U.S. patent application number 09/504132 was filed with the patent office on 2003-07-03 for methods for identifying agents that cause a lethal phenotype, and agents thereof.
Invention is credited to Caponigro, Gordano Michael, Kamb, Carl Alexander.
Application Number | 20030124520 09/504132 |
Document ID | / |
Family ID | 24004975 |
Filed Date | 2003-07-03 |
United States Patent
Application |
20030124520 |
Kind Code |
A1 |
Kamb, Carl Alexander ; et
al. |
July 3, 2003 |
METHODS FOR IDENTIFYING AGENTS THAT CAUSE A LETHAL PHENOTYPE, AND
AGENTS THEREOF
Abstract
The present invention is directed to methods for performing
negative selection assays leading to the identification of
cytostatic or cytotoxic agents that cause a lethal phenotype. The
invention is useful also for evaluation of conditional cytotoxicity
and cell-specific cytotoxicity.
Inventors: |
Kamb, Carl Alexander; (Salt
Lake City, UT) ; Caponigro, Gordano Michael; (Salt
Lake City, UT) |
Correspondence
Address: |
LI-HSIEN RIN-LAURES, M.D.
MARSHALL, O'TOOLE, GERSTEIN, MURRAY AND BORUN
233 SOUTH WACKER DRIVE
6300 SEARS TOWER
CHICAGO
IL
60606-6402
US
|
Family ID: |
24004975 |
Appl. No.: |
09/504132 |
Filed: |
February 15, 2000 |
Current U.S.
Class: |
435/6.14 ;
435/7.23 |
Current CPC
Class: |
C12N 15/1079 20130101;
C07K 14/47 20130101 |
Class at
Publication: |
435/6 ;
435/7.23 |
International
Class: |
C12Q 001/68; G01N
033/574 |
Claims
What is claimed is:
1. A method for performing a negative selection, comprising the
steps of: (a) introducing a genetic library encoding a plurality of
putative cytotoxic agents into a population of target cells; (b)
plating said population of target cells on a surface; (c)
collecting a subpopulation of target cells that disattaches from
said surface within a predetermined period of time; and (d)
recovering a first pool of genetic material from said
subpopulation.
2. The method of claim 1, further comprising the step of; (e)
identifying individual cells in said subpopulation that evidence a
lethal phenotype.
3. The method of claim 2, wherein said lethal phenotype is
apoptosis.
4. The method of claim 2, wherein said lethal phenotype is
necrosis.
5. The method of claim 2, wherein said lethal phenotype is growth
arrest.
6. The method of claim 1, wherein said genetic material is at least
partially sequenced.
7. The method of claim 1, further comprising the steps of (e)
introducing said genetic material recovered in step (d) into a
second population of target cells; (f) plating said second
population of target cells on a surface; (g) collecting a second
subpopulation of target cells that disattaches from said surface;
and (h) recovering a second pool of genetic material from said
second subpopulation.
8. The method of claim 1, wherein said target cells are mammalian
cells.
9. The method of claim 8, wherein said mammalian cells are primary
cells.
10. The method of claim 9, wherein said primary cells are selected
from a group consisting of epithelial cells, endothelial cells,
stem cells, mesenchymal cells, fibroblasts, neuronal cells and
hematopoietic cells.
11. The method of claim 8, wherein said mammalian cells are cancer
cells.
12. The method of claim 11, wherein said cancer cells are derived
from solid tumors.
13. The method of claim 11, wherein said cancer cells are
metastatic.
14. The method of claim 11, wherein said cancer cells are derived
from tissue selected from the group consisting of breast, colon,
lung, melanoma and prostate.
15. The method of claim 8 wherein said mammalian cells are
genetically altered primary cells.
16. The method of claim 15 wherein said genetically altered primary
cell is an immortalized primary cell.
17. The method of claim 15 wherein said genetically altered primary
cell is a transformed primary cell.
18. The method of claim 15 wherein said genetically altered primary
cell is derived from a primary cell selected from the group
consisting of epithelial cells, endothelial cells, stem cells,
mesenchymal cells, fibroblasts, neuronal cells and hematopoietic
cells
19. The method of claim 16 wherein said primary cell is
immortalized with a gene selected from the group consisting of E6,
E7, hTERT, Ras, T-antigen and adenovirus E1a.
20. The method of claim 1 wherein said target cells have a low
background of spontaneously disattaching cells.
21. The method of claim 20 wherein said background is no more than
about 2%.
22. The method of claim 20 wherein said background is not more than
about 10%.
23. The method of claim 20 wherein said target cells are selected
from a group consisting of HT29. colon cancer cells, SW620 colon
cancer cells, T47D breast cancer cells and HuVEC 8F1868 cells.
24. The method of claim 1, wherein said predetermined period of
time is at least about 12 hours.
25. The method of claim 1, wherein said genetic library encodes at
least about 1.times.10.sup.5 putative cytotoxic agents.
26. A method for obtaining cytotoxic agents that establish a lethal
phenotype, comprising the steps of (a) providing a population of
target cells with a genetic library encoding a plurality of
putative cytotoxic agents; (b) collecting a subpopulation of cells
that display a lethal phenotype; and (c) recovering a pool of
genetic material from said subpopulation.
27. The method of claim 26, wherein said lethal phenotype is
apoptosis.
28. The method of claim 27, wherein said step of assaying further
comprises enriching for said lethal phenotype prior to the step (b)
by collecting an enriched subpopulation of cells that disattach
from a culturing surface within a predetermined period of time.
29. The method of claim 26, wherein said lethal phenotype is
necrosis.
30. The method of claim 26, wherein said lethal phenotype is growth
arrest.
31. A method for identifying a cell-specific cytotoxic agent,
comprising the steps of: (a) introducing a genetic library encoding
a plurality of putative cytotoxic agents into a first population of
target cells; (b) collecting a first subpopulation of cells that
display a first lethal phenotype; (c) recovering a first sublibrary
of genetic material from said first subpopulation; (d) introducing
said first sublibrary of genetic material into a second, different,
population of target cells; (e) collecting a second subpopulation
of cells that do not display said lethal phenotype; and (f)
recovering a second sublibrary of material from said second
subpopulation; wherein said secondary genetic material encodes a
cell-specific cytotoxic agent.
32. The method of claim 31, wherein said lethal phenotype is
apoptosis.
33. The method of claim 32, wherein the first said step of
collecting further comprises enriching for said lethal phenotype
prior to step (b) by collecting an enriched subpopulation of cells
that disattach from a culturing surface within a predetermined
period of time.
34. The method of claim 31, wherein said lethal phenotype is
necrosis.
35. The method of claim 31, wherein said lethal phenotype is growth
arrest.
36. The method of claim 31, wherein said first population of target
cells are cancer cells, and said second population of target cells
are primary cells.
37. The method of claim 31, wherein said first population of target
cells are metastatic cancer cells and said second population of
target cells are non-metastatic cancer cells.
38. The method of claim 31, wherein said first population of target
cells are virally infected host cells, and said second population
of target cells are non-virally infected host cells.
39. The method of claim 31 wherein said first and said second
lethal phenotypes are the same phenotype.
40. The method of claim 31 wherein cell-specific cytotoxic agent is
a proteinaceous compound.
41. The method of claim 31 wherein cell-specific cytotoxic agent is
a nucleic acid.
42. A method of identifying a small organic molecule that induces a
lethal phenotype, comprising the steps of: (a) introducing into a
target cell a small organic molecule having a structure activity
relationship to a cytotoxic agent identified by the method of
claims 1, 25 or 30; and (b) determining whether said small organic
molecule induces a lethal phenotype in said cell.
43. A method of identifying a small organic molecule that induces a
lethal phenotype, comprising the steps of: (a) introducing into a
target cell a small organic molecule having the ability to displace
a proteinaceous cytotoxic agent identified by the method of claim
1, 23 or 30 from a corresponding endogenous protein; and (b)
determining whether said small organic molecule induces a lethal
phenotype in said cell.
44. A method of screening for conditional cytotoxicity, comprising
the steps of: (a) expressing a genetic library of putative
cytotoxicity-enhancing agents in a first population of target
cells; (b) exposing said first population of target cells to a
subtoxic threshold dose of a secondary reagent; (c) collecting a
first subpopulation of target cells that display a lethal phenotype
in response to said subtoxic threshold dose of said secondary
reagent; and (d) recovering genetic material from said first
subpopulation, wherein said genetic material encodes at least one
cytotoxicity-enhancing agent that confers conditional
cytotoxicity.
45. The method of claim 44, wherein said lethal phenotype is
apoptosis.
46. The method of claim 44, wherein said secondary reagent is
selected from the group consisting of ultraviolet radiation, X-ray
radiation and neutron radiation.
47. The method of claim 44, wherein said secondary reagent is a
chemotherapeutic agent.
48. The method of claim 46, wherein said chemotherapeutic reagent
is selected from a group consisting of methotrexate, cisplatin,
5-fluorouracil, colchicine, vinblastine, vincristine, doxyrubicin
and taxol.
49. The method of claim 44, wherein said target cells are cancer
cells.
50. The method of claim 49, wherein said cancer cells are derived
from a solid tumor.
51. The method of claim 44, further comprising the step of
performing a counterscreen, said counterscreen comprising
reiterating said process steps (a), (b), (c) and (d) with a second
cytotoxic substance.
52. The method of claim 44, wherein said step of exposing to said
cytotoxic substance is preceded by a step of preconditioning said
target cells.
53. The method of claim 52, wherein said preconditioning comprises
exposing said target cells to a preconditioning agent selected from
the group consisting of a growth factor, a cytokine and a
chemokine.
54. The method of claim 52, wherein said preconditioning comprises
activating an oncogene in said target cells.
55. A peptide fragment of BID having amino acids 33 to 195 of the
BID sequence of FIG. 9.
56. A peptide fragment of BID having amino acids 76 to 195 of the
BID sequence of FIG. 9.
57. A peptide fragment derived from clone 0013 consisting of the
amino acid sequence of FIG. 9.
58. A peptide fragment derived from clone 0195 consisting of the
amino acid sequence of FIG. 9.
59. A peptide fragment derived from clone 0328 comprising the amino
acid sequence of FIG. 9.
60. A peptide fragment derived from clone 0461 comprising the
partial amino acid sequence of FIG. 9.
Description
BACKGROUND OF THE INVENTION
[0001] Cancer and other diseases involving abnormal or undesired
cellular proliferation present a major challenge to the
pharmaceutical industry. Desirable therapeutic compounds frequently
act on cellular targets to inhibit cellular growth and/or kill
unwanted cells. In order to identify such therapeutic compounds
efficiently, it is often desirable to identify the cellular targets
that are involved in such growth inhibition or cell death. Yet such
cellular targets are difficult to identify, because cells
exhibiting the desired phenotype disappear from a cell population,
and consequently the targets (and the corresponding causative
agents) are lost.
[0002] In general terms, experiments that identify agents that
inhibit cellular growth and/or kill cells are termed "negative
selections"--i.e., selections for compounds that exert a cytotoxic
or cytostatic effect on a cellular population. Such negative
selections are needed for pharmaceutical research relating to a
number of areas, including cancer, viral infection and the like.
The art to date has not provided efficient, generally applicable
methods for conducting negative selections in mammalian
cells--i.e., for directly identifying the causative agents and
subsequently recovering the targets that interact with such agents
to result in growth inhibition or in cell death.
[0003] The lack of efficient negative selection protocols is of
particular concern in the field of cancer research. Drug discovery
for cancer requires identification of therapeutic agents that
interact with endogenous cellular targets so as to provide a
cytotoxic effect on the diseased or abnormal cell. Preferably, such
agents also will act with specificity for the target cell
type--i.e., selectively killing unwanted cells, while sparing
healthy, normal cells. One method for identifying such valuable
therapeutic agents is to first identify an endogenous cellular
target involved in that cytotoxic effect, and then use that target
as the basis of a screen to identify small molecule modulators that
interact with the target. Alternatively, therapeutic agents may be
either proteinaceous compounds that interact with an endogenous
cellular target or nucleic acids that prevent either the production
or function of that target. In such cases, it is desirable to
directly recover the agent that caused the desired cellular
inhibition or death.
[0004] In the case of cell death, the modulated target may in some
instances be involved in an apoptotic pathway, and in other
instances, may be involved in necrosis. In general terms, apoptosis
is the process of normal, programmed cell death in an organism,
while necrosis is a less specific, regulated response that lacks
many biochemical features associated with apoptosis. Many clinical
manifestations of cancer are believed to represent a malfunction in
this normal apoptotic process--i.e., a failure of normal cell
death, leading to uncontrolled proliferation of transformed cancer
cells in the body. Thus, the pharmaceutical industry particularly
desires to identify agents that will selectively promote the
apoptotic process, thereby encouraging death of the unwanted
cancerous cells.
[0005] Much of the current research for new chemotherapeutic agents
focuses largely on identifying new compounds that interact with, or
modulate the effect of, proteins that are already known to play a
key role in a given disease pathway. One such example is recent
work on the role of thymidine kinase in cancer, and the resulting
discovery of 5-Fluorouracil and folate analogues. Such techniques,
however, are inherently limited by the scope of pre-existing
knowledge of such key proteins. To maximize the development of new
chemotherapeutic agents for, e.g., cancer, it is preferable to be
able to broadly and generally screen for cytotoxic compounds
without being so limited to a small pre-existing pool of
targets.
[0006] Several general methods relate to the identification of dead
or dying cells, but lack the ability to directly identify
substances that caused the cell death (and, therefore, do not lead
to the direct identification of the cellular target that modulates
its cytotoxic effect); for example, a variety of staining methods
identify necrotic and/or apoptotic cells. Such methods include
antibody staining techniques and dye staining techniques such as,
e.g., propidium iodide staining. Other assays employ laborious
replica plating techniques, whereby duplicate colonies are
established and one such colony is exposed to putative cytotoxic
agents. When cellular death is observed in the one colony (via its
death, or absence from a replica plate), its corresponding
duplicate is then subjected to further analysis. However, such
replica plating techniques are time-consuming and not suited to
high-throughput screening procedures. Moreover, at best the replica
plating technique is an approximation, as the actual endogenous
cellular materials that are involved in the cell death are lost
with the duplicate colony that disappears from the replica
plate.
[0007] Thus, a need exists for a negative selection technique that
is direct (i.e., it is the dead or dying cells themselves that
provide the causative agents and corresponding endogenous targets
relating to their death). Moreover, a need exists for a negative
selection technique that provides rapid, efficient
evaluations--i.e., a technique that is suitable for high-throughput
screening. The present invention meets these needs.
SUMMARY OF THE INVENTION
[0008] The present invention provides methods for performing
negative selections. In some embodiments, the negative selections
are performed by introducing a genetic library into a population of
target cells, collecting a subpopulation of cells that disattach
from a culturing surface, and then recovering the genetic material
from that subpopulation. In other embodiments, the invention
provides methods for obtaining cytotoxic agents that establish a
lethal phenotype, wherein a genetic library is introduced into a
population of target cells, a subpopulation of cells displaying a
lethal phenotype is collected, and genetic material is then
recovered from that subpopulation. In variations of these
embodiments, cell-specific cytotoxic agents are identified by
employing a counterscreening step wherein the genetic material from
the subpopulation displaying disattachment and/or the lethal
phenotype is introduced into a second, different population of
cells, and a second sublibrary of genetic material is obtained from
a second subpopulation that does not display disattachment and/or
the lethal phenotype.
[0009] A variety of particular embodiments exist for each of these
basic embodiments. In some particular embodiments, the lethal
phenotype of the methodology may be apoptosis, necrosis, or growth
arrest. In embodiments in which the lethal phenotype is apoptosis,
the property of disattachment from a culturing substrate may be
used as a surrogate for apoptosis, thereby providing a technique
for enriching the apoptotic cell population. In other particular
embodiments, the genetic material may be partially sequenced, or
the method steps may be reiterated in a second population of the
same cells. The target cells may be mammalian cells, or more
particularly primary cells, especially primary cells derived from
epithelial or endothelial cells, stem cells, mesenchymal cells,
fibroblasts, neuronal cells or hematopoeitic cells. The mammalian
cells may also be cancer cells, or more particularly cancer cells
that are metastatic or derived from solid tumors. The cancer cells
may particularly be derived from breast, colon, lung, melanoma or
prostate tissue. In other particular embodiments, the mammalian
cells are genetically altered, and more particularly may be
immortalized or transformed.
[0010] In embodiments that utilize the property of disattachment of
target cells from a culturing surface, particular embodiments will
feature a low background of spontaneously disattaching cells, which
may more particularly be no more than about 10%, or alternatively
no more that about 2%. Target cells having such low backgrounds
include SW620 and HT29 colon cancer cells, T47D breast cancer
cells, and HuVEC cells. In particular embodiments, the disadhering
cells are collected over a period of at last about 12 hours. In
still other particular embodiments of the basic embodiments, the
genetic library is large or even very large(.about.10.sup.5 encoded
putative cytotoxic agents).
[0011] The invention also encompasses the identification of small
organic molecules that induce a lethal phenotype. In some
embodiments, organic molecules that displace a proteinaceous
cytotoxic agent from an endogenous protein are obtained. In other
embodiments, organic molecules having a structure-activity
relationship with that proteinaceous cytotoxic agent are
identified.
[0012] The invention also lends itself to embodiments that screen
for conditional cytotoxicity, wherein a genetic library is
introduced into a population of target cells, exposing those target
cells to a subtoxic threshold dose of a secondary reagent,
collecting a subpopulation of cells displaying a lethal phenotype,
and recovering genetic material from that subpopulation. Again, in
particular embodiments the lethal phenotype may be apoptosis,
necrosis or growth arrest. In other particular embodiments, the
secondary reagent may be UV, X-ray or neutron radiation, or may be
a chemotherapeutic agent, more particularly methotrexate,
cisplatin, 5-fluorouracil, colchicines, vinblastine, vincristine,
doxyrubicin or taxol. Particular embodiments include cancer cells,
more particularly solid tumors, as target cells, counterscreening
with a second cytotoxic substance, preconditioning the target cells
prior to exposure with, e.g., growth factors, cytokines,
chemokines, or activation of oncogenes.
[0013] The invention also encompasses compositions of matter, more
particularly six representative amino acid sequences, that are
obtained by applying the inventive negative selection methods to
HT29 colon cancer cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 is a bar graph depicting the results of FACS analysis
of Jurkat cells labeled with Apo2.7, in response to induction of
apoptosis with the anti-FAS antibody.
[0015] FIG. 2 is a pair of histograms depicting the differential
fluorescence patterns of adherent vs. disadhered ("floater") cells
stained with propidium iodide.
[0016] FIG. 3 is the FACS analysis of uninfected and mock-infected
HT29 cells. The mock-infected cells contain a GFP marker.
[0017] FIG. 4 is the FACS histogram depicting differential patterns
of PI staining in floater vs. adherent cell populations, 24 hours
after exposure to PI.
[0018] FIG. 5 is a diagrammatic representation of the construction
of a GFP reporter vector having internal XhoI/EcoRI/BamHI
restriction sites. Two sets of primers were used to PCR amplify the
left- and right-hand segments of GFP. The internal primer of each
primer set contains either XhoI-EcoRI or EcoRI-BamHI restriction
sites, as indicated. The subsequent digest (EcoRI) and ligation of
these fragments recreates GFP with a new internal cloning site,
XhoI-EcoRI-BamHI. Subsequent PCR amplification with the two
external primers allows amplification of the new GFP.
[0019] FIG. 6 is a FACS histogram depicting the background
fluorescence and induction characteristics of vector pBIGFII. Also
shown are the fluorescence signatures of the vector pVGRXR, and
CMV-GFP.
[0020] FIG. 7 is a FACS histogram of PI+(dead) HT29 cells (gate
M1), and a gel showing subsequent PCR amplification of that
fraction.
[0021] FIG. 8 is a gel comparing the PCR amplification of apoptotic
cells, live cells and gDNA controls.
[0022] FIG. 9 contains the peptide sequences of six cytotoxic
agents isolated from a negative selection in HT29 colon cancer
cells. Sequence (A) depicts two BH3 Interacting Domain Death
Agonist (BID) fragments. The fall length pro-BID is 195 amino acids
long. Pro-BID is cleaved at amino acid 55 (LQTD, gray text) by
caspase 8. The thin underline region represents BID clone number 1
(amino acids 33-195). The thick underline region represents clone
number 2 (amino acids 76-195). The shaded region "LAQVGDSMD" (gray)
represents the BH3 (Bcl-2 homology) domain. Sequence (B) is the
amino acid sequence of a cytotoxic agent isolated from a clone
designated 0113. Sequence (C) is the amino acid sequence of a
cytotoxic agent isolated from a clone designated 0195. Sequence (D)
is the amino acid sequence of a cytotoxic agent isolated from a
clone designated 0328 (xx represents unreadable sequence). Sequence
(E) is the partial amino acid sequence of a cytotoxic agent
isolated from a clone designated 0461. The cytotoxic agent is
estimated to be approximately 230 amino acids in length or
greater.
[0023] FIG. 10 depicts the analysis of clones from Sort VI of the
HT29 floater assay described herein. Thirty six clones picked at
random were tested in the HT29 floater assay. Five clones (BID,
0113, 0195, 0328, and 0461) showed increased levels of floaters
that were statistically significant relative to background.
[0024] FIG. 11 is a bar graph depicting the floater rates in SW620
cells at F0 (starting library), F2 (after one collection and one
sort), F3 (after one collection and two sorts) and F4 (after one
collection, three sorts), wherein SW620 cells were infected with
the random peptide perturbagen library and taken through several
cycles of the negative selection described herein. Floater rate
percentages were calculated at each step and compared with mock
infected and pVT334 infected controls.
[0025] FIG. 12 is a bar graph depicting cell number observations
for the SW620 cells of the negative selection described herein.
Equal numbers of control (i.e., mock infected and pVT334-infected)
cells and F3 (peptide library infected) cells were plated in T75
flasks. On day 5, the flasks were washed and trypsinized and the
total number of adherent cells was determined.
[0026] FIG. 13 is a kill curve for varying amounts of camptothecin
in T47D cells.
[0027] FIG. 14 shows two graphs comparing the doubling time and
senescence of two HuVEC cell isolates, 8F1868 and 9F0293.
[0028] FIG. 15 is a set of bar graphs showing the effects of
retroviral infection on cell number, doubling time and floater
rate. HuVEC 9F0293 cells were infected with the pLIBEGFP vector and
studied to determine the effects of retroviral infection and
infection procedures on cell number, doubling time and floater
rates. Doubling time is measured in hours. Floater rates are
measured in percentages (number of floating cells/number of
adherent cells).
[0029] FIG. 16 is a FACS histogram depicting the time course of
PI-/PI+ HuVECs in puromycin-treated cultures. 9F0293 cells were
treated with puromycin (2 .mu.g/ml) and followed over the course of
24 hours. Floater cells were collected at defined intervals and
were treated with PI and subjected to FACS analysis to determine
the percentage of dead and/or dying cells.
[0030] FIG. 17 is a diagrammatic representation of the
P-glycoprotein pump-mediated extrusion of Rhodamine 123 from an
MDR1 cell, in the presence and absence of library inserts (referred
to herein as "Perturbagens"). In an untransformed MDR1 cell, the
P-glycoprotein actively pumps Rh123 out of the cell, causing the
cells to be "dim." In the MDR1 cell bearing an active Perturbagen,
the pumping action of P-glycoprotein is blocked or disrupted, and
as a result, the cells retain Rh123 and remain "bright."
[0031] FIG. 18 is a diagrammatic representation of vectors
referenced in the description of some embodiments of this
invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0032] Overview of the Invention.
[0033] The invention provides a rapid, efficient way of screening
for (i) lethal agents or substances that cause or accelerate
cellular death of a cell, or for (ii) agents that trigger growth
and/or reproductive arrest in a population of cells and, thus,
eventually lead to the demise of that population. Both types of
agents are referred to herein as "cytotoxic agents," as the end
result is the loss of a cell population.
[0034] The invention accomplishes this end of efficient screening
by providing negative selection assays that first either directly
or indirectly selects for a lethal phenotype, and then yields
direct recovery of the modulators of endogenous proteins that
create that phenotype.
[0035] By "negative selection" is meant a procedure designed to
identify and isolate cells that are in one of any number of stages
of growth arrest and/or cell death--i.e., are evidencing a lethal
phenotype. By "lethal phenotype" is meant one or more cellular
events that result, directly or indirectly, in death of an
individual cell or a cell population.
[0036] The lethal phenotype may be the result of any number of
physiological events resulting in cell death. As non-limiting
examples, the cells may die by an active, pre-programmed pathway
such as apoptosis or by a more passive, degenerative means such as
necrosis, i.e., as a direct result of creating lethality in
individual cells. In other instances, the cells may disappear as an
indirect result, e.g., via some form of growth arrest. Such growth
arrest may be caused by a variety of mechanisms that block normal
cellular development, thereby freezing the cell in a given stage of
its cell growth cycle. For example, p16-induced growth arrest halts
the cells in the G1 phase of the cell cycle.
[0037] Generally, the selection methods of the invention begin by
providing a target cell population in which cells displaying a
lethal phenotype may be readily recovered. A variety of methods are
available for such recovery, many of which involve cell sorting
utilizing a fluorescent marker that directly or indirectly
identifies dead or dying cells, or even more specifically,
distinguishes apoptotic vs. necrotic cells. In other instances, the
lethal phenotype may have a surrogate phenotype that provides for
ready recovery of the desired target cell subpopulation. As one
example, the property of loss of cell adhesion can correlate with
cell death, thus providing for simple enrichment and/or selection
for cells having the correlative lethal phenotype. As another
example, alterations in cellular structure and/or function may be
an appropriate surrogate for lethality--e.g., loss of
P-glycoprotein overexpression correlates to increased sensitivity
to chemotherapeutic drugs in resistant cell lines and, therefore,
to increased rates of cell death.
[0038] One particular advantage of the invention is the direct
recovery of genetic material encoding the cytotoxic agents. By
"direct recovery" is meant the recovery of genetic material from
the growth arrested and/or dead or dying cell itself (as opposed to
indirect methods such as replica plating). Thus, the techniques
provide a direct sampling of the nucleic acids that constitute or
encode the agents that cause the lethal phenotype. Such direct
recovery is advantageous in that the actual, causative genetic
material is recovered and preserved for subsequent manipulation
and/or analysis, and for re-screening or counterscreening the
individual library inserts in another target cell population.
[0039] The invention is equally applicable to screening discrete
cytotoxic agents, or to libraries of putative cytotoxic agents. In
some embodiments, the library to be screened may be a large library
(i.e., more than about 1.times.10.sup.3 agents), or even a very
large library (i.e., more than about 1.times.10.sup.5 agents).
Although the invention may be used to evaluate an agent with a
known or suspected cytotoxic effect, it is equally applicable to
screening agents that previously were uncharacterized--i.e., were
not known or suspected to exert a cytotoxic effect. In some
instances, the agents will be proteinaceous or nucleic acid
moieties, while in others, the agents to be screened can be small
organic molecules.
[0040] The invention is well suited for evaluating the activity of
a cytotoxic agent in the presence or absence of other agents (e.g.,
sensitizers or synergistic reagents). Thus, in some embodiments,
the invention may be utilized to evaluate "conditional
cytotoxicity," in which one identifies a potentiating agent (e.g.,
a sensitizer encoded by a genetic library insert) that increases
the sensitivity of a cell to a secondary reagent (e.g., a known
chemotherapeutic drug or radiation from a variety of sources,
including ultraviolet, X-ray and neutron). Thus the potentiating
agent enhances the cytotoxicity of the secondary reagent, rendering
a normally subtoxic dosage or exposure of that secondary reagent
cytotoxic. This approach is of particular interest in evaluating
candidate agents for ameliorating multidrug resistance (MDR) in,
e.g., cancer cells, thereby making such cells susceptible to
standard chemotherapeutic agents such as, e.g., taxol, adriamycin,
vinblastine, actinomycin D, methotrexate, cisplatin,
5-fluorouracil, colchicine, vincristine, doxyrubicin and the
like.
[0041] In still other embodiments, the target cells may
pre-sensitized via some agent or that does not itself exert a
deleterious effect, for example, by addition of a growth factor. In
other instances, the target cells may be pre-sensitized by
activating the expression of a gene of interest, for example, an
oncogene.
[0042] The invention also lends itself to readily identifying
agents that act in a "cell-specific" manner. This can be
accomplished by conducting a counterscreening step utilizing a
second cell type. In such embodiments, the invention may be
utilized to identify cytotoxic agents that exert a differential
cytotoxic effect, for example by selectively killing a first type
of cell, while under similar conditions not exerting a cytotoxic
effect on a second cell type. As one specific but non-limiting
example, a library encoding putative cytotoxic substances may be
screened in a first cell population--e.g., a cancerous cell line
such as WM35. Agents that cause a lethal phenotype in those cells
are then isolated and screened in a second, corresponding primary
cell line. Agents that do not cause a lethal phenotype in the
non-cancerous cell line are then isolated and further
characterized.
[0043] Identification of a Lethal Phenotype
[0044] A variety of methods exist for identifying cells having a
lethal phenotype. For example, many methods familiar to those of
ordinary skill in the art target cellular components such as
surface antigens that arise only upon a cell's entry into an
apoptotic or necrotic pathway. In other instances, a change in
cellular morphology or cellular permeability that characterizes the
lethal phenotype is observed--e.g., changes in nuclear membrane
integrity or "blebbing" of the cell membrane. A variety of dyes,
stains and antibodies are available for such methods, including
without limitation the antibody Apo 2.7, propidium iodide, and
caspase dyes. When an identification agent is fluorescent, cells
displaying a lethal phenotype may readily be isolated from viable
cells using a fluorescence activated cell sorter (FACS), and the
genetic material recovered from the resulting isolated
subpopulation of dead and/or dying cells.
[0045] In other instances, a gross morphological or physiological
characteristic that is readily detected may be used as a surrogate
for the lethal phenotype. In some cell types, lack of cellular
adhesion is an excellent surrogate for cell death. Alternatively,
the presence or absence of a cellular marker such as a cytoplasmic
membrane-associated protein may be monitored.
[0046] Target Cells
[0047] A wide variety of different cell types are suitable for use
as target cells. In general, cells that bear some relation to a
known pathology or disease state, or to a known target tissue or
cell population, are utilized. In many embodiments, the target
cells will be mammalian cells.
[0048] In many instances, the disease of interest is cancer. Often
the cell type will represent a solid tumor, and metastatic cancer
cells are of particular interest. Representative cancer types
include, without limitation, breast, colon, prostate and lung
tumors, as well as melanoma. Corresponding cell lines include,
without limitation, SW620, HT29, DLD1, T47D, WM35 and the like.
[0049] In other instances, it may be desired to explore lethal
phenotypes in primary cells such as Human Umbilical Vein
Endothelial Cells (HuVECs). In general, the invention readily lends
itself to screening a variety of primary cell cultures derived from
epithelial cells, endothelial cells, stem cells, mesenchymal cells,
fibroblasts, neuronal cells and hematopoietic cells. In some
instances, the primary cell lines may be used in a counterscreening
step to investigate the selectivity of a cytotoxic agent. In other
instances, for example in angiogenesis, it may be desired to
identify agents that are cytotoxic to the primary cells
themselves.
[0050] The invention is also applicable to performing negative
selections in genetically altered primary cells. As non-limiting
examples, the primary cell may be genetically altered so as to
immortalize it, using standard techniques familiar to those of
ordinary skill in the art. Immortalizing techniques include use of
well-known genes such as HPV-E6, HPV-E7, hTERT, activated ras, SV40
large T-Antigen, Epstein-Barr Virus (EBV) BARF1 gene, Human T-Cell
Leukemia Virus Type 1 (HTLV-1) TAX (transactivation) gene, and
adenovirus E1A. In other instances, the primary cell lines may be
transformed by a variety of standard techniques. For example, cells
that are lacking one or more known tumor suppressor may be used.
Alternatively, a wide variety of transformed or immortalized cell
lines are available from ATCC and other such sources.
[0051] In many instances, it is also preferable that the target
cells have a low background rate for whatever identification
characteristic or surrogate characteristic used to select for the
lethal phenotype of interest. As one example, in the case of a
floater assay for apoptosis, target cells that have (i) low
backgrounds of spontaneous dissociation and/or (ii) good
correlation between dissociation and a lethal phenotype are
selected. Such target cells with low background dissociation rates
provide good levels of enrichment for, e.g., apoptotic cells, and
the enrichment may be further enhanced by collecting more than one
population of dissociated cells. The background rates of
dissociation are evaluated for a given target cell type. In many
instances, a rate of up to 1% or 1% or 2% is most preferred, with
background rates of 2-5%, and upward to about 10% still providing
adequate differentiation for use in the invention. Such selection
and optimization of a target cell line and its characteristics are
well within the skill of the art.
[0052] As described more fully elsewhere herein, colon cancer cell
lines such as, e.g., HT29 and SW620, breast cancer cell lines such
as, e.g., T47D, and HuVEC cell lines are particularly preferred for
floater assay embodiments. In still other embodiments, the negative
selection strategy may be applied to other cell types, with minor
modifications that are within the skill of the art. Non-limiting
examples include a wide variety of virally-infected mammalian cells
in which cytotoxic agents are selected on the basis of selective
killing of virally-infected cells.
[0053] Genetic Libraries
[0054] The present invention may screen a variety of types of
genetic material for cytotoxic agents. For ease of handling and
introduction into a cell, such genetic material is frequently in
the form of a genetic library, which in turn is incorporated into
an expression vector that is suitable for the target cell of
choice.
[0055] In some instances, the genetic library may be DNA encoding a
wholly or partially randomized peptide library, which is
synthesized using techniques familiar to those of skill in the art.
In other embodiments, the genetic library may encode specific
peptide sequences. Such peptide-encoding DNA may be expressed as
part of a scaffold structure, with the insertion sites being
internally located or, alternatively, located at or near the N- or
C-terminus of a scaffold polypeptide. The art is familiar with a
wide variety of such scaffolding structures. One non-limiting
example of such a randomized peptide library inserted into internal
scaffold sites is Abedi et al, N.A.R. 26(2):623-630 (1998), the
disclosure of which is incorporated by reference in its
entirety.
[0056] In other instances, the genetic material to be screened for
cytotoxic agents is derived from cellular sources. Such genetic
libraries may either be derived from genomic DNA (gDNA), cloned
DNA, or from cDNA derived from cellular RNA. Such libraries may be
derived from a wide variety of cellular sources, including without
limitation brain, human placental tissue, liver, kidney and the
like. Preferably, one generates a sufficient number of fragments of
DNA so as to ensure that all protein domains are likely to be
expressed in the library. E.g., Sambrook, Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press
(1989), Chapters 7-9, the disclosure of which is incorporated by
reference. The art is well versed in preparing a wide variety of
such cDNA and gDNA libraries.
[0057] As one non-limiting example, synthesis of cDNA and cloning
are accomplished by preparing double-stranded DNA from random
primed mRNA isolated from, e.g., human placental tissue.
Alternatively, randomly sheared genomic DNA fragments may be
utilized. In either case, the fragments are treated with enzymes to
repair the ends and are ligated into a vector suitable for
introduction into the target cell of interest, which in many cases
will be a mammalian cell. Exemplary vectors include a variety of
retroviral constructs, some nonlimiting examples of which are
described herein.
[0058] Cytotoxic Agents
[0059] A variety of cytotoxic agents are within the scope of this
invention. For example, the cytotoxic agent may be a proteinaceous
compound (e.g., a peptide, polypeptide or protein of natural or
synthetic origin), a nucleic acid agent (e.g., an RNA acting in an
antisense manner or otherwise interfering with normal cellular
functions), or a small organic molecule (e.g., a natural product or
member of a combinatorial chemistry library, or derivatives
thereof).
[0060] When the cytotoxic agent is proteinaceous or is a nucleic
acid, then the DNA encoding such agent is readily introduced into
the cell via standard techniques of molecular biology appropriate
for such target cells--e.g., retroviral transfer, electroporation,
and the like. When the cytotoxic agent is a small organic molecule,
then the target cells are exposed to such agents via a culture
medium into which a preselected concentration of the agent has been
added.
[0061] Cytotoxic agents that are small organic molecules may be
readily identified in at least two methods that are familiar to
those of skill in the art. One such method is a standard in vitro
displacement assay. In such assays, a cytotoxic polypeptide and its
corresponding endogenous cellular binding partner are first
prepared in vitro, often in a multi-well plate suitable for
high-throughput mechanized assay systems. Next, a library of small
organic molecules screened to identify those molecules that bind to
one of these cellular components, thereby disrupting the normal,
endogenous interaction between them. Alternatively, the small
organic molecules are obtained by systematically altering the
structure of the molecule and correlating that structure to a
resulting biological activity--termed here, a "structure-activity
relationship" study. As one of skill in the art appreciates, there
exist a variety of standard methods for creating such a
structure-activity relationship. In some instances, the work may be
purely empirical, and in others, the three-dimensional structure of
the endogenous polypeptide may be used as a starting point for the
rational design of a small molecule mimetic.
[0062] Exposure of Target Cells to Cytotoxic Agents
[0063] The cytotoxic agents may be proteinaceous (proteins, protein
fragments or domains, polypeptides or peptides) or nucleic acid
moieties that interact with endogenous components of a target cell,
or other organic or bioinorganic compounds. Proteinaceous and
nucleic acid agents may be presented to the target cells as
products of expression libraries comprised of, e.g., synthetic DNA,
cDNA or fragmented, sheared or digested genomic DNA ("genetic
libraries"). The genetic library inserts may be expressed in cells
without any additional sequences joined to them, or alternatively
may be fused to other molecules. For example, a polypeptide may be
fused to the perturbagen to increase stability of the perturbagen
in the assay system and/or to provide an easily detectable feature,
such as fluorescence. Examples of such fusion moieties include GFP,
LacZ or Gal4. Details are provided in co-pending, co-owned U.S.
Ser. No. 08/965,477, "Methods And Compositions For Peptide
Libraries Displayed On Light-Emitting Scaffolds," the disclosure of
which is incorporated herein in its entirety.
[0064] In some embodiments, genetic libraries encoding or
comprising putative cytotoxic agents are presented to the target
cell via a retroviral vector, using transfection procedures
familiar to those of ordinary skill in the art. Alternatively, such
material may be presented to the cell via electroporation or other
standard techniques.
[0065] Floater Cell Assays and Enrichment
[0066] In some embodiments of the invention, the lethal phenotype
(e.g., apoptosis or necrosis) is selected for by using a negative
selection assay that uses as a surrogate the selection property of
disattachment from a culturing surface--referred to herein as a
"floater assay." Accordingly, a cell population that is enriched or
even highly enriched in cells displaying the lethal phenotype may
be collected simply by collecting the cells that "float" in the
culture media after exposure to a cytotoxic agent.
[0067] Such a floater assay embodiment first involves the selection
of a suitable target cell type, for example a cell type that
correlates to a tissue or disease state of interest and which
displays a suitably low background of spontaneous disattachment
(i.e., disattachment of non-apoptotic cells), and high correlation
between disattachment and a lethal phenotype following exposure to
a lethality-inducing dose of a cytotoxic agent. Suitable cell types
can be selected as follows. First, a cell type relating to the
disease of interest (described in more detail above) is selected.
Next, a cell culture is established using standard techniques. Then
the cell culture is separated into two populations--"floaters" and
adherent cells. The "floater" population is recovered by
withdrawing the culture medium from the culture plate or flask, and
then culling the cells from that medium. The adherent population is
obtained by trypsinizing the cells that remained adhered to the
culture support following withdrawal of the culture medium. Each
population is then counted, and the relative number of spontaneous
floaters to adherent cells is calculated. The floater cell and
adherent cell populations are then analyzed to determine the number
of apoptotic or necrotic cells in each. Preferred cell types
provide a high correlation between the lack of adherence and the
lethal phenotype--i.e., the floater population is relatively
heavily populated with dead or dying cells, while the adherent
population is relatively heavily populated with viable cells.
[0068] Floater cells may present differing concentrations of lethal
and non-lethal phenotypes, depending on the cell type from which
they are derived. For example, in some cell lines, viable cells
(i.e., healthy, living cells that are still undergoing cellular
division and/or which are not replicating but which still display
normal cellular metabolism and physiology) are not adherent. In
such cell lines, the surrogate phenotype of non-adhesion does not
correlate to apoptosis, and thus such cell lines are not suitable
for the floater assay technique described herein (but may be used
for negative selections using direct recovery of genetic material
from dead or dying cells culled by, e.g., FACS analysis). In other
cell lines in which viable cells normally adhere to a plating
surface, a significant percentage of the viable, non-apoptotic
cells may enter the floater cell populace. In other cell lines,
some significant proportion of the floater cell populace may be
non-apoptotic, non-viable cells--for example, cells that have died
from cellular processes other than apoptosis. Cell lines providing
such mixed "floater" populations can be utilized the assay
techniques described herein if suitable controls are employed
and/or a second, independent identification method (e.g., Apo 2.7
or Propidium Iodide) is utilized in conjunction with the floater
assay technique.
[0069] Next, the chosen cell type is then exposed to the putative
cytotoxic agents. If the cytotoxic agent is or is encoded by
nucleic acid, then this is readily accomplished by providing a
population of the selected cell type with a library encoding a
variety of such agents, for example by following standard
procedures for the construction and infection of retroviral
libraries. The treated target cells are then cultured for
sufficient time to ensure establishment of the lethal phenotype,
following which the "floaters" or disattached cells in the cell
culture medium are collected and processed to extract the genetic
material. The DNA from the dead or dying cells is then amplified,
and at least partially sequenced in order to identify what
cytotoxic agent(s) correlate to the apoptotic lethal phenotype. The
correlation between the lethal phenotype and the recovered agent
may then be checked by introducing such agent into a second such
population of target cells, and verifying the presence of the
correlative lethal phenotype.
[0070] Alternatively, the floater cell population as a whole can be
utilized as a subpopulation that has been enriched for one or more
lethal phenotypes. When one wishes to distinguish, e.g., apoptotic
cells from necrotic cells, then the above strategy may be used to
enrich a given target cell subpopulation for lethal phenotypes. The
enriched subpopulation may then be further segregated using, e.g.,
an apoptosis-specific identification strategy (e.g., Apo 2.7) and
FACS sorting to obtain a purified apoptotic cell fraction.
[0071] Recovery of Genetic Material
[0072] Once the cells bearing the putative cytotoxic agents have
been screened and those cells having a lethal phenotype either
identified, directly via a staining technique or indirectly via a
surrogate phenotype such as lack of adhesion, the genetic material
from those cells is recovered via standard techniques. Briefly,
standard PCR techniques are used to rescue and amplify the genetic
material (DNA) of interest. PCR primers are selected so as to
amplify the region encoding the putative cytotoxic agents. The
genetic material may then be wholly or partially sequenced using
techniques familiar to those of skill in the art, and can be
re-constituted as a sublibrary for a second selection or for a
counterselection.
[0073] Endogenous Cellular Proteins
[0074] After completion of the negative selection protocols as
described herein, it is often advantageous to obtain the endogenous
cellular protein(s) that promote the lethal phenotype. By
"endogenous cellular protein" is meant a protein, polypeptide or
aggregate of polypeptide subunits that are encoded by the native
genetic material resident in the selected host cell. Such
endogenous cellular proteins may serve a variety of functions in
the cell, including without limitation (i) enzymatic function, (ii)
protein-protein interaction in a pathway in the cell cytoplasm or
nucleus; and (iii) transmembrane or secreted proteins, including
signalling and transport proteins and the like.
[0075] Endogenous cellular proteins of interest can be obtained by
a variety of methods. For example, if the cytotoxic agent is
proteinaceous, then the corresponding endogenous binding partner
may be identified via standard protein-protein interaction
methodologies such as the yeast two-hybrid binding assay, phage
display techniques or in vitro binding assays utilizing, e.g.,
protein-encoated substrates.
[0076] Assaying for Cell-Specific Cytotoxic Agents
[0077] In some embodiments, the inventive methodology may be
applied to identify agents that exert a differential cytotoxic
effect--i.e., are cytotoxic to one cell population but not to
another. Such embodiments are particularly advantageous for
identifying agents that will act with specificity against a given
cancer type, while leaving non-cancerous cells partially or wholly
unaffected. Similarly, the methodology can identify agents that are
specific to cancer cells in one developmental stage but not
another--e.g., metastatic cells. Such applications are particularly
advantageous in that the agents so identified are expected to
provide therapeutic advantages such as lack of undesirable side
effects, lower therapeutic dosages, and the like.
[0078] One general approach is as follows. The negative selection
strategy for selecting lethal phenotypes (e.g., apoptosis) is
implemented as described above, utilizing the cell type against
which a cell-specific agent is sought. Upon completion of this
step, the genetic material encoding or embodying the cytotoxic
agents is isolated, and reintroduced into a second population of
cells that is or is representative of the cell type for which it is
desired that the cytotoxic agent be relatively or completely
non-toxic. In this second counterselection step, one of two
strategies may be employed. First, the cells exhibiting a lethal
phenotype may be collected and the corresponding genetic material
be evaluated so as to eliminate putative cell-selective agents (as
having been demonstrated to be non-cell specific). Conversely, the
counterselection step may employ a positive selection
strategy--i.e., isolating the genetic material that corresponds to
the cells in the second population that do not exhibit the lethal
phenotype--i.e., continue to grow in the presence of the cytotoxic
agent.
[0079] Assaying for Conditional Cytotoxicity
[0080] The basic negative selection strategy described above may be
modified slightly to identify agents that increase sensitivity of a
target cell to a known cytotoxic agent (termed herein, "conditional
cytotoxicity"). Such embodiments are particularly advantageous for
identifying agents that can be used as an adjuvant, given in
conjunction with the known cytotoxic agent. Such a strategy permits
a lower dosage of the known cytotoxic agent to be administered,
with correspondingly lower incidence or severity of unwanted side
effects.
[0081] One general approach is as follows. A target cell type is
selected, and a cytotoxic substance of interest (referred to herein
as a "secondary reagent") is selected. Next, a "standard kill
curve" (i.e., dose-response curve, wherein increasing amounts of
agent are presented to target cells, and the resultant cell death
monitored and plotted) is prepared for that cell type and cytotoxic
substance. From the standard kill curve, a "subtoxic threshold"
dosage of the secondary reagent (i.e., the largest dosage from the
kill curve that does not initiate cell death in the target cell
population) is selected for further study. A population of the
target cells is then provided with one or more putative
cytotoxicity-enhancing agents (e.g., in the form of a genetic
library), and subsequently exposed to the selected subtoxic
threshold dosage of the secondary reagent. A negative selection as
described elsewhere herein is then conducted, and transformed
target cells that die in response to the subtoxic amount of the
secondary reagent are collected and the corresponding
cytotoxicity-enhancing agent identified. If that agent was a
proteinaceous or nucleic acid biomolecule, then the genetic
material that encodes or comprises the agent is isolated and
evaluated, for example by the PCR amplification and sequencing
strategy described elsewhere herein.
[0082] Preconditioning
[0083] In some embodiments of the invention, a preconditioning step
may be added to the negative selection strategy. In such
embodiments, a population of target cells is first exposed to a
preconditioning agent. The cells are then exposed to the putative
cytotoxic agents (e.g., a genetic library). Again, the selection
collects cells displaying a lethal phenotype (e.g., apoptosis or
necrosis), and isolates the corresponding cytotoxic agents, as
described elsewhere herein. This step results in the identification
of agents that act in the presence of the preconditioning
agent.
[0084] Optionally, a second selection step (a positive selection)
may be used to identify agents that act only in the presence of the
preconditioning agent. In such an embodiment, a second population
of the target cell is exposed in a similar manner to the cytotoxic
agent(s) isolated in the first (negative) selection step, but
without the prior step of exposure to the preconditioning agent.
Cells that live are collected, and the corresponding cytotoxic
agent identified, as described elsewhere herein.
[0085] A variety of preconditioning agents will be known to those
of skill in the art. Generally, these agents will be involved in
metabolic pathways related to cellular growth or death.
Non-limiting examples include growth factors such as the activated
EGF receptor, activated oncogenes such as ras or myc, knockouts of
genes such as p53, p16 or Rb, and the like.
[0086] The following examples for the generation and use of the
selection systems of the invention are given to enable those
skilled in the art to more clearly understand and to practice the
present invention. The present invention, however, is not limited
in scope by the exemplified embodiments, which are intended as
illustrations of single aspects of the invention only, and methods
and materials that are functionally equivalent are within the scope
of the invention. Various modifications of the invention in
addition to those described herein will become apparent to those
skilled in the art from the foregoing description and accompanying
drawings. Such modifications are intended to fall within the scope
of the appended claims.
EXAMPLES
Example One
[0087] Methods for Identifying and Characterizing Dead and Dying
Cells
[0088] Many negative selections, including some selections
described herein, require the identification of dead and/or dying
cells. As one of ordinary skill in the art appreciates, there are
many techniques that can be used to detect these cells.
[0089] A number of techniques exist for identifying cells that have
a lethal phenotype, and for distinguishing, e.g., apoptotic and
necrotric cells. In some instances, antibodies are used to identify
cells that are undergoing apoptosis. Koester et al., Monitoring
Early Cellular Responses in Apoptosis is Aided by the Mitochondrial
Membrane Protein-Specific Monoclonal Antibody APO2.7" Cytometry,
29:306-312 (1997). In some such embodiments, the antibodies
recognize antigens that are, under normal (viable) conditions,
hidden or masked from detection, but which become exposed in dying
cells. In other instances, apoptotic cells are detected using
substrates that are recognized by proteases (caspases) that are
unique to, and activated by, the apoptotic pathway. Green, D.,
Kroemer, G., "The Central Executioners of Apoptosis: Caspases or
Mitochondria". Trends in Cell Biology. 8:267-271 (1998). In still
other instances, dead and dying cells are distinguished from viable
cells on the basis of their interaction with various dyes. One
class, membrane permeable dyes (e.g. Trypan Blue), are actively
excluded from the intracellular compartments of living cells but
accumulate in the cytoplasmic/nuclear regions of dead or dying
cells. A second class of reagents, membrane impermeable dyes, is
excluded from all living cells, but is capable of penetrating the
compromised membrane boundaries of dead and/or dying cells. Many of
these reagents (e.g. propidium iodide, ethidium homodimer) have an
affinity for DNA and show an increase in fluorescence upon binding
to nucleic acids. Krishan, "Rapid flow cytofluormetric analysis of
mammalian cell cycle by propidium iodide staining," J. Cell Biology
59:766 (1973). These reagents may be used in conjunction with FACS
analysis or be applied in the more general techniques of
fluorescent microscopy. Shapiro, "Practical Flow Cytometry", H. M.
Wiley-Liss Publications (1995).
[0090] A. Apo 2.7 Antibody Staining.
[0091] Apo2.7 (Coulter Immunotech) is a monoclonal antibody that
recognizes an epitope in the mitochondrial membrane that is exposed
only in cells that are undergoing apoptosis. To test its efficacy
in negative selections, 1.times.10.sup.6 Jurkat cells in 2
milliliters of AIM-V serum free medium were induced to undergo
apoptosis using the anti-FAS antibody (1 ug/ml anti CD95 clone,
Yonehara, S. et al., "A cell killing monoclonal antibody (anti-FAS)
to a cell surface antigen co-down regulated with the receptor of
tumor necrosis factor." J. Exp. Med 169: 1747-1756 (1989)). After a
fixed period of exposure (0, 2, 10, 17, or 21 hours in anti-FAS
antibody), 100 .mu.l of a 100 .mu.g/ml solution of digitonin in PBS
was added (20 minutes on ice) to permeablize the cell membrane.
Following this procedure, the cells were spun (200.times.g) and
resuspended in a solution containing a fluorescent
R-phycoerythrin-cyanin labeled Apo2.7 antibody provided by
Coulter-Immunotech (10 .mu.l Apo2.7 antibody, 90 .mu.l PBS,
+cells). This reaction was allowed to incubate for 15 minutes at
room temperature in the dark. The cells were then pelleted by
centrifugation (200.times.g) and resuspended in 1 ml of PBS before
being analyzed by flow cytometry (excitation, 488 nm; emission,
660-690 nm). Results of FACS analysis (FIG. 1) showed that at
time=0 (i.e. control), only 4% of the population labeled with
Apo2.7 antibody. In contrast, exposure to the apoptotic-inducing
anti-FAS antibody led to increased binding of Apo2.7 to the Jurkat
cell line (t=21 hrs=81% labeling).
[0092] B. Propidium Iodide Staining.
[0093] Propidium iodide (PI) is a fluorescent, DNA intercalating,
molecule. Live cells with intact membranes exclude PI from
intracellular compartments and thus are non-fluorescent. Dead and
dying cells whose membranes have been compromised are permeable to
PI, and thus are fluorescent. The PI staining technique is equally
applicable to apoptotic and necrotic cells.
[0094] As a non-limiting example of the use of this type of reagent
for identification and purification of dead cells, the following
pilot experiment was performed. Floater cells (i.e., non-adherent
cells in an otherwise adherent cell population) were isolated from
a flask of HT-29 colon cancer cells. These cells, along with an
equally sized adherent cell population, were harvested by
centrifugation and subsequently resuspended at 1.times.10.sup.6
cells/ml in PBS. PI was then added to each sample at a
concentration of 2.0 .mu.g/ml and cells were analyzed by flow
cytometry (excitation 488 nm, emission, 610 nm). Dead cells that
had lost membrane integrity could be easily distinguished from live
cells based on their increased fluorescence (FIG. 2). The
percentage of adherent cells that were positive for PI uptake
averaged approximately 0.5-1.5% at this cell density. In
non-adherent "floater" cells, a higher percentage of cells
(>10%) were observed to be positive for PI uptake.
[0095] To make a positive correlation between PI staining and cell
viability, an equivalent number of PI positive and PI negative
cells were identified and collected separately using FACS. These
two populations were then plated onto 150 mm plastic tissue culture
dishes and allowed to attach and grow for 7-10 days. Cell viability
was then determined by counting the number of colonies that grew on
each plate. While cells that were PI negative were viable and
produced colonies, PI positive cells failed to grow.
[0096] C. Nuclear Condensation.
[0097] In contrast to necrosis, cells that die by apoptosis often
exhibit nuclear condensation. Thus, dye/stain techniques that allow
visualization of the nuclear morphology are used to assess the
method by which a cell dies.
[0098] Two cell lines, WM35 and HS294T, were plated out (50,000
cells per well, 24 well plate) and allowed to adhere. After 24
hours, the cells were treated for 4 hours with varying
concentrations (5-80 .mu.M) of Cisplatin (cis-platinum (II)
diammine dichloride), a well-known chemotherapeutic agent that
induces apoptosis. The following day (18-24 hrs later) the media
was then collected from each well and cells that did not adhere to
the well (termed herein, "floaters cells" or "floaters") were
collected by centrifugation (400.times.g). Adherent cell
populations were then lifted from the solid support by
trypsinization, centrifuged (400.times.g), and resuspended in PBS
(0.125 ml). To observe the nuclear morphology and percent cell
death in the WM35 and HS294T cell lines, cells from both floater
and adherent populations were stained concurrently with Syto16 and
ethidium homodimer (125 ul of cell suspension+2.5 ul 62.5 uM
Syto16+2.5 uM 100 ug/ml ethidium homodimer, 10 minutes at
37.degree. C.). Ethidium homodimer is a membrane impermeant
compound that fluoresces in the 617 nm range when it is
intercalated with chromosomal DNA. Thus, in a mixed cell population
containing both living and dead/dying cells, only those cells whose
membranes have been compromised will stain with ethidium homodimer.
In contrast, Syto 16 (Molecular Probes) is a membrane permeant dye
that fluoresces in the 518 nm range when associated with
chromosomal DNA. Together, these two dyes can be used to observe
and distinguish the nuclear morphology in a population containing
both living and dead/dying cells. Examination of the floater
population of Cisplatin treated HS294T cells showed that while
greater than 50% of the cells stained with ethidium homodimer, in
general, fewer than 20% of these cells showed condensed or
fragmented nuclei when observed by fluorescent microscopy. Instead,
the nuclei in these cells appeared diffuse and bloated, suggesting
that Cisplatin treated HS294T cells die by a necrotic, rather than
an apoptotic, pathway. In contrast, the floaters obtained from
Cisplatin treated WM35 cell lines showed both a high degree of
ethidium homodimer staining (45-50%) and a phenotypically distinct
condensed or fragmented nuclei (40-50% in higher concentrations of
Cisplatin) suggesting that a large percentage of these cells die by
an apoptotic pathway. Neither of the two adherent cell populations
exhibited significant amounts of ethidium homodimer staining
(generally <10%), indicating that the adherent population
largely comprised viable cells.
[0099] D. Caspase-Sensitive Dyes.
[0100] Caspase-3 and other proteases have been shown to play a role
in apoptotic induced cell death (Green and Kroemer, 1998). To test
the correlation between this enzymes activity and cell death, and
to study the possibility of using caspase-3 activity in negative
selections, WM35 (melanoma) cells are induced to undergo apoptosis
and then exposed to Rhodamine 123-YVAD, a caspase-3 fluorescent
substrate.
[0101] WM35 cells were passed one day prior to induction of
apoptosis and incubated for 24 hrs to allow the cells to attach to
the substrate. The media was subsequently removed, the remaining
adherent cells washed 1.times. with PBS, and subsequently exposed
to Cisplatin (15 .mu.g/ml) in fresh media. Eighteen to twenty-four
hours after the induction of apoptosis, the floater cell population
was collected, pelleted by centrifugation (400.times.g), and
resuspended at 3.times.10.sup.6 cells/ml in PBS. Samples were then
split into four groups: (1) uninduced minus Rhodamine 123-YVAD
(substrate), (2) uninduced plus substrate, (3) induced minus
substrate, and (4) induced plus substrate. For samples exposed to
Rhodamine 123-YVAD substrate, 50 ul of a pre-warmed (37.degree. C.)
cell suspension was combined with 25 ul of a stock substrate
solution (Cellprobe). Samples were incubated for 60 minutes at
37.degree. C. and then placed on ice prior to FACS analysis. In
addition to caspase-3 staining, a replicate of each sample was
stained with propidium iodide to determine the percentage of cells
within the population whose membranes had been compromised and the
overlap between PI and caspase-3 staining. For flow cytometric
analysis, each sample was brought to a total volume of 1 ml (PBS)
and excited at a wavelength of 488 nm (15 mwatts) using an argon
laser. Emission spectra were read at 515-535 nm wavelength using
the FL1 (PMT2) 525 nm blue filter.
[0102] Caspase-3 activity peaks early in the apoptotic cycle, long
before the disruption of the cell cytoplasmic membrane. Therefore,
caspase3-positive floater cells are predicted to be PI-negative,
while PI-positive floater cells are expected to have passed the
peak period of caspase-3 activity and therefore be phenotypically
caspase-3-negative. Consistent with these predictions, of the
PI-minus, Cisplatin-treated WM35 cells collected from the floater
population, 94.6% were found to be caspase-3 positive. The
remaining cells obtained from the floaters fell into the
PI-positive, caspase-3-negative group. Control studies with
adherent cell populations showed the vast majority (>95%) to be
both caspase and PI negative.
Example Two
[0103] Identifying Cell Types for Negative Selections Via Floater
Assays
[0104] Prior to performing negative selection assays, a cell line
with a phenotypic feature that is a readily monitored surrogate for
a lethal phenotype is identified. In this Example, lack of cellular
adhesion to a plastic, gelatin or other suitable culturing support
(i.e. presence of "floating cells" or "floaters") is selected as
the surrogate phenotypic feature that correlates to the lethal
phenotype.
[0105] In order to use floater populations as a method of
identifying and enriching for dead and/or dying cells in a negative
selections, cell lines preferably display three features: (1) in a
stable untreated cell population, the greater majority of cells are
adherent to the solid support (e.g. plastic, gelatin) and the
background rate of floater cells is relatively low (<1%); (2) in
an untreated or treated cell population (i.e. one exposed to
putative cytotoxic agents and optionally also a secondary agent), a
high percentage of the floater cells correlate with the dead and/or
dying cell population; and (3) the cell line is receptive to
standard or common techniques of introducing library inserts
encoding putative cytotoxic agents into the cell e.g. retroviral
infection or transduction.
[0106] A. Background Levels of Floater Cells.
[0107] The first variable, background floater levels, are evaluated
by establishing a stable culture of target cells and then comparing
the levels of cells floating in the media with the total number of
cells (adherent cells+floater cells). Additional procedures, such
as retroviral infection, can be overlaid on top of this
experimental design, thus making it possible to assess the effects
of retroviral infection on floater cell/total cell ratios and
determination of the receptiveness of the cell line to the
introduction of putative cytotoxic agents by transfection.
[0108] HT29 cells were tested for feasibility in the floater cell
assay as follows. Briefly, six flasks were inoculated with
6.25.times.10.sup.5 HT29 cells/flask on Day 0. On Day 1, after the
cells had been allowed to adhere to the solid support, two of these
flasks were infected with retroviral supernatant containing the
retroviral vector pVT324, which includes a selectable drug
resistant marker (e.g. neomycin), and which constitutively
expresses a green fluorescent protein. Of the remaining four
flasks, two were mock infected (i.e. exposed to all of the same
reagents/conditions as flasks 1 and 2, minus the retrovirus, see
"Example 3C") and two were left undisturbed. On Day 2, this
procedure was repeated (i.e. a double infection). On Day 3 (and
subsequently on Day 5) one flask was selected from each of the
three groups and processed by separating and counting the floater
and adherent cell populations. In the case of the floater cell
population, the media was collected, centrifuged at 200.times.g for
10 minutes, and resuspended in PBS prior to removing a sample for
counting on a hemocytometer. For the adherent cell population,
cells were first removed from the flask by trypsinization,
centrifuged, and then processed for analysis in a fashion analogous
to the floater cells. To determine the inherent background level of
floater cells present in the population, the ratio of the number of
floater cells to the total number of cells (adherent cells +floater
cells) was analyzed on both the Day 3 and Day 5 flasks that had not
been manipulated. These numbers were compared with the analogous
numbers taken from infected and mock-infected flasks to determine
whether the retrovirus or transfection procedures altered
background floater rates. To determine the susceptibility of HT29
cells to retroviral infection, the fraction of cells that expressed
GFP in pVT324 infected flasks was calculated using flow
cytometry.
[0109] The non-infected background floater rate of the HT29 cell
line was found to be 0.42%. Infected and mock infected HT29 cells
showed 0.51 and 0.37% floater rates respectively, indicating that
neither the retroviral infection procedures nor the retrovirus
itself increases background floater rates substantially. In
addition, FACS analysis of the pVT324 infected HT29 population
showed approximately 80% of the cells falling into the "bright"
gate (i.e. GFP expressing cells). FIG. 3. Together, the low
background floater rate and the high susceptibility of HT29 to
retroviral infection make it a desirable candidate for negative
selections. Additional cells lines--two colorectal adenocarcinoma
lines, SW620 and DLD-1 (CCL-221, ATCC), and a prostate
adenocarcinoma cell line, PC-3--also were examined using these same
criteria and been found to be suitable cell line candidates for
negative selections. In contrast, LNCaP, a human prostate carcinoma
cell line (ATCC), exhibited background floater rates of greater
than 10% thus making it less preferred for use in negative
selections which utilize lack of adhesion as a surrogate for a
lethal phenotype. See Table 1, below.
1 TABLE 1 Colon Colon Prostate Prostate HT29 SW620 DLD-1 PC-3 LNCaP
Background .ltoreq.1.0% .ltoreq.1.0% .ltoreq.1.0% .ltoreq.1.0% 4-5%
Death Floaters .ltoreq.0.5% 1.0% 0.5% 2.5% .gtoreq.10% Fraction of
dead 40% 65% 50% 30% 12% cells in floaters Do dead cells YES YES
YES YES ? eventually become floaters? Tolerates retroviral YES YES
YES YES YES infection
[0110] B. Correlation Between "Floaters" and Lethal Phenotypes.
[0111] An important component to the negative selections of the
present invention is the ability to demonstrate a correlation
between the floater population and dead and/or dying cells. This
correlation can be established using a variety of techniques known
to those of skill in the art, including without limit those
described above for detecting and characterizing such cells.
[0112] In this Example, propidium iodide (PI) was used as a method
of monitoring the percent dead/dying cells in both the adherent and
floating cell populations. To determine the percent of floaters
that were dead and/or dying, four separate cell lines (three colon
cancer cell lines, HT29, SW620, and DLD-1, and one prostrate cancer
cell line, PC3) were plated in tissue culture flasks and allowed to
adhere. After 24-48 hours, both adherent cells and floaters were
collected, stained with PI, and examined by flow cytometry. While
the adherent populations of all four cell lines typically showed
less than 1% PI.sup.+ cells, 30% or more of the floater cell
population were observed to be PI.sup.+.
[0113] These studies demonstrate that there is a strong correlation
between cell death and floaters in the above cell lines. In
addition, combining the techniques of floater collection with a
second selection (FACS sorting of PI.sup.+ cells) enables one to
further maximize the level of enrichment of dead and/or dying cells
having a lethal phenotype and thus, increasing the likelihood of
isolating cytostatic agents that exist at low frequency in the
population.
[0114] A second experiment designed to determine whether dead or
dying cells move from the adherent to floater population was
performed using a pulse-chase protocol. Alberts, B. et al.
"Molecular Biology of the Cell", pg. 180, Garland Publishing, Inc.
(1983). Adherent PC-3 cells in culture were stained for a brief
period with 2 .mu.g/ml PI while remaining attached to the plate.
The cells were then rinsed and returned to fresh media. Twenty-four
hours later, both the floater and adherent populations were
collected and scanned to determine the distribution of PI positive
cells amongst the two groups of cells. The results (FIG. 4) show
that the PI positive cells segregate specifically to the
non-adherent "floater" population of cells. This result indicates
that dead or dying cells that had previously been adherent move
into the floater population within 24 hours.
Example Three
[0115] Introduction and Recovery of Sequences Encoding Cytotoxic
Agents
[0116] In order to perform "floater assays" to identify sequences
that encode cytotoxic agents (i.e., agents that stimulate
relatively immediate death of individual cells, or agents that
prevent cell growth or proliferation, thus gradually leading to the
death of a cell population), libraries of sequences encoding
putative cytotoxic/cytostatic agents are constructed and then
introduced into the selected cell lines. The following Example
describes one non-limiting protocol for such work.
[0117] A. Preparation and Transfer of a cDNA Library
[0118] Using techniques that are common to individuals familiar
with the art, polyA mRNA is isolated from fetal brain tissue by
affinity chromatography on an oligo dT cellulose column
(polyASpin.TM., New England BioLabs). This material is then
subjected to first strand PCR (Pfu polymerase, Stratagene)
synthesis using oligo dT primers linked to sequences encoding a
selected restriction enzyme linker. Following the elimination of
RNA (RNAse A/H, Boehinger Mannheim) from the sample, second strand
synthesis proceeds, using random primed oligos that have been
constructed with the desired linker sequence. The double stranded
cDNA product is then size selected, treated with the appropriate
enzymes to create "sticky" ends, and ligated into an expression
vector suitable for the cell line of choice.
[0119] As an alternative to oligo dT primed cDNA libraries,
randomly primed cDNA libraries are used as a source of sequences
encoding putative cytotoxic agents. As one non-limiting example of
how to construct such a library, polyA mRNA derived from placental
tissue was PCR amplified using a random 9-mer linked to a unique
SfiI sequence ("SfiA"), followed by an additional set of
nucleotides that is used later for library amplification (OVT 906:
5' ACTCTGGACTAGGCAGGTTCAGTGGCCA TTATGGCC (N).sub.9). The product of
this reaction was size selected (>400 base pairs) and subjected
to RNAseA/H treatment to remove the original RNA template. The
remaining single stranded DNA was then subjected to a second round
of PCR using a random hexamer nucleotide sequence linked to a
second unique SfiI sequence ("SfiB") which was again followed by an
additional set of nucleotides for future library amplification:
(OVT 908: 5' AAGCAGTGGTGTCAACGCAGTGAGGCCGAGG CGGCC (N).sub.6). The
final product of this reaction was blunted/filled with Klenow
Fragment (New England BioLabs), size selected, PCR amplified (OVT
909: 5' ACTCT GGACTAGGCAGGTTCAGT and OVT 910: 5'
AAGCAGTGGTGTCAACGCAG TGA), digested with SfiI (New England
BioLabs), and inserted into a retroviral vector.
[0120] Alternatively, commercially available libraries can be used.
The cDNA inserts of such libraries are spliced out from the
original vector and inserted into an expression vector of choice.
As one non-limiting example, three libraries obtained from three
different tissue sources (brain, liver, and kidney) were obtained
from Origene Inc. (Catalogue # DHL101, DHL 105, and DHL 106). Using
standard techniques, bacterial hosts carrying the libraries were
expanded in liquid media (LB plus ampicillin) and used to prepare
large quantities of episomal (library) DNA (Maxiprep, Qiagen). The
cDNA insert in each vector was then released by digestion with the
appropriate restriction enzyme (EcoRI/XhoI) and the fragments were
then gel purified (0.4-2.8 kB) and ligated (T4 Ligase, Boehringer
Mannheim) into the compatible sites of the pVT340 retroviral vector
(described below).
[0121] B. Construction Of A Scaffolded Peptide Library
[0122] Construction of a scaffolded peptide library followed the
protocols developed by Abedi et al., N.A.R. 26(2): 623-630 (1998),
incorporated by reference herein in its entirety. Initially a
modified GFP containing BamHI, XhoI, and EcoRI sites at position 6
(pVT27) was constructed using pVT014 (also known as pACA151, a gift
of Dr. Jasper Rine) as a template. To accomplish this, two separate
PCR reactions using oligos OVT 312 (5' TGAGAA
TTCCTCGAGTTGTTTGTCTGCCATGATGTATAC), OVT 322 (5' TGAGAATTCG
GATCCAAGAATGGAATCAAAGTTAACTTC), OVT 329 (5' GTTAGCTCACTCA
TTAGGCACCC) and OVT 330 (5' CGGTATAGATCTGTATAGTTCATCC ATGCCATGTG)
were performed using recombinant Pfu polymerase (Stratagene). The
internal termini of the resulting fragments contained XhoI/EcoRI
and EcoRI/BamHI restriction sites (FIG. 5). The two fragments were
subsequently digested with EcoRI (New England Biolabs), ligated
with T4 DNA Ligase (Boebringer Mannheim) and PCR amplified using
the external primers OVT 329 and OVT330. The final product contains
a 6 codon insert incorporating XhoI/EcoRI/BamHI restriction sites
at the Gln157-Lys 158 insertion site of pVT27.
[0123] To construct the random peptide library, fifteen picomoles
of Aptamer 3 (5' TCGAGA GTGCAGGT[NN(G/C/T)].sub.15GGAGCTTCTG) was
mixed with Aptamer 4 (5' ACCTGC ACTC) and Aptamer 5(5'
GATCCAGAAGCTCC) in a molar ratio of 1:50:50 and annealed in 20 mM
Tris-HCl, pH 7.5, 2 mM MgCl.sub.2, 50 mM NaCl by heating to
70.degree. C. for 5 minutes. The solution was then allowed to cool
to room temperature and ligated to a BamHI/XhoI cut pVT 334
retroviral vector using T4 ligase (Boehringer Mannheim). As a
result of these manipulations, a biased-random fifteen amino acid
sequence flanked by three constant amino acids on either end was
inserted into position 6NVT27 of GFP. The library was transformed
into E. coli (DH10B, Gibco) by electroporation and plated on
LB-agar plates containing the selective drug, ampicillin.
[0124] C. Expression Vectors
[0125] A variety of retroviral or other vectors are suitable for
use in the invention. As one non-limiting example, of a retroviral
expression vector useful for constitutive expression of library
sequences in mammalian cells was constructed as follows. The 3.8 kB
HindIII/Scal band of pVT314 (FIG. 18) was ligated to the 1.9 kB
SSPI/PvuII band of pBluescript.TM. (Stratagene). The final product
of this reaction (referred to as pCLMFG, or MFG or pVT340) is a
vector that contains all the necessary components of a constitutive
retroviral expression vector including a Psi site for packaging,
constitutive CMV driven expression, a splice donor and acceptor
site for obtaining high levels of library insert expression, and a
multiple cloning site (MSC) linked to the 3' end of EGFP. Putative
cytotoxic agents are expressed constitutively as fusions with the
GFP scaffold.
[0126] As an alternative to the constitutive pCLMFG vector, an
inducible construct that can be regulated by ecdysone was
constructed as follows. The PmlI/XhoI fragment from pVT324 was
inserted into the MCS of the PIND vector (Invitrogen). This product
was then digested with BgIII, blunt-ended and inserted into a
pBabe-K-ras vector (pVT313-based) that had been digested with
BamnHI/XhoI and blunted (Klenow Fragment). The resulting vector was
designated pBabe-Forward-1. The XbaI fragment of pVT324 was then
inserted into the compatible site of pBabe-Forward-1. The resulting
vector was designated pBIGFII. Vector pBIGFII was subsequently
transfected into cells (ECR293, Invitrogen) that contain an
endogenous copy of the ecdysone receptor (pVgRXR). When these cells
are grown in the absence of ponesterone A, they exhibit a low level
of background fluorescence. In contrast, when the cells containing
both vectors are grown in the presence of 5 .mu.M ponesterone A,
the level of fluorescence increases by approximately thirty fold
(see FIG. 6). Thus, pBIGFII exhibits a low background fluorescence
and is strongly induced in the presence of ponesterone A. Such
vectors are useful in identifying sequences encoding cytotoxic
agents that disrupt the cell cycle or induce death via an apoptotic
pathway.
[0127] D. Retroviral Packaging and Infection
[0128] Next, the library constructs are packaged for retroviral
transfection into the cell of choice. One non-limiting method of
accomplishing this is described as follows. On Day 1,
3.times.10.sup.6 cells of the packaging cell line (293 gp) are
seeded into a T175 flask. On the second day, two tubes, one
carrying 15 ug of library DNA+10 ug of envelope plasmid
(pCMV-VSV.G-bpa)+1.5 ml DMEM (serum free), the second carrying 100
ul of LipofectAMINE (Gibco BRL)+1.5 ml DMEM (serum free) are mixed
and left at room temperature for 30 minutes. Subsequently, the two
tubes are mixed together along with 17 ml of serum free DMEM. This
cocktail is referred to as the "transfection mix." Previously
plated 293 gp cells are then gently washed with serum free media
and exposed to 20 ml of the transfection mix for 4 hours at
37.degree. C. Following this period, the transfection mix can be
removed and the cells are incubated with complete DMEM (10% serum)
for a period of 72 hours at 37.degree. C. On Day 4 or 5, the media
(now referred to as "viral supernatant") overlying the 293 gp cells
is collected, filtered through a 0.451.mu. filter and frozen down
in at -80.degree. C.
[0129] As an alternative to the LipofectAMINE method of retroviral
DNA packaging, a second protocol, referred to herein as the
"CaCl.sub.2 Method," can be used to package retroviral sequences.
In this method, 5.times.10.sup.6 cells of the packaging cell line
(293 gp) are seeded into a 15 cm.sup.2 flask on Day 1. On the
following day, the media is replaced with 22.5 mls of modified
DMEM. Subsequently, a single tube carrying 22.5 .mu.g of retroviral
library DNA and 22.5 .mu.g of envelope expression plasmid
(pCMV-VSV.G-bpa) is brought to 400 .mu.l with dH.sub.2O, to which
is added 100 .mu.l of CaCl.sub.2 (2.5M) and 500 .mu.l of BBS
(dropwise addition, 2.times. solution=50 mM, BES
(N,N-bis(2-hydroxyethyl)-2-aminoethane-sulfonic acid), 280 mM NaCl,
1.5 mM Na.sub.2HPO.sub.4, pH 6.95). After allowing this retroviral
mixture to sit at room temperature for 5-10 minutes, i.e. is added
to the 293 gp cells in a dropwise fashion, and the cells are then
incubated at 37.degree. C. (3% CO.sub.2) for 16-24 hours. The media
is then replaced and the cells are allowed to incubate for an
additional 48-72 hours at 37.degree. C. At that time, the media
containing the viral particles is then collected, filtered through
a 0.45.mu. filter and frozen down at -80.degree. C.
[0130] To infect the cell line or primary cells of interest, the
selected target cells (e.g. HT29, SW620) are plated out at a
density of approximately 1.5.times.10.sup.6 cells per T175 flask.
On the following day (Day 1), the library supernatant is added
directly to the media (10-30% total volume) along with 4tg/ml
polybrene and allowed to incubate overnight. On Days 2 and Day 3,
the supernatant is removed and replaced with fresh media. Floater
cell populations are then collected on Days 3-5.
[0131] E. Recovery of Cytotoxic Sequences From Dead and/or Dying
Cells.
[0132] In order to identify cytotoxic agents or substances which
cause cell death, those agents (or the DNA sequences that encode
them) are recovered from dead and/or dying cells.
[0133] Briefly, PCR is used to rescue and amplify DNA sequences
encoding cytotoxic agents from non-viable cells. McPherson, M. J.
et al., "PCR 2. A practical approach." Oxford University Press
(1995). To compare the sensitivity of PCR on dead cells with that
of viable cells, HT29 cells carrying a constitutive GFP encoding
retroviral insert (pVT324) were induced to undergo
apoptosis/necrosis using puromycin (2 .mu.g/ml). After several
days, floater cells were collected and stained with PI to allow
selective identification and recovery of cells that had lost
membrane integrity. Using flow cytometry, PI.sup.+ (dead) cells
were sorted directly into PCR tubes containing 25 .mu.l of cell
lysis buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.0, 0.5% Tween-20,
0.5% Triton X-100, 2 mM MgCl.sub.2, 1U/.mu.l Proteinase K) and
incubated at 1) 60.degree. C. for 2 hours and 2) 95.degree. C. for
10 minutes. Subsequently, 25.mu.l of the stock PCR reaction mix (50
mM KCl, 10 mM Tris-HCl pH 8.0, 400 uM dNTP's, 2 mM MgCl.sub.2) was
added to each tube and PCR was carried out using primers (0.4 uM)
specific for amplification of the retroviral GFP construct (OVT131,
5' GACCTTCGGCGTCCAGTGCTTCAG; OVT179, (5' AGCTAGCTTGCCAAACC TACA).
As a control, live cells (negative for PI uptake) from an untreated
culture were also sorted and used for PCR. Results show that
genomic DNA present in PI positive cells was clearly able to act as
a suitable template for PCR amplification (FIG. 7). Amplification
of the GFP product from dead cells did not appear altered in size
or quantity compared to the product amplified from live cells.
[0134] Cells that are positive for PI uptake may either be
necrotic, or be in the late stages of apoptosis. In order to
address specifically the question of whether DNA recovered from
cells undergoing apoptosis can serve as a good template for PCR,
the following experiment was performed. HT29 cells containing a
retroviral construct that constitutively expresses GFP (pVT324)
were treated with sulindac sulfide to induce apoptosis. After 48
hours of treatment, the majority of the cells had detached from the
dish and showed typical apoptotic morphology (condensed nuclei).
Apoptotic cells were counted into PCR tubes and PCR was carried out
using primers specific for the amplification of the retroviral GFP
construct. Live cells from an untreated culture were used as PCR
controls. There was no apparent difference in amplification of the
GFP product from apoptotic cells when compared to live cells (FIG.
8). Thus DNA recovered from cells undergoing either necrotic or
apoptotic cell death can serve as an effective template for PCR
amplification and construction of sublibraries.
Example Four
[0135] Negative Selection in HT29 Colon Cancer Cells
[0136] Twenty T175 flasks were seeded with 2.2.times.10.sup.6 HT29
cells/flask in McCoy's 5A media (Gibco BRL) modified with 10% FBS.
On Day 1, each flask was infected (4 .mu.g/ml polybrene, 50%
volume) with a retroviral supernatant containing a commercially
obtained brain cDNA library ("Example Three" above). On Day 2 the
media was changed. On Day 3 both the floater and adherent cell
populations were collected (separately) from the twenty flasks.
Approximately 652,500 floaters were isolated from a theoretical
background of 4.2.times.10.sup.7 adherents (1.5% floaters) and
frozen down for future studies. Using the fluorescent properties of
GFP as an indicator of infection, FACS analysis indicated that 76%
of the viable cells were infected with the retroviral library.
Additional floater cells were then collected Day 5, where the
collection and counting procedures were repeated and some
7.8.times.10.sup.6 floaters and 7.6.times.10.sup.8 adherents were
counted (1.03% floaters). The viable cell population was again
scanned by FACS and the infection rate (GFP+) was found to 88%. The
floater populations of Days 3 and 5 were then combined and readied
for a genomic DNA prep using a QIAamp kit (Qiagen) following
standard procedures. Briefly, some 9.times.10.sup.6 floater cells
in PBS were lysed to release gDNA. This material was passed over a
QIAamp column that was then washed several times to remove protein
and RNA contaminants. Twenty-seven micrograms of genomic DNA were
then eluted from the columns with dH.sub.2O and treated with RNAse
A to eliminate any RNA contamination. This GDNA was then subjected
to PCR procedures to amplify the library sequences encoded therein.
Briefly, the above gDNA aliquot was divided into 27.times.1 .mu.g
samples, for use as templates for PCR using the oligonucleotides
OVT 800 (5'GCCGCCGGGA TCACTCTC) and OVT 1211 (5' GCTAGCTTGC
CAAACCTACAGGTGGGG) (PCR conditions: 95.degree. C., 30 seconds;
95.degree. C., 15 seconds; 63.degree. C., 30 seconds; 72.degree.
C., 3 minutes, cycle to "Step 2" twenty four times; 72.degree. C.,
5 minutes). The resulting PCR products were then divided into 5
pools, and each pool was then purified using QIAquick (Qiagen),
digested with EcoRI and XhoI, and then directionally ligated into
the original retroviral vector (pVT340). This material was then
transformed into electrocompetent bacterial cells (DH10B, Gibco
BRL) and plated out on LB-amp plates to create five distinct
sublibraries. Each library was subsequently grown in liquid culture
(LB+ampicillin) and processed (Qiagen Maxi Prep) to yield material
for the second round of packaging in 293 gp cells (see above). The
resulting viral supernatants were then reinfected into nave HT29
cells (1.times.10.sup.6 cells per flask, three flasks per
sublibrary) to begin the second round of negative selection. Round
two and all subsequent rounds of the negative selection differ from
Round 1 in that a) only single infections were performed and b)
floater cells from Day 3 and Day 5 from each sublibrary were pooled
together. Repeated cycling in this fashion yields library clones
whose expression results in cell death.
2TABLE 2 Percent Floaters Mock infected 324 Pool 1 Pool 2 Pool 3
Pool 4 Pool 5 Cycle 2 0.6 0.7 1.1 0.9 1.1 1.1 1.1 Cycle 3 1.0 0.4
2.0 1.1 2.1 1.5 1.2 Cycle 4 0.9 -- 2.9 2.8 4.3 2.3 3.6 Cycle 5 0.7
0.6 3.2 4.4 9.0 3.8 5.5 Cycle 6 1.2 1.3 12.0 11.0 14.0 11.0
12.0
[0137] Results from six consecutive cycles of the negative
selections are shown in Table 2, above, and are summarized as
follows. Both mock infected cells and pVT324 control vector cells
consistently show 1% (or less) floaters in the media. In contrast,
all five pools show a steady increase in the percent floater
population over the course of the cycling with Pool 3 showing the
greatest level of enrichment with 14% floaters in cycle six. This
data demonstrates successful enrichment for perturbagen sequences
that increase the frequency of dead and/or dying HT29 cells.
[0138] In addition to cycling these library sequences (obtained as
described above) through an additional round of negative
selections, 50 clones were taken from each of the Cycle 5, day five
pools for sequence analysis. Two of these clones were found to
encode portions of BID (BH3 Interacting Domain Death Agonist, Gene
Bank Accession # AF042083), a known component of the apoptotic
pathway. Both of the BID clones obtained from these negative
selections encode N-terminal truncations of the native protein (BID
Clone #1 encodes amino acids 33-195, BID Clone #2 encodes amino
acids 76-195, See FIG. 9). BID clone #1 was reintroduced into
fresh, nave HT29 cells and floater rates were compared with cells
that had been mock infected or infected with the control vector,
pVT324. Both controls exhibited low background floater rates of
less than 1.5%. In contrast, HT29 cells infected with BID clone #1
exhibited roughly 18% floaters. In a similar experiment, BID clone
#1 was introduced into HuVECs (Human Umbilical Vein Endothelial
Cells, Clonetics/Biowhittaker) and cell viability was followed over
the course of 16 hours. While control cells gave a background of 1%
cell death at the 16 hour time point, 80% of the cells in the BID
clone #1-infected culture died during the same period of time.
[0139] In addition to BID clones #1 and #2, four new cytotoxic
agents have been identified from 36 clones picked at random (Sort
VI). All four clones (0113, 0195, 0328, and 0461) give heightened
levels of floaters in the HT29 floater assay. (FIG. 10). Weaker
cytotoxic agents (e.g. 0328 and 0461 give floater rates of 2-3%
(respectively) while the more moderate cytotoxic agents (0195 and
0113) induce between 4.5-7.5% floaters. The sequences of these
agents are shown in FIG. 9.
Example Five
[0140] Negative Selection in SW620 Colon Cancer Cells
[0141] In a negative selection very similar to the HT29 screen
described above, twenty flasks of SW620 colon cancer cells were
plated (3 million cells/flask) and infected with one of two
putative cytotoxic sequence-encoding libraries. The first library
was made from random primed placental cDNA inserted into the MFG
vector. The second library of putative cytotoxic agents was a
random oligonucleotide library inserted into an internal site
(insertion site 6, pVT27) of GFP (pVT 334, see Abedi et al. 1998).
Following infection of these libraries into the SW620 cell line,
floaters were collected at 48 and 96 hour time points (Days 3 and
5). These cells were then treated with propidium iodide (see above)
and PI.sup.+ cells were sorted out by FACS. PI.sup.+ floater cells
from both time points were then divided into three separate pools
for a genomic DNA preparation. Subsequently PCR was used to amplify
and recover the relevant perturbagen encoding sequences. Two unique
sets of primers were used for PCR amplification; for the random
primed placental library, OVT 1136 (5' GGATCACTCTCGGCATGGACGAG) and
OVT 1137 (5' ATCCGCGGCC GCGGCCATAATGGCC) were used. For the random
peptide (oligo) library, OVT 777 (5' GACTGCCATGGTGAGCAAGGGC) and
OVT144 (5' GCCGTCCTCGATGTTG TGGCGGAT) were used. Results show that
after performing four cycles of the infection and collection
procedures (F4) in SW620 cells infected with the peptide library,
the background level of Day 5 floater cells rose from approximately
1% in the original library to (on an average), 3.9% (FIG. 11). At
the same time, background levels of floaters in the mock and pVT334
remained low at 1.35%. While the increase in background floater
level was not accompanied with a concomitant increase in PI.sup.+
cells in the floater population, a decrease in the total cell
number was observed over the course of the selection process,
suggesting that one or more library sequence(s) that affect cell
growth rates/cell viability are being enriched (FIG. 12). These
potential cytotoxic agents (as well as those from earlier rounds of
selection using the random primed placental library) are then
reintroduced into nave SW620 cells and cycled again. Following 4-6
rounds of cycling, individual library inserts are sequenced and
validated for cytotoxic activity.
Example Six
[0142] Negative Selection in T47D Metastatic Mammary Epithelial
Cells
[0143] An additional example of floater assays involves the cell
line T47D (ATCC) which is derived from a metastatic mammary
epithelial cell tumor. T47D was chosen for study primarily due to
the relatively low floater rate that it displays, and its ease of
infection with retroviral based vectors.
[0144] To determine floater rates for the T47D cell line, cells
were plated to 20% confluency in T175 tissue culture flasks
(roughly 5.times.10.sup.5 cells/flask) and the number of floaters
as a percentage of total cells (adherent+floaters) was ascertained.
Floater rates for T47D cells were determined to be 0.5% over a 3-5
day period in culture. In addition, 70% of the floater cells were
observed to be dead as judged by trypan blue staining ("Handbook of
Fluorescent Probes and Research Chemicals" Haugland, R. P.,
Molecular Probes). In contrast, less than one percent of the
adherent cells were found to be dead using the same staining
methods. Thus by harvesting floater cells from a T47D culture, at
least 30% of the total number of dead and or dying cells are
obtained. As the infection rate of this cell line with the pVT324
retroviral vector was observed to be approximately 90%, the T47D
cell line thus was suitable for negative selections.
[0145] The T47D cell line is then utilized for a conditional
negative selection--i.e., a selection in which cytotoxic agents
that act under a unique set of conditions are identified. In this
non-limiting Example, library sequences that enhance the
sensitivity of T47D cells to the chemotherapeutic drug,
camptothecin (an inhibitor of topoisomerase II), are selected as
follows.
[0146] Initially, a maximal concentration of camptothecin that
failed to increase T47D cell floater rate was determined as
follows. Approximately 250,000 cells were seeded into each well of
a six well plate. Cells were then grown in media containing
camptothecin of varying concentrations (0-10 uM). After 5 days, the
number of cells remaining in each of the camptothecin-treated wells
was compared with untreated controls. From these experiments, it
was determined that camptothecin concentrations ranging from 1-4 nM
had no effect on T47D cell number over the course of the 5 days of
treatment. Treatment of cells with concentrations greater than 4 nM
resulted in a decrease in cell number relative to the untreated
control (FIG. 13). As can be seen, cell number in the presence of
10 nM camptothecin was roughly one third that found in the
untreated control, and virtually no cells remained adhered to the
plate when exposed to camptothecin concentrations greater than 50
nM. These results suggest that T47D cells can tolerate camptothecin
concentrations up to 4 nM without an adverse effect on either cell
viability or division. In order to determine whether this level of
treatment is concomitantly increasing the number of floaters in the
population, several flasks are seeded with T47D cells and then
treated with 1-4 nM concentrations of camptothecin. After a period
of three to five days, the media is collected and the number of
floater cells are counted and compared to the total number of cells
in the flask (floaters+adherents).
[0147] To perform a conditional negative selection involving T47D
cells, the following experiments are performed. Cells are infected
with either a retroviral-based cDNA or peptide expression library
(See "Example Three") as described for HT29 colon cancer assay.
Following infection, cells are treated with 4 nM camptothecin and
floater cells are harvested over a 5 day period. As was described
in "Example 5" and "Example 1B", additional enrichment of library
inserts encoding cytotoxic agents can be achieved by including in
this protocol a PI staining/recovery (FACS) step that enables the
identification of dead and/or dying cells. Library inserts present
in these floater cells are recovered by PCR, subcloned into a
retroviral vector, and subsequently reintroduced into nave T47D
cells. Following this second infection, floater cells are again
harvested over a five-day period in the presence of 4 nM
camptothecin and the cycle is repeated. As was the case with the
HT29 negative selection, repeated cycling in this manner should
yield library clones whose expression results in cell death either
in the presence or absence of camptothecin.
[0148] To identify the subset of library clones that cause cell
death only in the presence of sub-toxic levels of camptothecin, one
of two counterscreens is employed. First, the sub-library of
inserts that cause cell death is introduced into T47D cells in the
absence of camptothecin. Cells containing library clones that cause
non-specific cell death will die, whereas clones that induce death
only in the presence of camptothecin, will survive. To identify
those clones that specifically increase the sensitivity of
metastatic cells to camptothecin, a second counterselection is
employed. Library inserts that cause camptothecin-specific death
are introduced into primary mammary epithelial cell
(Clonetics-Bio-Whittaker, Catalogue # cc-2551), in the presence of
sub-toxic levels of camptothecin. Library inserts present in cells
that survive this treatment are then recovered by PCR, subcloned
into the original host retroviral vector, and analyzed. Through the
use of these two counter selections, cytotoxic agents that
specifically increase the sensitivity of metastatic breast
epithelial cells to the chemotherapeutic agent camptothecin are
identified.
Example 7
[0149] Negative Selections in HuVEC Cells
[0150] As an alternative to performing negative selections on
transformed (immortalized) cells (e.g. HT29), protocols have been
developed to apply the floater assay to primary cells. HuVECs
(Human Umbilical Vein Endothelial Cells) are primary cells
frequently used to pursue studies in angiogenesis. To prepare for
negative selections in primary cells, two isolates of HuVECs,
8F1868 and 9F0293 (Clonetics/Biowhittaker) were plated in EGM-2
media (Clonetics/Biowhittaker) and observed over the course of
several weeks to determine the doubling time and longevity of the
cultures. Both lines exhibited a fairly consistent doubling period
over the course of the first 10-12 passages (.about.24hrs). The
life span of 9F0293 was limited to twenty passages with later
passages (>12) exhibiting both broad fluctuations in doubling
time and an alteration in morphology from cobblestoned,
epithelial-like cells to a more flattened, fibroblast-like
morphology. In contrast, the 8F1868 line had a life span that
extended to 30 passages and showed a greater consistency in
doubling time. Because these two cultures performed identically
during the first six passages and because the proposed negative
selections would take place during passage four, line 9F0293 was
chosen for future negative (FIG. 14).
[0151] To assess the feasibility of using primary cell lines in
negative selections, the 9F0293 line was tested for a)
susceptibility to retroviral infection and b) the background
percentage of floater cells. Three samples of an early passage of
9F0293 cells (control, mock infected, and infected) were plated at
a density of 2.times.10.sup.5/15 cm.sup.2 plate and followed over
the course of 120 hours. During that time the total cell number,
doubling time, and floater ratios (calculated here as total # of
floaters/total # of adherents) were recorded and compared. Cells
were infected with pLIBEGFP (Clontech) and packaged using the
CaCl.sub.2 protocol described previously. Retroviral infection
protocols used in these procedures included a 12 hour period of
infection using an MOI (moiety of infection) of 2.0, and 4 ug/ml of
polybrene.
[0152] Results show that when compared to the controls, the
infection procedure and presence of retrovirus altered the total
cell number and doubling time of the 9F0293 line only slightly. In
addition, at all points prior to 120 hours, floater ratios in all
three scenarios were consistently below 1%. At 120 hours, cell
cultures were confluent and floater ratios increased (3% or
greater), an observation that is consistent with nearly all
mammalian cell cultures studied thus far (FIG. 15). In addition,
the 9F0293 line of HuVECs proved to be highly susceptible to
retroviral infection, with the percentage of cells falling into the
GFP.sup.+ gate averaging between 70-80%.
[0153] To determine the time course in which dead and/or dying
HuVECs detach from the solid support in response to a cytotoxic
agent, 9F0293 cells were plated and subsequently treated with
puromycin (2 ug/ml). Both floater and adherent cell populations
were then collected at varying times (t=4, 7, 9, 16, 20, and 24
hours) and analyzed to determine (a) the percent PI.sup.+ cells in
the floater population and (b) the fraction of cells which became
floaters. The results of these experiments showed that the majority
of HuVECs detached at the 16-hour time point and that 90-99% of the
cells became floaters within 24 hours after addition of puromycin.
The fraction of floaters that stained with PI (PI.sup.+ population)
increased with time. At early time points (4, 7, and 9 hours),
PI.sup.- and PI.sup.+ floater cells were in near equal numbers. By
20 hours, nearly all the floater cells fell into the PI.sup.+ gate,
suggesting HuVECs detach as PI.sup.- cells and then rapidly convert
to the PI.sup.+ phenotype (FIG. 16).
[0154] To identify cytotoxic agents that induce apoptosis/necrosis
in HuVECs, 9F0293 cells are plated on a solid support (gelatine)
and infected (MOI=2, 16 hr infection, 4 ug/ml polybrene) a
retroviral-based library of inserts which use the backbone of
pCLMFG (see "Example 3, Section B" above) or PLIB (Clontech) as the
retroviral vector. Either random oligonucleotides inserted into the
VT27 loop of GFP (see above, Abedi et. al. 1998), cDNA, or genomic
DNA fused to the C-terminus of GFP (see "Example 3, Section B"
above), are screened for cytotoxic agents."At 48 hr, 72 hr, and 96
hr time points post infection, floater cells are collected.
Floaters from the two earliest collection points are pooled
together (Pool 1). Floaters from the 96 hr time point form a
separate pool (Pool 2). Genomic DNA prepared from each pool is then
used to amplify the library inserts using standard PCR techniques
(see above). The product from this reaction is then recloned into
the appropriate retroviral vector, and reinfected into nave 9F0293
cells for subsequent rounds of screening and enrichment. In later
rounds of screening (>4), individual perturbagen clones are
isolated, reintroduced into HuVECs, and tested to determine if such
library inserts increase the level of floater cells above the
background floater rate observed in uninfected and mock infected
cultures.
[0155] Library inserts found to be cytotoxic in HuVECs are then
introduced into additional cell types to determine the cell or
tissue-type specificity of the encoded agents. Specifically, the
encoding cytotoxic agents are introduced into HT29, SW620, DLD-1,
as well as other cell lines (both primary and genetically altered
so as to be immortalized or transformed). The levels of cell death
are monitored using any one of (but not limited to) the techniques
described in "Example One".
Example 8
[0156] Identifying Agents That Overcome Multidrug Resistance
[0157] The present invention may be readily applied to identify
agents that sensitize multidrug resistant (MDR) cancer lines to
currently available chemotherapeutic agents. One nonlimiting
example is as follows.
[0158] Many MDR strains (e.g. LS513, LS1034) can be obtained
through ATCC. Alternatively, MDR strains can be obtained by the
following, non-limiting procedure. Ten T75 flasks containing
2.times.10.sup.6 HT29 cells/flask are subjected to a drug (e.g.
taxol) at concentrations that induce 90-95% cell death. Following
this treatment, the surviving cells are allowed to expand in normal
media, whereupon they are subjected to elevated levels (e.g.
5.times.) of the drug. As a result of multiple cycles of killing,
regrowth, and stepwise increases in drug concentrations, an HT29
MDR strain is evolved.
[0159] Prior to performing a screen for perturbagens that sensitize
multidrug resistant (NDR) cancer lines to currently available
chemotherapeutic agents, it is critical to first determine a
sublethal concentration of the drug to be used in the studies. In
this example, a "sublethal" dose is a concentration of a drug that
is capable of killing an MDR.sup.- cell line, but has little or no
effect on an MDR.sup.+ line. In one non-limiting example of how a
sublethal concentration can determined, killing curves are
performed on both LS513 (an MDR.sup.+ line) and several MDR.sup.-
control lines. Specifically, 1.times.10.sup.6 LS513 cells are
plated in 15 cm.sup.2 plates and allowed to adhere overnight. On
the following day, taxol is added to the culture at a range of
concentrations varying from 2 nM-500 uM. The cells are then
cultured for an additional 2-7 days, whereupon the cell number and
floater rates are compared. A sublethal concentration of taxol is
then defined as a concentration of the drug that that kills greater
than 50% of the MDR.sup.- (control) cells but induces less than 2%
lethality in the LS513 line.
[0160] To identify sequences that disrupt the MDR phenotype,
library inserts (either cDNA or random peptide based) are
introduced into adherent MDR lines (e.g. LS513 and LS1034
colorectal carcinoma cell lines, ATCC) using the retroviral
technology described above. These cells are then subjected to
sublethal concentrations of chemotherapeutic drugs (e.g. taxol,
adriamycin, vinblastine, actinomycin) and cultured over a period of
two to seven days. As the majority of cells do not contain a
library insert that will enable the drug to overcome or disrupt the
mechanism of multidrug resistance (e.g. P-glycoprotein), these
cells will continue to divide and remain adherent to the solid
support. To identify library inserts that enhance the sensitivity
of MDR cells to chemotherapeutics (essentially converting an
MDR.sup.+ line to MDR.sup.-) floater cells are collected over the
course of the experiment. Again, as described in previous sections,
additional enrichment of cytotoxic perturbagens with these
characteristics can be achieved by including in this protocol a PI
staining/recovery (FACS) procedure that enables the identification
and recovery of dead and/or dying cells. The sequence(s) are then
recovered and amplified from floater cell genomic DNA preparations
via PCR and recycled through an additional round(s) of selection to
enrich for perturbagen sequences that disrupt the MDR
phenotype.
[0161] To identify the subset of library clones that cause cell
death only in the presence of sub-toxic levels of taxol, a counter
screen is employed. The sub-library of inserts that cause cell
death is introduced into LS513 cells in the absence of taxol. Cells
containing library clones that cause non-specific cell death will
die. whereas clones that induce death only in the presence of taxol
will survive.
[0162] In many MDR cell lines, the drug resistant phenotype has
been associated with over-expression of P-glycoprotein (MDR1), a
cytoplasmic membrane associated protein that is capable of removing
(or pumping) a wide variety of chemotherapeutic drugs from the cell
cytoplasm to the extracellular space To enrich for agents that
disrupt the pumping action of P-glycoprotein, MDR1 strains are
infected with libraries encoding putative and grown in sublethal
concentrations of taxol. These cultures are then exposed to
Rhodamine 123 (Rh123), a membrane-permeable, fluorescent substrate
of P-glycoprotein. Subsequently, floater cells are collected and
sorted on the basis of fluorescence. Cells that exhibit a "dim"
phenotype by FACS are capable of removing Rh123 from the cytoplasm
and thus have an active P-glycoprotein pump (FIG. 17). These cells
do not contain an agent that interferes with the P-glycoprotein
pump action and are discarded. Cells that are "bright" accumulate
Rho123 in the cytoplasmic compartment, and thus contain an agent
that disrupts the function of the MDR1 pump. In this Example, the
term "disrupts" can refer either to molecules that directly
interfere with the action or activation of the MDR1 pump, or to
molecules that alter or prevent the localization of P-glycoprotein
to its native site. These Rh123 "dim" cells are collected by FACS
and recycled through additional rounds of selection (see above) to
enrich for sequences that interfere with the pumping action of
P-glycoprotein.
[0163] As an alternative to this assay, detection of agents that
disrupt the action of P-glycoprotein can be performed in the
absence of the chemotherapeutic drug. Under these circumstances,
cultures of MDR1 cells are infected with a library of inserts
encoding putative disruptive agents, cultured for a brief period
(24-72 hrs) to allow expression of the library inserts, and treated
with trypsin to release the cells from the solid support. The cells
are then exposed to Rh123. and sorted by FACS to identify
Rh123.sup.+ cells (cells that are unable to pump Rh123 out of the
cell) within the population. The library insert(s) encoding these
agents are then PCR amplified and recycled through additional
rounds of selection to enrich for sequences that interfere with the
product of the MDR1 gene.
[0164] All references cited within the body of the instant
specification are hereby incorporated by reference in their
entirety.
* * * * *