U.S. patent application number 10/291249 was filed with the patent office on 2003-06-26 for in vitro method for identifying target sites for antisense-mediated inhibition of a selected gene.
Invention is credited to Chen, Zhidong, Pierce, Michael L., Ruffner, Duane E..
Application Number | 20030119041 10/291249 |
Document ID | / |
Family ID | 26762440 |
Filed Date | 2003-06-26 |
United States Patent
Application |
20030119041 |
Kind Code |
A1 |
Ruffner, Duane E. ; et
al. |
June 26, 2003 |
In vitro method for identifying target sites for antisense-mediated
inhibition of a selected gene
Abstract
A method for making a directed antisense library against a
target transcript is described. A cDNA of the target transcript is
cloned in an appropriate cloning vector. Next, a plurality of
deletion derivatives of the cloned cDNA is prepared such that the
deletions serially extend into the cDNA from one end thereof. The
resulting deletion library is then treated such that cDNA is
removed from the other end of each cDNA insert, thus obtaining a
fragment library having fragments of a selected size. An antisense
gene is then inserted into each fragment of the fragment library,
resulting in the directed antisense library. An illustrative
antisense gene in the hammerhead ribozyme catalytic core. Plasmids
for making the antisense library, plasmids and methods for making
the fragment library, and a method for identifying target sites for
antisense-mediated gene inhibition are also described.
Inventors: |
Ruffner, Duane E.; (Salt
Lake City, UT) ; Pierce, Michael L.; (Salt Lake City,
UT) ; Chen, Zhidong; (Salt Lake City, UT) |
Correspondence
Address: |
ALAN J. HOWARTH
P.O. BOX 1909
SANDY
UT
84091-1909
US
|
Family ID: |
26762440 |
Appl. No.: |
10/291249 |
Filed: |
November 7, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10291249 |
Nov 7, 2002 |
|
|
|
09647344 |
Dec 4, 2000 |
|
|
|
09647344 |
Dec 4, 2000 |
|
|
|
PCT/US99/06742 |
Mar 28, 1999 |
|
|
|
60079792 |
Mar 28, 1998 |
|
|
|
60107504 |
Nov 6, 1998 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/455; 435/7.1 |
Current CPC
Class: |
C12N 2310/121 20130101;
C12N 15/1133 20130101; C12N 2310/111 20130101; C12N 15/113
20130101 |
Class at
Publication: |
435/6 ; 435/7.1;
435/455 |
International
Class: |
C12Q 001/68; G01N
033/53; C12N 015/85 |
Goverment Interests
[0002] This invention was made with government support under Grant
No. 1R03RR08849 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
The subject matter claimed is:
1. A method for identifying target sites for antisense-mediated
inhibition of a selected gene comprising: (a) constructing a
directed antisense library targeted at said selected gene wherein
said library is contained in a cloning vector having a promoter
configured for transcribing antisense transcripts from said
directed antisense library in vitro; (b) transcribing antisense
transcripts from said directed antisense library in vitro; (c)
incubating said antisense transcripts with a lysate from a cell
containing target transcripts transcribed from said selected gene
such that antisense transcripts targeted to the target transcripts
bind to such target transcripts; and (d) analyzing the antisense
transcripts that bind the target transcript and determining a
target site on the antisense transcript that is associated with
binding of the target transcript.
2. The method of claim 1 wherein constructing a directed antisense
library targeted at the selected gene comprises: (a) preparing a
double-stranded cDNA, comprising a first end, a second end, and a
central site thereof, from the target transcript and cloning the
cDNA in a cloning vector comprising a promoter configured such that
an antisense transcript of the cDNA is synthesized upon
transcription mediated by the promoter, resulting in a cloned cDNA;
(b) creating a plurality of deletion derivatives of the cloned cDNA
wherein each of the plurality of deletion derivatives has a
deletion extending from the first end into the cloned cDNA such
that the plurality of deletion derivatives comprises a deletion
library comprising deletions extending serially into the cDNA; (c)
reducing the size of the cDNA contained in the deletion library to
a preselected size by removing a portion of the cDNA from the
second end thereof to result in a fragment library; (d) inserting
an antisense gene DNA into the central site of the cDNA in the
fragment library, thereby obtaining the antisense library.
3. The method of claim 2 wherein said plurality of deletion
derivatives is created with exonuclease III resection of the cloned
cDNA.
4. The method of claim 2 wherein the reducing the size of the cDNA
contained in the deletion library to a preselected size comprises
digesting the deletion library with a type IIS restriction
endonuclease.
5. The method of claim 2 wherein the inserting an antisense gene
DNA into the central site of the cDNA in the fragment library
comprises digesting the fragment library with a type IIS
restriction endonuclease, thereby creating the central site, and
ligating the antisense gene DNA at the central site.
6. The method of claim 2 wherein the antisense gene DNA comprises a
ribozyme catalytic core.
7. The method of claim 2 wherein the ribozyme catalytic core is a
hammerhead ribozyme catalytic core.
8. The method of claim 1 wherein the cloning vector is pShuttle
(SEQ ID NO:14).
9. The method of claim 1 wherein the cloning vector is pBK (SEQ ID
NO: 17).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of U.S. Ser. No. 09/647,344,
filed Dec. 4, 2000, which is an application filed under 35 U.S.C.
.sctn.371 of PCT/US99/06742, filed Mar. 28, 1999, which claims the
benefit of U.S. Provisional Application No. 60/079,792, filed Mar.
28, 1998, and U.S. Provisional Application No. 60/107,504, filed
Nov. 6, 1998.
BACKGROUND OF THE INVENTION
[0003] This invention relates to antisense agents. More
particularly, the invention relates to compositions and methods for
generation of directed antisense libraries and methods of use
thereof wherein the antisense agents in the libraries can
potentially bind to every binding site on a selected RNA
transcript.
[0004] Antisense RNA, DNA, and ribozymes have been widely studied
as research tools and potential therapeutic agents for inhibiting
the expression of specific genes. These agents operate by binding
to a complementary region on an RNA transcript produced from the
gene of interest. On binding, the antisense agent can prevent
expression of the RNA, and this can occur through a variety of
different mechanisms. There are many sites on any given RNA for
targeted inhibition by an antisense molecule. For a typical RNA
transcript of 2000 nucleotides, just under 2000 target sites are
available. Examination of a few to tens of randomly chosen target
sites reveals a great variability in activity. Clearly, not all
target sites are equivalent in their ability to permit antisense
mediated inhibition. Consequently, identification of effective
target sites on the RNA transcript for interaction with the
antisense molecule is imperative for successful application of
antisense technology. Methods currently available for this purpose
include the use of computer algorithms to predict target
accessibility based on the predicted secondary structure of the
mRNA, the use of randomized oligonucleotide and ribozyme libraries
in cell free systems, and the examination of a few to tens of
antisense oligonucleotides, targeted to arbitrarily chosen sites,
in cell culture assays. These approaches have met with limited
success.
[0005] To identify the most effective target site(s), the following
conditions should be met. First, all possible sites on the target
RNA should be evaluated. Second, evaluation should be carried out
in the normal cellular milieu. This insures that the target is in
its natural structure, associated with its normal complement of
cellular factors. Additionally, the antisense agent has the
opportunity to act on alternate structures that may arise as a
result of the many RNA processing reactions.
[0006] To evaluate all target sites, antisense libraries must be
used. These libraries should contain antisense molecules targeted
to every site. One approach is the use of completely randomized
DNA, RNA, or ribozyme libraries. The use of completely randomized
libraries suffers from two major disadvantages. First, while such
libraries may contain antisense molecules directed at all sites on
the target RNA, they also contain antisense molecules directed at
all sites of all potential RNA transcripts produced by the cell.
Therefore, these random libraries potentially have the capability
to inhibit expression of every gene in the cell. Because of this,
random libraries are limited to in vitro use in cell free assays.
Second, the complexity of these libraries is enormous. For example,
a random library that uses 14 nucleotides to recognize its target
must contain at least 2.6.times.10.sup.8 (i.e., 4.sup.14) different
members. Realistically, the size of the library must be at least
10- to 100-fold greater in size to insure representation of all
sequences. The production and screening of such large libraries is
likely beyond current capabilities.
[0007] Herein there is described a new method for identifying
optimal antisense target sites against any desired RNA transcript.
This is a directed library approach. In other words, this approach
uses an antisense library that targets every site on any selected
RNA and only sites present on the selected RNA. This library,
therefore, does not inhibit other non-target RNA transcripts. This
approach is also an improvement over known methods because it uses
relatively small libraries. For example, a library targeting an RNA
transcript of 2000 nucleotides, and using 14 nucleotides to
recognize its target, theoretically needs 1986 members. In
practice, the library would need to be 10- to 50-times this size.
At 50 times, or 99,300 members, this is still a relatively small
library. These directed libraries can be used in both in vitro and
in vivo assays for the detection of effective target sites for
antisense mediated gene inhibition.
[0008] In view of the foregoing, it will be appreciated that a
method for generating directed antisense libraries would be a
significant advancement in the art. Herein is described a method
for examining the entire length of any RNA transcript for sites
that are accessible to antisense agents. This approach allows for
the localization of the most effective sites for targeting with
antisense agents.
BRIEF SUMMARY OF THE INVENTION
[0009] It is an advantage of the present invention to provide a
simple and inexpensive method for producing directed antisense
libraries against any selected RNA transcript.
[0010] It is also an advantage of the invention to provide a method
of producing directed antisense libraries wherein such libraries
contain antisense agents directed against all targets spanning the
entire selected RNA transcript.
[0011] It is another advantage of the invention to provide a method
of using directed antisense libraries for locating efficient target
sites on the selected RNA transcript.
[0012] It is still another advantage of the invention to provide
compositions for use in constructing directed antisense
libraries.
[0013] It is yet another advantage to provide a method for making
fragment libraries of a selected size of DNA fragment inserted in a
cloning vector.
[0014] These and other advantages can be addressed by providing a
method for generating an antisense library targeted to a selected
RNA transcript comprising:
[0015] (a) preparing a double-stranded cDNA, comprising a first
end, a second end, and a central site thereof, from the selected
RNA transcript and cloning the cDNA in a cloning vector comprising
a promoter configured such that an antisense transcript of the cDNA
is synthesized upon transcription mediated by the promoter,
resulting in a cloned cDNA;
[0016] (b) creating a plurality of deletion derivatives of the
cloned cDNA wherein each of the plurality of deletion derivatives
has a deletion extending from the first end into the cloned cDNA
such that the plurality of deletion derivatives comprises a
deletion library comprising deletions extend serially into the
cDNA;
[0017] (c) reducing the size of the cDNA contained in the deletion
library to a preselected size by removing a portion of the cDNA
from the second end thereof to result in a fragment library;
[0018] (d) inserting an antisense gene DNA into the central site of
the cDNA in the fragment library, thereby obtaining the antisense
library.
[0019] Illustrative cloning vectors comprise multi-cloning
sequences comprising SEQ ID NO:1 and a combination of SEQ ID NO:2
and SEQ ID NO:3. In an illustrative embodiment of the invention,
the deletion derivatives are created with exonuclease III resection
of the cloned cDNA.
[0020] The size of the cDNA contained in the deletion library is
illustratively reduced to a preselected size by digesting the
deletion library with a type IIS restriction endonuclease. Further,
inserting the antisense gene DNA into the central site of the cDNA
in the fragment library illustratively comprises digesting the
fragment library with a type IIS restriction endonuclease, thereby
creating the central site, and ligating the antisense gene DNA at
the central site. An illustrative antisense gene comprises a
ribozyme catalytic core, typically, a hammerhead ribozyme catalytic
core.
[0021] Another aspect of the invention relates to a method for
generating a library of DNA fragments of a selected size wherein
the fragments collectively span all possible sites of the selected
size in a source DNA comprising a first end, a second end, and a
central site thereof, comprising:
[0022] (a) cloning the source DNA in a cloning vector;
[0023] (b) creating a plurality of deletion derivatives of the
cloned source DNA wherein each of the plurality of deletion
derivatives has a deletion extending from the first end into the
cloned DNA such that the plurality of deletion derivatives
comprises a deletion library comprising deletions extend serially
into the cloned DNA; and
[0024] (c) reducing the size of the DNA contained in the deletion
library to a preselected size by removing a portion of the DNA from
the second end thereof to result in the library of fragments.
[0025] Still another aspect of the invention relates to a method
for identifying target sites for antisense-mediated inhibition of a
selected gene comprising:
[0026] (a) constructing a directed antisense library targeted at
the selected gene wherein the library is contained in a cloning
vector having a promoter configured for transcribing antisense
transcripts from the directed antisense library in suitable cells
wherein the selected gene is expressed as a target transcript;
[0027] (b) transforming a plurality of the suitable cells such that
each of the plurality of suitable cells transcribes an antisense
transcript that has access to the target transcript for potential
inactivation thereof;
[0028] (c) identifying a cell wherein an antisense transcript
inactivates the target transcript; and
[0029] (d) analyzing the antisense transcript that inactivates the
target transcript and determining a target site on the antisense
transcript that is associated with inactivation of the target
transcript.
[0030] Yet another aspect of the invention relates to a method for
identifying target sites for antisense-mediated inhibition of a
selected gene comprising:
[0031] (a) constructing a directed antisense library targeted at
the selected gene wherein the library is contained in a cloning
vector having a promoter configured for transcribing antisense
transcripts from the directed antisense library in vitro;
[0032] (b) transcribing antisense transcripts from the directed
antisense library in vitro;
[0033] (c) incubating the antisense transcripts with a lysate from
a cell containing target transcripts transcribed from the selected
gene such that antisense transcripts targeted to the target
transcripts bind to such target transcripts; and
[0034] (d) analyzing the antisense transcripts that bind the target
transcript and determining a target site on the antisense
transcript that is associated with binding of the target
transcript.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0035] FIGS. 1A and 1B show illustrative multi-cloning sequences
(MCS's) according to an aspect of the present invention.
[0036] FIG. 2 summarizes an illustrative method for making a DNA
fragment library containing 14 bp fragments according to the
present invention.
[0037] FIG. 3 shows a schematic representation of a hammerhead
ribozyme bound to a target substrate; the hammerhead ribozyme
comprises a catalytic core that cleaves the substrate at the
cleavage site indicated by the arrow and a recognition domain for
binding to the substrate by base pairing.
[0038] FIG. 4 summarizes an illustrative method for making a
hammerhead ribozyme library from an antisense RNA library according
to the present invention.
[0039] FIG. 5A shows an illustrative method for inserting a
selected cassette at an end of a deletion fragment in a deletion
fragment library according to the present invention.
[0040] FIG. 5B shows an illustrative method for inserting a
selected cassette in a MCS prior to preparation of a deletion
fragment library according to the present invention.
[0041] FIG. 6A shows a map of expression vector pBK, which is
suitable for use in identifying antisense targets in mammalian
cells according to the present invention.
[0042] FIG. 6B shows base pairing of nucleotides in a multi-cloning
sequence flanked by cis-acting ribozymes (CAR's).
[0043] FIG. 7A shows a map of vector pASlib according to the
present invention.
[0044] FIG. 7B shows a map of vector pShuttle according to the
present invention.
[0045] FIG. 7C shows a map of the MCS of pShuttle according to the
present invention.
[0046] FIG. 8 shows a histogram of the distribution of 56 target
sites in an illustrative antisense library according to the present
invention.
DETAILED DESCRIPTION
[0047] Before the present compositions and methods for generating
directed antisense libraries and methods of use thereof are
disclosed and described, it is to be understood that this invention
is not limited to the particular configurations, process steps, and
materials disclosed herein as such configurations, process steps,
and materials may vary somewhat. It is also to be understood that
the terminology employed herein is used for the purpose of
describing particular embodiments only and is not intended to be
limiting since the scope of the present invention will be limited
only by the appended claims and equivalents thereof.
[0048] The publications and other reference materials referred to
herein to describe the background of the invention and to provide
additional detail regarding its practice are hereby incorporated by
reference. The references discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the inventors are not entitled to antedate such disclosure by
virtue of prior invention.
[0049] It must be noted that, as used in this specification and the
appended claims, the singular forms "a," "an," and "the" include
plural referents unless the context clearly dictates otherwise.
[0050] In describing and claiming the present invention, the
following terminology will be used in accordance with the
definitions set out herein.
[0051] As used herein, "antisense agent" and similar terms mean
antisense RNA, antisense DNA, and ribozymes.
[0052] As used herein, "comprising," "including," "containing,"
"characterized by," and grammatical equivalents thereof are
inclusive or open-ended terms that do not exclude additional,
unrecited elements or method steps. "Comprising" is to be
interpreted as including the more restrictive terms "consisting of"
and "consisting essentially of."
[0053] As used herein, "consisting of" and grammatical equivalents
thereof exclude any element, step, or ingredient not specified in
the claim.
[0054] As used herein, "consisting essentially of" and grammatical
equivalents thereof limit the scope of a claim to the specified
materials or steps and those that do not materially affect the
basic and novel characteristic or characteristics of the claimed
invention.
[0055] Construction of Directed Antisense Libraries
[0056] The present invention includes a procedure that allows
construction of directed antisense libraries of a variety of types.
This requires the use of specially designed bacterial and/or
mammalian plasmid vectors. Most importantly, these vectors possess
a specially designed multi-cloning sequence (MCS). This approach is
not restricted to a single MCS, as many can be designed that allow
the procedure to be performed. Two illustrative MCS's are shown in
FIGS. 1A (SEQ ID NO:1) and 1B (SEQ ID NO:2 and SEQ ID NO:3). These
simply illustrate two possible multi-cloning sequences that could
be used for this method. While some of the same restriction enzyme
sites are used in both of these MCS's, such particular sites are
not necessarily the only sites that could be used. Many other
restriction enzyme sites could substitute for any of the
restriction sites, allowing the same procedure to be performed.
[0057] The procedure uses a special multi-cloning sequence and a
series of enzymatic manipulations to produce DNA fragment libraries
directed against any desired gene of interest. The fragment
libraries contain all overlapping fragments spanning the entire
length of the gene of interest. Transcription in vitro or in vivo
of the DNA fragment allows the production of an antisense RNA
targeted to the site on the RNA transcript that is encoded by the
DNA fragment. Transcription of the entire DNA fragment library
produces all antisense RNA molecules targeting all positions on the
RNA target. Expression of the library in mammalian cells allows
identification of effective target sites for antisense-mediated
gene inhibition.
[0058] The procedure is illustrated in FIG. 2 using the MCS shown
in FIG. 1A. Beginning with the MCS 10 in a suitable circular
plasmid vector (described in more detail below), a blunt-ended DNA
fragment encoding the gene of interest 14 is ligated into the
EcoRV-digested MCS (FIG. 2, step a). Since the gene can be inserted
in one of two orientations, a clone is selected, according to
methods well known in the in art such as nucleotide sequencing or
restriction mapping, wherein the gene insert is suitably oriented.
The orientation will depend on the placement of a transcriptional
promoter adjacent to the MCS. The orientation of the insert will be
chosen such that the antisense strand of the insert will be
transcribed by the adjacent promoter. Next, a deletion library is
prepared. The plasmid containing the gene of interest is digested
with both PmeI and BbeI (FIG. 2, step b). The BbeI terminus is
protected from exonuclease III digestion because of its 3'overhang
18, while the PmeI terminus 22 is a suitable substrate therefor.
The digested plasmid is then treated with exonuclease III and
aliquots are removed over time into a stop mixture (FIG. 2, step
c). The time points are chosen such that deletions are generated
after every nucleotide across the entire gene. After exonuclease
III digestion, the combined aliquots are treated with mung bean
nuclease to remove the resulting 5' overhang (FIG. 2, step c). The
termini are then polished with T4 DNA polymerase (FIG. 2, step d)
and the plasmid is re-circularized with T4 DNA ligase to produce
the deletion library (FIG. 2, step e). The deletion library is then
converted into a fragment library (14 base-pair fragments 26 in
this case) by digestion with restriction endonucleases BsmI and
BpmI (FIG. 2, step f), purification of the plasmid containing the
14 bp fragment 26 from the excised BpmI/BsmI fragment 30 (FIG. 2,
step g), end-polishing with T4 DNA polymerase (FIG. 2, step h), and
ligation with T4 DNA ligase (FIG. 2, step i). Not stated, but
implied, after each ligation step (i.e., steps a, e, and i) the
ligation mixture is transformed into bacteria, the DNA is recovered
from the bacteria, and the recovered DNA is used in the subsequent
step. All of these reactions involving restriction endonucleases,
ligases, polymerases, nucleases, and the like are well known in the
art and are performed according to standard methods, e.g., J.
Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed.,
1989); T. Maniatis et al., Molecular Cloning: A Laboratory Manual
(1982); F. Ausubel et al., Current Protocols in Molecular Biology
(1987), relevant parts of which are hereby incorporated by
reference.
[0059] The essence of the procedure is as follows. A gene of
interest is converted into a library of fragments serially deleted
after every nucleotide. This deletion library is subsequently
converted into a fragment library containing all overlapping
fragments encoded by the gene.
[0060] The fragment library can also serve as the starting point
for construction of other types of antisense libraries. One such
library is an antisense hammerhead ribozyme library.
[0061] A hammerhead ribozyme 34 is a small RNA that can catalyze
the cleavage of a complementary RNA target 38 (FIG. 3). The
hammerhead comprises a catalytic core 42 (SEQ ID NO:4), essential
for cleavage activity. Additionally, the hammerhead has a
recognition domain 46 that is required for interaction with a
complementary substrate, such as an RNA transcript. There are few
sequence requirements for the recognition domain, thus by changing
the sequence of the recognition domain almost any sequence can be
targeted for cleavage by the hammerhead. Cleavage of the substrate
38 occurs at a cleavage site 50 containing an NUH sequence (where N
is A, C, G, or U and H is A, C, or U). In the case where the
substrate is a gene transcript, the hammerhead can be used as an
antisense inhibitor of gene expression.
[0062] To convert the fragment (antisense RNA) library into a
hammerhead ribozyme library, a DNA fragment encoding the hammerhead
catalytic core is inserted into the DNA fragment encoding the
antisense RNA. This is performed as illustrated in FIG. 4. The 14
base-pair fragment 54 in the fragment library is bisected with HphI
(FIG. 4, step a). The resulting single-stranded overhang on each
terminus is then removed using the 3' to 5' exonuclease activity of
T4 DNA polymerase (FIG. 4, step b) to result in blunt ends 58, 62.
A DNA fragment encoding the hammerhead catalytic core 66 (SEQ ID
NO:4) is then inserted by ligation (FIG. 4, step c). The catalytic
core shown in FIG. 4 is interrupted by a promoter-less
chloramphenicol resistance gene 70 (CAT). A promoter is provided
flanking the MCS. Transforming bacteria and selecting for
chloramphenicol resistance allows selection for clones in which the
catalytic core is in the correct orientation to produce a bonafide
hammerhead ribozyme. Next, the CAT gene is removed and the sequence
encoding a hammerhead ribozyme 74 is generated by NruI digestion
(FIG. 4, step d) and ligation with T4 DNA ligase (FIG. 4, step
e).
[0063] Other types of antisense libraries can also be produced from
the fragment library. For instance, other cassettes can be ligated
into an HphI-digested fragment library. Catalytic cores from other
ribozymes, including those currently known and those to be
discovered, can be inserted. Additionally, other cassettes could be
used that encode sequences that cause modification to the target by
mechanisms other than cleavage. Similarly, ribozyme and
non-ribozyme sequences can be added to the end of the antisense
sequence. This is illustrated in FIG. 5A, wherein the DNA fragment
library is digested with BpmI, which digests the DNA at the distal
end of the inserted fragment 78 (step a). The unpaired nucleotides
resulting from this reaction are then removed with T4 DNA
polymerase (step b) to result in blunt ends 82, 86. Next, a
cassette 90 is inserted by ligation to recircularize the modified
plasmid 94, now containing the cassette inserted at an end of the
insert fragment. Alternatively, instead of inserting a cassette
after the fragment library is produced, a suitable cassette can be
engineered into the starting multi-cloning sequence. For instance,
the HphI site of the original MCS (FIG. 1A) could be replaced with
a cassette encoding any desired sequence (FIG. 5B). Then, using the
same procedure illustrated in FIG. 2, the cassette can be placed
against the fragment sequence in the conversion of the deletion
library into the fragment library. An example of a possible
cassette is one encoding the sequence CUGA. An antisense RNA with
this sequence at its 3' end has been shown to be capable of
directing the 2'-O-methylation of the complementary target (J.
Cavaille et al., Targeted ribose methylation of RNA in vivo
directed by tailored antisense RNA guides, 383 Nature 732-735
(1996)). This reaction is catalyzed by modification machinery
present in mammalian cells. 2'-O-methylation of a suitable target
site could be used to inhibit expression of the RNA transcript.
Other cellular RNA processing reactions can also be used in a
similar fashion with the use of different cassettes placed adjacent
to the antisense RNA sequence.
[0064] Use of Directed Libraries in the Identification of Target
Sites for Antisense-Mediated Gene Inhibition
[0065] Antisense libraries prepared according to the present
invention can be assayed in vitro in a cell free system or in vivo
in cultured cells, as will be described in more detail below.
[0066] In vivo assay. For in vivo, use the antisense library is
introduced by transfection into a suitable cell line that expresses
the gene of interest. The transfection conditions are chosen such
that only one member of the library is taken up by each individual
cell. The individual cells then each express a different antisense
molecule targeted to a different site on the RNA transcript of
interest. All target sites are represented in the entire cell
population produced by transfection. Using a suitable detection
method, cell clones can be identified in which expression of the
target RNA has been reduced or eliminated. These clones possess an
antisense molecule that targets an effective site on the RNA
transcript of interest. The plasmid encoding this antisense
molecule is recovered and the target sequence is identified by DNA
sequencing.
[0067] To identify suitable targets in vivo, specially designed
expression vectors are required. One key feature of such expression
vectors is that they are designed to replicate episomally in
mammalian cells. FIGS. 6A and 7B show two such episomal vectors,
pBK (SEQ ID NO: 17) and pShuttle (SEQ ID NO: 14), respectively.
Vector pBK possesses the origin of replication and the gene
encoding the T/t antigen from the human papova virus BK (BKV).
Vector pShuttle possesses the origin of replication and the EBNA1
gene from the human Epstein-Barr virus (EBV). These sequence
elements allow each of the plasmids to replicate extrachromosomally
(episomally). Episomal expression is desirable for several reasons.
First, it eliminates the clone-to-clone variation in expression
that occurs if stable transfectants are used. P. B. Belt et al., 84
Gene 407-417 (1989). Second, since the copy number of the episomal
vector is determined primarily by the transfection conditions and,
once established, remains tightly regulated, J. L. Yates & N.
Guan, 65 J. Virol. 483-488 (1991), then effects on expression due
to differences in copy number are minimal. Consequently, the
selection of antisense efficacy is based on accessibility and not
the level of expression. Third, the use of an episomal expression
vector allows for high transfection efficiency. P. B. Belt et al.,
84 Gene 407-417 (1989); R. F. Maragolskee et al., 8 Mol. Cell.
Biol. 2837-2847 (1988). This is important to ensure that all
antisense agents present in the library are represented in the
mammalian transfectants. Finally, the plasmid can be recovered and
shuttled back into bacterial cells. This allows the sequence of
effective antisense agents to be determined, thereby identifying
accessible target sites. As a demonstration of episomal
replication, pShuttle was used to transfect HeLa cells, and the
cells were grown in culture under 400 .mu.g/ml hygromycin
selection. After 1 month in culture, low molecular weight DNA was
isolated from 1.times.10.sup.7 cells and used to transform
Escherichia coli DH5.alpha., producing a total of 2475
hygromycin-resistant colonies.
[0068] Vector pBK illustrates other features of value for in vivo
expression of antisense libraries. pBK has a single antibiotic
resistance gene, bleomycin.sup.R, driven by dual mammalian (CMV)
and bacterial (em7) promoters. This allows the same selectable
marker to be used in both bacterial and mammalian cells. This helps
to minimize the size of the vector, since large vectors transfect
at a lower efficiency. pBK has both the BK origin of replication
and the origin of replication from the pUC series of bacterial
plasmids. Therefore pBK can be replicated in both bacterial and
mammalian cells, and can be shuttled between them. pBK was designed
such that the antisense library could be constructed and expressed
from the same vector. The antisense sequence is expressed by
read-through expression of the bleomycin.sup.R gene. This ensures
expression of the antisense agent when the cells are grown in the
presence of bleomycin. The antisense fragment is released from the
larger bleomycin transcript by the activity of cis-acting ribozymes
(CAR), hammerhead ribozymes in this case, that flank the antisense
sequence. In the absence of CAR, flanking sequences of the larger
bleomycin transcript could inhibit the activity of the antisense
agent. Sequences outside of the MCS (FIG. 1A) encode the cis-acting
ribozymes. They are illustrated in FIG. 6B where only the sequence
of the upper strand of the MCS is shown (SEQ ID NO:18). On cleavage
by the CAR, the antisense agent is released and stable hairpin
loops form to increase the nuclease resistance of the antisense
agent.
[0069] pShuttle shares many of the same features as pBK, with two
significant differences. First, this episomal vector is EBV-based
rather than BKV-based. The second and more significant difference
is that construction of the antisense library is not possible in
pShuttle. Instead, the antisense library is first constructed in
pASlib (SEQ ID NO:7), and subsequently transferred to pShuttle for
expression in mammalian cells. The antisense encoding fragment of
pASlib is removed by digestion with HindIII and SalI (FIG. 7A).
Subsequently, the HindIII/SalI fragment is ligated into the
multi-cloning site of pShuttle via the HindIII and XhoI sites (FIG.
7C). This places the antisense sequence downstream of a dual CMV/T7
promoter for expression in vivo in mammalian cells or,
alternatively, in vitro by transcription using T7 RNA
polymerase.
[0070] Although it is believed that episomal shuttle vectors are
advantageous for expression of directed antisense libraries, viral
vectors can also be used. Many viruses are currently being examined
for expression of foreign genes for the purpose of gene therapy.
These same viral vectors would be suitable for expression of
directed antisense libraries. Some of these vectors replicate
extrachromosomally and therefore behave similarly to the described
episomal vectors. Others integrate into chromosomes. For the use of
integrative viral vectors, two minor problems would need to be
dealt with. First, the antisense gene present within the viral
vector would integrate into the chromosome with the virus.
Consequently, recovering the gene to determine the site at which it
targets is not readily possible. This can be dealt with by using
polymerase chain reaction (PCR) to amplify the integrated antisense
gene. The PCR product could be sequenced directly, or cloned and
sequenced to identify the target site. Second, some of these viral
vectors integrate randomly and this would produce differing levels
of expression from different members of the directed antisense
library. As discussed, it is important that expression of all
members of the library be comparable. This problem can be dealt
with by using a viral vector that integrates at a specific
preferred site, such as adeno-associated virus.
[0071] In vitro assay. Identification of effective antisense target
sites using antisense libraries can also be performed using in
vitro assays. For instance, an assay such as that used by Lieber
and Strauss (A. Lieber & M. Strauss, Selection of efficient
cleavage sites in target RNAs by using a ribozyme expression
library, 15 Molecular and Cellular Biology 540-551 (1995)), can be
used. For this, the antisense library is produced by in vitro
transcription from a suitable promoter. In the present case, an
antisense ribozyme library in pShuttle might be used. Of course
other types of antisense libraries could be used similarly. The
library-containing pShuttle is digested with XbaI and used as a
template for run-off transcription of the antisense ribozyme by in
vitro transcription with T7 RNA polymerase, according to methods
well known in the art (e.g., C. J. Noren et al., 18 Nucleic Acids
Res. 83-88 (1990). Subsequently, the transcribed ribozyme library
is incubated in a lysate prepared from a mammalian cell line
expressing the gene of interest. Effective target sites are
identified by performing a primer extension reaction on purified
RNA from the lysate using a primer specific for the gene of
interest. Primer extension products terminate at the sites of
cleavage by effective ribozymes. These sites are identified by gel
electrophoresis of the primer extension products with suitable size
markers.
EXAMPLE 1
[0072] Construction of pASlib. In this example, there is described
an illustrative plasmid according to the present invention for
making a deletion library of a selected DNA. This plasmid was
constructed as follows.
[0073] The HindIII-HpaI fragment of pLA2917 (J. N. Allen & R.
S. Hanson, 161 J. Bact. 955-962 (1985)), containing the kanamycin
resistance gene, was inserted into HindIII/SmaI-digested pUC19 to
produce pUCKan. An HphI and two BsaHI sites were eliminated from
the kanamycin resistance gene by site-directed mutagenesis,
according to methods well known in the art, to produce pUCKan*. The
mutagenized kanamycin resistance gene was removed by HindIII/EcoRI
digestion, and the termini were blunted by 5'-overhang fill-in
using the Klenow fragment of DNA polymerase I and ligated to the
843 bp BspHI-SapI fragment of pUC 19 containing the origin of
replication. A clone (pKan) was selected wherein the EcoRI and
BspHI sites were juxtaposed. The BsmFI and PstI sites were
eliminated from pKan by site-directed mutagenesis using the
procedure of E. Merino et al., 12 Biotechniques 508-510 (1992). The
multiple cloning site for pASlib was constructed from the
overlapping oligodeoxynucleotides MCS-L (SEQ ID NO:5) and MCS-R
(SEQ ID NO:6) by 5'-overhang fill-in with the Klenow fragment of
DNA polymerase I. Oligonucleotides were synthesized using an
Applied Biosystems automated oligonucleotide synthesizer. The
double-stranded multiple cloning site was inserted into
EcoRI-linearized and blunted pKan to result in pASlib (SEQ ID
NO:7). Restriction endonuclease digestions, primer extension
reactions, ligation reactions, and the like were carried out
according to methods well known in the art. E.g., J. Sambrook et
al., Molecular Cloning: A Laboratory Manual (2d ed., 1989); T.
Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); F.
Ausubel et al., Current Protocols in Molecular Biology (1987).
[0074] Therefore, pASlib possesses the pUC19 origin of replication
and a kanamycin resistance gene allowing selection in bacterial
cells. The kanamycin resistance gene was chosen as the selectable
marker since, of all the available bacterial selection markers, it
possessed the fewest sites present in the MCS. Therefore, it was
the simplest to modify by site-specific mutagenesis to eliminate
the undesirable sites. The MCS contains the following salient
features. It possesses a short polylinker that allows much
flexibility in the cloning of the gene or cDNA sequence of
interest, which represents the first step in the construction of an
antisense library. The polylinker includes several restriction
sites that leave sticky ends upon digestion. These sites can be
used to directionally clone the cDNA or genomic fragment in the
correct orientation. Alternatively, the fragment can be cloned by
blunt-end ligation, and the correctly oriented clone can be
selected by restriction analysis. The PstI and PmeI sites allow the
generation of a substrate for unidirectional digestion by
exonuclease III into the cloned cDNA or genomic fragment. This
allows preparation of a serial deletion library of the cloned
insert. The BsmFI and BbsI sites are used together to convert the
deletion library into a 14 bp fragment library. The HphI site
allows bisection of the 14 bp fragment library for introduction of
the antisense agent.
EXAMPLE 2
[0075] Construction of pShuttle. In this example, there is
described the construction of an illustrative plasmid for use
according to the present invention for expressing an antisense
agent in either mammalian cells using the intermediate-early
promoter from cytomegalovirus or in vitro using T7 polymerase.
[0076] A hygromycin expression cassette capable of being expressed
in both mammalian and prokaryotic systems was constructed using
overlap extension PCR. PCR was carried out according to methods
well known in the art, e.g., U.S. Pat. No. 4,683,195; U.S. Pat. No.
4,683,202; U.S. Pat. No. 4,800,159; U.S. Pat. No. 4,965,188; PCR
Technology: Principles and Applications for DNA Amplification (H.
Erlich ed., Stockton Press, New York, 1989); PCR Protocols: A guide
to Methods and Applications (Innis et al. eds, Academic Press, San
Diego, Calif., 1990). The 1026 bp hygromycin resistance coding
sequence from EBOpLPP (ATCC) was joined at its 3'-end to the 322 bp
3'-untranslated region (UTR)/SV40 early polyadenylation sequence
from pRC/CMV (Invitrogen Corp., Carlsbad, Calif.), while the 527 bp
dual ampicillin/SV40 early promoter from pEGFP-1 was joined to the
5'-end. The sequences of the primers used in the PCR were as
follows: 3'-UTR/poly(A) segment, SEQ ID NO:8 and SEQ ID NO:9;
hygromycin coding region, SEQ ID NO: 10 and SEQ ID NO: 11; amp/SV40
early promoter, SEQ ID NO: 12 and SEQ ID NO: 13. Each portion of
the hygromycin cassette was prepared by PCR using one of the three
primer sets and the appropriate template. The resulting fragments
were gel purified. The hygromycin-encoding and the 3'-UTR/poly(A)
fragments were combined and used in a second PCR reaction to
produce the hygromycin-3'-UTR/poly(A) fragment. In a final PCR,
this fragment was combined with the amp/SV40 fragment to produce
the complete 1875 bp hygromycin gene cassette. The hygromycin gene
cassette was ligated into the 843 bp BspHI-SapI oriP-containing
fragment of pUCl9, producing pHyg. The 4914 bp EcoRI-BamHI fragment
containing the EBNA-1 and EBV oriP sequences from EBOpLPP was
inserted between the hygromycin cassette and the pUC 19 origin of
XhoI-digested pHyg to make pEBV. The 1060 bp expression cassette
was excised from pRC/CMV using NruI and PvuII and inserted into the
BamHI site of pEBV to produce pShuttle (SEQ ID NO:14).
[0077] pShuttle was designed to allow replication and expression of
the antisense library in mammalian cells. It possesses an MCS for
insertion of the antisense library. The MCS is flanked on one end
by a dual CMV/T7 promoter for allowing expression of the antisense
agent gene both in mammalian cells as well as by in vitro
transcription using T7 RNA polymerase. On the other end of the MCS
is a bovine growth hormone polyadenylation signal for efficient
expression in mammalian cells. pShuttle possesses a hygromycin
resistance gene driven by a dual promoter for allowing selection in
bacterial and mammalian cells. The pUC 19 origin of replication
allows replication in bacterial cells. For replication in mammalian
cells, the EBV origin and EBNA-1 gene were included. J. Yates et
al., 81 Proc. Nat'l Acad. Sci. USA 3806-3810 (1984); J. Yates et
al., 313 Nature 812-815 (1985).
EXAMPLE 3
[0078] Construction of a hammerhead ribozyme catalytic core
cassette. A cassette encoding the hammerhead catalytic core,
interrupted by the CAT gene (S. Horinouchi & B. Weisblum, 150
J. Bact. 815-825 (1982)), was constructed as follows. PCR primers
were prepared that were complementary to the CAT gene on their
3'-ends and encoded the hammerhead catalytic core on their 5'-ends.
The sequences of the primers were SEQ ID NO: 15 and SEQ ID NO:16.
Located between the CAT and hammerhead catalytic core sequences
were NruI restriction sites. The PCR contained 5 ng CAT gene DNA,
100 pmol each of the primers CatCass 1 and CatCass 2, 1 mM of each
of the four dNTPs, 5 units of VENT polymerase (New England Biolabs,
Beverly, Mass.) in the standard VENT polymerase buffer except that
the concentration of the MgSO.sub.4 was increased to 5.2 mM (i.e.,
10 mM KCl, 10 mM (NH4).sub.2SO.sub.4, 20 mM Tris-HCl (pH 8.8 at
24.degree. C.), 5.2 mM MgSO.sub.4, 0.1% Triton X-100). The use of
VENT polymerase ensured that the cassette possessed blunt ends.
[0079] The reaction mixture was incubated as follows:
[0080] (A) 2 minutes at 94.degree. C.;
[0081] (B) 5 cycles of 1 minute at 94.degree. C., 30 seconds at
45.degree. C., and 2 minutes at 72.degree. C.;
[0082] (C) 15 cycles of 30 seconds at 94.degree. C., 15 seconds at
60.degree. C., and 2 minutes at 72.degree. C.; and
[0083] (D) 5 minutes at 73.degree. C.
[0084] After amplification, the cassette was purified from
unincorporated primers by agarose gel electrophoresis, and the
agarose was subsequently removed from the cassette DNA using
standard procedures.
[0085] Introduction of a catalytic core into a fragment library
presents several difficulties. The core must be inserted by
blunt-end ligation and in the correct orientation to produce a
functional ribozyme. Additionally, due to its small size, it is
difficult to prevent the introduction of concatamers of the core
and/or contamination of the library with clones that do not acquire
a catalytic core. To increase the effectiveness and efficiency of
this step, the core interrupted by the CAT gene was designed. CAT
selection allows the use of a non-phosphorylated cassette. This
prevents insertion of multimers and selects against
non-recombinants. Additionally, the CAT gene allows selection of
clones acquiring a correctly oriented catalytic core. In the
desired orientation, transcription of the CAT and kanamycin genes
is in the same direction. In the incorrect orientation, CAT
expression is inhibited by antisense expression from the kanamycin
resistance gene. This phenomenon has been noted previously, R.
Bruckner et al., 32 Gene 151-1160 (1984). After selection, the CAT
gene is removed by digestion with NruI to produce a sequence
encoding a hammerhead ribozyme.
EXAMPLE 4
[0086] Construction of a Herpes ICP4 ribozyme library. The 4489 bp
BglII-EcoRI fragment from pTEG2, X. X. Zhu et al., 184 Virology
67-78 (1991), containing a herpes simplex virus ICP4 genomic
fragment was cloned into EcoRI-EcoRV-digested pASlib. This fragment
included 125 bp upstream of the translational start site, 466 bp
downstream of the translational termination sequence, and the
entire genomic coding sequence of ICP4. The resulting clone,
pASlib-ICP4, contained the ICP4 fragment with the sense strand as
the upper strand.
[0087] From pASlib-ICP4 a deletion library was produced as follows.
Twenty .mu.g of CsCl gradient purified plasmid DNA was digested
with PstI and XbaI, then concentrated and desalted using a Microcon
50 spin filter (Amicon). The DNA was brought up to a volume of 60.4
.mu.l of exonuclease III buffer (i.e., 50 mM Tris-HCl, pH 8.0, 5 mM
MgCl2, 10 mM 2-mercaptoethanol), warmed to 37.degree. C., and then
300 units of exonuclease III were added. At 1-minute intervals
after the addition of the exonuclease III, 2.5 .mu.l of the
reaction mixture was removed and placed in microfuge tubes on ice
containing 7.5 .mu.l of 66.7 mM sodium acetate, pH 5.2, 200 mM
NaCl, 1.3 mM ZnCl.sub.2, and 1 unit of mung bean nuclease. After 25
aliquots had been removed, the mung bean nuclease-containing tubes
were incubated at 20.degree. C. for 30 minutes. After 30 minutes,
the contents of all of the mung bean nuclease-containing tubes were
combined and extracted with phenol-chloroform (50:50), extracted
with chloroform, and then were precipitated with two volumes of
100% ethanol. The DNA was then pelleted and dried. The DNA was then
resuspended in 18 .mu.l of d.i. H.sub.2O, 2.5 .mu.l of 10 mM of
each of the four dNTPs, 2.5 .mu.l of 10.times.Pfu polymerase buffer
(e.g., 100 mM KCl, 100 mM (NH.sub.4).sub.2SO.sub.4, 200 mM Tris-Cl
(pH 8.75), 20 mM MgSO.sub.4, 1% Triton.RTM. X-100, 1000 mg/ml BSA),
and 5 units of Pfu polymerase (Stratagene, La Jolla, Calif.), then
incubated at 72.degree. C. for 15 minutes, and cooled to room
temperature. The plasmid DNA was recircularized by ligating in a
large volume (1.25 ml) in a buffer containing 5% PEG for 4 hours at
room temperature. Except for the modifications indicated, all
ligations were performed with T4 DNA ligase under the conditions
suggested by the manufacturer.
[0088] After transformation into E. coli DH5 a, the cells were
grown in liquid culture to amplify the deletion library. The
library DNA was purified and digested with BsmFI and BbsI, and then
the ends were blunted with Pfu polymerase as described above. The
DNA was then recircularized by ligation in a 600 .mu.l volume in a
buffer containing 5% polyethylene glycol (PEG) at room temperature
for 4 hours. After transformation into E. coli DH5.alpha.,
amplification and plasmid purification, 1 .mu.g of library plasmid
DNA was then subjected to digestion with 8 units of HphI for 1 hour
at 37.degree. C., and the ends were polished with T4 DNA
polymerase. The hammerhead core cassette was inserted by ligating
0.5 .mu.g of the HphI-digested library DNA with 5 .mu.g of the
ribozyme core sequence cassette prepared according to the procedure
of Example 3. That ligation product was transformed into DH5.alpha.
and grown in culture under chloramphenicol selection. After
purification, 2 .mu.g of the DNA was digested with HindII and SalI,
and the terminal phosphates were removed using shrimp alkaline
phosphatase (Amersham, Arlington Heights, Ill.). The HindIII/SalI
digest was fractionated on an agarose gel, and the dephosphorylated
ribozyme/chloramphenicol cassette was purified using standard
procedures. The cassette was combined with an equimolar amount of
HindIII-XhoI-digested pShuttle, prepared according to the procedure
of Example 2, and ligated using a modified two-step ligation
procedure, S. Damak & D. W. Bullock, 15 Biotechniques 448-450
(1993) (hereby incorporated by reference). The first step was
performed at room temperature for 1 hour, and the second step was
incubated overnight at 16.degree. C. The ligation mixture was
transformed in DH5.alpha. and grown in culture under
chloramphenicol selection. The library DNA was purified and then
digested with NruI to release the chloramphenicol gene. The
digested DNA was then recircularized by ligation in a volume of 600
.mu.l. The final ligation product was transformed into DH5.alpha.,
and the plasmid DNA was purified on a CsCl gradient.
[0089] To verify the effectiveness of this procedure, 56 clones
obtained at various steps were sequenced. Thirty-one were from the
final ribozyme library, and the remainder were from earlier steps,
beginning with the 14 bp fragment library. The results of the
sequencing are discussed below.
[0090] One observation made after the mung bean digestion was that
the deletions infrequently stopped at A-T base pairs. While
exonuclease III has been shown to exhibit a preference for stopping
at certain nucleotides (C>A=T>G), W. Linxweiler & W.
Horz, 10 Nucleic Acids Res. 4845-4859 (1982), this was not believed
to be the cause of the observed sequence bias. Instead, it is
believed that this is the result of a greater degree of "breathing"
at A-T terminated deletions and the subsequent removal of A-T
terminal pairs by mung bean nuclease. The mung bean nuclease
digestion was later performed at higher salt concentrations (150
mM) and at a lower temperature (20.degree. C.). This eliminated the
under-representation of A-T terminated deletions.
[0091] For construction of the library, two type IIS restriction
enzymes are required, BsmFI and HphI. Typical of type IIS
restriction enzymes, BsmFI and HphI cleave downstream of their
recognition sequences in a sequence-independent manner. Cleavage by
type IIS restriction enzymes can pose some problems since they can
exhibit infidelity in how far from their recognition site they
cleave. Cleavage by BsmFI was largely at the expected distance
(10/14), but also at 11/15. The reported 9/13 activity for this
enzyme, V. E. Velculescu et al., 270 Science 484-487 (1995), was
not seen in any of the clones sequenced. Infidelity of BsmFI does
not present a problem for construction of ribozyme libraries. The
result of this infidelity is that the recognition domains of the
ribozymes in the library can vary from 13 to 15 nucleotides.
[0092] In contrast, HphI infidelity can be problematical. HphI
digestion is a critical step in the construction of ribozyme
libraries. This enzyme produces a 1 nucleotide 3'-overhang that is
later removed by polishing with T4 DNA polymerase. It is essential
to the proper functioning of the resulting ribozyme that this 1
nucleotide be removed, since it does not have an antisense binding
partner in the ribozyme (FIG. 1, X).
[0093] HphI cleaves at 8/7, but also at 9/8. D. Kleid et al., 73
Proc. Nat'l Acad. Sci. USA 293-297 (1976). This infidelity is
demonstrated in the present library by the presence of ribozymes
with flanking helices of length 8 and 5, as would be expected if
HphI cleaved at 9/8. This type of infidelity, in itself, is not
problematical. It simply alters the relative lengths of the two
arms of the binding domain, leaving the total length of the binding
arms unchanged. The problem that arises with HphI infidelity is
that the enzyme can cleave twice at the same target, i.e., if it
first cleaves at 9/8 it can rebind and cleave at 8/7. The result is
that 2 bp are removed from the sequence upon polishing with T4 DNA
polymerase. Removal of 2 bp from the insertion site of the ribozyme
core produces a non-functional ribozyme. In early attempts to
produce a library, >40% of the clones were the product of double
cutting. This is close to the statistically predicted 50% that
would occur if HphI has no preference for either 8/7 or 9/8
cutting. To minimize the possibility of double cutting, HphI
digestion was performed under near "single hit" conditions. Under
these conditions, double cleavage was only 13% of the final
library. It should be possible to further reduce the percentage of
double hits by performing the cleavage under "sub-single hit"
conditions. This should not present any problem so long as the
amount of plasmid digested is sufficient to allow full
representation of the ribozyme library. Undigested molecules cannot
accept the catalytic core and are removed in the later step by
selection for chloramphenicol resistance. Other class IIS
restriction enzymes, such as MboII, could likely substitute for
HphI, but fidelity may not be any better.
[0094] The infidelity of HphI raises another issue. It is possible
that some sequences favor digestion at 8/7 and others at 9/8. This
could lead to the absence of some ribozyme target sequences in the
final library. This appears to be unlikely, however. First, as
discussed, under conditions that give nearly 100% cleavage by HphI,
>40% of the molecules are cut twice. This is close to the 50%
predicted if HphI exhibits no preference for 8/7 versus 9/8
cutting. Second, two clones that both contain the same 14 bp
sequence of ICP4, Rz8 and Rz9 (Table 1), are the products of 8/7
and 9/8 cleavage, respectively. This suggests that the intervening
sequence between the binding site and the cleavage site does not
affect where HphI cleaves.
[0095] HphI is also sensitive to overlapping dam methylation. This
is also true of MboII. Since 2 nucleotides of the four base
consensus sequence for dam methylation are provided by the variable
sequence of the cDNA insert, mathematically {fraction (1/16)} of
the clones in the 14 bp fragment library (6.25%) will not be
cleaved with HphI and will be eliminated from the final ribozyme
library. This can be prevented by passage of the 14 bp fragment
library in a dam.sup.- strain prior to HphI digestion.
1TABLE 1 Clone (Position) Target Seguence.sup.a SEQ ID NO: Rz1
(1754) cgacgccgcccgcc 19 Rz2 (1992) cugcgcgcguggcu 20 Rz3 (2045)
gcgccugcgcgggg 21 Rz4 (2252) cgccgccgacgcgc 22 Rz5 (2411)
cccccuccccgcg 23 Rz6 (2517) guggcccugucgcg 24 Rz7 (2590)
gccacacggcggcg 25 Rz8 (2729) cgccgcgcggugcg 26 Rz9 (2729).sup.b
cgccgcgcggugcg 27 Rz10 (2837) cccccugcgcgccuc 28 Rz11 (2915)
gguggugcuguacuc 29 Rz12 (3246) gggcccgcgguguc 30 Rz13 (3275).sup.c
ccuggcgugcgagc 31 Rz14 (3569) ggggaccaccgacgccauggc 32 Rz15 (3680)
cguggcgcuggggc 33 Rz16 (3842) cgggauucgcuggg.sup.d 34 .sup.aThe
nucleotide in bold indicates the unbound nucleotide, i.e., position
X in FIG. 3. .sup.bClone repeated 2 times. .sup.cClone repeated 3
times. .sup.dBona fide ribozyme target.
[0096] The target locations of the 56 sequenced clones are
illustrated in FIG. 8. The histogram indicates that the target
sites are fairly evenly distributed across the entire ICP4 gene,
with the exception that no clones were identified targeting the 5'-
and 3'-termini. It is unlikely that the library is devoid of
members targeting these regions since the libraries are prepared
with complexities far exceeding the total number of sites on the
gene. It is even possible that target sites in these regions are
similarly represented as those identified by the sequenced clones.
Due to the small number of clones sequenced, it is likely that some
larger gaps in the data could be observed even for a uniformly
represented library, such as the gap between positions 966 and
1282.
[0097] Of the 56 sequences determined, 42 (75%) occurred only once,
while four occurred multiple times (FIG. 8). Three were only mildly
over-represented, with two or three occurrences compared with the
single occurrence for the majority of clones. The three positions
were 2054 and 3246, with two occurrences each, and position 2729,
with three occurrences. One position, 3275, was significantly
over-represented, occurring seven times. Five of the occurrences
were observed within the 32 clones sequenced from the final
library, and the other two were found at early stages of the
construction. The over-representation of particular sites is likely
caused by some local sequence and/or structure in the DNA that
either stalls exonuclease III or causes it to fall off the
template. P. Abarzua & K. J. Marians, 81 Proc. Nat'l Acad. Sci.
USA 2030-2034 (1984). Performing the exonuclease III deletion at
higher temperatures might reduce this phenomenon if an inhibitory
structure is forming at certain sequences. Higher temperature also
allows for more distributive activity from the enzyme, J. D.
Hoheisel, 209 Anal. Biochem. 238-246 (1993), which is desirable in
this type of exonuclease III digestion. While it is possible that
the exonuclease III digestion conditions may need to be optimized
for each target cDNA, creating libraries larger than would be
necessary to represent every position would ensure complete
representation of all target sites.
[0098] Examination of the 31 clones obtained from the final library
allowed determination of the overall effectiveness of the
procedure. All 31 possessed a catalytic core, demonstrating the
effectiveness of the use of CAT selection for this purpose.
Nineteen of the 31 clones *.backslash.(61%) contained sequences
that could potentially be ribozymes if the sequence that they
targeted included the required NUH sequence at the correct
location. These are shown in Table 1. Counted among these potential
ribozymes were three clones that possess non-detrimental defects.
One has a single nucleotide deleted from loop II of the ribozyme
(Rz13). This produces a three-, instead of a four-nucleotide loop
II. The site of this defect is the NruI site used to remove CAT
from the catalytic core. The ends must have been damaged during
this step for this clone. The other two non-detrimental defects
were the result of incomplete digestion by BsmFI. These clones have
a longer flanking arm corresponding to helix III (Rz12 and Rz14).
This appears to be the result of a lack of cleavage of the BsmFI
site on pASlib and, instead, an internal BsmFI site on ICP4 was
used. These clones would be expected to produce functional
ribozymes had they targeted an NUH sequence.
[0099] The remaining 12 clones (39% of 31) possessed defects that
would prevent them from being potentially functional ribozymes.
Four of these (13%) were defective in that they were cleaved twice
with HphI. As discussed above, it is likely that this defect can be
reduced to close to zero by performing the HphI digestion under
"sub-single hit" conditions. Three (9.7%) were missing 1 nucleotide
from one end of the catalytic core. Since the deletion always
occurred at the same end of the cassette and the thermostable
polymerase used to make the cassette does not contain any 5' to 3'
exonuclease activity, the PCR primer constituting that end of the
cassette must have been contaminated with a small percentage of a
failure fragment of the DNA synthesis. This defect can be
eliminated by better purification of the primers. Five clones (16%)
possessed the catalytic core in the incorrect orientation. This is
in contrast to the expected 50% if there were no selection for
orientation. Incorrectly oriented clones could be eliminated by
moving the promoter for the CAT gene outside the MCS of pASlib.
Finally, three clones were the result of various unknown cloning
artifacts.
[0100] Therefore, the success rate of this library was 61%. As
discussed, a few procedural changes would increase the success rate
to 70-80%. This could be increased a further 16% by placing the CAT
promoter outside the MCS. Even at 61%, the success rate is more
than adequate. This just means that it is necessary to screen an
antisense library 140% the size needed if 100% success were
achieved. This would still be a small library relative to a
non-directed library approach.
[0101] Three of the 31 clones (9.7%) targeted a site on the ICP4
mRNA that contained a uridine at the proper position of the
consensus NUH site (Rz3, Rz5, and Rz16). Of the three, only one
targeted a consensus NUH site (Rz16). Due to the unusually high G/C
content of the ICP4 genomic fragment used to make the ribozyme
library, only 9.2% of the nucleotides in the mRNA are uridines, of
which 203 occur as an NUH triplet. The fact that the percentage of
sequenced clones in the library targeting an NU site is virtually
identical to the percentage of uridines in the ICP4 gene suggests
that the library is unbiased and likely to contain a fairly uniform
distribution of target sites.
[0102] The use of a direct library for target site selection
significantly simplifies the screening process, since only very
small libraries need be prepared and assayed. For ICP4, assuming
the library contains a uniform distribution of the 4475 distinct
sequences (4489-14), a library of 67,125 (15-fold excess) is
expected to have a probability of 99.9% of containing all
sequences. W. Feller, An Introduction to Probability Theory and Its
Applications (3d ed. 1968). Based on a .chi..sup.2 goodness-of-fit
analysis of the 56 sequences, the multiples observed at positions
2729 and 3275 occur with a higher frequency than would be expected
for a uniform distribution. All other positions are consistent with
a uniform distribution. Correcting for the two over-represented
sequences, a library of 81,057 (18-fold excess) is expected to
contain all sequences with probability of 99.9%. Preparation,
manipulation, and screening of such a library is well within the
limitations of current practice. In contrast, a non-directed
library targeting 14 nucleotides would require a minimum size of
2.7.times.10.sup.8 (4.sup.14). The ability to prepare and screen
such a library is questionable. Even if possible, the vast majority
of members of the library are directed at non-target genes.
Inhibition of non-target genes could pose problems in interpreting
the results.
Sequence CWU 1
1
50 1 62 DNA Artificial Sequence Multiple cloning site for use in
making deletion libraries. 1 gcttggtgat gcattcgata tcgtttaaac
gcccgggcgc ggccgcggcg cctccagtcg 60 ac 62 2 24 DNA Artificial
Sequence Portion of a multiple cloning site for use in making
deletion libraries. 2 gtcgacggga ctgcaggttt aaac 24 3 23 DNA
Artificial Sequence Portion of a multiple cloning site for use in
making deletion libraries. 3 gaagacagtc accaagcttc agc 23 4 23 DNA
Unknown Catalytic core of hammerhead ribozyme. 4 ctgatgaggt
cgcgagaccg aaa 23 5 49 DNA Artificial Sequence PCR primer for
construction of pASlib. 5 aagcttggtg actgtcttcg agctcgaatt
catcgatatc tagagttta 49 6 34 DNA Artificial Sequence PCR primer for
construction of pASlib. 6 gtcgacggga ctgcaggttt aaactctaga tatc 34
7 2077 DNA Artificial Sequence pASlib 7 tcagtggaac gaaaactcac
gttaagggat tttggtcatg aattgtcgac gggactgcag 60 gtttaaactc
tagatatcga tgaattcgag ctcgaagaca gtcaccaagc ttattcccag 120
agtcacgctc agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga
180 gcggcgatac cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag
ctcttcagca 240 atatcacggg tagccaacgc tatgtcctga tagcggtccg
ccacacccag ccggccacag 300 tcgatgaatc cagaaaagcg gccattttcc
accatgatat tcggcaagca ggcatcgcca 360 tgggtcacga cgagatcctc
gccgtcgggc atgcgcgcct tgagcctggc gaacagttcg 420 gctggcgcga
gcccctgatg ctcttcgtcc agatcatcct gatcgacaag accggcttcc 480
atccgagtac gtgctcgctc gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc
540 ggatcaagcg tatgcagccg ccgcattgca tcagccatga tggatacttt
ctcggcagga 600 gcaagatgag atgacaggag atcctgcccc ggcacttcgc
ccaatagcag ccaatccctt 660 cccgcttcag tgacaacgtc gagcacagct
gcgcaaggaa cgcccgtcgt ggcaagccac 720 gatagccgcg ctgcctcgtc
ttgcagttca ttcagggcac cggacaggtc ggtcttgaca 780 aaaagaaccg
gccgcccctg cgctgacagc cggaacacgg cggcatcaga ggagccgatt 840
gtctgttgtg cccagtcata gccgaatagc ctctccaccc aagcggccgg agaacctgcg
900 tgcaatccat cttgttcaat catgcgaaac gatcctcatc ctgtctcttg
atcagatctt 960 gatcccctgc gccatcagat ccttggcggc aagaaagcca
tccagtttac tttgcagggc 1020 ttcccaacct taccagaggt cgccccagct
ggcaattccg gttcgcttgc tgtccataaa 1080 accgcccagt ctagctatcg
ccatgtaagc ccactgcaag ctacctgctt tctctttgcg 1140 cttgcgtttt
cccttgtcca gatagcccag tagtgacatt catccggggt cagcaccgtt 1200
tctgcggact ggctttctac gtgttccgct tcctttagca gcccttgcgc cctgagtgct
1260 tgcggcagcg tgaagctgct tcctcgctca ctgactcgct gcgctcggtc
gttcggctgc 1320 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
atccacagaa tcaggggata 1380 acgcaggaaa gaacatgtga gcaaaaggcc
agcaaaaggc caggaaccgt aaaaaggccg 1440 cgttgctggc gtttttccat
aggctccgcc cccctgacga gcatcacaaa aatcgacgct 1500 caagtcagag
gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 1560
gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
1620 tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc
agttcggtgt 1680 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc
cgttcagccc gaccgctgcg 1740 ccttatccgg taactatcgt cttgagtcca
acccggtaag acacgactta tcgccactgg 1800 cagcagccac tggtaacagg
attagcagag cgaggtatgt aggcggtgct acagagttct 1860 tgaagtggtg
gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 1920
tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
1980 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa
aaaggatctc 2040 aagaagatcc tttgatcttt tctacggggt ctgacgc 2077 8 33
DNA Artificial Sequence PCR primer for amplifying a 3'-UTR/poly(A)
segment. 8 ccgagggcaa aggaataggc gggactctgg ggt 33 9 21 DNA
Artificial Sequence PCR primer for amplifying a 3'-UTR/poly(A)
segment. 9 ctcgaggtcg acgggatcca g 21 10 33 DNA Artificial Sequence
PCR primer for amplifying a hygromycin coding region. 10 ggatgaggat
cgtttcgcat gaaaaagcct gaa 33 11 33 DNA Artificial Sequence PCR
primer for amplifying a hygromycin coding region. 11 accccagagt
cccgcctatt cctttgccct cgg 33 12 20 DNA Artificial Sequence PCR
primer for amplifying an amp/SV40 early promoter. 12 cgtcaggtgg
cacttttcgg 20 13 33 DNA Artificial Sequence PCR primer for
amplifying the amp/SV40 early promoter. 13 ttcaggcttt ttcatgcgaa
acgatcctca tcc 33 14 8705 DNA Artificial Sequence pShuttle 14
tcgagcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta
60 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg
ctgcttgcaa 120 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg
atcaagagct accaactctt 180 tttccgaagg taactggctt cagcagagcg
cagataccaa atactgtcct tctagtgtag 240 ccgtagttag gccaccactt
caagaactct gtagcaccgc ctacatacct cgctctgcta 300 atcctgttac
cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 360
agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag
420 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga
gcattgagaa 480 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc
cggtaagcgg cagggtcgga 540 acaggagagc gcacgaggga gcttccaggg
ggaaacgcct ggtatcttta tagtcctgtc 600 gggtttcgcc acctctgact
tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 660 ctatggaaaa
acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 720
gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt
780 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc
agtgagcgag 840 gaagccgtca ggtggcactt ttcggggaaa tgtgcgcgga
acccctattt gtttattttt 900 ctaaatacat tcaaatatgt atccgctcat
gagacaataa ccctgataaa tgcttcaata 960 atattgaaaa aggaagagtc
ctgaggcgga aagaaccagc tgtggaatgt gtgtcagtta 1020 gggtgtggaa
agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 1080
tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc
1140 atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat
cccgccccta 1200 actccgccca gttccgccca ttctccgccc catggctgac
taattttttt tatttatgca 1260 gaggccgagg ccgcctcggc ctctgagcta
ttccagaagt agtgaggagg cttttttgga 1320 ggcctaggct tttgcaaaga
tcgatcaaga gacaggatga ggatcgtttc gcatgaaaaa 1380 gcctgaactc
accgcgacgt ctgtcgagaa gtttctgatc gaaaagttcg acagcgtctc 1440
cgacctgatg cagctctcgg agggcgaaga atctcgtgct ttcagcttcg atgtaggagg
1500 gcgtggatat gtcctgcggg taaatagctg cgccgatggt ttctacaaag
atcgttatgt 1560 ttatcggcac tttgcatcgg ccgcgctccc gattccggaa
gtgcttgaca ttggggaatt 1620 cagcgagagc ctgacctatt gcatctcccg
ccgtgcacag ggtgtcacgt tgcaagacct 1680 gcctgaaacc gaactgcccg
ctgttctgca gccggtcgcg gaggccatgg atgcgatcgc 1740 tgcggccgat
cttagccaga cgagcgggtt cggcccattc ggaccgcaag gaatcggtca 1800
atacactaca tggcgtgatt tcatatgcgc gattgctgat ccccatgtgt atcactggca
1860 aactgtgatg gacgacaccg tcagtgcgtc cgtcgcgcag gctctcgatg
agctgatgct 1920 ttgggccgag gactgccccg aagtccggca cctcgtgcac
gcggatttcg gctccaacaa 1980 tgtcctgacg gacaatggcc gcataacagc
ggtcattgac tggagcgagg cgatgttcgg 2040 ggattcccaa tacgaggtcg
ccaacatctt cttctggagg ccgtggttgg cttgtatgga 2100 gcagcagacg
cgctacttcg agcggaggca tccggagctt gcaggatcgc cgcggctccg 2160
ggcgtatatg ctccgcattg gtcttgacca actctatcag agcttggttg acggcaattt
2220 cgatgatgca gcttgggcgc agggtcgatg cgacgcaatc gtccgatccg
gagccgggac 2280 tgtcgggcgt acacaaatcg cccgcagaag cgcggccgtc
tggaccgatg gctgtgtaga 2340 agtactcgcc gatagtggaa accgacgccc
cagcactcgt ccgagggcaa aggaataggc 2400 gggactctgg ggttcgaaat
gaccgaccaa gcgacgccca acctgccatc acgagatttc 2460 gattccaccg
ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc 2520
tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc caacttgttt
2580 attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac
aaataaagca 2640 tttttttcac tgcattctag ttgtggtttg tccaaactca
tcaatgtatc ttatcatgtc 2700 tggatccgat gtacgggcca gatatacgcg
ttgacattga ttattgacta gttattaata 2760 gtaatcaatt acggggtcat
tagttcatag cccatatatg gagttccgcg ttacataact 2820 tacggtaaat
ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat 2880
gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggacta
2940 tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa
gtacgccccc 3000 tattgacgtc aatgacggta aatggcccgc ctggcattat
gcccagtaca tgaccttatg 3060 ggactttcct acttggcagt acatctacgt
attagtcatc gctattacca tggtgatgcg 3120 gttttggcag tacatcaatg
ggcgtggata gcggtttgac tcacggggat ttccaagtct 3180 ccaccccatt
gacgtcaatg ggagtttgtt ttggcaccaa aatcaacggg actttccaaa 3240
atgtcgtaac aactccgccc cattgacgca aatgggcggt aggcgtgtac ggtgggaggt
3300 ctatataagc agagctctct ggctaactag agaacccact gcttaactgg
cttatcgaaa 3360 ttaatacgac tcactatagg gagacccaag cttggtaccg
agctcggatc cactagtaac 3420 ggccgccagt gtgctggaat tctgcagata
tccatcacac tggcggccgc tcgagcatgc 3480 atctagaggg ccctattcta
tagtgtcacc taaatgctag agctcgctga tcagcctcga 3540 ctgtgccttc
tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 3600
tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc
3660 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag
ggggaggatt 3720 gggaagacaa tagcaggcat gctggggatg cggtgggctc
tatggcttct gaggcggaaa 3780 gaaccaggat cccccgccgc cggacgaact
aaacctgact acggcatctc tgccccttct 3840 tcgctggtac gaggagcgct
tttgttttgt attggtcacg gggcagtgca tgtaatccct 3900 tcagttggtt
ggtacaactt gccaactggg ccctgttcca catgtgacac ggggggggac 3960
caaacacaaa ggggttctct gactgtagtt gacatcctta taaatggatg tgcacatttg
4020 ccaacactga gtggctttca tcctggagca gactttgcag tctgtggact
gcaacacaac 4080 attgccttta tgtgtaactc ttggctgaag ctcttacacc
aatgctgggg gacatgtacc 4140 tcccaggggc ccaggaagac tacgggaggc
tacaccaacg tcaatcagag gggcctgtgt 4200 agctaccgat aagcggaccc
tcaagagggc attagcaata gtgtttataa ggcccccttg 4260 ttaaccctaa
acgggtagca tatgcttccc gggtagtagt atatactatc cagactaacc 4320
ctaattcaat agcatatgtt acccaacggg aagcatatgc tatcgaatta gggttagtaa
4380 aagggtccta aggaacagcg atatctccca ccccatgagc tgtcacggtt
ttatttacat 4440 ggggtcagga ttccacgagg gtagtgaacc attttagtca
caagggcagt ggctgaagat 4500 caaggagcgg gcagtgaact ctcctgaatc
ttcgcctgct tcttcattct ccttcgttta 4560 gctaatagaa taactgctga
gttgtgaaca gtaaggtgta tgtgaggtgc tcgaaaacaa 4620 ggtttcaggt
gacgccccca gaataaaatt tggacggggg gttcagtggt ggcattgtgc 4680
tatgacacca atataaccct cacaaacccc ttgggcaata aatactagtg taggaatgaa
4740 acattctgaa tatctttaac aatagaaatc catggggtgg ggacaagccg
taaagactgg 4800 atgtccatct cacacgaatt tatggctatg ggcaacacat
aatcctagtg caatatgata 4860 ctggggttat taagatgtgt cccaggcagg
gaccaagaca ggtgaaccat gttgttacac 4920 tctatttgta acaaggggaa
agagagtgga cgccgacagc agcggactcc actggttgtc 4980 tctaacaccc
ccgaaaatta aacggggctc cacgccaatg gggcccataa acaaagacaa 5040
gtggccactc ttttttttga aattgtggag tgggggcacg cgtcagcccc cacacgccgc
5100 cctgcggttt tggactgtaa aataagggtg taataacttg gctgattgta
accccgctaa 5160 ccactgcggt caaaccactt gcccacaaaa ccactaatgg
caccccgggg aatacctgca 5220 taagtaggtg ggcgggccaa gataggggcg
cgattgctgc gatctggagg acaaattaca 5280 cacacttgcg cctgagcgcc
aagcacaggg ttgttggtcc tcatattcac gaggtcgctg 5340 agagcacggt
gggctaatgt tgccatgggt agcatatact acccaaatat ctggatagca 5400
tatgctatcc taatctatat ctgggtagca taggctatcc taatctatat ctgggtagca
5460 tatgctatcc taatctatat ctgggtagta tatgctatcc taatttatat
ctgggtagca 5520 taggctatcc taatctatat ctgggtagca tatgctatcc
taatctatat ctgggtagta 5580 tatgctatcc taatctgtat ccgggtagca
tatgctatcc taatagagat tagggtagta 5640 tatgctatcc taatttatat
ctgggtagca tatactaccc aaatatctgg atagcatatg 5700 ctatcctaat
ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagcatagg 5760
ctatcctaat ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagtatatg
5820 ctatcctaat ttatatctgg gtagcatagg ctatcctaat ctatatctgg
gtagcatatg 5880 ctatcctaat ctatatctgg gtagtatatg ctatcctaat
ctgtatccgg gtagcatatg 5940 ctatcctcat gcatatacag tcagcatatg
atacccagta gtagagtggg agtgctatcc 6000 tttgcatatg ccgccacctc
ccaagggggc gtgaattttc gctgcttgtc cttttcctgc 6060 tggttgctcc
cattcttagg tgaatttaag gaggccaggc taaagccgtc gcatgtctga 6120
ttgctcacca ggtaaatgtc gctaatgttt tccaacgcga gaaggtgttg agcgcggagc
6180 tgagtgacgt gacaacatgg gtatgcccaa ttgccccatg ttgggaggac
gaaaatggtg 6240 acaagacaga tggccagaaa tacaccaaca gcacgcatga
tgtctactgg ggatttattc 6300 tttagtgcgg gggaatacac ggcttttaat
acgattgagg gcgtctccta acaagttaca 6360 tcactcctgc ccttcctcac
cctcatctcc atcacctcct tcatctccgt catctccgtc 6420 atcaccctcc
gcggcagccc cttccaccat aggtggaaac cagggaggca aatctactcc 6480
atcgtcaaag ctgcacacag tcaccctgat attgcaggta ggagcgggct ttgtcataac
6540 aaggtcctta atcgcatcct tcaaaacctc agcaaatata tgagtttgta
aaaagaccat 6600 gaaataacag acaatggact cccttagcgg gccaggttgt
gggccgggtc caggggccat 6660 tccaaagggg agacgactca atggtgtaag
acgacattgt ggaatagcaa gggcagttcc 6720 tcgccttagg ttgtaaaggg
aggtcttact acctccatat acgaacacac cggcgaccca 6780 agttccttcg
tcggtagtcc tttctacgtg actcctagcc aggagggccc ttaaaccttc 6840
tgcaatgttc tcaaatttcg ggttggaacc tccttgacca cgatgctttc caaaccaccc
6900 tccttttttg cgcctgcctc catcaccctg accccggggt ccagtgcttg
ggccttctcc 6960 tgggtcatct gcggggccct gctctatcgc tcccgggggc
acgtcaggct caccatctgg 7020 gccaccttct tggtggtatt caaaataatc
ggcttcccct acagggtgga aaaatggcct 7080 tctacctgga gggggcctgc
gcggtggaga cccggatgat gatgactgac tactgggact 7140 cctgggcctc
ttttctccac gtccacgacc tctccccctg gctctttcac gacttccccc 7200
cctggctctt tcacgtcctc taccccggcg gcctccacta cctcctcgac cccggcctcc
7260 actacctcct cgaccccggc ctccactgcc tcctcgaccc cggcctccac
ctcctgctcc 7320 tgcccctcct gctcctgccc ctcctcctgc tcctgcccct
cctgcccctc ctgctcctgc 7380 ccctcctgcc cctcctgctc ctgcccctcc
tgcccctcct gctcctgccc ctcctgcccc 7440 tcctcctgct cctgcccctc
ctgcccctcc tcctgctcct gcccctcctg cccctcctgc 7500 tcctgcccct
cctgcccctc ctgctcctgc ccctcctgcc cctcctgctc ctgcccctcc 7560
tgctcctgcc cctcctgctc ctgcccctcc tgctcctgcc cctcctgccc ctcctgcccc
7620 tcctcctgct cctgcccctc ctgctcctgc ccctcctgcc cctcctgccc
ctcctgctcc 7680 tgcccctcct cctgctcctg cccctcctgc ccctcctgcc
cctcctcctg ctcctgcccc 7740 tcctgcccct cctcctgctc ctgcccctcc
tcctgctcct gcccctcctg cccctcctgc 7800 ccctcctcct gctcctgccc
ctcctgcccc tcctcctgct cctgcccctc ctcctgctcc 7860 tgcccctcct
gcccctcctg cccctcctcc tgctcctgcc cctcctcctg ctcctgcccc 7920
tcctgcccct cctgcccctc ctgcccctcc tcctgctcct gcccctcctc ctgctcctgc
7980 ccctcctgct cctgcccctc ccgctcctgc tcctgctcct gttccaccgt
gggtcccttt 8040 gcagccaatg caacttggac gtttttgggg tctccggaca
ccatctctat gtcttggccc 8100 tgatcctgag ccgcccgggg ctcctggtct
tccgcctcct cgtcctcgtc ctcttccccg 8160 tcctcgtcca tggttatcac
cccctcttct ttgaggtcca ctgccgccgg agccttctgg 8220 tccagatgtg
tctcccttct ctcctaggcc atttccaggt cctgtacctg gcccctcgtc 8280
agacatgatt cacactaaaa gagatcaata gacatcttta ttagacgacg ctcagtgaat
8340 acagggagtg cagactcctg ccccctccaa cagccccccc accctcatcc
ccttcatggt 8400 cgctgtcaga cagatccagg tctgaaaatt ccccatcctc
cgaaccatcc tcgtcctcat 8460 caccaattac tcgcagcccg gaaaactccc
gctgaacatc ctcaagattt gcgtcctgag 8520 cctcaagcca ggcctcaaat
tcctcgtccc cctttttgct ggacggtagg gatggggatt 8580 ctcgggaccc
ctcctcttcc tcttcaaggt caccagacag agatgctact ggggcaacgg 8640
aagaaaagct gggtgcggcc tgtgaggatc agcttatcga tgataagctg tcaaacatga
8700 gaatt 8705 15 29 DNA Artificial Sequence CatCass1 15
ctgatgaggt cgcgactagt gttgacaat 29 16 27 DNA Artificial Sequence
CatCass2 16 ttcggtctcg cgagcaggtt agtgaca 27 17 5658 DNA Artificial
Sequence pBK 17 ctagttctgg cgcagaacca tggcctttgt ccagtttaac
tggggacaag gccaagattc 60 ctaggctcgc aaaacatgtc tgtcatgcac
tttccttcct gaggtcatgg tttggctgca 120 ttccatgggt aagcagctcc
tccctgtgag tcatgcactt tccttcctga ggtcatggtt 180 tggctgcatt
cccctgtgag tcatgcactt tccttcctga ggtcatggtt tggctgcatt 240
ccatgggtaa gcagctcctc cctgtggcct ttttttttat aatatataag aggccgaggc
300 cgcctctgcc tccacccttt ctctcaagta gtaagggtgt ggaggctttt
tctgaggcct 360 agcaaaacta tttggggaaa tccctattct tttgcaattt
ttgcaaaaat ggataaagtt 420 cttaacaggg aagaatccat ggagctcatg
gaccttttag gccttgaaag agctgcctgg 480 ggaaatcttc ccttaatgag
aaaagcttat ttaaggaagt gtaaggaatt tcatcctgac 540 aaagggggcg
acgaggataa aatgaagaga atgaatactt tgtataaaaa aatggagcag 600
gatgtaaagg tagctcatca gcctgatttt ggaacttgga gtagctcaga ggtttgtgct
660 gattttcctc tttgcccaga taccctgtac tgcaaggaat ggcctatttg
ttccaaaaag 720 ccttctgtgc actgcccttg catgctatgt cagcttagat
taaggcattt aaatagaaaa 780 tttttaagaa aagagccctt ggtttggata
gattgctact gcattgactg cttcacacag 840 tggtttggct tagacctaac
tgaagaaact ctgcaatggt gggtccaaat aattggagaa 900 actcccttca
gagatctaaa gctttaaggt aactaactta tatttagata aataataaaa 960
tattaaaagg ccctaagtaa ttattttttt tataggtgcc aacctatgga acagaagagt
1020 gggagtcctg gtggagttcc tttaatgaaa aatgggatga agatttattt
tgccatgaag 1080 atatgtttgc cagtgatgaa gaagcaacag cagattctca
acactcaaca ccacccaaaa 1140 aaaaaagaaa ggtagaagac cctaaagact
ttccctctga tctacaccag tttcttagtc 1200 aagctgtatt tagtaataga
acccttgcct gctttgctgt gtatactact aaagaaaaag 1260 ctcaaattct
gtataaaaaa cttatggaaa aatattctgt aacttttatt agtagacaca 1320
tgtgtgctgg gcataatatt atattctttt taactccaca tagacataga gtttctgcaa
1380 ttaataattt ctgtcaaaag ctgtgtacct ttagtttttt aatttgtaag
ggtgttaata 1440 aggaatactt actatatagt gccttaacta gagatccata
ccatactata gaagaaagca 1500 ttcaaggggg cttaaaggag catgatttta
gcccagaaga gcctgaagaa acaaagcagg 1560 tgtcttggaa attaattact
gagtatgcag tagagacaaa gtgtgaggat gtgtttttat 1620 tattaggtat
gtatttagaa tttcaataca atgtagagga gtgtaaaaag tgtcagaaaa 1680
aagaccagcc ttatcacttt aagtatcatg aaaagcactt tgcaaatgct attatttttg
1740 cagaaagtaa aaatcaaaaa agtatttgtc agcaagcagt agatacagtt
ttagctaaaa 1800 aaagagtaga tacccttcat atgaccaggg aagaaatgct
aacagaaaga ttcaatcata 1860 tattagataa aatggattta atatttggag
ctcatggaaa tgctgtacta gaacaatata 1920 tggcaggtgt tgcttggctg
cactgtttgc tacctaaaat ggattctgta atatttgatt 1980 ttttgcactg
tattgttttc aatgtaccta aaagaagata ctggttattt aaaggtccca 2040
ttgatagtgg aaaaacaaca ctagctgccg ggttattaga tttgtgtggt ggtaaagcct
2100 taaatgtaaa cctacccatg gaaaggctaa cctttgagct aggtgtagct
atagatcagt 2160 acatggttgt ttttgaagat gtaaaaggga caggagctga
atcaaaggat ttgccttcag 2220 gacatggaat aaacaattta gacagtttga
gagattattt agatggaagt gttaaggtaa 2280 atttagaaaa gaaacattta
aacaaaagaa cccaaatatt tccaccaggc ttggttacaa 2340 tgaatgagta
tcctgtccct aaaaccctgc aagctagatt tgtaagacaa atagatttta 2400
ggcccaaaat atatttaaga aaatccttac aaaactcaga gttcttactt gaaaaaagaa
2460 ttttacaaag tggaatgacc ttgttgctac tgctaatttg gtttaggcct
gtagctgatt 2520 ttgcaactga tatacaatct agaattgttg aatggaagga
aaggctggat tctgagataa 2580 gtatgtatac tttttcaagg atgaaatata
atatatgctt ggggaaatgt attcttgata 2640 ttacaagaga agaggattca
gaaactgaag actctggaca tggatcaagc actgaatccc 2700 aatcacaatg
ctcttcccaa gtctcagata cttcagcccc tgctgaagat tcccaaaggt 2760
cagaccccca tagtcaagag ttgcatttgt gtaaaggctt tcagtgtttt aaaaggccta
2820 aaacaccacc cccaaaataa cacaagctta aaagtggctt atacaaaagc
agcatttatt 2880 aaatgtatat gtacaataaa agcacctgtt taaagcattt
tggtttgcaa ttgtccctgt 2940 ttgtcaatat atcttatcat atctgggtcc
cctggaagta actagatgat ccgctgtgga 3000 atgtgtgtca gttagggtgt
ggaaagtccc caggctcccc agcaggcaga agtatgcaaa 3060 gcatctcaat
tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag 3120
tatgcaaagt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc
3180 cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga
cccccgccca 3240 ttgacgtcaa taatgacgta tgttcccata gtaacgccaa
tagggacttt ccattgacgt 3300 caatgggtgg agtatttacg gtaaactgcc
cacttggcag tacatcaagt gtatcatatg 3360 ccaagtacgc cccctattga
cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 3420 tacatgacct
tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 3480
accatggcga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt tgactcacgg
3540 ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca
ccaaaatcaa 3600 cgggactttc caaaatgtcg taacaactcc gccccattga
cgcaaatggg cggtaggcgt 3660 gtacggtggg aggtctatat aagcagagct
ggtttagtga accgtcagat ccgctagcgc 3720 taccggactc agatctcgag
ctcaagctaa tcatcggcat agtatatcgg catagtataa 3780 tacgactcac
tataggaggg ccaccatggc caagttgacc agtgccgttc cggtgcttac 3840
cgcgcgcgac gtcgccggag cggtcgagtt ctggaccgac cggctcgggt tctcccggga
3900 cttcgtggag gacgacttcg ccggtgtggt ccgggacgac gtgaccctgt
tcatcagcgc 3960 ggtccaggac caggtggtgc cggacaacac cctggcctgg
gtgtgggtgc gcggcctgga 4020 cgagctgtac gccgagtggt cggaggtcgt
gtccacgaac ttccgggacg cctccgggcc 4080 ggccatgacc gagatcggcg
agcagccgtg ggggcgggag ttcgccctgc gcgacccggc 4140 cggcaactgc
gtgcacttcg tggccgagga gcaggactga ccgacgccga ccaacaccgc 4200
cggggggagg ctaactgaaa cacggaagga gacaataccg gaaggaaccc gcgctatgac
4260 ggcaataaaa agacagaata aaacgcacgg tgttgggtcg tttgttcata
aacgcggggt 4320 tcggtcccag ggctggcact ctgtcgatac cccaccgacg
gcggcccacg ggtcgaattg 4380 cgcttccctg atgagaccga aaggtcgaaa
gtcgaaagac tcggaagcga aagcttggtg 4440 atgcattcga tatcgtttaa
acgcccgggc gcggccgcgg cgcctccagt cgacgaaagt 4500 cggtctgccg
aaaggcactg atgagtccga aaggacgaaa ccgacttgct agataactga 4560
tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac ctcccacacc
4620 tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg
tttattgcag 4680 cttataatgg ttacaaataa agcaatagca tcacaaattt
cacaaataaa gcattttttt 4740 cactgcattc tagttgtggt ttgtccaaac
tcatcaatgt atcttaacgc gtaaattgta 4800 agcgttaatc atgcggccca
tgaccaaaat cccttaacgt gagttttcgt tccactgagc 4860 gtcagacccc
gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 4920
ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga
4980 gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac
caaatactgt 5040 ccttctagtg tagccgtagt taggccacca cttcaagaac
tctgtagcac cgcctacata 5100 cctcgctctg ctaatcctgt taccagtggc
tgctgccagt ggcgataagt cgtgtcttac 5160 cgggttggac tcaagacgat
agttaccgga taaggcgcag cggtcgggct gaacgggggg 5220 ttcgtgcaca
cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 5280
tgagcattga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag
5340 cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg
cctggtatct 5400 ttatagtcct gtcgggtttc gccacctctg acttgagcgt
cgatttttgt gatgctcgtc 5460 aggggggcgg agcctatgga aaaacgccag
caacgcggcc tttttacggt tcctggcctt 5520 ttgctggcct tttgctcaca
tgttctttcc tgcgttatcc cctgattctg tggataaccg 5580 tattaccgcc
tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga 5640
gtcagtgagc gaggaagc 5658 18 178 DNA Artificial Sequence
Multi-cloning sequence flanked by two cis-acting ribozymes (CAR's).
18 gagctcgctt ccctgatgag tccgaaagga cgaaagtcga aagactcgga
agcgaaagct 60 tggtgatgca ttcgatatcg tttaaacgcc cgggcgcggc
cgcggcgcct ccagtcgacg 120 aaagtcggtc tgccgaaagg cactgatgag
tccgaaagga cgaaaccgac ttggtacc 178 19 14 DNA herpes simplex virus
19 cgacgccgcc cgcc 14 20 13 DNA herpes simplex virus 20 ctgcgcgcgt
ggc 13 21 14 DNA herpes simplex virus 21 gcgcctgcgc gggg 14 22 14
DNA herpes simplex virus 22 cgccgccgac gcgc 14 23 13 DNA herpes
simplex virus 23 ccccctcccc gcg 13 24 14 DNA herpes simplex virus
24 gtggccgtgt cgcg 14 25 14 DNA herpes simplex virus 25 gccacacggc
ggcg 14 26 14 DNA herpes simplex virus 26 cgccgcgcgg tgcg 14 27 14
DNA herpes simplex virus 27 cgccgcgcgg tgcg 14 28 15 DNA herpes
simplex virus 28 ccccctgcgc gcctc 15 29 15 DNA herpes simplex virus
29 ggtggtgctg tactc 15 30 14 DNA herpes simplex virus 30 gggcccgcgg
tgtc 14 31 14 DNA herpes simplex virus 31 cctggcgtgc gagc 14 32 21
DNA herpes simplex virus 32 ggggaccacc gacgccatgg c 21 33 14 DNA
herpes simplex virus 33 cgtggcgctg gggc 14 34 14 DNA herpes simplex
virus 34 cgggattcgc tggg 14 35 15 DNA Artificial Sequence Portion
of a multiple cloning site for use in making deletion libraries. 35
ggtgatgcat tcgat 15 36 38 DNA Artificial Sequence Portion of a
multiple cloning site for use in making deletion libraries. 36
atcgtttaaa cgcccgggcg cggccgcggc gcctccag 38 37 10 DNA Artificial
Sequence Portion of a multiple cloning site for use in making
deletion libraries. 37 ctggaggcgc 10 38 22 DNA Artificial Sequence
Portion of an intermediate in the making of a deletion library,
including a portion of a multiple cloning site. 38 nnnnnnnnnn
nnnnnnctcc ag 22 39 25 DNA Artificial Sequence 14 bp variable
sequence fragment of a deletion library including flanking portions
of multiple cloning site. 39 ggtgannnnn nnnnnnnnnc tccag 25 40 35
RNA Artificial Sequence A hammerhead ribozyme comprising a
catalytic core flanked by variable recognition domains. 40
nnnnnnncug augaggucgc gagaccgaaa nnnnn 35 41 14 RNA Artificial
Sequence A target substrate comprising variable sequence regions
flanking a cleavage site. 41 nnnnnuhnnn nnnn 14 42 12 DNA
Artificial Sequence A portion of an antisense library including an
HphI site. 42 ggtgannnnn nn 12 43 12 DNA Artificial Sequence A
portion of an antisense library including a BpmI site. 43
nnnnnnctcc ag 12 44 15 DNA Artificial Sequence A sequence flanking
a chloramphenicol (CAT) gene and containing an NruI site. 44
ctgatgaggt cgcga 15 45 14 DNA Artificial Sequence A sequence
flanking a chloramphenicol (CAT) gene and containing an NruI site.
45 tcgcgagagc cgaa 14 46 27 DNA Artificial Sequence Sequence
flanking a chloramphenicol (CAT) gene after insertion of the
antisense library. 46 ggtgannnnn nnctgatgag gtcgcga 27 47 25 DNA
Artificial Sequence Sequence flanking the chloramphenicol (CAT)
gene after insertion into the antisense library. 47 tcgcgagacc
gaannnnnnc tccag 25 48 46 DNA Artificial Sequence Hammerhead
ribozyme library with flanking sequences. 48 ggtgannnnn nnctgatgag
gtcgcgagac cgaannnnnn ctccag 46 49 20 DNA Artificial Sequence
Deletion fragment in a deletion fragment library, including a
portion of a multiple cloning site. 49 nnnnnnnnnn nnnnctccag 20 50
53 DNA Artificial Sequence Multiple cloning site for use in making
deletion libraries. 50 tgcattcgat atcgtttaaa cgcccgggcg cggccgcggc
gcctccagtc gac 53
* * * * *