U.S. patent application number 10/290794 was filed with the patent office on 2003-07-03 for site-specific isotopically-labeled proteins, amino acids, and biochemical precursors therefor.
Invention is credited to Augeri, David J., Fesik, Stephen W..
Application Number | 20030124673 10/290794 |
Document ID | / |
Family ID | 46281509 |
Filed Date | 2003-07-03 |
United States Patent
Application |
20030124673 |
Kind Code |
A1 |
Fesik, Stephen W. ; et
al. |
July 3, 2003 |
Site-specific isotopically-labeled proteins, amino acids, and
biochemical precursors therefor
Abstract
Site-specific isotopically-labeled valine, leucine, and
isoleucine and biosynthetic precursors for these amino acids are
provided. The amino acids are labeled with .sup.13C or .sup.14C at
the methyl group carbon atom(s) most remote from the carboxyl
group. Also disclosed are the biochemical precursors of these
labeled amino acids, 2-keto-4-(.sup.nC)butyric acid and
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-- butyric acid in which n, at
each occurrence, is 13 or 14. Also disclosed are proteins, protein
fragments, and polypeptides containing these site-specifically
isotopically labeled amino acids, and methods for preparing the
biochemical precursors, the amino acids, and the proteins, protein
fragments, and polypeptides.
Inventors: |
Fesik, Stephen W.; (Gurnee,
IL) ; Augeri, David J.; (Emerson, NJ) |
Correspondence
Address: |
STEVEN F. WEINSTOCK
ABBOTT LABORATORIES
100 ABBOTT PARK ROAD
DEPT. 377/AP6A
ABBOTT PARK
IL
60064-6008
US
|
Family ID: |
46281509 |
Appl. No.: |
10/290794 |
Filed: |
November 8, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10290794 |
Nov 8, 2002 |
|
|
|
09544620 |
Apr 6, 2000 |
|
|
|
60128668 |
Apr 9, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/106; 435/7.1; 562/553; 562/577 |
Current CPC
Class: |
C12P 21/02 20130101;
G01N 2458/00 20130101; C12P 13/04 20130101; C07B 2200/05 20130101;
C07C 229/08 20130101; C07C 59/347 20130101; G01N 33/6803
20130101 |
Class at
Publication: |
435/69.1 ;
435/7.1; 562/553; 562/577; 435/106 |
International
Class: |
G01N 033/53; C12P
021/02; C12P 013/04; C07C 229/06 |
Claims
We claim:
1. A compound of formula I 10or a salt thereof, wherein R.sup.1 is
oxygen or NH.sub.2; R.sup.2 is selected from the group consisting
of 11wherein R.sup.3 is hydrogen or .sup.nCH.sub.3; the dotted line
bond represents a second valence bond; m is zero or one; and n, at
each occurrence, is 13 or 14; with the provisos that i) when
R.sup.1 is NH.sub.2, the second valence bond represented by the
dotted line bond to R.sup.1 is absent and the hydrogen attached to
the dotted line bond is present; ii) when R.sup.1 is oxygen, the
second valence bond represented by the dotted line bond to R.sup.1
is present and the hydrogen atom attached to the dotted line bond
is absent; iii) when R.sup.1 is oxygen, R.sup.2 is B and m is zero;
and iv) when R.sup.1 is NH.sub.2, R.sup.3 is hydrogen or
.sup.nCH.sub.3.
2. A protein, protein fragment, or polypeptide containing an
aminoacyl residue derived from a compound according to claim 1
wherein R.sup.1 is --NH.sub.2.
3. A compound of formula Ia 12or a salt thereof, wherein R.sup.3 is
hydrogen or .sup.nCH.sub.3 and n, at each occurrence is 13 or
14.
4. A compound according to claim 3 selected from the group
consisting of: 2-keto-4-(.sup.13C)-butyric acid;
2-keto-3-(.sup.13C-methyl)-4-(.sup.13C)- -butyric acid;
2-keto-4-(.sup.14C)-butyric acid; and
2-keto-3-(.sup.14C-methyl)-4-(.sup.14C)-butyric acid; or salts
thereof.
5. A compound of formula Ib 13wherein R.sup.2 is selected from the
group consisting of 14where R.sup.3 is hydrogen or .sup.nCH.sub.3;
m is zero or one; and n, at each occurrence, is 13 or 14.
6. A compound according to claim 5 selected from the group
consisting of: L-2-amino-3-methyl-5-(.sup.13C)-pentanoic acid;
L-2-amino-3-methyl-5-(.su- p.14C)-pentanoic acid;
L-2-amino-3-(.sup.13C-methyl)-5-(.sup.13C)-butanoic acid;
L-2-amino-3-(.sup.14C-methyl)-5-(.sup.14C)-butanoic acid;
L-2-amino-4-(.sup.13C-methyl-5-(.sup.13C)-pentanoic acid; and
L-2-amino-4-(.sup.4C-methyl-5-(.sup.14C)-pentanoic acid; or salts
thereof.
7. A protein, protein fragment, or polypeptide containing one or
more aminoacyl residues, wherein said one or more amino acyl
residues comprise a compound of formula IIb 15wherein R.sup.2 is
selected from the group consisting of 16wherein R.sup.3 is hydrogen
or .sup.nCH.sub.3; m is zero or one; and n, at each occurrence, is
13 or 14.
8. A method of preparing a compound of formula Ia 17or a salt
thereof, wherein R.sup.3 is selected from the group consisting of
hydrogen and .sup.nCH.sub.3and n at each occurrence is 13 or 14,
which comprises a) reacting a compound of formula IV 18with
isotopically-labeled methyl iodide (H.sub.3.sup.nCI) to produce a
compound of formula V 19and b) removing the tert-butyl ester and
dimethylhydrazino groups to produce 2-keto-4-(.sup.nC)-butyric
acid.
9. A method according to claim 8, which further comprises salifying
the reaction product of step b).
10. A method according to claim 8, which further comprises c)
reacting the product of step b) with isotopically-labeled methyl
iodide (H.sub.3.sup.nCI), where n is 13 or 14, to produce a
compound of formula VI 20and d) removing the tert-butyl ester and
dimethylhydrazino groups to produce
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid.
11. A method according to claim 10, which further comprises
salifying the reaction product of step d).
12. A method of preparing a protein, protein fragment, or
polypeptide containing at least one amino acyl residue selected
from the group consisting of 4-(.sup.nC-methyl)-5-(.sup.nC)-leucyl,
5-(.sup.nC)-isoleucyl, and 3-(.sup.nC-methyl)-4-(.sup.nC)-valyl,
which comprises a) genetically modifying a suitable microorganism
to express said protein, protein fragment, or polypeptide; b)
culturing said genetically modified microorganism in a nutrient
medium containing a compound of formula Ia 21or salt thereof,
wherein n, at each occurrence is 13 or 14, and R.sup.3 is hydrogen
or .sup.nCH.sub.3; and c) isolating said protein, protein fragment,
or polypeptide.
13. A method of preparing a protein, protein fragment, or
polypeptide containing at least one 3-methyl-5-(.sup.nC)-isoleucyl
aminoacyl residue, which comprises a) genetically modifying a
suitable microorganism to express said protein, protein fragment,
or polypeptide; b) culturing said genetically modified
microorganism in a nutrient medium containing a compound of formula
Ia" 22or a salt thereof, wherein n, at each occurrence is 13 or 14;
and c) isolating said protein, protein fragment, or
polypeptide.
14. A method of preparing 2-amino-3-(C-methyl)-4-(.sup.nC)-butyric
acid which comprises a) genetically modifying a suitable
microorganism to express a homopolymer of valine; b) culturing said
genetically modified microorganism in a nutrient medium containing
a compound of formula Ia' 23or a salt thereof, where n, at each
occurrence, is 13 or 14; c) isolating the homopolymer of valine
expressed by said genetically modified microorganism; and d)
fragmenting said homopolymer to produce
2-amino-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid.
15. A method of preparing
2-amino-4-(.sup.nC-methyl)-5-(.sup.nC)-pentanoic acid which
comprises a) genetically modifying a suitable microorganism to
express a homopolymer of leucine; b) culturing said genetically
modified microorganism in a nutrient medium containing a compound
of formula Ia' 24or a salt thereof, where n, at each occurrence, is
13 or 14; c) isolating the homopolymer of leucine expressed by said
genetically modified microorganism; and d) fragmenting said
homopolymer to produce
2-amino-4-(.sup.nC-methyl)-5-(.sup.nC)-pentanoic acid.
16. A method of preparing 2-amino-3-methyl-5-(.sup.nC)-pentanoic
acid which comprises a) genetically modifying a suitable
microorganism to express a homopolymer of isoleucine; b) culturing
the genetically modified microorganism in a nutrient medium
containing a compound of formula Ia" 25or a salt thereof, where n,
at each occurrence, is 13 or 14; c) isolating the homopolymer of
isoleucine expressed by said genetically modified microorganism;
and d) fragmenting said homopolymer to produce
2-amino-3-methyl-5-(.sup.nC)-pentanoic acid.
Description
CONTINUING DATA
[0001] This application is an original conversion from the
provisional application Serial No. 60/128,668, filed Apr. 9,
1999.
FIELD OF THE INVENTION
[0002] The present invention relates to site-specific
isotopically-labeled organic compounds and processes for their
preparation. More particularly, the present invention concerns
site-specific isotopically-labeled biochemical precursors of
leucine, isoleucine, and valine, the isotopically-labeled amino
acids per se, proteins, protein fragments or polypeptides made
therefrom, and related methods of preparation.
BACKGROUND OF THE INVENTION
[0003] A recently-developed technique for discovering new drug
leads involves the use of nuclear magnetic resonance (NMR)
spectroscopy to discover compounds that bind to a particular target
molecule such as a protein (see, for example, U.S. Pat. Nos.
5,698,401 and 5,804,390, to Fesik, et al.). The technique involves
the determination of a first two-dimensional .sup.15N/.sup.1H NMR
correlation spectrum of a protein in which nitrogen atom sites have
been isotopically enriched with .sup.15N. This first correlation
spectrum is obtained for the protein in the absence of any
potential ligand compound(s). Next a suspected ligand compound, or
a mixture of such putative ligand compounds, is mixed with the
isotopically enriched protein, and a second NMR correlation
spectrum is obtained. The two spectra are compared, and differences
between the two spectra provide information about 1) the existence
of binding between any ligand and the host protein, 2) the site(s)
of binding, and 3) the strength(s) of binding.
[0004] The technique described in Fesik, et al., supra, employs
target molecules which have been isotopically enriched with the
NMR-detectable .sup.15N spin nucleus. This method relies upon the
genetic modification of a suitable microorganism to express the
desired protein, protein fragment, or polypeptide, followed by
culturing the modified microorganism in a nutrient medium
containing assimilable sources of carbon and nitrogen which include
.sup.15N-labeled nutrients. Comparatively inexpensive commercially
available .sup.15N ammonium salts provided the .sup.15N source.
[0005] However, the application of this NMR drug discovery
technique to target molecules isotopically enriched with .sup.13C
has been hampered by two drawbacks. First, it is comparatively
expensive to produce .sup.13C-enriched target molecules in any
useful quantities. For example, the production of proteins by
genetically modified microorganisms grown in nutrient media
containing commercially available uniformly-labeled glucose
(glucose-.sup.13C.sub.6) is expensive. At the time of filing this
application, the cost of glucose-.sup.13C.sub.6 was approximately
$480/g. Alternatively, the production of .sup.13C-labeled proteins
by including uniformly .sup.13C-labeled amino acids in the nutrient
medium is similarly expensive. Second, the biomolecules produced
using glucose-.sup.13C.sub.6 or commercially available uniformly
.sup.13C-enriched amino acids are not ideally suited for the NMR
correlation spectra technique. Biomolecules expressed by
microorganisms grown in nutrient media containing uniformly
.sup.13C-enriched starting materials contain adjacent
.sup.13C-labeled carbon atoms. Since the NMR technique depends upon
detection of spatial spin coupling (i.e., the nuclear Overhauser
effect), the relatively strong spin-spin coupling of adjacent
.sup.13C nuclei interferes with the desired observation. There is
thus a need for the development of site-specifically
.sup.13C-enriched amino acids, proteins and polypeptides.
SUMMARY OF THE INVENTION
[0006] The instant invention provides biochemical precursors of the
site-specific isotopically-enriched amino acids leucine,
isoleucine, and valine, as well as the site-specific
isotopically-enriched amino acids per se. Additionally, proteins,
protein fragments and polypeptides containing site-specific
isotopically-enriched aminoacyl residues derived from these amino
acids, and methods for their production, are also provided. The
amino acids and the amino acid biosynthetic precursors are
isotopically enriched with either .sup.13C or .sup.14C at the
carbon atoms of methyl groups most remote from their carboxyl
group. In the labeled amino acids of the present invention,
non-adjacent carbon atoms are labeled. In the case where the label
is .sup.13C, the amino acids of this invention are thus ideally
suited for use in the NMR drug discovery technique, since there is
no interference with the desired signals by adjacent atom
.sup.13C-.sup.13C spin-spin interaction. Moreover, since the amino
acids are labeled only at methyl groups, the three magnetically
equivalent hydrogen atoms of the methyl group(s) provide strong NMR
signals for observation of any effects of coupling with the
.sup.13C atom(s) to which they are attached.
[0007] Specifically, the present invention provides compounds of
formula I 1
[0008] or a salt thereof, wherein R.sup.1 is oxygen or NH.sub.2,
and R.sup.2 is selected from the group consisting of 2
[0009] In the formulae presented above, R.sup.3 is hydrogen or
.sup.nCH.sub.3, the dotted line bonds represent valence bonds, m is
zero or one, and n, at each occurrence, is 13 or 14, with the
provisos that: a) when R.sup.1 is NH.sub.2, the second valence bond
represented by the dotted line bond to R.sup.1 is absent and the
hydrogen attached to the dotted line bond is present; b) when
R.sup.1 is oxygen, the second valence bond represented by the
dotted line bond to R.sup.1 is present and the hydrogen atom
attached to the dotted line bond is absent; c) when R.sup.1 is
oxygen, R.sup.2 is B and m is zero; and d) when R.sup.1 is
NH.sub.2, R.sup.3 is hydrogen or .sup.nCH.sub.3.
[0010] The present invention provides the site-specific .sup.3C-
and .sup.4C-enriched amino acids isoleucine (formula I above where
R.sup.1 is amino, R.sup.2 is A); leucine (formula I above where
R.sup.1 is amino, R.sup.2 is B, R.sup.3 is .sup.nCH.sub.3, and m is
one), and valine (formula I above where R.sup.1 is amino, R.sup.2
is B, R.sup.3 is .sup.nCH.sub.3, and m is zero), and the
site-specific .sup.13C- and .sup.14C-enriched biochemical
precursors of these amino acids, 2-keto-4-(.sup.nC)-butyric acid
(formula I above where R.sup.1 is oxygen, R.sup.2 is B, m is zero,
and R.sup.3 is hydrogen) and
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid (formula I above
where R.sup.1 is oxygen, R.sup.2 is B, m is zero, and R.sup.3 is
.sup.nCH.sub.3). In the foregoing, n represents either 13 (i.e.,
.sup.13C-enriched compounds) or 14 (i.e., .sup.14C-enriched
compounds).
[0011] The present invention further provides proteins, protein
fragments, and polypeptides containing aminoacyl residues derived
from one or more of the amino acids selected from the group
consisting of L-2-amino-3-methyl-5-(.sup.13C)-pentanoic acid;
L-2-amino-3-methyl-5-(.su- p.14C)-pentanoic acid;
L-2-amino-4-(.sup.13C-methyl-5-(.sup.13C)-pentanoic- ;
L-2-amino-4-(.sup.14C-methyl-5-(.sup.14C)-pentanoic acid;
L-2-amino-3-(.sup.13C-methyl)-5-(.sup.13C)-butanoic acid; and
L-2-amino-3-(.sup.14C-methyl)-5-(.sup.14C)-butanoic acid.
[0012] Also provided by the present invention are chemical methods
of preparing the site-specific .sup.13C- and .sup.14C-labeled
biochemical precursors acids, 2-keto-4-(.sup.nC)-butyric acid and
3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid, or salts thereof,
which involves reacting a compound of formula IV 3
[0013] with isotopically-labeled methyl iodide (H.sub.3.sup.nCI) to
produce a compound of formula V 4
[0014] removing the protecting tert-butyl ester and
dimethylhydrazino groups of a compound of formula V to produce
2-keto-4-(.sup.nC)-butyric acid; or further reacting a compound of
formula V with isotopically-labeled methyl iodide (H.sub.3.sup.nCI)
where n is 13 or 14, to produce a compound of formula VI 5
[0015] removing the protecting tert-butyl ester and
dimethylhydrazino groups to produce
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid; and optionally
salifying the products.
[0016] The present invention additionally provides methods for
preparing the site-specific .sup.13C- and .sup.14C-labeled amino
acids, leucine, isoleucine, and valine. The process involves
genetically modifying a microorganism to express a polypeptide
containing an amino acid selected from leucine, isoleucine, valine
and mixtures thereof; culturing the modified microorganism in a
nutrient medium containing assimilable sources of carbon and
nitrogen which includes 2-keto-4-(.sup.nC)-butyric acid,
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid, and salts and
mixtures thereof; isolating the resulting expressed polypeptide;
and fragmenting the polypeptide and isolating the individual amino
acids. The expressed polypeptide is fragmented by conventional
methods known in the art including hydrolysis or enzymatic
cleavage.
[0017] The yield of a particular amino acid may be maximized and
the cost minimized by modifying the host microorganism to express a
homopolymer of the amino acid, and utilizing the appropriate
isotopically enriched biosynthetic precursor in the nutrient
medium.
[0018] The present invention still further provides a method of
preparing a protein, protein fragment, or polypeptide containing
amino acyl residues derived from amino acids selected from the
group consisting of L-2-amino-3-methyl-5-(.sup.13C)-pentanoic acid;
L-2-amino-3-methyl-5-(.su- p.14C)-pentanoic acid;
L-2-amino-4-(.sup.13C-methyl-5-(.sup.13C)-pentanoic- ;
L-2-amino-4-(.sup.14C-methyl-5-(.sup.14C)-pentanoic acid;
L-2-amino-3-(.sup.13C-methyl)-5-(.sup.13C)-butanoic acid; and
L-2-amino-3-(.sup.14C-methyl)-5-(.sup.14C)-butanoic acid which
involves genetically modifying a microorganism to express a
pre-determined protein, protein fragment or polypeptide; culturing
the modified microorganism in a nutrient medium containing
assimilable sources of carbon and nitrogen which includes
2-keto-4-(.sup.nC)-butyric acid,
2-keto-3-(.sup.nC-methyl)-4-(.sup.nC)-butyric acid, and salts and
mixtures thereof; and isolating the resulting expressed
polypeptide.
DETAILED DESCRIPTION OF THE INVENTION
[0019] The natural isotopic abundance of .sup.13C is 1.11%, and
that of .sup.14C is negligibly low. Thus the probability that any
given carbon atom within an organic molecule is .sup.13C is
normally about 0.0111, and the probability that any given carbon
atom is .sup.14C is quite low. When target proteins are prepared
for use in the adapted NMR "screening" or drug discovery process as
described by Fesik, et al., supra, it is desirable that the
.sup.13C NMR signal be enhanced by increasing the natural .sup.13C
content of the target molecule being studied. This is accomplished
by either uniformly or selectively enriching the target molecule
with .sup.13C. As used throughout this specification and the
appended claims, the terms "uniform enrichment," "uniformly
enriching," "uniformly enriched," "uniform labeling" and "uniformly
labeled" mean increasing to a value greater than 0.0111, by
synthetic means, the probability that a carbon atom randomly
selected throughout the target molecule will be .sup.13C. The terms
"specific enrichment," "site-specific enrichment," "specifically
enriching," "specifically enriched," "specifically labeling" and
"specifically labeled" mean increasing to a value greater than
0.0111, by synthetic means, the probability that carbon atoms at
one or more specific pre-selected site(s) within the target
molecule will be .sup.13C.
[0020] For example, biomolecules expressed by genetically modified
microorganisms grown in a nutrient medium containing uniformly
.sup.13C-enriched glucose will be uniformly .sup.13C enriched. A
protein expressed by a genetically modified microorganism grown in
a nutrient medium containing an amino acid which is
.sup.13C-enriched only on the methyl side chain would be
specifically enriched by .sup.13C at the alanyl residues contained
within the expressed protein. Similarly, proteins expressed by the
method of this invention will be site-specifically enriched by
.sup.13C or .sup.14C at the side-chain terminal methyl groups of
leucine, isoleucine, and valine.
[0021] The method of the present invention also permits the
preparation of site-specifically labeled leucine, isoleucine and
valine, proteins, protein fragments, or polypeptides made from
these labeled amino acids, and the amino acid biosynthetic
precursors with labeled with .sup.14C as well as .sup.13C. Such
compounds are useful, for example, in studies of protein metabolism
where it is desirable to follow the course and fate of protein
degradation by radiometric methods.
[0022] Further terms used throughout this specification and the
appended claims have their usually accepted meanings. The following
specific terms have the ascribed meanings:
[0023] "DTT" means dithiothreitol.
[0024] "HEPES" denotes
N-2-hydroxyethylpiperazine-N'-2-ethylsulfonic acid.
[0025] "IPTG" means isopropyl-.beta.-D-thiogalactopyranoside.
[0026] "PMSF" refers to .alpha.-toluenesulfonyl fluoride.
[0027] "SCD" refers to the catalytic domain (residues 81-256) of
stromelysin.
[0028] The preparation of an exemplary site-specific
.sup.nC-enriched protein fragment target molecule is set forth
below. The particular example shown demonstrates the preparation of
the so-called "catalytic domain" of human stromelysin ("SCD"),
labeled with site-specific .sup.13C-enriched leucine, valine, and
isoleucine. While shown with .sup.13C-labeled amino acid
precursors, the method is equally applicable starting with
.sup.14C-labeled amino acid precursors. A preferred means of
preparing adequate quantities of specifically .sup.nC-enriched
polypeptide-containing target molecules involves the transformation
of a host cell with an expression vector containing a
polynucleotide encoding the desired polypeptide. The protein or
polypeptide protein fragment is expressed by culturing the
transformed cell line in a medium containing assimilable sources of
carbon and nitrogen well known in the art and including the
.sup.nC-enriched biochemical precursors of this invention. For
site-specific labeling of the protein or protein fragment in
accordance with the present invention, assimilable sources for
.sup.nC labeling of a target polypeptide include .sup.nC-labeled
biosynthetic precursors of amino acids.
[0029] For example, it is known that .alpha.-keto-butyrate is the
biosynthetic precursor of isoleucine, and that
.alpha.-keto-isovalerate is the biosynthetic precursor of both
valine and leucine. Scheme I below shows how the specifically
.sup.nC-enriched biosynthetic precursors of leucine, isoleucine,
and valine can be synthesized. The Scheme employs the comparatively
inexpensive .sup.nC-enriched methyl iodide, H.sub.3.sup.nCI, as the
source for isotopic enrichment to produce
.sup.nC-terminally-labeled .alpha.-keto-butyric acid and
.alpha.-keto-isovaleric acid.
[0030] The use of a uniformly .sup.13C-enriched nutrient such as
glucose-.sup.13C.sub.6 has been typically used as a convenient
means of introducing .sup.13C enrichment into a target compound;
however, it is very expensive. Furthermore, a vast majority of the
carbon sites in uniformly .sup.13C-labeled targets will have a
covalently bonded neighbor which is also .sup.3C-labeled,
introducing .sup.13C-.sup.13 C coupling which can negatively impact
both the signal-to-noise and the relaxation properties of
.sup.13C-labeled sites in the target biomolecule. Alternatively,
the nutrient medium may include commercially available uniformly
.sup.13C-labeled amino acids. While this technique reduces the
"dilution" of the labeling, it too, is a costly alternative and
likewise suffers from the drawback of adjacent carbon atom
.sup.13C-.sup.13C spin-spin interactions.
[0031] However, the method of the present invention for
.sup.nC-labeling of a polypeptide target molecule comprises growing
the genetically modified cell line in a nutrient medium containing
.sup.nC-labeled biosynthetic precursors of particular amino acids.
Not only are certain of the amino acids in the resulting protein,
protein fragment or polypeptide isotopically enriched, those amino
acids are site-specifically labeled.
[0032] In a method of one embodiment of the invention, preferred
amino acid precursors are labeled .alpha.-keto-butyric acid and
.alpha.-keto-isovaleric acid. The biosynthetic products of these
precursors are leucine, isoleucine, and valine, in which particular
side-chain methyl groups are .sup.nC-enriched. Because the methyl
groups each have three hydrogen atoms connected to a
.sup.nC-labeled carbon atom, when n is 13, the corresponding NMR
signals are particularly strong and distinctive.
[0033] The synthesis for labeled .alpha.-keto-butyric acid and
.alpha.-keto-isovaleric acid involves the C-methylation of the
terminal carbon atom in pyruvic acid with .sup.nC-enriched methyl
iodide. Normally, the alkylation of .alpha.-keto acids such as
pyruvate is inherently difficult and is accompanied by
decomposition of the enolate intermediate with the formation of
numerous side products. However, Spencer, et al., Tetrahedron
Letters, 1975, 3889 and Williams, et al., ibid., 1990, 5881 have
shown that alkylation of the corresponding oxime enolate has been
carried out, although alkylation with primary electrophiles (for
example, methyl iodide) was problematic. D. Enders, et al., Angew.
Chem. Int. Eng. Ed., 1992, 618 and D. Enders, et al., Synlett,
1992, 901 have demonstrated that alkylation of an
N,N-dimethylhydrazone of pyruvate is possible, but specifically
mentioned that the bulky 2,6-dialkyl phenyl ester was necessary to
prevent self acylation.
[0034] Representative compounds of the present invention include
the following:
[0035] 2-keto-4-(.sup.13C)-butyric acid or a salt thereof;
[0036] 2-keto-4-(.sup.14C)-butyric acid or a salt thereof;
[0037] 2-keto-3-(.sup.13C-methyl)-4-(.sup.13C)-butyric acid or a
salt thereof;
[0038] 2-keto-3-(.sup.14C-methyl)-4-(.sup.14C)-butyric acid or a
salt thereof;
[0039] L-2-amino-3-methyl-5-(.sup.13C)-pentanoic acid or a salt
thereof;
[0040] L-2-amino-3-methyl-5-(.sup.14C)-pentanoic acid or a salt
thereof;
[0041] L-2-amino-4-(.sup.13C-methyl)-5-(.sup.13C)-pentanoic acid or
a salt thereof;
[0042] L-2-amino-4-(.sup.14C-methyl)-5-(.sup.14C)-pentanoic acid or
a salt thereof;
[0043] L-2-amino-3-(.sup.13C-methyl)-5-(.sup.13C)-butanoic acid or
a salt thereof; and
[0044] L-2-amino-3-(.sup.14C-methyl)-5-(.sup.14C)-butanoic acid or
a salt thereof.
[0045] The present invention additionally encompasses proteins,
protein fragments, and polypeptides containing the site-specific
isotopically enriched amino acids
L-2-amino-3-methyl-5-(.sup.13C)-pentanoic acid;
L-2-amino-3-methyl-5-(.sup.14C)-pentanoic acid;
L-2-amino-4-(.sup.13C-met- hyl)-5-(.sup.13C)-pentanoic;
L-2-amino-4-(.sup.14C-methyl)-5-(.sup.14C)-pe- ntanoic acid;
L-2-amino-3-(.sup.13C-methyl)-5-(.sup.13C)-butanoic acid; and
L-2-amino-3-(.sup.14C-methyl)-5-(.sup.14C)-butanoic acid.
[0046] Although the specific compounds named above have been
designated as having .sup.13C- or .sup.14C-isotopes at specific
sites in the compound, it will be understood by those of ordinary
skill in the art that the carbon atoms at these sites in the
compounds will not be completely .sup.13C or .sup.14C labeled. The
degree of isotopic substitution or "enrichment" at each molecular
site depends upon the corresponding degree of enrichment contained
in the starting materials utilized in the synthesis. 6
[0047] In Scheme I, tert-butyl pyruvate, 1, is converted to the
corresponding N,N-dimethylhydrazone, 2, by reaction with
N,N-dimethylhydrazine in diethyl ether at room temperature. The
resulting hydrazone, 2, is cooled in a tetrahydrofuran solution to
-78.degree. C., and treated with lithium bromide, followed by
lithium diisopropylamide to form the intermediate aza-allyl
enolate. The enolate is alkylated with .sup.nC-labeled methyl
iodide to produce hydrazone 3. A second course of alkylation of 3
produces the labeled dimethylated hydrazone, 4. Treatment of 3 and
4 first with aqueous 1N HCl in tetrahydrofuran or diethyl ether (to
remove hydrazone) followed by treatment with hydrogen chloride gas
in methylene chloride (to remove the t-butyl ester) gives the
corresponding .sup.nC-terminally labeled .alpha.-ketoacids, 5 and
6. Schemes II, III, and IV illustrate, respectively, how these
.alpha.-ketoacids are biosynthetically converted into
.sup.nC-leucine, isoleucine and valine. In all of the Schemes, the
site(s) of isotopic enrichment are indicated by asterisks. 7 8
9
[0048] Means for preparing expression vectors that contain
polynucleotide sequences coding specific polypeptides and for
transforming host cells with those vectors are well known in the
art. (See, for example R. W. Old, et al., Techniques of Gene
Manipulation, Blackwell Science, London, 1994, and similar
treatises in the field.) Likewise, methods for culturing the
transformed cells to express the coded polypeptide and for
isolating, purifying and re-folding the polypeptide are also well
known in the art. Examples presented below describe the production
of .sup.13C-enriched samples of the 81-256 amino acid catalytic
region of human stromelysin (SCD) from modified E. coli.
EXAMPLES
Example 1
Preparation of Uniformly .sup.13C-Enriched Catalytic Domain of
Human Stromelysin (SCD)
[0049] The 81-256 fragment (SEQ ID NO: 1) of stromelysin (SCD) is
prepared by inserting a plasmid which codes for the production of
the protein fragment into an E. coli strain and growing the
genetically-modified bacterial strain in a suitable culture medium.
The protein fragment is isolated from the culture medium, purified,
and subsequently used in the two-dimensional NMR analysis of its
affinity with test compounds in accordance with the method of this
invention. The procedures for the preparation processes are
described below.
[0050] Human skin fibroblasts (ATCC No. CRL 1507) are grown and
induced using the procedure described by Clark, et al., Archiv.
Biochem. and Biophys., 241: 36 (1985). Total RNA is isolated from 1
g of cells using a RNAgents.RTM. Total RNA Isolation System Kit
(Promega Corp., 2800 Woods Hollow Road, Madison, Wis. 53711,
U.S.A.) following the manufacturer's instructions. A 1 .mu.g
portion of the RNA is denatured by heating at 80.degree. C. for
five minutes and then subjected to reverse transcriptase PCR using
a GenAmp.RTM. RNA PCR kit (Applied Biosystems/Perkin-Elmer)
following the manufacturer's instructions.
[0051] Nested PCR is performed using first primers (a)
GAAATGAAGAGTCTTCAA (SEQ ID NO: 2) and (b) GCGTCCCAGGTTCTGGAG (SEQ
ID No. 3) and thirty-five cycles of 94.degree. C., two minutes;
45.degree. C., two minutes; and 72.degree. C., three minutes. This
is followed by re-amplification with internal primers (c)
TACCATGGCCTATCCATTGGATGGAGC (SEQ ID NO: 4) and (d)
ATAGGATCCTTAGGTCTCAGGGGA GTCAGG (SEQ ID NO: 5) using thirty cycles
under the same conditions described immediately above to generate a
DNA sequence coding for amino acid residues 1-256 of human
stromelysin.
[0052] The PCR fragment is then cloned into PCR cloning vector
pT7BIue.RTM. (Novagen, Inc.) according to the manufacturer's
instructions. The resulting plasmid is cut with NcoI and BamHI and
the stromelysin fragment is sub-cloned into the expression vector
pET3d (Novagen, Inc.), again using the manufacturer's
instructions.
[0053] A mature stromelysin expression construct coding for amino
acid residues 81-256 plus an initiating methionine aminoacyl
residue is generated from the 1-256 expression construct by PCR
amplification. The resulting PCR fragment is first cloned into the
pT7BIue.RTM. vector (Novagen, Inc.) and then sub-cloned into the
pET3d vector (Novagen, Inc.), using the manufacturer's instructions
in the manner described above, to produce plasmid pETST-83-256.
This final plasmid is identical to that described by Qi-Zhuang, et
al., Biochemistry, 31: 11231 (1992) with the exception that the
present plasmid codes for a peptide sequence beginning two amino
acids earlier, specifically at position 81, in the sequence of
human stromelysin. Plasmid pETST-83-256 is transformed into E. coli
strain BL21(DE3)/pLysS (Novagen, Inc.) in accordance with the
manufacturer's instructions, to generate an expression strain,
BL21(DE3)/pLysS/pETST-255-1.
[0054] A pre-culture medium is prepared by dissolving 1.698 g of
NaH.sub.2PO.sub.4.7H.sub.20, 0.45 g of KH.sub.2PO.sub.4, 0.075 g
NaCl, 0.150 g NH.sub.4Cl, 0.3 g U-.sup.13C-glucose, 300 .mu.l of 1M
aqueous MgSO.sub.4 solution, and 15 ml of aqueous CaCl solution in
150 ml of deionized water. The resulting solution of pre-culture
medium is sterilized and transferred to a sterile 500 ml baffle
flask. Immediately prior to inoculation of the pre-culture medium
with the bacterial strain, 150 ml of a solution containing 34
mg/ml, of chloramphenicol in 100% ethanol and 1.5 ml of a solution
containing 20 mg/ml of ampicillin is added to the flask contents.
The flask contents are then inoculated with 1 ml of glycerol stock
of genetically modified E. coli strain BL21(DE3)/pLysS/pETST-255-1.
The flask contents are shaken (225 rpm) at 37.degree. C. until an
optical density of 0.65 is observed.
[0055] A fermentation nutrient medium is prepared by dissolving
113.28 g of Na.sub.2HPO.sub.4.7H.sub.2O, 30 g of KH.sub.2PO.sub.4,
5 g NaCl and 10 ml of 1% DF-60 antifoam agent in 9604 ml of
deionized water. This solution is placed in a New Brunswick
Scientific Micros Fermenter (Edison, N.J.) and sterilized at
121.degree. C. for 40 minutes. Immediately prior to inoculation of
the fermentation medium, the following pre-sterilized components
are added to the fermentation vessel contents: 100 ml of a 10%
aqueous solution of NH.sub.4Cl, 15 g of uniformly .sup.13C-enriched
glucose, 20 ml of an aqueous 1M solution of MgSO.sub.4, 1 ml of an
aqueous 1M CaCl.sub.2 solution, 5 ml of an aqueous solution of
thiamin hydrochloride (10 mg/ml), 10 ml of a solution containing 34
mg/ml of chloramphenicol in 100% ethanol, and 1.9 g of ampicillin
dissolved in the chloramphenicol solution. The pH of the resulting
solution is adjusted to pH 7.00 by the addition of an aqueous
solution of 4N H.sub.2SO.sub.4.
[0056] The pre-culture of E. coli strain
BL21(DE3)/pLysS/pETST-255-1 from the shake flask scale procedure
described above is added to the fermenter contents, and cell growth
is allowed to proceed until an optical density of 0.48 is achieved.
During this process, the fermenter contents are automatically
maintained at pH 7.0 by the addition of 4N H.sub.2SO.sub.4 or 4N
KOH as needed. The dissolved oxygen content of the fermenter
contents is maintained above 55% air saturation through a cascaded
loop which increased agitation speed when the dissolved oxygen
content dropped below 55%. Air is fed to the fermenter contents at
7 standard liters per minute (SLPM) and the culture temperature is
maintained at 37.degree. C. throughout the process.
[0057] The cells are harvested by centrifugation at 17,000 .times.
g for 10 minutes at 4.degree. C. and the resulting cell pellets are
collected and stored at -85.degree. C. The wet cell yield is 3.5
g/L. Analysis of the soluble and insoluble fractions of cell
lysates by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) reveals that approximately 50% of the
stromelysin was found in the soluble phase.
[0058] The stromelysin fragment prepared as described above is
purified employing a modification of the technique described by Ye,
et al., Biochemistry, 31: 11231 (1992). The harvested cells are
suspended in 20 mM Tris-HCl buffer (pH 8.0), sodium azide solution
containing 1 mM MgCl.sub.2, 0.5 mM ZnCl.sub.2, 25 units/ml of
Benzonase.RTM. enzyme (Benzon Pharma A/S Roskilde, Denmark), and an
inhibitor mixture made up of 4-(2-aminoethyl)benzenesulfonyl
fluoride ("AEBSF") Leupeptin.RTM., Aprotinin.RTM. and
Pepstatin.RTM. (all at concentrations of 1 mg/ml. AEBSF,
Leupeptin.RTM., Aprotinin.RTM., and Pepstatin.RTM. are available
from American International Chemical). The resulting mixture is
gently stirred for one hour and then cooled to 4.degree. C. The
cells are then sonically disrupted using a 50% duty cycle. The
resulting lysate is centrifuged at 14,000 rpm for 30 minutes and
the pellet of insoluble fraction frozen at -80.degree. C. for
subsequent processing.
[0059] Solid ammonium sulfate is added to the supernatant to the
point of 20% of saturation and the resulting solution loaded onto a
700 ml phenyl Sepharose fast flow ("Q-Sepharose FF) column
(Pharmacia Biotech.). Prior to loading, the Sepharose column is
equilibrated with 50 mM Tris-HCl buffer (pH 7.6 at 4.degree. C.), 5
mM CaCl2, and 1M (NH.sub.4).sub.2SO.sub.4. The loaded column is
eluted with a linear gradient of decreasing concentrations of
aqueous (NH.sub.4).sub.2SO.sub.4 (from 1M down to 0M) and
increasing concentrations of aqueous CaCl.sub.2 (from 5 mM to 20
mM) in Tris-HCl buffer at pH 7.6. The active fractions of eluate
are collected and concentrated in an Amicon stirred cell (Amicon
Inc.). The concentrated sample is dialyzed overnight in the
starting buffer used with the Q-Sepharose FF column, 50 mM Tris-HCl
(pH 8.2 at 4.degree. C.) with 10 mM CaCl.sub.2.
[0060] The dialyzed sample is then loaded on the Q-Sepharose FF
column and eluted with a linear gradient comprising the starting
buffer and 200 nM NaCl. The purified soluble fraction of the
stromelysin fragment is concentrated and stored at 4.degree. C. The
pellet is solubilizcd in 8M guanidine-HCl. The solution is
centrifuged for 20 minutes at 20,000 rpm and the supernatant added
dropwise to a folding buffer comprising 50 mM Tris-HCl (pH 7.6), 10
mM CaCl.sub.2, 0.5 mM ZnCl.sub.2 and the inhibitor cocktail of
AEBSF, Leupeptin(R) Aprotinin(R) and Pepstatin(R) (all at
concentrations of 1 .mu.g/ml). The volume of folding buffer is ten
times that of the supernatant. The mixture of supernatant and
folding buffer are centrifuged at 20,000 rpm for 30 minutes. The
supernatant from this centrifugation is stored at 4.degree. C. and
the pellet subjected twice to the steps described above of
solubilization in guanidine-HCl, refolding in buffer, and
centrifugation. The final supernatants from each of the three
centrifugations are combined and solid ammonium sulfate was added
to the point of 20% saturation. The resulting solution thus derived
from the insoluble fraction is subjected to purification on phenyl
Sepharose and Q-Sepharose as described above for the soluble
fraction. The purified soluble and insoluble fractions are combined
to produce about 1.8 mg of purified stromelysin 81-256 fragment
(SCD) per gram of original cell paste, uniformly enriched with
.sup.13C.
Example 2
Preparation of Specifically .sup.13C-Enriched Catalytic Domain of
Human Stromelysin (SCD)
[0061] SCD is expressed by culturing the
BL21(DE3)/pLysS/pETST-255-1 modified E. coli strain in a medium
comprising 2-keto-4-(.sup.13C)-butyri- c acid, or a salt thereof,
and 2-keto-3-(.sup.13C-methyl)-4-(.sup.13C)-but- yric acid, or a
salt thereof. The methods used for preparation of the
genetically-engineered strain of E. coli, and for expressing,
isolating, and purifying the protein fragment are as described
above, except for the use of U-.sup.12C-glucose, instead of
U-.sup.13C-glucose.
[0062] It will be apparent to one of ordinary skill in the art that
various modifications in the illustrated embodiments can be made
without departing from the scope of the present invention.
* * * * *