U.S. patent application number 10/238667 was filed with the patent office on 2003-06-19 for dna encoding human alpha 1 adrenergic receptors and uses thereof.
This patent application is currently assigned to Synaptic Pharmaceutical Corporation. Invention is credited to Bard, Jonathan A., Forray, Carlos C., Weinshank, Richard L..
Application Number | 20030113772 10/238667 |
Document ID | / |
Family ID | 25493245 |
Filed Date | 2003-06-19 |
United States Patent
Application |
20030113772 |
Kind Code |
A1 |
Bard, Jonathan A. ; et
al. |
June 19, 2003 |
DNA encoding human alpha 1 adrenergic receptors and uses
thereof
Abstract
This invention provides an isolated nucleic acid, vectors,
transformed mammalian cells and non-human transgenic animals that
encode and express normal or mutant alpha 1a, alpha 1b and alpha 1c
adrenergic receptor genes. This invention also provides a protein,
and an antibody directed to the protein and pharmaceutical
compounds related to alpha 1a, alpha 1b and alpha 1c adrenergic
receptors. This invention provides nucleic acid probes, and
antisense oligonucleotides complementary to alpha 1a, alpha 1b and
alpha 1c adrenergic receptor genes. This invention further provides
methods for determining ligand binding, detecting expression, drug
screening, and treatments for alleviating abnormalities associated
with human alpha 1a, alpha 1b and alpha 1c adrenergic
receptors.
Inventors: |
Bard, Jonathan A.;
(Doylestown, PA) ; Weinshank, Richard L.;
(Teaneck, NJ) ; Forray, Carlos C.; (Paramus,
NJ) |
Correspondence
Address: |
Christopher C. Dunham
Cooper & Dunham LLP
1185 Avenue of the Americas
New York
NY
10036
US
|
Assignee: |
Synaptic Pharmaceutical
Corporation
|
Family ID: |
25493245 |
Appl. No.: |
10/238667 |
Filed: |
September 10, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10238667 |
Sep 10, 2002 |
|
|
|
09688415 |
Oct 16, 2000 |
|
|
|
6448011 |
|
|
|
|
09688415 |
Oct 16, 2000 |
|
|
|
09474551 |
Dec 29, 1999 |
|
|
|
6156518 |
|
|
|
|
09474551 |
Dec 29, 1999 |
|
|
|
09206899 |
Dec 7, 1998 |
|
|
|
6083705 |
|
|
|
|
09206899 |
Dec 7, 1998 |
|
|
|
08406855 |
Aug 21, 1995 |
|
|
|
5861309 |
|
|
|
|
08406855 |
Aug 21, 1995 |
|
|
|
PCT/US93/09187 |
Sep 24, 1993 |
|
|
|
PCT/US93/09187 |
Sep 24, 1993 |
|
|
|
07952798 |
Sep 25, 1992 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/320.1; 435/325; 435/69.1; 530/350; 536/23.5 |
Current CPC
Class: |
A61P 15/00 20180101;
A61P 43/00 20180101; C12N 15/85 20130101; A01K 2217/00 20130101;
A01K 2267/03 20130101; C12Q 1/6876 20130101; A61K 38/00 20130101;
A61P 9/08 20180101; C12Q 2600/158 20130101; A61P 3/08 20180101;
C12N 15/8509 20130101; A01K 2267/02 20130101; A61P 27/02 20180101;
A01K 2217/075 20130101; A61P 9/10 20180101; A61P 13/02 20180101;
G01N 33/9433 20130101; A01K 2227/10 20130101; A61P 9/06 20180101;
A01K 2267/0393 20130101; C07K 14/70571 20130101; A61P 9/12
20180101; G01N 2500/10 20130101; A61P 27/16 20180101; A01K 2217/05
20130101; A01K 2207/15 20130101; A01K 2227/105 20130101; C12Q
1/6897 20130101 |
Class at
Publication: |
435/6 ; 435/69.1;
435/320.1; 435/325; 530/350; 536/23.5 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 021/02; C12N 005/06; C07K 014/705 |
Claims
What is claimed:
1. An isolated nucleic molecule encoding a human .alpha..sub.1
adrenergic receptor.
2. A nucleic acid molecule of claim 1, wherein the nucleic acid
molecule encodes a human .alpha..sub.1a adrenergic receptor.
3. A nucleic acid molecule of claim 1, wherein the nucleic acid
molecule encodes a human .alpha..sub.1b adrenergic receptor.
4. A nucleic acid molecule of claim 1, wherein the nucleic acid
encodes a human .alpha..sub.1c adrenergic receptor.
5. A nucleic acid molecule of claim 1, wherein the nucleic acid
molecule is a DNA molecule.
6. A DNA molecule of claim 5, wherein the DNA molecule is a cDNA
molecule.
7. A nucleic acid molecule of claim 1, wherein the nucleic acid
molecule has been so mutated that the human .alpha..sub.1
adrenergic receptor encoded by the nucleic acid molecule is
incapable of receptor activity.
8. A nucleic acid molecule of claim 7, wherein the nucleic acid
molecule is a DNA molecule.
9. A DNA molecule of claim 8, wherein the DNA molecule is a cDNA
molecule.
10. A vector comprising a DNA molecule of claim 5.
11. A plasmid comprising the vector of claim 10.
12. A vector of claim 10 adapted for expression in a bacterial cell
which comprises the regulatory elements necessary for expression of
the DNA in a bacterial cell so located relative to the DNA encoding
a human .alpha..sub.1 adrenergic receptor as to permit expression
thereof.
13. A vector of claim 10 adapted for expression in a yeast cell
which comprises the regulatory elements necessary for the
expression of the DNA in a yeast cell so located relative to the
DNA encoding a human .alpha..sub.1 adrenergic receptor as to permit
expression thereof.
14. A vector of claim 10 adapted for expression in a mammalian cell
which comprises the regulatory elements necessary for expression of
the DNA in the mammalian cell so located relative to the DNA
encoding a human .alpha..sub.1 adrenergic receptor as to permit
expression thereof.
15. A plasmid of claim 11 adapted for expression in a mammalian
cell which comprises the regulatory elements necessary for
expression of the DNA in the mammalian cell so located relative to
the DNA encoding a human .alpha..sub.1 adrenergic receptor as to
permit expression thereof.
16. A plasmid designated pCEXV-.alpha..sub.1a.
17. A plasmid designated pcEXV-.alpha..sub.1b.
18. A plasmid designated pcEXV-.alpha..sub.1c.
19. A mammalian cell comprising the plasmid of claim 11.
20. A mammalian cell of claim 19, wherein the mammalian cell is an
LM (tk-) cell.
21. An LM (tk-) cell comprising the plasmid of claim 15.
22. A nucleic acid probe comprising a nucleic acid molecule of at
least 15 nucleotides capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a human .alpha..sub.1a receptor.
23. A nucleic acid probe comprising a nucleic acid molecule of at
least 15 nucleotides capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a human .alpha..sub.1b receptor.
24. A nucleic acid probe comprising a nucleic acid molecule of at
least 15 nucleotides capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a human .alpha..sub.1c receptor.
25. The nucleic acid probe of claim 22, 23, or 24, wherein the
nucleic acid is DNA.
26. A nucleic acid probe of claim 25, which comprises degenerate
oligonucleotides.
27. An antisense oligonucleotide having a sequence capable of
specifically binding to a mRNA molecule encoding a human
.alpha..sub.1a adrenergic receptor so as to prevent translation of
the mRNA molecule.
28. An antisense oligonucleotide having a sequence capable of
specifically binding to a mRNA molecule encoding a human
.alpha..sub.1b adrenergic receptor so as to prevent translation of
the mRNA molecule.
29. An antisense oligonucleotide having a sequence capable of
specifically binding to a mRNA molecule encoding a human
.alpha..sub.1c adrenergic receptor so as to prevent translation of
the mRNA molecule.
30. An antisense oligonucleotide having a sequence capable of
binding specifically to a cDNA molecule of claim 6.
31. Antisense oligonucleotides comprising degenerate
oligonucleotides of an antisense oligonucleotide of claims 27, 28,
or 29.
32. An antisense oligonucleotides of claims 27, 28, or 29
comprising chemical analogs of nucleotides.
33. A method for detecting expression of a specific human
.alpha..sub.1 adrenergic receptor, which comprises obtaining RNA
from cells or tissue, contacting the RNA so obtained with a nucleic
acid probe of claim 22, 23 or 24 under hybridizing conditions,
detecting the presence of any mRNA hybridized to the probe, the
presence of mRNA hybridized to the probe indicating expression of
the specific human .alpha..sub.1 adrenergic receptor, and thereby
detecting the expression of the specific human .alpha..sub.1
adrenergic receptor.
34. A method of detecting expression of a specific human
.alpha..sub.1 adrenergic receptor in a cell or tissue by in situ
hybridization, contacting the cell or tissue with a nucleic acid
probe of claim 25 or an antisense oligonucleotide of claims 27, 28
or 29 under hybridizing conditions, detecting the presence of any
mRNA hybridized to the probe, the presence of mRNA hybridized to
the probe indicating expression of the specific human .alpha..sub.1
adrenergic receptor, and thereby detecting the expression of the
specific human .alpha..sub.1 adrenergic receptor.
35. A method of isolating a gene encoding a receptor by nucleic
acid sequence homology using a nucleic acid probe of claims 25 or
26.
36. A method of claim 35, which comprises using the the polymerase
chain reaction to obtain a DNA molecule by nucleic acid sequence
homology, the DNA molecule of which is used to isolate a gene
encoding a receptor.
37. A nucleic acid molecule comprising the gene identified by the
method of claims 35 or 36.
38. A method of isolating DNA of claim 5, which comprises growing
bacteria transformed with a plasmid comprising the DNA of claim 5,
lysing the cells and purifying the DNA from the lysed cells.
39. A nucleic acid molecule of claim 1, wherein the nucleic acid
has been so mutated within a 5' transcriptional regulatory element
or other stability, processing, transcription, or
translation-determining region within the 5' or 3' untranslated
region of the DNA so as to increase the stability of the mRNA or to
enhance the processing, transcription, or translation of the
RNA.
40. A nucleic acid molecule of claim 1, wherein the nucleic acid
has been so mutated within a 5' transcriptional regulatory element
or other stability, processing, transcription, or
translation-determining region within the 5' or 3'untranslated
region of the DNA so as to decrease the stability of the mRNA or to
diminish the processing, transcription, or translation of the
RNA.
41. An isolated human .alpha..sub.1 adrenergic receptor
protein.
42. An isolated human .alpha..sub.1 adrenergic receptor protein of
claim 41, wherein the human .alpha..sub.1 adrenergic receptor
protein is the human .alpha..sub.1a adrenergic receptor
protein.
43. An isolated human .alpha..sub.1 adrenergic receptor protein of
claim 41, wherein the human .alpha..sub.1 adrenergic receptor
protein is the human .alpha..sub.1b adrenergic receptor
protein.
44. An isolated human .alpha..sub.1 adrenergic receptor protein of
claim 41, wherein the human .alpha..sub.1 adrenergic receptor
protein is the human .alpha..sub.1c adrenergic receptor
protein.
45. A method of preparing a human .alpha..sub.1 adrenergic receptor
protein of claim 41, which comprises inducing cells to express the
human .alpha..sub.1 adrenergic receptor protein, recovering the
human .alpha..sub.1 adrenergic receptor from the resulting cells,
and purifying the human .alpha..sub.1 adrenergic receptor so
recovered.
46. A method of preparing a human .alpha..sub.1 adrenergic receptor
of claim 41, which comprises inserting a nucleic acid molecule
encoding the human .alpha..sub.1 adrenergic receptor in a suitable
vector, inserting the resulting vector in suitable host cell,
recovering the human .alpha..sub.1 adrenergic receptor produced by
the resulting cell, and purifying the human .alpha..sub.1
adrenergic receptor so recovered.
47. An antibody directed to a human .alpha..sub.1a adrenergic
receptor or to a protein fragment of the human .alpha..sub.1a
adrenergic receptor.
48. An antibody directed to a human .alpha..sub.1b adrenergic
receptor or to a protein fragment of the human .alpha..sub.1b
adrenergic receptor.
49. An antibody directed to a human .alpha..sub.1c adrenergic
receptor or a protein fragment of the human .alpha..sub.1c
adrenergic receptor.
50. An antibody of claims 47, 48 or 49 wherein the antibody is a
monoclonal antibody.
51. A monoclonal antibody of claim 50 wherein the antibody is
directed to an epitope of a human cell-surface .alpha..sub.1
adrenergic receptor and having an amino acid sequence substantially
the same as the amino acid sequence for a cell-surface epitope of
the human .alpha..sub.1 adrenergic receptor.
52. A pharmaceutical composition comprising an amount of a
substance effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1a adrenergic receptor and a
pharmaceutically acceptable carrier.
53. A pharmaceutical composition comprising an amount of a
substance effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1b adrenergic receptor and a
pharmaceutically acceptable carrier.
54. A pharmaceutical composition comprising an amount of a
substance effective to alleviate the bnormalities resulting from
overexpression of a human .alpha..sub.1c adrenergic receptor and a
pharmaceutically acceptable carrier.
55. A pharmaceutical composition comprising an amount of a
substance effective to alleviate abnormalities resulting from
underexpression of a human .alpha..sub.1a adrenergic receptor and a
pharmaceutically acceptable carrier.
56. A pharmaceutical composition comprising an amount of a
substance effective to alleviate abnormalities resulting from
underexpression of a human .alpha..sub.1b adrenergic receptor and a
pharmaceutically acceptable carrier.
57. A pharmaceutical composition comprising an amount of a
substance effective to alleviate abnormalities resulting from
underexpression of a human .alpha..sub.1c adrenergic receptor and a
pharmaceutically acceptable carrier.
58. A pharmaceutical composition comprising an effective amount of
an oligonucleotide of claim 27 effective to reduce expression of a
human .alpha..sub.1a adrenergic receptor by passing through a cell
membrane and specifically binding with mRNA encoding a human
.alpha..sub.1a adrenergic receptor in the cell so as to prevent its
translation and a pharmaceutically acceptable hydrophobic carrier
capable of passing through a cell membrane.
59. A pharmaceutical composition comprising an effective amount of
an oligonucleotide of claim 28 effective to reduce expression of a
human .alpha..sub.1b adrenergic receptor by passing through a cell
membrane and specifically binding with mRNA encoding a human
.alpha..sub.1b adrenergic receptor in the cell so as to prevent its
translation and a pharmaceutically acceptable hydrophobic
carrier.
60. A pharmaceutical composition comprising an effective amount of
an oligonucleotide of claim 29 effective to reduce expression of a
human .alpha..sub.1c adrenergic receptor by passing through a cell
membrane and specifically binding with mRNA encoding a human
.alpha..sub.1c adrenergic receptor in the cell so as to prevent its
translation and a pharmaceutically acceptable hydrophobic
carrier.
61. A pharmaceutical composition claims 58, 59 or 60, wherein the
nucleotide is coupled to a substance which inactivates mRNA.
62. A pharmaceutical composition of claim 61, wherein the substance
which inactivates the mRNA is a ribozyme.
63. A pharmaceutical composition of claim 61, wherein the
pharmaceutically acceptable hydrophobic carrier capable of passing
through a cell membrane comprises a structure which binds to a
transporter specific for a selected cell type and is thereby taken
up by the cells of the selected cell type.
64. A pharmaceutical composition which comprises an amount of the
antibody of claim 47 effective to block binding of naturally
occurring substrates to a human .alpha..sub.1a adrenergic receptor
and a pharmaceutically acceptable carrier.
65. A pharmaceutical composition which comprises an amount of the
antibody of claim 48 effective to block binding of naturally
occurring substrates to a human .alpha..sub.1b adrenergic receptor
and a pharmaceutically acceptable carrier.
66. A pharmaceutical composition which comprises an amount of the
antibody of claim 49 effective to block binding of naturally
occurring substrates to a human .alpha..sub.1c adrenergic receptor
and a pharmaceutically acceptable carrier.
67. A transgenic nonhuman mammal which comprises a nucleic acid
molecule of claim 1.
68. A transgenic nonhuman mammal which comprises the DNA molecule
of claim 39.
69. A transgenic nonhuman mammal which comprises the nucleic acid
molecule of claim 7.
70. A transgenic nonhuman mammal which comprises the DNA molecule
of claim 40.
71. A transgenic nonhuman mammal whose genome comprises a nucleic
acid molecule of claim 1 so placed as to be transcribed into
antisense mRNA complementary to mRNA encoding a human .alpha..sub.1
adrenergic receptor and which hybridizes to mRNA encoding a human
.alpha..sub.1 adrenergic receptor thereby reducing its
translation.
72. The transgenic nonhuman mammal of any of claims 67, 68, 69, 70,
or 71, wherein the nucleic acid molecule further comprises an
inducible promoter.
73. The transgenic nonhuman mammal of any of claims 67, 68, 69, 70,
71, or 72 wherein the nucleic molecule additionally comprises
tissue specific regulatory elements.
74. The transgenic non-human mammal of any of claims 67, 68, 69,
70, 71, 72, or 73, wherein the transgenic non-human mammal is a
mouse.
75. A method of determining the physiological effects of varying
the levels of expression of a specific human .alpha..sub.1
adrenergic receptor which comprises producing a transgenic
non-human mammal whose levels of expression of a human
.alpha..sub.1 adrenergic receptor can be varied by use of an
inducible promoter.
76. A method of determining the physiological effects of expressing
varying levels of a specific human .alpha..sub.1 adrenergic
receptor which comprises producing a panel of transgenic non-human
mammals each expressing a different amount of a human .alpha..sub.1
adrenergic receptor.
77. A method of determining whether a ligand not known to be
capable of specifically binding to a human .alpha..sub.1 adrenergic
receptor can specifically bind to a human .alpha..sub.1 adrenergic
receptor, which comprises contacting a mammalian cell comprising a
plasmid which further comprises a DNA molecule adapted for
expression in a mammalian cell which allows subject cell to express
a human .alpha..sub.1 adrenergic receptor on the cell surface with
the ligand under conditions permitting binding of ligands known to
bind to a human .alpha..sub.1 adrenergic receptor, detecting the
presence of any ligand bound to the human .alpha..sub.1 adrenergic
receptor, the presence of bound ligand thereby determining the
ligand binds to the human .alpha..sub.1 adrenergic receptor, and
thereby determining whether the ligand binds to the human
.alpha..sub.1 adrenergic receptor.
78. The method of claim 77, wherein the receptor is a human
.alpha..sub.1a adrenergic receptor.
79. The method of claim 77, wherein the receptor is a human
.alpha..sub.1b adrenergic receptor.
80. The method of claim 77, wherein the receptor is a human
.alpha..sub.1c adrenergic receptor.
81. The method of claims 78, 79 or 80 wherein the mammalian cell is
a non-neuronal cell.
82. A method of screening drugs to identify drugs which interact
with, and bind to, a human .alpha..sub.1 adrenergic receptor on the
surface of a cell, which comprises contacting a mammalian cell
which comprises a plasmid adapted for expression in a mammalian
cell which further comprises a DNA molecule which expresses a human
.alpha..sub.1 adrenergic receptor on the cell surface with a
plurality of drugs, determining those drugs which bind to the human
.alpha..sub.1a adrenergic receptor expressed on the cell surface of
the mammalian cell, and thereby identifying drugs which interact
with, and bind to, the human .alpha..sub.1 adrenergic receptor.
83. The method of claim 82, wherein the receptor is a human
.alpha..sub.1a adrenergic receptor.
84. The method of claim 82, wherein the receptor is a human
.alpha..sub.1b adrenergic receptor.
85. The method of claim 82, wherein the receptor is a human
.alpha..sub.1c adrenergic receptor.
86. The method of claims 83, 84 or 85, wherein the mammalian cell
is a non-neuronal cell.
87. A method of determining whether a ligand not known to be
capable of binding to a human .alpha..sub.1 adrenergic receptor can
bind to a human .alpha..sub.1 adrenergic receptor, which comprises
preparing a cell extract from mammalian cells, which comprise a
plasmid adapted for expression in a mammal, which further comprise
a DNA molecule which expresses a human .alpha..sub.1 adrenergic
receptor on the cell surface, isolating a membrane fraction from
the cell extract, incubating the ligand with the membrane fraction
under conditions permitting binding of ligands known to bind to the
human .alpha..sub.1 adrenergic receptor, detecting the presence of
any bound ligand, and thereby determining whether the ligand binds
to the human .alpha..sub.1 adrenergic receptor.
88. The method of claim 87, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1a adrenergic
receptor.
89. The method of claim 87, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1b adrenergic
receptor.
90. The method of claim 87, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1c adrenergic
receptor.
91. The method of claims 88, 89 or 90, wherein the mammalian cell
is a non-neuronal cell.
92. A method of screening drugs to identify drugs that interact
with, and bind to, an .alpha..sub.1 adrenergic receptor, which
comprises preparing a cell extract from mammalian cells, which
comprise a plasmid adapted for expression in a mammalian cell which
further comprise a DNA molecule which expresses a human
.alpha..sub.1 adrenergic receptor on the cell surface, isolating a
membrane fraction from the cell extract, incubating the membrane
fraction with a plurality of drugs, determining those drugs which
interact with and bind to the human .alpha..sub.1 adrenergic
receptor, and thereby identifying drugs which interact with, and
bind to, the human .alpha..sub.1 adrenergic receptor.
93. The method claim 92, wherein the receptor is a human
.alpha..sub.1a adrenergic receptor.
94. The method of claim 92, wherein the receptor is a human
.alpha..sub.1b adrenergic receptor.
95. The method of claim 92, wherein the receptor is a human
.alpha..sub.1c adrenergic receptor.
96. The method of claims 93, 94, or 95, wherein the mammalian cell
is a non-neuronal cell.
97. A method of identifying a ligand which interacts with, and
activates or blocks the activation of, a a human .alpha..sub.1
adrenergic receptor on the surface of a cell, which comprises
contacting a mammalian cell which comprises a plasmid adapted for
expression in a mammalian cell which further comprises a DNA
molecule which expresses a human .alpha..sub.1 adrenergic receptor
on the cell surface with the ligand, determining whether the ligand
activates or blocks the activation of the receptor using a bioassay
such as second messenger assays, and thereby identifying a ligand
which interacts with, and activates or blocks the activation of, a
human .alpha..sub.1 adrenergic receptor.
98. The method of claim 97, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1a adrenergic
receptor.
99. The method of claim 97, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1b adrenergic
receptor.
100. The method of claim 97, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1c adrenergic
receptor.
101. The method of claims 96, 99 or 100, wherein the cell is a
non-neuronal cell comprising the cellular components required to
produce the second messenger which is being identified.
102. The method of claim 97, wherein the ligand is a drug.
103. A method for identifying a ligand which is capable of binding
to and activating or inhibiting a human .alpha..sub.1 adrenergic
receptor, which comprises contacting a mammalian cell, wherein the
membrane lipids have been labelled by prior incubation with a
labelled myo-inositol phosphate molecule, the mammalian cell
comprising a plasmid adapted for expression in a mammalian cell
which further comprises a DNA molecule which expresses a human
.alpha..sub.1 adrenergic receptor with the ligand and identifying
an inositol phosphate metabolite released from the membrane lipid
as a result of ligand binding to and activating an .alpha..sub.1
adrenergic receptor.
104. The method of claim 103, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1a adrenergic
receptor.
105. The method of claim 103, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1b adrenergic
receptor.
106. The method of claim 103, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1c adrenergic
receptor.
107. The method of claims 104, 105, or 106, wherein the cell is a
non-neuronal cell expressing the cellular components required to
produce the second messenger which is being identified.
108. The method of claim 103 wherein the ligand is a drug.
109. A method for identifying a ligand that is capable of binding
to and activating or inhibiting a human .alpha..sub.1 adrenergic
receptor, wherein the binding of ligand to the adrenergic receptor
results in a physiological response, which comprises contacting a
mammalian cell which comprises a plasmid adapted for expression in
a mammalian cell which further comprises a DNA molecule which
expresses a human .alpha..sub.1 adrenergic receptor with a calcium
sensitive fluorescent indicator, removing the indicator that has
not been taken up by the cell, contacting the cells with the ligand
and identifying an increase or decrease in intracellular Ca.sup.+2
as a result of ligand binding to and activating the receptor.
110. The method of claim 109, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1a adrenergic
receptor.
111. The method of claim 109, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1b adrenergic
receptor.
112. The method of claim 109, wherein the human .alpha..sub.1
adrenergic receptor is a human .alpha..sub.1c adrenergic
receptor.
113. The method of claim 110, 111 or 112, wherein the cell is a
non-neuronal cell expressing the cellular components required to
produce the second messenger which is being identified.
114. The method of claim 108, wherein the ligand is a drug.
115. A ligand identified by the methods of claims 77, 87, 97, 103
or 109.
116. A pharmaceutical composition of a drug identified by the
methods of claims 82, 92, 102, 108 or 114.
117. A method for detecting the presence of a human .alpha..sub.1a
adrenergic receptor on the surface of a cell, which comprises
contacting the cell with an antibody of claim 47, under conditions
that permit binding of the antibody to the receptor, detecting the
presence of any of the antibody bound to the cell, and thereby the
presence of a human .alpha..sub.1a adrenergic receptor on the
surface of the cell.
118. A method for detecting the presence of a human .alpha..sub.1b
adrenergic receptor on the surface of a cell, which comprises
contacting the cell with an antibody of claim 48, under conditions
that permit binding of the antibody to the receptor, detecting the
presence of any of the antibody bound to the cell, and thereby the
presence of a human .alpha..sub.1b adrenergic receptor on the
surface of the cell.
119. A method for detecting the presence of a human .alpha..sub.1c
adrenergic receptor on the surface of a cell, which comprises
contacting the cell with an antibody of claim 49, under conditions
that permit binding of the antibody to the receptor, detecting the
presence of any of the antibody bound to the cell, and thereby the
presence of a human .alpha..sub.1c adrenergic receptor on the
surface of the cell.
120. A method for treating an abnormal condition related to an
excess of activity of a human .alpha..sub.1 adrenergic receptor
subtype, which comprises administering a patient an amount of a
pharmaceutical composition of claim 116, effective to reduce
.alpha..sub.1 adrenergic activity as a result of naturally
occurring substrate binding to and activating a specific
.alpha..sub.1 adrenergic receptor.
121. The method of claim 120, wherein the condition is benign
prostatic hypertrophy.
122. The method of claim 120, wherein the condition is coronary
heart disease.
123. The method of claim 120, wherein the condition is insulin
resistance.
124. The method of claim 120, wherein the condition is
hypertension.
125. The method of claim 120, wherein the condition is urinary
retension.
126. The method of claim 120, wherein the condition is
glaucoma.
127. The method of claim 120, wherein the condition is erectile
dysfunction.
128. The method of claim 120, wherein the condition is Reynaud's
syndrome.
129. The method of treating abnormalities which are alleviated by
an increase in the activity of a specific human .alpha..sub.1
adrenergic receptor, which comprises administering a patient an
amount of a pharmaceutical composition of claim 116, effective to
increase the activity of the specific human .alpha..sub.1
adrenergic receptor thereby alleviating abnormalities resulting
from abnormally low receptor activity.
130. The method of claim 129, wherein the condition is urinary
incontinence.
131. The method of claim 129, wherein the condition is nasal
congestion.
132. The method of claim 129, wherein the condition is
hypotension.
133. A method for diagnosing a predisposition to a disorder
associated with the expression of a specific human .alpha..sub.1
adrenergic receptor allele which comprises: a. obtaining DNA from
subjects suffering from a disorder; b. performing a restriction
digest of the DNA with a panel of restriction enzymes; c.
electrophoretically separating the resulting DNA fragments on a
sizing gel; d. contacting the gel with a nucleic acid probe of
claim 22, 23, or 24 labelled with a detectable marker; e. detecting
the labelled bands which have hybridized to the DNA encoding either
an .alpha..sub.1a, .alpha..sub.1b or .alpha..sub.1c adrenergic
receptor, labelled with the detectable marker to create a unique
band pattern specific to the DNA of subjects suffering with the
disorder; f. preparing DNA for diagnosis by steps a-e; g. comparing
the unique band pattern specific to the DNA of patients suffering
from the disorder from step e and DNA obtained for diagnosis from
step f to determine whether the patterns are the same or different
and to diagnose thereby predisposition to the disorder if the
patterns are the same.
134. The method of claim 133, wherein a disorder associated with
the expression of a specific human .alpha..sub.1 adrenergic allele
is diagnosed.
135. A method of identifying a substance capable of alleviating the
abnormalities resulting from overexpression of a specific human
.alpha..sub.1 adrenergic receptor which comprises administering a
substance to the transgenic non-human mammal of claims 67, 68, 72,
or 73, and determining whether the substance alleviates the
physical and behavioral abnormalities displayed by the transgenic
nonhuman mammal as a result of overexpression of the human
.alpha..sub.1 adrenergic receptor subtype.
136. A method of identifying a substance capable of alleviating the
abnormalities resulting from underexpression of a human
.alpha..sub.1 adrenergic receptor subtype, which comprises
administering a substance to the transgenic mammal of claims 69 or
70, and determining whether the substance alleviates the physical
and behavioral abnormalities displayed by the transgenic nonhuman
mammal as a result of underexpression of a human .alpha..sub.1
adrenergic receptor subtype.
137. A method of treating abnormalities in a subject, wherein the
abnormality is alleviated by the reduced expression of a human
.alpha..sub.1 adrenergic receptor subtype which comprises
administering to a subject an effective amount of the
pharmaceutical composition of claims 52, 53, 54, 58, 59, 60, 64,
65, 66, 115 or 116 effective to reduce expression of the
.alpha..sub.1 adrenergic receptor subtype.
138. A method of treating abnormalities resulting from
underexpression of a human .alpha..sub.1 adrenergic receptor which
comprises administering to a subject an amount of a pharmaceutical
composition of claim 55, 56, 57, 115, or 116, effective to
alleviate abnormalities resulting from underexpression of the human
.alpha..sub.1 adrenergic receptor.
139. The method of claim 120, wherein the condition is
atherosclerosis.
140. The method of claim 120, wherein the condition is cardiac
arrythmias.
141. The method of claim 120, wherein the condition is sympathetic
dystrophy syndrome.
142. The method of claim 126, wherein the condition is congestive
heart failure.
Description
BACKGROUND OF THE INVENTION
[0001] Throughout this application various publications are
referred to by partial citations within parenthesis. Full citations
for these publications may be found at the end of the specification
immediately preceding the claims. The disclosures of these
publications, in their entireties, are hereby incorporated by
reference into this application in order to more fully describe the
state of the art to which this invention pertains.
[0002] Although adrenergic receptors (ARs) bind the same endogenous
catecholamines (epinephrine and norepinephrine, NE) their
physiological as well as pharmacological specificity is markedly
diverse. This diversity is due primarily to the existence of at
least nine different proteins encoding three distinct adrenergic
receptors types (.alpha..sub.1, .alpha.2, and .beta.). These
proteins belong to the super-family of G-protein coupled receptors,
and are characterized by a single polypeptide chain which span the
plasma membrane seven times, with an extracellular amino terminus,
and a cytoplasmic carboxyl terminus. The molecular cloning of three
genes encoding .alpha..sub.1-ARs supports the existence of
pharmacologically and anatomically distinct .alpha..sub.1-receptor
subtypes. The .alpha..sub.1b-receptor was originally cloned from a
hamster smooth muscle cell line cDNA library, and encodes a 515
a.a. peptide that shows 42-47% homology with other ARs. The message
for the .alpha..sub.1b-receptor is abundant in rat liver, heart,
cerebral cortex and kidney, and its gene was localized to human
chromosome 5 (4). A second cDNA clone from a bovine brain library
was found which encoded a 466-residue polypeptide with 72% homology
to the .alpha..sub.1b-AR gene. It was further distinguished from
.alpha..sub.1b by the finding that its expression was restricted to
human hippocampus, and by its localization to human chromosome 8
and it has been designated as the .alpha..sub.1c-AR (20). The
cloning of an .alpha..sub.1a-AR has been reported recently. This
gene, isolated from a rat brain cDNA library, encodes a 560-residue
polypeptide that shows 73% homology with the hamster
.alpha..sub.1b-receptor. The message for this subtype is abundant
in rat vas deferens, aorta, cerebral cortex and hippocampus, and
its gene has been localized to human chromosome 5 (12).
[0003] Pharmacological studies have demonstrated the existence of
two .alpha..sub.1-adrenergic receptor subtypes. The studies of
.alpha..sub.1-AR-mediated responses in vascular tissue suggested
the possible existence of receptor subtypes, based on the potency
and efficacy of adrenergic agonists, as well as differential
sensitivity of .alpha..sub.1 receptor-mediated responses to
extracellular calcium and calcium channel blockers (6, 24).
Although radioligand binding studies of brain .alpha..sub.1-ARs
with either [.sup.3H]WB4101 and [.sup.3H]prazosin showed good
agreement with the potency of .alpha.-adrenergic antagonists on
vascular responses (23, 10), subsequent binding studies of rat
brain .alpha..sub.1-ARs provided strong evidence for the existence
of receptor heterogeneity, based on the relative affinities for
prazosin and WB4101 (15). These observations were supported by the
finding that chloroethylclonidine (CEC) inactivated 50% of the
.alpha..sub.1, sites from rat cerebral cortex and 80% of the
binding sites from liver or spleen (.alpha..sub.1b), but did not
inactivate .alpha..sub.1-receptors from the hippocampus or vas
deferens (.alpha..sub.1a) (14). Taken together, these results
suggested a classification of the .alpha..sub.1a-subtype as high
affinity for WB4101 and insensitive to alkylation by CEC, and
.alpha..sub.1b-subtype as 10 to 20 fold lower affinity for WB4101,
but sensitive to inactivation by CEC. Consistent with this evidence
the transfection of the hamster .alpha..sub.1b gene into COS-7
cells induced the expression of an .alpha.1-receptor with high
affinity for WB4101, 95% of which could be inactivated by CEC.
Conversely, upon expression of the rat .alpha..sub.1a receptor gene
in COS-7 cells, it showed a 10-fold higher affinity for WB4101 than
the .alpha..sub.1b-receptor, and the binding site was resistant to
inactivation by CEC. The existence of the .alpha..sub.1c receptor
was not predicted from pharmacological data and upon expression it
showed 16 and 30 fold higher affinity for WB4101 and phentolamine
respectively, than the .alpha..sub.1b-receptor and was partially
inactivated (65%) by CEC.
[0004] Molecular cloning and pharmacological studies have
demonstrated the existence of at least three
.alpha..sub.1-adrenergic receptor subtypes. However, it is not
clear whether the pharmacological properties of these three
cognates might be due also to species differences. This caveat is
particularly relevant in the case of the bovine .alpha..sub.1c
receptor, due to its restricted species and tissue expression. The
cloning and expression of the human .alpha..sub.1 adrenergic
receptors will allow the further characterization of the
pharmacology of the individual human .alpha..sub.1 receptor
subtypes.
SUMMARY OF THE INVENTION
[0005] This invention provides and isolated nucleic acid molecule
encoding a human .alpha..sub.1 adrenergic receptor. This invention
further provides an isolated nucleic acid molecule encoding a human
.alpha..sub.1a receptor. In one embodiment of this invention, the
nucleic acid molecule comprises a plasmid pcEXV-.alpha..sub.1a.
This invention also provides an isolated nucleic acid molecule
encoding a human .alpha..sub.1b receptor. In one embodiment of this
invention, the nucleic acid molecule comprises a plasmid
pcEXV-.alpha..sub.1b. This invention further provides an isolated
nucleic acid molecule encoding a human .alpha..sub.1c receptor. In
one embodiment of this invention, the nucleic acid molecule
comprises a plasmid pcEXV-.alpha..sub.1c.
[0006] This invention also provides vectors such as plasmids
comprising a DNA molecule encoding a human .alpha..sub.1a receptor,
adapted for expression in a bacterial, a yeast cell, or a mammalian
cell which additionally comprise regulatory elements necessary for
expression of the DNA in the bacteria, yeast or mammalian cells so
located relative to the DNA encoding the human .alpha..sub.1a
receptor as to permit expression thereof. This invention also
provides vectors such as plasmids comprising a DNA molecule
encoding a human .alpha..sub.1b receptor, adapted for expression in
a bacterial, a yeast cell, or a mammalian cell which additionally
comprise regulatory elements necessary for expression of the DNA in
the bacteria, yeast or mammalian cells so located relative to the
DNA encoding the human .alpha..sub.1b receptor as to permit
expression thereof. This invention also provides vectors such as
plasmids comprising a DNA molecule encoding a human .alpha..sub.1c
receptor, adapted for expression in a bacterial, a yeast cell, or a
mammalian cell which additionally comprise regulatory elements
necessary for expression of the DNA in the bacteria, yeast or
mammalian cells so located relative to the DNA encoding the human
.alpha..sub.1c receptor as to permit expression thereof.
[0007] This invention provides a mammalian cell comprising a DNA
molecule encoding a human .alpha..sub.1a receptor. This invention
also provides a mammalian cell comprising a DNA molecule encoding a
human .alpha..sub.1b receptor. This invention also provides a
mammalian cell comprising a DNA molecule encoding a human
.alpha..sub.1c receptor.
[0008] This invention provides a nucleic acid probe comprising a
nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1a
receptor. This invention provides a nucleic acid probe comprising a
nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1b
receptor. This invention provides a nucleic acid probe comprising a
nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1c
receptor.
[0009] This invention provides an antisense oligonucleotide having
a sequence capable of specifically binding to any sequences of an
mRNA molecule encoding a human .alpha..sub.1a receptor so as to
prevent translation of the mRNA molecule. This invention provides
an antisense oligonucleotide having a sequence capable of
specifically binding to any sequences of an mRNA molecule encoding
a human .alpha..sub.1b receptor so as to prevent translation of the
mRNA molecule. This invention provides an antisense oligonucleotide
having a sequence capable of specifically binding to any sequences
of an mRNA molecule encoding a human .alpha..sub.1c receptor so as
to prevent translation of the mRNA molecule.
[0010] This invention provides method for detecting expression of a
specific human .alpha..sub.1 adrenergic receptor, which comprises
obtaining RNA from cells or tissue, contacting the RNA so obtained
with a nucleic acid probe comprising a nucleic acid molecule of at
least 15 nucleotides capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a human .alpha..sub.1 receptor under hybridizing
conditions, detecting the presence of any mRNA hybridized to the
probe, the presence of mRNA hybridized to the probe indicating
expression of the specific human .alpha..sub.1 adrenergic receptor,
and thereby detecting the expression of the specific human
.alpha..sub.1 adrenergic receptor.
[0011] This invention provides a method for detecting the
expression of a specific human .alpha..sub.1 adrenergic receptor in
a cell or tissue by in situ hybridization which comprises,
contacting the cell or tissue with a nucleic acid probe comprising
a nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1
receptor under hybridizing conditions, detecting the presence of
any mRNA hybridized to the probe, the presence of mRNA hybridized
to the probe indicating expression of the specific human
.alpha..sub.1 adrenergic receptor, and thereby detecting the
expression of the specific human .alpha..sub.1 adrenergic
receptor.
[0012] This invention provides a method for isolating a nucleic
acid molecule encoding a receptor by nucleic acid sequence homology
using a nucleic acid probe, the sequence of which is derived from
the nucleic acid sequence encoding a human .alpha..sub.1 adrenergic
receptor.
[0013] This invention provides a method for isolating a nucleic
acid molecule encoding a human .alpha..sub.1 adrenergic receptor
which comprises the use of the polymerase chain reaction and
oligonucleotide primers, the sequence of which are derived from the
nucleic acid sequence encoding a human .alpha..sub.1 adrenergic
receptor.
[0014] This invention provides a method for isolating a human
.alpha..sub.1 adrenergic receptor protein which comprises inducing
cells to express the human .alpha..sub.1 adrenergic receptor
protein, recovering the human .alpha..sub.1 adrenergic receptor
from the resulting cells, and purifying the human .alpha..sub.1
adrenergic receptor so recovered.
[0015] This invention provides an antibody to the human
.alpha..sub.1a adrenergic receptor. This invention also provides an
antibody to the human .alpha..sub.1b adrenergic receptor. This
invention also provides an antibody to the human .alpha..sub.1c
adrenergic receptor.
[0016] A pharmaceutical composition comprising an amount of a
substance effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1a adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this invention.
A pharmaceutical composition comprising an amount of a substance
effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1b adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this invention.
A pharmaceutical composition comprising an amount of a substance
effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1c adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this
invention.
[0017] A pharmaceutical composition comprising an amount of a
substance effective to alleviate abnormalities resulting from
underexpression of a human .alpha..sub.1a adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this invention.
A pharmaceutical composition comprising an amount of a substance
effective to alleviate abnormalities resulting from underexpression
of a human .alpha..sub.1b adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this invention.
A pharmaceutical composition comprising an amount of a substance
effective to alleviate abnormalities resulting from underexpression
of a human .alpha..sub.1c adrenergic receptor and a
pharmaceutically acceptable carrier is provided by this
invention.
[0018] This invention provides a transgenic non-human mammal whose
genome comprises a nucleic acid molecule encoding a human .alpha.1
adrenergic receptor, the DNA molecule so placed as to be
transcribed into antisense mRNA complementary to mRNA encoding a
human .alpha..sub.1 adrenergic receptor and which hybridizes to
mRNA encoding a human .alpha..sub.1 adrenergic receptor thereby
reducing its translation.
[0019] This invention provides a method for determining the
physiological effects of varying the levels of expression of a
specific human .alpha.1 adrenergic receptor which comprises
producing a transgenic non-human mammal whose levels of expression
of a human .alpha..sub.1 adrenergic receptor can be varied by use
of an inducible promoter.
[0020] This invention provides method for determining the
physiological effects of expressing varying levels of a specific
human .alpha..sub.1 adrenergic receptor which comprises producing a
panel of transgenic non-human mammals each expressing a different
amount of the human .alpha..sub.1 adrenergic receptor.
[0021] This invention provides a method for determining whether a
ligand not known to be capable of specifically binding to a human
.alpha..sub.1 adrenergic receptor can bind to a human .alpha..sub.1
adrenergic receptor, which comprises contacting a mammalian cell
comprising a plasmid adapted for expression in a mammalian cell
which further comprises a DNA molecule which expresses a human
.alpha..sub.1 adrenergic receptor on the cell surface with the
ligand under conditions permitting binding of ligands known to bind
to a human .alpha..sub.1 adrenergic receptor, detecting the
presence of any ligand bound to the human .alpha..sub.1 adrenergic
receptor, the presence of bound ligand thereby determining that the
ligand binds to the human .alpha..sub.1 adrenergic receptor.
[0022] This invention provides a method for screening drugs to
identify drugs which interact with, and specifically bind to, a
human .alpha..sub.1 adrenergic receptor on the surface of a cell,
which comprises contacting a mammalian cell which comprises a
plasmid adapted for expression in a mammalian cell which further
comprises a DNA molecule which expresses a human .alpha..sub.1
adrenergic receptor on the cell surface with a plurality of drugs,
determining those drugs which bind to the human .alpha..sub.1
adrenergic receptor expressed on the cell surface of the mammalian
cell, and thereby identifying drugs which interact with, and bind
to, the human .alpha..sub.11 adrenergic receptor.
[0023] This invention provides a method for identifying a ligand
which binds to and activates or blocks the activation of, a human
.alpha..sub.1 adrenergic receptor expressed on the surface of a
cell, which comprises contacting a mammalian cell which comprises a
plasmid adapted for expression in a mammalian cell which further
comprises a DNA molecule which expresses a human .alpha..sub.1
adrenergic receptor on the cell surface with the ligand,
determining whether the ligand binds to and activates or blocks the
activation of the receptor using a bioassay such as a second
messenger assays.
[0024] This invention also provides a method for identifying a
ligand which is capable of binding to and activating or inhibiting
a human .alpha..sub.1 adrenergic receptor, which comprises
contacting a mammalian cell, wherein the membrane lipids have been
labelled by prior incubation with a labelled lipid precursor
molecule, the mammalian cell comprising a plasmid adapted for
expression in a
[0025] mammalian cell which further comprises a DNA molecule which
expresses a human .alpha..sub.1 adrenergic receptor with the ligand
and identifying an inositol phosphate metabolite released from the
membrane lipid as a result of ligand binding to and activating an
.alpha..sub.1 adrenergic receptor.
[0026] This invention also provides a method for identifying a
ligand that is capable of binding to and activating or inhibiting a
human .alpha..sub.1 adrenergic receptor, wherein the binding of
ligand to the adrenergic receptor results in a physiological
response, which comprises contacting a mammalian cell which
comprises a plasmid adapted for expression in a mammalian cell
which further comprises a DNA molecule which expresses a human
.alpha..sub.1 adrenergic receptor with a calcium sensitive
fluorescent indicator, removing the indicator that has not been
taken up by the cell, contacting the cells with the ligand and
identifying an increase or decrease in intracellular Ca.sup.+2 as a
result of ligand binding to and activating or inhibiting
.alpha..sub.1 adrenergic receptor activity.
[0027] This invention provides a method for detecting the presence
of a human .alpha..sub.1a adrenergic receptor on the surface of a
cell, which comprises contacting the cell with an antibody to human
.alpha..sub.1a adrenergic receptor under conditions which permit
binding of the antibody to the receptor, detecting the presence of
any of the antibody bound to the human .alpha..sub.1a adrenergic
receptor and thereby the presence of a human .alpha..sub.1a
adrenergic receptor on the surface of the cell.
[0028] This invention provides a method for detecting the presence
of a human .alpha..sub.1b adrenergic receptor on the surface of a
cell, which comprises contacting the cell with an antibody to human
.alpha..sub.1b adrenergic receptor under conditions which permit
binding of the antibody to the receptor, detecting the presence of
any of the antibody bound to the human .alpha..sub.1b adrenergic
receptor and thereby the presence of a human .alpha..sub.1b
adrenergic receptor on the surface of the cell.
[0029] This invention provides a method for detecting the presence
of a human .alpha..sub.1c adrenergic receptor on the surface of a
cell, which comprises contacting the cell with an antibody to human
.alpha..sub.1c adrenergic receptor under conditions which permit
binding of the antibody to the receptor, detecting the presence of
any of the antibody bound to the human .alpha..sub.1c adrenergic
receptor and thereby the presence of a human .alpha..sub.1c
adrenergic receptor on the surface of the cell.
[0030] This invention provides a method of treating an abnormal
condition related to an excess of activity of a human .alpha..sub.1
adrenergic receptor subtype, which comprises administering an
amount of a pharmaceutical composition effective to reduce
.alpha..sub.1 adrenergic activity as a result of naturally
occurring substrate binding to and activating a specific
.alpha..sub.1 adrenergic receptor.
[0031] This invention provides a method for treating abnormalities
which are alleviated by an increase in the activity of a specific
human .alpha..sub.1 adrenergic receptor, which comprises
administering a patient an amount of a pharmaceutical composition
effective to increase the activity of the specific human
.alpha..sub.1 adrenergic receptor thereby alleviating abnormalities
resulting from abnormally low receptor activity.
[0032] This invention provides a method for diagnosing a disorder
or a predisposition to a disorder associated with the expression of
a specific human .alpha..sub.1 adrenergic receptor allele which
comprises: a.) obtaining DNA from subjects suffering from a
disorder; b.) performing a restriction digest of the DNA with a
panel of restriction enzymes; c.) electrophoretically separating
the resulting DNA fragments on a sizing gel; d.) contacting the gel
with a nucleic acid probe labelled with a detectable marker and
which hybridizes to the nucleic acid encoding a specific human
.alpha..sub.1 adrenergic receptor; e.) detecting the labelled bands
which have hybridized to the DNA encoding the specific
.alpha..sub.1 adrenergic receptor labelled with the detectable
marker to create a unique band pattern specific to the DNA of
subjects suffering with the disorder; f.) preparing DNA for
diagnosis by steps a-e; g.) comparing the unique band pattern
specific to the DNA of patients suffering from the disorder from
step e and DNA obtained for diagnosis from step f to determine
whether the patterns are the same or different and to diagnose
thereby predisposition to the disorder if the patterns are the
same.
[0033] This invention provides a method for identifying a substance
capable of alleviating the abnormalities resulting from
overexpression of a specific human .alpha..sub.1 adrenergic
receptor which comprises administering a substance to the
transgenic non-human mammal comprising the DNA encoding a specific
.alpha..sub.1 adrenergic receptor and determining whether the
substance alleviates the physical and behavioral abnormalities
displayed by the transgenic nonhuman mammal as a result of
overexpression of the human .alpha..sub.1 adrenergic receptor
subtype.
[0034] This invention provides a method for identifying a substance
capable of alleviating the abnormalities resulting from
underexpression of a human .alpha..sub.1 adrenergic receptor
subtype, which comprises administering a substance to a non-human
transgenic mammal which is expressing a human .alpha..sub.1
adrenergic receptor incapable of receptor activity or is
underexpressing the human .alpha..sub.1 adrenergic receptor
subtype, and determining whether the substance alleviates the
physical and behavioral abnormalities displayed by the transgenic
nonhuman mammal as a result of underexpression of a human
.alpha..sub.1 adrenergic receptor subtype.
[0035] This invention provides a method of treating abnormalities
in a subject, wherein the abnormality is alleviated by the reduced
expression of a human .alpha..sub.1 adrenergic receptor subtype
which comprises administering to a subject an effective amount of
the pharmaceutical composition effective to reduce expression of a
specific .alpha..sub.1 adrenergic receptor subtype.
[0036] This invention provides a method of treating abnormalities
resulting from underexpression of a human .alpha..sub.1 adrenergic
receptor which comprises administering to a subject an amount of a
pharmaceutical composition effective to alleviate abnormalities
resulting from underexpression of the specific human .alpha..sub.1
adrenergic receptor.
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIGS. 1A-I. Nucleotide Sequence and Deduced Amino Acid
Sequence of Novel Human Alpha-1a Adrenergic Receptor.
[0038] Nucleotides are presented in the 5' to 3' orientation and
the coding region is numbered starting from the initiating
methionine and ending in the termination codon. Deduced amino acid
sequence by translation of a long open reading frame is shown,
along with the 5' and 3' untranslated regions. Numbers in the left
and right margins represent nucleotide (top line) and amino acid
(bottom line) numberings, starting with the first position as the
adenosine (A) and the initiating methionine (M), respectively.
[0039] FIGS. 2A-H. Nucleotide Sequence and Deduced Amino Acid
Sequence of Novel Human Alpha-1b Adrenergic Receptor. Nucleotides
are presented in the 5' to 3' orientation and the coding region is
numbered starting from the initiating methionine and ending in the
termination codon. Deduced amino acid sequence by translation of a
long open reading frame is shown, along with the 5' and 3'
untranslated regions. Numbers in the left and right margins
represent nucleotide (top line) and amino acid (bottom line)
numberings, starting with the first position as the adenosine (A)
and the initiating methionine (M), respectively.
[0040] FIGS. 3A-G. Nucleotide Sequence and Deduced Amino Acid
Sequence of Novel Human Alpha-1c Adrenergic Receptor.
[0041] Nucleotides are presented in the 5' to 3' orientation and
the coding region is numbered starting from the initiating
methionine and ending in the termination codon. Deduced amino acid
sequence by translation of a long open reading frame is shown,
along with the 5' and 3' untranslated regions. Numbers in the left
and right margins represent nucleotide (top line) and amino acid
(bottom line) numberings, starting with the first position as the
adenosine (A) and the initiating methionine (M), respectively.
[0042] FIGS. 4A-D. Alignment of the Human Alpha-1a, H318/3
Alpha-1a, and Rat Alpha-1a Adrenergic Receptors. The deduced amino
acid sequence of the human .alpha..sub.1a receptor (first line),
from the starting methionine (M) to the stop codon (*), is aligned
with the previously published human ".alpha..sub.1a" adrenergic
receptor clone, H318/3 (2) (second line) and with the rat alphala
(12) (third line). Also shown is a consensus amino acid sequence
(fourth line), containing a hyphen at a particular position, when
all receptors have the same amino acid or an amino acid at this
position, when there is disparity in the three receptors. Dots
indicate spaces corresponding to no amino acid at this position.
Note that the human and rat .alpha..sub.1a receptors have greater
homology in the amino (positions 1-90) and carboxyl (positions
440-598) termini than do the previously published ".alpha..sub.1a"
(H318/3) and rat .alpha..sub.1a receptors (see text). Dots indicate
spaces corresponding to no amino acid at this position. Numbers
above amino acid sequences correspond to amino acid positions,
starting with the initiating methionine (M) and ending with the
termination codon (*).
[0043] FIGS. 5A-D. Alignment of the Human Alpha-1b, Hamster
Alpha-1b, and Rat Alpha-1b Adrenergic Receptors. The deduced amino
acid sequence of the human .alpha..sub.1b receptor (third line),
from the starting methionine (M) to the stop codon (*), is aligned
with the previously published rat .alpha..sub.1b adrenergic
receptor clone (25) (first line) and with the hamster alpha-1b
(4)(second line). Also shown is a consensus amino acid sequence
(fourth line), containing a hyphen at a particular position, when
all receptors have the same amino acid or an amino acid at this
position, when there is disparity in the three receptors. Dots
indicate spaces corresponding to no amino acid at this position.
Numbers above amino acid sequences correspond to amino acid
position, starting with the initiating methionine (M) and ending
with the termination codon (*).
[0044] FIGS. 6A-C. Alignment of the Human Alpha-1c and Bovine
Alpha-1c Adrenergic Receptors.
[0045] The deduced amino acid sequence of the human .alpha..sub.1c
receptor (first line), from the starting methionine (M) to the stop
codon (*), is aligned with the previously published bovine
.alpha..sub.1b adrenergic receptor clone (13) (first line). Also
shown is a consensus amino acid sequence (third line), containing a
hyphen at a particular position, when all receptors have the same
amino acid or an amino acid at this position, when there is
disparity in the three receptors. Dots indicate spaces
corresponding to no amino acid at this position. Numbers above
amino acid sequences correspond to amino acid position, starting
with the initiating methionine (M) and ending with the termination
codon (*).
[0046] FIG. 7. Illustrates the correlation of inhibition constants
(pK.sub.i) for a series of .alpha..sub.1 antagonists at the cloned
human .alpha..sub.1A, .alpha..sub.1B, and .alpha..sub.1C receptors
with efficiency of blocking contraction of human prostate tissue
(pA.sub.2).
DETAILED DESCRIPTION OF THE INVENTION
[0047] This invention provides an isolated nucleic acid molecule
encoding a human .alpha..sub.1 adrenergic receptor. This invention
also provides an isolated nucleic acid molecule encoding a human
.alpha..sub.1a adrenergic receptor. This invention also provides an
isolated nucleic acid molecule encoding a human .alpha..sub.1b
adrenergic receptor. This invention also provides an isolated
nucleic acid molecule encoding a human .alpha..sub.1c adrenergic
receptor. As used herein, the term "isolated nucleic acid molecule"
means a non-naturally occurring nucleic acid molecule that is, a
molecule in a form which does not occur in nature. Examples of such
an isolated nucleic acid molecule are an RNA, cDNA, or an isolated
genomic DNA molecule encoding a human .alpha..sub.1a, human
.alpha..sub.1b or human .alpha..sub.1c adrenergic receptor. As used
herein, the term ".alpha..sub.1 receptor", ".alpha..sub.1b
receptor", or ".alpha..sub.1c receptor" means a molecule which is a
distinct member of a class of .alpha..sub.1 adrenergic receptor
molecules which under physiologic conditions, is substantially
specific for the catecholamines epinephrine and norepinephrine, is
saturable, and having high affinity for the catecholamines
epinephrine and norepinephrine. The term ".alpha..sub.1 adrenergic
receptor subtype" refers to a distinct member of the class of human
.alpha..sub.1 adrenergic receptors, which may be any one of the
human .alpha..sub.1a, .alpha..sub.1b, or .alpha..sub.1c adrenergic
receptors. The term "specific .alpha..sub.1 adrenergic receptor"
refers to a distinct member of the group or class of human
.alpha..sub.1 adrenergic receptors, which may be any one of the
human .alpha..sub.1a, .alpha..sub.1b or .alpha..sub.1c adrenergic
receptors. One embodiment of this invention is an isolated human
nucleic acid molecule encoding a human .alpha..sub.1a adrenergic
receptor. Such a molecule may have coding sequences substantially
the same as the coding sequence in FIGS. 1A-1I. The DNA molecule of
FIGS. 1A-1I encodes the sequence of the human .alpha..sub.1a
adrenergic receptor. Another, preferred embodiment is an isolated
human nucleic acid molecule encoding a human .alpha..sub.1b
adrenergic receptor. Such a molecule may have coding sequences
substantially the same as the coding sequence in FIGS. 2A-2H. The
DNA molecule of FIGS. 2A-2H encodes the sequence of the human
.alpha..sub.1b adrenergic receptor. Another, preferred embodiment
is an isolated human nucleic acid molecule encoding a human
.alpha..sub.1c adrenergic receptor. Such a molecule may have coding
sequences substantially the same as the coding sequence in FIGS.
3A-3G. The DNA molecule of FIGS. 3A-3G encodes the sequence of the
human .alpha..sub.1c adrenergic receptor. One means of isolating a
nucleic acid molecule encoding a .alpha..sub.1 adrenergic receptor
is to screen a genomic DNA or cDNA library with a natural or
artificially designed DNA probe, using methods well known in the
art. In the preferred embodiment of this invention, .alpha..sub.1
adrenergic receptors include the human .alpha..sub.1a, human
.alpha..sub.1b and human .alpha..sub.1c adrenergic receptors and
the nucleic acid molecules encoding them were isolated by screening
a human genomic DNA library and by further screening of a human
cDNA library to obtain the sequence of the entire human
.alpha..sub.1a, human .alpha..sub.1b or human .alpha..sub.1c
adrenergic receptor. To obtain a single nucleic acid molecule
encoding the entire human .alpha..sub.1a, .alpha..sub.1b or
.alpha..sub.1c adrenergic receptor two or more DNA clones encoding
portions of the same receptor were digested with DNA restriction
endonuleases and ligated together with DNA ligase in the proper
orientation using techniques known to one of skill in the art. DNA
or cDNA molecules which encode a human .alpha..sub.1a,
.alpha..sub.1b or .alpha..sub.1, adrenergic receptor are used to
obtain complementary genomic DNA, cDNA or RNA from human, mammalian
or other animal sources, or to isolate related cDNA or genomic DNA
clones by the screening of cDNA or genomic DNA libraries, by
methods described in more detail below. Transcriptional regulatory
elements from the 5' untranslated region of the isolated clone, and
other stability, processing, transcription, translation, and tissue
specificity determining regions from the 3' and 5' untranslated
regions of the isolated gene are thereby obtained.
[0048] This invention provides an isolated nucleic acid molecule
which has been so mutated as to be incapable of encoding a molecule
having normal human .alpha..sub.1 adrenergic receptor activity, and
not expressing native human .alpha..sub.1 adrenergic receptor. An
example of a mutated nucleic acid molecule provided by this
invention is an isolated nucleic acid molecule which has an
in-frame stop codon inserted into the coding sequence such that the
transcribed RNA is not translated into protein.
[0049] This invention provides a cDNA molecule encoding a human
.alpha..sub.1a adrenergic receptor, wherein the cDNA molecule has a
coding sequence substantially the same as the coding sequence shown
in FIGS. 1A-1I. This invention also provides a cDNA molecule
encoding a human .alpha..sub.1b adrenergic receptor, wherein the
cDNA molecule has a coding sequence substantially the same as the
coding sequence shown in FIGS. 2A-2H. This invention also provides
a cDNA molecule encoding a human .alpha..sub.1c adrenergic
receptor, wherein the cDNA molecule has a coding sequence
substantially the same as the coding sequence shown in FIGS. 3A-3G.
These molecules and their equivalents were obtained by the means
further described below.
[0050] This invention provides an isolated protein which is a human
.alpha..sub.1 adrenergic receptor. In one embodiment of this
invention, the protein is a human .alpha..sub.1a adrenergic
receptor having an amino acid sequence substantially similar to the
amino acid sequence shown in FIGS. 1A-1H. In another embodiment of
this invention, the protein is a human .alpha..sub.1b adrenergic
receptor having an amino acid sequence substantially similar to the
amino acid sequence shown in FIGS. 2A-2H. In another embodiment of
this invention, the protein is a human .alpha..sub.1c adrenergic
receptor having an amino acid sequence substantially similar to the
amino acid sequence shown in FIGS. 3A-3G. As used herein, the term
"isolated protein" is intended to encompass a protein molecule free
of other cellular components. One means for obtaining an isolated
human .alpha..sub.1 adrenergic receptor is to express DNA encoding
the .alpha..sub.1 adrenergic receptor in a suitable host, such as a
bacterial, yeast, or mammalian cell, using methods well known to
those skilled in the art, and recovering the human .alpha..sub.1
adrenergic receptor after it has been expressed in such a host,
again using methods well known in the art. The human .alpha..sub.1
adrenergic receptor may also be isolated from cells which express
it, in particular from cells which have been transfected with the
expression vectors described below in more detail.
[0051] This invention also provides a vector comprising an isolated
nucleic acid molecule such as DNA, RNA, or cDNA, encoding a human
.alpha..sub.1a receptor. This invention also provides a vector
comprising an isolated nucleic acid molecule such as DNA, RNA, or
cDNA, encoding a human human .alpha..sub.1b adrenergic receptor.
This invention also provides a vector comprising an isolated
nucleic acid molecule such as DNA, RNA, or cDNA, encoding a human
.alpha..sub.1c adrenergic receptor. Examples of vectors are viruses
such as bacteriophages (such as phage lambda), cosmids, plasmids
(such as pUC18, available from Pharmacia, Piscataway, N.J.), and
other recombination vectors. Nucleic acid molecules are inserted
into vector genomes by methods well known to those skilled in the
art. Examples of such plasmids are plasmids comprising cDNA having
a coding sequence substantially the same as: the coding sequence
shown in FIGS. 1A-1I, 2A-2H, and 3A-3G. Alternatively, to obtain
these vectors, insert and vector DNA can both be exposed to a
restriction enzyme to create complementary ends on both molecules
which base pair with each other and are then ligated together with
a ligase. Alternatively, linkers can be ligated to the insert DNA
which correspond to a restriction site in the vector DNA, which is
then digested with the restriction enzyme which cuts at that site.
Other means are also available.
[0052] This invention also provides vectors comprising a DNA
molecule encoding a human .alpha..sub.1a, vectors comprising a DNA
molecule encoding a human .alpha..sub.1b adrenergic receptor and
vectors comprising a DNA molecule encoding a human .alpha..sub.1c
adrenergic receptor adapted for expression in a bacterial cell, a
yeast cell, or a mammalian cell which additionally comprise the
regulatory elements necessary for expression of the DNA in the
bacterial, yeast, or mammalian cells so located relative to the DNA
encoding a human .alpha..sub.1 adrenergic receptor as to permit
expression thereof. DNA having coding sequences substantially the
same as the coding sequence shown in FIGS. 1A-1I may be inserted
into the vectors to express a human .alpha..sub.1a adrenergic
receptor. DNA having coding sequences substantially the same as the
coding sequence shown in FIGS. 2A-2H may be inserted into the
vectors to express a human .alpha..sub.1b adrenergic receptor. DNA
having coding sequences substantially the same as the coding
sequence shown in FIGS. 3A-3G may be inserted into the vectors to
express a human .alpha..sub.1c adrenergic receptor. Regulatory
elements required for expression include promoter sequences to bind
RNA polymerase and transcription initiation sequences for ribosome
binding. For example, a bacterial expression vector includes a
promoter such as the lac promoter and for transcription initiation
the Shine-Dalgarno sequence and the start codon AUG (Maniatis, et
al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982).
Similarly, a eukaryotic expression vector includes a heterologous
or homologous promoter for RNA polymerase II, a downstream
polyadenylation signal, the start codon AUG, and a termination
codon for detachment of the ribosome. Such vectors may be obtained
commercially or assembled from the sequences described by methods
well known in the art, for example the methods described above for
constructing vectors in general. Expression vectors are useful to
produce cells that express a human .alpha..sub.1 adrenergic
receptor. Certain uses for such cells are described in more detail
below.
[0053] In one embodiment of this invention a plasmid is adapted for
expression in a bacterial, yeast, or, in particular, a mammalian
cell wherein the plasmid comprises a DNA molecule encoding a human
.alpha..sub.1a adrenergic receptor, a DNA molecule encoding a human
.alpha..sub.1b adrenergic receptor or a DNA molecule encoding a
human .alpha..sub.1c adrenergic receptor and the regulatory
elements necessary for expression of the DNA in the bacterial,
yeast, or mammalian cell so located relative to the DNA encoding a
human .alpha..sub.1 adrenergic receptor as to permit expression
thereof. Suitable plasmids may include, but are not limited to
plasmids adapted for expression in a mammalian cell, e.g., pCEXV-3
derived expression vector. Examples of such plasmids adapted for
expression in a mammalian cell are plasmids comprising cDNA having
coding sequences substantially the same as the coding sequence
shown in FIGS. 1A-1I, 2A-2H, and 3A-3G and the regulatory elements
necessary for expression of the DNA in the mammalian cell. These
plasmids have been designated pcEXV-.alpha..sub.1a deposited under
ATCC Accession No. 75319, pcEXV-.alpha..sub.1b deposited under ATCC
Accession No. 75318, and pcEXV-.alpha..sub.1c deposited under ATCC
Accession No. 75317, respectively. Those skilled in the art will
readily appreciate that numerous plasmids adapted for expression in
a mammalian cell which comprise DNA encoding human .alpha..sub.1
adrenergic receptors and the regulatory elements necessary to
express such DNA in the mammalian cell may be constructed utilizing
existing plasmids and adapted as appropriate to contain the
regulatory elements necessary to express the DNA in the mammalian
cell. The plasmids may be constructed by the methods described
above for expression vectors and vectors in general, and by other
methods well known in the art.
[0054] The deposits discussed supra were made pursuant to, and in
satisfaction of, the provisions of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the
Purpose of Patent Procedure with the American Type Culture
Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852.
[0055] This invention provides a mammalian cell comprising a DNA
molecule encoding a human .alpha..sub.1 adrenergic receptor, such
as a mammalian cell comprising a plasmid adapted for expression in
a mammalian cell, which comprises a DNA molecule encoding a human
.alpha..sub.1 adrenergic receptor and the regulatory elements
necessary for expression of the DNA in the mammalian cell so
located relative to the DNA encoding a human .alpha..sub.1
adrenergic receptor as to permit expression thereof. Numerous
mammalian cells may be used as hosts, including, but not limited
to, the mouse fibroblast cell NIH3T3, CHO cells, HeLa cells,
Ltk-cells, human embryonic kidney cells, Cos cells, etc. Expression
plasmids such as that described supra may be used to transfect
mammalian cells by methods well known in the art such as calcium
phosphate precipitation, or DNA encoding these human .alpha..sub.1
adrenergic receptors may be otherwise introduced into mammalian
cells, e.g., by microinjection, to obtain mammalian cells which
comprise DNA, e.g., cDNA or a plasmid, encoding a human
.alpha..sub.1 adrenergic receptor.
[0056] This invention provides a nucleic acid probe comprising a
nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1a
adrenergic receptor, for example with a coding sequence included
within the sequence shown in FIGS. 1A-1I. This invention also
provides a nucleic acid probe comprising a nucleic acid molecule of
at least 15 nucleotides capable of specifically hybridizing with a
sequence included within the sequence of a nucleic acid molecule
encoding a human .alpha..sub.1b adrenergic receptor, for example
with a coding sequence included within the sequence shown in FIGS.
2A-2H. This invention also provides a nucleic acid probe comprising
a nucleic acid molecule of at least 15 nucleotides capable of
specifically hybridizing with a sequence included within the
sequence of a nucleic acid molecule encoding a human .alpha..sub.1c
adrenergic receptor, for example with a coding sequence included
within the sequence shown in FIGS. 3A-3G. As used herein, the
phrase "specifically hybridizing" means the ability of a nucleic
acid molecule to recognize a nucleic acid sequence complementary to
its own and to form double-helical segments through hydrogen
bonding between complementary base pairs. Nucleic acid probe
technology is well known to those skilled in the art who will
readily appreciate that such probes may vary greatly in length and
may be labeled with a detectable label, such as a radioisotope or
fluorescent dye, to facilitate detection of the probe. Detection of
nucleic acid encoding a human .alpha..sub.1 adrenergic receptor is
useful as a diagnostic test for any disease process in which levels
of expression of the corresponding human .alpha..sub.1a,
.alpha..sub.1b or .alpha..sub.1c adrenergic receptor are altered.
DNA probe molecules are produced by insertion of a DNA molecule
which encodes a human .alpha..sub.1a, human .alpha..sub.1b, or
human .alpha..sub.1c adrenergic receptor or fragments thereof into
suitable vectors, such as plasmids or bacteriophages, followed by
insertion into suitable bacterial host cells and replication and
harvesting of the DNA probes, all using methods well known in the
art. For example, the DNA may be extracted from a cell lysate using
phenol and ethanol, digested with restriction enzymes corresponding
to the insertion sites of the DNA into the vector (discussed
above), electrophoresed, and cut out of the resulting gel. Examples
of such DNA molecules are shown in FIGS. 1A-1I, 2A-2H, and 3A-3G.
The probes are useful for "in situ" hybridization or in order to
identify tissues which express this gene family, or for other
hybridization assays for the presence of these genes or their mRNA
in various biological tissues. In addition, synthesized
oligonucleotides (produced by a DNA synthesizer) complementary to
the sequence of a DNA molecule which encodes a human .alpha..sub.1a
adrenergic receptor, or complementary to the sequence of a DNA
molecule which encodes a human .alpha..sub.1b adrenergic receptor
or complementary to the sequence of a DNA molecule which encodes a
human .alpha..sub.1c adrenergic receptor are useful as probes for
these genes, for their associated mRNA, or for the isolation of
related genes by homology screening of genomic or cDNA libraries,
or by the use of amplification techniques such as the Polymerase
Chain Reaction. This invention also provides a method for detecting
expression of a human .alpha..sub.1a adrenergic receptor on the
surface of a cell by detecting the presence of mRNA coding for a
human .alpha..sub.1a adrenergic receptor. This invention also
provides a method for detecting expression of a human
.alpha..sub.1b adrenergic receptor on the surface of a cell by
detecting the presence of mRNA coding for a human .alpha..sub.1b
adrenergic receptor. This invention also provides a method for
detecting expression of a human .alpha..sub.1c adrenergic receptor
on the surface of a cell by detecting the presence of mRNA coding
for a human .alpha..sub.1c adrenergic receptor. These methods
comprise obtaining total mRNA from the cell using methods well
known in the art and contacting the mRNA so obtained with a nucleic
acid probe as described hereinabove, under hybridizing conditions,
detecting the presence of mRNA hybridized to the probe, and thereby
detecting the expression of a specific human .alpha..sub.1
adrenergic receptor by the cell. Hybridization of probes to target
nucleic acid molecules such as mRNA molecules employs techniques
well known in the art. However, in one embodiment of this
invention, nucleic acids are extracted by precipitation from lysed
cells and the mRNA is isolated from the extract using a column
which binds the poly-A tails of the mRNA molecules (Maniatis, T. et
al., Molecular Cloning; Cold Spring Harbor Laboratory, pp.197-98
(1982)). The mRNA is then exposed to radioactively labelled probe
on a nitrocellulose membrane, and the probe hybridizes to and
thereby labels complementary mRNA sequences. Binding may be
detected by autoradiography or scintillation counting. However,
other methods for performing these steps are well known to those
skilled in the art, and the discussion above is merely an
example.
[0057] This invention provides an antisense oligonucleotide having
a sequence capable of specifically binding with any sequences of an
mRNA molecule which encodes a human .alpha..sub.1a adrenergic
receptor so as to prevent translation of the human .alpha..sub.1a
adrenergic receptor. This invention also provides an antisense
oligonucleotide having a sequence capable of specifically binding
with any sequences of an mRNA molecule which encodes a human
.alpha..sub.1b adrenergic receptor so as to prevent translation of
the human .alpha..sub.1b adrenergic receptor. This invention also
provides an antisense oligonucleotide having a sequence capable of
specifically binding with any sequences of an mRNA molecule which
encodes a human .alpha..sub.1c adrenergic receptor so as to prevent
translation of the human .alpha..sub.1c adrenergic receptor. As
used herein, the phrase "specifically binding" means the ability of
an antisense oligonucleotide to recognize a nucleic acid sequence
complementary to its own and to form double-helical segments
through hydrogen bonding between complementary base pairs. The
antisense oligonucleotide may have a sequence capable of
specifically binding with any sequences of the cDNA molecules whose
sequences are shown in FIGS. 1A-1I, 2A-2H or 3A-3G. A particular
example of an antisense oligonucleotide is an antisense
oligonucleotide comprising chemical analogues of nucleotides which
are known to one of skill in the art.
[0058] This invention also provides a pharmaceutical composition
comprising an effective amount of the oligonucleotide described
above effective to reduce expression of a human .alpha..sub.1a
adrenergic receptor, by passing through a cell membrane and
specifically binding with mRNA encoding the human .alpha..sub.1a
adrenergic receptor in the cell so as to prevent its translation
and a pharmaceutically acceptable hydrophobic carrier capable of
passing through a cell membrane. This invention also provides a
pharmaceutical composition comprising an effective amount of the
oligonucleotide described above effective to reduce expression of a
human .alpha..sub.1b adrenergic receptor in the cell so as to
prevent its translation and a pharmaceutically acceptable
hydrophobic carrier capable of passing through a cell membrane.
This invention further provides a pharmaceutical composition
comprising an effective amount of the oligonucleotide described
above effective to reduce expression of a human .alpha..sub.1c
adrenergic receptor in the cell so as to prevent its translation
and a pharmaceutically acceptable hydrophobic carrier capable of
passing through a cell membrane. As used herein, the term
"pharmaceutically acceptable carrier" encompasses any of the
standard pharmaceutical carriers, such as a phosphate buffered
saline solution, water, and emulsions, such as an oil/water or
water/oil emulsion, and various types of wetting agents. The
oligonucleotide may be coupled to a substance which inactivates
mRNA, such as a ribozyme. The pharmaceutically acceptable
hydrophobic carrier capable of passing through cell membranes may
also comprise a structure which binds to a transporter specific for
a selected cell type and is thereby taken up by cells of the
selected cell type. The structure may be part of a protein known to
bind a cell-type specific transporter, for example an insulin
molecule, which would target pancreatic cells. DNA molecules having
coding sequences substantially the same as the coding sequence
shown in FIGS. 1A-1I, 2A-2H, or 3A-3G may be used as the
oligonucleotides of the pharmaceutical composition.
[0059] This invention also provides a method of treating
abnormalities which are alleviated by reduction of expression of a
human .alpha..sub.1 adrenergic receptor. This method comprises
administering to a subject an effective amount of the
pharmaceutical composition described above effective to reduce
expression of the human .alpha..sub.1 adrenergic receptor by the
subject. This invention further provides a method of treating an
abnormal condition related to .alpha..sub.1 adrenergic receptor
activity which comprises administering to a subject an amount of
the pharmaceutical composition described above effective to reduce
expression of the human .alpha..sub.1 adrenergic receptor by the
subject. Examples of such an abnormal condition include but are not
limited to benign prostatic hypertrophy, coronary heart disease,
hypertension, urinary retention, insulin resistance,
atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac
arrythymias erectile dysfunction, and Renaud's syndrome.
[0060] Antisense oligonucleotide drugs inhibit translation of mRNA
encoding the human .alpha..sub.1a, human .alpha..sub.1b or human
.alpha..sub.1c adrenergic receptors. Synthetic antisense
oligonucleotides, or other antisense chemical structures are
designed to bind to mRNA encoding the human .alpha..sub.1a
adrenergic receptor, to mRNA encoding the human .alpha..sub.1b
adrenergic receptor or to mRNA encoding the human .alpha..sub.1c
adrenergic receptor and inhibit translation of mRNA and are useful
as drugs to inhibit expression of the human .alpha..sub.1a
adrenergic receptor, the human .alpha..sub.1b adrenergic receptor
or the human .alpha..sub.1c adrenergic receptor in patients. This
invention provides a means to therapeutically alter levels of
expression of the human .alpha..sub.1a adrenergic receptor, the
human .alpha..sub.1b adrenergic receptor or the human
.alpha..sub.1a adrenergic receptor by the of a synthetic antisense
oligonucleotide drug (SAOD) which inhibits translation of mRNA
encoding these .alpha..sub.1 adrenergic receptors. Synthetic
antisense oligonucleotides, or other antisense chemical structures
designed to recognize and selectively bind to mRNA, are constructed
to be complementary to portions of the nucleotide sequences shown
in FIGS. 1A-1I, 2A-2H, or 3A-3G of DNA, RNA or of chemically
modified, artificial nucleic acids. The SAOD is designed to be
stable in the blood stream for administration to patients by
injection, or in laboratory cell culture conditions, for
administration to cells removed from the patient. The SAOD is
designed to be capable of passing through cell membranes in order
to enter the cytoplasm of the cell by virtue of physical nd
chemical properties of the SAOD which render it capable of passing
through cell membranes (e.g., by designing small, hydrophobic SAOD
chemical structures) or by virtue of specific transport systems in
the cell which recognize and transport the SAOD into the cell. In
addition, the SAOD can be designed for administration only to
certain selected cell populations by targeting the SAOD to be
recognized by specific cellular uptake mechanisms which bind and
take up the SAOD only within certain selected cell populations. For
example, the SAOD may be designed to bind to a transporter found
only in a certain cell type, as discussed above. The SAOD is also
designed to recognize and selectively bind to the target mRNA
sequence, which may correspond to a sequence contained within the
sequences shown in FIGS. 1A01I, 2A-2H, or 3A-3G by virtue of
complementary base pairing to the mRNA. Finally, the SAOD is
designed to inactivate the target mRNA sequence by any of three
mechanisms: 2) by binding to the target mRNA and thus inducing
degradation of the mRNA by intrinsic cellular mechanisms such as
mRNA target by interfering with the binding of
translation-regulating factors or of other chemical structures,
such as ribozyme sequences or reactive chemical groups. which
either degrade or chemically modify the target mRNA. Synthetic
antisense oligonucleotide drugs have been shown to be capable of
the properties described above when directed against mRNA targets
(J. S. Cohen, Trends in Pharm. Sci 10, 435 (1989); H. M. Weintraub,
Sci. AM. January (1990) p. 40). In addition, coupling of ribozymes
to antisense oligonucleotides is a promising strategy for
inactivating target mRNA (N. Sarver et al., Science 247, 1222
(1990)). An SAOD serves as an effective therapeutic agent if it is
designed to be administered to a patient by injection, or if the
patient's target cells are removed, treated with the SAOD in the
laboratory, and replaced in the patient. In this manner, an SAOD
serves as a therapy to reduce human .alpha..sub.1 adrenergic
receptor expression in particular target cells of a patient, in any
clinical condition which may benefit from reduced expression of a
specific human .alpha..sub.1 adrenergic receptor.
[0061] This invention provides an antibody directed to a human
.alpha..sub.1a adrenergic receptor. This antibody may comprise, for
example, a monoclonal antibody directed to an epitope of a human
.alpha..sub.1a adrenergic receptor present on the surface of a
cell, the epitope having an amino acid sequence substantially the
same as an amino acid sequence for a cell surface epitope of the
human .alpha..sub.1a adrenergic receptor included in the amino acid
sequence shown in FIGS. 1A-1I. This invention also provides an
antibody directed to a human .alpha..sub.1b adrenergic receptor.
This antibody may comprise, for example, a monoclonal antibody
directed to an epitope of a human .alpha..sub.1b adrenergic
receptor present on the surface of a cell, the epitope having an
amino acid sequence substantially the same as an amino acid
sequence for a cell surface epitope of the human .alpha..sub.1b
adrenergic receptor included in the amino acid sequence shown in
FIGS. 2A-2H. This invention also provides an antibody directed to a
human .alpha..sub.1c adrenergic receptor. This antibody may
comprise, for example, a monoclonal antibody directed to an epitope
of a human .alpha..sub.1c adrenergic receptor present on the
surface of a cell, the epitope having an amino acid sequence
substantially the same as an amino acid sequence for a cell surface
epitope of the human .alpha..sub.1c adrenergic receptor included in
the amino acid sequence shown in FIGS. 3A-3G. Amino acid sequences
may be analyzed by methods well known to those skilled in the art
to determine whether they produce hydrophobic or hydrophilic
regions in the proteins which they build. In the case of cell
membrane proteins, hydrophobic regions are well known to form the
part of the protein that is inserted into the lipid bilayer which
forms the cell membrane, while hydrophilic regions are located on
the cell surface, in an aqueous environment. Therefore antibodies
to the hydrophilic amino acid sequences shown in FIGS. 1A-1I will
bind to a surface epitope of the human .alpha..sub.1a adrenergic
receptor, antibodies to the hydrophilic amino acid sequences shown
in FIGS. 2A-2H will bind to a surface epitope of a human
.alpha..sub.1b adrenergic receptor, and antibodies to the
hydrophilic amino acid sequences shown in FIGS. 3A-3G will bind to
a surface epitope of a human .alpha..sub.1c adrenergic receptor as
described. Antibodies directed to human .alpha..sub.1 adrenergic
receptors may be serum-derived or monoclonal and are prepared using
methods well known in the art. For example, monoclonal antibodies
are prepared using hybridoma technology by fusing antibody
producing B cells from immunized animals with myeloma cells and
selecting the resulting hybridoma cell line producing the desired
antibody. Cells such as NIH3T3 cells or Ltk.sup.- cells may be used
as immunogens to raise such an antibody. Alternatively, synthetic
peptides may be prepared using commercially available machines and
the amino acid sequence shown in FIGS. 1A-1I, 2A-2H, and 3A-3G. As
a still further alternative DNA, such as a cDNA or a fragment
thereof, may be cloned and expressed and the resulting polypeptide
recovered and used as an immunogen. These antibodies are useful to
detect the presence of human .alpha..sub.1 adrenergic receptors
encoded by the isolated DNA, or to inhibit the function of
.alpha..sub.1 adrenergic receptors in living animals, in humans, or
in biological tissues or fluids isolated from animals or
humans.
[0062] This invention provides a pharmaceutical composition which
comprises an effective amount of an antibody directed to an epitope
of a human .alpha..sub.1a adrenergic receptor and a
pharmaceutically acceptable carrier. A monoclonal antibody directed
to an epitope of a human .alpha..sub.1a adrenergic receptor present
on the surface of a cell which has an amino acid sequence
substantially the same as an amino acid sequence for a cell surface
epitope of the human .alpha..sub.1a adrenergic receptor present on
the surface of a cell which has an amino acid sequence
substantially the same as an amino acid sequence for a cell surface
epitope of the human .alpha..sub.1a adrenergic receptor included in
the amino acid sequence shown in FIGS. 1A-1I is useful for this
purpose. This invention also provides a pharmaceutical composition
which comprises an effective amount of an antibody directed to an
epitope of a human .alpha..sub.1b adrenergic receptor, effective to
block binding of naturally occurring substrates to the human
.alpha..sub.1b adrenergic receptor and a pharmaceutically
acceptable carrier. A monoclonal antibody directed to an epitope of
a human .alpha..sub.1b adrenergic receptor present on the surface
of a cell which has an amino acid sequence substantially the same
as an amino acid sequence for a cell surface epitope of the human
.alpha..sub.1b adrenergic receptor included in the amino acid
sequence shown in FIGS. 2A-2H is useful for this purpose. This
invention provides a pharmaceutical composition which comprises an
effective amount of an antibody directed to an epitope of a human
.alpha..sub.1c adrenergic receptor effective to block binding of
naturally occurring substrates to the human .alpha..sub.1c
adrenergic receptor and a pharmaceutically acceptable carrier. A
monoclonal antibody directed to an epitope of a human
.alpha..sub.1c adrenergic receptor present on the surface of the
cell which has an amino acid sequence substantially the same as an
amino acid sequence for a cell surface epitope of the human
.alpha..sub.1c adrenergic receptor included in the amino acid
sequence shown in FIGS. 3A-3G is useful for this purpose.
[0063] This invention also provides a method of treating
abnormalities in a subject which are alleviated by reduction of
expression of a specific human .alpha..sub.1 adrenergic receptor.
The method comprises administering to the subject an effective
amount of the pharmaceutical composition described above effective
to block binding of naturally occurring substrates to the human
.alpha..sub.1 adrenergic receptor and thereby alleviate
abnormalities resulting from overexpression of the human
.alpha..sub.1 adrenergic receptor. Binding of the antibody to the
human .alpha..sub.1 adrenergic receptor from functioning, thereby
neutralizing the effects of overexpression. The monoclonal
antibodies described above are useful for this purpose. This
invention additionally provides a method of treating an abnormal
condition related to an excess of a specific human .alpha..sub.1
adrenergic receptor activity which comprises administering to a
subject an amount of the pharmaceutical composition described above
effective to block binding of naturally occurring substrates to the
human .alpha..sub.1 adrenergic receptor and thereby alleviate the
abnormal condition. Examples of such an abnormal condition include
but are not limited to benign prostatic hypertrophy, coronary heart
disease, insulin resistance, atherosclerosis, sympathetic dystrophy
syndrome, glaucoma, cardiac arrythymias, hypertension, urinary
retention, erectile dysfunction, and Renaud's syndrome.
[0064] This invention provides methods of detecting the presence of
a specific human .alpha..sub.1 adrenergic receptor on the surface
of a cell which comprises contacting the cell with an antibody
directed to a specific human .alpha..sub.1 adrenergic receptor,
under conditions permitting binding of the antibody to the human
.alpha..sub.1 adrenergic receptor, under conditions permitting
binding of the antibody to the human .alpha..sub.1 adrenergic
receptor, detecting the presence of any antibody bound to the
.alpha..sub.1 adrenergic receptor, and thereby the presence of the
specific human .alpha.1 adrenergic receptor on the surface of the
cell. Such methods are useful for determining whether a given cell
is defective in expression of a specific human .alpha.1 adrenergic
receptor. Bound antibodies are detected by methods well known in
the art, for example by binding fluorescent markers to the
antibodies and examining the cell sample under a fluorescence
microscope to detect fluorescence on a cell indicative of antibody
binding. The monoclonal antibodies described above are useful for
this purpose.
[0065] This invention provides a transgenic nonhuman mammal
comprising DNA encoding DNA encoding a human .alpha..sub.1a
adrenergic receptor. This invention also provides a transgenic
nonhuman mammal comprising DNA encoding a human .alpha..sub.1b
adrenergic receptor. This invention also provides a transgenic
nonhuman mammal comprising DNA encoding a human .alpha..sub.1c
adrenergic receptor.
[0066] This invention also provides a transgenic nonhuman mammal
comprising DNA encoding a human .alpha..sub.1a adrenergic receptor
so mutated as to be incapable of normal human .alpha..sub.1a
adrenergic receptor activity, and not expressing native human
.alpha..sub.1a adrenergic receptor activity, and not expressing
native human .alpha..sub.1a adrenergic receptor. This invention
also provides a transgenic nonhuman mammal comprising DNA encoding
a human .alpha..sub.1b adrenergic receptor so mutated as to be
incapable of normal human .alpha..sub.1b adrenergic receptor
activity, and not expressing native human .alpha..sub.1b adrenergic
receptor. This invention also provides a transgenic nonhuman mammal
comprising DNA encoding a human .alpha..sub.1c adrenergic receptor
so mutated as to be incapable of normal human .alpha..sub.1c
adrenergic receptor activity, and not expressing native human
.alpha..sub.1c adrenergic receptor.
[0067] This invention provides a transgenic non-human animal whose
genome comprises DNA encoding a human .alpha..sub.1a adrenergic
receptor so placed as to be transcribed into antisense mRNA which
is complementary to mRNA encoding a human .alpha..sub.1a adrenergic
receptor thereby reducing its translation. This invention also
provides a transgenic nonhuman mammal whose genome comprises DNA
encoding a human .alpha..sub.1b adrenergic receptor so placed as to
be transcribed into antisense mRNA which is complementary to mRNA
encoding the human .alpha..sub.1b adrenergic receptor and which
hybridizes to mRNA encoding a human .alpha..sub.1b adrenergic
receptor thereby reducing its translation. This invention provides
a transgenic non-human animal whose genome comprises DNA encoding a
human .alpha..sub.1c adrenergic receptor so placed as to be
transcribed into antisense mRNA which is complementary to mRNA
encoding a human .alpha..sub.1c adrenergic receptor and which
hybridizes to mRNA encoding the human .alpha..sub.1c adrenergic
receptor thereby reducing its translation. The DNA may additionally
comprise an inducible promoter or additionally comprise tissue
specific regulatory elements, so that expression can be induced, or
restricted to specific cell types. Examples of DNA are DNA or cDNA
molecules having a coding sequence substantially the same as the
coding sequences shown in FIGS. 1A-1I, 2A-2H, or 3A-3G. An example
of a transgenic animal is a transgenic mouse. Examples of tissue
specificity-determining regions are the metallothionein promoter
(Low, M. J., Lechan, R. M., Hammer, R. E. et al. Science
231:1002-1004 (1986) and the L7 promoter (Oberdick, J., Smeyne, R.
J., Mann, J. R., Jackson, S. and Morgan, J. I. Science 248:223-226
(1990)).
[0068] Animal model systems which elucidate the physiological and
behavioral roles of human .alpha..sub.1 adrenergic receptors are
produced by creating transgenic animals in which the increased or
decreased, or the amino acid sequence of the expressed
.alpha..sub.1 adrenergic receptor is altered, by a variety of
techniques. Examples of these techniques include, but are not
limited to: 1) Insertion of normal or mutant versions of DNA
encoding a human .alpha..sub.1 adrenergic receptor or homologous
animal versions of these genes, by microinjection, retroviral
infection or other means well known to those skilled in the art,
into appropriate fertilized embryos in order to produce a
transgenic animal (Hogan B et al., Manipulating the Mouse Embryo, A
Laboratory Manual, Cold Spring Harbor Laboratory (1986)) or, 2)
Homologous recombination (Capecchi M. R. Science 244:1288-1292
(1989); Zimmer, A. and Gruss, P. Nature 338:150-153 (1989)) of
mutant or normal, human or animal version of the genes encoding
.alpha.1 adrenergic receptors with the native gene locus in
transgenic animals to alter the regulation of expression or the
structure .alpha.1 of these .alpha.1 adrenergic receptors. The
technique of homologous .alpha.1 adrenergic receptors. The
technique of homologous recombination is well known in the art. It
replaces the native gene with the inserted gene and so is useful
for producing an animal that cannot express native .alpha..sub.1
adrenergic receptor but does express, for example an inserted
mutant human .alpha..sub.1 adrenergic receptor, which has replaced
the native .alpha..sub.1 adrenergic receptor in the animal's genome
by recombination, resulting in underexpression of the .alpha..sub.1
adrenergic receptor. Microinjection adds genes to the genome, but
does not remove them, and so is useful for producing an animal
which expresses its own and added .alpha..sub.1 adrenergic
receptors, resulting in overexpression of the .alpha..sub.1
adrenergic receptor.
[0069] One means available for producing a transgenic animal, with
a mouse as an example, is as follows: Female mice are mated, and
the resulting fertilized eggs are dissected out of their oviducts.
The eggs are stored in an appropriate medium such as M2 medium
(Hogan B et al., Manipulating the Mouse Embryo, A Laboratory
Manual, Cold Spring Harbor Laboratory (1986)). DNA or cDNA encoding
a human .alpha..sub.1 adrenergic receptor is purified from a vector
(such as plasmids pCEXV-.alpha..sub.1b, or pCEXV-.alpha..sub.1c
described above) by methods well known in the art. Inducible
promoters may be fused with the coding region of the DNA to provide
an experimental means to regulate expression of the trans-gene.
Alternatively or in addition, tissue specific regulatory elements
may be fused with the coding region to permit tissue-specific
expression of the trans-gene. The DNA, in an appropriately buffered
solution, is put into a microinjection needle (which may be made
from capillary tubing using a pipet puller) and the egg to be
injected is put in a depression slide. The needle is inserted into
the pronucleus of the egg, and the DNA solution is injected. The
injected egg is then transferred into the oviduct of a
pseudopregnant mouse (a mouse stimulated by the appropriate
hormones to maintain pregnancy but which is not actually pregnant),
where it proceeds to the uterus, implants, and develops to term. As
noted above, microinjection is not the only method for inserting
DNA into the egg cell, and is used here only for exemplary
purposes.
[0070] Since the normal action of .alpha..sub.1 adrenergic-specific
drugs is to activate or to inhibit the .alpha..sub.1 adrenergic
receptor, the transgenic animal model systems described above are
useful for testing the biological activity of drugs directed
against specific human .alpha..sub.1 adrenergic receptors even
before such drugs become available. These animal model systems are
useful for predicting or evaluating possible therapeutic
applications of drugs which activate or inhibit these human
.alpha..sub.1 adrenergic receptors by inducing or inhibiting
expression of the native or transgene and thus increasing or
decreasing expression of normal or mutant human .alpha..sub.1
adrenergic receptor in the living animal. Thus, a model system is
produced in which the biological activity of drugs directed against
these human .alpha..sub.1 adrenergic receptors are evaluated before
such drugs become available. The transgenic animals which over or
under produce a specific human .alpha..sub.1 adrenergic over or
under produce a specific human .alpha..sub.1 adrenergic over or
under produce a specific human .alpha..sub.1 adrenergic receptor
indicate by their physiological state whether over or under
production of the human .alpha..sub.1 adrenergic receptor is
therapeutically useful. It is therefore useful to evaluate drug
action based on the transgenic model system. One use is based on
the fact that it is well known in the art that a drug such as an
antidepressant acts by blocking neurotransmitter uptake, and
thereby increases the amount of neurotransmitter in the synaptic
cleft. The physiological result of this action is to stimulate the
production of less human .alpha..sub.1 adrenergic receptor by the
affected cells, leading eventually to underexpression. Therefore,
an animal which underexpresses human .alpha..sub.1 adrenergic
receptor is useful as a test system to investigate whether the
actions of such drugs which result in under expression are in fact
therapeutic. Another use is that if overexpression is found to lead
abnormalities, then a drug which down-regulates or acts as an
antagonist to the human .alpha..sub.1 adrenergic receptor is
indicated as worth developing, and if a promising therapeutic
application is uncovered by these animal model systems, activation
or inhibition of the specific human .alpha..sub.1 adrenergic
receptor or antagonist drugs directed against these human
.alpha..sub.1 adrenergic receptors or by any method which increases
or decreases the expression of these .alpha..sub.1 adrenergic
receptors in man.
[0071] Further provided by this invention is a method of
determining the physiological effects of expressing varying levels
of a human .alpha..sub.1 adrenergic receptor which comprises
producing a transgenic nonhuman animal whose levels of
.alpha..sub.1 adrenergic receptor expression are varied by use of
an inducible promoter which regulates human .alpha..sub.1
adrenergic receptor expression. This invention also provides a
method for determining the physiological effects of expressing
varying levels of human .alpha..sub.1 adrenergic receptors which
comprise producing a panel of transgenic nonhuman animals each
expressing a different amount of a human .alpha..sub.1 adrenergic
receptor. Such animals may be produced by introducing different
amounts of DNA encoding a human .alpha..sub.1 adrenergic receptor
into the oocytes from which the transgenic animals are
developed.
[0072] This invention also provides a method for identifying a
substance capable of alleviating abnormalities resulting from
overexpression of a human .alpha..sub.1 adrenergic receptor
comprising administering the substance to a transgenic nonhuman
mammal expressing at least one artificially introduced DNA molecule
encoding a human .alpha..sub.1 adrenergic receptor and determining
whether the substance alleviates the physical and behavioral
abnormalities displayed by the transgenic nonhuman mammal as a
result of overexpression of a human .alpha..sub.1 adrenergic
receptor. As used herein, the term "substance" means a compound or
composition which may be natural, synthetic, or a product derived
from screening. Examples of DNA molecules are DNA or cDNA molecules
having a coding sequence substantially the same as the coding
sequences shown in FIGS. 1A-1I, 2A-2H, or 3A-3G.
[0073] This invention provides a pharmaceutical composition
comprising an amount of the substance described supra effective to
alleviate the abnormalities resulting from overexpression of a
human .alpha..sub.1a adrenergic receptor and a pharmaceutically
acceptable carrier. This invention provides a pharmaceutical
composition comprising an amount of the substance described supra
effective to alleviate the abnormalities resulting from
overexpression of a human .alpha..sub.1b adrenergic receptor and a
pharmaceutically acceptable carrier. This invention also provides a
pharmaceutical composition comprising an amount of the substance
described supra effective to alleviate the abnormalities resulting
from overexpression of a human .alpha..sub.1c adrenergic receptor
and a pharmaceutically acceptable carrier.
[0074] This invention further provides a method for treating the
abnormalities resulting from overexpression of a human
.alpha..sub.1 adrenergic receptor which comprises administering to
a subject an amount of the pharmaceutical composition described
above effective to alleviate the abnormalities resulting from
overexpression of the human .alpha..sub.1 adrenergic receptor.
[0075] This invention provides a method for identifying a substance
capable of alleviating the abnormalities resulting from
underexpression of a human .alpha..sub.1 adrenergic receptor
comprising administering the substance to the transgenic nonhuman
mammal described above which expresses only a nonfunctional human
.alpha..sub.1 adrenergic receptor and determining whether the
substance alleviates the physical and behavioral abnormalities
displayed by the transgenic nonhuman mammal as a result of
underexpression of the human .alpha..sub.1 adrenergic receptor.
[0076] This invention also provides a pharmaceutical composition
comprising an amount of a substance effective to alleviate
abnormalities resulting from underexpression of a human
.alpha..sub.1 adrenergic receptor and a pharmaceutically acceptable
carrier.
[0077] This invention also provides a method for treating the
abnormalities resulting from underexpression of a human
.alpha..sub.1 adrenergic receptor which comprises administering to
a subject an amount of the pharmaceutical composition described
above effective to alleviate the abnormalities resulting from
underexpression of a human .alpha..sub.1 adrenergic receptor.
[0078] This invention provides a method for diagnosing a
predisposition to a disorder associated with the expression of a
specific human .alpha..sub.1 adrenergic receptor allele which
comprises: a) obtaining DNA of subjects suffering from the
disorder; b) performing a restriction digest of the DNA with a
panel of restriction enzymes; c) electrophoretically separating the
resulting DNA fragments on a sizing gel; d) contacting the
resulting gel with a nucleic acid probe capable of specifically
hybridizing to DNA encoding a human .alpha..sub.1 adrenergic
receptor and labelled bands which have hybridized to the DNA
encoding a human .alpha..sup.1 adrenergic receptor labelled with a
detectable marker to create a unique band pattern specific to the
DNA of subjects suffering from the disorder; f) preparing DNA
obtained for diagnosis by steps a-e; and g) comparing the unique
band pattern specific to the DNA of subjects suffering from the
disorder from step e and the DNA obtained for diagnosis from step f
to determine whether the patterns are the same or different and
thereby to diagnose predisposition to the disorder if the patterns
are the same. This method may also be used to diagnose a disorder
associated with the expression of a specific human .alpha..sub.1
adrenergic receptor allele.
[0079] This invention provides a method of preparing an isolated
human .alpha..sub.1 adrenergic receptor which comprises inducing
cells to express the human .alpha..sub.1 adrenergic receptor,
recovering the .alpha..sub.1 adrenergic receptor from the resulting
cells, and purifying the .alpha..sub.1 adrenergic receptor so
recovered. An example of an isolated human .alpha..sub.1a
adrenergic receptor is an isolated protein having substantially the
same amino acid sequence as the amino acid sequence shown in FIGS.
1A-1I. An example of an isolated human .alpha..sub.1b adrenergic
receptor is an isolated protein having substantially the same amino
acid sequence as the amino acid sequence shown in FIGS. 1A-1I. An
example of an isolated human .alpha..sub.1b adrenergic receptor is
an isolated protein having substantially the same amino acid
sequence shown in FIGS. 2A-2H. An example of an isolated human
.alpha..sub.1c adrenergic receptor is an isolated protein having
substantially the same amino acid sequence shown in FIGS. 3A-3G.
For example, cells can be induced to express human .alpha..sub.1
adrenergic receptor by exposure to substances such as hormones. The
cells can then be homogenized and the human .alpha..sub.1
adrenergic receptor isolated from the homogenate using an affinity
column comprising, for example, epinephrine, norepinephrine, or
another substance which is known to bind to the human .alpha..sub.1
adrenergic receptor. The resulting fractions can then be purified
by contacting them with an ion exchange column, and determining
which fraction contains human .alpha..sub.1 adrenergic receptor
activity or binds anti-human .alpha..sub.1 adrenergic receptor
activity or binds anti-human .alpha.1 adrenergic receptor
antibodies.
[0080] This invention provides a method of preparing the isolated
human .alpha..sub.1a adrenergic receptor which comprises inserting
nucleic acid encoding the human .alpha..sub.1a adrenergic receptor
in a suitable vector, inserting the resulting vector in a suitable
host cell, recovering the .alpha..sub.1a adrenergic receptor
produced by the resulting cell, and purifying the .alpha..sub.1a
adrenergic receptor so recovered. An example of an isolated human
.alpha..sub.1a adrenergic receptor is an isolated protein having
substantially the same amino acid sequence as the amino acid
sequence shown in FIGS. 1A-1I. This invention also provides a
method of preparing the isolated human .alpha..sub.1b adrenergic
receptor which comprises inserting nucleic acid encoding the human
.alpha..sub.1b adrenergic receptor in a suitable vector, inserting
the resulting vector in a suitable host, recovering the
.alpha..sub.1b adrenergic receptor produced by the resulting cell,
and purifying the .alpha..sub.1c adrenergic receptor so recovered.
These methods for preparing human .alpha..sub.1 adrenergic receptor
uses recombinant DNA technology methods well known in the art. For
example, isolated nucleic acid encoding a human .alpha..sub.1
adrenergic receptor is inserted in a suitable vector, such as an
expression vector. A suitable host cell, such as a bacterial cell,
or a eukaryotic cell such as a yeast cell is transfected with the
vector. The human .alpha..sub.1 adrenergic receptor is isolated
from the culture medium by affinity purification or by
chromatography or by other methods well known in the art.
[0081] This invention provides a method of determining whether a
ligand not known to be capable of binding to a human .alpha..sub.1
adrenergic receptor can bind to a human .alpha..sub.1 adrenergic
receptor, which comprises contacting a mammalian cell comprising a
plasmid adapted for expression in a mammalian cell which further
comprises a DNA molecule which expresses a human .alpha..sub.1
adrenergic receptor on the cell surface with the ligand under
conditions permitting binding of ligands known to bind to the human
.alpha..sub.1 adrenergic receptor, detecting the presence of any
ligand bound to the human .alpha..sub.1 adrenergic receptor. The
DNA in the cell may have a coding sequence substantially the same
as the coding sequences shown in FIGS. 1A-1I, 2A-2h, or 3A-3G,
preferably, the mammalian cell is normeuronal in origin. An example
of a normeuronal mammalian cell is a Cos7 cell. The preferred
method for determining whether a ligand is capable of binding to
the human .alpha..sub.1 adrenergic receptor comprises contacting a
transfected normeuronal mammalian cell (i.e. a cell that does not
naturally express any type of human .alpha..sub.1 adrenergic
receptor, thus will only express such human .alpha..sub.1
adrenergic receptor if it is transfected into the cell) expressing
a human .alpha..sub.1 adrenergic receptor on it surface, or
contacting a membrane preparation derived from such a transfected
cell, with the ligand under conditions which are known to prevail,
and thus be associated with in vivo binding of the substrates to a
human .alpha..sub.1 adrenergic receptor, detecting the presence of
any of the ligand being tested bound to the human .alpha..sub.1
adrenergic receptor on the surface of the cell, and thereby
determining whether the ligand binds to the human .alpha..sub.1
adrenergic receptor. This response system is obtained by
transfection of isolated DNA into a suitable host cell. Such a host
system might be isolated from pre-existing cell lines, or can be
generated by inserting appropriate components into existing cell
lines. Such a transfection system provides a complete response
system for investigation or assay of the functional activity of
human .alpha..sub.1 adrenergic receptors with ligands as described
above. Transfection systems are useful as living cell cultures for
competitive binding assays between known or candidate drugs and
substrates which bind to the human .alpha..sub.1 adrenergic
receptor and which are labeled by radioactive, spectroscopic or
other reagents. Membrane preparations containing the transporter
isolated from transfected cells are also useful for these
competitive binding assays. A transfection system constitutes a
"drug discovery system" useful for the identification of natural or
synthetic compounds with potential for drug development that can be
further modified or used directly as therapeutic compounds to
activate or inhibit the natural functions of a specific human
.alpha..sub.1 adrenergic receptor. The transfection system is also
useful for determining the affinity and efficacy of known drugs at
human .alpha..sub.1 adrenergic receptor binding sites.
[0082] This invention provides a method for identifying a ligand
which interacts with, and activates or blocks the activation of, a
human .alpha..sub.1 adrenergic receptor on the surface of the cell,
which comprises contacting a mammalian cell which comprises a
plasmid adapted for expression in a mammalian cell which further
comprises a DNA molecule which expresses a human .alpha..sub.1
adrenergic receptor on the cell surface with the ligand,
determining whether the ligand activates or blocks the activation
of the receptor using a bioassay such as a second messenger assays,
and thereby identifying a ligand which interacts with, and
activates or blocks the activation of, a human .alpha..sub.1
adrenergic receptor.
[0083] This invention provides functional assays for identifying
ligands and drugs which bind to and activate or inhibit a specific
human .alpha..sub.1 adrenergic receptor activity.
[0084] This invention provides a method for identifying a ligand
which is capable of binding to and activating or inhibiting a human
.alpha..sub.1 adrenergic receptor, which comprises contacting a
mammalian cell, wherein the membrane lipids have been labelled by
prior incubation with a labelled myo-inositol phosphate molecule,
the mammalian cell comprising a plasmid adapted for expression in a
mammalian cell which further comprises a DNA molecule which
expresses a human .alpha..sub.1 adrenergic receptor with the ligand
and identifying an inositol phosphate metabolite released from the
membrane lipid as a result of ligand binding to and activating an
.alpha..sub.1 adrenergic receptor.
[0085] This invention provides method for identifying a ligand that
is capable of binding to and activating or inhibiting a human
.alpha..sub.1 adrenergic receptor, where in the binding of ligand
to the adrenergic receptor results in a physiological response,
which comprises contacting a mammalian cell which further comprises
a DNA molecule which expresses a human .alpha..sub.1 adrenergic
receptor with a calcium sensitive fluorescent indicator, removing
the indicator that has not been taken up by the cell, contacting
the cells with the ligand and identifying an increase or decrease
in intracellular Ca.sup.+2 as a result of ligand binding to and
activating receptors.
[0086] Transformed mammalian cells for identifying the ligands and
drugs that affect the functional properties of the human .alpha.
adrenergic receptor include 292-.alpha.1.alpha.-10, C-.alpha.1b-6
and C-.alpha.1c-7.
[0087] This invention also provides a method of screening drugs to
identify drugs which interact with, and bind to, a human
.alpha..sub.1 adrenergic receptor on the surface of a cell, which
comprises contacting a mammalian cell which comprises a plasmid
adapted for expression in a mammalian cell which further comprises
a DNA molecule which expresses a human .alpha..sub.1 adrenergic
receptor on the cell surface with a plurality of drugs, determining
those drugs which bind to the human .alpha..sub.1 adrenergic
receptor expressed on the cell surface of the mammalian cell, and
thereby identifying drugs which interact with, and bind to, the
human .alpha..sub.1 adrenergic receptor. Various methods of
detection may be employed. The drugs may be "labeled" by
association with a detectable marker substance (e.g., radiolabel or
a non-isotopic label such as biotin). The DNA in the cell may have
a coding sequence substantially the same as the coding sequences
shown in FIGS. 1A-1I, 2A-2H or 3A-3G. Preferably, the mammalian
cell is normeuronal in origin. An example of a normeuronal
mammalian cell is a Cos7 cell. Drug candidates are identified by
choosing chemical compounds which bind with high affinity to the
human .alpha..sub.1 adrenergic receptor expressed on the cell
surface in transfected cells, using radioligand binding methods
well known in the art, examples of which are shown in the binding
assays described herein. Drug candidates are also screened for
selectivity by identifying compounds which bind with high affinity
to one particular human .alpha..sub.1 adrenergic receptor subtype
but do not bind with high affinity to any other human .alpha..sub.1
adrenergic receptor subtype or to any other known receptor site.
Because selective, high affinity compounds interact primarily with
the target human .alpha..sub.1 adrenergic site after administration
to the patient, the chances of producing a drug with unwanted side
effects are minimized by this approach. This invention provides a
pharmaceutical composition comprising a drug identified by the
method described above and a pharmaceutically acceptable carrier.
As used herein, the term "pharmaceutically acceptable carrier"
encompasses any of the standard pharmaceutical carriers, such as a
phosphate buffered saline solution, water, and emulsions, such as
an oil/water or water/oil emulsion, and various types of wetting
agents. Once the candidate drug has been shown to be adequately
bio-available following a particular route of administration, for
example orally or by injection (adequate therapeutic concentrations
must be maintained at the site of action for an adequate period to
gain the desired therapeutic benefit), and has been shown to be
non-toxic and therapeutically effective in appropriate disease
models, the drug may be administered to patients by that route of
administration determined to make the drug bio-available, in an
appropriate solid or solution formulation, to gain the desired
therapeutic benefit.
[0088] This invention also provides a method for treating an
abnormal condition related to an excess of activity of a human
.alpha..sub.1 adrenergic receptor subtype, which comprises
administering a patient an amount of a pharmaceutical composition
described above, effective to reduce .alpha..sub.1 adrenergic
activity as a result of naturally occurring substrate binding to
and activating a specific .alpha..sub.1 adrenergic receptor.
Examples of such abnormalities related to an excess of activity of
a human .alpha..sub.1 adrenergic receptor subtype include but are
limited to benign prostatic hypertrophy, coronary heart disease,
hypertension, urinary retention, insulin resistance,
atherosclerosis, sympathetic dystrophy syndrome, glaucoma, cardiac
arrythymias erectile dysfunction, and Renaud's syndrome.
[0089] This invention also provides a method of treating
abnormalities which are alleviated by an increase in the activity
of a specific human .alpha..sub.1 adrenergic receptor, which
comprises administering a patient an amount of a pharmaceutical
composition described above, effective to increase the activity of
the specific human .alpha..sub.1 adrenergic receptor thereby
alleviating abnormalities resulting from abnormally low receptor
activity. Examples of such abnormalities related to a decrease in
the activity of a specific human .alpha..sub.1 adrenergic receptor
include but are not limited to congestive heart failure, urinary
incontinence, nasal congestion and hypotension.
[0090] Applicants have identified individual human .alpha..sub.1
adrenergic receptor subtypes and have described methods for the
identification of pharmacological compounds for therapeutic
treatments. Pharmacological compounds which are directed against a
specific human adrenergic receptor subtype provide effective new
therapies with minimal side effects.
[0091] Elucidation of the molecular structures of the neuronal
human .alpha..sub.1 adrenergic receptors transporters is an
important step in the understanding of .alpha.-adrenergic
neurotransmission. This disclosure reports the isolation, the
nucleic acid sequence, and functional expression of DNA clones
isolated from human brain which encode human .alpha..sub.1
adrenergic receptor. The identification of these human
.alpha..sub.1 adrenergic receptor will play a pivotal role in
elucidating the molecular mechanisms underlying .alpha.-adrenergic
transmission, and should also aid in the development of novel
therapeutic agents.
[0092] DNA clones encoding human .alpha..sub.1 adrenergic receptor
have been isolated from human brain, and their functional
properties have been examined in mammalian cells.
[0093] This invention identifies for the first time three new human
.alpha..sub.1 adrenergic receptor, their amino acid sequences, and
their human genes. The information and experimental tools provided
by this discovery are useful to generate new therapeutic agents,
and new therapeutic or diagnostic assays for these new human
receptors, their associated mRNA molecules or their associated
genomic DNAs. The information and experimental tools provided by
this discovery will be useful to generate new therapeutic agents,
and new therapeutic or diagnostic assays for these new human
receptors, their associates mRNA molecules, or their associated
genomic DNAs.
[0094] Specifically, this invention relates to the first isolation
of human DNA clones encoding three .alpha..sub.1-adrenergic
receptor. In addition, the human .alpha..sub.1 adrenergic receptor
have been expressed in mammalian cells by transfecting the cells
with the plasmids pCEXV-.alpha..sub.1a, pcEXV-.alpha..sub.1c. The
pharmacological binding properties of these receptor proteins have
been determined, and these binding properties classify these
receptor proteins as .alpha..sub.1 adrenergic receptor. Mammalian
cell lines expressing the human .alpha..sub.1 adrenergic receptor
on the cell surface have been constructed, thus establishing the
first well-defined, cultured cell lines with which to study human
.alpha.1 adrenergic receptor. Examples of transformed mammalian
cells, expressing human .alpha..sub.1 adrenergic receptor are
L-.alpha.-1a, expressing a human .alpha.1a adrenergic receptor,
L-.alpha.1b expressing a human .alpha.1b adrenergic receptor, and
L-.alpha.1c expressing a human .alpha.1c adrenergic receptor. These
cells are suitable for studying the pharmacological properties of
the human .alpha.1 adrenergic receptor and for the screening of
ligands and drugs that specifically bind to human .alpha.1
adrenergic receptor subtypes.
[0095] The invention will be better understood by reference to the
Experimental Details which follow, but those skilled in the art
will readily appreciate that the specific experiments detailed are
only illustrative, and are not meant to limit the invention as
described herein, which is defined by the claims which follow
thereafter.
[0096] Materials and Methods
[0097] Cloning and Sequencing
[0098] .alpha.1a: A human lymphocyte genomic library in .zeta. dash
II (.apprxeq.1.5.times.10.sup.6 total recombinants; Stratagene,
LaJolla, Calif.) was screened using a cloned rat PCR fragment
(RBNC2) as a probe. RBNC2 was obtained by amplifying randomly
primed rat brain cDNA with degenerate primers designed to conserved
regions of transmembrane (Tm) regions 2 and 6 of serotonin
receptors. The sequence of one PCR product, RBNC2, exhibited strong
homology to the .alpha.1 AR family.
[0099] The probe was labeled with [.sup.32 P] by the method of
random priming (5) (Prime-It Random Primer kit, Strategene,
LaJolla, Calif.). Hybridization was performed at 40.degree. C. in a
solution containing 50% formamide, 10% dextran sulfate, 5.times.
SSC (1.times. SSC is 0.15M sodium choloride, 0.015M sodium
citrate), 1.times. Denhardt's solution (0.02% polyvinylpyrrolidone,
0.02% Ficoll, 0.02% bovine serum albumin), and 200 .mu.g/.mu.l
sonicated salmon sperm DNA. The filters were washed at 50.degree.
C. in 0.1.times. SSC containing 0.5% sodium dodecyl sulfate and
exposed at -70.degree. C. to Kodak XAR film in the presence of an
intensifying screen. Lambda phage clones hybridizing with the probe
were plaque purified and DNA was prepared for Southern blot
analysis (22, 17). For subcloning and further Southern blot
analysis, DNA was cloned into pUC18 (Pharmacia, Piscataway, N.J.)
or pBluescript (Stratagene, LaJolla, Calif.). Nucleotide sequence
analysis was accomplished by the Sanger dideoxy nucleotide chain
termination method (18) on denatured double-stranded plasmid
templates, using Sequenase (US Biochemcial Corp., Cleveland, Ohio),
Bst DNA sequencing kit (Bio-Rad Laboratories, Richmond, Calif.), or
TaqTrack sequencing kit (Promega Corporation, Madison, Wis.).
[0100] In order to isolate a full-length clone, human cDNA
libraries were screened by polymerase chain reaction (PCR) with 1
.mu.M each of specific oligonucleotide primers designed off the
isolated genomic clone: from the sense strand (nucleotide 598-626),
5' CACTCAAGTACCCAGCCATCATGAC 3' and from the antisense stand
(nucleotide 979-1003), 5' CGGAGAGCGAGCTGCGGAAGGTGTG 3' (see FIGS.
1A01I). The primers were from non-conserved portions of the
receptor gene, specifically in the Tm3-Tm3 loop and in the Tm5-Tm6
loop regions for the upstream and downstream primers, respectively.
One to 2 .mu.l of phage DNA from cDNA libraries (.zeta. ZapII;
Stratagene, LaJolla, Calif.), representing
.apprxeq.10.sup.6-10.sup.7 pfu, were amplified in 10 mM Tris-HCl,
pH 8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 0.01% gelatin, 200 .mu.M each
DATP, dCTP, dTTP, 2.5 units of Thermus aquaticus DNA polymerase
(Taq polymerase; Perkin-Elmer-Cetus, Norwalk, Conn.). The
amplification profile was run for 30 cycles: a 5 min. initial (i.e.
1 cycle denaturation at 95.degree. C., followed by 2 min. at
94.degree. C., 2 min at 68.degree. C., and 3 min at 72.degree. C.,
with a 3 sec. extension, followed by a final 10 min. extension at
72.degree. C. PCR products were analyzed by ethidium bromide (EtBr)
stained agarose gels and any sample exhibiting a band on the EtBr
stained gel was considered positive.
[0101] A positive library was then plated and screened with
overlapping 45-mer oligonucleotide probes, filled-in using
[.alpha.-.sup.32P]dCTP and [.alpha.-.sup.32P]dATP and Klenow
fragment of DNA polymerase. This probe was internal to the
amplification primers discussed above from the sense strand
(nucleotide 890-934), 5' GCAAGGCCTCCGAGGTGGTGCTGCGCATCCACTGTCGCGGC-
GCGG 3', and from the anti-sense strand (nucleotide 915-961), 5'
TGCCGTGCGCCCCGTCGGCGCCCGTGGCCGCGCCGCGACAGTGGATG 3' (see FIGS.
1A-1I). Positive cDNA phage clones were plaque certified and
pBluescript recombinant DNAs were excision-rescued from .zeta. Zap
II using helper phage R408, as described by manufacturer's protocol
(Stratagene, LaJolla, Calif.). Insert size was confirmed by
restriction enzyme digest analysis and recombinants were sequences
as described above.
[0102] .alpha.1b: A human placenta genomic library in .lambda. dash
II (.apprxeq.1.5.times.10.sup.6 total recombinants; Stratagene,
LaJolla, Calif.) was screened using overlapping 45-mer
oligonucleotides radiolabeled as described above and directed to
the third, fifth and sixth transmembrane regions of serotonin
5HT1D.beta. receptor gene. Hybridization and washing conditions
were identical to that described for .alpha.1a above except lower
stringency hybridization nd washes were conducted; specifically,
hybridization in 25% formamide and washes at 40.degree. C.
[0103] Positive-hybridizing .lambda. phage clones were
plaque-purified, analyzed by Southern blot analysis, subcloned and
sequenced, as described above for .alpha.1a. In order to isolate
full-length clones, human cDNA libraries in .lambda. Zap II
(Strategene, LaJolla, Calif.) were screened by polymerase chain
reaction as described above. The upstream and downstream PCR
primers used were from the Tm40Tm5 loop and the Tm5-Tm6 loop,
respectively: from the sense strand (nucleotide 567-593), 5'
CAACGATGACAAGGA GTGCGGGGTCAC 3', and from the antisense strand
(nucleotide 822-847), 5' TTTGACAGCTATGGAACTCCTGGGG 3' (see FIG. 2).
PCR, library screen, plaque purification excision-rescue from
.lambda. Zap II, restriction digestions and sequencing were
accomplished as described above for .alpha.1a. The internal probe
was: from the sense strand (nucleotide 745-789),
5'AAGGAGCTGACCCTGAGGATCCATTCCAAGAACTTTC ACGAGGAC 3', and from the
anti-sense strand (nucleotide 770-814),
5'CCTTGGCCTTGGTACTGCTAAGGGTGTCCTCGTGAAA GTTCTTGG 3' (see FIGS.
2A-2H).
[0104] .alpha.1c: A human lymphocyte genomic library in .lambda.
dash II (.apprxeq.1.5.times.10.sup.6 total recombinants;
Stratagene, LaJolla, Calif.) was screened using overlapping 45-mer
oligonucleotides radiolabeled as described for .alpha.1a and
directed to the third, fifth and sixth transmembrane regions of
serotonin 5HT1A receptor gene. Hybridization and washing conditions
were identical to that described for .alpha.1b.
Positive-hybridizing A phage clones were plaque-purified, analyzed
by Southern blot analysis, subcloned and sequenced, as described
above for .alpha.1a. Identification and isolation of full=length
clones by PCR and screening cDNA libraries were accomplished as
described for .alpha.1b. The upstream and downstream PCR primers
used were from the Tm3-Tm4 loop and the Tm5-Tm6 loop, respectively:
from the sense strand (nucleotide 403-425), 5'
CCAACCATCGTCACCCAGAGGAG 3', and from the antisense strand
(nucleotide 775-802), 5' TCTCCCGGG AGAACTTGAGGAGCCTCAC 3' (see
FIGS. 3A-3G). The internal probe was: from the sense strand
(nucleotide 711-745), 5' TCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGC
AGCGGGATGG 3', and from the anti-sense strand (nucleotide 726-771),
5' GAAGTGCGTCTTGGTCTTGGCGCT GGCCATCCCGCTGCCTCCTGCC 3' (see FIGS.
3A-3G). PCR, library screen, plaque purification excision-rescue
from .lambda. Zap II, restriction digestions and sequencing were
accomplished as described above for .alpha.1a.
[0105] Expression
[0106] .alpha.1a: The entire coding region of .alpha.1a (1719 bp),
including 150 basepairs of 5' untranslated sequence (5' UT) and 300
bp of 3' untranslated sequence (3' UT), was cloned into the BamHI
and ClaI sites of the polylinker-modified eukaryotic expression
vector pCEXV-3 (13), called EXJ.HR (unpublished data). The
construct involved the ligation of partial overlapping human
lymphocyte genomic and hippocamppal cDNA clones: 5' sequences were
contained on a 1.2 kb SmaI-XhoI genomic fragment (the
vector-derived BamHI site was used for subcloning instead of the
internal insert-derived SmaI site) and 3' sequences were contained
on an 1.3 kb XhoI-ClaI cDNA fragment (the ClaI site was from the
vector polylinker). Stable cell lines were obtained by
cotransfection with the plasmid .alpha..sub.1a/EXJ (expression
vector containing the .alpha.1a receptor gene) and the plasmid
pGCcos3neo (plasmid containing the aminoglycoside transferase gene)
into LM(tk.sup.-), CHO, NIH3T3 cells, and 293 cells using calcium
phosphate technique. The cells were grown, in a controlled
environment (37.degree. C., 5% CO.sub.2), as monolayers in
Dulbecco's modified Eagle's Medium (GIBCO, Grand Island, N.Y.)
containing 25 mM glucose and supplemented with 10% bovine calf
serum, 100 units/ml penicillin G, and 100 .mu.g/ml streptomycin
sulfate. Stable clones were then selected for resistance to the
antibiotic G-418 (1 mg/ml) as described previously (26) and
membranes were harvested and assayed for their ability to bind
[.sup.3H]prazosin as described below (see "Radioligand Binding
Assays").
[0107] .alpha.1b: The entire coding region of .alpha.1b (1563 bp),
including 200 basepairs of 5' untranslated sequence (5' UT) and 600
bp of 3' untranslated sequence (3' UT), was cloned into the EcoRI
site of pCEXV-3 eukaryotic expression vector (13). The construct
involved ligating the full-length containing EcoRI brainstem cDNA
fragment from .lambda. Zap II into the expression vector. Stable
cell lines were selected as described above.
[0108] .alpha.1c: The entire coding region of .alpha.1c (1401 bp),
including 400 basepairs of 5' untranslated sequence (5' UT) and 200
bp of 3' untranslated sequence (3' UT), was cloned into the KpnI
site of the polylinker-modified pCEXV-3-derived (13) eukaryotic
expression vector, EXJ.RH (unpublished data). The construct
involved ligating three partial overlapping fragments: a 5' 0.6 kb
HincII genomic clone, a central 1.8 EcoRI hippocamppal cDNA clone,
and a 3' 0.6 kb PstI genomic clone. The hippocamppal cDNA fragment
overlaps with the 5' and 3' genomic clones so that the HincII and
PstI sites at the 5' and 3' ends of the cDNA clones, respectively,
were utilized for ligation. This full-length clone was cloned into
the KpnI sites of the fragment, derived from vector (ie
pBluescript) and 3' untranslated sequences, respectively. Stable
cell lines were selected as described above.
[0109] Radioligand Binding Assays
[0110] Transfected cells from culture flasks were scraped into 5 ml
of 5 mM tris-HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. The
cell lysates were centrifuged at 1000 rpm for 5 min at 4.degree. C.
The pellet was suspended in 50 mM Tris-HCl, 1 mM MgCl.sub.2, and
0.1% ascorbic acid at pH 7.5. Binding of the .alpha.1 antagonist
[.sup.3H]prazosin (0.5 nM, specific activity 76.2 Ci/mmol) to
membrane preparations of LM(tk-) cells was done in a final volume
of 0.25 ml and incubated at 37.degree. C. for 20 min. Nonspecific
binding was determined in the presence of 10 .mu.M phentolamine.
The reaction was stopped by filtration through GF/B filters using a
cell harvester. Data were analyzed by a computerized non-linear
regression program.
[0111] Measurement of [.sup.3H] Inositol Phosphates (IP)
Formation
[0112] Cells were suspended in Dulbecco's phosphate buffered saline
(PBS), and incubated with 5 .mu.Ci/ml [.sup.3H]m-inositol for 60
min at 37.degree. C., the reaction was stopped by adding
CHCl.sub.3:Methanol: HCl (2/1/0.01 v/v). Total [.sup.3H]IP were
separated by ion exchange chromatography and quantified as
described by Forray and El-Fakahany (7).
[0113] Calcium Measurements
[0114] Intracellular calcium levels ([Ca.sup.2+]i) were determined
with the calcium-sensitive dye fura-2, and microspectrofluorometry,
essentially as previously described (1,3). Briefly, cells were
plated into polylysine-coated coverslip bottom dishes (MatTek
Corporation, Ashland Mass.). To lead with fura-2, cells were washed
3.times. with HEPES-buffered saline (HBS, in mM: HEPES, 20; NaCl,
150; KC1, 5; CaCl.sub.2, 1; MgCl.sub.2, 1; glucose, 10; pH 7.4) and
incubated for 30 minutes at room temperature with fura-2 loading
solution (5 uM fura-2/AM, 0.03% pluronic F-127, and 2%
heat-inactivated fetal calf serum, in HBS). After loading, cells
were washed 3.times. with HBS, 1 ml of HBS was added, and the dish
was placed on the microscope for determination of
[Ca.sup.2+].sub.i. [Ca.sup.2+].sub.i was measured with a Leitz
Fluovert microscope equipped for UV-transmission epifluorescence.
Fura-2 fluorescence was alternately excited at 340 and 380 nm (0.25
sec), and a pair of readings (500 nm long pass) was taken every two
seconds, and recorded by a personal computer interfaced to a data
acquisition and control unit from Kinetek (Yonkers, N.Y.). To
determine [Ca.sup.2+].sub.i from the experimental data the
background fluorescence was subtracted, and the corrected ratios
were converted to [Ca.sup.2+].sub.i by comparison with buffers
containing saturating and low free calcium, assuming a K.sub.D of
400 nM (3).
[0115] RESULTS
[0116] .alpha.1a: We screened a human genomic lymphocyte library
with a rat PCR fragment that exhibited homology with the
.alpha.1-AR family. A total of six clones were isolated and
characterized by Southern blot analysis. One clone, h13, contained
a 4.0 kb XbaI fragment which hybridized with the radiolabeled rat
PCR fragment and was subsequently subcloned into pUC vector. DNA
sequence analysis indicated greatest homology to human .alpha.1a
and rat .alpha.1a ARs. This clone contained the initiating
methionine through Tm6 with .apprxeq.1.0-1.5 kb 5' UT region.
Subsequent Southern blot, analysis, subcloning and sequencing
analysis indicated the presence of a SmaI site .apprxeq.150 nts. 5'
to the initiating methionine codon. The homology between h13 and
rat .alpha.1a adrenergic gene breaks just downstream of Tm6,
indicating an intron which is located in an analogous region in the
.alpha.1b- and .alpha.1c-AR genes (4,20). In order to obtain a
full-length clone, aliquots of human cDNA libraries totaling
.apprxeq.1.5.times.10.sup.6 recombinants was screened by polymerase
chain reaction using specific oligonucleotide primers from sequence
determined off the genomic clone (see Materials and Methods). A
positive-containing human hippocamppal cDNA library (Stratagene,
LaJolla, Calif.) in .lambda. Zap II (.apprxeq.1.5.times.10.sup.6
recombinants) was screened using traditional plaque hybridization
with an internal probe (see Materials and Methods) and resulted in
the isolation of two positive cDNA clones, one containing the
upstream sequences (from 5' UT through the 5-6 loop; hH22) and the
other containing downstream sequences (from within Tm5 through
.apprxeq.200 nts. with a common XhoI site being present within this
common region.
[0117] The complete full-length gene was constructed by splicing
together two restriction fragments, one being the 3' cDNA (hH14)
and the other being the 5' genomic clone (h13), using a unique
restriction site (XhoI) present in the overlapping region. In
addition, another construct was accomplished by ligating the two
cDNA clones (hH14 and hH22), using the overlapping XhoI site;
however, since this construct produced the same pharmacology as the
genomic/cDNA construct, we will not discuss this recombinant
(unpublished observation). The genomic/cDNA construct contains an
open reading frame of 1719 bp and encoding a protein of 572 aa in
length, having a relative molecular mass of .apprxeq.63,000
daltons. Hydropathy analysis of the protein is consistent with a
putative topography of seven transmembrane domains, indicative of
the G protein-coupled receptor family. Initial sequence analysis
revealed that clone .alpha.1a/EXJ was most related to an AR since
it contained a number of conserved structural features/residues
found among the members of the adrenergic receptor family,
including conserve cysteines in the second and third extracellular
loops, a conserved glycine residue in Tm1, aspartic acid residues
in Tm regions II and III, conserved valine residues in TmIII, the
DRY sequence at the end of TmIII, the conserved proline residues of
Tm regions II, IV, V, VI and VII, and the consensus
D-V-L-X-X-T-X-S-I-X-X-L-C IN Tm3 and the consensus
G-Y-X-N-S-X-X-N-P-X-I-Y in the Tm VII, both consensus unique to the
adrenergic receptor family (2,26). Other features of this human
.alpha.1a receptor gene are the presence of two potential sites for
N-linked glycosylation in the amino terminus (asparagine residues
65 and 82; FIGS. 1a-1I) and the presence of several serines and
threonines in the carboxyl terminus and intracellular loops, which
may serve as sites for potential phosphorylation by protein
kinases.
[0118] .alpha..sub.1b: We screened a human genomic placenta library
with probes derived from Tm3, 5 and 6 regions of serotonin
5HT1D.sub.8 under low stringency. Out of several hundred positive
clones pursued by Southern blot analysis, subcloning and
sequencing, one resembled the .alpha..sub.1 adrenergic family of
receptors. This genomic fragment contained Tm3 through Tm6 of a
receptor which was most closely related to rat and hamster
.alpha..sub.1b receptors. In order to obtain a full-length clone,
several human cDNA libraries were screened by PCR using primers
derived from the 5-6 loop region of the genomic clone (see
Materials and Methods). A positive-containing human brainstem cDNA
library (Stratagene, LaJolla, Calif.) in .lambda. ZAPII
(.apprxeq.2.times.10.sup.6 recombinants) was screened using
traditional plaque hybridization with an internal probe, resulting
in the isolation of two identical cDNA clones, containing an insert
size of 2.4 kb. Upon sequencing, this clone was found to contain
the initiating MET aa, Tm1 through Tm7, and 5' and 3' UT sequences,
suggesting a full-length clone on a single EcoRI fragment. This
cDNA clone contains an open reading frame of 1563 bp and encodes a
protein of 520 aa in length, having a relative molecular mass of
.apprxeq.57,000 daltons. Hydropathy analysis of the protein is
consistent with a putative topography of seven transmembrane
domains, indicative of the G protein-coupled receptor family.
[0119] Sequence analysis revealed that clone .alpha..sub.1b/pCEXV
was most related to adrenergic receptor since it contained a number
of conserved structural features found among the adrenergic
receptor family, as described for .alpha..sub.1a receptor (see
above). This human .alpha..sub.1b receptor contains potential sites
for N-linked glycosylation in the amino terminus (asparagine
residues 10, 24, 29, 34 in FIGS. 2A-2H), consistent with the
finding that the .alpha..sub.1 AR is glycosylated (4,19).
[0120] .alpha.1c: We screened a human genomic lymphocyte library
with probes derived from the third, fifth and sixth transmembrane
regions of serotonin 5HT1A under low stringency. Out of several
hundred positive clones analyzed by Southern blot analysis,
subcloning and sequencing (see Materials and Methods), one phage
clone resembled a novel .alpha..sub.1 AR. This genomic fragment
contained Tm1 through Tm6 of a receptor with high homology to the
bovine .alpha..sub.1c receptor and thus suggesting the presence of
an intron downstream of Tm6, as shown for the .alpha..sub.1
receptor family (4,12,20). In order to obtain a full-length clone,
several human cDNA libraries were screened by PCR, as described for
.alpha..sub.1b (also see Materials and Methods). A
positive-containing human hippocamppal cDNA library (Stratagene,
LaJolla, Calif.) in .lambda. ZAPII (.apprxeq.2.times.10.sup.6
recombinants) was screened, as described for .alpha..sub.1b. A
positive clone (hH 20) was identified which contained a 1.7 kb
EcoRI cDNA fragment insert. However, this cDNA clone lacked both
the amino end of the receptor (the 5' end of the clone terminated
at the 5' end of Tm2) and part of the carboxyl tail (the 3' end of
the clone corresponded to 40 aa upstream from the "putative" stop
codon). Since an alternative genomic subclone which contained the
initiating MET codon in addition to Tm1 through Tm6 was available,
we needed to obtain the complete 3' carboxyl tail in order to
complete the construct of the full-length clone. This was
accomplished by using overlapping 45-mer oligonucleotide primers
(corresponding to nts. 1142-1212 in FIG. 3), designed within the
carboxyl tail of the receptor (at the 3' end of the hH20 cDNA
clone), to screen a human lymphocyte genomic library in order to
isolate a genomic clone containing the carboxyl tail that includes
the termination codon. Two identical positive human lymphocyte
genomic clones were isolated from this library. A 0.6 kb PstI
fragment was subcloned and shown to contain most of the carboxyl
tail (.apprxeq.20 aa downstream of Tm7) through the termination
codon and .apprxeq.200 bp of 3' UT sequence.
[0121] The complete full-length gene was constructed by splicing
together three restriction fragments: A 0.6 kb HincII fragment from
the genomic clone, containing .apprxeq.0.4 kb of 5' UT sequence and
the initiating MET codon through Tm2; the 0.8 kb HincII-PstI
fragment from the hH cDNA clone, which contains Tm2 through part of
the carboxyl tail, overlapping with the 5' genomic clone by 20 nts.
(sharing the unique HincII site at position 196 in FIG. 3); and a
0.6 kb PstI fragment from the second hl genomic clone, which
contains the carboxyl tail, the stop codon and .apprxeq.0.2 kb of
3' UT sequence, and overlapping with the hH cDNA clone (sharing the
unique Pst I site within the carboxyl tail at position 1038 in
FIGS. 3A-3G).
[0122] The resulting genomic/cDNA/genomic construct contains an
open reading frame of 1401 bp and encoding a protein of 466 aa in
length, having a molecular weight of .apprxeq.51,000 daltons.
Hydropathy analysis of the protein is consistent with a putative
topography of seven transmembrane domains, as indicated for the
previously described human .alpha..sub.1a and .alpha..sub.1b
receptors and indicative of the G protein-coupled receptor family.
Sequence analysis revealed that clone .alpha..sub.1c/EXJ was most
related to adrenergic receptor because it contained the structural
features commonly found among the adrenergic receptor family of
receptors, as described for the .alpha..sub.1a receptor above.
Other features of this human .alpha..sub.1 receptor gene is the
presence of three potential sites for N-linked glycosylation in the
amino terminus, at the same position described for the bovine
.alpha..sub.1c receptor (asparagine residues 7, 13 and 22 in FIGS.
3A-3G) (20). Several threonines and serines exist in the second and
third cytoplasmic loops of this .alpha..sub.1c receptor, which may
serve as potential sites for protein kinases and
phosphorylation.
1TABLE 1 Competition of adrenergic agonists and antagonists for the
binding of [.sup.3H]prazosin to membranes prepared from
LM(tk.sup.-) cells expressing the human .alpha..sub.1a,
.alpha..sub.1b, and .alpha..sub.1c-adrenergic receptor cDNA.
Membrane preparations from stabily transfected cell lines
increasing concentrations of various agonists or antagonists as
described under "Materials and Methods". Data is shown as the mean
.+-. S.E.M. of the binding parameters estimated by a computerized
non-linear regression analysis obtained in three independent
experiments each performed in triplicate. pKi .alpha..sub.1a
.alpha..sub.1b .alpha..sub.1c AGONISTS Norepinephrine 6.633 .+-.
0.12 5.614 .+-. 0.09 5.747 .+-. 0.18 Epinephrine 6.245 .+-. 0.10
5.297 .+-. 0.15 5.511 .+-. 0.13 Oxymetazoline 5.903 .+-. 0.16 5.919
.+-. 0.07 7.691 .+-. 0.10 Naphazoline 6.647 .+-. 0.18 6.155 .+-.
0.04 6.705 .+-. 0.22 Xylometazoline 5.913 .+-. 0.20 6.096 .+-. 0.30
7.499 .+-. 0.19 ANTAGONISTS Prazosin 9.479 .+-. 0.19 9.260 .+-.
0.23 9.234 .+-. 0.13 WB-4101 8.828 .+-. 0.12 7.909 .+-. 0.13 9.080
.+-. 0.09 (+) Niguldipine 6.643 .+-. 0.10 6.937 .+-. 0.12 8.693
.+-. 0.18 Indoramin 6.629 .+-. 0.09 7.347 .+-. 0.17 8.341 .+-. 0.25
5-Methyl Urapidil 7.795 .+-. 0.15 6.603 .+-. 0.09 8.160 .+-. 0.11
HEAT 7.857 .+-. 0.13 8.474 .+-. 0.10 8.617 .+-. 0.10 Urapidil 6.509
.+-. 0.18 5.932 .+-. 0.11 6.987 .+-. 0.14 Rauwolscine 5.274 .+-.
0.12 4.852 .+-. 0.08 4.527 .+-. 0.11
[0123] Pharmacological Analysis: To further assess the functional
identity of the cloned cDNA the coding regions were subcloned into
the pCEXV-3 expression vector, and LM(tk-) cell lines stably
expressing the human cDNA encoding each of the three
.alpha..sub.1-ARs were established. Membrane preparations of these
cell lines showed high affinity binding of [.sup.3H]prazosin, with
Kd values of 0.21.+-.0.03 nM (Bmax=0.72.+-.0.04 pmol/mg prot),
0.88.+-.0.1 nM (Bmax=4.59.+-.0.21 pmol/mg prot) and 0.39.+-.0.08 nM
(Bmax=1.9.+-.0.04 pmol/mg prot) for the cells expressing the
.alpha..sub.1a, .alpha..sub.1b, and .alpha..sub.1c-ARs
respectively. In contrast in competition binding experiments
rauwolscine showed extremely low affinity at the three cloned
receptors (Table 1), consistent with their identity as
.alpha..sub.1-AR. The .alpha.-adrenergic agonists NE and
epinephrine were found to be 6 and 5-fold respectively, more potent
at the human .alpha..sub.1a-AR, conversely the imidazoline
derivatives such as oxymetazoline and xylometazoline showed 52-fold
higher potency at the .alpha..sub.1c-AR. Similarly, several
antagonists showed marked differences in their potency to inhibit
[.sup.3H]prazosin binding from the cloned human .alpha..sub.1
receptors subtypes. The selective antagonists WB-4101 and
5-methyl-urapidil showed high affinity for the human .alpha..sub.1c
subtype (0.8 and 7 nM respectively), followed by less than 2-fold
lower potency at the human .alpha..sub.1a and at least an order of
magnitude (15 and 36-fold respectively) lower potency at the human
.alpha..sub.1b-AR. Similarly, indoramin was 50 and 10-fold more
potent at the .alpha..sub.1c than at the .alpha..sub.1a and
.alpha..sub.1b respectively. The calcium channel blocker
(+)-niguldipine showed the highest selectivity for the three
.alpha..sub.1-AR subtypes, displacing [.sup.3H]prazosin 112 and
57-fold more potently from the .alpha..sub.1c than from
.alpha..sub.1a and .alpha..sub.1b transfected cells
respectively.
2TABLE 2 Receptor-mediated formation of [.sup.3H] IP in cell lines
transfected with the human .alpha..sub.1-adrenergic receptors cDNA.
Cell lines stably expressing the human .alpha..sub.1-adrenergic
receptors were obtained and the IP formation was measured in the
absence or presence of 10 .mu.M norepinephrine (NE) in the presence
of 10 mM LiCl as described under "Material and Methods". Data are
shown as mean .+-. S.E.M. of three independent experiments
performed in triplicate. [.sup.3H] IP Fold Receptor .sup.a Density
Cell Line dpm/dish Stimulation pmol/mg Prot 293 .alpha..sub.1a 3.30
Control 288 .+-. 29 NE 3646 .+-. 144 13 CHO .alpha..sub.1b 0.49
Control 1069 .+-. 26 NE 5934 .+-. 309 6 NIH3T3 .alpha..sub.1c 0.24
Control 722 .+-. 61 NE 13929 .+-. 1226 19 .sup.aDetermined by
[.sup.3H] Prazosin binding.
[0124] The formation of [.sup.3H]IP was measured in 293, CHO, and
NIH3T3 cell stably expressing the cloned human .alpha..sub.1a,
.alpha..sub.1b, .alpha..sub.1c-ARs respectively, to assess the
functional coupling of these receptors with the activation of
phosphatidyl-inositol specific phospholipase C (PI-PLC). As shown
in Table 2, the adrenergic agonist NE (10 .mu.M) activated the
formation of IP by 13-fold in cells expressing the .alpha..sub.1a
receptor, and by 5 and 15-fold in cells expressing the
.alpha..sub.1a , .alpha..sub.1b and .alpha..sub.1c receptors
respectively. Furthermore, when cells expressing .alpha..sub.1b and
.alpha..sub.1c receptors were incubated in the presence of 10 .mu.M
NE, a rapid increase of cytosolic calcium was observed. The
response was characterized by an early peak, followed by a plateau
that slowly declined towards resting calcium levels (FIG. 7). The
concentration of [Ca.sup.2+].sub.i, was increased by 172.+-.33
(n=6), 170.+-.48 (n=6) and 224.+-.79 nM (n=6) in cell lines
transfected with the .alpha..sub.1a .alpha..sub.1b and
.alpha..sub.1c receptors respectively. The changes in
[Ca.sup.2+].sub.i induced by NE were suppressed by preincubation of
the cells with 10 nM prazosin, indicating that the calcium response
was mediated by .alpha..sub.1-ARs.
[0125] We have cloned DNA representing three .alpha..sub.1-ARs
subtypes (.alpha..sub.1a, .alpha..sub.1b and .alpha..sub.1c) from
human brain cDNA and genomic DNA. Of all known G protein-coupled
receptor sequences (EMBL/Genbank Data Base), the greatest homology
was found between .alpha..sub.1a/EXJ and the rat .alpha..sub.1a AR
(12), rat .alpha..sub.1d AR (16) and a previously reported putative
human ".alpha..sub.1a" adrenergic receptor (H318/3) (2). Comparison
of the human .alpha..sub.1a deduced aa sequence with known
.alpha..sub.1a ARs indicates the greatest concentration of
identical aa to be in the transmembrane domains. In these Tm
regions, the percentage of identity for the human .alpha..sub.1a AR
is 98% compared to rat .alpha..sub.1a AR (12) (this is
approximately the same for rat .alpha..sub.1d since rat
.alpha..sub.1d AR is the same as rat a AR, except for two amino
acid differences), 100% with the previously reported H318/3, 78%
with the human .alpha..sub.1b receptor (see below), and 69% with
the human .alpha..sub.1c receptor (see below), which is typical
among subtypes. When considering the full-length proteins, the
percent identity drops and is only 50% for the human .alpha..sub.1b
and 49% for the human .alpha..sub.1c receptor. Both the alignment
(see FIG. 4) and percent identity of this human .alpha..sub.1a
sequence, relative to other members of the AR family strongly
suggest that this is a new receptor and is the human species
homolog of the rat .alpha..sub.1a receptor.
[0126] FIG. 4 shows a comparison between the deduced aa sequence of
.alpha..sub.1a/EXJ and the sequences of rat .alpha..sub.1a and HAR.
An overall homology of 83.5% aa identity with rat .alpha..sub.1a
and 86.5% aa identity with the previously published H318/3 clone
was observed, suggesting that our human .alpha..sub.1a receptor is
not any more related to the previously published putative human
".alpha..sub.1a" than it is to the rat .alpha..sub.1a receptor. In
fact, in support of this conclusion, is the fact that the overall
aa homology of rat .alpha..sub.1a receptor with our human
.alpha..sub.1a receptor is 83.5% but is only 72% compared to the
H318/3 receptor. The main differences between our human
.alpha..sub.1a receptor and the previously reported
".alpha..sub.1a" receptor in relation to the rat .alpha..sub.1a are
indicated in FIG. 4. Most notably are the differences observed at
both the amino and carboxyl ends of the receptor. Specifically,
both our human .alpha..sub.1a and rat .alpha..sub.1a use the
starting MET aa at position 1 (see FIG. 4) whereas the previously
published H318/3 uses the starting MET 48 aa downstream. Also, the
amino terminus of the H318/3 clone is completely divergent from
either rat .alpha..sub.1a or our human .alpha..sub.1a receptor
until about 12 aa upstream of Tm1 where significant homology
begins. Similarly, in the carboxyl tail, the homology of H318/3
diverges .apprxeq.90 aa upstream from the stop codon of either rat
or our human .alpha..sub.1a receptor and instead, uses a stop codon
30 aa upstream from the stop codon on either of these receptors.
Finally, the H318/3 clone has an amino terminal extracellular
region that does not contain potential sites for N-linked
glycosylation (2), in contrast to the rat .alpha..sub.1a or our
human .alpha..sub.1a receptor, which contains two potential sites
(12, see also FIG. 1 and above). Thus, these data strongly suggest
that our human .alpha..sub.1a receptor is different in sequence
from the previously reported putative human ".alpha..sub.1a"
(H318/3) but is more related to the previously published rat
.alpha..sub.1a receptor. Interestingly, the rat .alpha..sub.1a aa
sequence diverges from both human .alpha..sub.1a receptors for
.apprxeq.65 aa in the carboxyl tail (position 434-508 in FIG. 1);
however, homology is seen again in our human .alpha..sub.1a
receptor but not with H318/3, downstream from this region.
[0127] The cloning of different .alpha..sub.1 receptor subtypes
permits analysis of both the pharmacological and functional
properties of adrenergic receptors. The human .alpha..sub.1b/pcEXV
clone exhibited the greatest homology with the rat and hamster
.alpha..sub.1b receptors, out of all known G protein-coupled
receptor clones (EMBL/Genbank Data Bank). Comparison of the human
.alpha..sub.1b deduced aa sequence with known .alpha..sub.1 ARs
indicates the greatest homology in the transmembrane regions. In
these Tm regions, the percent identity for the human .alpha..sub.1b
AR is 99% compared to either rat (25) or hamster (4) ab receptor,
78% with human .alpha..sub.1a receptor and 75% with human
.alpha..sub.1c receptor, which is typical among subtypes. When
analyzing the full-length proteins, the percent identity slightly
drops and is 94.5% compared to rat .alpha..sub.1b, 95.5% compared
to hamster .alpha..sub.1b receptor, 50% compared to human
.alpha..sub.1a and 51% compared to human .alpha..sub.1c receptor.
Both the alignment (see FIG. 5) and percent identity of this human
.alpha..sub.1b sequence, relative to other members of the AR
family, strongly suggest that this clone represents a new receptor
and is the human species homologue of the rat/hamster
.alpha..sub.1b receptor. FIG. 5 shows a comparison between the
deduced amino acid sequence of .alpha..sub.1b/pcEXV and the aa
sequence of rat .alpha..sub.1b and hamster .alpha..sub.1b
receptors.
[0128] A third human adrenergic receptor clone, .alpha..sub.1c/EXJ,
showed the greatest homology with the bovine .alpha..sub.1c AR gene
(20), from all known G protein-coupled receptor sequences
(EMBL/Genbank Data Bank). Comparison of the human .alpha..sub.1c
deduced aa sequence with the .alpha..sub.1 ARs indicates the
greatest homology to be in the transmembrane regions. In these Tm
regions, the percent identity for the human .alpha..sub.1c AR is
97% compared to the bovine .alpha..sub.1c AR (20), 75% with human
.alpha..sub.1b receptor and 69% with human .alpha..sub.1a receptor,
which is typical among subtypes. When one examines the full-length
proteins, the percent identity drops and is only 51% compared to
either the human .alpha..sub.1b or human .alpha..sub.1a receptor.
FIG. 6 shows a comparison between the deduced amino acid sequence
of .alpha..sub.1c/EXJ and the aa sequence of bovine .alpha..sub.1c.
An overall homology of 92% aa identity with bovine .alpha..sub.1c
receptor was observed. Both the alignment (see FIG. 6) and percent
identity of this human .alpha..sub.1c sequence, relative to other
members of the AR family, strongly suggest that this clone
represents a new receptor and is the human species homologue of the
bovine .alpha..sub.1c receptor.
[0129] The stable expression of the three cloned human
.alpha..sub.1 receptors enabled the characterization of their
pharmacological as well as their functional properties and allowed
identification of certain unique features of the human receptors,
not predicted from previous data. The rank-order of potency of
known .alpha.-adrenergic agonists and antagonists to compete with
[.sup.3H]prazosin in binding assays, confirmed that the cloned
cDNAs encode three human receptors of the .alpha..sub.1-AR family.
Moreover, the potencies of selective antagonists such as WB-4101
and 5-methyl-urapidil at the three human .alpha..sub.1-receptors
were found to be in close agreement with the potencies of these
antagonists at the cloned rat .alpha..sub.1a, hamster
.alpha..sub.1b and bovine .alpha..sub.1c (4, 12, 20). These results
suggest that the sequence homology between the three mammalian
.alpha..sub.1 receptors resulted in a conservation of their
pharmacological properties across different species. In the past
the pharmacological characterization of .alpha..sub.1-adrenergic
receptors took advantage of the existence of selective antagonists
such as WB-4101 and 5-methyl-urapidil that bind with high affinity
to a subset of .alpha..sub.1-receptors classified as .alpha..sub.1a
(9, 15). Our results using these selective antagonists indicate
that these antagonists bind with similar affinity to both human
.alpha..sub.1a and .alpha..sub.1c-receptors, and that they can only
discriminate between either of these two subtypes and the
.alpha..sub.1b receptor. The calcium channel blocker
(+)-niguldipine was found to bind with high affinity to a subset of
.alpha..sub.1-receptors also labeled by [.sup.3H]5-methyl-urapi-
dil in rat brain, thus defining this antagonist as .alpha..sub.1a
selective (8). The high affinity of the human .alpha..sub.1c
receptor for (+)-niguldipine and the fact that it binds to the
human .alpha..sub.1a and .alpha..sub.1b subtypes, with at least an
order of magnitude lower affinity, strongly supports the notion
that the human .alpha..sub.1c gene encodes the pharmacological
.alpha..sub.1a-receptor subtype. The possibility that this also
holds true in the rat, is suggested by the fact that the potency of
(+) niguldipine for the rat .alpha..sub.1a clone is also at least
an order of magnitude lower than that found for this antagonist in
rat tissues. Moreover in spite of the earlier reports on the
absence of the bovine .alpha..sub.1c cognate in rat tissues (20),
(24,21) pharmacological evidence suggests that this species express
an .alpha..sub.1 receptor similar to the cloned .alpha..sub.1c
receptor. These data altogether indicate that in trying to match
the pharmacological subclassification of the .alpha..sub.1-ARs with
the evidence from molecular cloning studies, the initial assignment
of the cloned rat .alpha..sub.1a receptor with the .alpha..sub.1a
receptor subtype was inadequate. Recently, a rat cDNA clone 99.8%
homologous to the rat .alpha..sub.1a-receptor, was described as a
novel .alpha..sub.1d subtype (16); however, this incorrect
classification was due to the poor correlation between the
affinities of .alpha..sub.1a-selective antagonists in tissue
preparations versus the cloned rat .alpha..sub.1a receptor.
[0130] The three human .alpha..sub.1 receptor subtypes were able to
induce the formation of IP, consistent with the known functional
coupling of .alpha..sub.1-ARs, through a GTP-dependent protein to
the activation of PI-PLC. In addition we demonstrated that upon
receptor activation by adrenergic agonists, the human .alpha..sub.1
subtypes induced transient changes three in [Ca.sup.2+].sub.i.
Consistent with the mobilization of calcium from intracellular
stores by inositol-1,3,5 triphosphate, released by the
receptor-mediated activation of PI-PLC.
[0131] We have cloned and expressed three human cDNA that encode
functional .alpha..sub.1-ARs. These three transcripts display
significant pharmacologic as well as molecular features to
constitute distinct .alpha..sub.1-AR subtypes. In sharp contrast
with the restricted expression of the rat and bovine transcripts,
our findings indicate that species homologs of the three
.alpha..sub.1-ARs are expressed in human tissues. These findings
together with recent reports on the dissimilar tissue distribution
of the .alpha..sub.1b and .alpha..sub.1c receptor cognates between
animal species such as rat and rabbit (21), commonly used in the
development of novel .alpha..sub.1-adrenergic agents, emphasize the
need to study the pharmacological properties of the human
.alpha..sub.1-receptors. In this regard, the results from this
study on the selectivity of clinically effective antihypertensives
such as indoramin, as well as vasoconstrictors such as
oxymetazoline and xylometazoline for the human .alpha..sub.1c-AR
suggest a potential role for this .alpha..sub.1-receptor subtype in
the physiological control of vascular tone in the human. Thus, the
availability of cell lines expressing each of the human
.alpha..sub.1-receptor subtypes constitute a unique tool in the
design of subtype specific agonists and antagonists, that can be
targeted to selective therapeutic applications. Of specific
interest for therapeutics are subtype selective alpha-1 antagonists
for the treatment of Benign Prostatic Hypertrophy, coronary heart
disease, insulin resistance, atherosclerosis, sympathetic dystrophy
syndrome, glaucoma, cardiac arrythymias, erectile dysfunction,
Reynaud's syndrome, hypertension and urinary retention
(44,27,31,32,33,34,35,48). Further interest exists for subtype
selective alpha-1 agonists for the treatment of congestive heart
failure, nasal congestion, urinary incontinence and hypotension
(45,46,47,48). In each case, a more selective drug is expected to
reduce the side effects which presently limit this avenue of
therapy.
[0132] The following compounds were synthesized in order to
evaluate their ability to act as antagonists of
.alpha..sub.1-receptor function in human prostrate. The synthetic
methods used to synthesize are provided herein.
[0133] The following Experimental Details are set forth to aid in
an understanding of the invention, and are not intended, and should
not be construed, to limit in any way the invention set forth in
the claims which follow thereafter.
[0134] Experimental Details.
[0135] Prazosin and 5-methylurapidil were obtained from Research
Biochemicals, Inc. A30360
(4-fluoro-4-(8-fluoro-1,3,4,5-tetrahydro-2H-pyr-
ido[4,3-b]indol-2-yl)butyrophenone hydrochloride) was obtained from
Aldrich Chemical Co. Other compounds were prepared according to the
examples which follow.
EXAMPLE 1
[0136] Synthesis of Terazosin Hydrochloride
[0137] N-(2-Furoyl)piperazine
[0138] This compound and its preparation has been described in
Great Britain Patents 1,390,014 and 1,390,015.
[0139] Piperazine hexahydrate (194 g, 1 mole) was dissolved in 250
ml H.sub.2O. The solution was acidified to pH 4.5 with 6 N HCl.
Furoyl chloride (130.5 g, 1 mole, Aldrich) was added along with 10%
NaOH solution at such a rate that the pH was maintained at 4.5.
After 1 hour, the solution was made basic (pH=8.5) with NaOH
solution. The reaction mixture was continuously extracted with
chloroform for 36 hours. The CHCl.sub.3 extract was dried over
MgSO.sub.4, and filtered. Distillation gave 108.2 g product (60%),
b.p. 132.degree.-138.degree. C./0.6 mm Hg, m.p.
69.degree.-70.degree. C.
[0140] N-(Tetrahydro-2-furoyl)piperazine
[0141] The furoylpiperazine of Example 1 was converted to the
hydrobromide salt (m.p. 173.degree.-175.degree. C.). This salt
(39.0 g) in 250 ml methyl alcohol and 9.0 g Raney nickel was
hydrogenated at 3 atm. After uptake of H.sub.2 ceased, the catalyst
was filtered, the solvent concentrated, and the residue
crystallized from isopropyl alcohol to give 35.2 g.
tetrahydrofuroylpiperazine HBr, m.p. 152.degree.-156.degree. C.
This was suspended in 20 ml H.sub.2O. Then 10.5 g 50%, NaOH
solution was added slowly followed by 2.0 g solid Na.sub.2CO.sub.3.
This was extracted with 4.times.100 ml portions of warm CHCl.sub.3.
The CHCl.sub.3 extractions were distilled to give 22.5 g
tetrahydrofurolylpiperazine, b.p. 120.degree.-125.degree. C./0.2 mm
Hg.
[0142]
2[4-(Tetrahydro-2-furoyl)piperazinyl]-4-amino-6,7-dimethoxyquinazol-
ine Hydrochloride
[0143] To 7.00 g 2-chloro-4-amino-6,7-dimethoxyquinazoline
(Lancaster Synthesis) in 50 ml methoxyethanol was added 10.8 g,
tetrahydrofurolylpiperazine, and the mixture refluxed 3 hours. The
clear solution was concentrated and an aqueous solution of
potassium bicarbonate was added. The resultant solid that formed
was filtered and washed with water. It was then added to methanol
and the resulting suspension was acidified with a solution of
hydrogen chloride in isopropyl alcohol. The resulting solution was
concentrated and the residue crystallized from isopropyl alcohol
giving 8.12 g. of product, m.p. 278.degree.-279.degree. C.
EXAMPLE 2
[0144] Preparation of Indoramin
[0145] 4-Benzamido-1-[2-(3-indolyl)ethylpyridinium Bromide
[0146] A solution of 4-benzamidopyridine (1.98 g) and
3-(2-bromoethyl)indole (2.24 g) in EtOH (15 ml) was refluxed for 2
hours, and the crystallized product (3.13 g, mp 264-266.degree. C.)
was collected by filtration from the hot reaction mixture.
Recyrstallization gave the hydrate.
[0147] 3-[2-4-Benzamidopiperid-1-yl)ethyl]indole (Indoramin)
[0148] 4-Benzamido-1-[2-(3-indolyl)ethyl]pyridinium bromide (3.0 g)
in 91% EtOH (300 ml) containing Et.sub.3N (0.8 g) was hydrogenated
in the presence of freshly prepared W-7 Raney Ni catalyst (ca. 3 g)
at 28.12 kg/cm.sup.2 and 50.degree. for 4 hours. After filtering
off the catalyst, the filtrate was evaporated and the residue was
shaken with CHCl.sub.3 and 2 N NaOH. The resulting insoluble
material (1.61 g, mp 203-206.degree. C.) was collected and dried.
Recrystallization from EtOH gave the product (1.34 g), as colorless
needles.
EXAMPLE 3
[0149] Preparation of 1-(3-benzoylpropyl)-4-benzamidopiperidine
(Compound 9)
[0150] A mixture of 4-chlorobutyrophenone (447 mg, 2.45 mmol),
4-benzamidopiperidine (500 mg, 2.45 mmol) and K.sub.2CO.sub.3 (338
mg, 2.45 mmol) was heated up in boiling water bath for 1 hour. The
reaction mixture was portioned between water and CHCl.sub.3. The
organic layer was separated and dried over Na.sub.2SO.sub.4. After
filtration and removal of solvent, the residue was purified by
chromatography (SiO.sub.2, MeOH:CHCl.sub.3, 5:95).
Recrystallization from AcOEt/hexane gave a white powder (78 mg,
8.2%). mp 143-144.degree. C.; .sup.1H NMR (CD.sub.3OD, 400 MHz)
.delta. 1.65 (dq, J.sub.1=3.16 Hz, J.sub.2=11.9 Hz, 2H), 1.90-2.00
(m, 4H), 2.18 (t, J=11.9 Hz, 2H), 2.48 (m, 2H), 3.00-3.10 (m, 4H),
3.88 (m, 1H), 7.40-8.00 (m, 10H); Mass spectrum (M+1).sup.+ at m/z
351.
EXAMPLE 4
[0151] Preparation of
1-[3-(4-chlorobenzoyl)propyl]-4-benzamidopiperidine (Compound
7)
[0152] A mixture of 3-(4-chlorobenzol)propyl bromide (640 mg, 2.45
mmol), 4-benzamidopiperidine (500 mg, 2.45 mmol) and
K.sub.2CO.sub.3 (1.01 g, 7.34 mmol) in 50 ml of acetone was heated
up to refluxing condition for 48 hours. The solid was removed by
filtration. Concentration of filtrate in vacuo gave a yellowish
solid, which was purified by chromatography (SiO.sub.2,
MeOH:CHCl.sub.3, 5:95). 320 mg (33.9%) of white powder was obtained
.sup.1H NMR (CDCl.sub.3, 300 mHz) .delta. 1.46 (dq, J.sub.1=1.0 Hz,
J.sub.2=8.4 Hz, 2H), 1.90-2.10 (m, 4H), 2.16 (m, 2H), 2.43 (t,
J=6.9 Hz, 2H), 2.80-2.90 (m, 2H), 2.97 (t, J=6.9 Hz, 2H), 3.97 (m,
1H), 5.92 (d, J=7.8 Hz, 1H, N--H), 7.40-8.00 (m, 9H); Product was
converted to HCl salt and recrystallized with MeOH/Et20, mp
243-244.degree. C.; Calcd for
C.sub.22H.sub.25ClN.sub.2O.sub.2.HCl.H.sub.2O: C 60.15, H 6.37, N
6.37; Found: C 60.18, H 6.34, N6.29.
EXAMPLE 5
[0153] Preparation of SKF-104856
[0154] 1-[(4-Chlorophenyl)thio}-2-propanone
[0155] Chloroacetone (32.3 g, 0.347 mol) was added to a mixture of
4-chlorothiophenol (50 g, 0.347 mmol) and sodium hydroxide (14 g,
0.347 mol) in water (400 ml) and the mixture was stirred at
25.degree. C. for 1 hour. The mixture was extracted with ethyl
ether and the organic phase was washed with water, dried with
magnesium sulfate and concentrated to give 69 g (99%) of
1-[(4-chlorophenyl)thio]-2-propanone.
[0156] 5-Chloro-3-methylbenzo(b)thiophene
[0157] 1-[(4-Cholorophenyl)thio}-2-propanone (50 g, 0.25 mol) was
added to polyphosphoric acid (300 g) and the mixture was stirred as
the temperature was gradually raised to 120.degree. C. as an
exotherm started. The mixture was stirred at 130.degree. C. for 1
hour, diluted with water, extracted with ethyl ether and the
organic phase was dried and concentrated. The residue was stirred
in methanol (200 ml), filtered and the filtrate concentrated to
give 17.5 g (40%) of 5-chloro-3-methylbenzo(b)thiophene: bp
120.degree. C. (0.6 mm Hg).
[0158] Ethyl 5-chloro-3-methylbenzo(b)thiophene-2-carboxylate
[0159] n-Butyllithium in hexane (2.6 M, 2.3 ml) was added to a
solution of 5-chloro-3-methylbenzo(b)thiophene (1,0 g, 6 mmol) in
ethyl ether (20 ml) stirred at 0.degree. C. under argon. The
mixture was stirred for 30 minutes and transferred slowly under
argon pressure to a stirred solution of ethyl chloroformate (0.63
g, 6 mmol) in ethyl ether (20 ml). The mixture was stirred at
0.degree. C. for 30 minutes and at 25.degree. C. for 1.5 hours. The
mixture was treated with water and the organic phase was dried,
concentrated and triturated with hexane to give 1.0 g (67%) of
ethyl 5-chloro-3-methylbenzo(b)thiophene-2-carboxylate: mp
92.5-94.degree. C.
[0160] Ethyl
3-bromomethyl-5-chlorobenzo(b)thiophene-2-carboxylate
[0161] A mixture of ethyl
5-chloro-3-methylbenzo(b)thiophene-2-carboxylate (9.0 g, 0.035
mol), N-bromosuccinimide (6.53 g, 0.037 mol) and benzoyl peroxide
(130 mg) in carbon tetrachloride (150 ml) was refluxed and
illuminated with sunlamp for 2 hours. The resulting suspension was
cooled, filtered and the filter cake was triturated with methanol
to give 9.9 g, (85%) of the methanol-insoluble ethyl
3-bromomethyl-5-chlorobenzo(- b)thiophene-2-carboxylate: mp
148-150.degree. C.
[0162] Ethyl
5-Chloro-3-[N-(2,2-dimethoxyethyl)-N-methyl(aminomethyl)]benz-
ol(b)thiophene-2-carboxylate
[0163] A mixture of ethyl
3-bromomethyl-5-chlorobenzo(b)thiophene-2-carbox- ylate (11 g,
0.033 mol), methylaminoacetaldehyde dimethyl acetal (4.76 g, 0.04
mol) and potassium carbonate (11.4 g, 0.8 mol) in dry acetone (200
ml) was stirred for 48 hours, filtered and the filtrate
concentrated to give 11.8 g, (96%) of ethyl
5-chloro-3-(N-2,2-dimethoxyethyl)-N-methyl(am-
inomethyl)benzol(b)thiophene-2-carboxylate.
[0164] Ethyl
7-chloro-3,4-dihydro-4-methylthieno[4,3,2-ef]-[3]benzazepine--
2-carboxylate
[0165] Ethyl
5-chloro-3-[N-(2,2-dimethoxyethyl)-N-methyl(aminomethyl)]benz-
o[b]thiophene-2-carboxylate (3.0 g, 8.1 mmol) was added in portions
to trifluoromethanesulfonic acid (10 ml) stirred at 0.degree. C.
under argon. The mixture was stirred at 25.degree. C. for 45
minutes and diluted with water. The mixture was basified with
aqueous sodium hydroxide and extracted with ethyl ether to give
ethyl
7-chloro-3,4-dihydro-4-methylthieno-[4,3,2-ef][3]benzazepine-2-carboxylat-
e.
[0166] Ethyl
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef][3]benzaz-
epine-2-carboxylate
[0167] Diborane in tetrahydrofuaran (1 M, 40 ml) was added to a
solution of ethyl
7-chloro-3,4-dihydro-4-methylthieno[4,3,2-ef][3]benzazepine-2-ca-
rboxylate (2.8 g) in tetrahydrofuran (30 ml) stirred at 0.degree.
C. The mixture was refluxed for 3 hours and stirred at 25.degree.
C. for 18 hours, cooled, treated with methanol (50 ml), refluxed
for 18 hours and concentrated. The residue was triturated with
ethyl ether-hexane (3:1) to give 1.6 g (84%) of ethyl
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,-
2-ef][3]benzazepine-2-carboxylate:mp 138-140.degree. C. The free
base was treated with hydrogen chloride to give ethyl
7-chloro-3,4,5,6-tetrahydro--
4-methylthieno[4,3,2-ef][3]benzazepine-2-carboxylate hydrochloride:
mp 240.degree. C.
[0168]
7-Chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef][3]benzazepine--
2-methanol
[0169] A solution of ethyl
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4.3.-
2-ef][3]benzazepine-2-carboxylate (4.0 g, 12.9 mmol), in ethyl
ether (48 ml) was treated with lithium aluminum hydride (0.53 g, 14
mmol). The mixture was stirred for 1.5 hours, cooled and treated
carefully with water (2.0 ml), 10% sodium hydroxide (1.0 ml) and
water (2.0 ml). The resulting mixture was filtered and the solvent
evaporated to give 1.9 g (57%) of
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef][3)benzazepi-
ne-2-methanol: mp 184-185.degree. C.
[0170]
7-Chloro-3,4,5,6-tetrahydro-4-methylthieno-4,3,2-ef][3]benzazepine--
2-carboxaldehyde
[0171] A solution of
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef][-
3]benzazepine-2-methanol (1.6 g, 6 mmol) in dichloromethane (150
ml) was stirred under argon with activated manganese dioxide (8.3
g) for 2 hours. The mixture was filtered through Celite and the
filtrate was dried with magnesium sulfate and concentrated to give
a 63% yield of
7-chloro-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef[[3]benzazepine-2-carb-
oxaldehyde.
[0172]
7-Chloro-2-ethenyl-3,4,5,6-tetrahdyro-4-methylthieno[4,3,2-ef][3]be-
nzazepine (SKF-104856)
[0173] Sodium hydride (60% dispersion in mineral oil. 3.8 mmol) was
added to a stirred solution of methyltriphenylphosphonium bromide
(1.35 g, 3.8 mmol) in dry tetrahydrofuran (30 ml) and stirred for
15 minutes. The mixture was treated with a solution of
7-chloro-3,4,5,6-tetrahydro-4-meth-
ylthieno[4,3,2-ef][3]-benzazepine-2-carboxaldehyde, prepared as in
Example 3, (0.5 g, 1.9 mmol) in dimethylformamide (4 ml), stirred
at 25.degree. C. for 16 hours, quenched with ice and extracted with
ethyl acetate. The organic phase was washed, dried and concentrated
and the residue was chromatographed on silica gel eluted with a
gradient of methylene chloride to methanol-methylene chloride
(3.5:96.5). The product was treated with hydrogen chloride to give
0.2 g (35%) of
7-chloro-2-ethenyl-3,4,5,6-tetrahydro-4-methylthieno[4,3,2-ef][3]benzazep-
ine hydrochloride: mp 234-236.degree. C.
[0174] The following is an example of the use of the cloned Human
.alpha..sub.1 adrenergic receptors to identify the relevant
.alpha..sub.1-Receptor subtype for the therapy of Benign Prostatic
Hypertrophy.
EXAMPLE 6
[0175] Protocol for the Determination of the Potency of
.alpha..sub.1 Antagonists
[0176] The activity of compounds at the different human receptors
was determined in vitro using cultured cell lines that selectively
express the receptor of interest. These cell lines were prepared by
transfecting the cloned cDNA or cloned genomic DNA or constructs
containing both genomic DNA and cDNA encoding the human
.alpha.-adrenergic, serotonin, histamine, and dopamine receptors as
follows:
[0177] .alpha..sub.1A Human Adrenergic Receptor: The entire coding
region of .alpha.1A (1719 bp), including 150 basepairs of 5'
untranslated sequence (5' UT) and 300 bp of 3' untranslated
sequence (3' UT), was cloned into the BamHI and ClaI sites of the
polylinker-modified eukaryotic expression vector pCEXV-3, called
EXJ.HR. The construct involved the ligation of partial overlapping
human lymphocyte genomic and hippocampal cDNA clones: 5' sequence
were contained on a 1.2 kb SmaI-XhoI genomic fragment (the
vector-derived BamHI site was used for subcloning instead of the
internal insert-derived SmaI site) and 3' sequences were contained
on an 1.3 kb XhoI-ClaI cDNA fragment (the ClaI site was from the
vector polylinker). Stable cell lines were obtained by
cotransfection with the plasmid .alpha.1A/EXJ (expression vector
containing the .alpha.1A receptor gene) and the plasmid pGCcos3neo
(plasmid containing the aminoglycoside transferase gene) into
LM(tk.sup.-), CHO, and NIH3T3 cells, using calcium phosphate
technique. The cells were grown, in a controlled environment
(37.degree. C., 5% CO.sub.2), as monolayers in Dulbecco's modified
Eagle's Medium (GIBCO, Grand Island, N.Y.) containing 25 mM glucose
and supplemented with 10% bovine calf serum, 100 units/ml
penicillin g, and 100 .mu.g/ml streptomycin sulfate. Stable clones
were then selected for resistance to the antibiotic G-418 (1
mg/ml), and membranes were harvested and assayed for their ability
to bind [.sup.3H]prazosin as described below (see "Radioligand
Binding assays").
[0178] .alpha..sub.1B Human Adrenergic Receptor: The entire coding
region of .alpha.1B (1563 bp), including 200 basepairs and 5'
untranslated sequence (5' UT) and 600 bp of 3' untranslated
sequence (3' UT), was cloned into the EcoRI site of pCEXV-3
eukaryotic expression vector. The construct involved ligating the
full-length containing EcoRI brainstem cDNA fragment from .lambda.
ZapII into the expression vector. Stable cell lines were selected
as described above.
[0179] .alpha..sub.1CHuman Adrenergic Receptor: The entire coding
region of .alpha.1C (1401 bp), including 400 basepairs of 5'
untranslated sequence (5' UT) and 200 bp of 3' untranslated
sequence (3' UT), was cloned into the KpnI site of the
polylinker-modified pCEXV-3-derived eukaryotic expression vector,
EXJ.RH. The construct involved ligating three partial overlapping
fragments: a 5' 0.6 kb HincII genomic clone, a central 1.8 EcoRI
hippocampal cDNA clone, and a 3' 0.6 Kb PstI genomic clone. The
hippocampal cDNA fragment overlaps with the 5' and 3' genomic
clones so that the HincII and PstI sites at the 5' and 3' ends of
the cDNA clone, respectively, were utilized for ligation. This
full-length clone was cloned into the KpnI site of the expression
vector, using the 5' and 3' KpnI sites of the fragment, derived
from vector (i.e., pBluescript) and 3'-untranslated sequences,
respectively. Stable cell lines were selected as described
above.
[0180] Radioligand Binding Assays: Transfected cells from culture
flasks were scraped into 5 ml of 5 mM Tris-HCl, 5 mM EDTA, pH 7.5,
and lysed by sonication. The cell lysates were centrifuged at 1000
rpm for 5 min at 4.degree. C., and the supernatant was centrifuged
at 30,000.times. g for 20 min at 4.degree. C. The pellet was
suspended in 50 mM Tris-HCl, 1 mM MgCl.sub.2, and 0.1% ascorbic
acid at pH 7.5. Binding of the .alpha..sub.1 antagonist
[.sup.3H]prazosin (0.5 nM, specific activity 76.2 Ci/mmol) to
membrane preparations of LM(tk-) cells was done in a final volume
of 0.25 ml and incubated at 37.degree. C. for 20 min. Nonspecific
binding was determined in the presence of 10 .mu.M phentolamine.
The reaction was stopped by filtration through GF/B filters using a
cell harvester. Inhibition experiments, routinely consisting of 7
concentrations of the tested compounds, were analyzed using a
non-linear regression curve-fitting computer program to obtain Ki
values.
EXAMPLE 7
[0181] Functional Properties of .alpha..sub.1 Antagonists in the
Human Prostate
[0182] The efficacy of .alpha..sub.1 adrenergic antagonists for the
treatment of benign prostatic hyperplasia (BPH) is related to their
ability to elicit relaxation of prostate smooth muscle. An index of
this efficacy can be obtained by determining the potency of
.alpha..sub.1 antagonists to antagonize the contraction of human
prostatic tissue induced by an .alpha..sub.1 agonist "in vitro".
Furthermore, by comparing the potency of subtype selective
.alpha..sub.1 antagonists in binding assays using human
.alpha..sub.1 receptors with their potency to inhibit
agonist-induced smooth muscle contraction, it is possible to
determine which of the .alpha..sub.1 adrenergic receptor subtypes
is involved in the contraction of prostate smooth muscle.
[0183] Methods: Prostatic adenomas were obtained at the time of
surgery from patients with symptomatic BPH. These were cut into
longitudinal strips of 15 mm long and 2-4 mm wide, and suspended in
5 ml organ baths containing Krebs buffer (pH 7.4). The baths were
maintained at 37.degree. C. and continuously oxygenated with 5%
CO.sub.2 and 95% O.sub.2. Isometric tension was measured with a
Grass Instrument FT03 force transducer interfaced with a
computer.
[0184] Tissue strips were contracted with varying concentrations of
phenylephrine after incubating for 20 minutes in the absence and
presence of at least three different concentrations of antagonist.
Dose-response curves for phenylephrine were constructed, and the
antagonist potency (pA.sub.2) was estimated by the dose-ratio
method. The concentration of some antagonists in the tissue bath
was assessed by measuring the displacement of [3H]prazosin by
aliquots of the bath medium, using membrane preparations of the
cloned human .alpha..sub.1C receptor. This control was necessary to
account for losses of antagonist due to adsorption to the tissue
bath and/or metabolism during the time the antagonists were
equilibrated with the prostate tissue.
[0185] Results:
[0186] Table 3 shows that the pA.sub.2 values measured for a series
of .alpha..sub.1 antagonists in human prostate tissue correlate
closely (r=0.76) with the corresponding pK.sub.i values measured in
the .alpha..sub.1C receptor assays. In contrast, the human prostate
pA.sub.2 values correlate poorly with the pK.sub.i values measured
at the .alpha..sub.1A (r=-0.06) and .alpha..sub.1B (r=-0.24)
adrenergic receptors. (See FIG. 7.) Thus, antagonists which are
more potent at blocking the .alpha..sub.1c adrenergic receptor are
more effective at blocking the contraction of the human prostate
than antagonists which are more potent at the .alpha..sub.1A or
.alpha..sub.1B adrenergic receptors. In addition, antagonists which
are selective for the .alpha..sub.1C receptor will have a better
therapeutic ratio than nonselective a antagonists.
3TABLE 3 COMPARISOM OF THE BINDING POTENCY (pK.sub.1) OF ALPHA-1
ANTAGONISTS IN CLONED HUMAN RECEPTORS AND THEIR PROTENCY (pA.sub.2)
TO INHIBIT PROSTATE SMOOTH MUSCLE CONTRACTION Human Alpha-1
Adrenergic (pK.sub.1) Human Compound a1A a1B a1C Prostate (pA) 1
Prazosin 9.48 9.26 9.23 9.08 3 A-30360 7.49 7.86 8.52 8.72 4
5-Methyl-Urapidil 7.79 6.77 8.35 8.38 5 Indoramin 6.74 7.39 8.35
7.86 6 SKF-104856 8.48 7.50 7.60 7.66 7 Compound 7 6.82 7.18 8.42
7.63 9 Compound 9 6.12 6.76 7.83 7.41 10 Terazosin 8.46 8.71 8.16
7.30
REFERENCES
[0187] 1.--Borden, L. A., Maxfield, F. R., Goldman, J. E., and
Shelanski, M. L., Neurobiol. Aging., 13, 33-38, 1991.
[0188] 2.--Bruno, J. F., J. Whittaker, J. Song, and M. Berelowitz.
Biochem. Biophys. Res. Comm. 179, 1485-1490 (1991).
[0189] 3.--Bush, A. W., Borden, L. A., Greene, L. A., and Maxfield,
F. R., J. Neurochem. 57, 562-574, 1991.
[0190] 4.--Cotecchia, S., Schwinn, D. A., Randall, R. R.,
Lefkowitz, R. J., Caron, M. G., and Kobilka, B. K., Proc. Natl.
Acad. Sci. USA, 85, 7159-7163, 1988.
[0191] 5.--Feinberg, A. P., and B. Vogelstein. Anal. Biochem. 132,
6-13 (1983).
[0192] 6.--Flavahan, N. A. and Vanhoutte, P. M., In: The Alpha-1
Adrenergic Receptors, (ed. by R. R. Ruffolo, Jr., Humana Press,
Clifton N.J.) pp. 351-403, 1987.
[0193] 7.--Forray, C., and El-Fakahany, E. E., Mol. Pharmacol., 37,
893-902, 1990.
[0194] 8.--Graziadei, I., Zernig, G., Boer, R., and Glossman, H.,
Eur. J. Pharmacol. 172, 329-337, 1989.
[0195] 9.--Gross, G., Hanft, G., and Rugevics, C., Eur. J.
Pharmacol., 151,333-335, 1989.
[0196] 10.--Hieble, J. P., Sarau, H. M., Foley, J. J., DeMarinis,
R. M., and Pendleton, P. G., Naunyn-Schmiedeberg's Arch.
Pharmacol., 318, 267-273, 1982.
[0197] 11.--Langer, S. Z., Pharmacol. Rev., 32, 377-360, 1980.
[0198] 12.--Lomasney, J. W., Cotecchia, S., Lorenz, W., Leung, W.
-Y., Schwinn, D. A., Yang-Feng, T. L., Brownstein, M., Lefkowitz,
R. J., and Caron, M., J. Biol. Chem., 266, 6365-6369, 1991.
[0199] 13.--Miller, J. and R. N. Germain. J. Exp. Med. 164,
1478-1489 (1986).
[0200] 14.--Minneman, K. P., Pharmacol. Rev., 40, 87-119, 1988.
[0201] 15.--Morrow, A. L., and Creese, I., Mol. Pharmacol., 29,
321-330, 1986.
[0202] 16.--Perez, D. M., M. T. Piascik, and R. M. Graham. Mol.
Pharmacol. 40, 876-883 (1991).
[0203] 17.--Sambrook, J., Fritsch, E. F., and Maniatis, T., In:
Molecular Cloning: A Laboratory Manual, 2 Edition (Cold Spring
Harbor Lab., Cold Spring Harbor, N.Y.), 1989.
[0204] 18.--Sanger, S. Proc. Natl. Acad. Sci. USA 74, 5463-5467
(1977).
[0205] 19.--Sawutz, D. G., S. M. Lanier, C. D. Warren, and R. M.
Graham. Mol. Pharmacol. 32, 565-571 (1987).
[0206] 20.--Schwinn, D. A., Lomasney, J. W., Lorenz, W., Szklut, P.
J., Fremeau, R. T., Yang-Feng, T. L., Caron, M. G., Lefkowitz, R.
J. and Cotecchia, S., J. Biol. Chem., 265, 8183-8189, 1990.
[0207] 21.--Schwinn, D. A., Page, S. A., Middleton, J. P., Lorenz,
W., Liggett, S. B., Yamamoto, E., Lapetina, E. G., Caron, M. G.,
Lefkowitz, R. J., and Cotecchia, S., Mol. Pharmacol., 40, 619-626,
1991.
[0208] 22.--Southern, E. M. J. Mol. Biol. 98,503-505 (1975).Starke,
S., Rev. Physiol. Biochem. Pharmacol., 88, 199-236, 1981.
[0209] 23.--Timmermans, P. B. M. W. M., Karamat Ali, F., Kwa, H.
Y., Schoop, A. M. C., Slothorst-Grisdijk, F. P., and van Zwieten,
P. A., Mol. Pharmacol., 20, 295-301, 1981.
[0210] 24.--Timmermans, P. B. M. W. M., and Thoolen. M. J. M. C.,
In: The Alpha-1 Adrenergic Receptors, (ed. by R. R. Ruffolo, Jr.,
Humana Press, Clifton N.J.) pp. 113-187, 1987.
[0211] 25.--Voigt, M. M., J. Kispert, and H. Chin. Nucleic Acid
Res. 18, 1053 (1990).
[0212] 26.--Weinshank, R. L., Zgombick, J. M., Macchi, M., Adham,
N., Lichtblau, H., Branchek, T. A., and Hartig, P. R., Mol.
0Pharmacol., 38, 681-688, 1990.
[0213] 27.--Cohen, J., (1993) J. Clin. Pharmacol., 33, 272-278.
[0214] 28.--Manning, A. S. and Hearse, D. J., (1984) J. Mol. Cell
Cardiol., 16: 497-518.
[0215] 29.--Benfey, B. G., (1992) Can. J. Physiol. Pharmacol., 71:
103-111.
[0216] 30.--Cubeddu, L. X., (1984) American Heart Journal, 116:
133-161.
[0217] 31.--Nishimura, K., Kuwayama, Y., Matsugi, T., Sun, N., and
Shirasawa, E., (1993) Investigative Ophthal. & Visual Sci., 34:
1761-1765.
[0218] 32.--Kincaid-Smith, P., (1989) Journal of Human
Hypertension, 2743: 75-83.
[0219] 33.--Ames, R. P. and Kiyasu, J. Y., (1989) J. Clin.
Pharmacol., 29: 123-127.
[0220] 34.--Pool, J. L., (1991) Am. Heart J., 121: 251-260.
[0221] 35.--Christ, G. J., Schwartz, C. B., Stone, B. A., Parker,
M., Janis, M., Gondre, M., Valcic, M., and Melman, A., (1992) Amer.
Physiological Soc., H15-H20.
[0222] 36.--Rosenthal, J., (1989) Journal of Human Hypertension, 3:
85-91.
[0223] 37.--Kowala, M. C. and Nicolosi, R. J., (1989) Journal of
Cardiovascular Pharm., 13: 545-549.
[0224] 38.--Nash, D. T., (1990) Clin. Cardiol., 13: 764-772.
[0225] 39.--Waite, M. A., (1991) Journal of Internal Medicine, 229:
113-117.
[0226] 40.--Achari, R. and Laddu, A., (1992) J. Clin. Pharm., 32:
520-523.
[0227] 41.--Kowala, M. C., Nunnari, J. J., Durham, S. K., and
Nicolosi, R. J., (1991) Athersclerosis, 91: 35-39.
[0228] 42.--Krupp, M. N., Hoover, K. W., and Valentine, J. J.,
(1989) Journal of Cardiovascular Pharm., 13: 511-519.
[0229] 43.--Jansen, H., Lammers, R., Baggen, M. G. A., and
Birkenhager, J. C., (1989) Journal of Cardiovascular Pharm., 13:
S5-S10.
[0230] 44.--Joint National Committee on Detection, Evaluation, and
Treatment of High Blood Pressure, (1993) Archives of Internal
Medicine, 163: 164-183.
[0231] 45.--Sourander, L. B., (1990) Gerontology, 36: 19-25.
[0232] 46.--Empey, D. W. and Medder, K. T., (1988) Drugs, 35:
438-443.
[0233] 47.--Andersson, K. E., (1988) Drugs, 35: 477-494.
[0234] 48.--MacDonald, E., Ruskoaho, H., Scheinen, M. and Virtanen,
R., (1988) Annals of Clin. Res., 20: 298-310.
[0235] 49.--Lepor, H., R. Tan, S. Meretyk, and E. Shapiro.
Alpha.sub.1 adrenoceptor subtypes in the human prostate. J. Urol.
149:640-642 (1993).
[0236] 50.--Lepor, H., S. Auerbach, A Puras-Baez, P. Narayan, M.
Soloway, F. Lowe, T. Moon, G. Leifer, and P. Madsen. A randomized,
placebo-controlled multicenter study of the efficacy and safety of
teazosin in the treatment of benign porstatic hyperplasia. J. Urol.
148:1467-4174 (1992).
[0237] 51.--Price, D. T., R. J. Lefkowitz, M. G. Caron, and D. A.
Schwinn. Alpha.sub.1-adrenergic receptor mRNA expression in human
tissues. FASEB J. 7:A141 (1993).
Sequence CWU 1
1
23 1 2140 DNA Homo sapiens 1 ccgggccagg cacgtccgct ctcggacagc
cgctccgcgt cacaggaact tgggcaggac 60 ccgacgggac ccgtgcgcgg
agctgcatct ggagccccgc ggctatgccc tgtgctcccc 120 tcctgccggc
cgctcgttct gtgcccccgg cccggccacc gacggccgcg cgttgagatg 180
actttccgcg atctcctgag cgtcagtttc gagggacccc gcccggacag cagcgcaggg
240 ggctccagcg cgggcggcgg cgggggcagc gcgggcggcg cggccccctc
ggagggcccg 300 gcggtgggcg gcgtgccggg gggcgcgggc ggcggcggcg
gcgtggtggg cgcaggcagc 360 ggcgaggaca accggagctc cgcgggggag
ccggggagcg cgggcgcggg cggcgacgtg 420 aatggcacgg cggccgtcgg
gggactggtg gtgagcgcgc agggcgtggg cgtgggcgtc 480 ttcctggcag
ccttcatcct tatggccgtg gcaggtaacc tgcttgtcat cctctcagtg 540
gcctgcaacc gccacctgca gaccgtcacc aactatttca tcgtgaacct ggccgtggcc
600 gacctgctgc tgagcgccac cgtactgccc ttctcggcca ccatggaggt
tctgggcttc 660 tgggcctttg gccgcgcctt ctgcgacgta tgggccgccg
tggacgtgct gtgctgcacg 720 gcctccatcc tcagcctctg caccatctcc
gtggaccggt acgtgggcgt gcgccactca 780 ctcaagtacc cagccatcat
gaccgagcgc aaggcggccg ccatcctggc cctgctctgg 840 gtcgtagccc
tggtggtgtc cgtagggccc ctgctgggct ggaaggagcc cgtgccccct 900
gacgagcgct tctgcggtat caccgaggag gcgggctacg ctgtcttctc ctccgtgtgc
960 tccttctacc tgcccatggc ggtcatcgtg gtcatgtact gccgcgtgta
cgtggtcgcg 1020 cgcagcacca cgcgcagcct cgaggcaggc gtcaagcgcg
agcgaggcaa ggcctccgag 1080 gtggtgctgc gcatccactg tcgcggcgcg
gccacgggcg ccgacggggc gcacggcatg 1140 cgcagcgcca agggccacac
cttccgcagc tcgctctccg tgcgcctgct caagttctcc 1200 cgtgagaaga
aagcggccaa gactctggcc atcgtcgtgg gtgtcttcgt gctctgctgg 1260
ttccctttct tctttgtcct gccgctcggc tccttgttcc cgcagctgaa gccatcggag
1320 ggcgtcttca aggtcatctt ctggctcggc tacttcaaca gctgcgtgaa
cccgctcatc 1380 tacccctgtt ccagccgcga gttcaagcgc gccttcctcc
gtctcctgcg ctgccagtgc 1440 cgtcgtcgcc ggcgccgccg ccctctctgg
cgtgtctacg gccaccactg gcgggcctcc 1500 accagcggcc tgcgccagga
ctgcgccccg agttcgggcg acgcgccccc cggagcgccg 1560 ctggccctca
ccgcgctccc cgaccccgac cccgaacccc caggcacgcc cgagatgcag 1620
gctccggtcg ccagccgtcg aaagccaccc agcgccttcc gcgagtggag gctgctgggg
1680 ccgttccgga gacccacgac ccagctgcgc gccaaagtct ccagcctgtc
gcacaagatc 1740 cgcgccgggg gcgcgcagcg cgcagaggca gcgtgcgccc
agcgctcaga ggtggaggct 1800 gtgtccctag gcgtcccaca cgaggtggcc
gagggcgcca cctgccaggc ctacgaattg 1860 gccgactaca gcaacctacg
ggagaccgat atttaaggac cccagagcta ggccgcggag 1920 tgtgctgggc
ttgggggtaa gggggaccag agaggcgggc tggtgttcta agagcccccg 1980
tgcaaatcgg agacccggaa actgatcagg gcagctgctc tgtgacatcc ctgaggaact
2040 gggcagagct tgaggctgga gcccttgaaa ggtgaaaagt agtggggccc
cctgctggac 2100 tcaggtgccc agaactcttt tcttagaagg gagaggctgc 2140 2
572 PRT Homo sapiens 2 Met Thr Phe Arg Asp Leu Leu Ser Val Ser Phe
Glu Gly Pro Arg Pro 1 5 10 15 Asp Ser Ser Ala Gly Gly Ser Ser Ala
Gly Gly Gly Gly Gly Ser Ala 20 25 30 Gly Gly Ala Ala Pro Ser Glu
Gly Pro Ala Val Gly Gly Val Pro Gly 35 40 45 Gly Ala Gly Gly Gly
Gly Gly Val Val Gly Ala Gly Ser Gly Glu Asp 50 55 60 Asn Arg Ser
Ser Ala Gly Glu Pro Gly Ser Ala Gly Ala Gly Gly Asp 65 70 75 80 Val
Asn Gly Thr Ala Ala Val Gly Gly Leu Val Val Ser Ala Gln Gly 85 90
95 Val Gly Val Gly Val Phe Leu Ala Ala Phe Ile Leu Met Ala Val Ala
100 105 110 Gly Asn Leu Leu Val Ile Leu Ser Val Ala Cys Asn Arg His
Leu Gln 115 120 125 Thr Val Thr Asn Tyr Phe Ile Val Asn Leu Ala Val
Ala Asp Leu Leu 130 135 140 Leu Ser Ala Thr Val Leu Pro Phe Ser Ala
Thr Met Glu Val Leu Gly 145 150 155 160 Phe Trp Ala Phe Gly Arg Ala
Phe Cys Asp Val Trp Ala Ala Val Asp 165 170 175 Val Leu Cys Cys Thr
Ala Ser Ile Leu Ser Leu Cys Thr Ile Ser Val 180 185 190 Asp Arg Tyr
Val Gly Val Arg His Ser Leu Lys Tyr Pro Ala Ile Met 195 200 205 Thr
Glu Arg Lys Ala Ala Ala Ile Leu Ala Leu Leu Trp Val Val Ala 210 215
220 Leu Val Val Ser Val Gly Pro Leu Leu Gly Trp Lys Glu Pro Val Pro
225 230 235 240 Pro Asp Glu Arg Phe Cys Gly Ile Thr Glu Glu Ala Gly
Tyr Ala Val 245 250 255 Phe Ser Ser Val Cys Ser Phe Tyr Leu Pro Met
Ala Val Ile Val Val 260 265 270 Met Tyr Cys Arg Val Tyr Val Val Ala
Arg Ser Thr Thr Arg Ser Leu 275 280 285 Glu Ala Gly Val Lys Arg Glu
Arg Gly Lys Ala Ser Glu Val Val Leu 290 295 300 Arg Ile His Cys Arg
Gly Ala Ala Thr Gly Ala Asp Gly Ala His Gly 305 310 315 320 Met Arg
Ser Ala Lys Gly His Thr Phe Arg Ser Ser Leu Ser Val Arg 325 330 335
Leu Leu Lys Phe Ser Arg Glu Lys Lys Ala Ala Lys Thr Leu Ala Ile 340
345 350 Val Val Gly Val Phe Val Leu Cys Trp Phe Pro Phe Phe Phe Val
Leu 355 360 365 Pro Leu Gly Ser Leu Phe Pro Gln Leu Lys Pro Ser Glu
Gly Val Phe 370 375 380 Lys Val Ile Phe Trp Leu Gly Tyr Phe Asn Ser
Cys Val Asn Pro Leu 385 390 395 400 Ile Tyr Pro Cys Ser Ser Arg Glu
Phe Lys Arg Ala Phe Leu Arg Leu 405 410 415 Leu Arg Cys Gln Cys Arg
Arg Arg Arg Arg Arg Arg Pro Leu Trp Arg 420 425 430 Val Tyr Gly His
His Trp Arg Ala Ser Thr Ser Gly Leu Arg Gln Asp 435 440 445 Cys Ala
Pro Ser Ser Gly Asp Ala Pro Pro Gly Ala Pro Leu Ala Leu 450 455 460
Thr Ala Leu Pro Asp Pro Asp Pro Glu Pro Pro Gly Thr Pro Glu Met 465
470 475 480 Gln Ala Pro Val Ala Ser Arg Arg Lys Pro Pro Ser Ala Phe
Arg Glu 485 490 495 Trp Arg Leu Leu Gly Pro Phe Arg Arg Pro Thr Thr
Gln Leu Arg Ala 500 505 510 Lys Val Ser Ser Leu Ser His Lys Ile Arg
Ala Gly Gly Ala Gln Arg 515 520 525 Ala Glu Ala Ala Cys Ala Gln Arg
Ser Glu Val Glu Ala Val Ser Leu 530 535 540 Gly Val Pro His Glu Val
Ala Glu Gly Ala Thr Cys Gln Ala Tyr Glu 545 550 555 560 Leu Ala Asp
Tyr Ser Asn Leu Arg Glu Thr Asp Ile 565 570 3 1738 DNA Homo sapiens
3 gccaggaggg cgcctctggg aagaagacca cgggggaagc aaagtttcag ggcagctgag
60 gagccttcgc cgcagccctt ccgagcccaa tcatccccca ggctatggag
ggcggactct 120 aagatgaatc ccgacctgga caccggccac aacacatcag
cacctgccca ctggggagag 180 ttgaaaaatg ccaacttcac tggccccaac
cagacctcga gcaactccac actgccccag 240 ctggacatca ccagggccat
ctctgtgggc ctggtgctgg gcgccttcat cctctttgcc 300 atcgtgggca
acatcctagt catcttgtct gtggcctgca accggcacct gcggacgccc 360
accaactact tcattgtcaa cctggccatg gccgacctgc tgttgagctt caccgtcctg
420 cccttctcag cggccctaga ggtgctcggc tactgggtgc tggggcggat
cttctgtgac 480 atctgggcag ccgtggatgt cctgtgctgc acagcgtcca
ttctgagcct gtgcgccatc 540 tccatcgatc gctacatcgg ggtgcgctac
tctctgcagt atcccacgct ggtcacccgg 600 aggaaggcca tcttggcgct
gctcagtgtc tgggtcttgt ccaccgtcat ctccatcggg 660 cctctccttg
ggtggaagga gccggcaccc aacgatgaca aggagtgcgg ggtcaccgaa 720
gaacccttct atgccctctt ctcctctctg ggctccttct acatccctct ggcggtcatt
780 ctagtcatgt actgccgtgt ctatatagtg gccaagagaa ccaccaagaa
cctagaggca 840 ggagtcatga aggagatgtc caactccaag gagctgaccc
tgaggatcca ttccaagaac 900 tttcacgagg acacccttag cagtaccaag
gccaagggcc acaaccccag gagttccata 960 gctgtcaaac tttttaagtt
ctccagggaa aagaaagcag ctaagacgtt gggcattgtg 1020 gtcggtatgt
tcatcttgtg ctggctaccc ttcttcatcg ctctaccgct tggctccttg 1080
ttctccaccc tgaagccccc cgacgccgtg ttcaaggtgg tgttctggct gggctacttc
1140 aacagctgcc tcaaccccat catctaccca tgctccagca aggagttcaa
gcgcgctttc 1200 gtgcgcatcc tcgggtgcca gtgccgcggc cgcggccgcc
gccgacgccg ccgccgccgt 1260 cgcctgggcg gctgcgccta cacctaccgg
ccgtggacgc gcggcggctc gctggagcgc 1320 tcgcagtcgc gcaaggactc
gctggacgac agcggcagct gcctgagcgg cagccagcgg 1380 accctgccct
cggcctcgcc gagcccgggc tacctgggcc gcggcgcgcc accgccagtc 1440
gagctgtgcg ccttccccga gtggaaggcg cccggcgccc tcctgagcct gcccgcgcct
1500 gagccccccg gccgccgcgg ccgccacgac tcgggcccgc tcttcacctt
caagctcctg 1560 accgagcccg agagccccgg gaccgacggc ggcgccagca
acggaggctg cgaggccgcg 1620 gccgacgtgg ccaacgggca gccgggcttc
aaaagcaaca tgcccctggc gcccgggcag 1680 ttttagggcc cccgtgcgca
gctttctttc cctggggagg aaaacatcgt ggggggga 1738 4 520 PRT Homo
sapiens 4 Met Asn Pro Asp Leu Asp Thr Gly His Asn Thr Ser Ala Pro
Ala His 1 5 10 15 Trp Gly Glu Leu Lys Asn Ala Asn Phe Thr Gly Pro
Asn Gln Thr Ser 20 25 30 Ser Asn Ser Thr Leu Pro Gln Leu Asp Ile
Thr Arg Ala Ile Ser Val 35 40 45 Gly Leu Val Leu Gly Ala Phe Ile
Leu Phe Ala Ile Val Gly Asn Ile 50 55 60 Leu Val Ile Leu Ser Val
Ala Cys Asn Arg His Leu Arg Thr Pro Thr 65 70 75 80 Asn Tyr Phe Ile
Val Asn Leu Ala Met Ala Asp Leu Leu Leu Ser Phe 85 90 95 Thr Val
Leu Pro Phe Ser Ala Ala Leu Glu Val Leu Gly Tyr Trp Val 100 105 110
Leu Gly Arg Ile Phe Cys Asp Ile Trp Ala Ala Val Asp Val Leu Cys 115
120 125 Cys Thr Ala Ser Ile Leu Ser Leu Cys Ala Ile Ser Ile Asp Arg
Tyr 130 135 140 Ile Gly Val Arg Tyr Ser Leu Gln Tyr Pro Thr Leu Val
Thr Arg Arg 145 150 155 160 Lys Ala Ile Leu Ala Leu Leu Ser Val Trp
Val Leu Ser Thr Val Ile 165 170 175 Ser Ile Gly Pro Leu Leu Gly Trp
Lys Glu Pro Ala Pro Asn Asp Asp 180 185 190 Lys Glu Cys Gly Val Thr
Glu Glu Pro Phe Tyr Ala Leu Phe Ser Ser 195 200 205 Leu Gly Ser Phe
Tyr Ile Pro Leu Ala Val Ile Leu Val Met Tyr Cys 210 215 220 Arg Val
Tyr Ile Val Ala Lys Arg Thr Thr Lys Asn Leu Glu Ala Gly 225 230 235
240 Val Met Lys Glu Met Ser Asn Ser Lys Glu Leu Thr Leu Arg Ile His
245 250 255 Ser Lys Asn Phe His Glu Asp Thr Leu Ser Ser Thr Lys Ala
Lys Gly 260 265 270 His Asn Pro Arg Ser Ser Ile Ala Val Lys Leu Phe
Lys Phe Ser Arg 275 280 285 Glu Lys Lys Ala Ala Lys Thr Leu Gly Ile
Val Val Gly Met Phe Ile 290 295 300 Leu Cys Trp Leu Pro Phe Phe Ile
Ala Leu Pro Leu Gly Ser Leu Phe 305 310 315 320 Ser Thr Leu Lys Pro
Pro Asp Ala Val Phe Lys Val Val Phe Trp Leu 325 330 335 Gly Tyr Phe
Asn Ser Cys Leu Asn Pro Ile Ile Tyr Pro Cys Ser Ser 340 345 350 Lys
Glu Phe Lys Arg Ala Phe Val Arg Ile Leu Gly Cys Gln Cys Arg 355 360
365 Gly Arg Gly Arg Arg Arg Arg Arg Arg Arg Arg Arg Leu Gly Gly Cys
370 375 380 Ala Tyr Thr Tyr Arg Pro Trp Thr Arg Gly Gly Ser Leu Glu
Arg Ser 385 390 395 400 Gln Ser Arg Lys Asp Ser Leu Asp Asp Ser Gly
Ser Cys Leu Ser Gly 405 410 415 Ser Gln Arg Thr Leu Pro Ser Ala Ser
Pro Ser Pro Gly Tyr Leu Gly 420 425 430 Arg Gly Ala Pro Pro Pro Val
Glu Leu Cys Ala Phe Pro Glu Trp Lys 435 440 445 Ala Pro Gly Ala Leu
Leu Ser Leu Pro Ala Pro Glu Pro Pro Gly Arg 450 455 460 Arg Gly Arg
His Asp Ser Gly Pro Leu Phe Thr Phe Lys Leu Leu Thr 465 470 475 480
Glu Pro Glu Ser Pro Gly Thr Asp Gly Gly Ala Ser Asn Gly Gly Cys 485
490 495 Glu Ala Ala Ala Asp Val Ala Asn Gly Gln Pro Gly Phe Lys Ser
Asn 500 505 510 Met Pro Leu Ala Pro Gly Gln Phe 515 520 5 1639 DNA
Homo sapiens 5 ccagccaaac cactggcagg ctccctccag ccgagacctt
ttattcccgg ctcccgagct 60 ccgcctccgc gccagcccgg gaggtggccc
tgacagccgg acctcgcccg gccccggctg 120 ggaccatggt gtttctctcg
ggaaatgctt ccgacagctc caactgcacc caaccgccgg 180 caccggtgaa
catttccaag gccattctgc tcggggtgat cttggggggc ctcattcttt 240
tcggggtgct gggtaacatc ctagtgatcc tctccgtagc ctgtcaccga cacctgcact
300 cagtcacgca ctactacatc gtcaacctgg cggtggccga cctcctgctc
acctccacgg 360 tgctgccctt ctccgccatc ttcgaggtcc taggctactg
ggccttcggc agggtcttct 420 gcaacatctg ggcggcagtg gatgtgctgt
gctgcaccgc gtccatcatg ggcctctgca 480 tcatctccat cgaccgctac
atcggcgtga gctacccgct gcgctaccca accatcgtca 540 cccagaggag
gggtctcatg gctctgctct gcgtctgggc actctccctg gtcatatcca 600
ttggacccct gttcggctgg aggcagccgg cccccgagga cgagaccatc tgccagatca
660 acgaggagcc gggctacgtg ctcttctcag cgctgggctc cttctacctg
cctctggcca 720 tcatcctggt catgtactgc cgcgtctacg tggtggccaa
gagggagagc cggggcctca 780 agtctggcct caagaccgac aagtcggact
cggagcaagt gacgctccgc atccatcgga 840 aaaacgcccc ggcaggaggc
agcgggatgg ccagcgccaa gaccaagacg cacttctcag 900 tgaggctcct
caagttctcc cgggagaaga aagcggccaa aacgctgggc atcgtggtcg 960
gctgcttcgt cctctgctgg ctgccttttt tcttagtcat gcccattggg tctttcttcc
1020 ctgatttcaa gccctctgaa acagttttta aaatagtatt ttggctcgga
tatctaaaca 1080 gctgcatcaa ccccatcata tacccatgct ccagccaaga
gttcaaaaag gcctttcaga 1140 atgtcttgag aatccagtgt ctctgcagaa
agcagtcttc caaacatgcc ctgggctaca 1200 ccctgcaccc gcccagccag
gccgtggaag ggcaacacaa ggacatggtg cgcatccccg 1260 tgggatcaag
agagaccttc tacaggatct ccaagacgga tggcgtttgt gaatggaaat 1320
ttttctcttc catgccccgt ggatctgcca ggattacagt gtccaaagac caatcctcct
1380 gtaccacagc ccgggtgaga agtaaaagct ttttgcaggt ctgctgctgt
gtagggccct 1440 caacccccag ccttgacaag aaccatcaag ttccaaccat
taaggtccac accatctccc 1500 tcagtgagaa cggggaggaa gtctaggaca
ggaaagatgc agaggaaagg ggaatatctt 1560 aggtaccata ccctggagtt
ctagaggatt cctcgacaag cttattccga tccagacatg 1620 atagatacat
tgatgagtt 1639 6 466 PRT Homo sapiens 6 Met Val Phe Leu Ser Gly Asn
Ala Ser Asp Ser Ser Asn Cys Thr Gln 1 5 10 15 Pro Pro Ala Pro Val
Asn Ile Ser Lys Ala Ile Leu Leu Gly Val Ile 20 25 30 Leu Gly Gly
Leu Ile Leu Phe Gly Val Leu Gly Asn Ile Leu Val Ile 35 40 45 Leu
Ser Val Ala Cys His Arg His Leu His Ser Val Thr His Tyr Tyr 50 55
60 Ile Val Asn Leu Ala Val Ala Asp Leu Leu Leu Thr Ser Thr Val Leu
65 70 75 80 Pro Phe Ser Ala Ile Phe Glu Val Leu Gly Tyr Trp Ala Phe
Gly Arg 85 90 95 Val Phe Cys Asn Ile Trp Ala Ala Val Asp Val Leu
Cys Cys Thr Ala 100 105 110 Ser Ile Met Gly Leu Cys Ile Ile Ser Ile
Asp Arg Tyr Ile Gly Val 115 120 125 Ser Tyr Pro Leu Arg Tyr Pro Thr
Ile Val Thr Gln Arg Arg Gly Leu 130 135 140 Met Ala Leu Leu Cys Val
Trp Ala Leu Ser Leu Val Ile Ser Ile Gly 145 150 155 160 Pro Leu Phe
Gly Trp Arg Gln Pro Ala Pro Glu Asp Glu Thr Ile Cys 165 170 175 Gln
Ile Asn Glu Glu Pro Gly Tyr Val Leu Phe Ser Ala Leu Gly Ser 180 185
190 Phe Tyr Leu Pro Leu Ala Ile Ile Leu Val Met Tyr Cys Arg Val Tyr
195 200 205 Val Val Ala Lys Arg Glu Ser Arg Gly Leu Lys Ser Gly Leu
Lys Thr 210 215 220 Asp Lys Ser Asp Ser Glu Gln Val Thr Leu Arg Ile
His Arg Lys Asn 225 230 235 240 Ala Pro Ala Gly Gly Ser Gly Met Ala
Ser Ala Lys Thr Lys Thr His 245 250 255 Phe Ser Val Arg Leu Leu Lys
Phe Ser Arg Glu Lys Lys Ala Ala Lys 260 265 270 Thr Leu Gly Ile Val
Val Gly Cys Phe Val Leu Cys Trp Leu Pro Phe 275 280 285 Phe Leu Val
Met Pro Ile Gly Ser Phe Phe Pro Asp Phe Lys Pro Ser 290 295 300 Glu
Thr Val Phe Lys Ile Val Phe Trp Leu Gly Tyr Leu Asn Ser Cys 305 310
315 320 Ile Asn Pro Ile Ile Tyr Pro Cys Ser Ser Gln Glu Phe Lys Lys
Ala 325 330 335 Phe Gln Asn Val Leu Arg Ile Gln Cys Leu Cys Arg Lys
Gln Ser Ser 340 345 350 Lys His Ala Leu Gly Tyr Thr Leu His Pro Pro
Ser Gln Ala Val Glu 355 360 365 Gly Gln His Lys Asp Met Val Arg Ile
Pro Val Gly Ser Arg Glu Thr 370 375 380 Phe Tyr Arg Ile Ser Lys Thr
Asp Gly Val Cys Glu Trp Lys Phe Phe 385 390 395 400 Ser Ser Met Pro
Arg Gly Ser Ala Arg Ile Thr Val Ser Lys Asp Gln 405 410 415 Ser Ser
Cys Thr Thr Ala Arg Val Arg Ser Lys Ser Phe Leu Gln Val 420 425
430 Cys Cys Cys Val Gly Pro Ser Thr Pro Ser Leu Asp Lys Asn His Gln
435 440 445 Val Pro Thr Ile Lys Val His Thr Ile Ser Leu Ser Glu Asn
Gly Glu 450 455 460 Glu Val 465 7 501 PRT Homo sapiens 7 Met Ala
Ala Ala Leu Arg Ser Val Met Met Ala Gly Tyr Leu Ser Glu 1 5 10 15
Trp Arg Thr Pro Thr Tyr Arg Ser Thr Glu Met Val Gln Arg Leu Arg 20
25 30 Met Glu Ala Val Gln His Ser Thr Ser Thr Ala Ala Val Gly Gly
Leu 35 40 45 Val Val Ser Ala Gln Gly Val Gly Val Gly Cys Phe Leu
Ala Ala Phe 50 55 60 Ile Leu Met Ala Val Ala Gly Asn Leu Leu Val
Ile Leu Ser Val Ala 65 70 75 80 Cys Asn Arg His Leu Gln Thr Val Thr
Asn Tyr Phe Ile Val Asn Leu 85 90 95 Ala Val Ala Asp Leu Leu Leu
Ser Ala Thr Val Leu Pro Phe Ser Ala 100 105 110 Thr Met Glu Val Leu
Gly Phe Ala Trp Phe Gly Arg Ala Phe Cys Asp 115 120 125 Val Trp Ala
Ala Val Asp Val Leu Cys Cys Thr Ala Ser Ile Leu Ser 130 135 140 Leu
Cys Thr Ile Ser Val Asp Arg Tyr Val Gly Val Arg His Ser Leu 145 150
155 160 Lys Tyr Pro Ala Ile Met Thr Glu Arg Lys Ala Ala Ala Ile Leu
Ala 165 170 175 Leu Leu Trp Val Val Ala Leu Val Val Ser Val Gly Pro
Leu Leu Gly 180 185 190 Trp Lys Glu Pro Val Pro Pro Asp Glu Arg Phe
Cys Gly Ile Thr Glu 195 200 205 Glu Ala Gly Tyr Ala Val Phe Ser Ser
Val Cys Ser Phe Tyr Leu Pro 210 215 220 Met Ala Val Ile Val Val Met
Tyr Cys Arg Val Tyr Val Val Ala Arg 225 230 235 240 Ser Thr Thr Arg
Ser Leu Glu Ala Gly Val Lys Arg Glu Arg Gly Lys 245 250 255 Ala Ser
Glu Val Val Leu Arg Ile His Cys Arg Gly Ala Ala Thr Gly 260 265 270
Ala Asp Gly Ala His Gly Met Arg Ser Ala Lys Gly His Thr Phe Arg 275
280 285 Ser Ser Leu Ser Val Arg Leu Leu Lys Phe Ser Arg Glu Lys Lys
Ala 290 295 300 Ala Lys Thr Leu Ala Ile Val Val Gly Val Phe Val Leu
Cys Trp Phe 305 310 315 320 Pro Phe Phe Phe Val Leu Pro Leu Gly Ser
Leu Phe Pro Gln Leu Lys 325 330 335 Pro Ser Glu Gly Val Phe Lys Val
Ile Phe Trp Leu Gly Tyr Phe Asn 340 345 350 Ser Cys Val Asn Pro Leu
Ile Tyr Pro Cys Ser Ser Arg Glu Phe Lys 355 360 365 Arg Ala Phe Leu
Arg Leu Leu Arg Cys Gln Cys Arg Arg Arg Arg Arg 370 375 380 Arg Arg
Pro Leu Trp Arg Val Tyr Gly His His Trp Arg Ala Ser Thr 385 390 395
400 Ser Gly Leu Arg Gln Asp Cys Ala Pro Ser Ser Gly Asp Ala Pro Pro
405 410 415 Gly Ala Pro Leu Ala Leu Thr Ala Leu Pro Asp Pro Asp Pro
Glu Pro 420 425 430 Pro Gly Thr Pro Glu Met Gln Ala Pro Val Ala Ser
Arg Arg Ser His 435 440 445 Pro Ala Pro Ser Ala Ser Gly Gly Cys Trp
Gly Arg Ser Gly Asp Pro 450 455 460 Arg Pro Ser Cys Ala Pro Lys Ser
Pro Ala Cys Arg Thr Arg Ser Pro 465 470 475 480 Pro Gly Ala Arg Ser
Ala Gln Arg Gln Arg Ala Pro Ser Ala Gln Arg 485 490 495 Trp Arg Leu
Cys Pro 500 8 560 PRT Rattus norvegicus 8 Met Thr Phe Arg Asp Ile
Leu Ser Val Thr Phe Glu Gly Pro Arg Ser 1 5 10 15 Ser Ser Ser Thr
Gly Gly Ser Gly Ala Gly Gly Gly Ala Gly Thr Val 20 25 30 Gly Pro
Glu Gly Gly Ala Val Gly Gly Val Pro Gly Ala Thr Gly Gly 35 40 45
Gly Ala Val Val Gly Thr Gly Ser Gly Glu Asp Asn Gln Ser Ser Thr 50
55 60 Gly Glu Pro Gly Ala Ala Ala Ser Gly Glu Val Asn Gly Ser Ala
Ala 65 70 75 80 Val Gly Gly Leu Val Val Ser Ala Gln Gly Val Gly Val
Gly Val Phe 85 90 95 Leu Ala Ala Phe Ile Leu Thr Ala Val Ala Gly
Asn Leu Leu Val Ile 100 105 110 Leu Ser Val Ala Cys Asn Arg His Leu
Gln Thr Val Thr Asn Tyr Phe 115 120 125 Ile Val Asn Leu Ala Val Ala
Asp Leu Leu Leu Ser Ala Ala Val Leu 130 135 140 Pro Phe Ser Ala Thr
Met Glu Val Leu Gly Phe Trp Ala Phe Gly Arg 145 150 155 160 Thr Phe
Cys Asp Val Trp Ala Ala Val Asp Val Leu Cys Cys Thr Ala 165 170 175
Ser Ile Leu Ser Leu Cys Thr Ile Ser Val Asp Arg Tyr Val Gly Val 180
185 190 Arg His Ser Leu Lys Tyr Pro Ala Ile Met Thr Glu Arg Lys Ala
Ala 195 200 205 Ala Ile Leu Ala Leu Leu Trp Ala Val Ala Leu Val Val
Ser Val Gly 210 215 220 Pro Leu Leu Gly Trp Lys Glu Pro Val Pro Pro
Asp Glu Arg Phe Cys 225 230 235 240 Gly Ile Thr Glu Glu Val Gly Tyr
Ala Ile Phe Ser Ser Val Cys Ser 245 250 255 Phe Tyr Leu Pro Met Ala
Val Ile Val Val Met Tyr Cys Arg Val Tyr 260 265 270 Val Val Ala Arg
Ser Thr Thr Arg Ser Leu Glu Ala Gly Ile Lys Arg 275 280 285 Glu Pro
Gly Lys Ala Ser Glu Val Val Leu Arg Ile His Cys Arg Gly 290 295 300
Ala Ala Thr Ser Ala Lys Gly Tyr Pro Gly Thr Gln Ser Ser Lys Gly 305
310 315 320 His Thr Leu Arg Ser Ser Leu Ser Val Arg Leu Leu Lys Phe
Ser Arg 325 330 335 Glu Lys Lys Ala Ala Lys Thr Leu Ala Ile Val Val
Gly Val Phe Val 340 345 350 Leu Cys Trp Phe Pro Phe Phe Phe Val Leu
Pro Leu Gly Ser Leu Phe 355 360 365 Pro Gln Leu Lys Pro Ser Glu Gly
Val Phe Lys Val Ile Phe Trp Leu 370 375 380 Gly Tyr Phe Asn Ser Cys
Val Asn Pro Leu Ile Tyr Pro Cys Ser Ser 385 390 395 400 Arg Glu Phe
Lys Arg Ala Phe Leu Arg Leu Leu Arg Cys Gln Cys Arg 405 410 415 Arg
Arg Arg Arg Arg Leu Trp Ser Leu Arg Pro Pro Leu Ala Ser Leu 420 425
430 Asp Arg Arg Arg Ala Phe Arg Leu Arg Pro Gln Pro Ser His Arg Ser
435 440 445 Pro Arg Gly Pro Ser Ser Pro His Cys Thr Pro Gly Cys Gly
Leu Gly 450 455 460 Arg His Ala Gly Asp Ala Gly Phe Gly Leu Gln Gln
Ser Lys Ala Ser 465 470 475 480 Leu Arg Leu Arg Glu Trp Arg Leu Leu
Gly Pro Leu Gln Arg Pro Thr 485 490 495 Thr Gln Leu Arg Ala Lys Val
Ser Ser Leu Ser His Lys Ile Arg Ser 500 505 510 Gly Ala Arg Arg Ala
Glu Thr Ala Cys Ala Leu Arg Ser Glu Val Glu 515 520 525 Ala Val Ser
Leu Asn Val Pro Gln Asp Gly Ala Glu Ala Val Ile Cys 530 535 540 Gln
Ala Tyr Glu Pro Gly Asp Tyr Ser Asn Leu Arg Glu Thr Asp Ile 545 550
555 560 9 515 PRT Rattus norvegicus 9 Met Asn Pro Asp Leu Asp Thr
Gly His Asn Thr Ser Ala Pro Ala His 1 5 10 15 Trp Gly Glu Leu Lys
Asp Asp Asn Phe Thr Gly Pro Asn Gln Thr Ser 20 25 30 Ser Asn Ser
Thr Leu Pro Gln Leu Asp Val Thr Arg Ala Ile Ser Val 35 40 45 Gly
Leu Val Leu Gly Ala Phe Ile Leu Phe Ala Ile Val Gly Asn Ile 50 55
60 Leu Val Ile Leu Ser Val Ala Cys Asn Arg His Leu Arg Thr Pro Thr
65 70 75 80 Asn Tyr Phe Ile Val Asn Leu Ala Ile Ala Asp Leu Leu Leu
Ser Phe 85 90 95 Thr Val Leu Pro Phe Ser Ala Thr Leu Glu Val Leu
Gly Tyr Trp Val 100 105 110 Leu Gly Arg Ile Phe Cys Asp Ile Trp Ala
Ala Val Asp Val Leu Cys 115 120 125 Cys Thr Ala Ser Ile Leu Ser Leu
Cys Ala Ile Ser Ile Asp Arg Tyr 130 135 140 Ile Gly Val Arg Tyr Ser
Leu Gln Tyr Pro Thr Leu Val Thr Arg Arg 145 150 155 160 Lys Ala Ile
Leu Ala Leu Leu Ser Val Trp Val Leu Ser Thr Val Ile 165 170 175 Ser
Ile Gly Pro Leu Leu Gly Trp Lys Glu Pro Ala Pro Asn Asp Asp 180 185
190 Lys Glu Cys Gly Val Thr Glu Glu Pro Phe Cys Ala Leu Phe Cys Ser
195 200 205 Leu Gly Ser Phe Tyr Ile Pro Leu Ala Val Ile Leu Val Met
Tyr Cys 210 215 220 Arg Val Tyr Ile Val Ala Lys Arg Thr Thr Lys Asn
Leu Glu Ala Gly 225 230 235 240 Val Met Lys Glu Met Ser Asn Ser Lys
Glu Leu Thr Leu Arg Ile His 245 250 255 Ser Lys Asn Phe His Glu Asp
Thr Leu Ser Ser Thr Lys Ala Lys Gly 260 265 270 His Asn Pro Arg Ser
Ser Ile Ala Val Lys Leu Phe Lys Phe Ser Arg 275 280 285 Glu Lys Lys
Ala Ala Lys Thr Leu Gly Ile Val Val Gly Met Phe Ile 290 295 300 Leu
Cys Trp Leu Pro Phe Phe Ile Ala Leu Pro Leu Gly Ser Leu Phe 305 310
315 320 Ser Thr Leu Lys Pro Pro Asp Ala Val Phe Lys Val Val Phe Trp
Leu 325 330 335 Gly Tyr Phe Asn Ser Cys Leu Asn Pro Ile Ile Tyr Pro
Cys Ser Ser 340 345 350 Lys Glu Phe Lys Arg Ala Phe Met Arg Ile Leu
Gly Cys Gln Cys Arg 355 360 365 Gly Gly Arg Arg Arg Arg Arg Arg Arg
Arg Leu Gly Ala Cys Ala Tyr 370 375 380 Thr Tyr Arg Pro Trp Thr Arg
Gly Gly Ser Leu Glu Arg Ser Gln Ser 385 390 395 400 Arg Lys Asp Ser
Leu Asp Asp Ser Gly Ser Cys Met Ser Gly Gln Lys 405 410 415 Arg Thr
Leu Pro Ser Ala Ser Pro Ser Pro Gly Tyr Leu Gly Arg Gly 420 425 430
Thr Gln Pro Pro Val Glu Leu Cys Ala Phe Pro Glu Trp Lys Pro Gly 435
440 445 Ala Leu Leu Ser Leu Pro Glu Pro Pro Gly Arg Arg Gly Arg Leu
Asp 450 455 460 Ser Gly Pro Leu Phe Thr Phe Lys Leu Leu Gly Asp Pro
Glu Ser Pro 465 470 475 480 Gly Thr Glu Ala Thr Ala Ser Asn Gly Gly
Cys Asp Thr Thr Thr Asp 485 490 495 Leu Ala Asn Gly Gln Pro Gly Phe
Lys Ser Asn Met Pro Leu Gly Pro 500 505 510 Gly His Phe 515 10 515
PRT Hamster sp. 10 Met Asn Pro Asp Leu Asp Thr Gly His Asn Thr Ser
Ala Pro Ala Gln 1 5 10 15 Trp Gly Glu Leu Lys Asp Ala Asn Phe Thr
Gly Pro Asn Gln Thr Ser 20 25 30 Ser Asn Ser Thr Leu Pro Gln Leu
Asp Val Thr Arg Ala Ile Ser Val 35 40 45 Gly Leu Val Leu Gly Ala
Phe Ile Leu Phe Ala Ile Val Gly Asn Ile 50 55 60 Leu Val Ile Leu
Ser Val Ala Cys Asn Arg His Leu Arg Thr Pro Thr 65 70 75 80 Asn Tyr
Phe Ile Val Asn Leu Ala Ile Ala Asp Leu Leu Leu Ser Phe 85 90 95
Thr Val Leu Pro Phe Ser Ala Thr Leu Glu Val Leu Gly Tyr Trp Val 100
105 110 Leu Gly Arg Ile Phe Cys Asp Ile Trp Ala Ala Val Asp Val Leu
Cys 115 120 125 Cys Thr Ala Ser Ile Leu Ser Leu Cys Ala Ile Ser Ile
Asp Arg Tyr 130 135 140 Ile Gly Val Arg Tyr Ser Leu Gln Tyr Pro Thr
Leu Val Thr Arg Arg 145 150 155 160 Lys Ala Ile Leu Ala Leu Leu Ser
Val Trp Val Leu Ser Thr Val Ile 165 170 175 Ser Ile Gly Pro Leu Leu
Gly Trp Lys Glu Pro Ala Pro Asn Asp Asp 180 185 190 Lys Glu Cys Gly
Val Thr Glu Glu Pro Phe Tyr Ala Leu Phe Ser Ser 195 200 205 Leu Gly
Ser Phe Tyr Ile Pro Leu Ala Val Ile Leu Val Met Tyr Cys 210 215 220
Arg Val Tyr Ile Val Ala Lys Arg Thr Thr Lys Asn Leu Glu Ala Gly 225
230 235 240 Val Met Lys Glu Met Ser Asn Ser Lys Glu Leu Thr Leu Arg
Ile His 245 250 255 Ser Lys Asn Phe His Glu Asp Thr Leu Ser Ser Thr
Lys Ala Lys Gly 260 265 270 Asn His Pro Arg Ser Ser Ile Ala Val Lys
Leu Phe Lys Phe Ser Arg 275 280 285 Glu Lys Lys Ala Ala Lys Thr Leu
Gly Ile Val Val Gly Met Phe Ile 290 295 300 Leu Cys Trp Leu Pro Phe
Phe Ile Ala Leu Pro Leu Gly Ser Leu Phe 305 310 315 320 Ser Thr Leu
Lys Pro Pro Asp Ala Val Phe Lys Val Val Phe Trp Leu 325 330 335 Gly
Tyr Phe Asn Ser Cys Leu Asn Pro Ile Ile Tyr Pro Cys Ser Ser 340 345
350 Lys Glu Phe Lys Arg Ala Phe Met Arg Ile Leu Gly Cys Gln Cys Arg
355 360 365 Ser Gly Arg Arg Arg Arg Arg Arg Arg Arg Leu Gly Ala Cys
Ala Tyr 370 375 380 Thr Tyr Arg Pro Trp Thr Arg Gly Gly Ser Leu Glu
Arg Ser Gln Ser 385 390 395 400 Arg Lys Asp Ser Leu Asp Asp Ser Gly
Ser Cys Met Ser Gly Ser Gln 405 410 415 Arg Thr Leu Pro Ser Ala Ser
Pro Ser Pro Gly Tyr Leu Gly Arg Gly 420 425 430 Ala Gln Pro Pro Leu
Glu Leu Cys Ala Tyr Pro Glu Trp Lys Ser Gly 435 440 445 Ala Leu Leu
Ser Leu Pro Glu Pro Pro Gly Arg Arg Gly Arg Leu Asp 450 455 460 Ser
Gly Pro Leu Phe Thr Phe Lys Leu Leu Gly Glu Pro Glu Ser Pro 465 470
475 480 Gly Tyr Glu Gly Asp Ala Ser Asn Gly Gly Cys Asp Ala Thr Thr
Asp 485 490 495 Leu Ala Asn Gly Gln Pro Gly Phe Lys Ser Asn Met Pro
Leu Ala Pro 500 505 510 Gly His Phe 515 11 466 PRT Unknown Organism
Description of Unknown Organism BOVINE 11 Met Val Phe Leu Ser Gly
Asn Ala Ser Asp Ser Ser Asn Cys Thr His 1 5 10 15 Pro Pro Pro Pro
Val Asn Ile Ser Lys Ala Ile Leu Leu Gly Val Ile 20 25 30 Leu Gly
Gly Leu Ile Leu Phe Gly Val Leu Gly Asn Ile Leu Val Ile 35 40 45
Leu Ser Val Ala Cys His Arg His Leu His Ser Val Thr His Tyr Tyr 50
55 60 Ile Val Asn Leu Ala Val Ala Asp Leu Leu Leu Thr Ser Thr Val
Leu 65 70 75 80 Pro Phe Ser Ala Ile Phe Glu Ile Leu Gly Tyr Trp Ala
Phe Gly Arg 85 90 95 Val Phe Cys Asn Val Trp Ala Ala Val Asp Val
Leu Cys Cys Thr Ala 100 105 110 Ser Ile Met Gly Leu Cys Ile Ile Ser
Ile Asp Arg Tyr Ile Gly Val 115 120 125 Ser Tyr Pro Leu Arg Tyr Pro
Thr Ile Val Thr Gln Lys Arg Gly Leu 130 135 140 Met Ala Leu Leu Cys
Val Trp Ala Leu Ser Leu Val Ile Ser Ile Gly 145 150 155 160 Pro Leu
Phe Gly Trp Arg Gln Pro Ala Pro Glu Asp Glu Thr Ile Cys 165 170 175
Gln Ile Asn Glu Glu Pro Gly Tyr Val Leu Phe Ser Ala Leu Gly Ser 180
185 190 Phe Tyr Val Pro Leu Thr Ile Ile Leu Val Met Tyr Cys Arg Val
Tyr 195 200 205 Val Val Ala Lys Arg Glu Ser Arg Gly Leu Lys Ser Gly
Leu Lys Thr 210 215 220 Asp Lys Ser Asp Ser Glu Gln Val Thr Leu Arg
Ile His Arg Lys Asn 225 230 235 240 Ala Gln Val Gly Gly Ser Gly Val
Thr Ser Ala Lys Asn Lys Thr His 245 250 255 Phe Ser Val Arg Leu Leu
Lys Phe Ser Arg Glu Lys Lys Ala Ala Lys 260 265 270 Thr Leu Gly Ile
Val Val Gly Cys Phe Val Leu Cys Trp Leu Pro Phe 275 280 285 Phe Leu
Val Met Pro Ile Gly Ser Phe Phe Pro Asp Phe Arg Pro
Ser 290 295 300 Glu Thr Val Phe Lys Ile Ala Phe Trp Leu Gly Tyr Leu
Asn Ser Cys 305 310 315 320 Ile Asn Pro Ile Ile Tyr Pro Cys Ser Ser
Gln Glu Phe Lys Lys Ala 325 330 335 Phe Gln Asn Val Leu Arg Ile Gln
Cys Leu Arg Arg Lys Gln Ser Ser 340 345 350 Lys His Thr Leu Gly Tyr
Thr Leu His Ala Pro Ser His Val Leu Glu 355 360 365 Gly Gln His Lys
Asp Leu Val Arg Ile Pro Val Gly Ser Ala Glu Thr 370 375 380 Phe Tyr
Lys Ile Ser Lys Thr Asp Gly Val Cys Glu Trp Lys Ile Phe 385 390 395
400 Ser Ser Leu Pro Arg Gly Ser Ala Arg Met Ala Val Ala Arg Asp Pro
405 410 415 Ser Ala Cys Thr Thr Ala Arg Val Arg Ser Lys Ser Phe Leu
Gln Val 420 425 430 Cys Cys Cys Leu Gly Pro Ser Thr Pro Ser His Gly
Glu Asn His Gln 435 440 445 Ile Pro Thr Ile Lys Ile His Thr Ile Ser
Leu Ser Glu Asn Gly Glu 450 455 460 Glu Val 465 12 25 DNA
Artificial Sequence Description of Artificial Sequence PRIMER/
PROBE 12 cactcaagta cccagccatc atgac 25 13 25 DNA Artificial
Sequence Description of Artificial Sequence PRIMER/ PROBE 13
cggagagcga gctgcggaag gtgtg 25 14 45 DNA Artificial Sequence
Description of Artificial Sequence PRIMER/ PROBE 14 gcaaggcctc
cgaggtggtg ctgcgcatcc actgtcgcgg cgcgg 45 15 47 DNA Artificial
Sequence Description of Artificial Sequence PRIMER/ PROBE 15
tgccgtgcgc cccgtcggcg cccgtggccg cgccgcgaca gtggatg 47 16 27 DNA
Artificial Sequence Description of Artificial Sequence PRIMER/
PROBE 16 caacgatgac aaggagtgcg gggtcac 27 17 25 DNA Artificial
Sequence Description of Artificial Sequence PRIMER/ PROBE 17
tttgacagct atggaactcc tgggg 25 18 45 DNA Artificial Sequence
Description of Artificial Sequence PRIMER/ PROBE 18 aaggagctga
ccctgaggat ccattccaag aactttcacg aggac 45 19 45 DNA Artificial
Sequence Description of Artificial Sequence PRIMER/ PROBE 19
ccttggcctt ggtactgcta agggtgtcct cgtgaaagtt cttgg 45 20 23 DNA
Artificial Sequence Description of Artificial Sequence PRIMER/
PROBE 20 ccaaccatcg tcacccagag gag 23 21 28 DNA Artificial Sequence
Description of Artificial Sequence PRIMER/ PROBE 21 tctcccggga
gaacttgagg agcctcac 28 22 45 DNA Artificial Sequence Description of
Artificial Sequence PRIMER/ PROBE 22 tccgcatcca tcggaaaaac
gccccggcag gaggcagcgg gatgg 45 23 46 DNA Artificial Sequence
Description of Artificial Sequence PRIMER/ PROBE 23 gaagtgcgtc
ttggtcttgg cgctggccat cccgctgcct cctgcc 46
* * * * *