U.S. patent application number 10/226355 was filed with the patent office on 2003-06-05 for methods and compositions for selecting tag nucleic acids and probe arrays.
This patent application is currently assigned to AFFYMETRIX, INC.. Invention is credited to Davis, Ronald W., Mittmann, Michael P., Morris, MacDonald S., Shoemaker, Daniel D..
Application Number | 20030104436 10/226355 |
Document ID | / |
Family ID | 24509751 |
Filed Date | 2003-06-05 |
United States Patent
Application |
20030104436 |
Kind Code |
A1 |
Morris, MacDonald S. ; et
al. |
June 5, 2003 |
Methods and compositions for selecting tag nucleic acids and probe
arrays
Abstract
Methods of selecting tag nucleic acids and VLSIPS.TM. arrays and
the arrays made by the methods are used to label and track
compositions, including cells and viruses, e.g., in libraries of
cells or viruses. In addition to providing a way of tracking
compositions in mixtures, the tags facilitate analysis of cell and
viral phenotypes.
Inventors: |
Morris, MacDonald S.;
(Felton, CA) ; Shoemaker, Daniel D.; (Stanford,
CA) ; Davis, Ronald W.; (Palo Alto, CA) ;
Mittmann, Michael P.; (Palo Alto, CA) |
Correspondence
Address: |
MORGAN LEWIS & BOCKIUS LLP
1111 PENNSYLVANIA AVENUE NW
WASHINGTON
DC
20004
US
|
Assignee: |
AFFYMETRIX, INC.
|
Family ID: |
24509751 |
Appl. No.: |
10/226355 |
Filed: |
August 23, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10226355 |
Aug 23, 2002 |
|
|
|
08626285 |
Apr 4, 1996 |
|
|
|
6458530 |
|
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
B01J 2219/00626
20130101; B01J 2219/00621 20130101; B01J 2219/00702 20130101; B01J
2219/00659 20130101; B01J 2219/00639 20130101; B01J 2219/00529
20130101; B01J 2219/00612 20130101; C40B 40/06 20130101; B01J
2219/00542 20130101; B01J 19/0046 20130101; B01J 2219/0061
20130101; B01J 2219/00637 20130101; B01J 2219/0054 20130101; B01J
2219/00695 20130101; B01J 2219/00608 20130101; B01J 2219/00722
20130101; C12Q 1/6837 20130101; C40B 70/00 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 001/68 |
Claims
What is claimed is:
1. A method of selecting a set of tag nucleic acids with minimal
cross hybridization to a nucleic acid, said method comprising
providing a list of tag nucleic acids, and excluding nucleic acids
from the list of tag nucleic acids which cross hybridize to a
single complementary nucleic acid under stringent conditions,
thereby providing a set of selected tag nucleic acids with minimal
cross hybridization to the nucleic acid.
2. The method of claim 1, wherein the method of selecting tag
nucleic acids further comprises: selecting a first tag nucleic acid
from the list of tag nucleic acids; selecting a second tag nucleic
acid from the list of tag nucleic acids; comparing the sequence of
the first tag nucleic acid to the sequence of the second tag
nucleic acid; and, determining that the second tag nucleic acid
hybridizes to the complement of the first tag nucleic acid with a
selected thermal binding stability, thereby excluding the second
nucleic acid from the selected set of nucleic acid tags.
3. The method of claim 2, wherein the method comprises rejecting or
selecting each tag in the list of tags in order.
4. The method of claim 2, wherein tags are not selected if they
have more than 8 contiguous nucleotides in common with any previous
tag.
5. The method of claim 2, wherein the method comprises rejecting or
selecting tags in complementary pairs, wherein each selected tag
has a complementary selected tag.
6. The method of claim 1, wherein the method further comprises
selecting a thermal binding stability for the tags, and excluding
all tag nucleic acids from the list of tag nucleic acids which do
not have the selected thermal binding stability.
7. The method of claim 6, wherein the thermal binding stability is
selected by specifying a ratio of G+C to A+T nucleotides for the
tag nucleic acids, and specifying a length for the tag nucleic
acids.
8. The method of claim 1, wherein the method further comprises
excluding tags which contain self-complementary regions from the
list of tags.
9. The method of claim 6, wherein the regions of self
complementarity are greater than 4 nucleotides in length.
10. The method of claim 1, wherein the tags are between 15 and 30
nucleotides in length.
11. The method of claim 1, wherein the tags are between 10 and 100
nucleotides in length.
12. The method of claim 1, wherein the tags are 20 nucleotides in
length.
13. The method of claim 1, wherein the method further comprises
selecting a complementary probe nucleic acid for tags in the
selected tag set, wherein each tag sequence is complementary to one
probe sequence, and the thermal binding stability between each tag
and each complementary probe is substantially similar.
14. The method of claim 13, wherein all of the tags have the same
length and the same GC to AT ratio.
15. The method of claim 1, wherein the method further comprises
selecting a constant region subsequence shared by all tag nucleic
acids, thereby determining the nucleotide position of variable
nucleotides in the tags.
16. The method of claim 15, wherein the method further comprises
providing a set of probe nucleic acids by determining the
complement to each variable nucleotide in each tag nucleic acid,
and selecting a probe comprising a corresponding complementary
nucleotide for each nucleotide in the variable tag sequence, which
probe does not hybridize to the constant region of the tag nucleic
acid, thereby providing a selected set of probes.
17. The method of claim 1, wherein the method further comprises
removing tag nucleic acids which have fewer than two nucleotide
differences when aligned for maximal sequence correspondence.
18. The method of claim 17, wherein: the total number of
nucleotides in each of the selected sets is identical; the number
of G+C nucleotides in each tag in the selected set is identical;
and, the overall number of A+G nucleotides in each of the variable
regions of the tags is even.
19. The method of claim 1, wherein the method further comprises
removing tag nucleic acids which have fewer than 5 nucleotide
differences when aligned for maximal sequence correspondence.
20. The method of claim 1, wherein tags which contain 4 contiguous
nucleotides selected from the group consisting of 4 X residues, 4 Y
residues and 4 Z residues, are eliminated from the tag set, wherein
X is selected from the group consisting of G and C, Y is selected
from the group consisting of G and A, and Z is selected from the
group consisting of A and T.
21. A composition comprising a set of tag nucleic acids, which set
of tag nucleic acids comprises a plurality of tag nucleic acids,
which tag nucleic acids comprise a variable region; which variable
region for each tag nucleic acid in the set of tag nucleic acids
has the same T.sub.m, the same G+C to A+T ratio, the same length
and does not cross-hybridize to a probe nucleic acid; and, wherein
the tag nucleic acids in the set of tag nucleic acids cannot be
aligned with less than two differences between any two of the tag
nucleic acids in the set of tag nucleic acids.
22. The composition of claim 21, wherein the tags comprise a
constant region.
23. The composition of claim 21, wherein the variable region of
each of the tag nucleic acids in the tag set comprises less than
two C nucleotides.
24. The composition of set of claim 21, wherein the variable region
of the tag nucleic acids from the set of tag nucleic acids
comprises an even number of A+G nucleotides.
25. A method of labeling a composition, comprising associating a
tag nucleic acid with the composition, wherein the tag nucleic acid
is selected from a group of tag nucleic acids which do not
cross-hybridize and which have a substantially similar Tm.
26. The method of claim 25, further comprising detection of the tag
nucleic acid.
27. The method of claim 25, further comprising detection of the tag
nucleic acid by labeling the nucleic acid and hybridizing the
nucleic acid to a solid substrate, which substrate comprises an
array of probe nucleic acids selected to hybridize to the group of
tag nucleic acids.
28. The method of claim 25, further comprising amplification of the
tag nucleic acids, thereby providing amplified tag nucleic acids
and detection of the amplified tag nucleic acids by hybridization
to an array of probes complementary to the tag nucleic acids.
29. The method of claim 28, wherein the tag nucleic acids are
amplified using the polymerase chain reaction.
30. The method of claim 28, wherein the amplified tag nucleic acids
are labeled with a fluorescent label.
31. A method of pre-selecting experimental probes in an
oligonucleotide probe array, wherein the probes have substantially
uniform hybridization properties and do not cross hybridize,
comprising: selecting a ratio of G+C to A+T nucleotides shared by
the experimental probes in the array; determining all possible 4
nucleotide subsequences for variable nucleic acids in the probes of
the array; and excluding all probes from the array which contain
prohibited 4 nucleotide sub-sequences, wherein 4 nucleotide
subsequences are prohibited when the nucleotide subsequences are
selected from the group consisting of self-complementary probes,
A.sub.4 probes, T.sub.4 probes, [G,C].sub.4 probes, and probes
complementary to constant region sub-sequences.
32. The method of claim 31, wherein the method further comprises
selecting a length for the probes in the array, thereby providing
selected length probes; selecting a constant region subsequence
shared by all selected length probes in the array, thereby
determining the nucleotide position of variable nucleic acids in
the probes of the array; and providing that the overall number of
A+G nucleotides in the probes of the array is even.
33. The method of claim 31, wherein the method further comprises
selecting control probes for addition to the array.
34. A method of detecting a plurality of nucleic acids in a sample,
comprising (i) providing an array of experimental oligonucleotide
probes, which probes do not cross hybridize under stringent
conditions, wherein the ratio of G+C bases in each probe is
substantially identical; wherein the probes of the array are
arranged into probe sets in which each probe set comprises a
homogeneous population of oligonucleotide probes; (ii) hybridizing
said array of oligonucleotides to the sample under stringent
hybridization conditions; and (iii) detecting hybridization of the
nucleic acids to the array of oligonucleotide probes.
35. The method of claim 34, wherein the probes of the array
specifically hybridize to at least one nucleic acid in the
sample.
36. The method of claim 34, wherein the nucleic acids comprise tag
sequences, which tag sequences bind to the probes of the array.
37. An array of oligonucleotide probes comprising a plurality of
experimental oligonucleotide probe sets attached to a solid
substrate, wherein each experimental oligonucleotide probe set in
the array hybridizes to a different target nucleic acid under
stringent hybridization conditions; each oligonucleotide probe in
the probe sets of the array comprises a variable region; and
wherein the nucleic acid probes do not cross-hybridize in the
array.
38. The array of claim 37, wherein each probe set in the array a
constant region, wherein the variable region does not cross
hybridize with the constant region under stringent hybridization
conditions.
39. The array of claim 37, wherein each probe set in the array
differs from every other probe set in the array by the arrangement
of at least two nucleotides in the probes of the probe set.
40. The array of claim 37, wherein the ratio of G+C bases in each
probe for each experimental probe set is substantially
identical.
41. The array of claim 37, wherein the array comprises a plurality
of probe sets selected from the output group of probes produced by
running tags.ccp.
42. The array of claim 37, wherein the array further comprises a
nucleic acid bound to a probe in the array.
43. The array of claim 37, wherein the array further comprises
control probes.
44. A method of detecting a target nucleic acid comprising
providing a population of nucleic acids to an array of
oligonucleotide probes and monitoring hybridization of the test
nucleic acids to the probes in the array, wherein the array of
oligonucleotide probes comprises a plurality of experimental
oligonucleotide probe sets attached to a solid substrate, wherein
each experimental oligonucleotide probe set in the array hybridizes
to a different target nucleic acid under stringent hybridization
conditions; each oligonucleotide probe in the probe sets of the
array comprises variable region; and wherein the nucleic acid
probes do not cross-hybridize in the array.
45. The method of claim 44, wherein the probes of the array
comprise a constant region, wherein the variable region does not
cross hybridize with the constant region under stringent
hybridization conditions.
46. The method of claim 44, wherein the array comprises a control
probe, and wherein the method further comprises hybridizing a
nucleic acid complementary to the control probe to the array.
47. A plurality of recombinant cells comprising tag nucleic acids
selected from a set of tag nucleic acids, which set of tag nucleic
acids comprises a plurality of tag nucleic acids, which tag nucleic
acids comprise a variable region; which variable region for each
tag nucleic acid in the set of tag nucleic acids has the same
T.sub.m, the same G+C to A+T ratio, the same length and does not
cross-hybridize; and, wherein the tag nucleic acids in the set of
tag nucleic acids cannot be aligned with less than two differences
between any two of the tag nucleic acids in the set of tag nucleic
acids.
48. The recombinant cell of claim 47, wherein the tags further
comprise a constant region, wherein the variable region does not
cross hybridize with the constant region under stringent
hybridization conditions.
49. The recombinant cell of claim 47, wherein the cell is selected
from a library of genetically distinct recombinant cells.
50. The recombinant cell of claim 47, wherein the cell is a
eukaryotic cell.
51. The recombinant cell of claim 47, wherein the cell is a
prokaryotic cell.
52. The recombinant cell of claim 47, wherein the cell is a yeast
cell.
53. A kit comprising an array of oligonucleotides, wherein the
array of oligonucleotide probes comprises a plurality of
experimental oligonucleotide probe sets attached to a solid
substrate; each experimental oligonucleotide probe set in the array
hybridizes to a different target nucleic acid under stringent
hybridization conditions; each oligonucleotide probe in the probe
sets of the array comprises a variable region; and the nucleic acid
probes do not cross-hybridize in the array.
54. The kit of claim 53, wherein each oligonucleotide in the array
further comprises a constant region, wherein the variable region
does not cross hybridize with the constant region under stringent
hybridization conditions.
55. The kit of claim 53, wherein the kit further comprises a
plurality of tag nucleic acids complementary to the experimental
oligonucleotide probes in the array.
56. The kit of claim 53, wherein the array further comprises
control oligonucleotide probes.
57. The kit of claim 53, wherein the kit further comprises PCR
reagents, a container and instructions.
Description
COPYRIGHT NOTICE
[0001] A portion of the disclosure of this patent document contains
material which is subject to copyright protection. The copyright
owner has no objection to the facsimile reproduction by anyone of
the patent document or the patent disclosure as it appears in the
Patent and Trademark Office patent file or records, but otherwise
reserves all copyright rights whatsoever.
FIELD OF THE INVENTION
[0002] This invention provides sets of nucleic acid tags, arrays of
oligonucleotide probes, nucleic acid-tagged sets of recombinant
cells and other compositions, and methods of selecting
oligonucleotide probe arrays. The invention relates to the
selection and interaction of nucleic acids, and nucleic acids
immobilized on solid substrates, including related chemistry,
biology, and medical diagnostic uses.
BACKGROUND OF THE INVENTION
[0003] Methods of forming large arrays of oligonucleotides and
other polymers on a solid substrate are known. Pirrung et al., U.S.
Pat. No. 5,143,854 (see also PCT Application No. WO 90/15070),
McGall et al. U.S. Pat. No. 5,412,087, Chee et al. SN
PCT/US94/12305, and Fodor et al., PCT Publication No. WO 92/10092
describe methods of forming arrays of oligonucleotides and other
polymers using, for example, light-directed synthesis
techniques.
[0004] In the Fodor et at. publication, methods are described for
using computer-controlled systems to direct polymer array
synthesis. Using the Fodor approach, one heterogenous array of
polymers is converted, through simultaneous coupling at multiple
reaction sites, into a different heterogenous array. See also,
Fodor et al. (1991) Science, 251: 767-777; Lipshutz et al. (1995)
Bio Techniques 19(3): 442-447; Fodor et al. (1993) Nature 364:
555-556; and Medlin (1995) Environmental Health Perspectives
244-246. The arrays are typically placed on a solid surface with an
area less than 1 inch.sup.2, although much larger surfaces are
optionally used.
[0005] Additional methods applicable to polymer synthesis on a
substrate are described, e.g., in U.S. Pat. No. 5,384,261,
incorporated herein by reference for all purposes. In the methods
disclosed in these applications, reagents are delivered to the
substrate by flowing or spotting polymer synthesis reagents on
predefined regions of the solid substrate. In each instance,
certain activated regions of the substrate are physically separated
from other regions when the monomer solutions are delivered to the
various reaction sites, e.g., by means of groves, wells and the
like.
[0006] Procedures for synthesizing polymer arrays are referred to
herein as very large scale immobilized polymer synthesis
(VLSIPS.TM.) procedures. Oligonucleotide VLSIPS.TM. arrays are
useful, for instance, in a variety of procedures for monitoring
test nucleic acids in a sample. In probe arrays with multiple probe
sets, many distinct hybridization interactions can be monitored
simultaneously. However, unwanted hybridization between probes, or
between probes and other nucleic acids, can make analysis of
multiple hybridizations problematic. This invention solves these
and other problems.
SUMMARY OF THE INVENTION
[0007] With this invention it is now possible to label and detect
many individual components present, inter alia, in molecular,
cellular and viral libraries using a limited number of
hybridization conditions. Components are labeled with specially
selected nucleic acid tags, and the presence of individual tags is
monitored by hybridization to a probe array (typically a VLSIPS.TM.
array of oligonucleotide probes). Thus, the tag nucleic acids are
labels for the individual components, and the probe array provides
a label reader which permits simultaneous detection of a very large
number of tag nucleic acids. This facilitates massive parallel
analysis of all of the components in a mixture in a single
assay.
[0008] For instance, as explained herein, all of the members of a
cellular library can be tested for response to an environmental
stimulus using a mixture of all of the members of the cellular
library in a single assay. This is accomplished, e.g., by labeling
each member of the cellular library, e.g., by cloning a nucleic
acid tag into each cell type in the library, mixing each cell type
in the library in an appropriate solution, and exposing part of the
solution to the selected environmental stimulus. The distribution
of nucleic acids in the library before and after the environmental
stimulus is compared by hybridization of the nucleic acids to a
VLSIPS.TM. array, allowing for detection of cells which are
specifically affected by the environmental stimulus.
[0009] Accordingly, the present invention provides, inter alia, tag
nucleic acids, sets of tag nucleic acids, methods of selecting tag
nucleic acids, libraries of cells, viruses or the like containing
tag nucleic acids, arrays of oligonucleotide probes, arrays of
VLSIPS.TM. probes, methods of selecting arrays of oligonucleotide
probes, methods of detecting tag nucleic acids with VLSIPS.TM.
arrays and other features which will become clear upon further
reading.
[0010] In one class of embodiments, the invention provides a method
of selecting a set of tag nucleic acids designed for minimal cross
hybridization to a VLSIPS.TM. array. The absence of cross
hybridization facilitates analysis of hybridization patterns to
VLSIPS.TM. arrays, because it reduces ambiguities in the
interpretation of hybridization results which arise due to multiple
nucleic acid species binding to a single species of probe on the
VLSIPS.TM. array. Thus, in the selection methods of the invention,
potential tags are excluded from set of tags where they bind to the
same nucleic acid as selected tags under stringent conditions. The
selection methods typically include the steps of selecting a
specific thermal binding stability for the tag acids against
complementary probes, and excluding tags which contain
self-complementary regions. Often, the thermal binding stability of
the tags is selected by specifying parameters which influence
binding stability, such as the length and base composition (e.g.,
by selecting tags with the same AT to GC ratio of nucleotides) for
the tag nucleic acids is selected. In this regard, tags which form
more GC bonds upon binding a complementary probe require fewer
overall bases to have the same binding stability with a
complementary probe as tags which have fewer GC residues. Binding
stability is also affected by base stacking interactions, the
formation of secondary structures and the choice of solvent in
which a tag is bound to a probe.
[0011] The size of the tags can vary substantially, but is
typically from about 8-150 nucleotides, more typically between 10
and 100 nucleotides, often between about 15 and 30 nucleotides,
generally between about 15 and 25 nucleotides and, in one preferred
embodiment, about 20 nucleotides in length. In a few applications,
the tags are substantially longer than the probes to which they
hybridize. The use of longer tags increases the number of tags from
which non-cross hybridizing probes can be selected.
[0012] The tag nucleic acids are optionally selected to have
constant and variable regions, which facilitates elimination of
secondary structure arising from self-complementarity, and provides
structural features for cloning and amplifying the tags. For
instance, PCR binding sites or restriction enzyme sites are
optionally incorporated into constant regions in the tags. In other
embodiments, short constant regions are added in coding theory
methods to prevent misalignment of the tags. Constant regions are
optionally cleaved from the tag during processing steps, for
instance by cleaving the tag nucleic acids with class II
restriction enzymes.
[0013] Often it is desirable to eliminate tags which contain runs
of 4 nucleotides selected from the group consisting of 4 X residues
4 Y residues and 4 Z residues, where X is selected from the group
consisting of G and C, Y is selected from the group consisting of G
and A, and Z is selected from the group consisting of A and T. The
elimination of tags from a tag set which contain such runs of
nucleotides reduces the formation of secondary structure in the
selected tags in the tag set. In some embodiments, certain runs are
permitted, while others are excluded. For instance, in one
embodiment, runs of 4 A/T or G/C nucleotides are prohibited.
[0014] In many embodiments, tags which differ by fewer than about
80% of the total number of nucleotides which comprise the tags are
excluded. For instance, all selected tags in a selected tag set
preferably differ by at least about 4-5 nucleotides. It is also
desirable to exclude tags which share substantial regions of
sequence identity, because the regions of identity can
cross-hybridize to nucleic acids which have subsequence
complementary to the region of identity. For instance, where 20-mer
tags are identical over regions of 9 or more nucleotides, they are
typically excluded.
[0015] The tags in the tag sets of the invention typically differ
by at least two nucleotides, and preferably by 3-5 nucleotides for
a typical 20-mer. A list of tags which differ by at least two
nucleotides can be generated by pairwise comparison of each tag, or
by other methods. For instance, the tag sequences can be aligned
for maximal correspondence and tags with a single-mismatch
discarded. In one class of embodiments, the number of A+G
nucleotides in each of the variable regions of each of the tags is
selected to be even (or, alternatively, odd), providing a "parity
base" or "error correcting base" which provides that each tag have
at least two hybridization mismatches between every tag in the tag
set, and any individual complementary nucleic acid probe (other
than the probe which is a perfect complement to the tag). Other
methods of ensuring that at least two mismatches exist between
every tag in a tag set and any individual hybridization probe are
also appropriate.
[0016] In general, the selection of the tag nucleic acids
facilitates selection of the probe nucleic acids, e.g., on
VLSIPS.TM. arrays used to monitor the tag nucleic acids by
hybridization. Specifically, the probes on the array are selected
for their ability to hybridize to variable sequences in the set of
tag nucleic acids (the "variable" region of a tag which does not
include a constant region is the entire tag). Thus, all of the
rules for selection of tag nucleic acids can be applied to the
selection of probe nucleic acids, for example by performing the tag
selection steps and then determining the complementary set of probe
nucleic acids.
[0017] In another class of embodiments, the invention provides
compositions comprising sets of tag nucleic acids, which include a
plurality of tag nucleic acids. In preferred embodiments, the set
of tag nucleic acids comprises from 100-100,000 tags. Typically, a
tag set will include between about 500 and 15,000 tags. Usually,
the number of tags in a tag set is between about 5,000 and about
14,000 tags. In one preferred embodiment, a set of tags of the
invention comprises about 8,000-9,000 tags. The tag sequences
typically comprise a variable region, where the variable region for
each tag nucleic acid in the set of tag nucleic acids has the same
the same G+C to A+T ratio, approximately the same T.sub.m, the same
length and do not cross-hybridize to a single complementary probe
nucleic acid. Most typically, the tag nucleic acids in the set of
tag nucleic acids cannot be aligned with less than two differences
between any two of the tag nucleic acids in the set of tag nucleic
acids, and often at least 5 differences exist between any pair of
tags in a tag set. In one embodiment, the tags also comprise a
constant region such as a PCR primer binding site for amplification
of the tag.
[0018] In one class of embodiments, the invention provides a method
of labeling a composition, comprising associating a tag nucleic
acid with the composition, wherein the tag nucleic acid is selected
from a group of tag nucleic acids which do not cross-hybridize and
which have a substantially similar T.sub.m. Typically, the tag
labels are detected with a VLSIPS.TM. array which comprises probes
complementary to the tags used to label the composition.
[0019] As described herein, preferred compositions include
constituents of cellular, viral or molecular libraries such as
recombinant cells, recombinant viruses or polymers. However, one of
skill will readily appreciate that other compositions can also be
labeled using the nucleic acid tags of the invention, and the tags
detected using VLSIPS.TM. arrays. For instance, high denomination
currency can be labeled with a set of nucleic acid tags, and
counterfeits detected by monitoring hybridization of a wash of the
currency (or, e.g., a PCR amplification of attached nucleic acids
which encode tag sequences) with an appropriate VLSIPS.TM.
array.
[0020] In another class of embodiments, the invention provides
methods of pre-selecting experimental probes in an oligonucleotide
probe array, wherein the probes have substantially uniform
hybridization properties and do not cross hybridize to a target tag
nucleic acid. In the methods, a ratio of G+C to A+T nucleotides
shared by the experimental probes in the array is selected and all
possible 4 nucleotide subsequences for the probes of the array are
determined. All potential probes from the array which contain
prohibited 4 nucleotide sub-sequences are excluded from the
experimental probes of the array. 4 nucleotide subsequences are
prohibited when the nucleotide subsequences are selected from the
group consisting of self-complementary probes, A.sub.4 probes,
T.sub.4 probes, and [G,C].sub.4 probes. Also, where the target tag
nucleic acid comprises a constant region, all probes complementary
to the constant region sub-sequence of the target tag nucleic acid
are prohibited, and not present in the tag set. Typically, a length
for the probes in the array is selected, although non-hybridizing
portions of the probe (i.e., nucleotides which do not hybridize to
a target nucleic acid) optionally vary between different classes of
probes. "Experimental probes" hybridize to a target tag nucleic
acid, while "control" probes either do not hybridize to a target
tag nucleic acid, or bind to a nucleic acid which has hybridization
properties which differ from those of the target tag nucleic acids
in a tag nucleic acid set. For instance, control probes are
optionally used in VLSIPS.TM. arrays to check hybridization
stringency against a known nucleic acid.
[0021] In one class of methods of the invention, a plurality of
test nucleic acids are simultaneously detected in a sample. In the
methods, an array of experimental probes which do not cross
hybridize to a target under stringent conditions is used to detect
the target nucleic acids. Typically, the ratio of G+C bases in each
experimental probe is substantially identical. The probes of the
array are arranged into probe sets in which each probe set
comprises a homogeneous population of oligonucleotide probes. For
example, many individual probes with the same nucleotide sequence
are arranged in proximity to one another on the surface of an array
to form a particular geometric shape. Probe sets are arranged in
proximity to each other to form an array of probes, For instance,
where the probe array is a VLSIPS.TM. array, the probe sets are
optionally arranged into squares on the surface of a substrate,
forming a checkerboard pattern of probe sets on the substrate.
[0022] The probes of the array specifically hybridize to at least
one test nucleic acid in the sample under stringent hybridization
conditions. The method further comprises detecting hybridization of
the test nucleic acids to the array of oligonucleotide probes.
Typically, the test nucleic acids comprise tag sequences, which
bind to the experimental probes of the array.
[0023] In one class of embodiments, the invention provides an array
of oligonucleotide probes comprising a plurality of experimental
oligonucleotide probe sets attached to a solid substrate, wherein
each experimental oligonucleotide probe set in the array hybridizes
to a different target nucleic acid under stringent hybridization
conditions. Each experimental oligonucleotide probe in the probe
sets of the array comprises a constant region and a variable
region. The variable region does not cross hybridize with the
constant region under stringent hybridization conditions, and the
nucleic acid probes do not cross-hybridize to target nucleic acids.
Typically, the probes from each probe set differ from the probes of
every other probe set in the array by the arrangement of at least
two nucleotides in the probes of the probe set. Generally, the
ratio of G+C bases in each probe for each experimental probe set is
substantially identical (meaning that the G+C ratio does not vary
by more than 5%), thereby assuring that they hybridize to a target
with similar avidity under similar hybridization conditions. The
arrays optionally comprise control probes, e.g., to assess
hybridization conditions by monitoring binding of a known
quantitated nucleic acid to the control probe.
[0024] In another class of embodiments, the invention provides a
plurality of recombinant cells or recombinant viruses comprising
tag nucleic acids, which tag nucleic acids comprise a constant
region and a variable region. Typically, the variable region for
each tag nucleic acid in the set of tag nucleic acids has
approximately the same T.sub.m, (e.g., the same G+C to A+T ratio
and the same length) and does not cross-hybridize to a probe
nucleic acid. Different tag nucleic acids in the set of tag nucleic
acids found in the different recombinant cells cannot be aligned
with less than two differences between the tag nucleic acids.
Generally, the recombinant cells are selected from a library of
genetically distinct recombinant cells (eukaryotic, prokaryotic or
archaebacterial) or viruses. For example, in one class of preferred
embodiments, the cells are yeast cells. In another class of
preferred embodiments, the cells are of mammalian origin.
[0025] The present invention provides arrays of oligonucleotides
attached to solid substrates. Typically, the oligonucleotide probes
in the array are arranged into probe sets at defined locations in
the array to enhance signal processing of hybridization reactions
between the oligonucleotide probes and test nucleic acids in a
sample. The oligonucleotide arrays can have virtually any number of
different oligonucleotide sets, determined largely by the number or
variety of test nucleic acids or nucleic acid tags to be screened
against the array in a given application. In one group of
embodiments, the array has from 10 up to 100 oligonucleotide sets.
In other groups of embodiments, the arrays have between 100 and
10,000 sets. In certain embodiments, the arrays have between 10,000
and 100,000 sets, and in yet other embodiments the arrays have
between 100,000 and 1,000,000 sets. Most preferred embodiments will
have between 7,500 and 12,500 sets. For example in one preferred
embodiment, the arrays will comprise about 8,000 sets of
oligonucleotide probes. In preferred embodiments, the array will
have a density of more than 100 sets of oligonucleotides at known
locations per cm.sup.2, or more preferably, more than 1000 sets per
cm.sup.2. In some embodiments, the arrays have a density of more
than 10,000 sets per cm.sup.2.
[0026] The present invention also provides kits embodying the
inventive concepts outlined above. For example, kits of the
invention comprise any of the arrays, cells, libraries or tag sets
described herein. Also, because the methods of using the arrays and
tags optionally include PCR, LCR and other in vitro amplification
techniques for amplifying tag nucleic acids, the kits of the
invention optionally include reagents for practicing in vitro
amplification methods such as taq polymerase, nucleotides, computer
software with tag selection programs and the like. The kits also
optionally comprise nucleic acid labeling reagents, instructions,
containers and other items that will be apparent to one of skill
upon further reading.
BRIEF DESCRIPTION OF THE DRAWING
[0027] FIG. 1 is a Scanned image of a 1.28 cm by 1.28 cm
high-density array hybridized with a fluorescently labeled control
oligonucleotide. The array contains complementary sequences to
4,500 20mer tags selected as described in Table 1. Control
oligonucleotides are synthesized in the corners and in a cross-hair
pattern across the array to verify the uniformity of the synthesis
and the hybridization conditions. "DNA TAGS" was spelled out with
control oligonucleotides as well. The dark areas indicate the
location of the 4,500 20 base molecular tags. Note that there is no
cross-hybridization of the control oligonucleotide and the
molecular tag sequences.
[0028] FIG. 2 shows a PCR-targeting strategy used to generate
tagged deletion strains. (a) The ORF is identified from the
sequence information in the database. Regions immediately flanking
the ORF are used to generate the deletion strain. (b) The
selectable marker (kan.sup.r) is amplified using a pair of long
primers to generate an ORF specific deletion construct. The
up-stream 86mer primer consists of (5' to 3'): 30 bases of yeast
homology, an 18 base common tag priming site, a 20 base molecular
tag, and a 22 base sequence that is homologous to one side of the
marker. The down-stream oligonucleotides consists of 50 bases of
yeast homology to the other side of the targeted ORF and 16 bases
that are homologous to the other side of the marker. The dashed
lines representing the long oligonucleotides illustrates that the
primers are unpurified and are missing sequence on the 5' end. (c)
A second round of PCR with 20mers homologous to the ends of the
initial PCR product was used to "flush" the ragged ends generated
by unpurified oligonucleotide in the first round. (d) The resulting
marker flanked by yeast ORF homology on either side is transformed
directly into haploid yeast strain and homologous recombination
results in the replacement of the targeted ORF with the marker,
20mer tag, and tag priming site.
[0029] FIG. 3 shows oligonucleotides used to generate the ADE1
tagged deletion strain. Similar sets of oligonucleotides were
synthesized for the other ten auxotrophic ORFS
[0030] FIG. 4 shows transformation results and tag information for
eleven auxotrophic ORFS. Eight colonies from each transformation
were analyzed by replica plating and PCR the resulting targeting
efficiency is shown for each of the ORFS. The sequence and x,y
coordinates are shown for the molecular tags that were used to
uniquely label the different deletion strains.
[0031] FIG. 5 shows the Tag amplification strategy described in
Example 1. (a) A deletion pool was generated by combining equal
numbers of the eleven tagged deletion strains described in FIG. 3.
Genomic DNA isolated from a representative aliquot of the pool was
used as template for a tag amplification reaction. (b) Tags were
amplified using a single pair of primers that are homologous to the
common priming sites which flank each tag. One of the common
primers is labeled with 5' fluorescein and included in a 10-fold
excess over the unlabeled primer. (c) The asymmetric nature of the
PCR generates a population of single-stranded fluorescently labeled
60mer tag amplicons that are directly hybridized the high-density
20mer array which is then washed and scanned. (d) An actual scanned
image of the array shows the (predicted) hybridization pattern for
the tags with virtually no cross-hybridization on the rest of the
chip. A closeup view of the left hand corner shows the location of
the tags for each of the different deletion strains.
[0032] FIG. 6 shows the analysis of a deletion pool containing 11
tagged auxotrophic deletion strains. A deletion pool was generated
by combining equal numbers of cells from each of the 11 deletion
strains described in FIG. 3. Representative aliquots were grown in
(A) complete media (SDC), (B) media missing adenine (SDC-ADE), (C)
or media missing tryptophan (SDC-TRP). Cells were harvested at the
indicated time points and cenomic DNA was isolated. Tags were
amplified from the genomic DNA and labeled amplicons were directly
hybridized to the high-density array for 30 minutes, washed, and
scanned. A blowup of the upper left hand corner for each of the
scans is shown.
DEFINITIONS
[0033] Unless defined otherwise, technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton et al. (1994) Dictionary of Microbiology and Molecular
Biology, second edition, John Wiley and Sons (New York) and March
(March, Advanced Organic Chemistry Reactions, Mechanisms and
Structure 4th ed J. Wiley and Sons (New York, 1992) provides one of
skill with a general guide to many of the terms used in this
invention.
[0034] Although one of skill will recognize many methods and
materials similar or equivalent to those described herein which can
be used in the practice of the present invention, the preferred
methods and materials are described. For purposes of the present
invention, the following terms are defined below.
[0035] "Eukaryotic" cells are cells which contain at least one
nucleus in which the cell's genomic DNA is organized, or which are
the differentiated offspring of cells which contained at least one
nucleus. Eukaryotes are distinguished from prokaryotes which are
cellular organisms which carry their genomic DNA in the cell's
cytoplasm.
[0036] A "nucleoside" is a pentose glycoside in which the aglycone
is a heterocyclic base; upon the addition of a phosphate group the
compound becomes a nucleotide. The major biological nucleosides are
.beta.-glycoside derivatives of D-ribose or D-2-deoxyribose.
Nucleotides are phosphate esters of nucleosides which are acidic
due to the hydroxy groups on the phosphate. The polymerized
nucleotides deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)
store the genetic information which controls all aspects of an
organism's interaction with its environment. The nucleosides of DNA
and RNA are connected together via phosphate units attached to the
3 position of one pentose and the 5 position of the next
pentose.
[0037] A "nucleic acid" is a deoxyribonucleotide or ribonucleotide
polymer in either single- or double-stranded form, and unless
otherwise limited, encompasses known analogs of natural nucleotides
that function in a manner similar to naturally occurring
nucleotides.
[0038] An "oligonucleotide" is a nucleic acid polymer composed of
two or more nucleotides or nucleotide analogues. An oligonucleotide
can be derived from natural sources but is often synthesized
chemically. It is of any size.
[0039] An "oligonucleotide array" is a spatially defined pattern of
oligonucleotide probes on a solid support. A "preselected array of
oligonucleotides" is an array of spatially defined oligonucleotides
on a solid support which is designed before being constructed
(i.e., the arrangement of polymers on solid substrate during
synthesis is deliberate, and not random).
[0040] A "nucleic acid reagent" utilized in standard automated
oligonucleotide synthesis typically caries a protected phosphate on
the 3' hydroxyl of the ribose. Thus, nucleic acid reagents are
referred to as nucleotides, nucleotide reagents, nucleoside
reagents, nucleoside phosphates, nucleoside-3'-phosphates,
nucleoside phosphoramidites, phosphoramidites, nucleoside
phosphonates, phosphonates and the like. It is generally understood
that nucleotide reagents carry a protected phosphate group in order
to form a phosphodiester linkage.
[0041] A "protecting group" as used herein, refers to any of the
groups which are designed to block one reactive site in a molecule
while a chemical reaction is carried out at another reactive site.
More particularly, the protecting groups used herein can be any of
those groups described in Greene, et al., Protective Groups In
Organic Chemistry, 2nd Ed., John Wiley & Sons, New York, N.Y.,
1991, which is incorporated herein by reference. The proper
selection of protecting groups for a particular synthesis is
governed by the overall methods employed in the synthesis. For
example, in "light-directed" synthesis, discussed herein, the
protecting groups are typically photolabile protecting groups such
as NVOC, MeNPoc, and those disclosed in co-pending Application
PCT/US93/10162 (filed Oct. 22, 1993), incorporated herein by
reference. In other methods, protecting groups are removed by
chemical methods and include groups such as FMOC, DMT and others
known to those of skill in the art.
[0042] A "solid substrate" has a fixed organizational support
matrix, such as silica, polymeric materials, or glass. In some
embodiments, at least one surface of the substrate is partially
planar. In other embodiments it is desirable to physically separate
regions of the substrate to delineate synthetic regions, for
example with trenches, grooves, wells or the like. Example of solid
substrates include slides, beads and polymeric chips. A solid
support is "functionalized" to permit the coupling of monomers used
in polymer synthesis. For example, a solid support is optionally
coupled to a nucleoside monomer through a covalent linkage to the
3'-carbon on a furanose. Solid support materials typically are
unreactive during polymer synthesis, providing a substratum to
anchor the growing polymer. Solid support materials include, but
are not limited to, glass, silica, controlled pore glass (CPG),
polystyrene, polystyrene/latex, and carboxyl modified Teflon. The
solid substrates are biological, nonbiological, organic, inorganic,
or a combination of any of these, existing as particles, strands,
precipitates, gels, sheets, tubing, spheres, containers,
capillaries, pads, slices, films, plates, slides, etc. depending
upon the particular application. In light-directed synthetic
techniques, the solid substrate is often planar but optionally
takes on alternative surface configurations. For example, the solid
substrate optionally contains raised or depressed regions on which
synthesis takes place. In some embodiments, the solid substrate is
chosen to provide appropriate light-absorbing characteristics. For
example, the substrate may be a polymerized Langmuir Blodgett film,
functionalized glass, Si, Ge, GaAs, Gap, SiO.sub.2, SiN.sub.4,
modified silicon, or any one of a variety of gels or polymers such
as (poly)tetrafluoroethylene, (poly)vinylidendifluoride,
polystyrene, polycarbonate, or combinations thereof. Other suitable
solid substrate materials will be readily apparent to those of
skill in the art. Preferably, the surface of the solid substrate
will contain reactive groups, such as carboxyl, amino, hydroxyl,
thiol, or the like, More preferably, the surface is optically
transparent and has surface Si--OH functionalities, such as are
found on silica surfaces. A substrate is a material having a rigid
or semi-rigid surface. In spotting or flowing VLSIPS.TM.
techniques, at least one surface of the solid substrate is
optionally planar, although in many embodiments it is desirable to
physically separate synthesis regions for different polymers with,
for example, wells, raised regions, etched trenches, or the like.
In some embodiments, the substrate itself contains wells, trenches,
flow through regions, etc. which form all or part of the regions
upon which polymer synthesis occurs.
[0043] The term "recombinant" when used with reference to a cell or
virus indicates that the cell or virus encodes a DNA or RNA whose
origin is exogenous to the cell or virus. Thus, for example,
recombinant cells optionally express nucleic acids (e.g., RNA) not
found within the native (non-recombinant) form of the cell.
[0044] "Stringent" hybridization conditions are sequence dependent
and will be different with different environmental parameters (salt
concentrations, presence of organics etc.). Generally, stringent
conditions are selected to be about 5.degree. C. to 20.degree. C.
lower than the thermal melting point (T.sub.m) for the specific
nucleic acid sequence at a defined ionic strength and pH.
Preferably, stringent conditions are about 5.degree. C. to
10.degree. C. lower than the thermal melting point for a specific
nucleic acid bound to a complementary nucleic acid. The T.sub.m is
the temperature (under defined ionic strength and pH) at which 50%
of a nucleic acid (e.g., tag nucleic acid) hybridizes to a
perfectly matched probe. "Thermal binding stability" is a measure
of the temperature-dependent stability of a nucleic acid duplex in
solution. The thermal binding stability for a duplex is dependent
on the solvent, base composition of the duplex, number and type of
base pairs, position of base pairs in the duplex. length of the
duplex and the like.
[0045] "Stringent" wash conditions are ordinarily determined
empirically for hybridization of each set of tags to a
corresponding probe array. The arrays are first hybridized
(typically under stringent hybridization conditions) and then
washed with buffers containing successively lower concentrations of
salts, and/or higher concentrations of detergents, and/or at
increasing temperatures until the signal to noise ratio for
specific to non-specific hybridization is high enough to facilitate
detection of specific hybridization.
[0046] Stringent temperature conditions will usually include
temperatures in excess of about 30.degree. C., more usually in
excess of about 37.degree. C., and occasionally in excess of about
45.degree. C. Stringent salt conditions will ordinarily be less
than about 1000 mM, usually less than about 500 mM, more usually
less than about 400 mM, typically less than about 300 mM,
preferably less than about 200 mM, and more preferably less than
about 150 mM. However, the combination of parameters is more
important than the measure of any single parameter. See, e.g.,
Wetmur and Davidson (1968) J. Mol. Biol. 31:349-370 and Wetmur
(1991) Critical Reviews in Biochemistry and Molecular Biology
26(3/4), 227-259.
[0047] The term "identical" in the context of two nucleic acid
sequences refers to the residues in the two sequences which are the
same when aligned for maximum correspondence. Optimal alignment of
sequences for comparison can be conducted, e.g., by the local
homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482
(1981), by the homology alignment algorithm of Needleman and Wunsch
J. Mol. Biol. 48:443 (1970), by the search for similarity method of
Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988),
by computerized implementations of these algorithms (GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package,
Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by
inspection.
[0048] A nucleic acid "tag" is a selected nucleic acid with a
specified nucleic acid sequence. A nucleic acid "probe" hybridizes
to a nucleic acid "tag." In one typical configuration, nucleic acid
tags are incorporated as labels into biological libraries, and the
tag nucleic acids are detected using a VLSIPS.TM. array of probes.
Thus, the "tag" nucleic acid functions in a manner analogous to a
bar code label, and the VLSIPS.TM. array of probes functions in a
manner analogous to as a bar code label reader. A "list of tag
nucleic acids" is a pool of tag nucleic acids, or a representation
(i.e., an electronic or paper copy) of the sequences in the pool of
tag nucleic acids. The pool of tags can be, for instance, all
possible tags of a specified length (i.e., all 20-mers), or a
subset thereof.
[0049] A set of nucleic acid tags binds to a probe with "minimal
cross hybridization" when a single species (or "type") of tag in
the tag set accounts for the majority of all tags which bind to an
array comprising a probe species under stringent conditions.
Typically, about 80% or more of the tags bound to the probe species
are of a single species under stringent conditions. Usually about
90% or more of the tags bound to the probe species are of a single
species under stringent conditions. Preferably 95% or more of the
tags bound to the probe species are of a single species under
stringent conditions.
DETAILED DESCRIPTION OF THE INVENTION
[0050] The invention provides methods of selecting and detecting
sets of tag nucleic acids. In addition, the invention provides
arrays of probe nucleic acids for detecting tag nucleic acids, sets
of tag nucleic acids and cells which comprise tag nucleic acids.
The tag nucleic acids, probe nucleic acid arrays and cells
transformed with tag nucleic acids have a variety of uses. Most
commonly, the tag nucleic acids of the invention are used to tag
cells with known genotypic markers (mutants, polymorphisms, etc.),
and to track the effect of environmental changes on the viability
of tagged cells.
[0051] For instance, with the completion of the sequencing of S.
cerevisiae, thousands of open reading frames (ORFs) have been
identified. One strategy for identifying the function of the
identified ORFs is to create deletion mutants for each ORF,
followed by analysis of the resulting deletion mutants under a wide
variety of selective conditions. Typically, the goal of such an
analysis is to identify a phenotype that reveals the function of
the missing ORF. If the analysis were to be carried out for each
deletion mutant in a separate experiment, the required time and
cost for monitoring the effect of altering an environmental
parameter on each deletion mutant would be prohibitive. For
instance, to identify ORFs which are required for synthesis of an
amino acid, all of the thousands of ORF deletion mutants would be
individually tested for the ability of the mutant to grow in media
lacking the amino acid. Even if the analysis were carried out in a
parallel fashion using, e.g., 96-well plates, the effort required
to plate, organize, label and track each clone would be
prohibitive. The present invention provides a much more
cost-effective approach to screening cells.
[0052] In the methods of the invention, all of the thousands of
deletion mutants described above can be tested in parallel in a
single experiment. The deletion mutants are each tagged with a tag
nucleic acid, and the deletion mutants are then pooled. The pooled,
tagged deletion mutants are then simultaneously tested for their
response to an environmental stimulus (e.g., growth in medium
lacking an amino acid). The deletion cell-specific tags are then
read using a probe array such as a VLSIPS.TM. array. Thus, by
analogy, the deletion cell-specific nucleic acid tags act as bar
code labels for the cells and the VLSIPS.TM. array acts as a bar
code reader.
[0053] While the example above specifically discusses labeling
yeast cells, one of skill will appreciate that essentially any cell
type can be labeled with the nucleic acid tags of the invention,
including prokaryotes, eukaryotes, and archaebacteria. Also,
essentially any virus can be similarly labeled, as can cellular
organelles with nucleic acids (mitochondria, chloroplasts, etc.).
In fact, labeling by tag nucleic acids and detection by probe
arrays is not in any way limited to biological materials. One of
skill will recognize that many other compositions can also be
labeled by nucleic acid tags and detected with probe arrays.
Essentially anything which benefits from the attachment of a label
can be labeled and detected by the tags, arrays, and methods of the
invention. For instance, high denominational currency, original
works of art, valuable stamps, significant legal documents such as
wills, deeds of property, and contracts can all be labeled with
nucleic acid tags and the tags read using the probe arrays of the
invention. Methods of attaching and cleaving nucleic acids to and
from many substrates are well known in the art, including glass,
polymers, paper, ceramics and the like, and these techniques are
applicable to the nucleic acid tags of the invention.
[0054] One of skill will also appreciate that while many of the
examples herein describe the use of a single tag nucleic acid to
label a cell, multiple tags can also be used to label any cell,
e.g., by cloning multiple nucleic acid tags into the cell.
Similarly, multiple nucleic acid tags can be used to label a
substance such as those described above. Indeed, multiple labels
are typically preferred where the object of the nucleic acid tags
is to detect forgery. For instance, the nucleic acids of the
invention can be used to label a high denomination currency bill
with hundreds, or even thousands, of distinct tags, such that
visualization of the hybridization pattern of the tags on a
VLSIPS.TM. array provides verification that the currency bill is
genuine.
[0055] In certain embodiments, multiple probes bind to unique
regions on a single tag. In these embodiments, the probes are
typically relatively large, e.g., about 50 nucleotides or longer.
Probes are selected such that each probe binds to a single region
on a single tag. The use of tags which bind multiple probes
increases the informational content of hybridization reactions by
providing making it possible to monitor multiple hybridization
events simultaneously.
[0056] One of skill will also appreciate that it is not necessary
to hybridize a tag directly to a probe array to achieve essentially
the same effect. For instance, tag nucleic acids are optionally
(and preferably) amplified, e.g., using PCR or LCR or other known
amplification techniques, and the amplification products
("amplicons") hybridized to the array. For instance, a nucleic acid
tag optionally includes or is in proximity to PCR primer binding
sites which, when amplified using standard PCR techniques,
amplifies the tag nucleic acid, or a subsequence thereof. Thus,
cells, or other tagged items can be detected even if the tag
nucleic acids are present in very small quantities. One of skill
will appreciate that a single molecule of a nucleic acid tag can
easily be detected after amplification, e.g., by PCR. The
complexity reduction from amplifying a selected mixture of tags
(i.e., there are relatively few amplicon nucleic acid species as
compared to a pool of genomic DNA) facilitates analysis of the
mixture of tags.
[0057] In one preferred embodiment, tags are selected such that
each selected tag has a complementary selected tag. For example, if
a tag is cloned into an organism, the tag can be amplified using
LCR, PCR or other amplification methods. The amplified tag is often
double-stranded. In preferred embodiments, tag sets which include
complementary sets of tags have corresponding probes for each
complementary tag. Both strands of a double-stranded tag
amplification product are separately monitored by the probe array.
Hybridization of each of the strands of the double-stranded tag
provides an independent readout for the presence or absence of the
tag nucleic acid in a sample.
[0058] Selection of Tag Nucleic Acids.
[0059] This invention provides ways of selecting nucleic acid tag
sets useful for labeling cells and other compositions as described
above. The tag sets provided by the selection methods of the
invention have uniform hybridization characteristics (i.e., similar
thermal binding stability to complementary nucleic acids), making
the tag sets suitable for detection by VLSIPS.TM. and other probe
arrays, such as Southern or northern blots. Because the
hybridization characteristics of the tags are uniform, all of the
tags in the set are typically detectable using a single set of
hybridization and wash conditions. As described in the Examples
below, various selection methods of the invention were used to
generate lists of about 10,000 suitable 20-mer nucleic acid tags
from all of possible 20-mer sequences (about 1,200,000,000,000).
The synthesis of a single array with 10,000 probes complementary to
the 10,000 tag nucleic acids (i.e., for the detection of the tags)
was carried out using standard VLSIPS.TM. techniques to make a
VLSIPS.TM. array.
[0060] Desirable nucleic acid tag sets have several properties.
These include, inter alia, that the hybridization of the tags to
their complementary probe (i.e., in the VLSIPS.TM. array) is strong
and uniform; that individual tags hybridize only to their
complementary probes, and do not significantly cross hybridize with
probes complementary to other sequence tags; that if there are
constant regions associated with the tags (e.g., cloning sites, or
PCR primer binding sites) that the constant regions do not
hybridize to a corresponding probe set. If the selected tag set has
the described properties, any mixture of tags can be hybridized to
a corresponding array, and the absence or presence of the tag can
be unambiguously determined and quantitated. Another advantage to
such a tag set is that the amount of binding of any tag set can be
quantitated, providing an indication of the relative ratio of any
particular tag nucleic acid to any other tag nucleic acid in the
tag set.
[0061] The properties outlined above are obtained by following some
or all of the selection steps outlined below for selection of tag
sequence characteristics.
[0062] (1) Determine all possible nucleic acid tags of a selected
length, or with selected hybridization properties. Although the
examples below provide ways of selecting tags from pools of tags of
a single length for illustrative purposes, one of skill will
appreciate that the tags can have different lengths, e.g., where
the tags have the same (or closely similar) melting temperatures
against perfectly complementary targets. One of skill will also
appreciate that a subset of all possible tags can be used,
depending on the application. For instance, where tags are used to
detect an organism, 20mers which either occur in the organism's
genome, or do not occur in the organism's genome can be used as a
starting point for a pool of potential nucleic acid tags. For
instance, the entire genome of S. cerevisiae is available. In
certain embodiments, endogenous sequences (e.g., those which appear
in ORFs) can be used as tags, obviating the need for cloning tags
into the organism. Thus, all possible 20-mers from the genome are
determined from the genomic sequence, and 20-mers with desired
hybridization characteristics to probes are selected.
Alternatively, where tags are cloned into the organism, it is
occasionally preferable to eliminate all 20-mers which appear
naturally in the genome from consideration as tag sequences, so
that introduced tag sequences are not confused with endogenous
sequences in hybridization assays.
[0063] The selection of the length of the nucleic acid tag is
dependent on the desired hybridization and discrimination
properties of the probe array for detecting the tag. In general,
the longer the tag, the higher the stringency of the hybridization
and washes of the hybridized nucleic acids on the array. However,
longer tags are not as easily discriminated on the array, because a
single mismatch on a long nucleic acid duplex has less of a
destabilizing effect on hybridization than a single mismatch on a
short nucleic acid duplex. It is expected that one of skill is
thoroughly familiar with the theory and practice of nucleic acid
hybridization to an array of nucleic acids. In addition to the
patents and literature cited supra in regards to the synthesis of
VLSIPS.TM. arrays, Gait, ed. Oligonucleotide Synthesis: A Practical
Approach, IRL Press, Oxford (1984); W. H. A. Kuijpers Nucleic Acids
Research 18(17), 5197 (1994); K. L. Dueholm J. Org. Chem. 59,
5767-5773 (1994); S. Agrawal (ed.) Methods in Molecular Biology,
volume 20; and Tijssen (1993) Laboratory Techniques in biochemistry
and molecular biology--hybridization with nucleic acid probes,
e.g., part I chapter 2 "overview of principles of hybridization and
the strategy of nucleic acid probe assays", Elsevier, New York
provide a basic guide to nucleic acid hybridization.
[0064] Most typically, tags are between 8 and 100 nucleotides in
length, and preferably between about 10 and 30 nucleotides in
length. Most preferably, the tags are between 15 and 25 nucleic
acids in length. For example, in one preferred embodiment, the
nucleic acid tags are about 20 nucleotides in length.
[0065] (2) The tags are selected so that there is no
complementarity between any of the probes in an array selected to
hybridize to the tag set and any constant tag region (constant tag
regions are optionally provided to provide primer binding sites,
e.g. for PCR amplification of the remainder of the tag, or to limit
the selected tags as described below). In other words, the
complementary nucleic acid of the variable region of a nucleic acid
tag cannot hybridize to any constant region of the nucleic acid
tag. One of skill will appreciate that constant regions in tag
sequences are optional, typically being used where a PCR or other
primer binding site is used within the tag.
[0066] (3) The tags are selected so that no tag hybridizes to a
probe with only one sequence mismatch (all tags differ by at least
two nucleotides). Optionally, tags can be selected which have at
least 2 mismatches, 3 mismatches, 4 mismatches 5 mismatches or more
to a probe which is not perfectly complementary to the tag,
depending on the application. Typically, all tag sequences are
selected to hybridize only to a perfectly complementary probe, and
the nearest mismatch hybridization possibility has at least two
hybridization mismatches. Thus, the tag sequences typically differ
by at least two nucleotides when aligned for maximal
correspondence. Preferably, the tags differ by about 5 nucleotides
when aligned for maximal correspondence (e.g., where the tags are
20-mers).
[0067] The tags are often selected so that they do not have
identical runs of nucleotides of a specified length. For instance,
where the tags are 20-mers, the tags are preferably selected so
that no two tags have runs of about 9 or more nucleotides in
common. One of skill will appreciate that the length of prohibited
identity varies depending on the selected length of the tag. It was
empirically determined that cross-hybridization occurs in tag sets
when 20-mer tags have more than about 8 contiguous nucleotides in
common.
[0068] (4) The tags are selected so that there is no secondary
structure within the complementary probes used to detect the tags
which are complementary to the tags. Typically, this is done by
eliminating tags from a selected tag set which have subsequences of
4 or more nucleotides which are complementary.
[0069] (5) The tags are selected so that no secondary structure
forms between a tag and any associated constant sequence.
Self-complementary tags have poor hybridization properties in
arrays, because the complementary portions of the probes (and
corresponding tags) self hybridize (i.e., form hairpin
structures).
[0070] (6) The tags are selected so that probes complementary to
the tags do not hybridize to each other, thereby preventing duplex
formation of the tags in solution.
[0071] (7) If there is more than one constant region in the tag,
the constant regions of the tag are selected so that they do not
self-hybridize or form hairpin structures.
[0072] (8) Where the tags are of a single length, the tags are
selected so that they have roughly the same, and preferably exactly
the same overall base composition (i.e., the same A+T to G+C ratio
of nucleic acids). Where the tags are of differing lengths, the A+T
to G+C ratio is determined by selecting a thermal melting
temperature for the tags, and selecting an A+T to G+C ratio and
probe length for each tag which has the selected thermal melting
temperature.
[0073] One of skill will recognize that there are a variety of
possible ways of performing the above selection steps. Most
typically, selection steps are performed using simple computer
programs to perform the selection in each of the steps outlined
above; however, all of the steps are optionally performed manually.
The following strategies are provided for exemplary purposes; one
of skill will recognize that a variety of similar strategies can be
used to achieve similar results.
[0074] In one embodiment, secondary structure was prevented within
the tag, and hybridization within or between pairs of complementary
probes (goals 4, 5, and 6 above) was prevented by analyzing 4 base
subsequences within the tags which were dynamically excluded when
any of the following properties were met:
[0075] (a) all tags with complementary regions of 4 or more bases,
including those which overlap in sequence, and 4mers which are self
complementary. To prevent tag variable sequences from hybridizing
to the constant primer sequences, regions of 4 or more bases in a
tag which are complementary to 4 base sequences fully or partially
contained in the constant sequence which were separated by at least
3 bases (i.e., the minimal separation typically required for
hairpin formation) were prohibited.
[0076] (b) To assure uniformity of hybridization strength, runs of
4mers comprised only of 4 As, 4 Ts or 4 G or C residues were
prohibited. Excluding runs of T/A and G/A is also desirable.
[0077] Further selection is optionally performed to refine aspects
of the selection steps outlined above. For instance, to select tags
which are less likely to cross-hybridize, more fixed or restricted
bases can be added for alignment purposes, the tags can be
lengthened, and additional coding requirements can be imposed. In
one embodiment, the tags selected by the method above is performed,
and a subset of tags with reduced hybridization is selected. For
example, a first tag from the set generated above is selected, and
a second tag is selected from the tag set. If the second tag does
not cross-hybridize with the first tag the second tag remains in
the tag set. If it does cross-hybridize, the tag is discarded.
Thus, each tag from the group selected by the methods outlined
above is compared to every other tag in the group, and selected or
discarded based upon comparison of hybridization properties. This
process of comparison of one tag to every other possible tag in a
pool of tags is referred to as pairwise comparison. Similar to the
steps outlined above, cross-hybridization can be determined in a
dynamic programming method as used for the sequence alignment
above.
[0078] Refinement of the above methods include accounting for the
differences in destabilization caused by positional effects of
mismatches in the probe:tag duplex. The total number of mismatches
is not the best estimate of hybridization potential because the
amount of destabilization is highly dependent on both the positions
and the types of the mismatches; for example, two adjacent
mismatched bases in a 20 nucleotide duplex is generally less
destabilizing than two mismatches spread at equal intervals. A
better estimate of cross-hybridization potential can be obtained by
comparing the two tags directly using dynamic programming or other
methods. In these embodiments, a set of tag sequences obeying the
following rules (in which the presence of a constant region in the
tags is optional) is generated:
[0079] (A) All tags are the same length, N and have similar base
composition. Certain runs of bases and potential hairpin structures
are prohibited (see above).
[0080] (B) No two tag sequences contain an identical subsequence of
length n, for some threshold length n. The second rule allows fast
screening of the majority of cross-hybridizing probes (the
selection method is linear), leaving a short list for which each
pair of probes is compared for similarity (this takes the
proportional to the square of the number of probes). The method is
essentially an alphabetical tree search with the addition of an
array to keep track of which n-mers have been used in previously
generated tags. Each time the addition of a base to the growing tag
creates an n-mer already used in a previous tag, the method
backtracks and tries the next value of the base.
[0081] (C) In this step, pairs of tags are compared to each other
using a more sophisticated hybridization energy rule. For each pair
of tags, the energy of hybridization of each tag to the complement
of the other is calculated. If the energy exceeds a certain
threshold, one of the tags is removed from the list. Probes are
removed until there are no pairs within the list exceeding the
threshold. For instance, in one embodiment, the energy rule is as
follows: one point for a match (two adjacent matching base pairs),
-2 points for errors in which a single base is bulged out on one
strand, and -3 for all other errors including long and asymmetric
loops. The highest scoring alignment between each pair of tags was
determined using a dynamic programming algorithm with a
preprocessor requiring a short match of at least 5 bases to
initiate comparison.
[0082] More sophisticated energy rules can be incorporated in this
framework by refining the hybridization rules. In addition, more
complex rules for calculating the hybridization energy can be used
in any of the above procedures. See, Vesnaver et al. (1989) Proc.
Natl. Acad. Sci. USA 86, 3614-3618; Wetmur (1991) Critical Reviews
in Biochemistry and Molecular Biology 26(3/4), 227-259, and
Breslauer et al. (1986) Proc. Natl. Acad. Sci. USA 83,
3746-3750.
[0083] The set of tags chosen using pairwise comparison is not
unique. It depends on the order of evaluation of the tags. For
instance, if the tags are evaluated in alphabetical order, the
final list contains more tags beginning with A than with T. A more
sophisticated approach to generating the largest maximal set of
such tags can also be used involving Debruijn sequences (sequences
in which every n-mer for some length n occurs exactly once). For
example, a Debruijn sequence incorporating all n-mers could be
divided into 20mers with overlaps of n-1, giving the maximal number
of 20mers which do not have an nmer in common. This procedure is
modified to take into account the other goals for tags outlined
above. For example, runs of bases are typically removed from the
original Debruijn sequence, and 20mers with imbalanced base
composition or palindromes (which occur on a length scale greater
than n) are deleted in a post-processing step.
[0084] Many alternative procedures for Tag selection and exclusion
are possible. For example, all pairwise energies can be computed
before discarding any potential tags, and the tag which has the
most near-matches exceeding the energy threshold can be discarded.
The remaining tag with the most near-matches (not including those
to tags which have already been discarded) can be discarded. This
process is repeated until there are no near-matches remaining.
[0085] For example, in one preferred embodiment of the above
selection methods, the tags lack a constant region. Tags are
selected by selecting all possible n-mers (e.g., 20-mers), and
eliminating sequences which:
[0086] (i) have runs of 4x where x is an A, T, C, or G (e.g.,
AAAA);
[0087] (ii) have secondary structure in which a run of 4 contiguous
nucleotides have a complementary matching run of 4 nucleotides
within the tag; or
[0088] (iii) have a 9 base subsequence (or other selected number of
subsequences, typically from 5 to 15) in common with any other
tag.
[0089] All tags are then selected to have the same GC content,
thereby providing all tags with similar melting temperatures when
bound to a complementary probe. Performing the above steps limits
the number of tags in the tag set to a pool of about 50,000
potential tags where the tags are 20-mers.
[0090] A pair-wise selection strategy is then performed to yield a
final set of tags. In the pair-wise comparison, a first tag is
compared to every other tag in the tag set for hybridization to the
complement of the first tag. If the first tag binds to a target
with a hybridization threshold a selected value higher than every
other tag in the potential set it is kept. If another tag in the
potential tag set binds to the complement of the first tag with a
hybridization energy above the selected threshold, the first tag is
discarded. This process is repeated for every tag remaining in the
pool of potential tags. An exemplar computer program written in "C"
is provided in Example 4 (Tags895.ccp) which performs the above
selection steps. Varying the threshold resulted in sets of 0 to
50,000 tags. In one preferred embodiment, 9,000 tags were
generated.
[0091] More generally, tags (or probes complementary to the tags)
are selected by eliminating tags which cross-hybridize (bind to the
same nucleic acid with a similar energy of hybridization). Tags
bind complementary nucleic acids with a similar energy of
hybridization when a complementary nucleic acid to one tag binds to
another tag with an energy exceeding a specified threshold value,
e.g., where one tag is a perfect match to the probe, a second tag
is excluded if it binds the same probe with an energy of
hybridization which is similar to the energy of hybridization of
the perfect match probe. Typically if the second tag binds to the
probe with about 80-95% or greater the energy of a perfectly
complementary tag, or more typically about 90-95% or greater, or
most typically about 95% or greater, the tag is discarded from the
tag set. The calculated energy can be based upon the stacking
energy of various base pairs, the energy cost for a loop in the
hybridized probe-tag nucleic acid chain, and/or upon assigned
values for hybridization of base pairs, or on other specified
hybridization parameters. In Example 2 below, tags were selected by
eliminating similar tags from a long list of possible tags, based
upon hybridization properties-such as assigned stacking values for
tag:probe hybrids.
[0092] Methods which do not involve pairwise comparison are also
used. In one embodiment, the tags were selected to comprise a
constant portion and a variable portion. The variable portion of
the tag sequence was limited to sequences which comprise no more
than 1 C residue. The constant region of the tag sequence was
chosen to be 3'(ACTC).sub.4CC. This selection of specific sequences
satisfies goal 7 above (the constant region was selected such that
it is not self-complementary). One of skill will recognize that
other constant regions can be selected, for instance where a primer
binding site or restriction endonuclease site is incorporated into
the tags.
[0093] Goal 2 is also met, because the probe (which is
complementary to the variable portion of the tag) has no contiguous
region of hybridizing bases with the exception of a single AGT or
TGA sequence present on some of the probes, and even these
sequences are not adjacent to the variable region of the tag where
the primary hybridization occurs. In order to meet goals (1) and
(8), the tags are selected to have the same length and the same
total G+C content.
[0094] To prevent cross-hybridization between a tag and probes
complementary to other tags, a set of tags which could not be
aligned with less than two errors was chosen, wherein an "error" is
either a mismatch hybridization or an overhanging nucleotide. This
was done by fixing the sequence of the bases at the ends of the
tags. In particular, the bases at the ends of the tags were
constrained to be the same. The residues at the ends were
constrained to be the same. In particular, the bases were selected
to start at the 5' end with the residues GA, and to end at the 3'
end with either an A or T residue, followed by a G residue. This
arrangement prevents tags from matching probes with a single
overhanging nucleotide and no other errors, because an overhang
forces either a G-A or a G-T mismatch. This arrangement also
prevents tags from matching with a single deletion error, because a
single deletion would cause the probe and the tag to be misaligned
at one end, causing a mismatch. One of skill will appreciate that
this strategy can be modified in many ways to yield equivalent
results, e.g., by selecting bases to yield C-T or C-A
mismatches.
[0095] To prevent single mismatch errors in the tag-probe
hybridization the next to last base from the 5' end was selected so
that the number of As plus the number of Gs in the variable region
is even (as noted above, the next to last base from the 5' end is
either a T or an A). This base acts in a manner analogous to a
parity bit in coding theory by requiring at least two differences
exist between any two tags in the tag set. This is true because the
GC content of all of the selected tags is the same (see, above);
therefore, any base differences in the variable region have to
involve the substitution of G and C residues, or T and A residues.
However, the substitution of less than two bases leads to an odd
number of G+A residues. Thus, at least two bases differ between any
two tags in the tag set, satisfying (3) above. Similarly, the
strategy could be varied, e.g., by selecting a different residue in
the tag as the parity base which assigns whether the A+G content of
the tag is even, or by adjusting the strategy above to yield an
even number of T+G residues.
[0096] A computer program in the standard programming language "C"
was written to perform each of the selection steps. For
completeness, the program is provided as Example 3 below, but it is
expected that one of skill can design similar programs, or perform
the selection steps outlined above manually to achieve essentially
similar results. Tags.ccp uses a pruned tree search to find all
sequences meeting the goals above, rather than testing every
sequence of a selected length for the desired sequence
characteristics. While this provides an elegant selection program
with few processing steps, one of skill will recognize that other
programs can be used which test every potential tag for a desired
sequence. Tags.ccp selects tag sets depending upon a variety of
parameters including the constant sequence, the variable sequence,
the GC content, the goal that the A+G ratio be even, and the
relationship of the constant and variable regions in the tags of
the tag set. For instance, in one experiment, a constant and a
variable region were selected. The variable sequence length was
selected to be 15 nucleotides in length, the G+C content of the
variable region selected to be 7 nucleotides, and the A+G total
number of bases was selected to be even, with a pattern of
.sub.11[AT]?, where ? is a selected fixed base. The parameters
resulted in a set of about 8,000 tag sequences. e. The
parameters
[0097] More generally, the problem of designing a set of tag
sequences which do not cross-hybridize has strong similarities to
the problem of designing error-correcting codes in coding theory.
The primary difference is that insertions and deletions do not have
a correlate in coding theory. This problem, is accounted for as
shown above by having constant regions within the probe sequences.
The strategy is generalized by changing the location of the parity
bit, the required parity, or the locations of the constant regions.
More complex codes are also useful, for example codes which require
more differences between pairs of tags. See, Blahut (1983) Theory
and Practice of Error Control Codes Addison-Wesley Publishing
Company, Menlo Park, Calif.
[0098] One of skill will also recognize that pairwise comparison
methods are used in conjunction with any other selection method.
For instance, the tags generated according to specified rules such
as those implemented by tags.ccp can be further selected using any
of the pairwise comparison methods described herein.
[0099] Synthesis of Oligonucleotide Arrays
[0100] Oligonucleotide arrays are selected to have oligonucleotides
complementary to the tag nucleic acids described above. The
synthesis of oligonucleotide arrays generally is known. The
development of very large scale immobilized polymer synthesis
(VLSIPS.TM.) technology provides methods for arranging large
numbers of oligonucleotide probes in very small arrays. Pirrung et
al., U.S. Pat. No. 5,143,854 (see also PCT Application No. WO
90/15070), McGall et al., U.S. Pat. No. 5,412,087, Chee et al. SN
PCT/US94/12305, and Fodor et al., PCT Publication No. WO 92/10092
describe methods of forming vast arrays of oligonucleotides using,
for example, light-directed synthesis techniques. See also, Fodor
et al. (1991) Science 251:767-777; Lipshutz et al. (1995) Bio
Techniques 19(3): 442-447; Fodor et al. (1993) Nature 364: 555-556;
and Medlin (1995) Environmental Health Perspectives 244-246.
[0101] As described above, diverse methods of making
oligonucleotide arrays are known; accordingly no attempt is made to
describe or catalogue all known methods. For exemplary purposes,
light directed VLSIPS.TM. methods are briefly described below. One
of skill will understand that alternate methods of creating
oligonucleotide strays, such as spotting and/or flowing reagents
over defined regions of a solid substrate, bead based methods and
pin-based methods are also known and applicable to the present
invention (See, e.g., U.S. Pat. No. 5,384,261, incorporated herein
by reference for all purposes). In the methods disclosed in these
applications, reagents are typically delivered to the substrate by
flowing or spotting polymer synthesis reagents on predefined
regions of the solid substrate.
[0102] Light directed VLSIPS.TM. methods are found, e.g., in U.S.
Pat. Nos. 5,143,854 and 5,412,087. The light directed methods
discussed in the '854 patent typically proceed by activating
predefined regions of a substrate or solid support and then
contacting the substrate with a preselected monomer solution. The
predefined regions are activated with a light source, typically
shown through a photolithographic mask. Other regions of the
substrate remain inactive because they are blocked by the mask from
illumination. Thus, a light pattern defines which regions of the
substrate react with a given monomer. By repeatedly activating
different sets of predefined regions and contacting different
monomer solutions with the substrate, a diverse array of
oligonucleotides is produced on the substrate. Other steps, such as
washing unreacted monomer solution from the substrate, are used as
necessary.
[0103] The surface of a solid support is typically modified with
linking groups having photolabile protecting groups (e.g., NVOC or
MeNPoc) and illuminated through a photolithographic mask, yielding
reactive groups (e.g., typically hydroxyl groups) in the
illuminated regions. For instance, during oligonucleotide
synthesis, a 3'-O-phosphoramidite (or other nucleic acid synthesis
reagent) activated deoxynucleoside (protected at the 5'-hydroxyl
with a photolabile group) is presented to the surface and coupling
occurs at sites that were exposed to light in the previous step.
Following capping, and oxidation, the substrate is rinsed and the
surface illuminated through a second mask, to expose additional
hydroxyl groups for coupling. A second 5'-protected,
3'-O-phosphoramidite activated deoxynucleoside (or other
oligonucleotide monomer as appropriate) is then presented to the
resulting array. The selective photodeprotection and coupling
cycles are repeated until the desired set of oligonucleotides is
produced.
[0104] In addition to VLSIPS.TM. arrays, other probe arrays can
also be made. For instance, standard Southern or northern blotting
technology can be used to fix nucleic acid probes to various
substrates such as papers, nitrocellulose, nylon and the like.
Because the formation of large arrays using standard technologies
is difficult, VLSIPS.TM. arrays are preferred.
[0105] Making Tag Nucleic Acids and Oligonucleotides to be Coupled
into Arrays; Synthesis of Test Nucleic Acids; Cloning of Tag
Nucleic Acids into Cells
[0106] As described above, several methods for the synthesis of
oligonucleotide arrays are know. In preferred embodiments, the
oligonucleotides are synthesized directly on a solid surface as
described above. However, in certain embodiments, it is useful to
synthesize the oligonucleotides and then couple the
oligonucleotides to the solid substrate to form the desired array.
Similarly, nucleic acids in general (e.g., tag nucleic acids) can
be synthesized on a solid substrate and then cleaved from the
substrate, or they can be synthesized in solution (using chemical
or enzymatic procedures), or they can be naturally occurring (i.e.,
present in a biological sample).
[0107] Molecular cloning and expression techniques for making
biological and synthetic oligonucleotides and nucleic acids are
known in the art. A wide variety of cloning and expression and in
vitro amplification methods suitable for the construction of
nucleic acids are well-known to persons of skill. Examples of
techniques and instructions sufficient to direct persons of skill
through many cloning exercises for the expression and purification
of biological nucleic acids (DNA and RNA) are found in Berger and
Kimmel, Guide to Molecular Cloning Techniques, Methods in
Enzymology volume 152 Academic Press, Inc., San Diego, Calif.
(Berger); Sambrook et al. (1989) Molecular Cloning--A Laboratory
Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold
Spring Harbor Press, NY, (Sambrook); and Current Protocols in
Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a
joint venture between Greene Publishing Associates, Inc. and John
Wiley & Sons, Inc., (1994 Supplement) (Ausubel). Nucleic acids
such as Tag nucleic acids can be cloned into cells (thereby
creating recombinant tagged cells) using standard cloning protocols
such as those described in Berger, Sambrook and Ausbel.
[0108] Examples of techniques sufficient to direct persons of skill
through in vitro methods of nucleic acid synthesis and
amplification of tags and probes in solution, including enzymatic
methods such as the polymerase chain reaction (PCR), the ligase
chain reaction (LCR), Q.beta.-replicase amplification (QBR),
nucleic acid sequence based amplification (NASBA), strand
displacement amplification (SDA), the cycling probe amplification
reaction (CPR), branched DNA (bDNA) and other DNA and RNA
polymerase mediated techniques are known. Examples of these and
related techniques are found in Berger, Sambrook, and Ausubel, as
well as Mullis et al., (1987) U.S. Pat. No. 4,683,202; PCR
Protocols A Guide to Methods and Applications (Innis et al. eds)
Academic Press Inc. San Diego, Calif. (1990) (Innis); Arnheim &
Levinson (Oct. 1,1990); WO 94/11383; Vooijs et al. (1993) Am J.
Hum. Genet. 52: 586-597; C&EN 36-47; The Journal Of NIH
Research (1991) 3, 81-94; (Kwoh et al. (1989) Proc. Natl. Acad.
Sci. USA 86, 1173; Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87, 1874; Lomell et al. (1989) J. Clin. Chem 35, 1826;
Landegren et al., (1988) Science 241, 1077-1080; Van Brunt (1990)
Biotechnology 8, 291-294; Wu and Wallace, (1989) Gene 4, 560;
Sooknanan and Malek (1995) Bio/Technology 13, 563-564; Walker et
al. Proc. Natl. Acad. Sci. USA 89, 392-396), and Barringer et al.
(1990) Gene 89, 117. Improved methods of cloning in vitro amplified
nucleic acids are described in Wallace et al., U.S. Pat. No.
5,426,039. In one preferred embodiment, nucleic acid tags are
amplified prior to hybridization with VLSIPS.TM. arrays as
described above. For instance, where tag nucleic acids are cloned
into cells in a cellular library, the tags can be amplified using
PCR.
[0109] Standard solid phase synthesis of nucleic acids is also
known. Oligonucleotide synthesis is optionally performed on
commercially available solid phase oligonucleotide synthesis
machines (see, Needham-VanDevanter et al. (1984) Nucleic Acids Res.
12:6159-6168) or manually synthesized using the solid phase
phosphoramidite triester method described by Beaucage et. al.
(Beaucage et. al. (1981) Tetrahedron Letts. 22 (20): 1859-1862).
Finally, as described above, nucleic acids are optionally
synthesized using VLSIPS.TM. methods in arrays, and optionally
cleaved from the array. The nucleic acids can then be optionally
reattached to a solid substrate to form a second array where
appropriate, or used as tag nucleic acids where appropriate, or
used as tag sequences for cloning into a cell.
[0110] Labels
[0111] The term "label" refers to a composition detectable by
spectroscopic, photochemical, biochemical, immunochemical, or
chemical means. For example, useful nucleic acid labels include
32P, 35S, fluorescent dyes, electron-dense reagents, enzymes (e.g.,
as commonly used in an ELISA), biotin, dioxigenin, or haptens and
proteins for which antisera or monoclonal antibodies are
available.
[0112] A wide variety of labels suitable for labeling nucleic acids
and conjugation techniques are known and are reported extensively
in both the scientific and patent literature, and are generally
applicable to the present invention for the labeling of tag nucleic
acids, or amplified tag nucleic acids for detection by the arrays
of the invention. Suitable labels include radionucleotides,
enzymes, substrates, cofactors, inhibitors, fluorescent moieties,
chemiluminescent moieties, magnetic particles, and the like.
Labeling agents optionally include e.g., monoclonal antibodies,
polyclonal antibodies, proteins, or other polymers such as affinity
matrices, carbohydrates or lipids. Detection of tag nucleic acids
proceeds by any known method, including immunoblotting, tracking of
radioactive or bioluminescent markers, Southern blotting, northern
blotting, southwestern blotting, northwestern blotting, or other
methods which track a molecule based upon size, charge or affinity.
The particular label or detectable group used and the particular
assay are not critical aspects of the invention. The detectable
moiety can be any material having a detectable physical or chemical
property. Such detectable labels have been well-developed in the
field of gels, columns, solid substrates and in general, labels
useful in such methods can be applied to the present invention.
Thus, a label is any composition detectable by spectroscopic,
photochemical, biochemical, immunochemical, electrical, optical or
chemical means. Useful labels in the present invention include
fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red,
rhodamine, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, or
32P), enzymes (e.g., LacZ, CAT, horse radish peroxidase, alkaline
phosphatase and others, commonly used as detectable enzymes, either
as marker gene products or in an ELISA), nucleic acid intercalators
(e.g., ethidium bromide) and colorimetric labels such as colloidal
gold or colored glass or plastic (e.g. polystyrene, polypropylene,
latex, etc.) beads.
[0113] The label is coupled directly or indirectly to the desired
nucleic acid according to methods well known in the art. As
indicated above, a wide variety of labels are used, with the choice
of label depending on the sensitivity required, ease of conjugation
of the compound, stability requirements, available instrumentation,
and disposal provisions. Non radioactive labels are often attached
by indirect means. Generally, a ligand molecule (e.g., biotin) is
covalently bound to a polymer. The ligand then binds to an
anti-ligand (e.g., streptavidin) molecule which is either
inherently detectable or covalently bound to a signal system, such
as a detectable enzyme, a fluorescent compound, or a
chemiluminescent compound. A number of ligands and anti-ligands can
be used. Where a ligand has a natural anti-ligand, for example,
biotin, thyroxine, and cortisol, it can be used in conjunction with
labeled, anti-ligands. Alternatively, any haptenic or antigenic
compound can be used in combination with an antibody. Labels can
also be conjugated directly to signal generating compounds, e.g.,
by conjugation with an enzyme or fluorophore. Enzymes of interest
as labels will primarily be hydrolases, particularly phosphatases,
esterases and glycosidases, or oxidoreductases, particularly
peroxidases. Fluorescent compounds include fluorescein and its
derivatives, rhodamine and its derivatives, dansyl, umbelliferone,
etc. Chemiluminescent compounds include luciferin, and
2,3-dihydrophthalazinediones, e.g., luminol. Means of detecting
labels are well known to those of skill in the art. Thus, for
example, where the label is a radioactive label, means for
detection include a scintillation counter or photographic film as
in autoradiography. Where the label is a fluorescent label, it may
be detected by exciting the fluorochrome with the appropriate
wavelength of light and detecting the resulting fluorescence, e.g.,
by microscopy, visual inspection, via photographic film, by the use
of electronic detectors such as charge coupled devices (CCDs) or
photomultipliers and the like. For detection in VLSIPS.TM. arrays,
fluorescent labels and detection techniques, particularly
microscopy are preferred. Similarly, enzymatic labels may be
detected by providing appropriate substrates for the enzyme and
detecting the resulting reaction product. Finally, simple
colorimetric labels are often detected simply by observing the
color associated with the label. Thus, in various dipstick assays,
conjugated gold often appears pink, while various conjugated beads
appear the color of the bead.
[0114] Substrates
[0115] As mentioned above, depending upon the assay, the tag
nucleic acids, or probes complementary to tag nucleic acids can be
bound to a solid surface. Many methods for immobilizing nucleic
acids to a variety of solid surfaces are known in the art. For
instance, the solid surface is optionally paper, or a membrane
(e.g., nitrocellulose), a microtiter dish (e.g., PVC,
polypropylene, or polystyrene), a test tube (glass or plastic), a
dipstick (e.g. glass, PVC, polypropylene, polystyrene, latex, and
the like), a microcentrifuge tube, or a glass, silica, plastic,
metallic or polymer bead or other substrate as described herein,
The desired component may be covalently bound, or noncovalently
attached to the substrate through nonspecific bonding.
[0116] A wide variety of organic and inorganic polymers, both
natural and synthetic may be employed as the material for the solid
surface. Illustrative polymers include polyethylene, polypropylene,
poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene
terephthalate), rayon, nylon, poly(vinyl butyrate), polyvinylidene
difluoride (PVDF), silicones, polyformaldehyde, cellulose,
cellulose acetate, nitrocellulose, and the like. Other materials
which are appropriate depending on the assay include paper,
glasses, ceramics, metals, metalloids, semiconductive materials,
cements and the like. In addition, substances that form gels, such
as proteins (e.g., gelatins), lipopolysaccharides, silicates,
agarose and polyacrylamides can be used. Polymers which form
several aqueous phases, such as dextrans, polyalkylene glycols or
surfactants, such as phospholipids, long chain (12-24 carbon atoms)
alkyl ammonium salts and the like are also suitable. Where the
solid surface is porous, various pore sizes may be employed
depending upon the nature of the system.
[0117] In preparing the surface, a plurality of different materials
are optionally employed, e.g., as laminates, to obtain various
properties. For example, protein coatings, such as gelatin can be
used to avoid non specific binding, simplify covalent conjugation,
enhance signal detection or the like. If covalent bonding between a
compound and the surface is desired, the surface will usually be
polyfunctional or be capable of being polyfunctionalized.
Functional groups which may be present on the surface and used for
linking can include carboxylic acids, aldehydes, amino groups,
cyano groups, ethylenic groups, hydroxyl groups, mercapto groups
and the like. In addition to covalent bonding, various methods for
noncovalently binding an assay component can be used.
EXAMPLES
[0118] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill will readily
recognize a variety of noncritical parameters which could be
changed or modified to yield essentially similar results.
Example 1
Parallel Analysis of Deletion Strains of S. cerevisie
[0119] The complete sequence of the S. cerevisiae genome is known.
In the process of sequencing the genome, thousands of open reading
frames, representing potential genes or gene fragments were
identified. The function of many of these ORFs is unknown.
[0120] Gene disruption is a powerful tool for determining the
function of unknown ORFs in yeast. Given the sequence of an ORF, it
is possible to generate a deletion strain using standard gene
disruption techniques. The deletion strain is then grown under a
variety of selective conditions to identify a phenotype which
reveals the function of the missing ORF. However, individual
analysis of thousands of deletion strains to assess a large number
of selective conditions is impractical.
[0121] To overcome this problem, individual ORF deletions were
tagged with a distinguishing molecular tag. The deletion specific
tags were read by hybridization to a high density array of
oligonucleotide probes comprising probe sets complementary to each
tag.
[0122] The molecular tagging strategy involves a four-step approach
for generating tagged deletion strains that can be pooled and
analyzed in parallel through selective growth assays.
[0123] Individual deletion strains were generated using a
PCR-targeting strategy (Baudin, Ozier-Kalogeropoulos et al. 1993
Nuc. Acids Res. 21(14): 3329-3330). ORF specific molecular tags
were incorporated during the transformation (FIG. 2). Tagged
deletion strains were pooled and representative aliquots grown
under different selective conditions. The molecular tags were
amplified from the surviving strains and hybridized to a
high-density array containing complements to the tag sequences
(FIG. 2). The array was then washed and scanned using a highly
sensitive confocal microscope. The normalized signal for each tag
reflects the relative abundance of the different deletion strains
in the pool. The fitness of the deletion strains in the pool was
determined by comparing the hybridization patterns obtained before
and after the selective growth.
[0124] To test the feasibility of the molecular tagging strategy, a
list of 9,105 unique 20mer tag sequences was generated using the
computer program tags.ccp (See, below and Table 1).
1 TABLE 1 Properties of Number of selected 20 mers Selection
criteria 20 mers accepted All Possible None 1.2 .times. 10.sup.12
20 mers Primary No hairpins > 4 bp Similar Tm Filter (+/-
7.degree. C.) No single nucleotide runs > Good 51,081 4 bases
hybridization Similar base composition No extreme (4-6 of each
base) homology No common 9 mers Secondary Low stringency pair-wise
Unique 51.081 Filter analysis 9,105 -> . . (4,500 selected at
random) . . 2,643 . . 853 . . 170 Highest stringency Very unique 42
comparisons
[0125] A 1.28 cm.times.1.28 cm array comprising probes
complementary to the tag sequences was produced by standard
light-directed VLSIPS.TM. methods. The resulting high-density array
of probes provides probe sets at known locations in the array.
Fluorescence imaging using a scanning confocal microscope permitted
quantitation of the hybridization signals for each of the 4,500
sets of 20mers on the array (FIG. 1). Hybridization experiments
with 120 different fluorescently labeled 20mer oligonucleotides
showed that the arrays are sensitive, quantitative, and highly
specific.
[0126] As part of a feasibility study, tagged deletion strains were
generated for eleven characterized auxotrophic yeast genes (ADE1,
ADE2, ADE3, ADE4, ADE5, AROA, AR07, TRP2, TRP3, TRP4, and TPR5)
using the strategy described in FIG. 2. The oligonucleotides used
to generate the deletion strains are described in FIG. 3 and
transformation results are shown in FIG. 4.
[0127] The strains were pooled and grown in complete media and
different drop-out medias. Genomic DNA extracted from the pool
served as a template for an asymmetric tag amplification using a
pair of primers homologous to common regions flanking each tag
(FIG. 4). Depletion of specific strains from the pool was
quantitatively measured by hybridizing the amplified tags to the
high-density arrays (FIGS. 6A-C).
Example 2
A Method for Selecting Tags from a Pool of Tags
[0128] Tags (or probes complementary to the tags) are selected by
eliminating tags which bind to the same target with a similar
energy of hybridization. Tags bind complementary nucleic acids with
a similar energy of hybridization when a complementary nucleic acid
to one tag binds to another tag with an energy exceeding a
specified threshold value. The calculated energy is based upon,
e.g., the stacking energy of various base pairs, and the energy
cost for a loop in the chain, and/or upon assigned values for
hybridization of base pairs, or on other specified hybridization
parameters. In this example, tags were selected by eliminating
similar tags from a long list of possible tags, based upon
hybridization properties such as assigned stacking values for
tag:probe hybrids.
[0129] Probecmp was written to create a list of non-similar tags
from a long list of tags. Tags are considered to be similar if a
perfect match to one tag binds to another tag with an energy
exceeding some specified threshold. Probecmp incorporates three
distinct ideas in selecting tags. The ideas are:
[0130] 1) a stacking and loop cost model for the calculation of
hybridization energy;
[0131] 2) algorithms to quickly calculate that energy, including a
recursive, heavily pruned algorithm, and a dynamic programming
algorithm; and
[0132] 3) a hash table to quickly find perfect match segments.
[0133] The Stacking and Loop Cost Model for the Calculation of
Hybridization Energy
[0134] The calculated energy is based on the stacking energy of
various base pairs, and the energy cost for a loop in the chain.
E.g., the user can specify that the energy from an TA stacking is
2, and the GC and CG is 4, and AC, AG, TC, GT, or TG is 3. With
these values, A G G T A C G is worth 3+4+3+2+3+4=19. The energy
cost for loops is given by a matrix of the loop size on each
strand:
2 0 1 2 3 0 0 5 10 10 1 5 0 5 10 2 10 5 5 10 3 10 10 10 10
[0135] For example, if the following match occurs, there is a loop
size of 1 on the first strand and 0 on the second strand.
Examination of the table reveals a loop penalty of 5, and a
resulting stacking energy of 14.
3 C target: A G G T A C G tag: T C C A T G C
[0136] The Algorithms to Quickly Calculate the Energy of
Hybridization
[0137] The hybridization energy can be calculated using either a
recursive algorithm, or a dynamic programming algorithm. The
recursive algorithm is fast if the energy cost for loops is large
relative to the stacking energy. The dynamic programming algorithm
is fast if the energy cost for loops is small relative to the
stacking energy. 1
[0138] Both energy calculation algorithms start out with 2 tags
which have a multiple base perfect match sequence. They then
calculate the energy of the perfect match sequence, then find the
matches that lead to the highest energy before the perfect match
region, and after the perfect match region. The total matching
energy is the sum of these three energies. Since this model does
not have an implied direction, the same algorithm can be used for
both the before match energy, and the after match energy, by
reversing the orders of the before match fragments.
[0139] A Recursive, Heavily Pruned Algorithm
[0140] The recursive algorithm tries all match trees, looking at
all loop sizes that have a low enough cost that they can be paid
for with the maximum possible energy for the remaining matches.
Code for the algorithm is as follows:
4 /* linkSet is a structure listing locations of matching bases,
and the corresponding energy. */ static linkSet local *
calculateEnergyAndLinksFromPointon(short pp, short tp, char local *
tag, char local *target, short basesLeftInTag, short
basesLeftInTarget){ register short i, j; float tempEnergy,
bestEnergy = 0; linkSet *en, *returnValue = NULL; short maxTagLoop;
maxTagLoop = min(basesLeftInTag, maxLegalLoop + 1); // only check
legal loop sizes for(i = 0; i < maxTagLoop; i+'0){ // i is loop
size along tag // bother with loop is an array that has
precalculated the minimum number of base pairs needed to pay for
that loop size. for(j = 0; min(basesLeftlnTag - i,
basesLeftInTarget - j) > botherWithLoop[i][j]; j++){ // j is
loop size along target if((tag[pp + i + 1] & target[tp + j +
1])){ // this tests that the tag matches the target en =
calculateEnergyAndLinksFrompointon(pp + i + 1, tp + j + 1, tag,
target, basesLeftinTag - i-1, basesLeftinTarget - j-1); // if this
is the last match, and the stacking energy pays for the loop, and
is better than our previous best.... if(en = = NULL &&
(tempEnergy = (stackingEnergy[target[tp]][target[tp + j + 1]]-
loopEnergy[i][j])) > bestEnergy ){ returnValue = makeNewLinkset(
return Value ); return Value-> energy = bestEnergy = tempEnergy;
if(i = = 0 && j = = 0){ // add self and successor as link
firstLink( returnValue, 2, pp, tp); }else{ // add successor as link
firstLink( retumValue, 1, pp + i + 1, tp + j + 1); addNewLink(
returnValue, 1, pp, tp ); } }else if( (i = = 0) && (j = =
0)){ // new matching base pair is adjacent to old one // if the
stacking energy pays for the loop, and is better than our previous
best.... if( (tempEnergy = en-> energy +
stackingEnergy[target[tp]][target[t- p + j + 1]]- loopEnergy[i][j])
> bestEnergy){ en-> energy = bestEnergy = tempEnergy;
makeFirstLinkOneLonger( en ); if( returnValue != NULL ) farfree(
returnValue ); returnValue = en; }else // new energy to small,
don't want it, just free it. if( en != NULL) farfree( en ); }else{
// loop size is non-zero // if the stacking energy pays for the
loop, and is better than our previous best.... if( (tempEnergy =
en->energy + stackingEnergy[target[tp]][target[tp + j + 1]] -
loopEnergy[i][j]) > bestEnergy){ en-> energy = bestEnergy =
tempEnergy; if( returnValue != NULL ) farfree( returnValue);
returnValue = en; addNewLink( retumValue, 1, pp, tp ); }else // new
energy to small, don't want it, just free it. if( en != NULL )
farfree( en ); } } } } return return Value; }
[0141] A Dynamic Programming Algorithm
[0142] The dynamic programming algorithm starts out by making a
matrix of permitted or "legal" connections between the two
fragments. 2
[0143] Then, starting at the upper left corner, each legal
connection is considered, and all previous bases are identified.
Previous bases are any legal base pair in the rectangle to the
upper left of the considered base. In the figure below, the first
three legal matches have no previous legal connection except the
(assumed) perfect match which occurs before the mismatch
segment.
[0144] The values in those cells are replaced by the sum of the
stacking energy, and the loop cost.
[0145] Then the process is repeated for each legal connection
further out in the matrix. If there is more than one legal loop,
the loop with the maximum value is used. When this process is
finished, path that resulted in the maximum cell value is the best
match.
[0146] A Hash Table to Quickly Find Perfect Match Segments
[0147] To speed up the comparison of one tag with all other tags in
the list, the program uses a hash table which points to all
occurrences of any given n-mer in the set of tags. The hash table
is implemented as two arrays of structures which point to locations
in tags. The first array is 4 to the n records long, and the second
is the size of the complete list of tags.
[0148] Thus, a file is created with a list of all of the tags (or
probes) from which desired tags are to be selected. Typically, the
tags are listed one per line, in a column, e.g., with the heading
"probe" or "tag." The above analysis is performed on the file, and
an output file is produced based on the above method resulting in a
list of tags in which no tag hybridizes to the complement of any
other tag with a stacking energy which exceeds a specified
threshold.
Example 3
"Tags.ccp"
[0149] The computer program tags.ccp, written in "C" and referred
to above is provided below:
5 #include <stdio.h> #include <stdlib.h> #include
<math.h> #include <alloc.h> char out[] = "TAGS.OUT";
char hout[] = "HIST.OUT"; char label[] = "ACGT"; #define BASES 4
//number of nucleotides //the following numbers include all the
nonperiodic bases at the //end of the primer (in this case one C)
in addition to the tag #define PRETAG 0 //bases of primer preceding
tag #define LENGTH 20 //length of tag plus pretag #define GCLIM 11
//max total of G's and C's allowed #define ATLIM 11 //max total of
A's and T's allowed #define AALIM 7 //max total of A's allowed
#define CCLIM 6 //max total of C's allowed #define GGLIM 6 //max
total of G's allowed #define TTLIM 7 //max total of T's allowed
#define NUMERS 256 //number of fourmers #define LMAT 10 //length of
long matches prohibited #define LNUM 1048576L //number of longmers
#define MXNUM ( 32768 / sizeof(int)) short numVectors; int far **
lngVectors; int test_base(int current_base); int
remove_base_data(int current_base); int complement(int fourier);
double seq_to_int(void); int print_sequence(void); int
pattern[LENGTH][BASES]; //identifies allowed bases each position
int fourmers[NUMERS]; //identifies prohibited 4mers int
sequence[LENGTH]; //base at specified position int fourseq[LENGTH];
//fourmers ending at specified position long longseq[LENGTH];
//longmers ending at specified position int basecnt[BASES];
//number of occurrences of each base to left of //current_position
int spacings[LENGTH]; //position past (or =) to which an occurrence
of //a complementary fourmer to the one at this //position is
prohibited FILE *outfile,*houtfile; main( ) { int i,j,k,cbs;
//counters long temp,c_b; //temp storage of longmer int
cseq[LENGTH] = {2,0,0,0,1,0,0,0.2,0,2,2,2,3,2}; //sample tag long
xpas; //number of passes thru loop over 4 long maxtag; //max number
of different tags int current_base; //current sequence position
within backtracking int tag_count; //count of acceptable tag
sequences int pass; //flag for whether tag was acceptable int
exflag; //flag indicating completion of all possible tags double
cur_seq: //integer representation of current tag sequence double
prev_seq; //integer representation of previously tested tag int
histogram[LENGTH]; //histogram of mismatches to cseq int
mismatches; numVectors = (LNUM/MXNUM); lngVectors = (int * *)
farcalloc(numVectors. sizeof(int far *)); if(lng Vectors = = NULL)
{ printf("\nerror allocating lngVectors!"); exit(1); } for(i=0; i
< numVectors; ++i) { lngVectors[i] = (int * ) farcalloc(MXNUM,
sizeof(int)); if(IngVectazs[i] = = NULL) {
printfC".backslash.nerror allocating vectors: i =
%d.backslash.n",i); exit(1); } } //open output file outfile =
fopen(out,"wt"); if(NULL = = outfile) { printf("\nerror opening
output file %s\n",out); exit(1); } //open houtput file houtfile =
fopen(hout,"wt"); if(NULL = = houtfile) { printf("\nerror opening
output file %s\n",hout); fclose(outflle);exit(1); } //initialize
histogram for(i=0; i<LENGTH; + +i) histogram[i] = 0;
//initialize prattern array for(i=0; i<LENGTH; + +i) for(k=0;
k<BASES; + +k) pattern[i][k] = 1; //initialize 4mer array
for(i=0; i<NUMERS; ++i) fourmers[i] = 1000; //initialize 9mer
array for(i=0; i<LMAT; ++i) lngVectors[i/MXNUM][i%MXNUM] = 0;
//Runs marked fourmers[0] = fourmers[85] = fourmers[170] =
fourmers[255] = -1; //initialize sequence for(i = 0; i<LENGTH; +
+i) sequence[i] = 0; //initialize spacings to disregard incomplete
wards at beginning for(i=0; i<3; + +i) spacing[i] = 1000; //
(initialize spacings to require 6mer palindrome for(i=3;
i<LENGTH; + +i) spacing[i] = 1+2; //initialize base sequence,
current position,base count,tag count etc. //start at "largest"
sequence we know is wrong sequence[0] = -1; current_base = 0;
basecnt[0] = basecnt[1] = basecnt[2] = basecnt[3]= 0; tag_count =
0; prev_seq = -1; //initialize fourseq for fourmers up to
current_base //don't need to since it is at zero and it will be
reset //initialize fourmers for fourmers up to current_base //don't
need to do anything because only one is at zero and //it will be
removed shortly anyway //calculate maximum number of different tags
for(maxtag = 1,i=0; i<LENGTH-PRETAG-1; ++i) { maxtag *= BASES; }
printf("\nmaxtag = %1d\n",maxtag); //THIS IS A DEBUG STATEMENT!!
REMOVE LATER maxtag = (long) 10000000000; pass = 0; //until all
probes are exhausted for(j=0, xpas=0,exflag=0; exflag != 1
&& xpas<maxtag; ++j) { /* if(j= =4){ + +xpas; j=0; } */
//DEBUG //fprintf(outfile, "\nNOW: "); //print_sequence();
//backtrack to last incrementable base for(; sequence[current_base]
= = BASES-1 .vertline. .vertline. (pass== 1 &&
current_base>7); --current_base) { /remove current base data
remove_base_data(current_base); //set base to zero
sequence[current_base] = 0; } if(current_base < PRETAG) { exflag
= 1; continue; } //remove current base data
remove_base_data(current_base); //increment current_base
++sequence[current_base]; //error checking to ensure sequence is
increasing //DEBUG //fprintf(outfile, ".backslash.nUPD: ");
//print_sequence(); /* cur_seq = seq_to_int(); if(cur_seq <=
prev_seq) { print_sequence();
printf(".backslash.n.backslash.n!!ERRROR: current_base = %d,
cur_seq = %d, prev_seq = %d, j =
%d.backslash.n",current_base,cur_seq,prev_seq,j);
fclose(outfile);exit(1); } prev_seq = cur_seq; */ //update base
data and test until reach end or failure for(pass = 1; current_base
< LENGTH && pass == 1; ++current_base) pass =
test_base(current_base); //if testing was successful, print
sequence --current_base; //extra check to be sure not repeating
longmers if(pass == 1) { //record prohibitions on 9mers for(cbs =
LMAT-1; cbs < LENGTH; ++cbs) { c_b = longseq[cbs];
if(lngVectors[c_b/MXNUM][c_b%MXNUM]!= 0) {
printf(".backslash.n.backslash.n!!ERROR: already matching 9mer
found: c_b = %1d, current_base = %d, longseq = %1d". c_b, cbs,
longseq[cbs]); fclose(outfile);exit(1); } { //record longmer
prohibitions for(cbs = LMAT-1; cbs < LENGTH; ++cbs) { c_b =
longseq[cbs]; lngVectors[c_b/MXNUM][c_b%MXNUM] = 1; } //increment
tag count ++tag_count; //print tag sequence fprintf(outfile,
".backslash.n"); print_sequence(); /* //calculate mismatches with
ref sequence, cseq mismatches = 0; for(i=0; i <:LENGTH; ++i)
if(cseq[i] != sequence[i]) ++mismatches; ++histogram[mismatches];
if(mismatches <= 2) { fprintf(houtfile, ".backslash.n");
for(i=PRETAG; i<LENGTH; ++i) fprintf(houtfile,"%c",
label[sequence[i]]); } */ //fprintf(outfile," OK!"); } } //if
exited onj>=MAX record error and exit if(j>=maxtag)
printf(".backslash.n!!ERROR: exceeded allowable passes through
primary loop.backslash.n"); //print tag count fprintf(outfile,
".backslash.n.backslash.nTag Count: %d.backslash.n",tag_count);
for(i =0; i <LENGTH; ++i) fprintf(houtfile,".backslash.n%d
mismatches: %d",i,histogram[i]); fclose(outfile); fclose(houtfile);
return(1); } int test_base(int current_base) { int comp;
//complement long c_b; //increment base count (must be accomplished
before exiting this function) ++basecnt[sequence[current_base]];
//fprintf(outfile,"\nbase = %d ",current_base); //test base count,
return upon failure if(basecnt[0] + basecnt[53] > ATLIM) {
//fprintf(outfile, "failed AT limit"); return(0); } if(basecnt[1] +
basecnt[2] > GCLIM) { //fprintf(outfile,"failed GC limit");
return(0); } if(basecnt[0] > AALIM) { //fprintf(outfile, "failed
A limit"); return(0); } if(basecnt[1] > CCLIM) {
//fprintf(outfile,"failed C limit"); return(0); } if(basecnt[2]
> GGLIM) { //fprintf(outfile,"failed G limit"); return(0); }
if(basecnt[3] > TTLIM) { //fprintf(outfile,"failed T limit");
return(0); } /* //test if base matches patterns, return upon
failure if(pattern[current_base][sequence[c- urrent_base]] != 1) {
//fprintf(outfile, "failed pattern match"); return(0); } //if at
last base verify checksum if(current_base = = LENGTH-1) if(0 = =
((basecnt[0]+basecnt[2])%2)) { //fprintf(outfile, "failed
checksum"); return(0); } */ //compute current 4mer if(current_base
= = 0) fourseq[0] = sequence[current_base]; else
fourseq[current_base] (4*fourseq[current_base-1])%256 +
sequence[current_base]; //if this is a full 4mer check 4mer and
return upon failure if(current_base > 2) { comp =
complement(fourseq[current_base]- ); if(fourmers[comp] < =
current_base) { //fprintf(outfile,"fourmer failed:curt: %d, comp:
%d, spacing: %d", // fourseq[current_base],comp, fourmers[comp]);
return(0); } } //compute current 9mer if full 9mer if(current_base
= = 0) longseq[0] = sequence[current_base]; else
longseq[current_base] = (4*longseq[current_base-1])%LNUM +
sequence[current_base]; //if full longmer check 9mer and return
upon failure if(current_base > LMAT-2) { c_b =
longseq[current_base]; if(lngVectors[c_b/MXNUM][c_b%MXNUM]= =1) {
/printf("hello"); //Ifprintf(outfile,"longmer failed:c_b: %1d,
lngVectors[c_b]: %d",c_b,lngVectors[c_b]); return(0); } } //record
prohibitions on 4mer if(current_base > 2 &&
fourmers[fourseq[current_base]] > spacings[current_base])
fourmers[fourseq[current_base]] = spacings[current_base]; //all
tests passed!! Add new base: //fprintf(outfile, "passed!"):
//passed all tests return(1); } int remove_base_data(int
current_base) { int i; int curt; //current fourmer
if(sequence[current_base] < 0) return(1); //calculate complement
curt = fourseq[current_base]; //remove current 4mer prohibitions
if(fourmers[curt] > -1) fourmers[curt] = 1000; //reinstate
prohibitions for previous copies of this 4mer for(i=0;
i<current_base; ++i) { if(fourseq[i] = = curt) {
if(fourmers[curt] > spacings[i]) fourmers[curt] = spacings[i]; }
} //adjust base count --basecnt[sequence[current_base]]; return(1);
} int complement(int fourmer) { int i; int comp; //assuming
fourmers in four bases for(i=0, comp=0; i<4; ++i) { comp *= 4;
comp += 3-(fourmer%4); //add complement of base fourmer /= 4; }
return(comp); } double seq_to_int() { int i; double seq_int = 0;
//assumes 4 bases for(i=PRETAG; i<LENGTH; ++i) } seq_int *= 4;
seq_int += sequence[i]; //printf(".backslash.n%1d",seq_int); }
return(seq_int); } int print_sequence() { int i; for(i=PRETAG;
i<LENGTH; ++i) fprintf(outfile,"%c",label[sequence[i]]);
return(1); }
Example 4
Tags895.ccp
[0150] A preferred method of selecting probe arrays involves
discarding all probes from a pool of probes which have identical
9mer runs (thereby eliminating many tags which will
cross-hybridize), followed by pair-wise comparison of the remaining
tag nucleic acids and elimination of tags which hybridize to the
same target. An exemplar program (Tags895.ccp) written in "C" is
provided below.
6 #include <stdio.h> #include <stdlib.h> #include
<math.h> #include <alloc.h> char out[] = "TAGS.OUT";
char hout[] = "HIST.OUT"; char label[] = "ACGT"; #/define BASES 4
//number of nucleotides //the following numbers include all the
nonperiodic bases at the //end of the primer (in this case one C)
in addition to the tag #define PRETAG 0 //bases of primer preceding
tag #define LENGTH 20 //length of tag plus pretag #define GCLIM 11
//max total of G's and C's allowed #define ATLIM 11 //max total of
A's and T's allowed #define AALIM 7 //max total of A's allowed
#define CCLIM 6 //max total of C's allowed #define GGLIM 6 //max
total of G's allowed #define TTLIM 7 //max total of T's allowed
#define NUMERS 256 //number of fourmers #define LMAT 10 //length of
long matches prohibited #define LNUM 1048576L //number of longmers
#define MXNUM ( 32768 / sizeof(int)) short numVectors; int far **
lngVectors; int test_base(int current_base); int
remove_base_data(int current_base); int complement(int fourier);
double seq_to_int(void); int print_sequence(void); int
pattern[LENGTH][BASES]; //identifies allowed bases each position
int fourmers[NUMERS]; //identifies prohibited 4mers int
sequence[LENGTH]; //base at specified position int fourseq[LENGTH];
//fourmers ending at specified position long longseq[LENGTH];
//longmers ending at specified position int basecnt[BASES];
//number of occurrences of each base to left of //current_position
int spacings[LENGTH]; //position past (or =) to which an occurrence
of //a complementary fourier to the one at this //position is
prohibited FILE *outfile,*houtfile; main() { int i,j,k,cbs;
//counters long temp,c_b; //temp storage of longmer int
cseq[LENGTH] = {2,0,0,0,1,0,0,0.2,0,2,2,2,3,2}; //sample tag long
xpas; //number of passes thru loop over 4 long maxtag; //max number
of different tags int current_base; //current sequence position
within backtracking int tag_count; //count of acceptable tag
sequences int pass; //flag for whether tag was acceptable int
exflag; //flag indicating completion of all possible zags double
cur_seq: //integer representation of current tag sequence double
prev_seq; //integer representation of previously tested tag int
histogram[LENGTH]; //histogram of mismatches to cseq int
mismatches; numVectors = (LNUM/MXNUM); lngVectors = (int * *)
farcalloc(numVectors. sizeof(int far 4*)); if(lng Vectors = = NULL)
{ printf(*\nerror allocating lngVectors!*); exit(1); } for(i=0; i
< numVectors; ++i) { lngVectors[i] = (int * ) farcalloc(MXNUM,
sizeof(int)); if(IngVectazs[i] = = NULL) {
printfC".backslash.nerror allocating vectors: i =
%d.backslash.n",i); exit(1); } } //open output file outfile =
fopen(out,"wt"); if(NULL = = outfile) { printf("\nerror opening
output file %s\n",out); exit(1); } //open houtput file houtfile =
fopen(hout,"wt"); if(NULL = = hovtfile) { printf("\nerror opening
output file %s\n",hout); fclose(outflle);exit(1); } //initialize
histogram for(i=0; i<LENGTH; ++i) histogram[i] = 0; //initialize
4mer array for(i=0; i<LENGTH; ++i) for(k=0; k<BASES; ++k)
pattern[i][k] = 1; //initialize 4mer array for(i=0; i<NUMERS;
++i) fourmers[i] = 1000; //initialize 9mer array for(i=0;
i<LMAT; ++i) lngVectors[i/MXNUM][i%MXNUM] = 0; //Runs marked
founners[0] = fourmers[85]= fourmers[170] = fourmers[255] = -1;
//initialize sequence for(i =0; i<LENGTH; ++i) sequence[i] = 0;
//initialize spacings to disregard incomplete wards at beginning
for(i=0; i<3; ++i) spacing[i] = 1000; // (initialize spacings to
require 6mer palindrome for(i=3; i<LENGTH; ++i) spacing[i] =
1+2; //initialize base sequence, current position,base count,tag
count etc. //start at "largest" sequence we know is wrong
sequence[0] = -1; current_base = 0; basecnt[0] = basecnt[1] =
basecnt[2] = basecnt[3]= 0; tag_count = 0; prev_seq = -1;
//initialize fourseq for fourmers up to current_base //don't need
to since it is at zero and it will be reset //initialize fourmers
for fourmers up to current_base //don't need to do anything because
only one is at zero and //it will be removed shortly anyway
//calculate maximum number of different tags for(maxtag = 1,i=0;
i<LENGTH-PRETAG-1; ++i) { maxtag *= BASES; } printf("\nmaxtag =
%1d\n",maxtag); //THIS IS A DEBUG STATEMENT!! REMOVE LATER maxtag =
(long) 10000000000; pass = 0; //until all probes are exhausted
for(j=0, xpas=0,exflag=0; exflag != 1 && xpas<maxtag;
++j) { /* if(j= =4){ + +xpas; j=0; } */ //DEBUG //fprintf(outfile,
"\nNOW: "); //print_sequence(); //backtrack to last incrementable
base for(; sequence[current_base] = = BASES-1 .vertline. .vertline.
(pass== 1 && current_base>7); --current_base) { /remove
current base data remove_base_data(current_base); //set base to
zero sequence[current_base] = 0; } if(current_base < PRETAG) {
exflag = 1; continue; } //remove current base data
remove_base_data(current_base); //increment current_base
++sequence[current_base]; //error checking to ensure sequence is
increasing //DEBUG //fprintf(outfile, ".backslash.nUPD: ");
//print_sequence(); /* cur_seq = seq_to_int(); if(cur_seq <=
prev_seq) { print_sequence();
printf(".backslash.n.backslash.n!!ERRROR: current_base = %d,
cur_seq = %d, prev_seq = %d, j =
%d.backslash.n",current_base,cur_seq,prev_seq,j);
fclose(outfile);exit(1); } prev_seq = cur_seq; */ //update base
data and test until reach end or failure for(pass = 1; current_base
< LENGTH && pass == 1; ++current_base) pass =
test_base(current_base); //if testing was successful, print
sequence --current_base; //extra check to be sure not repeating
longmers if(pass == 1) { //record prohibitions on 9mers for(cbs =
LMAT-1; cbs < LENGTH; ++cbs) { c_b = longseq[cbs];
if(lngVectors[c_b/MXNUM][c_b%MXNUM]!= 0) {
printf(".backslash.n.backslash.n!!ERROR: already matching 9mer
found: c_b = %1d, current_base = %d, longseq = %1d". c_b, cbs,
longseq[cbs]); fclose(outfile);exit(1); } { //record longmer
prohibitions for(cbs = LMAT-1; cbs < LENGTH; ++cbs) { c_b =
longseq[cbs]; lngVectors[c_b/MXNUM][c_b%MXNUM] = 1; } //increment
tag count ++tag_count; //print tag sequence fprintf(outfile,
".backslash.n"); print_sequence(); /* //calculate mismatches with
ref sequence, cseq mismatches = 0; for(i=0; i <:LENGTH; ++i)
if(cseq[i] != sequence[i]) ++mismatches; ++histogram[mismatches];
if(mismatches <= 2) { fprintf(houtfile, ".backslash.n");
for(i=PRETAG; i<LENGTH; ++i) fprintf(houtfile,"%c",
label[sequence[i]]); } */ //fprintf(outfile," OK!"); } } //if
exited onj>=MAX record error and exit if(j>=maxtag)
printf(".backslash.n!!ERROR: exceeded allowable passes through
primary loop.backslash.n"); //print tag count fprintf(outfile,
".backslash.n.backslash.nTag Count: %d.backslash.n",tag_count);
for(i =0; i <LENGTH; ++i) fprintf(houtfile,".backslash.n%d
mismatches: %d",i,histogram[i]); fclose(outfile); fclose(houtfile);
return(1); } int test_base(int current_base) { int comp;
//complement long c_b; //increment base count (must be accomplished
before exiting this function) ++basecnt[sequence[current_base]];
//fprintf(outfile,"\nbase = %d ",current_base); //test base count,
return upon failure if(basecnt[0] + basecnt[53] > ATLIM) {
//fprintf(outfile, "failed AT limit"); return(0); } if(basecnt[1] +
basecnt[2] > GCLIM) { //fprintf(outfile,"failed GC limit");
return(0); } if(basecnt[0] > AALIM) { //fprintf(outfile, "failed
A limit"); return(0); } if(basecnt[1] > CCLIM) {
//fprintf(outfile,"failed C limit"); return(0); } if(basecnt[2]
> GGLIM) { //fprintf(outfile,"failed G limit"); return(0); }
if(basecnt[3] > TTLIM) { //fprintf(outfile,"failed T limit");
return(0); } /* //test if base matches patterns, return upon
failure if(pattern[current_base][sequence[c- urrent_base]] != 1) {
//fprintf(outfile, "failed pattern match"); return(0); } //if at
last base verify checksum if(current_base = = LENGTH-1) if(0 = =
((basecnt[0]+basecnt[2])%2)) { //fprintf(outfile, "failed
checksum"); return(0); } */ //compute current 4mer if(current_base
= = 0) fourseq[0] = sequence[current_base]; else
fourseq[current_base] (4*fourseq[current_base-1])%256 +
sequence[current_base]; //if this is a full 4mer check 4mer and
return upon failure if(current_base > 2) { comp =
complement(fourseq[current_base]- ); if(fourmers[comp] < =
current_base) { //fprintf(outfile,"fourmer failed:curt: %d, comp:
%d, spacing: %d", // fourseq[current_base],comp, fourmers[comp]);
return(0); } } //compute current 9mer if full 9mer if(current_base
= = 0) longseq[0] = sequence[current_base]; else
longseq[current_base] = (4*longseq[current_base-1])%LNUM +
sequence[current_base]; //if full longmer check 9mer and return
upon failure if(current_base > LMAT-2) { c_b =
longseq[current_base]; if(lngVectors[c_b/MXNUM][c_b%MXNUM]= =1) {
/printf("hello"); //Ifprintf(outfile,"longmer failed:c_b: %1d,
lngVectors[c_b]: %d",c_b,lngVectors[c_b]); return(0); } } //record
prohibitions on 4mer if(current_base > 2 &&
fourmers[fourseq[current_base]] > spacings[current_base])
fourmers[fourseq[current_base]] = spacings[current_base]; //all
tests passed!! Add new base: //fprintf(outfile, "passed!"):
//passed all tests return(1); } int remove_base_data(int
current_base) { int i; int curt; //current fourmer
if(sequence[current_base] < 0) return(1); //calculate complement
curt = fourseq[current_base]; //remove current 4mer prohibitions
if(fourmers[curt] > -1) fourmers[curt] = 1000; //reinstate
prohibitions for previous copies of this 4mer for(i=0;
i<current_base; ++i) { if(fourseq[i] = = curt) {
if(fourmers[curt] > spacings[i]) fourmers[curt] = spacings[i]; }
} //adjust base count --basecnt[sequence[current_base]]; return(1);
} int complement(int fourmer) { int i; int comp; //assuming
fourmers in four bases for(i=0, comp=0; i<4; ++i) { comp *= 4;
comp += 3-(fourmer%4); //add complement of base fourmer /= 4; }
return(comp); } double seq_to_int() { int i; double seq_int = 0;
//assumes 4 bases for(i=PRETAG; i<LENGTH; ++i) } seq_int *= 4;
seq_int += sequence[i]; //printf(".backslash.n%1d",seq_int); }
return(seq_int); } int print_sequence() { int i; for(i=PRETAG;
i<LENGTH; ++i) fprintf(outfile,"%c",label[sequence[i]]);
return(1); }
[0151] A truncated output list is provided below:
7 **/SAMPLE OUTPUT FILE FOR TAGS895.CPP/** AAACAAACACCCGCGTGGTT
AAACAAAGACCCGCCGGTGT AAACAAATACCCGCCGTGGG AAACAACAACCCGCGTGTGG
AAACAACCAACCCGGTGTGG AAACAACGAACCCGCTGGTG AAACAACTAACCCGCTGTGG
AAACAAGAACCCGCCGTTGG AAACAAGCAACCCGGCGTGT AAACAAGGAACCCGCCTGGT
AAACAAGTAACCCGCCTTTG AAACAATAACCCGCGCTGGG AAACAATCAACCCGCTTGGG
AAACAATGAACCCGCGTCGG AAACAATTAACCCGCGTTCG AAACACAAACCCGGCTGGTG
AAACACACAACCCGTGGTGG AAACACAGAACCCGCTTTGG AAACACATAACCCGGCGGTG
AAACACCAAACCCGTTGTGG AAACACCCAAACCGTTGTGG AAACACCGAAACCCTGTGGG
AAACACCTAAACCCTTGTGG AAACACGAAACCCGGTCGGT AAACACGCAAACCCGGTGGT
AAACACGGAAACCCTCGGTG AAACACGTAAACCCGTCGGT AAACACTAAACCCGTGCGGT
AAACACTCAAACCCTGGTGG AAACACTGAAACCCGTCTGG AAACACTTAAACCCGTTCGG
AAACAGAAACCCGCTCGGTG AAACAGACAACCCGGCTTGG AAACAGAGAACCCGGCCTTG
AAACAGATAACCCGCTCTTG AAACAGCAAACCCGTGGCGT AAACAGCCAAACCGCGTGGT
//many lines removed here//
[0152] Tag Count: 14507
[0153] All publications and patent applications cited in this
specification are herein incorporated by reference for all purposes
as if each individual publication or patent application were
specifically and individually indicated to be incorporated by
reference.
[0154] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Sequence CWU 1
1
* * * * *