U.S. patent application number 10/153401 was filed with the patent office on 2003-06-19 for monoclonal antibody 1a7 and use for the treatment of melanoma and small cell carcinoma.
Invention is credited to Chatterjee, Malaya, Chatterjee, Sunil K., Foon, Kenneth A..
Application Number | 20030114398 10/153401 |
Document ID | / |
Family ID | 27005857 |
Filed Date | 2003-06-19 |
United States Patent
Application |
20030114398 |
Kind Code |
A1 |
Chatterjee, Malaya ; et
al. |
June 19, 2003 |
Monoclonal antibody 1A7 and use for the treatment of melanoma and
small cell carcinoma
Abstract
The present invention relates to monoclonal antibody 1A7. This
is an anti-idiotype produced by immunizing with an antibody
specific for ganglioside GD2, and identifying a hybridoma secreting
antibody with immunogenic potential in a multi-step screening
process. Also disclosed are polynucleotide and polypeptide
derivatives based on 1A7, including single chain variable region
molecules and fusion proteins, and various pharmaceutical
compositions. When administered to an individual, the 1A7 antibody
overcomes immune tolerance and induces an immune response against
GD2, which comprises a combination of anti-GD2 antibody and
GD2-specific T cells. The invention further provides methods for
treating a disease associated with altered GD2 expression,
particularly melanoma, neuroblastoma, glioma, soft tissue sarcoma,
and small cell carcinoma Patients who are in remission as a result
of traditional modes of cancer therapy may be treated with a
composition of this invention in hopes of reducing the risk of
recurrence.
Inventors: |
Chatterjee, Malaya; (Fort
Wright, KY) ; Foon, Kenneth A.; (Fremont, CA)
; Chatterjee, Sunil K.; (Fort Wright, KY) |
Correspondence
Address: |
Catherine M. Polizzi
Morrison & Foerster LLP
755 Page Mill Road
Palo Alto
CA
94304-1018
US
|
Family ID: |
27005857 |
Appl. No.: |
10/153401 |
Filed: |
May 21, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10153401 |
May 21, 2002 |
|
|
|
09293533 |
Apr 15, 1999 |
|
|
|
09293533 |
Apr 15, 1999 |
|
|
|
08372676 |
Jan 17, 1995 |
|
|
|
5612030 |
|
|
|
|
09293533 |
Apr 15, 1999 |
|
|
|
08591196 |
Jan 16, 1996 |
|
|
|
5977316 |
|
|
|
|
Current U.S.
Class: |
514/42 ;
424/277.1 |
Current CPC
Class: |
C12N 2799/023 20130101;
A61K 39/395 20130101; C07K 16/3084 20130101; A61K 39/285 20130101;
C07K 16/4241 20130101; C07K 14/55 20130101; A61K 2039/55577
20130101; C12N 15/86 20130101; C07K 2317/622 20130101; C07K 2319/30
20130101; G01N 33/574 20130101; C07K 16/4266 20130101; A61P 35/00
20180101; C12Q 1/68 20130101; C07K 2319/00 20130101; A61K 2039/505
20130101; A61K 2039/53 20130101; A61P 37/04 20180101; C07K 2317/56
20130101; C07K 14/535 20130101; G01N 33/577 20130101; C12N
2710/24143 20130101; C07K 2317/24 20130101; A61K 48/00 20130101;
A61K 39/00 20130101 |
Class at
Publication: |
514/42 ;
424/277.1 |
International
Class: |
A61K 031/739; A61K
039/00 |
Goverment Interests
[0002] This invention was made in part during work supported by a
grant from the United States Public Health Service (CA72018). The
government has certain rights in the invention.
Claims
What is claimed as the invention is:
1. Monoclonal antibody 1A7.
2. An antibody producing cell deposited under ATCC Accession No.
HB-11786, and the progeny thereof.
3. An antibody producing cell having all the identifying
characteristics of a cell according to claim 2.
4. A purified antibody having identifying characteristics identical
to antibody produced by a cell according to claim 2.
5. A polynucleotide comprising a sequence encoding a polypeptide
with immunological activity of monoclonal antibody 1A7, wherein the
polypeptide comprises at least 5 consecutive amino acids from a
variable region of monoclonal antibody 1A7.
6. A polynucleotide according to claim 5, wherein the variable
region is from a light chain.
7. A polynucleotide according to claim 5, wherein the variable
region is from a heavy chain.
8. The polynucleotide of claim 5, wherein the 5 consecutive amino
acids is contained in SEQ. ID NO:2.
9. The polynucleotide of claim 5, wherein the 5 consecutive amino
acids is contained in SEQ. ID NO:4.
10. The polynucleotide of claim 5, wherein the encoding sequence is
contained in SEQ. ID NO:1.
11. The polynucleotide of claim 5, wherein the encoding sequence is
contained in SEQ. ID NO:3.
12. An polynucleotide according to claim 5, wherein the
polynucleotide encodes at least 5 consecutive amino acids of a
complementarity determining region (CDR).
13. An isolated polynucleotide comprising a region of at least 20
consecutive nucleotides that is capable of forming a stable duplex
with a polynucleotide consisting of the light chain variable region
encoding sequence of SEQ. ID NO:1 under conditions where the region
does not form a stable hybrid with a polynucleotide consisting of a
variable region encoding sequence of a sequence selected from the
group consisting of SEQ. ID NOS:17-26.
14. An isolated polynucleotide comprising a region of at least 20
consecutive nucleotides that is capable of forming a stable duplex
with a polynucleotide consisting of the heavy chain variable region
encoding sequence of SEQ. ID NO:3 under conditions where the region
does not form a stable hybrid with a polynucleotide consisting of a
variable region encoding sequence of a sequence selected from the
group consisting of SEQ. ID NOS:27-44.
15. A polynucleotide according to claim 5, wherein the
polynucleotide is a cloning vector.
16. A polynucleotide according to claim 5, wherein the
polynucleotide is an expression vector.
17. The expression vector of claim 16, wherein the expression
vector is vaccinia.
18. A host cell comprising a polynucleotide according to claim
5.
19. A polypeptide having immunological activity of monoclonal
antibody 1A7, wherein the polypeptide comprises at least 5
consecutive amino acids from a variable region of monoclonal
antibody 1A7.
20. A polypeptide according to claim 19, wherein life variable
region is from a light chain.
21 A polypeptide according to claim 19, wherein the variable region
is from a heavy chain.
22. The polypeptide of claim 19, wherein the 5 consecutive amino
acids is contained in SEQ. ID NO:2.
23. The polypeptide of claim 19, wherein the 5 consecutive amino
acids is contained in SEQ. ID NO:4.
24. A polypeptide of claim 19, wherein the 5 consecutive amino
acids are from a complementarity determining region (CDR).
25. A fusion polypeptide comprising the polypeptide of claim
19.
26. The fusion polypeptide of claim 25, comprising at least 10
consecutive amino acids of SEQ. ID NO:2 and at least 10 consecutive
amino acids of SEQ. ID NO:4.
27. The fusion polypeptide of claim 26, wherein the amino acids of
SEQ. ID NO:2 and the amino acids of SEQ. ID NO:4 are joined by a
linker polypeptide of 5 to 20 amino acids.
28. The fusion polypeptide of claim 25, comprising a light chain
variable region and a heavy chain variable region of monoclonal
antibody 1A7.
29. The fusion polypeptide of claim 25, further comprising a
cytokine.
30. The fusion polypeptide of claim 29, wherein the cytokine is
GM-CSF.
31. The fusion polypeptide of claim 29, wherein the cytokine is
IL-2.
32. The fusion polypeptide of claim 19 further comprising a
heterologous immunoglobulin constant region.
33. A humanized antibody comprising the polypeptide of claim
19.
34. A polymeric 1A7 polypeptide comprising a plurality of the
polypeptide of claim 19.
35. A pharmaceutical composition comprising monoclonal antibody 1A7
of claim 1 and a pharmaceutically acceptable excipient.
36. A pharmaceutical composition comprising the polynucleotide of
claim 5 and a pharmaceutically acceptable excipient.
37. A pharmaceutical composition comprising the polypeptide of
claim 19 and a pharmaceutically acceptable excipient.
38. A vaccine comprising monoclonal antibody 1A7 of claim 1 and a
pharmaceutically acceptable excipient.
39. A vaccine comprising the polynucleotide of claim 5 and a
pharmaceutically acceptable excipient.
40. A vaccine comprising the polypeptide of claim 19 and a
pharmaceutically acceptable excipient.
41. The vaccine of claim 38, comprising an adjuvant.
42. The vaccine of claim 39, wherein the polynucleotide is
comprised in a viral expression vector.
43. The vaccine of claim 42 wherein the viral expression vector is
vaccinia.
44. A method of eliciting an immune response in an individual,
comprising administering to the individual an effective amount of
the monoclonal antibody 1A7 of claim 1.
45. A method of eliciting an immune response in an individual,
comprising administering to the individual an effective amount of
the polynucleotide of claim 5.
46. A method of eliciting an immune response in an individual,
comprising administering to the individual an effective amount of
the polypeptide of claim 19.
47. A method of treating a GD2-associated disease in an individual,
comprising administering to the individual an effective amount of
the monoclonal antibody 1A7 of claim 1.
48. A method of treating a GD2-associated disease in an individual,
comprising administering to the individual an effective amount of
the polynucleotide of claim 5.
49. A method of treating a GD2-associated disease in an individual,
comprising administering to the individual an effective amount of
the polypeptide of claim 19.
50. The method of claim 47, wherein the GD2-associated disease is
selected from the group consisting of melanoma, neuroblastoma,
glioma, soft tissue sarcoma, and small cell carcinoma.
51. The method of claim 47, wherein the individual has a clinically
detectable tumor.
52. The method of claim 47, which is a method for palliating the
GD2-associated disease.
53. The method of claim 47, wherein a tumor that was previously
detected in the individual has been treated and is clinically
undetectable at the time of the administering of the monoclonal
antibody 1A7.
54. The method of claim 47, which is a method of reducing the risk
of recurrence of a clinically detectable tumor.
55. A method for detecting the presence of an anti-GD2 antibody
bound to a tumor cell comprising contacting the tumor cell with
monoclonal antibody 1A7 according to claim 1 under conditions that
permit the monoclonal antibody 1A7 to bind to the anti-GD2
antibody, and detecting any monoclonal antibody 1A7 that has
bound.
56. A kit for detection or quantitation of an anti-GD2 antibody in
a sample, comprising monoclonal antibody 1A7 according to claim 1
in suitable packaging.
57. A kit for detection or quantitation of an anti-GD2 antibody in
a sample, comprising the polypeptide of claim 19 in suitable
packaging.
58. A kit for detection or quantitation of a polynucleotide with a
1A7 encoding sequence in a sample, comprising the isolated
polynucleotide of claim 13 in suitable packaging.
59. A kit for detection or quantitation of a polynucleotide with a
1A7 encoding sequence in a sample, comprising the isolated
polynucleotide of claim 14 in suitable packaging.
60. A method for detecting an anti-GD2 antibody in a sample,
comprising the steps of: a) contacting antibody in the sample with
the polypeptide of claim 19 under conditions that permit the
formation of a stable antibody-polypeptide complex; and b)
detecting any stable complex formed in step a).
61. Anti-idiotype monoclonal antibody 1A7, having all the
identifying characteristics of ATCC Accession No. HB-11786.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/372,676, filed Jan. 17, 1995; and U.S. Ser. No. 08/591,196,
filed Jan. 16, 1996; both of which are hereby incorporated herein
in their entirety.
BACKGROUND
[0003] In spite of numerous advances in medical research, cancer
remains the second leading cause of death in the United States.
Traditional modes of clinical care, such as surgical resection,
radiotherapy and chemotherapy, have a significant failure rate,
especially for solid tumors. Failure occurs either because the
initial tumor is unresponsive, or because of recurrence due to
regrowth at the original site or metastasis. Cancer remains a
central focus for medical research and development.
[0004] Under the hypothesis that neoplastic cells are normally
regulated by immune surveillance, an attractive approach is to
re-focus the immune system in affected individuals back towards the
tumor. Many types of cancers should be susceptible to the immune
system, because they express unusual antigens that reflect the
oncogenic transformation of the cell. Antibodies or T cells
directed against a target antigen specifically expressed on tumor
cells may be able to recruit immune effector functions, and thereby
eliminate the tumor or mitigate the pathological consequences.
[0005] There are several potential pitfalls in this approach. The
first is that the target tumor antigen may be shed from the cell,
and thereby block the approach of tumor-specific immune components.
The second is that the expression of the target antigen may be
heterologous. In this case, a specific immune response would be
ineffective in a substantial subclass of affected individuals, or
the risk of escape variants would be high The third difficulty is
that tumor-specific antigens are generally antigenically related to
autoantigens, or comprise autoantigens in an a typical mode of
expression. This means that tumor-associated antigens are often
poorly immunogenic; perhaps due to an active and ongoing
immunosuppression against them. Furthermore, cancer patients tend
to be immunosuppressed, and only respond to certain T-dependent
antigens.
[0006] A number of features suggest that gangliosides may be
preferable to other types of target antigens for antibody-mediated
killing of certain tumor types. Gangliosides like GD2 have simple,
well-defined structures, and the level of expression is not
affected by antibody binding. In vitro studies have shown that
monoclonal antibodies against gangliosides like GD2 and GD3
potentiate lymphocyte response which could potentially be directed
towards tumor cells. In addition, certain gangliosides have been
implicated in the adhesion of tumor cells to solid substrates, and
antibodies inhibit this attachment. An immune response against
them, even if not successful in eliminating the tumor cells, could
reduce the extent of pathology.
[0007] In particular, glycosphingolipid GD2 is expressed at high
density by tumors of human neuroectodermal origin; including
malignant melanoma, neuroblastoma, glioma, soft tissue sarcoma and
small cell carcinoma of the lung. The GD2 antigen is absent in most
normal tissues, except for low levels in brain and peripheral
nerve.
[0008] Melanoma is one of the human diseases for which there is an
acute need of new therapeutic modalities. It is a particularly
aggressive form of skin cancer, and occurs in increased frequency
in individuals with regular unguarded sun exposure. In the early
phases, melanoma is characterized by proliferation at the
dermal-epidermal junction, which soon invades adjacent tissue and
metastasizes widely. Worldwide, 70,000 patients are diagnosed and
25,000 deaths are reported each year. The American Cancer Society
projects that by the year 2000, 1 out of every 75 Americans will be
diagnosed with melanoma in their lifetime.
[0009] Fortunately, melanoma is one of the cancers for which
gangliosides hold significant promise as a target antigen
(Livingston (1995) Immunol. Rev. 145:147-166). Increased expression
of GD2 has been observed in a majority of malignant melanoma cells.
Several murine monoclonal anti-GD2 antibodies were reported to
suppress the growth of tumors of neuroectodermal origin in athymic
(nu/nu) mice or cause remission in patients with metastatic
melanoma A human-mouse chimeric anti-GD2 antibody remissions in
patients with metastatic neuroblastoma. The mechanism is thought to
involve antibody dependent cellular cytotoxicity (ADCC) or
complement-mediated cytotoxicity (CMC). Clinical responses have
been obtained by treating with monoclonal antibodies against GM2,
GD2 and GD3. Active immunization with a ganglioside vaccine
comprising GM2 produced anti-GM2 antibodies in 50/58 patients, who
survived longer on average than antibody negative patients.
[0010] Neuroblastoma is a highly malignant tumor occurring during
infancy and early childhood. Except for Wilm's tumor, it is the
most common retroperitoneal tumor in children. This tumor
metastasizes early, with widespread involvement of lymph nodes,
liver, bone, lung, and marrow. While the primary tumor is
resolvable by resection, the recurrence rate is high.
[0011] Small cell lung cancer is the most malignant and fastest
growing form of lung cancer. It accounts for 20-25% of new cases of
lung cancer, and 60,000 cases will be diagnosed in the US in 1996.
The primary tumor is generally responsive to chemotherapy, but is
shortly followed by wide-spread metastasis. The median survival
time at diagnosis is .about.1 year, with a 5 year survival rate of
only 5-10%.
[0012] If there was a simple and reliable therapeutic strategy for
providing immune reactivity against GD2, then the clinical
prospects for these types of cancers might improve.
[0013] Unfortunately, there are several reasons why GD2 is less
than ideal as a component of an active vaccine. For one thing, GD2
is of limited supply, and is difficult to purify. Of course,
because GD2 is a ganglioside, it cannot be generated by simple
recombinant techniques. Secondly, gangliosides in general, and GD2
in particular, are poorly immunogenic. In order to render them more
immunogenic in humans, it has been necessary to conjugate them to
protein carriers like KLH (U.S. Pat. No. 5,308,614; WO
94/16731).
[0014] Similarly, the passive administration of anti-GD2 antibodies
is less than ideal as an approach to long-term care. The amount of
antibody that must be provided passively is substantial. It may
lead to the formation of anti-immunoglobulin or anti-idiotype,
which in turn may lead to diminished responsiveness with each
succeeding dose. And perhaps most importantly, it fails to provide
the host with components of the immune response which may be
critical in tumor eradication; particularly tumor-directed
cytotoxic T cells.
[0015] How else, then, could an active immune response against GD2
be obtained? The network hypothesis of Lindemann and Jeme suggests
a way of overcoming both the natural immune tolerance against GD2,
and the shortage of supply of GD2. It relies on the fact that
antibodies comprise variable region epitopes that themselves may be
immunogenic, leading to the generation of second-level antibodies
called anti-idiotypes. According to the hypothesis, immunization
with a given tumor-associated antigen will generate production of
antibodies against this tumor-associated antigen (Ab1), which is
purified and used in a second round of immunization to generate the
anti-idiotype (Ab2). Some of these Ab2 molecules (called Ab2.beta.)
fit into the paratopes of Ab1, and can be used as surrogate
tumor-associated antigens. Thus, immunization with Ab2.beta. can
lead to the generation of anti-anti-idiotype antibodies (Ab3) that
recognize the corresponding original tumor-associated antigen
identified by Ab1. The idea is that the Ab2 presents a feature that
is structurally related to the tumor antigen in a different context
that makes it more immunogenic.
[0016] Accordingly, efforts have been made elsewhere using
anti-idiotypes to elicit a response against various
tumor-associated antigens. One group of investigators raised an
anti-idiotype related to the melanoma associated ganglioside
GM.sub.3 (Kanda et al., Yamamoto et al., Hastings et al.). Saleh et
al. and Cheung et al. have raised anti-idiotypes against GD2. Other
anti-idiotypes have entered early clinical trials: for example,
Mittelman et al. are using an anti-idiotype related to a high
molecular weight melanoma associated antigen (MAA). Chattopadhyay
et al. have developed anti-idiotypes against a melanoma-associated
proteoglycan. Chapman et al are treating melanoma patients with an
anti-idiotype related to ganglioside GD3. Most of these trials are
still at about the phase I level, with results still pending.
[0017] It is important to emphasize that every potential
anti-idiotype for use in tumor therapy must be evaluated on a
case-by-case basis. First, only a fraction of antibodies raised
against an Ab1 are limited in their reactivity against the paratope
of the Ab1 (i.e., non-reactive against features shared with other
potential antibodies in the host individual). Second,
anti-idiotypes are not necessarily immunogenic. Third, only a
fraction of immunogenic anti-idiotypes elicit a response against
the original tumor antigen and not against other antigens with less
tissue specificity. These properties are related to the structure
of the anti-idiotype, including the amino acid sequence of its
variable regions. Different anti-idiotypes raised against the same
Ab1 will be different in this respect, and must be evaluated
separately. Furthermore, the anti-tumor response elicited will
depend on the immunological status of the individual being
immunized.
SUMMARY OF THE INVENTION
[0018] This disclosure outlines a particular monoclonal
anti-idiotype antibody, designated 1A7. This antibody has been
established as being capable of eliciting an anti-GD2 response. It
has all the desirable properties that provide for escaping immune
tolerance to GD2, and is appropriate for treating GD2-associated
disease.
[0019] Also described are a number of other compounds derived from
1A7. These include in particular polynucleotides and polypeptides
based on the 1A7 heavy and light chain variable regions, which
distinguish 1A7 from other immunoglobulin molecules. A wide range
of such products are contemplated. Preferred derivative compounds
include a humanized version of intact 1A7, polypeptide fragments
from the complementarity determining regions of the 1A7 heavy
chain, and a vaccinia virus vector comprising an encoding region
for a 1A7 variable region. Especially preferred compounds include a
1A7 antibody fusion molecule comprising a polypeptide region with
GM-CSF or IL-2 attached to the heavy chain constant region, a
single-chain V.sub.H-V.sub.L or V.sub.L-V.sub.H variable region,
and polynucleotides encoding such polypeptides.
[0020] The compounds and compositions of this invention may be used
inter alia for eliciting a humoral or cellular immune response in
an individual. They may be used for detecting or treating a GD-2
associated disease; including therapy of advanced disease, and
prophylactic care, particularly for decreasing the risk of
recurrence in an adjuvant setting. Accordingly, this invention
embodies monoclonal antibody 1A7, and a hybridoma cell line that
produces it. Also included are antibodies having identifying
characteristics of 1A7.
[0021] Another embodiment of this invention is a polynucleotide
comprising a sequence encoding a polypeptide with immunological
activity of monoclonal antibody 1A7, wherein the polypeptide
comprises at least 5 consecutive amino acids from a variable region
of monoclonal antibody 1A7. The variable region may be from either
the 1A7 light chain or heavy chain. The 5 consecutive amino acids
preferably play a role in 1A7 immunologic reactivity, and may be
from a complementarity determining region. Another embodiment is an
isolated polynucleotide of at least 20 consecutive nucleotides
capable of forming a stable duplex with the 1A7 light or heavy
chain encoding sequence, but not with encoded sequences for other
previously described immunoglobulin molecules. Any of these
polynucleotides may be in the form of cloning vectors, expression
vectors, or transfected into host cells.
[0022] Also embodied is a polypeptide having immunological activity
of monoclonal antibody 1A7, wherein the polypeptide comprises at
least 5 consecutive amino acids from a variable region of
monoclonal antibody 1A7. The variable region may be from a light
chain or heavy chain. The 5 consecutive amino acids preferably play
a role in 1A7 immunologic reactivity, and may be from a
complementarity determining region. Intact 1A7, functionally active
fragments of 1A7, fusion proteins, humanized antibodies, multiple
antigen proteins, and other polypeptide derivatives of 1A7 are
included. Of special interest are single-chain variable regions and
fusion proteins comprising a cytokine.
[0023] Another embodiment is a pharmaceutical composition or
vaccine, comprising monoclonal antibody 1A7, a polynucleotide of
this invention, or a polypeptide of this invention, and a
pharmaceutically acceptable excipient.
[0024] A further embodiment of this invention is a method of
eliciting an immune response in an individual, comprising
administering to the individual an effective amount of monoclonal
antibody 1A7, or a polynucleotide or polypeptide of this invention.
The immune response may comprise either humoral or cellular
immunity, preferably both.
[0025] Yet another embodiment is a method of treating a
GD2-associated disease in an individual, comprising administering
monoclonal antibody 1A7, or a polynucleotide or polypeptide of this
invention. The disease may be melanoma, neuroblastoma, glioma, soft
tissue sarcoma, and small cell carcinoma. The individual may have a
clinically detectable tumor, or the tumor may have been previously
treated and rendered undetectable. The method may be for palliating
the disease, or for reducing the risk of recurrence.
[0026] A further embodiment of this invention is a kit for
detection or quantitation of an anti-GD2 antibody or a 1A7
polynucleotide in a sample, comprising monoclonal antibody 1A7 or a
polynucleotide or polypeptide of this invention in suitable
packaging. Also embodied are methods for detecting such antibodies
or polynucleotides by employing a reagent or kit embodied in this
invention.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIG. 1 is a depiction of the cDNA sequence (SEQ ID NO:1) and
the amino acid sequence (SEQ ID NO:2) of the light chain variable
region of 1A7 and adjoining residues.
[0028] FIG. 2 is a depiction of the cDNA sequence (SEQ ID NO:3) and
the amino acid sequence (SEQ ID NO:4) of the heavy chain variable
region of 1A7 and adjoining residues.
[0029] FIG. 3 is a listing in which the amino acid sequences of the
1A7 variable region are compared with 15 light and heavy chain
immunoglobulin sequences from the prior art. Panel A (amino acids 1
through 112 of SEQ. ID NO:2) shows the light chain comparison;
Panel B (SEQ. ID NOS:5-14) shows the heavy chain comparison. Panel
C shows variable region consensus sequences for the light and heavy
chains (SEQ. ID NOS:15-16), and compares them with those of 1A7.
The variable region of 1A7 shows splicing differences about the VDJ
junction of the heavy chain, and an additional 16 point
differences.
[0030] FIG. 4 is a graph depicting the binding of monkey Ab3 to Ab2
(1A7) by sandwich radioimmunoassay. Open squares denote Ab3 from
monkey PRO#685; open circles denote Ab3 from monkey PRO#778.
[0031] FIG. 5 is a bar graph depicting inhibition of Ab1-Ab2
binding by monkey Ab3 or vice-versa). For each pair of bars, the
left hand bar denotes Ab2-Ab3 with labeled Ab1; the right hand bar
denotes Ab1-Ab3 with labeled Ab2.
[0032] FIG. 6 is a bar graph depicting inhibition of binding of
.sup.125I labeled 14G2a antibody to GD2 positive melanoma cell line
M21/P6 in the presence of different concentrations of Ab1 and
monkey Ab3. Parallel inhibition curves were obtained using either
purified Ab1 or Ab3 from monkey sera. For each triad of bars, the
left hand bar denotes control binding with 14G2a; the middle
(hatched) bar denotes binding of Ab3 from monkey PRO#685; the right
hand bar denotes binding of Ab3 from monkey PRO#778.
[0033] FIG. 7 is a graph from a FACS analysis of the binding of
monkey Ab3 to tumor cells. Panel A shows the staining observed of
GD2-expressing M21/P6 cells labeled with preimmune and immune Ab3.
Panel B shows the staining observed on another cell line not
expressing Gd2. Panel C shows control staining of M21/P6 cells
using the GD2-specific antibody 14G2a, or no antibody.
[0034] FIG. 8 is a bar graph depicting binding of Ab1 and monkey
Ab3 to different gangliosides by ELISA. For each pair of bars, the
left hand (solid) bar denotes the binding of Ab3 from monkey
PRO#685; the right hand (hatched) bar denotes control binding by
anti-GD2 antibody 14G2a. This experiment shows the antibody induced
upon immunization with the anti-idiotype 1A7 is antigen
specific.
[0035] FIG. 9 is a bar graph depicting inhibition of binding of
.sup.125I-labeled 14G2a antibody to purified GD2 by 14G2a and
monkey Ab3. For each triad of bars, the left hand (solid) bar
denotes monkey PRO#778; the middle (open) bar denotes 14G2a; the
right hand (hatched) bar denotes monkey PRO#685.
[0036] FIG. 10 is a half-tone reproduction of a blot analysis
showing binding of 14G2a and monkey Ab3 to different gangliosides.
Lane 1, monkey PRO#685; lane 2, monkey PRO#778; lane 3, 14G2a; lane
4, monkey anti-IID10; lane 5, PBS-BSA.
[0037] FIG. 11 is a bar graph depicting the proliferation of T
cells obtained from monkeys immunized with monoclonal antibody 1A7,
when they are stimulated in culture using either antibody 1A7 or a
cancer cell line expressing GD2.
[0038] FIG. 12 is two bar graphs depicting the character of Ab3
antibody purified from the sera of human patients treated with
antibody 1A7. Upper panel shows that the Ab3 response comprises
specific antibody to ganglioside GD2 (hatched bars) but not GD3
(solid bars). Lower panel shows that the anti-GD2 response is
predominantly IgG (hatched bars) rather than IgM (solid bars).
[0039] FIG. 13 is two graphs further characterizing purified Ab3
from three human patients. The induced Ab3 inhibits the binding of
anti-GD2 to purified ganglioside GD2 (upper panel) or a
GD2-expressing cancer cell line (lower panel) in a dose-dependent
fashion.
[0040] FIG. 14 is a map of a model plasmid construct for creating a
vaccinia vector comprising a region encoding a 1A7 heavy or light
chain variable region.
[0041] FIG. 15 is a listing of the nucleotide sequence (SEQ. ID
NO:65) and amino acid translation (SEQ. ID NO:66) for a
single-chain variable region molecule (scFv), developed from the
variable region sequences of intact monoclonal antibody 1A7.
[0042] FIG. 16 is a map of a vector plasmid comprising an
expression cassette for a scFv and adapted for administration as a
human polynucleotide vaccine.
[0043] FIG. 17 depicts the 10 polynucleotide sequences that were
most closely matched to the 1A7 light chain variable region
encoding sequence in a database search These sequences have the
designations SEQ. ID NOS:17-26.
[0044] FIG. 18 depicts the 10 polynucleotide sequences that were
most closely matched to the 1A7 heavy chain variable region
encoding sequence in a database search These sequences have the
designations SEQ. ID NOS:27-44.
DETAILED DESCRIPTION
[0045] This invention relates to the discovery of an anti-idiotype
antibody that is capable of recruiting a tumor-specific response
against GD2. The antibody is designated 1A7. The immune response
elicited by 1A7 typically comprises both humoral and cellular
components, and is therefore expected to be useful in palliating
the clinical conditions related to GD2-associated tumors. The
invention comprises the 1A7 antibody molecule, along with
polynucleotide and polypeptide derivatives thereof, and methods for
using these compounds in diagnosis and treatment.
[0046] Cancer patients are typically tolerized to various tumor
associated antigens (TAA), including GD2. 1A7 successfully
circumvents immune tolerance, and elicits an immune response
against GD2. According to the network theory; Ab1 represents
anti-tumor monoclonal antibody; Ab2 represents anti-idiotypic
monoclonal antibody; and Ab3 represents anti-anti-idiotypic
monoclonal antibody. 1A7 is an Ab2 that stimulates Ab3 with the
same specificity as Ab1, and can therefore recruit effector
functions against tumors bearing the tumor antigen. An Ab3 response
reactive against the original TAA is referred to herein as
Ab1'.
[0047] While not wishing to be bound by theory, one explanation is
that the 1A7 combining site may present a region that at least
partly resembles an epitope in GD2 in the context of one or more
other epitopes which render it more immunogenic. The epitope of GD2
which may resemble that of 1A7 is identified by the Ab1 (14G2a)
used to generate 1A7. As a result, 1A7 escapes the normal immune
tolerance against GD2, and is able to elicit an anti-GD2
response.
[0048] FIGS. 1 and 2 show the nucleotide encoding region of the 1A7
light and heavy chain variable regions, respectively, along with
the corresponding amino acid translation. These sequences were
compared with those of other known immunoglobulin molecules
(Example 2). Both the polynucleotide and polypeptide variable
region sequences for 1A7 are unique.
[0049] Amongst the 50 database sequences matched most closely to
that of the 1A7 light chain variable region, none was identical.
1A7 differed from the five closest sequences by 2 substitution
differences at residues 50 and 55, which are contained in the
second CDR. The two differences at these positions were
non-conservative substitutions, and persisted in comparisons with
other light chain sequences.
[0050] Amongst the 50 database sequences matched most closely to
that of the 1A7 heavy chain variable region, none was identical
(FIG. 3, Panels A and B). The following summarizes the main points
deduced from the comparison.
[0051] The closest match was with a heavy chain fragment There were
2 deletions and 12 substitution differences.
[0052] The closest match with a full length heavy chain variable
region had the following features: There were 3 deletions and 17
substitution differences
[0053] 1A7 differed in length from all sequences but one, due to
insertions or deletions of 1 to 8 residues about the VDJ junction.
For the sequence of equal length, there were 26 substitution
differences.
[0054] All other comparisons showed a total of at least 22
insertions, deletions and substitution differences. Differences
appeared throughout the variable region.
[0055] FIG. 3 Panel C provides a comparison of the 1A7 amino acid
light and heavy chain sequences with consensus sequences derived
from the database sequences. Other than splicing differences about
the heavy chain VDJ junction, there appear to be about 16
differences between 1A7and the consensus sequences that have likely
arisen from somatic mutation during antibody maturation.
[0056] Particularly of interest in developing 1A7 derivatives with
1A7 immunologic activity are regions of the polynucleotide or
polypeptide sequence comprising part of the VDJ junction. Also of
interest are regions spanning at least one, preferably 2, and more
preferably 3 or more of the point differences between the 1A7 amino
acid sequences and the consensus sequences.
[0057] The full sequences of the 1A7 light and heavy chain constant
regions have not been determined, but are expected to be identical
or nearly identical to those of other mouse immunoglobulin
molecules.
[0058] For the mouse kappa light chain constant region, four
genetic allotypes encoding two protein allotypes have been
published by Solin et al. (1993) Immunogenetics 37:401407, which is
hereby incorporated herein by reference. FIG. 1 of Solin et al.
depicts mouse and rat immunoglobulin kappa chain gene sequences,
comparing the sequences within the kappa chain constant region for
different stains and highlighting allotypic differences. Included
are kappa chain constant region sequences for BALB/c, PL, SJL, and
M. spretus. Other naturally occurring allotypes are possible.
[0059] The mouse .gamma..sub.1 heavy chain constant region DNA
sequence from newborn mice has been published by Honjo et al.
(1979) Cell 18:559-568, which is hereby incorporated herein by
reference. FIG. 5 of Honjo et al. shows the germ-line DNA sequence,
along with the encoded protein sequence. Shown in the line above is
another protein sequence obtained from the mouse myeloma MOPC 21.
Other naturally occurring allotypes are possible.
[0060] The 1A7 antibody and derivatives thereof are useful, for
example, for eliciting an anti-GD2 immune response, for treating a
GD2-associated disease, and as reagents for detecting the presence
of anti GD2.
[0061] Certain compounds, compositions and methods described in
this application relate generally to 1A7 and derivatives thereof
which are routinely generated by classical techniques of
immunochemistry. This includes 1A7 which has been coupled to
another compound by chemical conjugation, or by mixing with an
excipient or an adjuvant. It includes such immunoglobulin fragments
as Fab, F(ab').sub.2, Fab', and isolated heavy and light chains.
First generation therapies are those based on such compounds and
compositions.
[0062] Other compounds, compositions and method described in this
application relate to polynucleotide and polypeptide derivatives of
1A7 that fall outside the preceding classification. The
compositions are typically generated by genetic engineering,
although they may alternatively be obtained by other methods and
combinations of methods. This classification includes (but is not
limited to) isolated polynucleotide fragments, recombinant
polynucleotides, engineered peptide fragments and fusion peptides,
and polynucleotides or polypeptides prepared by chemical synthesis
based on the sequence data. Preferred compounds include polypeptide
fragments of the 1A7 CDRs, antibody fusion proteins comprising
cytokine effector components, single-chain variable region proteins
and the polynucleotides encoding them, therapeutic plasmids
comprising 1A7 polynucleotides, and vectors such as vaccinia
vectors.
[0063] Unless explicitly stated otherwise or required by their
nature, methods of making or using certain compounds embodied in
this invention may be applied to other compounds of this invention,
as appropriate.
[0064] Pharmaceutical compositions and treatment modalities of this
invention may be brought to bear whenever it is desirable to elicit
a response against GD2, especially in humans. Human patients with
GD2-associated tumors, including melanoma, neuroblastoma, glioma,
soft tissue sarcoma, and small cell carcinoma (including small cell
lung cancer) are especially appropriate subjects. The subjects may
have an advanced form of disease, in which case the objective may
include mitigation or reversal of disease progression, and
amelioration of side effects. The subjects may have had a history
of the condition, for which they have already been treated, in
which case the objective will typically include a decrease or delay
in the risk of recurrence of clinical pathology.
[0065] Additionally, the antibodies and derivatives of this
invention may also be used as probes, primers, and polypeptides for
use as diagnostic reagents. These applications are described in
more detail in the sections that follow.
[0066] Definitions
[0067] "1A7" is a particular anti-idiotype antibody raised against
the anti-GD2 monoclonal antibody with the designation 14G2a. The
generation and characterization of 1A7 is described in Example
1.
[0068] "Immunological activity" of 1A7 refers to any of the
following activities: ability to specifically bind monoclonal
antibody 14G2a; ability to inhibit the binding of 1A7 to 14G2a or
14G2a to GD2 in a specific manner; and an ability to elicit an
immune response against GD2. A specific immune response may
comprise antibody, B cells, T cells, and any combination thereof,
and effector functions resulting therefrom. Included are the
antibody-mediated functions ADCC and complement-mediated cytolysis
(CMC). The T cell response includes T helper cell function,
cytotoxic T cell function, inflammation/inducer T cell function,
and T cell mediated suppression. A compound able to elicit a
specific immune response according to any of these criteria is
referred to as "immunogenic".
[0069] 1A7 "activity" or "function" refers to any of the
immunological activities of 1A7, or to any other biological
activity ascribed to 1A7 in this disclosure, including the role of
1A7 in the amelioration or palliation of GD2-associated
disease.
[0070] The "variable region" of 1A7 refers to the variable region
of the 1A7 light chain or the variable region of the 1A7 heavy
chain, either alone or in combination, and includes amino acids
encoded by the V, D, and J encoding regions of the respective gene,
as appropriate.
[0071] GM-CSF, IL-2, and other biologically active molecules
referred to herein are meant to include fragments and derivatives
based on the respective parent molecule that have the same biologic
or physiologic function.
[0072] A "polynucleotide" is a polymeric form of nucleotides of any
length, which contain deoxyribonucleotides, ribonucleotides, and
analogs in any combination analogs. Polynucleotides may have any
three-dimensional structure, and may perform any function, known or
unknown. The term "polynucleotide" includes double-,
single-stranded, and triple-helical molecules. Unless otherwise
specified or required, any embodiment of the invention described
herein that is a polynucleotide encompasses both the
double-stranded form and each of two complementary single-stranded
forms known or predicted to make up the double stranded form.
[0073] The following are non-limiting examples of polynucleotides:
a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA,
ribozymes, cDNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of any sequence, nucleic acid probes, and primers. A
polynucleotide may comprise modified nucleotides, such as
methylated nucleotides and nucleotide analogs, uracyl, other sugars
and linking groups such as fluororibose and thioate, and nucleotide
branches. The sequence of nucleotides may be interrupted by
non-nucleotide components. A polynucleotide may be further modified
after polymerization, such as by conjugation with a labeling
component. Other types of modifications included in this definition
are caps, substitution of one or more of the naturally occurring
nucleotides with an analog, and introduction of means for attaching
to proteins, metal ions, labeling components, other
polynucleotides, or a solid support.
[0074] The term "recombinant" polynucleotide as used herein intends
a polynucleotide of genomic, cDNA, semisynthetic, or synthetic
origin which either does not occur in nature or is linked to
another polynucleotide in an arrangement not found in nature.
[0075] The terms "polypeptide", "peptide" and "protein" are used
interchangeably herein to refer to polymers of amino acids of any
length. The polymer may be linear or branched, it may comprise
modified amino acids or amino acid analogs, and it may be
interrupted by non-amino acids. The terms also encompass an amino
acid polymer that has been modified naturally or by intervention;
for example, disulfide bond formation, glycosylation, lipidation,
acetylation, phosphorylation, or any other manipulation or
modification, such as conjugation with a labeling component. Unless
stated or implied otherwise, the term 1A7 polypeptide includes any
polypeptide monomer or polymer with 1A7 activity, including the
intact 1A7 antibody, and smaller and larger functionally equivalent
polypeptides, as described herein.
[0076] A "fusion polypeptide" is a polypeptide comprising regions
in a different position in the sequence than occurs in nature. The
regions may normally exist in separate proteins and are brought
together in the fusion polypeptide; or they may normally exist in
the same protein but are placed in a new arrangement in the fusion
polypeptide.
[0077] A "functionally equivalent fragment" of a 1A7 polypeptide or
polynucleotide varies from the native sequence by any combination
of additions deletions, or substitutions while preserving at least
one functional property of the fragment relevant to the context in
which it is being used. A functionally equivalent fragment of a 1A7
polynucleotide either encodes a polypeptide that is functionally
equivalent to 1A7 when used in an expression system, or has similar
hybridization specificity as a 1A7 polynucleotide when used in a
hybridization assay. A functionally equivalent fragment of a 1A7
polypeptide typically has one or more of the following properties:
ability to bind monoclonal antibody 14G2a; ability to inhibit the
binding of 1A7 to 14G2a or 14G2a to GD2 in a specific manner; and
an ability to elicit an immune response with a similar antigen
specificity as that elicited by 1A7.
[0078] A "cell line" or "cell culture" denotes higher eukaryotic
cells gown or maintained in vitro. It is understood that the
descendants of a cell may not be completely identical (either
morphologically, genotypically, or phenotypically) to the parent
cell.
[0079] A "vector" refers to a recombinant DNA or RNA plasmid or
virus that comprises a heterologous polynucleotide to be delivered
into a target cell, either in vitro or in vivo. The heterologous
polynucleotide may comprise a sequence of interest for purposes of
therapy, and may optionally be in the form of an expression
cassette. As used herein, a vector need not be capable of
replication in the ultimate target cell or subject. The term
includes cloning vectors for the replication of a polynucleotide,
and expression vectors for translation of a polynucleotide encoding
sequence. Also included are viral vectors, which comprise a
polynucleotide encapsidated or enveloped in a viral particle.
[0080] A "host cell" denotes a eukaryotic cell that has been
genetically altered, or is capable of being genetically altered by
administration of an exogenous polynucleotide, such as a
recombinant plasmid or vector. When referring to genetically
altered cells, the term refers both to the originally altered cell,
and to the progeny thereof.
[0081] "Heterologous" means derived from a genotypically distinct
entity from the rest of the entity to which it is being compared
For example, a polynucleotide may be placed by genetic engineering
techniques into a plasmid or vector derived from a different
source, and is a heterologous polynucleotide. A promoter removed
from its native coding sequence and operatively linked to a coding
sequence with which it is not naturally found linked is a
heterologous promoter.
[0082] A "signal sequence" or "leader sequence" is a short amino
acid sequence that directs a newly synthesized secretory or
membrane protein through a cellular membrane, usually the
endoplasmic reticulum. Signal sequences are typically in the
N-terminal portion of a polypeptide and are typically removed
between biosynthesis and secretion of the polypeptide from the
cell.
[0083] An "isolated" polynucleotide or polypeptide is one that is
substantially free of the materials with which it is associated in
nature. By substantially free is meant at least 50%, preferably at
least 70%, more preferably at least 80%, and even more preferably
at least 90% free of the materials with which it is associated in
nature.
[0084] A "stable duplex" of polynucleotides, or a "stable complex"
formed between any two or more components in a biochemical
reaction, refers to a duplex or complex that is sufficiently
long-lasting to persist between the formation of the duplex or
complex and subsequent detection, including any optional washing
steps or other manipulation that may take place in the interim.
[0085] A "biological sample" encompasses a variety of sample types,
including blood and other liquid samples of biological origin,
solid tissue samples such as a biopsy specimen or tissue cultures,
or cells derived therefrom and the progeny thereof. The definition
also includes samples that have been manipulated in any way after
their procurement, such as by treatment with reagents,
solubilization, or enrichment for certain components, such as
proteins or polynucleotides. The term encompasses various kinds of
clinical samples obtained from any species, and also includes cells
in culture, cell supernatants, and cell lysates.
[0086] A "vaccine" is a pharmaceutical composition for human or
animal use, which is administered with the intention of conferring
the recipient with a degree of specific immunological reactivity
against a particular target, or group of targets. The immunological
reactivity may be antibodies or cells particularly B cells, plasma
cells, T helper cells, and cytotoxic T lymphocytes, and their
precursors) that are immunologically reactive against the target,
or any combination thereof. For purposes of this invention, the
target is primarily tumor associated antigen GD2, but also includes
any tumor associated antigen bound by 14G2a. The immunological
reactivity may be desired for experimental purposes, for treatment
of a particular condition, for the elimination of a particular
substance, or for prophylaxis. An active vaccine is a vaccine
intended to elicit an immune response in the recipient that
persists in the absence of the vaccine components.
[0087] "Adjuvant" as used herein has two meanings, depending on the
context in which it is used. In the context of a pharmaceutical
preparation, an adjuvant is a chemical or biological agent given in
combination with an antibody, polynucleotide or polypeptide to
enhance its immunogenicity. In the context of cancer diagnosis or
management, it refers to a class of subjects with no clinically
detectable tumor mass, but who are suspected of being at risk of
recurrence because of a history of cancer.
[0088] When referring to a type of cancer that normally manifests
as a solid tumor, a "clinically detectable" tumor is one that is
detectable on the basis of tumor mass; i.e., by such procedures as
CAT scan, X-ray, or palpation. Positive biochemical, histological
or immunological findings on their own are insufficient to meet
this definition.
[0089] As used herein, "treatment" refers to clinical intervention
in an attempt to alter the natural course of the individual or cell
being treated, and may be performed either for prophylaxis or
during the course of clinical pathology. Desirable effects include
preventing occurrence or recurrence of disease, alleviation of
symptoms, diminishment of any direct or indirect pathological
consequences of the disease, preventing metastasis, lowering the
rate of disease progression, amelioration or palliation of the
disease state, and remission or improved prognosis.
[0090] The "pathology" associated with a disease condition is
anything that compromises the well-being, normal physiology, or
quality of life of the affected individual. This may involve (but
is not limited to) destructive invasion of affected tissues into
previously unaffected areas, growth at the expense of normal tissue
function, irregular or suppressed biological activity, aggravation
or suppression of an inflammatory or immunological response,
increased susceptibility to other pathogenic organisms or agents,
and undesirable clinical symptoms such as pain, fever, nausea,
fatigue, mood alterations, and such other features as may be
determined by an attending physician.
[0091] An "effective amount" is an amount sufficient to effect a
beneficial or desired clinical result. An effective amount can be
administered in one or more doses. For purposes of this invention,
an effective amount of a 1A7 polynucleotide or polypeptide is an
amount that induces an immune response, particularly an anti-GD2
response. In terms of treatment, an effective amount is amount that
is sufficient to palliate, ameliorate, stabilize, reverse or slow
the progression of the GD2-associated disease, or otherwise reduce
the pathological consequences of the disease.
[0092] An "individual" is a vertebrate, preferably a mammal, more
preferably a human. Mammals include, but are not limited to, farm
animals, sport animals, and pets.
[0093] General Techniques
[0094] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature, such as,
"Molecular Cloning: A Laboratory Manual", second edition (Sambrook
et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984);
"Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in
Enzymology" (Academic Press, Inc.); "Handbook of Experimental
Immunology" (D. M. Weir & C. C. Blackwell, eds.); "Gene
Transfer Vectors for Mammalian Cells" (J. M. Miller & M. P.
Calos, eds., 1987); "Current Protocols in Molecular Biology" (F. M.
Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction",
(Mullis et al., eds., 1994); "Current Protocols in Immunology" (J.
E. Coligan et al., eds., 1991).
[0095] All patents, patent applications, articles and publications
mentioned herein, both supra and infra, are hereby incorporated
herein by reference.
[0096] These techniques are applicable to the production of the
polynucleotides and polypeptides of the invention, and, as such,
may be considered in making and practicing the invention.
Particularly useful techniques for particular embodiments will be
discussed in the sections that follow.
[0097] How Monoclonal Antibody 1A7 was Generated and Selected
[0098] 1A7 was obtained by immunizing naive mice with 14G2a
anti-GD2 antibody to obtain an anti-idiotype response. 14G2a binds
to a unique epitope of GD2. Syngeneic BALB/c mice were immunized
four times with 14G2a (Ab1) and their spleen cells were fused with
the non-secretory mouse myeloma P3-653 cells.
[0099] To obtain an anti-idiotype with all the features desired, an
extensive screening process was employed, comprising the following
four important steps: (1) Positive selection for antibody binding
to 14G2a; (2) Negative selection against antibody recognizing
isotypic or allotypic determinants; (3) Positive selection for an
ability to inhibit the binding of 14G2a to GD2; and (4) Positive
selection for an ability to induce a humoral immune response
against the original tumor-associated antigen (GD2) in both mice
and rabbits.
[0100] Several anti-idiotype (Ab2) hybridomas were obtained that
were specific for the idiotype components of the 14G2a immunogen,
and did not react with its isotypic or allotypic determinants. To
determine whether the anti-14G2a were directed against the paratope
of 14G2a, the binding of radiolabeled 14G2a to the GD2-positive
cell line M21/P6 was studied in the presence of varying amounts of
Ab2 hybridoma culture supernatants. With as little as 5 .mu.l of
culture supernatant, three of the Ab2 tested inhibited the binding
by at least 70%. 1A7 showed the highest level of inhibition.
Accordingly, 1A7 was grown and purified from ascites fluid for
further studies, while the others were kept in reserve.
[0101] The purified Ab2 was prepared as a vaccine and injected into
naive mice and rabbits. After 4 injections, serum samples were
titered for the presence of Ab3 that bound not only to the
immunizing Ab2, but also to GD2. The Ab2 passing all of these
screening stages was designated 1A7. Further details of the method
used to obtain 1A7 are provided in Example 1.
[0102] Ab3 produced in animals immunized with 1A7 has been further
characterized. The immune sera from both mice and rabbits competed
with 14G2a for binding to the GD2-associated cell line M21/P6 and
inhibited the binding of radioiodinated 14G2a to 1A7. This
indicated that anti-anti-Id (Ab3) in mice and rabbits may share
idiotopes with 14G2a and they probably bind to the same epitope as
Ab1. Administration of 1A7 to non-human primates (cynomolgus
monkeys) also generated a specific immune response, comprising
activity against GD2 (Example 3).
[0103] The nucleic acid sequence encoding the light and heavy chain
variable regions of 1A7 have also been deduced, along with the
translated protein sequences (Example 2).
[0104] The invention also encompasses 1A7 conjugated to a label
capable of producing a detectable signal. These conjugated
antibodies are useful, for example, in detection systems such as
quantitation of anti-GD2 or tumor imaging. Such labels are known in
the art and include, but are not limited to, radioisotopes,
enzymes, fluorescent compounds, chemiluminescent compounds, and
bioluminescent compounds. The labels may be covalently linked to
1A7, or conjugated to the 1A7 through a secondary reagent, such as
a second antibody, protein A, or a biotin-avidin complex.
[0105] Preparation of 1A7 Antibody
[0106] The 1A7 antibody of this invention can be prepared in
several ways.
[0107] It is most conveniently obtained from the hybridoma
deposited with the ATCC under Accession No. HB-11786, or the
progeny thereof. For example, the cells can be cultured in a
suitable medium, and spent medium can be used as an antibody
source. Optionally, matrix-coated channels or beads and cell
co-cultures may be included to enhance growth of antibody-producing
cells. For the production of large amounts of antibody, it is
generally more convenient to obtain an ascites fluid. The method of
raising ascites generally comprises injecting hybridoma cells into
an immunologically naive histocompatible or immunotolerant mammal,
especially a mouse. The mammal is optionally primed for ascites
production by prior administration of a suitable composition; for
example, Pristane.
[0108] Alternatively, 1A7 can be chemically synthesized using
sequence data and other information provided in this disclosure, in
conjunction with standard methods of protein synthesis. A suitable
method is the solid-phase Merrifield technique. Automated peptide
synthesizers are commercially available, such as those manufactured
by Applied Biosystems, Inc. (Foster City, Calif.).
[0109] 1A7 may also be obtained by employing routine recombinant
methods such as described in Sambrook et al. (1989). For instance,
using the sequences and information provided herein, a
polynucleotide encoding either the 1A7 heavy or light chain can be
cloned into a suitable expression vector (which contains control
sequences for transcription, such as a promoter). The expression
vector is in turn introduced into a host cell. The host cell is
grown under suitable conditions such that the polynucleotide is
transcribed and translated into a protein. Heavy and light chains
of 1A7 may be produced separately, and then combined by disulfide
bond rearrangement. Alternatively, vectors with separate
polynucleotides encoding each chain of 1A7, or a vector with a
single polynucleotide encoding both chains as separate transcripts,
may be transfected into a single host cell which may then produce
and assemble the entire molecule. Preferably, the host cell is a
higher eukaryotic cell that can provide the normal carbohydrate
complement of the molecule. The 1A7 thus produced in the host cell
can be purified using standard techniques in the art. A
polynucleotide encoding 1A7 for use in the production of 1A7 by any
of these methods can in turn be obtained from the hybridoma
producing 1A7, or be produced synthetically or recombinantly from
the DNA sequence provided herein.
[0110] Methods of antibody isolation are well known in the art.
See, for example, Harlow and Lane (1988) Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory, New York. The 1A7 antibody
is a mouse immunoglobulin of the IgG1 subclass, and may be isolated
by any technique suitable for immunoglobulins of this isotype.
Purification methods may include salt precipitation (for example,
with ammonium sulfate), ion exchange chromatography (for example,
on a cationic or anionic exchange column run at neutral pH and
eluted with step gradients of increasing ionic strength), gel
filtration chromatography (including gel filtration HPLC), and
chromatography on affinity resins such as protein A, protein G,
hydroxyapatite, and anti-immunoglobulin. 1A7 may also be purified
on affinity columns comprising the 14G2a paratope; for example, in
the form of a purified Ab1 or Ab3. Preferably, 1A7 is purified from
BALB/c ascites using Protein-A-CL-SEPHAROSE.TM. 4B chromatography
followed by chromatography on a DEAE-SEPHAROSE.TM. 4B ion exchange
column.
[0111] If 1A7 is to be administered to an individual, it is
preferably at least 80% pure, more preferably it is at least 90%
pure, even more preferably it is at least 95% pure and free of
pyrogens and other contaminants. In this context, the percent
purity is calculated as a weight percent of the total protein
content of the preparation, and does not include constituents which
are deliberately added to the composition after the 1A7 is
purified.
[0112] Uses of 1A7 Antibody
[0113] The 1A7 antibody may be used for a number of purposes. These
include eliciting an antibody response to 1A7 or GD2, eliciting a T
cell response to 1A7 or GD2, and treating various types of cancer.
These uses are elaborated more fully in a later section.
[0114] 1A7 may also be used to purify anti-1A7 (Ab3), anti-GD2
(Ab1'), or 14G2a (Ab1). The method comprises contacting a
biological sample containing the antibody with a 1A7 polypeptide,
producing a complex, and recovering the Ab3 or Ab1 from the
complex. Typically, the 1A7 polypeptide is coupled to an affinity
matrix for affinity column purification. Such methods are routine
in the art and need not be described in detail herein.
[0115] The invention also encompasses methods of detecting anti-1A7
or anti-GD2 in a biological sample. Anti-GD2 is detectable whenever
(like 14G2a) it cross-reacts with 1A7. Anti-GD2 with this activity
may spontaneously arise during the course of a GD2-associated
disease. Anti-GD2 with this activity is especially likely in
individuals who have received a course of therapy with 1A7, or a
derivative thereof. These methods are applicable in a clinical
setting, for example, for monitoring antibody levels in an
individual, as well as an industrial setting, in which commercial
production of anti-1A7 or anti-GD2 is desired.
[0116] The assay methods entail contacting any anti-1A7 or anti-GD2
target antibody in the sample with a 1A7 antibody or polypeptide
under conditions suitable to allow the formation of a stable
complex between the target and the 1A7, and detecting any stable
complex formed. The sample is suitably prepared before conducting
the assay, optionally by enriching for antibody activity. When
using intact 1A7, it is generally preferable to deplete the sample
of any anti-mouse immunoglobulin activity that may be present.
Anti-mouse immunoglobulin antibody can be removed from a sample,
for example, by precipitation with normal mouse IgG or adsorption
with a mouse Ig adsorbant. Binding of anti-mouse immunoglobulin
antibody, particularly that specific for the Fc region, can be
minimized by judicious choice of the reagents of the assay.
F(ab').sub.2 or Fab fragments of 1A7 and other reagents with fewer
mouse determinants are appropriate.
[0117] After the sample is suitably prepared, it is mixed with a
excess functional equivalent of 1A7 under conditions that permit
formation of a complex between 1A7 and any target antibody that may
be present. The amount of complex is then determined, and compared
with complexes formed with standard samples containing known
amounts of target antibody in the range expected. Complex formation
may be observed by immunoprecipitation or nephelometry, but it is
generally more sensitive to employ a reagent labeled with such
labels as radioisotopes like .sup.125I, enzymes like peroxidase and
.beta.-galactosidase, or fluorochromes like fluorescein.
[0118] Antibody assays may be conducted entirely in fluid phase.
For example, anti-GD2 may be mixed with labeled 1A7. Alternatively,
the anti-GD2 in the sample may be used to compete with a labeled
anti-GD2 for binding sites on 1A7. Generally, bound and unbound
label is separated to quantitate the percent bound. Suitable
separation methods include gel filtration chromatography, and
precipitation with antibody against immunoglobulin of the species
from which the sample is obtained, optionally in the presence of
polyethylene glycol. Alternatively, the proportion of bound and
unbound label may be determined in situ, for example, using
fluorescence/quench labeling pairs or enzyme/inhibitor labeling
pairs. See, e.g., U.S. Pat. No. 3,996,345 (Ullman et al.).
[0119] It is generally more convenient to conduct a capture assay
using a reagent linked to a solid phase, such as a polyethylene
test tube, microtiter plate well, or magnetic bead. In a
competition-type capture assay, unlabeled target antibody in the
sample competes with a labeled analog reagent for binding to 1A7.
The 1A7 may be attached directly to the solid support, or captured
later, for example, using an anti-immunoglobulin. In this assay,
the amount of label associated with the solid phase is inversely
related to the amount of anti-GD2 in the sample.
[0120] In the sandwich-type capture assay, target antibody is
captured by 1A7 attached directly or through a secondary reagent to
a solid phase. After washing, the anti-GD2 is detected using
anti-immunoglobulin of the appropriate species, or a second 1A7
antibody, to which a label is directly or indirectly attached.
Alternatively, the anti-immunoglobulin may be attached to the solid
phase and labeled 1A7 is used to complete the sandwich. If the
anti-immunoglobulin used is isotype-specific, then the class of the
antibody may also be determined. In this type of assay, the amount
of label associated with the solid phase correlates positively with
the amount of anti-GD2 in the sample. Other methods of measuring
specific antibody are known in the art, and may be adapted to
measure anti-1A7 or anti-GD2 by using 1A7 as the specific
reagent.
[0121] 1A7 may also be used to measure the level of cellular
anti-1A7 or anti-GD2 activity. In one example, 1A7 is used to
identify anti-GD2 expressing cells in a cell suspension, perhaps B
or T lymphocytes expressing a receptor that binds 1A7. 1A7 may be
labeled and mixed into the cell suspension. Alternatively,
unlabeled 1A7 may be mixed with the cells, and followed with a
labeled secondary reagent such as labeled anti-mouse immunoglobulin
or protein A. Suitable labels for this purpose include radiolabels
and fluorescent labels. The use of fluorescent labels also allows
anti-GD2 cells to be separated from non-specific cells in a
fluorescence-activated cell sorter. In a second example, anti-GD2
expressing cells are detected in a tissue section. Typically, the
tissue is fixed and embedded in a suitable medium, overlaid with
1A7, and then developed with a secondary anti-immunoglobulin
coupled with a fluorescent or enzyme marker.
[0122] Polynucleotide Derivatives of 1A7
[0123] The invention provides various polynucleotides encoding the
anti-idiotype antibody 1A7 or fragments of 1A7, based on the
polynucleotide sequences provided herein. Various embodiments are
described in this section, comprising a number of different
combinations of the 1A7 heavy or light chain variable region
sequences. In general, a 1A7 polynucleotide of this invention
encodes at least one feature that is unique to the 1A7 molecule (in
comparison with other immunoglobulins). Preferably, this feature is
related in some way to an immunological reactivity of 1A7.
[0124] The invention encompasses a polynucleotide encoding a
portion of the 1A7 light chain variable region, comprising at least
about 70 consecutive nucleotides, preferably at least about 80
consecutive nucleotides, more preferably at least about 100
consecutive -nucleotides, even more preferably at least about 150
nucleotides of SEQ ID NO:1. The invention also encompasses a
polynucleotide encoding a portion of the 1A7 light chain variable
region, comprising at least about 25 consecutive nucleotides,
preferably at least about 30 consecutive nucleotides, even more
preferably at least about 35 consecutive nucleotides of the CDR1
encoding sequence thereof. The invention also encompasses a
polynucleotide encoding a portion of the 1A7 light chain variable
region, comprising at least about 20 consecutive nucleotides,
preferably at least about 25 consecutive nucleotides, even more
preferably at least about 35 consecutive nucleotides of the CDR2 or
CDR3 encoding sequence thereof.
[0125] The invention also encompasses a polynucleotide encoding a
portion of the 1A7 heavy chain variable region, comprising at least
about 70 consecutive nucleotides, preferably at least about 80
consecutive nucleotides, more preferably at least about 100
consecutive nucleotides, even more preferably at least about 150
nucleotides of SEQ ID NO:3. The invention also encompasses a
polynucleotide encoding a portion of the 1A7 light chain variable
region, comprising 15 consecutive nucleotides of the CDR1 encoding
sequence thereof. The invention also encompasses a polynucleotide
encoding a portion of the 1A7 light chain variable region,
comprising at least about 20 consecutive nucleotides, preferably at
least about 25 consecutive nucleotides, even more preferably at
least about 35 consecutive nucleotides of the CDR2 or CDR3 encoding
sequence thereof.
[0126] The invention includes isolated 1A7 polynucleotides encoding
a polypeptide having immunological activity of 1A7, wherein the
polypeptide encodes at least 5 amino acids of a variable light
chain of 1A7 as depicted in SEQ. ID. NO:2. In another embodiment,
the invention includes isolated 1A7 polynucleotides encoding a
polypeptide having immunological activity of 1A7, wherein the
polynucleotide encodes at least 5 amino acids of a variable heavy
chain of 1A7 as depicted in SEQ. ID. NO:4. The polynucleotide
sequence may be similar to those depicted in SEQ ID NO:1 (FIG. 1)
or SEQ ID NO:3 (FIG. 2) with changes designed to optimize codon
usage, stability, or to facilitate cloning, or for some other
purpose. It is within the skill of one in the art, given the amino
acid sequence in SEQ ID NO:2 or SEQ ID NO:4, to design such
polynucleotides. Preferred are polynucleotides encoding at least
five amino acids of a 1A7 complementarity determining region
(CDR).
[0127] The invention also encompasses polynucleotides encoding for
functionally equivalent variants and derivatives of 1A7 and
functionally equivalent fragments thereof which may enhance,
decrease or not significantly affect properties of the polypeptides
encoded thereby. These functionally equivalent variants,
derivatives, and fragments display the ability to induce an immune
response, preferably an anti-GD2 immune response. For instance,
changes in a DNA sequence that do not change the encoded amino acid
sequence, as well as those that result in conservative
substitutions of amino acid residues, one or a few amino acid
deletions or additions, and substitution of amino acid residues by
amino acid analogs are those which will not significantly affect
properties of the encoded polypeptide.
[0128] The 1A7 polynucleotides of the invention may comprise
additional sequences, such as additional encoding sequences within
the same transcription unit, controlling elements such as
promoters, ribosome binding sites, and polyadenylation sites,
additional transcription units under control of the same or a
different promoter, sequences that permit cloning, expression, and
transformation of a host cell, and any such construct as may be
desirable to provide embodiments of this invention.
[0129] The invention includes a polynucleotide of at least about 15
consecutive nucleotides, preferably at least about 20 nucleotides,
more preferably at least about 25 consecutive nucleotides, more
preferably at least about 35 consecutive nucleotides, more
preferably at least about 50 consecutive nucleotides, even more
preferably at least about 75 nucleotides, still more preferably at
least about 100 nucleotides, still more preferably at least about
200 nucleotides, and even more preferably at least about 300
nucleotides that forms a stable hybrid with a polynucleotide
encoding the light chain or heavy chain variable region of 1A7, but
not with other immunoglobulin encoding regions known at the time of
filing of this application. Any set of conditions may be used for
this test, as long as at least one set of conditions exist wherein
the test polynucleotide demonstrates the required specificity.
Preferably, the 1A7 encoding sequences to which the test
polynucleotide binds are those shown in SEQ. ID NOS:1 and 3. Since
the known immunoglobulin sequences fall into a hierarchy of
similarity with that of 1A7, the test may be performed by comparing
the hybridization of the test polynucleotide with the 1A7 sequence
with the hybridization with the most closely related sequences.
Preferred is a panel of about 10 of the most closely related
sequences to SEQ. ID NO:1 or 3, as appropriate. Sequences to which
the test polynucleotide should not form a duplex are the light
chain variable region encoding sequences listed in SEQ. ID
NOS:17-26 and the heavy chain variable region encoding sequences
listed in SEQ. ID NOS:27-44.
[0130] Hybridization reactions can be performed under conditions of
different "stringency". Conditions that increase stringency of a
hybridization reaction are published. See, for example, Sambrook
and Maniatis. Examples of relevant conditions include (in order of
increasing stringency): incubation temperatures of 25.degree. C.,
37.degree. C., 50.degree. C. and 68.degree. C.; buffer
concentrations of 10.times. SSC, 6.times. SSC, 1.times. SSC,
0.1.times. SSC (where SSC is 0.15 M NaCl and 15 mM citrate buffer)
and their equivalent using other buffer systems; formamide
concentrations of 0%, 25%, 50%, and 75%; incubation times from 5
minutes to 24 hours; 1, 2, or more washing steps; wash incubation
times of 1, 2, or 15 minutes; and wash solutions of 6.times. SSC,
1.times. SSC, 0.1.times. SSC, or deionized water.
[0131] "T.sub.m" is the temperature in degrees Centigrade at which
50% of a polynucleotide duplex made of complementary strands
hydrogen bonded in antiparallel direction by Watson-Crick base
pairing dissociates into single strands under conditions of the
experiment. T.sub.m may be predicted according to a standard
formula, such as:
T.sub.m=81.5+16.6 log[Na.sup.+]+0.41(%G/C)-0.61(%F)-600/L
[0132] where [Na.sup.+] is the cation concentration (usually sodium
ion) in mol/L; (%G/C) is the number of G and C residues as a
percentage of total residues in the duplex; (%F) is the percent
formamide in solution (wt/vol); and L is the number of nucleotides
in each strand of the duplex.
[0133] Useful 1A7 polynucleotides encoding fragments of 1A7 may be
identified by generating polynucleotide fragments (based on SEQ ID
NO:1 or SEQ ID NO:3, for example) and testing the polypeptides
encoded thereby for a function of interest. Alternatively, the
polypeptide fragment encoded by a particular polynucleotide may be
prepared and tested for a function of interest. Alternatively,
given a 1A7 polypeptide with desirable properties, a polynucleotide
could be designed that encodes it.
[0134] Included in all these embodiments are polynucleotides with
encoding regions for 1A7 polymers, fusion proteins, humanized
immunoglobulins, single-chain variable regions, and other
particular polypeptides of interest These polypeptides are
described in a later section.
[0135] The invention also provides polynucleotides covalently
linked with a detectable label. Such polynucleotides are useful,
for example, as probes for detection of related nucleotide
sequences.
[0136] Preparation of 1A7 Polynucleotides:
[0137] The polynucleotides of this invention can be obtained using
chemical synthesis, recombinant cloning methods, PCR, or any
combination thereof.
[0138] Methods of chemical polynucleotide synthesis are well known
in the art and need not be described in detail herein. One of skill
in the art can use the sequence data provided herein to obtain a
desired polynucleotide by employing a DNA synthesizer or ordering
from a commercial service.
[0139] Alternatively, 1A7 polynucleotide sequences can be obtained
from a 1A7 antibody producing cell line, 1A7 cloning vector, or 1A7
expression vector. RNA or DNA encoding the desired sequence may be
isolated, amplified, and processed by standard recombinant
techniques. Such techniques include digestion with restriction
nucleases, and amplification by polymerase chain reaction (PCR), or
a suitable combination thereof. PCR technology is described in U.S.
Pat. Nos. 4,683,195, 4,800,159, 4,754,065 and 4,683,202, as well as
PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer
Press, Boston (1994). A polynucleotide comprising a desired
sequence can be inserted into a suitable vector, and the vector in
turn can be introduced into a suitable host cell for replication
and amplification. Polynucleotides may be inserted into host cells
by any means known in the art. Cells are transformed by introducing
an exogenous polynucleotide by direct uptake, endocytosis,
transfection, f-mating or electroporation. Once introduced, the
exogenous polynucleotide can be maintained within the cell as a
non-integrated vector (such as a plasmid) or integrated into the
host cell genome. Amplified DNA can be isolated from the host cell
by standard methods: see, e.g., Sambrook et al. (1989). RNA may
also be obtained from transformed host cell, it may be obtained by
using an DNA-dependent RNA polymerase.
[0140] If used as a vaccine, plasmids containing 1A7
polynucleotides are preferably prepared by the method of Horn et
al. ((1995) Human Gene Therapy 6:565-573), which produces a
pharmaceutical grade plasmid DNA suitable for administration.
[0141] Cloning and Expression Vectors Comprising a 1A7
Polynucleotide
[0142] The present invention further includes a variety of vectors
comprising a 1A7 polynucleotide. These vectors can be used for
expression of recombinant polypeptides as well as a source of 1A7
polynucleotides. Cloning vectors can be used to obtain replicate
copies of the 1A7 polynucleotides they contain, or as a means of
storing the polynucleotides in a depository for future recovery.
Expression vectors (and host cells containing these expression
vectors) can be used to obtain polypeptides produced from the
polynucleotides they contain. They may also be used where it is
desirable to express 1A7 polypeptides in an individual and thus
have intact cells capable of synthesizing the polypeptide, such as
in gene therapy. Suitable cloning and expression vectors include
any known in the art, e.g., those for use in bacterial, mammalian,
yeast and insect expression systems. Specific vectors and suitable
host cells are known in the art and need not be described in detail
herein. For example, see Gacesa and Ramji, Vectors, John Wiley
& Sons (1994).
[0143] Cloning and expression vectors typically contain a
selectable marker (for example, a gene encoding a protein necessary
for the survival or growth of a host cell transformed with the
vector), although such a marker gene can be carried on another
polynucleotide sequence co-introduced into the host cell. Only
those host cells into which a selectable gene has been introduced
will grow under selective conditions. Typical selection genes
either: (a) confer resistance to antibiotics or other toxins
substances, e.g., ampicillin, neomycyin, methotrexate; (b)
complement auxotrophic deficiencies; or (c) supply critical
nutrients not available from complex media. The choice of the
proper marker gene will depend on the host cell, and appropriate
genes for different hosts are known in the art. Cloning and
expression vectors also typically contain a replication system
recognized by the host.
[0144] Suitable cloning vectors may be constructed according to
standard techniques, or may be selected from a large number of
cloning vectors available in the art. While the cloning vector
selected may vary according to the host cell intended to be used,
useful cloning vectors will generally have the ability to
self-replicate, may possess a single target for a particular
restriction endonuclease, or may carry genes for a marker that can
be used in selecting clones containing the vector. Suitable
examples include plasmids and bacterial viruses, e.g., pUC18, mp18,
mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNAs, and shuttle
vectors such as pSA3 and pAT28. These and many other cloning
vectors are available from commercial vendors such as BioRad,
Stratagene, and Invitrogen.
[0145] Expression vectors generally are replicable polynucleotide
constructs that contain a polynucleotide encoding a 1A7 polypeptide
of interest. The polynucleotide encoding the 1A7 polypeptide is
operatively linked to suitable transcriptional controlling
elements, such as promoters, enhancers and terminators. For
expression (i.e., translation), one or more translational
controlling elements are also usually required, such as ribosome
binding sites, translation initiation sites, and stop codons. These
controlling elements (transcriptional and translational) may be
derived from the 1A7 gene, or they may be heterologous (i.e.,
derived from other genes or other organisms). A polynucleotide
sequence encoding a signal peptide can also be included to allow a
1A7 polypeptide to cross or lodge in cell membranes or be secreted
from the cell. A number of expression vectors suitable for
expression in eukaryotic cells including yeast, avian, and
mammalian cells are known in the art. One example of an expression
vector is pcDNA3 (Invitrogen, San Diego, Calif., in which
transcription is driven by the cytomegalovirus (CMV) early
promoter/enhancer. This vector also contains recognition sites for
multiple restriction enzymes for insertion of the 1A7
polynucleotide of interest. Another example of an expression vector
(system) is the baculovirus/insect system.
[0146] The vectors containing the polynucleotides of interest can
be introduced into the host cell by any of a number of appropriate
means, including electroporation, transfection employing calcium
chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or
other substances; microprojectile bombardment; lipofection; and
infection (where the vector is an infectious agent, such as
vaccinia virus, which is discussed below). The choice of means of
introducing vectors or 1A7 polynucleotides will often depend
features of the on the host cell.
[0147] Once introduced into a suitable host cell, for example, E.
coli or COS-7, expression of a 1A7 polypeptide can be determined
using any of the assays described herein. For example, presence of
1A7 polypeptide can be detected by RIA or ELISA of the culture
supernatant (if the 1A7 polypeptide is secreted) or cell
lysates.
[0148] A particularly useful expression vector for 1A7
polynucleotides is a vaccinia virus comprised of a 1A7
polynucleotide sequence, which can also be used in vaccine
preparations (Moss (1991) Science 252:1662-1667). To introduce
polynucleotide sequences encoding 1A7 polypeptide, including 1A7
polypeptide fragments, into vaccinia, the polynucleotide sequence
of interest is first inserted into a plasmid containing a vaccinia
virus promoter with flanking sequences homologous to vaccinia DNA
inessential for replication. Plasmid-containing cells are then
infected with vaccinia, which leads to a low level of homologous
recombination between plasmid and virus, with resultant transfer of
the vaccinia promoter and 1A7 polypeptide-encoding polynucleotide
sequence into the vaccinia virus genome. Typically, the 1A7
polynucleotide is inserted into the viral tk (thymidine kinase)
gene. Insertion into the tk site attenuates the virus more than
10,000 fold compared to wild type (Flexner et al. (1980) Vaccine 88
(Cold Spring Harbor Laboratory), 179-184). Recombinant virus is
identified by the tk.sup.- phenotype. Preferably, expression of the
1A7 polynucleotide is under the control of the vaccinia early/late
promoter (7.5 K), whereby the resultant 1A7 polypeptides can be
expressed in infected cells throughout the life cycle of the virus.
However, other promoters known in the art can be used, such as pH
6, or synthetic promoters. Expression of the 1A7 polypeptide occurs
in cells infected with the recombinant vaccinia or individuals
which are immunized with the live recombinant vaccinia virus. Any
one of several strains of vaccinia can be used, including but not
limited to WR, ALVAC, and NYVAC.
[0149] A vaccinia vector of this invention can contain one or more
polynucleotides encoding a 1A7 polypeptide. It can also contain
polynucleotide sequences encoding other polypeptides that enhance,
facilitate, or modulate the desired result, such as lymphokines,
including, but not limited to, IL-2, 1L-4 and GM-CSF. A preferred
lymphokine is GM-CSF. Preferred GM-CSF constructs are those which
have been deleted for the AU-rich elements from the 3' untranslated
regions and sequences in the 5' untranslated region that are
capable of forming a hairpin loop. Also embodied in this invention
are vaccinia vectors encoding for recombinant 1A7 variants
containing 1A7 polypeptides, such as scFvs, chimeras, and polymers,
as described below.
[0150] Host Cells Transformed with 1A7 Polynucleotides
[0151] Other embodiments of this invention are host cells
transformed with 1A7 polynucleotides and vectors comprising 1A7
polynucleotide sequences, as described above. Both prokaryotic and
eukaryotic host cells may be used. Prokaryotic hosts include
bacterial cells, for example E. coli and mycobacteria. Among
eukaryotic hosts are yeast, insect, avian, plant and mammalian
cells. Host systems are known in the art and need not be described
in detail herein. One example of a mammalian host cell is NS0,
obtainable from the European Collection of Cell Cultures (England).
Transfection of NS0 cells with a plasmid, for example, which is
driven by a CMV promoter, followed by amplification of this plasmid
in using glutamine synthetase provides a useful system for protein
production. (Cockett et al. (1990) Bio/Technology 8:662-667).
[0152] The host cells of this invention can be used, inter alia, as
repositories of 1A7 polynucleotides, or as vehicles for production
of 1A7 polynucleotides and polypeptides. They may also be used as
vehicles for in vivo expression of 1A7 polypeptides.
[0153] Uses for 1A7 Polynucleotides
[0154] The polynucleotides of this invention have several uses. 1A7
polynucleotides are useful, for example, in expression systems for
the production of 1A7 or 1A7 fragments. They are also useful as
hybridization probes to assay for the presence of 1A7
polynucleotide or related sequences in a sample using methods well
known to those in the art. Further, 1A7 polynucleotides are also
useful as primers to effect amplification of desired
polynucleotides. The polynucleotides of this invention are also
useful in pharmaceutical compositions including vaccines and for
gene therapy.
[0155] 1A7 polynucleotides can also be used as hybridization probes
for detection of 1A7 encoding sequences. Suitable samples include
cells transformed ex vivo for use in gene therapy. In one
illustration, DNA or RNA is extra from a sample, and optionally run
on a gel and/or digested with restriction nucleases. The processed
sample polynucleotide is typically transferred to a medium suitable
for washing. The sample polynucleotide is then contacted with the
1A7 polynucleotide probe under conditions that permit a stable
duplex to form if the sample contains a matching 1A7 sequence. Any
stable duplexes formed are detected by any suitable means. For
example, the 1A7 polynucleotide probe may be supplied in labeled
form, and label remaining with the sample after washing will
directly reflect the amount of stable duplex formed. In a second
illustration, hybridization is performed in situ. A suitably
prepared tissue sample is overlaid with a labeled 1A7 probe to
indicate the location of 1A7 encoding sequences comprised
therein.
[0156] A short 1A7 polynucleotide may also be used as a primer for
a PCR reaction, particularly to amplify a longer sequence
comprising a region hybridizing with the primer. This may be
conducted preparatively, in order to produce polynucleotide for
further genetic manipulation. It may also be conducted
analytically, to determine whether a 1A7 encoding polynucleotide is
present, for example, in a sample of diagnostic interest.
[0157] The 1A7 polynucleotides of this invention can be used in
expression systems to produce 1A7 polypeptides, intact 1A7, or
recombinant forms of 1A7, such as are described below.
[0158] Another use of 1A7 polynucleotides is in vaccines and gene
therapy. The general principle is to administer the polynucleotide
so that it either promoters or attenuates the expression of the
polypeptide encoded therein. Thus, the present invention includes
methods of inducing an immune response and methods of treatment
comprising administration of an effective amount 1A7
polynucleotides to an individual. In these methods, a 1A7
polynucleotide encoding a 1A7 polypeptide is administered to an
individual, either directly or via cells transfected with the 1A7
polynucleotide. Preferably, the 1A7 polynucleotide is in the form
of a circular plasmid, preferably in a supercoiled configuration.
Preferably, the 1A7 polynucleotide is replicated inside a cell.
Thus, the 1A7 polynucleotide is operatively linked to a suitable
promoter, such as a heterologous promoter that is intrinsically
active in cells of the target tissue type. Preferably, once in cell
nuclei, plasmids persist as circular non-replicating episomal
molecules. In vitro mutation may be carried out with plasmid
constructs to provide, for example, molecules that are more
immunogenic or that comprise a T cell epitope with a desirable HLA
motif.
[0159] To determine whether plasmids containing 1A7 polynucleotides
are capable of expression in eukaryotic cells, eukaryotic cells
such as COS-7, CHO, or HeLa cells can be transfected with the
plasmids. Expression of 1A7 polypeptide is then determined by
immunoassay; for example, by Western blot. Smaller 1A7 polypeptides
can be detected, for example, by constructing the plasmid so that
the resultant 1A7 polypeptide is fused with a tag, such as a target
epitope or enzyme label. Further characterization of the expressed
1A7 polypeptide can be achieved by purifying the peptide and then
conducting one of the functional assays described herein.
[0160] In one mode of gene therapy, the polynucleotides of this
invention are used for genetically altering cells ex vivo. In this
strategy, cells removed from a donor or obtained from a cell line
are transfected or transduced with vectors encoding a 7
polypeptide, and then administered to a recipient. Suitable cells
for transfection include peripheral blood mononuclear cells.
[0161] In another mode of gene therapy, the polynucleotides of this
invention are used for genetically altering cells in vivo. The
purpose may include (but is not limited to) eliciting an antibody
response to 1A7 or GD2, eliciting a T cell response to 1A7 or GD2,
and treating various types of cancer. These uses are elaborated
more fully in a later section.
[0162] Polypeptide Derivatives of 1A7
[0163] The present invention encompasses polypeptide fragments of
1A7 containing at least a portion of a variable region of 1A7.
Preferred fragments are those with immunological activity of
1A7.
[0164] Also preferred are fragments which comprise amino acid
sequences substantially different from other immunoglobulins, and
fragments comprising a CDR. In one embodiment, the invention
includes a polypeptide fragment of the 1A7 light chain variable
region, comprising at least 5 consecutive amino acids, more
preferably 15 consecutive amino acids, still more preferably 30
consecutive amino acids of SEQ ID NO:2, wherein the fragment
contains one or the other (preferably both) of the lysine residues
at positions 50 and 55 of the mature light chain variable region
sequence. In other embodiments, the invention includes a
polypeptide fragment of the 1A7 heavy chain variable region,
comprising the 5 amino acids from the CDR1 or comprising at least
8, preferably 10, more preferably 12, and still more preferably 16
of the amino acids from the CDR2; or comprising at least 4,
preferably 6, more preferably 8, and still more preferably 9 of the
amino acids from the CDR3. In yet other embodiments, the peptide
comprises a combination of two or more sequences from positions
50-55 of the 1A7 light chain and the three CDRs of the heavy chain
as outlined in this paragraph, optionally in combination with other
1A7 variable region sequences.
[0165] The size of the 1A7 polypeptide fragments may be only the
minimum size required to provide a desired function. It may
optionally comprise additional sequence, either native to 1A7, or
from a heterologous source, as desired. 1A7 fragments may contain
only 5 consecutive amino acids from a 1A7 variable region sequence.
Polypeptides comprising 7 amino acids, more preferably about 10
amino acids, more preferably about 15 amino acids, more preferably
about 25 amino acids, more preferably about 50 amino acids, more
preferably about 75 amino acids from the 1A7 light or heavy chain
variable region are also included. Even more preferred are
polypeptides comprising the entire 1A7 light or heavy chain
variable region.
[0166] The invention includes modified 1A7 polypeptides which are
functionally equivalent to 1A7, or have altered but measurable 1A7
immunologic activity. Fragments with improved 1A7 immunologic
activity are preferred. Examples of modified polypeptides include
polypeptides with conservative substitutions of amino acid
residues, and one or more deletions or additions of amino acids
which do not significantly deleteriously change the functional
activity.
[0167] One example of this is 1A7 polypeptides comprising one or
more amino acid substitution in comparison with the prototype 1A7
sequence. Substitutions can range from changing or modifying one or
more amino acids to complete redesign of a region, such as the
variable region. Amino acid substitutions, if present, are
preferably conservative substitutions that do not deleteriously
affect folding or functional properties of the peptide. Groups of
functionally related amino acids within which conservative
substitutions may be made are glycine/alanine;
valine/isoleucine/leucine; asparagine/glutamine; aspartic
acid/glutamic acid; serine/threonine/methionine; lysine/arginine;
and phenylalanine/tryosine/tryptophan. Polypeptides of this
invention may be in glycosylated or unglycosylated form, may be
modified post-translationally (e.g., acetylation, and
phosphorylation) or may be modified synthetically (e.g., the
attachment of a labeling group).
[0168] The invention also encompasses fusion proteins comprising
one or more 1A7 polypeptide. A 1A7 fusion polypeptide can be
prepared, for example, by chemical synthesis, or by creating and
translating a polynucleotide in which the peptide regions are
encoded in the desired relationship. Alternatively, fusion proteins
may be provided in expression systems constructed by
co-transfection with plasmids comprising encoding regions for
different functional regions of the protein.
[0169] Useful heterologous sequences for inclusion in a fusion
polypeptide include sequences that provide for secretion from a
host cell, enhance immunological reactivity, or facilitate the
coupling of the polypeptide to an immunoassay support or a vaccine
carrier. One example is a bacterial "super antigens", such as
staphylococcal enterotoxin A (SEA) (Dohlsten et al. (1994) Proc.
Natl. Acad. Sci. USA 91:8945-8949). In a preferred example, a 1A7
polypeptide is fused with a bioresponse modifier, particularly a
cytokine, which may enhance immunogenicity. Examples of bioresponse
modifiers include cytokines and lymphokines such as GM-CSF,
interleukin-2 (IL-2), interleukin 4 (IL-4), and y-interferon.
GM-CSF and IL-2 are especially preferred. The preferred arrangement
is for the cytokine effector unit to be fused to the C-terminal of
the immunoglobulin heavy chain.
[0170] 1A7 polypeptide derivatives comprising both a 1A7 light
chain and a 1A7 heavy chain may be formed as separate light and
heavy chains and then assembled, or assembled in situ by an
expression system for both chains. Such expression systems may be
created by tranfecting with a plasmid comprising separate
transcribable regions for the light and heavy chain, or by
co-transfecting the same cell with plasmids for each chain. In a
third method, a suitable plasmid with a heavy chain encoding region
is transfected into a heavy chain loss mutant. For example, heavy
chain loss mutants can be obtained by treating 2.times.10.sup.7 1A7
cells with fluorescein-labeled rabbit anti-mouse IgG (H chain
specific, DAKO Corporation, Carpinteria, Calif.) according to the
supplier's instruction. The stained and unstained cell populations
are analyzed in a fluorescence-activated cell sorter. The unstained
cells are collected in a sterilized tube and placed in 96-well
plates with 1 cell/well by limiting dilution. The culture
supernatants are then assayed by ELISA using goat anti-mouse IgG
(heavy chain specific) and goat anti-mouse kappa. The clones with
kappa-positive and IgG-negative phenotype are subcloned at least 3
times to obtain stable 1A7.sup.(-H) mutants. mRNA from putative
heavy chain loss mutant 1A7.sup.(-H) clones can be isolated and the
sequence of the light chain variable region cDNA determined.
Reverse PCR of the mRNA for the 1A7 V.sub.H is performed with 2
sets of 5'- and 3'-primers, used for cloning of 1A7.sup.(-H) cDNA
(Example 2). A heavy chain loss mutant should yield no detectable
DNA band. Transfection of these cells may then proceed using a
suitable heavy chain plasmid construct.
[0171] The invention also encompasses a hybrid antibody, in which
one pair of heavy and light chains is obtained from a first
antibody, which the other pair of heavy and light chains is
obtained from a different second antibody. For purposes of this
invention, one pair of light and heavy chains is from 1A7. In one
example, each light-heavy chain pair binds different epitopes of
GD2. Such hybrids may also be formed using chimeric heavy or light
chains.
[0172] Another embodiment is a humanized version of 1A7.
"Humanized" antibodies are antibodies in which at least part of the
sequence has been altered from its initial form to render it more
like human immunoglobulins. In one version, the heavy chain and
light chain constant regions are replaced with human sequence. This
is a fusion polypeptide comprising a 1A7 variable region and a
heterologous immunoglobulin constant region. In another version,
the CDR regions comprise 1A7 amino acid sequences, while the
variable framework regions have also been converted human
sequences. See, for example, EP 0329400. In a third version,
variable regions are humanized by designing consensus sequences of
human and mouse variable regions, and converting residues outside
the CDRs that are different between the consensus sequences.
[0173] Another 1A7 derivative contemplated by this invention is an
antibody in which the 1A7 heavy or light chain has been modified to
provide additional properties. For instance, a change in amino acid
sequence can result in greater immunogenicity of the resultant 1A7
polypeptide. The changes range from changing of one or more amino
acids to the complete redesign of a region such as a constant
region domain. Changes contemplated affect complement fixation,
interaction with membrane receptors, and other effector functions.
A recombinant 1A7 antibody may also be designed to aid the specific
delivery of a substance (such as a lymphokine) to an effector cell.
Also contemplated are proteins in which various immunoglobulin
domains have been placed in an order other than occurs in
nature.
[0174] The invention also encompasses single chain variable region
fragments ("scFv") of 1A7. Single chain variable region fragments
are made by linking light and/or heavy chain variable regions by
using a short linking peptide (Bird et al. (1988) Science 242:
423-426). Any peptide having sufficient flexibility and length can
be used as a linker in a scFv. Usually the linker is selected to
have little to no immunogenicity. An example of a linking peptide
is (GGGGS)3 (SEQ. ID NO:45), which bridges approximately 3.5 nm
between the carboxy terminus of one variable region and the amino
terminus of another variable region. Other linker sequences may
also be used, and may provide additional functions, such as a means
for attaching a drug or to a solid support.
[0175] All or any portion of the heavy or light chain can be used
in any combination. Typically, the entire variable regions are
included in the scFv. For instance, the light chain variable region
can be linked to the heavy chain variable region. Alternatively, a
portion of the light chain variable region can be linked to the
heavy chain variable region, or portion thereof. Also contemplated
are scFvs in which the heavy chain variable region is from 1A7, and
the light chain variable region is from another immunoglobulin. It
is also possible to construct a biphasic, scFv in which one
component is a 1A7 polypeptide and another component is a different
polypeptide, such as a T cell epitope.
[0176] The scFvs can be assembled in any order, for example,
V.sub.H--(linker)--V.sub.L or V.sub.L--(linker)--V.sub.L. There may
be a difference in the level of expression of these two
configurations in particular expression systems, in which case one
of these forms may be preferred. Tandem scFvs can also be made,
such as (X)--(linker)--(X)--(li- nker)--(X), in which X are 1A7
polypeptides, or combinations of 1A7 polypeptides with other
polypeptides. In another embodiment, single chain 1A7 antibody
polypeptides have no linker polypeptide, or just a short,
inflexible linker. Possible configurations are V.sub.L-V.sub.H and
V.sub.H-V.sub.L. The linkage is too short to permit interaction
between V.sub.L and V.sub.H within the chain, and the chains form
homodimers with a V.sub.L/V.sub.H antigen binding site at each end.
Such molecules are referred to in the art as "diabodies".
[0177] Single chain variable regions may be produced either
recombinantly or synthetically. For synthetic production of scFv,
an automated synthier can be used. For recombinant production of
scFv, a suitable plasmid containing polynucleotide that encodes the
scFv can be introduced into a suitable host cell, either
eukaryotic, such as yeast, plant, insect or mammalian cells, or
prokaryotic, such as E. coli, and the expressed protein may be
isolated using standard protein purification techniques.
[0178] A particularly useful system for the production of 1A7
scFv's is plasmid vector pET-22b(+) (Novagen, Madison, Wis.) in E.
coli. pET-22b(+) contains a nickel ion binding domain consisting of
6 sequential histidine residues, which allows the expressed protein
to be purified on a suitable affinity resin. Another example of a
vector that can be used is pcDNA3 (Invitrogen, San Diego, Calif.),
described above.
[0179] Conditions of expression should be such that the scFv
polypeptide can assume optimal tertiary structure. Depending on the
plasmid used (especially the activity of the promoter) and the host
cell, it may be necessary to modulate the rate of production. For
instance, use of a weaker promoter, or expression at lower
temperatures, may be necessary to optimize production of properly
folded scFv in prokaryotic systems; or it may be preferably to
express scFv in eukaryotic cells.
[0180] Preferred single chain variable regions comprise at least 10
consecutive amino acids of SEQ. ID NO:2 and at least 10 consecutive
amino acids of SEQ. ID NO:4, especially wherein the amino acids of
SEQ. ID NO:2 and the amino acids of SEQ. ID NO:4 are joined by a
linker polypeptide of 5 to 20 amino acids, or comprising the light
chain variable region and the heavy chain variable region of
monoclonal antibody 1A7.
[0181] The invention also encompasses polymeric forms of 1A7
polypeptides, containing a plurality of 1A7 polypeptides. One
embodiment is a linear polymer of 1A7 polypeptides, optionally
conjugated to carrier. These linear polymers can comprise multiple
copies of a single 1A7 polypeptide, or combinations of different
1A7 polypeptides, and can have tandem 1A7 polypeptides, or 1A7
polypeptides separated by other amino acid sequences. Another
embodiment is 1A7 multiple antigen peptides (MAPs). MAPs have a
small immunologically inert core having radially branching lysine
dendrites, onto which a number of 1A7 polypeptides are covalently
attached. See Posnett et al. (1988) J. Biol. Chem. 263:1719-1725;
Tam (1989) Methods Enzymol. 168:7-15. The result is a large
macromolecule having a high molar ratio of 1A7 polypeptides to
core. MAPs are efficient immunogens and useful antigens for
immunoassays. The core for creating an 1A7 MAP can be made by
standard peptide synthesis techniques, or obtained commercially
(Quality Controlled Biochemicals, Inc., Hopkinton, Mass.). A
typical core matrix is made up of three levels of lysine and eight
amino acids.
[0182] In another embodiment of the invention, the immunogenicity
of the 1A7 polypeptides is enhanced by preparing them in expression
systems in which they are assembled with particle-forming proteins
such as, for example, those associated with hepatitis B virus. See,
e.g., U.S. Pat. No. 4,722,840. Constructs wherein the 1A7
polypeptide is linked directly to particle-forming protein coding
sequences produce hybrids which are immunogenic for an anti-GD2
response. The vectors also comprise immunogenic HBV epitopes; for
example, the pre-S peptide and stimulate a response against HBV.
Such expression systems may be provided in eukaryotic cells,
including yeast or mammalian cells.
[0183] In another embodiment, 1A7 polypeptides are conjugated to a
carrier molecule. This is desirable for a 1A7 peptide that
comprises a suitable epitope for eliciting anti-GD2, but is too
small to be immunogenic. Any conjugation method known in the art
may be used. Any carrier can be used which is not harmful to the
host Suitable carriers are typically large, slowly metabolized
macromolecules such as proteins; polysaccharides (such as latex
functionalized SEPHAROSE.TM., agarose, cellulose, cellulose beads
and the like); polymeric amino acids (such as polyglutamic acid,
polylysine, and the like); amino acid copolymers; and inactive
virus particles or attenuated bacteria, such as Salmonella.
Especially useful carrier proteins are serum albumins, keyhole
limpet hemocyanin (KLH), certain immunoglobulin molecules,
thyroglobulin, ovalbumin, and tetanus toxoid. KLH is especially
preferred.
[0184] 1A7 polypeptides of the invention can be identified in a
number of ways. For example, the variable regions of the light and
heavy chains can be screened by preparing a series of short
polypeptides that together span the entire variable region amino
acid sequence. Using a series of polypeptides of 20 or 50 amino
acids in length, each 1A7 variable region may be surveyed for
useful functional properties. It is also possible to carry out a
computer analysis of a protein sequence to identify potentially
interesting polypeptides, such as those that bear the shape of D2,
or those involved in idiotype-anti-idiotype contact.
[0185] Those skilled in the art will readily appreciate that the
various adaptations of 1A7 described in this section may be
combined in various fashions to yield other 1A7 polypeptides with
desirable properties. For instance, 1A7 polypeptides with modified
residues may be comprised in a MAP. In another example, a 1A7 scFv
is fused to a cytokine, such as IL-2. All such combinations are
contemplated in this invention.
[0186] Preparation of 1A7 Polypeptides
[0187] The polypeptides of this invention can be made by any
suitable procedure, including proteolysis of the 1A7 antibody, by
recombinant methods or by chemical synthesis. 1A7 polypeptides,
especially shorter polypeptides up to about 50 amino acids, are
conveniently made by chemical synthesis, based on the sequence data
and other information provided herein.
[0188] Certain 1A7 polypeptides which are fragments of the whole
molecule may alternatively be prepared from enzymatic cleavage of
intact 1A7. Examples of proteolytic enzymes include, but are not
limited to, trypsin, chymotrypsin, pepsin, papain, V8 protease,
subtilisin, plasmin, and thrombin. Intact 1A7 can be incubated with
one or more proteinases simultaneously or sequentially.
Alternatively, or in addition, intact 1A7 can be treated with
disulfide reducing agents. Peptides may then be separated from each
other by techniques known in the art, including but not limited to
gel filtration chromatography, gel electrophoresis, and
reverse-phase HPLC.
[0189] A 1A7 polypeptide can also be made by obtaining a
polynucleotide encoding it according to the information provided
elsewhere in this application, and introducing it into a suitable
expression system. Typically, polynucleotides encoding a 1A7
polypeptide are ligated into an expression vector under control of
a suitable promoter and used to genetically alter the intended host
cell. Both eukaryotic and prokaryotic host systems can be used. The
polypeptide is then isolated from lysed cells or from the culture
medium and purified to the extent needed for its intended use.
Examples of prokaryotic host cells appropriate for use with this
invention include E. coli. Examples of eukaryotic host cells
include avian, insect, plant, and animal cells such as COS7, HeLa,
and CHO cells.
[0190] In certain applications, such as when a 1A7 polypeptide is
expressed in a suitable storage medium such as a plant seed, the
1A7 polypeptide can be used without purification (Fiedler et al.
(1995) Biotechnology 13:1090-1093). For most applications, it is
generally preferable that the polypeptide is at least partially
purified from other cellular constituents. Preferably, the
polypeptide is at least about 50% pure. as a weight percent of
total protein. More preferably, the protein is at least about
50-75% pure. For clinical use, the polypeptide is preferably at
least about 80% pure, according to the criteria given in another
section.
[0191] Characterization of 1A7 Polypeptides
[0192] The 1A7 polypeptides of this invention can be characterized
in several ways. For instance, a 1A7 polypeptide may be tested for
its ability to bind specifically to 14G2a, for its ability to
specifically inhibit the binding between 14G2a and intact 1A7, or
for its ability to specifically inhibit the binding between 14G2a
and GD2. Alternatively, a 1A7 polypeptide can be tested for its
ability to elicit an immune response, preferably an anti-GD2
response. 1A7 polypeptides can also be tested for their ability to
palliate or ameliorate GD2-associated disease, such as
GD2-associated tumors. It is understood that only one of these
properties need be present in order for a polypeptide to come
within this invention, although preferably more than one of these
properties is present.
[0193] The ability of a 1A7 polypeptide to bind 14G2a may be tested
by immunoassay. Any form of direct binding assay is suitable. In
one such assay, the 14G2a or alternatively the 1A7 polypeptide is
labeled. Suitable labels include radioisotopes such as .sup.125I,
enzymes such as peroxidase, fluorescent labels such as fluorescein,
and chemiluminescent labels. Typically, the other binding partner
is insolubilized (for example, by coating onto a microtiter plate)
to facilitate washing. After combining the labeled component with
the insolubilized component, the solid phase is washed and the
amount of bound label is determined. Another such assay is a
sandwich assay, in which the putative 1A7 polypeptide is captured
by a first anti-immunoglobulin on a solid phase and developed with
a second anti-immunoglobulin. Either the insolubilized or labeled
anti-immunoglobulin or both is 14G2a In either of these examples,
the extent of binding of 1A7 is directly related to the amount of
label bound to the solid phase.
[0194] To conduct the inhibition assays, the putative 1A7
polypeptide is titered for its ability to decrease the binding of
1A7 to 14G2a, or 14G2a to GD2. Either of the binding pairs in the
reaction to be inhibited is labeled, while the other is typically
insolubilized in order to facilitate washing. GD2, if it is used,
may be provided as the purified ganglioside, or as a GD2-expressing
cell line, like M21/P6. The 1A7 polypeptide is typically mixed with
the labeled component, and then the mixture is combined with the
solid phase. Polypeptides with the characteristics of 1A7 will
proportionately decrease the amount of label attached to the solid
phase, compared with control polypeptides. This test may be more
sensitive than measuring direct binding, because lower affinity
interaction between 1A7 and Ab1 may be too weak to form a stable
bond, but adequate to interfere with the binding of another
ligand-receptor pair when present at sufficient concentration.
[0195] A 1A7 polypeptide or a molecule comprising such a peptide
that has an Fc-like effector component may be tested for their
ability to mediate immune effector reactions, particularly
complement-mediated cytolysis (CMC) and antibody-dependent cellular
cytotoxicity (ADCC). Suitable assays are described elsewhere in
this disclosure.
[0196] Another way of characterizing 1A7 polypeptides, particularly
those intended for use in therapy, is to test their ability to
generate an immune response. Suitable techniques for characterizing
the immune response are given in a later section.
[0197] Uses of Polypeptides
[0198] Polypeptide fragments, fusion proteins, and other
derivatives of 1A7 have many uses The uses generally parallel those
of the intact 1A7 antibody as outlined earlier in this disclosure.
Certain derivatives may have desirable effects for particular uses.
For example, humanized or single-chain variable region molecules
may be desirable for human administration, because they are less
likely to stimulate an anti-mouse isotype response. Fusion proteins
comprising a cytokine may be more immunogenic.
[0199] Preferred uses of these compounds include eliciting an
antibody response to 1A7 or more preferably GD2, eliciting a T cell
response to 1A7 or more preferably GD2, and treating various types
of GD2-associated cancer. These uses are elaborated more fully in a
later section.
[0200] Pharmaceutical Compositions and Vaccines Comprising 1A7
Antibody and Polynucleotide and Polypeptide Derivatives
[0201] The present invention encompasses pharmaceutical
compositions and vaccines containing 1A7 antibody, or
polynucleotide or polypeptide derivatives of 1A7 either alone or in
combination. Such pharmaceutical compositions and vaccines are
useful for eliciting an immune response and treating GD2-associated
diseases, either alone or in conjunction with other forms of
therapy, such as chemotherapy or radiotherapy.
[0202] Pharmaceutical compositions include vaccines for direct
administration to an individual. Vaccines may comprise 1A7
antibodies, polynucleotides, or polypeptide derivatives, or a
combination thereof.
[0203] Vaccines containing naked 1A7 polynucleotides can be used
for genetic immunization (see generally Tang et al. (1992) Nature
356: 152-154). Once in the cell nuclei, plasmids comprising 1A7
encoding regions may persist as circular non-replicating episomes
leading to dose-dependent and long-lived expression. (Spooner et
al. (1995) Gene Therapy 2:173-180). Immunization using
polynucleotides has been shown to generate cellular as well as
humoral responses (Spooner et al.; Wang et al. (1995) Human Gene
Therapy 6:407-418). Genetic immunization has many of the advantages
of live or attenuated microorganisms as vehicles for eliciting an
immune response, without the risk of infection.
[0204] Preferably, 1A7 polynucleotides are in the form of plasmid
vectors containing appropriate control sequences for transcription
and translation, such as promoters, enhancers, and signal
sequences. One or more 1A7 polynucleotides can be used within a
single cloning vector, or multiple vectors can be used. A preferred
1A7 encoding region for use in a polynucleotide vaccine encodes a
1A7 scFv. The polynucleotide vaccine may also comprise encoding
regions for other substances which will enhance the immune
response. A preferred example is GM-CSF.
[0205] Another preferred embodiment of an 1A7 polynucleotide
suitable for use as a vaccine is a viral vector. Examples include
adenovirus, adeno-associated retroviruses (AAV), and SV40.
Especially preferred is a vaccinia vector, whereby the polypeptide
encoded by the 1A7 polynucleotide is expressed along with the
immunogenic viral particle. Recombinant vaccinia comprising
polynucleotides encoding 1A7 polypeptides such as scFv may be used
for direct vaccination at about 10.sup.7 to 10.sup.8 plaque forming
units per dose. Vaccinia can be administered parenterally, by
subcutaneous or intramuscular injection, for example, as well as
through mucosal membranes, such as nasally, orally or by
inhalation. Alternatively, vaccinia can be administered via
vaccinia-infected cells. In this technique, suitable cells, such as
tumor cells, are infected with vaccinia in culture. The infected
cells are then reintroduced to the individual. Methods for
infecting cells with vaccinia and reintroducing these infected
cells, have been described (see, e.g., Moss (1991)).
[0206] Other 1A7 polynucleotide vaccines may be designed using
other delivery vehicles known in the art. Another such delivery
vehicle is cationic liposomes, to which DNA may be readily attached
by virtue of its charge.
[0207] Vaccines can also be prepared from the 1A7 antibody,
polypeptide derivatives thereof, or an combination thereof. A
protein can optionally be treated chemically to enhance its
immunogenicity, especially if 100 amino acids or less. This may
include cross-linking, for example, with glutaraldehyde; or linking
to a protein carrier, such as keyhole limpet hemocyanin (KLH) or
tetanus toxoid.
[0208] The preparation of pharmaceutical compositions that contain
1A7 antibody, or polynucleotide or polypeptide derivative as an
active ingredient is conducted in accordance with generally
accepted procedures for the preparation of pharmaceutical
preparations. See, for example, Remington's Pharmaceutical Sciences
18th Edition (1990), E. W. Martin ed., Mack Publishing Co., PA.
Depending on the intended use and mode of administration, it may be
desirable to process the active ingredient further in the
preparation of pharmaceutical compositions. Appropriate processing
may include sterilizing, mixing with appropriate non-toxic and
non-interfering components, dividing into dose units, and enclosing
in a delivery device.
[0209] Liquid pharmaceutically administrable compositions can, for
example, be prepared by dissolving or dispersing a vector embodied
herein in a liquid excipient, such as water, saline, aqueous
dextrose, glycerol, or ethanol. The composition may optionally also
contain other medicinal agents, pharmaceutical agents, adjuvants,
carriers, and auxiliary substances such as wetting or emulsifying
agents, and pH buffering agents.
[0210] Protein vaccines of this invention typically comprise an
adjuvant, which may be the same as or in addition to the excipient
or carrier. Examples of adjuvants include but are not limited to
aluminum hydroxide, alum, QS-21 (U.S. Pat. No. 5,057,540), DHEA
(U.S. Pat. Nos. 5,407,684 and 5,077,284) including its precursors
and modified forms (e.g., DHEA-S, the sulfonated form of DHEA),
.beta.2 microglobulin (WO 91/16924), muramyl dipeptides, muramyl
tripeptides (U.S. Pat. No. 5,171,568), monophosphoryl lipid A (U.S.
Pat. No. 4,436,728; WO 92/16231) and its derivatives, such as
various forms and generations of DETOX.TM. and BCG (U.S. Pat. No.
4,726,947). Other suitable adjuvants are aluminum salts, squalene
mixtures (SAF-1), muramyl peptide, saponin derivatives,
mycobacterium wall preparations, mycolic acid derivatives, nonionic
block copolymer surfactants, Quil A, cholera toxin B subunit,
polyphosphazene and derivatives, and immunostimulating complexes
(ISCOMs) such as those described by Takahashi et al. (1990) Nature
344:873-875. For veterinary use and for production of antibodies in
animals, complete and incomplete Freund's adjuvant can be used. The
choice of an adjuvant will depend, in part, on the stability of the
vaccine in the presence of the adjuvant, the route of
administration, and the regulatory acceptability of the adjuvant,
particularly when intended for human use. For instance, alum is
approved by the United States Food and Drug Administration (FDA)
for use as an adjuvant in humans.
[0211] A preferred vaccine composition comprising 1A7 antibody or
peptide derivative is prepared by mixing with aluminum hydroxide
and incubated to about 48.degree. C. for about 30 min. Even more
preferred are vaccine compositions comprising 1A7 and QS-21 or
RIBI.TM.PC. QS-21 and RIBI.TM.PC are equally preferred; and the
selection between them is made on the basis of availability.
[0212] Pharmaceutical compositions of the present invention are
administered by a mode appropriate for the form of composition.
Possible routes include intracutaneous, subcutaneous,
intramuscular, intraperitoneal, intradermal, oral, intranasal,
intradermal, and intrapulmonary (i.e., by aerosol). Protein
vaccines of this invention for human use are typically administered
by a parenteral route, most preferably subcutaneous. A series of
injections is preferably given at different subcutaneous sites.
[0213] Pharmaceutical compositions for oral, intranasal, or topical
administration can be supplied in solid, semi-solid or liquid
forms, including tablets, capsules, powders, liquids, and
suspensions. Compositions for injection can be supplied as liquid
solutions or suspensions, as emulsions, or as solid forms suitable
for dissolution or suspension in liquid prior to injection. For
administration via the respiratory tract, a preferred composition
is one that provides either a solid or liquid aerosol when used
with an appropriate aerosolizer device. Although not required,
pharmaceutical compositions are preferably supplied in unit dosage
form suitable for administration of a precise amount Also
contemplated by this invention are slow release or sustained
release forms, whereby a relatively consistent level of the active
compound are provided over an extended period.
[0214] It is recognized that a number of alternative vaccine
compositions, not limited to those described herein, may be
efficacious in inducing an immune response. All such compositions
are embodied within the present invention, providing they include a
1A7 polynucleotide or polypeptide as an active ingredient The
pharmaceutical compositions of this invention can be used in
conjunction with other modes of therapy, whether established or
experimental, whenever this is clinically desirable.
[0215] Testing 1A7 Compounds and Compositions for the Ability to
Elicit a Specific Immune Response
[0216] Compounds embodied in this invention may be assessed for
their ability to elicit a specific immune response. Accordingly,
test compounds are prepared as a suitable pharmaceutical
composition and administered to test subjects. Initial studies are
preferably done in small animals such as mice or rabbits,
optionally next in non-human primates and then ultimately in
humans. Immunogenicity is preferably tested in individuals without
a previous anti-1A7 response.
[0217] A test composition in an appropriate test dose is
administered on an appropriate immunization schedule. It may be
appropriate to compare different doses and schedules within the
predicted range.
[0218] Samples (usually blood samples) are collected regularly
during treatment, and assayed for a specific immune response. The
response may include antibody, helper-inducer T cells, or cytotoxic
T cells, or a combination thereof. As a screening test, the samples
may be measured for an anti-1A7 response. Since the objective is
typically to identify compositions useful in cancer therapy, the
samples are preferably measured for an anti-GD2 response, as
manifest in direct or inhibition type experiments.
[0219] This section outlines some non-limiting examples of assays
that are suitable to monitor the immune response.
[0220] Presence of anti-1A7 (Ab3) and anti-GD2 (Ab1') activity in a
humoral response is preferably determined after first
pre-incubating sera with autologous immunoglobulin or adsorbing on
a suitable affinity resin to remove antibody activity against
isotypic and allotypic determinants. The adsorbed serum is then
tested for Ab3 or Ab1 activity, for example, using ELISA or RIA.
For instance, different dilutions of pre-reacted sera are reacted
with 1A7 (or 1A7 polypeptide) coated on microtiter plates. An
unrelated Ab2 serves as a control. After washing, the Ab3-1A7
complex is labeled using, for example, .sup.125I-labeled 1A7 in a
homogeneous sandwich assay. Results from this assay are compared to
those obtained before administration of the 1A7 polypeptide
(Example 1). Alternatively, binding to GD2 positive cells, such as
M21/P6 cells, can be tested using immune flow cytometry. In a third
example, the specificity of Ab3 is determined by Western blot. GD2
is separated by SDS-PAGE and blotted to a nitrocellulose filter.
The filter is then incubated with sera containing Ab3, and the
reaction developed by a suitably labeled anti-immunoglobulin. If
the Ab3 binds to GD2, a band at the appropriate molecular weight
should appear.
[0221] If desired, the specificity of the Ab3 can be further
characterized. For example, competition assays can be performed to
determine whether Ab3 share Ab1 idiotopes. Accordingly, competition
experiments are conducted in which Ab3 is tested for inhibition of
binding between 1A7 and 14G2a. Inhibition indicates that Ab3 and
14G2a contain at least some similar binding determinants.
Competition of Ab3 with the binding of 14G2a to GD2 may also be
measured.
[0222] Another way of characterizing a composition of this
invention is testing its ability to elicit an antibody that is
cytotoxic. For determination of complement mediated cytotoxicity
(CMC), M21/P6 target cells expressing GD2 are labeled with
.sup.51Cr. Labeling may be accomplished by incubating about
10.sup.6 cells with approximately 200 .mu.Ci Na.sub.2SO.sub.4 for
60 minutes at 37.degree. C., followed by washing. The assay is
conducted by adding and incubating serum suspected of containing
antibody. Guinea pig serum pre-adsorbed with M21/P6 cells (or other
source of complement) is then added. After a suitable incubation
period at 37.degree. C., extent of .sup.51Cr release is then
measured and compared with that of unopsonized control cells.
Release of .sup.51Cr correlates with CMC activity (Herlyn et al.
(1981) Int J. Cancer 27:769).
[0223] Another way of characterizing a composition of this
invention is by testing its ability to elicit an anti-GD2 antibody
that participates in an ADCC response (Cheresh et al. (1986) Cancer
Research 46:5112-5118). In this assay, cultured human M21/P6 cells
(which express GD2 in their surface) are labeled with 5Cr and are
used as target cells. Normal human peripheral blood mononuclear
cells (PBMC) are used as effector cells. The Ab3 containing serum
from immunized subjects is supplied to mediate the ADCC reaction.
Preferably, the ADCC assay is conducted in the presence of
heat-inactivated serum with an effector to target cell ratio of
100:1 for 4 hours, although other suitable conditions may be used.
The amount of .sup.51Cr released is then measured.
[0224] The 1A7 antibodies, polynucleotides and polypeptides of this
invention can also be characterized by their ability to elicit a
cellular immune response. As used herein, a "cellular immune
response" is a response that involves T cells, and can be observed
in vitro or in vivo. Subjects are immunized with the 1A7
composition, and cells are recovered for assaying the response.
Where the subject is a small animal, cells are typically obtained
from the spleen. For larger animals including humans, cells are
typically obtained from peripheral blood. A suitable cell
population is recovered from the sample by standard separation
techniques, typically involving centrifugation over an appropriate
medium such as FICOLL-HYPAQUE.TM..
[0225] One way of detecting a cellular immune response is by
assaying for T cell proliferative activity. In this test, cellular
immune response is measured by proliferation of peripheral blood
mononuclear cells (PBMCs) incubated with 1A7 polypeptide. PBMCs are
isolated after a requisite number of administrations of 1A7
polypeptide, and are incubated with varying concentrations of 1A7
polypeptide. A non-specific mitogen such as PHA serves as a
positive control; incubation with an unrelated anti-idiotype
antibody serves as a negative control. Preferably, the stimulator
cells are autologous with the responder cells, particularly in
terms of histocompatibility Class II antigens. After incubation of
the PBMCs for an appropriate period (typically 5 days),
[.sup.3H]thymidine incorporation is measured. If desired,
determination of which subset of T cells are proliferating can be
performed using flow cytometry. Optionally, splenic T cells can be
pre depleted of either CD4.sup.+ or CD8.sup.+ cells before the
proliferation assay by incubation with monoclonal antibody RL.172
(anti-CD4.sup.+) or monoclonal antibody.168 (anti-CD8.sup.+) and
complement Another way of detecting a cellular immune response is
to test for T cell cytotoxicity (CTL) activity. In this test, an
enriched T cell population are used as effectors in a standard
.sup.51Cr release assay (Kantor et al. (1992) J. Natl. Cancer Inst.
84:1084-1091). An example of a .sup.51Cr release assay is the
following. GD2-positive tumor cells (typically 1-2.times.10.sup.6
cells) are radiolabeled as target cells with about 200 .mu.Ci of
Na.sub.2 .sup.51CrO.sub.4 (Amersham Corp., Arlington Heights, Ill.)
for 60 minutes at 37.degree. C., followed by thorough washing to
remove unincorporated isotopes. T cells and targets
(1.times.10.sup.4/well), both resuspended in culture medium, are
then be combined at various effector-to-target ratios in 96-well,
U-bottom plates (Costar Corp.). The plates are centrifuged at
100.times. g for 5 minutes to initiate cell contact, and are
incubated for 4 or 16 hours at 37.degree. C. with 5% CO.sub.2.
After incubation, supernatants are collected using a Supernatant
Collection System (Skatron, Inc., Sterling, Va.) and radioactivity
will be quantitated in a gamma counter (Beckman Instruments).
Spontaneous release of .sup.51Cr is determined by incubation of
targets in the absence of effectors, while maximum or total release
of .sup.51Cr will be determined by incubation of targets in 0.1%
TRITON X-100. Percentage of specific release of .sup.51Cr is
calculated in relation to spontaneous and maximal release.
[0226] Another way of characterizing a 1A7 polypeptide is testing
its ability to ameliorate, delay the progression or reduce the
extent of GD2-associated disease, as outlined in the following
section.
[0227] Use of Pharmaceutical Compositions for Eliciting an Immune
Response and Treating Disease
[0228] Compositions embodied in this invention such as those
outlined in the previous section may be used for administration to
individuals. They may be administered for experimental purposes, or
to obtain a source of anti-GD2.
[0229] Compositions of this invention are particularly suitable for
administration to human individuals with a GD2-associated disease.
A GD2 associated disease is one in which expression of the GD2
ganglioside is altered at the affected tissue site, usually an
elevation in cell-surface expression. Relevant diseases are those
in which an active immune response against GD2 would confer a
clinical benefit. Especially relevant are GD2-associated cancers;
particularly melanoma, neuroblastoma, glioma, sarcoma, and small
cell lung cancer.
[0230] The compositions of this invention may be administered to an
individual with one of several objectives in mind. For example, the
various compositions of this invention may be used to elicit an
immune response. This includes an anti-1A7 specific response, and
more preferably an anti-GD2 response. The desired response may be a
specific antibody response; a specific T helper-inducer repines, or
a specific cytotoxic T cell response. An ADCC response or a
cytotoxic T cell response is especially preferred in the context of
cancer therapy, since these arms of the immune system are believed
to be important effector elements in immune surveillance. The
presence of an antibody response may provide a convenient means for
routine clinical monitoring. Thus, a response that involves several
components of the immune response in combination is especially
preferred.
[0231] Assays for measuring and characterizing antibody response,
ADCC, antibody-mediated cytolytic activity, T cell proliferative
activity, and cytotoxic T cell activity are all described elsewhere
in this disclosure.
[0232] Also included in this invention are methods for treating
GD2-associated disease, such as a tumor expressing GD2. The method
comprises administering an amount of a pharmaceutical composition
effective to achieve the desired effect, be it palliation of an
existing tumor mass or prevention of recurrence.
[0233] Dose
[0234] For treatment of a GD2-associated disease in vivo, the
amount of a pharmaceutical composition administered is an amount
effective in producing the desired effect. An effective amount may
be provided in one or a series of administrations.
[0235] For intact 1A7, a mouse requires approximately 100 .mu.g of
KLH-coupled 1A7 emulsified in CFA and IFA in each of at least about
three and typically at least four administrations. Monkeys require
approximately 2 mg. The range of intact 1A7 that can be
appropriately administered to humans is from about 10 .mu.g to 20
mg, preferably 200 .mu.g to 15 mg, more preferably 500 .mu.g to 10
mg, still more preferably 1 mg to 4 mg, and even more preferably 2
mg. Smaller peptides and fusion proteins may be more potent on a
per-weight basis, and the preferred dose may be lower than with the
intact molecule. Appropriate doses can easily be determined by
comparing various doses of intact 1A7 and derivatives thereof in
animal models, and scaling appropriately for human use.
[0236] The amount of 1A7 polynucleotide to be administered will
depend upon several factors, such as the route of administration,
the condition of the individual, and the desired objective.
Typically, if administered directly, the amount per administration
is about 10 .mu.g to 1 mg, preferably 25 .mu.g to 500 .mu.g, more
preferably 30 .mu.g to 250 .mu.g, even more preferably 50 to 100
.mu.g.
[0237] Administrations are typically conducted on a weekly or
biweekly basis until a desired, measurable parameter is detected,
such as elicitation of an immune response. Administration can then
be continued on a less frequent basis, such as biweekly or monthly,
as appropriate.
[0238] The various compounds of this invention can be used alone,
or in conjunction with other active agents that promote the desired
objective, or provide a desirable adjunct therapy.
[0239] The exact dose and timing for the administration of any
composition of this invention depends on the individual to be
treated, the capacity of the individual's immune system to
synthesize antibodies, the route of administration, the degree of
protection desired, and the immunological and clinical response to
previous doses. The immunological response may be assessed by
assays given in the previous section. Choosing an appropriate
amount to administer accordance with the guidelines suggested are
the responsibility of the administering physician.
[0240] Appropriate Subjects for Therapy, and Desirable Effects
[0241] Suitable subjects include those who are suspected of being
at risk of a pathological effect of any GD2-associated condition
are suitable for treatment with the pharmaceutical compositions of
this invention. Those with a history of a GD2-associated cancer are
especially suitable.
[0242] The clinical studies described in the Example section are
designed to exclude subjects who have not been treated previously
with mouse immunoglobulin. The concept is that a proportion of
subjects who have been so treated may have circulating anti-mouse
immunoglobulin (HAMA). This selection criteria has been implemented
to facilitate initial testing. However, the presence of HAMA is not
believed to be an impediment to therapy, since the purpose of the
1A7 is to elicit a response, not remain in the circulation.
Patients are more typically chosen for therapy irrespective of
their history of previous treatment with mouse immunoglobulin. Of
course, for certain engineered compounds like humanized 1A7 and
scFv, most mouse isotype determinants have been deleted, and the
presence of HAMA in a potential recipient is even less of a
consideration.
[0243] Suitable human subjects for therapy comprise two groups,
which may be distinguished by clinical criteria.
[0244] Patients with "advanced disease" or "high tumor burden" are
those who bear a clinically measurable tumor. A clinically
measurable tumor is one that can be detected on the basis of tumor
mass (e.g., by palpation, CAT scan, or X-ray, positive biochemical
or histopathological markers on their own are insufficient to
identify this population). A pharmaceutical composition embodied in
this invention is administered to these patients to elicit an
anti-GD2 response, with the objective of palliating their
condition. Ideally, reduction in tumor mass occurs as a result, but
any clinical improvement constitutes a benefit. Clinical
improvement includes decreased risk or rate of progression or
reduction in pathological consequences of the tumor.
[0245] A second group of suitable subjects is known in the art as
the "adjuvant group". These are individuals who have had a history
of a GD2-associated cancer, but have been responsive to another
mode of therapy. The prior therapy may have included (but is not
restricted to) surgical resection, radiotherapy, and traditional
chemotherapy. As a result, these individuals have no clinically
measurable tumor. However, they are suspected of being at risk for
progression of the disease, either near the original tumor site, or
by metastasis.
[0246] This group may be further subdivided into high-risk and
low-risk individuals. The subdivision is made on the basis of
features observed before or after the initial treatment. These
features are known in the clinical arts, and are suitably defined
for each different GD2-associated cancer. Features typical of high
risk subgroups are those in which the tumor has invaded neighboring
tissues, or who show involvement of lymph nodes.
[0247] A pharmaceutical composition embodied in this invention is
administered to patients in the adjuvant group, or in either of
these subgroups, in order to elicit an anti-GD2 response. Ideally,
the composition delays recurrence of the cancer, or even better,
reduces the risk of recurrence (i.e., improves the cure rate). Such
parameters may be determined in comparison with other patient
populations and other modes of therapy.
[0248] Of course, crossovers between these two patient groups are
possible, and the pharmaceutical compositions of this invention may
be administered at any time that is appropriate. For example, 1A7
therapy may be conducted before or during traditional therapy of a
patient with high tumor burden, and continued after the tumor
becomes clinically undetectable. 1A7 therapy may be continued in a
patient who initially fell in the adjuvant group, but is showing
signs of recurrence. The attending physician has the discretion to
determine how or when the compositions of this invention are to be
used.
[0249] It is recognized in the art that the immunological status of
each of the aforementioned category differs one from another by
several criteria For example, patients with active disease are
generally immunosuppressed, either due to tumor-related pathology
or to recent radiotherapy or chemotherapy. Their immune system may
be under a barrage of tumor-associated antigen from the tumor site.
On the other hand, patients who are in remission may have stronger
active suppression against autoantigens. Accordingly, the ability
of an anti-idiotype based vaccine to elicit an anti-tumor response,
or improve the clinical condition, must be determined separately
for each patient category.
[0250] Other Clinical Indications
[0251] Various compounds and compositions of this invention have
other clinical indications, of which this section provides only a
survey.
[0252] One indication is the treatment of cells ex vivo. This may
be desirable for experimental purposes, or for treatment of an
individual with a GD2-associated disease. In one example, the 1A7
antibody, or a polynucleotide or polypeptide derivative are
administered to a culture of cells, such as peripheral blood cells
obtained from a donor, or a suitable cell line. This may be done,
for example, with the objective of stimulating T cell activity.
About 0.5 to 2 .mu.g/mL of 1A7 is an effective dose for this
purpose. If desired, the stimulated cells may then be administered
to a recipient, in an effort to convey passive immunity. In a
second example, donor cells are genetically altered with an
expression vector of this invention, to provide for ongoing
secretion of 1A7 antibody after administration of the cells to the
recipient.
[0253] The invention also encompasses compositions and methods
using 1A7 antibodies and polypeptide derivatives to remove a label
(particularly a radiolabel) from an individual who has received a
labeled anti-GD2 antibody (such as 14G2a) in the course of
radioscintigraphy or radiotherapy. Effective imaging using
radiolabeled antibodies is hampered due to excess circulating
radiolabeled antibody, which often takes several days to clear.
Accordingly, 1A7 antibody or a polypeptide derivative is
administered to the individual at a specified time after
administration of the labeled anti-GD2. The intention is for the
1A7 polypeptide to complex with anti-GD2 at sites other than the
tumor, such as in the circulation and interstitial spaces, and
thereby promote its clearance. As a result, the level of label in
unaffected tissues is reduced, and the image of the tumor (in
comparison to neighboring tissues) is enhanced. Similarly, when
radionuclides are given to subjects for irradiation of a tumor
site, it is desirable to reduce collateral exposure of unaffected
tissue. This invention thus includes methods of treatment in which
a radiolabeled anti-GD2 antibody is administered in a therapeutic
dose, and followed by a molar excess of 1A7.
[0254] In either of these applications, an amount of 1A7
polypeptide is chosen that is in sufficient molar excess over the
labeled anti-GD2 to locate and bind any anti-GD2 that is not
localized at the tumor site. The timing of administration and
amount of 1A7 polypeptide will depend upon the nature of the
radiolabeled antibody, the type of radioisotope used and the
condition of the individual. Preferably, the molar ratio of 1A7
polypeptide to the anti-GD2 antibody is at least about 5:1, more
preferably about 25:1 to 200:1. Preferably, 1A7 polypeptide is
administered 5 to 24 hours after the individual has received the
anti-GD2 antibody.
[0255] The invention also includes methods of detecting the
presence of an anti-GD2 antibody bound to a tumor cell comprising
the steps of treating an individual with 1A7 for a sufficient time
to allow binding to the anti-GD2 antibody, and detecting the
presence of any complex formed. The intention is for the 1A7 to
detect anti-GD2 that has pre-attached to the tumor cell; or
alternatively, to promote the binding of anti-GD2 to the tumor cell
by forming a polyvalent anti-GD2/1A7 immune complex. In the former
instance, the anti-GD2 is provided with a detectable label or a
means by which a label can be attached. In the latter instance,
either the anti-GD2 or the 1A7 is provided with a label. Suitable
labels include radiolabels such as .sup.111In, .sup.131I and
.sup.99mTc. The anti-GD2 and 1A7 are administered (usually
sequentially) into the subject and allowed to accumulate at the
tumor site. The tumor is then detected or visualized using standard
techniques of radioscintigraphy.
[0256] Diagnostic Kits
[0257] The present invention encompasses kits containing 1A7
antibodies, polynucleotides, or polypeptides. Diagnostic procedures
using the 1A7 polynucleotides or polypeptides of this invention can
be performed by diagnostic laboratories, experimental laboratories,
practitioners, or private individuals. Kits embodied by this
invention include those that allow someone to conduct an assay for
anti-GD2 or anti-1A7 activity, or for an 1A7 encoding sequence. An
alteration in one of these components resulting, for example, from
the presence of a GD2-associated disease or treatment directed
towards it is typically compared with that in a sample from a
healthy individual. The clinical sample is optionally pre-treated
for enrichment of the target being tested for. The user then
applies a reagent contained in the kit in order to detect the
changed level or alteration in the diagnostic component.
[0258] Each kit necessarily comprises the reagent which renders the
procedure specific: a reagent 1A7 antibody or polypeptide, used for
detecting anti-1A7 or anti-GD2 in the sample; or a reagent 1A7
encoding polynucleotide, used for detecting a 1A7 encoding
polynucleotide in the sample. Optionally, the reagent may be
conjugated with a label to permit detection of any complex formed
with the target in the sample. In another option, a second reagent
is provided that is capable of combining with the first reagent
after it has found its target. For example, labeled anti-mouse IgG
may be provided as a secondary reagent for use with intact 1A7.
Labeled avidin may be provided as a secondary reagent when the
primary reagent has been conjugated with biotin.
[0259] The kits may be employed on a variety of biological samples,
including both liquid samples, cell suspensions and tissue samples.
Suitable assays using 1A7 antibodies, polypeptides, and
polynucleotides that can be supplied in kit form include those
described elsewhere in this disclosure.
[0260] Each reagent is supplied in a solid form or liquid buffer
that is suitable for inventory storage, and later for exchange or
addition into the reaction medium when the test is performed.
Suitable packaging is provided. The kit may optionally provide
additional components that are useful in the procedure. These
optional components include buffers, capture reagents, developing
reagents, labels, reacting surfaces, means for detection, control
samples, instructions, and interpretive information.
[0261] Deposit
[0262] The foregoing description provides, inter alia, detailed
methods for preparing monoclonal antibody 1A7, along with 1A7
encoding polynucleotides, 1A7 polypeptide fragments, and other
derivatives.
[0263] A practitioner of ordinary skill in the art may practice
embodiments of this invention by referring to the sequence data for
1A7, which is provided herein. Alternatively, a practitioner may
practice the invention by first purifying the 1A7 antibody, or a
1A7 encoding polynucleotide from a 1A7 antibody producing cell. A
hybridoma cell line producing 1A7 antibody has been deposited with
the American Type Culture Collection (ATCC) under terms of the
Budapest Treaty, and has been given Accession No. HB-11786.
[0264] The following examples are provided to illustrate but not
limit the present invention.
EXAMPLES
[0265] Example 1
Generation and Characterization of 1A7 Anti-Idiotype Antibody
[0266] The monoclonal anti-idiotype antibody producing hybridoma
cell line 1A7 was created and identified according to the following
description. Aspects of both the immunization procedure and the
screening procedure were important to obtain an antibody with the
desired specificity and functionality. 1A7 was one of a number of
Ab2 that were initially produced, and was identified as the
candidate with the most desirable features.
[0267] 1A7 was obtained by using the 14G2a mouse monoclonal
antibody as immunogen for an anti-idiotype response. 14G2a binds to
a unique epitope of GD2 that is not present on other members of the
ganglioside family. Since the responding animal was also a mouse,
the Ab2 generated were expected to be directed against idiotypic
features of 14G2a. However, only a fraction of those would be
directed against the 14G2a paratope, an even smaller proportion
would be immunogenic and capable of eliciting an Ab3, and a still
smaller proportion would elicit Ab3 that cross-reacted with the
tumor-associated antigen.
[0268] To render 14G2a sufficiently immunogenic in an autologous
species, it was conjugated to the carrier KLH, and emulsified in
Freund's adjuvant. It was administered repetitively into the
recipient animals on an unusual schedule with only 2 weeks between
doses. Five mice were immunized according to this schedule.
Substantial responses arose in about 3 mice only after the fourth
immunization. Responding animals were boosted with a fifth dose of
14G2a intravenously., spleen cells were isolated, and hybridomas
were prepared separately from each animal. Cloning was performed
according to standard techniques.
[0269] The screening procedure comprised four important steps: (1)
Positive selection for antibody binding to 14G2a; (2) Negative
selection against antibody recognizing isotypic or allotypic
determinants; (3) Positive selection for an ability to inhibit the
binding of 14G2a to GD2; and (4) Positive selection for an ability
to induce a humoral immune response against the original
tumor-associated antigen (GD2) in both mice and rabbits. The rest
of this section provides an overview of the screening procedure,
which is given in more detail in the sections that follow.
[0270] Initial screening was conducted by immunoassay to identify
the clones that reacted with 14G2a, but not with other target
monoclonal antibodies sharing the same allotypic or isotypic
determinants. A critical assay was a sandwich RIA in which 14G2a is
attached to a solid phase, overlaid with culture supernatant, and
developed with radioiodinated 14G2a This assay requires the
antibody in the hybridoma supernatant to be functionally bivalent,
and be able to span between the capture 14G2a and the developing
14G2a Several clones that were idiotype specific and gave a strong
signal in this assay were selected for further study.
[0271] Subsequent screening was conducted by competition assays, in
which the Ab2 was required to block the binding of 14G2a to GD2.
This established that Ab2 recognized the paratope of 14G2a GD2 was
provided in the form of M21/P6 cells, a human melanoma cell line
expressing GD2 at the cell surface. The nature of the assay
requires the Ab2 to block the interaction between 14G2a and the
tumor antigen in its particular manner of presentation on tumor
cells. At a minimum, candidate Ab2 which had passed the earlier
screening tests were required to inhibit the binding of 14G2a to
the cells by at least 75%. There were about three Ab2 that
substantially exceeded the minimum, with 1A7 providing about the
highest level of inhibition.
[0272] The ultimate screening test was a determination of whether
the candidate Ab2 were capable of eliciting an Ab3 of the desired
specificity when injected into a recipient Sufficient quantities of
Ab2 were prepared from mouse ascites, and tested in mice and
rabbits. Sera from the test animals were first assayed for the
presence of Ab3 in a sandwich immunoassay using the same labeled
Ab2 used for immunization. Sera testing positively were then
assayed for ability of the Ab3 to react against the
tumor-associated antigen; namely GD2. A preparation of GD2 was used
to coat microtiter plates, overlaid with the test serum in serial
dilutions, and the Ab3 that bound was detected using labeled
anti-immunoglobulin. The titer of the Ab3 binding to GD2 defined
the "quality" of Ab2, as a reflection of its capacity as an inducer
of anti-GD2.
[0273] Monoclonal antibody 1A7 emerged as the anti-idiotype with
the highest quality, and is the original basis for various
compounds, compositions, and procedures embodied in this invention.
The cell line producing 1A7 was recloned twice by limiting
dilution, to ensure the stability of the line.
[0274] Materials
[0275] Antibody: The hybridoma cell line producing monoclonal
antibody 14G2a was obtained from the Scripps Research Institution.
14G2a has been subtyped as an IgG2ac. The specificity of 14G2a was
reconfirmed by immunoperoxidase staining and flow microfluorimetry
analysis using cells expressing GD2. Other monoclonal and myeloma
mouse immunoglobulins were used as controls in various experiments
herein described.
[0276] Ascites of 14G2a hybridomas and other cell lines were
prepared by connecting individual Pristane-primed mice i.p. with
2-10.times.10.sup.6 viable cells. The IgG fraction was isolated
from ascites by 45% saturated ammonium sulfate precipitation and
subsequent chromatography on Protein A SEPHAROSE.TM. CL-4B (Ey et
al. (1978) Immunochemistry 15:429). The purity of the isolated IgG
was checked by immunodiffusion, immunoelectrophoresis, and high
pressure liquid chromatography (HPLC) fractionation.
[0277] Coupling of antibody with KLH: 14G2a was coupled to keyhole
limpet hemocyanin (KLH) according to a method described by Maloney
et al. (1985; Hybridoma 4:191). Antibody stock solution (1 mg/ml)
was mixed with KLH (1 mg/ml) in PBS in the presence of freshly
diluted glutaraldehyde solution (final concentration 0.05%). The
mixture was rotated end-over-end for 1 h at room temperature, and
then dialyzed exhaustively against PBS at 4.degree. C.
[0278] Immunization of syngeneic BALB/c mice: BALB/c females were
immunized four times over a period of 2 months. The first injection
was given i.p. using 100 .mu.g of 14G2a, emulsified in complete
Freund's adjuvant. The next two injections were given with 100
.mu.g of 14G2a coupled to KLH in incomplete Freund's adjuvant,
either s.c. or i.p. Mice were bled from time to time, and sera were
checked for anti-Id activity by ELISA in a binding assay by using
F(ab').sub.2 fragments of 14G2a and normal pooled BALB/c mouse
serum IgG as control. Three days before the fusion, the mice were
boosted i.v. with 14G2a in PBS.
[0279] Production of Anti-Idiotype Hybridomas
[0280] The fusion partner used to produce the hybridoma lines was
the mouse non-secretory myeloma cell line P3-653, ancestally
related to P3X63Ag8.653, available from the ATCC as No. CRL-1580.
Established human cell lines were cultured in RPMI 1640
supplemented with 5% fetal calf serum as described elsewhere (Seon
et al. (1984) J. Immunol. 132:2089).
[0281] Hybridomas were produced essentially following the method of
Oi and Herzenberg ((1980) Selected Methods of Cellular Immunology,
Mishell & Shiigi eds., Freeman Publs., at 351-372). Spleen
cells from immunized mice were mixed with P3-653 cells at a ratio
of 1:1 to 10:1, in the presence of 50% polyethylene glycol (PEG, mw
.about.4500). Fused cells were then washed and cultured. Hybrids
were selected using hypoxanthine-aminopterin-thymidine media
[0282] Initial Selection of Anti-Idiotype Antibody (Ab2) Secreting
Hybridoma Dones:
[0283] Initial screening of the hybridoma clones was performed by
RIA. Purified 14G2a was radioiodinated by the Chloramine T method
(Hunter (1970) Proc. Soc. Exp. Biol. Med. 133:989). The assay was
conducted by coating microtiter plate wells with 14G2a antibody (or
control) at 500 ng/well. After incubating overnight at 4.degree.
C., the plates were blocked with 1% bovine serum albumin (BSA) in
PBS. 100 .mu.l of hybridoma culture supernatants or 20.times.
concentrate was incubated in the well for 4 h at room temperature.
After washing with PBS, the plates were further incubated for 4 h
at room temperature or overnight at 4.degree. C. with labeled
14G2a, washed, and counted. This RIA is a stringent test for
antibody specificity, since it requires that the antibody be able
to span between two 14G2a molecules.
[0284] An ELISA was conducted in a similar fashion, using
subclass-specific anti-immunoglobulin as both the plate coat and
detecting reagent. Generally, antibody of certain IgG subclasses is
desired because it is stable, easily purified by protein A
chromatography, and may have useful effector functions.
[0285] A number of monoclonal Ab2 secreting cell lines emerged from
these screening assays with the desired properties. Amongst them
was monoclonal antibody 1A7.
[0286] Confirmation that Ab2 are Specific for 14G2a Idiotype
[0287] Idiotype specificity of Ab2 was confirmed by direct binding
to Ab1. Various purified Ab2 were labeled with .sup.125I, and
tested for binding to plates coated with a panel of monoclonal
anti-TAA Ab1. 1A7 bound almost exclusively to 14G2al there was
virtually no cross-reactivity with any of the other Ab1 tested.
[0288] Specificity for the 14G2a idiotype was further established
in competition experiments. .about.25,000 cpm of various labeled
Ab2 was mixed with different members of a panel of unlabeled
competitors comprising Ab2, Ab1, and other mouse immunoglobulins.
The Ab2 was then tested for binding to 14G2a coated plates. For the
best Ab2, greater than 90% inhibition was obtained using either Ab2
or 14G2a as competitor. Virtually no inhibition was obtained, up to
a concentration of 5 .mu.g, using control immunoglobulins as
potential competitors.
[0289] Screening for Anti-Idiotypes Directed Against the 14G2a
Paratope
[0290] To determine whether the Ab2 were directed against the
paratope of 14G2a, the Ab2 were used to compete for the binding of
radiolabeled 14G2a to GD2. This was performed conducted using
M21/P6 cells, a human cancer cell line expressing GD2 as a membrane
constituent
[0291] To conduct the assay, M21/P6 cells were grown as confluent
monolayer in 96-well tissue culture plates. Various dilutions of
the test Ab2 (either culture supernatant or purified antibody) were
mixed with the labeled 14G2a, and then added to the cultured cells.
Percent inhibition of the assay was calculated according to the
formula: 1 % i n h i b i t i o n = [ 1 - ( R T - R C R MAX - R C )
] .times. 100 %
[0292] where R.sub.T is the average cpm of the experimental well
with inhibitors; R.sub.C is the average background cpm; and
R.sub.MAX is the average maximum binding without any
inhibitors.
[0293] Three Ab2, including 1A7, inhibited the binding of labeled
14G2a to the GD2 expressing cells at amounts as low as about 25 ng.
Purified control antibody demonstrated no inhibition.
[0294] Antibody-producing clones testing positively in the
screening tests described so far were used to prepare mouse ascites
as a source of Ab2. The Ab2 were purified by chromatography using
Protein A and Protein G affinity resins by standard techniques.
[0295] Screening for Anti-Idiotypes Capable of Eliciting a
Tumor-Specific Immune Response
[0296] Since a central purpose of these experiments was to find an
anti-idiotype capable of eliciting an anti-GD2 immune response, the
next screening step was to test its immunogenicity in animal
models. The Ab2 would have to be not only immunogenic, but capable
of raising Ab3 that cross-reacted back to the tumor antigen
GD2.
[0297] Accordingly, the monoclonal antibody that gave the strongest
result in the competition experiments with the GD2-expressing cells
was brought forward for testing in this part of the study. The
other two antibodies showing specific inhibition were held in
reserve in case 1A7 failed to demonstrate the desired properties in
this test.
[0298] Accordingly, 1A7 was prepared as a vaccine composition and
injected into test animals. First, syngeneic BALB/c mice (68 weeks
old) were immunized with 50 .mu.g of 1A7 coupled to the carrier KLH
(1:1 ratio) in the presence of equal volume (0.1 ml) of Freund's
Complete or Incomplete adjuvant on days 0, 14, 28, and 42,
subcutaneously. Blood samples were drawn from each mouse 10 days
after the 4th immunization and analyzed for total Ab3 response
(anti-iso/allo/idiotypic) by sandwich RIA and anti-anti-idiotypic
response by the inhibition of Ab1 (14G2a) binding to Ab2 (1A7 on
the plate) by Ab3 sera. In addition, serum was checked for
inhibition of .sup.125I-14G2a binding to GD2 positive melanoma
cells (M21/P6). Also, direct binding of sera to purified GD2,
coated onto microtiter plate, was determined by ELISA assay.
Representative date from 3 BALB/c mice are shown in Table 1
1TABLE 1 Results of Immunizing BALB/c Mice with 1A7-KLH Assay Serum
Dilution Mouse #1 Mouse #2 Mouse #3 Sandwich RIA (CPM) 1:50 16.700
24.576 26.214 % Inhibition of Ab1-Ab2 Binding by Ab3 1:50 87 95 97
Sera % Inhibition of Ab1 Binding to M21/P6 1:50 28 32 27 Melanoma
Cells Direct Binding to GD2 by ELISA 1:10 0.70 0.76 0.71 (OD405 nm)
PBS-BSA Control 0.08
[0299] There was no reactivity with GD2 negative cell lines or
unrelated gangliosides such as GD3 and GM3. Results are expressed
as mean value of triplicate determinations (S.D.<10%).
[0300] Next, allogeneic C57BU6 mice (6.about.8 weeks old) were
immunized with three different formulations of anti-id 1A7 vaccine:
(I) 1A7-KLH+Freund's Adjuvant; (ii) 1A7-KLH+QS-21 (10 .mu.g per
mouse); (iii) 1A7+QS-21 (10 .mu.g per mouse). Results shown in
Table 2.
2TABLE 2 Humoral Immune Response % Inhibition of % Inhibition of
Ab1 Direct Binding of Sandwich RIA of Ab1-Ab2 Binding to M21/P6 Ab3
Sera (1:10 Ab3 Sera Binding by Ab3 Melanoma Cells by dilution) to
GD2 (1:50 dilution) Sera Ab3 Sera by ElISA Immunized with cpm (1:50
dilution) (1:50 dilution) (OD 405 nm) 1A7-KLH + Freunds Mouse #1
4,729 80 27 1.28 Mouse #2 6,067 83 14 0.62 Mouse #3 9,391 96 13
0.41 PBS-BSA Control 650 -- -- 0.10 1A7-KLH + QS-21 Mouse #1 5,506
79 37 0.64 Mouse #2 5,831 95 38 0.63 Mouse #3 7,315 94 43 0.63
PBS-BSA Control 549 -- -- 0.09 1A7 + QS-21 Mouse #1 847 70 73 0.66
Mouse #2 738 77 79 0.62 Mouse #3 1,000 74 80 0.64 PBS-BSA Control
153 -- -- 0.09
[0301] Results are expressed as mean value of the triplicate
determinations (S.D.<10%). There was no reactivity with
GD2-negative cell lines or unrelated gangliosides, such as GD3 and
GM3.
[0302] Comparison between the three vaccine preparations suggests
that in C57BL/6 allogeneic mice 1A7-KLH and Freund's adjuvant
induced almost identical humoral immune responses as 1A7-KLH and
QS-21. The production of total Ab3 response was less in 1A7+QS-21
immunized mice; however, the binding of Ab1 to melanoma cells was
inhibited much more strongly and the production of anti-GD2
antibodies (Ab1') was comparable to the other two groups. Thus,
there was no additional advantage of coupling of KLH to 1A7. KLH
apparently induced strong anti-isotypic and anti-allotypic
responses in C57BL/6 mice. Immune mice sera at 1:100 dilution
reacted strongly with M21/P6 melanoma cells and EL4 lymphoma cells,
but not with the unrelated colon carcinoma LS174-T cells by FACS
analysis.
[0303] The T cell responses of the spleen cells were also compared
from the differently immunized groups of mice to various stimuli by
T-cell proliferation assay. Representative data from all three
groups of C57BL/6 mice and BALB/c mice are presented in Table
3.
3TABLE 3 T cell proliferation 1A7-KLH + 1A7-KLH + 1A7-KLH + Freunds
QS-21 1A7 + QS-21 Freunds (BALB/c) (C57BL/6) (C57BL/6) (C57BL/6)
Stimulant CPM (S.I.) CPM (S.I.) CPM (S.I.) CPM (S.I) Anti-id 1A7 (2
.mu.g) 10,919 (15.1) 4,428 (4.4) 8,288 (6.3) 5,629 (4.3) Anti-id
3H1, Control 8,451 (10.1) 1,468 (1.4) 5,296 (4.0) 3,235 (2.4) 2
.mu.g) M21/P6 irradiated 29,671 (35.5) 9,648 (9.5) 17,753 (13.5)
27,739 (21.0) Melanoma Cells (l .times. 10.sup.6) EL4 Murine
Lymphoma n.d. 12,037 (11.8) 17,528 (13.3) 12,999 (9.8) Irradiated
Cells (1 .times. 10.sup.6) LS174-T Control Colon 2,973 (3.5) 2,074
(2.0) 3,944 (3.0) 2,340 (1.7) Carcinoma Irradiated Cells (1 .times.
10.sup.6) GD2 (1 .mu.g) 514 (0.6) 2,121 (2.1) 2,932 (2.2) 2,520
(1.9) GD3 (1 .mu.g) 290 (0.3) 1,346 (1.3) 1,180 (0.9) 1,285 (0.9)
Medium 834 (1.0) 1,015 (1.0) 1,313 (1.0) 1,320 (1.0)
[0304] The data are expressed as mean CPM of triplicate wells (S.D.
<10%). S.I.=Stimulation Index. S.I.>3.0 was arbitrarily
considered as positive.
[0305] The results indicated that in C57BL/6 mice, immunization
with all three regimens induced 1A7 specific, M21/P6 melanoma cell
specific and EL4 cells specific proliferative responses, some
reactivity against control 3H1 and no reaction against control cell
line LS174-T cells or ganglioside GD2 or GD3. These data support
the postulate that for T cell activation, GD2 needs to be
associated with cell surface oligopeptides. There was also no
significant difference in Stimulation Index obtained with any of
these surface regimens. 1A7+-QS-21 was as good as 1A7-KLH+QS-21 or
1A7-KLH+Freunds in C57BL/6 mice.
[0306] In order to assess the ability of these vaccines to induce
T-cell mediated DTH response, C57BL/6 mice immunized with
1A7-KLH+Freunds', 1A7-KLH+QS-21 and 1A7+QS-21 were given
intradermal foot pad injection of irradiated M21/P6 cells or
irradiated LS174-T (control) cells. In another experiment, mice
received intradermal foot pad injection of purified GD2 or purified
GD3. Mice were observed for development of DTH response at the
inoculation site at 24 hours and 48 hours. There were significant
DTH responses directed at GD2-positive M21/P6 cells but not
GD2-negative LS174-T cells in all three groups of immunized mice
(data not shown). There was, however, no DTH reactivity directed at
GD2 or GD3 in any of the groups of immunized mice.
[0307] Rabbits were selected next for the immunization studies with
1A7-KLH+QS-21 and 1A7+QS-21. The relative composition and tissue
distribution of gangliosides in rabbits is similar to that of
humans. Each group of three rabbits were immunined with either 500
.mu.g of 1A7 mixed with 50 .mu.g of QS-21, or 500 .mu.g of
1A7-KLH+50 .mu.g of QS-21. The injections were given
intramuscularly on days 0, 14, 28 and 42. Blood samples were
collected 10 days after the fourth immunization, and analyzed for
Ab3 (Ab1') responses and T-cell proliferation. Table 4 shows the
humoral immune response induced.
4TABLE 4 Binding studies using rabbit serum .RTM. 1A7-KLH + QS-21
1A7 + QS-21 Serum Rabbit Nos. Rabbit Nos. Assays Dilution #4819
#4821 #4823 #4818 #4820 #4822 Sandwich RIA 1:50 101,313 107,219
100,157 72,554 100,837 52,702 (CPM) % Inhibition of Ab1- 1:50 45 52
56 72 65 79 Ab2 Binding by Ab3 % Inhibition of Ab1 1:100 33 41 37
42 35 44 Binding to M21/P6 Melanoma Cells Direct Binding to 1:10
0.64 0.59 0.18 0.95 0.17 1.75 GD2 by ELISA (OD 450 nm)
[0308] Results are expressed as the mean value of triplicate
determinations (S.D.<10%). There was no reactivity with
GD2-negative cell lines or the gangliosides GD3 or GM3. The O.D.
value obtained with PBS-BSA control was 0.08.
[0309] KLH-coupled 1A7 plus QS-21 induced higher levels of
anti-isotypic and anti-allotypic responses in all three rabbits.
Ab3 and GD2-positive cell binding inhibition reactions were better
in all three 1A7+QS-21 immunized rabbits. Two out of 3 rabbits in
each group raised anti-GD2 antibodies, and the response was better
in 1A7+QS-21 immunized group as compared to 1A7-KLH+QS-21
group.
[0310] Thus, 1A7+QS-21 was capable of raising desired anti-tumor
responses in both mice and rabbits. There was no additional
advantage of coupling 1A7 to KLH. The isotype of the anti-GD2
antibodies in the rabbit sera was mostly of IgG type with trace
amount of IgM. The Ab1' antibody in rabbit sera also reacted with
melanoma cells but not with GD2-negative carcinoma cells by FACS
analysis.
[0311] The Ab3 sera were cytotoxic to M21/P6 and EL4 cells by in
vitro ADCC assay, conducted as described elsewhere in this
disclosure. Briefly, target cells were labeled with .sup.51Cr,
washed thrice with DMEM without FCS and suspended in growth medium.
10.sup.4 target cells in 25 .mu.L were added to microtiter plate
wells and incubated with different dilutions of sera from immunized
animals and effector cells. The immune sera induced 30.about.40%
specific lysis of the target cells.
[0312] PBL were isolated from immunized rabbits and used to study
the cellular immune response in a PBL-transformation assay. Results
are shown in Table 5.
5TABLE 6 T Cell Proliferation Assay of Rabbit PBL 1A7-KLD + QS-21
1A7 + QS-21 Stimulant CPM Stimulation Index CPM Stimulation Index
Anti-id 1A7 21,329 4.42 9,794 4.92 (2 .mu.g) Anti-id 3H1 11,550
2.39 5,691 2.85 Control (2 .mu.g) M21/P6 71,596 14.86 28,845 14.48
Melanoma Cells (1 .times. 10.sup.6), Irradiated EL4 Munne 44,6l9
9.26 28,040 14.08 Lymphoma Cells (1 .times. 10.sup.6), Irradiated
LS174-T Colon 5,196 1.07 3,131 1.57 Carcinoma Cells (1 .times.
10.sup.6), Irradiated GD2 (1 .mu.g) 11,345 2.35 5,988 3.00 GD3 (1
.mu.g) 7,329 1.52 4,678 2.34 Medium 4,816 1.0 1,991 1.0
[0313] Results are expressed as the mean value of triplicate
determinations (S.D.<10%). Stimulation Index>3.0 was
considered as positive.
[0314] The results demonstrate that immunization of rabbits with
both 1A7-KLH+QS-21 and 1A7-QS-21 induced T cell proliferation in
PBL against anti-Id 1A7, irradiated GD2-positive M21/P6 cells and
EL4 cells but not against GD2-negative LS174-T cells or against GD2
and GD3. There was insignificant stimulation against normal
isotype-matched control Ab2 (S.I.<3.0). Stimulation Index
against various stimuli was almost identical in both groups of
immunized rabbits.
[0315] Rabbits immunized with 1A7 were subjected to skin testing to
confirm that the cellular response induced by administration of 1A7
can mediate a hypersensitivity response. The rabbits were shaved on
the back and challenged with an intradermal inoculum of purified
gangliosides. Slight erythema and induration was observed as a
result of challenge with either GD2 or GD3. In a separate
experiment, immunized rabbits were challenged with an intradermal
inoculum of 1.times.10.sup.6 cells inactivated by irradiation at
12,000 rads. In a rabbit immunized with 1A7+QS-21 and challenged
with M21/P6 cells (a GD2-expressing line), the induration was
13.times.12 mm at 24 h and 18.times.13 mm at 48 h. In a rabbit
immunized with 1A7-KLH+QS-21 and challenged with M21/P6 cells, the
induration was 18.times.16 mm at 24 h and 24.times.10.sup.6 mm at
48 h. In contrast, when challenged with LS174-T cells (a
GD2-negative line), the induration was 4.times.4 mm and 5.times.3
mm respectively at 24 h, and negligible at 48 h.
Example 2
Obtaining the 1A7 Heavy and Light Chain Sequences
[0316] The polynucleotide sequence was obtained for the 1A7
antibody by isolating messenger RNA from the 1A7 producing cell
line. For each sequence determination, total RNA was isolated from
1.times.10.sup.7 1A7 hybridoma cells. Messenger RNA was prepared by
passage through two cycles of chromatography of
oligothymidylate-cellulose columns. The yield of mRNA was about 10
.mu.g. First strand cDNA was synthesized using SUPERSCRIPT.TM.
Preamplification kit (GIBCO/BRL).
[0317] To sequence the heavy chain variable region, PCRs were
conducted on the cDNA using a reverse primer corresponding to amino
acids 126 to 119 of the murine .gamma..sub.1 constant region:
[0318] 5'-CCCAAGCTTCCAGGGRCCARKGGATARACIGRTGG-3' (SEQ. ID
NO:46)
[0319] and various mixtures of forward primers, corresponding to
the N-terminal leader sequences of murine variable region
subgroups. The forward primer that gave a positive reaction
was:
[0320] 5'-ACTAGTCGACATGGCTGTCYTRGBGCTGYTCYTCTG-3' (SEQ. ID
NO:47)
[0321] corresponding to amino acids -20 to -12.
[0322] The amplified fragment of cDNA was subcloned into pT7
plasmid and NOVABLUE.TM. competent cells were transformed using a
protocol provided by the supplier (Novagen). Recombinant colonies
were picked up by color selection and plasmid DNA was prepared by
miniprep procedure. The DNA sequence of the double stranded plasmid
was determined using a Sequenase Version 2.0 kit (USB, Cleveland,
Ohio). The sequence of the DNA insert in the plasmid was determined
from both orientations using primers specific for the plasmid;
namely T7 promoter (FAATACGACTCACTATAGGG) (SEQ. ID NO:48) and U-19
(GTTTTCCCAGTCACGACGT) (SEQ. ID NO:49). At least 8 clones were
picked for sequence determination.
[0323] The sequence of the 1A7 light chain variable region was
determined in a similar fashion. The forward and reverse primers
giving a positive result in the PCR were:
[0324] 5'-ACTAGTCGACATGAAGTTGCCTGTTAGGCTGTTGGTGCT-3' (SEQ. ID
NO:50)
[0325] 5'-CCCAAGCTTACTGGATGGTGGGAAGATGGA-3' (SEQ. ID NO:51)
[0326] corresponding to amino acids -19 to -10 of the leader
sequence, and 122 to 116 of the mouse .kappa. chain constant
region.
[0327] In order to minimize the error rates in PCR amplification,
pfu DNA polymerase (Stratagene, San Diego) was used for
amplification in all subsequent experiments. Mutant frequency with
this thermostable DNA polymerase is {fraction (1/10)} compared to
Taq DNA polymerase.
[0328] Confirmation that the isolated cDNA correspond to the 1A7
heavy and light chains is obtained by amino acid sequencing of the
N-terminal of the isolated antibody. Fifty .mu.g of purified 1A7
antibody is diluted with sample loading buffer (50 mM Tris-HCl, pH
6.8, 1% SDS, 1% glycerol, 0.1% .beta.-mercaptoethanol) and heated
to 100.degree. C. for 3 minutes. The denatured protein is loaded
onto a 7.5% polyacrylamide gel (BioRad Miniprotean II Dual Slab
Cell) containing SDS and subjected to electrophoresis at 200 V for
1 hour. Proteins in the gels are transferred to polyvinylidene
difluoride (PVDF) membranes by the procedure described by Towbin et
al. ((1979) Proc. Natl. Acad. Sci. USA. 78: 4350-4354) at 150 mA
overnight The transfer buffer contains 25 mM Tris, 192 mM glycine,
20% (v/v) methanol. The membranes are stained by quick dipping in
0.1% Coomassie Brilliant Blue in 50% methanol-50% acetic acid,
followed by washing in a solution containing 40% methanol plus 10%
acetic acid. After drying the membrane at room temperature, the
stained heavy and light chain bands are excised with a clean razor
blade. The proteins on the membrane slices are subjected to
N-terminal microsequencing by automated Edman degradation using an
Applied Biosystem Model 477A protein sequencer employing
pulsed-liquid chemistry and on-line phenyl-ethiohydantion amino
acid identification. Each protein is subjected to 10-15 degradative
cycles and the converted cleavage products from each cycle were
analyzed by reverse-phase HPLC
[0329] The nucleic acid sequence and the corresponding translation
for the heavy and light chain variable regions of monoclonal
antibody 1A7 is shown in FIGS. 1 and 2.
[0330] The heavy and light chain polynucleotide and amino acid
sequences were compared using the BLAST algorithm at the National
Center for Biotechnology Information with sequences available from
the PDB, SwissProt, PIR, SPUpdate, GenPept, and GPUpdate databases.
The comparison was performed on Dec. 16, 1995.
[0331] FIG. 17 shows the ten most closely matched polynucleotide
sequences to the 1A7 light chain variable region encoding sequence.
FIG. 18 shows the ten most closely matched polynucleotide sequences
to the 1A7 heavy chain variable region encoding sequence.
[0332] FIG. 3 is a comparative depiction of the 1A7 light and heavy
chain amino acid sequence with the 15 closest sequences found in
the BLAST search Panel (A) shows the light chain comparison. Panel
(B) shows the heavy chain comparison. The database identifiers for
the matched sequences are shown in Table 6:
6TABLE 6 Matched immunoglobulin amino acid sequences Light Chain
Variable Region 1 gp.vertline. M34588.vertline.MU SIGKABR_1 Mouse
Ig kappa-chain mRNA V-J regi . . . 2 gp.vertline.
L18941.vertline.MU SIG438B_1 Mouse rearranged immunoglobulin li . .
. 3 gp.vertline. Z22035.vertline.MD IGKVAH_1 immunoglobulin
variable region [Mu . . . 4 gp.vertline. M32857.vertline.MU
SIGKCSP_1 Mouse Ig rearranged kappa-chain mR . . . 5 gp.vertline.
M34589.vertline.MU SIGKABS_1 Mouse Ig kappa-chain mRNA V-J regi . .
. 6 gp.vertline. J04438.vertline.MUSIGKCWA_1 Mouse Ig-kappa chain
(PAC1) mRNA V . . . 7 gp.vertline. M31271.vertline.MUSIGKCSM_1 IgM
gene product [Mus musculus] 8 gp.vertline.
M32858.vertline.MUSIGKCSQ_1 Mouse Ig rearranged kappa-chain mR . .
. 9 gp.vertline. U29428.vertline.MMU29428_1 anti-PC Ig kappa chain
[Mus musculus] 10 gp.vertline. X65770.vertline.MMIGMMM4_1 IgM gene
product [Mus musculus] 11 gp.vertline. M83723.vertline.MUSIGKD2A_2
immunoglobulin kappa-chain VK-1 [M . . . 12 pir.vertline.
B39276.vertline.B39276 Ig light chain precursor V-D-J reg . . . 13
gp.vertline. L14370.vertline.MUSIGKJVSA_1 immunoglobulin kappa
chain [Mus mu . . . 14 pir.vertline. A31807.vertline.A31807 Ig
kappa chain V region (PAC1) - m . . . 15
gp.vertline.U29267.vertline.MMU29267_1 IgL rearranged kappa chain
V-J reg . . . Heavy Chain Variable Region 1 gp.vertline.
M36221.vertline.MUSIGHAEB_1 immunoglobulin heavy chain V-region 2
gp.vertline. U01185.vertline.MMU01185_1 immunoglobulin heavy chain
[Mus . . . 3 sp.vertline. P01819.vertline.HV43_MOUSE IG HEAVY CHAIN
PRECURSOR V REGION . . . 4 gp.vertline. M26985.vertline.MUSIGH1PR_2
Igh gene product [Mus musculus] 5 gp.vertline.
M36217.vertline.MUSIGHADX_1 immunoglobulin heavy chain V-regio . .
. 6 gp.vertline. M36228.vertline.MUSIGHAEI_1 immunoglobulin heavy
chain V-regio . . . 7 gp.vertline. M34626.vertline.MUSIGHACK_1
Mouse Ig rearranged heavy chain (N . . . 8 gp.vertline.
A05515.vertline.A05515_1 Vector pSW2HPOLY DNA sequence. [un . . . 9
pdb.vertline. 1FDL.vertline.H IgG1 Fab Fragment (Anti-Lysozyme A .
. . 10 gp.vertline. L43544.vertline.MUSALCA_1 antibody [Mus
musculus] 11 gp.vertline. A03907.vertline.A03907_1 antibody D1.3 V
region (VDJ) [Homo . . . 12 pir.vertline. S38563.vertline.S38563 Ig
heavy chain V region (ASWS1) - . . . 13 pir.vertline.
A32456.vertline.A32456 Ig heavy chain precursor V region . . . 14
gp.vertline. A05504.vertline.A05504_1 pSW1 protein [unidentified]
>gp.vertline.A0 . . . 15 gp.vertline. L43544.vertline.MUSALCA_3
Mus musculus (clone pCT.kvhdl) ant . . .
[0333] Amongst the 50 database sequences matched most closely to
that of the 1A7 light chain variable region, none was identical.
1A7 differed from the five closest sequences by 2 substitution
differences at residues 50 and 55, which are contained in the
second complementary determining region (CDR2). The two differences
at these positions were non-conservative substitutions, and
persisted in comparisons with other light chain sequences.
[0334] Amongst the 50 database sequences matched most closely to
that of the 1A7 heavy chain variable region, none was identical.
The following summarizes the main points deduced from the
comparison.
[0335] The closest match was with a heavy chain fragment beginning
at residue 9 (designation
gp.vertline.M36221.vertline.MUSIGHAEB.sub.--1). There were 6
substitutions between residues 1 and 97 (before the VDJ junction),
6 substitution differences after residue 97, and 1A7 was shorter
about the VDJ junction by 2 residues.
[0336] The closest match with a full length heavy chain variable
region had the following features (designation
gp.vertline.U01185.vertline.MMU01- 185): There were 10 substitution
differences between residues 1 and 97, 7 substitutions after
residue 97, and 1A7 was shorter about the VDJ junction by 3
residues.
[0337] 1A7 differed in length from all sequences but one, due to
insertions or deletions of 1 to 8 residues about the VDJ junction.
For the sequence of equal length (designation
pir.vertline.S11106.vertline.S1- 1106), there were 18 substitution
differences between residues 1 and 97, and 8 substitutions after
residue 97.
[0338] All other comparisons showed at least 14 substitution
differences between residues 1 and 97.
[0339] All other comparisons showed at least 4 substitution
differences after residue 97.
[0340] All other comparisons showed a total of at least 22
insertions, deletions and substitution differences.
[0341] Differences appeared throughout the variable region.
[0342] Amino acid consensus sequences of the 15 most closely
matched V.sub.L and V.sub.H regions were designed, and compared
with the 1A7 sequences. This is shown in FIG. 3(C). Other than
splicing differences about the VDJ junction, there appear to be
about 16 differences between 1A7 and the prototype sequences. Two
of these differences are present in the light chain; 14 are present
in the heavy chain. Seven occur in the CDRs, while nine occur in
the variable region framework. The point differences likely have
arisen from somatic mutation of germline variable region
sequences.
Example 3
1A7 as an Immunogen in Non-Human Primates
[0343] As a model more closely related to humans, the effect of
anti-Id 1A7 on the induction of GD2-specific humoral responses was
investigated in cynomolgus monkeys (Macaca fascicularis). The
normal tissue distribution of GD2 in cynomolgus monkeys is very
similar to that in human. As such, this primate model is ideal to
gauge toxicities induced by these agents and to establish useful
dosage for initial clinical trials.
[0344] Cynomolgus monkeys (two per group, 2-4 kg weight) received
four intramuscular injections of purified Ab2 (2 mg) mixed with 100
.mu.g of QS 21 as adjuvant Control monkeys were immunized with
unrelated Ab2, 3H1 mixed with QS 21 in the similar way. All
injections were given at 2-week intervals. Monkeys were bled 10
days after each immunization.
[0345] The sera were analyzed for Ab3 responses by sandwich RIA and
inhibition of Ab2 binding to Ab1. For these assays, the sera were
pretreated with normal mouse immunoglobulin (500 .mu.g/ml) to block
anti-isotypic and antiallotypic reactivities. 250 ng of 1A7 (Ab2)
was coated into 96-well plate. After blocking, 50 .mu.l of
different concentrations of PRO#685 or PRO#778 (Ab3) was added and
incubated 2 h at room temp with shaking. After washing, 90,000 cpm
of .sup.125I-1A7 was added to each well and incubated 1.5 h at room
temp. The plate was then washed and bound radioactivity was
measured.
[0346] Results are shown in FIG. 4. Ab3 sera from monkeys (PRO 685
and PRO 778) immunized with 1A7 bound specifically to the
immunizing Ab2 (1A7) with minimal reactivity with unrelated Ab2
(3H1).
[0347] FIG. 5 shows that monkey Ab3 sera also inhibited the binding
of radiolabeled Ab2 to Ab1 500 ng of 1A7 (Ab2) or 14G2a (Ab1) was
coated into 96-well plate. After blocking, 50 .mu.l of different
concentrations of PRO#685 (Ab3) along with 50 .mu.l of
.sup.125I-14G2a or 1251-1A7 (90,000 cpm) were added to each well.
After 1.5 h incubation, plates were washed and bound radioactivity
was counted. There was no inhibition with preimmune sera or sera
obtained from monkeys (PRO 541 and PRO 667) immunized with the
unrelated Ab2 3H1. These results indicate that monkey Ab3 sera
share idiotypes with the Ab1.
[0348] To measure anti-GD2 reactivity in the serum of immunized
monkeys, purified GD2 (250 ng/well) was absorbed into 96-well
plates. After blocking wells with 1% BSA in PBS, test serum and Ab1
were diluted in same buffer and added to wells and incubated
overnight at room temp. After washing, the bound antibodies were
detected using alkaline phosphatase labeled anti-mouse or
anti-human Ig reagents as second antibodies. Sera from both monkeys
tested positively.
[0349] To determine whether 1A7 immunized monkey sera bound
specifically to GD2-positive melanoma cells, the binding of monkey
Ab3 sera to the melanoma cell line M21/P6 was tested. M21/P6 cells
(2.times.10.sup.6) were incubated with different concentrations of
PRO#685, PRO#778 (Ab3) or 14G2a (Ab1), and the amount of bound
antibody was determined.
[0350] FIG. 6 shows the sera collected after the fourth
immunization, reacted with melanoma cells but not with the
antigen-negative MCF-7 breast cancer cell line. The Ab3 sera also
bound specifically to purified GD2 coated onto microtiter plates by
ELISA. Control sera from preimmune monkeys or monkeys immunized
with unrelated Ab2 (3H1) did not show appreciable binding to GD2.
In parallel experiments, the same Ab3s from monkey PRO 685 were
compared on a plate coated with CEA (an unrelated tumor-specific
antigen) and were negative.
[0351] The Ab3 antibodies were then purified from sera by
absorption and elution from the affinity column made of antibody
1A7 coupled to SEPHAROSE.TM. 4B. The eluted antibody was then
passed over an immunoadsorbent column consisting of normal mouse Ig
coupled to SEPHAROSE.TM. 4B to remove anti-isotypic and
anti-allotypic reactivities. Antibody that passed through was
concentrated and used as purified Ab3. The purified Ab3 from monkey
sera were then compared with the reactivity of purified Ab1 (14G2a)
in different assays. 2.6 mg of purified Ab3 were recovered from 10
ml of sera (i.e. about 260 .mu.g of Ab3 per ml of serum) from
monkey #PRO 685 and a little less from monkey #PRO 778.
[0352] Binding of Ab3 to M21/P6 cells was analyzed by flow
cytometry. Target cells M21/P6 or control cells MOLT-4
(5.times.10.sup.5 in PBS supplemented with 0.2% BSA) were incubated
with different dilutions of Ab3 and Ab1 for 1 h at 4.degree. C.
After washing with PBS, the staining was done with FITC labeled
second antibody and analyzed on a FACScan flow cytometer.
[0353] Results are shown in FIG. 7. In Panel A, tumor cells
(M21/P6) were reacted with preimmune sera and Ab3 sera (1:100
dilution) from monkeys immunized with 1A7 mixed with QS-21. The
reaction was developed with goat anti-human F(ab)2 IgG-FITC-labeled
antibody. In Panel B, MOLT-4 cells that do not express GD2 were
reacted with preimmune and immune monkey Ab3 sera raised against
1A7 plus QS-21. In Panel C, tumor cells (M21/P6) were reacted with
PBS-BSA control and purified Ab1 (14G2a). The reaction was
developed with goat-anti-mouse-F(ab').sub.2 IgG-FITC-labeled
antibody. The results show that Ab3 from immune but not pre-immune
sera was specific for GD2-bearing M21/P6 cells.
[0354] FIG. 8 shows results from an experiment in which Ab3 was
shown to bind directly to the GD2 target antigen in a specific
fashion. 250 ng of different gangliosides were coated into 96-well
plate. After blocking, 50 .mu.g of different concentrations of
PRO#685 (Ab3) and 14G2a (Ab1) was added and incubated 4 h at room
temp. Bound antibody was detected using alkaline phosphatase
conjugated second antibody.
[0355] FIG. 9 shows the corresponding inhibition experiment
Different gangliosides (250 ng) were coated into 96-well plate as
before. Different concentrations of Ab3 and Ab1 along with 90,000
cpm of .sup.125I-14G2a were added. The plate was incubated 2h at
room temperature with shaking, washed and counted. Percent
inhibition was calculated and plotted against concentration of Ab1
and Ab3.
[0356] Reactivity of immunized sera and purified Ab3 for anti-GD2
antibodies against various gangliosides was also measured by
immunoblotting (FIG. 10). Purified gangliosides (2 .mu.g each of
GM3, GM2, GM1, GD3, GD2 and GT1b) were spotted on strips of PVDF
cellulose membrane at 1 cm intervals. After blocking with 3% BSA in
PBS, the strips were incubated with PRO#685 (Ab3) or PRO#778 (Ab3)
or 14G2a (Ab1) or an unrelated monkey Ab3 which was raised against
an unrelated Ab2, 11D10 and PBS control; each antibody was used at
10 .mu.g/ml, 5 ml of total solution. The incubation was done for 4
h at room temperature with shaking. After washing, the strips were
incubated with alkaline-phosphatase labeled second antibody (1:1000
dilutions) for 2 h at room temperature.
[0357] The results clearly demonstrate that 1A7-QS21 immunized
monkey Ab3 antibody binds to the same antigen GD2 as Ab1.
[0358] The ability of the induced Ab3 to mediate antibody-dependent
cellular cytotoxicity was confirmed in a standard ADCC assay.
M21/P6 cells were labeled with .sup.51Cr, and incubated in
microtiter plate wells with dilutions of immune monkey sera. Normal
human PBMC isolated by FICOLL/HYPAQUE.RTM. were then added as
effector cells at an effector:target ratio of 50:1. The plates were
centrifuged at 400.times. g for 2 min, and incubated for 4 h at
37.degree. C. in a humidified atmosphere containing 5% CO.sub.2.
After incubation, the plates were centrifuged at 400.times. g for 5
min, and specific lysis was calculated from the cpm released into
the supernatant. The sera of two immunized monkeys (PRO 778 and PRO
685) each mediated specific lysis of 40-50% of target cells at a
dilution of 1:10. In contrast, preimmune serum or the serum from a
monkey immunized with an unrelated antiidiotype mediated specific
lysis of only 4-8% of the labeled target cells.
[0359] The presence of a cellular immune response in the immunized
monkeys was demonstrated in an in vitro proliferation assay.
Mononuclear cells were isolated from the peripheral blood of
immunized monkeys by FICOLLUHYPAQUE.RTM. gradient centrifugation.
5.times.10.sup.5 cells per well were incubated with different
concentrations of stimulant for 5 d at 37.degree. C., and then
pulsed with 1 .mu.Ci/well [.sup.3H]-thymidine for 20 h. Stimulation
index was calculated by dividing the sample cpm by the average cpm
obtained in medium control wells. The SD was <10% for each
determination, done in triplicate.
[0360] Results of the proliferation assay are shown in FIG. 11.
Legend: Close hatching, 2 .mu.g antibody 1A7; Open bars, 2 .mu.g of
an unrelated murine antiidiotype; Filled bars, radiation-killed
M21/P6 cells (a GD2-expressing cancer line); Shaded bars,
radiation-killed LS174-T cells (a GD2-negative cancer line); Light
hatching, medium control. The reactivity indicated by the open bars
likely represents a cellular response to non-idiotypic antibody
components (i.e., an anti-murine immunoglobulin reaction). The
additional reactivity observed when stimulated with 1A7 is
consistent with a cellular response to the idiotypic components of
1A7. The ability of a GD2-expressing cell line but not a
GD2-negative cell line to induce proliferation suggests that the
cellular response comprises anti-GD2 activity.
[0361] The induction of Ab3 responses in monkeys did not cause any
apparent side effects in animals despite the presence of GD2 in
some normal tissues. Only mild local swelling and irritation were
observed at the injection site as a result of multiple
immunizations. The monkeys were routinely checked by physical
examinations and weight measurements. They did not show any signs
of abnormalities or neurological problems. Immunohistochemistry
analysis of autopsy specimens obtained after 7 months indicated
that there was no toxicity induced by the anti-Id 1A7 plus QS-21
vaccine treatment
Example 4
Clinical Use of 1A7 Antibody Vaccines in Patients with High Tumor
Burden
[0362] 9.7 g of purified 1A7 antibody have been prepared for
clinical use. The antibody was purified by TSD BioServices under
GMP-conditions. The regulatory testings on the antibody preparation
have been completed according to FDA guidelines. Approval from the
FDA has been obtained (BB-IND #6183) for use of 1A7 plus QS-21 in
advanced melanoma patients.
[0363] The objectives of this study are to determine the effects of
a first generation vaccine on various components of the immune
response (both humoral and cellular), to determine the optimum
immunomodulatory dose and toxicity of anti-Id antibody, and to
determine whether there is a the benefit to clinical condition.
[0364] Eligible patients are those having metastatic melanoma that
is confirmed as bearing the GD2 antigen. Patients must have a life
expectancy greater than six months, adequate nutrition,
non-pregnant, Southwest Oncology Group performance score 0, off all
previous anti-cancer therapy for at least four weeks, no prior mAb
therapy, no ongoing use of nonsteroidal anti-inflammatory agents or
cimetidine or other H.sub.2 receptor antagonists, adequate blood
count and the ability to sign an informed consent.
[0365] All patients in the study are immunized with either 1 mg, 2
mg, 4 mg or 8 mg of 1A7 mixed with 100 .mu.g of QS-21 adjuvant.
Patients are randomized to one of the four dose levels. The total
number of patients is between about 12 and 32. Injections are given
biweekly for four total doses, or until an immune response is
observed. Therapy continues with monthly injections until tumor
progression is found. Patients are monitored carefully for
anaphylaxis, serum sickness, and other potential side effects.
[0366] Periodic blood samples are obtained to determine the effect
on hematopoietic cells as well as renal and hepatic function. All
patients entered into the study undergo leukapheresis prior to the
first immunization (pre-therapy). In addition, blood samples are
obtained prior to each injection of 1A7 to determine serum levels
of Ab3 and Ab1' antibodies and cytotoxic T cell responses. The
specificity of the humoral responses is confirmed by immune flow
cytometry, radioimmunoassay, and dot blot analysis. Antiglobulin
responses to the murine antibody is tested by sandwich RIA. Sera
are also be tested for the ability to inhibit the binding of
anti-GD2 mAb to GD2 antigen. The immune profile of patients is
further assessed by testing the proliferative response of patient's
lymphocytes to anti-id antibody, purified GD2 antigen, and
irradiated tumor cells and the cytotoxicity of patient's
lymphocytes for GD2-positive HLA-matched cell lines or autologous
tumor cells (where possible).
[0367] The development of humoral immunity induced by immunization
with Ab2 is assessed by testing sera obtained from patients at
different time points (pre-therapy, after 3 and 4 immunizations,
and then periodically before injection if therapy continues). The
sera is initially tested for total human anti-murine antibody
(HAMA) response (anti-isotype and anti-allotype) by sandwich RIA.
Briefly, microtiter plates are coated with 1A7 and incubated with
different dilutions of patients' sera. After washings, the
antigen-antibody reaction is developed using .sup.125I-labeled 1A7
in a homogeneous sandwich RIA. Since 1A7 is injected as intact IgG
in this study, patients are expected to mount HAMA responses.
[0368] Sera from immunized patients with positive responses are
then tested for the presence of anti-anti-idiotypic antibodies
(Ab3). Sera are diluted with buffer containing normal murine
immunoglobulin to block human antibodies against isotypic and
allotypic determinants, and then checked for the presence of
anti-1A7 by RIA. Unrelated Ab2 is used as a control. After washing,
the antigen-antibody reaction is developed using .sup.125I-labeled
anti-id reagent in a homogeneous sandwich RIA as above.
Pre-treatment non-immune sera and sera from normal donors is used
as control in these assays.
[0369] If antibody is detected against 1A7, the sera are checked
for its ability to inhibit the binding of .sup.125I-labeled 1A7 to
14G2a bound to microtiter plates, or inhibit the binding of
radiolabeled 14G2a to 1A7 on the plate. An unrelated Ab1-Ab2 system
is used as a control. This demonstrates whether Ab3 in patients'
sera share idiotopes with 14G2a (Ab1). This inhibition assay of
Ab1-Ab2 binding by Ab3 sera also demonstrates whether Ab3 is a true
anti-anti-idiotype.
[0370] To assess humoral immune responses directed against native
target antigens, patients' Ab3 sera is tested for reactivity with
cell lines known to express GD2 in a RIA, and also by FACS
analysis, using anti-human IgG and IgM tracer reagents. In
addition, the sera is checked for reactivity against a solubilized
purified preparation of GD2 antigen coated onto microtiter plates.
The antigen-antibody reaction is detected by using
.sup.125I-labeled anti-human Ig reagents. Pre-immune sera is used
as a control. Unrelated antigen is also used in the assay. Isotype
of human Ab3 sera binding to GD2 antigen is determined by ELISA
using anti-human isotype specific reagents.
[0371] To demonstrate that Ab3 and Ab1 bind to the same antigenic
determinant, inhibition of 14G2a binding to an Ag positive tumor
cell line or GD2 antigen by Ab3 sera is determined in an RIA. If
Ab3 in patients' sera bind specifically to tumor cells, the ability
of Ab3 to lyse these cell in conjunction with ADCC effector cells
or complement can be demonstrated in standard ADCC or
complement-mediated cytolysis (CMC) assays.
[0372] Quantitation of the Response:
[0373] Host Ab3 (anti-1A7 antibody) and Ab1' (anti-tumor antibody)
reactivity are a key measurement in this example. The expression of
anti-antiidiotyoe antibody (Ab3) in the patients' sera is
quantitated by RIA inhibition studies as follows. Briefly,
microtiter plates are coated with 14G2a (Ab1) and reacted with a
fixed amount of .sup.125I-labeled Ab2. A standard inhibition curve
is generated using purified 14G2a as inhibitors. Next, patients'
sera depleted of anti-iso-allotypic activity at different dilutions
are checked for an ability to inhibit the Ab1-Ab2 reaction, and the
amount of Ab1-like antibody in the sera is estimated from the
standard inhibition curve. The induction and duration of Ab3
response are compared among different dose levels. If there is no
statistical difference between Ab3 responses or duration at a
number of doses, the titer of specific anti-tumor response (Ab1')
in the sera by ELISA assay against purified GD2 antigen coated
plates is compared among different dose levels.
[0374] If the serum of a particular patient tests positive for
anti-1A7 (Ab3) but negative for anti-GD2 (Ab1'), it may be because
the anti-GD2 is bound to the patent's tumor cells. The production
of anti-GD2 is optionally demonstrated by stimulating the patients'
PBMC in culture with 1A7 and then measuring anti-GD2 activity in
the supernatant According to network hypothesis, patients immunized
with 1A7 may eventually also induce an Ab4 response
(anti-anti-antiidiotype) which may mimic the specificity of the
antiidiotype 1A7. To study this possibility, Ab3 positive patients'
sera (depleted of anti-isotype and anti-allotype antibodies) are
optionally measured for anti-idiotype activity by reacting with
14G2a (Ab1) by ELISA or RIA. Positive and negative controls are
included as described for the Ab3 assay. Sera for this assay are
obtained three months after the last therapy.
[0375] Cell-Mediated Immunity
[0376] Whether a specific T Cell response to the tumor associated
glycolipid GD2 is generated in the 1A7 treated melanoma patients is
tested by the following criteria: (1) if a T cell response is
present which targets GD2 on the tumor cells, and (2) whether this
response increases with repeated immunizations. Analysis proceeds
in 2 phases. The first is to determine whether T cells from all
PBMC samples received can be expanded following in vitro
immunizations against the 1A7. If this occurs, the next step is to
determine whether these T cells, can lyse or release cytokines
against autologous GD2 bearing melanoma tumor cells or allogeneic
GD2 expressing melanoma cells sharing a single HLA antigen in
common with the autologous CTL.
[0377] Patients entered into the study are leukapheresed prior to
the first immunization and FICOLL-HYPAQUE.RTM. separated peripheral
blood mononuclear cells (PBMC) are prepared and cryopreserved for
future studies. These PBMC (1) provide antigen presenting feeder
cells for subsequent studies (2) serve as baseline for T cell
responses and (3) are used to generate an autologous EBV cell line
which is a transfection target for immunological studies. In
addition, following each immunization, 60 ml of peripheral blood is
drawn, FICOLL-HYPAQUE.RTM. separated and cryopreserved for the
determination of T cell responses. The T cell responses to be
studied are generation of specific cytotoxic T cells, cytokine
producing T cells, and proliferation of the T cell cultures in
response to the antigens. When available, cutaneous tumor biopsies
are obtained from the patients to provide a source of tumor
infiltrating lymphocytes (TIL). Similar studies are run using TIL
to determine if tumor biopsies become a source of GD2 specific
cells. Also, tumor biopsies provide a source of tumor cells to
serve as critical autologous targets for cytotoxicity assays,
cytokine production, and proliferation assays.
[0378] In-Vitro Functional activity of T cells is measured as
follows: FICOLL HYPAQUE.RTM. separated PBMC (1-3.times.10.sup.6)
are incubated in the presence of medium alone, IL-2 (10 Cetus
units/ml), or 0.1 to 100 .mu.g/ml anti-id 1A7 antibody. The cell
culture medium includes Iscoves medium supplemented with 10% human
AB serum, gentamycin, sodium pyruvate, non-essential amino acids,
L-glutamine and 10 Cetus units/ml recombinant IL-2. Every 7 days
the cultures are stimulated with irradiated autologous PBL
pre-senzitized with the appropriate antigen used at day 0. The
method of in vitro sensitization is similar to that recently
described by Rivolitini et al., (1995) J. Immunol. 154:2257-2265.
Beginning day 21 and on a weekly basis, proliferating cells are
assessed for cell surface phenotype and cytotoxic and cytokine
producing potential. Initially, all T cells are tested for their
ability to recognize and lyse from autologous and allogeneic EBV
cells transfected with the cDNA containing the sequence for the 1A7
anti-id molecule. Cultures lysing 1A7 transfected autologous EBV
cells>10% are further tested against the NK sensitive line K562,
the LAK sensitive line Daudi, autologous tumor if available and
other HLA matched and mismatched GD2 bearing melanoma tumor cells.
Preferably, a panel of over 40 well characterized melanoma tumor
cell lines each expressing both class I and class II antigens is
used. In addition, GM-CSF assays are run to determine if there is
specific release of cytokines in addition to or in place of
specific cytotoxicity. Proliferation of the cultures to the agents
is determined by increases in cell numbers following in vitro
stimulations.
[0379] The possible outcome of these studies following up to 6
rounds of in vitro stimulation is a kinetic increase in T cell
cytotoxicity against both 1A7 transfected EBV cells, and autologous
tumor and/or HLA matched allogeneic melanoma tumor cell lines. This
indicates a successful immunization of the patients against their
own tumor cells using the anti-id 1A7 molecule. Studies are then
done to determine if the antigen recognized is GD2 on the tumor
cells and identify the possible mechanisms of recognition.
[0380] Objectives of this study include: (1) determination of an
optimal dose to elicit an immune response against GD2 in the
various arms of the immune system; a T cell response being
particularly desirable; (2) ideally, remission or palliation of the
cancer.
[0381] Results
[0382] Five patients have been participating in the study over a
sufficient period to provide confirmation of an immunological
response. Each patient was immunized with 1 mg, 2 mg, 4 mg, or 8 mg
of antibody 1A7 in QS-21 on a biweekly schedule. The first 24 doses
were given intramuscularly, and periodic serum samples were
collected to determine the presence of human anti-mouse (HAMA)
activity and anti-1A7 activity. Titers were low, and it was decided
to continue the course of immunization subcutaneously. All patients
seroconverted positive with respect to both HAMA and anti-1A7, as
determined by immunoassay. The response comprised specific Ab3
activity, as demonstrated by the ability of each serum to inhibit
the binding of radiolabeled 1A7 to solid-phase linked 14G2a
(Ab1).
[0383] To investigate the nature of the response further, anti-1A7
antibody was affinity purified from the sera of 4 of the patents.
First, each sample was passed over a column of 14G2a antibody,
eluted with a glycine buffer (pH .about.2.5), and exchanged into
PBS. Next, HAMA activity that was not Ab3 was depleted by negative
selection on a mouse immunoglobulin adsorbant. The amount of
specific anti-1A7 (Ab3) obtained was as follows: Patient 1
(administered 1 mg 1A7 per dose), yield 0.67 mg Ab3 from 10 mL
serum. Patient 2 (administered 2 mg 1A7 per dose), yield 1.32 mg
Ab3 from 10 mL serum. Patient 3 (administered 4 mg 1A7 per dose),
yield 1.71 mg Ab3 from 10 mL serum. Patient 4 (administered 4 mg
1A7 per dose), yield 0.73 mg Ab3 from 10 mL serum. This indicates
that a substantial amount of Ab3 is produced as a result of
administering 1A7 at any of the doses tested, and apparently is in
molar excess of antigen in the circulation.
[0384] The affinity and specificity of the response to GD2 was
further confirmed by using the affinity purified Ab3 in several of
the assay systems described earlier. Results are shown in FIGS. 12
and 13.
[0385] FIG. 12 shows the results of ELISA conducted on Ab3 affinity
purified from three different patients. In the upper panel, an
assay plate has been coated with ganglioside GD2 (hatched bars) or
GD3 (solid bars), overlaid with purified Ab3, and then developed
with alkaline phosphatase labeled anti-immunoglobulin. The results
show that each patient's response comprises the production of
anti-GD2 antibody (Ab1'). In the lower panel, the plate was coated
with GD2, overlaid with purified Ab3, and then developed with
isotype-specific anti-immunoglobulin reagents. The anti-GD2
response is apparently a mature response comprising more IgG
(hatched bars) than IgM (solid bars).
[0386] FIG. 13 shows the results of inhibition titration
experiments conducted using purified Ab3 from three different
patients. In the upper panel, an assay plate was coated with
ganglioside GD2, and varying amounts of purified Ab3 were tested
for the ability to inhibit the binding of radiolabeled 14G2a (Ab1).
Diamonds: Patient 1; Squares: Patient 2; Triangles, Patient 3. The
half-titration point was comparable to that of unlabeled 14G2a
(Circles). In the lower panel, varying amounts of purified Ab3 were
tested for their ability to inhibit the binding of radiolabeled
14G2a to the GD2-expressing murine lymphoma cell line EL4. The
results indicate that the Ab3 induced by administration of 1A7
competes for binding to GD2 both in plate-binding assays and when
presented on cancer cells.
[0387] Additional patients are enrolled in the study to
characterize the immune response elicited by administration of
antibody 1A7, and to follow any effect on the melanoma.
[0388] At the completion of the study, a second study is designed
using the optimum immunomodulatory dose. The total number of
patients in the second study is chosen for statistical reasons and
is between about 16 to 25.
Example 5
Clinical Use of 1A7 Antibody Vaccines in the Adjuvant Setting
[0389] The objectives of this study comprise ascertaining the
effects of the 1A7 in patients who have been treated for a
GD2-associated cancer and have no clinical manifestations of the
disease. Ideally, 1A7 given at an optical dose lessens the risk or
rate of recurrence.
[0390] Eligible patients are those with GD2-positive small cell
lung cancer. All of the patients must have entered a complete
clinical remission following standard chemotherapy, and be within 6
weeks of completion of chemotherapy and radiation therapy. Patients
must have a life expectancy greater than six months, adequate
nutrition, non-pregnant, Southwest Oncology Group performance score
0, no history of monoclonal antibody therapy, no ongoing use of
nonsteroidal anti-inflammatory agents or cymetidine or other
H.sub.2 receptor antagonists, adequate blood count, and the ability
to sign an informed consent.
[0391] Various dose levels of 1A7 are combined with a suitable
adjuvant. One candidate is QS-21. The QS-21 molecule consists of a
triterpene glycoside with the general structure of a quillaic acid
3,28-O-bis glycoside. It consists of two structural isomers
designated V-1 and V-2 at a typical ratio of about 2:1. Both
isomers have adjuvant activity. QS-21 has been shown to promote a
response to both T-dependent antigens and unconjugated
T-independent antigens. QS-21 also augments the induction of Class
I MHC-restricted cytotoxic T lymphocytes as well as antigen
specific T-cell proliferation when used in subunit antigen
vaccines. 100 .mu.g QS-21 has been established as the optimal
amount of adjuvant per dose in a trial conducted at the Memorial
Sloan-Kettering Cancer Center, NY. The other candidate is
RIBI.TM.PC, which is obtained from Ribi Immunochem Research Inc.,
Hamilton Mont., and used according to manufacturer's
directions.
[0392] Patients receive one intramuscular injection of 1A7 every
two weeks for a total of four injections. Patients are immunized
with either 1 mg, 2 mg, or 4 mg of 1A7 per injection mixed with 100
.mu.g QS-21. Therapy continues on a monthly basis for 24 months,
then every 3 months or until tumor progression is detected. The
total number of patients is between 9 and 24.
[0393] Blood samples are obtained monthly prior to each treatment
Serum levels of Ab3 (anti-1A7), Ab1' (anti-Gd2) and human
anti-mouse antibody (HAMA) are measured by standard immunoassay.
The specificity of these responses is confirmed by indirect
immunoprecipitation of radiolabeled cells and SDS-PAGE. Sera is
also tested for the ability to inhibit the binding of labeled 1A7
to M21/P6 cells or purified GD2.
[0394] To determine if the vaccine is inducing T-cell immunity, the
buffy coat of one unit of blood is centrifuged on
FICOLL-HYPAQUE.RTM.. The peripheral blood mononuclear cells (PBMC)
are removed, washed, and the lymphocyte precursor frequency is
determined. Immunostaining for CD3, CD28, and CD45R markers is used
to measure and sort cytotoxic T cells from suppressor T cells,
using three-color flow cytometry. The proliferative response to 1A7
antibody and purified tumor antigen is determined. Cytotoxicity
assays are conducted using HLA-matched colon cancer cell lines or
autologous tumor cells. Suppressor cell function of CD8+ CD28+
CD45R+ cells is measured as the suppression of B cell
immunoglobulin secretion.
[0395] The clinical features of each recipient are monitored
regularly, and compared with the control population to determine
the efficacy of treatment. The dose and frequency of 1A7 treatment
is adjusted if necessary as more patents enter the study. A dose of
1A7 is identified that significantly increases the risk or rate of
progression compared with controls.
Example 6
Construction of a Recombinant Vaccinia Vector Encoding a 1A7
Polypeptide Fragment
[0396] Recombinant vaccinia virus (rvv) can provide a powerful
agent for overcoming immune tolerance. Vaccinia virus is highly
immunogenic and stimulates both humoral and cell-mediated immune
responses. Vaccinia is also capable of representing TAA along with
the cellular MHC complex.
[0397] This example describes plasmid construction and production
of recombinant vaccinia viruses. The scheme for construction of a
general vaccinia vector (rvv) is shown in FIG. 14. The complete
sequence of TK gene of the wild type WR stain of vaceinia virus
(GenBank, accession number J02425,) was obtained from the National
Center for Biotechnology Information (NCBI) by the BLAST program.
Aitschul et al. (1990) J. Mol. Biol. 215:403-410. From the sequence
data, forward and reverse PCR primers 5'-CAGATGGAAGGGCCCAAC (SEQ.
ID NO:52) and 5'-GATTGATGCATATCATTACC (SEQ. ID NO:53) were
synthesized, corresponding to nucleotides 22-39 and 727-708
respectively of the TK sequence Hruby et al. (1983) Pro. Natl.
Acad. Sci. USA 80:3411-3415. An Apa I site (underlined) was
introduced into the forward primer and a Nsi I site (underlined) in
the reverse primer for insertion into the plasmid pGEM-7Zf(+)
(Promega). DNA from the wild type WR strain of vaccinia was
isolated and TK gene was amplified by PCR. A DNA fragment of
expected size (about 700 bp) was obtained by PCR This DNA was
separated by electrophoresis in low melting point agarose and
purified by digestion with GELase (Epicentre Tech.). The TK DNA
fragment was ligated to the pGEM-7Zf(+) after digestion with Apa I
plus Nsi I. The resulting plasmid (pGEM-TK) was amplified by
standard transformation techniques. Insertion was verified by
restriction mapping.
[0398] Promoter 7.5 K was amplified from wild type vaccinia virus
by PCR using the forward primer 5'-GTTATCGATGTCGAATAGCC (SEQ. ID
NO:54) and the reverse primer 5'-TTGCTGCAGATTGAGTACTGTTCT (SEQ. ID
NO:55), corresponding to nucleotides 69-88 and 335-312 of the 7.5 K
promoter sequence. Cochran et al. (1985) J. Virol. 54:30-37. A Cla
I site (forward) and a Pst I site (reverse) were included in the
primers. The amplified DNA fragment was digested with Pst I. A
polynucleotide adaptor was synthesized with the smaller
oligonucleotide being phosphorylated at the 5'-end by
polynucleotide kinase. The hemi-phosphorylated adaptor was ligated
to Pst I digested PCR amplified 7.5 K promoter DNA fragment. The
product was digested with Cla I/EcoR I digested pGEM-TK.
[0399] A cDNA insert encoding a 1A7 polypeptide is inserted between
the Nco I and Xma I (Sma I) sites of pVV. This plasmid also
contains the leader sequence of the V.sub.H at the 5' end of the
scFv cDNA. If desired, a vaccinia control plasmid can be
constructed containing cDNA for E. coli .beta.-galactosidase.
[0400] Construction of rvv: Rvvs are constructed by homologous
recombination of vaccinia plasmids and wild-type WR strain of
vaccinia virus according to the procedure of Mackett et al. (DNA
Cloning, Vol. II, D. M. Glover, ed., IRL Press 1985) using CV-1
cells. Recombinant viral clones expressing P-galactosidase are
selected by growth on TK.sup.- 143B cells in the presence of
5'-bromodeoxyuridine and 5-bromo-4-chloro-3-indo-
yl-.beta.-D-galactosidase (X-Gal). Blue recombinant viruses are
picked by Pasteur pipettes and plaque purified. As a second step in
clone selection, Southern blot of extracted DNA is performed, using
1A7 cDNA as the probe. Further selection of rvv is made by assay of
culture supernatant of the virally infected CV-1 or any other
eukaryotic cells by ELISA. If cell-associated 1A7 polypeptide is in
the rvv (i.e., if the leader sequence is deleted), cell lysate is
assayed. Western blotting with 14G2a as probe is also performed.
Biological activity of the 1A7 polypeptide synthesized by the
vaccinia virus is determined by cell binding inhibition assay, as
described above. Rvv clones containing 1A7 polynucleotides are
selected by staining with 0.1% neutral red and plaque purified as
above. Viral clones are grown into a high-titer lysate using
standard techniques (Mackett et al (1982) Proc. Natl. Acad. Sci.
USA 79:7415-7419). Typically a clone producing the highest amount
of 1A7 polypeptide is selected for further studies.
[0401] Assay of 1A7 Polypeptides (Foreign Proteins) Expressed By
Recombinant Vaccinia Virus: CV-1 cells are propagated in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% fetal calf
serum and 100 units of penicillin and 100 .mu.g of streptomycin per
ml in 25-cm.sup.2 flasks or Swell Cluster flasks. Cells are
inoculated with rvv at a MOI of 30. The virus is allowed to absorb
for 2 hours at 37.degree. C. in a tissue culture incubator,
following which the inoculum is replaced with the culture medium
and the incubation was continued. Supernatant is removed after
incubation for indicated time and the 1A7 polypeptide secreted is
assayed. As a control, supernatant from mock infected cells is
used. Assay of 1A7 polypeptides can be performed by testing for
binding to 14G2a as described elsewhere in this disclosure.
.beta.-D-galactopyranoside produced by rvv-lacZ is assayed
according to Miller (Experiments in Molecular Genetics, Cold Spring
Harbor Pines 1972) with p-nitro-.beta.-D-galactopyranoside as the
substrate. Culture supernatant from virus infected cells is treated
with .beta.-propionate to inactivate the virus before assay
(Corcoran et al. (1988) J. Parasit. 74:763). Incorporation of
.sup.3H-thymidine by NFS60 cells is used as a measure of cell
proliferation (Jaffee et al. (1993) Cancer Res. 53:2221-2226).
Radioactivity due to .sup.3H-thymidine incorporation in the
presence of supernatant from mock infected CV-1 cells is subtracted
as background. As positive control and for standard of biological
activity, intact 1A7 is used. Alternatively, standard solutions of
GM-CSF can be used as described in Qin and Chatterjee (1996) Gene
Therapy.
[0402] Testing vaccinia 1A7 vaccines: For administration of
vaccinia, a virus titer of 10.sup.4 to 10.sup.7 pfu is injected in
a mouse. Injections can be subcutaneous, intramuscular, intradermal
or interperitoneal. Immunizations are performed weekly. Mice are
bled 7 days after every immunization for determination of Ab3
(including Ab1'). Testing for development of T cell immunity is
performed 10 days after the booster immunization. Mice can also be
tested by tumor challenge, in which survival after injection with
tumor cells is monitored.
[0403] For administration of vaccinia via virally infected tumor
cells, autologous tumor cells are maintained in Eagles medium
containing 10% (vol/vol) fetal calf serum, 2 mM glutamine and
gentamicin. A monolayer of confluent cells in a 75-cm.sup.2 flask
is inoculated with (3.times.10.sup.8) plaque forming units (pfu) of
rvv. After 2 hours at 37.degree. C., the inoculum is replaced by
DMEM and the incubation was continued for another 24 hours. After
examination under microscope, cells are collected by scraping and
washed two times with PBS and resuspended in PBS at a desired
concentration. (10.sup.3to 10.sup.5/200 .mu.l). Female C57BL/6
mice, 6-8 weeks old are purchased from Harlan Bioproducts for
Science Inc., (IN). Animals are injected subcutaneously with the
cellular vaccine in the rear left flank and two weeks later tumor
cells are injected at the rear right flank for challenge. Survival
of mice following tumor challenge and the presence of tumor is
monitored daily. If the tumor is measurable, tumors are measured
weekly by a caliper in two dimensions and the volumes are
calculated using the formula (width.sup.2.times.length)/2. Tumors
which are palpable but too small for measuring the volume
accurately are recorded as zero volume, but tumor incidence is
recorded as positive. Tumor volumes are averaged only for those
that actually develop tumors over the observation period of 120
days. Zero values are included for those mice that eventually
develop tumors but were tumor-free at a given time point.
[0404] Statistical evaluation is done using SigmaStat software
(Jandel, Inc. San Rafael, Calif., USA). A P value of <0.05 is
considered to indicate statistical significance.
Example 7
Expression and Characterization of a 1A7 Single chain Variable
Region Molecule
[0405] Based on the sequence data listed elsewhere in this
application, a cDNA construct is prepared by standard recombinant
cloning techniques for single chain 1A7 derivatives in which
V.sub.H and V.sub.L are joined through a linker sequence.
[0406] The strategy is as follows. The construct is incorporated
into the pET-22b(+) plasmid vector (Novagen, Madison, Wis.) and
expressed in E. coli. Sequence analysis is performed to confirm the
plasmid construct, which contains the carboxy end of V.sub.H linked
to the framework of V.sub.L and not the leader region. pET-22b(+)
contains a nickel ion binding domain consisting of 6 sequential
histidine residues (His.sub.6). The His.sub.6 domain has a high
affinity for nickel, which is used for the purification of the
recombinant 1A7 scFv.
[0407] A cell binding competition assay is performed to investigate
whether the 1A7 scFv retains the antigen mimicry shown by intact
1A7. GD2-positive M21/P6 cells (1.times.10.sup.5 cells/well in 50
.mu.l volume) are placed in a 96-well plate. The cells are
incubated for 2 hours at room temperature with [.sup.125I] 14G2a
(Ab1), 100,000 cpm, in the absence and presence of increasing
concentrations of 1A7 or the 1A7 scFv fragment. Percent inhibition
is calculated according to standard formulae.
[0408] The strategy has been implemented to prepare genetic
constructs encoding scFv of the form
V.sub.H--(GGGGS).sub.3--V.sub.L and
V.sub.L--(GGGGS).sub.3--V.sub.H. T-vector derived plasmids
containing the encoding sequence for the 1A7 heavy chain variable
region (pT1A7VH) and for the 1A7 light chain variable region
(pT1A7VL) were obtained as described in Example 2. The plasmids
were linearized by digestion with AvaI. Using the linearized
plasmids as template, PCR amplification was conducted using a
special set of primers designed to incorporate the following
features:
[0409] 1. A unique restriction nuclease site for subsequent
ligation of the construct into a vector plasmid. An EcoRV site was
used.
[0410] 2. A Kozak's consensus sequence for ribosome binding
operably linked at the 5' end to a start codon and the encoding
region for the signal peptide of the first variable region;
[0411] 3. A (GGGGS).sub.n encoding sequence linked directly at the
3' end of the coding sequence of the first variable region
(Framework 4);
[0412] 4. A (GGGGS).sub.n encoding sequence linked directly at the
5' end of the coding sequence of the second variable region without
the signal peptide (Framework 1);
[0413] 5. A stop codon linked directly at the 3' end of the coding
sequence of the second variable region (Framework 4).
[0414] 6. A second unique restriction nuclease site. XbaI was
used.
[0415] For the construct V.sub.H--(GGGGS).sub.3--V.sub.L, V.sub.H
was the first variable region and V.sub.L was the second; whereas
for V.sub.L--(GGGGS).sub.3--V.sub.H, V.sub.L was the first variable
region and V.sub.H was the second.
[0416] Using these primers in the initial PCR incorporates the
translation and linker sequences during amplification. A region of
overlap is present through the linker, which then permits the heavy
and light chain sequences to be amplified together in a second
round of PCR using the outermost primers.
[0417] The primers were synthesized by standard techniques by the
Macromolecular Structure Analysis Facility at the University of
Kentucky. The sequences are shown in Table 7. The abbreviaton Lk
stands for the linker (GGGGS).sub.3 (SEQ. ID NO:45).
7TABLE 7 PCR primers used for constructing plasmid for 1A7 scFv
expression Used to Designation Construct amplify Orientation
Sequence (5'.fwdarw.3') P1-VH V.sub.H-(Lk)-V.sub.L V.sub.H forward
GCCGATATCACCATGGCTGTCTTGGGG SEQ. ID NO:56 CTGCTC P3-VLL V.sub.H
reverse TTGGGTCATCAAAACATCGGATCCGCCG SEQ. ID NO:57
CCACCCGAGCCGCCACCGCCCGAGCCA CCTCCCCCTGAGGAGACGGTGACTGA P2-VHL
V.sub.L forward TCAGTCACCGTCTCCTCAGGGGGAGGT SEQ. ID NO:58
GGCTCGGGCGGTGGCGGCTCGGGTGG CGGCGGATCCGATGTTTTGATGA- CCCAA 3'-VL
V.sub.L reverse CATCTCTAGATTATTTGATTTCCAGCTTG SEQ. ID NO:59 GTGCC
5'-VL V.sub.L-(Lk)-V.sub.H V.sub.L forward
GCCGATATCACCATGGAGTTGCCTGTTA SEQ. ID NO:60 GGCTG VLL3 V.sub.L
reverse TGACTCCTTCACCTGCACCTGGGATCCG SEQ. ID NO:61
CCGCCACCCGAGCCGCCACCGCCCGAG CCACCTCCCCCTTTGATTTCCAGCTTGG TGCC
5'-VLLVH V.sub.H forward GGCACCAAGCTGGAAATCAAAGGGGGA SEQ. ID NO:62
GGTGGCTCGGGCGGTGGCGGCTCGGG TGGCGGCGGATCCCAGGTGCAGGTGAA GGAGTCA
3'-VH V.sub.H reverse CATCTCTAGATTATGAGGAGACG- GTGAC SEQ. ID NO:63
TGAGGT
[0418] The V.sub.H--(Lk)--V.sub.L construct was assembled in the
following way: A PCR amplification was conducted on the linearized
pT1A7VH plasmid using P1-VH and P3-VLL, and on the linearized
pT1A7VL plasmid using P2-VHL and 3'-VL. The amplified products were
freed of primers, annealed, and another round of PCR amplification
was done using the primers P1-VH and 3'-VL. The product was a DNA
fragment comprising an encoding sequence for a single-chain
molecule containing in order: the V.sub.H signal sequence, V.sub.H,
the linker, and V.sub.L.
[0419] FIG. 15 lists the nucleotide sequence (SEQ. ID NO:65) for
the V.sub.H--(Lk)--V.sub.L obtained from the second round of PCR
amplification. Restriction sites EcoRV and XbaI are shown by
underlining. The ATG start codon is italicized and preceded by a
.vertline.. The linker sequence is the long underlined section near
the middle of the sequence. The termination codon TAA is italicized
and followed by a .vertline.. The Kozak's consensus sequence
ACCATGG (SEQ. ID NO:64) precedes the start codon. Shown below the
nucleotide sequence is the expected translation product (SEQ. ID
NO:66) which is 263 amino acids in length.
[0420] The V.sub.L--(Lk)--V.sub.H construct was assembled in
exactly the same fashion, except that the second set of primers
listed in Table 7 were used in the PCR amplification reactions.
[0421] Each of the constructs was cloned into a pcDNA3-derived
vector plasmid. pcDNA is a -5445 base-pair circular DNA containing
in order the CMV promoter, a polycloning site, and the bovine
growth hormone polyadenylation signal (BGHpA), and was obtained
from InVitrogen. The pcDNA3 plasmid was first modified to remove
unneeded sequences to improve its suitability for administration to
human subjects. First, it was digested with PvuII and self-ligated.
This resulted in removal of 2165 base pairs comprising the neomycin
resistance gene. The product was digested with NruI and PvuI, and
blunted by digestion with 3'-5'-exonuclease. This removed the
ampicillin resistance gene, resulting in a linear DNA designated
pcDNA 3.2. Kanamucin resistance gene was cut out from pUC4K with
PstI, and blunted by 3'-5'-exonuclease digestion to make a DNA
fragment designated pUC4K1.2. pUC4K1.2 and pcDNA3.2 were then
ligated, resulting in the formation of a "humanized" plasmid with a
kanamucin resistance gene, designated pHcDNA3. The scFv encoding
sequences were cloned into pHcDNA3 by digesting both the plasmid
and the scFv DNA fragment with EcoRV and XbaI, followed by
ligation.
[0422] FIG. 16 is a map of the construct comprising an expressible
gene for the V.sub.H--(Lk)--V.sub.L scFv. The encoding region is
under control of the CMV promoter, and linked downstream to the
bGHpA polyadenylation sequence.
[0423] Ability of the plasmids to express the encoded protein in a
suitable conformation is tested by transfecting CHO cells and MC38
cells. TRANSFECTAMINE.TM. or electroporation are alternatively used
to effect the transfection. Both the culture supernatant and a cell
lysate are tested for the presence of the gene product. A sandwich
ELISA is conducted using antibody 14G2a (Ab1) as both plate coat
and .sup.125I-labeled developing reagent. A parallel assay using an
irrelevant antibody as developing reagent is used as negative
control. Positive results are confirmed by conducting a Western
blot using .sup.125I-14G2a. The expected size of the scFv gene
product is .about.44 kDa.
[0424] The scFv can be isolated by affinity chromatography using a
14G2a adsorbant, eluted with a pH .about.2.5 glycine buffer.
Further investigation of the specificity of the scFv is conducted
using the affinity-purified protein. GD2-positive M21/P6 cells
(1.times.10.sup.5 cells/well in 50 pi volume) are placed in a
96-well plate. The cells are incubated for 2 hours at room
temperature with .sup.125I-14G2a (Ab1), 100,000 cpm, in the absence
and presence of increasing concentrations of 1A7 or the 1A7 scFv
fragment. Percent inhibition is calculated according to standard
formulae.
[0425] Plasmids encoding scFv with the correct specificity are
assembled into candidate 1A7 vaccines using methods known in the
art for assembling polynucleotide vaccines. One such candidate is a
naked DNA vaccine. It is prepared by growing the plasmid to
sufficient quantities, purifying it from the host cell, and mixing
it with a pharmaceutically compatible buffer. Another candidate
comprises cationic liposomes to facilitate transfection. Materials
and methods for assembling cationic liposomes are known in the art:
see U.S. Pat. Nos. 5,264,618; 5,334,761; and 5,459,127.
[0426] Candidate 1A7 polynucleotide vaccines are tested for
immunogenicity as follows. Two groups of 10-15 female C57BL/6 mice
(6-8 weeks old) are immunized intramuscularly with doses of 50-100
.mu.g purified plasmid. Various routes of administration are
compared, such as intramuscular, intradermal, subcutaneous and
interperitoneal.
[0427] Mice are bled 7 days after each immunization for
determination of anti-1A7 and anti-GD2 activity as described
elsewhere in this disclosure. Three mice are sacrificed from each
group for isolation of spleens for the T cell proliferation assay
10 days after a booster immunization. To determine whether effects
are specific, the following negative controls are used: (a) plasmid
without the 1A7 scFv polynucleotide insert; (b) plasmid with the
scFv polynucleotide insert in the opposite orientation with respect
to the promoter, and (c) plasmid containing a polynucleotide
encoding an scfv of an unrelated anti-idiotype antibody.
Example 8
Development of an Animal Model for Testing Vaccines Comprising a
1A7 Polynucleotide or Polypeptide Derivative
[0428] A number of different fragments, constructs, plasmids, and
fusion proteins are contemplated in this invention as a second
generation vaccine for GD2-associated tumors. Animals have been
established in the examples given so far as suitable for testing
whether a candidate vaccine can elicit an immune response.
Ultimately, the objective is to use the vaccine in tumor therapy,
and it is desirable to have an animal model that can be used to
screen candidate vaccines for this end-point.
[0429] Accordingly, a (57BL/16) mouse EL4 lymphoma model was
developed.
[0430] Cheung et al. (1993, Int. J. Cancer 54:499-505) reported
that murine lymphoma EL4 cells express GD2 at high density. MAb
14G2a was tested for binding to EL4 cells. Essentially 100% of the
EL4 cells (a gift from Dr. Suzanne Rosenberg, Univ. of Maryland)
bound at high fluorescence intensity with 14G2a by FACS analysis.
The cell binding inhibition curve showed that 1A7 can effectively
inhibit the binding of 125-labeled 14G2a to EL4 cells. Immunization
of C57BL/6 mice with anti-Id 1A7 plus QS-21 induced anti-GD2
antibodies which bind to EL4 cells and kill EL4 cells in in vitro
ADCC assay. Also, spleen cells from immunized C57BL/6 mice showed
in vitro T cell proliferation in presence of irradiated EL4 cells.
Thus, murine EL4 lymphoma in syngeneic immunocompetent C57BL/6 mice
can serve as a suitable animal model for evaluating the efficacy of
anti-Id A7-based vaccines.
[0431] 100,000 EL4 cells are injected subcutaneously (s.c.) into
C57BL/6 mice. This is lethal to the host, and the median survival
time is approximately four weeks. Since median survival time is
dependent on the inoculum of tumor cells, a dose related time curve
is generated using 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, and
10.sup.7 tumor cells/mouse, injected s.c., with 10 mice per group.
A dose is determined that develops into a slow growing or rapidly
growing tumor. The subcutaneous tumor model permits us to more
closely monitor tumor growth and host immune response without
sacrificing the mouse. EL4 cells also can be injected i.p. which
grow very rapidly with intra-abdominal metastasis. The
intraperitoneal model can be adapted to study the immune response
to tumors which develop systemically.
[0432] Five different forms of vaccines are explored and compared
for efficacy. The vaccines are:
[0433] (i) 1A7-QS21 (as our standard control)
[0434] (ii) Irradiated EL4 cells (Positive Control)
[0435] (iii) GD2-KLH plus QS-21 (Antigen Vaccine)
[0436] (iv) 1A7-plasmid
[0437] (v) 1A7-Vaccinia Construct
[0438] The serum levels of anti-anti-Id (Ab3) and anti-GD2
antibodies is measured as described elsewhere in this disclosure.
Typically, blood samples are obtained before vaccination and ten
days after each immunization and assayed for anti-GD2 antibodies.
The time course is determined over which the immune response
develops, the intensity of the immune response, the effect of
multiple injections of vaccine (boosting), duration of the humoral
response and variability of the humoral response between animals.
Comparing the anti-GD2 titers with survival of tumor challenge
establishes whether there is any correlation between the level of
humoral response and tumor protection. The specificity of the
immune response is examined by ELISA, RIA, Dot Blot analysis and
FACS analysis. The serum Ab3 is also studied by in vitro ADCC or
CMC assays. The target cells are EL4. The isotypes of anti-GD2
antibodies in the serum of mice are determined by ELISA using
isotype specific reagents.
[0439] The cellular immune response is assayed using a T cell
proliferation assay and a cytotoxic T lymphocyte (CTL) assay. The
proliferation assay is used to assess the proliferative response of
cells from vaccinated mice to various stimuli. Spleen cells are
harvested from animals immunized with an experimental vaccine or
control vaccine and placed into in vitro cultures. The splenocytes
are then stimulated with either media alone, phytohemagglutinin
(PHA), irradiated EL4 cells, purified GD2, anti-Id 1A7 or an
irrelevant Ab2. Cell proliferation is measured after 5 days of
culture and then stimulation for 18 hours by [.sup.3H]-thymidine
incorporation. Stimulation of the spleen cells with PHA shows the
maximum proliferation of T cells, and culturing with media alone
measures base line proliferation. Splenocyte cultures are of mixed
cell type, including antigen presenting cells. Pulsing cells with
the above stimulants results in antigen processing by these cells
and a reactive T lymphocyte proliferation. By comparing the
proliferative response of the differently vaccinated mice, it is
possible to determine if there is an advantage of any particular
vaccine form over others.
[0440] In order to determine which subset of T-cells are being
induced, the proliferating cells are phenotyped by flow cytometry.
Alternatively, splenic T-cells are depleted of either CD4+ or CD8+
cells before proliferation assay by incubation with monoclonal
antibody RL.172 (anti-CD4+) or mAb.168 (anti-CD8+) and
complement.
[0441] One of the effector mechanism thought to be important for
tumor protection is antigen specific CTL killing. EL4 or GD2
specific CTL activity will be assayed to determine if the vaccines
induce this type of cellular response. Splenocytes are harvested
from vaccinated mice and co-cultured with irradiated EL4 tumor
cells and IL-2 for five days to expand Ag specific CTL. The
splenocytes are then mixed with .sup.51Cr-labeled target cells at
various effector to target ratios, and then assayed for released
radioactivity. The target cells are EL4 cells and MC38 cells. MC38
is a murine colonic tumor cell line which was derived from the same
mouse strain and thus shares the same H-2 haplotype but has
different surface antigen markers. Both of these tumor cells take
up .sup.51Cr and have a low spontaneous release. Vaccination of
mice should stimulate the production of CTL which specifically lyse
EL4 cells and not MC38 cells.
[0442] By comparing the CTL activity in differently vaccinated
mice, the particular type of vaccine stimulates different levels of
CTL response is determined. Also determined is whether different
adjuvants or cytokines are needed to influence this type of immune
response generated.
Example 9
Evaluating the Efficacy of Derivative Vaccines
[0443] Efficacy of the different vaccinations is measured by the
degree of tumor protection caused by vaccines using the animal
model outlined in the previous example. Tumor protection is
compared with other measurements of the immune response to
determine if there is any correlation between tumor protection and
level of humoral or cellular response.
[0444] To evaluate the ability of vaccinations to prevent tumor
growth, vaccinated mice are challenged with a lethal number of
tumor cells. The immunization schedule is determined by evaluating
the humoral and cellular immune response as described above. It is
likely that the schedule and number of immunizations necessary to
induce a significant immune responses varies between the different
types of vaccines. Fifteen mice are used in each vaccination group
including one group of mice immunized with an irrelevant Ab2. Blood
samples are obtained after 7 days of each immunization to monitor
the humoral response. Once immunized, 10 of the mice are challenged
with a previously established lethal number of EL4 cells injected
s.c. The survival of the different vaccination groups is compared
using Kaplan-Meier analysis. The other five mice in each
vaccination group are used for CTL assays. These studies give
information about the immune status at the time of tumor challenge
and protection from tumor growth. Different types of vaccines are
also compared (anti-Id protein, cells, GD2-KLH or DNA) for their
ability to stimulate a protective immune response.
[0445] The level of tumor protection is evaluated by the number of
mice that survive a tumor challenge and the dose of tumor cells
immunized mice can survive. The level of tumor protection is
measured for each of the vaccines which stimulate tumor protecting
immune responses.
[0446] Specificity of tumor protection is evaluated using an
unrelated tumor cell such as MC38 which grows subcutaneously in
C57BL/6 mice. Groups of mice are vaccinated with different vaccines
and then challenged with either EL4 or MC38 cells. The mice are
observed daily and survival comparison between two groups of mice
is made using Kaplan-Meier analysis.
[0447] To evaluate the effectiveness of vaccine therapy in the
treatment of mice with established tumor, C57BU6 mice are injected
with appropriate number of EL4 cells subcutaneously and then 24
hours later immunized with different vaccines or unrelated Ab2
vaccine. The mice are reimmunized every week and followed for tumor
growth and survival.
[0448] Experiments are conducted to determine the immune effector
arm involved in protective immunity against syngeneic GD2 antigen
bearing tumors. Adoptive transfer of immune Ab3 serum (containing
Ab1') or immune T-lymphocyte subsets (CD4+or CD8+) or NK cells is
done into naive recipient C57BL/6 mice previously treated with
sublethal dose of radiation to allow for cell expansion. The
recipient mice and previously vaccine immunized positive control
mice are then injected with a lethal number of tumor cells and
followed for tumor growth and survival.
Example 10
Clinical Use of Derivative Vaccines
[0449] Promising results using plasmids in the animal tumor model
of the previous example lead to development of plasmid vectors for
human use. The pcDNA3 vector is modified according to Conry et al.
for incorporation of the appropriate Ab2.beta. fragment This
modification involves deletion of the neomycin gene and replacing
it with Tn903 kanamycin resistance gene. Ampicillin resistance gene
and viral sequences corresponding to nucleotide 5004-208 are also
deleted. The plasmid is prepared on a large scale under Good
Manufacturing Practice (GMP) conditions. Purified plasmid is stored
at -70.degree. C. in aliquots of 5 mg/ml.
[0450] Vaccinia constructs are made in Wyeth-calf adapted strain of
vaccinia This strain of vaceinia has been used for smallpox
vaccination and has been shown to be safe in cancer patients.
Clones of rvv are picked and plaque purified. Rvv are grown under
GMP conditions using certified strains of eukaryotic cells. Virus
is concentrated by sucrose gradient centrifugation.
[0451] An initial study is done in six advanced melanoma patients.
Depending on results, anti-Id based DNA vaccines is combined with
the standard control 1A7 plus QS-21 vaccines for augmenting tumor
specific immunity in vaccinated patients.
ADDITIONAL REFERENCES
[0452] Gangliosides as Tumor Antigens
[0453] Livingston, P. O. Approaches to augmenting the
immunogenicity of melanoma gangliosides: From whole melanoma cells
to ganglioside-KLH conjugate vaccines. Immunol. Review,
145:147-166, 1995.
[0454] Hamilton, W. B., et al. Ganglioside expression human
malignant melanoma assessed by quantitative immune thin layer
chromatography. 1 ng. J. Cancer, 53:566-573, 1993.
[0455] Hamilton, W. B., et al. Ganglioside expression on sarcoma
and small cell lung carcinoma compared to tumors of neuroectodermal
origin. Proc. Am. Assoc. Cancer Res. 34:491, 1993.
[0456] Tsuchida, T., et al. Gangliosides of human melanoma. J.
Natl. Cancer Inst. 78:45-54, 1987.
[0457] Cheresh, D. A., et al. Biosynthesis and expression of the
disialoganglioside GD2, a relevant target antigen on small cell
lung carcinoma for monoclonal antibody-mediated cytolysis. Cancer
Res. 46:5412-5118, 1996.
[0458] Mujoo, K., et al. Disialoganglioside GD2 on human
neuroblastoma cells. Target antigen for monoclonal
antibody-mediated cytolysis and suppression of tumor growth. Cancer
Res. 47:1098-1104, 1987.
[0459] Plasmid and Vaccinia Vaccines
[0460] Spooner, R. A., et al. DNA vaccination for cancer treatment.
Gene Therapy, 2:173-180, 1995.
[0461] Wang, B., et al. Immunization by direct DNA inoculation
induces rejection of tumor cell challenge. Human Gene Therapy,
6:407-418, 1995.
[0462] Conry, R. M., et al. A carcinoembryonic antigen
polynucleotide vaccine for human clinical use. Gene Therapy,
2:33-38, 1995.
[0463] Hawkins, R E., et al. A genetic approach to idiotypic
vaccination. J. Immunother. 14:273-278,1993.
[0464] Pisetsky, D. S. DNA vaccination: a clue to memory? Human
Immunol., 38:241-242, 1993.
[0465] Jiao, S., et al. Direct gene transfer into nonhuman primate
myofibers in vivo. Human Gene Ther. 3:21-33, 1992.
[0466] Nabel, G. J., et al. Direct gene transfer with DNA-liposome
complexes in melanoma: expression, biological activity, and lack of
toxicity in humans. Proc. Natl. Acad. Sci. USA. 90:11307-11311,
1992.
[0467] Kaufman, H., et al. A recombinant vaccinia virus expressing
human carcinoembryonic antigen (GD2). Int. J. Cancer, 48:900-907,
1991.
[0468] Moss, B. and Flexner, C. Vaccinia virus expression vectors.
Ann. Rev. Immunol., 5:305-324, 1987.
[0469] Moss, B., et al. Live recombinant vaccinia virus protects
chimpanzees against hepatitis B. Nature, 311:67-69, 1984.
[0470] Wachsman, M., et al. Expression of herpes simplex virus
glycoprotein D on antigen presenting cells infected with vaccinia
recombinants and protective immunity. Biosci. Res. 8:323-334,
1988.
[0471] Anti-Idiotypes as Inducers of Anti-Tumor Immune Response
[0472] Foon, K. A., et al. Active Immunity to the Carcinoembryonic
Antigen in Patients Treated with an Anti-idiotype Antibody Vaccine.
J. Clin. Invest 96:334-342, 1995.
[0473] Bhattacharya-Chatterjee, M., et al. Idiotype vaccines
against human T cell acute lymphoblastic leukemia. I. Generation
and characterization of biologically active monoclonal
anti-idiotypes. J. Immunol. 139:1354-1360, 1987.
[0474] Bhattacharya-Chatterjee, M., et al. Idiotype vaccines
against human T-cell leukemia J. Immunol. 141:1398-1403, 1988.
[0475] Bhattacharya-Chatterjee, M., et al. Murine monoclonal
anti-idiotype antibody as a potential network antigen for human
carcinoembryonic antigen. J. Immunol. 145:2758-2765, 1990.
[0476] Bhattacharya-Chatterjee, M., et al. Anti-idiotype antibodies
as potential therapeutic agents for human breast cancer. In Antigen
and Antibody Molecular Engineering in Breast Cancer Diagnosis and
Treatment. Conf. on Breast Cancer Therapy Immunology, R. L. Ceriani
(Ed.), Plenum Press, N.Y., pp 139-148, 1994.
[0477] Chakraborty, M., et al. Induction of Human Breast
Cancer-Specific Antibody Response in Cynomolgus Monkeys by a Murine
Monoclonal Anti-idiotype Antibody. Cancer Res. 55:1525-1530,
1995.
[0478] Bhattacharya-Chatterjee, M., et al. Syngeneic monoclonal
anti-idiotype antibodies against a monoclonal antibody to human
melanoma associated antigen. J. Immunol. 150:142A, 1993.
[0479] Sen, G., et al. Murine Monoclonal Antibody-idiotype Antibody
Breaks Tolerance and Induces Specific Antibody Response to Human
Disialoganglioside GD2 in Cynomolgus Monkeys. Abstract presented at
the 9th International Congress of Immunology, San Francisco,
Calif., July 23-29, A5250, p885, 1995
[0480] Chapman, P. B. and Houghton, A. N. Induction of IgG
antibodies against GD3 ganglioside in rabbits by an anti-idiotypic
monoclonal antibody. J. Clin. Invest 88:186-192, 1991.
[0481] Saleh M. N., Stapleton, J. D., Khazaeli M. B. and LoBuglio,
A. F. Generation of a human anti-idiotypic antibody that mimics the
GD2 antigen. J. Immunol. 151:33909-3398, 1993.
[0482] Cheung, N. -K. V., Canete, A., Cheung, I. Y., Ye, J. -N. and
Liu, C. Disialoganglioside GD2 anti-idiotypic monoclonal
antibodies. Int. J. Cancer 54:499-505, 1993.
[0483] Kanda, S, Takeyama H., Kikumoto, Y., Morrison S. L., Morton
D. L. and Irie, R. F. Both V.sub.H and V.sub.L regions contribute
to the antigenicity of anti-idiotypic antibody that mimics melanoma
associated ganglioside GM.sub.3 Cell Biophys. 24/25:65-74,
1994.
[0484] Yamamoto S., Yamamoto T., Saxton R. E., Hoon D. S. B., and
Irie, R. F. Anti-idiotype monoclonal antibody carrying the internal
image of ganglioside GM3. J. Natl. Cancer Inst. 82:1757-1760,
1990.
[0485] Hastings, A., Morrison S. L., Kanada S., Saxton, R. E., and
Irie, R. F. Production and characterization of a murine/human
chimeric anti-idiotype antibody that mimics ganglioside. Cancer
Res. 52:1681-1686, 1992.
[0486] Hakomori et al. U.S. Pat. No. 5,303,614. Methods for the
production of antibodies and induction of immune responses to
tumor-associated gangliosides by immunization with ganglioside
lactones.
[0487] Livingston et al. WO 94/16731. Ganglioside-KLH conjugate
vaccines with QS-21.
Sequence CWU 1
1
* * * * *