linker moiety that is cleaved during mass
spectrometry. Presently preferred photocleavable linkers are set
forth in the EXAMPLES.
[0237] Furthermore, the linkage can be formed with L' being a
quaternary ammonium group, in which case, preferably, the surface
of the solid support carries negative charges which repel the
negatively charged nucleic acid backbone and thus facilitate the
desorption required for analysis by a mass spectrometer. Desorption
can occur either by the heat created by the laser pulse and/or,
depending on L,' by specific absorption of laser energy which is in
resonance with the L' chromophore.
[0238] Thus, the L-L' chemistry can be of a type of disulfide bond
(chemically cleavable, for example, by mercaptoethanol or
dithioerythrol), a biotin/streptavidin system, a heterobifunctional
derivative of a trityl ether group (see, e.g., Koster et al. (1990)
"A Versatile Acid-Labile Linker for Modification of Synthetic
Biomolecules," Tetrahedron Letters 31:7095) that can be cleaved
under mildly acidic conditions as well as under conditions of mass
spectrometry, a levulinyl group cleavable under almost neutral
conditions with a hydrazinium/acetate buffer, an arginine-arginine
or lysine-lysine bond cleavable by an endopeptidase enzyme like
trypsin or a pyrophosphate bond cleavable by a pyrophos-phatase, or
a ribonucleotide bond in between the oligodeoxynucleotide sequence,
which can be cleaved, for example, by a ribonuclease or alkali.
[0239] The functionalities, L and L,' can also form a charge
transfer complex and thereby form the temporary L-L' linkage. Since
in many cases the "charge-transfer band" can be determined by
UV/vis spectrometry (see, e.g., Organic Charge Transfer Complexes
by R. Foster, Academic Press, 1969), the laser energy can be tuned
to the corresponding energy of the charge-transfer wavelength and,
thus, a specific desorption off the solid support can be initiated.
Those skilled in the art will recognize that several combinations
can serve this purpose and that the donor functionality can be
either on the solid support or coupled to the nucleic acid molecule
to be detected or vice versa.
[0240] In yet another approach, a reversible L-L' linkage can be
generated by homolytically forming relatively stable radicals.
Under the influence of the laser pulse, desorption (as discussed
above) as well as ionization will take place at the radical
position. Those skilled in the art will recognize that other
organic radicals can be selected and that, in relation to the
dissociation energies needed to homolytically cleave the bond
between them, a corresponding laser wavelength can be selected (see
e.g., Reactive Molecules by C. Wentrup, John Wiley & Sons,
1984).
[0241] An anchoring function L' can also be incorporated into a
target capturing sequence (TCS) by using appropriate primers during
an amplification procedure, such as PCR (FIG. 4), LCR (FIG. 5) or
transcription amplification (FIG. 6A).
[0242] When performing exonuclease sequencing using MALDI-TOF MS, a
single stranded DNA molecule immobilized via its 5-end to a solid
support is unilaterally degraded with a 3'-processive exonuclease
and the molecular weight of the degraded nucleotide is determined
sequentially. Reverse Sanger sequencing reveals the nucleotide
sequence of the immobilized DNA. By adding a selectively cleavable
linker, not only can the mass of the free nucleotides be determined
but also, upon removal of the nucleotides by washing, the mass of
the remaining fragment can be detected by MALDI-TOF upon cleaving
the DNA from the solid support. Using selectively cleavable
linkers, such as the photocleavable and chemical cleavable linkers
provided herein, this cleavage can be selected to occur during the
ionization and volatizing steps of MALDI-TOF. The same rationale
applies for a 5' immobilized strand of a double stranded DNA that
is degraded while in a duplex. Likewise, this also applies when
using a 5'-processive exonuclease and the DNA is immobilized
through the 3'-end to the solid support.
[0243] As noted, at least three version of immobilization are
contemplated herein: 1) the target nucleic acid is amplified or
obtained (the target sequence or surrounding DNA sequence must be
known to make primers to amplify or isolated); 2) the primer
nucleic acid is immobilized to the solid support and the target
nucleic acid is hybridized thereto (this is for detecting the
presence of or sequencing a target sequence in a sample); or 3) a
double stranded DNA (amplified or isolated) is immobilized through
linkage to one predetermined strand, the DNA is denatured to
eliminate the duplex and then a high concentration of a
complementary primer or DNA with identity upstream from the target
site is added and a strand displacement occurs and the primer is
hybridized to the immobilized strand.
[0244] In the embodiments where the primer nucleic acid is
immobilized on the solid support and the target nucleic acid is
hybridized thereto, the inclusion of the cleavable linker allows
the primer DNA to be immobilized at the 5'-end so that free 3'-OH
is available for nucleic acid synthesis (extension) and the
sequence of the "hybridized" target DNA can be determined because
the hybridized template can be removed by denaturation and the
extended DNA products cleaved from the solid support for MALDI-TOF
MS. Similarly for 3), the immobilized DNA strand can be elongated
when hybridized to the template and cleaved from the support. Thus,
Sanger sequencing and primer oligo base extension (PROBE),
discussed below, extension reactions can be performed using an
immobilized primer of a known, upstreamn DNA sequence complementary
to an invariable region of a target sequence. The nucleic acid from
the person is obtained and the DNA sequence of a variable region
(deletion, insertion, missense mutation that cause genetic
predisposition or diseases, or the presence of viral/bacterial or
fungal DNA) not only is detected, but the actual sequence and
position of the mutation is also determined.
[0245] In other cases, the target DNA must be immobilized and the
primer annealed. This requires amplifying a larger DNA based on
known sequence and then sequencing the immobilized fragments (i.e.,
the extended fragments are hybridized but not immobilized to the
support as described above). In these cases, it is not desirable to
include a linker because the MALDI-TOF spectrum is of the
hybridized DNA; it is not necessary to cleave the immobilized
template.
[0246] Any linker known to those of skill in the art for
immobilizing nucleic acids to solid supports may be used herein to
link the nucleic acid to a solid support. The preferred linkers
herein are the selectively cleavable linkers, particularly those
exemplified herein. Other linkers include, acid cleavable linkers,
such as bismaleimideothoxy propane, acid-labile trityl linkers.
[0247] Acid cleavable linkers, photocleavable and heat sensitive
linkers may also be used, particularly where it may be necessary to
cleave the targeted agent to permit it to be more readily
accessible to reaction. Acid cleavable linkers include, but are not
limited to, bismaleimideothoxy propane; and adipic acid dihydrazide
linkers (see, e., Fattom et al. (1992) Infection & Immun.
60:584-589) and acid labile transferrin conjugates that contain a
sufficient portion of transferrin to permit entry into the
intracellular transferrin cycling pathway (see, e.g., Welhoner et
al. (1991) J. Biol. Chem. 266:4309-4314).
[0248] Photocleavable Linkers
[0249] Photocleavable linkers are provided. In particular,
photocleavable linkers as their phosphoramidite derivatives are
provided for use in solid phase synthesis of oligonucleotides. The
linkers contain o-nitrobenzyl moieties and phosphate linkages which
allow for complete photolytic cleavage of the conjugates within
minutes upon UV irradiation. The UV wavelengths used are selected
so that the irradiation will not damage the oligonucleotides and
are preferrably about 350-380 nm, more preferably 365 nm. The
photocleavable linkers provided herein possess comparable coupling
efficiency as compared to commonly used phosphoramidite monomers
(see, Sinha et al. (1983) Tetrahedron Lett. 24:5843-5846; Sinha et
al. (1984) Nucleic Acids Res. 12:4539-4557; Beaucage et al. (1993)
Tetrahedron 49:6123-6194; and Matteucci et al. (1981) J. Am. Chem.
Soc. 103:3185-3191).
[0250] In one embodiment, the photocleavable linkers have formula
I: 1
[0251] where R.sup.20 is .omega.-(4,4'-dimethoxytrityloxy)alkyl or
.omega.-hydroxyalkyl; R.sup.21 is selected from hydrogen, alkyl,
aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R.sup.22 is
hydrogen or (dialkylamino)(.omega.-cyanoalkoxy)P--; t is 0-3; and
R.sup.50 is alkyl, alkoxy, aryl or aryloxy.
[0252] In a preferred embodiment, the photocleavable linkers have
formula II: 2
[0253] where R.sup.20 is .omega.-(4,4'-dimethoxytrityloxy)alkyl,
.omega.-hydroxyalkyl or alkyl; R.sup.21 is selected from hydrogen,
alkyl, aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R.sup.22
is hydrogen or (dialkylamino)(.omega.-cyanoalkoxy)P--; and X.sup.20
is hydrogen, alkyl or OR.sup.20.
[0254] In particularly preferred embodiments, R.sup.20 is
3-(4,4'-dimethoxytrityloxy)propyl, 3-hydroxypropyl or methyl;
R.sup.21 is selected from hydrogen, methyl and carboxy; R.sup.22 is
hydrogen or (diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is
hydrogen, methyl or OR.sup.20. In a more preferred embodiment,
R.sup.20 is 3-(4,4'-dimethoxytrityloxy)propyl; R.sup.21 is methyl;
R.sup.22 is (diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is
hydrogen. In another more preferred embodiment, R.sup.20 is methyl;
R.sup.21 is methyl; R.sup.22 is
(diisopropylamino)(2-cyanoethoxy)P--; and X.sup.20 is
3-(4,4'-dimethoxytrityloxy)propoxy.
[0255] In another embodiment, the photocleavable linkers have
formula III: 3
[0256] where R.sup.23 is hydrogen or
(dialkylamino)(.omega.-cyanoalkoxy)P-- -; and R.sup.24 is selected
from .omega.-hydroxyalkoxy,
.omega.-(4,4'-dimethoxytrityloxy)alkoxy, .omega.-hydroxyalkyl and
.omega.-(4,4'-dimethoxytrityloxy)alkyl, and is unsubstituted or
substituted on the alkyl or alkoxy chain with one or more alkyl
groups; r and s are each independently 0-4; and R.sup.50 is alkyl,
alkoxy, aryl or aryloxy. In certain embodiments, R.sup.24 is
.omega.-hydroxyalkyl or .omega.-(4,4'-dimethoxytrityloxy)alkyl, and
is substituted on the alkyl chain with a methyl group.
[0257] In preferred embodiments, R.sup.23 is hydrogen or
(diisopropylamino)(2-cyanoethoxy)P--; and R.sup.24 is selected from
3-hydroxypropoxy, 3-(4,4'-dimethoxytrityloxy)propoxy,
4-hydroxybutyl, 3-hydroxy-1-propyl, 1-hydroxy-2-propyl,
3-hydroxy-2-methyl-1-propyl, 2-hydroxyethyl, hydroxymethyl,
4-(4,4'-dimethoxytrityloxy)butyl,
3-(4,4'-dimethoxytrityloxy)-1-propyl,
2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy)-2-propyl,
3-(4,4'-dimethoxytrityloxy)-2-methy- l-1-propyl and
4,4'-dimethyoxytrityloxymethyl.
[0258] In more preferred embodiments, R.sup.23 is
(diisopropylamino)(2-cya- noethoxy)P--; r and s are 0; and R.sup.24
is selected from 3-(4,4'-dimethoxytrityloxy) propoxy,
4-(4,4'-dimethoxytrityloxy) butyl,
3-(4,4'-dimethoxytrityloxy)propyl,
2-(4,4'-dimethoxytrityloxy)ethyl,
1-(4,4'-dimethoxytrityloxy)-2-propyl,
3-(4,4'-dimethoxytrityloxy)-2-methy- l-1-propyl and
4,4'-dimethyoxytrityloxymethyl. R.sup.24 is most preferably
3-(4,4'-dimethoxytrityloxy)propoxy.
[0259] Preparation of the Photocleavable Linkers
[0260] A. Preparation of Photocleavable Linkers of Formulae I or
II
[0261] Photocleavable linkers of formulae I or II may be prepared
by the methods described below, by minor modification of the
methods by choosing the appropriate starting materials or by any
other methods known to those of skill in the art. Detailed
procedures for the synthesis of photocleavable linkers of formula
II are provided in the Examples.
[0262] In the photocleavable linkers of formula II where X.sup.20
is hydrogen, the linkers may be prepared in the following manner.
Alkylation of 5-hydroxy-2-nitrobenzaldehyde with an
.omega.-hydroxyalkyl halide, e.g., 3-hydroxypropyl bromide,
followed by protection of the resulting alcohol as, e.g., a silyl
ether, provides a 5-(.omega.-silyloxyalkoxy)-2-- nitrobenzaldehyde.
Addition of an organometallic to the aldehyde affords a benzylic
alcohol. Organometallics which may be used include
trialkylaluminums (for linkers where R.sup.21 is alkyl), such as
trimethylaluminum, borohydrides (for linkers where R.sup.21 is
hydrogen), such as sodium borohydride, or metal cyanides (for
linkers where R.sup.21 is carboxy or alkoxycarbonyl), such as
potassium cyanide. In the case of the metal cyanides, the product
of the reaction, a cyanohydrin, would then be hydrolyzed under
either acidic or basic conditions in the presence of either water
or an alcohol to afford the compounds of interest.
[0263] The silyl group of the side chain of the resulting benzylic
alcohols may then be exchanged for a 4,4'-dimethoxytriyl group by
desilylation with, e.g., tetrabutylammonium fluoride, to give the
corresponding alcohol, followed by reaction with
4,4'-dimethoxytrityl chloride. Reaction with, e.g., 2-cyanoethyl
diisopropylchlorophosphoramid- ite affords the linkers where
R.sup.22 is (dialkylamino)(.omega.-cyanoalko- xy)P--.
[0264] A specific example of a synthesis of a photocleavable linker
of formula II is shown in the following scheme, which also
demonstrates use of the linker in oligonucleotide synthesis. This
scheme is intended to be illustrative only and in no way limits the
scope of the invention. Experimental details of these synthetic
transformations are provided in the Examples. 4
[0265] Synthesis of the linkers of formula II where X.sup.20 is
OR.sup.20, 3,4-dihydroxyacetophenone is protected selectively at
the 4-hydroxyl by reaction with, e.g., potassium carbonate and a
silyl chloride. Benzoate esteres, propiophenones, butyrophenones,
etc. may be used in place of the acetophenone. The resulting
4-silyloxy-3-hydroxyacetophenone is then alkylated at the with an
alkyl halide (for linkers where R.sup.20 is alkyl) at the
3-hydroxyl and desilylated with, e.g., tetrabuylammonium fluoride
to afford a 3-alkoxy-4-hydroxyacetophenone. This compound is then
alkylated at the 4-hydroxyl by reaction with an
.omega.-hydroxyalkyl halide, e.g., 3-hydroxypropyl bromide, to give
a 4-(.omega.-hydroxyalkoxy- )-3-alkoxyacetophenone. The side chain
alcohol is then protected as an ester, e.g., an acetate. This
compound is then nitrated at the 5-position with, e.g.,
concentrated nitric acid to provide the corresponding
2-nitroacetophenones. Saponification of the side chain ester with,
e.g., potassium carbonate, and reduction of the ketone with, e.g.,
sodium borohydride, in either order gives a
2-nitro-4-(.omega.-hydroxyalkoxy)-5-- alkoxybenzylic alcohol.
[0266] Selective protection of the side chain alcohol as the
corresponding 4,4'-dimethoxytrityl ether is then accomplished by
reaction with 4,4'-dimethoxytrityl chloride. Further reaction with,
e.g., 2-cyanoethyl diisopropylchlorophosphoramidite affords the
linkers where R.sup.22 is
(dialkylamino)(.omega.-cyanoalkoxy)P--.
[0267] A specific example of the synthesis of a photocleavable
linker of formula II is shown the following scheme. This scheme is
intended to be illustrative only and in no way limit the scope of
the invention. Detailed experimental procedures for the
transformations shown are found in the Examples. 56
[0268] B. Preparation of Photocleavable Linkers of Formula III
[0269] Photocleavable linkers of formula III may be prepared by the
methods described below, by minor modification of the methods by
choosing appropriate starting materials, or by other methods known
to those of skill in the art.
[0270] In general, photocleavable linkers of formula III are
prepared from .omega.-hydroxyalkyl- or alkoxyaryl compounds, in
particular w-hydroxy-alkyl or alkoxy-benzenes. These compounds are
commercially available, or may be prepared from an
.omega.-hydroxyalkyl halide (e.g., 3-hydroxypropyl bromide) and
either phenyllithium (for the w-hydroxyalkylbenzenes) or phenol
(for the .omega.-hydroxyalkoxybenzenes)- . Acylation of the
.omega.-hydroxyl group (e.g., as an acetate ester) followed by
Friedel-Crafts acylation of the aromatic ring with 2-nitrobenzoyl
chloride provides a 4-(.omega.-acetoxy-alkyl or
alkoxy)-2-nitrobenzophenone. Reduction of the ketone with, e.g.,
sodium borohydride, and saponification of the side chain ester are
performed in either order to afford a
2-nitrophenyl-4-(hydroxy-alkyl or alkoxy)phenylmethanol. Protection
of the terminal hydroxyl group as the corresponding
4,4'-dimethoxytrityl ether is achieved by reaction with
4,4'-dimethoxytrityl chloride. The benzylic hydroxyl group is then
reacted with, e.g., 2-cyanoethyl diisopropylchlorophosphoramidite
to afford linkers of formula II where R.sup.23 is
(dialkylamino)(.omega.-cya- noalkoxy)P--.
[0271] Other photocleavable linkers of formula III may be prepared
by substituting 2-phenyl-1-propanol or 2-phenylmethyl-1-propanol
for the .omega.-hydroxy-alkyl or alkoxy-benzenes in the above
synthesis. These compounds are commercially available, but may also
be prepared by reaction of, e.g., phenylmagnesium bromide or
benzylmagnesium bromide, with the requisite oxirane (i.e.,
propylene oxide) in the presence of catalytic cuprous ion.
[0272] Chemically Cleavable Linkers
[0273] A variety of chemically cleavable linkers may be used to
introduce a cleavable bond between the immobilized nucleic acid and
the solid support. Acid-labile linkers are presently preferred
chemically cleavable linkers for mass spectrometry, especially
MALDI-TOF MS, because the acid labile bond is cleaved during
conditioning of the nucleic acid upon addition of the 3-HPA matrix
solution. The acid labile bond can be introduced as a separate
linker group, eg., the acid labile trityl groups (see FIG. 68;
Example 16) or may be incorporated in a synthetic nucleic acid
linker by introducing one or more silyl internucleoside bridges
using diisopropylsilyl, thereby forming diisopropylsilyl-linked
oligonucleotide analogs. The diisopropylsilyl bridge replaces the
phoshodiester bond in the DNA backbone and under mildly acidic
conditions, such as 1.5% trifluoroacetic acid (TFA) or 3-HPA/1% TFA
MALDI-TOF matrix solution, results in the introduction of one or
more intra-strand breaks in the DNA molecule. Methods for the
preparation of diisopropylsilyl-linked oligonucleotide precursors
and analogs are known to those of skill in the art (see e.g., Saha
et al. (1993) J. Org. Chem. 58:7827-7831). These oligonucleotide
analogs may be readily prepared using solid state oligonucleotide
synthesis methods using diisopropylsilyl derivatized
deoxyribonucleosides.
[0274] Nucleic Acid Conditioning
[0275] Prior to mass spectrometric analysis, it may be useful to
"condition" nucleic acid molecules, for example to decrease the
laser energy required for volatilization and/or to minimize
fragmentation. Conditioning is preferably performed while a target
detection site is immobilized. An example of conditioning is
modification of the phosphodiester backbone of the nucleic acid
molecule (e.g., cation exchange), which can be useful for
eliminating peak broadening due to a heterogeneity in the cations
bound per nucleotide unit. Contacting a nucleic acid molecule with
an alkylating agent such as akyliodide, iodoacetamide,
.beta.-iodoethanol, or 2,3-epoxy-1-propanol, the monothio
phosphodiester bonds of a nucleic acid molecule can be transformed
into a phosphotriester bond. Likewise, phosphodiester bonds may be
transformed to uncharged derivatives employing trialkylsilyl
chlorides. Further conditioning involves incorporating nucleotides
that reduce sensitivity for depurination (fragmentation during MS)
e.g., a purine analog such as N7- or N9-deazapurine nucleotides, or
RNA building blocks or using oligonucleotide triesters or
incorporating phosphorothioate functions which are alkylated or
employing oligonucleotide mimetics such as PNA.
[0276] Multiplex Reactions
[0277] For certain applications, it may be useful to simultaneously
detect more than one (mutated) loci on a particular captured
nucleic acid fragment (on one spot of an array) or it may be useful
to perform parallel processing by using oligonucleotide or
oligonucleotide mimetic arrays on various solid supports.
"Multiplexing" can be achieved by several different methodologies.
For example, several mutations can be simultaneously detected on
one target sequence by employing corresponding detector (probe)
molecules (e.g., oligonucleotides or oligonucleotide mimetics). The
molecular weight differences between the detector oligonucleotides
D1, D2 and D3 must be large enough so that simultaneous detection
(multiplexing) is possible. This can be achieved either by the
sequence itself (composition or length) or by the introduction of
mass-modifying functionalities M1-M3 into the detector
oligonucleotide (seeI FIG. 2).
[0278] Mass Modification of Nucleic Acids
[0279] Mass modifying moieties can be attached, for instance, to
either the 5'-end of the oligonucleotide (M.sup.1), to the
nucleobase (or bases) (M.sup.2, M.sup.7), to the phosphate backbone
(M.sup.3), and to the 2'-position of the nucleoside (nucleosides)
(M.sup.4, M.sup.6) and/or to the terminal 3'-position (M.sup.5).
Examples of mass modifying moieties include, for example, a
halogen, an azido, or of the type, XR, wherein X is a linking group
and R is a mass-modifying functionality. The mass-modifying
functionality can thus be used to introduce defined mass increments
into the oligonucleotide molecule.
[0280] The mass-modifying functionality can be located at different
positions within the nucleotide moiety (see, e.g., U.S. Pat. No.
5,547,835 and International PCT application No. WO 94/21822). For
example, the mass-modifying moiety, M, can be attached either to
the nucleobase, M.sup.2 (in case of the c.sup.7-deazanucleosides
also to C-7, M.sup.7), to the triphosphate group at the alpha
phosphate, M.sup.3, or to the 2'-position of the sugar ring of the
nucleoside triphosphate, M.sup.4 and M.sup.6. Modifications
introduced at the phosphodiester bond (M4), such as with alpha-thio
nucleoside triphosphates, have the advantage that these
modifications do not interfere with accurate Watson-Crick
base-pairing and additionally allow for the one-step post-synthetic
site-specific modification of the complete nucleic acid molecule
e.g., via alkylation reactions (see, e.g., Nakamaye et al.
(1988)Nucl. Acids Res. 16:9947-59). Particularly preferred
mass-modifying functionalities are boron-modified nucleic acids
since they are better incorporated into nucleic acids by
polymerases (see, e., Porter et al. (1995) Biochemistry
34:11963-11969; Hasan et al. (1996) Nucleic Acids Res.
24:2150-2157; Li et al. (1995) Nucl. Acids Res. 23:4495-4501).
[0281] Furthermore, the mass-modifying functionality can be added
so as to affect chain termination, such as by attaching it to the
3'-position of the sugar ring in the nucleoside triphosphate,
M.sup.5. For those skilled in the art, it is clear that many
combinations can be used in the methods provided herein. In the
same way, those skilled in the art will recognize that
chain-elongating nucleoside triphosphates can also be mass-modified
in a similar fashion with numerous variations and combinations in
functionality and attachment positions.
[0282] Without being bound to any particular theory, the
mass-modification, M, can be introduced for X in XR as well as
using oligo-/polyethylene glycol derivatives for R. The
mass-modifying increment in this case is 44, i.e. five different
mass-modified species can be generated by just changing m from 0 to
4 thus adding mass units of 45 (m=0), 89 (m=1), 133 (m=2), 177
(m=3) and 221 (m=4) to the nucleic acid molecule (e.g., detector
oligonucleotide (D) or the nucleoside triphosphates (FIG. 6(C)),
respectively). The oligo/polyethylene glycols can also be
monoalkylated by a lower alkyl such as methyl, ethyl, propyl,
isopropyl, t-butyl and the like. A selection of linking
functionalities, X, are also illustrated. Other chemistries can be
used in the mass-modified compounds (see, e.g., those described in
Oligonucleotides and Analogues, A Practical Approach, F. Eckstein,
editor, IRL Press, Oxford, 1991).
[0283] In yet another embodiment, various mass-modifying
functionalities, R, other than oligo/polyethylene glycols, can be
selected and attached via appropriate linking chemistries, X. A
simple mass-modification can be achieved by substituting H for
halogens like F, Cl, Br and/or I, or pseudohalogens such as CN,
SCN, NCS, or by using different alkyl, aryl or aralkyl moieties
such as methyl, ethyl, propyl, isopropyl, t-butyl, hexyl, phenyl,
substituted phenyl, benzyl, or functional groups such as CH.sub.2F,
CHF.sub.2, CF.sub.3, Si(CH.sub.3).sub.3
Si(CH.sub.3).sub.2(C.sub.2H.sub.5),
Si(CH.sub.3)(C.sub.2H.sub.5).sub.2 , Si(C.sub.2H.sub.5).sub.3. Yet
another mass-modification can be obtained by attaching homo- or
heteropeptides through the nucleic acid molecule (e.g., detector
(D)) or nucleoside triphosphates. One example. useful in generating
mass-modified species with a mass increment of 57. is the
attachment of oligoglycines, e.g., mass-modifications of 74 (r=1,
m=0), 131 (r=1, m=1), 188 (r=1, m=2), 245 (r=1, m=3) are achieved.
Simple oligoamides also can be used, e.g., mass-modifications of 74
(r=1, m=0), 88 (r=2, m=0), 102 (r=3, m=0), 116(r=4, m=0), etc. are
obtainable. Variations in additions to those set forth herein will
be apparent to the skilled artisan.
[0284] Different mass-modified detector oligonucleotides can be
used to simultaneously detect all possible variants/mutants
simultaneously (FIG. 6B). Alternatively, all four base permutations
at the site of a mutation can be detected by designing and
positioning a detector oligonucleotide, so that it serves as a
primer for a DNA/RNA polymerase with varying combinations of
elongating and terminating nucleoside triphosphates (FIG. 6C). For
example, mass modifications also can be incorporated during the
amplification process.
[0285] FIG. 3 shows a different multiplex detection format, in
which differentiation is accomplished by employing different
specific capture sequences which are position-specifically
immobilized on a flat surface (e.g., a `chip array`). If different
target sequences T1-Tn are present, their target capture sites
TCS1-TCSn will specifically interact with complementary immobilized
capture sequences C1-Cn. Detection is achieved by employing
appropriately mass differentiated detector oligonucleotides D1-Dn,
which are mass modifying functionalities M1-Mn.
[0286] Mass Spectrometric Methods for Sequencing DNA
[0287] Amenable mass spectrometric formats for use herein include
the ionization (I) techniques, such as matrix assisted laser
desorption ionization (MALDI), electrospray (ESI) (e.g., continuous
or pulsed); and related methods (e.g., Ionspray, Thermospray, Fast
Atomic Bombardment), and massive cluster impact (MCI); these ion
sources can be matched with detection formats including lin-linear
fields) time-of-flight (TOF), single or multiple quadrupole, single
or multiple magnetic sector, Fourier transform ion cyclotron
resonance (FTICR), ion trap, or combinations of these to give a
hybrid detector (e.g., ion trap--time of flight). For ionization,
numerous matrix/wavelength combinations including frozen analyte
preparation (MALDI) or solvent combinations (ESI) can be
employed.
[0288] Since a normal DNA molecule includes four nucleotide units
(A, T, C, G), and the mass of each of these is unique (monoisotopic
masses 313.06, 304.05, 289.05, 329.05 Da, respectively), an
accurate mass determination can define or constrain the possible
base compositions of that DNA. Only above 4900 Da does each unit
molecular weight have at least one allowable composition; among all
5-mers there is only one non-unique nominal molecular weight, among
8-mers, 20. For these and larger oligonucleotides, such mass
overlaps can be resolved with the .about.{fraction (1/10)}.sup.5
(.about.10 part per million, ppm) mass accuracy available with high
resolution FTICR MS. For the 25-mer A.sub.5T.sub.20, the 20
composition degeneracies when measured at .+-.0.5 Da is reduced to
three (A.sub.5T.sub.20, T.sub.4C.sub.12G.sub.9,
AT.sub.3C.sub.4G.sub.16) when measured with 2 ppm accuracy. Given
composition constraints (e.g., the presence or absence of one of
the four bases in the strand) can reduce this further (see
below).
[0289] Medium resolution instrumentation, including but not
exclusively curved field reflectron or delayed extraction
time-of-flight MS instruments, can also result in improved DNA
detection for sequencing or diagnostics. Either of these are
capable of detecting a 9 Da (.DELTA.m (A-T)) shift in
.gtoreq.30-mer strands generated from, for example primer oligo
base extension (PROBE), or competitive oligonucleotide single base
extension (COSBE), sequencing, or direct detection of small
amplified products.
[0290] BiomassScan
[0291] In this embodiment, exemplified in Example 33, two single
stranded nucleic acids are individually immobilized to solid
supports. One support contains a nucleic acid encoding the wild
type sequence whereas the other support contains a nucleic acid
encoding a mutant target sequence. Total human genomic DNA is
digested with one or more restriction endonuclease enzyme resulting
in the production of small fragments of double stranded genomic DNA
(10-1,000 bp). The digested DNA is incubated with the immobilized
single stranded nucleic acids and the sample is heated to denature
the DNA duplex. The immobilized nucleic acid competes with the
other genomic DNA strand for the complementary DNA strand and under
the appropriate conditions, a portion of the complementary DNA
strand hybridizes to the immobilized nucleic acid resulting in a
strand displacement. By using high stringency washing conditions,
the two nucleic acids will remain as a DNA duplex only if there is
exact identity between the immobilized nucleic acid and the genomic
DNA strand. The DNA that remains hybridized to the immobilized
nucleic acid is analyzed by mass spectrometry and detection of a
signal in the mass spectrum of the appropriate mass is diagnostic
for the wild type or mutant allele. In this manner, total genomic
DNA can be isolated from a biological sample and screened for the
presence or absence of certain mutations. By immobilizing a variety
of single stranded nucleic acids in an array format, a panel of
mutations may be simultaneously screened for a number of genetic
loci (i.e., multiplexing).
[0292] In addition, using less stringent washing conditions the
hybridized DNA strand may be analyzed by mass spectrometry for
changes in the mass resulting from a deletion or insertion within
the targeted restriction endonuclease fragment.
[0293] Primer Oligonucleotide Base Extension
[0294] As described in detail in the following Example 11, the
primer oligo base extension (PROBE) method combined with mass
spectrometry identifies the exact number of repeat units (i.e. the
number of nucleotides in homogenous stretches) as well as second
site mutations within a polymorphic region, which are otherwise
only detectable by sequencing. Thus, the PROBE technique increases
the total number of detectable alleles at a distinct genomic site,
leading to a higher polymorphism information content (PIC) and
yielding a far more definitive identification in for instance
statistics-based analyses in paternity or forensics
applications.
[0295] The method is based on the extension of a detection primer
that anneals adjacent to a variable nucleotide tandem repeat (VNTR)
or a polymorphic mononucleotide stretch using a DNA polymerase in
the presence of a mixture of deoxyNTPs and those dideoxyNTPs that
are not present in the deoxy form. The resulting products are
evaluated and resolved by MALDI-TOF mass spectrometry without
further labeling of the DNA. In a simulated routine application
with 28 unrelated individuals, the mass error of this procedure
using external calibration was in the worst case 0.38% (56-mer),
which is comparable to approximately 0.1 base accuracy; routine
standard mass deviations are in the range of 0.1% (0.03 bases).
Such accuracy with conventional electrophoretic methods is not
realistic, underscoring the value of PROBE and mass spectrometry in
forensic medicine and paternity testing.
[0296] The ultra-high resolution of Fourier Transform mass
spectrometry makes possible the simultaneous measurement of all
reactions of a Sanger or Maxam Gilbert sequencing experiment, since
the sequence may be read from mass differences instead of base
counting from 4 tubes.
[0297] Additionally, the mass differences between adjacent bases
generated from unilateral degradation in a stepwise manner by an
exonuclease can be used to read the entire sequence of fragments
generated. Whereas UV or fluorescent measurements will not
discriminate mixtures of the nucleoside/nucleotide which are
generated when the exonuclease enzyme gets out of phase, this is no
problem with mass spectrometry since the resolving power in
differentiating between the molecular mass of dA, dT, dG and dC is
more than significant. The mass of the adjacent bases (i.e.
nucleotides) can be determined, for example, using Fast Atomic
Bombardment (FAB) or Electronspray Ionization (ESI) mass
spectrometry.
[0298] New mutation screening over an entire amplified product can
be achieved by searching for mass shifted fragments generated in an
endonuclease digestion as described in detail in the following
Examples 4 and 12.
[0299] Partial sequence information obtained from tandem mass
spectrometry (MS.sup.n) can place composition constraints as
described in the preceding paragraph. For the 25-mer above,
generation of two fragment ions formed by collisionally activated
dissociation (CAD) which differ by 313 Da discounts
T.sub.4C.sub.12G.sub.9, which contains no A nucleotides; confirming
more than a single A eliminates AT.sub.3C.sub.4G.sub.16 as a
possible composition.
[0300] MS.sup.n can also be used to determined full or partial
sequences of larger DNAs; this can be used to detect, locate, and
identify new mutations in a given gene region. Enzymatic digest
products whose masses are correct need not be further analyzed;
those with mass shifts could be isolated in real time from the
complex mixture in the mass spectrometer and partially sequenced to
locate the new mutation.
[0301] Table I describes the mutation/polymorphism detection tests
that have been developed.
1TABLE I Mutation/Polymorphism Detection Tests Clinical Association
Gene Mutation/Polymorphism Cystic Fibrosis CFTR 38 disease causing
mutations in 14 exons/introns Heart Disease (Cholesterol Apo E
112R, 112C, 158R, 158C Metabolism) Apo A-IV 347S, 347T, 360H, 360Q
Apo B-100 3500Q, 3500R Thyroid Cancer RET proto- C634W, C634T,
C634R, oncogene C634S, C634F Sickle Cell Anemia/ beta-globin Sickle
cell anemia S and C Thalassemia 45 thalassemia alleles HIV
Susceptibility CKR-5 32 bp deletion Breast Cancer BRCA-2 2 bp (AG)
deletion in exon 2 Susceptibility Thrombosis Factor V R506Q
Arteriosclerosis GpIIIa L33P E-selectin S128R Hypertension ACE I/D
polymorphism
[0302] Detection of Mutations
[0303] Diagnosis of Genetic Diseases
[0304] The mass spectrometric processes described above can be
used, for example, to diagnose any of the more than 3000 genetic
diseases currently known (e.g., hemophilias, thalassemias, Duchenne
Muscular Dystrophy (DMD), Huntington's Disease (HD), Alzheimer's
Disease and Cystic Fibrosis (CF)) or to be identified.
[0305] The following Example 3 provides a mass spectrometric method
for detecting a mutation (.DELTA.F508) of the cystic fibrosis
transmembrane conductance regulator gene (CFTR), which differs by
only three base pairs (900 daltons) from the wild type of CFTR
gene. As described further in Example 3, the detection is based on
a single-tube, competitive oligonucleotide single base extension
(COSBE) reaction using a pair of primers with the 3'-terminal base
complementary to either the normal or mutant allele. Upon
hybridization and addition of a polymerase and the nucleoside
triphosphate one base downstream, only those primers properly
annealed (i.e., no 3'-terminal mismatch) are extended; products are
resolved by molecular weight shifts as determined by matrix
assisted laser desorption ionization time-of-flight mass
spectrometry. For the cystic fibrosis .DELTA.F508 polymorphism,
28-mer `normal` (N) and 30-mer `mutant` (M) primers generate 29-
and 31-mers for N and M homozygotes, respectively, and both for
heterozygotes. Since primer and product molecular weights are
relatively low (<10 kDa) and the mass difference between these
are at least that of a single .about.300 Da nucleotide unit, low
resolution instrumentation is suitable for such measurements.
[0306] Thermosequence cycle sequencing, as further described in
Example 11, is also useful for detecting a genetic disease.
[0307] In addition to mutated genes, which result in genetic
disease, certain birth defects are the result of chromosomal
abnormalities such as Trisomy 21 (Down's Syndrome), Trisomy 13
(Patau Syndrome), Trisomy 18 (Edward's Syndrome), Monosomy X
(Turner's Syndrome) and other sex chromosome aneuploidies such as
Klienfelter's Syndrome (XXY). Here, "house-keeping" genes encoded
by the chromosome in question are present in different quantity and
the different amount of an amplified fragment compared to the
amount in a normal chromosomal configuration can be determined by
mass spectrometry.
[0308] Further, there is growing evidence that certain DNA
sequences may predispose an individual to any of a number of
diseases such as diabetes, arteriosclerosis, obesity, various
autoimmune diseases and cancer (e.g., colorectal, breast, ovarian,
lung). Also, the detection of "DNA fingerprints", e.g.,
polymorphisms, such as "mini- and micro-satellite sequences", are
useful for determining identity or heredity (e.g., paternity or
maternity).
[0309] The following Examples 4 and 12 provide mass spectrometer
based methods for identifying any of the three different isoforms
of human apolipoprotein E, which are coded by the E2, E3 and E4
alleles. For example, the molecular weights of DNA fragments
obtained after restriction with appropriate restriction
endonucleases can be used to detect the presence of a mutation
and/or a specific allele.
[0310] Depending on the biological sample, the diagnosis for a
genetic disease, chromosomal aneuploidy or genetic predisposition
can be preformed either pre- or post-natally.
[0311] Diagnosis of Cancer
[0312] Preferred mass spectrometer-based methods for providing an
early indication of the existence of a tumor or a cancer are
provide herein. For example, as described in Example 13, the
telomeric repeat amplification protocol (TRAP) in conjunction with
telomerase specific extension of a substrate primer and a
subsequent amplification of the telomerase specific extension
products by an amplification step using a second primer
complementary to the repeat structure was used to obtain extension
ladders, that were easily detected by MALDI-TOF mass spectrometry
as an indication of telomerase activity and therefor
tumorigenesis.
[0313] Alternatively, as described in Example 14, expression of a
tumor or cancer associated gene (eq., human tyrosine 5-hydroxylase)
via RT-PCR and analysis of the amplified products by mass
spectrometry can be used to detect the tumor or cancer (e.g.,
biosynthesis of catecholamine via tyrosine 5-hydroxylase is a
characteristic of neuroblastoma).
[0314] Further, a primer oligo base extension reaction and
detection of products by mass spectrometry provides a rapid means
for detecting the presence of oncogenes, such as the RET proto
oncogene codon 634, which is related to causing multiple endocrine
neoplasia, type II (MEN II), as described in Example 15.
[0315] Diagnosis of Infection
[0316] Viruses, bacteria, fungi and other infectious organisms
contain distinct nucleic acid sequences, which are different from
the sequences contained in the host cell. Detecting or quantitating
nucleic acid sequences that are specific to the infectious organism
is important for diagnosing or monitoring infection. Examples of
disease causing viruses that infect humans and animals and which
may be detected by the disclosed processes include: Retroviridae
(e.g., human immunodeficiency viruses, such as HIV-1 (also referred
to as HTLV-III, LAV or HTLV-III/LAV, see, e.g., Ratner et al.
(1985) Nature 313: 227-284; Wain-Hobson et al. (1985) Cell
40:9-17); HIV-2 (see, Guyader et al. (1987) Nature 328:662-669
European Patent Publication No. 0 269 520; Chakrabarti et al.
(1987) Nature 328:543-547; and European Patent Application No. 0
655 501); and other isolates, such as HIV-LP (International PCT
application No. WO 94/00562 entitled "A Novel Human
Immunodeficiency Virus"; Picornaviridae (e.g., polio viruses,
hepatitis A virus, (see, e.g., Gust et al. (1983) Intervirology
20:1-7); entero viruses, human coxsackie viruses, rhinoviruses,
echoviruses); Calciviridae (e.g., strains that cause
gastroenteritis); Togaviridae (e.g., equine encephalitis viruses,
rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis
viruses, yellow fever viruses); Coronaviridae (e.g.,
coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae
(e.g., parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g., influenza
viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g., reoviruses, orbiviruses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegaovirus (CMV), herpes viruses'); Poxviridae (variola
viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g.,
African swine fever virus); and unclassified viruses (e.g., the
etiological agents of Spongiform encephalopathies, the agent of
delta hepatitis (thought to be a defective satellite of hepatitis B
virus), the agents of non-A, non-B hepatitis (class 1=internally
transmitted; class 2=parenterally transmitted (i.e., Hepatitis C);
Norwalk and related viruses, and astroviruses).
[0317] Examples of infectious bacteria include, but are not limited
to: Helicobacter pyloris, Borelia burgdorferi, Legionella
pneumophilia, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M.
intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus,
Neisseria gonorrhoeae, Neisseria meningitidis, Listeria
monocytogenes, Streptococcus pyogenes (Group A Streptococcus),
Streptococcus agalactiae (Group B Streptococcus), Streptococcus
(viridans group), Streptococcus faecalis, Streptococcus bovis,
Streptococcus (anaerobic sps.), Streptococcus phhenumoniae,
pathogenic Campylobacter sp., Enterococcus sp., Haemophilus
influenzae, Bacillus antracis, corynebacterium diphtheriae,
corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium
perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella
pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium
nucleatum, Streptobacillus moniliformis, Treponema pallidium,
Treponema pertenue, Leptospira, and Actinomyces israelli.
[0318] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
falciparum and Toxoplasma gondii.
[0319] The processes provided herein makes use of the known
sequence information of the target sequence and known mutation
sites. Although new mutations can also be detected. For example, as
shown in FIG. 8, transcription of a nucleic acid molecule obtained
from a biological sample can be specifically digested using one or
more nucleases and the fragments captured on a solid support
carrying the corresponding complementary nucleic acid sequences.
Detection of hybridization and the molecular weights of the
captured target sequences provide information on whether and where
in a gene a mutation is present. Alternatively, DNA can be cleaved
by one or more specific endonucleases to form a mixture of
fragments. Comparison of the molecular weights between wildtype and
mutant fragment mixtures results in mutation detection.
[0320] Sequencing by Generation of Specifically Terminated
Fragements
[0321] In another embodiment, an accurate sequence determination of
a relatively large target nucleic acid, can be obtained by
generating specifically terminated fragments from the target
nucleic acid, determining the mass of each fragment by mass
spectrometry and ordering the fragments to determine the sequence
of the larger target nucleic acid. In a preferred embodiment, the
specifically terminated fragments are partial or complete
base-specifically terminated fragments.
[0322] One method for generating base specifically terminated
fragments involves using a base-specific ribonulclease after e.g.,
a transcription reaction. Preferred base-specific ribonucleases are
selected from among: T.sub.1-ribonuclease (G-specific),
U.sub.2-ribonuclease (A-specific), PhyM-ribonuclease U specific and
ribonuclease A (U/C specific). Other efficient and base-specific
ribonucleases can be identified using the assay described in
Example 21. Preferably modified nucleotides are included in the
transcription reaction with unmodified nucleotides. Most
preferably, the modified nucleotides and unmodified nucleotides are
added to the transcription reaction at appropriate concentrations,
so that both moieties are incorporated at a preferential rate of
about 1:1. Alternatively, two separate transcriptions of the target
DNA sequence one with the modified and one with the unmodified
nucleotides can be performed and the results compared. Preferred
modified nucleotides include: boron or bromine modified nucleotides
(Porter et el. (1995) Biochemistry 34:11963-11969; Hasan et al.
(1996) Nucl. Acids Res. 24 2150-2157; Li et al. (1995) Nucleic
Acids Res. 23:4495-4501.alpha.-thio-m- odified nucleotides, as well
as mass-modified nucleotides as described above.
[0323] Another method for generating base specifically terminated
fragments involves performing a combined amplification and
base-specific termination reaction. For example, a combined
amplification and termination reaction can be performed using at
least two different polymerase enzymes, each having a different
affinity for the chain terminating nucleotide, so that
polymerization by an enzyme with relatively low affinity for the
chain terminating nucleotide leads to exponential amplification
whereas an enzyme with relatively high affinity for the chain
terminating nucleotide terminates the polymerization and yields
sequencing products.
[0324] The combined amplification and sequencing can be based on
any amplification procedure that employs an enzyme with
polynucleotide synthetic ability (e.g., polymerase). One preferred
process, based on the polymerase chain reaction (PCR), includes the
following three thermal steps: 1) denaturing a double stranded (ds)
DNA molecule at an appropriate temperature and for an appropriate
period of time to obtain the two single stranded (ss) DNA molecules
(the template: sense and antisense strand); 2) contacting the
template with at least one primer that hybridizes to at least one
ss DNA template at an appropriate temperature and for an
appropriate period of time to obtain a primer containing ss DNA
template; 3) contacting the primer containing template at an
appropriate temperature and for an appropriate period of time with:
(i) a complete set of chain elongating nucleotides, (ii) at least
one chain terminating nucleotide, (iii) a first DNA polymerase,
which has a relatively low affinity towards the chain terminating
nucleotide; and (iv) a second DNA polymerase, which has a
relatively high affinity towards the chain terminating
nucleotide.
[0325] Steps 1)-3) can be sequentially performed for an appropriate
number of times (cycles) to obtain the desired amount of amplified
sequencing ladders. The quantity of the base specifically
terminated fragment desired dictates how many cycles are performed.
Although an increased number of cycles results in an increased
level of amplification, it may also detract from the sensitivity of
a subsequent detection. It is therefore generally undesirable to
perform more than about 50 cycles, and is more preferable to
perform less than about 40 cycles (e.g., about 20-30 cycles).
[0326] Another preferred process for simultaneously amplifying and
chain terminating a nucleic acid sequence is based on strand
displacement amplification (SDA) (see, e., Walker et al. (1994)
Nucl. Acids Res. 22:2670-77; European Patent Publication Number 0
684 315 entitled "Strand Displacement Amplification Using
Thermophilic Enzymes"). In essence, this process involves the
following three steps, which altogether constitute a cycle: 1)
denaturing a double stranded (ds) DNA molecule containing the
sequence to be amplified at an appropriate temperature and for an
appropriate period of time to obtain the two single stranded (ss)
DNA molecules (the template: sense and antisense strand); 2)
contacting the template with at least one primer (P), that contains
a recognition/cleavage site for a restriction endonuclease (RE) and
that hybridizes to at least one ss DNA template at an appropriate
temperature and for an appropriate period of time to obtain a
primer containing ss DNA template; 3) contacting the primer
containing template at an appropriate temperature and for an
appropriate period of time with (i) a complete set of chain
elongating nucleotides; (ii) at least one chain terminating
nucleotide; (iii) a first DNA polymerase, which has a relatively
low affinity towards the chain terminating nucleotide; (iv) a
second DNA polymerase, which has a relatively high affinity towards
the chain terminating nucleotide; and (v) an RE that nicks the
primer recognition/cleavage site.
[0327] Steps 1)-3) can be sequentially performed for an appropriate
number of times (cycles) to obtain the desired amount of amplified
sequencing ladders. As with the PCR based process, the quantity of
the base specifically terminated fragment desired dictates how many
cycles are performed. Preferably, less than 50 cycles, more
preferably less than about 40 cycles and most preferably about 20
to 30 cycles are performed.
[0328] Preferably about 0.5 to about 3 units of polymerase is used
in the combined amplification and chain termination reaction. Most
preferably about 1 to 2 units is used. Particularly preferred
polymerases for use in conjunction with PCR or other thermal
amplification process are thermostable polymerases, such as Taq DNA
polymerase (Boehringer Mannheim), AmpliTaq FS DNA polymerase
(Perkin-Elmer), Deep Vent (exo-), Vent, Vent (exo-) and Deep Vent
DNA polymerases (New England Biolabs), Thermo Sequenase (Amersham)
or exo(-) Pseudococcus furiosus (Pfu) DNA polymerase (Stratagene,
Heidelberg, Germany). AmpliTaq, Ultman, 9 degree Nm, Tth, Hot Tub,
and Pyrococcus furiosus. In addition, preferably the polymerase
does not have 5'-3' exonuclease activity.
[0329] In addition to polymerases, which have a relatively high and
a relatively low affinity to the chain terminating nucleotide, a
third polymerase, which has proofreading capacity (e.g., Pyrococcus
woesei (Pwo)) DNA polymerase may also be added to the amplification
mixture to enhance the fidelity of amplification.
[0330] Yet another method for generating base specifically
terminated fragments involves contacting an appropriate amount of
the target nucleic acid with a specific endonuclease or
exonuclease. Preferably, the original 5' and/or 3' end of the
nucleic acid is tagged to facilitate the ordering of fragments.
Tagging of the 3' end is particularly preferred when in vitro
nucleic acid transcripts are being analyzed, so that the influence
of 3' heterogeneity, premature termination and nonspecific
elongation can be minimized. 5' and 3' tags can be natural (e.g., a
3' poly A tail or 5' or 3' heterogeneity) or artificial. Preferred
5' and/or 3' tags are selected from among the molecules described
for mass-modification above.
[0331] The methods provided herein are further illustrated by the
following examples, which should not be construed as limiting in
any way.
EXAMPLE 1
[0332] MALDI-TOF Desorption of Oligonucleotides Directly on Solid
Supports
[0333] 1 g CPG (Controlled Pore Glass) was functionalized with
3-(triethoxysilyl)-epoxypropan to form OH-groups on the polymer
surface. A standard oligonucleotide synthesis with 13 mg of the
OH--CPG on a DNA synthesizer (Milligen, Model 7500) employing
.beta.-cyanoethyl-phosphoami- dites (Koster et al. (1994) Nucleic
Acids Res. 12:4539) and TAC N-protecting groups (Koster et al.
(1981) Tetrahedron 37:362) was performed to synthesize a
3'-T.sub.5-50mer oligonucleotide sequence in which 50 nucleotides
are complementary to a "hypothetical" 50mer sequence. T.sub.5
serves as a spacer. Deprotection with saturated ammonia in methanol
at room temperature for 2 hours furnished according to the
determination of the DMT group CPG which contained about 10 umol
55mer/g CPG. This 55mer served as a template for hybridizations
with a 26-mer (with 5'-DMT group) and a 40-mer (without DMT group).
The reaction volume is 100 .mu.l and contains about 1 nmol CPG
bound 55mer as template, an equimolar amount of oligonucleotide in
solution (26-mer or 40-mer) in 20 mM Tris-HCl, pH 7.5, 10 mM
MgCl.sub.2 and 25 mM NaCl. The mixture was heated for 10 min at
65.degree. C. and cooled to 37.degree. C. during 30' (annealing).
The oligonucleotide which has not been hybridized to the
polymer-bound template were removed by centrifugation and three
subsequent washing/centrifugation steps with 100 ul each of
ice-cold 50 mM ammoniumcitrate. The beads were air-dried and mixed
with matrix solution (3-hydroxypicolinic acid/10 mM ammonium
citrate in acetonitrilelwater, 1:1), and analyzed by MALDI-TOF mass
spectrometry. The results are presented in FIGS. 10 and 11.
EXAMPLE 2
[0334] Electrospray (ES) Desorption and Differentiation of an
18-mer and 19-mer
[0335] DNA fragments at a concentration of 50 pmole/ul in
2-propanol/10 mM ammoniumcarbonate (1/9, v/v) were analyzed
simultaneously by an electrospray mass spectrometer.
[0336] The successful desorption and differentiation of an 18-mer
and 19-mer by electrospray mass spectrometry is shown in FIG.
12.
EXAMPLE 3
[0337] Detection of The Cystic Fibrosis Mutation .DELTA.F508, by
Single Step Dideoxy Extension and Analysis by MALDI-TOF Mass
Spectrometry (Competitive Oligonucleotide Simple Base
Extension=COSBE)
[0338] The principle of the COSBE method is shown in FIG. 13, N
being the normal and M the mutation detection primer,
respectively.
[0339] Materials and Methods
[0340] PCR Amplification and Strand Immobilization.
[0341] Amplification was carried out with exon 10 specific primers
using standard PCR conditions (30 cycles: 1'@95.degree. C.,
1'@55.degree. C., 2'@72.degree. C.); the reverse primer was 5'
labelled with biotin and column purified (Oligopurification
Cartridge, Cruachem). After amplification the amplified products
were purified by column separation (Qiagen Quickspin) and
immobilized on streptavidin coated magnetic beads (Dynabeads,
Dynal, Norway) according to their standard protocol; DNA was
denatured using 0.1 M NaOH and washed with 0.1 M NaOH, 1.times.B+W
buffer and TE buffer to remove the non-biotinylated sense
strand.
[0342] COSBE Conditions.
[0343] The beads containing ligated antisense strand were
resuspended in 18 .mu.l of Reaction mix 1 (2 .mu.l 10.times. Taq
buffer, 1 .mu.L (1 unit) Taq Polymerase, 2 .mu.L of 2 mM dGTP, and
13 .mu.L H.sub.2O) and incubated at 80.degree. C. for 5' before the
addition of Reaction mix 2 (100 ng each of COSBE primers). The
temperature was reduced to 60.degree. C. and the mixtures incubated
for a 5' annealing/extension period; the beads were then washed in
25 mM triethylammonium acetate (TEAA) followed by 50 mM ammonium
citrate.
[0344] Primer Sequences.
[0345] All primers were synthesized on a Perseptive Biosystems
Expedite 8900 DNA Synthesizer using conventional phosphoramidite
chemistry (Sinha et al. (1984) Nucleic Acids Res. 12:4539). COSBE
primers (each containing an intentional mismatch one base before
the 3'-terminus) were those used in a previous ARMS study (Ferrie
et al. (1992) Am J Hum Genet 51:251-262) with the exception that
two bases were removed from the 5'-end of the normal:
2 Ex10 PCR (Forward): 5'-BIO-GCA AGT GAA TCC TGA GCG TG-3' (SEQ ID
No. 1) Ex10 PCR (Reverse): 5'-GTG TGA AGG GTT CAT ATG C-3' (SEQ ID
No. 2) COSBE .DELTA.F508-N 5'-ATC TAT ATT CAT CAT AGG AAA CAC CAC
A-3'(28-mer) (SEQ ID No. 3) COSBE .DELTA.F508-N 5'-GTA TCT ATA TTC
ATC ATA GGA AAC ACC ATT-3'(30-mer) (SEQ ID No. 4)
[0346] Mass Spectrometry.
[0347] After washing, beads were resuspended in 1.mu.L 18 Mohm/cm
H.sub.2O. 300 nL each of matrix (Wu et al. (1993) Rapid Commun.
Mass Spectrom. 7:142-146) solution (0.7 M 3-hydroxypicolinic acid,
0.7 M dibasic ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN) and
resuspended beads (Tang et al. (1995) Rapid Commun Mass Spectrom
8:727-730) were mixed on a sample target and allowed to air dry. Up
to 20 samples were spotted on a probe target disk for introduction
into the source region of an unmodified Thermo Bioanalysis
(formerly Finnigan) Visions 2000 MALDI-TOF operated in reflectron
mode with 5 and 20 kV on the target and conversion dynode,
respectively. Theoretical average molecular weights (Mr(calc)) were
calculated from atomic compositions. Vendor provided software was
used to determine peak centroids using external calibration; 1.08
Da has been subtracted from these to correct for the charge
carrying proton mass to yield the text M.sub.r (exp) values.
[0348] Scheme.
[0349] Upon annealing to the bound template, the N and M primers
(8508.6 and 9148.0 Da, respectively) are presented with dGTP; only
primers with proper Watson-Crick base paring at the variable (V)
position are extended by the polymerase. Thus if V pairs with the
3'-terminal base of N, N is extended to a 8837.9 Da product (N +1).
Likewise, if V is properly matched to the M terminus, M is extended
to a 9477.3 Da M+1 product.
[0350] Results
[0351] FIGS. 14-18 show the representative mass spectra of COSBE
reaction products. Better results were obtained when amplified
products were purified before the biotinylated anti-sense strand
was bound.
EXAMPLE 4
[0352] Differentiation of Human Apolipoprotein E Isoforms by Mass
Spectrometry
[0353] Apolipoprotein E (Apo E), a protein component of
lipoproteins, plays an essential role in lipid metabolism. For
example, it is involved with cholesterol transport, metabolism of
lipoprotein particles, immunoregulation and activation of a number
of lipolytic enzymes.
[0354] There are three common isoforms of human Apo E (coded by E2,
E3 and E4 alleles). The most common is the E3 allele. The E2 allele
has been shown to decrease the cholesterol level in plasma and
therefore may have a protective effect against the development of
atherosclerosis. The DNA encoding a portion of the E2 allele is set
forth in SEQ ID No. 130. Finally, the E4 isoform has been
correlated with increased levels of cholesterol, conferring
predisposition to atherosclerosis. Therefore, the identity of the
apo E allele of a particular individual is an important determinant
of risk for the development of cardiovascular disease.
[0355] As shown in FIG. 19, a sample of DNA encoding apolipoprotein
E can be obtained from a subject, amplified (e.g., via PCR); and
the amplified product can be digested using an appropriate enzyme
(e.g., CfoI). The restriction digest obtained can then be analyzed
by a variety of means. As shown in FIG. 20, the three isotypes of
apolipoprotein E (E2, E3 and E4 have different nucleic acid
sequences and therefore also have distinguishable molecular weight
values.
[0356] As shown in FIG. 21A-C, different Apolipoprotein E genotypes
exhibit different restriction patterns in a 3.5% MetPhor Agarose
Gel or 12% polyacrylamide gel. As shown in FIGS. 22 and 23, the
various apolipoprotein E genotypes can also be accurately and
rapidly determined by mass spectrometry.
EXAMPLE 5
[0357] Detection of Hepatitis B Virus in Serum Samples.
[0358] Materials and Methods
[0359] Sample Preparation
[0360] Phenol/choloform extraction of viral DNA and the final
ethanol precipitation was done according to standard protocols.
[0361] First PCR
[0362] Each reaction was performed with 5 .mu.l of the DNA
preparation from serum. 15 pmol of each primer and 2 units Taq DNA
polymerase (Perkin Elmer, Weiterstadt, Germany) were used. The
final concentration of each dNTP was 200 .mu.M, the final volume of
the reaction was 50 .mu.l. 10.times. PCR buffer (Perkin Elmer,
Weiterstadt, Germany) contained 100 mM Tris-HCl, pH 8.3, 500 mM
KCl, 15 mM MgCl.sub.2, 0.01% gelatine (w/v).
[0363] Primer sequences:
3 SEQ ID Primer SEQUENCE No. 1 5'-GCTTTGGGGCATGGACATTGACCCGTATAA-3'
5 +L,t32 2 5'-CTGACTACTAATTCCCTGGATGCTGGGTCT-3' 6
[0364] Nested PCR:
[0365] Each reaction was performed either with 1 .mu.l of the first
reaction or with a 1:10 dilution of the first PCR as template,
respectively. 100 pmol of each primer, 2.5 u Pfu(exo-) DNA
polymerase (Stratagene, Heidelberg, Germany), a final concentration
of 200 .mu.M of each dNTPs and 5 .mu.l 10.times. Pfu buffer (200 mM
Tris-HCl, pH 8.75, 100 mM KCl, 100 mM (NH.sub.4).sub.2SO.sub.4, 1%
Triton X-100, 1 mg/ml BSA, (Stratagene, Heidelberg, Germany) were
used in a final volume 50 .mu.l. The reactions were performed in a
thermocycler (OmniGene, MWG-Biotech, Ebersberg, Germany) using the
following program: 92.degree. C. for 1 minute, 60.degree. C. for 1
minute and 72.degree. C. for 1 minute with 20 cycles. Sequence of
oligodeoxynucleotides (purchased HPLC-purified from MWG-Biotech,
Ebersberg, Germany):
4 HBV13: 5'-TTGCCTGAGTGCAGTATGGT-3' (SEQ ID NO. 7) HBV15bio:
Biotin-5'-AGCTCTATATCGGGAAGCCT-3' (SEQ ID NO. 8)
[0366] Purification of Amplified Products:
[0367] For the recording of each spectrum, one PCR, 50 .mu.l,
(performed as described above) was used. Purification was done
according to the following procedure: Ultrafiltration was done
using Ultrafree-MC filtration units (Millipore, Eschborn, Germany)
according to the protocol of the provider with centrifugation at
8000 rpm for 20 minutes. 25.mu.l (10 .mu.g/.mu.l) streptavidin
Dynabeads (Dynal, Hamburg, Germany) were prepared according to the
instructions of the manufacturer and resuspended in 25 .mu.l of B/W
buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl). This
suspension was added to the PCR samples still in the filtration
unit and the mixture was incubated with gentle shaking for 15
minutes at ambient temperature. The suspension was transferred in a
1.5 ml Eppendorf tube and the supernatant was removed with the aid
of a Magnetic Particle Collector, MPC, (Dynal, Hamburg, Germany).
The beads were washed twice with 50 .mu.l of 0.7 M ammonium citrate
solution, pH 8.0 (the supernatant was removed each time using the
MPC). Cleavage from the beads can be accomplished by using
formamide at 90.degree. C. The supernatant was dried in a speedvac
for about an hour and resuspended in 4 .mu.l of ultrapure water
(MilliQ UF plus Millipore, Eschborn, Germany). This preparation was
used for MALDI-TOF MS analysis.
[0368] MALDI-TOF MS:
[0369] Half a microliter of the sample was pipetted onto the sample
holder, then immediately mixed with 0.5 .mu.l matrix solution (0.7
M3-hydroxypicolinic acid 50% acetonitrile, 70 mM ammonium citrate).
This mixture was dried at ambient temperature and introduced into
the mass spectrometer. All spectra were taken in positive ion mode
using a Finnigan MAT Vision 2000 (Finnigan MAT, Bremen, Germany),
equipped with a reflectron (5 keV ion source, 20 keV
postacceleration) and a 337 nm nitrogen laser. Calibration was done
with a mixture of a 40-mer and a 100-mer. Each sample was measured
with different laser energies. In the negative samples, the
amplified product was detected neither with less nor with higher
laser energies. In the positive samples the amplified product was
detected at different places of the sample spot and also with
varying laser energies.
[0370] Results
[0371] A nested PCR system was used for the detection of HBV DNA in
blood samples employing oligonucleotides complementary to the c
region of the HBV genome (primer 1: beginning at map position 1763,
primer 2 beginning at map position 2032 of the complementary
strand) encoding the HBV core antigen (HBVcAg). DNA was isolated
from patients serum according to standard protocols. A first PCR
was performed with the DNA from these preparations using a first
set of primers. If HBV DNA was present in the sample a DNA fragment
of 269 bp was generated.
[0372] In the second reaction, primers which were complementary to
a region within the PCR fragment generated in the first PCR were
used. If HBV related amplified products were present in the first
PCR a DNA fragment of 67 bp was generated (see FIG. 25A) in this
nested PCR. The usage of a nested PCR system for detection provides
a high sensitivity and also serves as a specificity control for the
external PCR (Rolfs et al. (1992) PCR: Clinical Diagnostics and
Research, Springer, Heidelberg). A further advantage is that the
amount of fragments generated in the second PCR is high enough to
ensure an unproblematic detection although purification losses can
not be avoided.
[0373] The samples were purified using ultrafiltration to
restreptavidin Dynabeads. This purification was done because the
shorter primer fragments were immobilized in higher yield on the
beads due to stearic reasons. The immobilization was done directly
on the ultrafiltration membrane to avoid substance losses due to
unspecific absorption on the membrane. Following immobilization,
the beads were washed with ammonium citrate to perform cation
exchange (Pieles et al. (1993) Nucl. Acids Res. 21:3191-3196). The
immobilized DNA was cleaved from the beads using 25% ammonia which
allows cleavage of DNA from the beads in a very short time, but
does not result in an introduction of sodium or other cations.
[0374] The nested PCRs and the MALDI TOF analysis were performed
without knowing the results of serological analysis. Due to the
unknown virus titer, each sample of the first PCR was used
undiluted as template and in a 1:10 dilution, respectively.
[0375] Sample 1 was collected from a patient with chronic active
HBV infection who was positive in Hbs- and Hbe-antigen tests but
negative in a dot blot analysis. Sample 2 was a serum sample from a
patient with an active HBV infection and a massive viremia who was
HBV positive in a dot blot analysis. Sample 3 was a denatured serum
sample therefore no serological analysis could be performed by an
increased level of transaminases indicating liver disease was
detected. In autoradiograph analysis (FIG. 24), the first PCR of
this sample was negative. Nevertheless, there was some evidence of
HBV infection. This sample is of interest for MALDI-TOF analysis,
because it demonstrates that even low-level amounts of amplified
products can be detected after the purification procedure. Sample 4
was from a patient who was cured of HBV infection. Samples 5 and 6
were collected from patients with a chronic active HBV
infection.
[0376] FIG. 24 shows the results of a PAGE analysis of the nested
PCR reaction. A amplified product is clearly revealed in samples 1,
2, 3, 5 and 6. In sample 4 no amplified product was generated, it
is indeed HBV negative, according to the serological analysis.
Negative and positive controls are indicated by + and -,
respectively. Amplification artifacts are visible in lanes 2, 5, 6
and +if non-diluted template was used. These artifacts were not
generated if the template was used in a 1:10 dilution. In sample 3,
amplified product was merely detectable if the template was not
diluted. The results of PAGE analysis are in agreement with the
data obtained by serological analysis except for sample 3 as
discussed above.
[0377] FIG. 25A shows a mass spectrum of a nested amplified product
from sample number 1 generated and purified as described above. The
signal at 20754 Da represents the single stranded amplified product
(calculated: 20735 Da, as the average mass of both strands of the
amplified product cleaved from the beads). The mass difference of
calculated and obtained mass is 19 Da (0.09%). As shown in FIG.
25A, sample number 1 generated a high amount of amplified product,
resulting in an unambiguous detection.
[0378] FIG. 25B shows a spectrum obtained from sample number 3. As
depicted in FIG. 24, the amount of amplified product generated in
this section is significantly lower than that from sample number 1.
Nevertheless, the amplified product is clearly revealed with a mass
of 20751 Da (calculated 20735). The mass difference is 16 Da
(0.08%). The spectrum depicted in FIG. 25C was obtained from sample
number 4 which is HBV negative (as is also shown in FIG. 24). As
expected no signals corresponding to the amplified product could be
detected. All samples shown in FIG. 25 were analyzed with MALDI-TOF
MS, whereby amplified product was detected in all HBV positive
samples, but not in the HBV negative samples. These results were
reproduced in several independent experiments.
EXAMPLE 6
[0379] Analysis of Ligase Chain Reaction Products via MALDI-TOF
Mass Spectrometry
[0380] Materials and Methods
[0381] Oligodeoxynucleotides
[0382] Except the biotinylated one and all other oligonucleotides
were synthesized in a 0.2 .mu.mol scale on a MilliGen 7500 DNA
Synthesizer (Millipore, Bedford, Mass., USA) using the
.beta.-cyanoethylphosphoamidit- e method (Sinha, N. D. et al.
(1984) Nucleic Acids Res. 12:4539-4577). The oligodeoxynucleotides
were RP-HPLC-purified and deprotected according to standard
protocols. The biotinylated oligodeoxynucleotide was purchased
(HPLC-purified) from Biometra, Gottingen, Germany). Sequences and
calculated masses of the oligonucleotides used:
5 Oligodeoxy- SEQ ID nucleotide SEQUENCE No. A
5'-p-TTGTGCCACGCGGTTGGGAATGTA 9 (7521 Da) B
5'-p-AGCAACGACTGTTTGCCCGCCAGTTG 10 (7948 Da) C
5'-bio-TACATTCCCAACCGCGTGGCACAAC 11 (7960 Da) D
5'-p-AACTGGCGGGCAAACAGTCGTTGCT 12 (7708 Da)
[0383] 5-Phosphorylation of Oligonucleotides A and D
[0384] This was performed with polynucleotide kinase (Boehringer,
Mannheim, Germany) according to published procedures, the
5'-phosphorylated oligonucleotides were used unpurified for
LCR.
[0385] Ligase chain reaction
[0386] The LCR was performed with Pfu DNA ligase and a ligase chain
reaction kit (Stratagene, Heidelberg, Germany) containing two
different pBluescript KII phagemids. One carrying the wildtype form
of the E.coli lacI gene and the other one a mutant of this gene
with a single point mutation at bp 191 of the lacI gene.
[0387] The following LCR conditions were used for each reaction:
100 pg template DNA (0.74 fmol) with 500 pg sonified salmon sperm
DNA as carrier, 25 ng (3.3 pmol) of each 5'-phosphorylated
oligonucleotide, 20 ng (2.5 pmol) of each non-phosphorylated
oligonucleotide, 4 U Pfu DNA ligase in a final volume of 20 .mu.l
buffered ss 50-mer was used (I fmol) as template, in this case
oligo C was also biotinylated. All reactions were performed in a
thermocycler (OmniGene, MWG-Biotech, Ebersberg, Germany) with the
following program: 4 minutes 92.degree. C., 2 minutes 60.degree. C.
and 25 cycles of 20 seconds 92.degree. C., 40 seconds 60.degree. C.
Except for HPLC analysis the biotinylated ligation educt C was
used. In a control experiment the biotinylated and non-biotinylated
oligonucleotides revealed the same gel electrophoretic results. The
reactions were analyzed on 7.5% polyacrylamide gels. Ligation
product 1 (oligo A and B) calculated mass: 15450 Da, ligation
product 2 (oligo C and D) calculated mass: 15387 Da.
[0388] Smart-HPLC
[0389] Ion exchange HPLC (IE HPLC) was performed on the
SMART-system (Pharmacia, Freiburg, Germany) using a Pharmacia Mono
Q, PC 1.6/5 column. Eluents were buffer A (25 mM Tris-HCl, 1 mM
EDTA and 0.3 M NaCl at pH 8.0) and buffer B (same as A, but 1 M
NaCl). Starting with 100% A for 5 minutes at a flow rate of 50
.mu.l/min. a gradient was applied from 0 to 70% B in 30 minutes,
then increased to 100% B in 2 minutes and held at 100% B for 5
minutes. Two pooled LCR volumes (40.mu.l) performed with either
wildtype or mutant template were injected.
[0390] Sample preparation for MALDI-TOF-MS
[0391] Preparation of immobilized DNA: For the recording of each
spectrum two LCRs (performed as described above) were pooled and
diluted 1:1 with 2.times. B/W buffer (10 mM Tris-HCl, pH 7.5, 1 mM
EDTA, 2 M NaCl). To the samples 5 .mu.l streptavidin DynaBeads
(Dynal, Hamburg, Germany) were added, the mixture was allowed to
bind with gentle shaking for 15 minutes at ambient temperature. The
supernatant was removed using a Magnetic Particle Collector, MPC,
(Dynal, Hamburg, Germany) and the beads were washed twice with 50
.mu.l of 0.7 M ammonium citrate solution (pH 8.0) (the supernatant
was removed each time using the MPC). The beads were resuspended in
1 .mu.l of ultrapure water (MilliQ, Millipore, Bedford,
Mabelow).
[0392] Combination of ultrafiltration and streptavidin DynaBeads:
For the recording of spectrum two LCRs (performed as described
above) were pooled, diluted 1:1 with 2.times. B/W buffer and
concentrated with a 5000 NMWL Ultrafree-MC filter unit (Millipore,
Eschborn, Germany) according to the instructions of the
manufacturer. After concentration the samples were washed with 300
.mu.l 1.times. B/W buffer to streptavidin DynaBeads were added. The
beads were washed once on the Ultrafree-MC filtration unit with 300
pl of 1.times. B/W buffer and processed as described above. The
beads were resuspended in 30 to 50 .mu.l of 1.times. B/W buffer and
transferred in a 1.5 ml Eppendorf tube. The supernatant was removed
and the beads were washed twice with 50 .mu.l of 0.7 M ammonium
citrate (pH 8.0). Finally, the beads were washed once with 30 .mu.l
of acetone and resuspended in 1 .mu.l of ultrapure water. The
ligation mixture after immobilization on the beads was used for
MALDS-TOF-MS analysis as described below.
[0393] MALDI-TOF-MS
[0394] A suspension of streptavidin-coated magnetic beads with the
immobilized DNA was pipetted onto the sample holder, then
immediately mixed with 0.5 .mu.l matrix solution (0.7 M
3-hydroxypicolinic acid in 50% acetonitrile, 70 mM ammonium
citrate). This mixture was dried at ambient temperature and
introduced into the mass spectrometer. All spectra were taken in
positive ion mode using a Finnigan MAT Vision 2000 (Finnigan MAT,
Bremen, Germany), equipped with a reflectron (5 keV ion source, 20
keV postacceleration) and a nitrogen laser (337 nm). For the
analysis of Pfu DNA ligase 0.5 .mu.l of the solution was mixed on
the sample holder with 1 .mu.l of matrix solution and prepared as
described above. For the analysis of unpurified LCRs 1 .mu.l of an
LCR was mixed with 1 .mu.l matrix solution.
[0395] Results
[0396] The E. coli lacI gene served as a simple model system to
investigate the suitability of MALDI-TOF-MS as detection method for
products generated in ligase chain reactions. This template system
contains of an E. coli lacI wildtype gene in a pBluescript KII
phagemid and an E. coli lacI gene carrying a single point mutation
at bp 191 (C to T transition; SEQ ID No. 131) in the same phagemid.
Four different oligonucleotides were used, which were ligated only
if the E coli lacI wildtype gene was present (FIG. 26).
[0397] LCR conditions were optimized using Pfu DNA ligase to obtain
at least 1 pmol ligation product in each positive reaction. The
ligation reactions were analyzed by polyacrylamide gel
electrophoresis (PAGE) and HPLC on the SMART system (FIGS. 27, 28
and 29). FIG. 27 shows a PAGE of a positive LCR with wildtype
template (lane 1), a negative LCR with mutant template (1 and 2)
and a negative control which contains enzyme, oligonucleotides and
no template but salmon sperm DNA. The gel electrophoresis clearly
shows that the ligation product (50 bp) was produced only in the
reaction with wildtype template; whereas neither the template
carrying the point mutation nor the control reaction with salmon
sperm DNA generated amplification products. In FIG. 28, HPLC was
used to analyze two pooled LCRs with wildtype template performed
under the same conditions. The ligation product was clearly
revealed. FIG. 29 shows the results of a HPLC in which two pooled
negative LCRs with mutant template were analyzed. These
chromatograms confirm the data shown in FIG. 27 and the results
taken together clearly demonstrate, that the system generates
ligation products in a significant amount only if the wildtype
template is provided.
[0398] Appropriate control runs were performed to determine
retention times of the different compounds involved in the L CR
experiments. These include the four oligonucleotides (A, B, C, and
D), a synthetic ds 50-mer (with the same sequence as the ligation
product), the wildtype template DNA, sonicated salmon sperm DNA and
the Pfu DNA ligase in ligation buffer.
[0399] In order to test which purification procedure should be used
before a LCR reaction can be analyzed by MALDI-TOF-MS, aliquots of
an unpurified LCR (FIG. 30A) and aliquots of the enzyme stock
solution (FIG. 30B) were analyzed with MALDI-TOF-MS. It turned out
that appropriate sample preparation is absolutely necessary since
all signals in the unpurified LCR correspond to signals obtained in
the MALDI-TOF-MS analysis of the Pfu DNA ligase. The calculated
mass values of oligo A and the ligation product are 7521 Da and
15450 Da, respectively. The data in FIG. 30 show that the enzyme
solution leads to mass signals which do interfere with the expected
signals of the ligation educts and products and therefore makes an
unambiguous signal assignment impossible. Furthermore, the spectra
showed signals of the detergent Tween20 being part of the enzyme
storage buffer which influences the crystallization behavior of the
analyte/matrix mixture in an unfavorable way.
[0400] In one purification format streptavidin-coated magnetic
beads were used. As was shown in a recent paper, the direct
desorption of DNA immobilized by Watson-Crick base pairing to a
complementary DNA fragment covalently bound to the beads is
possible and the non-biotinylated strand will be desorbed
exclusively (Tang et al. (1995) Nucleic Acids Res. 23:3126-3131).
This approach in using immobilized ds DNA ensures that only the
non-biotinylated strand will be desorbed. If non-immobilized ds DNA
is analyzed both strands are desorbed (Tang et al. (1994) Rapid
Comm. Mass Spectrom. 7 183-186) leading to broad signals depending
on the mass difference of the two single strands. Therefore,
employing this system for LCR only the non-ligated oligonucleotide
A, with a calculated mass of 7521 Da, and the ligation product from
oligo A and oligo B (calculated mass: 15450 Da) will be desorbed if
oligo C is biotinylated at the 5'-end and immobilized on
steptavidin-coated beads. This results in a simple and unambiguous
identification of the LCR educts and products.
[0401] FIG. 31A shows a MALDI-TOF mass spectrum obtained from two
pooled LCRs (performed as described above) purified on streptavidin
DynaBeads and desorbed directly from the beads showed that the
purification method used was efficient (compared with FIG. 30). A
signal which represents the unligated oligo A and a signal which
corresponds to the ligation product could be detected. The
agreement between the calculated and the experimentally found mass
values is remarkable and allows an unambiguous peak assignment and
accurate detection of the ligation product. In contrast, no
ligation product but only oligo A could be detected in the spectrum
obtained from two pooled LCRs with mutated template (FIG. 31B). The
specificity and selectivity of the LCR conditions and the
sensitivity of the MALDI-TOF detection is further demonstrated when
performing the ligation reaction in the absence of a specific
template. FIG. 32 shows a spectrum obtained from two pooled LCRs in
which only salmon sperm DNA was used as a negative control, only
oligo A could be detected, as expected.
[0402] While the results shown in FIG. 31A can be correlated to
lane 1 of the gel in FIG. 27, the spectrum shown in FIG. 31B is
equivalent to lane 2 in FIG. 27, and finally also the spectrum in
FIG. 32 corresponds to lane 3 in FIG. 27. The results are in
congruence with the HPLC analysis presented in FIGS. 28 and 29.
While gel electrophoresis (FIG. 27) and HPLC (FIGS. 28 and 29)
reveal either an excess or almost equal amounts of ligation product
over ligation educts, the analysis by MALDI-TOF mass spectrometry
produces a smaller signal for the ligation product (FIG. 31A).
[0403] The lower intensity of the ligation product signal could be
due to different desorption/ionization efficiencies between 24- and
a 50-mer. Since the T.sub.m value of a duplex with 50 compared to
24 base pairs is significantly higher, more 24-mer could be
desorbed. A reduction in signal intensity can also result from a
higher degree of fragmentation in case of the longer
oligonucleotides.
[0404] Regardless of the purification with streptavidin DynaBeads,
FIG. 32 reveals traces of Tween20 in the region around 2000 Da.
Substances with a viscous consistence, negatively influence the
process of crystallization and therefore can be detrimental to mass
spectrometer analysis. Tween20 and also glycerol which are part of
enzyme storage buffers therefore should be removed entirely prior
to mass spectrometer analysis. For this reason an improved
purification procedure which includes an additional ultrafiltration
step prior to treatment with DynaBeads was investigated. Indeed,
this sample purification resulted in a significant improvement of
MALDI-TOF mass spectrometric performance.
[0405] FIG. 33 shows spectra obtained from two pooled positive
(FIG. 33A) and negative (FIG. 33B) LCRs, respectively. The positive
reaction was performed with a chemically synthesized, single strand
50mer as template with a sequence equivalent to the ligation
product of oligo C and D. Oligo C was 5'-biotinylated. Therefore
the template was not detected. As expected, only the ligation
product of Oligo A and B (calculated mass 15450 Da) could be
desorbed from the immobilized and ligated oligo C and D. This newly
generated DNA fragment is represented by the mass signal of 15448
Da in FIG. 33A. Compared to FIG. 32A, this spectrum clearly shows
that this method of sample preparation produces signals with
improved resolution and intensity.
EXAMPLE 7
[0406] Mutation Detection by Solid Phase Oligo Base Extension of a
Primer and Analysis by MALDI-TOF Mass Spectrometry (Primer Oligo
Base Extension=Probe)
[0407] Summary
[0408] The solid-phase oligo base extension method detects point
mutations and small deletions as well as small insertions in
amplified DNA. The method is based on the extension of a detection
primer that anneals adjacent to a variable nucleotide position on
an affinity-captured amplified template, using a DNA polymerase, a
mixture of three dNTPs, and the missing one dideoxy nucleotide. The
resulting products are evaluated and resolved by MALDI-TOF mass
spectrometry without further labeling procedures. The aim of the
following experiment was to determine mutant and wildtype alleles
in a fast and reliable manner.
[0409] Description of the Experiment
[0410] The method used a single detection primer followed by a
oligonucleotide extension step to give products differing in length
by some bases specific for mutant or wildtype alleles which can be
easily resolved by MALDI-TOF mass spectrometry. The method is
described by using as example the exon 10 of the CFTR-gene. Exon 10
of this gene bears the most common mutation in many ethnic groups
(.DELTA.F508) that leads in the homozygous state to the clinical
phenotype of cystic fibrosis.
[0411] Materials and Methods
[0412] Genomic DNA
[0413] Genomic DNA were obtained from healthy individuals,
individuals homozygous or heterozygous for the .DELTA.F508
mutation, and one individual heterozygous for the 1506S mutation.
The wildtype and mutant alleles were confirmed by standard Sanger
sequencing.
[0414] PCR Amplification of Exon 10 of the CFTR Gene
[0415] The primers for PCR amplification were CFEx10-F
(5-GCAAGTGAATCCTGAGCGTG-3' (SEQ ID No. 13) located in intron 9 and
biotinylated) and CFEx10-R (5'-GTGTGAAGGGCGTG-3' SEQ ID No. 14)
located in intron 10). Primers were used in a concentration of 8
pmol. Taq-polymerase including 10.times. buffer were purchased from
Boehringer-Mannheim and dTNPs were obtained from Pharmacia. The
total reaction volume was 50 .mu.l. Cycling conditions for PCR were
initially 5 min. at 95.degree. C., followed by 1 min. at 94.degree.
C., 45 sec at 53.degree. C., and 30 sec at 72.degree. C. for 40
cycles with a final extension time of 5 min at 72.degree. C.
[0416] Purification of the Amplified Products
[0417] Amplification products were purified by using Qiagen's PCR
purification kit (No. 28106) according to manufacturer's
instructions. The elution of the purified products from the column
was done in 50 .mu.l TE-buffer (10 mM Tris, 1 mM EDTA, pH 7,5).
[0418] Affinity-Capture and Denaturation of the Double Stranded
DNA
[0419] 10 .mu.L aliquots of the purified amplified product were
transferred to one well of a streptavidin-coated microtiter plate
(No. 1645684 Boehringer-Mannheim or No. 95029262 Labsystems).
Subsequently, 10 .mu.l incubation buffer (80 mM sodium phosphate,
400 mM NaCl, 0,4% Tween20, pH 7,5) and 30 .mu.l water were added.
After incubation for 1 hour at room temperature the wells were
washed three times with 200 .mu.l washing buffer (40 mM Tris, 1 mM
EDTA, 50 mM NaCl, 0.1% Tween 20, pH 8.8). To denature the double
stranded DNA the wells were treated with 100 .mu.l of a 50 mM NaOH
solution for 3 min and the wells washed three times with 200 .mu.l
washing buffer.
[0420] Oligo Base Extension Reaction
[0421] The annealing of 25 pmol detection primer (CF508:
5'-CTATATTCATCATAGGAAACACCA-3' (SEQ ID No. 15) was performed in 50
.mu.l annealing buffer (20 mM Tris, 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 2 mM MgSO2, 1% Triton X-100, pH 8) at
50.degree. C. for 10 min. The wells were washed three times with
200 .mu.l washing buffer and once in 200 .mu.l TE buffer. The
extension reaction was performed by using some components of the
DNA sequencing kit from USB (No. 70770) and dNTPs or ddNTPs from
Pharmacia. The total reaction volume was 45 .mu.l, containing of 21
.mu.l water, 6 .mu.l Sequenase-buffer, 3 .mu.l 10 mM DTT solution,
4,5 .mu.l, 0,5 mM of three dNTPs, 4,5 .mu.l, 2 mM the missing one
ddNTP, 5,5 .mu.l glycerol enzyme dilution buffer, 0,25 .mu.l
Sequenase 2.0, and 0,25 pyrophosphatase. The reaction was pipetted
on ice and then incubated for 15 min at room temperature and for 5
min at 37.degree. C. Hence, the wells were washed three times with
200 .mu.l washing buffer and once with 60 .mu.l of a 70 mM
NH.sub.4-Citrate solution.
[0422] Denaturation and Precipitation of the Extended Primer
[0423] The extended primer was denatured in 50 .mu.l 10%-DMSO
(dimethylsufoxide) in water at 80.degree. C. for 10 min. For
precipitation, 10 .mu.l NH.sub.4-Acetate (pH 6.5), 0,5 .mu.l
glycogen (10 mg/ml water, Sigma No. G1765), and 100 .mu.l absolute
ethanol were added to the supernatant and incubated for 1 hour at
room temperature. After centrifugation at 13.000 g for 10 min the
pellet was washed in 70% ethanol and resuspended in 1 .mu.l 18
Mohm/cm H.sub.2O water.
[0424] Sample Preparation and Analysis on MALDI-TOF Mass
Spectrometry
[0425] Sample preparation was performed by mixing 0,3, .mu.l of
each of matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M
dibasic ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN) and of
resuspended DNA/glycogen pellet on a sample target and allowed to
air dry. Up to 20 samples were spotted on a probe target disk for
introduction into the source region of an unmodified Thermo
Bioanalysis (formerly Finnigan) Visions 2000 MALDI-TOF operated in
reflectron mode with 5 and 20 kV on the target and conversion
dynode, respectively. Theoretical average molecular mass
(M.sub.r(calc)) were calculated from atomic compositions; reported
experimental M.sub.r(M.sub.r(exp)) values are those of the
singly-protonated form, determined using external calibration.
[0426] Results
[0427] The aim of the experiment was to develop a fast and reliable
method independent of exact stringencies for mutation detection
that leads to high quality and high throughput in the diagnosis of
genetic diseases. Therefore a special kind of DNA sequencing (oligo
base extension of one mutation detection primer) was combined with
the evaluation of the resulting mini-sequencing products by
matrix-assisted laser desorption ionization (MALDI) mass
spectrometry (MS). The time-of-flight (TOF) reflectron arrangement
was chosen as a possible mass measurement system. To prove this
hypothesis, the examination was performed with exon 10 of the
CFTR-gene, in which some mutations could lead to the clinical
phenotype of cystic fibrosis, the most common monogenetic disease
in the Caucasian population.
[0428] The schematic presentation as given in FIG. 34 shows the
expected short sequencing products with the theoretically
calculated molecular mass of the wildtype and various mutations of
exon 10 of the CFTR-gene (SEQ ID No. 132). The short sequencing
products were produced using either ddTTP (FIG. 34A; SEQ ID Nos.
133-135) or ddCTP (FIG. 34B; SEQ ID Nos. 136-139) to introduce a
definitive sequence related stop in the nascent DNA strand. The
MALDI-TOF-MS spectra of healthy, mutation heterozygous, and
mutation homozygous individuals are presented in FIG. 35. All
samples were confirmed by standard Sanger sequencing which showed
no discrepancy in comparison to the mass spec analysis. The
accuracy of the experimental measurements of the various molecular
masses was within a range of minus 21.8 and plus 87.1 dalton (Da)
to the range expected. This allows a definitive interpretation of
the results in each case. A further advantage of this procedure is
the unambiguous detection of the .DELTA.1507 mutation. In the ddTTP
reaction, the wildtype allele would be detected, whereas in the
ddCTP reaction the three base pair deletion would be disclosed.
[0429] The method described is highly suitable for the detection of
single point mutations or microlesions of DNA. Careful choice of
the mutation detection primers will open the window of multiplexing
and lead to a high throughput including high quality in genetic
diagnosis without any need for exact stringencies necessary in
comparable allele-specific procedures. Because of the uniqueness of
the genetic information, the oligo base extension of mutation
detection primer is applicable in each disease gene or polymorphic
region in the genome like variable number of tandem repeats (VNTR)
or other single nucleotide polymorphisms (e.g., apolipoprotein E
gene), as also described here.
EXAMPLE 8
[0430] Detection of Polymerase Chain Reaction Products Containing
7-Deazapurine Moieties with Matrix-Assisted Laser
Desorption/Ionization Time-of-Flight (MALDI-TOF) Mass
Spectrometry
[0431] Materials and Methods
[0432] Nucleic Acid Amplifications
[0433] The following oligodeoxynucleotide primers were either
synthesized according to standard phosphoamidite chemistry (Sinha,
N. D,. et al., (1983) Tetrahedron Let. Vol. 24, Pp. 5843-5846;
Sinha, N. D., et al., (1984) Nucleic Acids Res., Vol. 12, Pp.
4539-4557) on a MilliGen 7500 DNA synthesizer (Millipore, Bedford,
Mass., USA) in 200 nmol scales or purchased from MWG-Biotech
(Ebersberg, Germany, primer 3) and Biometra (Goettingen, Germany,
primers 6-7).
6 (SEQ ID NO. 16) primer 1: 5'-GTCACCCTCGACCTGCAG; (SEQ ID NO. 17)
primer 2: 5'-TTGTAAAACGACGGCCAGT; (SEQ ID NO. 18) primer 3:
5'-CTTCCACCGCGATGTTGA; (SEQ ID NO. 19) primer 4:
5'-CAGGAAACAGCTATGAC; (SEQ ID NO. 20) primer 5:
5'-GTAAAACGACGGCCAGT; (SEQ ID NO. 21) primer 6:
5'-GTCACCCTCGACCTGCAgC (g: RiboG); (SEQ ID NO. 22) primer 7:
5'-GTTGTAAAACGAGGGCCAgT (g: RiboG);
[0434] The 99-mer (SEQ ID No. 141) and 200-mer DNA strands (SEQ ID
No. 140; modified and unmodified) as well as the ribo- and
7-deaza-modified 100-mer were amplified from pRFc1 DNA (10 ng,
generously supplied by S. Feyerabend, University of Hamburg) in 100
,L reaction volume containing 10 mmol/L KCl, 10 mmol/L
(NH.sub.4).sub.2SO.sub.4, 20 mmol/L Tris HCl (pH 8.8), 2 mmol/L
MgSO.sub.41 (exo(-) Pseudococcus furiosus (Pfu)-Buffer, Pharmacia,
Freiburg, Germany), 0.2 mmol/L each dNTP (Pharmacia, Freiburg,
Germany), 1 .mu.mol/L of each primer and 1 unit of exo(-)Pfu DNA
polymerase (Stratagene, Heidelberg, Germany). For the 99-mer
primers 1 and 2, for the 200-mer primers 1 and 3 and for the
100-mer primers 6 and 7 were used. To obtain 7-deazapurine modified
nucleic acids, during PCR-amplification dATP and dGTP were replaced
with 7-deaza-dATP and 7-deaza-dGTP. The reaction was performed in a
thermal cycler (OmniGene, MWG-Biotech, Ebersberg, Germany) using
the cycle: denaturation at 95.degree. C. for 1 min., annealing at
51.degree. C. for 1 min. and extension at 72.degree. C. for 1 min.
For all PCRs the number of reaction cycles was 30. The reaction was
allowed to extend for additional 10 min. at 72.degree. C. after the
last cycle.
[0435] The 103-mer DNA strands (modified and unmodified; SEQ ID No.
245) were amplified from Ml3mp18 RFI DNA (100 ng, Pharmacia,
Freiburg, Germany) in 100 .mu.L reaction volume. using primers 4
and 5 all other concentrations were unchanged. The reaction was
performed using the cycle: denaturation at 95.degree. C. for 1
min., annealing at 40.degree. C. for 1 min. and extension at
72.degree. C. for 1 min. After 30 cycles for the unmodified and 40
cycles for the modified 103-mer respectively, the samples were
incubated for additional 10 min. at 72.degree. C.
[0436] Synthesis of 5'-[.sup.32-P]-labeled PCR-Primers
[0437] Primers 1 and 4 were 5'-[.sup.32-P]-labeled employing
T4-polynucleotidkinase (Epicentre Technologies) and
(.gamma.-.sup.32P)-ATP. (BLU/NGG/502A, Dupont, Germany) according
to the protocols of the manufacturer. The reactions were performed
substituting 10% of primer 1 and 4 in PCR with the labeled primers
under otherwise unchanged reaction-conditions. The amplified DNAs
were separated by gel electrophoresis on a 10% polyacrylamide gel.
The appropriate bands were excised and counted on a Packard
TRI-CARB 460C. liquid scintillation system (Packard, Conn.,
USA).
[0438] Primer-Cleavage from Ribo-Modified PCR-Product
[0439] The amplified DNA was purified using Ultrafree-MC filter
units (30,000 NMWL), it was then redissolved in 100 .mu.l of 0.2
mol/L NaOH and heated at 95.degree. C. for 25 minutes. The solution
was then acidified with HC1 (1 mol/L) and further purified for
MALDI-TOF analysis employing Ultrafree-MC filter units (10,000
NMWL) as described below.
[0440] Purification of Amplified Products
[0441] All samples were purified and concentrated using
Ultrafree-MC units 30000 NMWL (Millipore, Eschborn, Germany)
according to the manufacturer's description. After lyophilization,
amplified products were redissolved in 5 .mu.L (3 .mu.L for the
200-mer) of ultrapure water. This analyte solution was directly
used for MALDI-TOF measurements.
[0442] MALDI-TOF MS
[0443] Aliquots of 0.5 .mu.L of analyte solution and 0.5 .mu.L of
matrix solution (0.7 mol/L 3-HPA and 0.07 mol/L ammonium citrate in
acetonitrile/water (1:1, v/v)) were mixed on a flat metallic sample
support. After drying at ambient temperature the sample was
introduced into the mass spectrometer for analysis. The MALDI-TOF
mass spectrometer used was a Finnigan MAT Vision 2000 (Finnigan
MAT, Bremen, Germany). Spectra were recorded in the positive ion
reflector mode with a 5 keV ion source and 20 keV postacceleration.
The instrument was equipped with a nitrogen laser (337 nm
wavelength). The vacuum of the system was 3-4.multidot.10.sup.-8
hPa in the analyzer region and 1-4.multidot.10.sup.-7hPa in the
source region. Spectra of modified and unmodified DNA samples were
obtained with the same relative laser power; external calibration
was performed with a mixture of synthetic oligodeoxynucleotides
(7-to 50-mer).
[0444] Results and Discussion
[0445] Enzymatic Synthesis of 7-Deazapurine Nucleotide Containing
Nucleic Acids by PCR
[0446] In order to demonstrate the feasibility of MALDI-TOF MS for
the rapid, gel-free analysis of short amplified products and to
investigate the effect of 7-deazapurine modification of nucleic
acids under MALDI-TOF conditions, two different primer-template
systems were used to synthesize DNA fragments. Sequences are
displayed in FIGS. 36 and 37. While the two single strands of the
103-mer amplified product had nearly equal masses (.DELTA.m=8 u),
the two single strands of the 99-mer differed by 526 u. Considering
that 7-deaza purine nucleotide building blocks for chemical DNA
synthesis are approximately 160 times more expensive than regular
ones (Product Information, Glen Research Corporation, Sterling,
Va.) and their application in standard, .beta.-cyano-phosphoamidite
chemistry is not trivial (Product Information, Glen Research
Corporation, Sterling, Va.; Schneider et al. (1995) Nucl. Acids
Res. 23:1570) the cost of 7-deaza purine modified primers would be
very high. Therefore, to increase the applicability and scope of
the method, all PCRs were performed using unmodified
oligonucleotide primers which are routinely available. Substituting
dATP and dGTP by c.sup.7-dATP and c.sup.7-dGTP in polymerase chain
reaction led to products containing approximately 80%
7-deaza-purine modified nucleosides for the 99-mer and 103-mer; and
about 90% for the 200-mer, respectively. Table II shows the base
composition of all PCR products.
7TABLE II Base composition of the 99-mer, 103-mer and 200-mer PCR
amplification products (unmodified and 7-deaza purine modified)
rel. DNA-fragments.sup.1 C T A G c.sup.7-deaza-A c.sup.7-deaza-6
mod.2 200-mers 54 34 56 56 -- -- -- modified 200-mer s 54 34 6 5 50
51 90% 200-mer a 56 56 34 54 -- -- -- modified 200-mer a 56 56 3 4
31 50 92% 103-mer s 28 23 24 28 -- -- -- modified 103-mer s 28 23 6
5 18 23 79% 103-mer a 28 24 23 28 -- -- -- modified 103-mer a 28 24
7 4 16 24 78% 99-mer s 34 21 24 20 -- -- -- modified 99-mer s 34 21
6 5 18 15 75% 99-mer a 20 24 21 34 -- -- -- modified 99-mer a 20 24
3 4 18 30 87% .sup.1"s" and "a" describe "sense" and "antisense"
strands of the double-stranded amplified product. .sup.2indicates
relative modification as percentage of 7-deaza purine modified
nucleotides of total amount of purine nucleotides.
[0447] It remained to be determined whether 80-90% 7-deaza-purine
modification is sufficient for accurate mass spectrometer
detection. It was therefore important to determine whether all
purine nucleotides could be substituted during the enzymatic
amplification step. This was not trivial since it had been shown
that c.sup.7-dATP cannot fully replace dATP in PCR if Taq DNA
polymerase is employed (Seela, F. and A. Roelling (1992) Nucleic
Acids Res., 20,55-61). Fortunately it was found that exo(-)Pfu DNA
polymerase indeed could accept c.sup.7-dATP and c.sup.7-dGTP in the
absence of unmodified purine nucleoside triphosphates. The
incorporation was less efficient leading to a lower yield of
amplified product (FIG. 38).
[0448] To verify these results, the amplications with
[.sup.32P]-labeled primers were repeated. The autoradiogram (FIG.
39) clearly shows lower yields for the modified PCR-products. The
bands were excised from the gel and counted. For all amplified
products the yield of the modified nucleic acids was about 50%,
referring to the corresponding unmodified amplification product.
Further experiments showed that exo(-)DeepVent and Vent DNA
polymerase were able to incorporate c.sup.7-dATP and c.sup.7-dGTP
during PCR as well. The overall performance, however, turned out to
be best for the exo(-)Pfu DNA polymerase giving least side products
during amplification. Using all three polymerases, it was found
that such PCRs employing c.sup.7-dATP and c.sup.7-dGTP instead of
their isosteres showed less side-reactions giving a cleaner
PCR-product. Decreased occurrence of amplification side products
may be explained by a reduction of primer mismatches due to a ling
template which is synthesized during PCR. Decreased melting point
for DNA duplexes containing 7-deaza-purine have been described
(Mizusawa, S. et al., (I 986) Nucleic Acids Res., 14, 1319-1324).
In addition to the three polymerases specified above (exo(-) Deep
Vent DNA polymerase, 5Vent DNA polymerase and exo(-) (Pfu) DNA
polymerase), it is anticipated that other polymerases, such as the
Large Klenow fragment of E.coli DNA polymerase, Sequenase, Taq DNA
polymerase and U AmpliTaq DNA polymerase can be used. In addition,
where RNA is the template, RNA polymerases, such as the SP6 or the
T7 RNA polymerase, must be used.
[0449] MALDI-TOF Mass Spectrometry of Modified and Unmodified
Amplified Products.
[0450] The 99-mer, 103-mer and 200-mer amplified products were
analyzed by MALDI-TOF MS. Based on past experience, it was known
that the degree of depurination depends on the laser energy used
for desorption and ionization of the analyte. Since the influence
of 7-deazapurine modification on fragmentation due to depurination
was to be investigated, all spectra were measured at the same
relative laser energy.
[0451] FIGS. 40a and 40b show the mass spectra of the modified and
unmodified 103-mer nucleic acids. In case of the modified 103-mer,
fragmentation causes a broad (M+H).sup.+ signal. The maximum of the
peak is shifted to lower masses so that the assigned mass
represents a mean value of (M+H).sup.+ signal and signals of
fragmented ions, rather than the (M+H).sup.+ signal itself.
Although the modified 103-mer still contains about 20% A and G from
the oligonucleotide primers, it shows less fragmentation which is
featured by much more narrow and symmetric signals. Especially peak
tailing on the lower mass side due to depurination, is
substantially reduced. Hence, the difference between measured and
calculated mass is strongly reduced although it is still below the
expected mass. For the unmodified sample a (M+H).sup.+ signal of
31670 was observed, which is a 97 u or 0.3% difference to the
calculated mass. While, in case of the modified sample this mass
difference diminished to 10 u or 0.03% (31713 u found, 31723 u
calculated). These observations are verified by a significant
increase in mass resolution of the (M+H).sup.+ signal of the two
signal strands (n/.DELTA.m=67 as opposed to 18 for the unmodified
sample with .DELTA.m=full width at half maximum, fwhm). Because of
the low mass difference between the two single strands (8 u) their
individual signals were not resolved.
[0452] With the results of the 99 base pair DNA fragments the
effects of increased mass resolution for 7-deazapurine containing
DNA becomes even more evident. The two single strands in the
unmodified sample were not resolved even though the mass difference
between the two strands of the amplified product was very high with
526 u due to unequal distribution of purines and pyrimidines (FIG.
41a). In contrast to this, the modified DNA showed distinct peaks
for the two single strands (FIG. 41b) which demonstrates the
superiority of this approach for the determination of molecular
weights to gel electrophoretic methods even more profound. Although
base line resolution was not obtained the individual masses were
able to be assigned with an accuracy of 0.1%: .DELTA.m=27 u for the
lighter (calc. mass=30224 u) and Am=14 u for the heavier strand
(calc. mass=30750 u). Again, it was found that the full width at
half maximum was substantially decreased for the 7-deazapurine
containing sample.
[0453] In case the 99-mer and 103-mer, the 7-deazapurine containing
nucleic acids seem to give higher sensitivity despite the fact that
they still contain about 20% unmodified purine nucleotides. To get
comparable signal-to-noise ratio at similar intensities for the (M
+H).sup.+ signals, the unmodified 99-mer required 20 laser shots in
contrast to 12 for the modified one and the 103-mer required 12
shots for the unmodified sample as opposed to three for the
7-deazapurine nucleoside-containing amplified product.
[0454] Comparing the spectra of the modified and unmodified 200-mer
amplicons, improved mass resolution was again found for the
7-deazapurine containing sample as well as increased signal
intensities (FIGS. 42A and 42B). While the signal of the single
strands predominates in the spectrum of the modified sample the
DNA-duplex and dimers of the single strands gave the strongest
signal for the unmodified sample.
[0455] A complete 7-deaza purine modification of nucleic acids may
be achieved either using modified primers in PCR or cleaving the
unmodified primers from the partially modified amplified product.
Since disadvantages are associated with modified primers, as
described above, a 100-mer was synthesized using primers with a
ribo-modification. The primers were cleaved hydrolytically with
NaOH according to a method developed earlier in our laboratory
(Koester, H. et al., Z Physiol. Chem., 359, 1570-1589). FIGS. 43A
and 43B display the spectra of the amplified product before and
after primer cleavage. FIG. 43b shows that the hydrolysis was
successful: The hydrolyzed amplified product as well as the two
released primers could be detected together with a small signal
from residual uncleaved 100-mer. This procedure is especially
useful for the MALDI-TOF analysis of very short PCR-products since
the share of unmodified purines originating from the primer
increases with decreasing length of the amplified sequence.
[0456] The remarkable properties of 7-deazapurine modified nucleic
acids can be explained by either more effective desorption and/or
ionization, increased ion stability and/or a lower denaturation
energy of the double stranded purine modified nucleic acid. The
exchange of the N-7 for a methyl group results in the loss of one
acceptor for a hydrogen bond which influences the ability of the
nucleic acid to form secondary structures due to non-Watson-Crick
base pairing (Seela, F. and A. Kehne (1987) Biochemistry, 26,
2232-2238.). In addition to this the aromatic system of
7-deazapurine has a lower electron density that weakens
Watson-Crick base pairing resulting in a decreased melting point
(Mizusawa, S. et al., (1986) Nucleic Acids Res., 14, 1319-1324) of
the double-strand. This effect may decrease the energy needed for
denaturation of the duplex in the MALDI process. These aspects as
well as the loss of a site which probably will carry a positive
charge on the N-7 nitrogen renders the 7-deazapurine modified
nucleic acid less polar and may promote the effectiveness of
desorption.
[0457] Because of the absence of N-7 as proton acceptor and the
decreased polarization of the C--N bond in 7-deazapurine
nucleosides depurination following the mechanisms established for
hydrolysis in solution is prevented. Although a direct correlation
of reactions in solution and in the gas phase is problematic, less
fragmentation due to depurination of the modified nucleic acids can
be expected in the MALDI process. Depurination may either be
accompanied by loss of charge which decreases the total yield of
charged species or it may produce charged fragmentation products
which decreases the intensity of the non fragmented molecular ion
signal.
[0458] The observation of increased sensitivity and decreased peak
tailing of the (M+H).sup.+signals on the lower mass side due to
decreased fragmentation of the 7-deazapurine containing samples
indicate that the N-7 atom indeed is essential for the mechanism of
depurination in the MALDI-TOF process. In conclusion, 7-deazapurine
containing nucleic acids show distinctly increased ion-stability
and sensitivity under MALDI-TOF conditions and therefore provide
for higher mass accuracy and mass resolution.
EXAMPLE 9
[0459] Solid Phase Sequencing and Mass Spectrometer Detection
[0460] Materials and Methods
[0461] Oligonucleotides were purchased from Operon Technologies
(Alameda, Calif.) in an unpurified form. Sequencing reactions were
performed on a solid surface using reagents from the sequencing kit
for Sequenase Version 2.0 (Amersham, Arlington Heights, Ill.).
[0462] Sequencing a 39-mer Target
[0463] Sequencing Complex:
8 SEQUENCE SEQ ID NO.
5'-TCTGGCCTGGTGCAGGGCCTATTGTAGTTGTGACGTACA-(A.sup.b).sub.a-3' 23
5'-TGTACGTCACAACT-3' (PNA 16/DNA) 24
[0464] In order to perform solid-phase DNA sequencing, template
strand DNA11683 was 3'-biotinylated by terminal deoxynucleotidyl
transferase. A 30 .mu.l reaction, containing 60 pmol of DNA11683,
1.3 nmol of biotin 14-dATP (GIBCO BRL, Grand Island, N.Y.), 30
units of terminal transferase (Amersham, Arlington Heights, Ill.),
and 1.times. reaction buffer (supplied with enzyme), was incubated
at 37.degree. C. for 1 hour. The reaction was stopped by heat
inactivation of the terminal transferase at 70.degree. C. for 10
min. The resulting product was desalted by passing through a TE-10
spin column (Clontech). More than one molecules of biotin-14-dATP
could be added to the 3'-end of DNA11683. The biotinylated DNA11683
was incubated with 0.3 mg of Dynal streptavidin beads in 30 .mu.l
1.times. binding and washing buffer at ambient temperature for 30
min. The beads were washed twice with TE and redissolved in 30
.mu.l TE, 10 .mu.l aliquot (containing 0.1 mg of beads) was used
for sequencing reactions.
[0465] The 0.1 mg beads from previous step were resuspended in a 10
.mu.l volume containing 2 .mu.l of 5.times. Sequenase buffer (200
mM Tris-HCl, pH 7.5, 100 mM MgCl.sub.2, and 250 mM NaCl) from the
Sequenase kit and 5 pmol of corresponding primer PNA 16/DNA. The
annealing mixture was heated to 70.degree. C. and allowed to cool
slowly to room temperature over a 20-30 min time period. Then 1
.mu.l 0.1 M dithiothreitol solution, 1 .mu.l Mn buffer (0.15 M
sodium isocitrate and 0.1 M MgCl.sub.2), and 2.mu.l of diluted
Sequenase (3.25 units) were added. The reaction mixture was divided
into four aliquots of 3 .mu.l each and mixed with termination mixes
(each contains of 3 .mu.l of the appropriate termination mix: 32
.mu.M c7dATP, 32 .mu.M dCTP, 32 .mu.M c7dGTP, 32 .mu.M dTTP and 3.2
.mu.M of one of the four ddTNPs, in 50 mM NaCl). The reaction
mixtures were incubated at 37.degree. C. for 2 min. After the
completion of extension, the beads were precipitated and the
supernatant was removed. The beads were washed twice and
resuspended in TE and kept at 4.degree. C.
[0466] Sequencing a 78-mer Target
[0467] Sequencing Complex:
9 (SEQ ID NO. 25) 5'-AAGATCTGACCAGGGATTCGGTTAGCGTGACTGCTGCT-
GCTGCTGCT GCTGCTGGATGATCCGACGCATCAGATCTGG-(A.sup.b).sub.n-3'
(TNR.PLASM2) (SEQ ID NO. 26) 5'-CTGATGCGTCGGATCATC-3'(C- M1)
[0468] The target TNR.PLASM2 was biotinylated and sequenced using
procedures similar to those described in previous section
(sequencing a 39-mer target).
[0469] Sequencing a 15-mer Target with Partially Duplex Probe
[0470] Sequencing Complex:
10 (SEQ ID No. 27) .sup.5'-F-GATGATCCGACGCATCACAGCTC.sup.3- ' (SEQ
ID No. 28) .sup.5'-TCGGTTCCAAGAGCTGTGATGC-
GTCGGATCATC-b-.sup.3'
[0471] CM1B3B was immobilized on Dynabeads M280 with streptavidin
(Dynal, Norway) by incubating 60 pmol of CM1 B3B with 0.3 magnetic
beads in 30 .mu.l 1 M NaCl and TE (1.times. binding and washing
buffer) at room temperature for 30 min. The beads were washed twice
with TE and redissolved in 30 .mu.l TE, 10 or 20 .mu.l aliquot
(containing 0.1 or 0.2 mg of beads respectively) was used for
sequencing reactions.
[0472] The duplex was formed by annealing corresponding aliquot of
beads from previous step with 10 pmol of DF11a5F (or 20 pmol of
DF11 a5F for 0.2 mg of beads) in a 9 .mu.l volume containing 2
.mu.l of 5.times. Sequenase buffer (200 mM Tris-HCl, pH 7.5, 100 mM
MgCl.sub.2, and 250 mM NaCl) from the Sequenase kit. The annealing
mixture was heated to 65.degree. C. and allowed to cool slowly to
37.degree. C. over a 20-30 min time period. The duplex primer was
then mixed with 10 pmol of TS10 (20 pmol of TS10 for 0.2 mg of
beads) in 1 .mu.l volume, and the resulting mixture was further
incubated at 37.degree. C. for 5 min, room temperature for 5-10
min. Then 1 .mu.l 0.1 M dithiothreitol solution, 1 .mu.Mn buffer
(0.15 M sodium isocitrate and 0.1 M MnCl.sub.2), and 2 .mu.l of
diluted Sequenase (3.25 units) were added. The reaction mixture was
divided into four aliquots of 3 .mu.l each and mixed with
termination mixes (each contains of 4 .mu.l of the appropriate
termination mix: 16 .mu.M dATP, 16 .mu.M dCTP, 16 .mu.M dGTP,
16.mu.M dTTP and 1.6 .mu.M of one of the four ddNTPs, in 50 mM
NaCl). The reaction mixtures were incubated at room temperature for
5 min, and 37.degree. C. for 5 min. After the completion of
extension, the beads were precipitated and the supernatant was
removed. The beads were resuspended in 20 .mu.l TE and kept at
4.degree. C. An aliquot of 2 .mu.l (out of 20.mu.l) from each tube
was taken and mixed with 8 .mu.l of formamide, the resulting
samples were denatured at 90-95.degree. C. for 5 min and 2 .mu.l
(out of 10 .mu.l total) was applied to an ALF DNA sequencer
(Pharmacia, Piscataway, N.J.) using a 10% polyacrylamide gel
containing 7 M urea and 0.6.times. TBE. The remaining aliquot was
used for MALDI-TOF MS analysis.
[0473] MALDI Sample Preparation and Instrumentation
[0474] Before MALDI analysis, the sequencing ladder loaded magnetic
beads were washed twice using 50 mM ammonium citrate and
resuspended in 0.5 .mu.l pure water. The suspension was then loaded
onto the sample target of the mass spectrometer and 0.5 .mu.l of
saturated matrix solution (3-hydroxypicolinic acid (HPA): ammonium
citrate=10:1 mole ratio in 50% acetonitrile) was added. The mixture
was allowed to dry prior to mass spectrometer analysis.
[0475] The reflectron TOFMS mass spectrometer (Vision 2000,
Finnigan MAT, Bremen, Germany) was used for analysis. 5 kV was
applied in the ion source and 20 kV was applied for
postacceleration. All spectra were taken in the positive ion mode
and a nitrogen laser was used. Normally, each spectrum was averaged
for more than 100 shots and a standard 25-point smoothing was
applied.
[0476] Results and Discussion
[0477] Conventional Solid-Phase Sequencing
[0478] In conventional sequencing methods, a primer is directly
annealed to the template and then extended and terminated in a
Sanger dideoxy sequencing. Normally, a biotinylated primer is used
and the sequencing ladders are captured by streptavidin-coated
magnetic beads. After washing, the products are eluted from the
beads using EDTA and formamide. Previous findings indicated that
only the annealed strand of a duplex is desorbed and the
immobilized strand remains on the beads. Therefore, it is
advantageous to immobilize the template and anneal the primer.
After the sequencing reaction and washing, the beads with the
immobilized template and annealed sequencing ladder can be loaded
directly onto the mass spectrometer target and mix with matrix. In
MALDI, only the annealed sequencing ladder will be desorbed and
ionized, and the immobilized template will remain on the
target.
[0479] A 39-mer template (SEQ ID No. 23) was first biotinylated at
the 3'-end by adding biotin-14-dATP with terminal transferase. More
than one biotin-14-dATP molecule could be added by the enzyme.
Since the template was immobilized and remained on the beads during
MALDI, the number of biotin-14-dATP would not affect the mass
spectra. A 14-mer primer (SEQ ID No. 24) was used for the
solid-state sequencing to generate DNA fragments 3-27 below (SEQ ID
Nos. 142-166). MALDI-TOF mass spectra of the four sequencing
ladders are shown in FIG. 44 and the expected theoretical values
are shown in Table III.
11TABLE III 1 5'-TCTGGCCTGGTGCAGGGCCTATTGTAGTTGT-
GACGTACA(A.sup.B).sub.n-3' 2 3'-TCAACACTGCATGT-5- 3
3'-ATCAACACTGCATGT-5' 4 3'-CATCAACACTGCATGT-5' 5
3'-ACATCAACACTGCATGT-5' 6 3'-AACATCAACACTGCATGT-5' 7
3'-TAACATCAACACTGCATGT-5' 8 3'-ATAACATCAACACTGCATGT-5' 9
3'-GATAACATCAACACTGCATGT-5' 10 3'-GGATAACATCAACACTGCATGT-5' 11
3'-CGGATAACATCAACACTGCATGT-5' 12 3'-CCGGATAACATCAACACTGCATGT-5' 13
3'-CCCGGATAACATCAACACTGCATGT-5' 14 3'-TCCCGGATAACATCAACACTGCATGT-5'
15 3'-GTCCCGGATAACATCAACACTGCATGT-5' 16
3'-CGTCCCGGATAACATCAACACTGCATGT-5' 17
3'-ACGTCCCGGATAACATCAACACTGCATGT-5' 18
3'-CACGTCCCGGATAACATCAACACTGCATGT-5' 19
3'-CCACGTCCCGGATAACATCAACACTGCATGT-5' 20
3'-ACCACGTCCCGGATAACATCAACACTGCATGT-5' 21
3'-GACCACGTCCCGGATAACATCAACACTGCATGT-5' 22
3'-GGACCACGTCCCGGATAACATCAACACTGCATGT-5' 23
3'-CGGACCACGTCCCGGATAACATCAACACTGCATGT-5' 24
3'-CCGGACCACGTCCCGGATAACATCAACACTGCATGT-5' 25
3'-ACCGGACCACGTCCCGGATAACATCAACACTGCATGT-5' 26
3'-GACCGGACCACGTCCCGGATAACATCAACACTGCATGT-5' 27
3'-AGACCGGACCACGTCCCGGATAACATCAACACTGCATGT-5' A-reaction C-reaction
G-reaction T-reaction 1. 2. 4223.8 4223.8 4223.8 4223.8 3. 4521.1
4. 4809.2 5. 5133.4 6. 5434.6 7. 5737.8 8. 6051.1 9. 6379.2 10.
6704.4 11. 6995.6 12. 7284.8 13. 7574.0 14. 7878.2 15. 8207.4 16.
8495.6 17. 8808.8 18. 9097.0 19. 9386.2 20. 9699.4 21. 10027.6 22.
10355.8 23. 10644.0 24. 10933.2 25. 11246.4 26. 11574.6 27.
11886.8
[0480] The sequencing reaction produced a relatively homogenous
ladder, and the full-length sequence was determined easily. One
peak around 5150 appeared in all reactions are not identified. A
possible explanation is that a small portion of the template formed
some kind of secondary structure, such as a loop, which hindered
sequenase extension. Mis-incorporation is of minor importance,
since the intensity of these peaks were much lower than that of the
sequencing ladders. Although 7-deaza purines were used in the
sequencing reaction, which could stabilize the N-glycosidic bond
and prevent depurination, minor base losses were still observed
since the primer was not substituted by 7-deazapurines. The full
length ladder, with a ddA at the 3' end, appeared in the A reaction
with an apparent mass of 11899.8. A more intense peak of 12333
appeared in all four reactions and is likely due to an addition of
an extra nucleotide by the Sequenase enzyme.
[0481] The same technique could be used to sequence longer DNA
fragments. A 78-mer template containing a CTG repeat (SEQ ID No.
25) was 3'-biotinylated by adding biotin-14-dATP with terminal
transferase. An 18-mer primer (SEQ ID No. 26) was annealed right
outside the CTG repeat so that the repeat could be sequenced
immediately after primer extension. The four reactions were washed
and analyzed by MALDI-TOFMS as usual. An example of the G-reaction
is shown in FIG. 45 (SEQ ID Nos. 167-220) and the expected
sequencing ladder is shown in Table IV with theoretical mass values
for each ladder component. All sequencing peaks were well resolved
except the last component (theoretical value 20577.4) was
indistinguishable from the background. Two neighboring sequencing
peaks (a 62-mer and a 63-mer) were also separated indicating that
such sequencing analysis could be applicable to longer templates.
Again, an addition of an extra nucleotide by the Sequenase enzyme
was observed in this spectrum. This addition is not template
specific and appeared in all four reactions which makes it easy to
be identified. Compared to the primer peak, the sequencing peaks
were at much lower intensity in the long template case.
12TABLE IV AAGATCTGACCAGGGATTCGGTTAGCGTG-
ACTGCTGCTGCTGCTGCTGGATGATCCGACGCATCAGATCTGG-(A.sup.B).sub.n-3' 1
3'-CTACTAGGCTGCGTAGTC-5' 2 3'-CCTACTAGGCTGCGTAGTC-5' 3
3'-ACCTACTAGGCTGCGTAGTC-5' 4 3'-GACCTACTAGGCTGCGTAGTC-5' 5
3'-CGACCTACTAGGCTGCGTAGTC-5' 6 3'-ACGACCTACTAGGCTGCGTAGTC-5' 7
3'-GACGACCTACTAGGCTGCGTAGTC-5' 8 3'-CGACGACCTACTAGGCTGCGTAGTC-5' 9
3'-ACGACGACCTACTAGGCTGCGTAGTC- -5' 10
3'-GACGACGACCTACTAGGCTGCGTAGTC-5' 11
3'-CGACGACGACCTACTAGGCTGCGTAGTC-5' 12 3'-ACGACGACGACCTACTAGGCTGCG-
TAGTC-5' 13 3'-GACGACGACGACCTACTAGGCTGCGTAGTC-5' 14
3'-CGACGACGACGACCTACTAGGCTGCGTAGTC-5' 15
3'-ACGACGACGACGACCTACTAGGCT- GCGTAGTC-5' 16
3'-GACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 17
3'-CGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 18
3'-ACGACGACGACGACGACCTACTA- GGCTGCGTAGTC-5' 19
3'-GACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 20
3'-CGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 21
3'-ACGACGACGACGACGACGACCTAC- TAGGCTGCGTAGTC-5' 22
3'-GACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 23
3'-CGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 24
3'-ACGACGACGACGACGACGACGACC- TACTAGGCTGCGTAGTC-5' 25
3'-GACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 26
3'-TGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 27
3'-CTGACGACGACGACGACGACGAC- GACCTACTAGGCTGCGTAGTC-5' 28
3'-ACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 29
3'-CACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-- 5' 30
3'-GCACTGACGACGACGACGACGACG- ACGACCTACTAGGCTGCGTAGTC-5' 31
3'-CGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 32
3'-TCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAG- TC-5' 33
3'-ATCGCACTGACGACGACGACGACG- ACGACGACCTACTAGGCTGCGTAGTC-5' 34
3'-AATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 35
3'-CAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCG- TAGTC-5' 36
3'-CCAATCGCACTGACGACGACGACG- ACGACGACGACCTACTAGGCTGCGTAGTC-5' 37
3'-GCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 38
3'-AGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCT- GCGTAGTC-5' 39
3'-AAGCCAATCGCACTGACGACGACG- ACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 40
3'-TAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 41
3'-CTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTA- GGCTGCGTAGTC-5'
42 3'-CCTAAGCCAATCGCACTGACGAC-
GACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 43
3'-CCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5'
44 3'-TCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTAC-
TAGGCTGCGTAGTC-5' 45 3'-GTCCCTAAGCCAATCGCACTGACG-
ACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 46
3'-GGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5'
47 3'-TGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACC-
TACTAGGCTGCGTAGTC-5' 48 3'-CTGGTCCCTAAGCCAATCGCACTG-
ACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 49
3'-ACTGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5'
50 3'-GACTGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGAC-
GACCTACTAGGCTGCGTAGTC-5' 51 3'-AGACTGGTCCCTAAGCCAATCGC-
ACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 52
3'-TAGACTGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC--
5' 53 3'-CTAGACTGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACG-
ACGACCTACTAGGCTGCGTAGTC-5' 54 3'-TCTAGACTGGTCCCTAAGCCAATC-
GCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAGTC-5' 55
3'-TTCTAGACTGGTCCCTAAGCCAATCGCACTGACGACGACGACGACGACGACGACCTACTAGGCTGCGTAG-
TC-5' ddATP ddCTP ddGTP ddTTP 1. 5491.6 5491.6 5491.6 5491.6 2.
5764.8 3. 6078.0 4. 6407.2 5. 6696.4 6. 7009.6 7. 7338.8 8. 7628.0
9. 7941.2 10. 8270.4 11. 8559.6 12. 8872.8 13. 9202.0 14. 9491.2
15. 9804.4 16. 10133.6 17. 10422.88 18. 10736.0 19. 11065.2 20.
11354.4 21. 11667.6 22. 11996.8 23. 12286.0 24. 12599.2 25. 12928.4
26. 13232.6 27. 13521.8 28. 13835.0 29. 14124.2 30. 14453.4 31.
14742.6 32. 15046.8 33. 15360.0 34. 15673.2 35. 15962.4 36. 16251.6
37. 16580.8 38. 16894.0 39. 17207.2 40. 17511.4 41. 17800.6 42.
18189.8 43. 18379.0 44. 18683.2 45. 19012.4 46. 19341.6 47. 19645.8
48. 19935.0 49. 20248.2 50. 20577.4 51. 20890.6 52. 21194.4 53.
21484.0 54. 21788.2 55. 22092.4
[0482] Sequencing Using Duplex DNA Probes for Capturing and
Priming
[0483] Duplex DNA probes with single-stranded overhang have been
demonstrated to be able to capture specific DNA templates and also
serve as primers for solid-state sequencing. The scheme is shown in
FIG. 46. Stacking interactions between a duplex probe and a
single-stranded template allow only a 5-base overhang to be
sufficient for capturing. Based on this format, a 5'
fluorescent-labeled 23-mer (5'-GAT GAT CCG ACG CAT CAC AGC TC-3')
(SEQ ID No. 29) was annealed to a 3'-biotinylated 18-mer (5'-GTG
ATG CGT CGG ATC ATC-3') (SEQ ID No. 30), leaving a 5-base overhang.
A 15-mer template (5'-TCG GTT CCA AGA GCT-3') (SEQ ID No. 31) was
captured by the duplex and sequencing reactions were performed by
extension of the 5-base overhang. MALDI-TOF mass spectra of the
reactions are shown in FIG. 47A-D. All sequencing peaks were
resolved although at relatively low intensities. The last peak in
each reaction is due to unspecific addition of one nucleotide to
the full length extension product by the Sequenase enzyme. For
comparison, the same products were run on a conventional DNA
sequencer and a stacking fluorogram of the results is shown in FIG.
48. As can be seen from the Figure, the mass spectra had the same
pattern as the fluorogram with sequencing peaks at much lower
intensity compared to the 23-mer primer.
EXAMPLE 10
[0484] Thermo Sequenase Cycle Sequencing
[0485] Materials and Methods
[0486] PCR Amplification.
[0487] Human leukocytic genomic DNA was used for PCR amplification.
PCR primers to amplify a 209 bp fragment of the .beta.-globin gene
were the .beta.2 forward primer (5'-CAT TTG CTT CTG ACA CAA CTG-3'
SEQ ID NO. 32) and the .beta.11 reverse primer (5'-CTT CTC TGT CTC
CAC ATG C-3' SEQ ID NO. 33). Taq polymerase and 10.times. buffer
were purchased from Boehringer-Mannheim (Germany) and dNTPs from
Pharmacia (Freiburg, Germany). The total reaction volume was
50.mu.l including 8 pmol of each primer with approximately 200 ng
of genomic DNA used as template and a final dNTP concentration of
200 .mu.M. PCR conditions were: 5 min at 94.degree. C., followed by
40 cycles of 30 sec at 94.degree. C., 45 sec at 53.degree. C., 30
sec at 72.degree. C., and a final extension time of 2 min at
72.degree. C. The generated amplified product was purified and
concentrated (2.times.) with the Qiagen `Qiaquick` PCR purification
kit (#28106) and stored in H.sub.2O.
[0488] Cycle Sequencing.
[0489] Sequencing ladders were generated by primer extension with
Thermo Sequenase.TM.-DNA Polymerase (Amersham LIFE Science,
#E79000Y) under the following conditions: 7 pmol of HPLC purified
primer (Cod5 12mer: 5'-TGC ACC TGA CTC-3' SEQ ID No. 34) were added
to 6 .mu.l purified and concentrated amplified product (i.e. 12
.mu.l of the original amplified product), 2.5 units Thermo
Sequenase and 2.5 ml Thermo Sequenase reaction buffer in a total
volume of 25 .mu.l. The final nucleotide concentrations were 30
.mu.M of the appropriate ddNTP (ddATP, ddCTP, ddGTP or ddTTP;
Pharmacia Biotech, #27-2045-01) and 210 .mu.M of each dNTP
(7-deaza-dATP, DCTP, 7-deaza-GTP, dTTP; Pharmacia Biotech).
[0490] Cycling conditions were: denaturation for 4 min at
94.degree. C., followed by 35 cycles of 30 sec at 94.degree. C., 30
sec at 38.degree. C., 30 sec at 55.degree. C., and a final
extension of 2 min at 72.degree. C.
[0491] Sample preparation and analysis by MALDI-TOF MS. After
completion of the cycling program, the reaction volume was
increased to 50 .mu.l by addition of 25 .mu.l H.sub.2O. Desalting
was achieved by shaking 30 .mu.l of ammonium saturated DOWEX (Fluka
#44485) cation exchange beads with 50 .mu.l of the analyte for 2
min at room temperature. The Dowex beads, purchased in the
protonated form, were pre-treated with 2M NH.sub.4OH to convert
them to the ammonium form, then washed with H.sub.2O until the
supernatant was neutral, and finally put in 10 mM ammonium citrate
for usage. After the cation exchange, DNA was purified and
concentrated by ethanol precipitation by adding 5 .mu.l 3 M
ammonium acetate (pH 6.5), 0.5 .mu.l glycogen (10 mg/ml, Sigma),
and 110 .mu.l absolute ethanol to the analyte and incubated at room
temperature for 1 hour. After 12 min centrifugation at
20,000.times. g the pellet was washed in 70% ethanol and
resuspended in 1 .mu.l 118 Mohm/cm H.sub.2O water.
[0492] For MALDI-TOF MS analysis 0.35 .mu.l of resuspended DNA was
mixed with 0.35-1.3 .mu.l matrix solution (0.7 M 3-hydroxypicolinic
acid (3-HPA), 0.07 M ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN)
on a stainless steel sample target disk and allowed to air dry
preceding spectrum acquisition using a Thermo Bioanalysis Vision
2000 MALDI-TOF operated in reflectron mode with 5 and 20 kV on the
target and conversion dynode, respectively. External calibration
generated from eight peaks (3000-18000 Da) was used for all
spectra.
[0493] Results
[0494] FIG. 49 shows a MALDI-TOF mass spectrum of the sequencing
ladder generated from a biological amplified product as template
and a 12mer (5'-TGC ACC TGA CTC-3'(SEQ ID NO.34)) sequencing
primer. The peaks resulting from depurinations and peaks which are
not related to the sequence are marked by an asterisk. MALDI-TOF MS
measurements were taken on a reflectron TOF MS. A.) Sequencing
ladder stopped with ddATP; B.) Sequencing ladder stopped with
ddCTP; C.) Sequencing ladder stopped with ddGTP; D.) Sequencing
ladder stopped with ddTTP.
[0495] FIG. 50 shows a schematic representation of the sequencing
ladder generated in FIG. 49 with the corresponding calculated
molecular masses up to 40 bases after the primer (SEQ ID Nos
221-260). For the calculation the following masses were used:
3581.4 Da for the primer, 312.2 Da for 7-deaza-dATP, 304.2 Da for
dTTP, 289.2 Da for dCTP and 328.2 Da for 7-deaza-dGTP.
[0496] FIG. 51 shows the sequence of the amplified 209 bp amplified
product within the .beta.-globin gene (SEQ ID No. 261), which was
used as a template for sequencing. The sequences of the appropriate
PCR primer and the location of the 12mer sequencing primer is also
shown. This sequence represents a homozygote mutant at the position
4 after the primer. In a wildtype sequence this T would be replaced
by an A.
EXAMPLE 11
[0497] Microsatellite Analysis Using Primer Oligo Base Extension
(PROBE) and MALDI-TOF Mass Spectrometry
[0498] Summary
[0499] The method uses a single detection primer followed by an
oligonucleotide extension step to give products differing in length
by a number of bases specific for the number of repeat units or for
second site mutations within the repeated region, which can be
easily resolved by MALDI-TOF mass spectrometry. The method is
demonstrated using as a model system the AluVpA polymorphism in
intron 5 of the interferon-a receptor gene located on human
chromosome 21, and the poly T tract of the splice acceptor site of
intron 8 from the CFTR gene located on human chromosome 7.
[0500] Materials and Methods
[0501] Genomic DNA was obtained from 18 unrelated individuals and
one family including of a mother, father, and three children. The
repeated region was evaluated conventionally by denaturing gel
electrophoresis and results obtained were confirmed by standard
Sanger sequencing.
[0502] The primers for PCR amplification (8 pmol each) were
IFNAR-IVS5-5': (5'-TGC TTA CTT AAC CCA GTG TG-3' SEQ ID. NO.35) and
IFNAR-IVS5-3'.2: (5'-CAC ACT ATG TAA TAC TAT GC-3' SEQ ID. NO.36)
for a part of the intron 5 of the interferon-.alpha. receptor gene,
and CFEx9-F:(5'-GAA AAT ATC TGA CAA ACT CAT C-3' SEQ ID. NO.37)
(5'-biotinylated) and CFEx9-R:(5'-CAT GGA CAC CAA ATT AAG TTC-3'SEQ
ID. NO.38) for CFTR exon 9 with flanking intron sequences of the
CFTR gene. Taq-polymerase including 10.times. buffer were purchased
from Boehringer-Mannheim and dNTPs were obtained from Pharmacia.
The total reaction volume was 50 .mu.1. PCR conditions were 5 min
at 94.degree. C. followed by 40 cycles of: 1 min at 94.degree. C.,
45 sec at 53.degree. C., and 30 sec at 72.degree. C., and a final
extension time of 5 min at 72.degree. C.
[0503] Amplification products were purified using Qiagen's PCR
purification kit (No.28106) according to manufacturer's
instructions. Purified products were eluted from the column in 50
.mu.l TE-buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7,5).
[0504] A) Primer Oligo Base Extension Reaction (Thermo Cycling
Method
[0505] CyclePROBE was performed with 5 pmol appropriate detection
primer (IFN:5'-TGA GAC TCT GTC TC-3'SEQ ID. NO.39) in a total
volume of 25 .mu.l including I pmol purified template, 2 units
Thermosequenase (Amersham Life Science, Cat. #E79000Y) 2.5 .mu.l
Thermosequenase buffer, 25 .mu.mol of each deoxynucleotide
(7-deaza-dATP, dTTP, and in some experiments extra dCTP) and 100
.mu.mol of dideoxyguanine and in some experiments additional ddCTP.
Cycling conditions: initial denaturation 94.degree. C. for 5 min
followed by, 30 cycles with 44.degree. C. annealing temperature for
30 sec and 55.degree. C. extension temperature for 1 min.
[0506] Primer Oligo Base Extension Reaction (Isothermal Method)
[0507] 10 .mu.l aliquots of the purified double-stranded amplified
product (.about.3 pmol) were transferred to a streptavidin-coated
microliter plate well (.about.16 pmol capacity per 50 .mu.l volume;
No. 1645684 Boehringer-Mannheim), followed by addition of 10 .mu.l
incubation buffer (80 mM sodium phosphate, 400 mM NaCl, 0.4% Tween
20, pH 7.5) and 30 .mu.l water. After incubation for 1 hour at room
temperature, the wells were washed three times with 200 .mu.l
washing buffer A (40 mM Tris, 1 mM EDTA, 50 mM NaCl, 0.1% Tween 20,
pH 8.8) and incubated with 100 .mu.l of 50 mM NaOH for 3 min to
denature the double-stranded DNA. Finally, the wells were washed
three times with 200 .mu.l 70 mM ammonium citrate solution.
[0508] The annealing of 100 pmol detection primer (CFpT: 5'-TTC CCC
AAA TCC CTG-3' SEQ ID NO. 40) was performed in 50 .mu.l annealing
buffer (50 mM ammonium phosphate buffer, pH 7.0 and 100 mM ammonium
chloride) at 65.degree. C. for 2 min, at 37.degree. C. for 10 min,
and at room temperature for 10 min. The wells were washed three
times with 200 .mu.l washing buffer B (40 mM Tris, 1 mM EDTA, 50 mM
NH.sub.4Cl, 0.1% Tween 20, pH 8.8) and once in 200 .mu.l TE buffer.
The extension reaction was performed using some components of the
DNA sequencing kit from USB (No. 70770) and dNTPs or ddNTPs from
Pharmacia. Total reaction volume was 45 .mu.l, containing of 21
.mu.l water, 6 .mu.l Sequenase-buffer, 3 .mu.l 100 mM DTT solution,
50 .mu.mol of 7-deaza-dATP, 20 .mu.mol ddCTP, 5.5 .mu.l glycerol
enzyme dilution buffer, 0.25 .mu.l Sequenase 2.0, and 0.25 .mu.l
pyrophosphatase. The reaction was pipetted on ice and incubated for
15 min at room temperature and for 5 min at 37.degree. C. Finally,
the wells were washed three times with 200 .mu.l washing buffer
B.
[0509] The extended primer was denatured from the template strand
by heating at 80.degree. C. for 10 min in 50 .mu.l of a 50 mM
ammonium hydroxide solution.
[0510] For precipitation, 10 .mu.l 3 M NH4-acetate (pH 6.5), 0.5
.mu.l glycogen (10 mg/ml water, Sigma, Cat.#G1765), and 110 .mu.l
absolute ethanol were added to the supernatant and incubated for 1
hour at room temperature. After centrifugation at 13.000 g for 10
min the pellet was washed in 70% ethanol and resuspended in 1 .mu.l
18 Mohm/cm H.sub.2O water.
[0511] Sample preparation was performed by mixing 0.6 .mu.l of
matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic
ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN) with 0.3 .mu.l of
resuspended DNA/glycogen pellet on a sample target and allowed to
air dry. Up to 20 samples were spotted on a probe target disk for
introduction into the source region of a Thermo Bioanalysis
(formerly Finnigan) Visions 2000 MALDI-TOF operated in reflectron
mode with 5 and 20 kV on the target and conversion dynode,
respectively. Theoretical average molecular mass (M.sub.r(calc))
were calculated from atomic compositions; reported experimental
M.sub.r(M.sub.r(exp)) values are those of the singly-protonated
form, determined using external calibration.
[0512] Results
[0513] The aim of the experiments was to develop a fast and
reliable method for the exact determination of the number of repeat
units in microsatellites or the length of a mononucleotide stretch
including the potential to detect second site mutations within the
polymorphic region. Therefore, a special kind of DNA sequencing
(primer oligo base extension, PROBE) was combined with the
evaluation of the resulting products by matrix-assisted laser
desorption ionization (MALDI) mass spectrometry (MS). The
time-of-flight (TOF) reflectron arrangement was chosen-as a
possible mass measurement system. As an initial feasibility study,
an examination was performed first on an AluVpA repeat polymorphism
located in intron 5 of the human interferon-a receptor gene
(cyclePROBE reaction) and second on the poly T tract located in
intron 8 of the human CFTR gene (isothermal PROBE reaction).
[0514] A schematic presentation of the cyclePROBE experiment for
the AluVpA repeat polymorphism is given in FIG. 52. The extension
of the antisense strand (SEQ ID No. 262) was performed with the
sense strand serving as the template. The detection primer is
underlined. In a family study co-dominant segregation of the
various alleles could be demonstrated by the electrophoretic
procedure as well as by the cyclePROBE method followed by mass spec
analysis (FIG. 53). Those alleles of the mother and child 2, for
which direct electrophoresis of the amplified product indicated one
of the two copies to have 13 repeat units, were measured using
cyclePROBE to have instead only 11 units using ddG as terminator.
The replacement of ddG by ddC resulted in a further unexpected
short allele with a molecular mass of approximately 11650 in the
DNA of the mother and child 2 (FIG. 54). Sequence analysis verified
this presence of two second site mutations in the allele with 13
repeat units. The first is a C to T transition in the third repeat
unit and the second mutation is a T to G transversion in the ninth
repeat unit. Examination of 28 unrelated individuals shows that the
13 unit allele is spliced into a normal allele and a truncated
allele using cyclePROBE. Statistical evaluation shows that the
polymorphism is in Hardy-Weinberg equilibrium for both methods,
however, using cyclePROBE as detection method the polymorphism
information content is increased to 0.734.
[0515] PROBE was also used as an isothermic method for the
detection of the three common alleles at the intron 8 splice
acceptor site of the CFTR gene (SEQ ID No. 263). FIG. 55 shows a
schematic presentation of the expected diagnostic products (SEQ ID
Nos. 264-266) with the theoretical mass values. The reaction was
also performed in the antisense direction.
[0516] FIG. 56 demonstrates that all three common alleles (T5, T7,
and T9, respectively) at this locus could be reliably disclosed by
this method. Reference to FIG. 56 indicates that mass accuracy and
precision with the reflectron time of flight used in this study
ranged from 0-0.4%, with a relative standard deviation of 0.13%.
This corresponds to far better than single base accuracy for the up
to <90-mer diagnostic products generated in the IFNAR system.
Such high analytical sensitivity is sufficient to detect single or
multiple insertion/deletion mutations within the repeat unit or its
flanking regions, which would induce >1% mass shifts in a
90-mer. This is analogous to the FIG. 56 polyT tract analysis.
Other mutations (i.e. an A to T or a T to A mutation within the
IFNAR gene A3T repeat) which do not cause premature product
termination are not detectable using any dNTP/ddNTP combination
with PROBE and low performance MS instrumentation; a 9 Da shift in
a 90-mer corresponds to a 0.03% mass shift. Achieving the accuracy
and precision required to detect such minor mass shifts has been
demonstrated with higher performance instrumentation such as
Fourier transform (FT)MS, for which single Da accuracy is obtained
up to 100-mers. Further, tandem FTMS, in which a mass shifted
fragment can be isolated within the instrument and dissociated to
generate sequence specific fragments, has been demonstrated to
locate point mutations to the base in comparably sized products.
Thus the combination of PROBE with higher performance
instrumentation will have an analytical sensitivity which can be
matched only by cumbersome full sequencing of the repeat
region.
EXAMPLE 12
[0517] Improved Apolipoprotein E Genotyping Using Primer Oligo Base
Extension (PROBE) and MALDI-TOF Mass Spectrometry
[0518] Materials and Methods
[0519] PCR Amplification
[0520] Human leukocytic genomic DNA from 100 anonymous individuals
from a previously published study (Braun, A et al., (1992) Human
Genet. 89:401-406) were screened for apolipoprotein E genotypes
using conventional methods. PCR primers to amplify a portion of
exon 4 of the apo E gene were delineated according to the published
sequence (Das, H K et al., (1985) J. Biol. Chem. 260:6240-6247)
(forward primer, apoE-F: 5'-GGC ACG GCT GTC CAA GGA G-3'SEQ ID.
NO.41; reverse, apoE-R: 5'-AGG CCG CGC TCG GCG CCC TC-3'SEQ ID.
NO.42). Taq polymerase and 10.times. buffer were purchased from
Boehringer-Mannheim (Germany) and dNTPs from Pharmacia (Freiburg,
Germany). The total reaction volume was 50 .mu.L including 8 pmol
of each primer and 10% DMSO (dimethylsulfoxide, Sigma) with
approximately 200 ng of genomic DNA used as template. Solutions
were heated to 80.degree. C. before the addition of 1 U polymerase;
PCR conditions were: 2 min at 94.degree. C., followed by 40 cycles
of 30 sec at 94.degree. C., 45 sec at 63.degree. C., 30 sec at
72.degree. C., and a final extension time of 2 min at 72.degree.
C.
[0521] Restriction Enzyme Digestion and Polyacrylamide
Electrophoresis
[0522] CfoI and RsaI and reaction buffer L were purchased from
Boehringer-Mannheim, and Hhal from Pharmacia (Freiburg, Germany).
For CfoI alone and simultaneous CfoI/RsaI digestion, 20 pL of
amplified products were diluted with 15 .mu.l water and 4 pL
Boehringer-Mannheim buffer L; after addition of 10 units of
appropriate restriction enzyme(s) the samples were incubated for 60
min at 37.degree. C. The procedure for simultaneous HhaI/RsaI
digestion required first digestion by RsaI in buffer L for one hour
followed by addition of NaCl (50 mM end concentration) and Hhal,
and additional incubation for one hour. 20 pL of the restriction
digest were analyzed on a 12% polyacrylamide gel as described
elsewhere (Hixson (1990) J. Lipid Res. 31:545-548). Recognition
sequences of RsaI and CfoI (HhaI) are GT/AC and GCG/C,
respectively; masses of expected digestion fragments from the
252-mer amplified product with CfoI alone and the simultaneous
double digest with CfoI (or HhaI) and RsaI are given in Table
V.
[0523] Thermo-PROBE
[0524] PCR amplification was performed as described above, but with
products purified with the Qiagen `Qiaquick` kit to remove
unincorporated primers. Multiplex Thermo-PROBE was performed with
35 .mu.l amplified product and 8 pmol each of the codon 112 (5'-GCG
GAC ATG GAG GAC GTG-3' SEQ ID. NO.43) and 158 (5'-GAT GCC GAT GAC
CTG CAG AAG-3' SEQ ID. NO.44) detection primers in 20 .mu.l
including .about.1 pmol purified biotinylated antisense template
immobilized on streptavidin coated magnetic beads, 2.5 units
Thermosequenase, 2 .mu.l Thermosequenase buffer, 50 .mu.M of each
dNTP and 200 .mu.M of ddXTP, with the base identity of N and X as
described in the text. Cycling conditions were: denaturation
(94.degree. C., 30 sec) followed by 30 cycles at 94.degree. C. (10
min) and 60.degree. C. (45 sec).
[0525] Sample Preparation and Analysis by MALDI-TOF MS.
[0526] For precipitation (Stults etal., (1991) Rapid Commun. Mass
Spectrom. 5: 359-363) of both digests and PROBE products, 5.mu.l 3M
ammonium acetate (pH 6.5), 0.5 .mu.l glycogen (10 mg/ml, Sigma),
and 110 .mu.l absolute ethanol were added to 50 .mu.l of the
analyte solutions and stored for 1 hour at room temperature. After
10 min centrifugation at 13,000.times. g the pellet was washed in
70% ethanol and resuspended in 1 .mu.l 18 Mohm/cm H.sub.2O water.
Where noted in the text, additional desalting was achieved by
shaking 10-20 .mu.L of ammonium saturated DOWEX (Fluka #44485)
cation exchange beads in 40 .mu.L of analyte. The beads, purchased
in the protonated form, were pre-treated with three 5 min
spin-decant steps in 2M NH.sub.4OH, followed with H.sub.2O and 10
mM ammonium citrate.
[0527] 0.35 .mu.L of resuspended DNA was mixed with 0.35-1.3 .mu.L
matrix solutions (Wu et al. (1993) Rapid Commun. Mass Spectrom.
7:142-146) 0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium
citrate in 1:1 H.sub.2O:CH.sub.3CN) on a stainless steel sample
target disk and allowed to air dry preceding spectrum acquisition
using a Thermo Bioanalysis Vision 2000 MALDI-TOF operated in
reflectron mode with 5 and 20 kV on the target and conversion
dynode, respectively. Theoretical average molecular masses
(M.sub.r(calc)) of the fragments were calculated from atomic
compositions; the mass of a proton (1.08 Da) is subtracted from raw
data values in reporting experimental molecular masses
(M.sub.r(exp)) as neutral basis. An external calibration generated
from eight peaks (3000-18000 Da) was applied to all spectra.
[0528] Results
[0529] Digestion with CfoI Alone
[0530] The inset to FIG. 57a shows a 12% polyacrylamide gel
electrophoretic separation of an .epsilon.3/.epsilon.3 genotype
after digestion of the 252 bp apo E amplified product with CfoI.
Comparison of the electrophoretic bands with a molecular weight
ladder shows the cutting pattern to be as mostly as expected (Table
V) for the .epsilon.3/.epsilon.3 genotype. Differences are that the
faint band at approximately 25 bp is not expected, and the smallest
fragments are not observed. The accompanying mass spectrum of
precipitated digest products shows a similar pattern, albeit at
higher resolution. Comparison with Table V shows that the observed
masses are consistent with those of single-stranded DNA; the
combination of an acidic matrix environment (3-HPA, pK.sub.a3) and
the absorption of thermal energy via interactions with the 337 nm
absorbing 3-HPA upon ionization is known to denature short
stretches of dsDNA under normal MALDI conditions (Tang, K et al.,
(1994) Rapid Commun Mass Spectrom 8:183-186).
[0531] The approximately 25-mers, unresolved with electrophoresis,
are resolved by MS as three single stranded fragments; while the
largest (7427 Da) of these may represent a doubly charged ion from
the 14.8 kDa fragments (m=14850, z=2; m/z=7425), the 6715 and 7153
Da fragments could result from PCR artifacts or primer impurities;
all three peaks are not observed when amplified products are
purified with Qiagen purification kits prior to digestion. The
Table V 8871 Da 29-mer sense strand 3'-terminal fragment is not
observed; the species detected at 9186 Da is consistent with the
addition of an extra base (9187-8871=316, consistent with A) by the
Taq-polymerase during PCR amplification (Hu, G et al., (1993) DNA
and Cell Biol 12:763-770). The individual single strands of each
double strand with <35 bases (11 kDa) are resolved as single
peaks; the 48-base single strands (M.sub.r(calc) 14845 and 14858),
however, are observed as an unresolved single peak at 14850 Da.
Separating these into single peaks would require a mass resolution
(m/.DELTA.m, the ratio of the mass to the peak width at half
height) of 14850/13=1140, nearly an order of magnitude greater than
what is routine with the standard reflectron time-of-flight
instrumentation used in this study; resolving such small mass
differences with high performance instrumentation such as Fourier
transform MS, which provides up to three orders of magnitude higher
resolution in this mass range, has been demonstrated. The 91-mer
single strands (M.sub.r(calc)27849 and 28436) are also not
resolved, even though this requires a resolution of only <50.
The dramatic decrease in peak quality at higher masses is due to
metastable fragmentation (i.e. depurination) resulting from excess
internal energy absorbed during and subsequent to laser
irradiation.
[0532] Simultaneous Digestion with CfoI and RsaI
[0533] FIG. 57b (inset) shows a 12% polyacrylamide gel
electrophoresis separation of .epsilon.3/.epsilon.3 double digest
products, with bands consistent with dsDNA with 24, 31, 36, 48, and
55 base pairs, but not for the smaller fragments. Although more
peaks are generated (Table V) than with CfoI alone, the
corresponding mass spectrum is more easily interpreted and
reproducible since all fragments contain <60 bases, a size range
far more appropriate for MALDI-MS if reasonably accurate M.sub.r
values (e.g., 0.1%) are desired. For fragments in this mass range,
the mass measuring accuracy using external calibration is -0.1%
(i.e. <+10 Da at 10 kDa). Significant depurination (indicated in
Figure by asterisk) is observed for all peaks above 10 kDa, but
even the largest peak at 17171 Da is clearly resolved from its
depurination peak so that an accurate M.sub.r can be measured.
Although molar concentrations of digest products should be
identical, some discrimination against those fragments with
.ltoreq.11 bases is observed, probably due to their loss in the
ethanol/glycogen precipitation step. The quality of MS results from
simultaneous digestion with CfoI (or HhaI) and RsaI is superior to
those with CfoI (or HhaI) alone, since the smaller fragments
generated are good for higher mass accuracy measurements, and with
all genotypes there is no possibility for dimer peaks overlapping
with high mass diagnostic peaks. Since digestion by RsaI/CfoI and
RsaI/HhaI produce the same restriction fragments but the former may
be performed as a simultaneous digest since their buffer
requirements are the same, this enzyme mixture was used for all
subsequent genotyping by restriction digest protocols.
13TABLE V Mass and Copy Number of Expected Restriction Digest
Products Table Va Cfol Digestion.sup.a (+) (-) e2/e2 e2/e2 e2/e2
e2/e2 e2/e2 e2/e2 5781, 5999 -- -- 1 -- 1 2 10752, 10921 -- 1 1 2 2
2 14845, 14858 -- 1 1 2 2 2 22102, 22440 -- -- 1 -- 1 2 25575,
25763 2 1 1 -- -- -- 27849, 28436 2 2 1 2 1 --
[0534]
14TABLE Vb Cfol/Rsal Digestion.sup.b (+) (-) e2/e2 e2/e3 e2/e4
e3/e3 e3/e4 e4/e4 3428, 4025 -- 1 1 2 2 2 5283, 5880 -- -- 1 -- 1 2
5781, 5999 -- -- 1 -- 1 2 11279, 11627 2 2 1 2 1 -- 14845, 14858 --
1 1 2 2 2 18269, 18848 2 2 1 -- -- -- .sup.aCfol Invariant fragment
masses: 1848, 2177, 2186, 2435, 4924, 50041 5412, 5750, 8871, 9628
Da. .sup.bCfol/Rsal Invariant fragment masses: 1848, 2177, 2186,
2436, 4924, 5004, 5412, 5750, 6745, 7510, 8871, 9628, 16240, 17175
Da.
[0535]
15 TABLE VI ddT M.sub.r (Calc) ddT M.sub.r (Exp) ddC M.sub.5 (Calc)
ddC M.sub.r (Exp) e2/e2 .sup.a5918, .sup.b6768 -- .sup.a6536,
.sup.b7387 -- e2/e3 .sup.a5918, .sup.b6768, 5919, 6769, .sup.a6536,
.sup.b6753, 6542, 6752, .sup.b7965 7967 .sup.b7387 7393 e2/e4
.sup.a5918, .sup.b6768 -- .sup.a5903, .sup.b6536, -- .sup.b7965,
.sup.a8970 .sup.b6753, .sup.a7387 e3/e3 .sup.a5918, .sup.b7965
5918, 7966 .sup.a6536, .sup.b6753 6542, 6756 e3/e4 .sup.a5918,
.sup.b7965, 5914, 7959, .sup.a5903, .sup.b6536 5898, 6533,
.sup.a8970 8965 .sup.b6753 6747 e4/e4 .sup.b7965, .sup.a8970 7966,
8969 .sup.a5903, .sup.b6753 5900, 6752 .sup.aFrom codon 112
detection primer (unextended 5629.7 Da). .sup.bFrom codon 158
detection primer (unextended 6480.3 Da). Dashed lines: this
genotype not available from the analyzed pool of 100 patients.
[0536] FIG. 58a-c shows the ApoE .epsilon.3/.epsilon.3 genotype
after digestion with CfoI and a variety of precipitation schemes;
equal volume aliquots of the same amplified product were used for
each. The sample treated with a single precipitation (FIG. 58a)
from an ammonium acetate/ethanol/gly-cogen solution results in a
mass spectrum characterized by broad peaks, especially at high
mass. The masses for intense peaks at 5.4, 10.7, and 14.9 kDa are
26 Da (0.5%), 61 Da (0.6%), and 45 Da (0.3%) Da higher,
respectively, than the expected values; the resolution (the ratio
of a peak width at half its total intensity to the measured mass of
the peak) for each of these is -50, and decreases with increasing
mass. Such observations are consistent with a high level of
nonvolatile cation adduction; for the 10.8 kDa fragment, the
observed mass shift is consistent with a greater than unit ratio of
adducted:nonadducted molecular ions.
[0537] MS peaks from a sample redissolved and precipitated a second
time are far sharper (FIG. 58b), with resolution values nearly
double those of the corresponding FIG. 58a peaks. Mass accuracy
values are also considerably improved; each is within 0.07% of its
respective calculated values, close to the independently determined
instrumental limits for DNA measurement using 3-HPA as a matrix.
Single (not shown) and double (FIG. 58C) precipitations with
isopropyl alcohol (IPA) instead of ethanol result in resolution and
mass accuracy values comparable to those for corresponding ethanol
precipitations, but enhanced levels of dimerization are observed,
again potentially confusing measurements when such dimers overlap
with higher mass "diagnostics" monomers present in the solution.
EtOH/ammonium acetate precipitation with glycogen as a nucleation
agent results in nearly quantitative recovery of fragments except
for the 7-mers, serving as a simultaneous concentration and
desalting step prior to MS detection. Precipitation from the same
EtOH/ammonium acetate solutions in the absence of glycogen results
in far poorer recovery, especially at low mass.
[0538] The results indicate that to obtain accurate (M.sub.r(exp)
values after either 1 PA and EtOH precipitations, a second
precipitation is necessary to maintain high mass accuracy and
resolution.
[0539] The ratio of matrix:digest product also affects spectral
quality; severe suppression of higher mass fragments (not shown)
observed with 1:1 volume matrix: digest product (redissolved in 1
.mu.L) is alleviated by using a 3-5 fold volume excess of
matrix.
[0540] Apo E Genotyping by Enzymatic Digestion
[0541] Codon 112 and 158 polymorphisms fall within CfoI (but not
RsaI) recognition sequences. In the 252 bp amplified product
studied here, invariant (i.e. cut in all genotypes) sites cause
cuts after bases 31, 47, 138, 156, 239, and 246. The cutting site
after base 66 is only present for .epsilon.4, while that after base
204 is present in .epsilon.3 and .epsilon.4; the .epsilon.2
genotype is cut at neither of these sites. These differences in the
restriction pattern can be demonstrated as variations in mass
spectra. FIG. 59 shows mass spectra from several ApoE genotypes
available from a pool of 100 patients (Braun, A et al., (1992) Hum.
Genet. 89:401-406). Vertical dashed lines are drawn through those
masses corresponding to the expected Table V diagnostic fragments;
other labeled fragments are invariant. Referring to Table V, note
that a fragment is only considered "invariant" if it is present in
duplicate copies for a given allele; to satisfy this requirement,
such a fragment must be generated in each of the .epsilon.2m
.epsilon.3, and .epsilon.4 alleles.
[0542] The spectrum in FIG. 59a contains all of the expected
invariant fragments above 3 kDa, as well as diagnostic peaks at
3428 and 4021 (both weak), 11276 and 11627 (both intense), 14845,
18271, and 18865 Da. The spectrum in FIG. 59b is nearly identical
except that the pair of peaks at 18 kDa is not detected, and the
relative peak intensities, most notably among the 11-18 kDa
fragments, are different. The spectrum in FIG. 59c also has no 18
kDa fragments, but instead has new low intensity peaks between 5-6
kDa. The intensity ratios for fragments above 9 kDa are similar to
those of FIG. 59b except for a relatively lower 11 kDa fragment
pair. FIG. 59d, which again contains the 5-6 kDa cluster of peaks,
is the only spectrum with no 11 kDa fragments, and like the
previous two also has no 18 kDa fragment.
[0543] Despite the myriad of peaks in each spectrum, each genotype
can be identified by the presence and absence of only a few of the
Table Vb diagnostic peaks. Due to the limited resolution of the
MALDI-TOF instrumentation employed, the most difficult genotypes to
differentiate are those based upon the presence or absence of the
four diagnostic fragments between 5.2 and 6.0 kDa characteristic of
the .epsilon.4 allele, since these fragments nearly overlap with
several invariant peaks. It has been found herein that the 5283 Da
diagnostic fragment overlaps with a depurination peak from the 5412
Da invariant fragment, and the 5781 Da diagnostic peak is normally
not completely resolved from the 5750 Da invariant fragment. Thus,
distinguishing between an .epsilon.2/.epsilon.4 and
.epsilon.2/.epsilon.3, or between an .epsilon.3/.epsilon.4 and an
.epsilon.3/.epsilon.3 allele, relies upon the presence or absence
of the 5880 and 5999 Da fragments. Each of these is present in
FIGS. 59c and 59d, but not in 59a or 59b.
[0544] The genotype of each of the patients in FIG. 59 can be more
rapidly identified by reference to the flowchart in FIG. 60.
Consider the FIG. 59a spectrum. The intense pair of peaks at 11 kDa
discounts the possibility of homozygous .epsilon.4, but does not
differentiate between the other five genotypes. Likewise, the
presence of the unresolved 14.8 kDa fragments is inconsistent with
homozygous .epsilon.2, but leaves four possibilities
(.epsilon.2/.epsilon.3, .epsilon.2/.epsilon.4,
.epsilon.3/.epsilon.3, .epsilon.3/.epsilon.4). Of these only
.epsilon.2/.epsilon.3 and .epsilon.2/.epsilon.4 are consistent with
the 18 kDa peaks; the lack of peaks at 5283, 5879, 5779, and 5998,
Da indicate that the FIG. 59a sample is .epsilon.2/.epsilon.3.
Using the same procedure, the FIGS. 59b-d genotypes can be
identified as .epsilon.3/3, .epsilon.3/.epsilon.4, and
.epsilon.4/.epsilon.4, respectively. To date, all allele
identifications by this method have been consistent with, and in
many cases more easily interpreted than, those attained via
conventional methods. The assignment can be further confirmed by
assuring that fragment intensity ratios are consistent with the
copy numbers of Table V. For instance, the 14.8 kDa fragments are
of lower intensity than those at 16-17 kDa in FIG. 59a, but the
opposite is seen in FIGS. 59b-d. This is as expected, since in the
latter three genotypes the 14.8 kDa fragments are present in
duplicate, but the first is a heterozygote containing .epsilon.2,
so that half of the amplified products do not contribute to the
14.8 kDa signal. Likewise, comparison of the 11 kDa fragment
intensify to those at 9.6 and 14.8 kDa indicate that this fragment
is double, double, single, and zero copy in FIGS. 59a, d,
respectively. These data confirm that MALDI can perform in a
semi-quantitative way under these conditions.
[0545] ApoE genotyping by Primer Oligo Base Extension (PROBE).
[0546] The PROBE reaction was also tested as a means of
simultaneous detection of the codon 112 and 158 polymorphisms. A
detection primer is annealed to a single-stranded PCR-amplified
template so that its 3' terminus is just downstream of the variable
site. Extension of this primer by a DNA polymerase in the presence
of three dNTPs and one ddXTP (that is not present as a dNTP)
results in products whose length and mass depend upon the identity
of the polymorphic base. Unlike standard Sanger type sequencing, in
which a particular base-specific tube contains -99% dXTP and -1%
ddXTP, the PROBE mixture contains 100% of a particular ddXTP
combined with the other three dNTPs. Thus with PROBE a full stop of
all detection primers is achieved after the first base
complementary to the ddXTP is reached.
[0547] For the .epsilon.2/.epsilon.3 genotype, the PROBE reaction
(mixture of ddTTP, dATP, dCTP, dGTP) causes a Mr(exp) shift of the
codon 112 primer to 5919 Da, and of the codon 158 primer to 6769
and 7967 Da (Table VI); a pair of extension products results from
the single codon 158 primer because the .epsilon.2/.epsilon.3
genotype is heterozygous at this position. Three extension products
(one from codon 158, two from 112) are also observed from the
heterozygote .epsilon.3/.epsilon.4 (FIG. 61c and Table VI), while
only two products (one from each primer) are observed from the FIG.
61b (.epsilon.3/.epsilon.3) and FIG. 59d (.epsilon.4/.epsilon.4)
homozygote alleles. Referring to Table VI, each of the available
alleles result in all expected ddT reaction product masses within
0.1% of the theoretical mass, and thus each is unambiguously
characterized by this data alone. Further configuration of the
allele identities may be obtained by repeating the reaction with
ddCTP (plus dATP, dTTP, dGTP); these results, summarized also in
Table VI, unambiguously confirm the ddT results.
[0548] Appropriateness of the methods. Comparison of FIG. 59
(restriction digestion) and 61 (PROBE) indicates that the PROBE
method provides far more easily interpreted spectra for the
multiplex analysis of codon 112 and 158 polymorphisms than does the
restriction digest analysis. While the digests generate up to -25
peaks per mass spectrum and in some case diagnostic fragments
overlapping with invariant fragments, the PROBE reaction generates
a maximum of only two peaks per detection primer (i.e.
polymorphism). Automated peak detection, spectrum analysis, and
allele identification would clearly be far more straightforward for
the latter. Spectra for highly multiplexed PROBE, in which several
polymorphic sites from the same or different amplified products are
measured from one tube, are also potentially simple to analyze.
Underscoring its flexibility, PROBE data analysis can be further
simplified by judicious a priori choice of primer lengths, which
can be designed so that no primers or products can overlap in
mass.
[0549] Thus while PROBE is the method of choice for large scale
clinical testing of previously well characterized polymorphic
sites, the restriction digest analysis as described here is ideally
suited to screening for new mutations. The identity of each of the
two polymorphisms discussed in this study affects the fragment
pattern; if this is the only information used, then the MS
detection is a faster alternative to conventional electrophoretic
separation of restriction fragment length polymorphism products.
The exact measurement of fragment M.sub.r values can also give
information on about sites completely remote from the enzyme
recognition site since other single point mutations necessarily
alter the mass of each of the single strands of the double stranded
fragment containing the mutation. The 252 bp amplified product
could also contain allelic variants resulting in, for example,
previously described GlyI27 Asp (Weisgraber, K H et al., (1984) J.
Clin. Invest. 73:1024-1033), ArgI36Ser (Wardell, M R et al., (1987)
J. Clin. Invest. 80:483-490), ArgI42Cys (Horie, Y et al, (1992) J.
Biol. Chem. 267:1962-1968), Arg145Cys (Rail S C Jr et al., (1982)
Proc. Natl. Acad. Sci. U.S.A. 79:4696-4700), LysI46Glu (Mann, W A
et al., (1995) J. Clin. Invest. 96:1100-1107), or LysI46Gln (Smit,
M et al., (1990) J. Lipid Res. 31:45-53) substitutions. The
G.fwdarw.A base substitution which codes for the Gly127 Asp amino
acid substitution would result in a -16 Da shift in the sense
strand, and in a +15 Da (C.fwdarw.T) shift in the antisense strand,
but not in a change in the restriction pattern. Such a minor change
would be virtually invisible by electrophoresis; however, with
accurate mass determination the substitution could be detected; the
invariant 55-mer fragment at 16240 (sense) and 17175 Da would shift
to 16224 and 17190 Da, respectively. Obtaining the mass accuracy
required to detect such minor mass shifts using current MALDI-TOF
instrumentation, even with internal calibration, is not routine
since minor unresolved adducts and/or poorly defined peaks limit
the ability for accurate mass calling. With high performance
electrospray ionization Fourier transform (ESI-FTMS) single Da
accuracy has been achieved with synthetic oligonucleotides (Little,
D P et al., (1995) Proc. Natl. Acad. Sci. U.S.A. 92:2318-2322) up
to 100-mers (Little, D P et al., (1994) J. Am. Chem. Soc.
116:4893-4897), and similar results have recently been achieved
with up to 25-mers using MALDI-FTMS (Li, Y et al, (1996) Anal.
Chem. 68:2090-2096).
EXAMPLE 13
[0550] A Method for Mass Spectrometric Detection of DNA Fragments
Associated With Telomerase Activity
[0551] Introduction
[0552] One-fourth of all deaths in the United States are due to
malignant tumors (R. K. Jain, (1996) Science 271:1079-1080). For
diagnostic and therapeutic purposes there is a high interest in
reliable and sensitive methods of tumor cell detection.
[0553] Malignant cells can be distinguished from normal cells by
different properties. One of those is the immortalization of
malignant cells which enables uncontrolled cell-proliferation.
Normal diploid mammalian cells undergo a finite number of
population doublings in culture, before they undergo senescence. It
is supposed that the number of population doublings in culture,
before they undergo senescence. It is supposed that the number of
population doublings is related to the shortening of chromosome
ends, called telomers, in every cell division. The reason for said
shortening is based on the properties of the conventional
semiconservative replication machinery. DNA polymerases only work
in 5' to 3' direction and need an RNA primer.
[0554] Immortalization is thought to be associated with the
expression of active telomerase. Said telomerase is a
ribonucleoprotein catalyzing repetitive elongation of templates.
This activity can be detected in a native protein extract of
telomerase containing cells by a special PCR-system (N. W. Kim et
al. (1994) Science 266:2011-2015) known as telomeric repeat
amplification protocol (TRAP). The assay, as used herein, is based
on the telomerase specific extension of a substrate primer (TS) and
a subsequent amplification of the telomerase specific extension
products by a PCR step using a second primer (bioCX) complementary
to the repeat structure. The characteristic ladder fragments of
those assays are conventionally detected by the use of gel
electrophoretic and labeling or staining systems. These methods can
be replaced by MALDI-TOF mass spectrometry leading to faster
accurate and automated detection.
[0555] Materials and Methods
[0556] Preparation of Cells
[0557] 1.times.10.sup.6 cultured telomerase-positive cells were
pelleted, washed once with PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM
Na.sub.2HPO.sub.4.7H.sub.2O, 1.4 mM KH.sub.2PO.sub.4 in sterile
DEPC water). The prepared cells may be stored at -75.degree. C.
Tissue samples have to be homogenized, according to procedures well
known in the art, before extraction.
[0558] Telomerase Extraction
[0559] Pellet was resuspended in 200 .mu.l CHAPS lysis buffer (10
mM Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 1 mM EGTA, 0.1 mM benzamidine,
5 mM, .beta.-mercaptoethanol, 0.5% CHAPS, 10% glycerol) and
incubated on ice for 30 min. The sample was centrifuged at 12,000 g
for 30 min at 4.degree. C. The supernatant was transferred into a
fresh tube and stored at 75.degree. C. until use.
[0560] TRAP-Assay
[0561] 2 .mu.l of telomerase extract were added to a mixture of
10.times. TRAP buffer (200 mM Tris-HCl pH 8.3, 15 mM MgCl.sub.2,
630 mM KCl, 0.05% Tween 20, 10 mM EGTA) 50.times. dNTP-mix (2.5 mM
each dATP, dTTP, dGTP, and dCTP), 10 pmol of TS primer and 50 pmol
of bio CX primer in a final volume of 50 .mu.l. The mixture was
incubated at 30.degree. C. for 10 minutes and 5 min. at 94.degree.
C., 2 units of Taq Polymerase were added and a PCR was performed
with 30 cycles of 94.degree. C. for 30 seconds, 50.degree. C. for
30 seconds and 72.degree. C. for 45 seconds.
[0562] Purification of TRAP-Assay Products
[0563] For every TRAP-assay to be purified, 50 .mu.l Streptavidin
M-280 Dynabeads (10 mg/ml) were washed twice with 1.times. BW
buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl). 50 .mu.l of
2.times. BW buffer were added to the PCR mix and the beads were
resuspended in this mixture. The beads were incubated under gentle
shaking for 15 min. at ambient temperature. The supernatant was
removed and the beads were washed twice with 1.times. BW buffer. To
the beads 50 pi 25% ammonium hydroxide were added and incubated at
60.degree. C. for 10 min. The supernatant was saved, the procedure
repeated, both supernatants were pooled and 300 .mu.l ethanol
(100%) were added. After 30 min. the DNA was pelleted at 13,000 rpm
for 12 min., the pellet was air-dried and resuspended in 600 nl
ultrapure water.
[0564] MALDI-TOF MS of TRAP-Assay Products
[0565] 300 .mu.l sample were mixed with 500 nl of saturated
matrix-solution (3-HPA:ammonium citrate=10:1 molar ratio in 50%
aqueous acetonitrile), dried at ambient temperature and introduced
into the mass spectrometer (Vision 2000, Finigan MAT). All spectra
were collected in reflector mode using external calibration.
[0566] Sequences and Masses
16 bioCX: d(bio-CCC TTA CCC TTA CCC TTA CCC TAA SEQ ID NO.45),
mass: 7540 Da. TS: d(AAT CCG TGC AGC AGA GTT SEQ ID NO.46), mass:
5523 Da.
[0567] Telomeric-repeat structure: (TTAGGG).sub.n, mass of one
repeat: 1909.2
[0568] Amplification Products:
[0569] TS elongated by three telomeric repeats (first amplification
product): 12452 Da. (N.sub.3)
[0570] TS elongated by four telomeric repeats: 14361 Da.
(N.sub.4)
[0571] TS elongated by seven telomeric repeats: 20088 Da.
(N.sub.7)
[0572] Results
[0573] FIG. 62 depicts a section of a TRAP-assay MALDI-TOF mass
spectrum. Assigned are the primers TS and bioCX at 5497 and 7537
Da, respectively (calculated 5523 and 7540 Da). The signal marked
by an asterisk represents n-1 primer product of chemical DNA
synthesis. The first telomerase specific TRAP-assay product is
assigned at 12775 Da. This product represents a 40-mer containing
three telomeric repeats. Due to primer sequences this is the first
expected amplification product of a positive TRAP-assay. The
product is elongated by an additional nucleotide due to extendase
activity of Taq DNA polymerase (calculated non-extended product:
12452 Da, by A extended product: 12765 Da). The signal at 6389 Da
represents the doubly charged ion of this product (calculated: 6387
Da). FIG. 63 shows a section of higher masses of the same spectrum
as depicted in FIG. 62, therefore the signal at 12775 Da is
identical to that in FIG. 62. The TRAP-assay product containing
seven telomeric repeats, representing a 64-mer also elongated by an
additional nucleotide, is detected at 20322 Da (calculated: 20395
Da). The signals marked 1, 2, 3 and 4 cannot be base-line resolved.
This region includes of: 1. signal of dimeric n-1 primer, 2. second
TRAP-assay amplification product, containing 4 telemeric repeats
and therefore representing a 46-mer (calculated: 14341 Da/14674 Da
for extendase elongated product) and 3. dimeric primer-ion and
furthermore all their corresponding depurination signals. There is
a gap observed between the signals of the second and fifth
extension product. This signal gap corresponds to the reduced band
intensities observed in some cases for the third and fourth
extension product in autoradiographic analysis of TRAP-assays (N.
W. Kim et al. (1994) Science 266:2013).
[0574] The above-mentioned problems, caused by the dimeric primer
and related signals, can be overcome using an ultrafiltration step
employing a molecular weight cut-off membrane for primer removal
prior to MALDI-TOF-MS analysis. This will permit an unambiguous
assignment of the second amplification product.
EXAMPLE 14
[0575] A Method for Detecting Neuroblastoma-Specific Nested
RT-Amplified Products via MALDI-TOF Mass Spectrometry
[0576] Introduction
[0577] Neuroblastoma is predominantly a tumor of early childhood
with 66% of the cases presenting in children younger than 5 years
of age. The most common symptoms are those due to tumor mass, bone
pain, or those caused by excessive catecholamine secretion. In rare
cases, neuroblastoma can be identified prenatally (R. W. Jennings
et al, (1993) J. Ped. Surgery 28:1168-1174). Approximately 70% of
all patients with neuroblastoma have metastatic disease at
diagnosis. The prognosis is dependent on age at diagnosis, clinical
stage and other parameters.
[0578] For diagnostic purposes there is a high interest in reliable
and sensitive methods of tumor cell detection, e.g., in control of
autologous bone marrow transplants or on-going therapy.
[0579] Since catecholamine synthesis is a characteristic property
of neuroblastoma cells and bone marrow cells lack this activity (H.
Naito et al., (1991) Eur. J. Cancer 27:762-765), neuroblastoma
cells or metastasis in bone marrow can be identified by detection
of human tyrosine 3-hydroxylase (E.C. 1.14.16.2, hTH) which
catalyzes the first step in biosynthesis of catecholamines.
[0580] The expression of hTH can be detected via reverse
transcription (RT) polymerase chain reaction (PCR) and the
amplified product can be analyzed via MALDI-TOF mass
spectrometry.
[0581] Materials and Methods
[0582] Cell- or tissue-Treatment
[0583] Cultures cells were pelleted (10 min. 8000 rpm) and washed
twice with PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM
Na.sub.2HPO.sub.4.7H.sub.2O, 1.4 mM KH.sub.2PO.sub.4 in sterile
PEPC water). The pellet was resuspended in 1 ml lysis/binding
buffer (100 mM Tris-HCl, pH 8.0, 500 mM LiCl, 10 mM EDTA, 1%
Li-dodecyl sulfate, 5 mM DTT) until the solution becomes viscose.
Viscosity was reduced by DNA-shear step using a 1 ml syringe. The
lysate may be stored in -75.degree. C. or processed further
directly. Solid tissues (e.g., patient samples) have to be
homogenized before lysis.
[0584] Preparation of Magnetic Oligo-dT(25) Beads
[0585] 100 .mu.L beads per 1.times.10.sup.6 cells were separated
from the storage buffer and washed twice with 200 .mu.L
lysis/binding buffer.
[0586] Isolation of Poly A.sup.+ RNA
[0587] The cell lysate was added to the prepared beads and
incubated for 5 min. at ambient temperature. The beads were
separated magnetically for 2-5 min. and washed twice with 0.5 ml
LDS (10 mM Tris-HCl, pH 8.0, 0.15 M LiCl, 1 mM EDTA, 0.1%
LIDS).
[0588] Solid-Phase First-Strand cDNA Synthesis
[0589] The poly A.sup.+ RNA containing beads were resuspended in 20
.mu.L of reverse transcription mix (50 mM Tris-HCl, pH 8.3, 8 mM
MgCl.sub.2, 30 mM KCl, 10 mM DTT, 1.7 mM dNTPs, 3 U AMV reverse
transcriptase) and incubated for 1 hour at 45.degree. C. (with a
resuspension step all ten min.). The beads were separated from the
reverse transcription mix, resuspended in 50 .mu.L of elution
buffer (2 mM EDTA pH 8.0) and heated to 95.degree. C. for 1 min.
fur elution of the RNA. The beads with the cDNA first-strand can be
stored in TB (0.089 M Tris-base, 0.089 M boric acid, 0.2 mM EDTA pH
8.0), TE 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) or 70% ethanol for
further processing.
[0590] Nested Polymerase Chain Reaction
[0591] Beads containing cDNA first-strand were washed twice with
1.times. PCR buffer (20 mM Tris-HCl pH 8.75, 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 2 mM MgSO.sub.4, 0.1% Triton X-100, 0.1
mg bovine serum albumin) and resuspended in PCR mix (containing
100) pmol of each outer primer, 2.5 u Pfu (exo-) DNA polymerase,
200 .mu.M of each dNTP and PCR buffer in a final volume of 50
.mu.L). The mixture was incubated at 72.degree. C. 1 min. and
amplified by PCR for 30 cycles. for the nested reaction: 1 .mu.L of
the first PCR was added as template to a PCR mix d(as above but
nested primers instead of outer primers) and subjected to the
following temperature program: 94.degree. C. 1 min., 65.degree. C.
1 min. and 72.degree. C. 1 min. for 20 cycles.
[0592] Purification of Nested Amplified Products
[0593] Primers and low-molecular reaction by-products are removed
using 10,000 Da cut-off ultrafiltration-unit. Ultrafiltration was
performed at 7,500 g for 25 minutes. For every PCR to be purified,
50 .mu.L Streptavidin M-280 Dynabeads (10 mg/ml) were washed twice
with 1.times.BW buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M
NaCl), added to the ultrafiltration membrane and incubated under
gentle shaking for 15 min. at ambient temperature. The supernatant
was removed and the beads were washed twice with 1.times.BW buffer.
50 .mu.L 25% ammonium hydroxide were added to the beads and
incubated at ambient temperature for 10 min. The supernatant was
saved, the procedure repeated, both supernatants were pooled and
300 .mu.L ethanol (100%) were added. After 30 min. the DNA was
pelleted at 13,000 rpm for 12 min., the pellet was air-dried and
resuspended in 600 nl ultrapure water.
[0594] MALDI-TOF MS of Nested Amplified Products
[0595] 300 nl sample was mixed with 500 nl of saturated
matrix-solution (3-HPA: ammonium citrate=10:1 molar ratio in 50%
aqueous acetonitrile), dried at ambient temperature and introduced
into the mass spectrometer (Vision 2000, Finigan MAT). All spectra
were collected in reflector mode using external calibration.
17 Outer primers: hTH1: d(TGT GAG AGC TGG ACA AGT GT SEQ ID NO:47)
hTH2: d(GAT ATT GTC TTC CCG GTA GC SEQ ID NO:48) Nested primers:
bio-hTH d(bio-CTC GGA CCA GGT GTA CCG CC SEQ ID NO:49), mass: 6485
Da hTH6; d(CCT GTA CTG GAA GGC GAT CTC SEQ ID NO:50), mass: 6422 21
Da mass of biotinylated single strand amplified product: 19253:6 Da
mass of nonbiotinylated single strand amplified product: 18758.2
Da
[0596] Results
[0597] A MALDI-TOF mass spectrum of a human tyrosine 3-hydroxylase
(hTH) specific nested amplified product (61-mer) is depicted in
FIG. 64. The signal at 18763 Da corresponds to non-biotinylated
strand of the amplified product (calculated: 18758.2 Da, mass
error: 0.02 Da). The signals below 10,000 and above 35,000 Da are
due to multiply charged and dimeric amplified product-ions,
respectively.
[0598] The product was obtained from a solid phase cDNA derived in
a reverse transcription reaction from 1.times.10.sup.6 cells of a
neuroblastoma cell-line (L-A-N-1) as described above. The cDNA
first-strand was subjected to a first PCR using outer primers (hTH1
and hTH2), an aliquot of this PCR was used as template in a second
PCR using nested primers (biohTH and hTH6). The nested amplified
product was purified and MALDI-TOF MS analyzed:
[0599] The spectrum in FIG. 64 demonstrates the possibility of
neuroblastoma cell detection using nested RT-PCR and MALDI-TOF MS
analysis.
EXAMPLE 15
[0600] Rapid Detection of the RET Proto-Oncogene Codon 634 Mutation
Using Mass Spectrometry
[0601] Material and Methods
[0602] Probe
[0603] The identity of codon 634 in each of the three alleles was
confirmed by RsaI enzymatic digestion, single strand conformational
polymorphism or Sanger sequencing. Exon 11 of the RET gene was PCR
amplified (40 cycles) from genomic DNA using Taq-Polymerase
(Boehringer-Mannheim) with 8 pmol each of 5'-biotinylated forward
(5'-biotin-CAT GAG GCA GAG CAT ACG CA-3' SEQ ID NO:5') and
unmodified reverse (5'-GAC AGC AGC ACC GAG ACG AT-3' SEQ ID NO:52)
primer per tube; amplified products were purified using the Qiagen
(QIAquick" kit to remove unincorporated primers. 15 .mu.l of
amplified product were immobilized on 10 .mu.L (10 mg/mL) Dynal
streptavidin coated magnetic beads, denatured using the
manufacturer's protocol, and the supernatant containing antisense
strand discarded, the PROBE reaction was performed using
thermoSequenase (TS) DNA Polymerase (Amersham) and Pharmacia
dNTP/ddNTPs. 8 pmol of extension primer (5'-CGG CTG CGA TCA CCG TGC
GG-3' SEQ ID NO:53) was added to 13 .mu.L H.sub.2O, 2 .mu.L
TS-buffer, 2 .mu.L 2 mM ddATP (or ddTTP), and 2 .mu.L of 0.5 mM
dGTP/dCTP/dTTP (or dGTP/DCTP/dATP), and the mixture heated for 30
sec@94.degree. C., followed by 30 cycles of 10 sec@94.degree. C.
and 45 sec@50.degree. C.; after a 5 min. incubation@95.degree. C.,
the supernatant was decanted, and products were desalted by ethanol
precipitation with the addition of 0.5 .mu.L of 10 mg/mL glycogen.
The resulting pellet was washed in 70% ethanol, air dried, and
suspended in 1 .mu.L H.sub.2O. 300 nL of this was mixed with the
MALDI matrix (0.7 M 3-hydroxypicolinic acid, 0.07 M ammonium
citrate in 1:1 H.sub.2O:CH.sub.3CN) on a stainless steel sample
probe and air dried. Mass, spectra were collected on a Thermo
Bionalysis Vision 2000 MALDI-TOF operated in reflectron mode with 5
and 20 kV on the target and conversion dynode, respectively.
Experimental masses (m.sub.r(exp)) reported are those of the
neutral molecules as measured using external calibration.
[0604] Direct Measurement of Diagnostic Products
[0605] PCR amplifications conditions for a 44 bp region containing
codon 634 were the same as above but using Pfu polymerase; the
forward primer contained a ribonucleotide at its 3'-terminus
(forward, 5'-GAT CCA CTG TGC GAC GAG C (SEQ ID NO:54)-ribo;
reverse, 5'-GCG GCT GCG ATC ACC GTG C (SEQ ID NO:55). After product
immobilization and washing, 80 .mu.L of 12.5% NH.sub.4OH was added
and heated at 80.degree. C. overnight to cleave te primer from
44-mer (sense strand) to give a 25-mer. Supernatant was pipetted
off while still hot, dried resuspended in 50 .mu.L H.sub.2O,
precipitated, resuspended, and measured by MALDI-TOF as above.
MALDI-FTMS spectra of 25-mer synthetic analogs were collected as
previously described (Li, Y. et al., (1996) Anal. Chem.
68:2090-2096); briefly, 1-10 pmol DNA was mixed 1:1 with matrix on
a direct insertion probe, admitted into the external ion source
(positive ion mode), ionized upon irradiance with a 337 nm
wavelength laser pulse, and transferred via rf-only quadruple rods
into a 6.5 Tesla magnetic field where they were trapped
collisionally. After a 15 second delay, ions were excited by a
broadband chirp pulse and detected using 256K data points,
resulting in time domain signals of 5 s duration. Reported
(neutral) masses are those of the most abundant isotope peak after
subtracting the mass of the charge carrying proton (1.01 Da).
[0606] Results
[0607] The first scheme presented utilizes the PROBE reaction shown
schematically in FIG. 65. A 20-mer primer is designed to bind
specifically to a region on the complementary template downstream
of the mutation site; upon annealing to the template, which is
labelled with biotin and immobilized to streptavidin coated
magnetic beads, the PROBE primer is presented with a mixture of the
three deoxynucleotide triphosphates (dNTPs), a di-dNTP (ddNTP), and
a DNA polymerase (FIG. 65). The primer is extended by a series of
bases specific to the identity of the variable base in codon 634;
for any reaction mixture (e.g., ddA+dT+dC+dG), three possible
extension products representing the three alleles are possible
(FIG. 65).
[0608] For the negative control (FIG. 66), the PROBE reaction with
ddATP+dNTPs (N=T, C, G) causes a M.sub.r(exp) shift of the primer
from 6135 to 6726 Da (.DELTA.m +591). The absence of a peak at 6432
rules out a C.fwdarw.A mutation (FIG. 65); the mass of the single
observed peak is more consistent with extension by C-ddA
(M.sub.r(calc) 6721,+0.07% error) than by T-ddA (M.sub.r(calc)
6736,-0.15% error) than of A.sub.3TC.sub.2G expected for C.fwdarw.A
mutant. Combining the ddA and ddT reaction data, it is clear that
the negative control is as expected homozygous normal at codon
634.
[0609] The ddA reaction for patient 1 also results in a single peak
(M.sub.r(exp)=6731) between expected values for wildtype and
C.fwdarw.T mutation (FIG. 65b). The ddT reaction, however, results
in two clearly resolved peaks consistent with a heterozygote
wildtype (M.sub.r(exp) 8249, +0.04% mass error)/C.fwdarw.T mutant
(M.sub.r(exp) 6428 Da, +0.08% mass error). For patient 2, the pair
of FIG. 66c ddA products represent a heterozygote C.fwdarw.A
(M.sub.r(exp) 6431,-0.06% mass error)/normal (M.sub.r(exp)
6719,-0.03% mass error) allele. The ddT reaction confirms this,
with a single peak measured at 8264 Da consistent with unresolved
wildtype and C.fwdarw.A alleles. The value of duplicate experiments
is seen by comparing FIGS. 66a and 66b; while for patient 1 the
peak at 6726 from the ddA reaction represents only one species,
similar peak from patient 1 is actually a pair of unresolved peaks
differing in mass by 15 Da.
[0610] An alternate scheme for point mutation detection is
differentiation of alleles by direct measurement of diagnostic
product masses. A 44-mer containing the RET634 site was generated
by the PCR, and the 19-mer sense primer removed by NH.sub.4OH
cleavage at a ribonucleotide at its 3' terminus.
[0611] FIG. 67 shows a series of MALDI-FTMS spectra of synthetic
analogs of short amplified products containing the RET634 mutant
site. FIGS. 67a-c and 67d-f are homozygous and heterozygous
genotypes, respectively. An internal calibration was done using the
most abundant isotope peak for the wildtype allele; application of
this (external) calibration to the five other spectra resulted in
better than 20 ppm mass accuracy for each. Differentiation by mass
alone of the alleles is straightforward, even for heterozygote
mixtures whose components differ by 16.00 (FIG. 67d), 2501 (FIG.
67e), or 9.01 Da (FIG. 65f). The value of high performance MS is
clear when recognition of small DNA mass shifts is the basis for
diagnosis of the presence or absence of a mutation. The recent
reintroduction of delayed extraction (DE) techniques has improved
the performance of MALDI-TOF with shorts DNAs (Roskey, M. T. et
al., (1996) Anal. Chem. 68:941-946); a resolving power (RP) of
>10.sup.3 has been reported for a mixed-base 50-mer, and a pair
of 31-mere with a C or a T (.DELTA.m 15 Da) at a variable position
resolved nearly to baseline. Thus DE-TOF-MS has demonstrated the RP
required for separation of the individual components of
heterozygotes. Even with DE, however, the precision of DNA mass
measurement with TOF is typically 0.1% (8 Da at 8 kDa) using
external calibration, sufficiently high to result in incorrect
diagnoses. Despite the possibility of space charge induced
frequency shifts (Marshall, A. G. et al. (1991) Anal. Chem. 63:21
5A-229A), MALDI-FTMS mass errors are rarely as high as 0.005% (0.4
Da at 8 KDa), making internal calibration unnecessary.
[0612] The methods for DNA point mutation presented here are not
only applicable to the analysis of single base mutations, but also
to less demanding detection of single or multiple base insertions
or deletions, and quantification of tandem two, three, or four base
repeats. The PROBE reaction yields products amenable to analysis by
relatively low performance ESI or MALDI instrumentation; direct
measurement of short amplified product masses is an even more
direct means of mutation detection,and will likely become more
widespread with the increasing interest in high performance MS
available with FTMS.
EXAMPLE 16
[0613] Immobilization of Nucleic Acids on Solid Supports via an
Acid-Labile Covalent Bifunctional Trityl Linker
[0614] Aminolinked DNA was prepared and purified according to
standard methods. A portion (10 eq) was evaporated to dryness on a
speedvac and suspended in anhydrous DMF/pyridine (9:1; 0.1 ml). To
this was added the chlorotrityl chloride resin (1 eq, 1.05
.mu.mol/mg loading) and the mixture was shaken for 24 hours. The
loading was checked by taking a sample of the resin, detritylating
this using 80% AcOH, and measuring the absorbance at 260 nm.
Loading was ca. 150 pmol/mg resin.
[0615] In 80% acetic acid, the half-life of cleavage was found to
be substantially less than 5 minutes--this compares with trityl
ether-based approaches of half-lives of 105 and 39 minutes for para
and meta substituted bifunctional dimethoxytrityl linkers
respectively. Preliminary results have also indicated that the
hydroxy picolinic acid matrix alone is sufficient to cleave the DNA
from the chlorotrityl resin.
EXAMPLE 17
[0616] Immobilization of Nucleic Acids on Solid Supports via
Hydrophobic Trityl Linker
[0617] The primer contained a 5'-dimethoxytrityl group attached
using routine trityl-on DNA synthesis.
[0618] CI8 beads from an oligo purification cartridge (0.2 mg)
placed in a filter tip was washed with acetonitrile, then the
solution of DNA (50 ng in 25 .mu.l) was flushed through. This was
then washed with 5% acetonitrile in ammonium citrate buffer (70 mM,
250 .mu.l). To remove the DNA form the CI8, the beads were washed
with 40% acetonitrile in water (10 .mu.l) and concentrated to ca 2
.mu.l on the Speedvac. The sample was then submitted to MALDI.
[0619] The results showed that acetonitrile/water at levels of ca.
>30% are enough to dissociate the hydrophobic interaction. Since
the matrix used in MALDI contains 50% acetonitrile, the DNA can be
released from the support and successfully detected using MALDI-TOF
MS (with the trityl group removed during the MALDI process).
[0620] FIG. 69 is a schematic representation of nucleic acid
immobilization via hydrophobic trityl linkers.
EXAMPLE 18
[0621] Immobilization of Nucleic Acids on Solid Supports via
Streptavidin-Iminobiotin
[0622] Experimental Procedure
[0623] 2-iminobiotin N-hydroxy-succinimid ester (Sigma) was
conjugated to the oligonucleotides with a 3'- or 5-'amino linker
following the conditions suggested by the manufacturer. The
completion of the reaction was confirmed by MALDI-TOF MS analysis
and the product was purified by reverse phase HPLC.
[0624] For each reaction, 0.1 mg of streptavidin-coated magnetic
beads (Dynabeads M-280 Streptavidin from Dynal) were incubated with
80 pmol of the corresponding oligo in the presence of 1 M NaCl and
50 mM ammonium carbonate (pH 9.5) at room temperature for one hour.
The beads bound with oligonucleotides were washed twice with 50 mM
ammonium carbonate (pH 9.5). Then the beads were incubated in 2
.mu.l of 3-HPA matrix at room temperature for 2 min. An aliquot of
0.5 .mu.l of supernatant was applied to MALDI-TOF. For biotin
displacement experiment, 1.6. mol of free biotin (80-fold excess to
the bound oligo) in 1 .mu.l of 50 mM ammonium citrate was added to
the beads. After a 5 min. incubation at room temperature, 1 .mu.l
of 3-HPA matrix was added and 0.5 .mu.l of supernatant was applied
to MALDI-TOF MS. To maximize the recovery of the bound iminobiotin
oligo, the beads from the above treatment were again incubated with
a 2 .mu.l of 3-HPA matrix and 0.5 .mu.l of supernatant was applied
to MALDI-TOF MS. The matrix alone and free biotin treatment
quantitatively released iminobiotin oligo off the streptavidin
beads as shown in FIGS. 70 and 71.
EXAMPLE 19
[0625] Mutation Analysis Using Loop Primer Oligo Base Extension
[0626] Materials and Methods
[0627] Genomic DNA
[0628] Genomic DNA was obtained from healthy individuals and
patients suffering from sickle cell anemia. The wildtype and
mutated sequences have been evaluated conventionally by standard
Sanger sequencing.
[0629] PCR-Amplification
[0630] PCR amplifications of a part of the .beta.-globin was
established and optimized to use the reaction product without a
further purification step for capturing with streptavidin coated
bead. The target amplification for LOOP-PROBE reactions were
performed with the loop-cod5 d(GAG TCA GGT GCG CCA TGC CTC AAA CAG
ACA CCA TGG CGC, SEQ ID No. 58) as forward primer and .beta.-11-bio
d(TCT CTG TCT CCA CAT GCC CAG, SEQ ID. No. 59) as biotinylated
reverse primer. The underlined nucleotide in the loop-cod5 primer
is mutated to introduce an invariant CfoI restriction site into the
amplicon and the nucleotides in italics are complementary to a part
of the amplified product. The total PCR volume was 50 .mu.l
including 200 ng genomic DNA, 1 U Taq-polymerase
(Boehringer-Mannheim, Cat# 1596594), 1.5 mM MgCl.sub.2, 0.2 mM
dNTPs (Boehringer-Mannheim, Ca# 1277049), and 10 pmol of each
primer. A specific fragment of the .beta.-globin gene was amplified
using the following cycling condition: 5 min 94.degree. C. followed
by 40 cycles of: 30 sec@94.degree. C., 30 sec@ 56.degree. C., 30
sec@72.degree. C., and a final extension of 2 min at 72.degree.
C.
[0631] Capturing and Denaturation of Biotinylated Templates
[0632] 10 .mu.l paramagnetic beads coated with streptavidin (10
mg/ml; Dynal, Dynabeads M-280 streptavidin Cat# 112.06) and treated
with 5.times. binding solution (5 M NH.sub.4Cl, 0.3M NH.sub.4OH)
were added to 40 .mu.l PCR volume (10 .mu.l of the amplified
product was saved for check electrophoresis). After incubation for
30 min at 37.degree. C. the supernatant was discarded. The captured
templates were denatured with 50 .mu.l 100 mM NaOH for 5 min at
ambient temperature, then washed once with 50 .mu.l 50 mM
NH.sub.4OH and three times with 100 .mu.10 mM Tris.Cl, pH 8.0. The
single stranded DNA served as templates for PROBE reactions.
[0633] Primer Oligo Base Extension (PROBE) Reaction
[0634] The PROBE reactions were performed using Sequenase 2.0 (USB
Cat# E70775Z including buffer) as enzyme and dNTPs and ddNTPs
supplied by Boehringer-Mannheim (Cat# 1277049 and 1008382). The
ratio between dNTPs (dCTP, dGTP, dTTP) and ddATP was 1:1 and the
total used concentration was 50 .mu.M of each nucleotide. After
addition of 5 .mu.1-fold Sequenase-buffer the beads were incubated
for 5 min at 65.degree. C. and for 10 min at 37.degree. C. During
this time the partially self complementary primer annealed with the
target site. The enzymatic reaction started after addition of 0.5
.mu.l 100 mM dithiothreitol (DTT), 3.5 .mu.l dNTP/ddNTP solution,
and 0.5 .mu.l Sequenase (0.8 U) and incubated at 37.degree. C. for
10 min. Hereafter, the beads were washed once in 1-fold TE buffer
(10 mM Tris, 1 mM EDTA, pH 8.0).
[0635] CfoI restriction digest. The restriction enzyme digest was
performed in a total volume of 5 .mu.l using 10 U CfoI in 1-fold
buffer L purchased from Boehringer-Mannheim. The incubation time
was 20 min at 37.degree. C.
[0636] Conditioning of the Diagnostic Products for Mass
Spectrometric Analysis
[0637] After the restriction digest, the supernatant was
precipitated in 45 .mu.l H.sub.2O, 10 .mu.l 3M NH.sub.4-acetate (pH
6.5), 0.5 .mu.l glycogen (10 mg/ml in water, Sigma, Cat# G1765),
and 110 .mu.l absolute ethanol for 1 hour at room temperature.
After centrifugation at 13,000 g for 10 min the pellet was washed
in 70% ethanol and resuspended in 2 .mu.l 18 Mohm/cm H.sub.2O. The
beads were washed in 100 .mu.l 0.7 M NH.sub.4- citrate followed by
100 .mu.l 0.05 M NH.sub.4- citrate. The diagnostic products were
obtained by heating the beads in 2 .mu.l 50 mM NH.sub.4OH at
80.degree. C. for 2 min.
[0638] Sample Preparation and Analysis on MALDI-TOF Mass
Spectrometry
[0639] Same preparation was performed by mixing 0.6 .mu.l of matrix
solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic ammonium
citrate in 1:1 H.sub.2O:CH.sub.3CN) with 0.3 .mu.l of either
resuspended DNA/glycogen pellet or supernatant after heating the
beads in 50 mM NH.sub.4OH on a sample target and allowed to air
dry. The sample target was automatically introduced in to the
source region of an unmodified Perspective Voyager MALDI-TOF
operated in delayed extraction linear mode with 5 and 20 kV on the
target and conversion dynode, respectively. Theoretical molecular
mass (M.sub.r(calc)) were calculated from atomic compositions;
reported experimental (M.sub.r(exp)) values are those of the
singly-protonated form.
[0640] Results
[0641] The LOOP-PROBE has been applied to the detection of the most
common mutation of codon 6 of the human .gamma.-globin gene leading
to sickle cell anemia. The single steps of the method are
schematically presented in FIG. 72. For the analysis of codon 6, a
part of the .beta.-globin gene was amplified by PCR using the
biotinylated reverse primer .beta.11 bio and the primer loop-cod5
which is modified to introduce a CfoI recognition site (FIG. 72a).
The amplified product is 192 bp in length. After PCR the
amplification product was bound to streptavidin coated paramagnetic
particles as described above. The antisense strand was isolated by
denaturation of the double stranded amplified product (FIG. 72b).
The intra-molecule annealing of the complementary 3' end was
accomplished by a short heat denaturation step and incubation at
37.degree. C. The 3' end of the antisense strand is now partially
double stranded (FIG. 72c). For analyzing the DNA downstream of the
self annealed 3'-end of the antisense strand, the primer oligo base
extension (PROBE) has been performed using ddATP, dCTP, dGTP, dTTP
(FIG. 72d). This generates different products in length specific
for the genotype of the analyzed individual. Before the
determination of the length of these diagnostic products, the DNA
was incubated with the CfoI restriction endonuclease that cuts 5'
of the extended product. This step frees the stem loop from the
template DNA whereas the extended product still keeps attached to
the template. The extended products are then denatured by heating
from the template stand and analyzed by MALDI-TOF mass
spectrometry.
[0642] Since the MALDI-TOF analyses were performed with a
non-calibrated instrument, the mass deviation between observed and
expected values was approximately 0.6% higher than theoretically
calculated. Nevertheless, the results obtained were conclusive and
reproducible within repeated experiments. In all analyzed
supernatants after the restriction digest the stem loop could be
detected. Independent of the genotype, the stem loop has had in all
analyses molecular masses about 8150 Da (expected 8111 Da). An
example is shown in FIG. 73a. The second peak in this figure with a
mass of 4076 Da is a doubly charged ion of the stem loop. FIG. 73b
to 73d show the analyses of different genotypes as indicated in the
respective inserts. HbA is the wildtype genotype and HbC and HbS
are two different mutations in codon 6 of the .beta.-globin gene
which cause sickle cell disease. In the wildtype situation a single
peak with a molecular mass of 4247 Da and another with 6696 Da are
detected (FIG. 73b). The latter corresponds to the biotinylated PCR
primer (.beta.-11-bio) unused in the PCR reaction which also has
been removed in some experiments. The former corresponds to the
diagnostic product for HbA. The analyses of the two individual DNA
molecules with HbS trait as well as compound heterozygosity
(HbS/HbC) for the sickle cell disorder lead also to unambiguous
expected results (FIG. 73c and 73d).
[0643] In conclusion, the LOOP-PROBE is a powerful means for
detection of mutations especially predominant disease causing
mutations or common polymorphisms. The technique eliminates one
specific reagent for mutation detection and, therefore, simplifies
the process and makes it more amenable to automation. The specific
extended product that is analyzed is cleaved off from the primer
and is therefore shorter compared to the conventional method. In
addition, the annealing efficiency is higher compared to annealing
of an added primer and should therefore generate more product. The
process is compatible with multiplexing and various detection
schemes (e.g., single base extension, oligo base extension and
sequencing). For example, the extension of the loop-primer can be
used for generation of short diagnostic sequencing ladders within
highly polymorphic regions to perform, for example, HLA typing or
resistance as well as species typing (e.g., Mycobacterium
tuberculosis)).
EXAMPLE 20
[0644] T7-RNA Polymerase Dependent Amplification of CKR-5 and
Detection by MALDI-MS
[0645] Materials and Methods
[0646] Genomic DNA
[0647] Human genomic DNA was obtained from healthy individuals
[0648] PCR-Amplification and Purification
[0649] PCR amplification of a part of the CKR-5 gene was
accomplished using ckrT7f as sense primer d(ACC TAG CGT TCA GTT CGA
CTG AGA TAA TAC GAC TCA CTA TAG CAG CTC TCA TTT TCC ATA C (SEQ ID
NO. 60). The underlined sequence corresponds to the sequence
homologous to CKR-5, the bolded sequence corresponds to the T7-RNA
polymerase promoter sequence and the italic sequence was chosen
randomly. ckr5r was used as antisense primer d(AAC TAA GCC ATG TGC
ACA ACA (SEQ ID NO. 61). Purification of the amplified product and
removal of unincorporated nucleotides was carried out using the
QIAquick purification kit (Qiagen, cat# 28104). In the final PCR
volume of 50 .mu.l were 200 ng genomic DNA, 1 U Taq-polymerase
(Boehringer-Mannheim, cat# 1596594), 1.5 mM MgCl.sub.2 0.2 mM dNTPs
(Boehringer-Mannheim, cat# 1277049), and 10 pmol of each primer.
The specific fragment of the CKR-5 gene was amplified using the
following cycling conditions: 5 min@94.degree. C. followed by 40
cycles of 45 sec@94.degree. C., 45 sec 52.degree. C., 5
sec@72.degree. C., and a final extension of 5 min at 72.degree.
C.
[0650] T7-RNA Polymerase Conditions
[0651] One third of the purified DNA (about 60 ng) was used in the
T7-RNA polymerase reaction. (Boehringer-Mannheim, cat# 881 767).
The reaction was carried out for 2h at 37.degree. C. according to
the manufacturer's conditions using the included buffer. The final
reaction volume was 20 .mu.l 0.7 .mu.l RNasin (33 U/.mu.l) had been
added. After the extension reaction, the enzyme was inactivated by
incubation for 5 min at 65.degree. C.
[0652] DNA Digestion and Conditioning of the Diagnostic Products
for Mass Spec Analysis
[0653] The template DNA was digested by adding RNase-free DNase I
(Boehringer-Mannheimn, cat# 776 758) to the inactivated T7 mixture
and incubation for 20 min at room temperature. Precipitation was
carried out by adding 1 .mu.l glycogen (10 mg/ml, Sigma, cat#
G1765), 1/10 volume 3M NH.sub.2- acetate (pH 6.5), and 3 volume
absolute ethanol and incubation for 1 hour at room temperature.
After centrifugation at 13,000 g for 10 min, the pellet was washed
in 70% ethanol and resuspended in 3 .mu.l 18 Mohm/cm H.sub.2O. 1
.mu.l was analyzed on an agarose gel.
[0654] Sample Preparation and Analysis on MALDI-TOF Mass
Spectrometry
[0655] Sample preparation was performed by mixing 0.6 .mu.l of
matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic
ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN) with 0.3 .mu.l of
resuspended DNA/glycogen on a sample target and allowed to air dry.
The sample target was introduced into the source region of an
unmodified Finnigan VISION2000 MALDI-TOF operated in relectron mode
with 5 kV. The theoretical molecular mass was calculated form
atomic composition; reported experimental values are those of
singly-pronated form.
[0656] Results
[0657] The chemokine receptor CKR-5 has been identified as a major
coreceptor in HIV-1 (see e.g., WO 96/39437 to Human Genome
Sciences; Cohen, J. et al. Science 275:1261). A mutant allele that
is characterized by a 32 bp deletion is found in 16% of the HIV-1
seronegative population whereas the frequency of this allele is 35%
lower in the HIV-1 seropositive population. It is assumed that
individuals homozygous for this allele are resistant to HIV-1. The
T7-RNA polymerase dependent amplification was applied to identify
this specific region of the chemokine receptor CKR-5 (FIG. 74).
Human genomic DNA was amplified using conventional PCR. The sense
primer has been modified so that it contains a random sequence of
24 bases that facilitate polymerase binding and the T7-RNA
polymerase promoter sequence (FIG. 75). The putative start of
transcription is at the first base 5' of the promoter sequence.
ckr5r was used as an antisense primer. PCR conditions are outlined
above. The amplified product derived from wildtype alleles is 75 bp
in length. Primer and nucleotides were separated from the
amplification product using the Qiagen QIAquick purification kit.
One third of the purified product was applied to in vitro
transcription with T7-RNA polymerase. To circumvent interference of
the template DNA, it was digested by adding RNase-free DNase I. RNA
was precipitated and this step also leaves the degraded DNA in the
supernatant. Part of the redissolved RNA was analyzed on an agarose
gel and the rest of the sample was prepared for MALDI-TOF analysis.
The expected calculated mass of the product is 24560 Da. A dominant
peak, that corresponds to an approximate mass of 25378.5 Da can be
observed. Since the peak is very broad, an accurate determination
of molecular mass was not possible. The peak does not correspond to
residual DNA template. First, the template DNA is digested, and
second, the DNA strands would have a mass of 23036.0 and 23174 Da,
respectively.
[0658] This example shows that T7 RNA polymerase can effectively
amplify target DNA. The generated RNA can be detected by Mass
spectrometry. In conjunction with modified (e.g.,
3'-deoxy)ribonucleotides that are specifically incorporated by a
RNA polymerase but not extended any further, this method can be
applied to determine the sequence of a template DNA.
EXAMPLE 21
[0659] MALDI Mass Spectrometry of RNA Endonuclease Digests
[0660] Materials
[0661] Synthetic RNA (Sample A:5'-UCCGGUCUGAUGAGUCCGUGAGGAC-3' (SEQ
ID 62); sample B:5'-GUCACUACAGGUGAGCUCCA-3' (SEQ ID NO 63); sample
C:5'-CCAUGCGAGAGUAAGUAGUA-3' (SEQ ID NO. 64)) samples were obtained
from DNA technology (Aahus, Denmark) and purified on a denaturing
polyacrylamide gel (Shaler, T. A. et al. (1996) Anal. Chem.
63:5766-579). Rnases T.sub.1 (Eurogentec), U.sub.2 (Calbiochem), A
(Boehringer-Mannheim) and PhyM (Pharmacia) were used without
additional purification. Streptavidin-coated magnetic beads
(Dynabeads M-280 Streptavidin, Dynal) were supplied as a suspension
of 6-7.times.10.sup.8 bead/ml (10 mg/ml) dissolved in
phosphate-buffered saline (PBS) containing 0.1% BSA and 0.02%
NaN.sub.3. 3-Hydroxypicolinic acid (3-HPA) (Aldrich) was purified
by a separate desalting step before use as described in more detail
elsewhere (Little, D. P. et al. (1995) Proc. Natl. Acad. Sci.
U.S.A. 92, 2318-2322).
[0662] Methods
[0663] In vitro Transcription Reaction.
[0664] The 5'-biotinylated 49 nt in vitro transcript (SEQ ID No.
65): AGGCCUGCGGCAAGACGGAAAGACCAUGGUCCCUNAUCUGCCGCAGGAUC was
produced by transcription of the plasmid pUTMS2 (linearized with
the restriction enzyme BamHI) with T7 RNA polymerase (Promega). For
the transcription reaction 3 .mu.g template DNA and 50u T7 RNA
polymerase were used in a 50 .mu.l volume of 1 u/.mu.l RNA guard
(Rnax inhibitor, Pharmacia), 0.5 mM NTP's 1.0 mM 5'-biotin-ApG
dinucleotide, 40 mM Tris-HCl (pH 8.0), 6 mM MgCl.sub.2 2 mM
spermidine and 10 mM DTT. Incubation was performed at 37.degree. C.
for 1 hour, then another aliquot of 50 units T7 RNA polymerase was
added and incubation was continued for another hour. The mixture
was adjusted to 2M NH.sub.4 acetate and the RNA was precipitated by
addition of one volume of ethanol and one volume of isopropanol.
The precipitated RNA was collected by centrifugation at
20,000.times. g for 90 min at 4.degree. C., the pellet was washed
with 70% ethanol, dried and redissolved at 8 M urea. Further
purification was achieved by electrophoresis through a denaturing
polyacrylamide gel as described elsewhere (Shaler, T. A. et al.
(1996) Anal. Chem. 68:576-579). The ration of 5'-biotinylated to
non-biotinylated transcripts was about 3:1.
[0665] Ribonuclease Assay.
[0666] For partial digestion with selected RNases different enzyme
concentrations ad assay conditions were employed as summarized in
table VII. The solvents for each enzyme were selected following the
suppliers' instructions. The concentrations of the synthetic RNA
samples and the in vitro transcript were adjusted to
5-10.times.10.sup.-6M.
18TABLE VII Overview and Assay Conditions of the RNAses
Concentration Incubation Time [units Rnase/ (max. number Rnase
Source .mu.gRNA] Conditions of fragments) References T.sub.1
Aspergillus oryzae 0.2 20 mM Tris-HCl, 5 min. Donis-Keller, H. et
al., (1977) pH5.7, 37.degree. C. Nuc. Acids Res. 4:2527- 2537
U.sub.2 Ustilago 0.01 20 mM DAC, pH 5.0, 15 min Donis-Keller, H. et
al., (1977) Sphaerogena 37.degree. C. Nuc. Acids Res. 4:2527- 2537
PhyM Physarum 20 20 mM DAC, pH 5.0, 15 min Donis-Keller, H. et al.,
(1980) polycephalu m 50.degree. C. Nucl. Acids Res. 8:3133 3142 A
bovine pancrease 4 .times. 10.sup.-9 10 mM Tris-HCl, pH 30 min
Breslow, R. and R. Xu. 7.5, 37.degree. C. (1993) Proc. Natl. Acad.
Sci. USA 90:1201-1207 CL.sub.3 chicken liver 0.01 10 mM Tris-HCl,
pH 30 min Boguski, et al., (1980) J. 6.5, 37.degree. C. Biol. Chem.
255:2160-2163 cusativin cucumis sativus L. 0.05 ng 10 mM Tris-HCl,
pH 30 min Rojo, M. A. et al. (1994) 6.5, 37.degree. C. Planta
194:328-338
[0667] The reaction was stopped at selected times by mixing 0.6
.mu.l aliquots of the assay with 1.5 .mu.l of 3 HPA-solution. The
solvent was subsequently evaporated in a stream of cold air for the
MALDI-MS analysis.
[0668] Limited alkaline hydrolysis was performed by mixing equal
volumes (2.0 .mu.l) of 25% ammonium hydroxide and RNA sample
(5-10.times.10.sup.-6 M) at 60.degree. C. 1 .mu.l aliquots were
taken out at selected times and dried in a stream of cold air. For
these samples it turned out to be important to first dry the
digests in a stream of cold air, before 1.5 .mu.l of the matrix
solution and 0.7 .mu.l of NH.sub.4+loaded cation exchanged polymer
beads were added.
[0669] The reaction was stopped at selected times by mixing 0.6
.mu.l aliquots of the assay with 1.5 .mu.l of 3HPA-solution. The
solvent was subsequently evaporated in a stream of cold air for the
MALDI-MS analysis.
[0670] Limited alkaline hydrolysis was performed by mixing equal
volumes (2.0 .mu.l) of 25% ammonium hydroxide and RNA sample
(5-10.times.10.sup.-6 M) at 60.degree. C. 1 .mu.l aliquots were
taken out at selected times and dried in a stream of cold air. For
these samples it turned out to be important to first dry the
digests in a stream of cold air, before 1.5 .mu.l of the matrix
solution and 0.7 .mu.l if a suspension of NH.sub.4+loaded cation
exchange polymer beads were added.
[0671] Separation of 5'-Biotinylated Fragments.
[0672] Steptavidin-coated magnetic beads were utilized to separate
5'-biotinylated fragments of the in vitro transcript after partial
RNase degradation. The biotin moiety in this sample was introduced
during the transcription reaction initiated by the
5'-biotin-pApG-dinucleotide. Prior to use, the beads were washed
twice with 2.times. binding & washing (b&w) buffer (20 mM
Tris-HCl, 2 mM EDTA, 2 M NaCl pH 8.2) and resuspended at 10 mg/ml
in 2.times. b&w buffer. Circa 25 pmol of the RNA in vitro
transcript were digested by RNase U2 using the protocol described
above. The digestion was stopped by adding 3 .mu.l of 95% formamide
containing 10 mM
trans-1,2-diaminocyclohexane-N,N,N.sup.1,N.sup.1-tetraacetic acid
(CDTA) at 90.degree. C. for 5 min, followed by cooling on ice.
Subsequently, capture of the biotinylated fragments was achieved by
incubation of 6 .mu.l of the digest with 6 .mu.l of the bead
suspension and 3 .mu.l of b&w buffer at room temperature for 15
min. Given the binding capacity of the beads of 200 pmol of
biotinylated oligonucleotide per mg of beads, as specified by the
manufacturer, the almost 2-times excess of oligonucleotide was used
to assure a full loading of the beads. The supernatant was removed,
and the beads were washed twice with 6 .mu.l of H.sub.2O. The CDTA
and 95% formamide at 90.degree. C. for 5 min. After evaporation of
the solvent and the formamide the .ltoreq.2.5 pmol of fragments
were resuspended in 2 .mu.l H.sub.2O and analyzed by MALDI-MS as
described above.
[0673] Sample Preparation for MALDI-MS
[0674] 3-Hydroxypicolinic Acid (3-HPA) was dissolved in ultra pure
water to a concentration of ca. 300 mM. Metal cations were
exchanged against NH.sub.4.sup.+ as described in detail previously.
(Little, D. P. et al. (1995)Proc. Natl. Acad. Sci. U.S.A. 92:
2318-2322). Aliquots of 0.6 .mu.l of the analyte solution were
mixed with 1.5 .mu.l 3-HPA on a flat inert metal substrate.
Remaining alkali cations, present in the sample solution as well as
on the substrate surface, were removed by the addition of 0.7 .mu.l
of the solution of NH.sub.4.sup.+-loaded cation exchange polymer
beads. During solvent evaporation, the beads accumulated in the
center of the preparation, were not used for the analysis, and were
easily removed with a pipette tip.
[0675] Instrument
[0676] A prototype of the Vision 2000 (ThermBioanalysis, Hemel,
Hempstead, UK) reflectron time of flight mass spectrometer was used
for the mass spectrometry. Ions were generated by irradiation with
a frequency-tripled ND:YAG laser (355 nm, 5 ns; Spektrum GmbH,
Berlin, Germany) and accelerated to 10 ke V. Delayed ion extraction
was used for the acquisition of the spectra shown, as it was found
to substantially enhance the signal to noise ratio and/or signal
intensity. The equivalent flight path length of the system is 1.7
m, the base pressure is 10.sup.4.sup.- Pa. Ions were detected with
a discrete dynode secondary-electron multiplier (R2362, Hamamatsu
Photonics), equipped with a conversion dynode for effective
detection of high mass ions. The total impact energy of the ions on
the conversion dynode was adjusted to values ranging from 16 to 25
keV, depending on the mass to be detected. The preamplified output
signal of the SEM was digitized by a LeCroy 9450 transient recorder
(LeCroy, Chestnut Ridge, N.Y., USA) with a sampling rate of up to
400 MHz. For storage and further evaluation, the data were
transferred to a personal computer equipped with custom-made
software (ULISSES). All spectra shown were taken in the positive
ion mode. Between 20 and 30 single shot spectra were averaged for
each of the spectra shown.
[0677] Results
[0678] Specificity of Rnases
[0679] Combining base-specific RNA cleavage with MALDI-MS requires
reaction conditions optimized to retain the activity and
specificity of the selected enzymes on the one hand and complying
with the boundary conditions for MALDI on the other.
Incompatibility mainly results because the alkaline-ion buffers,
commonly used in the described reaction, such as Na-phosphate,
Na-citrate or Na-acetate as well as EDTA interfere with the MALDI
sample preparation; presumably they disturb the matrix
crystallization and/or analyte incorporation. Tris-HCl or ammonium
salt buffers, in contrast, are MALDI compatible (Shaler, T. A. et
al. (1996) Anal. Chem. 68:576-579). Moreover, alkaline salts in the
sample lead to the formation of a heterogenous mixture of multiple
salts of the analyte, a problem increasing with increasing number
of phosphate groups. Such mixtures result in loss of mass
resolution and accuracy as well as signal-to-noise ratio (Little,
D. P. et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92:2318-2322;
Nordhoff, E., Cramer, R. Karas, M., Hillenkamp, F., Kirpekar, F.,
Kristiansen, K. and Roepstorff, P. (1993) Nucleic Acids Res., 21,
3347-3357). Therefore, RNase digestions were carried out under
somewhat modified conditions compared to the ones described in the
literature. They are summarized above in table VII. For Rnase
T.sub.1, A, CL.sub.3 ad Cusativin, Tris-HCl (pH 6-7.5) was used as
buffer. 20 mM DAC provides the pH of 5, recommended for maximum
activity of RNases U.sub.2 and PhyM. The concentration of 10-20 mM
of these compounds were found to not interfere significantly with
the MALDI analysis. To examine the specificity of the selected
ribonucleases under these conditions, three synthetic 20-25mer RNA
molecules with different nucleotide sequences were digested.
[0680] The MALDI-MS spectra of FIG. 77 shows five different
cleavage patterns (A-E) of a 25 nt RNA obtained after partial
digestion with RNases T.sub.1, U.sub.2, PhyM, A, and alkaline
hydrolysis. These spectra were taken from aliquots which were
removed from the assay after empirically determined incubation
times, chosen to get an optimum coverage of the sequence. As the
resulting samples were not fractionated prior to mass spectrometric
analysis, they contain all fragments generated at that time by the
respective RNases. In practice, uniformity of the cleavages, can be
affected by a preferential attack on the specific phophodiester
bonds (Donis-Keller, H., Maxam, A. M., and Gilbert, W. (1977)
Nucleic Acids Res., 4, 1957-1978; Donis-Keller, H. (1980) Nucleic
Acids Res., 8 3133-3142). The majority of the expected fragments
are indeed observed in the spectra. It is also worth noting that
for the reaction protocols as used, correct assignment of all
fragment masses is only possible, if a 2', 3'-cyclic phosphate
group is assumed. It is well known that such cyclic phosphates are
intermediates in the cleavage reaction and get hydrolyzed in a
second, independent and slower reaction step involving the enzyme
(Richards, F. M., and Wycoff, H. W. in The Enzymes Vol. 4, 3rd Ed.,
(ed. Boyer, P. D.) 746-806 (1971, Academic Press, New York);
Heinemann, U and W. Saenger (1985) Pure Appl. Chem. 57, 417-422;
Ikehara, M. et al., (1987) Pure Appl. Chem. 59-965-968) Vreslow, R.
and Xu, R. (1993) Proc. Nal. Acad. Sci. USA, 90, 1201-1207). In a
few cases different fragments have equal mass of differ by as
little as 1 Dalton., In these cases, mass peaks cannot
unambiguously be assigned to one or the other fragments. Digestion
of two additional different 20 nt RNA samples was, therefore,
performed (Hahner, S., Kirpekar, F., Nordoff, E., Kristiansen, K.,
Roepstorff, P. and Hillenkamp, F. (1996) Proceedings of the 44th
ASMS Conference on Mass Spectrometry, Portland, Oreg.) in order to
sort out these ambiguities. For all samples tested, the selected
ribonucleases appear to cleave exclusively at the specified
nucleotides leading to fragments arising from single as well as
multiple cleavages.
[0681] In FIG. 77, peaks, indicating fragments containing the
original 5'-terminus, are marked by arrows. All non marked peaks
can be assigned to internal sequences or those with retained
3'-terminus. For a complete sequence all possible fragments bearing
exclusively either the 5'- or the 3'-terminus of the original RNA
would suffice. In practice, the 5'-fragments are better suited for
this purpose, because the spectra obtained after incubation of all
three synthetic RNA samples contain the nearly complete set of
originals of 5'-ions for all different RNases (Hahner, S.,
Kirpekar, F., Nordoff, E., Kristiansen, K., Roepstorff and
Hillenkamp, F. (1996) Proceedings of the 44th ASMS Conference on
Mass Spectrometry, Portland, Oreg.). Internal fragments are
somewhat less abundant and fragments containing the original
3'-terminus appear suppressed in the spectra. In agreement with
observations reported in the literature (Gupta, R. C. and
Randerath, K. (1977) Nucleic Acids Res., 4, 1957-1978), cleavages
close to the 3'-terminus were partially suppressed in partial
digests of the RNA 25 mer by RNase T.sub.1, and U.sub.2 (even if
they are internal or contain the original 5'-terminus). Fragments
from such cleavages appear as weak and poorly resolved signals in
the mass spectra.
[0682] For larger RNA molecules secondary structure is known to
influence the uniformity of the enzymatic cleavages (Donis-Keller,
H., Maxam, A. M. and Gilbert, A. (1977) Nucleic Acids Res. 8,
3133-3142). This can, in principle be, overcome by altered reaction
conditions. In assay solutions containing 5-7 M urea, the activity
of RNases such as T.sub.2, U.sub.2, A, Cl.sub.3, and PhyM is known
to be retained (Donis-Keller, H., Maxam, A. M. and Gilbert, W.
(1977) Nucleic Acids Res., 4, 2527-2537; Boguski, M. S., Hieter, P.
A., and Levy, C. C. (1980) J. Biol. Chem.,255, 2160-2163;
Donis-Keller, H. (1980) Nucleic Acids Res., 8, 3133-3142, while RNA
is sufficiently denatured. UV-MALDI-analysis with 3-HPA as matrix
is not possible under such high concentrations of urea in the
sample. Up to a concentration of 2 M urea in the reaction buffer,
MALDI analysis of the samples was still possible although
significant changes in matrix crystallization were observed.
Spectra of the RNA 20 mer (sample B), digested in the presence of 2
M urea still resembled those obtained under conditions listed in
Table VII.
[0683] Digestion by RNases which exclusively recognize one
nucleobase is desirable to reduce the complexity of the fragment
patterns and thereby facilitate the mapping of the respective
nucleobase. RNases CL.sub.3 and cursavitin are enzymes reported to
cleave at cytidylic acid residues. Upon limited RNase CL.sub.3 and
cursativin digestion of the RNA-20mer (sample B) under
non-denaturing conditions, fragments corresponding to cleavages at
cytidylic residues were indeed observed (FIG. 78). Similar to the
data reported so far (Boguski, M. S., Hieter, P. A. and Levy, C. C.
(1980) J. Biol. Chem.,255, 2160-2163: Rojo, M. A., Arias, F. J.,
Iglesias, R., Ferreras, J. M., Munoz, R., Escarmis, C., Soriano,
F., Llopez-Fando, Mendez, E., and Girbes, T. (1994) Planta, 194,
328-338). The degradation pattern in FIG. 78, however, reveals that
not every cytidine residue is recognized, especially for
neighboring C residues. RNase CL.sub.3 is also reported to be
susceptible to the influence of secondary structure (Boguski, M.
S., Heiter, P. A., and Levy, C. C. (1980) J Biol. Chem., 255,
2160-2163), but for RNA of the size employed in this study, such an
influence should be negligible. Therefore, unrecognized cleavage
sites in this case can be attributed to a lack of specificity of
this enzyme. To confirm these data, a further RNase
CL.sub.3-digestion was performed with the RNA 20mer (sample C). As
a result of the sequence of this analyte, all three linkages
containing cytidylic acid were readily hydrolyzed, but additional
cleavages at uridylic acid residues were detected as well. Since
altered reaction conditions such as increased temperature
(90.degree. C.), various enzyme to substrate ratios, and addition
of 2M urea did not result in a digestion of the expected
specificity, application of this enzyme to sequencing was not
pursued further. Introduction of a new cytidine-specific
ribonuclease, cusativin, isolated form dry seeds of Cucumis sativus
L. looked promising for RNA sequencing (Rojo, M. A., Arias, F. J.,
Iglesias, R., Ferreras, J. M., Munoz, R., Escarmis, C., Soriano,
F., Llopez-Fando, J., Mendez, E. and Girbes, T. (1994) Planta, 194,
328-338). As shown in FIG. 78, not every cytidine residue was
hydrolyzed and additional cleavages occurred at uridylic acid
residues for the recommended concentration of the enzyme. RNases
CL.sub.3 and cusativin will, therefore not yield the desired
sequence information for mapping of cytidine residues and their use
was not further pursued. The distinction of pyrimidine residues can
be achieved, however, by use of RNases with multiple specificities,
such as Physarum polycephalum RNase (cleaves ApN, UpN) and
pancreatic RNase A (cleaves UpN, CpN) (see FIG. 77). All
5'-terminus fragments, generated by the monospecific RNase U.sub.2
and apparent in the spectrum of FIG. 77C were also evident in the
spectrum of the RNase PhyM digest (FIG. 77D). Five of the six
uridilic cleavage sites could, this way, be uniquely identified by
this indirect method. In a next step, the knowledge of the uridine
cleavage sites was used to identify sites of cleavage of cytidilic
acid residues in the spectrum recorded after incubation with RNase
A (FIG. 77E), again using exclusively ions containing the original
5'-terminus. Two of the four expected cleavage sites were
identified this way. A few imitations are apparent from these
spectra, if only the fragments containing the original 5'-terminus
are used for the sequence determination. The first two nucleotides
usually escape the analysis, because their signals get lost in the
low mass matrix background. Because of this, the corresponding
fragments are missing in the spectra of the U- and C-specific
cleavages. Large fragments with cleavage sites close to the
3'-terminus are often difficult to identify, particularly in
digests with RNases T.sup.1 and U.sub.2, because of their low yield
(vide supra) and the often strong nearby signal of the non-digested
transcript. Accordingly the cleavages in position 22 and 23 do not
show up in the spectrum of the G-specific RNase T, (FIG. 77A) and
the cleavage site 24 cannot be identified from the spectra of the
U.sub.2 and PhyM digests (FIGS. 77C and D). Also site 16 and 17
with two neighboring cytidilic acids cannot be identified in the
RNase A spectrum of FIG. 77E. These observations demonstrate that a
determination of exclusively the 5'-terminus fragments may not
always suffice and the information contained in the internal
fragments may be needed for a full sequence analysis.
[0684] Finally, limited alkaline hydrolysis provides a continuum of
fragments (FIG. 77B), which can be used to complete the sequence
data. Again, the spectrum is dominated by ions of fragments
containing the 5'-terminus, although the hydrolysis should be equal
for all phosphodiester bonds. As was true for the enzymatic
digests, correct mass assignments requires one to assume that all
fragments have a 2', 3'-cyclic phosphate. The distribution of
peaks, therefore, resembles that obtained after a 3'-exonuclease
digest (Pieles, U., Zurcher, W., Schar, M. and Moser, H. E., (1993)
Nucleic Acids Res., 21, 3191-3196; Nordhoff, E. et al. (1993) Book
of Abstracts, 13.sup.th Internat. Mass Spectrom. Conf., Budapest p.
218; Kirpekar, F., Nordhoff, E., Kristiansen, K., Roepstorff, P.,
Lezius, A. Hahner, S., Karas, M. and Hillenkamp. F. (1994) Nucleic
Acid Res., 22, 3866-3870). In principle, the alkaline hydrolysis
alone could, therefore, be used for a complete sequencing. This is,
however, only possible for quite small oligoribonucleotides,
because larger fragment ions, differing in mass by only a few mass
units will not be resolved in the spectra and the mass of larger
ions cannot be determined with the necessary accuracy of better
than 1 Da, even if peaks are partially or fully resolved. The
interpretation of the spectra particularly from digests of unknown
RNA samples is substantially simplified, if only the fragments
containing the original 5'-terminus are separated out prior to the
mass spectrometric analysis. A procedure for this approach is
described in the following section.
[0685] Separation of 5'-Biotinylated Fragments
[0686] Streptavidin-coated magnetic beads (DynaI) were tested for
the extraction of fragments containing the original 5'-terminus
from the digests. Major features to be checked for this solid-phase
approach are the selective immobilization and efficient elution of
biotinylated species. In preliminary experiments, a 5'-biotinylated
DNA (19 nt) and streptavidin were incubated and MALDI analyzed
after standard preparation. Despite the high affinity of the
streptavidin-biotin interaction, the intact complex was not found
in the MALDI spectra. Instead, signals of the monomeric subunit of
streptavidin and the biotinylated DNA were detected. Whether the
complex dissociates in the acidic matrix solution (pKA 3) or during
the MALDI desorption process, is not known. Surprisingly, if the
streptavidin is immobilized on a solid surface such as magnetic
beads, the same results are not observed. A mixture of two
5'-biotinylated DNA samples (19 nt and 27 nt) and two unlabeled DNA
sequences (12 nt and 22 nt) were incubated with the beads. The
beads were extracted and carefully washed before incubation in the
3-HPA MALDI matrix. No analyte signals could be obtained from these
samples. To test whether the biotinylated species had been bound to
the beads altogether, elution form the extracted and washed beads
was performed by heating at 90.degree. C. in the presence of 95%
formamide. This procedure is expected to denature the streptavidin,
thereby breaking the streptavidin/biotin complex. FIG. 79B shows
the expected signals of the two biotinylated species, proving that
release of the bound molecules in the MALDI process is the problem
rather than the binding of the beads; FIG. 79A shows a spectrum of
the same sample after standard preparation, showing signals of all
four analytes as a reference. Complete removal of the formamide
after the elution and prior to the mass spectrometric analysis was
found to be important, otherwise crystallization of the matrix is
disturbed. Mass resolution and the signal-to-noise ration in
spectrum 79B are comparable to those of the reference spectrum.
These results testify to the specificity of the streptavidin-biotin
interaction, since no or only minor signals of the non-biotinylated
analyte were detected after incubation with the Dynal beads.
Increased suppression of nonspecific binding was reported through
an addition of the detergent Tween-20 to the binding buffer (Tong,
X. and Smith, L. M. (1992) Anal Chem., 64, 2672-2677). Although
this effect could be confirmed in this study, peak broadening
affected the quality of the spectra due to remaining amounts of the
detergent. The necessity of an elution step as a prerequisite for
detection of the captured biotinylated species can be attributed to
a stabilizing effect of the complex by the immobilization of the
streptavidin to the magnetic beads.
[0687] For practical application of this solid phase method to
sequencing a maximum efficiency of binding and elution of
biotinylated species is of prime importance. Among a variety of
conditions investigated so far, addition of salts such as EDTA gave
best results in the case of DNA sequencing by providing ionic
strength to the buffer (Tong, X. and Smith, L. M. (1992) Anal
Chem.,64, 2672-2677). To examine such an effect on the solid-phase
method, several salt additives were tested for the binding and
elution of the 5'-biotinylated RNA in vitro transcript (49 nt). The
results are shown in FIG. 80. Judging from the relative intensity,
signal-to-noise ration, and resolution of the respective signals, a
95% formamide solution containing 10 mM CDTA (FIG. 80D) is most
efficient for the binding/elution. Since CDTA acts as a chelating
agent for divalent cation, formation of proper secondary an
tertiary structure of the RNA is prevented. An improved sensitivity
and spectral resolution has been demonstrated under such conditions
for the analysis of RNA samples by electrospray mass spectrometry
(Limbach, P. A., Crain, P. F. and McCloskey, J. A. (1995) J Am.
Soc. Mass. Spectrom., 6, 27-39). The improvement in the MALDI
analysis is actually not very significant compared to the spectrum
obtained for the solution containing formamide alone (FIG. 81b),
but the reproducibility for spectra of good quality was
substantially improved for the CDTA/formamide solution. Thus in
addition to the improved binding/elution, this additive may also
improve the incorporation of the analyte into the matrix crystals.
Unfortunately, a striking signal broadening on the high mass side
was observed in case of formamide solutions containing EDTA, CDTA
or 25% ammonium hydroxide. Since this effect is most prominent in
case of 25% ammonium hydroxide and this agent was also used for
adjusting EDTA and CDTA to their optimum pH, a pronounced NH.sub.3
adduct ion formation ca be assumed.
[0688] The applicability of streptavidin-coated magnetic beads
separation to RNA sequencing was demonstrated for the Rnase U.sub.2
digest of the 5'-biotinylated RNA in vitro transcript (49 nt) (FIG.
81). The entire fragment pattern obtained after incubation with
Rnase U.sub.2 is shown is spectrum 81A. Separation of the
biotinylated fragments reduces the complexity of the spectrum (FIG.
81B) since only 5'-terminal fragments are captured by the beads.
The signals in the spectrum are broadened and the increased number
of signals in the low mass range indicate that even after stringent
washing of the beads, some amounts of buffer and detergent used for
the binding and elution remained. Further improvements of the
method are, therefore, needed. Another possible strategy for
application of the magnetic beads is the immobilization of the
target RNA prior to RNase digestion by an elution of the remaining
fragments for further analysis. Cleavage of the RNA was impeded in
this case, as evidenced by a prolonged reaction time for the digest
under otherwise identical reaction conditions.
EXAMPLE 22
[0689] Parallel DNA Sequencing Mutation Analysis and Microsatellite
Analysis Using Primers with Tags and Mass Spectrometric
Detection
[0690] This EXAMPLE describes specific capturing of DNA products
generated in DNA analysis. The capturing is mediated by a specific
tag (5 to 8 nucleotides long) at the 5' end of the analysis product
that binds to a complementary sequence. The capture sequence can be
provided by a partially double stranded oligonucleotide bound to a
solid support. Different DNA analysis (e.g., sequencing, mutation,
diagnostic, microsatellite analysis) can be carried out in
parallel, using, for example, a conventional tube or microtiter
plate (MTP). The products are then specifically captured and sorted
out via the complementary identification sequence on the tag
oligonucleotide. The capture oligonucleotide can be bound onto a
solid support (e.g., silicon chip) by a chemical or biological
bond. Identification of the sample is provided by the predefined
position of the capute oligonucleotide. Purification, conditioning
and analysis by mass spectrometry are done on solid support. -This
method was applied for capturing specific primers that had a 6 base
tag sequence.
[0691] Materials and Methods
[0692] Genomic DNA
[0693] Genomic DNA was obtained from healthy individuals.
[0694] PCR Amplification
[0695] PCR amplifications of part of the .beta.-globin gene were
established using .beta.92 d(CATTTGCTTCTGACACAACT Seq. ID. No. 66)
as forward primer and .beta.11 d(TCTCTGTCTCCACATGCCCAG Seq. ID. No.
67) as reverse primer. The total PCR volume was 50 .mu.l including
200 ng genomic DNA, 1 U Taq-polymerase (Boehringer-Mannheim, Cat#
159594), 1.5 mM MgCl.sub.2, 0.2 mM dNTPs (Boehringer-Mannheim, Cat#
1277049), and 10 pmol of each primer. A specific fragment of the
.beta.-globin gene was amplified using the following cycling
conditions: 5 min@94.degree. C. followed by 40 cycles of 30
sec@94.degree. C., 45 sec@53.degree. C., 30 sec@72.degree. C., and
a final extension of 2 min@72.degree. C. Purification of the
amplified product and removal of unincorporated nucleotides was
carried out using the QIAquick purification kit (Qiagen, Cat
28104). One fifth of the purified product was used for the primer
oligo base extension (PROBE) or sequencing reactions,
respectively.
[0696] Primer Oligo Base Extension (PROBE) and Sequencing
Reactions
[0697] Detection of putative mutations in the human .beta.-globin
gene at codon 5 and 6 and at codon 30 and in the IVS-1 donor site,
respectively, was done in parallel (FIG. 82A). .beta.-TAG1
(GTCGTCCCATGGTGCACCTGACTC Seq. ID. No. 68) served as primer to
analyze codon 5 and 6 and .beta.-TAG2 (CGCTGTGGTGAGGCCCTGGGCA Seq.
ID. No. 69) for the analyses of codon 30 and the IVS-1 donor site.
The primer oligo base extension (PROBE) reaction was done by
cycling, using the following conditions: final reaction volume was
20 .mu.l, .beta.-TAG1 primer (5 pmol), .beta.-TAG2 primer (5 pmol),
dCTP, dGTP, dTTP, (final concentration each 25 .mu.M), ddATP (final
concentration 100 .mu.M) dNTPs and ddNTPs purchased from
Boeringer-Mannheim, Cat# 1277049 and 1008382), 2 .mu.l of 10.times.
ThermoSequence buffer and 2.5 U ThermoSequenase (Amersham,
CAT#E79000Y). The cycling program was as follows: 5 min@94.degree.
C., 30 sec@53.degree. C., 30 sec@72.degree. C. and a final
extension step for 8 min@72.degree. C. Sequencing was performed
under the same conditions except that the reaction volume was 25
.mu.l and the concentration of nucleotides was 250 .mu.M for
ddNTP.
[0698] Capturing Using TAG Sequence and Sample Preparation
[0699] The capture oligonucleotides cap-tag1
d(GACGACGACTGCTACCTGACTCCA Seq ID No. 70) and cap-tag2
d(ACAGCGGACTGCTACCTGACTCCA Seq ID No. 71), respectively, were
annealed to equimolar amounts of uni-as d(TGGAGTCAGGTAGCAGTC Seq ID
No. 72) (FIG. 82A). Each oligonucleotide had a concentration of 10
pmol/.mu.l in ddH.sub.2O and incubated for 2 min@80.degree. C. and
5 min@37.degree. C. This solution was stored at -20.degree. C. and
aliquots were taken. 10 pmol annealed capture oligonucletides were
bound to 10 .mu.l paramagnetic beads coated with streptavidin (10
mg/ml; Dynal, Dynabeads M-280 streptavidin Cat# 112.06) by
incubation for 30 min @ 37.degree. C. Beads were captured and the
PROBE or sequencing reaction, respectively, was added to the
capture oligonucleotides. To facilitate binding of .beta.-TAG1 abd
.beta.-TAG2, respectively, the reaction was incubated for 5
min@25.degree. C. and for 30 min@16.degree. C. The beads were
washed twice with ice cold 0.7 M NH.sub.4 Citrate to wash away
unspecific bound extension products and primers. The bound products
were dissolved by adding 1 .mu.l DDH.sub.2O and incubation for 2
min@65.degree. C. and cooling on ice. 0.3 .mu.l of the sample were
mixed with 0.3 .mu.l matrix solution (saturated 3-hydroxy-picolinic
acid, 10% molar ratio ammonium-citrate in acetonitrile/water
(50/50. v/v)) and allowed to air dry. The sample target was
automatically introduced into the source region of an unmodified
Perspective Voyager MALDI-TOF operated in delayed extraction linear
mode with 5 and 20 kV on the target and conversion dynode,
respectively. Theoretical average molecular mass (M.sub.r(calc))
were calculated from atomic compositions; reported experimental
M.sub.r(M.sub.r(exp)) values are those of the singly-pronated
form.
[0700] Results
[0701] Specific capturing of a mixture of extension products by a
short complementary sequence has been applied to isolate sequencing
and primer oligo base extension (PROBE) products. This method was
used for the detection of putative mutations in the human
.beta.-globin gene at codon 5 and 6 and at codon 30 and IVS-1 donor
site, respectively (FIG. 82A). Genomic DNA has been amplified using
the primers .beta.2 and .beta.11. The amplification product was
purified and the nucleotides separated. One fifth of the purified
product was used for analyses by primer oligo base extension. To
analyze both sites in a single reaction, primers, .beta.-TAG1 and
.beta.-TAG2, were used respectively. .beta.-TAG1 binds upstream of
codons 5 and 6 and .beta.-TAG2 upstream of codon 30 and the IVS-1
donor site. Extension of these primers was performed by cycling in
the presence of ddATP and dCTP, dGTP and dTTP, leading to specific
products, depending on the phenotype of the individual. The
reactions were then mixed with the capture oligonucleotides.
Capture oligonucleotides include the biotinylated capture primer
cap-tag1 and cap-tag2, respectively. They have 6 bases at the 5'
end, that are complementary to the 5' end of .beta.-TAG1 and
.beta.-TAG2, respectively. Therefore, they specifically capture
these primers and the extended products. By annealing a universal
oligonucleotide (uni-as) to the capture oligonucleotide, the
capture primer is transformed into a partially double stranded
molecule where only the capture sequence stays single stranded
(FIG. 82). This molecule is then bound to streptavidin coated
paramagnetic particles, to which the PROBE or sequencing reaction,
respectively is added. The mixture was washed to bind only the
specifically annealed oligonucleotides. Captured oligonucleotides
are dissolved and analyzed by mass spectrometry.
[0702] PROBE products of one individual (FIG. 83) show a small peak
with a molecular mass of 7282.8 Da. This corresponds to the
unextended .beta.-TAG1 that has a calculated mass of 7287.8 Da. The
peak at 8498.6 Da corresponds to a product, that has been extended
by 4 bases. This corresponds to the wildtype situation. The
calculated mass of this product is 8500.6 Da. There is no
significant peak indicating a heterozygote situation. Furthermore
only .beta.-TAG1 and not .beta.-TAG2 has been captured, indicating
a high specificity of this method.
[0703] Analyses of what was bound to cap-tag2 (FIG. 84) shows only
one predominant peak with a molecular mass of 9331.5 Da. This
corresponds to an extension of 8 nucleotides. It indicates a
homozygous wildtype situation where the calculated mass of the
expected product is 9355 Da. There is no significant amount of
unextended primer and only .beta.-TAG2 has been captured.
[0704] To prove that this approach is also suitable for capturing
specific sequencing products, the same two primers .beta.-TAG1 and
.beta.-TAG2, respectively, were used. The primers were mixed, used
in one sequencing reaction and then sorted by applying the above
explained method. Two different termination reactions using ddATP
and ddCTP were performed with these primers (FIGS. 85 and 86,
respectively). All observed peaks in the spectrograms correspond to
the calculated masses in a wildtype situation.
[0705] As shown above, parallel analysis of different mutations
(e.g., different PROBE primers) is now possible. Further, the
described method is suitable for capturing specific sequencing
products. Capturing can be used for separation of different
sequencing primers out of one reaction tube/well, isolation of
specific multiplex-amplified products, PROBE products, etc.
Conventional methods, like cycle sequencing, and conventional
volumes can be used. A universal chip design permits the use of
many different applications. Further, this method can be automated
for high throughput.
EXAMPLE 23
[0706] Deletion Detection by Mass-Spectrometry
[0707] Various formats can be employed for mass spectrometer
detection of a deletion within a gene. For example, molecular mass
of a double standard amplified product can be determined, or either
or both of the strands of a double stranded product can be isolated
and the mass measured as described in previous examples.
[0708] Alternatively, as described herein, a specific enzymatic
reaction can be performed and the mass of the corresponding product
can be determined by mass spectrometry, The deletion size can be up
to several tens of bases in length, still allowing the simultaneous
detection of the wildtype and mutated allele. By simultaneous
detection of the specific products, it is possible to identify in a
single reaction whether the individual is homozygous or
heterozygous for a specific allele or mutation.
[0709] Materials and Methods
[0710] Genomic DNA
[0711] Leukocyte genomic DNA was obtained from unrelated healthy
individuals
[0712] PCR Amplification
[0713] PCR amplification of the target DNA was established and
optimized to use the reaction products without a further
purification step for capturing with streptavidin coated beads. The
primers for target amplification and for PROBE reactions were as
follows:
[0714] CKR.DELTA.-F:d(CAG CTC TCA TTT TCC ATA C SEQ ID. NO. 73) and
CKR.DELTA.-R bio: d(AGC CCC AAG ATG ACT ATC SEQ ID. NO. 74). CKR-5
was amplified by the following program: 2 min@94.degree. C., 45
seconds@52.degree. C., 5 seconds@72.degree. C., and a final
extension of 5 minutes at 72.degree. C. The final volume was 50
.mu.l including 200 ng genomic DNA 1 U Taq-polymerase
(Boehringer-Mannheim, Cat # 1596594), 1.5 Mm MgCl.sub.2, 0.2 Mm
DNTPS (Boehringer-Mannheim, Cat # 1277049), 10 pmol of unmodified
forward primers, and 8 pmol 5' biotinylated reverse primer.
[0715] Capturing and Denaturation of Biotinylated Templates
[0716] 10 .mu.l paramagnetic beads coated with streptavidin (10
mg/ml; Dynal, Dynabeads M-280 streptavidin Cat # 112.06) in
5.times. binding solution (5M NH.sub.4Cl, 0.3 M NH.sub.4OH) were
added to 45 .mu.l PCR reaction (5 .mu.l of PCR reaction were saved
for electrophoresis). After binding by incubation for 30 min. at
37.degree. C. the supernatant was discarded. Captured templates
were denatured with 50 .mu.l of 100 Mm NaOH for 5 min. at ambient
temperature, washed once with 50 .mu.l 50 Mm NH.sub.4OH and three
times with 100 .mu.l 10 Mm Tris/Cl, Ph 8.0. The single stranded DNA
served as templates for PROBE reactions.
[0717] Primer Oligo Base Extension (PROBE) Reaction
[0718] The PROBE reaction was performed using Sequence 2.0 (USB Cat
# E70775Z including buffer). dATP/DGTP and ddTTP were supplied by
Boehringer-Mannheim (Cat # 1277049 and 1008382). d(CAG CTC TCA TTT
TCC ATA C (SEQ ID. NO. 73) was used as PROBE primer (FIG. 87). The
following solutions were added tot he beads: 3.0 .mu.l H.sub.2O,
1.0 .mu.l reaction buffer, 1.0 .mu.l PROBE primer (10 pmol) and
incubated at 65.degree. C. for 5 minutes followed by 37.degree. C.
for 10 min. Then 0.5 .mu.l DTT, 3.5 .mu.l DNTPS/ddntp each 50 .mu.M
and 0.5 .mu.l Sequenase (0.8 U) were added and incubated at
37.degree. C. for 10 min.
[0719] T4 Treatment of DNA
[0720] To generate blunt ended DNA, amplification products were
treated with T4 DNA polymerase (Boehringer-Mannheim Cat# 1004786).
The reactions were carried out according to the manufacturer's
protocol for 20 min. at 11.degree. C.
[0721] Direct Size Determination of Extended Products
[0722] To determine the size of the amplified product, MALDI-TOF
was applied to one strand of the amplification product. samples
were bound to beads, as described above, conditioned and denatured,
as described below.
[0723] DNA Conditioning
[0724] After the PROBE reaction the supernatant was discarded nd
the beads were washed first in 50 .mu.l 700 mM NH.sub.4-citrate and
second 50 .mu.l 50 mM NH.sub.4-citrate. The generated diagnostic
products were removed for the template by heating the beads in 2
.mu.l H.sub.2O at 80.degree. C. for 2 min. The supernatant was used
for MALDI-TOF analysis.
[0725] Sample Preparation and Analysis with MALDI-TOF Mass
Spectrometry
[0726] Sample preparation was performed by mixing 0.6 .mu.l of
matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic
citrate in 1:1 H.sub.2O:CH.sub.3CN) with 0.3 .mu.l of diagnostic
PROBE products in water on a sample target and allowed to air dry.
Up to 100 samples were spotted on a probe target disk for
introduction into the source region of an unmodified Perspective
Voyager MALDI-TOF instrument operated in linear mode with delayed
extraction and 5 and 30 kV on the target and conversion dynode,
respectively. Theoretical average molecular mass (M.sub.r(calc)) of
analytes were calculated from atomic compositions, reported
experimental M.sub.r(M.sub.r(exp)) values are those of the
singly-pronated form, determined using internal calibration with
unextended primers in the case of PROBE reactions.
[0727] Conventional Analyses
[0728] Conventional analyses were performed by native
polyacrylamide gel electrophoresis according to standard protocols.
The diagnostic products were denatured with formamide prior to
loading onto the gels and stained with ethidium bromide or silver,
respectively.
[0729] Results
[0730] The CKR-5 status of 10 randomly chosen DNA samples of
healthy individuals were analyzed. Leukocyte DNA was amplified by
PCR and an aliquot of the amplified product was analyzed by
standard polyacrylamide gel electrophoresis and silver staining of
the DNA (FIG. 88). Four samples showed two bands presumably
indicating heterozygosity for CKR-5, whereas the other 6 samples
showed one band, corresponding to a homozygous gene (FIG. 88). In
the case where two bands were observed, they correspond to the
expected size of 75 bp for the wildtype gene and 43 bp for the
allele with the deletion (FIG. 87). Where one band was observed,
the size was about 75 bp which indicated a homozygous wildtype
CKR-5 allele. One DNA sample derived from a presumably heterozygous
one from a homozygous individual were used for all further
analysis. To determine the molecular mass of the amplified product,
DNA was subjected to matrix assisted laser desorption/ionization
coupled with time of flight analysis (MALDI-TOF). Double stranded
DNA, bound to streptavidin coated paramagnetic particles, was
denatured and the strand released into the supernatant was
analyzed. FIG. 89A shows a spectrograph of a DNA sample, that was
supposed to be heterozygous according to the result derived by
polyacrylamide gel electrophoresis (FIG. 88). The calculated mass
of the sense strand for a wildtype gene is 23036 Da and for the
sense strand carrying the deletion allele 13143 (FIG. 87 and Table
VI). Since many thermostable polymerases unspecifically add an
adenosine to the 3' end of the product, those masses were also
calculated. They are 23349 and 13456 Da. The masses of the observed
peaks (FIG. 89A) are 23119 Da, which corresponds to the calculated
mass of a wildtype DNA strand where an adenosine has been added
(23349 Da). Since no peak with a mass of about 23036 Da was
observed, the polymerase must have qualitatively added adenosine.
Two peaks, which are close to each other, have a mass of 13451 and
13137 Da. This corresponds to the calculated masses of the allele,
with the 32bp deletion. The higher mass peak corresponds to the
product, where adenosine has been added and the lower mass peak to
the one without the unspecific adenosine. Both peaks have about the
same height, indicating that to about half of the product adenosine
has been added. The peak with a mass of 11682 Da is a doubly
charged molecule of the DNA corresponding to 23319 Da
(2.times.11682 Da=23364 Da). The peaks with masses of 6732 and 6575
Da are doubly charged molecules of the one with masses of 13451 and
13137 Da and the peak with 7794 Da corresponds to the triply
charged molecule of 23319 Da. Multiple charged molecules are
routinely identified by calculation. Amplified DNA derived from a
homozygous individual shows in the spectrograph (FIG. 89C) one peak
with a mass 23349.6 and a much smaller peak with a mass of 23039.9
Da. The higher mass peak corresponds to DNA resulting from a
wildtype allele with an added adenosine, that has a calculated mass
of 23349 Da. The lower mass peak corresponds to the same product
without adenosine. Three further peaks with a mass of 11686, 7804.6
and 5852.5 Da correspond to doubly, triply and quadruply charged
molecules.
[0731] The unspecific added adenine can be removed from the
amplified DNA by treatment of the DNA and T4 DNA polymerase. DNA
derived from a heterozygous and a homozygous individual was
analyzed after T4 DNA polymerase treatment. FIG. 89B shows the
spectrograph derived from heterozygous DNA. The peak corresponding
to the wildtype strand has a mass of 23008 Da indicating that the
added adenine had been removed completely. The same is observed for
the strand with a mass of 13140 Da. The other three peaks are
multiply charged molecules of the parent peaks. The mass
spectrograph for the homozygous DNA shows one peak that has a mass
of 23004 Da, corresponding to the wildtype DNA strand without an
extra adenine added. All other peaks are derived from multiply
charged molecules of this DNA. The amplified products can be
analyzed by direct determination of their masses, as described
above, or by measuring the masses of products, that are derived
from the amplified product in a further reaction. In this "primer
oligo base extension (PROBE)" reaction, a primer that can be
internal, as it is in the nested PCR, or identical to one of the
PCR primers, is extended for just a few bases before the
termination nucleotide is incorporated. Depending on the extension
length, the genotype can be specified. CKR.DELTA.-F was used as a
PROBE primer, and dATP/dGTP and ddTTP as nucleotides. The primer
extension is AGT in case of a wildtype template and AT in case of
the deletion (FIG. 87). The corresponding masses are 6604 Da for
the wildtype and 6275 Da for the deletion, respectively. PROBE was
applied to two standard DNAs. The spectrograph (FIG. 90A) shows
peaks with masses of 6604 Da corresponding to the wildtype DNA and
at 6275 Da corresponding to the CKR-5 deletion allele (Table VIII).
The peak at a mass of 5673 Da corresponds to CKRA-F (calculated
mass of 5674 Da). Further samples were analyzed in analogous way
(FIG. 90B). It is unambiguously identified as homozygous DNA, since
the peak with a mass of 6607 Da corresponds to the wildtype allele
and the peak with a mass of 5677 Da to the unextended primer. No
further peaks were observed.
[0732] The example demonstrates that deletion analysis can be
performed by mass spectrometry. As shown herein, the deletion can
be analyzed by direct detection of single stranded amplified
products, or by analysis of specifically generated diagntic
products (PROBE). In addition, as shown in the following Example
26, double stranded DNA amplified products can be analyzed.
19 Size Calculated Mass Measured Mass wildtype w/o A 23036
23039/23009/23004 wildtype with A 23349 23319/23350 deletion w/o A
13143 13137/13139 deletion with A 13456 13451 PROBE wildtype 6604
6604/6608 deletion 6275 6275 All masses are in Dalton.
EXAMPLE 24
[0733] Pentaplex Tc-PROBE
[0734] Summary
[0735] The multiplexing of thermocycling primer oligo base
extension (tc-PROBE) was performed using five polymorphic sites in
three different apolipoprotein genes, which are thought to be
involved in the pathogenesis of atherosclerosis. The apolipoprotein
A IV gene (codons 347 and 360), the apolipoprotein E gene (codons
112 and 158), and the apolipoprotein B gene (codon 3500) were
examined. All mass spectra were easy to interpret with respect to
the five polymorphic sites.
[0736] Materials and Methods
[0737] PCR Amplification
[0738] Human leukocytic genomic DNA was used for PCR. Listed below
are the primers used for the separated amplification of portions of
the Apo A IV, Apo E and the Apo B genes:
20 Apo A IV: A347F: 5'-CGA GGA GCT CAA GGC CAG AAT-3' (SEQ ID
NO.75) A360 R-2-bio: *5'-CAG GGG CAG CTC AGC TCT C-3' (SEQ ID
NO.76) Apo E: ApoE-F: 5'-GGC ACG GCT GTC CAA GGA-3' (SEQ ID NO.77)
ApoE-R bio: *5'-AGG CCG CGC TCG GCG CCC TC-3' (SEQ ID NO.78) Apo B:
ApoB-F2 bio: *5'-CTT ACT TGA ATT CCA AGA GC-3' (SEQ ID NO.79) Apo
B-R: 5'-GGG CTG ACT TGC ATG GAC CGG A-3' (SEQ ID NO.80)
*biotinylated
[0739] Taq polymerase and 10.times. buffer were purchased from
Boehringer-Mannheim (Germany) and dNTPs for Pharmacia (Freiburg,
Germany). The total PCR reaction volume was 50 .mu.l including 10
pmol of each primer and 10% DMSO (dimethylsulfoxide, Sigma) (no
DMSO for the PCR of the Apo B gene), with .about.200 mg of genomic
DNA used as template and a final dNTP concentration of 200 .mu.M.
Solutions were heated to 80.degree. C. before the addition of 1 U
Taq polymerase; PCR conditions were: 5 min at 95.degree. C.,
followed by 2 cycles 30 sec 94.degree. C., 30 sec 62.degree. C., 30
sec 72.degree. C., 2 cycles 30 sec 94.degree. C. 30 sec 58.degree.
C., 30 sec 72.degree. C., 35 cycles of 30 sec at 94.degree. C., 30
sec at 56.degree. C., 30 sec at 72.degree. C., and a final
extension time of 2 min at 72.degree. C. To remove unincorporated
primers and nucleotides, amplified products were purified using the
"QIAquick" (Qiagen, Germany )kit, with elution of the purified
products in 50 .mu.L of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH
8.0).
[0740] Binding of the Amplified Product on Beads
[0741] 10 .mu.l of each purified amplified product was bound to 5
.mu.l DynaBeads (DynaI, M-280 Streptavidin) and denatured according
to the protocol from DynaI. For the pentaplex tc-PROBE reaction the
three different amplified product (bound on the beads) were
pooled.
[0742] Tc-PROBE
[0743] For the PROBE reaction the following primers were used:
21 (Apo A) P347: 5'-AGC GAG GAC AAG-3' (SEQ ID NO.81) (Apo A) P360:
5'-ACA GCA GGA ACA GCA-3' (SEQ ID NO.82) (Apo E) P112: 5'-GCG GAG
ATG GAG GAC GTG-3' (SEQ ID NO.83) (Apo E) P158: 5'-GAT GOC GAT GAG
CTG GAG AAG-3' (SEQ ID NO.84) (Apo B) P3500: 5'-GTG GGG TGC AGG TTG
ACT GAA GAC-3' (SEQ ID NO.85)
[0744] The tc-PROBE was carried out in a final volume of 25 .mu.l
containing 10 pmol of each primer listed above, 2.5 U Thermoquenase
(Amersham), 2.5 .mu.L Thermoquenase buffer, and 50 .mu.M dTTP
(final concentrations) and 200 .mu.M of ddA/C/GTP, respectively.
Tubes containing the mixture were placed in a thermocycler and
subjected to the following cycling conditions: denaturation
(94.degree. C.) the supernatant was carefully removed from the
beads and `desalted` by ethanol precipitation to exchange
nonvolatile cations such as Na+ and K+ with NH.sub.4+, which
evaporated during the ionization process; 5 .mu.L 3M ammonium
acetate (pH 6.5) 0.5 .mu.L glycogen (10 mg/mL, Sigma), 25 .mu.L
H.sub.2O, and 110 .mu.L absolute ethanol were added to 25 .mu.L
PROBE supernatant and incubated for 1 hour at 4.degree. C. After a
10 min. centrifugation at 13,000.times. g, the pellet was washed in
70% ethanol and resuspended in 1 .mu.L 18 Mohm/cm H.sub.2O. A 0.35
.mu.L aliquot of resuspended DNA was mixed with 0.35 .mu.L matrix
solution (0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium
citrate in 1:1 H.sub.2O:CH.sub.3CN) on a stainless steel sample
target disk and allowed to air dry preceding spectrum acquisition
using the Thermo Bioanalysis Version 2000 MALDI-TOF operated in
reflectron mode with 5 and 20 kV on the target and conversion
dynode, respectively, Theoretical average molecular masses
(M.sub.1(calc)) of the fragments were calculated from atomic
compositions. External calibration generated from synthetic
(ATCG).sub.n oligonucleotide (3.6-18 kDa) was used. Positive ion
spectra from 1-37500 Da were collected.
[0745] Results
[0746] Table VIII shows the calculated molecular masses of all
possible extension products including the mass of the primer
itself. FIG. 91 shows a respective MALDI-TOP MS spectra of a
tc-PROBE using three different templates and 5 different PROBE
primers simultaneously in ne reaction. Comparison of the observed
and calculated masses (see table VIII) allows a fast genetic
profiling of various polymorphic sites in an individual DNA sample.
The sample presented in FIG. 91 is homozygous for threonine and
glutamine at position 347 and 360, respectively, in the
apolipoprotein A IV gene, bears the epsilon 3 allele homozygous in
the apolipoprotein E gene, and is also homozygous at the codon 3500
for arginine in the apolipoprotein B gene.
22 TABLE VIII SEQ ID mass allele Apolipoprotein A IV
5'-AGCCAGGACAAG-3'(347) 86 3688.40 unextended primer
5'-AGCCAGGACAAGTC-3' 87 4265.80 347Ser 5'-AGCCAGGACAAGA-3' 88
3985.60 347Thr 5'-ACAGCACCAACAGCA-3'(360) 89 4604.00 unextended
primer 5'-ACAGCAGGAACAGCATC-3' 90 5181.40 360His
5'-ACAGCAGGAACAGCAG-3'(1- 12) 91 4917.20 360Gln Apolipoprotein E
5'-GCGGACATGGAGGACGTG-3'(112) 92 5629.60 unextended primer
5'-GCGGACATGGAGGACGTGGc-3' 93 6247.00 112Cys
5'-GCGGACATGGAGGACGTGC-3' 94 5902.80 112Arg
5'-GATGCCGATGACCTGCAGAAG-3'(158) 95 6480.20 unextended primer
5'-GATGCCGATGACCTGCAGAAGC-3' 96 6753.40 158Arg
5'-GATGCCGATGACCTGCAGAAGTG-3' 97 7097.60 158Cys Apolipoprotein
B-100 5'-GTGCCCTGCAGCTTCACTGAAGAC-3' 98 7313.80 unextended (3500)
primer 5'-GTGCCCTGCAGCTTCACTGAAGACTG-3' 99 7931.20 3500Gln
5'-GTGCCCTGCAGCTTCACTGAAGACC-3' 100 7587.00 3500Arg
EXAMPLE 25
[0747] Sequencing Exons 5 to 8 of the p53 Gene by MALDI-TOF Mass
Spectrometry
[0748] Materials & Methods
[0749] Thirty-five cycles of PCR reactions were performed in a 96
well microliter plate with each well containing a total volume of
50 .mu.l including 200 ng genomic DNA, 1 unit Taq DNA polymerase,
1.5 mM Mg Cl.sub.2, 0.2 mM dNTPx, 10 pmol of the forward primer and
6 or 8 of the biotinylated reverse primer. The sequences of PCR
primers prepared according to established chemistry (N. D. Sinha,
J. Biernat, H. Kter, Tetrahed. Lett. 24:5843-5846 (1983) are as
follows: exon 5:dbiotin
23 TATCTGTTCACTTGTGCCC SEQ ID NO.101) and d(biotin-
CAGAGGCCTGGGGACCCTG SEQ ID NO.102); exon 6: D(ACGACAGGGCTGGTTGCC
SEQ ID NO.103) and d(biotin- ACTGACAACCACCCTTAAC SEQ ID NO.104);
exon 7: d(CTGCTTGCCACAGGTCTC SEQ ID NO.105) and d(biotin-
CACAGCAGGCCAGTGTGC SEQ ID NO.106; exon 8: d(GGACCTGATTTCCTTACTG SEQ
ID NO.107) and d(biotin- TGAATCTGAGGCATAACTG SEQ ID NO.108).
[0750] To each well of the 96-well microliter plate containing
unpurified amplified product, 0.1 mg of paramagnetic streptavidin
beads (Dynal) in 10 .mu.l of 5.times. binding solution (5 M
NH.sub.4OH) was added and incubated at 3 7.degree. C. for 30 min.
Then beads were treated with 0.1 M NaOH at room temperature for 5
min followed by one wash with 50 mM NH.sub.4OH at room temperature
for 5 min followed by one wash with 50 mM Tris-HCl.
[0751] Four dideoxy termination reactions were carried out in
separate wells of the microliter plate. A total of 84 reactions (21
primers .times.4 reactions/primer) can be performed in a single
microliter plate. To each well containing immobilized
single-stranded template, a total volute of 10 .mu.l reaction
mixture was added including 1.times. reaction buffer, 10 pmol of
sequencing primer, 250 mM of dNTPs, 25 mM of one of the ddNTPs, and
1.congruent.2 units of Thermosequenase (Amersham). Sequencing
reactions were carried out on a thermal cycler using non-cycling
conditions: 80.degree. C., 1 min, 50.degree. C., 1 min, 50.degree.
C. to 72.degree. C., ramping 0.1.degree./sec, and 72.degree. C., 5
min. The beads were then washed with 0.7 M ammonium citrate
followed by 0.05 M ammonium citrate. Sequencing products were then
removed from beads by heating the beads to 80.degree. C. in 2 .mu.l
of 50 mM NH.sub.4OH for 2 min. The supernatant was used for
MALDI-TOF MS analysis.
[0752] Matrix was prepared as described in Kter, et al (Kter, H. et
al., Nature Biotechnol. 14: 1123-1128 (1996)). This saturated
matrix solution was then diluted 1.52 times with pure water before
use. 0.3 .mu.l of the diluted matrix solution was then diluted 1.52
times with pure water before use. 0.3 .mu.l of the diluted matrix
solution was loaded onto the sample target and allowed to
crystallize followed by addition of 0.3 .mu.l of the aqueous
analyte. A Perseptive Voyager DE mass spectrometer was used for the
experiments, and the samples were typically analyzed in the manual
mode. The target and middle plate were kept at +18.2 kV for 200
nanoseconds after each laser shot and then the garget voltage was
raised to +20 kV. the ion guide wire in the flight tube was kept at
-2V. Normally, 250 laser shots were accumulated foe each sample.
The original spectrum was acquired under 500 MHz digitizing rate,
and the final spectrum was smoothed by a 455 point average
(Savitsky and Golay, (1964) Analytical Chemistry, 36:1627). Default
calibration of the mass spectrometer was used to identify each peak
and assign sequences. The theoretical mass values of two sequencing
peaks were used to recalibrate each spectrum. (D.P. Little, T. J.
Cornish, M. J. O'Donnel, A. Braun, R. J. Cotter, H. Kter, Anal.
Chem., submitted).
[0753] Results
[0754] Alterations of the p53 gene are considered to be a critical
step in the development of many human cancers (Greenblatt, et al.,
(1994) Cancer Res. 54, 4855--4878; C. C. Harris, (1996) J. Cancer,
73, 261-269; and D. Sidransky and M. Hollstein, (1996)
Annu.Res.Med., 47,285-301). Mutations may serve as molecular
indicators of clonality or as early markers of relapse in a patient
with a previously identified mutation in a primary tumor (Hainaut,
et al., (1997) Nucleic Acid Res., 25, 151-157). The prognosis of
the cancer may differ according to the nature of the p53 mutations
present (H. S. Goh et al., (1995) Cancer Res, 55, 5217-5221). Since
the discovery of the p53 gene, more than 6000 different mutations
have been detected. Exons 5-8 were selected as sequencing targets
where most of the mutations cluster (Hainaut et al. (1997) Nucleic
Acids Res., 25, 151-7).
[0755] FIG. 96 schematically depicts the single tube process for
target amplification and sequencing, which was performed, as
described in detail in the Materials and Methods. Each of exon 5-8
of the p53 gene was PCR amplified using flanking primers in the
intron region; the down stream primer was biotinylated.
Amplifications of different exons were optimized to use the same
cycling profile, and the products were used without further
purification. PCR reactions were performed in a 96 well microliter
plate and the product generated in one well was used as the
template for one sequencing reaction. Streptavidin-coated magnetic
beads were added to the same microliter plate and amplified
products were immobilized. The beads were then treated with NaOH to
generate immobilized single-stranded DNA as sequencing template.
The beads were washed extensively with Tris buffer since remaining
base would reduce the activity of sequencing enzyme.
[0756] A total of 21 primers were selected to sequence exon 5-8 of
the p53 gene by primer walking. The 3'-end nucleotide of all the
primers is located at the site where no known mutation exists. Four
termination reactions were performed separately which resulted in a
total of 84 sequencing reactions on the same PCR microliter plate.
Non-cycling conditions were adopted for sequencing since
streptavidin coated beads do not tolerate the repeated application
of high temperature. Sequencing reactions were designed so that mt
terminated fragments were under 70 nucleotides, a size range easily
accessible by MALDI-TOF MS and yet long enough to sequence through
the next primer binding site. Thermequenase was the enzyme of
choice since it could reproducible generate a high yield of
sequencing products in the desired mass range. After the sequencing
reactions, the beads were washed with ammonium ion buffers to
replace all other cations. The sequencing ladders were then removed
from the beads by heating in ammonium hydroxide solution or simply
in water.
[0757] A sub-microliter aliquot of each of the 84 sequencing
reactions was loaded onto one MS sample holder containing preloaded
matrix. FIG. 94 gives an example of sequencing data generated from
one primer; four spectra are superimposed.
[0758] All sequencing peaks were well resolved in the mass range
needed to read through the next sequencing primer site. Sometimes
doubly charged peaks were observed which could be easily identified
by correlating the mass to that of the singly charged ion. False
stops generated by early termination of the enzymatic extension can
be observed cle to the primer site. Since the mass resolution is
high enough, it is easy to differentiate the false stop peaks from
the real sequencing peaks by calculating the mass difference of the
neighboring peaks and crs comparing the four spectra. Additionally,
mt primers generated detectable data through the region of the
downstream primer binding site thereby covering the false stop
region.
[0759] Using optimized procedures of amplification, sequencing, and
conditioning, exons 5-8 of the p53 gene were successfully
sequenced. Correct wildtype sequence data were obtained from all
exons with a mass resolution about 300 to 800 over the entire mass
range. The overall mass accuracy is 0.05% or better. The average
amount of each sequencing fragment loaded on the MS sample holder
is estimated to be 50 fmol or less.
[0760] This example demonstrates the feasibility of sequencing
exons of a human gene by MALDI-TOF MS. Compare to gel-based
automated fluorescent DNA sequencing, the read lengths are shorter.
Microchip technology can be incorporated to provide for parallel
processing. Sequencing products generated in the microtiter plate
can be directly transferred to a microchip which serves as a
launching pad for MALDI-TOF MS analysis. Robot-driven serial and
parallel nanoliter dispensing tools are being used to produce
100-1000 element DNA arrays on <1" square chips with flat or
geometrically altered (e.g., with wells) surfaces for rapid mass
spectrometric analysis.
[0761] FIG. 94 shows an MS spectrum obtained on a chip where the
sample was transferred from a microtiter plate by a pintool. The
estimated amount of each termination product loaded is 5 fmol or
less which is in the range of amounts used in conventional Sanger
sequencing with radiolabeled or fluorescent detection (0.5-1 fmol
per fragment). The low volume MALDI sample deposition has the
advantages of miniaturization (reduced reagent cts), enhanced
reproducibility and automated signal acquisition.
EXAMPLE 26
[0762] Direct Detection of Synthetic and Biologically Generated
Double-Stranded DNA by MALDI-TOF MS
[0763] Introduction
[0764] Typically, matrix-associated laser desorption/ionization
(Karas, et. al., (1989) Int. J. Mass Spectrom, Ion Processes, 92,
231) time-of-flight mass spectrometry (MALDI-TOF MS) of DNA
molecules which are double stranded (ds) in solution yields
molecular ions representative of the two single stranded components
(Tang, et al. (1994) Rapid Commun. Mass Spectrom. 8:183; Tang, et
al. (1995) Nucleic Acids Res. 23:3126; Benner, et al. (1995) Rapid
Commun. Mass Spectrom. 9:537; Liu, et al. (1995) Anal. Chem.
67:3482; Siegert et al. (1996) Anal. Biochem. 243:55; and Doktycz,
et al. (1995) Anal. Biochem. 230:205); this has been observed in
several reports dealing with biologically generated DNA from a
polymerase chain reaction (PCR) amplification (Tang, et al. (1994)
Rapid Commun. Mass Spectrom. 8:183; Liu, et al. (1995) Anal. Chem.
67:3482; Siegert et al. (1996) Anal. Biochem. 243:55; and Doktycz,
et al. (1995) Anal. Biochem. 230:205). It is not clear whether the
double strand is destabilized because of the decreased pH in the
matrix environment or because of absorbance by the duplex during
desorption/ionization/accelera- tion of an energy sufficient to
overcome the attractive van der Waals and "stacking" stabilization
forces (Cantor and Shimmel, Biophysical Chemistry Part I: The
conformation of Biomolecules, W. H. Freeman, New York, (1980),
176). When analyte is present at high concentrations formation of
non-specific gas-phase DNA multimers is, as with proteins (Karas,
et. al., (1989) Int. J. Mass Spectrom, Ion Processes 92:231),
common; however, Lecchi and Pannell (Lecchi et al. (1995) J. Am.
Soc. Mass Spectrom. 6:972) have provided strong evidence for
specific Watson Crick (WC) base pairing being maintained in the gas
phase. They detected these specific dimers when using
6-aza-2-thiothymine as a matrix, but did not observe them with
3-hydroxypicclinic acid (3-HPA) or 2,4,6-hydroxyacetophenone
matrix. As described below, by using a low acceleration voltage of
the ions and preparing samples for MALDI analysis at reduced
temperatures, routine detection of dsDNA is possible.
[0765] Materials and Methods
[0766] Synthetic DNA
[0767] Oligonucleotides were synthesized (Sinha, et al. (1984)
Nucleic Acids Res., 12, 4539) on a Perspective Expedite DNA
synthesizer and reverse phase HPLC purified in-house. Sequences
were: 50-mer (15337 Da): 5'-TTG CGT ACA CAC TGG CCG TCG TTT TAC AAC
GTC GTG ACT GGG AAA ACC CT-3' (SEQ ID NO. 109); 27-merc
(complementary, 8343 Da): 5'-GTA AAA CGA CGG CCA GTG TGT ACG CAA-3'
(SEQ ID NO. 110); 27-mer.sub.nc (non-complementary, 8293 Da):
5'-TAC TGG AAG GCG ATC TCA GCA ATC AGC-3' (SEQ ID NO. 111). 100
.mu.M stock solutions were diluted to 20, 10, 5, and 2.5 .mu.M
using 18Mohm/cm H.sub.2O. 2/ .mu.L each of equimolar solutions of
the 50-mer and either 27-mer.sub.c or 27-mer.sub.nc were mixed and
allowed to anneal at room temperature for 10 minutes. 0.5 .mu.L of
these mixtures were mixed directly on a sample target with 1 .mu.L
matrix (0.7 M 3-HPA, 0.07 M ammonium citrate in 50% acetonitrile)
and allowed to air dry.
[0768] Biological DNA
[0769] Enzymatic digestion of human genomic DNA from leukocytes was
performed. PCR primers (forward, 5'-GGC ACG GCT GTC CAA GGA G-3'
(SEQ ID NO. 112)); reverse, 5'-AGG CCG CGC TCG GCG CCC TC-3' (SEQ
ID NO. 113) to amplify a portion of exon 4 of the apolipoprotein E
gene were delineated from the published sequence (Das et al.,
(1985) J. Biol. Chem., 260 6240). Taq polymerase and 10.times.
buffer were purchased from Boehringer-Mannheim (Germany) and dNTPs
from Pharmacia (Freiburg, Germany). The total reaction volume was
50 .mu.l including 20 pmol of each primer and 10% DMSO
(dimethylsulfoxide, Sigma) with approximately 200 ng of genomic DNA
used as template. Solutions were heated to 80.degree. C. before the
addition of IU polymerase; PCR conditions were: 2 min at 94.degree.
C., followed by 40 cycles of 30 sec at 94.degree. C., 45 sec at
63.degree. C., 30 sec at 72.degree. C., and a final extension time
of 2 min at 72.degree. C. While no quantitative data was collected
to determine the final yield of amplified product, it is estimated
that -2 pmol were available for the enzymatic digestion.
[0770] CfoI and RsaI and reaction buffer L were purchased from
Boehringer-Mannheim. 20 .mu.l of amplified products were diluted
with 15 .mu.l water and 4 .mu.l buffer L; after addition of 10
units of restriction enzymes the samples were incubated for 60 min
at 37.degree. C. For precipitation of digest products 5 .mu.l of 3M
ammonium acetate (pH 6.5), (5 .mu.l glycogen (Braun, et al. (1997)
Clin. Chem. 43:1151) (10 mg/ml, Sigma), and 110 .mu.l absolute
ethanol were added to 50 .mu.L of the analyte solutions and stored
for 1 hour at room temperature. After at 10 min centrifugation at
13,000.times. g, the pellet was washed in 70% ethanol and
resuspended in 1 .mu.l 18Mohm/cm H.sub.2O.
[0771] Sample Preparation and Analysis by MALDI-TOF MS
[0772] 0.35 .mu.l of resuspended DNA was mixed with 0.35-1.3 .mu.L
matrix solution (0.7M 3-hydroxypicolinic acid (3-HPA), 0.07 M
ammonium citrate in 1:1 H.sub.2O:CH.sub.3CN) (Wu, et al. (1993)
Rapid Commun. Mass Spectrom. 7:142) on a stainless steel sample
target disk and allowed to air dry preceding spectrum acquisition
using a Thermo Bioanalysis Vision 2000 MALDI-TOF instrument
operated in pitive ion reflectron mode with 5 and 20 kV on the
target and conversion dynode, respectively. Theoretical average
molecular masses (M.sub.r(calc)) of the fragments were calculated
from atomic compositions; the mass of a proton (1.08 Da) was
subtracted from raw data values in reporting experimental molecular
masses (M.sub.r(exp)) as neutral basis. External calibration
generated from eight peaks (2000-18000 Da) was used for all
spectra.
[0773] Results and Discussion
[0774] FIG. 96A is a MALDI-TOF mass spectrum of a mixture of the
synthetic 50-mer with (non-complementary) 27-mer.sub.nc (each 10
.mu.M, the highest final concentration used in this study); the
laser power was adjusted to just above the threshold irradiation
for ionization. The peaks at 8.30 and 15.34 kDa represent singly
charged ions derived from the 27- and 50-mer single strands,
respectively. Poorly resolved low intensity signals at -16.6 and
-30.7 kDa represent homodimers of 27-and 50-mer, respectively; that
at 23.6 kDa is consistent with a heterodimer containing one 27-mer
and one 50-mer strand. Thus low intensity dimer ions representing
all possible combinations from the two non-complementary
oligonucleotides (27+27; 27+50; 50+50) were observed. Increasing
the irradiance even to a point where depurination peaks dominated
the spectrum resulted in slightly higher intensities of these dimer
peaks. Note that the hybridization was performed at room
temperature and with a very low salt concentration, conditions at
which non-specific hybridization may occur.
[0775] FIG. 96 shows a MALDI-TOF spectrum of the same 50-mer mixed
with (complementary) 27-mer.sub.c; the final concentration of each
oligonucleotide was again 10 .mu.M. Using the same laser power as
in FIG. 96A, intense signals were again observed at 88.34 and 15.34
Kda, consistent with single stranded 27- and 50-mer, respectively.
Homodimer peaks (27+27; 50+50) were barely apparent in the noise;
however, singly (23.68 Kda) and doubly (11.84k Da) charged
heterodimer (27+50) peaks were dominant. Although the 23.68 Kda
dimer peak could be detected from all irradiated positions, its
intensity relative to the monomer peaks varied slightly from
spot-to-spot. Repeating the experiment with individual
oligonucleotide concentrations of 5, 2.5, and 1.25 .mu.M resulted
in decreasing amounts of the 27-/50-mer Watson-Crick dimer peak
relative to the 27- and 50-mer single stranded peaks. At the lowest
concentrations, the observation of dimer was "crystal-dependent",
that is, irradiation of some crystals produced significant
27-/50-mer dimer signal, while other crystals reproducibly yielded
very little or none. This indicates that the incorporation of dsdna
into the matrix crystals or the effectiveness of retaining this
interaction through the ionization/desorption process is dependent
upon the microscopic properties of the crystals, and/or that there
exist steep concentration gradients of the duplex throughout the
sample.
[0776] Thus the FIG. 96 spectra provide strong evidence that
specific WC base paired dsdna can be observed using gentle laser
conditions with high concentrations of oligonucleotides in this
mass range, the first report of this using a 3-HPA matrix. The
study was extended to a complex mixture of dsdna derived from an
enzymatic digest (RsaI/CfoI) of a region of exon 4 of the
apolipoprotein E gene (Das et. al., (1985) J. Biol. Chem., 260
6240); expected fragment masses are given in Table IX.
24TABLE IX Cfol/Rsal Digestion Products from ApoE gene exon 4.sup.2
bases.sup.b ssDNA (Da) dsdna (Da) (+) (-) (+) (-) 11 13 3428 4025
7453 16 5004 4924 9928 18 5412 5750 11162 17 19 5283 5880 11163 19
5999 5781 11780 24 22 7510 6745 14225 31 29 9628 9185 18813 36 38
11279 11627 22906 48 14845 14858 29703 55 53 17175 16240 33415
.sup.a.epsilon.3 allele has no 17/19 or 19/19 pairs; .epsilon.4
allele contains no 36/38 pair. .sup.b(+) sense strand, (-)
antisense strand
[0777] After the digestion step, the samples were purified and
concentrated by ethanol precipitation and resuspended in 1 .mu.L
H.sub.2O before mixing them at room temperature with matrix on the
sample target. Nearly 20 peaks ranging in mass from 3.4-17.2 Kda
were resolved in the products' MALDI spectrum (FIG. 97A), all
consistent with denatured single stranded components of the double
strand (Table IX). Many such analyses of similar biological
products over a period of months also yielded spectra with
negligible dsdna, consistent with previous reports (Tang, et al.
(1994) Rapid Commun. Mass Spectrom. 8:183; Liu, et al. (1995) Anal.
Chem. 67:3482; Siegert et al. (1996) Anal. Biochem. 243:55; and
Doktycz, et al. (1995) Anal. Biochem. 230:205); contrarily, intact
double strands were observed under similar conditions for the
synthetic DNA (FIG. 96A). It is difficult to estimate the strand
concentration available after the biological reactions, but
presumably that it was far lower than that at which dimerization of
synthetic samples occurred. Furthermore, maintaining specific
hybrids within the two-component synthetic mixture may be
kinetically favored relative to the far more complex mixture of 20
single-stranded DNA components from the digest.
[0778] The effect of reduced temperature on maintaining dsDNA was
tested. An aliquot of the digested DNA solution, the matrix,
pipette, pipette tips, and the stainless steel sample target were
stored in a 4.degree. C. "cold room" for 15 minutes; as with normal
preparations matrix, and then analyte, were spotted on the target
and allowed to co-crystallize while air drying. Crystallization for
mixtures of 300 nL 3HPA (50% acetonitrile) with 300 nL analyte
required .about.1 minute at room temperature but .about.15 minutes
at the reduced temperature. Sample spots prepared in the cold room
environment typically contained a high proportion of large
transparent crystals.
[0779] MALDI-TOF analysis of an ApoE digest aliquot prepared at
reduced temperature produced the FIG. 97B spectrum. While the low
mass range appeared qualitatively similar to FIG. 97A, dramatic
differences above 8 kDa were observed. Only signals consistent with
single strands (Table IX) were observed in FIG. 97A, but the FIG.
97B cold room prepared samples did not yield signals for the same
masses except below 8 kDa. Even more striking were the additional
high mass peaks in FIG. 97B; clearly these represent dimer peaks
containing lower mass components. As was done with the synthetic
DNA, it was important to determine whether these represent
non-specific heterodimers, specific WC heterodimers, or nonspecific
homodimers. Consider first the 33.35 kDa fragment. Ignoring the
unlikely possibility that the high mass fragment represents a
trimer or higher multimer, as a dimer it must only contain the
highest mass ssDNA components, i.e., the >16 kDa.
Homodimerization of the 15.24 and 17.18 kDa fragments would result
in 32.49 and 34.35 kDa peaks, respectively; corresponding mass
errors for these incorrect assignments relative to the observed
33.35 kDa would be -2.6% and +3.0% respectively. A far better match
is achieved if this peak originates from a heterodimer of the two
highest mass single stranded fragments; their summed mass
(16.24+17.18=33.42 kDa) differed by 0.2% from the observed dimer
mass 33.35 kDa, an acceptable mass error for MALDI-TOF analysis of
large DNA fragments using external calibration. Likewise, the
29.66kDa fragment was measured only 0.13% lower than the 29.70 Da
expected for a heterodimer of 48-mers; the sum of no other possible
homodimers or heterodimers were within a reasonable range of this
mass. Similar arguments could be made for the 22.89 and 18.83 kDa
fragments, representing 36-138-mer and 31-/29-heterodimers,
respectively; the signal at 14.86 kDa is consistent with singly
charged single stranded and doubly charged double-stranded 48-mer.
The agreement of the FIG. 97B masses above 15 kDa with the of dsDNA
expected from this digest and the absence of homodimers and
non-specific heterodimers at random masses indicated that the base
pairings were indeed highly specific and provided further evidence
that gas-phase WC interactions may be retained in MALDI-generated
ions.
[0780] FIG. 98 shows a MALDI-TOF spectrum of an .epsilon.4 allele,
which, unlike the .epsilon.3, was expected to yield no 36-/38-mer
pair upon CfoI/RsaI digestion. The .epsilon.3 and .epsilon.4 mass
spectra were similar except that abundant 22.89 kDa fragment in
FIG. 97B was not present in FIG. 98; with this information alone
(Table IX) .epsilon.3 and .epsilon.4 alleles were easily
distinguished, thereby demonstrating the genotyping by direct
measurement of dsDNA by MALDI-TOF MS. Similarly dsDNA could be
ionized, transferred to the gas phase, and detected by MALDI-TOF
MS. The acceleration voltage typically employed on our instrument
was only -5kV corresponding to 1.5 kV/mm up to -2 mm from the
sample target, with the electric field strength decreasing rapidly
with distance from the sample target. Most previous work used at
least 20 kV acceleration (Lecchi et al. (1995) J. Am. Soc. Mass
Spectrom. 6:972); in one exception a 27-mer dsDNA was detected
using a frozen matrix solution and 100 V acceleration (Nelson, et
al. (1990) Rapid Commun. Mass Spectrom. 4:348). Without being bound
by any theory MALDI-induced "denaturation" of dsDNA may be due to
gas-phase collisional activation that disrupts the WC pairing when
high acceleration fields are employed, analogous to the
denaturation presumed to be a first step in the fragmentation used
for sequencing the single stranded components of dsDNA using
electrospray ionization (McLafferty et al. (1996) Int. J. Mass
Spectrom., Ion Processes). It appears that the high salt
concentrations (typically >10 mM NaCl or KCl) required to
stabilize WC paired dsDNA in solution are unsuitable for MALDI
analysis (Nordhoff et al. (1993) Nucleic Acids Res. 21:3347);
reducing the concentration of such non-volatile cations is
necessary to avoid cation-adducted MALDI signals, but destabilizes
the double strands in solution. The low pH conditions of the matrix
environment should also destabilize the duplex. As shown in FIGS.
97B and 98, storing and preparing even low concentrations of the
biological samples at reduced temperature at least in part offset
these denaturing effects, especially for longer strands where
melting temperatures are higher due to a more extensive hydrogen
bonding network. The conditions used here are recognized to be very
non-stringent annealing conditions.
[0781] The low mass tails on high mass dsDNA peaks (e.g., FIG. 97B,
232 kDa) are consistent with depurination generated to a higher
extent than the sum of depurination from each of the single strands
combined. Although depurination in solution is an acid-catalyzed
reaction, the weakly acidic conditions in the 3-HPA matrix do not
induce significant depurination; molecular ion signals from a
mixed-base 50-mer measured with De-MALDI-TOF had only minor
contributions from depurination peaks (Juhaz, et al. (1996) Anal.
Chem. 68:941). Depurination from the single stranded components of
the gas-phase dsDNA is observed even though these bases are
expected to be hydrogen bonded to the complementary base of the
accompanying strand, implying that covalent bonds are being broken
before the strand is denatured.
EXAMPLE 27
[0782] Efficiency and Specificity Assay for Base-Specific
Ribonucleases
[0783] Aliquots sampled at regular time intervals during digestion
of selected synthetic 20 to 25 mers were analyzed by mass
spectrometry. Three of the RNAses were found to be efficient and
specific. These include: the G-specific T.sub.1, the A-specific
U.sub.2 and the A/U-specific PhyM. The ribonucleases presumed to be
C-specific were found to be less reliable, e.g., did not cleave at
every C or also cleaved at U in an unpredictable manner. The three
promising RNAses all yielded cleavage at all of the predicted
positions and a complete sequence coverage was obtained. In
addition, the presence of cleavage products containing one or
several uncleaved positions (short incubation times), allowed
alignment of the cleavage products. An example of the
MALDI-spectrum of an aliquot sampled after T.sub.1 digest of a
synthetic 20-mer [SEQ ID NO:114] RNA is shown in FIG. 100.
EXAMPLE 28
[0784] Immobilization of Amplified DNA Targets to Silicon
Wafers
[0785] Silicon Surface Preparation
[0786] Silicon wafers were washed with ethanol, flamed over bunsen
burner, and immersed in an anhydrous solution of 25% (by volume)
3-aminopropyltriethoxysilane in toluene for 3 hours. The silane
solution was then removed, and the wafers were washed three times
with toluene and three times with dimethyl sulfoxide (DMSO). The
wafers were then incubated in a 10 mM anhydrous solution of
N-succinimidyl (4-iodoacetyl) aminobenzoate (SIAB) (Pierce
Chemical, Rockford, Ill.) in anhydrous DMSO. Following the
reaction, the SIAB solution was removed, and the wafers were washed
three times with DMSO. In all cases, the
iodoacetamido-functionalized wafers were used immediately to
minimize hydrolysis of the labile iodoacetamido-functionality.
Additionally, all further wafer manipulations were performed in the
dark since the iodoacetamido-functionality is light sensitive.
[0787] Immobilization of amplified thiol-containing nucleic acids
The SIAB-conjugated silicon wafers were used to analyze specific
free thiol-containing DNA fragments of a particular amplified DNA
target sequence. A 23-mer oligodeoxynucleotide containing a
5'-disulfide linkage [purchased from Operon Technologies; SEQ ID
NO: 117] that is complementary to the 3'-region of a 112 bp human
genomic DNA template [Genebank Acc. No.: Z52259; SEQ ID NO: 118]
was used as a primer in conjunction with a commercially available
49-mer primer, which is complementary to a portion of the 5'-end of
the genomic DNA [purchased from Operon Technologies; SEQ ID NO:
119], in PCR reactions to amplify a 135 bp DNA product containing a
5'-disulfide linkage attached to only one strand of the DNA duplex
[SEQ ID NO: 120].
[0788] The PCR amplification reactions were performed using the
Amplitaq GoldKit [Perkin Elmer Catalog No. N808-0249]. Briefly, 200
ng 112 bp human genomic DNA template was incubated with 10 .mu.M of
23-mer primer and 8 .mu.M of commercially available 49-mer primer,
10 mM dNTPs, 1 unit of Amplitaq Gold DNA polymerase in the buffer
provided by the manufacturer and PCR was performed in a
thermocycler.
[0789] The 5'-disulfide bond of the resulting amplified product was
fully reduced using 10 mM tris-(2-carboxyethyl) phosphine (TCEP)
(Pierce Chemical, Rockford, Ill.) to generate a free 5'-thiol
group. Disulfide reduction of the modified oligonucleotide was
monitored by observing a shift in retention time on reverse-phase
FPLC. It was determined that after five hours in the presence of 10
mM TCEP, the disulfide was fully reduced to a free thiol.
Immediately following disulfide cleavage, the modified
oligonucleotide was incubated with the iodacetamido-functionaliz-
ed wafers and conjugated to the surface of the silicon wafer
through the SIAB linker. To ensure complete thiol deprotonation,
the coupling reaction was performed at pH 8.0. Using 10 mM TCEP to
cleave the disulfide and the other reaction conditions described
above, it was possible to reproducibly yield a surface density of
250 fmol per square mm of surface.
[0790] Hybridization and MALDI-TOF Mass Spectrometry
[0791] The silicon wafer conjugated with the 135 bp
thiol-containing DNA was incubated with a complementary 12-mer
oligonucleotide [SEQ ID NO: 121] and specifically hybridized DNA
fragments were detected using MALDI-TOF MS analysis. The mass
spectrum revealed a signal with an observed experimental
mass-to-charge ratio of 3618.33; the theoretical mass-to-charge
ratio of the 12-mer oligomer sequence is 3622.4 Da.
[0792] Thus, specific DNA target molecule that contain a
5'-disulfide linkage can be amplified. The molecules are
immobilized at a high density on a SIAB-derivatized silicon wafer
using the methods described herein and specific complementary
oligonucleotides may be hybridized to these target molecules and
detected using MALDI-TOF MS analysis.
EXAMPLE 29
[0793] Use of High Density Nucleic Acid Immobilization to Generate
Nucleic Acid Arrays
[0794] Employing the high density attachment procedure described in
EXAMPLE 28, an array of DNA oligomers amenable to MALDI-TOF mass
spectrometry analysis was created on a silicon wafer having a
plurality of locations, e.g., depressions or patches, on its
surface. To generate the array, a free thiol-containing
oligonucleotide primer was immobilized only at the selected
locations of the wafer [e.g., see EXAMPLE 28]. The each location of
the array contained one of three different oligomers. To
demonstrate that the different immobilized oligomers could be
separately detected and distinguished, three distinct
oligonucleotides of differing lengths that are complementary to one
of the three oligomers were hybridized to the array on the wafer
and analyzed by MALDI-TOF mass spectrometry.
[0795] Oligodeoxynucleotides
[0796] Three sets of complementary oligodeoxynucleotide pairs were
synthesized in which one member of the complementary
oligonucleotide pair contains a 3'- or 5'-disulfide linkage
[purchased from Operon Technologies or Oligos, Etc.]. For example,
Oligomer 1 [d(CTGATGCGTCGGATCATCTTTTTT-SS); SEQ ID NO: 122]
contains a 3'-disulfide linkage whereas Oligomer 2
[d(SS-CCTCTTGGGAACTGTGTAGTATT); a 5'-disulfide derivative of SEQ ID
NO: 117] and Oligomer 3 [d(SS-GAATTCGAGCTCGGTACCCGG)- ; a
5'-disulfide derivative of SEQ ID NO: 115] each contain a
5'-disulfide linkage.
[0797] The oligonucleotides complementary to Oligomers 1-3 were
designed to be of different lengths that are easily resolvable from
one another during MALDI-TOF MS analysis. For example, a 23-mer
oligonucleotide [SEQ ID NO: 123] was synthesized complementary to a
portion of Oligomer 1, a 12-mer oligonucleotide [SEQ ID NO: 121]
was synthesized complementary to a portion of Oligomer 2 and a
21-mer [SEQ ID NO: 116] was synthesized complementary to a portion
of Oligomer 3. In addition, a fourth 29-mer oligonucleotide [SEQ ID
NO: 124] was synthesized that lacks complementarity to any of the
three oligomers. This fourth oligonucleotide was used as a negative
control.
[0798] Silicon Surface Chemistry and DNA Immobilization
[0799] (a) 4.times.4 (16-Location) Array
[0800] A 2.times.2 cm.sup.2 silicon wafer having 256 individual
depressions or wells in the form of a 16.times.16 well array was
purchased from a commercial supplier [Accelerator Technology Corp.,
College Station, Tex.]. The wells were 800.times.800 .mu.m.sup.2,
120 .mu.m deep, on a 1.125 pitch. The silicon wafer was reacted
with 3-aminopropyltriethoxysilane to produce a uniform layer of
primary amines on the surface and then exposed to the
heterobifunctional crosslinker SIAB resulting in iodoacetamido
functionalities on the surface [e.g., see EXAMPLE 28].
[0801] To prepare the oligomers for coupling to the various
locations of the silicon array, the disulfide bond of each oligomer
was fully reduced using 10 mM TCEP as depicted in EXAMPLE 28, and
the DNA resuspended at a final concentration of 10 .mu.M in a
solution of 100 mM phosphate buffer, pH 8.0. Immediately following
disulfide bond reduction, the free-thiol group of the oligomer was
coupled to the iodoacetamido functionality at 16 locations on the
wafer using the probe coupling conditions essentially as described
above in EXAMPLE 28. To accomplish the separate coupling at 16
distinct locations of the wafer, the entire surface of the wafer
was not flushed with an oligonucleotide solution but, instead, an
.about.30-nl aliquot of a predetermined modified oligomer was added
in parallel to each of 16 locations (i.e., depressions) of the 256
wells on the wafer to create a 4.times.4 array of immobilized DNA
using a robotic pintool.
[0802] The robotic pintool consists of 16 probes housed in a probe
block and mounted on an X Y, Z robotic stage. The robotic stage was
a gantry system which enables the placement of sample trays below
the arms of the robot. The gantry unit itself is composed of X and
Y arms which move 250 and 400 mm, respectively, guided by brushless
linear servo motors with positional feedback provided by linear
optical encoders. A lead screw driven Z axis (50 mm vertical
travel) is mounted to the xy axis slide of the gantry unit and is
controlled by an in-line rotary servo motor with positional
feedback by a motor-mounted rotary optical encoder. The work area
of the system is equipped with a slide-out tooling plate that holds
five microtiter plates (most often, 2 plates of wash solution and 3
plates of sample for a maximum of 1152 different oligonucleotide
solutions) and up to ten 20.times.20 mm wafers. The wafers are
placed precisely in the plate against two banking pins and held
secure by vacuum. The entire system is enclosed in plexi-glass
housing for safety and mounted onto a steel support frame for
thermal and vibrational damping. Motion control is accomplished by
employing a commercial motion controller which was a 3-axis servo
controller and is integrated to a computer; programming code for
specific applications is written as needed.
[0803] To create the DNA array, a pintool with assemblies that have
solid pin elements was dipped into 16 wells of a multi-well DNA
source plate containing solutions of Oligomers 1-3 to wet the
distal ends of the pins, the robotic assembly moves the pin
assembly to the silicon wafer, and the sample spotted by surface
contact. Thus, one of modified Oligomers 1-3 was covalently
immobilized to each of 16 separate wells of the 256 wells on the
silicon wafer thereby creating a 4.times.4 array of immobilized
DNA.
[0804] In carrying out the hybridization reaction, the three
complementary oligonucleotides and the negative control
oligonucleotide were mixed at a final concentration of 10 .mu.M for
each oligonucleotide in 1 ml of TE buffer [10 mM Tris-HCl, pH 8.0,
1 mM EDTA] supplemented with 1 M NaCl, and the solution was heated
at 65.degree. C. for 10 min. Immediately thereafter, the entire
surface of the silicon wafer was flushed with 800 .mu.l of the
heated oligonucleotide solution. The complementary oligonucleotides
were annealed to the immobilized oligomers by incubating the
silicon array at ambient temperature for 1 hr, followed by
incubation at 4.degree. C. for at least 10 min. Alternatively, the
oligonucleotide solution can be added to the wafer which is then
heated and allowed to cool for hybridization.
[0805] The hybridized array was then washed with a solution of 50
mM ammonium citrate buffer for cation exchange to remove sodium and
potassium ions on the DNA backbone (Pieles et al., (1993) Nucl.
Acids Res. 21:3191-3196). A 6-nl aliquot of a matrix solution of
3-hydroxypicolinic acid [0.7 M 3-hydroxypicolinic acid-10% ammonium
citrate in 50% acetonitrile; see Wu et al. Rapid Commun. Mass
Spectrom. 7:142-146 (1993)] was added in series to each location of
the array using a robotic piezoelectric serial dispenser (i.e., a
piezoelectric pipette system).
[0806] The piezoelectric pipette system is built on a system
purchased from Microdrop GmbH, Norderstedt Germany and contains a
piezoelectric element driver which sends a pulsed signal to a
piezoelectric element bonded to and surrounding a glass capillary
which holds the solution to be dispensed; a pressure transducer to
load (by negative pressure) or empty (by positive pressure) the
capillary; a robotic xyz stage and robot driver to maneuver the
capillary for loading, unloading, dispensing, and cleaning, a
stroboscope and driver pulsed at the frequency of the piezo element
to enable viewing of `suspended` droplet characteristics; separate
stages for source and designation plates or sample targets (i.e. Si
chip); a camera mounted to the robotic arm to view loading to
designation plate; and a data station which controls the pressure
unit, xyz robot, and piezoelectric driver.
[0807] The 3-HPA solution was allowed to dry at ambient temperature
and thereafter a 6-nl aliquot of water was added to each location
using the piezoelectric pipette to resuspend the dried matrix-DNA
complex, such that upon drying at ambient temperature the
matrix-DNA complex forms a uniform crystalline surface on the
bottom surface of each location.
[0808] MALDI-TOF MS Analysis
[0809] The MALDI-TOF MS analysis was performed in series on each of
the 16 locations of the hybridization array illustrated in FIG. 6
essentially as described in EXAMPLE 28. The resulting mass spectrum
of oligonucleotides that specifically hybridized to each of the 16
locations of the DNA hybridization revealed a specific signal at
each location representative of observed experimental
mass-to-charge ratio corresponding to the specific complementary
nucleotide sequence.
[0810] For example, in the locations that have only Oligomer 1
conjugated thereto, the mass spectrum revealed a predominate signal
with an observed experimental mass-to-charge ratio of 7072.4
approximately equal to that of the 23-mer; the theoretical
mass-to-charge ratio of the 23-mer is 7072.6 Da. Similarly,
specific hybridization of the 12-mer oligonucleotide to the array,
observed experimental mass-to-charge ratio of 3618.33 Da
(theoretical 3622.4 Da), was detected only at those locations
conjugated with Oligomer 2 whereas specific hybridization of MJM6
(observed experimental mass-to-charge ratio of 6415.4) was detected
only at those locations of the array conjugated with Oligomer 3
[theoretical 6407.2 Da].
[0811] None of the locations of the array revealed a signal that
corresponds to the negative control 29-mer oligonucleotide
(theoretical mass-to-charge ratio of 8974.8) indicating that
specific target DNA molecules can be hybridized to oligomers
covalently immobilized to specific locations on the surface of the
silicon array and a plurality of hybridization assays may be
individually monitored using MALDI-TOF MS analysis.
[0812] (b) 8.times.8 (64-Location) Array
[0813] A 2.times.2 cm.sup.2 silicon wafer having 256 individual
depressions or wells that form a 16.times.16 array of wells was
purchased from a commercial supplier [Accelerator Technology Corp.,
College Station, Tex.]. The wells were 800.times.800 .mu.m.sup.2,
120 .mu.m deep, on a 1.125 pitch. The silicon wafer was reacted
with 3-aminopropyltriethoxysilane to produce a uniform layer of
primary amines on the surface and then exposed to the
heterobifunctional crosslinker SIAB resulting in iodoacetamido
functionalities on the surface as described above.
[0814] To make an array of 64 elements, a pintool was used
following the procedures described above. The pintool was dipped
into 16 wells of a 384 well DNA source plate containing solutions
of Oligomers 1-3, moved to the silicon wafer, and the sample
spotted by surface contact. Next, the tool was dipped in washing
solution, then dipped into the same 16 wells of the source plate,
and spotted onto the target 2.25 mm offset from the initial set of
16 spots; the entire cycle was repeated to make a 2.times.2 array
from each pin to produce an 8.times.8 array of spots (2.times.2
elements/pin .times.16 pins=64 total elements spotted).
[0815] Oligomers 1-3 immobilized to the 64 locations were
hybridized to complementary oligonucleotides and analyzed by
MALDI-TOF MS analysis. As observed for the 16-location array,
specific hybridization of the complementary oligonucleotide to each
of the immobilized thiol-containing oligomers was observed in each
of the locations of the DNA array.
EXAMPLE 30
[0816] Extension of Hybridized DNA Primers Bound to DNA Templates
Immobilized on a Silicon Wafer
[0817] The SIAB-derivatized silicon wafers can also be employed for
primer extension reactions of the immobilized DNA template using
the procedures essentially described in EXAMPLE 7.
[0818] A 27-mer oligonucleotide [SEQ ID NO: 125] containing a
3'-free thiol group was coupled to a SIAB-derivatized silicon wafer
as described above, for example, in EXAMPLE 28. A 12-mer
oligonucleotide primer [SEQ ID NO: 126] was hybridized to the
immobilized oligonucleotide and the primer was extended using a
commercially available kit [e.g., Sequenase or ThermoSequenase,
U.S. Biochemical Corp]. The addition of Sequenase DNA polymerase or
ThermoSequenase DNA polymerase in the presence of three
deoxyribonucleoside triphosphates (dNTPs; dATP, dGTP, dCTP) and
dideoxyribonucleoside thymidine triphosphate (ddTTP) in buffer
according to the instructions provided by the manufacturer resulted
in a 3-base extension of the 12-mer primer while still bound to the
silicon wafer. The wafer was then analyzed by MALDI-TOF mass
spectrometry as described above. The mass spectrum results clearly
distinguish the 15-mer [SEQ ID NO: 127] from the original
unextended 12-mer thus indicating that specific extension can be
performed on the surface of a silicon wafer and detected using
MALDI-TOF MS analysis.
EXAMPLE 31
[0819] Effect of Linker Length on Polymerase Extension of
Hybridized DNA Primers Bound to DNA Templates Immobilized on a
Silicon Wafer
[0820] The effect of the distance between the SIAB-conjugated
silicon surface and the duplex DNA formed by hybridization of the
target DNA to the immobilized oligomer template was investigated,
as well as choice of enzyme.
[0821] Two SIAB-derivatized silicon wafers were conjugated to the
3'-end of two free thiol-containing oligonucleotides of identical
DNA sequence except for a 3-base poly dT spacer sequence
incorporated at the 3'-end:
25 CTGATGCGTC GGATCATCTT TTTT SEQ ID No.122 CTGATGCGTC GGATCATCTT
TTTTTTT SEQ ID No.125.
[0822] These oligonucleotides were synthesized and each was
separately immobilized to the surface of a silicon wafer through
the SIAB cross-linker [e.g., see EXAMPLE 28]. Each wafer was
incubated with a 12-mer oligonucleotide:
26 AAAAAAGATG AT SEQ ID No.126 GATGATCCGA CG SEQ ID No.128
GATCCGACGC AT SEQ ID No.129,
[0823] which is complementary to portions of the nucleotide
sequences common to both of the oligonucleotides, by denaturing at
75.degree. C. and slow cooling the silicon wafer. The wafers were
then analyzed by MALDI-TOF mass spectrometry as described
above.
[0824] As described in EXAMPLE 30 above, a 3-base specific
extension of the bound 12-mer oligonucleotide was observed using
the oligomer primer where there is a 9-base spacer between the
duplex and the surface [SEQ ID NO: 125]. Similar results were
observed when the DNA spacer lengths between the SIAB moiety and
the DNA duplex were 0, 3, 6 and 12. In addition, the extension
reaction may be performed using a variety of DNA polymerases, such
as Sequenase and Thermo Sequenase (US Biochemical). Thus, the SIAB
linker may be directly coupled to the DNA template or may include a
linker sequence without effecting primer extension of the
hybridized DNA.
EXAMPLE 32
[0825] Spectrochip Mutant Detection in ApoE Gene
[0826] This example describes the hybridization of an immobilized
template, primer extension and mass spectrometry for detection of
the wildtype and mutant Apolipoprotein E gene for diagnostic
purposes. This example demonstrates that immobilized DNA molecules
containing a specific sequence can be detected and distinguished
using primer extension of unlabeled allele specific primers and
analysis of the extension products using mass spectrometry.
[0827] A 50 base synthetic DNA template complementary to the coding
sequence of allele 3 of the wildtype apolipoprotein E gene:
[0828] 5'-GCCTGGTACACTGCCAGGCGCTTCTGCAGGTCATCGGCATCGCGGAGGAG-3'
[SEQ ID NO: 280] or complement to the mutant apolipoprotein E gene
carrying a G.fwdarw.A transition at codon 158:
[0829] 5'-GCCTGGTACACTGCCAGGCACTTCTGCAGGTCATCGGCATCGCGGAGGAG-3'
[SEQ ID NO: 281] containing a 3'-free thiol group was coupled to
separate SIAB-derivatized silicon wafers as described in Example
28.
[0830] A 21-mer oligonucleotide primer: 5'-GAT GCC GAT GAC CTG CAG
AAG-3' [SEQ ID NO: 282] was hybridized to each of the immobilized
templates and the primer was extended using a commercially
available kit [e.g., Sequenase or Thermosequenase, U.S. Biochemical
Corp]. The addition of Sequenase DNA polymerase or Thermosequenase
DNA polymerase in the presence of three deoxyribonucleoside
triphosphates (dNTPs; dATP, dGTP, dTTP) and dideoxyribonucleoside
cytosine triphosphate (ddCTP) in buffer according to the
instructions provided by the manufacturer resulted in a single base
extension of the 21-mer primer bound to the immobilized template
encoding the wildtype apolipoprotein E gene and a three base
extension of the 21-mer primer bound to the immobilized template
encoding the mutant form of apolipoprotein E gene.
[0831] The wafers were analyzed by mass spectrometry as described
herein. The wildtype apolipoprotein E sequence results in a mass
spectrum that distinguishes the primer with a single base extension
(22-mer) with a mass to charge ratio of 6771.17 Da (the theoretical
mass to charge ratio is 6753.5 Da) from the original 21-mer primer
with a mass to charge ration of 6499.64 Da. The mutant
apolipoprotein E sequence results in a mass spectrum that
distinguishes the primer with a three base extension (24-mer) with
a mass to charge ratio of 7386.9 (the theoretical mass charge is
7386.9) from the original 21-mer primer with a mass to charge
ration of 6499.64 Da.
EXAMPLE 33
[0832] Detection of Double-Stranded Nucleic Acid Molecules via
Strand Displacement and Hybridization to an Immobilized
Complementary Nucleic Acid
[0833] This example describes immobilization of a 24-mer primer and
the specific hybridization of one strand of a duplex DNA molecule,
thereby permitting amplication of a selected target molecule in
solution phase and permitting detection of the double stranded
molecule. This method is useful for detecting single base changes,
and, particularly for screening genomic libraries of
double-stranded fragments.
[0834] A 24-mer DNA primer CTGATGCGTC GGATCATCTT TTTT SEQ ID No.
122, containing a 3'-free thiol group was coupled to a
SIAB--derivatized silicon wafer as described in Example 29.
[0835] An 18-mer synthetic oligonucleotide:
5'-CTGATGCGTCGGATCATC-3' [SEQ ID NO: 286] was premixed with a
12-mer 5'-GATGATCCGACG-3' [SEQ ID NO: 285] that has a sequence that
is complementary to 12 base portion of the 18-mer oligonucleotide.
The oligonucleotide mix was heated to 75.degree. C. and cooled
slowly to room temperature to faciliate the formation of a duplex
molecule:
27 5'-CTGATGCGTCGGATCATC-3' [SEQ ID NO.286] 3'-GCAGCCTAGTAG-5' [SEQ
ID NO:287].
[0836] The specific hybridization of the 12-mer strand of the
duplex molecule to the immobilized 24-mer primer was carried out by
mixing 1 .mu.M of the duplex molecule using the hybridization
conditions described in Example 30.
[0837] The wafers were analyzed by mass spectrometry as described
above. Specific hybridization was detected in a mass spectrum of
the 12-mer with a mass to charge ratio of 3682.78 Da.
EXAMPLE 34
[0838]
1-(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)phenyl)-1-O-((2-cyano-
ethoxy)-diisopropylaminophosphino)ethane
[0839] A. 2-Nitro-5-(3-hydroxypropoxy)benzaldehyde
[0840] 3-Bromo-1-propanol (3.34 g, 24 mmol) was refluxed in 80 ml
of anhydrous acetonitrile with 5-hydroxy-2-nitrobenzaldehyde (3.34
g, 20 mmol), K.sub.2CO.sub.3 (3.5 g), and KI (100 mg) overnight (15
h). The reaction mixture was cooled to room temperature and 150 ml
of methylene chloride was added. The mixture was filtered and the
solid residue was washed with methylene chloride. The combined
organic solution was evaporated to dryness and redissolved in 100
ml methylene chloride. The resulted solution was washed with
saturated NaCl solution and dried over sodium sulfate. 4.31 g (96%)
of desired product was obtained after removal of the solvent in
vacuo. Rf=0.33 (dichloromethane/methanol, 95/5).
[0841] UV (methanol) maximum: 313, 240 (shoulder), 215 nm; minimum:
266 nm. .sup.1H NMR (DMSO-d.sub.6).delta. 10.28 (s, 1H), 8.17 (d,
1H), 7.35 (d, 1H), 7.22 (s, 1H), 4.22(t, 2H), 3.54 (t, 2H), 1.90
(m, 2H). .sup.13C NMR (DMSO-d.sub.6).delta. 189.9, 153.0, 141.6,
134.3, 127.3, 118.4, 114.0, 66.2, 56.9, 31.7.
[0842] B.
2-Nitro-5-(3-O-t-butyidimethylsilylpropoxy)benzaldehyde
[0843] 2-Nitro-5-(3-hydroxypropoxy)benzaldehyde(1 g, 4.44 mmol) was
dissolved in 50 ml anhydrous acetonitrile. To this solution, it was
added 1 ml of triethylamine, 200 mg of imidazole, and 0.8 g (5.3
mmol) of tBDMSCI. The mixture was stirred at room temperature for 4
h. Methanol (1 ml) was added to stop the reaction. The solvent was
removed in vacuo and the solid residue was redissolved in 100 ml
methylene chloride. The resulted solution was washed with saturated
sodium bicarbonate solution and then water. The organic phase was
dried over sodium sulfate and the solvent was removed in vacuo. The
crude mixture was subjected to a quick silica gel column with
methylene chloride to yield 1.44 g (96%) of
2-nitro-5-(3-O-t-butyldimethylsilylpropoxy)benzaldehyde. Rf=0.67
(hexane/ethyl acetate, 5/1).
[0844] UV (methanol), maximum: 317, 243, 215 nm; minimum: 235, 267
nm. .sup.1H NMR (DMSO-d.sub.6).delta. 10.28 (s, 1H), 8.14 (d, 1H),
7.32 (d, 1H), 7.20 (s, 1H), 4.20 (t, 2H), 3.75 (t, 2H), 1.90 (m,
2H), 0.85 (s, 9H), 0.02 (s, 6H). .sup.13C NMR (DMSO-d.sub.6).delta.
189.6, 162.7, 141.5, 134.0, 127.1, 118.2, 113.8, 65.4, 58.5, 31.2,
25.5,-3.1,-5.7.
[0845] C.
1-(2-Nitro-5-(3-O-t-butyidimethylsilylpropoxy)phenyl)ethanol
[0846] High vacuum dried
2-nitro-5-(3-O-t-butyldimethylsilylpropoxy)benzal- dehyde (1.02 g,
3 mmol) was dissolved 50 ml of anhydrous methylene chloride. 2 M
Trimethylaluminium in toluene (3 ml) was added dropwise within 10
min and keeped the reaction mixture at room temperature. It was
stirred further for 10 min and the mixture was poured into 10 ml
ice cooled water. The emulsion was separated from water phase and
dried over 100 g of sodium sulfate to remove the remaining water.
The solvent was removed in vacuo and the mixture was applied to a
silica gel column with gradient methanol in methylene chloride.
0.94 g (86%) of desired product was isolated. Rf=0.375
(hexane/ethyl acetate, 5/1).
[0847] UV (methanol), maximum: 306, 233, 206 nm; minimum: 255, 220
nm. .sup.1H NMR (DMSO-d.sub.6).delta. 8.00 (d, 1H), 7.36 (s, 1H),
7.00 (d, 1H), 5.49 (b, OH), 5.31 (q, 1H), 4.19 (m, 2H), 3.77 (t,
2H), 1.95 (m, 2H), 1.37 (d, 3H), 0.86 (s, 9H), 0.04 (s, 6H).
.sup.13C NMR (DMSO-d.sub.6).delta. 162.6, 146.2, 139.6, 126.9,
112.9, 112.5, 64.8, 63.9, 58.7, 31.5, 25.6, 24.9,-3.4,-5.8.
[0848] D. 1-(2-Nitro-5-(3-hydroxypropoxy)phenyl)ethanol
[0849] 1-(2-Nitro-5-(3-O-t-butyldimethylsilylpropoxy)phenyl)ethanol
(0.89 g, 2.5 mmol) was dissolved in 30 ml of THF and 0.5 mmol of
nBu.sub.4NF was added under stirring. The mixture was stirred at
room temperature for 5 h and the solvent was removed in vacuo. The
remaining residue was applied to a silica gel column with gradient
methanol in methylene chloride.
1-(2-Nitro-5-(3-hydroxypropoxy)phenyl)ethanol (0.6 g (99%) was
obtained. Rf=0.17 (dichloromethane/methanol, 95/5).
[0850] UV (methanol), maximum: 304, 232, 210 nm; minimum: 255, 219
nm.
[0851] .sup.1H NMR (DMSO-d.sub.6) .delta. 8.00 (d, 1H), 7.33 (s,
1H), 7.00 (d, 1H), 5.50 (d, OH), 5.28 (t, OH), 4.59 (t, 1H), 4.17
(t, 2H), 3.57 (m, 2H), 1.89 (m, 2H), 1.36 (d, 2H).
[0852] .sup.13C NMR (DMOS-d.sub.6).delta. 162.8, 146.3, 139.7,
127.1, 113.1, 112.6, 65.5, 64.0, 57.0, 31.8, 25.0.
[0853] E.
1-(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)phenyl)ethanol
[0854] 1-(2-Nitro-5-(3-hydroxypropoxy)phenyl)ethanol (0.482 g, 2
mmol) was co-evaporated with anhydrous pyridine twice and dissolved
in 20 ml anhydrous pyridine. The solution was cooled in ice-water
bath and 750 mg (2.2 mmol) of DMTCI was added. The reaction mixture
was stirred at room temperature overnight and 0.5 ml methanol was
added to stop the reaction. The solvent was removed in vacuo and
the residue was co-evaporated with toluene twice to remove trace of
pyridine. The final residue was applied to a silica gel column with
gradient methanol in methylene chloride containing drops of
triethylamine to yield 0.96 g (89%) of the desired product
1-(2-nitro-5-(3-O-4,4'-dimethoxytrityl-propoxy)phenyl)ethanol.
Rf=0.50 (dichloromethane/methanol, 99/1).
[0855] UV (methanol), maximum: 350 (shoulder), 305, 283, 276
(shoulder), 233, 208 nm; minimum: 290, 258, 220 nm.
[0856] .sup.1H NMR (DMSO-d.sub.6).delta. 8.00 (d, 1H), 6.82-7.42
(ArH), 5.52 (d, OH), 5.32 (m, 1H), 4.23 (t, 2H), 3.71 (s, 6H), 3.17
(t, 2H), 2.00 (m, 2H), 1.37 (d, 3H).
[0857] .sup.13C NMR (DMOS-d.sub.6).delta. 162.5, 157.9, 157.7,
146.1, 144.9, 140.1, 139.7, 135.7, 129.5, 128.8, 127.6, 127.5,
127.3, 126.9, 126.4, 113.0, 112.8, 112.6, 85.2, 65.3, 63.9, 59.0,
54.8, 28.9, 24.9.
[0858] F.
1-(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)phenyl)-1-O-((2-cy-
anoethoxy)-diisopropylaminophosphino)ethane
[0859] 1-(2-Nitro-5-(3-O-4,4'-dimethoxytritylpropoxy)
phenyl)ethanol (400 mg, 0.74 mmol) was dried under high vacuum and
was dissolved in 20 ml of anhydrous methylene chloride. To this
solution, it was added 0.5 ml N,N-diisopropylethylamine and 0.3 ml
(1.34 mmol) of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite.
The reaction mixture was stirred at room temperature for 30 min and
0.5 ml of methanol was added to stop the reaction. The mixture was
washed with saturated sodium bicarbonate solution and was dried
over sodium sulfate. The solvent was removed in vacuo and a quick
silica gel column with 1% methanol in methylene chloride containing
drops of triethylamine yield 510 mg (93%) the desired
phosphoramidite.
[0860] Rf=0.87 (dichloromethane/methanol, 99/1).
EXAMPLE 35
[0861]
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)-1-O-
-((2-cyanoethoxy)-diisopropylaminophosphino)ethane
[0862] A. 4-(3-Hydroxypropoxy)-3-methoxyacetophenone
[0863] 3-Bromo-1-propanol (53 ml, 33 mmol) was refluxed in 100 ml
of anhydrous acetonitrile with 4-hydroxy-3-methoxyacetophenone (5
g, 30 mmol), K.sub.2CO.sub.3 (5 g), and KI (300 mg) overnight (15
h). Methylenechloride (150 ml) was added to the reaction mixture
after cooling to room temperature. The mixture was filtered and the
solid residue was washed with methylene chloride. The combined
organic solution was evaporated to dryness and redissolved in 100
ml methylene chloride. The resulted solution was washed with
saturated NaCl solution and dried over sodium sulfate. 6.5 g
(96.4%) of desired product was obtained after removal of the
solvent in vacuo.
[0864] Rf=0.41 (dichloromethane/methanol, 95/5).
[0865] UV (methanol), maximum: 304, 273, 227, 210 nm: minimum: 291,
244, 214 nm.
[0866] .sup.1H NMR (DMSO-d.sub.6).delta. 7.64 (d, 1H), 7.46 (s,
1H), 7.04 (d, 1H), 4.58 (b, OH), 4.12 (t, 2H), 3.80 (s, 3H), 3.56
(t, 2H), 2.54 (s, 3H), 1.88 (m, 2H).
[0867] .sup.13C NMR (DMSO-d.sub.6).delta. 196.3, 152.5, 148.6,
129.7, 123.1, 111.5, 110.3, 65.4, 57.2, 55.5, 31.9, 26.3.
[0868] B. 4-(3-Acetoxypropoxy)-3-methoxyacetophenone
[0869] 4-(3-Hydroxypropoxy)-3-methoxyacetophenone (3.5 g, 15.6
mmol) was dried and dissolved in 80 ml anhydrous acetonitrile. This
mixture, 6 ml of triethylamine and 6 ml of acetic anhydride were
added. After 4 h, 6 ml methanol was added and the solvent was
removed in vacuo. The residue was dissolved in 100 ml
dichloromethane and the solution was washed with dilute sodium
bicarbonate solution, then water. The organic phase was dried over
sodium sulfate and the solvent was removed. The solid residue was
applied to a silica gel column with methylene chloride to yield
4.1g of 4-(3-acetoxypropoxy)-3-methoxyacetophenone (98.6%).
[0870] Rf 0.22 (dichloromethane/methanol, 99/1).
[0871] UV (methanol), maximum: 303, 273, 227, 210 nm; minimum: 290,
243, 214 nm.
[0872] .sup.1H NMR (DMSO-d.sub.6).delta. 7.62 (d, 1H), 7.45 (s,
1H), 7.08 (d, 1H), 4.12 (m, 4H, 3.82 (s, 3H), 2.54 (s, 3H), 2.04
(m, 2H), 2.00 (s, 3H).
[0873] .sup.13C NMR (DMSO-d.sub.6).delta. 196.3, 170.4, 152.2,
148.6, 130.0, 123.0, 111.8, 110.4, 65.2, 60.8, 55.5, 27.9, 26.3,
20.7.
[0874] C. 4-(3-Acetoxypropoxy)-3-methoxy-6-nitroacetophenone
[0875] 4-(3-Acetoxypropoxy)-3-methoxyacetophenone (3.99 g, 15 mmol)
was added portionwise to 15 ml of 70% HNO.sub.3 in water bath and
keep the reaction temperature at the room temperature. The reaction
mixture was stirred at room temperature for 30 min and 30 g of
crushed ice was added. This mixture was extracted with 100 ml of
dichloromethane and the organic phase was washed with saturated
sodium bicarbonate solution. The solution was dried over sodium
sulfate and the solvent was removed in vacuo. The crude mixture was
applied to a silica gel column with gradient methanol in methylene
chloride to yield 3.8 g (81.5%) of desired product
4-(3-acetoxypropoxy)-3-methoxy-6-nitroacetophenone and 0.38 g (8%)
of ipso-substituted product 5-(3-acetoxypropoxy)-4-methoxy-1,
2-dinitrobenzene. Side ipso-substituted product
5-(3-acetoxypropoxy)-4-me- thoxy-1,2-dinitrobenzene:
[0876] Rf=0.47 (dichloromethane/methanol, 99/1).
[0877] UV (methanol), maximum: 334, 330, 270, 240, 212 nm; minimum:
310, 282, 263, 223 nm.
[0878] .sup.1H NMR (CDCl.sub.3).delta. 7.36 (s, 1H), 7.34 (s, 1H),
4.28 (t, 2H), 4.18 (t, 2H), 4.02 (s, 3H), 2.20 (m, 2H), 2.08 (s,
3H).
[0879] .sup.13C NMR (CDCl.sup.3).delta. 170.9, 152.2, 151.1, 117.6,
111.2, 107.9, 107.1, 66.7, 60.6, 56.9, 28.2, 20.9.
[0880] Desired product
4-(3-acetoxypropoxy)-3-methoxy-6-nitroacetophenone: Rf=0.29
(dichloromethane/methanol, 99/1).
[0881] UV (methanol), maximum: 344, 300, 246, 213 nm; minimum: 320,
270, 227 nm.
[0882] .sup.1H NMR (CDCl.sub.3).delta. 7.62 (s, 1 H), 6.74 (s, 1H),
4.28 (t, 2H), 4.20 (t, 2H), 3.96 (s, 3H), 2.48 (s, 3H), 2.20 (m,
2H), 2.08 (s, 3H).
[0883] .sup.13C NMR (CDCl.sub.3).delta. 200.0, 171.0, 154.3, 148.8,
138.3, 133.0, 108.8, 108.0, 66.1, 60.8, 56.6, 30.4, 28.2, 20.9.
[0884] D.
1-(4-(3-Hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethanol
[0885] 4-(3-Acetoxypropoxy)-3-methoxy-6-nitroacetophenone (3.73 g,
12 mmol) was added 150 ml ethanol and 6.5 g of K.sub.2CO.sub.3. The
mixture was stirred at room temperature for 4h and TLC with 5%
methanol in dichloromethane indicated the completion of the
reaction. To this same reaction mixture, it was added 3.5 g of
NaBH.sub.4 and the mixture was stirred at room temperature for 2h.
Acetone (10 ml) was added to react with the remaining NaBH.sub.4.
The solvent was removed in vacuo and the residue was uptaken into
50 g of silica gel. The silica gel mixture was applied on the top
of a silica gel column with 5% methanol in methylene chloride to
yield 3.15 g (97%) of desired product 1-(4-(3-hydroxypropoxy)-
-3-methoxy-6-nitrophenyl)ethanol. Intermediate product
4-(3-hydroxypropoxy)-3-methoxy-6-nitroacetophenone after
deprotection:
[0886] Rf=0.60 (dichloromethane/methanol, 95/5).
[0887] Final product
1-(4-(3-hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethan- ol:
[0888] Rf=0.50 (dichloromethane/methanol, 95/5).
[0889] UV (methanol), maximum: 344, 300, 243, 219 nm: minimum: 317,
264, 233 nm.
[0890] .sup.1H NMR (DMSO-d.sub.6).delta. 7.54 (s, 1H), 7.36 (s, 1
H), 5.47 (d, OH), 5.27 (m, 1H), 4.55 (t, OH), 4.05 (t, 2H), 3.90
(s, 3H), 3.55 (q, 2H), 1.88 (m, 2H), 1.37 (d, 3H).
[0891] .sup.13C NMR (DMSO-d.sub.6).delta. 153.4, 146.4, 138.8,
137.9, 109.0, 108.1, 68.5, 65.9, 57.2, 56.0, 31.9, 29.6.
[0892] E.
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)e-
thanol
[0893] 1-(4-(3-Hydroxypropoxy)-3-methoxy-6-nitrophenyl)ethanol
(0.325 g, 1.2 mmol) was co-evaporated with anhydrous pyridine twice
and dissolved in 15 ml anhydrous pyridine. The solution was cooled
in ice-water bath and 450 mg (1.33 mmol) of DMTCI was added. The
reaction mixture was stirred at room temperature overnight and 0.5
ml methanol was added to stop the reaction. The solvent was removed
in vacuo and the residue was co-evaporated with toluene twice to
remove trace of pyridine. The final residue was applied to a silica
gel column with gradient methanol in methylene chloride containing
drops of triethylamine to yield 605 mg (88%) of desired product
1-(4-(3-O-4,4'-dimethoxytritylpropoxy)-3-methoxy-
-6-nitrophenyl)ethanol. Rf=0.50 (dichloromethane/methanol,
95/5).
[0894] UV (methanol), maximum: 354, 302, 282, 274, 233, 209 nm;
minimum: 322, 292, 263, 222 nm.
[0895] .sup.1H NMR (DMSO-d.sub.6).delta. 7.54 (s, 1 H), 6.8-7.4
(ArH), 5.48 (d, OH), 5.27 (m, 1H), 4.16 (t, 2H), 3.85 (s, 3H), 3.72
(s, 6H), 3.15 (t, 2H), 1.98 (t, 2H), 1.37 (d, 3H).
[0896] .sup.13C NMR (DMSO-d.sub.6).delta. 157.8, 153.3, 146.1,
144.9, 138.7, 137.8, 135.7, 129.4, 128.7, 127.5, 127.4, 126.3,
112.9, 112.6, 108.9, 108.2, 85.1, 65.7, 63.7, 59.2, 55.8, 54.8,
29.0, 25.0.
[0897] F.
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)--
1-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane
[0898]
1-(4-(3-O-4,4'-Dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)etha-
nol (200 mg, 3.5 mmol) was dried under high vacuum and was
dissolved in 15 ml of anhydrous methylene chloride. To this
solution, it was added 0.5 ml N,N-diisopropylethylamine and 0.2 ml
(0.89 mmol) of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite.
The reaction mixture was stirred at room temperature for 30 min and
0.5 ml of methanol was added to stop the reaction. The mixture was
washed with saturated sodium bicarbonate solution and was dried
over sodium sulfate. The solvent was removed in vacuo and a quick
silica gel column with 1% methanol in methylene chloride containing
drops of triethylamine yield 247 mg (91.3%) the desired
phosphoramidite 1-(4-(3-O-4,4'-dimethoxytritylpropoxy)-3-meth-
oxy-6-nitrophenyl)-1-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane.
[0899] Rf 0.87 (dichloromethane/methanol, 99/1).
EXAMPLE 36
[0900] Oligonucleotide Synthesis
[0901] The oligonucleotide conjugates containing photocleavable
linker were prepared by solid phase nucleic acid synthesis (see:
Sinha et al. Tetrahedron Lett. 1983, 24, 5843-5846; Sinha et al.
Nucleic Acids Res. 1984, 12, 4539-4557; Beaucage et al. Tetrahedron
1993, 49, 6123-6194; and Matteucci et al. J. Am. Chem. Soc. 1981,
103, 3185-3191) under standard conditions. In addition a longer
coupling time period was employed for the incorporation of
photocleavable unit and the 5' terminal amino group. The coupling
efficiency was detected by measuring the absorbance of released DMT
cation and the results indicated a comparable coupling efficiency
of phosphoramidite 1-(2-nitro-5-(3-O-4,4'-dimethoxytritylpropo- xy)
phenyl)-1-O-((2-cyanoethoxy)-diisopropylaminophosphino)ethane or
1-(4-(3-O-4,4'-dimethoxytritylpropoxy)-3-methoxy-6-nitrophenyl)-1-O-((2-c-
yanoethoxy)-diisopropylaminophosphino)ethane with those of common
nucleoside phosphoramodites. Deprotection of the base protection
and release of the conjugates from the solid support was carried
out with concentrated ammonium at 55.degree. C. overnight.
Deprotection of the base protection of other conjugates was done by
fast deprotection with AMA reagents. Purification of the MMT-on
conjugates was done by HPLC (trityl-on) using 0.1 M
triethylammonium acetate, pH 7.0 and a gradient of acetonitrile (5%
to 25% in 20 minutes). The collected MMT or DMT protected conjugate
was reduced in volume, detritylated with 80% aqueous acetic acid
(40 min, 0.degree. C.), desalted, stored at -20.degree. C.
EXAMPLE 37
[0902] Photolysis Study
[0903] In a typical case, 2 nmol of oligonucleotide conjugate
containing photocleavable linker in 200 .mu.l distilled water was
irradiated with a long wavelength UV lamp (Blak Ray XX-15 UV lamp,
Ultraviolet products, San Gabriel, Calif.) at a distance of 10 cm
(emission peak 365 nm, lamp intensity=1.1 mW/cm.sup.2 at a distance
of 31 cm). The resulting mixture was analyzed by HPLC (trityl-off)
using 0.1 M triethylammonium acetate, pH 7.0 and a gradient of
acetonitrile. Analysis showed that the conjugate was cleaved from
the linder within minutes upon UV irradiation.
[0904] Equivalents
[0905] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, numerous
equivalents to the specific procedures described herein. Such
equivalents are considered to be within the scope of this invention
and are covered by the following claims.
Sequence CWU 0
0
* * * * *