U.S. patent application number 10/252384 was filed with the patent office on 2003-06-05 for circular dna expression cassettes for gene transfer.
This patent application is currently assigned to Aventis Pharma S.A.. Invention is credited to Cameron, Beatrice, Crouzet, Joel, Darquet, Anne-Marie, Scherman, Daniel, Wils, Pierre.
Application Number | 20030104444 10/252384 |
Document ID | / |
Family ID | 9476445 |
Filed Date | 2003-06-05 |
United States Patent
Application |
20030104444 |
Kind Code |
A1 |
Crouzet, Joel ; et
al. |
June 5, 2003 |
Circular DNA expression cassettes for gene transfer
Abstract
Double-stranded DNA molecules characterised in that they are
circular and in that they essentially include one or more genes of
interest.
Inventors: |
Crouzet, Joel; (Sceaux,
FR) ; Scherman, Daniel; (Paris, FR) ; Cameron,
Beatrice; (Paris, FR) ; Wils, Pierre; (Paris,
FR) ; Darquet, Anne-Marie; (Vitry sur Seine,
FR) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT &
DUNNER LLP
1300 I STREET, NW
WASHINGTON
DC
20006
US
|
Assignee: |
Aventis Pharma S.A.
|
Family ID: |
9476445 |
Appl. No.: |
10/252384 |
Filed: |
September 24, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10252384 |
Sep 24, 2002 |
|
|
|
09655728 |
Sep 5, 2000 |
|
|
|
6492164 |
|
|
|
|
09655728 |
Sep 5, 2000 |
|
|
|
08894511 |
Aug 19, 1997 |
|
|
|
6143530 |
|
|
|
|
08894511 |
Aug 19, 1997 |
|
|
|
PCT/FR96/00274 |
Feb 21, 1996 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
536/23.1 |
Current CPC
Class: |
C12N 2830/55 20130101;
C12N 2800/30 20130101; C12Q 1/6813 20130101; C12Q 1/6839 20130101;
C12N 15/10 20130101; C12N 2830/002 20130101; C12N 15/85
20130101 |
Class at
Publication: |
435/6 ;
536/23.1 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 23, 1995 |
FR |
FR95/02117 |
Claims
1. Double-stranded DNA molecule, characterized in that: it is in
circular and supercoiled form, it comprises an expression cassette
consisting of a gene of interest under the control of a
transcription promoter and a transcription terminator which are
active in mammalian cells, it lacks an origin of replication, it
lacks a marker gene, and it comprises a region resulting from the
site-specific recombination between two sequences, said region
being located outside the expression cassette.
2. Molecule according to claim 1, characterized in that it
contains, in addition, a sequence capable of interacting
specifically with a ligand.
3. Molecule according to claim 2, characterized in that the
sequence capable of interacting specifically with a ligand is a
sequence capable of forming a triple helix by hybridization with a
specific oligonucleotide.
4. Molecule according to claim 3, characterized in that the
sequence capable of forming a triple helix comprises from 5 to 30
base pairs.
5. Molecule according to claim 3 or 4, characterized in that the
sequence capable of forming a triple helix is a
homopurine-homopyrimidine sequence.
6. Molecule according to claim 1, characterized in that it
comprises a sequence resulting from the site-specific recombination
between two att attachment sequences or between two recognition
sequences of the resolvase of a transposon or parA of RK2.
7. Molecule according to one of the preceding claims, characterized
in that it comprises, in addition, an mrs sequence originating from
the par locus of RK2, permitting the resolution of multimers.
8. Molecule according to one of the preceding claims, characterized
in that the gene of interest is a nucleic acid coding for a
therapeutic, vaccinal, agricultural or veterinary product.
9. Molecule according to one of the preceding claims, characterized
in that it is obtained by excision from a plasmid or chromosome, by
site-specific recombination.
10. Recombinant DNA, comprising an expression cassette consisting
of a gene of interest under the control of a transcription promoter
and a transcription terminator which are active in mammalian cells,
flanked by two sequences permitting a site-specific recombination,
positioned in the direct orientation.
11. Recombinant DNA according to claim 13, characterized in that it
is a replicative plasmid comprising: a) an origin of replication
and optionally a marker gene, b) two sequences permitting a
site-specific recombination, positioned in the direct orientation,
and, c) placed between said sequences b), an expression cassette
consisting of a gene of interest under the control of a
transcription promoter and a transcription terminator which are
active in mammalian cells.
12. Recombinant DNA according to claims 10 and 11, characterized in
that the sequences permitting site-specific recombination are
sequences capable of recombining specifically in the presence of a
recombinase.
13. Recombinant DNA according to claim 12, characterized in that
the recombinase is chosen from the recombinases of the integrase
family of phage lambda and of the resolvase family of the
transposon Tn3.
14. Recombinant DNA according to one of claims 10 to 13,
characterized in that the sequences permitting site-specific
recombination are derived from a bacteriophage.
15. Recombinant DNA according to claim 14, characterized in that
the sequences permitting site-specific recombination consist of the
att attachment sequences of a bacteriophage, or derived
sequences.
16. Recombinant DNA according to claim 15, characterized in that
the sequences permitting site-specific recombination consist of the
attachment sequences of bacteriophage lambda, P22, .PHI.80, P1 or
HP1 or alternatively of plasmid pSAM2 or the 2 plasmid, or derived
sequences.
17. Recombinant DNA according to claim 16, characterized in that
the sequences permitting site-specific recombination comprise all
or part of the sequences SEQ ID No.1, 2, 6, 7, 8, 9, 10, 11, 12, 13
or 14.
18. Plasmid, characterized in that it comprises: (a) a bacterial
origin of replication and optionally a marker gene; (b) the attP
and attB sequences of a bacteriophage selected from the phages
lambda, P22, .PHI.80, P1 and HP1 or of plasmid pSAM2 or the 2
plasmid, positioned in the direct orientation; and, (c) placed
between said sequences, an expression cassette consisting of a gene
of interest under the control of a transcription promoter and a
transcription terminator which are active in mammalian cells.
19. Plasmid according to claim 18, characterized in that the
sequences permitting site-specific recombination consist of the
attachment sequences of bacteriophage lambda.
20. Recombinant DNA according to claim 14, characterized in that
the sequences permitting site-specific recombination are derived
from bacteriophage P1.
21. Plasmid, characterized in that it comprises: (a) a bacterial
origin of replication and optionally a marker gene; (b) the
inverted repeat sequences of bacteriophage P1 (loxP region),
positioned in the direct orientation; and, (c) placed between said
sequences (b), an expression cassette consisting of a gene of
interest under the control of a transcription promoter and a
transcription terminator which are active in mammalian cells.
22. Recombinant DNA according to one of claims 10 to 13,
characterized in that the sequences permitting site-specific
recombination are derived from a transposon.
23. Recombinant DNA according to claim 22, characterized in that
the sequences permitting site-specific recombination consist of the
recognition sequences of the resolvase of the transposon Tn3, Tn21
or Tn522, or derived sequences.
24. Recombinant DNA according to claim 23, characterized in that
the sequences permitting site-specific recombination comprise all
or part of the sequence SEQ ID No.15.
25. Recombinant DNA according to one of claims 10 to 13,
characterized in that the sequences permitting site-specific
recombination are derived from the par region of plasmid RP4.
26. Recombinant DNA according to one of claims 10 to 25,
characterized in that it comprises, in addition, a sequence capable
of interacting specifically with a ligand.
27. Plasmid, characterized in that it comprises: a) an origin of
replication and optionally a marker gene, b) two sequences
permitting a site-specific recombination, positioned in the direct
orientation, and, c) placed between said sequences b), one or more
genes of interest and a sequence capable of interacting
specifically with a ligand.
28. Plasmid, characterized in that it comprises: a) an origin of
replication and optionally a marker gene, b) two sequences
permitting a site-specific recombination, positioned in the direct
orientation, and, c) placed between said sequences b), one or more
genes of interest and an mrs sequence originating from the par
locus of RK2, permitting the resolution of multimers.
29. Plasmid, characterized in that it comprises: a) an origin of
replication and optionally a marker gene, b) two sequences
permitting a site-specific recombination, positioned in the direct
orientation, and, c) placed between said sequences b), one or more
genes of interest, an mrs sequence originating from the par locus
of RK2, permitting the resolution of multimers, and a sequence
capable of interacting specifically with a ligand.
30. Plasmid, characterized in that it comprises: a) an origin of
replication and optionally a marker gene, b) two sequences
permitting an integrase-dependent site-specific recombination,
positioned in the direct orientation, and two sequences permitting
a resolvase-dependent site-specific recombination, positioned next
to the first two sequences and also in the direct orientation, and,
c) placed between said sequences b), one or more genes of interest
and optionally a sequence capable of interacting specifically with
a ligand.
31. Plasmid according to claims 27, 29 and 30, characterized in
that the sequence capable of interacting specifically with a ligand
is defined as in claims 2 to 5.
32. Recombinant cell containing a plasmid according to claim 14,
27, 29 or 30.
33. Recombinant cell comprising, inserted into its genome, one or
more copies of a recombinant DNA according to claim 10.
34. Recombinant cell according to claim 32 or 33, characterized in
that it is a bacterium.
35. Recombinant cell according to claim 32 or 33, characterized in
that it is a eukaryotic cell.
36. Recombinant cell according to claim 34, characterized in that
it is the bacterium E. coli D1210HP.
37. Pharmaceutical composition comprising at least one DNA molecule
according to one of claims 1 to 9.
38. Method for the preparation of a DNA molecule according to one
of claims 1 to 19, characterized in that a culture of host cells
containing a recombinant DNA as defined in claim 10 is brought into
contact with the recombinase enabling site-specific recombination
to be induced in vivo.
39. Method according to claim 38, characterized in that the culture
of host cells is a culture of cells according to claim 32.
40. Method according to claim 38, characterized in that the culture
of host cells is a culture of cells according to claim 33.
41. Method according to one of claims 38 to 40, characterized in
that the culture is brought into contact with the recombinase by
transfection or infection of the cell culture with a plasmid or a
phage containing the gene for said recombinase.
42. Method according to one of claims 38 to 40, characterized in
that the culture is brought into contact with the recombinase by
induction of the expression of a gene coding for said recombinase,
present in the host cell.
43. Method according to claim 42, characterized in that the host
cell contains, integrated in its genome, the recombinase gene
having a temperature-regulated expression, and the culture is
brought into contact with the recombinase by culturing at the
induction temperature.
44. Method according to claim 43, characterized in that the host
cell used contains a lysogenic phage integrated in its genome,
containing the gene for said recombinase.
45. Method for the preparation of a DNA molecule according to one
of claims 1 to 9, characterized in that a plasmid preparation
according to claim 11 is brought into contact with the recombinase
enabling site-specific recombination to be induced in vitro.
46. Method according to claim 37 or 45, characterized in that it
comprises an additional step of purification of the minicircle.
47. Method according to claim 46, characterized in that the
purification comprises a step of bringing a solution containing the
minicircle into contact with a specific ligand, optionally grafted
onto a support.
48. Method according to claim 47, characterized in that the
solution containing the minicircle is brought into contact with an
oligonucleotide, optionally grafted onto a support, capable of
forming, by hybridization, a triple helix with a specific sequence
present in the minicircle.
Description
[0001] Gene therapy consists in correcting a deficiency or an
abnormality by introducing genetic information into the affected
cell or organ. This information may be introduced either in vitro
into a cell extracted from the organ and then reinjected into the
body, or in vivo, directly into the tissue concerned. Being a high
molecular weight, negatively charged molecule, DNA has difficulties
in passing spontaneously through the phospholipid cell membranes.
Different vectors are hence used in order to permit gene transfer:
viral vectors on the one hand, natural or synthetic, chemical
and/or biochemical vectors on the other hand. Viral vectors
(retroviruses, adenoviruses, adeno-associated viruses, etc.) are
very effective, in particular in passing through membranes, but
present a number of risks, such as pathogenicity, recombination,
replication, immunogenicity, etc. Chemical and/or biochemical
vectors enable these risks to be avoided (for reviews, see Behr,
1993, Cotten and Wagner, 1993). These vectors are, for example,
cations (calcium phosphate, DEAE-dextran, etc.) which act by
forming precipitates with DNA, which precipitates can be
"phagocytosed" by the cells. They can also be liposomes in which
DNA is incorporated and which fuse with the plasma membrane.
Synthetic gene transfer vectors are generally lipids or cationic
polymers which complex DNA and form a particle therewith carrying
positive surface charges. These particles are capable of
interacting with the negative charges of the cell membrane and then
of crossing the latter. Dioctadecylamidoglycylspermine (DOGS,
Transfectam.TM.) or
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride
(DOTMA, Lipofectin.TM.) may be mentioned as examples of such
vectors. Chimeric proteins have also been developed: they consist
of a polycationic portion which condenses DNA, linked to a ligand
which binds to a membrane receptor and carries the complex into the
cells by endocytosis. It is thus theoretically possible to "target"
a tissue or certain cell populations so as to improve the in vivo
bioavailability of the transferred gene.
[0002] However, the use of chemical and/or biochemical vectors or
of naked DNA implies the possibility of producing large amounts of
DNA of pharmacological purity. In effect, in these gene therapy
techniques, the medicinal product consists of the DNA itself, and
it is essential to be able to manufacture, in appropriate amounts,
DNAs having suitable properties for therapeutic use in man.
[0003] The plasmids currently used in gene therapy carry (i) an
origin of replication, (ii) a marker gene such as a gene for
resistance to an antibiotic (kanamycin, ampicillin, etc.) and (iii)
one or more transgenes with sequences required for their expression
(enhancer(s), promoter(s), polyadenylation sequences, etc.). These
plasmids currently used in gene therapy (in clinical trials such as
the treatment of melanomas, Nabel et al., 1992, or in experimental
studies) display, however, some drawbacks associated, in
particular, with their dissemination in the body. Thus, as a result
of this dissemination, a competent bacterium present in the body
can, at a low frequency, receive this plasmid. The chance of this
occurring is all the greater for the fact that the treatment in
question entails in vivo gene therapy in which the DNA may be
disseminated in the patient's body and may come into contact with
bacteria which infect this patient or alternatively with bacteria
of the commensal flora. If the bacterium which is a recipient of
the plasmid is an enterobacterium such as E. coli, this plasmid may
replicate. Such an event then leads to the dissemination of the
therapeutic gene. Inasmuch as the therapeutic genes used in gene
therapy treatments can code, for example, for a lymphokine, a
growth factor, an anti-oncogene, or a protein whose function is
lacking in the host and hence enables a genetic defect to be
corrected, the dissemination of some of these genes could have
unforeseeable and worrying effects (for example if a pathogenic
bacterium were to acquire the gene for a human growth factor).
Furthermore, the plasmids used in non-viral gene therapy also
possess a marker for resistance to an antibiotic (ampicillin,
kanamycin, etc.) Hence the bacterium acquiring such a plasmid has
an undeniable selective advantage, since any therapeutic antibiotic
treatment using an antibiotic of the same family as the one
selecting the resistance gene of the plasmid will lead to the
selection of the plasmid in question. In this connection,
ampicillin belongs to the .beta.-lactams, which is the family of
antibiotics most widely used in the world, it is hence necessary to
seek to limit as far as possible the dissemination of the
therapeutic genes and the resistance genes. Moreover, the genes
carried by the plasmid, corresponding to the vector portion of the
plasmid (function(s) required for replication, resistance gene),
also run the risk of being expressed in the transfected cells.
There is, in effect, a transcription background, which cannot be
ruled out, due to the host's expression signals on the plasmid.
This expression of exogenous proteins may be thoroughly detrimental
in a number of gene therapy treatments, as a result of their
potential immunogenicity and hence of the attack of the transfected
cells by the immune system.
[0004] Hence it is especially important to be able to have at one's
disposal medicinal DNA molecules having a genetic purity suitable
for therapeutic use. It is also especially important to have at
one's disposal methods enabling these DNA molecules to be prepared
in amounts appropriate for pharmaceutical use. The present
invention provides a solution to these problems.
[0005] The present invention describes, in effect, DNA molecules
which can be used in gene therapy, having greatly improved genetic
purity and impressive properties of bioavailability. The invention
also describes an especially effective method for the preparation
of these molecules and for their purification.
[0006] The present invention lies, in particular, in the
development of DNA molecules which can be used in gene therapy,
virtually lacking any non-therapeutic region. The DNA molecules
according to the invention, also designated minicircles on account
of their circular structure, their small size and their supercoiled
form, display many advantages.
[0007] They make it possible, in the first place, to eliminate the
risks associated with dissemination of the plasmid, such as (1)
replication and dissemination which may lead to an uncontrolled
overexpression of the therapeutic gene, (2) the dissemination and
expression of resistance genes, and (3) the expression of genes
present in the non-therapeutic portion of the plasmid, which are
potentially immunogenic and/or inflammatory, and the like. The
genetic information contained in the DNA molecules according to the
invention is limited, in effect, essentially to the therapeutic
gene(s) and to the signals for regulation of its/their expression
(neither origin of replication, nor gene for resistance to an
antibiotic, and the like). The probability of these molecules (and
hence of the genetic information they contain) being transferred to
a microorganism and being stably maintained is almost zero.
[0008] Furthermore, due to their small size, DNA molecules
according to the invention potentially have better bioavailability
in vivo. In particular, they display improved capacities for cell
penetration and cellular distribution. Thus, it is recognized that
the coefficient of diffusion in the tissues is inversely
proportional to the molecular weight (Jain, 1987). Similarly, at
cellular level, high molecular weight molecules have inferior
permeability through the plasma membrane. In addition, for the
plasmid to progress to the nucleus, which is essential for its
expression, high molecular weight is also a drawback, the nuclear
pores imposing a size limit for diffusion to the nucleus (Landford
et al., 1986). The elimination of the non-therapeutic portions of
the plasmid (origin or replication and resistance gene in
particular) according to the invention also enables the size of the
DNA molecules to be decreased. This decrease may be estimated at a
factor of 2, reckoning, for example, 3 kb for the origin of
replication and the resistance marker (vector portion) and 3 kb for
the transgene with the sequences required for its expression. This
decrease (i) in molecular weight and (ii) in negative charge endows
the molecules of the invention with improved capacities for tissue,
cellular and nuclear diffusion and bioavailability.
[0009] Hence a first subject of the invention lies in a
double-stranded DNA molecule having the following features: it is
circular in shape and essentially comprises one or more genes of
interest. As stated above, the molecules of the invention
essentially lack non-therapeutic regions, and especially an origin
of replication and/or a marker gene. In addition, they are
advantageously in supercoiled form.
[0010] The present invention is also the outcome for the
development of a method, of constructions and of cell hosts which
are specific and especially effective for the production of these
therapeutic DNA molecules. More especially, the method according to
the invention lies in the production of therapeutic DNA molecules
defined above, by excision from a plasmid or from a chromosome by
site-specific recombination. The method according to the invention
is especially advantageous, since it does not necessitate a prior
step of purification of the plasmid, is very specific, especially
effective, does not decrease the amounts of DNA produced and leads
directly to therapeutic molecules of very great genetic purity and
of great bioavailability. This method leads, in effect, to the
generation of circular DNA molecules (minicircles) essentially
containing the gene of interest and the regulator sequences
permitting its expression in the cells, tissue, organ or apparatus,
or even the whole body, in which the expression is desired. In
addition, these molecules may then be purified by standard
techniques.
[0011] The site-specific recombination may be carried out by means
of various systems which lead to site-specific recombination
between sequences. More preferably, the site-specific recombination
in the method of the invention is obtained by means of two specific
sequences which are capable of recombining with one another in the
presence of a specific protein, generally designated recombinase.
For this reason, the DNA molecules according to the invention
generally comprise, in addition, a sequence resulting from this
site-specific recombination. The sequences permitting the
recombination used in the context of the invention generally
comprise from 5 to 100 base pairs, and more preferably fewer than
50 base pairs.
[0012] The site-specific recombination may be carried out in vivo
(that is to say in the host cell) or in vitro (that is to say on a
plasmid preparation).
[0013] In this connection, the present invention also provides
particular genetic constructions suitable for the production of the
therapeutic DNA molecules defined above. These genetic
constructions, or recombinant DNAs, according to the invention
comprise, in particular, the gene or genes of interest flanked by
the two sequences permitting site-specific recombination,
positioned in the direct orientation. The position in the direct
orientation indicates that the two sequences follow the same 5'-3'
polarity in the recombinant DNA according to the invention. The
genetic constructions of the invention can be double-stranded DNA
fragments (cassettes) essentially composed of the elements
mentioned above. These cassettes can be used for the construction
of cell hosts having these elements integrated in their genome
(FIG. 1). The genetic constructions of the invention can also be
plasmids, that is to say any linear or circular DNA molecule
capable of replicating in a given host cell, containing the gene or
genes of interest flanked by the two sequences permitting
site-specific recombination, positioned in the direct orientation.
The construction can be, more specifically, a vector (such as a
cloning and/or expression vector), a phage, a virus, and the like.
These plasmids of the invention may be used to transform any
competent cell host for the purpose of the production of
minicircles by replication of the plasmid followed by excision of
the minicircle (FIG. 2).
[0014] In this connection, another subject of the invention lies in
a recombinant DNA comprising one or more genes of interest, flanked
by two sequences permitting site-specific recombination, positioned
in the direct orientation.
[0015] The recombinant DNA according to the invention is preferably
a plasmid comprising at least:
[0016] a) an origin of replication and optionally a marker
gene,
[0017] b) two sequences permitting a site-specific recombination,
positioned in the direct orientation, and,
[0018] c) placed between said sequences b), one or more genes of
interest.
[0019] The specific recombination system present in the genetic
constructions according to the invention can be of different
origins. In particular, the specific sequences and the recombinases
used can belong to different structural classes, and in particular
to the integrase family of bacteriophage .lambda. or to the
resolvase family of the transposon Tn3.
[0020] Among recombinases belonging to the integrase family of
bacteriophage .lambda., there may be mentioned, in particular, the
integrase of the phages lambda (Landy et al., Science 197 (1977)
1147), P22 and .PHI.80 (Leong et al., J. Biol. Chem. 260 (1985)
4468), HP1 of Haemophilus influenza (Hauser et al., J. Biol. Chem.
267 (1992) 6859), the Cre integrase of phage P1, the integrase of
the plasmid pSAM2 (EP 350,341) or alternatively the FLP recombinase
of the 2.mu. plasmid. When the DNA molecules according to the
invention are prepared by recombination by means of a site-specific
system of the integrase family of bacteriophage lambda, the DNA
molecules according to the invention generally comprise, in
addition, a sequence resulting from the recombination between two
att attachment sequences of the corresponding bacteriophage or
plasmid.
[0021] Among recombinases belonging to the family of the transposon
Tn3, there may be mentioned, in particular, the resolvase of the
transposon Tn3 or of the transposons Tn21 and Tn522 (Stark et al.,
1992); the Gin invertase of bacteriophage mu or alternatively the
resolvase of plasmids, such as that of the par fragment of RP4
(Albert et al., Mol. Microbiol. 12 (1994) 131). When the DNA
molecules according to the invention are prepared by recombination
by means of a site-specific system of the family of the transposon
Tn3, the DNA molecules according to the invention generally
comprise, in addition, a sequence resulting from the recombination
between two recognition sequences of the resolvase of the
transposon in question.
[0022] According to a particular embodiment, in the genetic
constructions of the present invention, the sequences permitting
site-specific recombination are derived from a bacteriophage. More
preferably, these latter are attachment sequences (attP and attB
sequences) of a bacteriophage, or derived sequences. These
sequences are capable of recombining specifically with one another
in the presence of a recombinase designated integrase. The term
derived sequence includes the sequences obtained by modification(s)
of the attachment sequences of the bacteriophages, which retain the
capacity to recombine specifically in the presence of the
appropriate recombinase. Thus, such sequences can be reduced
fragments of these sequences or, on the contrary, fragments
extended by the addition of other sequences (restriction sites, and
the like). They can also be variants obtained by mutation(s), in
particular by point mutation(s). The terms attP and attB sequences
of a bacteriophage or of a plasmid denote, according to the
invention, the sequences of the recombination system specific to
said bacteriophage or plasmid, that is to say the attP sequence
present in said phage or plasmid and the corresponding chromosomal
attB sequence.
[0023] By way of preferred examples, there may be mentioned, in
particular, the attachment sequences of the phages lambda, P22,
.PHI.80, P1 and HP1 of Haemophilus influenzae or alternatively of
plasmid pSAM2 or the 2.mu. plasmid. These sequences are
advantageously chosen from all or part of the sequences SEQ ID No.
1, SEQ ID No. 2, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID
No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13
and SEQ ID No. 14. These sequences comprise, in particular, the
central region homologous to the attachment sequences of these
phages.
[0024] In this connection, a preferred plasmid according to the
present invention comprises
[0025] (a) a bacterial origin of replication and optionally a
marker gene,
[0026] (b) the attP and attB sequences of a bacteriophage selected
from the phages lambda, P22, .PHI.80, HP1 and P1 or of plasmid
pSAM2 or the 2.mu. plasmid, or derived sequences; and,
[0027] (c) placed between said sequences b), one or more genes of
interest.
[0028] According to an especially preferred embodiment, the
sequences in question are the attachment sequences (attP and attB)
of phage lambda. Plasmids carrying these sequences are, in
particular, the plasmids pXL2648, pXL2649 or pXL2650. When these
plasmids are brought, in vivo or in vitro, into contact with the
integrase of phage lambda, the sequences recombine with one another
to generate in vivo or in vitro, by excision, a minicircle
according to the invention essentially comprising the elements (c),
that is to say the therapeutic portion (FIG. 2).
[0029] Still according to a particular embodiment of the invention,
the sequences permitting site-specific recombination are derived
from the loxP region of phage P1. This region is composed
essentially of two inverted repeat sequences capable of recombining
specifically with one another in the presence of a protein,
designated Cre (Sternberg et al., J. Mol. Biol. 150 (1971) 467). In
a particular variant, the invention hence relates to a plasmid
comprising (a) a bacterial origin of replication and optionally a
marker gene; (b) the inverted repeat sequences of bacteriophage P1
(loxP region) ; and (c) placed between said sequences (b), one or
more genes of interest.
[0030] According to another particular embodiment, in the genetic
constructions of the present invention, the sequences permitting
site-specific recombination are derived from a transposon. More
preferably, the sequences in question are recognition sequences of
the resolvase of a transposon, or derived sequences. By way of
preferred examples, there may be mentioned, in particular, the
recognition sequences of the transposons Tn3, Tn21 and Tn522. By
way of a preferred example, there may be mentioned the sequence SEQ
ID No. 15 or a derivative of the latter (see also Sherrat, P.
163-184, Mobile DNA, Ed. D. Berg and M. Howe, American Society for
Microbiology, Washington D.C. 1989).
[0031] According to another especially advantageous variant, the
plasmids of the invention comprise, in addition, a multimer
resolution sequence. This is preferably the mrs (multimer
resolution system) sequence of the plasmid RK2. More preferably,
the invention relates to a plasmid comprising:
[0032] (a) a bacterial origin of replication and optionally a
marker gene,
[0033] (b) the attP and attB sequences of a bacteriophage, in the
direct orientation, selected from the phages lambda, P22, .PHI.80,
HP1 and P1 or of plasmid pSAM2 or the 2.mu. plasmid, or derived
sequences; and,
[0034] (c) placed between said sequences b), one or more genes of
interest and the mrs sequence of plasmid RK2.
[0035] This embodiment is especially advantageous. Thus, when
plasmids pXL2649 or pXL2650 are brought into contact with the
integrase of the bacteriophage in vivo, the sequences recombine to
generate the minicircle and the miniplasmid, but also multimeric or
topological forms of minicircle or of miniplasmid. It is especially
advantageous to be able to decrease the concentration of these
forms in order to increase the production and facilitate the
purification of minicircle.
[0036] The multimeric forms of plasmids are known to a person
skilled in the art. For example, the cer fragment of ColE1 (Summers
et al., 1984 Cell 36 p. 1097) or the mrs site of the par locus of
RK2 (L. Ebert 1994 Mol. Microbiol. 2 p. 131) permit the resolution
of multimers of plasmids and participate in an enhanced stability
of the plasmid. However, whereas resolution at the cer site
requires four proteins encoded by the E. coli genome (Colloms et
al., 1990 J. Bacteriol. 172 p. 6973), resolution at the mrs site
requires only the parA protein for which the parA gene is mapped on
the par locus of RK2. As a result, it would appear advantageous to
use all or a portion of the par locus containing parA and the mrs
sequence. For example, the mrs sequence may be placed between the
attB and attP sequences of phage lambda, and the parA gene be
expressed in trans or in cis from its own promoter or from an
inducible promoter. In this connection, a particular plasmid of the
invention comprises:
[0037] (a) a bacterial origin of replication and optionally a
marker gene,
[0038] (b) the attP and attB sequences of a bacteriophage, in the
direct orientation, selected from the phages lambda, P22, .PHI.80,
HP1 and P1 or of plasmid pSAM2 or the 2.mu. plasmid, or derived
sequences,
[0039] (c) placed between said sequences b), one or more genes of
interest and the mrs sequence of plasmid RK2, and
[0040] (d) the parA gene of plasmid RK2.
[0041] One such plasmid is, in particular, the plasmid pXL2960
described in the examples. It may be employed, and can enable
minicircle to be produced exclusively in monomeric form.
[0042] According to another advantageous variant, the plasmids of
the invention comprise two sets of site-specific recombination
sequences from a different family. These advantageously comprise a
first set of integrase-dependent sequences and a second set of
parA-dependent sequences. The use of two sets of sequences enables
the production yields of minicircles to be increased when the first
site-specific recombination is incomplete. Thus, when plasmids
pXL2650 or pXL2960 are brought into contact with the integrase of
the bacteriophage in vivo, the sequences recombine to generate the
miniplasmid and the minicircle, but this reaction is not complete
(5 to 10% of initial plasmid may be left). The introduction, in
proximity to each of the att sequences of phage lambda, of an mrs
sequence of RK2 enables the production of minicircles to be
increased. Thus, after induction of the integrase of phage lambda
and Int-dependent recombination, the unrecombined molecules will be
able to come under the control of the ParA protein of RK2 and to
recombine at the mrs sites. Conversely, after induction of the ParA
protein and ParA-dependent recombination, the unrecombined
molecules will be able to come under the control of the integrase
of phage lambda and will be able to recombine at the att sites.
Such constructions thus make it possible to produce minicircle and
negligible amounts of unrecombined molecules. The att sequences,
like the mrs sequences, are in the direct orientation, and the int
and parA genes may be induced simultaneously or successively from
the same inducible promoter or from two inducible promoters.
Preferably, the sequences in question are the attB and attP
attachment sequences of phage lambda in the direct orientation and
two mrs sequences of RK2 in the direct orientation.
[0043] As stated above, another aspect of the present invention
lies in a method for the production of therapeutic DNA molecules
defined above, by excision, from a plasmid or chromosome, by
site-specific recombination.
[0044] Another subject of the present invention hence lies in a
method for the production of a DNA molecule (minicircle) as defined
above, according to which a culture of host cells containing a
recombinant DNA as defined above is brought into contact with the
recombinase enabling site-specific recombination to be induced.
More preferably, the culture and recombinase are brought into
contact either by transfection or infection with a plasmid or a
phage containing the gene for said recombinase; or by induction of
the expression of a gene coding for said recombinase, present in
the host cell. As mentioned below, this gene may be present in the
host cell in integrated form in the genome, on a replicative
plasmid or alternatively on the plasmid of the invention, in the
non-therapeutic portion.
[0045] To permit the production of the minicircles according to the
invention by site-specific recombination in vivo, the recombinase
used must be introduced into, or induced in, cells or the culture
medium at a particular instant. For this purpose, different methods
may be used. According to a first method, a host cell is used
containing the recombinase gene in a form permitting its regulated
expression. It may, in particular, be introduced under the control
of a promoter or of a system of inducible promoters, or
alternatively in a temperature-sensitive system. In particular, the
gene may be present in a temperature-sensitive phage, latent during
the growth phase, and induced at a suitable temperature (for
example lysogenic phase lambda Xis.sup.- cI857). The cassette for
expression of the recombinase gene may be carried by a plasmid, a
phage or even by the plasmid of the invention, in the
non-therapeutic region. It may be integrated in the genome of the
host cell or maintained in replicative form. According to another
method, the cassette for expression of the gene is carried by a
plasmid or a phage used to transfect or infect the cell culture
after the growth phase. In this case, it is not necessary for the
gene to be in a form permitting its regulated expression. In
particular, any constitutive promoter may be used. The cell may
also be brought into contact with the recombinase in vitro, on a
plasmid preparation, by direct incubation with the protein.
[0046] It is preferable, in the context of the present invention,
to use a host cell capable of expressing the recombinase gene in a
regulated manner. This embodiment, in which the recombinase is
supplied directly by the host cell after induction, is especially
advantageous. In effect, it suffices simply to place the cells in
culture at the desired time under the conditions for expression of
the recombinase gene (permissive temperature for a
temperature-sensitive gene, addition of an inducer for a regulable
promoter, and the like) in order to induce the site-specific
recombination in vivo and thus the excision of the minicircle of
the invention. In addition, this excision takes place in especially
high yields, since all the cells in culture express the
recombinase, which is not necessarily the case if a transfection or
an infection has to be carried out in order to transfer the
recombinase gene.
[0047] According to a first embodiment, the method of the invention
comprises the excision of the molecules of therapeutic DNA by
site-specific recombination from a plasmid. This embodiment employs
the plasmids described above permitting, in a first stage,
replication in a chosen host, and then, in a second stage, the
excision of the non-therapeutic portions of said plasmid (in
particular the origin of replication and the resistance gene) by
site-specific recombination, generating the circular DNA molecules
of the invention. To carry out the method, different types of
plasmid may be used, and especially a vector, a phage or a virus. A
replicative vector is preferably used.
[0048] Advantageously, the method of the invention comprises a
prior step of transformation of host cells with a plasmid as
defined above, followed by culturing of the transformed cells,
enabling suitable amounts of plasmid to be obtained. Excision by
site-specific recombinations is then carried out by bringing into
contact with the recombinase under the conditions defined above
(FIG. 2). As stated above, in this embodiment, the site-specific
recombination may be carried out in vivo. (that is to say in the
host cell) or in vitro (that is to say on a plasmid
preparation).
[0049] According to a preferred embodiment, the DNA molecules of
the invention are hence obtained from a replicative vector, by
excision of the non-therapeutic portion carrying, in particular,
the origin of replication and the marker gene, by site-specific
recombination.
[0050] According to another embodiment, the method of the invention
comprises the excision of the DNA molecules from the genome of the
host cell by site-specific recombination. This embodiment is based
more especially on the construction of cell hosts comprising,
inserted into their genome, one or more copies of a cassette
comprising-the gene of interest flanked by the sequences permitting
recombination (FIG. 1). Different techniques may be used for
insertion of the cassette of the invention into the genome of the
host cell. In particular, insertion at several distinct points of
the genome may be obtained by using integrative vectors. In this
connection, different transposition systems such as, in particular,
the miniMu system or defective transposons such as Tn10
derivatives, for example, may be used (Kleckner et al., Methods
Enzymol. 204 (1991) 139; Groisman E., Methods Enzymol. 204 (1991)
180). The insertion may also be carried out by homologous
recombination, enabling a cassette containing two recombination
sequences in the direct orientation flanking one or more genes of
interest to be integrated in the genome of the bacterium. This
process may, in addition, be reproduced as many times as desired so
as to have the largest possible number of copies per cell. Another
technique also consists in using an in vivo amplification system
using recombination, as described in Labarre et al. (Labarre J., O.
Reyes, Guyonvarch, and G. Leblon. 1993. Gene replacement,
integration, and amplification at the gdhA locus of Corynebacterium
glutamicum. J. Bacteriol. 175:1001-107), so as to augment from one
copy of the cassette to a much larger number.
[0051] A preferred technique consists in the use of miniMu. To this
end, miniMu derivatives are constructed comprising a resistance
marker, the functions required in cis for their transposition and a
cassette containing two recombination sequences in the direct
orientation flanking the gene or genes of interest. These miniMus
are advantageously placed at several points of the genome using a
resistance marker (kanamycin, for example) enabling several copies
per genome to be selected (Groisman E. cited above). As described
above, the host cell in question can also express inducibly a
site-specific recombinase leading to the excision of the fragment
flanked by the recombination sequences in the direct orientation.
After excision, the minicircles may be purified by standard
techniques.
[0052] This embodiment of the method of the invention is especially
advantageous, since it leads to the generation of a single type of
plasmid molecule: the minicircle of the invention. The cells do not
contain, in effect, any other episomal plasmid, as is the case
during production from a plasmid (FIGS. 1 and 2).
[0053] Another subject of the invention also lies in a modified
host cell comprising, inserted into its genome, one or more copies
of a recombinant DNA as defined above.
[0054] The invention also relates to any recombinant cell
containing a plasmid as defined above. These cells are obtained by
any technique known to a person skilled in the art enabling a DNA
to be introduced into a given cell. Such a technique can be, in
particular, transformation, electroporation, conjugation,
protoplast fusion or any other technique known to a person skilled
in the art. As regards transformation, different protocols have
been described in the prior art. In particular, cell transformation
may be carried out by treating whole cells in the presence of
lithium acetate and polyethylene glycol according to the technique
described by Ito et al. (J. Bacteriol. 153 (1983) 163-168), or in
the presence of ethylene glycol and dimethyl sulphoxide according
to the technique of Durrens et al. (Curr. Genet. 18 (1990) 7). An
alternative protocol has also been described in Patent Application
EP 361,991. As regards electroporation, this may be carried out
according to Becker and Guarentte (in: Methods in Enzymology Vol194
(1991) 182).
[0055] The method according to the invention may be carried out in
any type of cell host. Such hosts can be, in particular, bacteria
or eukaryotic cells (yeasts, animal cells, plant cells), and the
like. Among bacteria, E. coli, B. subtilis, Streptomyces,
Pseudomonas (P. putida, P. aeruginosa), Rhizobium meliloti,
Agrobacterium tumefaciens, Staphylococcus aureus, Streptomyces
pristinaespiralis, Enterococcus faecium or Clostridium, and the
like, may be mentioned more preferentially. Among bacteria, it is
preferable to use E. coli. Among yeasts, Kluyveromyces,
Saccharomyces, Pichia, Hansenula, and the like, may be mentioned.
Among mammalian animal cells, CHO, COS, NIH3T3, and the like, cells
may be mentioned.
[0056] In accordance with the host used, the plasmid according to
the invention is adapted by a person skilled in the art to permit
its replication. In particular, the origin of replication and the
marker gene are chosen in accordance with the host cell
selected.
[0057] The marker gene may be a resistance gene, in particular for
resistance to an antibiotic (ampicillin, kamamycin, geneticin,
hygromycin, and the like), or any gene endowing the cell with a
function which it no longer possesses (for example a gene which has
been deleted on the chromosome or rendered inactive), the gene on
the plasmid reestablishing this function.
[0058] In a particular embodiment, the method of the invention
comprises an additional step of purification of the minicircle.
[0059] In this connection, the minicircle may be purified by
standard techniques of plasmid DNA purification, since it is
supercoiled like plasmid DNA. These techniques comprise, inter
alia, purification on a caesium chloride density gradient in the
presence of ethidium bromide, or alternatively the use of anion
exchange columns (Maniatis et al., 1989). In addition, if the
plasmid DNA corresponding to the non-therapeutic portions (origin
of replication and selectable marker in particular) is considered
to be present in an excessively large amount, it is also possible,
after or before the purification, to use one or more restriction
enzymes which will digest the plasmid and not the minicircle,
enabling them to be separated by techniques that separate
supercoiled DNA from linear DNA, such as a caesium chloride density
gradient in the presence of ethidium bromide (Maniatis et al.,
1989).
[0060] In addition, the present invention also describes an
improved method for the purification of minicircles. This method
enables minicircles of very great purity to be obtained in large
yields in a single step. This improved method is based on the
interaction between a double-stranded sequence present in the
minicircle and a specific ligand. The ligand can be of various
natures, and in particular protein, chemical or nucleic acid in
nature. It is preferably a ligand of the nucleic acid type, and in
particular an oligonucleotide, optionally chemically modified,
capable of forming by hybridization a triple helix with the
specific sequence present in the DNA molecule of the invention. It
was, in effect, shown that some oligonucleotides were capable of
specifically forming triple helices with double-stranded DNA
sequences (Helene et al., Biochim. Biophys. Acta 1049 (1990) 99;
see also FR 94/15162 incorporated in the present application by
reference).
[0061] In an especially advantageous variant, the DNA molecules of
the invention hence contain, in addition, a sequence capable of
interacting specifically with a ligand (FIG. 3). Preferably, it is
a sequence capable of forming, by hybridization, a triple helix
with a specific oligonucleotide. This sequence may be positioned at
any site of the DNA molecule of the invention, provided it does not
affect the functionality of the gene of interest. This sequence is
also present in the genetic constructions of the invention
(plasmids, cassettes), in the portion containing the gene of
interest (see, in particular, the plasmid pXL2650). Preferably, the
specific sequence present in the DNA molecule of the invention
comprises between 5 and 30 base pairs.
[0062] The oligonucleotides used for carrying out the method
according to the invention can contain the following bases;
[0063] thymidine (T), which is capable of forming triplets with A.T
doublets of double-stranded DNA (Rajagopal et al., Biochem 28
(1989) 7859);
[0064] adenine (A), which is capable of forming triplets with A.T
doublets of double-stranded DNA;
[0065] guanine (G), which is capable of forming triplets with G.C
doublets of doubled-stranded DNA;
[0066] protonated cytosine (C+), which is capable of forming
triplets with G.C doublets of doubled-stranded DNA (Rajagopal et
al., cited above).
[0067] Preferably, the oligonucleotide used comprises a
homopyrimidine sequence containing cytosines, and the specific
sequence present in the DNA molecule is a homopurine-homopyrimidine
sequence. The presence of cytosines makes it possible to have a
triple helix which is stable at acid pH where the cytosines are
protonated, and destabilized at alkaline pH where the cytosines are
neutralized.
[0068] To permit the formation of a triple helix by hybridization,
it is important for the-oligonucleotide and the specific sequence
present in the DNA molecule of the invention to be complementary.
In this connection, to obtain the best yields and best selectivity,
an oligonucleotide and a specific sequence which are fully
complementary are used in the method of the invention. Possible
combinations are, in particular, a poly(CTT) oligonucleotide and a
poly(GAA) specific sequence. By way of example, there may be
mentioned the oligonucleotide of sequence GAGGCTTCTTCTTCTTCTTCTTCTT
(SEQ ID No. 5), in which the bases GAGG do not form a triple helix
but enable the oligonucleotide to be spaced apart from the coupling
arm.
[0069] It is understood, however, that some mismatches may be
tolerated, provided they do not lead to too great a loss of
affinity. The oligonucleotide used may be natural (composed of
unmodified natural bases) or chemically modified. In particular,
the oligonucleotide may advantageously possess some chemical
modifications enabling its resistance or its protection against
nucleases, or its affinity for the specific sequence, to be
increased.
[0070] Thus, the oligonucleotide may be rendered more resistant to
nucleases by modification of the skeleton (e.g. methylphosphonates,
phosphorothiates, phosphotriester, phosphoramidate, and the like).
Another type of modification has as its objective, more especially,
to improve the interaction and/or the affinity between the
oligonucleotide and the specific sequence. In particular, a
thoroughly advantageous modification according to the invention
consists in methylating the cytosines of the oligonucleotide. The
oligonucleotide thus methylated displays the noteworthy property of
forming a stable triple helix with the specific sequence at neutral
pH. Hence it makes it possible to work at higher pH values than the
oligonucleotides of the prior art, that is to say at pH values
where the risks of degradation of the plasmid DNA are lower.
[0071] The length of the oligonucleotide used in the method of the
invention is at least 3 bases, and preferably between 5 and 30. An
oligonucleotide of length greater than 10 bases is advantageously
used. The length may be adapted to each individual case by a person
skilled in the art in accordance with the desired selectivity and
stability of the interaction.
[0072] The oligonucleotides according to the invention may be
synthesized by any known technique. In particular, they may be
prepared by means of nucleic acid synthesizers. It is quite obvious
that any other method known to a person skilled in the art may be
used.
[0073] To carry out the method of the invention, the specific
ligand (protein, nucleic acid, and the like) may be grafted or
otherwise onto a support. Different types of supports may be used
for this purpose, such as, in particular, functionalized
chromatography supports, in bulk form or prepacked in columns,
functionalized plastic surfaces or functionalized latex beads,
magnetic or otherwise. Chromatography supports are preferably used.
By way of, example, the chromatography supports which may be used
are agarose, acrylamide or dextran, as well as their derivatives
(such as Sephadex, Sepharose, Superose, etc.), polymers such as
poly(styrenedivinylbenzene), or grafted or ungrafted silica, for
example. The chromatography columns can function in the diffusion
or perfusion mode.
[0074] To permit its covalent coupling to the support, the ligand
is generally functionalized. In the case of an oligonucleotide,
this may be modified, for example, with a terminal thiol, amine or
carboxyl group at the 5' or 3' position. In particular, the
addition of a thiol, amine or carboxyl group makes it possible, for
example, to couple the oligonucleotide to a support carrying
disulphide, maleimide, amine, carboxyl, ester, epoxide, cyanogen
bromide or aldehyde functions. These couplings form by the
establishment of disulphide, thioether, ester, amide or amine links
between the oligonucleotide and the support. Any other method known
to a person skilled in the art may be used, such as bifunctional
coupling reagents, for example.
[0075] Moreover, to improve the activity of the coupled
oligonucleotide, it may be advantageous to perform the coupling by
means of an "arm". Use of an arm makes it possible, in effect, to
bind the oligonucleotide at a chosen distance from the support,
enabling its conditions of interaction with the DNA molecule of the
invention to be improved. The arm advantageously consists of
nucleotide bases that do not interfere with the hybridization.
Thus, the arm may comprise purine bases. By way of example, the arm
may comprise the sequence GAGG.
[0076] The DNA molecules according to the invention may be used in
any application of vaccination or of gene and cell therapy, for the
transfer of a gene to a body, a tissue or a given cell. In
particular, they may be used for a direct administration in vivo,
or for the modification of cells in vitro or ex vivo with a view to
their implantation in a patient. In this connection, the molecules
according to the invention may be used as they are (in the form of
naked DNA), or in combination with different synthetic or natural,
chemical and/or biochemical vectors. The latter can be, in
particular, cations (calcium phosphate, DEAE-dextran, etc.) which
act by forming precipitates with DNA, which precipitates can be
"phagocytosed" by the cells. They can also be liposomes in which
the DNA molecule is incorporated and which fuse with the plasma
membrane. Synthetic gene transfer vectors are generally lipids or
cationic polymers which complex DNA and form a particle therewith
carrying positive surface charges. These particles are capable of
interacting with the negative charges of the cell membrane and then
of crossing the latter. DOGS (Transfectam.TM.) or DOTMA
(Lipofectin.TM.) may be mentioned as examples of such vectors.
Chimeric proteins have also been developed: they consist of a
polycationic portion which condenses DNA, linked to a ligand which
binds to a membrane receptor and carries the complex into the cells
by endocytosis. The DNA molecules according to the invention may
also be used for gene transfer into cells by physical transfection
techniques such as bombardment, electroporation, and the like. In
addition, prior to their therapeutic use, the molecules of the
invention may optionally be linearized, for example by enzymatic
cleavage.
[0077] In this connection, another subject of the present invention
relates to any pharmaceutical composition comprising at least one
DNA molecule as defined above. This molecule may be naked or
combined with a chemical and/or biochemical transfection vector.
The pharmaceutical compositions according to the invention may be
formulated with a view to topical, oral, parenteral, intranasal,
intravenous, intramuscular, subcutaneous, intra-ocular,
transdermal, and the like, administration. Preferably, the DNA
molecule is used in an injectable form or by application. It may be
mixed with any pharmaceutically acceptable vehicle for an
injectable formulation, in particular for a direct injection at the
site to be treated. The compositions can be, in particular, in the
form of isotonic sterile solutions, or of dry, in particular
lyophilized compositions which, on addition of sterilized water or
physiological saline as appropriate, enable injectable solutions to
be made up. Diluted Tris or PBS buffers in glucose or sodium
chloride may be used in particular. A direct injection of the
nucleic acid into the affected region-of the patient is
advantageous, since it enables the therapeutic effect to be
concentrated in the tissues affected. The doses of nucleic acid
used may be adapted in accordance with different parameters, and in
particular in accordance with the gene, the vector, the mode of
administration used, the pathology in question or alternatively the
desired treatment period.
[0078] The DNA molecules of the invention may contain one or more
genes of interest, that is to say one or more nucleic acids (cDNA,
gDNA, synthetic or semi-synthetic DNA, and the like) whose
transcription and, where appropriate, translation in the target
cell generate products of therapeutic, vaccinal, agricultural or
veterinary value.
[0079] Among the genes of therapeutic value, there may be
mentioned, more especially, the genes coding for enzymes, blood
derivatives, hormones, lymphokines, namely interleukins,
interferons, TNF, and the like (FR 92/03120), growth factors,
neurotransmitters or their precursors or synthetic enzymes, trophic
factors, namely BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5,
and the like; apolipoproteins, namely ApoAI, ApoAIV, ApoE, and the
like (FR 93/05125), dystrophin or a minidystrophin (FR 91/11947),
tumour suppressive genes, namely p53, Rb, RaplA, DCC, k-rev, and
the like (FR 93/04745), genes coding for factors involved in
coagulation, namely factors VII, VIII, IX, and the like, suicide
genes, namely thymidine kinase, cytosine deaminase, and the like;
or alternatively all or part of a natural or artificial
immunoglobulin (Fab, ScFv, and the like), a ligand RNA
(WO91/19813), and the like. The therapeutic gene can also be an
antisense gene or sequence whose expression in the target cell
enables gene expression or the transcription of cellular mRNAs to
be controlled. Such sequences can, for example, be transcribed in
the target cell into RNAs complementary to cellular mRNAs, and can
thus block their translation into protein, according to the
technique described in Patent EP 140,308.
[0080] The gene of interest can also be a vaccinating gene, that is
to say a gene coding for an antigenic peptide, capable of
generating an immune response in man or animals for the purpose of
vaccine production. Such antigenic peptides can be, in particular,
those specific to the Epstein-Barr virus, the HIV virus, the
hepatitis B virus (EP 185,573) or the pseudorabies virus, or
alternatively tumour-specific peptides (EP 259,212).
[0081] Generally, in the plasmids and molecules of the invention,
the gene of therapeutic, vaccinal, agricultural or veterinary value
also contains a transcription promoter region which is functional
in the target cell or body (i.e. mammals), as well as a region
located at the 3' end and which specifies a transcription
termination signal and a polyadenylation site (expression
cassette). As regards the promoter region, this can be a promoter
region naturally responsible for the expression of the gene in
question when the latter is capable of functioning in the cell or
body in question. The promoter regions can also be those of
different origin (responsible for the expression of other proteins,
or even synthetic promoters). In particular, the promoter sequences
can be from eukaryotic or viral genes. For example, they can be
promoter sequences originating from the genome of the target cell.
Among eukaryotic promoters, it is possible to use any promoter or
derived sequence that stimulates or represses the transcription of
a gene, specifically or otherwise, inducibly or otherwise, strongly
or weakly. They can be, in particular, ubiquitous promoters
(promoter of the HPRT, PGK, .alpha.-actin, tubulin, and the like,
genes), promoters of intermediate filaments (promoter of the GFAP,
desmin, vimentin, neurofilament, keratin, and the like, genes),
promoters of therapeutic genes (for example the promoter of the
MDR, CFTR, factor VIII, ApoAI, and the like, genes),
tissue-specific promoters (promoter of the pyruvate kinase gene,
villin gene, gene for intestinal fatty acid binding protein, gene
for .alpha.-actin of smooth muscle, and the like) or alternatively
promoters that respond to a stimulus (steroid hormone receptor,
retinoic acid receptor, and the like). Similarly, the promoter
sequences may be those originating from the genome of a virus, such
as, for example, the promoters of the adenovirus ElA and MLP genes,
the CMV early promoter or alternatively the RSV LTR promoter, and
the like. In addition, these promoter regions may be modified by
the addition of activator or regulator sequences or sequences
permitting a tissue-specific or -preponderant expression.
[0082] Moreover, the gene of interest can also contain a signal
sequence directing the synthesized product into the pathways of
secretion of the target cell. This signal sequence can be the
natural signal sequence of the product synthesized, but it can also
be any other functional signal sequence, or an artificial signal
sequence.
[0083] Depending on the gene of interest, the DNA molecules of the
invention may be used for the treatment or prevention of a large
number of pathologies, including genetic disorders (dystrophy,
cystic fibrosis, and the like), neurodegenerative diseases
(Alzheimer's, Parkinson's, ALS, and the like), cancers, pathologies
associated with disorders of coagulation or with
dyslipoproteinaemias, pathologies associated with viral infections
(hepatitis, AIDS, and the like), or in the agricultural and
veterinary fields, and the like.
[0084] The present invention will be described more completely by
means of the examples which follow, which are to be regarded as
illustrative and non-limiting.
LEGEND TO THE FIGURES
[0085] FIG. 1: Production of a minicircle from a cassette
integrated in the genome.
[0086] FIG. 2: Production of a minicircle from a plasmid.
[0087] FIG. 3: Production of a minicircle containing a sequence
specific to a ligand.
[0088] FIG. 4: Construction of pXL2649. Ori: Origin of replication;
Kan.sup.r: Marker gene conferring resistance to kanamycin;
Am.sup.r: Marker gene conferring resistance to ampicillin; galK:
Galactosidase gene of E. coli; Plac: Promoter of the lactose
operon.
[0089] FIG. 5: Luciferase activity obtained after transfection of
NIH3T3 mouse fibroblasts with plasmid pXL2650, the minicircle
generated from plasmid pXL2650 and PGL2-Control (Promega, Biotech).
The transfection was carried out under the following conditions:
0.5 mg of DNA per well, 50,000 cells per well. The lipofectant used
is RPR 115335. The result is recorded in RLU per microgram of
proteins as a function of the lipofectant/DNA charge ratio.
[0090] FIG. 6: Construction of the plasmid pXL2793. This plasmid
generates, after recombination, a minicircle containing a synthetic
homopurine-homopyrimidine sequence and the luciferase cassette of
pXL2727.
[0091] FIG. 7: Well 1 corresponds to the SalI digestion of the
fraction eluted after purification with a triple-helix column. Well
2 corresponds to the XmnI digestion of the fraction eluted after
purification with a triple-helix column. Well 3 corresponds to the
undigested fraction eluted after purification with a triple-helix
column. Well 4 corresponds to uninduced, undigested plasmid
pXL2793. Wells 5 and 6 correspond, respectively, to the linear DNA
and supercoiled DNA size markers.
[0092] FIG. 8: Diagrammatic description of the construction of the
plasmid pXL2776.
[0093] FIG. 9: Diagrammatic description of the constructions of the
plasmids pXL2777 and pXL2960.
[0094] FIG. 10: Action of the integrase of bacteriophage 1 in E.
coli on plasmids pXL2777 and pXL2960. M: linear DNA or supercoiled
DNA 1 kb molecular weight marker. N.I.: not induced. I: induced.
N.D.: not digested.
[0095] FIG. 11: Kinetics of recombination of the integrase of
bacteriophage 1 in E. coli on plasmids pXL2777 and pXL2960. 2': 2
minutes. O/N: 14 hours. M: linear DNA or supercoiled DNA 1 kg
molecular weight marker. N.I.: not induced. I: induced. N.D.: not
digested.
GENERAL TECHNIQUES OF CLONING AND MOLECULAR BIOLOGY
[0096] The standard methods of molecular biology, such as
centrifugation of plasmid DNA in a caesium chloride-ethidium
bromide gradient, digestion with restriction enzymes, gel
electrophoresis, electroelution of DNA fragments from agarose gels,
transformation in E. coli, precipitation of nucleic acids, and the
like, are described in the literature (Maniatis et al., 1989,
Ausubel et al., 1987). Nucleotide sequences were determined by the
chain termination method according to the protocol already put
forward (Ausubel et al., 1987).
[0097] Restriction enzymes were supplied by New-England Biolabs
(Biolabs), Bethesda Research Laboratories (BRL) or Amersham Ltd.
(Amersham).
[0098] To carry out ligation, DNA fragments are separated according
to their size on 0.7% agarose or 8% acrylamide gels, purified by
electrophoresis and then electroelution, extracted with phenol,
precipitated with ethanol and then incubated in, a buffer
comprising 50 mM Tris-HCl, pH 7.4, 10 mM MgCl.sub.2, 10 mM, DTT, 2
mM ATP in the presence of phage T4 DNA ligase (Biolabs).
Oligonucleotides are synthesized using phosphoramidite chemistry
with the latter derivatives protected at the b position by a
cyanoethyl group (Sinha et al., 1984, Giles 1985), with the
Biosearch 8600 automatic DNA synthesizer, using the manufacturer's
recommendations.
[0099] The ligated DNAs are used to transform the following strains
rendered competent.Arrow-up bold.: E. coli MC1060 [(LacIOPZYA)X74,
galU, galK, strA.sup.r, hsdR] (Casadaban et al., 1983); HB101
[hsdS20, supE44, recA13, ara-14, proA2, lacy1, galK2, rpsL20,
xyl-5, mtl-1, .lambda.-, F-] (Maniatis et al., 1989); and
DH5.alpha. (endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1
.lambda.-.PHI.80 dlacZ.DELTA.M15] for the plasmids.
[0100] LB and 2XTY culture media are used for the bacteriological
part (Maniatis et al., 1989).
[0101] Plasmid DNAs are purified according to the alkaline lysis
technique (Maniatis et al., 1989).
[0102] Definition of the Terms Employed and Abbreviations
[0103] Recombinant DNA: set of techniques which make it possible
either to combine, within the same microorganism, DNA sequences
which are not naturally combined, or to mutagenize a DNA fragment
specifically.
[0104] ATP: adenosine 5'-triphosphate
[0105] BSA: bovine serum albumin
[0106] PBS: 10 mM phosphate buffer, 150 mM NaCl, pH 7.4
[0107] dNTP: 2'-deoxyribonucleoside 5'-triphosphates
[0108] DTT: dithiothreitol
[0109] kb: kilobases
[0110] bp: base pairs
EXAMPLE 1
Construction of a Plasmid Carrying the attP and attB Sequences of
the Bacteriophage, in Repeated Direct Orientations
[0111] The plasmid pNH16a was used as starting material, inasmuch
as it already contains a fragment of bacteriophage .lambda.
carrying the attP sequence (Hasan and Szybalski, 1987). This
plasmid was digested with EcoRI. oligonucleotides which contain the
attB sequence (Landy, 1989) were synthesized. They have the
following sequence:
[0112] oligonucleotide 5476 (SEQ ID No.1)
5'-AATTGTGAAGCCTGCTTTTTTATACTAAC- TTGAGCGG-3'
[0113] oligonucleotide 5477 (SEQ ID No.2)
5'-AATTCCGCTCAAGTTAGTATAAAAAAGCA- GGCTTCAC-3'
[0114] They were hybridized to re-form the attB sequence and then
ligated at the EcoRI site of the 4.2-kb EcoRI fragment of pNH16a
(Hasan and Szybalski, 1987). After transformation of DHSA, a
recombinant clone was retained. The plasmid thereby constructed was
designated pXL2648 (see FIG. 4). This plasmid contains the attP and
attB sequences of the bacteriophage in the direct orientation.
Under the action of the integrase of the bacteriophage (Int
protein), there should be excision of the sequences lying between
the two att sites. This results in separation of the material
inserted between the two att sequences from the origin of
replication and from the resistance marker of the plasmid, which
are positioned on the outside.
EXAMPLE 2
Obtaining a Minicircle in vivo in E. coli
[0115] A cassette for resistance to kanamycin was cloned at the
EcoRI site of plasmid pXL2648 (FIG. 4). This cassette originates
from the plasmid pUC4KIXX (Pharmacia Biotech.). For this purpose,
10 g of plasmid pUC4KIXX were digested with EcoRI and then
separated by agarose gel electrophoresis; the 1.6-kb fragment
containing the kanamycin resistance marker was purified by
electro-elution; it was then ligated to plasmid pXL2648 linearized
with EcoRI. The recombinant clones were selected after
transformation into E. coli DH5a and selection for resistance to
kanamycin. The expected restriction profile was observed on one
clone; this plasmid clone was designated pXL2649 (FIG. 4). This
plasmid was introduced by transformation into two E. coli
strains:
[0116] D1210 [hsdS20, supE44, recA13, ara-14, proA2, lacY1, galK2,
rpsL20, xyl-5, mtl-1, .lambda..sup.-, F-, lacIg] (Sadler et al.,
1980)
[0117] D1210HP, which corresponds to DH1210 lysogenized with the
phage xis.sup.- (Xis.sup.- Kil.sup.`) cI857 (Podjaska et al.,
1985).
[0118] The transformants were selected at 30.degree. C. on 2XTY
medium with kanamycin (50 mg/l). After reisolation on selective
medium, the strains were inoculated into 5 ml of L medium
supplemented with kanamycin (50 mg/l). After 16 h of incubation at
30.degree. C. with agitation (5 cm of rotational amplitude), the
cultures were diluted to {fraction (1/100)} in 100 ml of the same
medium. These cultures were incubated under the same conditions
until an OD.sub.610 of 0.3 was reached. At this point, half of the
culture was removed and then incubated for 10 min at 42.degree. C.
to induce the lytic cycle of the phage, hence the expression of the
integrase. After this incubation, the cultures were transferred
again to 30.degree. C. and then incubated for 1 h under these
conditions. Next, culturing was stopped and minipreparations of
plasmid DNA were produced. Irrespective of the conditions, in the
strain D1210, the agarose gel electrophoresis profile of the
undigested plasmid DNA of plasmid pXL2649 is unchanged, as is also
the case in the strain D1210HP which has not been thermally
induced. On the contrary, in D1210HP which has been incubated for
10 min at 42.degree. C. and then cultured for 1 hour at 30.degree.
C., it is found that there is no longer a plasmid, but two circular
DNA molecules: one of low molecular weight, migrating faster and
containing an EcoRI site; and one of higher molecular weight,
containing a unique BalI site, as expected. Hence there has indeed
been excision of the sequences present between the two att
sequences, and generation of a minicircle bereft of any origin of
replication. This supercoiled circular DNA not carrying an origin
of replication is termed a minicircle. This name takes, in effect,
better account of the circular nature of the molecule. The starting
plasmid pXL2649 is present, but it represents approximately 10% of
the plasmid which has excised the sequences flanked by att.
[0119] The minicircle may then be purified by standard techniques
of plasmid DNA purification, since it is supercoiled like plasmid
DNA. These techniques comprise, inter alia, purification on a
caesium chloride density gradient in the presence of ethidium
bromide, or alternatively the use of anion exchange columns
(Maniatis et al., 1989). In addition, if the plasmid DNA
corresponding to the origin of replication and to the selectable
marker is considered to be present in an excessively large amount,
it is always possible, after purification, to use one or more
restriction enzymes which will digest the plasmid and not the
minicircle, enabling them to be separated by techniques that
separate supercoiled DNA from linear DNA, such as in a caesium
chloride density gradient in the presence of ethidium bromide
(Maniatis et al., 1989).
EXAMPLE 3
Obtaining a Minicircle Containing a Cassette for the Expression of
Luciferase
[0120] In order to test the use of these minicircles in vivo, a
reporter gene with the sequences required for its expression was
cloned into plasmid pXL2649 (see Example 2). This was done using,
more especially, a 3150-bp BalII-BamHI cassette originating from
pGL2-Control (Promega Biotech). This cassette contains the SV40
early promoter, the enhancer of the SV40 early promoter, the
luciferase gene of Photinus pyralis and a polyadenylation site
derived from SV40. The 3150-bp BqlII-BamHI fragment was cloned at
the BamHI site of pXL2649 digested with BamHI so as to replace the
cassette for resistance to kanamycin by the cassette for the
expression of luciferase from pGL2-control. The plasmid thus
constructed was called pXL2650. In this plasmid, the attP and attB
sites flank the cassette for the expression of luciferase.
Site-specific recombination enables only the sequences required for
the expression of luciferase together with the luciferase gene to
be excised. This recombination may be carried out exactly as
described in Example 2. A minicircle such as plasmid pXL2650 may be
used thereafter in in vivo or in vitro transfection
experiments.
[0121] A 1-litre culture of the strain D1210HP pXL2650 in 2XTY
medium supplemented with ampicillin (50 mg/ml) was set up at
30.degree. C. At an OD.sub.610 equal to 0.3, the culture was
transferred to 42.degree. C. for 20 min, then replaced for 20 min
at 30.degree. C. The episomal DNA was prepared by the clear lysate
technique (Maniatis et al., 1989), followed by a caesium chloride
density gradient supplemented with ethidium bromide (Maniatis et
al., 1989), then by an extraction of the ethidium bromide with
isopropanol and by a dialysis. This DNA was shown to contain the
mini-circle. 100 .mu.g of this preparation were digested with PstI,
and the hydrolysate was then subjected to a caesium chloride
density gradient supplemented with ethidium bromide (Maniatis et
al., 1989). An identical result is obtained when the preparation is
digested jointly with AlwNI and XmnI. The supercoiled form was
recovered and, after removal of the ethidium bromide (Maniatis et
al.), it was found to correspond only to the minicircle, lacking an
origin of replication and any marker gene. This minicircle
preparation may be used for in vitro and in vivo transfection
experiments.
EXAMPLE 4
In vitro Transfection of Mammalian Cells, and More Especially of
Human Cells, With a Mini-circle
[0122] The minicircle DNA containing the luciferase gene of
Photinus pyralis as described in Example 3, that is to say
corresponding to the minicircle generated from plasmid pXL2650, is
diluted in 150 mM NaCl and mixed with a transfectant. It is
possible to use various commercial transfectants, such as
dioctadecylamidoglycylspermine (DOGS, Transfectam.TM., Promega),
Lipofectin.TM. (Gibco-BRL), and the like, in different
positive/negative charge ratios. By way of illustration, the
transfecting agent was used in charge ratios greater than or equal
to 3. The mixture is vortexed, left for 10 minutes at room
temperature, diluted in culture medium without foetal calf serum,
and then added to the cells in the proportion of 2 .mu.g of DNA per
culture well. The cells used are Caco-2, derived from a human colon
adenocarcinoma, cultured according to a protocol described (Wils et
al., 1994) and inoculated on the day before the experiment into
48-well culture plates in the proportion of 50,000 cells/well.
After two hours at 37.degree. C., 10% v/v of foetal calf serum is
added and the cells are incubated for 24 hours at 37.degree. C. in
the presence of 5% CO.sub.2. The cells are washed twice with PBS
and the luciferase activity is measured according to the protocol
described (such as the Promega kit). It is possible to use other
lines (fibroblasts, lymphocytes, etc.) originating from different
species, or alternatively cells taken from an individual
(fibroblasts, keratinocytes, lymphocytes, etc.) and which will be
reinjected into him or her after transfection.
EXAMPLE 5
In vitro Transfection of NIH 3T3 Cells
[0123] The minicircle DNA containing the luciferase gene of
Photinus pyralis, as described in Example 3, that is to say
corresponding to the minicircle generated from plasmid pXL2650, was
transfected in vitro into mammalian cells; pXL2650 and PGL2-Control
(Promega Biotech.), which contain the same expression cassette,
were used as control. The cells used are NIH 3T3 mouse fibroblasts,
inoculated on the day before the experiment into 24-well culture
plates in the proportion of 50,000 cells per well. The plasmid is
diluted in 150 mM NaCl and mixed with the lipofectant RPR115335.
However, it is possible to use various other commercial agents such
as dioctadecylaminoglycylspermine (DOGS, Transfectam.TM., Promega)
(Demeneix et al., Int. J. Dev. Biol. 35 (1991) 481), Lipofectin.TM.
(Gibco-BRL) (Fegner et al., Proc. Natl. Acad. Sci. USA 84 (1987)
7413), and the like. A positive charge of the lipofectant/negative
charge of the DNA ratio equal to or greater than 3 is used. The
mixture is vortexed, left for ten minutes at room temperature,
diluted in medium without foetal calf serum, and then added to the
cells in the proportion of 0.5 mg of DNA per culture well. After
two hours at 37.degree. C., 10% by volume of foetal calf serum is
added and the cells are incubated for 48 hours at 37.degree. C. in
the presence of 5% CO.sub.2. The cells are washed twice with PBS
and the luciferase activity is measured according to the protocol
described (Promega kit, Promega Corp. Madison, Wis.), on a Lumat
LB9501 luminometer (EG and G Berthold, Evry). The transfection
results corresponding to the conditions which have just been stated
are presented in FIG. 5. They show unambiguously that the
minicircle has the same transfection properties as plasmids
possessing an origin of replication. Thus these minicircles could
be used in the same way as standard plasmids in gene therapy
applications.
EXAMPLE 6
Affinity Purification of a Minicircle Using a Triple-helix
Interaction
[0124] This example describes a method of purification of a
minicircle according to the invention from a mixture containing the
plasmid form which has excised it, by triple-helix type
interactions which will take place with a synthetic DNA sequence
carried by the minicircle to be purified. This example demonstrates
how the technology of purification by triple-helix formation may be
used to separate a minicircle from a plasmid form which has excised
it.
[0125] 6-1. Obtaining a Minicircle Containing a Synthetic
Homopurine-homopyrimidine Sequence
[0126] 6-1.1. Insertion of a Homopurine-homopyrimidine Sequence
into Plasmid pXL2650
[0127] Plasmid pXL2650 possesses a unique BamHI site immediately
after the cassette containing the luciferase gene of Photinus
pyralis. This unique site was used to clone the following two
oligonucleotides:
1 4957 (SEQ ID No.3) 5'-GATCCGAAGAGAAGAAGAAGAAGAAGA-
AGAAGAAGAAGAAGAAGAA GAAGAAGAAC -3' 4958 (SEQ ID No.4)
5'-GATCGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT- TCTTCTTCTTCTTCTTCG-
3'
[0128] These oligonucleotides, when hybridized and cloned into
plasmid pXL2650, introduce a homopurine-homopyrimidine sequence
(GAA).sub.17, as described above.
[0129] To carry out this cloning, the oligonucleotides were first
hybridized in the following manner. One g of each of these two
oligonucleotides were placed together in 40 ml of a final buffer
comprising 50 mM Tris-HCl, pH 7.4, 10 mM MgCl.sub.2. This mixture
was heated to 95.degree. C. and was then placed at room temperature
so that the temperature would fall slowly. Ten ng of the mixture of
hybridized oligonucleotides were ligated with 200 ng of plasmid
pXL2650 linearized with BamHI, 30 ml of final. After ligation, an
aliquot was transformed into DH5. The transformation mixtures were
plated out on L medium supplemented with ampicillin (50 mg/l).
Twenty-four clones were digested with PflMI and BamHI. One clone
was found which had the size of the 950-bp PflMI-BamHI fragment
increased by 50 bp. This clone was selected and designated
pXL2651.
[0130] Plasmid pXL2651 was purified according to the Wizard
Megaprep kit (Promega Corp., Madison, Wis.) according to the
supplier's recommendations.
[0131] 6-1.2. Insertion of a Homopurine-homopyrimidine Sequence
into Plasmid pXL2649
[0132] a) Insertion of New Restriction Sites on Each Side of the
Kanamycin Cassette of pXL2649
[0133] Plasmid pXL2649, as described in Example 2, was digested
with EcoRI so as to take out the kanamycin cassette originating
from plasmid pUC4KIXX (PharmaciaBiotech, Uppsala, Sweden). For this
purpose, 5 mg of plasmid pXL2649 were digested with EcoRI. The
4.2-kb fragment was separated by agarose gel electrophoresis and
purified by electroelution.
[0134] In addition, the plasmid pXL1571 was used. The latter was
constructed from the plasmid pFR10 (Gene 25 (1983), 71-88), into
which the 1.6-kb fragment originating from pUC4KIXX, corresponding
to the kanamycin gene, was inserted at the SstI site. This cloning
enabled 12 new restriction sites to be inserted on each side of the
kanamycin gene.
[0135] Five micrograms of pXL1571 were dialysed with EcoRI. The
1.6-kb fragment corresponding to the kanamycin gene was separated
by agarose gel electrophoresis and purified by electroelution. It
was then ligated with the 4.2-kb EcoRI fragment of pXL2649. The
recombinant clones were selected after transformation into E. coli
DH5a and selection for resistance to kanamycin and to ampicillin.
The expected restriction profile was observed on one clone; this
plasmid clone was designated pXL2791.
[0136] b) Extraction of the Kanamycin Cassette From Plasmid
pXL2791
[0137] Plasmid pXL2791 was digested with SstI so as to take out the
kanamycin cassette. The 4.2-kb fragment was separated by agarose
gel electrophoresis and purified with the Jetsorb extraction gel
kit (Genomed). It was then ligated. The recombinant clones were
selected for resistance to ampicillin after transformation into E.
coli DH5a. The expected restriction profile was observed on one
clone. This plasmid clone was designated pXL2792. This clone
comprises, inter alia, SalI and XmaI restriction sites between the
attP and attB sites.
[0138] c) Cloning of a Homopurine-homopyrimidine Sequence as Well
as of a Cassette Permitting the Expression of Luciferase Between
the Two attP and attB Sites of Plasmid pXL2792
[0139] Plasmid pXL2727 was used. This plasmid, digested with XmaI
and SalI, enables a fragment comprising the following to be taken
out the pCMV promoter, the luciferase gene of Photinus pyralis, a
polyadenylation site derived from SV40 and a
homopurine-homopyrimidine sequence. The latter was obtained after
hybridization and cloning of the following two
oligonucleotides:
2 6006: (SEQ ID No.16) 5'- GATCTGAAGAAGAAGAAGAAGAAG-
AAGAAGAAGAAGAAGAAGAAGAA GAAGAAGAACTGCAGATCT -3' 6008: (SEQ ID
No.17) 5'- GATCAGATCTGCAGTTCTTCTTCTTCTTCTTCT- TCTTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCA-3'
[0140] The homopurine-homopyrimidine sequence present in pXL2727
was sequenced by the Sequence Version 2.0 method (United States
Biochemical Corporation). The result obtained shows that the
homopurine-homopyrimidin- e sequence actually present in plasmid
pXL2727 contains 10 repeats (GAA-CTT), and not 17 as the sequence
of the oligonucleotides 6006 and 6008 suggested would be the case.
The sequence actually present in plasmid pXL2727, read after
sequencing on the strand corresponding to the oligonucleotide 6008,
is as follows:
3 (SEQ ID No.18) 5'-GATCAGATCTGCAGTCTCTTCTTCTTCTTCTTCTTCTTC-
TTCTTCT- TCTCTTCTCA-3'
[0141] One microgram of pXL2727 was digested with XmaI and SalI.
The 3.7-kb fragment was separated by agarose gel electrophoresis
and purified with the Jetsorb extraction gel kit (Genomed). In
addition, 1.7 mg of pXL2792 were digested with XmaI and SalI. The
4.2-kb fragment was separated on agarose gel, purified with the
Jetsorb extraction gel kit (Genomed) and ligated with the 3.7-kb
XmaI-SalI fragment of pXL2727. The recombinant clones were selected
after transformation into E. coli DH5a and selection for resistance
to ampicillin. The expected restriction profile was observed on one
clone; this clone was designated pXL2793. Plasmid pXL2793 was
purified using a caesium chloride density gradient according to a
method already described (Maniatis et al., 1989).
[0142] 6-2. Preparation of the Column Enabling Triple-helix Type
Interactions With a Homopurine-homopyrimidine Sequence Present in
the Minicircle to be Effected
[0143] The column was prepared in the following manner:
[0144] The column used is a 1-ml HiTrap column activated with NHS
(N-hydroxysuccinimide, Pharmacia), connected to a peristaltic pump
(flow rate <1 ml/min). The specific oligonucleotide used
possesses an NH.sub.2 group at the 5' end.
[0145] For plasmid pXL2651, its sequence is as follows:
[0146] 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID No.5) For plasmid
pXL2793, its sequence is as follows (oligo 116418):
[0147] 5'-CTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID No. 19)
[0148] The buffers used are the following:
[0149] Coupling buffer: 0.2 M NaHCO.sub.3, 0.5 M NaCl, pH 8.3.
[0150] Washing buffer:
[0151] Buffer A: 0.5 M ethanolamine, 0.5 M NaCl, pH 8.3.
[0152] Buffer B: 0.1 M acetate, 0.5 M NaCl, pH 4.
[0153] Fixing and eluting buffer:
[0154] Buffer F: 2 M NaCl, 0.2 M acetate, pH 4.5.
[0155] Buffer E: 1 M Tris-HCl, pH 9, 0.5 mM EDTA.
[0156] The column is prepared in the following manner:
[0157] The column is washed with 6 ml of 1 mM HCl, and the
oligonucleotide diluted in the coupling buffer (50 nmol in 1 ml) is
then applied to the column and left for 30 minutes at room
temperature. The column is washed with 3 ml of coupling buffer,
then with 6 ml of buffer A, followed by 6 ml of buffer B. The
latter two buffers are applied three times in succession to the
column. In this way, the oligonucleotide is linked covalently to
the column via a CONH link. The column is stored at 4.degree. C. in
PBS, 0.1% NaN.sub.3.
[0158] 6-3. Purification of a Minicircle Containing a Synthetic
Homopurine-homopyrimidine Sequence, by a Triple-helix Type
Interaction
[0159] 6-3.1. Purification of Plasmid pXL2651
[0160] Plasmid pXL2651 was introduced into the strain D1210HP. This
recombinant strain [D1210HP (pXL2651)] was cultured as described in
Example 3 so as to generate the minicircle containing the
luciferase gene of Photinus pyralis. Twenty ml of culture were
removed and centrifuged. The cell pellet is taken up in 1.5 ml of
50 mM glucose, 25 mM Tris-HCl, pH 8, 10 mM EDTA. Lysis is carried
out with 2 ml of 0.2 M NaOH, 1% SDS, and neutralization with 1.5 ml
of 3 M potassium acetate, pH 5. The DNA is then precipitated with 3
ml of 2-propranol, and the pellet is taken up in 0.5 ml of 0.2 M
sodium acetate, pH 5, 0.1 M NaCl and loaded onto an oligonucleotide
column capable of forming triple-helix type interactions with
poly(GAA) sequences contained in the minicircle, as described
above. After the column has been washed beforehand with 6 ml of
buffer F, the solution containing the minicircle to be purified is
incubated, after being applied to the column, for two hours at room
temperature. The column is washed with 10 ml of buffer F and
elution is then carried out with buffer E.
[0161] Purified DNA corresponding to the minicircle is thereby
obtained. The minicircle obtained, analysed by agarose gel
electrophoresis and ethidium bromide staining, takes the form of a
single band of supercoiled circular DNA. Less than 5% of starting
plasmid pXL2651 is left in the preparation.
[0162] 6-3.2. Purification of Plasmid pXL2793
[0163] The 7.9-kb plasmid pXL2793 was introduced into the strain
D1210HP. This recombinant strain was cultured as described in
Example 3, so as to generate the 4-kb minicircle containing the
luciferase gene of Photinus pyralis and a 3.9-kb plasmid. Two
hundred ml of culture were removed and centrifuged. The cell pellet
was treated with the Wizard Megaprep kit (Promega Corp., Madison,
Wis.) according to the supplier's recommendations. The DNA was
taken up in a final volume of 2 ml of 1 mM Tris, 1 mM EDTA, pH 8.
Two hundred and fifty microlitres of this plasmid sample were
diluted with buffer F in a final volume of 2.5 ml. The column was
washed beforehand with 6 ml of buffer F. The whole of the diluted
sample was loaded onto an oligonucleotide column capable of forming
triple-helix type interactions with poly(GAA) sequences contained
in the minicircle, prepared as described above. After washing with
10 ml of buffer F, elution is carried out with buffer E. The eluted
sample is recovered in 1-ml fractions.
[0164] By this method, purified DNA corresponding to the minicircle
generated from pXL2793 is obtained. The DNA sample eluted from the
column was analysed by agarose gel electrophoresis and ethidium
bromide staining, and by enzyme restriction. For this purpose, the
eluted fractions which were shown to contain DNA by assay at
OD.sub.260 nm were dialysed for 24 hours against 1 mM Tris, 1 mM
EDTA, then precipitated with isopropanol and taken up in 200 ml of
H.sub.2O. Fifteen microlitres of the sample thereby obtained were
digested with SalI, this restriction site being present in the
minicircle and not in the 3.9-kb plasmid generated by the
recombination, or with XmnI, this restriction site being present in
the 3.9-kb plasmid generated by the recombination and not in the
minicircle. The result obtained is presented in FIG. 7, showing
that the minicircle has been purified of the recombinant
plasmid.
EXAMPLE 7
In vivo Transfection of Mammalian Cells with a Minicircle
[0165] This example describes the transfer of a minicircle coding
for the luciferase gene into the brain of newborn mice. The
minicircle (30 .mu.g) is diluted in sterile 150 mM NaCl to a
concentration of 1 .mu.g/.mu.l. A synthetic transfectant such as
dioctadecylamidoglycyl-spermine (DOGS) is then added in a
positive/negative charge ratio less than or equal to 2. The mixture
is vortexed, and 2 .mu.g of DNA are injected into the cerebral
cortex of anaesthetized newborn mice using a micromanipulator and a
microsyringe. The brains are removed 48 hours later, homogenized
and centrifuged and the supernatant is used for the assay of
luciferase by the protocols described (such as the Promega
kit).
EXAMPLE 8
Use of the par Locus of RK2 to Reduce the Presence of Minicircle or
Miniplasmid Topoisomers
[0166] This example demonstrates the presence of topological forms
derived i) from the plasmid possessing the attP and attB sequences
in the direct orientation, ii) from the minicircle or iii) from the
miniplasmid, after the action of the integrase of bacteriophage 1
in E. coli. This example also shows that these topological or
oligomeric forms may be resolved by using the par locus of RK2
(Gerlitz et al., 1990 J. Bacteriol. 172 p. 6194). In effect, this
locus contains, in particular, the parA gene coding for a resolvase
acting at the mrs (multimer resolution system) site (Eberl et al.,
1994 Mol. Microbiol. 12 p. 131).
[0167] 8-1. Construction of Plasmids pXL2777 and pXL2960
[0168] Plasmids pXL2777 and pXL2960 are derived from the vector
pXL2776, and possess in common the minimal replicon of ColE1, the
gene of the transposon Tn5 coding for resistance to kanamycin and
the attP and attB sequences of bacteriophage 1 in the direct
orientation. These plasmids differ in respect of the genes inserted
between the attP and attB sequences, in particular pXL2777 contains
the omegon cassette (coding for the gene for resistance to
spectinomycin) whereas plasmid pXL2960 carries par locus of
RK2.
[0169] 8-1.1. Minimal Vector pXL2658
[0170] The vector pXL2658 (2.513 kb) possesses the minimal replicon
of ColE1 originating from pBluescript (ori) and the gene of the
transposon Tn5 coding for resistance to kanamycin (Km) as
selectable marker. After the BsaI end has been blunted by the
action of the Klenow enzyme, the 1.15-kb BsaI-PvuII fragment of
pBKS+ (obtained from Stratagene) was cloned with the 1.2-kb SmaI
fragment of pUC4KIXX (obtained from Pharmacia) to generate the
plasmid pXL2647. The oligo-nucleotides 5542 5' (AGC TTC TCG AGC TGC
AGG ATA TCG AAT TCG GAT CCT CTA GAG CGG CCG CGA GCT CC)3' (SEQ ID
No.20) and 5543 5' (AGC TGG AGC TCG CGG CCG CTC TAG AGG ATC CGA ATT
CGA TAT CCT GCA GCT CGA GA)3' (SEQ ID No.21) were hybridized with
one another and then cloned at the HindIII site of pXL2647; in this
way pXL2658 is constructed. In this plasmid, the multiple cloning
site is SstI, NotI, XbaI, BamHI, EcoRI, EcoRV, PstI, XhoI and
HindIII between the origin of replication and the gene coding for
resistance to kanamycin.
[0171] 8-1.2. Vector pXL2776 Containing the attP and attB Sequences
of Phage 1
[0172] The vector pXL2776 (2.93 kb) possesses the minimal replicon
of ColE1 originating from pBluescript, the gene coding for
resistance to kanamycin and the attP and attB sequences of
bacteriophage 1 in the direct orientation, see FIG. 8. The 29-bp
attB sequence (Mizuuchi et al., 1980 Proc. Natl. Acad. Sci. USA 77
p. 3220) was introduced between the SacI and HindIII restriction
sites of pXL2658 after the sense oligonucleotide 6194 5' (ACT AGT
GGC CAT GCA TCC GCT CAA GTT AGT ATA AAA AAG CAG GCT TCA G)3' (SEQ
ID No.22) has been hybridized with the antisense oligonucleotide
6195 5' (AGC TCT GAA GCC TGC TTT TTT ATA CTA ACT TGA GCG GAT GCA
TGG CCA CTA GTA GCT)3' (SEQ ID No.23) in such a way that the SacI
and HindIII sites are no longer re-formed after cloning. This
plasmid, the sequence of which was verified with respect to attB,
is then digested with SDeI and NsiI in order to introduce in it the
attP sequence flanked by the NsiI and XbaI restriction sites and
thus to generate plasmid pXL2776. The attP sequence was obtained by
PCR amplification using plasmid pXL2649 (described in Example 2) as
template, the sense oligonucleotide 6190 5' (GCG TCT AGA ACA GTA
TCG TGA TGA CAG AG)3' (SEQ ID No.24) and the antisense
oligonucleotide 6191 5' (GCC AAG CTT AGC TTT GCA CTG GAT TGC GA)3'
(SEQ ID No.25), and performing 30 cycles during which the
hybridization temperature is 50.degree. C. The PCR product digested
at the XbaI and HindIII sites was cloned into the phage M13mpEH
between the XbaI and HindIII sites. The amplified sequence is
identical to the attP sequence described in Lambda II (edited by R.
W. Hendrix, J. W. Roberts, F. W. Stahl, R. A. Weisberg; Cold Spring
Harbor Laboratory 1983) between positions 27480 and 27863.
[0173] 8-1.3. Plasmid pXL2777
[0174] Plasmid pXL2777 (6.9 kb) possesses the minimal replicon of
ColE1 originating from pBluescript; the gene coding for resistance
to kanamycin, the attP and attB sequences of bacteriophage 1 in the
direct orientation and separated by the sacB gene coding for
levansucrase of B. subtilis (P. Gay et al., 1983 J. Bacteriol. 153
p. 1424), and the Sp omegon coding for the gene for resistance to
spectinomycin Sp and streptomycin Sm (P. Prentki et al., 1984 Gene
29 p. 303). The sacB-Sp cassette having EcoRV and NsiI cloning ends
comes from the plasmid pXL2757 (FR95/01632) and was cloned between
the EcoRV and NsiI sites of pXL2776 to form pXL2777.
[0175] 8-1.4. Plasmid pXL2960
[0176] Plasmid pXL2960 (7.3 kb) possesses the minimal replicon of
ColE1 originating from pBluescript, the gene coding for resistance
to kanamycin and the attP and attB sequences of bacteriophage 1 in
the direct orientation and separated by i) the sacB gene coding for
levansucrase of B. subtilis (P. Gay et al., 1983 J. Bacteriol. 153
p. 1424) and ii) the par locus of RK2 (Gerlitz et al., 1990 J.
Bacteriol. 172 p. 6194). The par cassette having BamHI ends comes
from the plasmid pXL2433 (PCT/FR95/01178) and was introduced
between the BamHI sites of pXL2777 to generate pXL2960.
[0177] 8-2. Resolution of Minicircle or Miniplasmid Topoisomers
[0178] Plasmids pXL2777 and pXL2960 were introduced by
transformation into E. coli strain D1210HP. The transformants were
selected and analysed as described in Example 2, with the following
modifications: the expression of the integrase was induced at
42.degree. C. for 15 min when the optical density of the cells at
610 nm is 1.8, and the cells are then incubated at 30.degree. C.
for 30 min, see FIG. 9, or for a period varying from 2 minutes to
14 hours (O/N), see FIG. 10. The plasmid DNA originating from
uninduced and induced cultures was then analysed on agarose gel
before or after digestion with a restriction enzyme exclusive to
the minicircle portion (EcoRI) or miniplasmid portion (BglII), see
Figure Y, or after the action of DNA topoisomerase A or the gyrase
of E. coli. The supercoiled dimer forms of minicircle or
miniplasmid are clearly revealed by i) their molecular weight, ii)
their linearization by the restriction enzyme, iii) their change in
topology through the action of topoisomerase A (relaxed dimer) or
of the gyrase (supersupercoiled dimer), iv) specific hybridization
with an internal fragment peculiar to the minicircle or the
miniplasmid. Other topological forms of higher molecular weights
than that of the initial plasmid originate from the initial plasmid
or the minicircle or the miniplasmid, since they disappear after
digestion with the restriction enzyme exclusive to the minicircle
portion (EcoRI) or miniplasmid portion (BglII). These forms are
much less abundant with pXL2960 than with pXL2777 as initial
plasmid, see FIG. 10. In particular, the dimer form of minicircle
is present to a not insignificant extent with plasmid pXL2777,
whereas it is invisible with plasmid pXL2960 when the cells are
incubated for at least 30 min at 30.degree. C., see FIGS. 9 and 10.
It should be noted that minicircle dimers are observed at the
beginning of the kinetic experiment with pXL2960 (2 to 10 min), and
are thereafter resolved (after 30 min), see FIG. 10. Consequently,
the par locus leads to a significant reduction in the
oligomeric/topological forms resulting from the action of the
integrase of bacteriophage 1 in E. coli on plasmids containing the
attP and attB sequences, in the direct orientation.
IDENTIFICATION OF THE NUCLEOTIDE SEQUENCES
[0179] SEQ ID No.1: oligonucleotide 5476:
[0180] 5'-AATTGTGAAGCCTGCTTTTTTATACTAACTTGAGCGG-3'
[0181] SEQ ID No.2: oligonucleotide 5477
[0182] 5'-AATTCCGCTCAAGTTAGTATAAAAAAGCAGGCTTCAC-3'
[0183] SEQ ID No.3: oligonucleotide 4957:
[0184] 5'-
GATCCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAC-3'
[0185] SEQ ID No.4: oligonucleotide 4958:
[0186]
5'-GATCGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCG-3'
[0187] SEQ ID No.5: oligonucleotide poly-CTT:
[0188] 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3'
[0189] SEQ ID No.6: (attB sequence of phage lambda):
[0190] 5'-CTGCTTTTTTATACTAACTTG-3'
[0191] SEQ ID No.7: (attP sequence of phage lambda):
[0192] 5'-CAGCTTTTTTATACTAAGTTG-3'
[0193] SEQ ID No.8: (attB sequence of phage P22):
[0194] 5'-CAGCGCATTCGTAATGCGAAG-3'
[0195] SEQ ID No.9: (attP sequence of phage P22):
[0196] 5'-CTTATAATTCGTAATGCGAAG-3'
[0197] SEQ ID No.10: (attB sequence of phage F80):
[0198] 5'-AACACTTTCTTAAATGGTT-3'
[0199] SEQ-ID No.11: (attP sequence of phage F80):
[0200] 5'-AACACTTTCTTAAATTGTC-3'
[0201] SEQ ID No.12: (attB sequence of phage HP1):
[0202] 5'-AAGGGATTTAAAATCCCTC-3'
[0203] SEQ ID No.13: (attP sequence of phage HP1):
[0204] 5'-ATGGTATTTAAAATCCCTC-3'
[0205] SEQ ID No.14: (att sequence of plasmid pSAM2):
[0206] 5'-TTCTCTGTCGGGGTGGCGGGATTTGAACCCACGACCTCTTCGTCCCGAA-3'
[0207] SEQ ID No.15: (Recognition sequence of the resolvase of the
transposon Tn3):
[0208] 5' - CGTCGAAATATTATAAATTATCAGACA-3'
[0209] SEQ ID No.16: oligonucleotide 6006:
[0210]
5'-GATCTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAACTGCAGAT-
CT-3'
[0211] SEQ ID No.17: oligonucleotide 6008:
[0212]
5'-GATCAGATCTGCAGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT-
CA-3'
[0213] SEQ ID No.18: (Sequence present in plasmid pXL2727
corresponding to the oligonucleotide 6008):
[0214]
5'-GATCAGATCTGCAGTCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTTCTTCA-3'
[0215] SEQ ID No.19: (oligonucleotide 116418):
[0216] 5'-CTTCTTCTTCTTCTTCTTCTT-3'
[0217] SEQ ID No.20: (oligonucleotide 5542):
[0218] 5'
-AGCTTCTCGAGCTGCAGGATATCGAATTCGGATCCTCTAGAGCGGOCCGCGAGCTCC-3'
[0219] SEQ ID No.21: (oligonucleotide 5543):
[0220] 5'
-AGCTGGAGCTCGCGGCCGCTCTAGAGGATCCGAATTCGATATCCTGCAGCTCGAGA-3'
[0221] SEQ ID No.22: sense oligonucleotide 6194:
[0222] 5'-ACTAGTGGCCATGCATCCGCTCAAGTTAGTATAAAAAAGCAGGCTTCAG-3'
[0223] SEQ ID No.23: antisense oligonucleotide 6195:
[0224]
5'-AGCTCTGAAGCCTGCTTTTTTATACTTAACTTGAGCGGATGCATGGCCACTAGTAGCT-3'
[0225] SEQ ID No.24: sense oligonucleotide 6190:
[0226] 5'-GCGTCTAGAACAGTATCGTGATGACAGAG-3'
[0227] SEQ ID No.25: antisense oligonucleotide 6191:
[0228] 5'-GCCAAGCTTAGCTTTGCACTGGATTGCGA-3'
Bibliographic References
[0229] Ausubel et al. Current protocols in molecular biology
1987-1988. John Willey and Sons, New York.
[0230] Behr J. P. 1993. Acc. Chem. Res. 26:274-278.
[0231] Casadaban et al. 1983. Methods Enzymol. 100, 293-308.
[0232] Cotten et al. E. 1993. Curr. Biol. 4:705-710.
[0233] Giles, J. W. 1985. Am. Biotechnol., Nov./Dec.
[0234] Hasan et al. 1987. Gene 56:145-151.
[0235] Jain, R. K. 1987. Cancer Res. 47:3039-3051.
[0236] Landford et al. 1986. Cell 46:575-582.
[0237] Landy, A. 1989. Ann; Rev. Biochem. 58:913-949.
[0238] Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989.
Molecular cloning: a laboratory manual, second edition. Cold Spring
Harbor Laboratory, Cold Spring Harbor Laboratory Press, New
York.
[0239] Nabel et al. 1992. Human Gene Therapy 3:399-410.
[0240] Podhajska et al. 1985. Gene 40:163:168.
[0241] Sadler et al. 1980. Gene, 8:279-300.
[0242] Sinha et al. 1984. Acids Res., 12, 4539-4557.
[0243] Stark et al. 1992. Trends Genet. 8:432-439.
[0244] Viera et al. 1982. Gene, 19, 259-268.
[0245] Wils et al. Biochem. Pharmacol. 48:1528-1530.
Sequence CWU 1
1
* * * * *