U.S. patent application number 10/193960 was filed with the patent office on 2003-06-05 for chimeric polyclonal antibodies.
This patent application is currently assigned to Biosite Diagnostics, Inc.. Invention is credited to Buechler, Joe, Gray, Jeff, Valkirs, Gunars.
Application Number | 20030104477 10/193960 |
Document ID | / |
Family ID | 27125574 |
Filed Date | 2003-06-05 |
United States Patent
Application |
20030104477 |
Kind Code |
A1 |
Buechler, Joe ; et
al. |
June 5, 2003 |
Chimeric polyclonal antibodies
Abstract
The invention is directed to production of chimeric antibodies
using display screening methods. The invention is based in part on
two related but self-sufficient improvements in conventional
display methods. The first improvement provides methods of
enriching conventional display libraries for members displaying
more than one copy of a polypeptide prior to affinity screening of
such libraries with a target of interest. These methods can achieve
diverse populations in which the vast majority of members retaining
full-length coding sequences encode polypeptides having specific
affinity for the target. In a second aspect, the invention provides
methods of subcloning nucleic acids encoding displayed polypeptides
of enriched libraries from a display vector to an expression vector
without the need for clonal isolation of individual members. These
methods can be used to produce polyclonal libraries of chimeric
antibodies for use, e.g., as diagnostic or therapeutic
reagents.
Inventors: |
Buechler, Joe; (Carlsbad,
CA) ; Valkirs, Gunars; (Escondido, CA) ; Gray,
Jeff; (Solana Beach, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Biosite Diagnostics, Inc.
San Diego
CA
|
Family ID: |
27125574 |
Appl. No.: |
10/193960 |
Filed: |
July 12, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10193960 |
Jul 12, 2002 |
|
|
|
09410903 |
Oct 2, 1999 |
|
|
|
6420113 |
|
|
|
|
09410903 |
Oct 2, 1999 |
|
|
|
PCT/US98/06704 |
Apr 3, 1998 |
|
|
|
PCT/US98/06704 |
Apr 3, 1998 |
|
|
|
08835159 |
Apr 4, 1997 |
|
|
|
PCT/US98/06704 |
Apr 3, 1998 |
|
|
|
08832985 |
Apr 4, 1997 |
|
|
|
6057098 |
|
|
|
|
Current U.S.
Class: |
506/14 ; 435/7.1;
436/518; 530/387.2; 530/388.15 |
Current CPC
Class: |
C12N 15/1037 20130101;
G01N 2400/50 20130101; C40B 40/02 20130101; C07K 16/1282 20130101;
G01N 2333/33 20130101; G01N 33/54326 20130101; C07K 16/00 20130101;
C07K 2319/00 20130101 |
Class at
Publication: |
435/7.1 ;
436/518; 530/387.2; 530/388.15 |
International
Class: |
G01N 033/53; G01N
033/543; C07K 016/44 |
Claims
What is claimed:
1. A library of at least four chimeric antibodies, wherein at least
50% of the antibodies in the library have specific affinity for the
same target and no library member constitues more than 25% of the
library.
2. The library of claim 1, wherein the antibodies are Fab
fragments.
3. The library of claim 1, wherein the antibodies comprise two
copies of a light chain and two copies of a heavy chain.
4. The library of claim 1, wherein the antibodies are single-chain
antibodies.
5. The library of claim 1, wherein each chimeric antibody comprises
a heavy chain and a light chain, the light chain comprising a
nonhuman variable region and a human constant region, and the heavy
chain comprising a nonhuman variable region and a human constant
region.
6. The library of claim 5, wherein the nonhuman light and heavy
chain variable regions are mouse light and heavy chain variable
regions respectively.
7. The library of claim 6, wherein the human heavy chain constant
region comprises a C.sub.H1 region.
8. The library of claim 6, wherein the human light chain constant
region is a C.sub..kappa. chain.
9. The library of claim 1, wherein each antibody comprises a light
chain and a heavy chain, and in at least some antibodies the light
and heavy chain variable regions are randomly associated.
10. A library of at least four different nucleic segments encoding
chimeric antibody chains comprising a variable region and a
constant region from different species, wherein at least 90% of
segments in the library encode chimeric antibody chains showing
specific affinity for the same target and no library member
constitutes more than 50% of the library.
11. The library of claim 11, wherein the library comprises at least
four pairs of the different nucleic acid segments, the members of a
pair respectively encoding heavy and light chimeric antibody
chains, wherein at least 90% of the pairs encode heavy and light
chimeric antibody chains that form complexes showing specific
affinity for the same target, and no pair of nucleic acid segments
constitutes more than 50% of the library.
12. The library of claim 10, wherein the chimeric antibody chains
are chimeric single-chain antibodies comprises a heavy chain
variable region, a heavy chain constant region, a light chain
variable region, and a light chain constant region, the heavy and
light chain variable regions being obtained from different species
than the respective heavy and light chain constant regions.
13. The library of claim 11, wherein the heavy and light chain
variable regions are nonhuman and the heavy and light chain
constant regions are human.
14. The library of 13, wherein the heavy chain constant region
comprises a C.sub.H1 region.
15. The library of claim 13, wherein the heavy chain constant
region comprises a C.sub.H1 region, a hinge region, a C.sub.H2
region and a C.sub.H3 region.
16. The library of claim 13, wherein the light chain constant
region comprises a human C.sub..kappa. constant region.
17. The library of claim 13, wherein the light chain constant regon
comprises a human C.sub..kappa. or C.sub..lambda. constant
region.
18. The library of claim 11, wherein at least 95% of library
members encode chimeric antibody chains forming complexes having
specific affinity for the target and no member constitutes more
than 25% of the library.
19. The library of claim 11 having at least 100 different
members.
20. The library of claim 11, wherein each pair of nucleic acids is
expresssed as a discistronic transcript.
21. A library of cells containing the library of claim 10, wherein
a member cell contains a member nucleic acid segment.
22. A method of producing a library of chimeric antibodies,
comprising: providing the library of cells of claim 21; propagating
the library of cells under conditions in which the nucleic acid
segments are expressed to produce the chimeric antibody
library.
23. A method of producing a chimeric antibody library having
affinity for a target, comprising: providing a library of
replicable genetic packages, wherein a member comprises a
replicable genetic package capable of displaying an antibody chain
encoded by a genome of the package and the antibody chain varying
between members, subcloning a mixed population of DNA molecules
encoding at least four different antibody chains of the library of
replicable genetic packages into multiple copies of an expression
vector to produce modified forms of the expression vector; and
introducing the modified forms of the expression vector into a host
and expressing the antibody chains as chimeric antibody chains in
the host, wherein a library of at least four different chimeric
antibody chains are expressed, at least 90% of modified forms of
the expression vector encode chimeric antibody chains having
specific affinity for a target and no modified form of the
expression vector constitutes more than 50% of the total forms.
24. The method of claim 23, wherein the antibody chains comprise
variable regions from a first species and the expression vector
encodes a constant domain from a second species which is expressed
in-frame with the antibody chains subcloned from the library of
replicable genetic packages to form the chimeric antibody
chains.
25. The method of claim 23, wherein the antibody chains encoded by
the genome of the package are chimeric antibody chains comprising a
variable region from a first species and a constant region from a
second species.
26. The method of claim 24 or 25, wherein the variable regions are
nonhuman variable regions, and the constant region is a human
constant region.
27. The method of claim 23, wherein the antibody chains encoded by
the genome of the package are chimeric antibody chains, a chimeric
antibody chain comprising a variable region from a first species
and a first segment of a constant region from a second species, and
the expression vector encodes a second segment of the constant
region of the second species, which is expressed in-frame with the
first segment of the constant region.
28. The method of claim 27, wherein the antibody chains are heavy
chains, the first segment comprises a C.sub.H1 region, and the
second segment comprises a hinge, C.sub.H2 and C.sub.H3
regions.
29. The method of claim 23, further comprising releasing the
polypeptides from the host.
30. The method of claim 23, wherein the antibody chain encoded by
the replicable genetic package comprises an antibody heavy or light
chain variable domain, and in at least some library members, the
heavy or light chain variable domain is respectively complexed with
a partner light or heavy chain antibody variable domain to form a
Fab fragment, and the subcloning comprises subcloning a mixture of
DNA molecules encoding at least four different antibodies chains
and their respective partner into multiple copies of an expression
vector, whereby each copy encodes an antibody chain and its
partner, and the antibody chains and their partners are expressed
as chimeric chains and complex to form chimeric Fab fragments.
31. The method of claim 30, wherein the host cells are procaryotic
and the antibody heavy or light chain variable domain and the
partner heavy or light chain variable domain are expressed as
chimeric antibody chains from the same promoter in the expression
vector as a polycistronic message.
36. The method of claim 23, further comprising incorporating the
antibody chains into a pharmaceutical composition.
37. The method of claim 36, wherein the antibody chains antagonize
a receptor.
38. A method of producing an antibody library having affinity for a
target, comprising: providing a library of phage, wherein a member
of the library comprises a phage capable of displaying from its
outersurface an antibody comprising an antibody heavy chain
variable domain complexed with an antibody light chain variable
domain, wherein either the heavy or light chain variable domain is
expressed as a fusion protein with a coat protein of the phage and
the heavy and light chain variable domains are encoded by the
genome of the phage, and the heavy and light chain varies between
members; subcloning a mixture of DNA moleculy encoding the heavy
and light chain variable domains from the phage library members
into an expression vector to produce modified forms of the
expression vector; introducing the modified forms of the expression
vector into a host and expressing the heavy and light chain
variable domains as chimeric heavy and light chains, which complex
as chimeric antibodies, the antibodies being released from the host
to form an antibody library of at least four antibodies wherein at
least 90% of modified forms of the expression vector encode
antibodies with specific affinity for a target and no modified form
of the expression vector constitutes more than 50% of the total
forms.
39. The method of claim 38, wherein the heavy and light chains
comprise heavy and light variabel regions from a first species and
the expression vector encodes heavy and light chain constant
fregions from a second species expressed in frame with the antibody
heavy and light chains sucloned from the library of replicable
genetic packages to form the chimeric antibody chains.
40. The method of claim 38, wherein the heavy and light antibody
chains encoded by the genome of the package are chimeric antibody
chains respectively comprising a heavy or light chain variable
region from a first species and a heavy or a light chain constant
region from a second species.
41. The method of claim 39 or 40, wherein the variable regions are
nonhuman variable regions, and the constant region is a human
constant region.
42. The method of claim 38, further comprising subcloning a
population of DNA segments encoding antibody light chains and a
population of DNA segments encoding antibody heavy chains into
multiple copies of a phage vector, whereby a copy of the vector
receives a random combination of heavy and light chains from the
respective populations of heavy and light chains.
43. A method of enriching a polypeptide display library,
comprising: providing a library of replicable genetic packages,
wherein a member comprises a replicable genetic package capable of
displaying from its outersurface an antibody chain to be screened
and a tag fused to the antibody chain or to a binding partner of
the antibody chain, if present, which antibody chain is encoded by
a segment of a genome of the package, the antibody chains varying
between library members, the number of copies of the antibody chain
and/or the binding partner (if present) displayed per library
member varying between library members, and the tag being the same
in different library members and wherein the antibody chain is a
chimeric antibody chain comprising a variable region from a first
species and a constant region from a second species; and contacting
the library with a receptor having a specific affinity for the tag
under conditions whereby library members displaying the antibody
chain or the binding partner fused to the tag are bound to
immobilized receptor; separating library members bound to the
immobilized receptor from unbound library members to produce a
sublibrary enriched relative to the library for members displaying
the antibody chain or the binding partner.
43. The method of claim 42, wherein the replicable genetic package
is a phage.
44. The method of claim 42, wherein the replicable genetic package
is an RNA molecule and the RNA molecule encodes a fusion protein
comprising a polypeptide linked to the RNA molecule, the antibody
chain to be screened and the tag. antibody chain or the tag.
45. The method of claim 42, wherein the antibody chain comprises a
nonhuman variable region and a human constant region.
46. The method of claim 45, wherein the antibody chain is a heavy
chain and the constant region comprises a C.sub.H1 region.
47. The method of claim 45, wherein the antibody chain is a light
chain and the constant region comprises a C.sub..kappa. or
C.sub..lambda. constant region.
48. The method of claim 42, wherein the antibody chain comprises a
heavy or light chimeric chain which in at least some library
members is complexed to a binding partner, comprising respectively
a partner light or heavy chimeric chain to form a Fab fragment.
49. The method of claim 48, wherein the heavy chain component of
the Fab fragment comprises a nonhuman variable region and a human
constant region, and the light chain component of the Fab fragment
comprises a nonhuman variable region and a human constant
region.
50. The method of claim 42, wherein the receptor is immobilized to
a support during the contacting step.
51. A method of enriching a Fab phage display library, comprising:
providing a library of phage, wherein a library member comprises a
phage capable of displaying from its outersurface a fusion protein
comprising a phage coat protein, a chimeric antibody light or heavy
chain comprising a variable region and a constant region from
different species, and a tag, wherein in at least some members, the
chimeric antibody heavy or light chain is complexed with a partner
chimeric antibody heavy or light chain domain chain, comprising a
variable region and a constant region from the different species,
the complex forming a Fab fragment to be screened, wherein the
fusion protein and/or the partner chimeric antibody heavy or light
chain are encoded by segment(s) of the genome of the phage, and the
number of copies of the fusion protein and the partner chimeric
antibody chain displayed per phage vary between library members;
contacting the library or a fraction thereof with a receptor having
a specific affinity for the tag whereby library members displaying
a copy of the fusion protein are bound to immobilized receptor by
bonding between the receptor and the tag; separating library
members bound to the receptor from unbound library members to
produce an sublibrary enriched relative to the library for members
displaying the fusion protein.
52. A method of enriching a phage display library, comprising:
providing a library of phage, wherein a library member comprises a
phage capable of displaying from its outersurface a fusion protein
comprising a phage coat protein, and a chimeric antibody heavy or
light chain comprising a heavy or light chain variable region from
a first species and a heavy or light chain constant region from a
second species, wherein in at least some members, the chimeric
antibody heavy or light chain is complexed with a partner chimeric
antibody heavy or light chain comprising a heavy or light chain
variable region from the first species and a heavy or light chain
constant region from the second species, the partner being fused to
a tag, the complex forming a chimeric Fab fragment to be screened,
wherein the fusion protein and/or the partner chimeric antibody
heavy or light chain fused to the tag are encoded by segment(s) of
the genome of the phage, and the number of copies of the fusion
protein and the partner chimeric antibody chain displayed per phage
vary between library members; contacting the library or a fraction
thereof with a receptor having a specific affinity for the tag
under conditions whereby library members displaying the partner
chimeric antibody chain are bound to immobilized receptor by
binding between the immobilized receptor and the tag; separating
library members bound to the receptor from unbound library members
to produce an sublibrary enriched relative to the library for
members displaying the partner chimeric antibody chain.
53. The method of claim 51 or 52, further comprising subcloning a
population of DNA segments encoding antibody light chains and a
population of DNA segments encoding antibody heavy chains into
multiple copies of a phage vector, whereby a copy of the vector
receives a random combination of heavy and light chains from the
respective populations of heavy and light chains.
54. The method of claim 51 or 52, further comprising: contacting
the sublibrary with a target lacking specific affinity for the tag
and separating library members bound to the target via their
displayed Fab fragments from unbound library members.
55. The method of claim 54, further comprising subcloning a mixed
population of DNA segments encoding the chimeric antibody heavy or
light chain and/or the chimeric partner antibody light or heavy
chain from a bound library member to an expression vector;
introducing the expression vector into a host and expressing the
DNA segments in the host to produce a chimeric antibody having
affinity for the target.
56. The method of claim 55, wherein the DNA segments is/are
subcloned from a plurality of library members and expressed in the
host to produce a plurality of Fab fragments having affinity for
the target.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of PCT
98/06704, filed, Apr. 3, 1998, which is a continuation-in-part of
U.S. Ser. No. 08/835,159, filed Apr. 4, 1997 and U.S. Ser. No.
08/832,985, filed Apr. 4, 1997, all of which are incorporated by
reference in their entirety for all purposes. Related application
No. 60/044,292, filed Apr. 4, 1997 and No. 08/835,159, filed Apr.
4, 1997, are also incorporated by reference in their entirety for
all purposes.
BACKGROUND
[0002] Over recent years, many publications have reported the use
of phage-display technology to produce and screen libraries of
polypeptides for binding to a selected target. See, e.g, Cwirla, et
al., Proc. Natl. Acad. Sci. USA 87:6378-6382 (1990); Devlin, et
al., Science 249:404-406 (1990), Scott & Smith, Science
249:386-388 (1990); Ladner, et al., U.S. Pat. No. 5,571,698. A
basic concept of phage display methods is the establishment of a
physical association between DNA encoding a polypeptide to be
screened and the polypeptide. This physical association is provided
by the phage particle, which displays a polypeptide as part of a
capsid enclosing the phage genome which encodes the polypeptide.
The establishment of a physical association between polypeptides
and their genetic material allows simultaneous mass screening of
very large numbers of phage bearing different polypeptides. Phage
displaying a polypeptide with affinity to a target bind to the
target and these phage are enriched by affinity screening to the
target. The identity of polypeptides displayed from these phage can
be determined from their respective genomes. Using these methods a
polypeptide identified as having a binding affinity for a desired
target can then be synthesized in bulk by conventional means.
[0003] Phage display technology has also been used to produce and
screen libraries of heterodimeric proteins, such as Fab fragments.
See e.g., Garrard, et al., Bio/Tech 9:1373-1377 (1991). Phage
display libraries of Fab fragments are produced by expressing one
of the component chains as a fusion with a coat protein, as for
display of single-chain polypeptides. The partner antibody chain is
expressed in the same cell from the same or a different replicon as
the first chain, and assembly occurs within the cell. Thus, a
phage-Fab fragment has one antibody chain fused to a phage coat
protein so that it is displayed from the outer surface of the phage
and the other antibody chain is complexed with the first chain.
[0004] In a further expansion of the basic approach, polypeptide
libraries have been displayed from replicable genetic packages
other than phage. These replicable genetic packages include
eukaryotic viruses and bacteria. The principles and strategy are
closely analogous to those employed for phage, namely, that nucleic
acids encoding antibody chains or other polypeptides to be
displayed are inserted into the genome of the package to create a
fusion protein between the polypeptides to be screened and an
endogenous protein that is exposed on the cell or viral surface.
Expression of the fusion protein and transport to the cell surface
result in display of polypeptides from the cell or viral
surface.
[0005] Although conventional display methods have achieved
considerable success in isolating antibodies and other polypeptides
with specific binding to selected targets, some inefficiencies and
limitations remain. In conventional methods, many library members
bind nonspecifically to the target or the solid phase bearing the
target and are amplified along with specifically bound library
members causing poor efficiency at each round of affinity
selection. Not only can this waste time and effort in performing
many rounds of affinity selection, but members bearing polypeptides
having specific affinity are lost at each round. Selection is
generally terminated when sufficient rounds of affinity selection
have been performed to achieve a significant number of members
bearing polypeptides with affinity for a target even though many
nonspecifically binding members are still present. Clonal isolates
are then picked and tested individually to reduce the risk of
losing specific-binding members through further rounds of
selection. Clonal isolates shown to bind specifically may then be
cloned into an expression work for future analysis, and,
large-scale production. Accordingly, only one or a few of library
members bearing polypeptides with specific affinity for the target
present in the original repertoire are ever isolated.
[0006] The present application provides inter alia novel methods
that overcome these inefficiencies and difficulties, and produce
new diagnostic and therapeutic reagents.
SUMMARY OF THE INVENTION
[0007] The invention provides libraries of at least four chimeric
antibodies. At least 50% of the antibodies in the library have
specific affinity for the same target and no library member
constitutes more than 25% of the library. In some libraries, the
antibodies are Fab fragments. In some libraries, the antibodies are
single-chain antibodies. In some libraries, the antibodies are
intact antibodies. Typically, a chimeric antibody light chain
comprises a nonhuman light chain variable region and a human light
chain constant region. Typically, a chimeric antibody heavy chain
comprises a nonhuman heavy chain variable region and a human heavy
chain constant region. In some libraries at least some antibodies
have light and heavy chain variable regions that are randomly
associated.
[0008] The invention further provides libraries of at least four
different nucleic segments encoding chimeric antibody chains
comprising a variable region and a constant region from different
species. At least 90% of segments in the library encode chimeric
antibody chains showing specific affinity for the same target and
no library member constitutes more than 50% of the library. Some
such libraries comprise at least four pairs of the different
nucleic acid segments, the members of a pair respectively encoding
heavy and light chimeric antibody chains, wherein at least 90% of
the pairs encode heavy and light chimeric antibody chains that form
complexes showing specific affinity for the same target, and no
pair of nucleic acid segments constitutes more than 50% of the
library. In some libraries, at least 95% of library members encode
chimeric antibody chains forming complexes having specific affinity
for the target and no member constitutes more than 25% of the
library. Some libraries have at least 100 different members. In
some libraries, each pair of nucleic acids is expressed as a
discistronic transcript.
[0009] The invention further provides methods of producing a
polypeptide library having affinity for a target. Such methods
entail providing a library of replicable genetic packages, wherein
a member comprises a replicable genetic package capable of
displaying an antibody chain encoded by a genome of the package and
the antibody chain varying between members. One then subclones a
mixed population of DNA molecules encoding at least four different
antibody chains of the library of replicable genetic packages into
multiple copies of an expression vector to produce modified forms
of the expression vector. One then introduces the modified forms of
the expression vector into a host and expressing the antibody
chains as chimeric antibody chains in the host, wherein a library
of at least four different chimeric antibody chains are expressed,
at least 90% of modified forms of the expression vector encode
chimeric antibody chains having specific affinity for a target and
no modified form of the expression vector constitutes more than 50%
of the total forms.
[0010] The invention further provides methods of producing an
antibody library having affinity for a target as follows. A library
of phage is provided in which a member of the library comprises a
phage capable of displaying from its outersurface an antibody
comprising an antibody heavy chain variable domain complexed with
an antibody light chain variable domain, in which either the heavy
or light chain variable domain is expressed as a fusion protein
with a coat protein of the phage and the heavy and light chain
variable domains are encoded by the genome of the phage, and the
heavy and light chain varies between members. A mixture of DNA
molecules encoding the heavy and light chain variable domains from
the phage library members are subcloned into an expression vector
to produce modified forms of the expression vector. The modified
forms of the expression vector are then into a host and expressed
to produce the heavy and light chain variable domains as chimeric
heavy and light chains, which complex as chimeric antibodies. The
antibodies are released from the host to form an antibody library
of at least four antibodies in which at least 90% of modified forms
of the expression vector encode antibodies with specific affinity
for a target and no modified form of the expression vector
constitutes more than 50% of the total forms.
[0011] The invention further provides method of enriching a
polypeptide display library. Such methods entail providing a
library of replicable genetic packages, in which a member comprises
a replicable genetic package capable of displaying from its
outersurface an antibody chain to be screened and a tag fused to
the polypeptide or to a binding partner of the antibody chain, if
present, which antibody chain is encoded by a segment of a genome
of the package. The antibody chains varies between library members.
The number of copies of the antibody chain and/or the binding
partner (if present) displayed per library member varies between
library members, and the tag is the same in different library
members. The antibody chain is a chimeric antibody chain comprising
a variable region from a first species and a constant region from a
second species. The library is then contacted with a receptor
having a specific affinity for the tag under conditions in which
library members displaying the antibody chain or the binding
partner fused to the tag are bound to immobilized receptor. Library
members bound to the immobilized receptor are separated from
unbound library members to produce a sublibrary enriched relative
to the library for members displaying the antibody chain or the
binding partner.
[0012] The invention further provides methods of enriching a Fab
phage display library. Such methods entail providing a library of
phage in which a library member comprises a phage capable of
displaying from its outersurface a fusion protein comprising a
phage coat protein, a chimeric antibody light or heavy chain
comprising a variable region and a constant region from different
species, and a tag, wherein in at least some members, the chimeric
antibody heavy or light chain is complexed with a partner chimeric
antibody heavy or light chain domain chain, comprising a variable
region and a constant region from the different species, the
complex forming a Fab fragment to be screened, wherein the fusion
protein and/or the partner chimeric antibody heavy or light chain
are encoded by segment(s) of the genome of the phage, and the
number of copies of the fusion protein and the partner chimeric
antibody chain displayed per phage vary between library members.
The library or a fraction thereof is contacted with a receptor
having a specific affinity for the tag whereby library members
displaying a copy of the fusion protein are bound to immobilized
receptor by bonding between the receptor and the tag. Library
members bound to the receptor are separated from unbound library
members to produce an sublibrary enriched relative to the library
for members displaying the fusion protein.
[0013] The invention further provides a method of enrich a phage
display library as follows.
[0014] A library of phage is provided in which a library member
comprises a phage capable of displaying from its outersurface a
fusion protein comprising a phage coat protein, and a chimeric
antibody heavy or light chain comprising a heavy or light chain
variable region from a first species and a heavy or light chain
constant region from a second species, wherein in at least some
members, the chimeric antibody heavy or light chain is complexed
with a partner chimeric antibody heavy or light chain comprising a
heavy or light chain variable region from the first species and a
heavy or light chain constant region from the second species, the
partner being fused to a tag, the complex forming a chimeric Fab
fragment to be screened, wherein the fusion protein and/or the
partner chimeric antibody heavy or light chain fused to the tag are
encoded by segment(s) of the genome of the phage, and the number of
copies of the fusion protein and the partner chimeric antibody
chain displayed per phage vary between library members. The library
or a faction thereof is contacted with a receptor having a specific
affinity for the tag under conditions whereby library members
displaying the partner chimeric antibody chain are bound to
immobilized receptor by binding between the immobilized receptor
and the tag. Library members bound to the receptor are separated
from unbound library members to produce an sublibrary enriched
relative to the library for members displaying the partner chimeric
antibody chain.
[0015] In another aspect, the invention provides methods of
producing a multivalent polypeptide display library. The starting
material is a library of replicable genetic packages, such as
phage. A member of such a library is capable of displaying from its
outer surface a fusion protein comprising a polypeptide to be
screened and a tag. The fusion protein is encoded by a segment of a
genome of the package. The polypeptides vary between library
members, as does the number of copies of the fusion protein
displayed per library member. The tag is the same in different
library members. The library is contacted with a receptor having a
specific affinity for the tag under conditions whereby library
members displaying at least two copies of the fusion protein are
preferentially bound to immobilized receptor by multivalent bonds
between the receptor and the at least two copies of the tag.
Library members bound to the immobilized receptor are then
separated from unbound library members to produce a sublibrary
enriched relative to the library for members displaying at least
two copies of the fusion protein.
[0016] Polypeptides of particular interest are antibodies,
particularly Fab fragments. Multivalent Fab phage display libraries
can be produced as follows. The starting material is a library of
phage in which a library member comprises a phage capable of
displaying from its outer surface a fusion protein comprising a
phage coat protein, an antibody light or heavy chain variable
domain, and a tag. In at least some members, the antibody heavy or
light chain is complexed with a partner antibody heavy or light
chain variable domain chain, the complex forming a Fab fragment to
be screened. The fusion protein and/or the partner antibody heavy
or light chain are encoded by segment(s) of the genome of the
phage. The number of copies of the fusion protein and the partner
antibody chain displayed per phage vary between library members.
The library or a fraction thereof is contacted with a receptor
having a specific affinity for the tag under conditions whereby
library members displaying at least two copies of the fusion
protein are preferentially bound to immobilized receptor by
multivalent bonds between the receptor and the at least two copies
of the tag. Library members bound to the receptor are then
separated from unbound library members to produce a sublibrary
enriched relative to the library for members displaying at least
two copies of the fusion protein.
[0017] An alternative method of producing a multivalent Fab phage
display library is as follows. The starting material is a library
of phage in which a library member comprises a phage capable of
displaying from its outer surface a fusion protein comprising a
phage coat protein, and an antibody light or heavy chain variable
domain. At least in some members, the antibody light or heavy chain
is complexed with a partner antibody heavy or light chain variable
domain chain fused to a tag, the complex forming a Fab fragment to
be screened. The fusion protein and/or the partner antibody heavy
or light chain fused to the tag are encoded by segment(s) of the
genome of the phage. The number of copies of the fusion protein and
the partner antibody chain displayed per phage vary between library
members. The library or a fraction thereof is contacted with a
receptor having a specific affinity for the tag under conditions
whereby library members displaying at least two copies of the
partner antibody chain are preferentially bound to immobilized
receptor by multivalent bonds between the immobilized receptor and
the at least two copies of the tag. Bound library members are
separated from unbound library members to produce an sublibrary
enriched relative to the library for members displaying at least
two copies of the partner antibody chain.
[0018] Having produced a polyvalent phage display library, such as
described above, it can be screened by contacting the library with
a target lacking specific affinity for the tag moiety(ies) and
separating library members bound to the target via their displayed
polypeptides from unbound library members.
[0019] DNA segments encoding polypeptides having specific affinity
for a target can be subcloned in an expression vector, and the
polypeptides expressed in host cells. Polypeptides can then, for
example, be formulated with diagnostic or therapeutic
excipients.
[0020] In another aspect, the invention provides libraries of
nucleic acid segments encoding polyclonal polypeptides having
specific affinity for a target. Such a library comprises least four
different nucleic acid segments. At least 90% of segments in the
library encode polypeptides showing specific affinity for a target
and no library member constitutes more than 50% of the library. In
some libraries, at least 95% of library members encode polypeptides
having specific affinity for a target and no member constitutes
more than 25% of the library. Some libraries have at least 100
different members. In some libraries, the segments are contained in
a vector. In some libraries, the segment encode antibody chains. In
some libraries, first and second segments are present, respectively
encoding antibody heavy chains and partner antibody light chains,
which can complex to form a Fab fragment. The first and second
segments can be incorporated into the same or different
vectors.
[0021] The invention further provides cell libraries in which a
member cell contains a nucleic acid segment from a nucleic acid
library, as described above. Such a library of cells can be
propagated under conditions in which the DNA segments are expressed
to produce polyclonal polypeptides.
[0022] The invention further provides methods of producing
polyclonal polypeptides having specific affinity for a target. The
starting material for such methods is a library of replicable
genetic packages. A member comprises a replicable genetic package
capable of displaying a polypeptide to be screened encoded by a
genome of the package. The polypeptides vary between members. DNA
encoding at least four different polypeptides of the library of
replicable genetic packages is subcloned into an expression vector
to produce modified forms of the expression vector. The modified
forms of the expression vector are introduced into a host and
expressed in the host producing at least four different
polypeptides. At least 75% of modified forms of the expression
vector encode polypeptides having specific affinity for a target
and no modified form of the expression vector constitutes more than
50% of the total.
[0023] Polypeptides of particular interest are antibodies and these
are typically displayed from phage libraries. A typical member of
such a library is a phage capable of displaying from its outer
surface an antibody comprising an antibody heavy chain variable
domain complexed with an antibody light chain variable domain.
Either the heavy or light chain variable domain is expressed as a
fusion protein with a coat protein of the phage and either the
heavy or light chain variable domain or both is/are encoded by the
genome of the phage. The heavy and/or light chain varies between
members. DNA encoding the heavy and/or light chain variable domains
are subcloned from the phage library members into an expression
vector to produce modified forms of the expression vector. The
modified forms of the expression vector are introduced into a host
and expressed to produce antibodies formed by the heavy and light
chain variable domains of the phage library in the host. The
antibodies are then released from the host to form an antibody
library of at least four antibodies. At least 75% of modified forms
of the expression vector encode antibodies with specific affinity
for a target and no modified form of the expression vector
constitutes more than 50% of the total.
[0024] Polyclonal libraries of antibodies and other polypeptides
produced by the above methods can be incorporated into a diagnostic
kit, or formulated for use as a diagnostic or therapeutic
reagent.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1: Primers used for amplification of immunoglobulin
heavy chains.
[0026] FIG. 2: Primers used for amplification of immunoglobulin
light chains.
[0027] FIG. 3: Vectors used for cloning antibodies. FIG. 3A shows a
vector obtained from Ixsys, Inc. and described in Huse, W0
92/06204, which provides the starting material for producing the
vectors shown in FIGS. 3B and 3C. FIGS. 3B and 3C show the BS39 and
BS45 vectors used in the present examples. The following
abbreviations are used:
[0028] A. Nonessential DNA sequence later deleted.
[0029] B. Lac promoter and ribosome binding site.
[0030] C. Pectate lyase signal sequence.
[0031] D. Kappa chain variable region.
[0032] E. Kappa chain constant region.
[0033] F. DNA sequence separating kappa and heavy chain, includes
ribosome binding site for heavy chain.
[0034] G. Alkaline phosphatase signal sequence.
[0035] H. Heavy chain variable region.
[0036] I. Heavy chain constant region including 5 amino acids of
the hinge region.
[0037] J. Decapeptide DNA sequence.
[0038] K. Pseudo gene VIII sequence with amber stop codon at 5'
end.
[0039] L. Nonessential DNA sequence that was later deleted.
[0040] M. Deleted kappa chain variable sequence with translational
step sequences.
[0041] N. Polyhistidine (6 codon sequence).
[0042] O. Same as F above, but lacking the HindIII site.
[0043] P. Deleted heavy chain variable sequence with translational
stop sequence.
[0044] Q. Pseudo gene VIII sequence without amber stop codon at 5'
end.
[0045] R. Deleted kappa chain variable sequence with
transcriptional stop sequence.
[0046] FIG. 4: Oligonucleotides used in vector construction.
[0047] FIG. 5: Insertion of araC into pBR-based vector (FIG. 5A)
and the resulting vector pBRnco (FIG. 5B).
[0048] FIG. 6: Subcloning of a DNA segment encoding a Fab by T4
exonuclease digestion.
[0049] FIG. 7: Map of the vector pBRncoH3.
DEFINITIONS
[0050] Specific binding between an antibody or other binding agent
and an antigen means a binding affinity of at least 10.sup.6
M.sup.-1. Preferred binding agents bind with affinities of at least
about 10.sup.7 M.sup.-1, and preferably 10.sup.8 M.sup.-1 to
10.sup.9 M.sup.-1 or 10.sup.10 M.sup.-.
[0051] The term epitope means an antigenic determinant capable of
specific binding to an antibody. Epitopes usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. Conformational and nonconformational epitopes are
distinguished in that the binding to the former but not the latter
is lost in the presence of denaturing solvents.
[0052] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 Kda). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxyl-terminal portion of each chain defines a constant region
primarily responsible for effector function.
[0053] Light chains are classified as either kappa or lambda. Heavy
chains are classified as gamma, mu, alpha, delta, or epsilon, and
define the antibody's isotype as IgG, IgM, IgA, IgD and IgE,
respectively. Within light and heavy chains, the variable and
constant regions are joined by a "J" region of about 12 or more
amino acids, with the heavy chain also including a "D" region of
about 10 more amino acids. (See generally, Fundamental Immunology
(Paul, W., ed., 2nd ed. Raven Press, N.Y., 1989, 4th edition
(1999), Paul William E., ed. Raven Press, N.Y.,(incorporated by
reference in its entirety for all purposes). The term constant
region is used to refer to both full-length natural constant
regions and segments thereof, such as C.sub.H1, hinge, C.sub.H2 and
C.sub.H3 or fragments thereof. Typically, segments of light and
heavy chain constant regions in antibodies have sufficient length
to contribute to interchain bonding between heavy and light
chain.
[0054] The variable regions of each light/heavy chain pair form the
antibody binding site. Thus, an intact antibody has two binding
sites. Except in bifunctional or bispecific antibodies, the two
binding sites are the same. The chains all exhibit the same general
structure of four relatively conserved framework regions (FR)
joined by three hypervariable regions, also called complementarily
determining regions or CDRs. The CDRs from the two chains of each
pair are aligned by the framework regions, enabling binding to a
specific epitope. CDR and FR residues are delineated according to
the standard sequence definition of Kabat, et al., supra. An
alternative structural definition has been proposed by Chothia, et
al., J. Mol. Biol. 196:901-917 (1987); Nature 342:878-883 (1989);
and J. Mol. Biol. 186:651-663 (1989).
[0055] The term antibody is used to mean whole antibodies and
binding fragments thereof. Binding fragments include single chain
fragments, Fv fragments and Fab fragments The term Fab fragment is
sometimes used in the art to mean the binding fragment resulting
from papain cleavage of an intact antibody. The terms Fab' and
F(ab').sub.2 are sometimes used in the art to refer to binding
fragments of intact antibodies generated by pepsin cleavage. Here,
Fab is used to refer generically to double chain binding fragments
of intact antibodies having at least substantially complete light
and heavy chain variable domains sufficient for antigen-specific
bindings, and parts of the light and heavy chain constant regions
sufficient to maintain association of the light and heavy chains.
Usually, Fab fragments are formed by complexing a full-length or
substantially full-length light chain with a heavy chain comprising
the variable domain and at least the C.sub.H1 domain of the
constant region.
[0056] Chimeric antibodies are antibodies whose light and heavy
chain genes have been constructed, typically by genetic
engineering, from immunoglobulin gene segments belonging to
different species. For example, the variable (V) segments of the
genes from a mouse monoclonal antibody can be joined to human
constant (C) segments, such as IgG1 and IgG4. A typical chimeric
antibody is thus a hybrid protein consisting of the V or
antigen-binding domain from a mouse antibody and a C or effector
domain from a human antibody. Chimeric antibodies have the same or
similar binding specificity and affinity as a mouse or other
nonhuman antibody that provides the variable regions of the
antibody.
[0057] An isolated species or population of species means an object
species (e.g., binding polypeptides of the invention) that is the
predominant species present (i.e., on a molar basis it is more
abundant than other species in the composition). Preferably, an
isolated species comprises at least about 50, 80 or 90 percent (on
a molar basis) of all macromolecular species present. Most
preferably, the object species is purified to essential homogeneity
(contaminant species cannot be detected in the composition by
conventional detection methods). A target is any molecule for which
it is desired to isolate partners with specific binding affinity
for the target.
[0058] Targets of interest include antibodies, including
anti-idiotypic antibodies and autoantibodies present in autoimmune
diseases, such as diabetes, multiple sclerosis and rheumatoid
arthritis. Other targets of interest are growth factor receptors
(e.g., FGFR, PDGFR, EFG, NGFR, and VEGF) and their ligands. Other
targets are G-protein receptors and include substance K receptor,
the angiotensin receptor, the .alpha.- and .beta.-adrenergic
receptors, the serotonin receptors, and PAF receptor. See, e.g.,
Gilman, Ann. Rev. Biochem. 56:625-649 (1987). Other targets include
ion channels (e.g., calcium, sodium, potassium channels),
muscarinic receptors, acetylcholine receptors, GABA receptors,
glutamate receptors, and dopamine receptors (see Harpold, U.S. Pat.
No. 5,401,629 and U.S. Pat. No. 5,436,128). Other targets are
adhesion proteins such as integrins, selectins, and immunoglobulin
superfamily members (see Springer, Nature 346:425-433 (1990).
Osborn, Cell 62:3 (1990); Hynes, Cell 69:11 (1992)). Other targets
are cytokines, such as interleukins IL-1 through IL-13, tumor
necrosis factors .alpha. & .beta., interferons .alpha., .beta.
and .gamma., tumor growth factor Beta (TGF-.beta.), colony
stimulating factor (CSF) and granulocyte monocyte colony
stimulating factor (GM-CSF). See Human Cytokines: Handbook for
Basic & Clinical Research (Aggrawal et al. eds., Blackwell
Scientific, Boston, Mass. 1991). Other targets are hormones,
enzymes, and intracellular and intercellular messengers, such as,
adenyl cyclase, guanyl cyclase, and phospholipase C. Drugs are also
targets of interest. Target molecules can be human, mammalian or
bacterial. Other targets are antigens, such as proteins,
glycoproteins and carbohydrates from microbial pathogens, both
viral and bacterial, and tumors. Still other targets are described
in U.S. Pat. No. 4,366,241. Some agents screened by the target
merely bind to a target. Other agents agonize or antagonize the
target.
[0059] Display library members having full-length polypeptide
coding sequences have coding sequences the same length as that of
the coding sequences originally inserted into a display vector
before propagation of the vector.
[0060] The term phage is used to refer to both phage containing
infective genomes and phage containing defective genomes that can
be packaged only with a helper phage. Such phage are sometimes
referred to as phagemids.
[0061] The term "human antibody"includes antibodies having variable
and constant regions (if present) derived from human germline
immunoglobulin sequences. Some human antibodies include amino acid
residues not encoded by human germline immunoglobulin sequences
(e.g., mutations introduced by random or site-specific mutagenesis
in vitro or by somatic mutation in vivo).
DETAILED DESCRIPTION
[0062] I. General
[0063] The present invention is directed to inter alia two related
but self-sufficient improvements in conventional display methods.
The first improvement provides methods of enriching conventional
display libraries for members displaying polypeptides capable of
binding to a target. Although practice of the claimed methods is
not dependent on an understanding of mechanism, the rationale for
these methods is believed to be that affinity selection of library
members to immobilized binding partners occurs predominantly or
exclusively through formation of multivalent bonds between multiple
copies of displayed polypeptides on a library member and
immobilized binding partners. Accordingly, only members of a
library displaying multiple copies of a polypeptide are capable of
surviving affinity selection to immobilized binding partners. For
example, conventional libraries of polypeptides fused to pVIII of a
filamentous phage typically exhibit a Poisson distribution, in
which most members display no copies of a polypeptide, a small
proportion display one copy of a polypeptide, a still smaller
proportion display two copies, and a still smaller proportion
display three or more copies. It is believed that the methods of
the present invention enrich for the small proportion of
conventional display libraries displaying two or more copies of a
polypeptide. It is this rare fraction of conventional libraries
that is capable of being affinity selected by immobilized binding
partners.
[0064] Enrichment can be achieved by the inclusion of a tag as a
component of the fusion protein from which polypeptides are
displayed. The tag can be any polypeptide with a known receptor
showing high binding specificity for the tag. The same tag is
included in each member of the library. Enrichment is effected by
screening the library for affinity binding to an immobilized
receptor for the tag. Only library members having two or more
copies of the tag are capable of binding to the immobilized
receptor. By implication, library members having two copies of the
tag have two copies of the fusion protein containing the tag, and
two copies of a polypeptide to be screened. The library members
that bind to the receptor thus constitute the small subpopulation
of library members displaying two or more polypeptides. The library
members not binding to the receptor are the majority of library
members which display fewer than two copies of a polypeptide (i.e.,
zero or one copy). These library members, which would
nonspecifically bind to the immobilized target in subsequent steps
without contributing any members capable of surviving affinity
screening through specific binding of the displayed polypeptide,
can thus be substantially eliminated.
[0065] The bound library members, which display multiple copies of
polypeptide, can then be subject to one or more rounds of affinity
screening to any immobilized target of interest. Because most
library members that would otherwise contribute to nonspecific
binding have been eliminated before affinity screening to the
target, each round of affinity screening typically results in a
greater enrichment for library members with affinity for the target
than would be the case in conventional methods. The greater degree
of enrichment per round of screening allows adequate screening to
be accomplished in fewer rounds and/or a greater proportion of the
repertoire of specifically binding library members to be
identified.
[0066] So efficient are the selection methods of the invention that
they result in diverse populations in which the vast majority of
members retaining full-length coding sequences encode polypeptides
having specific affinity for the target. These polypeptides may
differ in fine binding specificity within the target and binding
affinity for the target.
[0067] A second aspect in which the invention represents a
substantial departure from conventional methods resides in the
subcloning of nucleic acids encoding displayed polypeptides of
enriched libraries from a display vector to an expression vector
without clonal isolation of individual members. The utility of
transferring populations of coding sequences from a display vector
to an expression vector without clonal isolation is realizable
because the enriched libraries contain a high proportion of members
having the desired binding specificity as described above.
[0068] Subcloning is achieved by excising or amplifying nucleic
acids encoding polypeptides from the enriched library. The nucleic
acids are then preferably size-fractionated on a gel and only
full-length sequences are retained. The full-length sequences are
inserted into an expression vector in operable linkage to
appropriate regulatory sequences to ensure their expression. The
modified expression vector is then introduced into appropriate host
cells and expressed. Expression results in a population of
polypeptides having specific affinity for the desired target. The
population of polypeptides can be purified from the host cells by
conventional methods. The population of polypeptides typically has
substantially the same members in substantially the same
proportions as were encoded by the enriched display library. As in
the display library, the polypeptides typically differ in fine
binding specificity, and binding affinity for the chosen
target.
[0069] The populations of polypeptides can be used as diagnostic
and therapeutic reagents. For example, if the target is a viral
antigen, the polypeptides can be used to assay the presence of the
virus in tissue samples. If the target is a tumor antigen, the
polypeptides can be used as a therapeutic reagent to deliver a
toxic substance to cells bearing the tumor antigen. The use of a
polyclonal preparation has advantages over a monoclonal reagent in
both of these types of applications. For example, the diverse fine
binding specificity of members of a population often allows the
population to bind to several variant forms of target (e.g.,
species variants, escape mutant forms) to which a monoclonal
reagent may be unable to bind.
[0070] II. Display Libraries
[0071] A. Display Packages
[0072] A display package, sometimes referred to as a replicable
genetic package, is a screenable unit comprising a polypeptide to
be screened linked to a nucleic acid encoding the polypeptide. The
nucleic acid should be replicable either in vivo (e.g., as a
vector), optionally in conjunction with host proteins or a helper
virus, or in vitro (e.g., by PCR). Cells, spores or viruses are
examples of display packages. These display packages can be
eukaryotic or prokaryotic. A display library is formed by
introducing nucleic acids encoding exogenous polypeptides to be
displayed into the genome of the display package to form a fusion
protein with an endogenous protein that is normally expressed from
the outer surface of the replicable genetic package. Expression of
the fusion protein, transport to the outer surface and assembly
results in display of exogenous polypeptides from the outer surface
of the genetic package.
[0073] A further type of display package comprises a polypeptide
bound to a nucleic acid encoding the polypeptide. Such an
arrangement can be achieved in several ways. U.S. Pat. No.
5,733,731 describe a method in which a plasmid is engineered to
expression a fusion protein comprising a DNA binding polypeptide
and a polypeptide to be screened. After expression the fusion
protein binds to the vector encoding it though the DNA binding
polypeptide component. Vectors displaying fusion proteins are
screened for binding to a target, and vectors recovered for further
rounds of screening or characterization. In another method,
polypeptides are screened as components of display package
comprising a polypeptide being screened, and mRNA encoding the
polypeptide, and a ribosome holding together the mRNA and
polypeptide(see Hanes & Pluckthun, PNAS 94, 4937-4942 (1997);
Hanes et al., PNAS 95, 14130-14135 (1998); Hanes et al., FEBS Let.
450, 105-110 (1999); U.S. Pat. No. 5,922,545). mRNA of selected
complexes is amplified by reverse transcription and PCR and in
vitro transcription, and subject to further screening linked to a
ribosome and protein translated from the mRNA. In another method,
RNA is fused to a polypeptide encoded by the RNA for screening
(Roberts & Szostak, PNAS 94, 12297-12302 (1997), Nemoto et al.,
FEBS Letters 414, 405-408 (1997). RNA from complexes surviving
screening is amplified by reverse transcription PCR and in vitro
transcription.
[0074] The genetic packages most frequently used for display
libraries are bacteriophage, particularly filamentous phage, and
especially phage M13, Fd and F1. Most work has inserted libraries
encoding polypeptides to be displayed into either gIII or gVIII of
these phage forming a fusion protein. See, e.g., Dower, WO
91/19818; Devlin, WO 91/18989; MacCafferty, WO 92/01047 (gene III);
Huse, WO 92/06204; Kang, WO 92/18619 (gene VIII). Such a fusion
protein comprises a signal sequence, usually from a secreted
protein other than the phage coat protein, a polypeptide to be
displayed and either the gene III or gene VIII protein or a
fragment thereof. Exogenous coding sequences are often inserted at
or near the N-terminus of gene III or gene VIII although other
insertion sites are possible. Some filamentous phage vectors have
been engineered to produce a second copy of either gene III or gene
VIII. In such vectors, exogenous sequences are inserted into only
one of the two copies. Expression of the other copy effectively
dilutes the proportion of fusion protein incorporated into phage
particles and can be advantageous in reducing selection against
polypeptides deleterious to phage growth. In another variation,
exogenous polypeptide sequences are cloned into phagemid vectors
which encode a phage coat protein and phage packaging sequences but
which are not capable of replication. Phagemids are transfected
into cells and packaged by infection with helper phage. Use of
phagemid system also has the effect of diluting fusion proteins
formed from coat protein and displayed polypeptide with wild type
copies of coat protein expressed from the helper phage. See, e.g.,
Garrard, WO 92/09690.
[0075] Eukaryotic viruses can be used to display polypeptides in an
analogous manner. For example, display of human heregulin fused to
gp70 of Moloney murine leukemia virus has been reported by Han, et
al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995). Spores can
also be used as replicable genetic packages. In this case,
polypeptides are displayed from the outer surface of the spore. For
example, spores from B. subtilis have been reported to be suitable.
Sequences of coat proteins of these spores are provided by Donovan,
et al., J. Mol. Biol. 196:1-10 (1987). Cells can also be used as
replicable genetic packages. Polypeptides to be displayed are
inserted into a gene encoding a cell protein that is expressed on
the cells surface. Bacterial cells including Salmonella
typhimurium, Bacillus subtilis, Pseudomonas aeruginosa, Vibrio
cholerae, Klebsiella pneumonia, Neisseria gonorrhoeae, Neisseria
meningitidis, Bacteroides nodosus, Moraxella bovis, and especially
Escherichia coli are preferred. Details of outer surface proteins
are discussed by Ladner, et al., U.S. Pat. No. 5,571,698, and
Georgiou, et al., Nature Biotechnology 15:29-34 (1997) and
references cited therein. For example, the lamB protein of E. coli
is suitable.
[0076] B. Displayed Polypeptides
[0077] Polypeptides typically displayed from replicable genetic
packages fall into a number of broad categories. One category is
libraries of short random or semi random peptides. See, e.g.,
Cwirla et al., supra. The strategy here is to produce libraries of
short peptides in which some or all of the positions are
systematically varied for the different amino acids. Random peptide
coding sequences can be formed by the cloning and expression of
randomly-generated mixtures of oligonucleotides is possible in the
appropriate recombinant vectors. See, e.g., Oliphant, et al., Gene
44:177-183 (1986)
[0078] A second category of library comprises variants of a
starting framework protein. See Ladner, et al., supra. In this
approach, a starting polypeptide which may be of substantial length
is chosen and only selected positions are varied. The nucleic acid
encoding the starting polypeptide can be mutagenized by, for
example, insertion of mutagenic cassette(s) or error-prone PCR.
[0079] A third category of library consists of antibody libraries.
Antibody libraries can be single or double chain. Single chain
antibody libraries can comprise the heavy or light chain of an
antibody alone or the variable domain thereof. However, more
typically, the members of single-chain antibody libraries are
formed from a fusion of heavy and light chain variable domains
separated by a peptide spacer within a single contiguous protein.
See e.g., Ladner, et al., WO 88/06630; McCafferty, et al., WO
92/01047. Double-chain antibodies are formed by noncovalent
association of heavy and light chains or binding fragments thereof.
Double chain antibodies can also form by association of two single
chain antibodies, each single chain antibody comprising a heavy
chain variable domain, a linker and a light chain variable domain.
In such antibodies, known as diabodies, the heavy chain of one
single-chain antibody binds to the light chain of the other and
vice versa, thus forming two identical antigen binding sites (see
Hollinger et al., Proc. Natl. Acad. Sci. USA 90, 6444-6448 (1993)
and Carter & Merchan, Curr. Op. Biotech. 8, 449-454 (1997).
Thus, phage displaying single chain antibodies can form diabodies
by association of two single chain antibodies as a diabody.
[0080] The diversity of antibody libraries can arise from obtaining
antibody-encoding sequences from a natural source, such as a
nonclonal population of immunized or unimmunized B cells.
Alternatively, or additionally, diversity can be introduced by
artificial mutagenesis as discussed for other proteins.
[0081] Nucleic acids encoding polypeptides to be displayed
optionally flanked by spacers are inserted into the genome of a
replicable genetic package as discussed above by standard
recombinant DNA techniques (see generally, Sambrook, et al.,
Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989, incorporated by
reference herein). The nucleic acids are ultimately expressed as
polypeptides (with or without spacer or framework residues) fused
to all or part of the an outer surface protein of the replicable
package. Libraries often have sizes of about 10.sup.3, 10.sup.4,
10.sup.6, 10.sup.7, 10.sup.8 or more members.
[0082] C. Double-Chain Antibody Display Libraries
[0083] Double-chain antibody display libraries represent a species
of the replicable genetic display libraries discussed above.
Production of such libraries is described by, e.g., Dower, U.S.
Pat. No. 5,427,908; Huse WO 92/06204; Huse, in Antibody
Engineering, (Freeman 1992), Ch. 5; Kang, WO 92/18619; Winter, WO
92/20791; McCafferty, WO 92/01047; Hoogenboom WO 93/06213; Winter,
et al., Annu. Rev. Immunol. 12:433-455 (1994); Hoogenboom, et al.,
Immunological Reviews 130:41-68 (1992); Soderlind, et al.,
Immunological Reviews 130:109-124 (1992). In double-chain antibody
libraries, one antibody chain is fused to a phage coat protein, as
is the case in single chain libraries. The partner antibody chain
is complexed with the first antibody chain, but the partner is not
directly linked to a phage coat protein. Either the heavy or light
chain can be the chain fused to the coat protein. Whichever chain
is not fused to the coat protein is the partner chain. This
arrangement is typically achieved by incorporating nucleic acid
segments encoding one antibody chain gene into either gill or gVIII
of a phage display vector to form a fusion protein comprising a
signal sequence, an antibody chain, and a phage coat protein.
Nucleic acid segments encoding the partner antibody chain can be
inserted into the same vector as those encoding the first antibody
chain. Optionally, heavy and light chains can be inserted into the
same display vector linked to the same promoter and transcribed as
a polycistronic message. Alternatively, nucleic acids encoding the
partner antibody chain can be inserted into a separate vector
(which may or may not be a phage vector). In this case, the two
vectors are expressed in the same cell (see WO 92/20791). The
sequences encoding the partner chain are inserted such that the
partner chain is linked to a signal sequence, but is not fused to a
phage coat protein. Both antibody chains are expressed and exported
to the periplasm of the cell where they assemble and are
incorporated into phage particles.
[0084] Antibody encoding sequences can be obtained from lymphatic
cells of a human or nonhuman animal. Often the cells have been
immunized, in which case immunization can be performed in vivo
before harvesting cells, or in vitro after harvesting cells, or
both. Spleen cells of an immunized animal are a preferred source
material. Immunization of humans is only possible with certain
antigens. The number of different H chain genes and L chain genes
in a spleen from an immunized animal is about 10.sup.6, which can
be assembled in 10.sup.12 potential combinations.
[0085] Rearranged immunoglobulin genes can be cloned from genomic
DNA or mRNA. For the latter, mRNA is extracted from the cells and
cDNA is prepared using reverse transcriptase and poly dT
oligonucleotide primers. Primers for cloning antibody encoding
sequences are discussed by Larrick, et al., Bio/Technology 7:934
(1989), Danielsson & Borrebaceick, in Antibody Engineering: A
Practical Guide (Freeman, NY, 1992), p. 89 and Huse, id. at Ch.
5.
[0086] Repertoires of antibody fragments have been constructed by
combining amplified V.sub.H and V.sub.L sequences together in
several ways. Light and heavy chains can be inserted into different
vectors and the vectors combined in vitro (Hogrefe, et al., Gene
128:119-126 (1993)) or in vivo (Waterhouse, et al., Nucl. Acids.
Res.: 2265-66 (1993)). Alternatively, the light and heavy chains
can be cloned sequentially into the same vector (Barbas, et al.,
Proc. Natl. Acad. Sci. USA 88: 7987-82 (1991)) or assembled
together by PCR and then inserted into a vector (Clackson, et al.,
Nature 352:624-28 (1991)). Repertoires of heavy chains can be also
be combined with a single light chain or vice versa. Hoogenboom, et
al., J. Mol. Biol. 227: 381-88 (1992).
[0087] Typically, segments encoding heavy and light antibody chains
are subcloned from separate populations of heavy and light chains
resulting in random association of a pair of heavy and light chains
from the populations in each vector. Thus, modified vectors
typically contain combinations of heavy and light chain variable
region not found in the same lymphatic cell in nature. Some of
these combinations typically survive the selection process and also
exist in the polyclonal libraries described below.
[0088] Some exemplary vectors and procedures for cloning
populations of heavy chain and light chain encoding sequences have
been described by Huse, WO 92/06204. Diverse populations of
sequences encoding H.sub.c polypeptides are cloned into M13IX30 and
sequences encoding L.sub.c polypeptides are cloned into M13IX11.
The populations are inserted between the XhoI-SeeI or StuI
restriction enzyme sites in M13IX30 and between the SacI-XbaI or
EcoRV sites in M13IX11 (FIGS. 1A and B of Huse, respectively). Both
vectors contain two pairs of MluI-HindIII restriction enzyme sites
(FIGS. 1A and B of Huse) for joining together the H.sub.c and
L.sub.c encoding sequences and their associated vector sequences.
The two pairs are symmetrically orientated about the cloning site
so that only the vector proteins containing the sequences to be
expressed are exactly combined into a single vector.
[0089] Others exemplary vectors and procedures for cloning antibody
chains into filamentous phage are described in the present
Examples.
[0090] III. Enrichment for Polyvalent Display Members
[0091] A. Theory of the method
[0092] That members of a library displaying multiple copies of a
polypeptide are comparatively rare in display libraries is a
finding apparently at variance with some early reports in the
field. See, e.g., Cwirla et al., supra. Most work on display
libraries has been done by inserting nucleic acid libraries into
pIII or pVIII of filamentous phage. Because pIII is present in 4 or
5 copies per phage and pVIII is present in several hundred copies
per phage, some early reports assumed that foreign polypeptides
would be displayed in corresponding numbers per phage. However,
more recent work has made clear that the actual number of copies of
polypeptide displayed per phage is well below theoretical
expectations, perhaps due to proteolytic cleavage of polypeptides.
Winter, et al., Ann. Rev. Immunol. 12:433-55 (1994). Further,
vector systems used for phage display often encode two copies of a
phage coat protein, one of which is a wild type protein and the
other of which forms a fusion protein with exogenous polypeptides
to be displayed. Both copies are expressed and the wild type coat
protein effectively dilutes the representation of the fusion
protein in the phage coat.
[0093] A typical ratio of displayed Fabs per phage, when Fabs are
expressed from pVIII of a filamentous phage is about 0.2. The
probability, Pr(y), of y Fabs being expressed on a phage particle
if the average frequency of expression per phage is n is given by
the Poisson probability distribution
Pr(y)=e.sup.-nn.sup.y/y!
[0094] For a frequency of 0.2 Fabs per phage, the probabilities for
the expression of 0, 1, 2, and 3 Fabs per phage are 0.82, 0.16,
0.016, and 0.0011. The proportion of phage particle displaying two
or more Fabs is therefore only 0.017.
[0095] The low representation of members displaying more than one
Fab fragment in a phage display library can be related to the
present inventors' result that only a small percentage of such
library members are capable of surviving affinity selection to
immobilized binding partners. A library was constructed in which
all members encoded the same Fab fragment which was known to have a
high binding affinity for a particular target. It was found that
even under the mildest separation conditions for removal of free
from bound phage, it was not possible to bind more than about 0.004
of the total phage. This proportion is the same order of magnitude
as the proportion of phage displaying at least two Fab fragments,
suggesting that phage must display at least two Fab fragments to
bind to immobilized target. Probably shear forces dissociate phage
displaying only a single Fab fragment from the solid phase.
Therefore, at least two binding events are necessary for a
phage-Fab library member to be bound to immobilized target with
sufficient avidity to enable separation of the bound from the free
phage. It is expected that similar constraints apply in other forms
of display library.
[0096] The strategy of the present invention is to enrich for
library members displaying more than one polypeptide before the
library is contacted with a screening target. Library members
lacking two or more polypeptides, which are incapable of surviving
affinity selection via binding through displayed polypeptides to
any immobilized screening target, but which nevertheless can
survive affinity selection by formation of multiple nonspecific
bonds to such a target or its support, are thus substantially
eliminated before screening of the library to the target is
performed.
[0097] B. Tags and Receptors
[0098] The above strategy is effected by the use of paired tags and
receptors. A tag can any peptide sequence that is common to
different members of the library, heterologous to the replicable
genetic package, and fused to a polypeptide displayed from the
replicable genetic package. For example, a tag can be a synthetic
peptide sequence, a constant region of an antibody. In some
methods, single chain antibodies are displayed in which only the
light or heavy chain variable region but not both varies between
members. In such situations, among others, the variable region that
is the same in different members can be used as a tag. Suitable
tag-receptor combinations include epitope and antibody; for
example, many high affinity hexapeptide ligands are known for the
anti-dynorphin mAb 32.39, (see Barrett et al., Neuropeptides
6:113-120 (1985) and Cull et al., Proc. Nat'l Acad. Sci. USA
89:1865-1869 (1992)) and a variety of short peptides are known to
bind the MAb 3E7 (Schatz, Biotechnology 11:1138-43 (1993)). Another
combination of tag and antibody is described by Blanar &
Rutter, Science 256:1014-1018 (1992).
[0099] Another example of a tag-receptor pair is the FLAG.TM.
system (Kodak). The FLAG.TM. molecular tag consists of an eight
amino acid FLAG peptide marker that is linked to the target binding
moiety. A 24 base pair segment containing a FLAG coding sequence
can be inserted adjacent to a nucleotide sequence that codes for
the displayed polypeptide. The FLAG peptide includes an
enterokinase recognition site that corresponds to the
carboxyl-terminal five amino acids. Capture moieties suitable for
use with the FLAG peptide marker include antibodies Anti-FLAG M1,
M2 and M5, which are commercially available.
[0100] Still other combinations of peptides and antibodies can be
identified by conventional phage display methods. Further suitable
combinations of peptide sequence and receptor include polyhistidine
and metal chelate ligands containing Ni.sup.2+ immobilized on
agarose (see Hochuli in Genetic Engineering: Principles and Methods
(ed. J K Setlow, Plenum Press, NY), Ch. 18, pp. 87-96 and maltose
binding protein (Mama, et al., Gene 74:365-373 (1988)).
[0101] Receptors are often labeled with biotin allowing the
receptors to be immobilized to an avidin-coated support. Biotin
labeling can be performed using the biotinylating enzyme, BirA
(see, e.g., Schatz, Biotechnology 11:1138-43 (1993)).
[0102] A nucleic acid sequence encoding a tag is inserted into a
display vector in such a manner that the tag is expressed as part
of the fusion protein containing the polypeptide to be displayed
and an outer surface protein of the replicable genetic package. The
relative ordering of these components is not critical provided that
the tag and polypeptide to be displayed are both exposed on the
outer surface of the package. For example, the tag can be placed
between the outer surface protein and the displayed polypeptide or
at or near the exposed end of the fusion protein.
[0103] In replicable genetic packages displaying Fabs, a tag can be
fused to either the heavy or the light Fab chain, irrespective
which chain is linked to a phage coat protein. Optionally, two
different tags can used one fused to each of the heavy and light
chains. One tag is usually positioned between the phage coat
protein and antibody chain linked thereto, and the other tag is
positioned at either the N- or C-terminus of the partner chain.
[0104] C. Selection of Polyvalent Members
[0105] Selection of polyvalent library members is performed by
contacting the library with the receptor for the tag component of
library members. Usually, the library is contacted with the
receptor immobilized to a solid phase and binding of library
members through their tag to the receptor is allowed to reach
equilibrium. The complexed receptor and library members are then
brought out of solution by addition of a solid phase to which the
receptor bears affinity (e.g., an avidin-labeled solid phase can be
used to immobilize biotin-labeled receptors). Alternatively, the
library can be contacted with receptor in solution and the receptor
subsequently immobilized. The concentration of receptor should
usually be at or above the Kd of the tag/receptor during solution
phase binding so that most displayed tags bind to a receptor at
equilibrium. When the receptor-library members are contacted with
the solid phase only the library members linked to receptor through
at least two displayed tags remain bound to the solid phase
following separation of the solid phase from library members in
solution. Library members linked to receptor through a single tag
are presumably sheared from the solid phase during separation and
washing of the solid phase. After removal of unbound library
members, bound library members can be dissociated from the receptor
and solid phase by a change in ionic strength or pH, or addition of
a substance that competes with the tag for binding to the receptor.
For example, binding of metal chelate ligands immobilized on
agarose and containing Ni.sup.2+ to a hexahistidine sequence is
easily reversed by adding imidazole to the solution to compete for
binding of the metal chelate ligand. Antibody-peptide binding can
often be dissociated by raising the pH to 10.5 or higher.
[0106] The average number of polypeptides per library member
selected by this method is affected by a number of factors.
Decreasing the concentration of receptor during solution-phase
binding has the effect of increasing the average number of
polypeptides in selected library members. An increase in the
stringency of the washing conditions also increases the average
number of polypeptides per selected library member. The physical
relationship between library members and the solid phase can also
be manipulated to increase the average number of polypeptides per
library member. For example, if discrete particles are used as the
solid phase, decreasing the size of the particles increases the
steric constraints of binding and should require a higher density
of polypeptides displayed per library member.
[0107] For Fab libraries having two tags, one linked to each
antibody chain, two similar rounds of selection can be performed,
with the products of one round becoming the starting materials for
the second round. The first round of selection is performed with a
receptor to the first tag, and the second round with a receptor to
the second tag. Selecting for both tags enriches for library
members displaying two copies of both heavy and light antibody
chains (i.e., two Fab fragments).
[0108] Although the theory underlying the above methods of
polyvalent enrichment is believed to be correct, the practice of
the invention is in no way dependent on the correctness of this
theory. The data presented in the Examples show that prescreening a
display library for members binding to a tag, followed by screening
those members for binding to a target results in a higher degree of
enrichment for members with affinity for a target than if the
method is performed without the prescreening step. Thus, the method
can be practiced as described, and achieve the desired result of
highly enriched libraries without any understanding of the
underlying mechanism.
[0109] D. Selection For Affinity to Target
[0110] Library members enriched for polyvalent display of Fabs or
other polypeptides are screened for binding to a target. The target
can be any molecule of interest for which it is desired to identify
binding partners. The target should lack specific binding affinity
for the tag(s), because in this step it is the displayed
polypeptides being screened, and not the tags that bind to the
target. The screening procedure at this step is closely analogous
to that in the previous step except that the affinity reagent is a
target of interest rather than a receptor to a tag. The enriched
library members are contacted with the target which is usually
labeled (e.g., with biotin) in such a manner that allows its
immobilization. Binding is allowed to proceed to equilibrium and
then target is brought out of solution by contacting with the solid
phase in a process known as panning (Parmley & Smith, Gene
73:305-318 (1988)). Library members that remain bound to the solid
phase throughout the selection process do so by virtue of
polyvalent bonds between them and immobilized target molecules.
Unbound library members are washed away from the solid phase.
[0111] Usually, library members are subject to amplification before
performing a subsequent round of screening. Often, bound library
members can be amplified without dissociating them from the
support. For example, gene VIII phage library members immobilized
to beads, can be amplified by immersing the beads in a culture of
E. coli. Likewise, bacterial display libraries can be amplified by
adding growth media to bound library members. Alternatively, bound
library members can be dissociated from the solid phase (e.g., by
change of ionic strength or pH) before performing subsequent
selection, amplification or propagation.
[0112] After affinity selection, bound library members are now
enriched for two features: multivalent display of polypeptides and
display of polypeptides having specific affinity for the target of
interest. However, after subsequent amplification, to produce a
secondary library, the secondary library remains enriched for
display of polypeptides having specific affinity for the target,
but, as a result of amplification, is no longer enriched for
polyvalent display of polypeptides. Thus, a second cycle of
polyvalent enrichment can then be performed, followed by a second
cycle of affinity enrichment to the screening target. Further
cycles of affinity enrichment to the screening target, optionally,
alternating with amplification and enrichment for polyvalent
display can then be performed, until a desired degree of enrichment
has been achieved.
[0113] In a variation, affinity screening to a target is performed
in competition with a compound that resembles but is not identical
to the target. Such screening preferentially selects for library
members that bind to a target epitope not present on the compound.
In a further variation, bound library members can be dissociated
from the solid phase in competition with a compound having known
crossreactivity with a target for an antigen. Library members
having the same or similar binding specificity as the known
compound relative to the target are preferentially eluted. Library
members with affinity for the target through an epitope distinct
from that recognized by the compound remain bound to the solid
phase.
[0114] Discrimination in selecting between polypeptides of
different monovalent affinities for the target is affected by the
valency of library members and the concentration of target during
the solution phase binding. Assuming a minimum of i labeled target
molecules must be bound to a library member to immobilize it on a
solid phase, then the probability of immobilization can be
calculated for a library member displaying n polypeptides. From the
law of mass action, the bound/total polypeptide fraction, F, is
K[targ]/(1+K[targ]), where [targ] is the total target concentration
in solution. Thus, the probability that i or more displayed
polypeptides per library member are bound by the labeled target
ligand is given by the binomial probability distribution: 1 n y = i
( n ! / [ y ! ( n - y ) ! ] F y ( 1 - F ) n - y
[0115] As the probability is a function of K and [target],
multivalent display members each having a monovalent affinity, K,
for the target can be selected by varying the concentration of
target. The probabilities of solid-phase immobilization for i=1, 2,
or 3, with library members exhibiting monovalent affinities of
0.1/[Ag], 1/[Ag], and 10/[Ag], and displaying n polypeptides per
member are:
1 Probability of Immobilization (i = 1) n K = 0.1/[targ] K =
1/[targ] K = 10/[targ] 1 0.09 0.5 0.91 2 0.17 0.75 0.99 3 0.25
0.875 4 0.32 0.94 5 0.38 0.97 6 0.44 0.98 7 0.49 0.99 8 0.53 9 0.58
10 0.61 20 0.85 50 0.99
[0116]
2 Probability of Immobilization (i = 2) n K = 0.1/[targ] K =
1/[targ] K = 10/[targ] 2 0.008 0.25 0.83 3 0.023 0.50 0.977 4 0.043
0.69 0.997 5 0.069 0.81 6 0.097 0.89 7 0.128 0.94 8 0.160 0.965 9
0.194 0.98 20 0.55 50 0.95
[0117]
3 Probability of Immobilization (i = 3) n K = 0.1/[targ] K =
1/[targ] K = 10/[targ] 3 0.00075 0.125 0.75 4 0.0028 0.31 0.96 5
0.0065 0.50 0.99 6 0.012 0.66 7 0.02 0.77 8 0.03 0.855 9 0.0415
0.91 10 0.055 0.945 12 0.089 0.98 14 0.128 0.99 20 0.27 50 0.84
[0118] The above tables show that the discrimination between
immobilizing polypeptides of different monovalent binding
affinities is affected by the valency of library members (n) and by
the concentration of target for the solution binding phase.
Discrimination is maximized when n (number of polypeptides
displayed per phage) is equal to i (minimum valency required for
solid phase binding). Discrimination is also increased by lowering
the concentration of target during the solution phase binding.
Usually, the target concentration is around the Kd of the
polypeptides sought to be isolated. Target concentration of
10.sup.-8-10.sup.-10 M are typical.
[0119] Enriched libraries produced by the above methods are
characterized by a high proportion of members encoding polypeptides
having specific affinity for the target. For example, at least 10,
25, 50, 75, 90, 95, or 99% of members encode polypeptides having
specific affinity for the target. In libraries of double chain
antibodies, a pair of segments encoding heavy and light chains of
an antibody is considered a library member. The exact percentage of
members having affinity for the target depends whether the library
has been amplified following selection, because amplification
increases the representation of genetic deletions. However, among
members with full-length polypeptide coding sequences, the
proportion encoding polypeptides with specific affinity for the
target is very high (e.g., at least 50, 75, 90, 95 or 99%). Not all
of the library members that encode a polypeptide with specific
affinity for the target necessarily display the polypeptide. For
example, in a library in which 95% of members with full-length
coding sequences encode polypeptides with specific affinity for the
target, usually fewer than half actually display the polypeptide.
Usually, such libraries have at least 4, 10, 20, 50, 100, 1000,
10,000 or 100,000 different coding sequences. Usually, the
representation of any one such coding sequences is no more than
50%, 25% or 10% of the total coding sequences in the library.
[0120] IV. Polyclonal Libraries
[0121] A. Production
[0122] The nucleic acid sequences encoding displayed polypeptides
such as are produced by the above methods can be subcloned directly
into an expression vector without clonal isolation and testing of
individual members. Generally, the sequence encoding the outer
surface protein of the display vector fused to displayed
polypeptides is not excised or amplified in this process. The
nucleic acids can be excised by restriction digestion of flanking
sequences or can be amplified by PCR using primers to sites
flanking the coding sequences. See generally PCR Technology:
Principles and Applications for DNA Amplification (ed. H. A.
Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to
Methods and Applications (eds. Innis, et al., Academic Press, San
Diego, Calif., 1990); Mattila, et al., Nucleic Acids Res. 19:967
(1991); Eckert, et al., PCR Methods and Applications 1:17 (1991);
PCR (eds. McPherson et al., IRL Press, Oxford). PCR primers can
contain a marker sequence that allows positive selection of
amplified fragments when introduced into an expression vector. PCR
primers can also contain restriction sites to allow cloning into an
expression vector, although this is not necessary. For Fab
libraries, if heavy and light chains are inserted adjacent or
proximate to each other in a display vector, the two chains can be
amplified or excised together. For some Fab libraries, only the
variable domains of antibody chain(s) are excised or amplified. If
the heavy or light chains of a Fab library are excised or amplified
separately, they can subsequently be inserted into the same or
different expression vectors.
[0123] Having excised or amplified fragments encoding displayed
polypeptides, the fragments are usually size-purified on an agarose
gel or sucrose gradient. Typically, the fragments run as a single
sharp full-length band with a smear at lower molecular
corresponding to various deleted forms of coding sequence. The band
corresponding to full-length coding sequences is removed from the
gel or gradient and these sequences are used in subsequent
steps.
[0124] The next step is to join the nucleic acids encoding
full-length coding sequences to an expression vector thereby
creating a population of modified forms of the expression vector
bearing different inserts. This can be done by conventional
ligation of cleaved expression vector with a mixture of inserts
cleaved to have compatible ends. Alternatively, the use of
restriction enzymes on insert DNA can be avoided. This method of
cloning is beneficial because naturally encoded restriction enzyme
sites may be present within insert sequences, thus, causing
destruction of the sequence when treated with a restriction enzyme.
For cloning without restricting, a mixed population of inserts and
linearized vector sequences are treated briefly with a .sub.3' to
5' exonuclease such as T4 DNA polymerase or exonuclease III. See
Sambrook, et al., Molecular Cloning, A Laboratory Manual (2nd Ed.,
CSHP, New York 1989). The protruding 5' termini of the insert
generated by digestion are complementary to single-stranded
overhangs generated by digestion of the vector. The overhangs are
annealed, and the re-annealed vector transfected into recipient
host cells. The same result can be accomplished using 5' to 3'
exonucleases rather than a 3' to 5' exonuclease.
[0125] Preferably, ligation of inserts to expression vector is
performed under conditions that allow selection against re-annealed
vector and uncut vector. A number of vectors containing conditional
lethal genes that allow selection against re-annealed vector under
nonpermissive conditions are known. See, e.g., Conley &
Saunders, Mol. Gen. Genet. 194:211-218 (1984). These vectors
effectively allow positive selection for vectors having received
inserts. Selection can also be accomplished by cleaving an
expression vector in such a way that a portion of a positive
selection marker (e.g., antibiotic resistance) is deleted. The
missing portion is then supplied by full-length inserts. The
portion can be introduced at the 3' end of polypeptide coding
sequences in the display vector, or can be included in a primer
used for amplification of the insert. An exemplary selection
scheme, in which inserts supply a portion of a
tetracycline-resistance gene promoter deleted by HindIII cleavage
of a pBR-derivative vector, is described in Example 17.
[0126] The choice of expression vector depends on the intended host
cells in which the vector is to be expressed. Typically, the vector
includes a promoter and other regulatory sequences in operable
linkage to the inserted coding sequences that ensure the expression
of the latter. Use of an inducible promoter is advantageous to
prevent expression of inserted sequences except under inducing
conditions. Inducible promoters include arabinose, lacZ,
metallothionein promoter or a heat shock promoter. Cultures of
transformed organisms can be expanded under noninducing conditions
without biasing the population for coding sequences whose
expression products are better tolerated by the host cells. The
vector may also provide a secretion signal sequence position to
form a fusion protein with polypeptides encoded by inserted
sequences, although often inserted polypeptides are linked to a
signal sequences before inclusion in the vector. Vectors to be used
to receive sequences encoding antibody light and heavy chain
variable domains sometimes encode constant regions or parts thereof
that can be expressed as fusion proteins with inserted chains
thereby leading to production of intact antibodies or fragments
thereof.
[0127] E. coli is one prokaryotic host useful particularly for
cloning the polynucleotides of the present invention. Other
microbial hosts suitable for use include bacilli, such as Bacillus
subtilis, and other enterobacteriaceae, such as Salmonella,
Serratia, and various Pseudomonas species. In these prokaryotic
hosts, one can also make expression vectors, which typically
contain expression control sequences compatible with the host cell
(e.g., an origin of replication). In addition, any number of a
variety of well-known promoters will be present, such as the
lactose promoter system, a tryptophan (trp) promoter system, a
beta-lactamase promoter system, or a promoter system from phage
lambda. The promoters typically control expression, optionally with
an operator sequence, and have ribosome binding site sequences and
the like, for initiating and completing transcription and
translation.
[0128] Other microbes, such as yeast, are also used for expression.
Saccharomyces is a preferred host, with suitable vectors having
expression control sequences, such as promoters, including
3-phosphoglycerate kinase or other glycolytic enzymes, and an
origin of replication, termination sequences and the like as
desired. Insect cells in combination with baculovirus vectors can
also be used.
[0129] Mammalian tissue cell culture can also be used to express
and produce the polypeptides of the present invention (see
Winnacker, From Genes to Clones (VCH Publishers, N.Y., N.Y., 1987).
A number of suitable host cell lines capable of secreting intact
immunoglobulins have been developed including the CHO cell lines,
various Cos cell lines, HeLa cells, myeloma cell lines, transformed
B-cells and hybridomas. Expression vectors for these cells can
include expression control sequences, such as an origin of
replication, a promoter, and an enhancer (Queen, et al., Immunol.
Rev. 89:49-68 (1986)), and necessary processing information sites,
such as ribosome binding sites, RNA splice sites, polyadenylation
sites, and transcriptional terminator sequences. Preferred
expression control sequences are promoters derived from
immunoglobulin genes, SV40, adenovirus, bovine papilloma virus, or
cytomegalovirus.
[0130] Methods for introducing vectors containing the
polynucleotide sequences of interest vary depending on the type of
cellular host. For example, calcium chloride transfection is
commonly utilized for prokaryotic cells, whereas calcium phosphate
treatment or electroporation may be used for other cellular hosts.
(See generally Sambrook, et al., supra).
[0131] Once expressed, collections of antibodies or other
polypeptides are purified from culture media and host cells.
Usually, polypeptides are expressed with signal sequences and are
thus released to the culture media. However, if polypeptides are
not naturally secreted by host cells, the polypeptides can be
released by treatment with mild detergent. Polypeptides can then be
purified by conventional methods including ammonium sulfate
precipitation, affinity chromatography to immobilized target,
column chromatography, gel electrophoresis and the like (see
generally Scopes, Protein Purification (Springer-Verlag, N.Y.,
1982)).
[0132] B. Characteristics of Libraries
[0133] The above methods result in novel libraries of nucleic acid
sequences encoding polypeptides having specific affinity for a
chosen target. The libraries of nucleic acids typically have at
least 5, 10, 20, 50, 100, 1000, 10.sup.4 or 10.sup.5 different
members. Usually, no single member constitutes more than 25 or 50%
of the total sequences in the library. Typically, at least 25, 50%,
75, 90, 95, 99 or 99.9% of library members encode polypeptides with
specific affinity for the target molecules. In the case of double
chain antibody libraries, a pair of nucleic acid segments encoding
heavy and light chains respectively is considered a library member.
The nucleic acid libraries can exist in free form, as components of
any vector or transfected as a component of a vector into host
cells.
[0134] The nucleic acid libraries can be expressed to generate
polyclonal libraries of antibodies or other polypeptides having
specific affinity for a target. The composition of such libraries
is determined from the composition of the nucleotide libraries.
Thus, such libraries typically have at least 5, 10, 20, 50, 100,
1000, 10.sup.4 or 10.sup.5 members with different amino acid
composition. Usually, no single member constitutes more than 25 or
50% of the total polypeptides in the library. The percentage of
polypeptides in a polypeptide library having specific affinity for
a target is typically lower than the percentage of corresponding
nucleic acids encoding the peptides. The difference is due to the
fact that not all polypeptides fold into a structure appropriate
for binding despite having the appropriate primary amino acid
sequence to support appropriate folding. In some libraries, at
least 25, 50, 75, 90, 95, 99 or 99.9% of polypeptides have specific
affinity for the target molecules. Again, in libraries of
multi-chain antibodies, each antibody (such as a Fab or intact
antibody) is considered a library member. The different
polypeptides differ from each other in terms of fine binding
specificity and affinity for the target. Some such libraries
comprise members binding to different epitopes on the same antigen.
Some such libraries comprises at least two members that bind to the
same antigen without competing with each other.
[0135] V. Polyclonal Chimeric Antibody Libraries
[0136] In a variation of the procedures described above, the
invention further provides libraries of polyclonal chimeric
antibodies, and libraries of the DNA segments encoding the same. A
chimeric antibody comprises at least one chimeric antibody chain,
meaning that the antibody has a variable region from a first
species, and a constant region from a second species. Such
libraries share the property of low immunogenicity of chimeric
monoclonals described by Cabilly U.S. Pat. No. 4,816,567, but offer
advantages in terms of including antibodies that bind to multiple
epitopes within an antigen in a single preparation. Some chimeric
antibodies, such as Fab fragments, have a chimeric heavy chain and
a chimeric light chain. The chimeric light chain comprises a light
chain variable region from a first species, and a constant region
from a second species. Likewise the chimeric heavy chain comprises
a heavy chain variable region from a first species, and a heavy
chain constant region from a second species. An intact chimeric
antibody comprises two copies of a chimeric light chain and two
copies of a chimeric heavy chain.
[0137] The variable regions of such antibodies are typically
obtained from a nonhuman species, such as mouse, rat, rabbit,
guinea pig, cow, horse, sheep, vulcher, monkey or chimpanzee. The
constant regions are typically human for chimerics intended for use
in humans or from the animal species of intended use for veterinary
applications. In a Fab fragment, the heavy chain constant region
usually comprises a C.sub.H1 region, and optionally, part or all of
a hinge region, and the light chain constant region is an intact
light chain constant region, such as C.sub..kappa. or
C.sub..lambda.. In an intact antibody, the heavy chain constant
region typically includes C.sub.H1, hinge, C.sub.H2, and C.sub.H3
regions, and the light chain an intact C.sub..kappa. or
C.sub..lambda. light chain. Typically, the constant regions in
chimeric antibodies are naturally occurring human constant regions;
a few conservative substitutions can be tolerated although are not
preferred. Likewise, the variable regions are usually natural
variable regions of a nonhuman species, although additional
variation can be introduced by induced mutations of such sequences.
Choice of constant region isotype depends in part on whether
complement-dependent cytotoxity is required. For example, human
isotypes IgG1 and IgG4 support such cytotoxicity whereas IgG2 and
IgG3 do not.
[0138] The libraries of chimeric antibodies provided by the
invention show the same diversity and composition as the polyclonal
libraries described above. For example, a library of chimeric
antibodies typically have at least 5, 10, 20, 50, 100, 1000,
10.sup.4 or 10.sup.5 members with different amino acid composition.
Usually, no single member constitutes more than 25 or 50% of the
total antibodies in the library. In some libraries, at least 25,
50, 75, 90, 95, 99 or 99.9% of antibodies have specific affinity
for the target molecules.
[0139] Again, in libraries of multi-chain chimeric antibodies, each
stable combination of antibody chains (such as a Fab or intact
antibody) is considered a library member.
[0140] Likewise, libraries of nucleic acids typically have at least
5, 10, 20, 50, 100, 1000, 10.sup.4 or 10.sup.5 different members.
Usually, no single member constitutes more than 25 or 50% of the
total sequences in the library. Typically, at least 75, 90, 95, 99
or 99.9% of library members encode antibodies with specific
affinity for the target molecules. In the case of double chain
antibody libraries, including libraries of diabodies, a pair of
nucleic acid segments encoding heavy and light chains respectively
is considered a library member.
[0141] Some libraries of double chain chimeric antibodies comprises
members having randomly associated heavy and light chains resulting
from random combination of heavy and light chain antibody
populations when subcloning into the replicable genetic package.
Some libraries of chimeric antibodies contain members having
specificity for distinct epitopes on a common target, such members
binding to the same target but not in competition with each
other.
[0142] Libraries of chimeric antibodies can be produced by any of
several variations on the basic cloning and selection strategy
described above. In one variation, the phage vector or other
replicable genetic package used for screening antibodies is
genetically modified to express heavy and light chain constant
regions in frame with inserted heavy and light chain variable
regions. For example, the vector can be modifed to encode a human
CHI region in frame with an inserted heavy chain variable region
and an intact human light chain constant region, such as kappa or
lambda, in frame with an inserted light chain variable region. In
such an arrangement, replicable genetic packages are capable of
expressing and displaying chimeric Fab fragments comprising
nonhuman variable regions and human constant regions. Libraries of
replicable genetic packages displaying chimeric Fab fragments are
enriched for polyvalent members by binding of a tag to a receptor
as described above, and then screened for binding to a target.
Optionally, additional cycles of polyalent enrichment and screening
to a target are performed until a high percentage of library
members encode antibodies with affinity for the target. The DNA
encoding heavy and light chimeric chains, including both constant
and variable regions, can then be excised as a unit from such
vectors, and subcloned en masse (i.e., as a mixture of sequences
encoding different antibodies) into multiple copies of an
expression vector, using the same subcloning procedures described
above. The resulting population of expression vectors then encodes
and expresses a population of chimeric Fab fragments.
[0143] In another variation, a library of replicable genetic
packages encoding chimeric Fab fragments is screened as described
above. Further, sequences encoding heavy and light chimeric chains
are subcloned en masse into an expression vector as above. However,
the expression vector is designed to encode an additional segment
of the human heavy chain constant region (typically, hinge,
C.sub.H2 and C.sub.H3) regions in-frame with the segment of the
chimeric heavy chain present in the Fab fragment. The resulting
population of modified vectors expresses a population of intact
antibodies. Of course, many minor variations are possible as to
precisely which segment of the human heavy chain constant region is
supplied by the replicable genetic package and which by the
expression vector. For example, the replicable genetic package can
be designed to include a C.sub.H1 region, and some or all of the
hinge region. In this case, the expression vector is designed to
supply the residual portion of the hinge region (if any) and the
C.sub.H2 and C.sub.H3 regions for expression of intact
antibodies.
[0144] In a further variation, antibody chains are initially
screened in a replicable genetic package in nonchimeric form, and
human constant regions are supplied by subcloning into a second
replicable genetic package. As an example, mouse Fab fragments
containing both variable regions and constant regions from a mouse,
can be displayed from a variable genetic package and screened as
described above. A subpopulation of vectors expressing mouse Fabs
with affinity for a target is isolated. The heavy and light chain
variable regions from these vectors are then separately isolated
and recloned into a second vector, which provides light and heavy
chain constant regions in-frame with incorporated light and heavy
chain mouse variable regions. Typically, the recloning is performed
en masse resulting in random association of heavy and light chains
in the second vector. Thus, the second vector is typically a
replicable genetic package allowing display of antibodies and
rescreening. Following rescreening, chimeric heavy and light chain
are subcloned as a unit en masse from the replicable genetic
package to an expression vector, optionally modified to contain an
additional segment of the human heavy chain constant region. The
resulting population of modified expression vectors express
chimeric Fab fragments or intact antibodies as described above.
[0145] In a further variation, antibodies are initially screened as
single-chain antibodies comprising a heavy chain variable region, a
spacer and a light chain variable region. Heavy and light chains
from replicable genetic packages surviving selection are then
separately isolated and subcloned into a second vector, which
provides human heavy and light chain constant regions as described
above. Such subcloning results in random association of heavy and
light chains, so typically the second vector is also a replicable
genetic package allowing rescreening. Following rescreening,
chimeric heavy and light chain are subcloned as a unit en masse
from the replicable genetic package to an expression vector,
optionally modified to contain an additional segment of the human
heavy chain constant region. The resulting population of modified
expression vectors again express chimeric Fab fragments or intact
antibodies.
[0146] In a further variation, a library of nonhuman heavy chains
or nonhuman light chains (but not both) is subcloned into a
replicable genetic package for screening. The library can be
screened as single chain antibodies, or in combination with a
partner chain encoded by a second replicon. In such methods, the
antibody chain encoded by the replicable genetic package can be
linked to either a mouse or human constant region. Typically, the
antibody chain is linked to the same type of constant region as the
partner chain encoded by the second replicon (if present).
Following screening and selection of the library, antibody chains
surviving selection are subcloned en masses into an expression
vector. If the antibody chains are screened linked to a human
constant region, this constant region is typically transferred to
the expression vector as a unit with the antibody variable region.
Optionally, the expression vector can supply a further segment of a
human constant region expressed in frame with that already linked
to antibody chains being cloned into the vector. If antibody chains
were screened in combination with a partner antibody chain encoded
by a second replicon, the expression vector typically encodes the
variable region of the partner antibody chain in frame with a human
constant region. Accordingly, the expression vector expressing
chimeric antibodies comprises chimeric antibody chains originally
encoded by the replicable genetic package complexed with chimeric
partner chains. Such an expression vector can express either Fab
fragments or intact antibodies depending on how much of the human
heavy chain constant region is present.
[0147] VII. Diagnostic and Therapeutics Uses
[0148] The use of polyclonal antibodies in diagnostics and
therapeutics has been limited by the inability to generate
preparations that have a well-defined affinity and specificity.
Monoclonal antibodies developed using hybridoma technology do have
well-defined specificity and affinity, but the selection process is
often long and tedious. Further, a single monoclonal antibody often
does not meet all of the desired specificity requirements.
Formation of polyclonal mixtures by isolation, and characterization
of individual monoclonal antibodies, which are then mixed would be
time consuming process which would increase in proportion to the
number of monoclonals included in the mixture and become
prohibitive for substantial numbers of monoclonal antibodies. The
polyclonal libraries of antibodies and other polypeptides having
specificity for a given target produced by the present methods
avoid these difficulties, and provide reagents that are useful in
many therapeutic and diagnostic applications.
[0149] The use of polyclonal mixtures has a number of advantages
with respect to compositions made of one monoclonal antibody. By
binding to multiple sites on a target, polyclonal antibodies or
other polypeptides can generate a stronger signal (for diagnostics)
or greater blocking/inhibition/cytotoxicity (for therapeutics) than
a monoclonal that binds to a single site. Further, a polyclonal
preparation can bind to numerous variants of a prototypical target
sequence (e.g., allelic variants, species variants, strain
variants, drug-induced escape variants) whereas a monoclonal
antibody may bind only to the prototypical sequence or a narrower
range of variants thereto.
[0150] Polyclonal preparations of antibodies and other polypeptides
can be incorporated into compositions for diagnostic or treatment
use (both prophylactic and therapeutic). The preferred form depends
on the intended mode of administration and diagnostic or
therapeutic application. The compositions can also include,
depending on the formulation desired, pharmaceutically-acceptable,
non-toxic carriers or diluents, which are defined as vehicles
commonly used to formulate pharmaceutical compositions for animal
or human administration. The diluent is selected so as not to
affect the biological activity of the combination. Examples of such
diluents are distilled water, physiological phosphate-buffered
saline, Ringer's solutions, dextrose solution, and Hank's solution.
In addition, the pharmaceutical composition or formulation may also
include other carriers, adjuvants, or nontoxic, nontherapeutic,
nonimmunogenic stabilizers and the like. See Remington's
Pharmaceutical Science, (15th ed., Mack Publishing Company, Easton,
Pa., 1980). Compositions intended for in vivo use are usually
sterile. Compositions for parental administration are sterile,
substantially isotonic and made under GMP condition.
[0151] Although the invention has been described in detail for
purposes of clarity of understanding, it will be obvious that
certain modifications may be practiced within the scope of the
appended claims. All publications and patent documents cited in
this application are hereby incorporated by reference in their
entirety for all purposes to the same extent as if each were so
individually denoted. Cell lines producing antibodies CD.TXA.1.PC
(ATCC 98388, Apr. 3, 1997), CD.43.9 (ATCC 98390, Apr. 3, 1997),
CD.43.5.PC (ATCC 98389, Apr. 3, 1997) and 7F11 (HB-12443, Dec. 5,
1997) have been deposited at the American Type Culture Collection,
Rockville, Md. under the Budapest Treaty on the dates indicated and
given the accession numbers indicated. The deposits will be
maintained at an authorized depository and replaced in the event of
mutation, nonviability or destruction for a period of at least five
years after the most recent request for release of a sample was
received by the depository, for a period of at least thirty years
after the date of the deposit, or during the enforceable life of
the related patent, whichever period is longest. All restrictions
on the availability to the public of these cell lines will be
irrevocably removed upon the issuance of a patent from the
application.
EXAMPLES
Example 1
Immunization of Mice with Antigens and Purification of RNA From
Mouse Spleens
[0152] Mice were immunized by the following method based on
experience of the timing of spleen harvest for optimal recovery of
mRNA coding for antibody. Two species of mice were used: Balb/c
(Charles River Laboratories, Wilmington, Mass.) and A/J (Jackson
Laboratories, Bar Harbor, Me.). Each of ten mice were immunized
intraperitoneally with antigen using 50 .mu.g protein in Freund's
complete adjuvant on day 0, and day 28. Tests bleeds of mice were
obtained through puncture of the retro-orbital sinus. If, by
testing the titers, they were deemed high by ELISA using
biotinylated antigen immobilized via streptavidin, the mice were
boosted with 50 .mu.g of protein on day 70, 71 and 72, with
subsequent sacrifice and splenectomy on day 77. If titers of
antibody were not deemed satisfactory, mice were boosted with 50
.mu.g antigen on day 56 and a test bleed taken on day 63. If
satisfactory titers were obtained, the animals were boosted with 50
.mu.g of antigen on day 98, 99, and 100 and the spleens harvested
on day 105. Typically, a test bleed dilution of 1:3200 or more
resulted in a half maximal ELISA response to be considered
satisfactory.
[0153] The spleens were harvested in a laminar flow hood and
transferred to a petri dish, trimming off and discarding fat and
connective tissue. The spleen was, working quickly, macerated with
the plunger from a sterile 5 cc syringe in the presence of 1.0 ml
of solution D (25.0 g guanidine thiocyanate (Boehringer Mannheim,
Indianapolis, Ind.), 29.3 ml sterile water, 1.76 ml 0.75 M sodium
citrate (pH 7.0), 2.64 ml 10% sarkosyl (Fisher Scientific,
Pittsburgh, Pa.), 0.36 ml 2-mercaptoethanol (Fisher Scientific,
Pittsburgh, Pa.)). The spleen suspension was pulled through an 18
gauge needle until viscous and all cells were lysed, then
transferred to a microcentrifuge tube. The petri dish was washed
with 100 .mu.l of solution D to recover any remaining spleen, and
this was transferred to the tube. The suspension was then pulled
through a 22 gauge needle an additional 5-10 times. The sample was
divided evenly between two microcentrifuge tubes and the following
added in order, with mixing by inversion after each addition: 100
.mu.l 2 M sodium acetate (pH 4.0), 1.0 ml water-saturated phenol
(Fisher Scientific, Pittsburgh, Pa.), 200 .mu.l chloroform/isoamyl
alcohol 49:1 (Fisher Scientific, Pittsburgh, Pa.). The solution was
vortexed for 10 seconds and incubated on ice for 15 min. Following
centrifugation at 14 krpm for 20 min at 2-8.degree. C., the aqueous
phase was transferred to a fresh tube. An equal volume of water
saturated phenol/chloroform/isoamyl alcohol (50:49:1) was added,
and the tube was vortexed for ten seconds. After a 15 min
incubation on ice, the sample was centrifuged for 20 min at
2-8.degree. C., and the aqueous phase was transferred to a fresh
tube and precipitated with an equal volume of isopropanol at
-20.degree. C. for a minimum of 30 min. Following centrifugation at
14,000 rpm for 20 min at 4.degree. C., the supernatant was
aspirated away, the tubes briefly spun and all traces of liquid
removed. The RNA pellets were each dissolved in 300 .mu.l of
solution D, combined, and precipitated with an equal volume of
isopropanol at -20.degree. C. for a minimum of 30 min. The sample
was centrifuged 14, 000 rpm for 20 min at 4.degree. C., the
supernatant aspirated as before, and the sample rinsed with 100
.mu.l of ice-cold 70% ethanol. The sample was again centrifuged
14,000 rpm for 20 min at 4.degree. C., the 70% ethanol solution
aspirated, and the RNA pellet dried in vacuo. The pellet was
resuspended in 100 .mu.l of sterile distilled water. The
concentration was determined by A.sub.260 using an absorbance of
1.0 for a concentration of 40 .mu.g/ml. The RNA was stored at
-80.degree. C.
Example 2
Preparation of Complementary DNA (cDNA)
[0154] The total RNA purified as described above was used directly
as template for cDNA. RNA (50 .mu.g) was diluted to 100 .mu.L with
sterile water, and 10 .mu.L-130 ng/mL oligo dT.sub.12 (synthesized
on Applied Biosystems Model 392 DNA synthesizer at Biosite
Diagnostics) was added. The sample was heated for 10 min at
70.degree. C., then cooled on ice. 40 .mu.L 5.times. first strand
buffer was added (Gibco/BRL, Gaithersburg, Md.), 20 .mu.L 0.1 M
dithiothreitol (Gibco/BRL, Gaithersburg, Md.), 10 .mu.L 20 mM
deoxynucleoside triphosphates (dNTP's, Boehringer Mannheim,
Indianapolis, Ind.), and 10 .mu.L water on ice. The sample was then
incubated at 37.degree. C. for 2 min. 10 .mu.L reverse
transcriptase (Superscript.TM. II, Gibco/BRL, Gaithersburg, Md.)
was added and incubation was continued at 37.degree. C. for 1 hr.
The cDNA products were used directly for polymerase chain reaction
(PCR).
Example 3
Amplification of cDNA by PCR
[0155] To amplify substantially all of the H and L chain genes
using PCR, primers were chosen that corresponded to substantially
all published sequences. Because the nucleotide sequences of the
amino terminals of H and L contain considerable diversity, 33
oligonucleotides were synthesized to serve as 5' primers for the H
chains (FIG. 1), and 29 oligonucleotides were synthesized to serve
as 5' primers for the kappa L chains (FIG. 2). The 5' primers were
made according to the following criteria. First, the second and
fourth amino acids of the L chain and the second amino acid of the
heavy chain were conserved. Mismatches that changed the amino acid
sequence of the antibody were allowed in any other position.
Second, a 20 nucleotide sequence complementary to the M13 uracil
template was synthesized on the 5' side of each primer. This
sequence is different between the H and L chain primers,
corresponding to 20 nucleotides on the 3' side of the pelB signal
sequence for L chain primers and the alkaline phosphatase signal
sequence for H chain primers. The constant region nucleotide
sequences required only one 3' primer each to the H chains and the
kappa L chains (FIG. 2). Amplification by PCR was performed
separately for each pair of 5' and 3' primers. A 50 .mu.L reaction
was performed for each primer pair with 50 pmol of 5' primer, 50
pmol of 3' primer, 0.25 .mu.L Taq DNA Polymerase (5 units/.mu.L,
Boehringer Mannheim, Indianapolis, Ind.), 3 .mu.L cDNA (described
in Example 2), 5 .mu.L 2 mM dNTP's, 5 .mu.L 10.times. Taq DNA
polymerase buffer with MgCl2 (Boehringer Mannheim, Indianapolis,
Ind.), and H.sub.2O to 50 .mu.L. Amplification was done using a
GeneAmp.RTM. 9600 thermal cycler (Perkin Elmer, Foster City,
Calif.) with the following program: 94.degree. C. for 1 min; 30
cycles of 94.degree. C. for 20 sec, 55.degree. C. for 30 sec, and
72.degree. C. for 30 sec; 72.degree. C. for 6 min; 4.degree. C.
[0156] The dsDNA products of the PCR process were then subjected to
asymmetric PCR using only 3' primer to generate substantially only
the anti-sense strand of the target genes. A 100 .mu.L reaction was
done for each dsDNA product with 200 pmol of 3' primer, 2 .mu.L of
ds-DNA product, 0.5 .mu.L Taq DNA Polymerase, 10 .mu.L 2 mM dNTP's,
10 .mu.L 10.times. Taq DNA polymerase buffer with MgCl.sub.2
(Boehringer Mannheim, Indianapolis, Ind.), and H.sub.2O to 100
.mu.L. The same PCR program as that described above was used to
amplify the single-stranded (ss)-DNA.
Example 4
Purification of ss-DNA by High Performance Liquid Chromatography
and Kinasing ss-DNA
[0157] The H chain ss-PCR products and the L chain ss-PCR products
were ethanol precipitated by adding 2.5 volumes ethanol and 0.2
volumes 7.5 M ammonium acetate and incubating at -20.degree. C. for
at least 30 min. The DNA was pelleted by centrifuging in an
Eppendorf centrifuge at 14,000 rpm for 10 min at 2-8.degree. C. The
supernatant was carefully aspirated, and the tubes were briefly
spun a 2nd time. The last drop of supernatant was removed with a
pipet. The DNA was dried in vacuo for 10 min on medium heat. The H
chain products were pooled in 210 .mu.L water and the L chain
products were pooled separately in 210 .mu.L water. The ss-DNA was
purified by high performance liquid chromatography (HPLC) using a
Hewlett Packard 1090 HPLC and a Gen-Pak.TM. FAX anion exchange
column (Millipore Corp., Milford, Mass.). The gradient used to
purify the ss-DNA is shown in Table 1, and the oven temperature was
at 60.degree. C. Absorbance was monitored at 260 nm. The ss-DNA
eluted from the HPLC was collected in 0.5 min fractions. Fractions
containing ss-DNA were ethanol precipitated, pelleted and dried as
described above. The dried DNA pellets were pooled in 200 .mu.L
sterile water.
4TABLE 1 HPLC gradient for purification of ss-DNA Time (min) % A %
B % C Flow (mL/min) 0 70 30 0 0.75 2 40 60 0 0.75 32 15 85 0 0.75
35 0 100 0 0.75 40 0 100 0 0.75 41 0 0 100 0.75 45 0 0 100 0.75 46
0 100 0 0.75 51 0 100 0 0.75 52 70 30 0 0.75 Buffer A is 25 mM
Tris, 1 mM EDTA, pH 8.0 Buffer B is 25 mM Tris, 1 mM EDTA, 1 M
NaCl, pH 8.0 Buffer C is 40 mm phosphoric acid
[0158] The ss-DNA was kinased on the 5' end in preparation for
mutagenesis (Example 7). 24 .mu.L 10.times. kinase buffer (United
States Biochemical, Cleveland, Ohio), 10.4 .mu.L 10 mM
adenosine-5'-triphosphate (Boehringer Mannheim, Indianapolis,
Ind.), and 2 .mu.L polynucleotide kinase (30 units/.mu.L, United
States Biochemical, Cleveland, Ohio) was added to each sample, and
the tubes were incubated at 37.degree. C. for 1 hr. The reactions
were stopped by incubating the tubes at 70.degree. C. for 10 min.
The DNA was purified with one extraction of equilibrated phenol
(pH>8.0, United States Biochemical, Cleveland,
Ohio)-chloroform-isoamy- l alcohol (50:49:1) and one extraction
with chloroform:isoamyl alcohol (49:1). After the extractions, the
DNA was ethanol precipitated and pelleted as described above. The
DNA pellets were dried, then dissolved in 50 .mu.L sterile water.
The concentration was determined by measuring the absorbance of an
aliquot of the DNA at 260 nm using 33 .mu.g/mL for an absorbance of
1.0. Samples were stored at -20.degree. C.
Example 5
Antibody Phage Display Vector
[0159] The antibody phage display vector for cloning antibodies was
derived from an M13 vector supplied by Ixsys, designated 668-4. The
vector 668-4 contained the DNA sequences encoding the heavy and
light chains of a mouse monoclonal Fab fragment inserted into a
vector described by Huse, WO 92/06024. The vector had a Lac
promoter, a pelB signal sequence fused to the 5' side of the L
chain variable region of the mouse antibody, the entire kappa chain
of the mouse antibody, an alkaline phosphatase signal sequence at
the 5' end of the H chain variable region of the mouse antibody,
the entire variable region and the first constant region of the H
chain, and 5 codons of the hinge region of an IgG1 H chain. A
decapeptide sequence was at the 3' end of the H chain hinge region
and an amber stop codon separated the decapeptide sequence from the
pseudo-gene VIII sequence. The amber stop allowed expression of H
chain fusion proteins with the gene VIII protein in E. coli
suppressor strains such as XL1 blue (Stratagene, San Diego,
Calif.), but not in nonsuppressor cell strains such as MK30
(Boehringer Mannheim, Indianapolis, Ind.) (see FIG. 3A).
[0160] To make the first derivative cloning vector, deletions were
made in the variable regions of the H chain and the L chain by
oligonucleotide directed mutagenesis of a uracil template (Kunkel,
Proc. Natl. Acad. Sci. USA 82:488 (1985); Kunkel, et al., Methods.
Enzymol. 154:367 (1987)). These mutations deleted the region of
each chain from the 5' end of CDR1 to the 3' end of CDR3, and the
mutations added a DNA sequence where protein translation would stop
(see FIG. 4 for mutagenesis oligonucleotides). This prevented the
expression of H or L chain constant regions in clones without an
insert, thereby allowing plaques to be screened for the presence of
insert. The resulting cloning vector was called BS11.
[0161] Many changes were made to BS11 to generate the cloning
vector used in the present screening methods. The amber stop codon
between the heavy chain and the pseudo gene VIII sequence was
removed so that every heavy chain was expressed as a fusion protein
with the gene VIII protein. This increased the copy number of the
antibodies on the phage relative to BS11. A HindIII restriction
enzyme site in the sequence between the 3' end of the L chain and
the 5' end of the alkaline phosphatase signal sequence was deleted
so antibodies could be subcloned into a pBR322 derivative (Example
21). The interchain cysteine residues at the carboxyl-terminus of
the L and H chains were changed to serine residues. This increased
the level of expression of the antibodies and the copy number of
the antibodies on the phage without affecting antibody stability.
Nonessential DNA sequences on the 5' side of the lac promoter and
on the 3'side of the pseudo gene VIII sequence were deleted to
reduce the size of the M13 vector and the potential for
rearrangement. A transcriptional stop DNA sequence was added to the
vector at the L chain cloning site in addition to the translational
stop so that phage with only heavy chain proteins on their surface,
which might bind nonspecifically in panning, could not be made.
Finally, DNA sequences for protein tags were added to different
vectors to allow enrichment for polyvalent phage by metal chelate
chromatography (polyhistidine sequence) or by affinity purification
using a decapeptide tag and a magnetic latex having an immobilized
antibody that binds the decapeptide tag. The vector BS39 had a
polyhistidine sequence at the 3' end of the kappa chain with no tag
at the end of the heavy chain (FIG. 3B) BS45 had a polyhistidine
sequence between the end of the heavy chain constant region and the
pseudo-gene VIII sequence, and a decapeptide sequence at the 3' end
of the kappa chain constant region (FIG. 3C).
Example 6
Preparation of Uracil Templates Used in Generation of Spleen
Antibody Phage Libraries
[0162] 1 mL of E. coli CJ236 (BioRAD, Hercules, Calif.) overnight
culture was added to 50 ml 2.times. YT in a 250 mL baffled shake
flask. The culture was grown at 37.degree. C. to OD.sub.600=0.6,
inoculated with 10 .mu.l of a {fraction (1/100)} dilution of vector
phage stock and growth continued for 6 hr. Approximately 40 mL of
the culture was centrifuged at 12,000 rpm for 15 minutes at
4.degree. C. The supernatant (30 mL) was transferred to a fresh
centrifuge tube and incubated at room temperature for 15 minutes
after the addition of 15 .mu.l of 10 mg/ml RnaseA (Boehringer
Mannheim, Indianapolis, Ind.). The phage were precipitated by the
addition of 7.5 ml of 20% polyethylene glycol 8000 (Fisher
Scientific, Pittsburgh, Pa.)/3.5M ammonium acetate (Sigma Chemical
Co., St. Louis, Mo.) and incubation on ice for 30 min. The sample
was centrifuged at 12,000 rpm for 15 min at 2-8.degree. C. The
supernatant was carefully discarded, and the tube was briefly spun
to remove all traces of supernatant. The pellet was resuspended in
400 .mu.l of high salt buffer (300 mM NaCl, 100 mM Tris pH 8.0, 1
mM EDTA), and transferred to a 1.5 mL tube. The phage stock was
extracted repeatedly with an equal volume of equilibrated
phenol:chloroform:isoamyl alcohol (50:49:1) until no trace of a
white interface was visible, and then extracted with an equal
volume of chloroform:isoamyl alcohol (49: 1). The DNA was
precipitated with 2.5 volumes of ethanol and 1/5 volume 7.5 M
ammonium acetate and incubated 30 min at -20.degree. C. The DNA was
centrifuged at 14,000 rpm for 10 min at 4.degree. C., the pellet
washed once with cold 70% ethanol, and dried in vacuo. The uracil
template DNA was dissolved in 30 .mu.l sterile water and the
concentration determined by A.sub.260 using an absorbance of 1.0
for a concentration of 40 .mu.g/ml. The template was diluted to 250
ng/.mu.l with sterile water, aliquoted, and stored at -20.degree.
C.
Example 7
Mutagenesis of Uracil Template with ss-DNA and Electroporation into
E. coli to Generate Antibody Phage Libraries
[0163] Antibody phage-display libraries were generated by
simultaneously introducing single-stranded heavy and light chain
genes onto a phage-display vector uracil template. A typical
mutagenesis was performed on a 2 .mu.g scale by mixing the
following in a 0.2 mL PCR reaction tube: 8 .mu.l of (250 ng/.mu.l)
uracil template (examples 5 and 6), 8 .mu.l of 10.times. annealing
buffer (200 mM Tris pH 7.0, 20 mM MgCl.sub.2, 500 mM NaCl), 3.33
.mu.l of kinased single-stranded heavy chain insert (100 ng/.mu.l),
3.1 .mu.l of kinased single-stranded light chain insert (100
ng/ml), and sterile water to 80 .mu.l. DNA was anlealed in a
GeneAmp.RTM. 9600 thermal cycler using the following thermal
profile: 20 sec at 94.degree. C., 85.degree. C. for 60 sec,
85.degree. C. to 55.degree. C. ramp over 30 min, hold at 55.degree.
C. for 15 min. The DNA was transferred to ice after the program
finished. The extension/ligation was carried out by adding 8 .mu.l
of 10.times. synthesis buffer (5 mM each dNTP, 10 mM ATP, 100 mM
Tris pH 7.4, 50 mM MgCl.sub.2, 20 mM DTT), 8 .mu.l T4 DNA ligase (1
U/.mu.l, Boehringer Mannheim, Indianapolis, Ind.), 8 .mu.l diluted
T7 DNA polymerase (1 U/.mu.l, New England BioLabs, Beverly, Mass.)
and incubating at 37.degree. C. for 30 min. The reaction was
stopped with 300 .mu.l of mutagenesis stop buffer (10 mM Tris pH
8.0, 10 mM EDTA). The mutagenesis DNA was extracted once with
equilibrated phenol (pH>8):chloroform:isoamyl alcohol (50:49:1),
once with chloroform:isoamyl alcohol (49: 1), and the DNA was
ethanol precipitated at -20.degree. C. for at least 30 min. The DNA
was pelleted and the supernatant carefully removed as described
above. The sample was briefly spun again and all traces of ethanol
removed with a pipetman. The pellet was dried in vacuo. The DNA was
resuspended in 4 .mu.l of sterile water. 1 .mu.l mutagenesis DNA
was (500 ng) was transferred into 40 .mu.l electrocompetent E. coli
DH12S (Gibco/BRL, Gaithersburg, Md.) using the electroporation
conditions in Example 8. The transformed cells were mixed with 1.0
mL 2.times. YT broth (Sambrook, et al., supra) and transferred to
15 mL sterile culture tubes. The first round antibody phage was
made by shaking the cultures overnight at 23.degree. C. and 300
rpm. The efficiency of the electroporation was measured by plating
10 .mu.l of 10.sup.-3 and 10.sup.-4 dilutions of the cultures on LB
agar plates (see Example 12). These plates were incubated overnight
at 37.degree. C. The efficiency was determined by multiplying the
number of plaques on the 10.sup.-3 dilution plate by 105 or
multiplying the number of plaques on the 10.sup.-4 dilution plate
by 10.sup.6. The overnight cultures from the electroporations were
transferred to 1.5 ml tubes, and the cells were pelleted by
centrifuging at 14,000 rpm for 5 min. The supernatant, which is the
first round of antibody phage, was then transferred to 15 mL
sterile centrifuge tubes with plug seal caps.
Example 8
Transformation of E. coli by Electroporation
[0164] The electrocompetent E. coli cells were thawed on ice. DNA
was mixed with 20-40 .mu.L electrocompetent cells by gently
pipetting the cells up and down 2-3 times, being careful not to
introduce air-bubbles. The cells were transferred to a Gene Pulser
cuvette (0.2 cm gap, BioRAD, Hercules, Calif.) that had been cooled
on ice, again being careful not to introduce an air-bubble in the
transfer. The cuvette was placed in the E. coli Pulser (BioRAD,
Hercules, Calif.) and electroporated with the voltage set at 1.88
kV according to the manufacturer's recommendation. The transformed
sample was immediately diluted to 1 ml with 2.times. YT broth and
processed as procedures dictate.
Example 9
Preparation of Biotinylated Antigens and Antibodies
[0165] Protein antigens or antibodies were dialyzed against a
minimum of 100 volumes of 20 mM borate, 150 mM NaCl, pH 8 (BBS) at
2-8.degree. C. for at least 4 hr. The buffer was changed at least
once prior to biotinylation. Protein antigens or antibodies were
reacted with biotin-XX-NHS ester (Molecular Probes, Eugene, Oreg.,
stock solution at 40 mM in dimethylformamide) at a final
concentration of 1 mM for 1 hr at room temperature. After 1 hr, the
protein antigens or antibodies were extensively dialyzed into BBS
to remove unreacted small molecules.
Example 10
Preparation of Alkaline Phosphatase-Antigen Conjugates
[0166] Alkaline phosphatase (AP, Calzyme Laboratories, San Luis
Obispo, Calif.) was placed into dialysis versus a minimum of 100
volumes of column buffer (50 mM potassium phosphate, 10 mM borate,
150 mM NaCl, 1 mM MgSO.sub.4, pH 7.0) at 2-8.degree. C. for at
least four hr. The buffer was changed at least twice prior to use
of the AP. When the AP was removed from dialysis and brought to
room temperature, the concentration was determined by absorbance at
280 nm using an absorbance of 0.77 for a 1 mg/mL solution. The AP
was diluted to 5 mg/mL with column buffer. The reaction of AP and
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC,
Pierce Chemical Co., Rockford, Ill.) was carried out using a 20:1
ratio of SMCC:AP. SMCC was dissolved in acetonitrile at 20 mg/mL
and diluted by a factor of 84 when added to AP while vortexing or
rapidly stirring. The solution was allowed to stand at room
temperature for 90 min before the unreacted SMCC and low molecular
weight reaction products were separated from the AP using gel
filtration chromatography (G50 Fine, Pharmacia Biotech, Piscataway,
N.J.) in a column equilibrated with column buffer.
[0167] Protein antigen was dialyzed versus a minimum of 100 volumes
of 20 mM potassium phosphate, 4 mM borate, 150 mM NaCl, pH 7.0 at
2-8.degree. C. for at least four hr. The buffer was changed at
least twice prior to use of the antigen. The amount of antigen was
quantitated by absorbance at 280 nm. The extinction coefficient for
creatine kinase MB subunits (CKMB, Scripps Laboratories, San Diego,
Calif.) was 0.88 mL/mg-cm, Clostridium difficile toxin A (Tech Lab,
Blacksburg, Va.) was 1.29 mL/mg-cm, and Clostridium difficile
glutamate dehydrogenase (Example 19) was 1.45 mL/mg-cm. The
reaction of antigen and N-succinimidyl
3-[2-pyridyldithio]propionate (SPDP, Pierce Chemical Co., Rockford,
Ill.) was carried out using a 20:1 molar ratio of SPDP:antigen.
SPDP was dissolved in dimethylformamide at 40 mM and diluted into
the antigen solution while vortexing. The solution was allowed to
stand at room temperature for 90 min, at which time the reaction
was quenched by adding taurine (Aldrich Chemical Co., Milwaukee,
Wis.) to a final concentration of 20 mM for 5 min. Dithiothreitol
(Fisher Scientific, Pittsburgh, Pa.) was added to the protein at a
final concentration of 1 mM for 30 min. The low molecular weight
reaction products were separated from the antigen using gel
filtration chromatography in a column equilibrated in 50 mM
potassium phosphate, 10 mM borate, 150 mM NaCl, 0.1 mM ethylene
diamine tetraacetic acid (EDTA, Fisher Scientific, Pittsburgh,
Pa.), pH 7.0.
[0168] The AP and antigen were mixed together in an equimolar
ratio. The reaction was allowed to proceed at room temperature for
2 hr. The conjugate was diluted to 0.1 mg/mL with block containing
1% bovine serum albumin (from 30% BSA, Bayer, Kankakee, Ill.), 10
mM Tris,150 mM NaCl, 1 mM MgCl.sub.2, 0.1 mM ZnCl.sub.2, 0.1%
polyvinyl alcohol (80% hydrolyzed, Aldrich Chemical Co., Milwaukee,
Wis.), pH 8.0.
Example 11
Preparation of Avidin Magnetic Latex
[0169] The magnetic latex (Estapor, 10% solids, Bangs Laboratories,
Fishers, Ind.) was thoroughly resuspended and 2 ml aliquoted into a
15 ml conical tube. The magnetic latex was suspended in 12 ml
distilled water and separated from the solution for 10 min using a
magnet. While still in the magnet, the liquid was carefully removed
with a 10 mL sterile pipet. This washing process was repeated an
additional three times. After the final wash, the latex was
resuspended in 2 ml of distilled water. In a separate 50 ml conical
tube, 10 mg of avidin-HS (NeutrAvidin, Pierce, Rockford, Ill.) was
dissolved in 18 ml of 40 mM Tris, 0.15 M sodium chloride, pH 7.5
(TBS). While vortexing, the 2 ml of washed magnetic latex was added
to the diluted avidin-HS and the mixture vortexed an additional 30
seconds. This mixture was incubated at 45.degree. C. for 2 hr,
shaking every 30 minutes. The avidin magnetic latex was separated
from the solution using a magnet and washed three times with 20 ml
BBS as described above. After the final wash, the latex was
resuspended in 10 ml BBS and stored at 4.degree. C.
[0170] Immediately prior to use, the avidin magnetic latex was
equilibrated in panning buffer (40 mM TRIS, 150 mM NaCl, 20 mg/mL
BSA, 0.1% Tween 20 (Fisher Scientific, Pittsburgh, Pa.), pH 7.5).
The avidin magnetic latex needed for a panning experiment (200
.mu.l/sample) was added to a sterile 15 ml centrifuge tube and
brought to 10 ml with panning buffer. The tube was placed on the
magnet for 10 min to separate the latex. The solution was carefully
removed with a 10 mL sterile pipet as described above. The magnetic
latex was resuspended in 10 mL of panning buffer to begin the
second wash. The magnetic latex was washed a total of 3 times with
panning buffer. After the final wash, the latex was resuspended in
panning buffer to the initial aliquot volume.
Example 12
Plating M13 Phage or Cells Transformed with Antibody Phage-Display
Vector Mutagenesis Reaction
[0171] The phage samples were added to 200 .mu.L of an overnight
culture of E. coli XL 1-Blue when plating on 100 mm LB agar plates
or to 600 .mu.L of overnight cells when plating on 150 mm plates in
sterile 15 ml culture tubes. After adding LB top agar (3 mL for 100
mm plates or 9 mL for 150 mm plates, top agar stored at 55.degree.
C., Appendix A1, Molecular Cloning, A Laboratory Manual, (1989)
Sambrook. J), the mixture was evenly distributed on an LB agar
plate that had been pre-warmed (37.degree. C.-55.degree. C.) to
remove any excess moisture on the agar surface. The plates were
cooled at room temperature until the top agar solidified. The
plates were inverted and incubated at 37.degree. C. as
indicated.
Example 13
Develop Nitrocellulose Filters with Alkaline Phosphatase
Conjugates
[0172] After overnight incubation of the nitrocellulose filters on
LB agar plates, the filters were carefully removed from the plates
with membrane forceps and incubated for 2 hr in either casein block
(block with 1% casein (Hammersten grade, Research Organics,
Cleveland, Ohio)), when using antigen-AP conjugates or block when
using goat anti-mouse kappa-AP (Southern Biotechnology Associates,
Inc, Birmingham, Ala.). After 2 hr, the filters were incubated with
the AP conjugate for 2-4 hr. Antigen-AP conjugates were diluted
into casein block at a final concentration of 1 .mu.g/mL and goat
anti-mouse kappa-AP conjugates were diluted into block at a final
concentration of 1 .mu.g/mL. Filters were washed 3 times with 40 mM
TRIS, 150 mM NaCl, 0.05% Tween 20, pH 7.5 (TBST) (Fisher Chemical,
Pittsburgh, Pa.) for 5 min each. After the final wash, the filters
were developed in a solution containing 0.2 M
2-amino-2-methyl-1-propanol (JBL Scientific, San Luis Obispo,
Calif.), 0.5 M TRIS, 0.33 mg/mL nitro blue tetrazolium (Fisher
Scientific, Pittsburgh, Pa.) and 0.166 mg/mL
5-bromo-4-chloro-3-indolyl-phosphate, p-toluidine salt.
Example 14
Enrichment of Polyclonal Phage to CKMB with no Tags on the Heavy
Chain and a Polyhistidine Sequence on the Kappa Chain
[0173] This example describes multiple rounds of screening of a
phage library to the antigen creatine kinase MB (M and B designate
muscle and brain subunits). Some of the rounds of screening to CKMB
were alternated with rounds of enrichment for phage displaying
multiple copies of antibodies. The percentage of phage displaying
any light chain, and the percentage of phage displaying Fab
fragments with specific affinity for CKMB was measured after each
round of screening to CKMB.
[0174] The first round antibody phage was prepared as described
above using BS39 uracil template. Two electroporations of
mutagenesis DNA had efficiencies of 9.7.times.10.sup.7 PFU and
8.3.times.10.sup.7 PFU. The phage from both electroporations were
combined and diluted to 3.2 ml with panning buffer. The phage was
aliquoted into 2-1 mL aliquots in 15 mL disposable sterile
centrifuge tubes with plug seal caps. CKMB-biotin (10 .mu.L,
10.sup.-6 M stock concentration) was added to each phage aliquot.
The phage samples were incubated overnight at 2-8.degree. C.
[0175] After the incubation, the phage samples were panned with
avidin magnetic latex. The equilibrated avidin magnetic latex (see
Example 11), 200 .mu.L latex per sample, was incubated with the
phage for 10 min at room temperature. After 10 min, approximately 9
mL of panning buffer was added to each phage sample, and the
magnetic latex was separated from the solution using a magnet.
After 10 min in the magnet, the unbound phage was carefully removed
with a 10 mL sterile pipet. The magnetic latex was then resuspended
in 10 mL of panning buffer to begin the second wash. The latex was
washed a total of 5 times as described above. For each wash, the
tubes were in the magnet for 10 min to separate unbound phage from
the magnetic latex. After the 5th wash, the magnetic latex was
resuspended in 1 mL TBS and transferred to a 1.5 mL tube. Aliquots
of the latex were taken at this point to plate on 100 mm LB agar
plates as described above. The bulk of the magnetic latex (99%) was
resuspended in 200 .mu.L 2.times.YT and was plated on a 150 mm LB
agar plate as described in Example 12. The 100 mm LB agar plates
were incubated at 37.degree. C. for 6-7 hr, then the plates were
transferred to room temperature and nitrocellulose filters (pore
size 0.45 .mu.m, BA85 Protran, Schleicher and Schuell, Keene, N.H.)
were overlayed onto the plaques. Plates with nitrocellulose filters
were incubated overnight at room temperature. The 150 mm plates
were used to amplify the phage binding to the magnetic latex to
generate the next round of antibody phage. These plates were
incubated at 37.degree. C. for 4 hr, then overnight at 20.degree.
C.
[0176] After the overnight incubation, the antibody phage was
eluted from the 150 mm plates, and the filters were developed with
alkaline phosphatase-CKMB as described in Example 13. The antibody
phage was eluted from the 150 mm plates by pipeting 8 mL 2YT media
onto the lawn and gently shaking the plate at room temperature for
20 min. The phage were transferred to a 15 mL disposable sterile
centrifuge tubes with plug seal cap and the debris from the LB
plate was pelleted by centrifuging for 15 min at 3500 rpm. The 2nd
round antibody phage was then transferred to a new tube.
[0177] To begin the 2nd round of panning, the antibody phage were
titered by plating 10 .mu.L of 10.sup.-7 and 10.sup.-8 dilutions of
the phage on 100 mm LB agar plates. The plates were incubated at
37.degree. C. for 6-7 hr, then the number of plaques on the plates
were counted. Also, to monitor the percentage of kappa positives in
the antibody phage, a nitrocellulose filter was overlayed onto the
plate and incubated overnight at room temperature. The percentage
of kappa positives is a measure of the proportion of phage
displaying intact Fab fragments.
[0178] Both 2nd round antibody phage samples were pooled by
diluting each sample into panning buffer at a final concentration
of 5.times.10.sup.9 PFU/mL to a final volume of 1 mL. (The titers
of the antibody phage were about 2.times.10.sup.12 PFU/mL and
1.7.times.10.sup.12). CKMB-biotin (10 .mu.L, 10.sup.-6 M stock
concentration) was added to the phage and the phage was incubated
at 2-8.degree. C. overnight. The nitrocellulose filters on the
antibody phage titer plates were developed with goat anti-mouse
kappa AP as described in Example 13. The second round antibody
phage was panned with avidin magnetic latex as described above.
After washing the latex with panning buffer, the latex was
resuspended in 1 mL TBS and transferred to a 1.5 mL tube. Aliquots
of the latex were plated on 100 mm LB agar plates as described
above to check functional positives, and the rest of the latex was
plated on 150 mm LB agar plates to generate the 3rd round antibody
phage. This general procedure of titering the antibody phage,
diluting the phage into panning buffer and adding CKMB-biotin,
incubating the phage at least 16 hr at 2-8.degree. C., panning the
phage with avidin magnetic latex, and plating the magnetic latex
was followed through 10 rounds of panning. The only changes from
that described above is the concentration of CKMB-biotin was lower
to increase the affinity of bound antibodies, and the number of
phage panned was between 10.sup.10 and 10.sup.8. The results of the
filter lifts on the percentage of kappa positives in the antibody
phage and the percentage of functional antibodies binding to the
magnetic latex are shown in Table 2.
[0179] After the 10th round of panning to CKMB-biotin, the antibody
phage were subject to a round of enrichment for polyvalent display.
Enrichment was effected by binding of the hexahistidine tag fused
to the displayed light chain to Ni NTA agarose (Qiagen Inc.,
Chatsworth, Calif.). The 11th round antibody phage (2.5 mL) were
diluted into 2.5 mL panning buffer in a 15 mL disposable sterile
centrifuge tube with plug seal cap. The Ni NTA was equilibrated
into panning buffer using the following procedure. The resin (1 mL
per phage sample) was diluted to 50 mL with panning buffer in a 50
mL disposable sterile centrifuge tube with plug seal cap and then
was pelleted in an IEC centrifuge at 500 rpm for 1 min. The
supernatant was carefully removed with a 50 mL disposable pipet,
then the resin was again diluted to 50 mL with panning buffer for
the second wash. The resin was washed in this manner a total of 4
times in order to equilibrate the resin in panning buffer. The
equilibrated resin was then resuspended to its original volume with
panning buffer. Equilibrated resin (1 mL) was then added to the
phage, and the tube was gently rocked for 15 min. After 15 min, the
resin was pelleted in an IEC centrifuge at 500 rpm for 1 min. The
supernatant was gently removed with a 10 mL disposable pipet, and
the resin was resuspended in 10 mL panning buffer for the first
wash. The resin was pelleted as described above, the supernatant
was removed, and the resin was resuspended a 2nd time in 10 mL
panning buffer. This procedure was repeated for a total of 5
panning buffer washes. After the 5th wash was removed, the resin
was resuspended in 1 mL of elution buffer (50 mM citrate, 150 mM
NaCl, pH 4.0) and transferred to a 1.5 mL tube. The resin was
gently rocked for 1 hr to elute the antibody phage. After 1 hr, the
resin was pelleted (14,000 rpm in Eppendorf centrifuge for 5 min),
and the phage was removed while being careful not to transfer any
resin. In order to adjust the pH of the phage solution to 8, 50
.mu.L of 1 M Tris, pH 8.3 and 46 .mu.L of 1 M NaOH were added to
the 1 mL phage sample. Also, 10 1L of 300 mg/mL bovine serum
albumin (Bayer, Kankakee, Ill.) was added to the phage sample. The
resulting phage solution (1 mL) was transferred to a 15 mL
disposable sterile centrifuge tube with plug seal cap for the 11th
round of panning with CKMB-biotin, as described above. As shown in
Table 2, panning the antibody phage with Ni NTA prior to panning to
CKMB significantly increased the percentage of CKMB functional
positives binding to the avidin magnetic latex.
[0180] The 12th-14th rounds of panning were done as described
above, where the antibody phage was bound to Ni NTA, eluted, and
the eluted phage panned with CKMB-biotin. However, in round 13,
unlabelled creatine kinase BB subunits (Scripps Laboratories, San
Diego, Calif.) and creatine kinase MM subunits (Scripps
Laboratories, San Diego, Calif.) were added to the phage eluted
from the Ni NTA at 100-fold molar excess to the CKMB-biotin to
select antibodies that specifically bind to CKMB without binding to
CKMM or CKBB. The percentage of functional CKMB antibodies was
greater than 95% by round 13.
5TABLE 2 Summary of kappa positives and CKMB functional positives
at each round of panning phage binding to antibody phage avidin
latex % kappa round # % functional 202/253 (80%) 1 0/32 (0%)
175/234 (75%) 2 0/129 (0%) 87/120 (73%) 3 4/79 (5.1%) 81/165 (49%)
4 35/409 (8.6%) 149/342 (44%) 5 5/31 (16%) 40/192 (21%) 6 30/400
(7.5%) 1/54 (2%) 7 6/54 (11%) 6/106 (6%) 8 4/46 (9%) 35/93 (38%) 9
19/551 (3%) 14/191 (7%) 10 18/400 (5%) N/A 11 349/553 (63%) 96/100
(96%) 12 232/290 (80%) 31/31 (100%) 13 (>95%) 147/149 (99%) 14
400/405 (99%)
[0181] Table 2 illustrates the importance of polyvalent enrichment
for making phage libraries with a high proportion of phage
displaying antibodies with specific affinity for the chosen target
(functional positives). The percentage of phage with specific
affinity for the selected target is zero after the first two rounds
of panning but then increase to about ten percent before leveling
off in subsequent rounds of panning through round ten. Then in
rounds 11-14, which are performed concurrently with polyvalent
enrichment, the percentage of functional positive phage increases
to 99%. The rapid increase in functional positive phage in rounds
11-14, in which polyvalent enrichment is performed, compared with
the plateau of about 10% achieved in rounds 1-10 without polyvalent
enrichment illustrates the power of the present methods to achieve
libraries with a high percent of functional positives.
[0182] The variation in percent kappa positives in different rounds
of screening is also instructive. The percentage is initially high
but decreases in the first ten rounds of screening (which are not
performed concurrently with polyvalent enrichment). The decrease
arises because kappa negative phage grow faster than kappa positive
phage and are preferentially amplified between rounds of panning.
In rounds 11-14, the percent of kappa positives increases to near
100%. The increase is due to polyvalent selection, which is
effected by screening for phage displaying at least two kappa
chains.
Example 15
Enrichment of Polyclonal Phage to Clostridium difficile Toxin A
with a Polyhistidine Tag on the Heavy Chain; Selection of an
Epitope Specificity on Toxin A Different From a Reference
Antibody
[0183] The first round antibody phage was prepared as described in
Example 7 using BS45 uracil template. Eight electroporations of
mutagenesis DNA were performed yielding 8 different phage samples.
To create more diversity in the polyclonal library, each phage
sample was panned separately. The antibody phage (about 0.9 mL)
from each electroporation was transferred to a 15 mL disposable
sterile centrifuge tube with plug seal cap. BSA (30 .mu.L 300 mg/mL
solution) and 1 M Tris (50 .mu.L, 1 M stock solution, pH 8.0) were
added to each phage stock, followed by 10 .mu.L 10.sup.-6 M toxin
A-biotin. The antibody phage was allowed to come to equilibrium
with the toxin A-biotin by incubating the phage at 2-8.degree. C.
overnight. After the incubation, the phage were panned with avidin
magnetic latex as described above in Example 14, except only 4
panning buffer washes were performed instead of 5. The entire
magnetic latex of each sample was plated on 150 mm LB plates to
generate the 2nd round antibody phage. The 150 mm plates were
incubated at 37.degree. C. for 4 hr, then overnight at 20.degree.
C.
[0184] The 2nd round antibody phage were eluted from the 150 mm
plates as described in Example 14 except 10 mL 2.times. YT was used
to elute the phage instead of 8 mL. The second round of panning was
set up by diluting 100 .mu.L of each phage stock (8 total) into 900
.mu.L panning buffer in 15 mL disposable sterile centrifuge tubes
with plug seal cap. Toxin A-biotin (10 .mu.L of 10.sup.-7 M) was
added to each sample, and the phage were incubated overnight at
2-8.degree. C. The antibody phage were not titered before panning
as described in Example 14. The phage samples were panned with
avidin magnetic latex following the overnight incubation. After
washing the latexes with panning buffer, each latex was plated on
150 mm LB agar plates. The plates were incubated at 37.degree. C.
for 4 hr, then 20.degree. C. overnight.
[0185] The 3rd round antibody phage were bound to Ni NTA resin and
eluted prior to panning with toxin A-biotin. Each phage sample was
bound to Ni NTA and washed with panning buffer as described in
Example 14. After the final wash, the antibody phage was eluted by
adding 0.8 mL 300 mM imidazole (Fisher Scientific, Pittsburgh, Pa.)
in panning buffer to each sample, and rocking the tubes for 10 min
at room temperature. The resin was pelleted by centrifuging the
tubes at 14,000 rpm for 5 min at room temperature, and the phage
were carefully transferred to new tubes. Each phage sample was
diluted to about 1.1 mL with panning buffer, then 1 mL of each
sample was transferred to 15 mL disposable sterile centrifuge tube
with plug seal cap. Toxin A-biotin (10 .mu.L of 10.sup.-7 M) was
added to each sample, and the phage were incubated overnight at
2-8.degree. C. After the overnight incubation, the phage were
panned with avidin magnetic latex. After washing, each latex was
resuspended in 1 mL panning buffer, and aliquots of each latex were
plated on 100 mm LB agar plates to determine the percentage of
kappa positives or functional positives. The majority of latex from
each panning (99%) was plated on 150 mm LB agar plates to amplify
the phage binding to the latex (see Example 14).
[0186] Two nitrocellulose filters from the 3rd round of panning
were developed with goat anti-mouse kappa AP and had 83% and 85%
positives. Six filters developed with toxin A-AP were all between
39-47% functional positive. At this point, 10 .mu.L of 10.sup.-7
and 20 .mu.L of 10.sup.-8 dilutions of each antibody phage stock
were plated on 100 mm LB plates to determine the titers of each
phage stock. The titers of the phage stocks were determined prior
to pooling so that phage stocks with very high titers did not bias
the antibody phage library. The titers (PFU/mL) were determined by
counting the number of plaques on each plate and multiplying that
number by 10.sup.9 (10.sup.-7 dilution plate) or 5.times.10.sup.9
(10.sup.-8 dilution plate). Once the titers were determined,
2.times.10.sup.11 PFU from each phage stock was pooled. The pooled
phage (1.5 mL) was diluted to 5 mL with panning buffer, then the
phage was panned with Ni NTA. The eluted phage was panned to toxin
A in the presence of an antibody to toxin A, PCG4 (described U.S.
Pat. No. 4,533,630), to screen for phage-antibodies to toxin A that
have a different specificity than PCG4. The eluted phage was
diluted to about 1.1 mL with panning buffer, and 1 mL was aliquoted
into a 15 mL tube. In a 1.5 mL tube, unlabeled toxin A (7.5 .mu.L,
10.sup.-7 M) and biotinylated PCG4 (15 .mu.L, 10.sup.-6 M) were
mixed and incubated at room temperature for 15 min. A 20-fold molar
excess of biotinylated antibody over toxin A was used so that no
antibody phage could bind at the PCG4 epitope. The mixture of toxin
A and biotinylated antibody (l 5 .mu.L) was added to the 1 mL phage
and incubated overnight at 2-8.degree. C. The phage sample was
panned with avidin magnetic latex as described in Example 14.
[0187] The process of panning the eluted antibody phage, binding
and eluting the phage with Ni NTA, and panning the resulting eluted
phage with biotinylated PCG4/toxin A was repeated 4 times. After
the 5th round of selection, the polyclonal antibody phage stock
complementary to PCG4 was 99% kappa positive and 98% had specific
affinity for toxin A by plaque lift analysis.
Example 16
Cloning of Clostridium difficile Glutamate Dehydrogenase (the
Target for Panning in Example 17)
[0188] PCR primers were made corresponding to the coding sequence
at the 5'-end of glutamate dehydrogenase, and the coding sequence
at the 3'-end of glutamate dehydrogenase, including six histidine
codons inserted between the end of the coding sequence and the stop
codon to assist in purification of the recombinant protein by
metal-chelate chromatography, primers Q and R, respectively (Table
3). In addition, the 5' primer contains 20 base-pairs of vector
sequence at its 5'-end corresponding to the 3'-end of the pBRnsiH3
vector. The 3' primer contains the 19 base-pairs of tet promoter
removed by HindIII digestion, in addition to 20 base-pairs of
vector sequence 3' to the HindIII site at its 5' end (Example
21).
[0189] The PCR amplification of the glutamate dehydrogenase gene
insert was done on a 100 .mu.l reaction scale containing 100 pmol
of 5' primer (O), 100 pmol of 3' primer (R), 2 units of Expand
polymerase, 10 .mu.l 2 mM dNTPs, 10 .mu.l 10.times. Expand reaction
buffer, 1 .mu.l C. difficile genomic DNA (75 ng) as template, and
water to 100 .mu.l. The reaction was carried out in a Perkin-Elmer
thermal cycler as described in Example 22. The PCR products were
precipitated and fractionated by agarose gel electrophoresis and
full-length products excised from the gel, purified, and
resuspended in water (Example 21). The insert and NsiI/HindIII
digested pBRnsiH3 vector were prepared for T4 exonuclease digestion
by adding 1.0 .mu.l of 10.times. Buffer A to 1.0 .mu.g of DNA and
bringing the final volume to 9 .mu.l with water. The samples were
digested for 4 min at 30.degree. C. with 1 .mu.l (1 U/.mu.l)of T4
DNA polymerase. The T4 DNA polymerase was heat inactivated by
incubation at 70.degree. C. for 10 min. The samples were cooled,
briefly spun, and 70 ng of the digested insert added to 100 ng of
digested pBRnsiH3 vector in a fresh microfuge tube. After the
addition of 1 .mu.l of 10.times. annealing buffer, the volume was
brought to 10 .mu.l with water and the mixture heated to 70.degree.
C. for 2 min and cooled over 20 min to room temperature. The
annealed DNA was diluted one to four with distilled water and
electroporated (Example 8) into 301l of electrocompetent E. coli
strain, DH10B. The transformed cells were diluted to 1.0 ml with
2.times. YT broth and 10 .mu.l, 100 .mu.l and 300 .mu.l plated on
LB agar plates supplemented with tetracycline (10 .mu.g/ml) and
grown overnight at 37.degree. C. Clones were picked and grown
overnight in 2.times. YT (10 .mu.g/ml tetracycline) at 37.degree.
C. The following day glycerol freezer stocks made for long term
storage at -80.degree. C. The glutamate dehydrogenase clone was
grown and purified on a preparative scale as described in Example
24.
Example 17
Enrichment of Polyclonal Phage to Clostridium difficile Glutamate
Dehydrogenase Using a Decapeptide Tag on the Kappa Chain
[0190] The first round antibody phage was prepared as described in
Example 7 using BS45 uracil template, which has a hexahistidine tag
for polyvalent enrichment fused to the heavy chain of displayed
Fabs. Twelve electroporations of mutagenesis DNA from 4 different
spleens (3 electroporations from each spleen) yielded 12 different
phage samples. Each phage sample was panned separately to create
more diversity in the polyclonal library. The antibody phage (about
0.9 mL) from each electroporation was transferred to a 15 mL
disposable sterile centrifuge tube with plug seal cap. BSA (30
.mu.L of a 300 mg/mL solution) and 1 M Tris (50 .mu.L, pH 8.0) were
added to each phage stock, followed by 10 .mu.L 10.sup.-7 M
glutamate dehydrogenase-biotin (Example 16). The antibody phage was
allowed to come to equilibrium with the glutamate
dehydrogenase-biotin by incubating the phage at room temperature
for 4 hr. After the incubation, the phage samples were panned with
avidin magnetic latex as described in Example 14. The entire latex
of each sample was plated on 150 mm LB agar plates to generate the
2nd round antibody phage (Example 14). The resulting phage were
panned with glutamate dehydrogenase-avidin-magnetic latex as
described for the first round of panning.
[0191] A procedure was developed to enrich the antibody phage using
the decapeptide tag on the kappa chain and a monoclonal antibody
magnetic latex that binds the decapeptide. Binding studies had
previously shown that the decapeptide could be eluted from the
monoclonal antibody 7F11 (see Example 25) at a relatively mild pH
of 10.5-11. The third round antibody phage resulting from panning
Ni NTA enriched 2nd round phage were bound to the 7F 11 magnetic
latex and eluted as described below. The 7F11 magnetic latex (2.5
mL) was equilibrated with panning buffer as described above for the
avidin magnetic latex. Each phage stock (1 mL) was aliquoted into a
15 mL tube. The 7F 11 magnetic latex (200 .mu.L per phage sample)
was incubated with phage for 10 min at room temperature. After 10
min, 9 mL of panning buffer was added, and the magnetic latex was
separated from unbound phage by placing the tubes in a magnet for
10 min. The latexes were washed with 1 additional 10 mL panning
buffer wash. Each latex was resuspended in 1 mL panning buffer and
transferred to 1.5 mL tubes. The magnetic latex was separated from
unbound phage by placing the tubes in a smaller magnet for 5 min,
then the supernatant was carefully removed with a sterile pipet.
Each latex was resuspended in 1 mL elution buffer (20 mM
3-(cyclohexylamino)propanesulfonic acid (United States Biochemical,
Cleveland, Ohio), 150 mM NaCl, 20 mg/mL BSA, pH 10.5) and incubated
at room temperature for 10 min. After 10 min, tubes were placed in
the small magnet again for 5 min and the eluted phage was
transferred to a new 1.5 mL tube. The phage samples were again
placed in the magnet for 5 min to remove the last bit of latex that
was transferred. Eluted phage was carefully removed into a new tube
and 25 .mu.L 3 M Tris, pH 6.8 was added to neutralize the phage.
Panning with glutamate dehydrogenase-biotin was set up for each
sample by mixing 900 .mu.L 7F11/decapeptide enriched phage, 100
.mu.L panning buffer, and 10 .mu.L 10.sup.-7 M glutamate
dehydrogenase-biotin and incubating overnight at 2-8.degree. C. The
phage was panned with avidin magnetic latex as described in Example
14.
[0192] One of the functional positive plaques was arbitrarily
picked off an LB agar plate, and the antibody was subcloned into
the expression vector described in Example 22. The monoclonal
antibody was used as a reference to isolate polyclonal antibodies
having different epitope specificity than the monoclonal antibody
for sandwich assay development. This is similar to what is
described above for toxin A except the monoclonal antibody for
toxin A was a hybridoma antibody from a commercial source and the
monoclonal antibody described here is from the antibody phage
library.
[0193] The resulting 4th round antibody phage was panned again with
7F11 magnetic latex prior to functional panning. The eluted phage
samples were set up for panning with the biotinylated monoclonal
antibody (CD.43.9) and unlabelled glutamate dehydrogenase as
described in Example 15 for toxin A antibodies. As discussed above,
the monoclonal antibody was picked from the phage library and a
polyclonal antibody phage stock that was complementary to the
monoclonal was needed. Mixed the monoclonal antibody biotin (125
.mu.L, 10.sup.-6M) and glutamate dehydrogenase (125 .mu.L,
5.times.10.sup.-8 M) at room temperature for 15 min. Added 20 .mu.L
of the mixture to each 1 mL phage sample (0.7 mL panning buffer and
0.3 mL phage eluted from the 7F11 latex), and incubated the samples
overnight at 2-8.degree. C. The phage samples were panned with the
avidin magnetic latex following the standard procedure.
[0194] The 5th round antibody phage were eluted from the 150 mm LB
agar plates as described in Example 15. The antibody phage were
titered by plating 10 .mu.L 10.sup.-7 dilutions of each phage stock
on 100 mm LB agar plates. After 6 hr at 37.degree. C., the number
of plaques on each plate was counted, and the titers were
calculated by multiplying the number of plaques by 10.sup.9. A pool
of ten fifth round phage was made by mixing an equal number of
phage from each phage stock so that high titer phage stocks would
not bias the pool. Two of the samples were discarded because they
had low functional percentages by plaque lift. The pooled phage
were panned with 7F11 magnetic latex as described above. The eluted
phage was set up for panning by mixing 0.1 mL panning buffer, 0.9
mL 7F11 eluted phage, and 20 .mu.L monoclonal antibody
biotin/glutamate dehydrogenase (see above). Phage were incubated
overnight at 2-8.degree. C. The phage sample was panned with avidin
magnetic latex following the standard procedure. The phage binding
to the latex was 97% functional positive by plaque lift assay.
Example 18
Enrichment of Polyclonal Page to Human Vascular Endothelial Growth
Factor 165.
[0195] The immunization of vascular endothelial growth factor 165
(VEGF1.sub.65, R&D Systems, Minneapolis, Minn.), purification
of RNA, preparation of cDNA, and amplification of cDNA by PCR were
done as described in Examples 1,2 and 3. The ss-DNA was purified by
HPLC and kinased as described in Example 4 with the following
changes in the HPLC gradient shown in Table 1. The time to 85% B
was changed from 32 min to 17 min, the time to 100% B was changed
from 35 min to 18 min, and every time after 35 min was decreased by
17 min. The total time for the HPLC program was decreased from 52
min to 35 min. Mutagenesis of the BS45 uracil template was done as
described in Example 7 with the following exceptions. The kinased
heavy chain ss-DNA from 4 different spleens (5 .mu.L of 100 ng/mL
from each spleen) was pooled, and separately the kinased kappa
chain ss-DNA from 4 different spleens (5 .mu.L of 100 ng/1L from
each spleen) was pooled. The pooled ss-DNA was used in the
mutagenesis of BS45 instead of ss-DNA from individual spleens. Four
electroporations of the mutagenesis DNA were done as described in
Example 8 except the transformed samples were resuspended in 400
.mu.L 2XYTand 600 .mu.L overnight XL1 cells instead of 1 mL of
2XYT. The first round antibody phage samples were generated by
plating the electroporated samples on 150 mm LB plates as described
in Example 12 except no lawn cells were added. The plates were
incubated at 37.degree. C. for 4 hr, then 20.degree. C. overnight.
The first round antibody phage was eluted from the 150 mm plates by
pipeting 10 mL 2YT media onto the lawn and gently shaking the plate
at room temperature for 20 min. The phage were transferred to 15 mL
disposable sterile centrifuge tubes with plug seal cap and the
debris from the LB plate was pelleted by centrifuging for 15 min at
3500 rpm. The four 1st round antibody phage samples were then
transferred to new tubes.
[0196] Prior to functional panning, the antibody phage samples were
enriched for polyvalent display using the decapeptide tag on the
kappa chain and the 7F11 magnetic latex, as described in Example
17. The same procedure was followed except one 9 mL panning buffer
wash and two 1 mL panning buffer washes were done instead of that
described in Example 17. The first round of panning was set up with
biotinylated VEGF at 10.sup.-9 M final concentration. The antigen
was biotinylated as described in Example 9. The functional panning
was done as described in Example 14 except there were only one 10
mL panning buffer wash and three 1 mL panning buffer washes of the
avidin magnetic latex prior to plating the latexes on LB plates.
The entire latex of each sample was plated on 150 mm LB plates to
generate the 2nd round antibody phage. The 150 mm plates were
incubated at 37.degree. C. for 4 hr, then overnight at 20.degree.
C.
[0197] The resulting 2.sup.nd round antibody phage samples were set
up for the second round of functional panning in separate 15 mL
disposable sterile centrifuge tubes with plug seal cap by mixing
900 .mu.L panning buffer, 100 .mu.L 2.sup.nd round antibody phage,
and 10 .mu.L 10.sup.-6M VEGF-biotin. After 1 hr at room
temperature, the phage samples were panned with avidin magnetic
latex as described above. An aliquot of one sample was plated on a
100 mm LB agar plate to determine the percentage of kappa
positives, as described in Example 14. The percentage of kappa
positives was 84%.
[0198] The 3rd round antibody phage was eluted from the plates and
a third round of functional panning was set up as described above
using 950 .mu.L panning buffer, 50 1L 3rd round antibody phage, and
10 .mu.L 10.sup.-6 M VEGF-biotin. After incubation for 46 hours at
2-8.degree. C., the phage samples were panned with avidin magnetic
latex and aliquots of each sample were plated to determine the
percentage of kappa positives, as described above. The percentage
of kappa positives was between 57-74%.
[0199] The 4th round antibody phage samples were titered by plating
40 .mu.L 10.sup.-8 dilutions on 100 mm LB plates. After 6 hr at
37.degree. C., the number of plaques on each plate was counted. A
pool of 4th round phage was made by mixing an equal number of phage
from each phage stock, so that high titer phage stocks would not
bias the pool. The pooled antibody phage was panned with 7F11
magnetic latex as described above, and the eluted phage was set up
for functional panning by adding VEGF-biotin to a final
concentration of 10.sup.-9M. After allowing the mixture to come to
equilibrium, the phage sample was panned with avidin magnetic latex
as described above.
[0200] The eluted 5.sup.th round phage was set up in duplicate for
a 5.sup.th round of functional panning as described above using 950
.mu.L panning buffer, 50 .mu.L 5th round pooled-antibody phage. One
sample (foreground) received 10 .mu.L 10.sup.-7M VEGF-biotin, and
the other sample (background) did not receive antigen and served as
a blank to monitor non-specific binding of phage to the magnetic
latex. After incubation for 18 hours at 2-8.degree. C., the phage
samples were panned with avidin magnetic latex as described above.
The next day, the 6.sup.th round antibody phage was eluted and the
number of plaques was counted on the foreground and background
plates. The foreground:background ratio was 134:1.
Example 19
Preparation of M13 Cloning Vector with Human Constant Region
Sequences
[0201] The mouse heavy and kappa constant region sequences were
deleted from BS45 by oligonucleotide directed mutagenesis.
Oligonucleotide 864 was used to delete the mouse kappa chain and
oligonucleotide 862 was used to delete the mouse heavy chain.
6 Oligonucleotide 864 5' ATC TGG CAC ATC ATA TGG ATA AGT TTC GTG
TAC AAA ATG CCA GAC CTA GAG GAA TTT TAT TTC CAG CTT GGT CCC
Oligonucleotide 862 5' GTG ATG GTG ATG GTG ATG GAT CGG AGT ACC AGG
TTA TCG AGC CCT CGA TAT TGA GGA GAC GGT GAC TGA
[0202] Deletion of both constant region sequences was determined by
amplifying the DNA sequence containing both constant regions by PCR
using oligonucleotides 5 and 197, followed by sizing the PCR
products on DNA agarose gel. The PCR was accomplished as described
in Example 3 for the double-stranded DNA, except 1 .mu.L of phage
was template instead of cDNA. Phage with the desired deletion had a
shorter PCR product than one deletion or no deletion. Uracil
template was made from one phage stock having both deletions, as
described in Example 6. This template, BS50, was used to insert the
human constant region sequences for the kappa chain and IgG1.
7 Primer 5 5' GCA ACT GTT GGG AAG GG Primer 197 5' TC GCT GCC CAA
CCA GCC ATG
[0203] The human constant region DNA sequences were amplified from
human spleen cDNA (Clontech, Palo Alto, Calif.). Oligonucleotides
869 and 870 were used to amplify the kappa constant region
sequence, and oligonucleotides 867 and 876 were used to amplify the
IgG1 constant region sequence and the codons for 6 amino acids of
the hinge region (Kabat et al., Sequences of Proteins of
Immunological Interest, 1991).
8 5' PCR primer (869)-GGG ACC AAG CTG GAA ATA AAA CGG GCT GTG GCT
GCA CCA TCT GTC T 3' PCR primer (870)-ATC TGG CAC ATC ATA TGG ATA
AGA CTC TCC CCT GTT GAA GCT CTT 5' PCR primer (867)-TCA GTC ACC GTC
TCC TCA GCC TCC ACC AAG GGC CCA TC 3' PCR primer (876)-GTG ATG GTG
ATG GTG ATG AGA TTT GGG CTC TGC TTT CTT GTC C
[0204] PCR (1-50 .mu.L reaction for each chain) was performed using
Expand high-fidelity PCR system (Roche Molecular Biochemicals,
Indianapolis, Ind.). Each 50 .mu.L reaction contained 50 pmol of 5'
primer, 50 pmol of 3' primer, 0.35 units of Expand DNA polymerase,
5 .mu.L 2 mM dNTP's, 5 L 10.times. Expand reaction buffer, 1 .mu.L
cDNA as template, and water to 50 .mu.L. The reaction was carried
out in a Perkin-Elmer thermal cycler (Model 9600) using the
following thermal profile for the kappa chain: one cycle of
denaturation at 94.degree. C. (1 min); ten cycles of denaturation
(15 sec, 94.degree. C.), annealing (30 sec, 55.degree. C.),
elongation (60 sec, 72.degree. C.); fifteen cycles of denaturation
(15 sec, 94.degree. C.), annealing (30 sec, 55.degree. C.),
elongation (80 sec plus 20 sec for each additional cycle,
72.degree. C.); elongation (6 min, 72.degree. C.); soak (4.degree.
C., indefinitely). The thermal profile used for the heavy chain
reaction had twenty cycles instead of fifteen in the second part of
the thermal profile.
[0205] The dsDNA products of the PCR process were then subjected to
asymmetric PCR using only 3' primer to generate substantially only
the anti-sense strand of the human constant region genes, as
described in Example 3. Five reactions were done for the kappa
chain and ten reactions were done for the heavy chain (100 .mu.L
per reaction). The thermal profile for both constant region genes
is the same as that described in Example 3, including the heavy
chain asymmetric PCR was done with 30 cycles and the kappa chain
asymmetric PCR was done with 25 cycles. The single stranded DNA was
purified by HPLC as described in Example 4. The HPLC purified kappa
chain DNA was dissolved in 55 .mu.L of water and the HPLC purified
heavy chain was dissolved in 1001L of water. The DNA was quantified
by absorbance at 260 nm, as described in Example 4, then the DNA
was kinased as described in Example 4 except added 6 .mu.L
10.times. kinase buffer, 2.6 .mu.L 10 mM ATP, and 0.5 .mu.L of
polynucleotide kinase to 50 .mu.L of kappa chain DNA. Twice those
volumes of kinase reagents were added to 100L of heavy chain
DNA.
[0206] The kinased DNA was used to mutate BS50 without purifying
the DNA by extractions. The mutagenesis was performed on a 2 .mu.g
scale by mixing the following in a 0.2 mL PCR reaction tube: 8
.mu.l of (250 ng/.mu.l) BS50 uracil template, 8 .mu.l of 10.times.
annealing buffer (200 mM Tris pH 7.0, 20 mM MgCl.sub.2, 500 mM
NaCl), 2.85 .mu.l of kinased single-stranded heavy chain insert (94
ng/.mu.l),6.6 .mu.l of kinased single-stranded kappa chain insert
(43.5 ng/.mu.l), and sterile water to 80 .mu.l. DNA was annealed in
a GeneAmp.RTM. 9600 thermal cycler using the following thermal
profile: 20 sec at 94.degree. C., 85.degree. C. for 60 sec,
85.degree. C. to 55.degree. C. ramp over 30 min, hold at 55.degree.
C. for 15 min. The DNA was transferred to ice after the program
finished. The extension/ligation was carried out by adding 8 .mu.l
of 10.times. synthesis buffer (5 mM each dNTP, 10 mM ATP, 100 mM
Tris pH 7.4, 50 mM MgCl.sub.2, 20 mM DTT), 8 .mu.l T4 DNA ligase (1
U/.mu.l, Roche Molecular Biochemicals, Indianapolis, Ind.), 8 .mu.l
diluted T7 DNA polymerase (1 U/.mu.l, New England BioLabs, Beverly,
Mass.) and incubating at 37.degree. C. for 30 min. The reaction was
stopped with 296 .mu.l of mutagenesis stop buffer (10 mM Tris pH
8.0, 10 mM EDTA). The mutagenesis DNA was extracted once with
equilibrated phenol (pH>8):chloroform:isoamyl alcohol (50:49:
1), once with chloroform:isoamyl alcohol (49:1), and the DNA was
ethanol precipitated at -20.degree. C. for at least 30 min. The DNA
was pelleted and the supernatant carefully removed as described
above. The sample was briefly spun again and all traces of ethanol
removed with a pipetman. The pellet was dried in vacuo. The DNA was
resuspended in 4 .mu.l of sterile water. 1 .mu.l mutagenesis DNA
was (500 ng) was transferred into 40 .mu.l electrocompetent E. coli
DH12S (Gibco/BRL, Gaithersburg, Md.) using the electroporation
conditions in Example 8. The transformed cells were mixed with 1.0
mL 2.times. YT broth (Sambrook, et al., supra) and transferred to a
15 mL sterile culture tube. Aliquots (10 .mu.L of 10.sup.-3 and
10.sup.-4 dilutions) of the transformed cells were plated on 100 mm
LB agar plates as described in Example11. After 6 hr of growth at
37.degree. C., 20 individual plaques were picked from a plate into
2.75 mL 2.times. YT and 0.25 ml overnight XL1 blue cells. The
cultures were grown at 37.degree. C., 300 rpm overnight to amplify
the phage from the individual plaques. The phage samples were
analyzed for insertion of both constant regions by PCR using
oligonucleotides 197 and 5 (see above in BS50 analysis), followed
by sizing of the PCR products by agarose gel electrophoresis. The
sequence of two clones having what appeared to be two inserts by
agarose gel electrophoresis was verified at MacConnell Research
(San Diego, Calif.) by the dideoxy chain termination method using a
Sequatherm sequencing kit (Epicenter Technologies, Madison, Wis.)
and a LI-COR 4000L automated sequencer (LI-COR, Lincoln, Nebr.).
Oligonucleotide primers 885 and 5, that bind on the 3' side of the
kappa chain and heavy chain respectively, were used. Both clones
had the correct sequence. The uracil template having human constant
region sequences, called BS46, was prepared as described in Example
6.
[0207] Primer 885
[0208] 5' TAA GAG CGG TAA GAG TGC CAG
Example 20
Preparation of Chimeric Omniclonal to VEGF From Mouse Phage
Library
[0209] The variable region sequences of the phage library from
Example 18 were amplified using oligonucleotides 197 and 938 for
the kappa chain sequences, and oligonucleotides 949 and 950 for the
heavy chain sequences. PCR was performed using a high-fidelity PCR
system, Expand (Roche Molecular Biochemicals, Indianapolis, Ind.).
Each 50 .mu.L reaction contained 50 pmol of each primer, 0.35 units
of Expand DNA polymerase, 5 .mu.L 2 mM dNTP's, 5 .mu.L 10.times.
Expand reaction buffer, 1 .mu.l diluted (1:20 dilution) phage stock
as template, and water to 50 .mu.L. The reaction was carried out as
described in Example22 except twenty cycles was used instead of
fifteen in the second part of the thermal profile. The double
stranded DNA products were used as template to make single standed
DNA as described in Example 3. For each chain, five 100 .mu.L
reactions were done using oligonucleotide 938 for the kappa chain
and oligonucleotide 939 for the heavy chain, and only 25 cycles of
amplification were done instead of 30. The ss-DNA was purified as
described in Example 18. The HPLC purified DNA was quantified by
absorbance at 260 nm, as described in Example 4, then the DNA was
kinased as described in Example 4 except added 6 .mu.L 10.times.
kinase buffer, 2.6 .mu.L 10 mM ATP, and 0.5 .mu.L of polynucleotide
kinase to 50 .mu.L of DNA. The kinased heavy and light chain ss-DNA
samples were then used to mutate BS46 uracil template as described
in Example 7 except the mutagenesis was done on a 1 .mu.g scale
instead of 2 .mu.g. Electroporated 11L of the mutagenesis DNA into
DH12S cells as described in Example 8. The first round antibody
phage was generated as described in Example 18. The plates were
incubated at 37.degree. C. for 4 hr, then 20.degree. C. overnight.
The first round antibody phage was eluted from the plates as
described in Example 18.
[0210] Prior to functional panning, the antibody phage sample was
enriched for polyvalent display using the decapeptide tag on the
kappa chain and the 7F11 magnetic latex, as described in Example
18. The first round of functional panning was set up with the
VEGF-biotin at 10.sup.-9 M final concentration. After allowing the
phage and antigen to reach equilibrium, the phage sample was panned
with avidin magenetic latex as described in Example 18. The second
and third rounds of panning were set up and finished as described
in Example 18 using a final VEGF-biotin concentration of 10.sup.-8
M. After 3 rounds of functional panning, the foreground/background
was 67.
9 Oligonucleotide 197- 5' TC GCT GCC CAA CCA GCC ATG
Oligonucleotide 938- 5' GAT GAA GAC AGA TGG TGC AGC CAC AG
Oligonucleotide 939- 5' GG GAA GAC CGA TGG GCC CTT GGT GGA GGC
Oligonucleotide 949- 5' TTT ACC CCT GTG GCA AAA GCC Oligonucleotide
950- 5' TGG ATA GAC AGA TGG GCC CGT CGT GGT GGC
[0211] The antibody phage population was subcloned into the
expression vector and electroporated as described in Example 22
with the following changes. The 3' PCR primer used to amplify the
antibody gene insert, oligonucleotide 970, was different from
primer J. Annealing was done by mixing 1 .mu.L of the T4 digested
antibody gene insert (100 ng), 1 uL of the T4 digested vector (100
ng), 1 .mu.L of 10.times. annealing buffer and water to 10 uL,
followed by heating at 70.degree. C. for 2 min and slow cooling.
The vector and insert were ligated together by adding 1 .mu.L of
10.times. synthesis buffer, 1 .mu.L T4 DNA ligase, 1 .mu.L diluted
T7 DNA polymerase and incubating at 37.degree. C. for 15 min. The
ligated DNA was electroporated by diluting 11 L of the ligated DNA
into 2 .mu.L of water, then electroporating 11L of the diluted DNA
into 40 .mu.L of electrocompetent DH10B cells.
10 Oligonucleotide 970- 5' GT GAT AAA CTA CCG TA AAG CTT ATC GAT
GAT AAG CTG TCA A TTA GTG ATG GTG ATG GTG ATG AGA TTT G
[0212] The recombinant omniclonal was expressed as described in
Example 23. The antibody was purified as follows. The first step in
purification uses immobilized metal affinity chromatography (IMAC).
Streamline Chelating resin (Amersham Pharmacia Biotech, Piscataway,
N.J.) is charged with 0.1 M NiCl.sub.2, and then equilibrated in 20
mM Borate, 150 mM NaCl, 10 mM Imidazole, 0.01% NaN.sub.3, pH 8.0
buffer. The culture homogenate is adjusted to contain 10 mM
Imidazole, using a 5M Imidazole stock solution. It is then
contacted with the Ni-charged resin (1 L culture homogenate per 100
mL resin) in a 2 L Pyrex bottle on a G-10 incubator shaker (New
Brunswick Scientific, Edison, NJ) at room temperature, 160 rpm, for
1 hour. The Fab is captured by means of the high affinity
interaction between the nickel ligand and the hexahistidine tag on
the Fab heavy chain. Following the batch binding step, the resin is
allowed to settle by sedimentation, and the culture homogenate is
decanted for disposal. The resin with the bound Fab is then washed
three times, each time with 1 L of equilibration buffer for 5
minutes. The sedimentation and decanting method described above is
used between washes to recover the resin with the bound Fab. After
washing, the resin is packed into a column, and washed further
until baseline is established on the UV detector. The Fab is eluted
with 20 mM Borate, 150 mM NaCl, 200 mM Imidazole, 0.01% NaN.sub.3,
pH 8.0 buffer.
[0213] The second step in purification uses ion-exchange
chromatography (IEC). Q Sepharose FastFlow resin (Amersham
Pharmacia Biotech, Piscataway, N.J.) is equilibrated in 20 mM
Borate, 250 mM NaCl, 0.01% NaN.sub.3, pH 8.0. The IMAC elution pool
from the first step is mixed 1:1 with 20 mM Borate, 350 mM NaCl,
0.01% NaN.sub.3, pH 8.0. This diluted IMAC pool, now in 20 mM
Borate, 250 mM NaCl, 0.01% NaN.sub.3, pH 8.0, is loaded onto the
IEC column. The load is chased with equilibration buffer to UV
baseline. The Fab is collected in the flowthrough pool, while other
contaminants bind to the column. The contaminants are stripped from
the column with 20 mM Borate, 1 M NaCl, 0.01% NaN.sub.3, pH
8.0.
[0214] The third step in purification uses protein G chromatography
(PGC). Protein G Sepharose FastFlow resin (Amersham Pharmacia
Biotech, Piscataway, N.J.) is equilibrated in 20 mM Borate, 150 mM
NaCl, 0.01% NaN.sub.3, pH 8.0. The IEC flowthrough pool from the
second step is loaded onto the PGC column. The column is washed
equilibration buffer to UV baseline. The Fab binds to the column by
means of high affinity interaction between the protein G ligand and
the heavy chain on the Fab, while other contaminants pass through
the column. The Fab is eluted with 0.1 M Glycine, 0.01% NaN.sub.3,
pH 3.0. The elution pool is immediately neutralized to pH 8.0 by
addition of 3.3%V/V of 1 M TRIS, pH 10.2 buffer.
[0215] Finally, the Fab pool from the third step is concentrated to
about 25 mg/mL using a stirred-cell concentrator fitted with a YM10
10 kDa disc membrane (Amicon, Beverly, Mass.). The concentrate is
dialyzed overnight into 20 mM Borate, 150 mM NaCl, 0.01% NaN.sub.3,
pH 8.0 buffer, using 12-14 kDa dialysis tubing (Spectrum, Laguna
Hills, CA). The concentrated and dialyzed Fab pool is then filtered
with a 0.2.mu., PES syringe filter (Nalgene, Rochester, N.Y.) and
tansferred to storage at 2-8.degree. C.
[0216] The concentration of the purified Fab is measured by UV
absorbance at 280 nm, using an extinction coefficient of 1.6
mg/(mL.cm). The purity is evaluated using a 4-20% TRIS-Glycine
SDS-PAGE gel in an Xcell II system (Novex, San Diego, Calif.), and
by means of a G250 Zorbax HPLC column (Hewlett-Packard).
Example 21
Construction of the pBR Expression Vector
[0217] An expression vector and a process for the subcloning of
monoclonal and polyclonal antibody genes from a phage-display
vector has been developed that is efficient, does not substantially
bias the polyclonal population, and can select for vector
containing an insert capable of restoring antibiotic resistance.
The vector is a modified pBR322 plasmid, designated pBRncoH3, that
contains an arabinose promoter, ampicillin resistance
(beta-lactamase) gene, a partial tetracycline resistance gene, a
pelB (pectate lyase) signal sequence, and NcoI and HindIII
restriction sites. (FIG. 7). The pBRncoH3 vector can also be used
to clone proteins other than Fabs with a signal sequence. A second
vector, pBRnsiH3, has been developed for cloning proteins with or
without signal sequences, identical to the vector described above
except that the pelB signal sequence is deleted and the NcoI
restriction site has been replaced with an NsiI site.
[0218] The araC regulatory gene (including the araBAD promoter) was
amplified from E. coli K-12 strain NL31-001 (a gift from Dr. Nancy
Lee at UCSB) by PCR (Example 3) using Taq DNA polymerase
(Boehringer Mannheim, Indianapolis, Ind.) with primers A and B
(Table 3). Primers A and B contain 20 base-pairs of the BS39 vector
sequence at their 5'-ends complementary to the 5' side of the lac
promoter and the 5' side of the pelB signal sequence, respectively.
Primer A includes an EcoRI restriction site at its 5'-end used
later for ligating the ara insert into the pBR vector. The
araCparaBAD PCR product was verified by agarose gel electrophoresis
and used as template for an asymmetric PCR reaction with primer `B`
in order to generate the anti-sense strand of the insert. The
single-stranded product was run on agarose gel electrophoresis,
excised, purified with GeneClean (Bio101, San Diego, Calif.), and
resuspended in water as per manufacturers recommendations. The
insert was kinased with T4 polynucleotide kinase for 45 min at
37.degree. C. The T4 polynucleotide kinase was heat inactivated at
70.degree. C. for 10 min and the insert extracted with an equal
volume of phenol/chloroform, followed by chloroform. The DNA was
precipitated with ethanol at -20.degree. C. for 30 min. The DNA was
pelleted by centrifugation at 14 krpm for 15 min at 4.degree. C.,
washed with ice-cold 70% ethanol, and dried in vacuo.
[0219] The insert was resuspended in water and the concentration
determined by A.sub.260 using an absorbance of 1.0 for a
concentration of 40 .mu.g/ml. The insert was cloned into the
phage-display vector BS39 for sequence verification and to
introduce the pelB signal sequence in frame with the arabinose
promoter (the pelB signal sequence also contains a NcoI restriction
site at its 3'-end used later for ligating the ara insert into the
pBR vector). The cloning was accomplished by mixing 250 ng of BS39
uracil template (Example 5), 150 ng of kinased araCpBAD insert, and
1.0 .mu.l of 10.times. annealing buffer in a final volume of 10
.mu.l. The sample was heated to 70.degree. C. for 2 min and cooled
over 20 min to room temperature to allow the insert and vector to
anneal. The insert and vector were ligated together by adding 1
.mu.l of 10.times. synthesis buffer, 1 .mu.l T4 DNA ligase
(1U/.mu.l), 1 .mu.l T7 DNA polymerase (1 U/.mu.l) and incubating at
37.degree. C. for 30 min. The reaction was stopped with 90 .mu.l of
stop buffer (10 mM Tris pH 8.0, 10 mM EDTA) and 1 .mu.l
electroporated (Example 8) into electrocompetent E. coli strain,
DH10B, (Life Technologies, Gaithersburg, Md.).
[0220] The transformed cells were diluted to 1.0 ml with 2.times.
YT broth and 1 .mu.l, 10 .mu.l, 100 .mu.l plated as described in
Example 12. Following incubation overnight at 37.degree. C.,
individual plaques were picked, amplified by PCR with primers A and
B, and checked for full-length insert by agarose gel
electrophoresis. Clones with full-length insert were sequenced with
primers D, E, F, G (Table 3) and checked against the literature. An
insert with the correct DNA sequence was amplified by PCR (Example
3) from BS39 with primers A and C (FIG. 5A) and the products run on
agarose gel electrophoresis.
[0221] Full-length products were excised from the gel and purified
as described previously and prepared for cloning by digestion with
EcoRI and NcoI. A pBR lac-based expression vector that expressed a
murine Fab was prepared to receive this insert by EcoRI and NcoI
digestion. This digestion excised the lac promoter and the entire
coding sequence up to the 5'-end of the heavy chain (C.sub.H1)
constant region (FIG. 5A).
[0222] The insert and vector were mixed (2:1 molar ratio) together
with 1 .mu.l 10 mM ATP, 1 .mu.l (1U/.mu.l) T4 DNA ligase, 1 .mu.l
10.times. ligase buffer in a final volume of 10 .mu.l and ligated
overnight at 15.degree. C. The ligation reaction was diluted to 20
.mu.l, and 1 .mu.l electroporated into electrocompetent E. coli
strain, DH 10B (Example 8), plated on LB tetracycline (10 .mu.g/ml)
plates and grown overnight at 37.degree. C.
[0223] Clones were picked and grown overnight in 3 ml LB broth
supplemented with tetracycline at 20 .mu.g/ml. These clones were
tested for the correct insert by PCR amplification (Example 3) with
primers A and C, using 1 .mu.l of overnight culture as template.
Agarose gel electrophoresis of the PCR reactions demonstrated that
all clones had the araCparaB insert. The vector (plasmid) was
purified from each culture by Wizard miniprep columns (Promega,
Madison, Wis.) following manufacturers recommendations. The new
vector contained the araC gene, the araB promoter, the pelB signal
sequence, and essentially the entire C.sub.H1 region of the heavy
chain (FIG. 5B).
[0224] The vector was tested for expression by re-introducing the
region of the Fab that was removed by EcoRI and NcoI digestion. The
region was amplified by PCR, (Example 3) from a plasmid (20 ng)
expressing 14F8 with primers H and I (Table 3). The primers, in
addition to having sequence specific to 14F8, contain 20 base-pairs
of vector sequence at their 5'-end corresponding to the 3'-end of
the pelB signal sequence and the 5'-end of the C.sub.H1 region for
cloning purposes. The PCR products were run on agarose gel
electrophoresis and full-length products excised from the gel and
purified as described previously.
[0225] The vector was linearized with NcoI and together with the
insert, prepared for cloning through the 3'.fwdarw.5' exonuclease
activity of T4 DNA polymerase. The insert and NcoI digested vector
were prepared for T4 exonuclease digestion by aliquoting 1.0 .mu.g
of each in separate tubes, adding 1.0 .mu.l of 10.times.
restriction endonuclease Buffer A (Boehringer Mannheim,
Indianapolis, Ind.) and bringing the volume to 9.0 .mu.l with
water. The samples were digested for 5 min at 30.degree. C. with 1
.mu.l (1U/.mu.l) of T4 DNA polymerase. The T4 DNA polymerase was
heat inactivated by incubation at 70.degree. C. for 15 min. The
samples were cooled, briefly spun, and the digested insert (35 ng)
and vector (100 ng) mixed together and the volume brought to 10
.mu.l with 1 mM MgCl.sub.2. The sample was heated to 70.degree. C.
for 2 min and cooled over 20 min to room temperature to allow the
complementary 5' single-stranded overhangs of the insert and vector
resulting from the exonuclease digestion to anneal together (FIG.
6). The annealed DNA (1.5 .mu.l) was electroporated (Example 8)
into 30 .mu.l of electrocompetent E. coli strain DH10B. The
transformed cells were diluted to 1.0 ml with 2.times. YT broth and
1 .mu.l, 10 .mu.l, and 100 .mu.l plated on LB agar plates
supplemented with tetracycline (10 .mu.g/ml) and grown overnight at
37.degree. C. The following day, two clones were picked and grown
overnight in 2.times. YT (10 .mu.g/ml tetracycline) at 37.degree.
C. To test protein expression driven from the ara promoter, these
cultures were diluted 1/50 in 2.times. YT(tet) and grown to
OD.sub.600=1.0 at which point they were each split into two
cultures, one of which was induced by the addition of arabinose to
a final concentration of 0.2% (W/V). The cultures were grown
overnight at room temperature, and assayed for Fab production by
ELISA. Both of the induced cultures were producing approximately 20
.mu.g/ml Fab. There was no detectable Fab in the uninduced
cultures.
[0226] Initial efforts to clone polyclonal populations of Fab were
hindered by backgrounds of undigested vector ranging from 3-13%.
This undigested vector resulted in loss of Fab expressing clones
due to the selective advantage non-expressing clones have over Fab
expressing clones. A variety of means were tried to eliminate
undigested vector from the vector preparations with only partial
success; examples including: digesting the vector overnight
37.degree. C. with NcoI, extracting, and redigesting the
preparation a second time; including spermidine in the NcoI digest;
including single-stranded binding protein (United States
Biochemical, Cleveland, Ohio) in the NcoI digest; preparative gel
electrophoresis. It was then noted that there is a HindIII
restriction site in pBR, 19 base-pairs from the 5'-end of the
tetracycline promoter. A vector missing these 19 base-pairs is
incapable of supporting growth in the presence of tetracycline,
eliminating background due to undigested vector.
[0227] The ara-based expression vector was modified to make it
tetracycline sensitive in the absence of insert. This was done by
digesting the pBRnco vector with NcoI and HindIII (Boehringer
Mannheim, Indianapolis, Ind.), which removed the entire antibody
gene cassette and a portion of the tet promoter (FIG. 5B). The
region excised by NcoI/HindIII digestion was replaced with a
stuffer fragment of unrelated DNA by ligation as described above.
The ligation reaction was diluted to 20 .mu.l, and 1 .mu.l
electroporated (Example 8) into electrocompetent E. coli strain
DH10B, plated on LB ampicillin (100 .mu.g/ml) and incubated at
37.degree. C.
[0228] After overnight incubation, transformants were picked and
grown overnight in LB broth supplemented with ampicillin (100
.mu.g/ml). The vector (plasmid) was purified from each culture by
Wizard (Promega, Madison, Wis.) miniprep columns following
manufacturers recommendations. This modified vector, pBRncoH3, is
tet sensitive, but still retains ampicillin resistance for growing
preparations of the vector.
[0229] The antibody gene inserts were amplified by PCR with primers
I and J (Table 3) as described in Example 3; primer J containing
the 19 base-pairs of the tet promoter removed by HindIII digestion,
in addition to 20 base-pairs of vector sequence 3' to the HindIII
site for annealing. This modified vector was digested with
NcoI/HindIII and, together with the insert, exonuclease digested
and annealed as described previously. The tet resistance is
restored only in clones that contain an insert capable of
completing the tet promoter. The annealed Fab/vector (1 .mu.l) was
transformed (Example 8) into 30 .mu.l of electrocompetent E. coli
strain, DH10B.
[0230] The transformed cells were diluted to 1.0 ml with 2.times.
YT broth and 10 .mu.l of 10.sup.-2 and 10.sup.-3 dilutions plated
on LB agar plates supplemented with tetracycline at 10 .mu.g/ml to
determine the size of the subcloned polyclonal population. This
plating also provides and opportunity to pick individual clones
from the polyclonal if necessary. The remaining cells were
incubated at 37.degree. C. for 1 hr and then diluted 1/100 into 30
ml 2.times. YT supplemented with 1% glycerol and 20 .mu.g/ml
tetracycline and grown overnight at 37.degree. C. The overnight
culture was diluted 1/100 into the same media and grown 8 hr at
which time glycerol freezer stocks were made for long term storage
at -80.degree. C.
[0231] The new vector eliminates growth bias of clones containing
vector only, as compared to clones with insert. This, together with
the arabinose promoter which is completely repressed in the absence
of arabinose, allows cultures of transformed organisms to be
expanded without biasing the polyclonal antibody population for
antibodies that are better tolerated by E. coli until
induction.
[0232] A variant of this vector was also constructed to clone any
protein with or without a signal sequence. The modified vector has
the NcoI restriction site and all of the pelB signal-sequence
removed. In its place a NsiI restriction site was incorporated such
that upon NsiI digestion and then T4 digestion, there is single
base added, in frame, to the araBAD promoter that becomes the
adenosine residue (A) of the ATG initiation codon. The HindIII site
and restoration of the tetracycline promoter with primer J (Table
3) remains the same as described for the pBRncoH3 vector.
Additionally, the T4 exonuclease cloning process is identical to
that described above, except that the 5' PCR primer used to amplify
the insert contains 20 bp of vector sequence at its 5'-end
corresponding to 3'-end of the araBAD promoter rather than the
3'-end of the PelB signal sequence.
[0233] Three PCR primers, K, L, and M (Table 3) were used for
amplifying the araC regulatory gene (including the araBAD
promoter). The 5'-primer, primer K, includes an EcoRI restriction
site at its 5'-end for ligating the ara insert into the pBR vector.
The 3'-end of the insert was amplified using two primers because a
single primer would have been too large to synthesize. The inner
3'-primer (L) introduces the NsiI restriction site, in frame, with
the araBAD promoter, with the outer 3' primer (M) introducing the
HindIII restriction site that will be used for ligating the insert
into the vector.
[0234] The PCR reaction was performed as in Example 3 on a
4.times.100 .mu.l scale; the reactions containing 100 pmol of 5'
primer (K), 1 pmol of the inner 3' primer (L), and 100 pmol of
outer 3' primer (M), 10 .mu.l 2 mM dNTPs, 0.5 .mu.L Taq DNA
Polymerase, 10 .mu.l 10.times. Taq DNA polymerase buffer with
MgCl.sub.2, and H.sub.2O to 100 .mu.L. The araCparaBAD PCR product
was precipitated and fractionated by agarose gel electrophoresis
and full-length products excised from the gel, purified,
resuspended in water, and prepared for cloning by digestion with
EcoRI and HindIII as described earlier. The pBR vector (Life
Technologies, Gaithersburg, Md.) was prepared to receive this
insert by digestion with EcoRI and HindIII and purification by
agarose gel electrophoresis as described above.
[0235] The insert and vector were mixed (2:1 molar ratio) together
with 1 .mu.l 10 mM ATP, 1 .mu.l (1 U/.mu.l) T4 DNA ligase, 1 .mu.l
10.times. ligase buffer in a final volume of 10 .mu.l and ligated
overnight at 15.degree. C. The ligation reaction was diluted to 20
.mu.l, and 1 .mu.l electroporated into electrocompetent E. coli
strain, DH10B (Example 8), plated on LB tetracycline (10 .mu.g/ml)
plates and grown overnight at 37.degree. C. Clones were picked and
grown overnight in 3 ml LB broth supplemented with
tetracycline.
[0236] These clones were tested for the correct insert by PCR
amplification (Example 3) with primers K and M, using 1 .mu.l of
overnight culture as template. Agarose gel electrophoresis of the
PCR reactions demonstrated that all clones had the araCparaB
insert. The vector (plasmid) was purified from each culture by
Wizard miniprep columns following manufacturers recommendations.
The new vector, pBRnsi contained the araC gene, the araBAD
promoter, and a NsiI restriction site.
[0237] The vector was tested for expression by introducing a murine
Fab. The region was amplified by PCR (Example 3) from a plasmid (20
ng) containing a murine Fab with primers O and N (Table 3). The
primers, in addition to having sequence specific to the Fab,
contain 20 bp of vector sequence at their 5'-end corresponding to
the 3'-end araBAD promoter and the 5'-end of the C.sub.H1 region
for cloning purposes. The pBRnsi vector was linearized with NsiI
and HindIII. The vector and the PCR product were run on an agarose
gel, and full-length products were excised from the gel and
purified as described previously. The vector and insert were
digested with T4 DNA polymerase and annealed as described earlier.
The annealed DNA (1 .mu.l) was electroporated (Example 8) into 30
.mu.l of electrocompetent E. coli strain DH10B. The transformed
cells were diluted to 1.0 ml with 2.times. YT broth and 1 .mu.l, 10
.mu.l, and 100 .mu.l plated on LB agar plates supplemented with
tetracycline (10 .mu.g/ml) and grown overnight at 37.degree. C.
[0238] Nitrocellulose lifts were placed on the placed on the
surface of the agar plates for 1 min and processed as described
(Section 12.24, Molecular Cloning, A laboratory Manual, (1989)
Sambrook. J.). The filters were developed with goat anti-kappa-AP,
and a positive (kappa expressing) clone was picked and grown
overnight in 2.times. YT (10 .mu.g/ml tetracycline) at 37.degree.
C. The vector (plasmid) was purified from the culture by Wizard
miniprep columns (Promega, Madison, Wis.) following manufacturers
recommendations. The Fab region was excised by NcoI/HindIII
digestion and replaced with a stuffer fragment of unrelated DNA by
ligation as described above. The ligation reaction was diluted to
20 .mu.l, and 1 .mu.l electroporated (Example 8) into
electrocompetent E. coli strain DH10B, plated on LB ampicillin (100
.mu.g/ml) and incubated at 37.degree. C. After overnight
incubation, transformants were picked and grown overnight in LB
broth supplemented with ampicillin (100 .mu.g/ml). The vector
(plasmid) was purified from each culture by Wizard miniprep columns
following manufacturers recommendations. This modified vector,
pBRnsiH3, is tet sensitive, but still retains ampicillin resistance
for growing preparations of the vector.
Example 22
Subcloning Monoclonal and Polyclonal Fab Populations into
Expression Vectors and Electroporation into Escherichia coli
[0239] The final round of the polyclonal glutamate dehydrogenase
antibody phage (see Example 17) was diluted 1/30 in 2.times. YT
(approximately 2.times.10.sup.9/ml) and 1 .mu.l used as template
for PCR amplification of the antibody gene inserts with primers I
and P (Table 3). PCR (3-100 .mu.L reactions) was performed using a
high-fidelity PCR system, Expand (Boehringer Mannheim,
Indianapolis, Ind.) to minimize errors incorporated into the DNA
product. Each 100 .mu.l reaction contained 100 pmol of 5' primer
1,100 pmol of 3' primer J, 0.7 units of Expand DNA polymerase, 10
.mu.l 2 mM dNTPs, 10 .mu.l 10.times.Expand reaction buffer, 1 .mu.l
diluted phage stock as template, and water to 100 .mu.l. The
reaction was carried out in a Perkin-Elmer thermal cycler (Model
9600) using the following thermal profile: one cycle of
denaturation at 94.degree. C. (1 min); ten cycles of denaturation
(15 sec, 94.degree. C.), annealing (30 sec, 55.degree. C.),
elongation (60 sec, 72.degree. C.); fifteen cycles of denaturation
(15 sec, 94.degree. C.), annealing (30 sec, 55.degree. C.),
elongation (80 sec plus 20 sec for each additional cycle,
72.degree. C.); elongation (6 min, 72.degree. C.); soak (4.degree.
C., indefinitely). The PCR products were ethanol precipitated,
pelleted and dried as described above. The DNA was dissolved in
water and fractionated by agarose gel electrophoresis. Only
full-length products were excised from the gel, purified, and
resuspended in water as described earlier.
[0240] The insert and NcoI/HindIII digested pBRncoH3 vector were
prepared for T4 exonuclease digestion by adding 1.0 .mu.l of
10.times. Buffer A to 1.0 .mu.g of DNA and bringing the final
volume to 9 .mu.l with water. The samples were digested for 4 min
at 30 C with 1 .mu.l (1U/.mu.l) of T4 DNA polymerase. The T4 DNA
polymerase was heat inactivated by incubation at 70.degree. C. for
10 min. The samples were cooled, briefly spun, and 5 .mu.l of the
digested antibody gene insert and 2.0 .mu.l of 10.times. annealing
buffer were mixed with 5 .mu.L of digested vector in a 1.5 mL tube.
The volume was brought to 20 .mu.l with water, heated to 70.degree.
C. for 2 min and cooled over 20 min to room temperature to allow
the insert and vector to anneal.
[0241] The insert and vector were ligated together by adding 2
.mu.l of 10.times. synthesis buffer, 2 .mu.l T4 DNA ligase
(1U/.mu.l), 2 .mu.l diluted T7 DNA polymerase (1U/.mu.l) and
incubating at 37.degree. C. for 30 min. The reaction was stopped
with 370 .mu.l of stop buffer (10 mM Tris pH 8.0, 10 mM EDTA),
extracted with phenol/chloroform, chloroform, and precipitated from
ethanol at -20.degree. C. The reaction was centrifuged and the
supernatant aspirated. The sample was briefly spun an additional
time and all traces of ethanol removed with a pipetman. The pellet
was dried in vacuo.
[0242] The DNA was resuspended in 2 .mu.l of water and 1 .mu.l
electroporated (Example 8) into 40 .mu.l of electrocompetent E.
coli strain, DH10B. The transformed cells were diluted to 1.0 ml
with 2.times. YT broth and 10 .mu.l of 10.sup.-1, 10.sup.-2 and
10.sup.-3 dilutions plated on LB agar plates supplemented with
tetracycline at 10 .mu.g/ml to determine the size of the subcloned
polyclonal population. The remaining cells were incubated at
37.degree. C. for 1 hr and then diluted 1/100 into 30 ml 2.times.
YT supplemented with 1% glycerol and 20 .mu.g/ml tetracycline and
grown overnight at 37.degree. C. The overnight culture was diluted
1/100 into the same media, grown 8 hr, and glycerol freezer stocks
made for long term storage at -80.degree. C. The polyclonal
antibody was designated CD.43.5.PC.
[0243] The monoclonal antibody to glutamate dehydrogenase (Example
17) was also subcloned following the same general procedure
described above. The subcloned monoclonal antibody was designated
CD.43.9. The polyclonal antibody phage stock for Clostridium
difficile toxin A (Example 15) was subcloned in a similar way. The
subcloned polyclonal antibody was designated CD.TXA. 1.PC.
Example 23
Growth of E. coli Cultures and Purification of Recombinant
Antibodies and Antigens
[0244] A shake flask inoculum is generated overnight from a
-70.degree. C. cell bank in an Innova 4330 incubator shaker (New
Brunswick Scientific, Edison, NJ) set at 37.degree. C., 300 rpm.
The inoculum is used to seed a 20 L fermenter (Applikon, Foster
City, Calif.) containing defined culture medium (Pack, et al.,
Bio/Technology 11:1271-1277 (1993)) supplemented with 3 g/L
L-leucine, 3 g/L L-isoleucine, 12 g/L casein digest (Difco,
Detroit, Mich.), 12.5 g/L glycerol and 10 mg/ml tetracycline. The
temperature, pH and dissolved oxygen in the fermenter are
controlled at 26.degree. C., 6.0-6.8 and 25% saturation,
respectively. Foam is controlled by addition of polypropylene
glycol (Dow, Midland, Mich.). Glycerol is added to the fermenter in
a fed-batch mode. Fab expression is induced by addition of
L(+)-arabinose (Sigma, St. Louis, Mo.) to 2 g/L during the late
logarithmic growth phase. Cell density is measured by optical
density at 600 nm in an UV-1201 spectrophotometer (Shimadzu,
Columbia, Md.). Final Fab concentrations are typically 100-500
mg/L. Following run termination and adjustment of pH to 6.0, the
culture is passed twice through an M-210B-EH Microfluidizer
(Microfluidics, Newton, Mass.) at 17000 psi. The high pressure
homogenization of the cells releases the Fab into the culture
supernatant.
[0245] The first step in purification is expanded bed immobilized
metal affinity chromatography (EB-IMAC). Streamline Chelating resin
(Pharmacia, Piscataway, N.J.) is charged with 0.1 M NiCl.sub.2. It
is then expanded and equilibrated in 50 mM acetate, 200 mM NaCl, 10
mM imidazole, 0.01% NaN.sub.3, pH 6.0 buffer flowing in the upward
direction. A stock solution is used to bring the culture homogenate
to 10 mM imidazole, following which, it is diluted two-fold or
higher in equilibration buffer to reduce the wet solids content to
less than 5% by weight. It is then loaded onto the Streamline
column flowing in the upward direction at a superficial velocity of
300 cm/hr. The cell debris passes through unhindered, but the Fab
is captured by means of the high affinity interaction between
nickel and the hexahistidine tag on the Fab heavy chain. After
washing, the expanded bed is converted to a packed bed and the Fab
is eluted with 20 mM borate, 150 mM NaCl, 200 mM imidazole, 0.01%
NaN.sub.3, pH 8.0 buffer flowing in the downward direction. The
second step in purification uses ion-exchange chromatography (IEC).
Q Sepharose FastFlow resin (Pharmacia, Piscataway, N.J.) is
equilibrated in 20 mM borate, 37.5 mM NaCl, 0.01% NaN.sub.3, pH
8.0. The Fab elution pool from the EB-IMAC step is diluted
four-fold in 20 mM borate, 0.01% NaN.sub.3, pH 8.0 and loaded onto
the IEC column. After washing, the Fab is eluted with a 37.5-200 mM
NaCl salt gradient. The elution fractions are evaluated for purity
using an Xcell II SDS-PAGE system (Novex, San Diego, Calif.) prior
to pooling. Finally, the Fab pool is concentrated and diafiltered
into 20 mM borate, 150 mM NaCl, 0.01% NaN.sub.3, pH 8.0 buffer for
storage. This is achieved in a Sartocon Slice system fitted with a
10,000 MWCO cassette (Sartorius, Bohemia, N.Y.). The final
purification yields are typically 50%. The concentration of the
purified Fab is measured by UV absorbance at 280 nm, assuming an
absorbance of 1.6 for a 1 mg/mL solution.
Example 24
Expression of Antigen or Antibodies in Shake Flasks and
Purification
[0246] A shake flask inoculum is generated overnight from a
-70.degree. C. cell bank in an incubator shaker set at 37.degree.
C., 300 rpm. The cells are cultured in a defined medium described
above. The inoculum is used to seed a 2 L Tunair shake flask
(Shelton Scientific, Shelton, Conn.) which is grown at 37.degree.
C., 300 rpm. Expression is induced by addition of L(+)-arabinose to
2 g/L during the logarithmic growth phase, following which, the
flask is maintained at 23.degree. C., 300 rpm. Following batch
termination, the culture is passed through an M-110Y Microfluidizer
(Microfluidics, Newton, Mass.) at 17000 psi. The homogenate is
clarified in a J2-21 centrifuge (Beckman, Fullerton, Calif.).
[0247] Purification employs immobilized metal affinity
chromatography. Chelating Sepharose FastFlow resin (Pharmacia,
Piscataway, N.J.) is charged with 0.1 M NiCl.sub.2 and equilibrated
in 20 mM borate, 150 mM NaCl, 10 mM imidazole, 0.01% NaN.sub.3, pH
8.0 buffer. A stock solution is used to bring the culture
supernatant to 10 mM imidazole. The culture supernatant is then
mixed with the resin and incubated in the incubator shaker set at
room temperature, 150-200 rpm. The antigen is captured by means of
the high affinity interaction between nickel and the hexahistidine
tag on the antigen. The culture supernatant and resin mixture is
poured into a chromatography column. After washing, the antigen is
eluted with 20 mM borate, 150 mM NaCl, 200 mM imidazole, 0.01%
NaN.sub.3, pH 8.0 buffer. The antigen pool is concentrated in a
stirred cell fitted with a 10,000 MWCO membrane (Amicon, Beverly,
Mass.). It is then dialysed overnight into 20 mM borate, 150 mM
NaCl, 0.01% NaN.sub.3, pH 8.0 for storage, using 12-14,000 MWCO
dialysis tubing. The purified antigen is evaluated for purity by
SDS-PAGE analysis. A yield of 150 mg of purified antigen per liter
of shake flask culture is expected. The concentration of the C.
difficile glutamate dehydrogenase antigen is based on UV absorbance
at 280 nm, assuming an absorbance of 1.48 for a 1 mg/mL solution.
Antibody shake flask expression and purification is done as
described for antigen.
Example 25
Preparation of 7F11 Monoclonal Antibody
[0248] Synthesis of Acetylthiopropionic Acid
[0249] To a stirred solution of 3-mercaptopropionic acid (7 ml,
0.08 moles) and imidazole (5.4 g, 0.08 moles) in tetrahydrofuran
(THF, 700 ml) was added dropwise over 15 min, under argon, a
solution of 1-acetylimidazole (9.6 g, 0.087 moles) in THF (100 ml).
The solution was allowed to stir a further 3 hr at room temperature
after which time the THF was removed in vacuo. The residue was
treated with ice-cold water (18 ml) and the resulting solution
acidified with ice-cold concentrated HCl (14.5 ml) to pH 1.5-2. The
mixture was extracted with water (2.times.50 ml), dried over
magnesium sulfate and evaporated. The residual crude yellow oily
solid product (10.5 g) was recrystallized from chloroform-hexane to
afford 4.8 g (41% yield) acetylthiopropionic acid as a white solid
with a melting point of 44-45.degree. C.
[0250] Decapeptide Derivatives
[0251] The decapeptide, YPYDVPDYAS, (Chiron Mimotopes Peptide
Systems, San Diego, Calif.) was dissolved (0.3 g) in dry DMF (5.4
mL) in a round bottom flask under argon with moderate stirring.
Imidazole (0.02 g) was added to the stirring solution. Separately,
acetylthiopropionic acid (0.041 g) was dissolved in 0.55 mL of dry
DMF in a round bottom flask with stirring and 0.056 g of
1,1'-carbonyldiimidazole (Aldrich Chemical Co., Milwaukee, Wis.)
was added to the stirring solution. The flask was sealed under
argon and stirred for at least 30 min at room temperature. This
solution was added to the decapeptide solution and the reaction
mixture was stirred for at least six hr at room temperature before
the solvent was removed in vacuo. The residue in the flask was
triturated twice using 10 mL of diethyl ether each time and the
ether was decanted. Methylene chloride (20 mL) was added to the
residue in the flask and the solid was scraped from the flask and
filtered using a fine fritted Buchner funnel. The solid was washed
with an additional 20 mL of methylene chloride and the Buchner
funnel was dried under vacuum. In order to hydrolyze the derivative
to generate a free thiol, it was dissolved in 70% DMF and 1 M
potassium hydroxide was added to a final concentration of 0.2 M
while mixing vigorously. The derivative solution was allowed to
stand for 5 min at room temperature prior to neutralization of the
solution by the addition of a solution containing 0.5 M potassium
phosphate, 0.1 M borate, pH 7.0, to which concentrated hydrochloric
acid has been added to a final concentration of 1 M. The thiol
concentration of the hydrolyzed decapeptide derivative was
determined by diluting 10 .mu.L of the solution into 990 .mu.L of a
solution containing 0.25 mM 5,5'-dithiobis(2-nitrobenzoic acid)
(DTNB, Aldrich Chemical Co., Milwaukee Wis.) and 0.2 M potassium
borate, pH 8.0. The thiol concentration in mM units was equal to
the A412(100/13.76).
[0252] Preparation of Conjugates of Decapeptide Derivative with
Keyhole Limpet Hemocyanin and Bovine Serum Albumin
[0253] Keyhole limpet hemocyanin (KLH, 6 ml of 14 mg/ml,
Calbiochem, San Diego, Calif.) was reacted with sulfosuccinimidyl
4-(N-maleimidomethyl)cy- clohexane-1-carboxylate (SULFO-SMCC) by
adding 15 mg of SULFO-SMCC and maintaining the pH between 7 and 7.5
with 1N potassium hydroxide over a period of one hr at room
temperature while stirring. The protein was separated from the
unreacted SULFO-SMCC by gel filtration chromatography in 0.1 M
potassium phosphate, 0.02 M potassium borate, and 0.15 M sodium
chloride, pH 7.0, and 24 ml of KLH-maleimide was collected at a
concentration of 3.1 mg/ml. The hydrolyzed decapeptide derivative
was separately added to portions of the KLH-maleimide in
substantial molar excess over the estimated maleimide amounts
present and the solution was stirred for 4 hr at 4.degree. C. and
then each was dialyzed against 3 volumes of one liter of
pyrogen-free phosphate-buffered saline, pH 7.4, prior to
immunization.
[0254] Bovine serum albumin (BSA, 3.5 ml of 20 mg/ml) was reacted
with SMCC by adding a solution of 6.7 mg of SMCC in 0.3 ml
acetonitrile and stirring the solution for one hr at room
temperature while maintaining the pH between 7 and 7.5 with 1N
potassium hydroxide. The protein was separated from unreacted
materials by gel filtration chromatography in 0.1 M potassium
phosphate, 0.02 M potassium borate, 0.15 M sodium chloride, pH 7.0.
The hydrolyzed decapeptide derivative was separately added to
portions of the BSA-maleimide in substantial molar excess over the
estimated maleimide amounts present and the solution was stirred
for 4 hr at 4.degree. C. The solutions were used to coat microtiter
plates for the detection of antibodies that bound to the
decapeptide derivative by standard techniques.
[0255] Production and Primary Selection of Monoclonal Antibodies
Immunization of Balb/c mice was performed according to the method
of Liu, et al. Clin Chem 25:527-538 (1987). Fusions of spleen cells
with SP2/0-Ag 14 myeloma cells, propagation of hybridomas, and
cloning were performed by standard techniques. Selection of
hybridomas for further cloning began with culture supernatant at
the 96-well stage. A standard ELISA procedure was performed with a
BSA conjugate of decapeptide derivative adsorbed to the ELISA
plate. Typically, a single fusion was plated out in twenty plates
and approximately 10.sup.-20 wells per plate were positive by the
ELISA assay. At this stage, a secondary selection could be
performed if antibodies to the SMCC part of the linking arm were to
be eliminated from further consideration. An ELISA assay using BSA
derivatized with SMCC but not linked to the decapeptide derivative
identified which of the positive clones that bound the BSA
conjugates were actually binding the SMCC-BSA. The antibodies
specific for SMCC-BSA may be eliminated at this step. Monoclonal
antibody 7F11, specific for the decapeptide derivative, was
produced and selected by this process.
Example 26
Preparation of 7F11 Magnetic Latex
[0256] MAG/CM-BSA
[0257] To 6 mL of 5% magnetic latex (MAG/CM, 740 .mu.m 5.0%,
Seradyn, Indianapolis, Ind.) was added 21 mL of water followed by 3
mL of 600 mM 2-(4-morpholino)-ethane sulfonic acid, pH 5.9 (MES,
Fisher Scientific, Pittsburgh, Pa.). Homocysteine thiolactone
hydrochloride (HCTL, 480 mg, Aldrich Chemical Co., Milwaukee, Wis.)
and 1-(3-Dimethylaminopropyl)-3-et- hylcarbodiimide (EDAC, 660 mg,
Aldrich Chemical Co., Milwaukee, Wis.) were added in succession,
and the reaction mixture was rocked at room temperature for 2 h.
The derivatized magnetic latex was washed 3 times with 30 mL of
water (with magnet as in Example 14) using probe sonication to
resuspend the particles. The washed particles were resuspended in
30 mL of water. Three mL of a solution containing sodium hydroxide
(2M) and EDTA (1 mM) was added to the magnetic latex-HCTL
suspension, and the reaction proceeded at room temperature for 5
min. The pH was adjusted to 6.9 with 6.45 mL of 1 M hydrochloric
acid in 500 mM sodium phosphate, 100 mM sodium borate. The
hydrolyzed magnetic latex-HCTL was separated from the supernate
with the aid of a magnet, and then resuspended in 33 mL of 50 mM
sodium phosphate, 10 mM sodium borate, 0.1 mM EDTA, pH 7.0. The
magnetic latex suspension was then added to 2 mL of 36 mg mL-1
BSA-SMCC (made as described in Example 21 with a 5-fold molar
excess of SMCC over BSA), and the reaction mixture was rocked
overnight at room temperature. N-Hydroxyethylmaleimide (NHEM, 0.42
mL of 500 mM, Organix Inc., Woburn, Mass.) was added to cap any
remaining thiols for 30 min. After 30 min, the magnetic latex-BSA
was washed twice with 30 mL of 50 mM potassium phosphate, 10 mM
potassium borate, 150 mM sodium chloride, pH 7.0 (50/10/150) and
twice with 30 mL of 10 mM potassium phosphate, 2 mM potassium
borate, 200 mM sodium thiocyanate, pH 7.0 (10/2/200). The magnetic
latex-BSA was resuspended in 30 mL of 10/2/200.
[0258] 7F11-SH (1:5)
[0259] To a solution of 7F 1 (3.8 mL of 5.85 mg mL.sup.-1) was
added 18 .mu.L of SPDP (40 mM in acetonitrile). The reaction
proceeded at room temperature for 90 min after which taurine
(Aldrich Chemical Co., Milwaukee, Wis.) was added to a final
concentration of 20 mM. Fifteen min later DTT was added to a final
concentration of 2 mM, and the reduction reaction proceeded at room
temperature for 30 min. The 7F11-SH was purified on G-50 (40 mL)
that was eluted with 50/10/150 plus 0.1 mM EDTA. The pool of
purified 7F11-SH was reserved for coupling to the
MAG/CM-BSA-SMCC.
[0260] MAG/CM-BSA-7F11
[0261] SMCC (10 mg) was dissolved in 0.5 mL of dry
dimethylformamide (Aldrich Chemical Co., Milwaukee, Wis.), and this
solution was added to the magnetic latex-BSA suspension. The
reaction proceeded at room temperature with gentle rocking for 2 h.
Taurine was added to a final concentration of 20 mM. After 20 min
the magnetic latex-BSA-SMCC was separated from the supernate with
the aid of a magnet and then resuspended in 10/2/200 (20 mL) with
probe sonication. The magnetic latex was purified on a column of
Superflow-6 (240 mL, Sterogene Bioseparations Inc., Carlsbad,
Calif.) that was eluted with 10/2/200. The buffer was removed, and
to the magnetic latex cake was added 30 mL of 0.7 mg mL.sup.-1
7F11-SH. The reaction mixture was rocked overnight at room
temperature. After 20 hr the reaction was quenched with
mercaptoethanol (2 mM, Aldrich Chemical Co., Milwaukee, Wis.)
followed by NHEM (6 mM). The MAG/CM-7F11 was washed with 10/2/200
followed by 50/10/150. The magnetic latex was then resuspended in
30 mL of 50/10/150.
11TABLE 3 PCR and Sequencing Primer Sequence
A-5'(CACTCAACCCTATCTATTAATGTGGAATTCAAATGGACGAAGCAG GGATT)
B-5'(GTAGGCAATAGGTATTTCATCGTTTCACTCCATCCAAA)
C-5'(TCCGTGCCGGTTGTGAAG) D-5'(TACGCGAGGCTTGTCAGT)
E-5'(TTCATCACTACGGTCGTC) F-5'(GACGGCAATGTCTGATGC)
G-5'(GATATCAACGTTTATCTAA- TCAGGCCATGGCTGGTTGGGCAG)
H-5'(GGCATCCCAGGGTCACCATG) I-5'(TCGCTGCCCAACCAGCCATG)
J-5'(GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAT
TAAGAATCCCTGGGCACAATTTTC) K-5'(AGAGCTGCAGAATTCAGCTGATCATC-
TCACCAATAAAAAACGCCC GGCGGCAACCGAGCGTTCTGAACAAATGGACGAAGCAGGGAT- TC)
L-5'(TCTCTCCAAGGAAGCTTAAAAAAAAGCCCGCTCATTAGGCGGGCT
AGCTTAATCAATCATGCATCGTTTCACTCCATCCAAAAAAAC)
M-5'(ACAGGTACGAAGCTTATCGATGATAAGCTGTCAAACCAAGGAGCT
TAAAAAAAAGCCCGCTCATTAGGC) N-5'(ACCCGTTTTTTTGGATGGAGTGAAAC-
GATGCATTACCTATTGCCT ACGGCA)
O-5'(GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAT
TAAGAAGCGTAGTAGTCCGGAACGTC) P-5'(GTGATAAACTACCGCATTAAAGCT-
TATCGATGATAAGCTGTCAAT TAGTGATGGTGATGGTGATGACAATCCCTG) Q
5'(ACCCGTTTTTTTGGATGGAGTGAAACGATGTCAGGAAAAGATGTA AATGTC)
R-5'(GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAT
TAGTGATGGTGATGGTGATGGTACCATCCTCTTAATTTCATAGC) Note: restriction
enzyme sites are in bold type. GAATTC = EcoRI CCATGG = NcoI AAGCTT
= HindIII
* * * * *