U.S. patent application number 10/223085 was filed with the patent office on 2003-05-29 for compositions and methods for the diagnosis and treatment of disorders involving angiogenesis.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Baker, Kevin P., Ferrara, Napoleone, Gerber, Hanspeter, Gerritsen, Mary E., Goddard, Audrey, Godowski, Paul J., Gurney, Austin L., Hillan, Kenneth J., Marsters, Scot A., Pan, James, Stephan, Jean-Philippe F., Watanabe, Colin K., Williams, P. Mickey, Wood, William I., Ye, Weilan.
Application Number | 20030100497 10/223085 |
Document ID | / |
Family ID | 22161840 |
Filed Date | 2003-05-29 |
United States Patent
Application |
20030100497 |
Kind Code |
A1 |
Baker, Kevin P. ; et
al. |
May 29, 2003 |
Compositions and methods for the diagnosis and treatment of
disorders involving angiogenesis
Abstract
Compositions and methods are disclosed for stimulating or
inhibiting angiogenesis and/or cardiovascularization in mammals,
including humans. Pharmaceutical compositions are based on
polypeptides or antagonists thereto that have been identified for
one or more of these uses. Disorders that can be diagnosed,
prevented, or treated by the compositions herein include trauma
such as wounds, various cancers, and disorders of the vessels
including atherosclerosis and cardiac hypertrophy. In addition, the
present invention is directed to novel polypeptides and to nucleic
acid molecules encoding those polypeptides. Also provided herein
are vectors and host cells comprising those nucleic acid sequences,
chimeric polypeptide molecules comprising the polypeptides of the
present invention fused to heterologous polypeptide sequences,
antibodies which bind to the polypeptides of the present invention
and to methods for producing the polypeptides of the present
invention.
Inventors: |
Baker, Kevin P.;
(Darnestown, MD) ; Ferrara, Napoleone; (San
Francisco, CA) ; Gerber, Hanspeter; (San Francisco,
CA) ; Gerritsen, Mary E.; (San Mateo, CA) ;
Goddard, Audrey; (San Francisco, CA) ; Godowski, Paul
J.; (Hillsborough, CA) ; Gurney, Austin L.;
(Belmont, CA) ; Hillan, Kenneth J.; (San
Francisco, CA) ; Marsters, Scot A.; (San Carlos,
CA) ; Pan, James; (Etobicoke, CA) ; Stephan,
Jean-Philippe F.; (Millbrae, CA) ; Watanabe, Colin
K.; (Moraga, CA) ; Williams, P. Mickey; (Half
Moon Bay, CA) ; Wood, William I.; (Hillsborough,
CA) ; Ye, Weilan; (Foster City, CA) |
Correspondence
Address: |
GENENTECH, INC.
1 DNA WAY
SOUTH SAN FRANCISCO
CA
94080
US
|
Assignee: |
Genentech, Inc.
|
Family ID: |
22161840 |
Appl. No.: |
10/223085 |
Filed: |
August 16, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10223085 |
Aug 16, 2002 |
|
|
|
10081056 |
Feb 20, 2002 |
|
|
|
10081056 |
Feb 20, 2002 |
|
|
|
PCT/US01/21735 |
Jul 9, 2001 |
|
|
|
10081056 |
Feb 20, 2002 |
|
|
|
PCT/US01/19692 |
Jun 20, 2001 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/183; 435/320.1; 435/325; 514/13.3; 514/16.4; 514/18.9;
514/19.3; 514/9.4; 530/350; 536/23.2 |
Current CPC
Class: |
C07K 14/47 20130101;
C12N 5/06 20130101; C07H 21/04 20130101; C12N 9/00 20130101; C12P
21/02 20130101; A61K 38/17 20130101; C07K 14/435 20130101 |
Class at
Publication: |
514/12 ; 530/350;
536/23.2; 435/69.1; 435/183; 435/320.1; 435/325 |
International
Class: |
A61K 038/17; C07K
014/435; C12P 021/02; C12N 005/06; C07H 021/04; C12N 009/00 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule having at least 80% nucleic
acid sequence identity to a nucleotide sequence that encodes an
amino acid sequence selected from the group consisting of the amino
acid sequence shown in FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO:
4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID
NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16
(SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20),
FIG. 22 (SEQ ID NO: 22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID
NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32
(SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36),
FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID
NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48
(SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52),
FIG. 54 (SEQ ID NO: 54), FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID
NO: 58), FIG. 60 (SEQ ID NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64
(SEQ ID NO: 64), FIG. 66 (SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68),
FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID
NO: 74), FIG. 76 (SEQ ID NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80
(SEQ ID NO: 80), FIG. 82 (SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84),
FIG. 86 (SEQ ID NO: 86), FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID
NO: 90), FIG. 92 (SEQ ID NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96
(SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO:
100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG.
106 (SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID
NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114),
FIG. 116 (SEQ ID NO: 116), FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ
ID NO: 120), FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ ID NO: 124),
FIG. 126 (SEQ ID NO: 126), FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ
ID NO: 130), FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ ID NO: 134),
FIG. 136 (SEQ ID NO: 136), FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ
ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ ID NO: 144),
FIG. 146 (SEQ ID NO: 146), FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ
ID NO: 150), FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ ID NO: 154),
FIG. 156 (SEQ ID NO: 156), FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ
ID NO: 160), FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ ID NO: 164),
FIG. 166 (SEQ ID NO: 166), FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ
ID NO: 170), FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ ID NO: 174),
FIG. 176 (SEQ ID NO: 176), FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ
ID NO: 180), FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ ID NO: 184),
FIG. 186 (SEQ ID NO: 186), FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ
ID NO: 190), FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ ID NO: 194),
FIG. 196 (SEQ ID NO: 196), FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ
ID NO: 200), FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ ID NO: 204),
FIG. 206 (SEQ ID NO: 206), FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ
ID NO: 210), FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ ID NO: 214),
FIG. 216 (SEQ ID NO: 216), FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ
ID NO: 220), FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ ID NO: 224),
FIG. 226 (SEQ ID NO: 226), FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ
ID NO: 230), FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ ID NO: 234),
FIG. 236 (SEQ ID NO: 236), FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ
ID NO: 240), FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ ID NO: 244),
FIG. 246 (SEQ ID NO: 246), FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ
ID NO: 250), FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ ID NO: 254),
FIG. 256 (SEQ ID NO: 256), FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ
ID NO: 260), FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ ID NO: 264),
FIG. 266 (SEQ ID NO: 266), FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ
ID NO: 270), FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ ID NO: 274),
FIG. 276 (SEQ ID NO: 276), FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ
ID NO: 280), FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ ID NO: 284),
FIG. 286 (SEQ ID NO: 286), FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ
ID NO: 290), FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ ID NO: 294),
FIG. 296 (SEQ ID NO: 296), FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ
ID NO: 300), FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ ID NO: 304),
FIG. 306 (SEQ ID NO: 306), FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ
ID NO: 310), FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ ID NO: 314),
FIG. 316 (SEQ ID NO: 316), FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ
ID NO: 320), FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ ID NO: 324),
FIG. 326 (SEQ ID NO: 326), FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ
ID NO: 330), FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ ID NO: 334),
FIG. 336 (SEQ ID NO: 336), FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ
ID NO: 340), FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ ID NO: 344),
FIG. 346 (SEQ ID NO: 346), FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ
ID NO: 350), FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ ID NO: 354),
FIG. 356 (SEQ ID NO: 356), FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ
ID NO: 360), FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ ID NO: 364),
FIG. 366 (SEQ ID NO: 366), FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ
ID NO: 370), FIG. 372 (SEQ ID NO: 372) and FIG. 374 (SEQ ID NO:
374).
2. An isolated nucleic acid molecule having at least 80% nucleic
acid sequence identity to a nucleotide sequence selected from the
group consisting of the nucleotide sequence shown in FIG. 1 (SEQ ID
NO: 1), FIG. 3 (SEQ ID NO: 3), FIG. 5 (SEQ ID NO: 5), FIG. 7 (SEQ
ID NO: 7), FIG. 9 (SEQ ID NO: 9), FIG. 11 (SEQ ID NO: 11), FIG. 13
(SEQ ID NO: 13), FIG. 15 (SEQ ID NO: 15), FIG. 17 (SEQ ID NO: 17),
FIG. 19 (SEQ ID NO: 19), FIG. 21 (SEQ ID NO: 21), FIG. 23 (SEQ ID
NO: 23), FIG. 25 (SEQ ID NO: 25), FIG. 27 (SEQ ID NO: 27), FIG. 29
(SEQ ID NO: 29), FIG. 31 (SEQ ID NO: 31), FIG. 33 (SEQ ID NO: 33),
FIG. 35 (SEQ ID NO: 35), FIG. 37 (SEQ ID NO: 37), FIG. 39 (SEQ ID
NO: 39), FIG. 41 (SEQ ID NO: 41), FIG. 43 (SEQ ID NO: 43), FIG. 45
(SEQ ID NO: 45), FIG. 47 (SEQ ID NO: 47), FIG. 49 (SEQ ID NO: 49),
FIG. 51 (SEQ ID NO: 51), FIG. 53 (SEQ ID NO: 53), FIG. 55 (SEQ ID
NO: 55), FIG. 57 (SEQ ID NO: 57), FIG. 59 (SEQ ID NO: 59), FIG. 61
(SEQ ID NO: 61), FIG. 63 (SEQ ID NO: 63), FIG. 65 (SEQ ID NO: 65),
FIG. 67 (SEQ ID NO: 67), FIG. 69 (SEQ ID NO: 69), FIG. 71 (SEQ ID
NO: 71), FIG. 73 (SEQ ID NO: 73), FIGS. 75A-75B (SEQ ID NO: 75),
FIG. 77 (SEQ ID NO: 77), FIG. 79 (SEQ ID NO: 79), FIG. 81 (SEQ ID
NO: 81), FIG. 83 (SEQ ID NO: 83), FIG. 85 (SEQ ID NO: 85), FIG. 87
(SEQ ID NO: 87), FIG. 89 (SEQ ID NO: 89), FIG. 91 (SEQ ID NO: 91),
FIG. 93 (SEQ ID NO: 93), FIG. 95 (SEQ ID NO: 95), FIG. 97 (SEQ ID
NO: 97), FIG. 99 (SEQ ID NO: 99), FIG. 101 (SEQ ID NO: 101), FIG.
103 (SEQ ID NO: 103), FIG. 105 (SEQ ID NO: 105), FIG. 107 (SEQ ID
NO: 107), FIG. 109 (SEQ ID NO: 109), FIG. 111 (SEQ ID NO: 111),
FIG. 113 (SEQ ID NO: 113), FIG. 115 (SEQ ID NO: 115), FIG. 117 (SEQ
ID NO: 117), FIG. 119 (SEQ ID NO: 119), FIG. 121 (SEQ ID NO: 121),
FIG. 123 (SEQ ID NO: 123), FIG. 125 (SEQ ID NO: 125), FIG. 127 (SEQ
ID NO: 127), FIG. 129 (SEQ ID NO: 129), FIG. 131 (SEQ ID NO: 131),
FIG. 133 (SEQ ID NO: 133), FIG. 135 (SEQ ID NO: 135), FIG. 137 (SEQ
ID NO: 137), FIG. 139 (SEQ ID NO: 139), FIG. 141 (SEQ ID NO: 141),
FIG. 143 (SEQ ID NO: 143), FIG. 145 (SEQ ID NO: 145), FIG. 147 (SEQ
ID NO: 147), FIG. 149 (SEQ ID NO: 149), FIG. 151 (SEQ ID NO: 151),
FIG. 153 (SEQ ID NO: 153), FIG. 155 (SEQ ID NO: 155), FIG. 157 (SEQ
ID NO: 157), FIG. 159 (SEQ ID NO: 159), FIG. 161 (SEQ ID NO: 161),
FIG. 163 (SEQ ID NO: 163), FIG. 165 (SEQ ID NO: 165), FIG. 167 (SEQ
ID NO: 167), FIG. 169 (SEQ ID NO: 169), FIG. 171 (SEQ ID NO: 171),
FIG. 173 (SEQ ID NO: 173), FIG. 175 (SEQ ID NO: 175), FIG. 177 (SEQ
ID NO: 177), FIG. 179 (SEQ ID NO: 179), FIG. 181 (SEQ ID NO: 181),
FIG. 183 (SEQ ID NO: 183), FIG. 185 (SEQ ID NO: 185), FIG. 187 (SEQ
ID NO: 187), FIG. 189 (SEQ ID NO: 189), FIG. 191 (SEQ ID NO: 191),
FIG. 193 (SEQ ID NO: 193), FIG. 195 (SEQ ID NO: 195), FIG. 197 (SEQ
ID NO: 197), FIG. 199 (SEQ ID NO: 199), FIG. 201 (SEQ ID NO: 201),
FIG. 203 (SEQ ID NO: 203), FIG. 205 (SEQ ID NO: 205), FIG. 207 (SEQ
ID NO: 207), FIG. 209 (SEQ ID NO: 209), FIG. 211 (SEQ ID NO: 211),
FIG. 213 (SEQ ID NO: 213), FIG. 215 (SEQ ID NO: 215), FIG. 217 (SEQ
ID NO: 217), FIG. 219 (SEQ ID NO: 219), FIG. 221 (SEQ ID NO: 221),
FIG. 223 (SEQ ID NO: 223), FIG. 225 (SEQ ID NO: 225), FIG. 227 (SEQ
ID NO: 227), FIG. 229 (SEQ ID NO: 229), FIG. 231 (SEQ ID NO: 231),
FIG. 233 (SEQ ID NO: 233), FIG. 235 (SEQ ID NO: 235), FIG. 237 (SEQ
ID NO: 237), FIG. 239 (SEQ ID NO: 239), FIG. 241 (SEQ ID NO: 241),
FIG. 243 (SEQ ID NO: 243), FIG. 245 (SEQ ID NO: 245), FIG. 247 (SEQ
ID NO: 247), FIG. 249 (SEQ ID NO: 249), FIG. 251 (SEQ ID NO: 251),
FIG. 253 (SEQ ID NO: 253), FIG. 255 (SEQ ID NO: 255), FIG. 257 (SEQ
ID NO: 257), FIG. 259 (SEQ ID NO: 259), FIG. 261 (SEQ ID NO: 261),
FIG. 263 (SEQ ID NO: 263), FIG. 265 (SEQ ID NO: 265), FIG. 267 (SEQ
ID NO: 267), FIG. 269 (SEQ ID NO: 269), FIG. 271 (SEQ ID NO: 271),
FIG. 273 (SEQ ID NO: 273), FIG. 275 (SEQ ID NO: 275), FIG. 277 (SEQ
ID NO: 277), FIG. 279 (SEQ ID NO: 279), FIG. 281 (SEQ ID NO: 281),
FIG. 283 (SEQ ID NO: 283), FIG. 285 (SEQ ID NO: 285), FIG. 287 (SEQ
ID NO: 287), FIGS. 289A-289B (SEQ ID NO: 289), FIG. 291 (SEQ ID NO:
291), FIG. 293 (SEQ ID NO: 293), FIG. 295 (SEQ ID NO: 295), FIG.
297 (SEQ ID NO: 297), FIG. 299 (SEQ ID NO: 299), FIG. 301 (SEQ ID
NO: 301), FIG. 303 (SEQ ID NO: 303), FIG. 305 (SEQ ID NO: 305),
FIG. 307 (SEQ ID NO: 307), FIG. 309 (SEQ ID NO: 309), FIGS.
311A-311B (SEQ ID NO: 311), FIG. 313 (SEQ ID NO: 313), FIG. 315
(SEQ ID NO: 315), FIG. 317 (SEQ ID NO: 317), FIG. 319 (SEQ ID NO:
319), FIG. 321 (SEQ ID NO: 321), FIG. 323 (SEQ ID NO: 323), FIG.
325 (SEQ ID NO: 325), FIG. 327 (SEQ ID NO: 327), FIG. 329 (SEQ ID
NO: 329), FIG. 331 (SEQ ID NO: 331), FIG. 333 (SEQ ID NO: 333),
FIG. 335 (SEQ ID NO: 335), FIG. 337 (SEQ ID NO: 337), FIG. 339 (SEQ
ID NO: 339), FIG. 341 (SEQ ID NO: 341), FIG. 343 (SEQ ID NO: 343),
FIG. 345 (SEQ ID NO: 345), FIG. 347 (SEQ ID NO: 347), FIG. 349 (SEQ
ID NO: 349), FIGS. 351A-351B (SEQ ID NO: 351), FIG. 353 (SEQ ID NO:
353), FIG. 355 (SEQ ID NO: 355), FIG. 357 (SEQ ID NO: 357), FIG.
359 (SEQ ID NO: 359), FIG. 361 (SEQ ID NO: 361), FIG. 363 (SEQ ID
NO: 363), FIG. 365 (SEQ ID NO: 365), FIG. 367 (SEQ ID NO: 367),
FIG. 369 (SEQ ID NO: 369), FIG. 371 (SEQ ID NO: 371) and FIG. 373
(SEQ ID NO: 373).
3. An isolated nucleic acid molecule having at least 80% nucleic
acid sequence identity to a nucleotide sequence selected from the
group consisting of the full-length coding sequence of the
nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID
NO: 3), FIG. 5 (SEQ ID NO: 5), FIG. 7 (SEQ ID NO: 7), FIG. 9 (SEQ
ID NO: 9), FIG. 11 (SEQ ID NO: 11), FIG. 13 (SEQ ID NO: 13), FIG.
15 (SEQ ID NO: 15), FIG. 17 (SEQ ID NO: 17), FIG. 19 (SEQ ID NO:
19), FIG. 21 (SEQ ID NO: 21), FIG. 23 (SEQ ID NO: 23), FIG. 25 (SEQ
ID NO: 25), FIG. 27 (SEQ ID NO: 27), FIG. 29 (SEQ ID NO: 29), FIG.
31 (SEQ ID NO: 31), FIG. 33 (SEQ ID NO: 33), FIG. 35 (SEQ ID NO:
35), FIG. 37 (SEQ ID NO: 37), FIG. 39 (SEQ ID NO: 39), FIG. 41 (SEQ
ID NO: 41), FIG. 43 (SEQ ID NO: 43), FIG. 45 (SEQ ID NO: 45), FIG.
47 (SEQ ID NO: 47), FIG. 49 (SEQ ID NO: 49), FIG. 51 (SEQ ID NO:
51), FIG. 53 (SEQ ID NO: 53), FIG. 55 (SEQ ID NO: 55), FIG. 57 (SEQ
ID NO: 57), FIG. 59 (SEQ ID NO: 59), FIG. 61 (SEQ ID NO: 61), FIG.
63 (SEQ ID NO: 63), FIG. 65 (SEQ ID NO: 65), FIG. 67 (SEQ ID NO:
67), FIG. 69 (SEQ ID NO: 69), FIG. 71 (SEQ ID NO: 71), FIG. 73 (SEQ
ID NO: 73), FIGS. 75A-75B (SEQ ID NO: 75), FIG. 77 (SEQ ID NO: 77),
FIG. 79 (SEQ ID NO: 79), FIG. 81 (SEQ ID NO: 81), FIG. 83 (SEQ ID
NO: 83), FIG. 85 (SEQ ID NO: 85), FIG. 87 (SEQ ID NO: 87), FIG. 89
(SEQ ID NO: 89), FIG. 91 (SEQ ID NO: 91), FIG. 93 (SEQ ID NO: 93),
FIG. 95 (SEQ ID NO: 95), FIG. 97 (SEQ ID NO: 97), FIG. 99 (SEQ ID
NO: 99), FIG. 101 (SEQ ID NO: 101), FIG. 103 (SEQ ID NO: 103), FIG.
105 (SEQ ID NO: 105), FIG. 107 (SEQ ID NO: 107), FIG. 109 (SEQ ID
NO: 109), FIG. 111 (SEQ ID NO: 111), FIG. 113 (SEQ ID NO: 113),
FIG. 115 (SEQ ID NO: 115), FIG. 117 (SEQ ID NO: 117), FIG. 119 (SEQ
ID NO: 119), FIG. 121 (SEQ ID NO: 121), FIG. 123 (SEQ ID NO: 123),
FIG. 125 (SEQ ID NO: 125), FIG. 127 (SEQ ID NO: 127), FIG. 129 (SEQ
ID NO: 129), FIG. 131 (SEQ ID NO: 131), FIG. 133 (SEQ ID NO: 133),
FIG. 135 (SEQ ID NO: 135), FIG. 137 (SEQ ID NO: 137), FIG. 139 (SEQ
ID NO: 139), FIG. 141 (SEQ ID NO: 141), FIG. 143 (SEQ ID NO: 143),
FIG. 145 (SEQ ID NO: 145), FIG. 147 (SEQ ID NO: 147), FIG. 149 (SEQ
ID NO: 149), FIG. 151 (SEQ ID NO: 151), FIG. 153 (SEQ ID NO: 153),
FIG. 155 (SEQ ID NO: 155), FIG. 157 (SEQ ID NO: 157), FIG. 159 (SEQ
ID NO: 159), FIG. 161 (SEQ ID NO: 161), FIG. 163 (SEQ ID NO: 163),
FIG. 165 (SEQ ID NO: 165), FIG. 167 (SEQ ID NO: 167), FIG. 169 (SEQ
ID NO: 169), FIG. 171 (SEQ ID NO: 171), FIG. 173 (SEQ ID NO: 173),
FIG. 175 (SEQ ID NO: 175), FIG. 177 (SEQ ID NO: 177), FIG. 179 (SEQ
ID NO: 179), FIG. 181 (SEQ ID NO: 181), FIG. 183 (SEQ ID NO: 183),
FIG. 185 (SEQ ID NO: 185), FIG. 187 (SEQ ID NO: 187), FIG. 189 (SEQ
ID NO: 189), FIG. 191 (SEQ ID NO: 191), FIG. 193 (SEQ ID NO: 193),
FIG. 195 (SEQ ID NO: 195), FIG. 197 (SEQ ID NO: 197), FIG. 199 (SEQ
ID NO: 199), FIG. 201 (SEQ ID NO: 201), FIG. 203 (SEQ ID NO: 203),
FIG. 205 (SEQ ID NO: 205), FIG. 207 (SEQ ID NO: 207), FIG. 209 (SEQ
ID NO: 209), FIG. 211 (SEQ ID NO: 211), FIG. 213 (SEQ ID NO: 213),
FIG. 215 (SEQ ID NO: 215), FIG. 217 (SEQ ID NO: 217), FIG. 219 (SEQ
ID NO: 219), FIG. 221 (SEQ ID NO: 221), FIG. 223 (SEQ ID NO: 223),
FIG. 225 (SEQ ID NO: 225), FIG. 227 (SEQ ID NO: 227), FIG. 229 (SEQ
ID NO: 229), FIG. 231 (SEQ ID NO: 231), FIG. 233 (SEQ ID NO: 233),
FIG. 235 (SEQ ID NO: 235), FIG. 237 (SEQ ID NO: 237), FIG. 239 (SEQ
ID NO: 239), FIG. 241 (SEQ ID NO: 241), FIG. 243 (SEQ ID NO: 243),
FIG. 245 (SEQ ID NO: 245), FIG. 247 (SEQ ID NO: 247), FIG. 249 (SEQ
ID NO: 249), FIG. 251 (SEQ ID NO: 251), FIG. 253 (SEQ ID NO: 253),
FIG. 255 (SEQ ID NO: 255), FIG. 257 (SEQ ID NO: 257), FIG. 259 (SEQ
ID NO: 259), FIG. 261 (SEQ ID NO: 261), FIG. 263 (SEQ ID NO: 263),
FIG. 265 (SEQ ID NO: 265), FIG. 267 (SEQ ID NO: 267), FIG. 269 (SEQ
ID NO: 269), FIG. 271 (SEQ ID NO: 271), FIG. 273 (SEQ ID NO: 273),
FIG. 275 (SEQ ID NO: 275), FIG. 277 (SEQ ID NO: 277), FIG. 279 (SEQ
ID NO: 279), FIG. 281 (SEQ ID NO: 281), FIG. 283 (SEQ ID NO: 283),
FIG. 285 (SEQ ID NO: 285), FIG. 287 (SEQ ID NO: 287), FIGS.
289A-289B (SEQ ID NO: 289), FIG. 291 (SEQ ID NO: 291), FIG. 293
(SEQ ID NO: 293), FIG. 295 (SEQ ID NO: 295), FIG. 297 (SEQ ID NO:
297), FIG. 299 (SEQ ID NO: 299), FIG. 301 (SEQ ID NO: 301), FIG.
303 (SEQ ID NO: 303), FIG. 305 (SEQ ID NO: 305), FIG. 307 (SEQ ID
NO: 307), FIG. 309 (SEQ ID NO: 309), FIGS. 311A-311B (SEQ ID NO:
311), FIG. 313 (SEQ ID NO: 313), FIG. 315 (SEQ ID NO: 315), FIG.
317 (SEQ ID NO: 317), FIG. 319 (SEQ ID NO: 319), FIG. 321 (SEQ ID
NO: 321), FIG. 323 (SEQ ID NO: 323), FIG. 325 (SEQ ID NO: 325),
FIG. 327 (SEQ ID NO: 327), FIG. 329 (SEQ ID NO: 329), FIG. 331 (SEQ
ID NO: 331), FIG. 333 (SEQ ID NO: 333), FIG. 335 (SEQ ID NO: 335),
FIG. 337 (SEQ ID NO: 337), FIG. 339 (SEQ ID NO: 339), FIG. 341 (SEQ
ID NO: 341), FIG. 343 (SEQ ID NO: 343), FIG. 345 (SEQ ID NO: 345),
FIG. 347 (SEQ ID NO: 347), FIG. 349 (SEQ ID NO: 349), FIGS.
351A-351B (SEQ ID NO: 351), FIG. 353 (SEQ ID NO: 353), FIG. 355
(SEQ ID NO: 355), FIG. 357 (SEQ ID NO: 357), FIG. 359 (SEQ ID NO:
359), FIG. 361 (SEQ ID NO: 361), FIG. 363 (SEQ ID NO: 363), FIG.
365 (SEQ ID NO: 365), FIG. 367 (SEQ ID NO: 367), FIG. 369 (SEQ ID
NO: 369), FIG. 371 (SEQ ID NO: 371) and FIG. 373 (SEQ ID NO:
373).
4. An isolated nucleic acid molecule having at least 80% nucleic
acid sequence identity to the full-length coding sequence of the
DNA deposited under any ATCC accession number shown in Table 7.
5. A vector comprising the nucleic acid of claim 1.
6. A host cell comprising the vector of claim 5.
7. The host cell of claim 6, wherein said cell is a CHO cell.
8. The host cell of claim 6, wherein said cell is an E. coli.
9. The host cell of claim 6, wherein said cell is a yeast cell.
10. A process for producing a PRO polypeptide comprising culturing
the host cell of claim 6 under conditions suitable for expression
of said PRO polypeptide and recovering said PRO polypeptide from
the cell culture.
11. An isolated polypeptide having at least 80% amino acid sequence
identity to an amino acid sequence selected from the group
consisting of the amino acid sequence shown in FIG. 2 (SEQ ID NO:
2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID
NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14
(SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18),
FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. 24 (SEQ ID
NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30
(SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34),
FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID
NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46
(SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50),
FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), FIG. 56 (SEQ ID
NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60 (SEQ ID NO: 60), FIG. 62
(SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64), FIG. 66 (SEQ ID NO: 66),
FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID
NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76 (SEQ ID NO: 76), FIG. 78
(SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80), FIG. 82 (SEQ ID NO: 82),
FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID NO: 86), FIG. 88 (SEQ ID
NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92 (SEQ ID NO: 92), FIG. 94
(SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98),
FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ
ID NO: 104), FIG. 106 (SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108),
FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ
ID NO: 114), FIG. 116 (SEQ ID NO: 116), FIG. 118 (SEQ ID NO: 118),
FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ
ID NO: 124), FIG. 126 (SEQ ID NO: 126), FIG. 128 (SEQ ID NO: 128),
FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ
ID NO: 134), FIG. 136 (SEQ ID NO: 136), FIG. 138 (SEQ ID NO: 138),
FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ
ID NO: 144), FIG. 146 (SEQ ID NO: 146), FIG. 148 (SEQ ID NO: 148),
FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ
ID NO: 154), FIG. 156 (SEQ ID NO: 156), FIG. 158 (SEQ ID NO: 158),
FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ
ID NO: 164), FIG. 166 (SEQ ID NO: 166), FIG. 168 (SEQ ID NO: 168),
FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ
ID NO: 174), FIG. 176 (SEQ ID NO: 176), FIG. 178 (SEQ ID NO: 178),
FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ
ID NO: 184), FIG. 186 (SEQ ID NO: 186), FIG. 188 (SEQ ID NO: 188),
FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ
ID NO: 194), FIG. 196 (SEQ ID NO: 196), FIG. 198 (SEQ ID NO: 198),
FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ
ID NO: 204), FIG. 206 (SEQ ID NO: 206), FIG. 208 (SEQ ID NO: 208),
FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ
ID NO: 214), FIG. 216 (SEQ ID NO: 216), FIG. 218 (SEQ ID NO: 218),
FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ
ID NO: 224), FIG. 226 (SEQ ID NO: 226), FIG. 228 (SEQ ID NO: 228),
FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ
ID NO: 234), FIG. 236 (SEQ ID NO: 236), FIG. 238 (SEQ ID NO: 238),
FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ
ID NO: 244), FIG. 246 (SEQ ID NO: 246), FIG. 248 (SEQ ID NO: 248),
FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ
ID NO: 254), FIG. 256 (SEQ ID NO: 256), FIG. 258 (SEQ ID NO: 258),
FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ
ID NO: 264), FIG. 266 (SEQ ID NO: 266), FIG. 268 (SEQ ID NO: 268),
FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ
ID NO: 274), FIG. 276 (SEQ ID NO: 276), FIG. 278 (SEQ ID NO: 278),
FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ
ID NO: 284), FIG. 286 (SEQ ID NO: 286), FIG. 288 (SEQ ID NO: 288),
FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ
ID NO: 294), FIG. 296 (SEQ ID NO: 296), FIG. 298 (SEQ ID NO: 298),
FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ
ID NO: 304), FIG. 306 (SEQ ID NO: 306), FIG. 308 (SEQ ID NO: 308),
FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ
ID NO: 314), FIG. 316 (SEQ ID NO: 316), FIG. 318 (SEQ ID NO: 318),
FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ
ID NO: 324), FIG. 326 (SEQ ID NO: 326), FIG. 328 (SEQ ID NO: 328),
FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ
ID NO: 334), FIG. 336 (SEQ ID NO: 336), FIG. 338 (SEQ ID NO: 338),
FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ
ID NO: 344), FIG. 346 (SEQ ID NO: 346), FIG. 348 (SEQ ID NO: 348),
FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ
ID NO: 354), FIG. 356 (SEQ ID NO: 356), FIG. 358 (SEQ ID NO: 358),
FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ
ID NO: 364), FIG. 366 (SEQ ID NO: 366), FIG. 368 (SEQ ID NO: 368),
FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ ID NO: 372) and FIG. 374
(SEQ ID NO: 374).
12. An isolated polypeptide having at least 80% amino acid sequence
identity to an amino acid sequence encoded by the full-length
coding sequence of the DNA deposited under any ATCC accession
number shown in Table 7.
13. A chimeric molecule comprising a polypeptide according to claim
11 fused to a heterologous amino acid sequence.
14. The chimeric molecule of claim 13, wherein said heterologous
amino acid sequence is an epitope tag sequence.
15. The chimeric molecule of claim 13, wherein said heterologous
amino acid sequence is a Fc region of an immunoglobulin.
16. An antibody which specifically binds to a polypeptide according
to claim 11.
17. The antibody of claim 16, wherein said antibody is a monoclonal
antibody, a humanized antibody or a single-chain antibody.
18. An isolated nucleic acid molecule having at least 80% nucleic
acid sequence identity to: (a) a nucleotide sequence encoding the
polypeptide shown in FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4),
FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO:
10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ
ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG.
22 (SEQ ID NO: 22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO:
26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ
ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG.
38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO:
42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ
ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG.
54 (SEQ ID NO: 54), FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO:
58), FIG. 60 (SEQ ID NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ
ID NO: 64), FIG. 66 (SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG.
70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO:
74), FIG. 76 (SEQ ID NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ
ID NO: 80), FIG. 82 (SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG.
86 (SEQ ID NO: 86), FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO:
90), FIG. 92 (SEQ ID NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ
ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100),
FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ
ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110),
FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ
ID NO: 116), FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120),
FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ
ID NO: 126), FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130),
FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ
ID NO: 136), FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140),
FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ
ID NO: 146), FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150),
FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ
ID NO: 156), FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160),
FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ
ID NO: 166), FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170),
FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ
ID NO: 176), FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180),
FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ
ID NO: 186), FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190),
FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ
ID NO: 196), FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200),
FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ
ID NO: 206), FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210),
FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ
ID NO: 216), FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220),
FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ
ID NO: 226), FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230),
FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ
ID NO: 236), FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240),
FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ
ID NO: 246), FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250),
FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ
ID NO: 256), FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260),
FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ
ID NO: 266), FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270),
FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ
ID NO: 276), FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280),
FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ
ID NO: 286), FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290),
FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ
ID NO: 296), FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300),
FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ
ID NO: 306), FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310),
FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ
ID NO: 316), FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320),
FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ
ID NO: 326), FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330),
FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ
ID NO: 336), FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340),
FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ
ID NO: 346), FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350),
FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ
ID NO: 356), FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360),
FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ
ID NO: 366), FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370),
FIG. 372 (SEQ ID NO: 372) or FIG. 374 (SEQ ID NO: 374), lacking its
associated signal peptide; (b) a nucleotide sequence encoding an
extracellular domain of the polypeptide shown in FIG. 2 (SEQ ID NO:
2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID
NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14
(SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18),
FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. 24 (SEQ ID
NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30
(SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34),
FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID
NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46
(SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50),
FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), FIG. 56 (SEQ ID
NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60 (SEQ ID NO: 60), FIG. 62
(SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64), FIG. 66 (SEQ ID NO: 66),
FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID
NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76 (SEQ ID NO: 76), FIG. 78
(SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80), FIG. 82 (SEQ ID NO: 82),
FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID NO: 86), FIG. 88 (SEQ ID
NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92 (SEQ ID NO: 92), FIG. 94
(SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98),
FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ
ID NO: 104), FIG. 106 (SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108),
FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ
ID NO: 114), FIG. 116 (SEQ ID NO: 116), FIG. 118 (SEQ ID NO: 118),
FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ
ID NO: 124), FIG. 126 (SEQ ID NO: 126), FIG. 128 (SEQ ID NO: 128),
FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ
ID NO: 134), FIG. 136 (SEQ ID NO: 136), FIG. 138 (SEQ ID NO: 138),
FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ
ID NO: 144), FIG. 146 (SEQ ID NO: 146), FIG. 148 (SEQ ID NO: 148),
FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ
ID NO: 154), FIG. 156 (SEQ ID NO: 156), FIG. 158 (SEQ ID NO: 158),
FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ
ID NO: 164), FIG. 166 (SEQ ID NO: 166), FIG. 168 (SEQ ID NO: 168),
FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ
ID NO: 174), FIG. 176 (SEQ ID NO: 176), FIG. 178 (SEQ ID NO: 178),
FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ
ID NO: 184), FIG. 186 (SEQ ID NO: 186), FIG. 188 (SEQ ID NO: 188),
FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ
ID NO: 194), FIG. 196 (SEQ ID NO: 196), FIG. 198 (SEQ ID NO: 198),
FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ
ID NO: 204), FIG. 206 (SEQ ID NO: 206), FIG. 208 (SEQ ID NO: 208),
FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ
ID NO: 214), FIG. 216 (SEQ ID NO: 216), FIG. 218 (SEQ ID NO: 218),
FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ
ID NO: 224), FIG. 226 (SEQ ID NO: 226), FIG. 228 (SEQ ID NO: 228),
FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ
ID NO: 234), FIG. 236 (SEQ ID NO: 236), FIG. 238 (SEQ ID NO: 238),
FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ
ID NO: 244), FIG. 246 (SEQ ID NO: 246), FIG. 248 (SEQ ID NO: 248),
FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ
ID NO: 254), FIG. 256 (SEQ ID NO: 256), FIG. 258 (SEQ ID NO: 258),
FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ
ID NO: 264), FIG. 266 (SEQ ID NO: 266), FIG. 268 (SEQ ID NO: 268),
FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ
ID NO: 274), FIG. 276 (SEQ ID NO: 276), FIG. 278 (SEQ ID NO: 278),
FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ
ID NO: 284), FIG. 286 (SEQ ID NO: 286), FIG. 288 (SEQ ID NO: 288),
FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ
ID NO: 294), FIG. 296 (SEQ ID NO: 296), FIG. 298 (SEQ ID NO: 298),
FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ
ID NO: 304), FIG. 306 (SEQ ID NO: 306), FIG. 308 (SEQ ID NO: 308),
FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ
ID NO: 314), FIG. 316 (SEQ ID NO: 316), FIG. 318 (SEQ ID NO: 318),
FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ
ID NO: 324), FIG. 326 (SEQ ID NO: 326), FIG. 328 (SEQ ID NO: 328),
FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ
ID NO: 334), FIG. 336 (SEQ ID NO: 336), FIG. 338 (SEQ ID NO: 338),
FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ
ID NO: 344), FIG. 346 (SEQ ID NO: 346), FIG. 348 (SEQ ID NO: 348),
FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ
ID NO: 354), FIG. 356 (SEQ ID NO: 356), FIG. 358 (SEQ ID NO: 358),
FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ
ID NO: 364), FIG. 366 (SEQ ID NO: 366), FIG. 368 (SEQ ID NO: 368),
FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ ID NO: 372) or FIG. 374
(SEQ ID NO: 374), with its associated signal peptide; or (c) a
nucleotide sequence encoding an extracellular domain of the
polypeptide shown in FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4),
FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO:
10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ
ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG.
22 (SEQ ID NO: 22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO:
26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ
ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG.
38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO:
42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ
ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG.
54 (SEQ ID NO: 54), FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO:
58), FIG. 60 (SEQ ID NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ
ID NO: 64), FIG. 66 (SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG.
70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO:
74), FIG. 76 (SEQ ID NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ
ID NO: 80), FIG. 82 (SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG.
86 (SEQ ID NO: 86), FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO:
90), FIG. 92 (SEQ ID NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ
ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100),
FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ
ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110),
FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ
ID NO: 116), FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120),
FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ
ID NO: 126), FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130),
FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ
ID NO: 136), FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140),
FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ
ID NO: 146), FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150),
FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ
ID NO: 156), FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160),
FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ
ID NO: 166), FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170),
FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ
ID NO: 176), FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180),
FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ
ID NO: 186), FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190),
FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ
ID NO: 196), FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200),
FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ
ID NO: 206), FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210),
FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ
ID NO: 216), FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220),
FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ
ID NO: 226), FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230),
FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ
ID NO: 236), FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240),
FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ
ID NO: 246), FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250),
FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ
ID NO: 256), FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260),
FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ
ID NO: 266), FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270),
FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ
ID NO: 276), FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280),
FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ
ID NO: 286), FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290),
FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ
ID NO: 296), FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300),
FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ
ID NO: 306), FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310),
FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ
ID NO: 316), FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320),
FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ
ID NO: 326), FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330),
FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ
ID NO: 336), FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340),
FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ
ID NO: 346), FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350),
FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ
ID NO: 356), FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360),
FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ
ID NO: 366), FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370),
FIG. 372 (SEQ ID NO: 372) or FIG. 374 (SEQ ID NO: 374), lacking its
associated signal peptide.
19. An isolated polypeptide having at least 80% amino acid sequence
identity to: (a) an amino acid sequence of the polypeptide shown in
FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO:
6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID
NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18
(SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22),
FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID
NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34
(SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38),
FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID
NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50
(SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54),
FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60 (SEQ ID
NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64), FIG. 66
(SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70),
FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76 (SEQ ID
NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80), FIG. 82
(SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID NO: 86),
FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92 (SEQ ID
NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96), FIG. 98
(SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO:
102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ ID NO: 106), FIG.
108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID
NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116),
FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ
ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ ID NO: 126),
FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ
ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ ID NO: 136),
FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ
ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ ID NO: 146),
FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ
ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ ID NO: 156),
FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ
ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ ID NO: 166),
FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ
ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ ID NO: 176),
FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ
ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ ID NO: 186),
FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ
ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ ID NO: 196),
FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ
ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ ID NO: 206),
FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ
ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ ID NO: 216),
FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ
ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ ID NO: 226),
FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ
ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ ID NO: 236),
FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ
ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ ID NO: 246),
FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ
ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ ID NO: 256),
FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ
ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ ID NO: 266),
FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ
ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ ID NO: 276),
FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ
ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ ID NO: 286),
FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ
ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ ID NO: 296),
FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ
ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ ID NO: 306),
FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ
ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ ID NO: 316),
FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ
ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ ID NO: 326),
FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ
ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ ID NO: 336),
FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ
ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ ID NO: 346),
FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ
ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ ID NO: 356),
FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ
ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ ID NO: 366),
FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ
ID NO: 372) or FIG. 374 (SEQ ID NO: 374), lacking its associated
signal peptide; (b) an amino acid sequence of an extracellular
domain of the polypeptide shown in FIG. 2 (SEQ ID NO: 2), FIG. 4
(SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG.
10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO:
14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ
ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. 24 (SEQ ID NO: 24), FIG.
26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO:
30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ
ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG. 40 (SEQ ID NO: 40), FIG.
42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO:
46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ
ID NO: 52), FIG. 54 (SEQ ID NO: 54), FIG. 56 (SEQ ID NO: 56), FIG.
58 (SEQ ID NO: 58), FIG. 60 (SEQ ID NO: 60), FIG. 62 (SEQ ID NO:
62), FIG. 64 (SEQ ID NO: 64), FIG. 66 (SEQ ID NO: 66), FIG. 68 (SEQ
ID NO: 68), FIG. 70 (SEQ ID NO: 70), FIG. 72 (SEQ ID NO: 72), FIG.
74 (SEQ ID NO: 74), FIG. 76 (SEQ ID NO: 76), FIG. 78 (SEQ ID NO:
78), FIG. 80 (SEQ ID NO: 80), FIG. 82 (SEQ ID NO: 82), FIG. 84 (SEQ
ID NO: 84), FIG. 86 (SEQ ID NO: 86), FIG. 88 (SEQ ID NO: 88), FIG.
90 (SEQ ID NO: 90), FIG. 92 (SEQ ID NO: 92), FIG. 94 (SEQ ID NO:
94), FIG. 96 (SEQ ID NO: 96), FIG. 98 (SEQ ID NO: 98), FIG. 100
(SEQ ID NO: 100), FIG. 102 (SEQ ID NO: 102), FIG. 104 (SEQ ID NO:
104), FIG. 106 (SEQ ID NO: 106), FIG. 108 (SEQ ID NO: 108), FIG.
110 (SEQ ID NO: 110), FIG. 112 (SEQ ID NO: 112), FIG. 114 (SEQ ID
NO: 114), FIG. 116 (SEQ ID NO: 116), FIG. 118 (SEQ ID NO: 118),
FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ ID NO: 122), FIG. 124 (SEQ
ID NO: 124), FIG. 126 (SEQ ID NO: 126), FIG. 128 (SEQ ID NO: 128),
FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ ID NO: 132), FIG. 134 (SEQ
ID NO: 134), FIG. 136 (SEQ ID NO: 136), FIG. 138 (SEQ ID NO: 138),
FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG. 144 (SEQ
ID NO: 144), FIG. 146 (SEQ ID NO: 146), FIG. 148 (SEQ ID NO: 148),
FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ ID NO: 152), FIG. 154 (SEQ
ID NO: 154), FIG. 156 (SEQ ID NO: 156), FIG. 158 (SEQ ID NO: 158),
FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ ID NO: 162), FIG. 164 (SEQ
ID NO: 164), FIG. 166 (SEQ ID NO: 166), FIG. 168 (SEQ ID NO: 168),
FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ ID NO: 172), FIG. 174 (SEQ
ID NO: 174), FIG. 176 (SEQ ID NO: 176), FIG. 178 (SEQ ID NO: 178),
FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ ID NO: 182), FIG. 184 (SEQ
ID NO: 184), FIG. 186 (SEQ ID NO: 186), FIG. 188 (SEQ ID NO: 188),
FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ ID NO: 192), FIG. 194 (SEQ
ID NO: 194), FIG. 196 (SEQ ID NO: 196), FIG. 198 (SEQ ID NO: 198),
FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ ID NO: 202), FIG. 204 (SEQ
ID NO: 204), FIG. 206 (SEQ ID NO: 206), FIG. 208 (SEQ ID NO: 208),
FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ ID NO: 212), FIG. 214 (SEQ
ID NO: 214), FIG. 216 (SEQ ID NO: 216), FIG. 218 (SEQ ID NO: 218),
FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ ID NO: 222), FIG. 224 (SEQ
ID NO: 224), FIG. 226 (SEQ ID NO: 226), FIG. 228 (SEQ ID NO: 228),
FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ ID NO: 232), FIG. 234 (SEQ
ID NO: 234), FIG. 236 (SEQ ID NO: 236), FIG. 238 (SEQ ID NO: 238),
FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ ID NO: 242), FIG. 244 (SEQ
ID NO: 244), FIG. 246 (SEQ ID NO: 246), FIG. 248 (SEQ ID NO: 248),
FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ ID NO: 252), FIG. 254 (SEQ
ID NO: 254), FIG. 256 (SEQ ID NO: 256), FIG. 258 (SEQ ID NO: 258),
FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ ID NO: 262), FIG. 264 (SEQ
ID NO: 264), FIG. 266 (SEQ ID NO: 266), FIG. 268 (SEQ ID NO: 268),
FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ ID NO: 272), FIG. 274 (SEQ
ID NO: 274), FIG. 276 (SEQ ID NO: 276), FIG. 278 (SEQ ID NO: 278),
FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ ID NO: 282), FIG. 284 (SEQ
ID NO: 284), FIG. 286 (SEQ ID NO: 286), FIG. 288 (SEQ ID NO: 288),
FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ ID NO: 292), FIG. 294 (SEQ
ID NO: 294), FIG. 296 (SEQ ID NO: 296), FIG. 298 (SEQ ID NO: 298),
FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ ID NO: 302), FIG. 304 (SEQ
ID NO: 304), FIG. 306 (SEQ ID NO: 306), FIG. 308 (SEQ ID NO: 308),
FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ ID NO: 312), FIG. 314 (SEQ
ID NO: 314), FIG. 316 (SEQ ID NO: 316), FIG. 318 (SEQ ID NO: 318),
FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ ID NO: 322), FIG. 324 (SEQ
ID NO: 324), FIG. 326 (SEQ ID NO: 326), FIG. 328 (SEQ ID NO: 328),
FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ ID NO: 332), FIG. 334 (SEQ
ID NO: 334), FIG. 336 (SEQ ID NO: 336), FIG. 338 (SEQ ID NO: 338),
FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ ID NO: 342), FIG. 344 (SEQ
ID NO: 344), FIG. 346 (SEQ ID NO: 346), FIG. 348 (SEQ ID NO: 348),
FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ ID NO: 352), FIG. 354 (SEQ
ID NO: 354), FIG. 356 (SEQ ID NO: 356), FIG. 358 (SEQ ID NO: 358),
FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ ID NO: 362), FIG. 364 (SEQ
ID NO: 364), FIG. 366 (SEQ ID NO: 366), FIG. 368 (SEQ ID NO: 368),
FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ ID NO: 372) or FIG. 374
(SEQ ID NO: 374), with its associated signal peptide; or (c) an
amino acid sequence of an extracellular domain of the polypeptide
shown in FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ
ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12
(SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16),
FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID
NO: 22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28
(SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32),
FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID
NO: 38), FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44
(SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48),
FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID
NO: 54), FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60
(SEQ ID NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64),
FIG. 66 (SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID
NO: 70), FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76
(SEQ ID NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80),
FIG. 82 (SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID
NO: 86), FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92
(SEQ ID NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96),
FIG. 98 (SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ
ID NO: 102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ ID NO: 106),
FIG. 108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ
ID NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116),
FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ
ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ ID NO: 126),
FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ
ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ ID NO: 136),
FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ
ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ ID NO: 146),
FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ
ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ ID NO: 156),
FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ
ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ ID NO: 166),
FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ
ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ ID NO: 176),
FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ
ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ ID NO: 186),
FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ
ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ ID NO: 196),
FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ
ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ ID NO: 206),
FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ
ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ ID NO: 216),
FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ
ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ ID NO: 226),
FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ
ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ ID NO: 236),
FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ
ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ ID NO: 246),
FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ
ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ ID NO: 256),
FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ
ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ ID NO: 266),
FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ
ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ ID NO: 276),
FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ
ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ ID NO: 286),
FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ
ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ ID NO: 296),
FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ
ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ ID NO: 306),
FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ
ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ ID NO: 316),
FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ
ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ ID NO: 326),
FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ
ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ ID NO: 336),
FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ
ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ ID NO: 346),
FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ
ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ ID NO: 356),
FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ
ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ ID NO: 366),
FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ
ID NO: 372) or FIG. 374 (SEQ ID NO: 374), lacking its associated
signal peptide.
20. A method for treating a cardiovascular, endothelial or
anglogenic disorder in a mammal comprising administering to the
mammal a therapeutically effective amount of a polypeptide shown in
FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO:
6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID
NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18
(SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22),
FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID
NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34
(SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38),
FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID
NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50
(SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54),
FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60 (SEQ ID
NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64), FIG. 66
(SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70),
FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76 (SEQ ID
NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80), FIG. 82
(SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID NO: 86),
FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92 (SEQ ID
NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96), FIG. 98
(SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO:
102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ ID NO: 106), FIG.
108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID
NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116),
FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ
ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ ID NO: 126),
FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ
ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ ID NO: 136),
FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ
ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ ID NO: 146),
FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ
ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ ID NO: 156),
FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ
ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ ID NO: 166),
FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ
ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ ID NO: 176),
FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ
ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ ID NO: 186),
FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ
ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ ID NO: 196),
FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ
ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ ID NO: 206),
FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ
ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ ID NO: 216),
FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ
ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ ID NO: 226),
FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ
ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ ID NO: 236),
FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ
ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ ID NO: 246),
FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ
ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ ID NO: 256),
FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ
ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ ID NO: 266),
FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ
ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ ID NO: 276),
FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ
ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ ID NO: 286),
FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ
ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ ID NO: 296),
FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ
ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ ID NO: 306),
FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ
ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ ID NO: 316),
FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ
ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ ID NO: 326),
FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ
ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ ID NO: 336),
FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ
ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ ID NO: 346),
FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ
ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ ID NO: 356),
FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ
ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ ID NO: 366),
FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ
ID NO: 372) or FIG. 374 (SEQ ID NO: 374), or agonist or antagonist
thereof.
21. The method according to claim 20, wherein the mammal is
human.
22. The method of claim 21, wherein the human has suffered
myocardial infarction.
23. The method of claim 21, wherein the human has cardiac
hypertrophy, trauma, a cancer, or age-related macular
degeneration.
24. The method of claim 23, wherein the cardiac hypertrophy is
characterized by the presence of an elevated level of
PGF.sub.2.alpha..
25. The method of claim 20, wherein the polypeptide is administered
together with a cardiovascular, endothelial or angiogenic
agent.
26. The method of claim 23, wherein the polypeptide is administered
following primary angioplasty.
27. The method of claim 20, wherein the cardiovascular, endothelial
or angiogenic disorder is cancer.
28. The method of claim 27, wherein the polypeptide is administered
in combination with a chemotherapeutic agent, a growth inhibitory
agent or a cytotoxic agent.
29. The method of claim 20, wherein said agonist is an antibody to
said polypeptide.
30. The method of claim 20, wherein said antagonist is an antibody
to said polypeptide.
31. A method for treating a cardiovascular, endothelial or
angiogenic disorder in a mammal comprising administering to the
mammal a nucleic acid molecule that encodes a polypeptide shown in
FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO:
6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID
NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18
(SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22),
FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID
NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34
(SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38),
FIG. 40 (SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID
NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50
(SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54),
FIG. 56 (SEQ ID NO: 56), FIG. 58 (SEQ ID NO: 58), FIG. 60 (SEQ ID
NO: 60), FIG. 62 (SEQ ID NO: 62), FIG. 64 (SEQ ID NO: 64), FIG. 66
(SEQ ID NO: 66), FIG. 68 (SEQ ID NO: 68), FIG. 70 (SEQ ID NO: 70),
FIG. 72 (SEQ ID NO: 72), FIG. 74 (SEQ ID NO: 74), FIG. 76 (SEQ ID
NO: 76), FIG. 78 (SEQ ID NO: 78), FIG. 80 (SEQ ID NO: 80), FIG. 82
(SEQ ID NO: 82), FIG. 84 (SEQ ID NO: 84), FIG. 86 (SEQ ID NO: 86),
FIG. 88 (SEQ ID NO: 88), FIG. 90 (SEQ ID NO: 90), FIG. 92 (SEQ ID
NO: 92), FIG. 94 (SEQ ID NO: 94), FIG. 96 (SEQ ID NO: 96), FIG. 98
(SEQ ID NO: 98), FIG. 100 (SEQ ID NO: 100), FIG. 102 (SEQ ID NO:
102), FIG. 104 (SEQ ID NO: 104), FIG. 106 (SEQ ID NO: 106), FIG.
108 (SEQ ID NO: 108), FIG. 110 (SEQ ID NO: 110), FIG. 112 (SEQ ID
NO: 112), FIG. 114 (SEQ ID NO: 114), FIG. 116 (SEQ ID NO: 116),
FIG. 118 (SEQ ID NO: 118), FIG. 120 (SEQ ID NO: 120), FIG. 122 (SEQ
ID NO: 122), FIG. 124 (SEQ ID NO: 124), FIG. 126 (SEQ ID NO: 126),
FIG. 128 (SEQ ID NO: 128), FIG. 130 (SEQ ID NO: 130), FIG. 132 (SEQ
ID NO: 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ ID NO: 136),
FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ
ID NO: 142), FIG. 144 (SEQ ID NO: 144), FIG. 146 (SEQ ID NO: 146),
FIG. 148 (SEQ ID NO: 148), FIG. 150 (SEQ ID NO: 150), FIG. 152 (SEQ
ID NO: 152), FIG. 154 (SEQ ID NO: 154), FIG. 156 (SEQ ID NO: 156),
FIG. 158 (SEQ ID NO: 158), FIG. 160 (SEQ ID NO: 160), FIG. 162 (SEQ
ID NO: 162), FIG. 164 (SEQ ID NO: 164), FIG. 166 (SEQ ID NO: 166),
FIG. 168 (SEQ ID NO: 168), FIG. 170 (SEQ ID NO: 170), FIG. 172 (SEQ
ID NO: 172), FIG. 174 (SEQ ID NO: 174), FIG. 176 (SEQ ID NO: 176),
FIG. 178 (SEQ ID NO: 178), FIG. 180 (SEQ ID NO: 180), FIG. 182 (SEQ
ID NO: 182), FIG. 184 (SEQ ID NO: 184), FIG. 186 (SEQ ID NO: 186),
FIG. 188 (SEQ ID NO: 188), FIG. 190 (SEQ ID NO: 190), FIG. 192 (SEQ
ID NO: 192), FIG. 194 (SEQ ID NO: 194), FIG. 196 (SEQ ID NO: 196),
FIG. 198 (SEQ ID NO: 198), FIG. 200 (SEQ ID NO: 200), FIG. 202 (SEQ
ID NO: 202), FIG. 204 (SEQ ID NO: 204), FIG. 206 (SEQ ID NO: 206),
FIG. 208 (SEQ ID NO: 208), FIG. 210 (SEQ ID NO: 210), FIG. 212 (SEQ
ID NO: 212), FIG. 214 (SEQ ID NO: 214), FIG. 216 (SEQ ID NO: 216),
FIG. 218 (SEQ ID NO: 218), FIG. 220 (SEQ ID NO: 220), FIG. 222 (SEQ
ID NO: 222), FIG. 224 (SEQ ID NO: 224), FIG. 226 (SEQ ID NO: 226),
FIG. 228 (SEQ ID NO: 228), FIG. 230 (SEQ ID NO: 230), FIG. 232 (SEQ
ID NO: 232), FIG. 234 (SEQ ID NO: 234), FIG. 236 (SEQ ID NO: 236),
FIG. 238 (SEQ ID NO: 238), FIG. 240 (SEQ ID NO: 240), FIG. 242 (SEQ
ID NO: 242), FIG. 244 (SEQ ID NO: 244), FIG. 246 (SEQ ID NO: 246),
FIG. 248 (SEQ ID NO: 248), FIG. 250 (SEQ ID NO: 250), FIG. 252 (SEQ
ID NO: 252), FIG. 254 (SEQ ID NO: 254), FIG. 256 (SEQ ID NO: 256),
FIG. 258 (SEQ ID NO: 258), FIG. 260 (SEQ ID NO: 260), FIG. 262 (SEQ
ID NO: 262), FIG. 264 (SEQ ID NO: 264), FIG. 266 (SEQ ID NO: 266),
FIG. 268 (SEQ ID NO: 268), FIG. 270 (SEQ ID NO: 270), FIG. 272 (SEQ
ID NO: 272), FIG. 274 (SEQ ID NO: 274), FIG. 276 (SEQ ID NO: 276),
FIG. 278 (SEQ ID NO: 278), FIG. 280 (SEQ ID NO: 280), FIG. 282 (SEQ
ID NO: 282), FIG. 284 (SEQ ID NO: 284), FIG. 286 (SEQ ID NO: 286),
FIG. 288 (SEQ ID NO: 288), FIG. 290 (SEQ ID NO: 290), FIG. 292 (SEQ
ID NO: 292), FIG. 294 (SEQ ID NO: 294), FIG. 296 (SEQ ID NO: 296),
FIG. 298 (SEQ ID NO: 298), FIG. 300 (SEQ ID NO: 300), FIG. 302 (SEQ
ID NO: 302), FIG. 304 (SEQ ID NO: 304), FIG. 306 (SEQ ID NO: 306),
FIG. 308 (SEQ ID NO: 308), FIG. 310 (SEQ ID NO: 310), FIG. 312 (SEQ
ID NO: 312), FIG. 314 (SEQ ID NO: 314), FIG. 316 (SEQ ID NO: 316),
FIG. 318 (SEQ ID NO: 318), FIG. 320 (SEQ ID NO: 320), FIG. 322 (SEQ
ID NO: 322), FIG. 324 (SEQ ID NO: 324), FIG. 326 (SEQ ID NO: 326),
FIG. 328 (SEQ ID NO: 328), FIG. 330 (SEQ ID NO: 330), FIG. 332 (SEQ
ID NO: 332), FIG. 334 (SEQ ID NO: 334), FIG. 336 (SEQ ID NO: 336),
FIG. 338 (SEQ ID NO: 338), FIG. 340 (SEQ ID NO: 340), FIG. 342 (SEQ
ID NO: 342), FIG. 344 (SEQ ID NO: 344), FIG. 346 (SEQ ID NO: 346),
FIG. 348 (SEQ ID NO: 348), FIG. 350 (SEQ ID NO: 350), FIG. 352 (SEQ
ID NO: 352), FIG. 354 (SEQ ID NO: 354), FIG. 356 (SEQ ID NO: 356),
FIG. 358 (SEQ ID NO: 358), FIG. 360 (SEQ ID NO: 360), FIG. 362 (SEQ
ID NO: 362), FIG. 364 (SEQ ID NO: 364), FIG. 366 (SEQ ID NO: 366),
FIG. 368 (SEQ ID NO: 368), FIG. 370 (SEQ ID NO: 370), FIG. 372 (SEQ
ID NO: 372) or FIG. 374 (SEQ ID NO: 374), or agonist or antagonist
thereof.
32. The method of claim 31, wherein said agonist is an antibody to
said polypeptide.
33. The method of claim 31, wherein said antagonist is an antibody
to said polypeptide.
34. The method of claim 31, wherein the mammal is human.
35. The method of claim 31, wherein the nucleic acid molecule is
administered via ex vivo gene therapy.
36. A method for inhibiting endothelial cell growth in a mammal
comprising administering to the mammal a PRO229, PRO238, PRO247,
PRO444, PRO720, PRO827, PRO1007, PRO1029, PRO1075, PRO1184,
PRO1190, PRO1195, PRO1274, PRO1279, PRO1419, PRO1474, PRO1477,
PRO1488, PRO1782, PRO1890, PRO4302, PRO4405, PRO5725, PRO5776,
PRO6006, PRO7436, PRO9771, PRO10008, PRO21384 or PRO28631
polypeptide or agonist thereof, wherein endothelial cell growth in
said mammal is inhibited.
37. A method for stimulating endothelial cell growth in a mammal
comprising administering to the mammal a PRO21, PRO181, PRO205,
PRO214, PRO221, PRO231, PRO238, PRO241, PRO247, PRO256, PRO258,
PRO263, PRO265, PRO295, PRO321, PRO322, PRO337, PRO363, PRO365,
PRO533, PRO697, PRO725, PRO771, PRO788, PRO791, PRO819, PRO828,
PRO836, PRO846, PRO865, PRO1005, PRO1006, PRO1025, PRO1054,
PRO1071, PRO1079, PRO1080, PRO1114, PRO1131, PRO1155, PRO1160,
PRO1186, PRO1192, PRO1244, PRO1272, PRO1273, PRO1279, PRO1283,
PRO1286, PRO1306, PRO1309, PRO1325, PRO1329, PRO1347, PRO1356,
PRO1376, PRO1382, PRO1411, PRO1412, PRO1508, PRO1550, PRO1556,
PRO1760, PRO1787, PRO1801, PRO1868, PRO1887, PRO3438, PRO3444,
PRO4324, PRO4333, PRO4341, PRO4342, PRO4353, PRO4354, PRO4356,
PRO4371, PRO4408, PRO4422, PRO4425, PRO4499, PRO5723, PRO5737,
PRO6029, PRO6071, PRO9821, PRO9873, PRO10008, PRO10096, PRO19670,
PRO20040, PRO20044, PRO21055 or PRO21384 polypeptide, or agonist
thereof, wherein endothelial cell growth in said mammal is
stimulated.
38. A method for inducing cardiac hypertrophy in a mammal
comprising administering to the mammal a PRO21 polypeptide or
agonist thereof, wherein cardiac hypertrophy in said mammal is
induced.
39. A method for stimulating angiogenesis induced by a PRO1376 or
PRO1449 polypeptide in a mammal comprising administering a
therapeutically effective amount of said polypeptide to the mammal,
wherein said angiogenesis is stimulated.
40. A method for inducing endothelial cell apoptosis comprising
administering to the endothelial cell a PRO4302 polypeptide or
agonist thereof, wherein apoptosis in said endothelial cell is
induced.
41. A method for stimulating smooth muscle cell growth comprising
administering to the smooth muscle cell a PRO162, PRO182, PRO204,
PRO221, PRO230, PRO256, PRO258, PRO533, PRO697, PRO725, PRO738,
PRO826, PRO836, PRO840, PRO846, PRO865, PRO982, PRO1025, PRO1029,
PRO1071, PRO1083, PRO1134, PRO1160, PRO1182, PRO1184, PRO1186,
PRO1192, PRO1274, PRO1279, PRO1283, PRO1306, PRO1308, PRO1325,
PRO1337, PRO1338, PRO1343, PRO1376, PRO1387, PRO1411, PRO1412,
PRO1415, PRO1434, PRO1474, PRO1550, PRO1556, PRO1567, PRO1600,
PRO1754, PRO1758, PRO1760, PRO1787, PRO1865, PRO1868, PRO1917,
PRO1928, PRO3438, PRO3562, PRO4333, PRO4345, PRO4353, PRO4354,
PRO4408, PRO4430, PRO4503, PRO6714, PRO9771, PRO9820, PRO9940,
PRO10096, PRO21055, PRO21184 or PRO21366 polypeptide, or agonist
thereof, wherein smooth muscle cell growth in said smooth muscle
cell is stimulated.
42. A method for inhibiting smooth muscle cell growth comprising
administering to the smooth muscle cell a PRO181, PRO195, PRO1080,
PRO1265, PRO1309, PRO1488, PRO4302, PRO4405 or PRO5725 polypeptide,
or agonist thereof, wherein smooth muscle cell growth in said
smooth muscle cell is stimulated.
43. A method for inducing endothelial cell tube formation
comprising administering to the endothelial cell a PRO178, PRO195,
PRO228, PRO301, PRO302, PRO532, PRO724, PRO730, PRO734, PRO793,
PRO871, PRO938, PRO1012, PRO1120, PRO1139, PRO1198, PRO1287,
PRO1361, PRO1864, PRO1873, PRO2010, PRO3579, PRO4313, PRO4527,
PRO4538, PRO4553, PRO4995, PRO5730, PRO6008, PRO7223, PRO7248,
PRO7261 polypeptide, or agonist thereof, wherein tube formation in
said endothelial cell is induced.
Description
1. FIELD OF THE INVENTION
[0001] The present invention relates to compositions and methods
useful for the modulation (e.g., promotion or inhibition) of
angiogenesis and/or cardiovascularization in mammals in need of
such biological effect. The present invention further relates to
the diagnosis and treatment of disorders involving angiogenesis
(e.g., cardiovascular as well as oncological disorders).
2. BACKGROUND OF THE INVENTION
2.1. Angiogenesis
[0002] Angiogenesis, defined as the growth or sprouting of new
blood vessels from existing vessels, is a complex process that
primarily occurs during embryonic development. Under normal
physiological conditions in adults, angiogenesis takes place only
in very restricted situations such as hair growth and wounding
healing (Auerbach, W. and Auerbach, R., 1994, Pharmacol Ther
63(3):265-311; Ribatti et al., 1991, Haematologica 76(4):311-20;
Risau, 1997, Nature 386(6626):67 1-4). Unregulated angiogenesis has
gradually been recognized to be responsible for a wide range of
disorders, including, but not limited to cardiovascular disease,
cancer, rheumatoid arthritis, psoriasis and diabetic retinopathy
(Folkman, 1995, Nat Med 1(1):27-31; Isner, 1999, Circulation
99(13): 1653-5; Koch, 1998, Arthritis Rheum 41(6):951-62; Walsh,
1999, Rheumatology (Oxford) 38(2):103-12; Ware and Simons, 1997,
Nat Med 3(2): 158-64).
2.2. Cardiac Disorders and Factors
[0003] Heart failure affects approximately five million Americans,
and new cases of heart failure number about 400,000 each year. It
is the single most frequent cause of hospitalization for people age
65 and older in the United States. Recent advances in the
management of acute cardiac diseases, including acute myocardial
infarction, are resulting in an expanding patient population that
will eventually develop chronic heart failure. From 1979 to 1995,
hospitalizations for congestive heart failure (CHF) rose from
377,000 to 872,000 (a 130 percent increase) and CHF deaths
increased 116 percent.
[0004] CHF is a syndrome characterized by left ventricular
dysfunction, reduced exercise tolerance, impaired quality of life,
and markedly shortened life expectancy. The sine qua non of heart
failure is an inability of the heart to pump blood at a rate
sufficient to meet the metabolic needs of the body's tissues (in
other words, there is insufficient cardiac output).
[0005] At least four major compensatory mechanisms are activated in
the setting of heart failure to boost cardiac output, including
peripheral vasoconstriction, increased heart rate, increased
cardiac contractility, and increased plasma volume. These effects
are mediated primarily by the sympathetic nervous system and the
renin-angiotensin system. See, Eichhorn, American Journal of
Medicine, 104: 163-169 (1998). Increased output from the
sympathetic nervous system increases vascular tone, heart rate, and
contractility. Angiotensin II elevates blood pressure by 1)
directly stimulating vascular smooth muscle contraction, 2)
promoting plasma volume expansion by stimulating aldosterone and
antidiuretic hormone secretion, 3) stimulating sympathetic-mediated
vascular tone, and 4) catalyzing the degradation of bradykinin,
which has vasodilatory and natriuretic activity. See, review by
Brown and Vaughan, Circulation, 97: 1411-1420 (1998). As noted
below, angiotensin II may also have directly deleterious effects on
the heart by promoting myocyte necrosis (impairing systolic
function) and intracardiac fibrosis (impairing diastolic and in
some cases systolic function). See, Weber, Circulation, 96:
4065-4082 (1998).
[0006] A consistent feature of congestive heart failure (CHF) is
cardiac hypertrophy, an enlargement of the heart that is activated
by both mechanical and hormonal stimuli and enables the heart to
adapt to demands for increased cardiac output. Morgan and Baker,
Circulation, 83: 13-25 (1991). This hypertrophic response is
frequently associated with a variety of distinct pathological
conditions such as hypertension, aortic stenosis, myocardial
infarction, cardiomyopathy, valvular regurgitation, and
intracardiac shunt, all of which result in chronic hemodynamic
overload.
[0007] Hypertrophy is generally defined as an increase in size of
an organ or structure independent of natural growth that does not
involve tumor formation. Hypertrophy of the heart is due either to
an increase in the mass of the individual cells (myocytes), or to
an increase in the number of cells making up the tissue
(hyperplasia), or both. While the enlargement of an embryonic heart
is largely dependent on an increase in myocyte number (which
continues until shortly after birth), post-natal cardiac myocytes
lose their proliferative capacity. Further growth occurs through
hypertrophy of the individual cells.
[0008] Adult myocyte hypertrophy is initially beneficial as a short
term response to impaired cardiac function by permitting a decrease
in the load on individual muscle fibers. With severe, long-standing
overload, however, the hypertrophied cells begin to deteriorate and
die. Katz, "Heart Failure", in: Katz A. M. ed., Physiology of the
Heart (New York: Raven Press, 1992) pp. 638-668. Cardiac
hypertrophy is a significant risk factor for both mortality and
morbidity in the clinical course of heart failure. Katz, Trends
Cardiovasc. Med., 5: 37-44 (1995). For further details of the
causes and pathology of cardiac hypertrophy see, e.g., Heart
Disease, A Textbook of Cardiovascular Medicine, Braunwald, E. ed.
(W. B. Saunders Co., 1988), Chapter 14, "Pathophysiology of Heart
Failure."
[0009] On a cellular level, the heart is composed of myocytes and
surrounding support cells, generically called non-myocytes. While
non-myocytes are primarily fibroblast/mesenchymal cells, they also
include endothelial and smooth muscle cells. Indeed, although
myocytes make up most of the adult myocardial mass, they represent
only about 30% of the total cell numbers present in heart. In
response to hormonal, physiological, hemodynamic, and pathological
stimuli, adult ventricular muscle cells can adapt to increased
workloads through the activation of a hypertrophic process. This
response is characterized by an increase in myocyte cell size and
contractile protein content of individual cardiac muscle cells,
without concomitant cell division and activation of embryonic
genes, including the gene for atrial natriuretic peptide (ANP).
Chien et al., FASEB J., 5: 3037-3046 (1991); Chien et al., Annu.
Rev. Physiol., 55: 77-95 (1993). An increment in myocardial massas
a result of an increase in myocyte size that is associated with an
accumulation of interstitial collagen within the extracellular
matrix and around intramyocardial coronary arteries has been
described in left ventricular hypertrophy secondary to pressure
overload in humans. Caspari et al., Cardiovasc. Res., 11: 554-558
(1977); Schwarz et al., Am. J. Cardiol., 42: 895-903 (1978); Hess
et al., Circulation, 63: 360-371 (1981); Pearlman et al., Lab.
Invest., 46: 158-164 (1982).
[0010] It has also been suggested that paracrine factors produced
by non-myocyte supporting cells may additionally be involved in the
development of cardiac hypertrophy, and various non-myocyte derived
hypertrophic factors, such as, leukocyte inhibitory factor (LIF)
and endothelin, have been identified. Metcalf, Growth Factors, 7:
169-173 (1992); Kurzrock et al., Endocrine Reviews, 12: 208-217
(1991); Inoue et al., Proc. Natl. Acad. Sci. USA, 86: 2863-2867
(1989); Yanagisawa and Masaki, Trends Pharm. Sci., 10: 374-378
(1989); U.S. Pat. No. 5,573,762 (issued Nov. 12, 1996). Further
exemplary factors that have been identified as potential mediators
of cardiac hypertrophy include cardiotrophin-1 (CT-1) (Pennica et
al., Proc. Nat. Acad. Sci. USA, 92: 1142-1146 (1995)),
catecholamines, adrenocorticosteroids, angiotensin, and
prostaglandins.
[0011] At present, the treatment of cardiac hypertrophy varies
depending on the underlying cardiac disease. Catecholamines,
adrenocorticosteroids, angiotensin, prostaglandins, LIF, endothelin
(including endothelin-1, -2, and -3 and big endothelin), and CT-1
are among the factors identified as potential mediators of
hypertrophy. For example, beta-adrenergic receptor blocking drugs
(beta-blockers, e.g., propranolol, timolol, tertalolol, carteolol,
nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol,
carvedilol, etc.) and verapamil have been used extensively in the
treatment of hypertrophic cardiomyopathy. The beneficial effects of
beta-blockers on symptoms (e.g., chest pain) and exercise tolerance
are largely due to a decrease in the heart rate with a consequent
prolongation of diastole and increased passive ventricular filling.
Thompson et al., Br. Heart J., 44: 488-98 (1980); Harrison et al.,
Circulation, 29: 84-98 (1964). Verapamil has been described to
improve ventricular filling and probably reducing myocardial
ischemia. Bonow et al., Circulation, 72: 853-64 (1985).
[0012] Nifedipine and diltiazem have also been used occasionally in
the treatment of hypertrophic cardiomyopathy. Lorell et al.,
Circulation, 65: 499-507 (1982); Betocchi et al., Am. J. Cardiol.,
78: 451-457 (1996). However, because of its potent vasodilating
properties, nifedipine may be harmful, especially in patients with
outflow obstruction. Disopyramide has been used to relieve symptoms
by virtue of its negative inotropic properties. Pollick, N. Engl.
J. Med., 307: 997-999 (1982). In many patients, however, the
initial benefits decrease with time. Wigle et al., Circulation, 92:
1680-1692 (1995). Antihypertensive drug therapy has been reported
to have beneficial effects on cardiac hypertrophy associated with
elevated blood pressure. Examples of drugs used in antihypertensive
therapy, alone or in combination, are calcium antagonists, e.g.,
nitrendipine; adrenergic receptor blocking agents, e.g., those
listed above; angiotensin converting enzyme (ACE) inhibitors such
as quinapril, captopril, enalapril, ramipril, benazepril,
fosinopril, and lisinopril; diuretics, e.g., chlorothiazide,
hydrochlorothiazide, hydroflumethazide, methylchlothiazide,
benzthiazide, dichlorphenamide, acetazolamide, and indapamide; and
calcium channel blockers, e g., diltiazem, nifedipine, verapamil,
and nicardipine.
[0013] For example, treatment of hypertension with diltiazem and
captopril showed a decrease in left ventricular muscle mass, but
the Doppler indices of diastolic function did not normalize.
Szlachcic et al., Am. J. Cardiol., 63: 198-201 (1989); Shahi et
al., Lancet, 336: 458-461 (1990). These findings were interpreted
to indicate that excessive amounts of interstitial collagen may
remain after regression of left ventricular hypertrophy. Rossi et
al., Am. Heart J., 124: 700-709 (1992). Rossi et al., supra,
investigated the effect of captopril on the prevention and
regression of myocardial cell hypertrophy and interstitial fibrosis
in pressure overload cardiac hypertrophy, in experimental rats.
[0014] Agents that increase cardiac contractility directly
(iontropic agents) were initially thought to benefit patients with
heart failure because they improved cardiac output in the short
term. However, all positive inotropic agents except digoxigenin
have been found to result in increased long-term mortality, in
spite of short-term improvements in cardiac performance. Massie,
Curr. Op. in Cardiology, 12: 209-217 (1997); Reddy et al., Curr.
Opin. Cardiol., 12: 233-241 (1997). Beta-adrenergic
receptorblockers have recently been advocated for use in heart
failure. Evidence from clinical trials suggests that improvements
in cardiac function can be achieved without increased mortality,
though documented improvements of patient survival have not yet
been demonstrated. See also, U.S. Pat. Nos. 5,935,924, 5,624,806;
5,661,122; and 5,610,134 and WO 95/28173 regarding the use of
cardiotropin-1 or antagonists thereof, or growth hormone and/or
insulin-like growth factor-I in the treatment of CHF. Another
treatment modality is heart transplantation, but this is limited by
the availability of donor hearts.
[0015] Endothelin is a vasoconstricting peptide comprising 21 amino
acids, isolated from swine arterial endothelial culture supernatant
and structurally determined. Yanagisawa et al., Nature, 332:
411-415 (1988). Endothelin was later found to exhibit various
actions, and endothelin antibodies as endothelin antagonists have
proven effective in the treatment of myocardial infarction, renal
failure, and other diseases. Since endothelin is present in live
bodies and exhibits vasoconstricting action, it is expected to be
an endogenous factor involved in the regulation of the circulatory
system, and may be associated with hypertension, cardiovascular
diseases such as myocardial infarction, and renal diseases such as
acute renal failure. Endothelin antagonists are described, for
example, in U.S. Pat. No. 5,773,414; JP Pat. Publ. 3130299/1991, EP
457,195; EP 460,679; and EP 552,489. A new endothelin B receptor
for identifying endothelin receptor antagonists is described in
U.S. Pat. No. 5,773,223.
[0016] Current therapy for heart failure is primarily directed to
using angiotensin-converting enzyme (ACE) inhibitors, such as
captopril, and diuretics. These drugs improve hemodynamic profile
and exercise tolerance and reduce the incidence of morbidity and
mortality in patients with CHF. Kramer et al., Circulation, 67(4):
807-816 (1983); Captopril Multicenter Research Group, J.A.C.C.,
2(4): 755-763 (1983); The CONSENSUS Trial Study Group, N. Engl. J.
Med., 316(23): 1429-1435 (1987); The SOLVD Investigators, N. Engl.
J. Med., 325(5): 293-302 (1991). Further, they are useful in
treating hypertension, left ventricular dysfunction,
atherosclerotic vascular disease, and diabetic nephropathy. Brown
and Vaughan, supra. However, despite proven efficacy, response to
ACE inhibitors has been limited. For example, while prolonging
survival in the setting of heart failure, ACE inhibitors appear to
slow the progression towards end-stage heart failure, and
substantial numbers of patients on ACE inhibitors have functional
class III heart failure.
[0017] Moreover, improvement of functional capacity and exercise
time is only small and mortality, although reduced, continues to be
high. The CONSENSUS Trial Study Group, N. Engl. J. Med., 316(23):
1429-1453 (1987); The SOLVD Investigators, N. Engl. J. Med.,
325(5): 293-302 (1991); Cohn et al., N. Engl. J. Med., 325(5):
303-310 (1991); The Captopril-Digoxin Multicenter Research Group,
JAMA, 259(4): 539-544 (1988). Hence, ACE inhibitors consistently
appear unable to relieve symptoms in more than 60% of heart failure
patients and reduce mortality of heart failure only by
approximately 15-20%. For further adverse effects, see Brown and
Vaughan, supra.
[0018] An alternative to ACE inhibitors is represented by specific
AT1 receptor antagonists. Clinical studies are planned to compare
the efficacy of these two modalities in the treatment of
cardiovascular and renal disease. However, animal model data
suggests that the ACE/Ang II pathway, while clearly involved in
cardiac hypertrophy, is not the only, or even the primary pathway
active in this role. Mouse genetic "knockout" models have been made
to test individual components of the pathway. In one such model,
the primary cardiac receptor for Ang II, AT sub 1A, has been
genetically deleted; these mice do not develop hypertrophy when Ang
II is given experimentally (confirming the basic success of the
model in eliminating hypertrophy secondary to Ang II). However,
when the aorta is constricted in these animals (a model of
hypertensive cardiac stress), the hearts still become hypertrophic.
This suggests that alternative signaling pathways, not depending on
this receptor (AT sub 1A), are activated in hypertension. ACE
inhibitors would presumably not be able to inhibit these pathways.
See, Harada et al., Circulation, 97: 1952-1959 (1998). See also,
Homcy, Circulation, 97: 1890-1892 (1998) regarding the enigma
associated with the process and mechanism of cardiac
hypertrophy.
[0019] About 750,000 patients suffer from acute myocardial
infarction (AMI) annually, and approximately one-fourth of all
deaths in the United States are due to AMI. In recent years,
thrombolytic agents, e.g., streptokinase, urokinase, and in
particular tissue plasminogen activator (t-PA) have significantly
increased the survival of patients who suffered myocardial
infarction. When administered as a continuous intravenous infusion
over 1.5 to 4 hours, t-PA produces coronary patency at 90 minutes
in 69% to 90% of the treated patients. Topol et al., Am. J.
Cardiol., 61: 723-728 (1988); Neuhaus et al., J. Am. Coll.
Cardiol., 12: 581-587 (1988); Neuhaus et al., J. Am. Coll.
Cardiol., 14: 1566-1569 (1989). The highest patency rates have been
reported with high dose or accelerated dosing regimens. Topol, J.
Am. Coll. Cardiol., 15: 922-924 (1990). t-PA may also be
administered as a single bolus, although due to its relatively
short half-life, it is better suited for infusion therapy. Tebbe et
al., Am. J. Cardiol., 64: 448-453 (1989). A t-PA variant,
specifically designed to have longer half-life and very high fibrin
specificity, TNK t-PA (a T103N, N117Q, KHRR(296-299)AAAA t-PA
variant, Keyt et al., Proc. Natl. Acad. Sci. USA, 91: 3670-3674
(1994)) is particularly suitable for bolus administration. However,
despite all these advances, the long-term prognosis of patient
survival depends greatly on the post-infarction monitoring and
treatment of the patients, which should include monitoring and
treatment of cardiac hypertrophy.
2.3. Growth Factors
[0020] Various naturally occurring polypeptides reportedly induce
the proliferation of endothelial cells. Among those polypeptides
are the basic and acidic fibroblast growth factors (FGF) (Burgess
and Maciag, Annual Rev. Biochem., 58: 575 (1989)), platelet-derived
endothelial cell growth factor (PD-ECGF) (Ishikawa et al., Nature,
338: 557 (1989)), and vascular endothelial growth factor (VEGF).
Leung et al., Science, 246: 1306 (1989); Ferrara and Henzel,
Biochem. Biophys. Res. Commun., 161: 851 (1989); Tischer et al.,
Biochem. Biophys. Res. Commun., 165: 1198 (1989); EP 471,754B
granted Jul. 31, 1996.
[0021] Media conditioned by cells transfected with the human VEGF
(hVEGF) cDNA promoted the proliferation of capillary endothelial
cells, whereas control cells did not. Leung et al., Science, 246:
1306 (1989). Several additional cDNAs were identified in human cDNA
libraries that encode 121-, 189-, and 206-amino acid isoforms of
hVEGF (also collectively referred to as hVEGF-related proteins).
The 121-amino acid protein differs from hVEGF by virtue of the
deletion of the 44 amino acids between residues 116 and 159 in
hVEGF. The 189-amino acid protein differs from hVEGF by virtue of
the insertion of 24 amino acids at residue 116 in hVEGF, and
apparently is identical to human vascular permeability factor
(hVPF). The 206-amino acid protein differs from hVEGF by virtue of
an insertion of 41 amino acids at residue 116 in hVEGF. Houck et
al., Mol. Endocrin., 5: 1806 (1991); Ferrara et al., J. Cell.
Biochem., 47: 211 (1991); Ferrara et al., Endocrine Reviews, 13: 18
(1992); Keck et al., Science, 246: 1309 (1989); Connolly et al., J.
Biol. Chem., 264: 20017 (1989); EP 370,989 published May 30,
1990.
[0022] It is now well established that angiogenesis, which involves
the formation of new blood vessels from preexisting endothelium, is
implicated in the pathogenesis of a variety of disorders. These
include solid tumors and metastasis, atherosclerosis, retrolental
fibroplasia, hemangiomas, chronic inflammation, intraocular
neovascular syndromes such as proliferative retinopathies, e.g.,
diabetic retinopathy, age-related macular degeneration (AMD),
neovascular glaucoma, immune rejection of transplanted corneal
tissue and other tissues, rheumatoid arthritis, and psoriasis.
Folkman et al., J. Biol. Chem., 267: 10931-10934 (1992); Klagsbrun
et al., Annu. Rev. Physiol., 53: 217-239 (1991); and Garner A.,
"Vascular diseases", In: Pathobiology of Ocular Disease. A Dynamic
Approach, Garner A., Klintworth G K, eds., 2nd Edition (Marcel
Dekker, NY, 1994), pp 1625-1710.
[0023] In the case of tumor growth, angiogenesis appears to be
crucial for the transition from hyperplasia to neoplasia, and for
providing nourishment for the growth and metastasis of the tumor.
Folkman et al., Nature, 339: 58 (1989). The neovascularization
allows the tumor cells to acquire a growth advantage and
proliferative autonomy compared to the normal cells. A tumor
usually begins as a single aberrant cell which can proliferate only
to a size of a few cubic millimeters due to the distance from
available capillary beds, and it can stay `dormant` without further
growth and dissemination for a long period of time. Some tumor
cells then switch to the angiogenic phenotype to activate
endothelial cells, which proliferate and mature into new capillary
blood vessels. These newly formed blood vessels not only allow for
continued growth of the primary tumor, but also for the
dissemination and recolonization of metastatic tumor cells.
Accordingly, a correlation has been observed between density of
microvessels in tumor sections and patient survival in breast
cancer as well as in several other tumors. Weidner et al., N. Engl.
J. Med, 324: 1-6 (1991); Horak et a., Lancet, 340: 1120-1124
(1992); Macchiarini et al., Lancet, 340: 145-146 (1992). The
precise mechanisms that control the angiogenic switch is not well
understood, but it is believed that neovascularization of tumor
mass results from the net balance of a multitude of angiogenesis
stimulators and inhibitors (Folkman, 1995, Nat Med 1(1):27-31).
[0024] The search for positive regulators of angiogenesis has
yielded many candidates, including aFGF, bFGF, TGF-.alpha.,
TGF-.beta., HGF, TNF-.alpha., angiogenin, IL-8, etc. Folkman et
al., J.B.C., supra, and Klagsbrun et al., supra. The negative
regulators so far identified include thrombospondin (Good et al.,
Proc. Natl. Acad. Sci. USA., 87: 6624-6628 (1990)), the
16-kilodalton N-terminal fragment of prolactin (Clapp et al.,
Endocrinology, 133: 1292-1299 (1993)), angiostatin (O'Reilly et
al., Cell, 79: 315-328 (1994)), and endostatin. O'Reilly et al.,
Cell, 88: 277-285 (1996).
[0025] Work done over the last several years has established the
key role of VEGF, not only in stimulating vascular endothelial cell
proliferation, but also in inducing vascular permeability and
angiogenesis. Ferrara et al., Endocr. Rev., 18: 4-25 (1997). The
finding that the loss of even a single VEGF allele results in
embryonic lethality points to an irreplaceable role played by this
factor in the development and differentiation of the vascular
system. Furthermore, VEGF has been shown to be a key mediator of
neovascularization associated with tumors and intraocular
disorders. Ferrara et al., Endocr. Rev., supra. The VEGF mRNA is
overexpressed by the majority of human tumors examined. Berkman et
al., J. Clin. Invest., 91: 153-159 (1993); Brown et al., Human
Pathol., 26: 86-91 (1995); Brown et al., Cancer Res., 53: 4727-4735
(1993); Mattern et al., Brit. J. Cancer, 73: 931-934 (1996) Dvorak
et al., Am. J. Pathol., 146: 1029-1039 (1995).
[0026] Also, the concentration levels of VEGF in eye fluids are
highly correlated to the presence of active proliferation of blood
vessels in patients with diabetic and other ischemia-related
retinopathies. Aiello et al., N Engl. J. Med., 331: 1480-1487
(1994). Furthermore, recent studies have demonstrated the
localization of VEGF in choroidal neovascular membranes in patients
affected by AMD. Lopez et al., Invest. Ophthalmol. Vis. Sci., 37:
855-868 (1996).
[0027] Anti-VEGF neutralizing antibodies suppress the growth of a
variety of human tumor cell lines in nude mice (Kim et al., Nature,
362: 841-844 (1993); Warren et al., J. Clin. Invest., 95: 1789-1797
(1995); Borgstrom et al., Cancer Res., 56: 4032-4039 (1996); Melnyk
et al., Cancer Res., 56: 921-924 (1996)) and also inhibit
intraocular angiogenesis in models of ischemic retinal disorders.
Adamis et al., Arch. Ophthalmol., 114: 66-71 (1996). Therefore,
anti-VEGF monoclonal antibodies or other inhibitors of VEGF action
are promising candidates for the treatment of solid tumors and
various intraocular neovascular disorders. Such antibodies are
described, for example, in EP 817,648 published Jan. 14, 1998 and
in WO98/45331 and WO98/45332 both published Oct. 15, 1998.
[0028] There exist several other growth factors and mitogens,
including transforming oncogenes, that are capable of rapidly
inducing a complex set of genes to be expressed by certain cells.
Lau and Nathans, Molecular Aspects of Cellular Regulation, 6:
165-202 (1991). These genes, which have been named immediate-early-
or early-response genes, are transcriptionally activated within
minutes after contact with a growth factor or mitogen, independent
of de novo protein synthesis. A group of these intermediate-early
genes encodes secreted, extracellular proteins that are needed for
coordination of complex biological processes such as
differentiation and proliferation, regeneration, and wound healing.
Ryseck et al., Cell Growth Differ., 2: 235-233 (1991).
[0029] Highly-related proteins that belong to this group include
cef 10 (Simmons et al., Proc. Natl. Acad. Sci. USA, 86:1178-1182
(1989)), cyr 61, which is rapidly activated by serum- or
platelet-derived growth factor(PDGF (O'Brien et al., Mol. Cell
Biol., 10: 3569-3577 (1990), human connective tissue growth factor
(CTGF) (Bradham et al., J. Cell. Biol., 114: 1285-1294 (1991)),
which is secreted by human vascular endothelial cells in high
levels after activation with transforming growth factor beta
(TGF-.beta.), exhibits PDGF-like biological and immunological
activities, and competes with PDGF for a particular cell surface
receptor,fisp-12 (Ryseck et al., Cell Growth Differ., 2: 235-233
(1991)), human vascular IBP-like growth factor (VIGF) (WO
96/17931), and nov, normally arrested in adult kidney cells, which
was found to be overexpressed in
myeloblastosis-associated-virus-type-1-induced nephroblastomas.
Joloit et al., Mol. Cell. Biol., 12: 10-21 (1992).
[0030] The expression of these immediate-early genes acts as "third
messengers" in the cascade of events triggered by growth factors.
It is also thought that they are needed to integrate and coordinate
complex biological processes, such as differentiation and wound
healing in which cell proliferation is a common event.
[0031] As additional mitogens, insulin-like growth factor binding
proteins (IGFBPs) have been shown, in complex with insulin-like
growth factor (IGF), to stimulate increased binding of IGF to
fibroblast and smooth muscle cell surface receptors. Clemmons et
al., J. Clin. Invest., 77: 1548 (1986). Inhibitory effects of IGFBP
on various IGF actions in vitro include stimulation of glucose
transport by adipocytes, sulfate incorporation by chondrocytes, and
thymidine incorporation in fibroblast. Zapf e al., J. Clin.
Invest., 63: 1077 (1979). In addition, inhibitory effects of IGFBPs
on growth factor-mediated mitogen activity in normal cells have
been shown.
2.4. Need for Further Treatments
[0032] In view of the role of vascular endothelial cell growth and
angiogenesis in many diseases and disorders, it is desirable to
have a means of reducing or inhibiting one or more of the
biological effects causing these processes. It is also desirable to
have a means of assaying for the presence of pathogenic
polypeptides in normal and diseased conditions, and especially
cancer. Further, in a specific aspect, as there is no generally
applicable therapy for the treatment of cardiac hypertrophy, the
identification of factors that can prevent or reduce cardiac
myocyte hypertrophy is of primary importance in the development of
new therapeutic strategies to inhibit pathophysiological cardiac
growth. While there are several treatment modalities for various
cardiovascular and oncologic disorders, there is still a need for
additional therapeutic approaches.
3. SUMMARY OF THE INVENTION
[0033] The present invention provides compositions and methods for
modulating (e.g., promoting or inhibiting) angiogenesis and/or
cardiovascularization in mammals. The present invention is based on
the identification of compounds (i.e., proteins) that test positive
in various cardiovascular assays that test modulation (e.g.,
promotion or inhibition) of certain biological activities.
Accordingly, the compounds are believed to be useful drugs and/or
drug components for the diagnosis and/or treatment (including
prevention and amelioration) of disorders where such effects are
desired, such as the promotion or inhibition of angiogenesis,
inhibition or stimulation of vascular endothelial cell growth,
stimulation of growth or proliferation of vascular endothelial
cells, inhibition of tumor growth, inhibition of
angiogenesis-dependent tissue growth, stimulation of
angiogenesis-dependent tissue growth, inhibition of cardiac
hypertrophy and stimulation of cardiac hypertrophy, e.g., for the
treatment of congestive heart failure. In addition, the
compositions and methods of the invention provide for the
diagnostic monitoring of patients undergoing clinical evaluation
for the treatment of angiogenesis-related disorders, for monitoring
the efficacy of compounds in clinical trials and for identifying
subjects who may be predisposed to such angiogenic-related
disorders.
[0034] In one embodiment, the present invention provides a
composition comprising a PRO polypeptide, an agonist or antagonist
thereof, or an anti-PRO antibody in admixture with a
pharmaceutically acceptable carrier. In one aspect, the composition
comprises a therapeutically effective amount of the polypeptide,
agonist, antagonist or antibody. In another aspect, the composition
comprises a further active ingredient, namely, a cardiovascular,
endothelial or angiogenic agent or an angiostatic agent, preferably
an angiogenic or angiostatic agent. Preferably, the composition is
sterile. The PRO polypeptide, agonist, antagonist or antibody may
be administered in the form of a liquid pharmaceutical formulation,
which may be preserved to achieve extended storage stability.
Preserved liquid pharmaceutical formulations might contain multiple
doses of PRO polypeptide, agonist, antagonist or antibody, and
might, therefore, be suitable for repeated use. In a preferred
embodiment, where the composition comprises an antibody, the
antibody is a monoclonal antibody, an antibody fragment, a
humanized antibody, or a single-chain antibody.
[0035] In a further embodiment, the present invention provides a
method for preparing such a composition useful for the treatment of
a cardiovascular, endothelial or angiogenic disorder comprising
admixing a therapeutically effective amount of a PRO polypeptide,
agonist, antagonist or antibody with a pharmaceutically acceptable
carrier.
[0036] In a still further aspect, the present invention provides an
article of manufacture comprising:
[0037] (a) a composition of matter comprising a PRO polypeptide or
agonist or antagonist thereof;
[0038] (b) a container containing said composition; and
[0039] (c) a label affixed to said container, or a package insert
included in said container referring to the use of said PRO
polypeptide or agonist or antagonist thereof in the treatment of a
cardiovascular, endothelial or angiogenic disorder, wherein the
agonist or antagonist may be an antibody which binds to the PRO
polypeptide. The composition may comprise a therapeutically
effective amount of the PRO polypeptide or the agonist or
antagonist thereof.
[0040] In another embodiment, the present invention provides a
method for identifying an agonist of a PRO polypeptide
comprising:
[0041] (a) contacting cells and a test compound to be screened
under conditions suitable for the induction of a cellular response
normally induced by a PRO polypeptide; and
[0042] (b) determining the induction of said cellular response to
determine if the test compound is an effective agonist, wherein the
induction of said cellular response is indicative of said test
compound being an effective agonist.
[0043] In another embodiment, the present invention provides a
method for identifying an agonist of a PRO polypeptide
comprising:
[0044] (a) contacting cells and a test compound to be screened
under conditions suitable for the stimulation of cell proliferation
by a PRO polypeptide; and
[0045] (b) measuring the proliferation of said cells to determine
if the test compound is an effective agonist, wherein the
stimulation of cell proliferation is indicative of said test
compound being an effective agonist.
[0046] In another embodiment, the invention provides a method for
identifying a compound that inhibits the activity of a PRO
polypeptide comprising contacting a test compound with a PRO
polypeptide under conditions and for a time sufficient to allow the
test compound and polypeptide to interact and determining whether
the activity of the PRO polypeptide is inhibited. In a specific
preferred aspect, either the test compound or the PRO polypeptide
is immobilized on a solid support. In another preferred aspect, the
non-immobilized component carries a detectable label. In a
preferred aspect, this method comprises the steps of:
[0047] (a) contacting cells and a test compound to be screened in
the presence of a PRO polypeptide under conditions suitable for the
induction of a cellular response normally induced by a PRO
polypeptide; and
[0048] (b) determining the induction of said cellular response to
determine if the test compound is an effective antagonist.
[0049] In another preferred aspect, this process comprises the
steps of:
[0050] (a) contacting cells and a test compound to be screened in
the presence of a PRO polypeptide under conditions suitable for the
stimulation of cell proliferation by a PRO polypeptide; and
[0051] (b) measuring the proliferation of the cells to determine if
the test compound is an effective antagonist.
[0052] In another embodiment, the invention provides a method for
identifying a compound that inhibits the expression of a PRO
polypeptide in cells that normally expresses the polypeptide,
wherein the method comprises contacting the cells with a test
compound and determining whether the expression of the PRO
polypeptide is inhibited. In a preferred aspect, this method
comprises the steps of:
[0053] (a) contacting cells and a test compound to be screened
under conditions suitable for allowing expression of the PRO
polypeptide; and
[0054] (b) determining the inhibition of expression of said
polypeptide.
[0055] In a still further embodiment, the invention provides a
compound that inhibits the expression of a PRO polypeptide, such as
a compound that is identified by the methods set forth above.
[0056] Another aspect of the present invention is directed to an
agonist or an antagonist of a PRO polypeptide which may optionally
be identified by the methods described above.
[0057] One type of antagonist of a PRO polypeptide that inhibits
one or more of the functions or activities of the PRO polypeptide
is an antibody. Hence, in another aspect, the invention provides an
isolated antibody that binds a PRO polypeptide. In a preferred
aspect, the antibody is a monoclonal antibody, which preferably has
non-human complementarity-determining-region (CDR) residues and
human framework-region (FR) residues. The antibody may be labeled
and may be immobilized on a solid support. In a further aspect, the
antibody is an antibody fragment, a single-chain antibody, or a
humanized antibody. Preferably, the antibody specifically binds to
the polypeptide.
[0058] In a still further aspect, the present invention provides a
method for diagnosing a disease or susceptibility to a disease
which is related to a mutation in a PRO polypeptide-encoding
nucleic acid sequence comprising determining the presence or
absence of said mutation in the PRO polypeptide nucleic acid
sequence, wherein the presence or absence of said mutation is
indicative of the presence of said disease or susceptibility to
said disease.
[0059] In a still further aspect, the invention provides a method
of diagnosing a cardiovascular, endothelial or angiogenic disorder
in a mammal which comprises analyzing the level of expression of a
gene encoding a PRO polypeptide (a) in a test sample of tissue
cells obtained from said mammal, and (b) in a control sample of
known normal tissue cells of the same cell type, wherein a higher
or lower expression level in the test sample as compared to the
control sample is indicative of the presence of a cardiovascular,
endothelial or angiogenic disorder in said mammal. The expression
of a gene encoding a PRO polypeptide may optionally be accomplished
by measuring the level of mRNA or the polypeptide in the test
sample as compared to the control sample.
[0060] In a still further aspect, the present invention provides a
method of diagnosing a cardiovascular, endothelial or angiogenic
disorder in a mammal which comprises detecting the presence or
absence of a PRO polypeptide in a test sample of tissue cells
obtained from said mammal, wherein the presence or absence of said
PRO polypeptide in said test sample is indicative of the presence
of a cardiovascular, endothelial or angiogenic disorder in said
mammal.
[0061] In a still further embodiment, the invention provides a
method of diagnosing a cardiovascular, endothelial or angiogenic
disorder in a mammal comprising (a) contacting an anti-PRO antibody
with a test sample of tissue cells obtained from the mammal, and
(b) detecting the formation of a complex between the antibody and
the PRO polypeptide in the test sample, wherein the formation of
said complex is indicative of the presence of a cardiovascular,
endothelial or angiogenic disorder in the mammal. The detection may
be qualitative or quantitative, and may be performed in comparison
with monitoring the complex formation in a control sample of known
normal tissue cells of the same cell type. A larger or smaller
quantity of complexes formed in the test sample indicates the
presence of a cardiovascular, endothelial or angiogenic dysfunction
in the mammal from which the test tissue cells were obtained. The
antibody preferably carries a detectable label. Complex formation
can be monitored, for example, by light microscopy, flow cytometry,
fluorimetry, or other techniques known in the art. The test sample
is usually obtained from an individual suspected to have a
cardiovascular, endothelial or angiogenic disorder.
[0062] In another embodiment, the invention provides a method for
determining the presence of a PRO polypeptide in a sample
comprising exposing a sample suspected of containing the PRO
polypeptide to an anti-PRO antibody and determining binding of said
antibody to a component of said sample. In a specific aspect, the
sample comprises a cell suspected of containing the PRO polypeptide
and the antibody binds to the cell. The antibody is preferably
detectably labeled and/or bound to a solid support.
[0063] In further aspects, the invention provides a cardiovascular,
endothelial or angiogenic disorder diagnostic kit comprising an
anti-PRO antibody and a carrier in suitable packaging. Preferably,
such kit further comprises instructions for using said antibody to
detect the presence of the PRO polypeptide. Preferably, the carrier
is a buffer, for example. Preferably, the cardiovascular,
endothelial or angiogenic disorder is cancer.
[0064] In yet another embodiment, the present invention provides a
method for treating a cardiovascular, endothelial or angiogenic
disorder in a mammal comprising administering to the mammal an
effective amount of a PRO polypeptide. Preferably, the disorder is
cardiac hypertrophy, trauma such as wounds or burns, or a type of
cancer. In a further aspect, the mammal is further exposed to
angioplasty or a drug that treats cardiovascular, endothelial or
angiogenic disorders such as ACE inhibitors or chemotherapeutic
agents if the cardiovascular, endothelial or angiogenic disorder is
a type of cancer. Preferably, the mammal is human, preferably one
who is at risk of developing cardiac hypertrophy and more
preferably has suffered myocardial infarction.
[0065] In another preferred aspect, the cardiac hypertrophy is
characterized by the presence of an elevated level of
PGF.sub.2.alpha.. Alternatively, the cardiac hypertrophy may be
induced by myocardial infarction, wherein preferably the
administration of the PRO polypeptide is initiated within 48 hours,
more preferably within 24 hours, following myocardial
infarction.
[0066] In another preferred embodiment, the cardiovascular,
endothelial or angiogenic disorder is cardiac hypertrophy and said
PRO polypeptide is administered together with a cardiovascular,
endothelial or angiogenic agent. The preferred cardiovascular,
endothelial or angiogenic agent for this purpose is selected from
the group consisting of an antihypertensive drug, an ACE inhibitor,
an endothelin receptor antagonist and a thrombolytic agent. If a
thrombolytic agent is administered, preferably the PRO polypeptide
is administered following administration of such agent. More
preferably, the thrombolytic agent is recombinant human tissue
plasminogen activator.
[0067] In another preferred aspect, the cardiovascular, endothelial
or angiogenic disorder is cardiac hypertrophy and the PRO
polypeptide is administered following primary angioplasty for the
treatment of acute myocardial infarction, preferably wherein the
mammal is further exposed to angioplasty or a cardiovascular,
endothelial, or angiogenic agent.
[0068] In another preferred embodiment, the cardiovascular,
endothelial or angiogenic disorder is a cancer and the PRO
polypeptide is administered in combination with a chemotherapeutic
agent, a growth inhibitory agent or a cytotoxic agent.
[0069] In a further embodiment, the invention provides a method for
treating a cardiovascular, endothelial or angiogenic disorder in a
mammal comprising administering to the mammal an effective amount
of a PRO polypeptide agonist, antagonist or anti-PRO antibody.
Preferably, the cardiovascular, endothelial or angiogenic disorder
is cardiac hypertrophy, trauma, a cancer, or age-related macular
degeneration. Also preferred is where the mammal is human, and
where an effective amount of an angiogenic or angiostatic agent is
administered in conjunction with the agonist, antagonist or
anti-PRO antibody.
[0070] In still further embodiments, the invention provides a
method for treating a cardiovascular, endothelial or angiogenic
disorder in a mammal that suffers therefrom comprising
administering to the mammal a nucleic acid molecule that codes for
either (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide
or (c) an antagonist of a PRO polypeptide, wherein said agonist or
antagonist may be an anti-PRO antibody. In a preferred embodiment,
the mammal is human. In another preferred embodiment, the gene is
administered via ex vivo gene therapy. In a further preferred
embodiment, the gene is comprised within a vector, more preferably
an adenoviral, adeno-associated viral, lentiviral, or retroviral
vector.
[0071] In yet another aspect, the invention provides a recombinant
retroviral particle comprising a retroviral vector consisting
essentially of a promoter, nucleic acid encoding (a) a PRO
polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or
(c) an antagonist polypeptide of a PRO polypeptide, and a signal
sequence for cellular secretion of the polypeptide, wherein the
retroviral vector is in association with retroviral structural
proteins. Preferably, the signal sequence is from a mammal, such as
from a native PRO polypeptide.
[0072] In a still further embodiment, the invention supplies an ex
vivo producer cell comprising a nucleic acid construct that
expresses retroviral structural proteins and also comprises a
retroviral vector consisting essentially of a promoter, nucleic
acid encoding (a) a PRO polypeptide, (b) an agonist polypeptide of
a PRO polypeptide or (c) an antagonist polypeptide of a PRO
polypeptide, and a signal sequence for cellular secretion of the
polypeptide, wherein said producer cell packages the retroviral
vector in association with the structural proteins to produce
recombinant retroviral particles.
[0073] In yet another embodiment, the invention provides a method
for inhibiting endothelial cell growth in a mammal comprising
administering to the mammal (a) a PRO polypeptide, (b) an agonist
of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide,
wherein endothelial cell growth in said mammal is inhibited, and
wherein said agonist or antagonist may be an anti-PRO antibody.
Preferably, the mammal is human and the endothelial cell growth is
associated with a tumor or a retinal disorder.
[0074] In yet another embodiment, the invention provides a method
for stimulating endothelial cell growth in a mammal comprising
administering to the mammal (a) a PRO polypeptide, (b) an agonist
of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide,
wherein endothelial cell growth in said mammal is stimulated, and
wherein said agonist or antagonist may be an anti-PRO antibody.
Preferably, the mammal is human.
[0075] In yet another embodiment, the invention provides a method
for inhibiting cardiac hypertrophy in a mammal comprising
administering to the mammal (a) a PRO polypeptide, (b) an agonist
of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide,
wherein cardiac hypertrophy in said mammal is inhibited, and
wherein said agonist or antagonist may be an anti-PRO antibody.
Preferably, the mammal is human and the cardiac hypertrophy has
been induced by myocardial infarction.
[0076] In yet another embodiment, the invention provides a method
for stimulating cardiac hypertrophy in a mammal comprising
administering to the mammal (a) a PRO polypeptide, (b) an agonist
of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide,
wherein cardiac hypertrophy in said mammal is stimulated, and
wherein said agonist or antagonist may be an anti-PRO antibody.
Preferably, the mammal is human who suffers from congestive heart
failure.
[0077] In yet another embodiment, the invention provides a method
for inhibiting angiogenesis induced by a PRO polypeptide in a
mammal comprising administering a therapeutically effective amount
of an anti-PRO antibody to the mammal. Preferably, the mammal is a
human, and more preferably the mammal has a tumor or a retinal
disorder.
[0078] In yet another embodiment, the invention provides a method
for stimulating angiogenesis induced by a PRO polypeptide in a
mammal comprising administering a therapeutically effective amount
of a PRO polypeptide to the mammal. Preferably, the mammal is a
human, and more preferably angiogenesis would promote tissue
regeneration or wound healing.
[0079] In yet another embodiment, the invention provides a method
for modulating (e.g., inhibiting or stimulating) endothelial cell
growth in a mammal comprising administering to the mammal a PRO21,
PRO181, PRO205, PRO214, PRO221, PRO229, PRO231, PRO238, PRO241,
PRO247, PRO256, PRO258, PRO263, PRO265, PRO295, PRO321, PRO322,
PRO337, PRO363, PRO365, PRO444, PRO533, PRO697, PRO720, PRO725,
PRO771, PRO788, PRO791, PRO819, PRO827, PRO828, PRO836, PRO846,
PRO865, PRO1005, PRO1006, PRO1007, PRO1025, PRO1029, PRO1054,
PRO1071, PRO1075, PRO1079, PRO1080, PRO1114, PRO1131, PRO1155,
PRO1160, PRO1184, PRO1186, PRO1190, PRO1192, PRO1195, PRO1244,
PRO1272, PRO1273, PRO1274, PRO1279, PRO1283, PRO1286, PRO1306,
PRO1309, PRO1325, PRO1329, PRO1347, PRO1356, PRO1376, PRO1382,
PRO1411, PRO1412, PRO1419, PRO1474, PRO1477, PRO1488, PRO1508,
PRO1550, PRO1556, PRO1760, PRO1782, PRO1787, PRO1801, PRO1868,
PRO1887, PRO1890, PRO3438, PRO3444, PRO4302, PRO4324, PRO4333,
PRO4341, PRO4342, PRO4353, PRO4354, PRO4356, PRO4371, PRO4405,
PRO4408, PRO4422, PRO4425, PRO4499, PRO5723, PRO5725, PRO5737,
PRO5776, PRO6006, PRO6029, PRO6071, PRO7436, PRO9771, PRO9821,
PRO9873, PRO10008, PRO10096, PRO19670, PRO20040, PRO20044,
PRO21055, PRO21384 or PRO28631 polypeptide, agonist or antagonist
thereof, wherein endothelial cell growth in said mammal is
modulated.
[0080] In yet another embodiment, the invention provides a method
for modulating (e.g., inhibiting or stimulating) smooth muscle cell
growth in a mammal comprising administering to the mammal a PRO162,
PRO181, PRO182, PRO195, PRO204, PRO221, PRO230, PRO256, PRO258,
PRO533, PRO697, PRO725, PRO738, PRO826, PRO836, PRO840, PRO846,
PRO865, PRO982, PRO1025, PRO1029, PRO1071, PRO1080, PRO1083,
PRO1134, PRO1160, PRO1182, PRO1184, PRO1186, PRO1192, PRO1265,
PRO1274, PRO1279, PRO1283, PRO1306, PRO1308, PRO1309, PRO1325,
PRO1337, PRO1338, PRO1343, PRO1376, PRO1387, PRO1411, PRO1412,
PRO1415, PRO1434, PRO1474, PRO1488, PRO1550, PRO1556, PRO1567,
PRO1600, PRO1754, PRO1758, PRO1760, PRO1787, PRO1865, PRO1868,
PRO1917, PRO1928, PRO3438, PRO3562, PRO4302, PRO4333, PRO4345,
PRO4353, PRO4354, PRO4405, PRO4408, PRO4430, PRO4503, PRO5725,
PRO6714, PRO9771, PRO9820, PRO9940, PRO10096, PRO21055, PRO21184 or
PRO21366 polypeptide, agonist or antagonist thereof, wherein
endothelial cell growth in said mammal is modulated.
[0081] In yet another embodiment, the invention provides a method
for modulating (e.g., inducing or reducing) cardiac hypertrophy in
a mammal comprising administering to the mammal a PRO21
polypeptide, agonist or antagonist thereof, wherein cardiac
hypertrophy in said mammal is modulated.
[0082] In yet another embodiment, the invention provides a method
for modulating (e.g., inducing or reducing) endothelial cell
apoptosis in a mammal comprising administering to the mammal a
PRO4302 polypeptide, agonist or antagonist thereof, wherein cardiac
hypertrophy in said mammal is modulated.
[0083] In yet another embodiment, the invention provides a method
for modulating (e.g., stimulating or inhibiting) angiogenesis in a
mammal comprising administering a therapeutically effective amount
of a PRO1376 or PRO1449 polypeptide, agonist or antagonist thereof
to the mammal, wherein said angiogenesis is modulated.
[0084] In yet another embodiment, the invention provides a method
for modulating (e.g., inducing or reducing) angiogenesis by
modulating (e.g., inducing or reducing) endothelial cell tube
formation in a mammal comprising administering to the mammal a
PRO178, PRO195, PRO228, PRO301, PRO302, PRO532, PRO724, PRO730,
PRO734, PRO793, PRO871, PRO938, PRO1012, PRO1120, PRO1139, PRO1198,
PRO1287, PRO1361, PRO1864, PRO1873, PRO2010, PRO3579, PRO4313,
PRO4527, PRO4538, PRO4553, PRO4995, PRO5730, PRO6008, PRO7223,
PRO7248 or PRO7261 polypeptide, agonist or antagonist thereof,
wherein endothelial cell tube formation in said mammal is
modulated.
[0085] In other embodiments of the present invention, the invention
provides an isolated nucleic acid molecule comprising a nucleotide
sequence that encodes a PRO polypeptide.
[0086] In one aspect, the isolated nucleic acid molecule comprises
a nucleotide sequence having at least about 80%, 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97% or 98% nucleic acid sequence identity and alternatively at
least about 99% nucleic acid sequence identity to (a) a DNA
molecule encoding a PRO polypeptide having a full-length amino acid
sequence as disclosed herein, an amino acid sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a
transmembrane protein, with or without the signal peptide, as
disclosed herein or any other specifically defined fragment of the
full-length amino acid sequence as disclosed herein, or (b) the
complement of the DNA molecule of (a).
[0087] In other aspects, the isolated nucleic acid molecule
comprises a nucleotide sequence having at least about 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97% or 98% nucleic acid sequence identity and
alternatively at least about 99% nucleic acid sequence identity to
(a) a DNA molecule comprising the coding sequence of a full-length
PRO polypeptide cDNA as disclosed herein, the coding sequence of a
PRO polypeptide lacking the signal peptide as disclosed herein, the
coding sequence of an extracellular domain of a transmembrane PRO
polypeptide, with or without the signal peptide, as disclosed
herein or the coding sequence of any other specifically defined
fragment of the full-length amino acid sequence as disclosed
herein, or (b) the complement of the DNA molecule of (a).
[0088] In a further aspect, the invention provides an isolated
nucleic acid molecule comprising a nucleotide sequence having at
least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% nucleic acid sequence
identity and alternatively at least about 99% nucleic acid sequence
identity to (a) a DNA molecule that encodes the same mature
polypeptide encoded by any of the human protein cDNAs deposited
with the ATCC as disclosed herein, or (b) the complement of the DNA
molecule of (a).
[0089] Another aspect of the present invention provides an isolated
nucleic acid molecule comprising a nucleotide sequence encoding a
PRO polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated, or is complementary to such
encoding nucleotide sequence, wherein the transmembrane domain(s)
of such polypeptide are disclosed herein. Therefore, soluble
extracellular domains of the herein described PRO polypeptides are
contemplated.
[0090] Another embodiment is directed to fragments of a PRO
polypeptide coding sequence, or the complement thereof, that may
find use as, for example, hybridization probes, for encoding
fragments of a PRO polypeptide that may optionally encode a
polypeptide comprising a binding site for an anti-PRO antibody or
as antisense oligonucleotide probes. Such nucleic acid fragments
are usually at least about 20, 30, 40, 50, 60, 70, 80, 90, 100,
110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350,
400, 450, 500, 600, 700 or 800 nucleotides in length and
alternatively at least about 1000 nucleotides in length, wherein in
this context the term "about" means the referenced nucleotide
sequence length plus or minus 10% of that referenced length. It is
noted that novel fragments of a PRO polypeptide-encoding nucleotide
sequence may be determined in a routine manner by aligning the PRO
polypeptide-encoding nucleotide sequence with other known
nucleotide sequences using any of a number of well known sequence
alignment programs and determining which PRO polypeptide-encoding
nucleotide sequence fragment(s) are novel. All of such PRO
polypeptide-encoding nucleotide sequences are contemplated herein.
Also contemplated are the PRO polypeptide fragments encoded by
these nucleotide molecule fragments, preferably those PRO
polypeptide fragments that comprise a binding site for an anti-PRO
antibody.
[0091] In another embodiment, the invention provides an isolated
PRO polypeptide encoded by any of the isolated nucleic acid
sequences hereinabove identified.
[0092] In a certain aspect, the invention provides an isolated PRO
polypeptide comprising an amino acid sequence having at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97% or 98% amino acid sequence identity and
alternatively at least about 99% amino acid sequence identity to a
PRO polypeptide having a fill-length amino acid sequence as
disclosed herein, an amino acid sequence lacking the signal peptide
as disclosed herein, an extracellular domain of a transmembrane
protein, with or without the signal peptide, as disclosed herein or
any other specifically defined fragment of the full-length amino
acid sequence as disclosed herein.
[0093] In a further aspect, the invention provides an isolated PRO
polypeptide comprising an amino acid sequence having at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94% 95%, 96%, 97% or 98% amino acid sequence identity and
alternatively at least about 99% amino acid sequence identity to an
amino acid sequence encoded by any of the human protein cDNAs
deposited with the ATCC as disclosed herein.
[0094] In a specific aspect, the invention provides an isolated PRO
polypeptide without the N-terminal signal sequence and/or the
initiating methionine and that is encoded by a nucleotide sequence
that encodes such an amino acid sequence as hereinbefore described.
Processes for producing the same are also herein described, wherein
those processes comprise culturing a host cell comprising a vector
which comprises the appropriate encoding nucleic acid molecule
under conditions suitable for expression of the PRO polypeptide and
recovering the PRO polypeptide from the cell culture.
[0095] Another aspect of the invention provides an isolated PRO
polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated. Processes for producing the same
are also herein described, wherein those processes comprise
culturing a host cell comprising a vector which comprises the
appropriate encoding nucleic acid molecule under conditions
suitable for expression of the PRO polypeptide and recovering the
PRO polypeptide from the cell culture.
[0096] In yet another embodiment, the invention provides agonists
and antagonists of a native PRO polypeptide as defined herein. In a
particular embodiment, the agonist or antagonist is an anti-PRO
antibody or a small molecule.
[0097] In a further embodiment, the invention provides a method of
identifying agonists or antagonists to a PRO polypeptide which
comprise contacting the PRO polypeptide with a candidate molecule
and monitoring a biological activity mediated by said PRO
polypeptide. Preferably, the PRO polypeptide is a native PRO
polypeptide.
[0098] In a still further embodiment, the invention provides a
composition of matter comprising a PRO polypeptide, or an agonist
or antagonist of a PRO polypeptide as herein described, or an
anti-PRO antibody, in combination with a carrier. Optionally, the
carrier is a pharmaceutically acceptable carrier.
[0099] Another embodiment of the present invention is directed to
the use of a PRO polypeptide, or an agonist or antagonist thereof
as hereinbefore described, or an anti-PRO antibody, for the
preparation of a medicament useful in the treatment of a condition
which is responsive to the PRO polypeptide, an agonist or
antagonist thereof or an anti-PRO antibody.
[0100] In additional embodiments of the present invention, the
invention provides vectors comprising DNA encoding any of the
herein described polypeptides. Host cells comprising any such
vector are also provided. By way of example, the host cells may be
CHO cells, E. Coli, yeast, or Baculovirus-infected insect cells. A
process for producing any of the herein described polypeptides is
further provided and comprises culturing host cells under
conditions suitable for expression of the desired polypeptide and
recovering the desired polypeptide from the cell culture.
[0101] In other embodiments, the invention provides chimeric
molecules comprising any of the herein described polypeptides fused
to a heterologous polypeptide or amino acid sequence. Example of
such chimeric molecules comprise any of the herein described
polypeptides fused to an epitope tag sequence or a Fc region of an
immunoglobulin.
[0102] In yet another embodiment, the invention provides an
antibody which specifically binds to any of the above or below
described polypeptides. Optionally, the antibody is a monoclonal
antibody, humanized antibody, antibody fragment or single-chain
antibody.
[0103] In yet other embodiments, the invention provides
oligonucleotide probes useful for isolating genomic and cDNA
nucleotide sequences or as antisense probes, wherein those probes
may be derived from any of the above or below described nucleotide
sequences.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0104] FIG. 1 shows a nucleotide sequence (SEQ ID NO: 1) of a
native sequence PRO181 cDNA, wherein SEQ ID NO: 1 is a clone
designated herein as "DNA23330-1390".
[0105] FIG. 2 shows the amino acid sequence (SEQ ID NO: 2) derived
from the coding sequence of SEQ ID NO: 1 shown in FIG. 1.
[0106] FIG. 3 shows a nucleotide sequence (SEQ ID NO: 3) of a
native sequence PRO178 cDNA, wherein SEQ ID NO: 3 is a clone
designated herein as "DNA23339-1130".
[0107] FIG. 4 shows the amino acid sequence (SEQ ID NO: 4) derived
from the coding sequence of SEQ ID NO: 3 shown in FIG. 3.
[0108] FIG. 5 shows a nucleotide sequence (SEQ ID NO: 5) of a
native sequence PRO444 cDNA, wherein SEQ ID NO: 5 is a clone
designated herein as "DNA26846-1397".
[0109] FIG. 6 shows the amino acid sequence (SEQ ID NO: 6) derived
from the coding sequence of SEQ ID NO: 5 shown in FIG. 5.
[0110] FIG. 7 shows a nucleotide sequence (SEQ ID NO: 7) of a
native sequence PRO195 cDNA, wherein SEQ ID NO: 7 is a clone
designated herein as "DNA26847-1395".
[0111] FIG. 8 shows the amino acid sequence (SEQ ID NO: 8) derived
from the coding sequence of SEQ ID NO: 7 shown in FIG. 7.
[0112] FIG. 9 shows a nucleotide sequence (SEQ ID NO: 9) of a
native sequence PRO182 cDNA, wherein SEQ ID NO: 9 is a clone
designated herein as "DNA27865-1091".
[0113] FIG. 10 shows the amino acid sequence (SEQ ID NO: 10)
derived from the coding sequence of SEQ ID NO: 9 shown in FIG.
9.
[0114] FIG. 11 shows a nucleotide sequence (SEQ ID NO: 11) of a
native sequence PRO205 cDNA, wherein SEQ ID NO: 11 is a clone
designated herein as "DNA30868-1156".
[0115] FIG. 12 shows the amino acid sequence (SEQ ID NO: 12)
derived from the coding sequence of SEQ ID NO: 11 shown in FIG.
11.
[0116] FIG. 13 shows a nucleotide sequence (SEQ ID NO: 13) of a
native sequence PRO204 cDNA, wherein SEQ ID NO: 13 is a clone
designated herein as "DNA30871-1157".
[0117] FIG. 14 shows the amino acid sequence (SEQ ID NO: 14)
derived from the coding sequence of SEQ ID NO: 13 shown in FIG.
13.
[0118] FIG. 15 shows a nucleotide sequence (SEQ ID NO: 15) of a
native sequence PRO1873 cDNA, wherein SEQ ID NO: 15 is a clone
designated herein as "DNA30880".
[0119] FIG. 16 shows the amino acid sequence (SEQ ID NO: 16)
derived from the coding sequence of SEQ ID NO: 15 shown in FIG.
15.
[0120] FIG. 17 shows a nucleotide sequence (SEQ ID NO: 17) of a
native sequence PRO214 cDNA, wherein SEQ ID NO: 17 is a clone
designated herein as "DNA32286-1191 ".
[0121] FIG. 18 shows the amino acid sequence (SEQ ID NO: 18)
derived from the coding sequence of SEQ ID NO: 17 shown in FIG.
17.
[0122] FIG. 19 shows a nucleotide sequence (SEQ ID NO: 19) of a
native sequence PRO221 cDNA, wherein SEQ ID NO: 19 is a clone
designated herein as "DNA33089-1132".
[0123] FIG. 20 shows the amino acid sequence (SEQ ID NO: 20)
derived from the coding sequence of SEQ ID NO: 19 shown in FIG.
19.
[0124] FIG. 21 shows a nucleotide sequence (SEQ ID NO: 21) of a
native sequence PRO228 cDNA, wherein SEQ ID NO: 21 is a clone
designated herein as "DNA33092-1202".
[0125] FIG. 22 shows the amino acid sequence (SEQ ID NO: 22)
derived from the coding sequence of SEQ ID NO: 21 shown in FIG.
21.
[0126] FIG. 23 shows a nucleotide sequence (SEQ ID NO: 23) of a
native sequence PRO229 cDNA, wherein SEQ ID NO: 23 is a clone
designated herein as "DNA33100-1159".
[0127] FIG. 24 shows the amino acid sequence (SEQ ID NO: 24)
derived from the coding sequence of SEQ ID NO: 23 shown in FIG.
23.
[0128] FIG. 25 shows a nucleotide sequence (SEQ ID NO: 25) of a
native sequence PRO230 cDNA, wherein SEQ ID NO: 25 is a clone
designated herein as "DNA33223-1136".
[0129] FIG. 26 shows the amino acid sequence (SEQ ID NO: 26)
derived from the coding sequence of SEQ ID NO: 25 shown in FIG.
25.
[0130] FIG. 27 shows a nucleotide sequence (SEQ ID NO: 27) of a
native sequence PRO7223 cDNA, wherein SEQ ID NO: 27 is a clone
designated herein as "DNA34385".
[0131] FIG. 28 shows the amino acid sequence (SEQ ID NO: 28)
derived from the coding sequence of SEQ ID NO: 27 shown in FIG.
27.
[0132] FIG. 29 shows a nucleotide sequence (SEQ ID NO: 29) of a
native sequence PRO241 cDNA, wherein SEQ ID NO: 29 is a clone
designated herein as "DNA34392-1170".
[0133] FIG. 30 shows the amino acid sequence (SEQ ID NO: 30)
derived from the coding sequence of SEQ ID NO: 29 shown in FIG.
29.
[0134] FIG. 31 shows a nucleotide sequence (SEQ ID NO: 31) of a
native sequence PRO263 cDNA, wherein SEQ ID NO: 31 is a clone
designated herein as "DNA34431-1177".
[0135] FIG. 32 shows the amino acid sequence (SEQ ID NO: 32)
derived from the coding sequence of SEQ ID NO: 31 shown in FIG.
31.
[0136] FIG. 33 shows a nucleotide sequence (SEQ ID NO: 33) of a
native sequence PRO321 cDNA, wherein SEQ ID NO: 33 is a clone
designated herein as "DNA34433-1308".
[0137] FIG. 34 shows the amino acid sequence (SEQ ID NO: 34)
derived from the coding sequence of SEQ ID NO: 33 shown in FIG.
33.
[0138] FIG. 35 shows a nucleotide sequence (SEQ ID NO: 35) of a
native sequence PRO231 cDNA, wherein SEQ ID NO: 35 is a clone
designated herein as "DNA34434-1139".
[0139] FIG. 36 shows the amino acid sequence (SEQ ID NO: 36)
derived from the coding sequence of SEQ ID NO: 35 shown in FIG.
35.
[0140] FIG. 37 shows a nucleotide sequence (SEQ ID NO: 37) of a
native sequence PRO238 cDNA, wherein SEQ ID NO: 37 is a clone
designated herein as "DNA35600-1162".
[0141] FIG. 38 shows the amino acid sequence (SEQ ID NO: 38)
derived from the coding sequence of SEQ ID NO: 37 shown in FIG.
37.
[0142] FIG. 39 shows a nucleotide sequence (SEQ ID NO: 39) of a
native sequence PRO247 cDNA, wherein SEQ ID NO: 39 is a clone
designated herein as "DNA35673-1201".
[0143] FIG. 40 shows the amino acid sequence (SEQ ID NO: 40)
derived from the coding sequence of SEQ ID NO: 39 shown in FIG.
39.
[0144] FIG. 41 shows a nucleotide sequence (SEQ ID NO: 41) of a
native sequence PRO256 cDNA, wherein SEQ ID NO: 41 is a clone
designated herein as "DNA35880-1160".
[0145] FIG. 42 shows the amino acid sequence (SEQ ID NO: 42)
derived from the coding sequence of SEQ ID NO: 41 shown in FIG.
41.
[0146] FIG. 43 shows a nucleotide sequence (SEQ ID NO: 43) of a
native sequence PRO258 cDNA, wherein SEQ ID NO: 43 is a clone
designated herein as "DNA35918-1174".
[0147] FIG. 44 shows the amino acid sequence (SEQ ID NO: 44)
derived from the coding sequence of SEQ ID NO: 43 shown in FIG.
43.
[0148] FIG. 45 shows a nucleotide sequence (SEQ ID NO: 45) of a
native sequence PRO265 cDNA, wherein SEQ ID NO: 45 is a clone
designated herein as "DNA36350-1158".
[0149] FIG. 46 shows the amino acid sequence (SEQ ID NO: 46)
derived from the coding sequence of SEQ ID NO: 45 shown in FIG.
45.
[0150] FIG. 47 shows a nucleotide sequence (SEQ ID NO: 47) of a
native sequence PRO21 cDNA, wherein SEQ ID NO: 47 is a clone
designated herein as "DNA36638-1056".
[0151] FIG. 48 shows the amino acid sequence (SEQ ID NO: 48)
derived from the coding sequence of SEQ ID NO: 47 shown in FIG.
47.
[0152] FIG. 49 shows a nucleotide sequence (SEQ ID NO: 49) of a
native sequence PRO295 cDNA, wherein SEQ ID NO: 49 is a clone
designated herein as "DNA38268-1188".
[0153] FIG. 50 shows the amino acid sequence (SEQ ID NO: 50)
derived from the coding sequence of SEQ ID NO: 49 shown in FIG.
49.
[0154] FIG. 51 shows a nucleotide sequence (SEQ ID NO: 51) of a
native sequence PRO302 cDNA, wherein SEQ ID NO: 51 is a clone
designated herein as "DNA40370-1217".
[0155] FIG. 52 shows the amino acid sequence (SEQ ID NO: 52)
derived from the coding sequence of SEQ ID NO: 51 shown in FIG.
51.
[0156] FIG. 53 shows a nucleotide sequence (SEQ ID NO: 53) of a
native sequence PRO301 cDNA, wherein SEQ ID NO: 53 is a clone
designated herein as "DNA40628-1216".
[0157] FIG. 54 shows the amino acid sequence (SEQ ID NO: 54)
derived from the coding sequence of SEQ ID NO: 53 shown in FIG.
53.
[0158] FIG. 55 shows a nucleotide sequence (SEQ ID NO: 55) of a
native sequence PRO337 cDNA, wherein SEQ ID NO: 55 is a clone
designated herein as "DNA43316-1237".
[0159] FIG. 56 shows the amino acid sequence (SEQ ID NO: 56)
derived from the coding sequence of SEQ ID NO: 55 shown in FIG.
55.
[0160] FIG. 57 shows a nucleotide sequence (SEQ ID NO: 57) of a
native sequence PRO7248 cDNA, wherein SEQ ID NO: 57 is a clone
designated herein as "DNA44195".
[0161] FIG. 58 shows the amino acid sequence (SEQ ID NO: 58)
derived from the coding sequence of SEQ ID NO: 57 shown in FIG.
57.
[0162] FIG. 59 shows a nucleotide sequence (SEQ ID NO: 59) of a
native sequence PRO846 cDNA, wherein SEQ ID NO: 59 is a clone
designated herein as "DNA44196-1353".
[0163] FIG. 60 shows the amino acid sequence (SEQ ID NO: 60)
derived from the coding sequence of SEQ ID NO: 59 shown in FIG.
59.
[0164] FIG. 61 shows a nucleotide sequence (SEQ ID NO: 61) of a
native sequence PRO1864 cDNA, wherein SEQ ID NO: 61 is a clone
designated herein as "DNA45409-251".
[0165] FIG. 62 shows the amino acid sequence (SEQ ID NO: 62)
derived from the coding sequence of SEQ ID NO: 61 shown in FIG.
61.
[0166] FIG. 63 shows a nucleotide sequence (SEQ ID NO: 63) of a
native sequence PRO363 cDNA, wherein SEQ ID NO: 63 is a clone
designated herein as "DNA45419-1252".
[0167] FIG. 64 shows the amino acid sequence (SEQ ID NO: 64)
derived from the coding sequence of SEQ ID NO: 63 shown in FIG.
63.
[0168] FIG. 65 shows a nucleotide sequence (SEQ ID NO: 65) of a
native sequence PRO730 cDNA, wherein SEQ ID NO: 65 is a clone
designated herein as "DNA45624-1400".
[0169] FIG. 66 shows the amino acid sequence (SEQ ID NO: 66)
derived from the coding sequence of SEQ ID NO: 65 shown in FIG.
65.
[0170] FIG. 67 shows a nucleotide sequence (SEQ ID NO: 67) of a
native sequence PRO365 cDNA, wherein SEQ ID NO: 67 is a clone
designated herein as "DNA46777-1253".
[0171] FIG. 68 shows the amino acid sequence (SEQ ID NO: 68)
derived from the coding sequence of SEQ ID NO: 67 shown in FIG.
67.
[0172] FIG. 69 shows a nucleotide sequence (SEQ ID NO: 69) of a
native sequence PRO532 cDNA, wherein SEQ ID NO: 69 is a clone
designated herein as "DNA48335".
[0173] FIG. 70 shows the amino acid sequence (SEQ ID NO: 70)
derived from the coding sequence of SEQ ID NO: 69 shown in FIG.
69.
[0174] FIG. 71 shows a nucleotide sequence (SEQ ID NO: 71) of a
native sequence PRO322 cDNA, wherein SEQ ID NO: 71 is a clone
designated herein as "DNA48336-1309".
[0175] FIG. 72 shows the amino acid sequence (SEQ ID NO: 72)
derived from the coding sequence of SEQ ID NO: 71 shown in FIG.
71.
[0176] FIG. 73 shows a nucleotide sequence (SEQ ID NO: 73) of a
native sequence PRO1120 cDNA, wherein SEQ ID NO: 73 is a clone
designated herein as "DNA48606-1479".
[0177] FIG. 74 shows the amino acid sequence (SEQ ID NO: 74)
derived from the coding sequence of SEQ ID NO: 73 shown in FIG.
73.
[0178] FIG. 75 shows a nucleotide sequence (SEQ ID NO: 75) of a
native sequence PRO7261 cDNA, wherein SEQ ID NO: 75 is a clone
designated herein as "DNA49149".
[0179] FIG. 76 shows the amino acid sequence (SEQ ID NO: 76)
derived from the coding sequence of SEQ ID NO: 75 shown in FIG.
75.
[0180] FIG. 77 shows a nucleotide sequence (SEQ ID NO: 77) of a
native sequence PRO533 cDNA, wherein SEQ ID NO: 77 is a clone
designated herein as "DNA49435-1219".
[0181] FIG. 78 shows the amino acid sequence (SEQ ID NO: 78)
derived from the coding sequence of SEQ ID NO: 77 shown in FIG.
77.
[0182] FIG. 79 shows a nucleotide sequence (SEQ ID NO: 79) of a
native sequence PRO724 cDNA, wherein SEQ ID NO: 79 is a clone
designated herein as "DNA49631-1328".
[0183] FIG. 80 shows the amino acid sequence (SEQ ID NO: 80)
derived from the coding sequence of SEQ ID NO: 79 shown in FIG.
79.
[0184] FIG. 81 shows a nucleotide sequence (SEQ ID NO: 81) of a
native sequence PRO734 cDNA, wherein SEQ ID NO: 81 is a clone
designated herein as "DNA49817".
[0185] FIG. 82 shows the amino acid sequence (SEQ ID NO: 82)
derived from the coding sequence of SEQ ID NO: 81 shown in FIG.
81.
[0186] FIG. 83 shows a nucleotide sequence (SEQ ID NO: 83) of a
native sequence PRO771 cDNA, wherein SEQ ID NO: 83 is a clone
designated herein as "DNA49829-1346".
[0187] FIG. 84 shows the amino acid sequence (SEQ ID NO: 84)
derived from the coding sequence of SEQ ID NO: 83 shown in FIG.
83.
[0188] FIG. 85 shows a nucleotide sequence (SEQ ID NO: 85) of a
native sequence PRO2010 cDNA, wherein SEQ ID NO: 85 is a clone
designated herein as "DNA50792".
[0189] FIG. 86 shows the amino acid sequence (SEQ ID NO: 86)
derived from the coding sequence of SEQ ID NO: 85 shown in FIG.
85.
[0190] FIG. 87 shows a nucleotide sequence (SEQ ID NO: 87) of a
native sequence PRO871 cDNA, wherein SEQ ID NO: 87 is a clone
designated herein as "DNA50919-1361".
[0191] FIG. 88 shows the amino acid sequence (SEQ ID NO: 88)
derived from the coding sequence of SEQ ID NO: 87 shown in FIG.
87.
[0192] FIG. 89 shows a nucleotide sequence (SEQ ID NO: 89) of a
native sequence PRO697 cDNA, wherein SEQ ID NO: 89 is a clone
designated herein as "DNA50920-1325".
[0193] FIG. 90 shows the amino acid sequence (SEQ ID NO: 90)
derived from the coding sequence of SEQ ID NO: 89 shown in FIG.
89.
[0194] FIG. 91 shows a nucleotide sequence (SEQ ID NO: 91) of a
native sequence PRO1083 cDNA, wherein SEQ ID NO: 91 is a clone
designated herein as "DNA50921-1458".
[0195] FIG. 92 shows the amino acid sequence (SEQ ID NO: 22)
derived from the coding sequence of SEQ ID NO: 91 shown in FIG.
91.
[0196] FIG. 93 shows a nucleotide sequence (SEQ ID NO: 93) of a
native sequence PRO725 cDNA, wherein SEQ ID NO: 93 is a clone
designated herein as "DNA52758-1399".
[0197] FIG. 94 shows the amino acid sequence (SEQ ID NO: 94)
derived from the coding sequence of SEQ ID NO: 93 shown in FIG.
93.
[0198] FIG. 95 shows a nucleotide sequence (SEQ ID NO: 95) of a
native sequence PRO720 cDNA, wherein SEQ ID NO: 95 is a clone
designated herein as "DNA53517-1366-1".
[0199] FIG. 96 shows the amino acid sequence (SEQ ID NO: 96)
derived from the coding sequence of SEQ ID NO: 95 shown in FIG.
95.
[0200] FIG. 97 shows a nucleotide sequence (SEQ ID NO: 97) of a
native sequence PRO738 cDNA, wherein SEQ ID NO: 97 is a clone
designated herein as "DNA53915-1258".
[0201] FIG. 98 shows the amino acid sequence (SEQ ID NO: 98)
derived from the coding sequence of SEQ ID NO: 97 shown in FIG.
97.
[0202] FIG. 99 shows a nucleotide sequence (SEQ ID NO: 99) of a
native sequence PRO865 cDNA, wherein SEQ ID NO: 99 is a clone
designated herein as "DNA53974-1401".
[0203] FIG. 100 shows the amino acid sequence (SEQ ID NO: 100)
derived from the coding sequence of SEQ ID NO: 99 shown in FIG.
99.
[0204] FIG. 101 shows a nucleotide sequence (SEQ ID NO: 101) of a
native sequence PRO840 cDNA, wherein SEQ ID NO: 101 is a clone
designated herein as "DNA53987-1438".
[0205] FIG. 102 shows the amino acid sequence (SEQ ID NO: 102)
derived from the coding sequence of SEQ ID NO: 101 shown in FIG.
101.
[0206] FIG. 103 shows a nucleotide sequence (SEQ ID NO: 103) of a
native sequence PRO1080 cDNA, wherein SEQ ID NO: 103 is a clone
designated herein as "DNA56047-1456".
[0207] FIG. 104 shows the amino acid sequence (SEQ ID NO: 104)
derived from the coding sequence of SEQ ID NO: 103 shown in FIG.
103.
[0208] FIG. 105 shows a nucleotide sequence (SEQ ID NO: 105) of a
native sequence PRO1079 cDNA, wherein SEQ ID NO: 105 is a clone
designated herein as "DNA56050-1455".
[0209] FIG. 106 shows the amino acid sequence (SEQ ID NO: 106)
derived from the coding sequence of SEQ ID NO: 105 shown in FIG.
105.
[0210] FIG. 107 shows a nucleotide sequence (SEQ ID NO: 107) of a
native sequence PRO793 cDNA, wherein SEQ ID NO: 107 is a clone
designated herein as "DNA56110-1437".
[0211] FIG. 108 shows the amino acid sequence (SEQ ID NO: 108)
derived from the coding sequence of SEQ ID NO: 107 shown in FIG.
107.
[0212] FIG. 109 shows a nucleotide sequence (SEQ ID NO: 109) of a
native sequence PRO788 cDNA, wherein SEQ ID NO: 109 is a clone
designated herein as "DNA56405-1357".
[0213] FIG. 110 shows the amino acid sequence (SEQ ID NO: 110)
derived from the coding sequence of SEQ ID NO: 109 shown in FIG.
109.
[0214] FIG. 111 shows a nucleotide sequence (SEQ ID NO: 111) of a
native sequence PRO938 cDNA, wherein SEQ ID NO: 111 is a clone
designated herein as "DNA56433-1406".
[0215] FIG. 112 shows the amino acid sequence (SEQ ID NO: 112)
derived from the coding sequence of SEQ ID NO: 111 shown in FIG.
111.
[0216] FIG. 113 shows a nucleotide sequence (SEQ ID NO: 113) of a
native sequence PRO1012 cDNA, wherein SEQ ID NO: 113 is a clone
designated herein as "DNA56439-1376".
[0217] FIG. 114 shows the amino acid sequence (SEQ ID NO: 114)
derived from the coding sequence of SEQ ID NO: 113 shown in FIG.
113.
[0218] FIG. 115 shows a nucleotide sequence (SEQ ID NO: 115) of a
native sequence PRO1477 cDNA, wherein SEQ ID NO: 115 is a clone
designated herein as "DNA56529-1647".
[0219] FIG. 116 shows the amino acid sequence (SEQ ID NO: 116)
derived from the coding sequence of SEQ ID NO: 115 shown in FIG.
115.
[0220] FIG. 117 shows a nucleotide sequence (SEQ ID NO: 117) of a
native sequence PRO1134 cDNA, wherein SEQ ID NO: 117 is a clone
designated herein as "DNA56865-1491".
[0221] FIG. 118 shows the amino acid sequence (SEQ ID NO: 118)
derived from the coding sequence of SE ID NO: 117 shown in FIG.
117.
[0222] FIG. 119 shows a nucleotide sequence (SEQ ID NO: 119) of a
native sequence PRO162 cDNA, wherein SEQ ID NO: 119 is a clone
designated herein as "DNA56965-1356".
[0223] FIG. 120 shows the amino acid sequence (SEQ ID NO: 120)
derived from the coding sequence of SEQ ID NO: 119 shown in FIG.
119.
[0224] FIG. 121 shows a nucleotide sequence (SEQ ID NO: 121) of a
native sequence PRO1114 cDNA, wherein SEQ ID NO: 121 is a clone
designated herein as "DNA57033-1403-1".
[0225] FIG. 122 shows the amino acid sequence (SEQ ID NO: 122)
derived from the coding sequence of SEQ ID NO: 121 shown in FIG.
121.
[0226] FIG. 123 shows a nucleotide sequence (SEQ ID NO: 123) of a
native sequence PRO828 cDNA, wherein SEQ ID NO: 123 is a clone
designated herein as "DNA57037-1444".
[0227] FIG. 124 shows the amino acid sequence (SEQ ID NO: 124)
derived from the coding sequence of SEQ ID NO: 123 shown in FIG.
123.
[0228] FIG. 125 shows a nucleotide sequence (SEQ ID NO: 125) of a
native sequence PRO827 cDNA, wherein SEQ ID NO: 125 is a clone
designated herein as "DNA57039-1402".
[0229] FIG. 126 shows the amino acid sequence (SEQ ID NO: 126)
derived from the coding sequence of SEQ ID NO: 125 shown in FIG.
125.
[0230] FIG. 127 shows an nucleotide sequence (SEQ ID NO: 127) of a
native sequence PRO1075 cDNA, wherein SEQ ID NO: 127 is a clone
designated herein as "DNA57689-1385".
[0231] FIG. 128 shows the amino acid sequence (SEQ ID NO: 128)
derived from the coding sequence of SEQ ID NO: 127 shown in FIG.
127.
[0232] FIG. 129 shows a nucleotide sequence (SEQ ID NO: 129) of a
native sequence PRO1007 cDNA, wherein SEQ ID NO: 129 is a clone
designated herein as "DNA57690-1374".
[0233] FIG. 130 shows the amino acid sequence (SEQ ID NO: 130)
derived from the coding sequence of SEQ ID NO: 129 shown in FIG.
129.
[0234] FIG. 131 shows a nucleotide sequence (SEQ ID NO: 131) of a
native sequence PRO826 cDNA, wherein SEQ ID NO: 131 is a clone
designated herein as "DNA57694-1341".
[0235] FIG. 132 shows the amino acid sequence (SEQ ID NO: 132)
derived from the coding sequence of SEQ ID NO: 131 shown in FIG.
131.
[0236] FIG. 133 shows a nucleotide sequence (SEQ ID NO: 133) of a
native sequence PRO819 cDNA, wherein SEQ ID NO: 132 is a clone
designated herein as "DNA57695-1340".
[0237] FIG. 134 shows the amino acid sequence (SEQ ID NO: 134)
derived from the coding sequence of SEQ ID NO: 133 shown in FIG.
133.
[0238] FIG. 135 shows a nucleotide sequence (SEQ ID NO: 135) of a
native sequence PRO1006 cDNA, wherein SEQ ID NO: 135 is a clone
designated herein as "DNA57699-1412".
[0239] FIG. 136 shows the amino acid sequence (SEQ ID NO: 136)
derived from the coding sequence of SEQ ID NO: 135 shown in FIG.
135.
[0240] FIG. 137 shows a nucleotide sequence (SEQ ID NO: 137) of a
native sequence PRO982 cDNA,wherein SEQ ID NO: 137 is a clone
designated herein as "DNA57700-1408".
[0241] FIG. 138 shows the amino acid sequence (SEQ ID NO: 138)
derived from the coding sequence of SEQ ID NO: 137 shown in FIG.
137.
[0242] FIG. 139 shows a nucleotide sequence (SEQ ID NO: 139) of a
native sequence PRO1005 cDNA, wherein SEQ ID NO: 139 is a clone
designated herein as "DNA57708-1411".
[0243] FIG. 140 shows the amino acid sequence (SEQ ID NO: 140)
derived from the coding sequence of SEQ ID NO: 139 shown in FIG.
139.
[0244] FIG. 141 shows a nucleotide sequence (SEQ ID NO: 141) of a
native sequence PRO791 cDNA, wherein SEQ ID NO: 141 is a clone
designated herein as "DNA57838-1337".
[0245] FIG. 142 shows the amino acid sequence (SEQ ID NO: 142)
derived from the coding sequence of SEQ ID NO: 141 shown in FIG.
141.
[0246] FIG. 143 shows a nucleotide sequence (SEQ ID NO: 143) of a
native sequence PRO1071 cDNA, wherein SEQ ID NO: 143 is a clone
designated herein as "DNA58847-1383".
[0247] FIG. 144 shows the amino acid sequence (SEQ ID NO: 144)
derived from the coding sequence of SEQ ID NO: 143 shown in FIG.
43.
[0248] FIG. 145 shows a nucleotide sequence (SEQ ID NO: 145) of a
native sequence PRO1415 cDNA, wherein SEQ ID NO: 145 is a clone
designated herein as "DNA58852-1637".
[0249] FIG. 146 shows the amino acid sequence (SEQ ID NO: 146)
derived from the coding sequence of SEQ ID NO: 145 shown in FIG.
145.
[0250] FIG. 147 shows a nucleotide sequence (SEQ ID NO: 147) of a
native sequence PRO1054 cDNA, wherein SEQ ID NO: 147 is a clone
designated herein as "DNA58853-1423".
[0251] FIG. 148 shows the amino acid sequence (SEQ ID NO: 148)
derived from the coding sequence of SEQ ID NO: 147 shown in FIG.
147.
[0252] FIG. 149 shows a nucleotide sequence (SEQ ID NO: 149) of a
native sequence PRO1411 cDNA, wherein SEQ ID NO: 149 is a clone
designated herein as "DNA59212-1627".
[0253] FIG. 150 shows the amino acid sequence (SEQ ID NO: 150)
derived from the coding sequence of SEQ ID NO: 149 shown in FIG.
149.
[0254] FIG. 151 shows a nucleotide sequence (SEQ ID NO: 151) of a
native sequence PRO1184 cDNA, wherein SEQ ID NO: 151 is a clone
designated herein as "DNA59220-1514".
[0255] FIG. 152 shows the amino acid sequence (SEQ ID NO: 152)
derived from the coding sequence of SEQ ID NO: 151 shown in FIG.
151.
[0256] FIG. 153 shows the nucleotide sequence (SEQ ID NO: 153) of a
native sequence PRO1029 cDNA, wherein SEQ ID NO: 153 is a clone
designated herein as "DNA59493-1420".
[0257] FIG. 154 shows the amino acid sequence (SEQ ID NO: 154)
derived from the coding sequence of SEQ ID NO: 153 shown in FIG.
153.
[0258] FIG. 155 shows the nucleotide sequence (SEQ ID NO: 155) of a
native sequence PRO1139 cDNA, wherein SEQ ID NO: 155 is a clone
designated herein as "DNA59497-1496".
[0259] FIG. 156 shows the amino acid sequence (SEQ ID NO: 156)
derived from the coding sequence of SEQ ID NO: 155 shown in FIG.
155.
[0260] FIG. 157 shows a nucleotide sequence (SEQ ID NO: 157) of a
native sequence PRO1190 cDNA, wherein SEQ ID NO: 157 is a clone
designated herein as "DNA59586-1520".
[0261] FIG. 158 shows the amino acid sequence (SEQ ID NO: 158)
derived from the coding sequence of SEQ ID NO: 157 shown in FIG.
157.
[0262] FIG. 159 shows a nucleotide sequence (SEQ ID NO: 159) of a
native sequence PRO1309 cDNA, wherein SEQ ID NO: 159 is a clone
designated herein as "DNA59588-1571".
[0263] FIG. 160 shows the amino acid sequence (SEQ ID NO: 160)
derived from the coding sequence of SEQ ID NO: 159 shown in FIG.
159.
[0264] FIG. 161 shows a nucleotide sequence (SEQ ID NO: 161) of a
native sequence PRO836 cDNA, wherein SEQ ID NO: 161 is a clone
designated herein as "DNA59620-1463".
[0265] FIG. 162 shows the amino acid sequence (SEQ ID NO: 162)
derived from the coding sequence of SEQ ID NO: 161 shown in FIG.
161.
[0266] FIG. 163 shows a nucleotide sequence (SEQ ID NO: 163) of a
native sequence PRO) 1025 cDNA, wherein SEQ ID NO: 163 is a clone
designated herein as "DNA59622-1334".
[0267] FIG. 164 shows the amino acid sequence (SEQ ID NO: 164)
derived from the coding sequence of SEQ ID NO: 163 shown in FIG.
163.
[0268] FIG. 165 shows a nucleotide sequence (SEQ ID NO: 165) of a
native sequence PRO) 1131 cDNA, wherein SEQ ID NO: 165 is a clone
designated herein as "DNA59777-1480".
[0269] FIG. 166 shows the amino acid sequence (SEQ ID NO: 166)
derived from the coding sequence of SEQ ID NO: 165 shown in FIG.
165.
[0270] FIG. 167 shows a nucleotide sequence (SEQ ID NO: 167) of a
native sequence PRO) 1182 cDNA, wherein SEQ ID NO: 167 is a clone
designated herein as "DNA59848-1512".
[0271] FIG. 168 shows the amino acid sequence (SEQ ID NO: 168)
derived from the coding sequence of SEQ ID NO: 167 shown in FIG.
167.
[0272] FIG. 169 shows a nucleotide sequence (SEQ ID NO: 169) of a
native sequence PRO1155 cDNA, wherein SEQ ID NO: 169 is a clone
designated herein as "DNA59849-1504".
[0273] FIG. 170 shows the amino acid sequence (SEQ ID NO: 170)
derived from the coding sequence of SEQ ID NO: 169 shown in FIG.
169.
[0274] FIG. 171 shows a nucleotide sequence (SEQ ID NO: 171) of a
native sequence PRO1186 cDNA, wherein SEQ ID NO: 171 is a clone
designated herein as "DNA60621-1516".
[0275] FIG. 172 shows the amino acid sequence (SEQ ID NO: 172)
derived from the coding sequence of SEQ ID NO: 171 shown in FIG.
171.
[0276] FIG. 173 shows a nucleotide sequence (SEQ ID NO: 173) of a
native sequence PRO1198 cDNA, wherein SEQ ID NO: 173 is a clone
designated herein as "DNA60622-1525".
[0277] FIG. 174 shows the amino acid sequence (SEQ ID NO: 174)
derived from the coding sequence of SEQ ID NO: 173 shown in FIG.
173.
[0278] FIG. 175 shows a nucleotide sequence (SEQ ID NO: 175) of a
native sequence PRO1265 cDNA, wherein SEQ ID NO: 175 is a clone
designated herein as "DNA60764-1533".
[0279] FIG. 176 shows the amino acid sequence (SEQ ID NO: 176)
derived from the coding sequence of SEQ ID NO: 175 shown in FIG.
175.
[0280] FIG. 177 shows a nucleotide sequence (SEQ ID NO: 177) of a
native sequence PRO1361 cDNA, wherein SEQ ID NO: 177 is a clone
designated herein as "DNA60783-1611".
[0281] FIG. 178 shows the amino acid sequence (SEQ ID NO: 176)
derived from the coding sequence of SEQ ID NO: 177 shown in FIG.
177.
[0282] FIG. 179 shows a nucleotide sequence (SEQ ID NO: 179) of a
native sequence PRO1287 cDNA, wherein SEQ ID NO: 179 is a clone
designated herein as "DNA61755-1554".
[0283] FIG. 180 shows the amino acid sequence (SEQ ID NO: 180)
derived from the coding sequence of SEQ ID NO: 179 shown in FIG.
179.
[0284] FIG. 181 shows a nucleotide sequence (SEQ ID NO: 181) of a
native sequence PRO1308 cDNA, wherein SEQ ID NO: 181 is a clone
designated herein as "DNA62306-1570".
[0285] FIG. 182 shows the amino acid sequence (SEQ ID NO: 182)
derived from the coding sequence of SEQ ID NO: 181 shown in FIG.
181.
[0286] FIG. 183 shows a nucleotide sequence (SEQ ID NO: 183) of a
native sequence PRO4313 cDNA, wherein SEQ ID NO: 183 is a clone
designated herein as "DNA62312-2558".
[0287] FIG. 184 shows the amino acid sequence (SEQ ID NO: 184)
derived from the coding sequence of SEQ ID NO: 183 shown in FIG.
183.
[0288] FIG. 185 shows a nucleotide sequence (SEQ ID NO: 185) of a
native sequence PRO1192 cDNA, wherein SEQ ID NO: 185 is a clone
designated herein as "DNA62814-1521 ".
[0289] FIG. 186 shows the amino acid sequence (SEQ ID NO: 186)
derived from the coding sequence of SEQ ID NO: 185 shown in FIG.
185.
[0290] FIG. 187 shows a nucleotide sequence (SEQ ID NO: 187) of a
native sequence PRO1160 cDNA, wherein SEQ ID NO: 187 is a clone
designated herein as "DNA62872-1509".
[0291] FIG. 188 shows the amino acid sequence (SEQ ID NO: 188)
derived from the coding sequence of SEQ ID NO: 187 shown in FIG.
187.
[0292] FIG. 189 shows a nucleotide sequence (SEQ ID NO: 189) of a
native sequence PRO1244 cDNA, wherein SEQ ID NO: 189 is a clone
designated herein as "DNA64883-1526".
[0293] FIG. 190 shows the amino acid sequence (SEQ ID NO: 190)
derived from the coding sequence of SEQ ID NO: 189 shown in FIG.
189.
[0294] FIG. 191 shows a nucleotide sequence (SEQ ID NO: 191) of a
native sequence PRO1356 cDNA, wherein SEQ ID NO: 191 is a clone
designated herein as "DNA64886-1601".
[0295] FIG. 192 shows the amino acid sequence (SEQ ID NO: 192)
derived from the coding sequence of SEQ ID NO: 191 shown in FIG.
191.
[0296] FIG. 193 shows a nucleotide sequence (SEQ ID NO: 193) of a
native sequence PRO1274 cDNA, wherein SEQ ID NO: 193 is a clone
designated herein as "DNA64889-1541".
[0297] FIG. 194 shows the amino acid sequence (SEQ ID NO: 194)
derived from the coding sequence of SEQ ID NO: 193 shown in FIG.
193.
[0298] FIG. 195 shows a nucleotide sequence (SEQ ID NO: 195) of a
native sequence PRO1272 cDNA, wherein SEQ ID NO: 195 is a clone
designated herein as "DNA64896-1539".
[0299] FIG. 196 shows the amino acid sequence (SEQ ID NO: 196)
derived from the coding sequence of SEQ ID NO: 195 shown in FIG.
195.
[0300] FIG. 197 shows a nucleotide sequence (SEQ ID NO: 197) of a
native sequence PRO1412 cDNA, wherein SEQ ID NO: 197 is a clone
designated herein as "DNA64897-1628 ".
[0301] FIG. 198 shows the amino acid sequence (SEQ ID NO: 198)
derived from the coding sequence of SEQ ID NO: 197 shown in FIG.
197.
[0302] FIG. 199 shows a nucleotide sequence (SEQ ID NO: 199) of a
native sequence PRO1286 cDNA, wherein SEQ ID NO: 199 is a clone
designated herein as "DNA64903-1553".
[0303] FIG. 200 shows the amino acid sequence (SEQ ID NO: 200)
derived from the coding sequence of SEQ ID NO: 199 shown in FIG.
199.
[0304] FIG. 201 shows a nucleotide sequence (SEQ ID NO: 201) of a
native sequence PRO1347 cDNA, wherein SEQ ID NO: 201 is a clone
designated herein as "DNA64950-1590".
[0305] FIG. 202 shows the amino acid sequence (SEQ ID NO: 202)
derived from the coding sequence of SEQ ID NO: 201 shown in FIG.
201.
[0306] FIG. 203 shows a nucleotide sequence (SEQ ID NO: 203) of a
native sequence PRO1273 cDNA, wherein SEQ ID NO: 203 is a clone
designated herein as "DNA65402-1540".
[0307] FIG. 204 shows the amino acid sequence (SEQ ID NO: 204)
derived from the coding sequence of SEQ ID NO: 203 shown in FIG.
203.
[0308] FIG. 205 shows a nucleotide sequence (SEQ ID NO: 205) of a
native sequence PRO1283 cDNA, wherein SEQ ID NO: 205 is a clone
designated herein as "DNA65404-1551".
[0309] FIG. 206 shows the amino acid sequence (SEQ ID NO: 206)
derived from the coding sequence of SEQ ID NO: 205 shown in FIG.
205.
[0310] FIG. 207 shows a nucleotide sequence (SEQ ID NO: 207) of a
native sequence PRO1279 cDNA, wherein SEQ ID NO: 207 is a clone
designated herein as "DNA65405-1547".
[0311] FIG. 208 shows the amino acid sequence (SEQ ID NO: 208)
derived from the coding sequence of SEQ ID NO: 207 shown in FIG.
207.
[0312] FIG. 209 shows a nucleotide sequence (SEQ ID NO: 209) of a
native sequence PRO1306 cDNA, wherein SEQ ID NO: 209 is a clone
designated herein as "DNA65410-1569".
[0313] FIG. 210 shows the amino acid sequence (SEQ ID NO: 210)
derived from the coding sequence of SEQ ID NO: 209 shown in FIG.
209.
[0314] FIG. 211 shows a nucleotide sequence (SEQ ID NO: 211) of a
native sequence PRO1195 cDNA, wherein SEQ ID NO: 211 is a clone
designated herein as "DNA65412-1523".
[0315] FIG. 212 shows the amino acid sequence (SEQ ID NO: 212)
derived from the coding sequence of SEQ ID NO: 211 shown in FIG.
211.
[0316] FIG. 213 shows a nucleotide sequence (SEQ ID NO: 213) of a
native sequence PRO4995 cDNA, wherein SEQ ID NO: 213 is a clone
designated herein as "DNA66307-2661".
[0317] FIG. 214 shows the amino acid sequence (SEQ ID NO: 214)
derived from the coding sequence of SEQ ID NO: 213 shown in FIG.
213.
[0318] FIG. 215 shows a nucleotide sequence (SEQ ID NO: 215) of a
native sequence PRO1382 cDNA, wherein SEQ ID NO: 215 is a clone
designated herein as "DNA66526-1616".
[0319] FIG. 216 shows the amino acid sequence (SEQ ID NO: 216)
derived from the coding sequence of SEQ ID NO: 215 shown in FIG.
215.
[0320] FIG. 217 shows a nucleotide sequence (SEQ ID NO: 217) of a
native sequence PRO1325 cDNA, wherein SEQ ID NO: 217 is a clone
designated herein as "DNA66659-1593".
[0321] FIG. 218 shows the amino acid sequence (SEQ ID NO: 218)
derived from the coding sequence of SEQ ID NO: 217 shown in FIG.
217.
[0322] FIG. 219 shows a nucleotide sequence (SEQ ID NO: 219) of a
native sequence PRO1329 cDNA, wherein SEQ ID NO: 219 is a clone
designated herein as "DNA66660-1585".
[0323] FIG. 220 shows the amino acid sequence (SEQ ID NO: 220)
derived from the coding sequence of SEQ ID NO: 219 shown in FIG.
219.
[0324] FIG. 221 shows a nucleotide sequence (SEQ ID NO: 221) of a
native sequence PRO1338 cDNA, wherein SEQ ID NO: 221 is a clone
designated herein as "DNA66667-1596".
[0325] FIG. 222 shows the amino acid sequence (SEQ ID NO: 222)
derived from the coding sequence of SEQ ID NO: 221 shown in FIG.
221.
[0326] FIG. 223 shows a nucleotide sequence (SEQ ID NO: 223) of a
native sequence PRO1337 cDNA, wherein SEQ ID NO: 223 is a clone
designated herein as "DNA66672-1586".
[0327] FIG. 224 shows the amino acid sequence (SEQ ID NO: 224)
derived from the coding sequence of SEQ ID NO: 223 shown in FIG.
223.
[0328] FIG. 225 shows a nucleotide sequence (SEQ ID NO: 225) of a
native sequence PRO1343 cDNA, wherein SEQ ID NO: 225 is a clone
designated herein as "DNA66675-1587".
[0329] FIG. 226 shows the amino acid sequence (SEQ ID NO: 226)
derived from the coding sequence of SEQ ID NO: 225 shown in FIG.
225.
[0330] FIG. 227 shows a nucleotide sequence (SEQ ID NO: 227) of a
native sequence PRO1376 cDNA, wherein SEQ ID NO: 227 is a clone
designated herein as "DNA67300-1605".
[0331] FIG. 228 shows the amino acid sequence (SEQ ID NO: 228)
derived from the coding sequence of SEQ ID NO: 227 shown in FIG.
227.
[0332] FIG. 229 shows a nucleotide sequence (SEQ ID NO: 229) of a
native sequence PRO1434 cDNA, wherein SEQ ID NO: 229 is a clone
designated herein as "DNA68818-2536".
[0333] FIG. 230 shows the amino acid sequence (SEQ ID NO: 230)
derived from the coding sequence of SEQ ID NO: 229 shown in FIG.
229.
[0334] FIG. 231 shows a nucleotide sequence (SEQ ID NO: 231) of a
native sequence PRO3579 cDNA, wherein SEQ ID NO: 231 is a clone
designated herein as "DNA68862-2546".
[0335] FIG. 232 shows the amino acid sequence (SEQ ID NO: 232)
derived from the coding sequence of SEQ ID NO: 231 shown in FIG.
231.
[0336] FIG. 233 shows a nucleotide sequence (SEQ ID NO: 233) of a
native sequence PRO1387 cDNA, wherein SEQ ID NO: 233 is a clone
designated herein as "DNA68872-1620".
[0337] FIG. 234 shows the amino acid sequence (SEQ ID NO: 234)
derived from the coding sequence of SEQ ID NO: 233 shown in FIG.
233.
[0338] FIG. 235 shows a nucleotide sequence (SEQ ID NO: 235) of a
native sequence PRO1419 cDNA, wherein SEQ ID NO: 235 is a clone
designated herein as "DNA71290-1630".
[0339] FIG. 236 shows the amino acid sequence (SEQ ID NO: 236)
derived from the coding sequence of SEQ ID NO: 235 shown in FIG.
235.
[0340] FIG. 237 shows a nucleotide sequence (SEQ ID NO: 237) of a
native sequence PRO1488 cDNA, wherein SEQ ID NO: 237 is a clone
designated herein as "DNA73736-1657".
[0341] FIG. 238 shows the amino acid sequence (SEQ ID NO: 238)
derived from the coding sequence of SEQ ID NO: 237 shown in FIG.
237.
[0342] FIG. 239 shows a nucleotide sequence (SEQ ID NO: 239) of a
native sequence PRO1474 cDNA, wherein SEQ ID NO: 239 is a clone
designated herein as "DNA73739-1645".
[0343] FIG. 240 shows the amino acid sequence (SEQ ID NO: 240)
derived from the coding sequence of SEQ ID NO: 239 shown in FIG.
239.
[0344] FIG. 241 shows a nucleotide sequence (SEQ ID NO: 241) of a
native sequence PRO1508 cDNA, wherein SEQ ID NO: 241 is a clone
designated herein as "DNA73742-1662".
[0345] FIG. 242 shows the amino acid sequence (SEQ ID NO: 242)
derived from the coding sequence of SEQ ID NO: 241 shown in FIG.
241.
[0346] FIG. 243 shows a nucleotide sequence (SEQ ID NO: 243) of a
native sequence PRO1754 cDNA, wherein SEQ ID NO: 243 is a clone
designated herein as "DNA76385-1692".
[0347] FIG. 244 shows the amino acid sequence (SEQ ID NO: 244)
derived from the coding sequence of SEQ ID NO: 243 shown in FIG.
243.
[0348] FIG. 245 shows a nucleotide sequence (SEQ ID NO: 245) of a
native sequence PRO1550 cDNA, wherein SEQ ID NO: 245 is a clone
designated herein as "DNA76393-1664".
[0349] FIG. 246 shows the amino acid sequence (SEQ ID NO: 246)
derived from the coding sequence of SEQ ID NO: 245 shown in FIG.
245.
[0350] FIG. 247 shows a nucleotide sequence (SEQ ID NO: 247) of a
native sequence PRO1758 cDNA, wherein SEQ ID NO: 247 is a clone
designated herein as "DNA76399-1700".
[0351] FIG. 248 shows the amino acid sequence (SEQ ID NO: 248)
derived from the coding sequence of SEQ ID NO: 247 shown in FIG.
247.
[0352] FIG. 249 shows a nucleotide sequence (SEQ ID NO: 249) of a
native sequence PRO1917 cDNA, wherein SEQ ID NO: 249 is a clone
designated herein as "DNA76400-2528".
[0353] FIG. 250 shows the amino acid sequence (SEQ ID NO: 250)
derived from the coding sequence of SEQ ID NO: 249 shown in FIG.
249.
[0354] FIG. 251 shows a nucleotide sequence (SEQ ID NO: 251) of a
native sequence PRO1787 cDNA, wherein SEQ ID NO: 251 is a clone
designated herein as "DNA76510-2504".
[0355] FIG. 252 shows the amino acid sequence (SEQ ID NO: 252)
derived from the coding sequence of SEQ ID NO: 251 shown in FIG.
251.
[0356] FIG. 253 shows a nucleotide sequence (SEQ ID NO: 253) of a
native sequence PRO1556 cDNA, wherein SEQ ID NO: 253 is a clone
designated herein as "DNA76529-1666".
[0357] FIG. 254 shows the amino acid sequence (SEQ ID NO: 254)
derived from the coding sequence of SEQ ID NO: 253 shown in FIG.
253.
[0358] FIG. 255 shows a nucleotide sequence (SEQ ID NO: 255) of a
native sequence PRO1760 cDNA, wherein SEQ ID NO: 255 is a clone
designated herein as "DNA76532-1702".
[0359] FIG. 256 shows the amino acid sequence (SEQ ID NO: 256)
derived from the coding sequence of SEQ ID NO: 255 shown in FIG.
255.
[0360] FIG. 257 shows a nucleotide sequence (SEQ ID NO: 257) of a
native sequence PRO1567 cDNA, wherein SEQ ID NO: 257 is a clone
designated herein as "DNA76541-1675".
[0361] FIG. 258 shows the amino acid sequence (SEQ ID NO: 258)
derived from the coding sequence of SEQ ID NO: 257 shown in FIG.
257.
[0362] FIG. 259 shows a nucleotide sequence (SEQ ID NO: 259) of a
native sequence PRO1600 cDNA, wherein SEQ ID NO: 259 is a clone
designated herein as "DNA77503-1686".
[0363] FIG. 260 shows the amino acid sequence (SEQ ID NO: 260)
derived from the coding sequence of SEQ ID NO: 259 shown in FIG.
259.
[0364] FIG. 261 shows a nucleotide sequence (SEQ ID NO: 261) of a
native sequence PRO1868 cDNA, wherein SEQ ID NO: 261 is a clone
designated herein as "DNA77624-2515".
[0365] FIG. 262 shows the amino acid sequence (SEQ ID NO: 262)
derived from the coding sequence of SEQ ID NO: 261 shown in FIG.
261.
[0366] FIG. 263 shows a nucleotide sequence (SEQ ID NO: 263) of a
native sequence PRO1890 cDNA, wherein SEQ ID NO: 263 is a clone
designated herein as "DNA79230-2525".
[0367] FIG. 264 shows the amino acid sequence (SEQ ID NO: 264)
derived from the coding sequence of SEQ ID NO: 263 shown in FIG.
263.
[0368] FIG. 265 shows a nucleotide sequence (SEQ ID NO: 265) of a
native sequence PRO1887 cDNA, wherein SEQ ID NO: 265 is a clone
designated herein as "DNA79862-2522".
[0369] FIG. 266 shows the amino acid sequence (SEQ ID NO: 265)
derived from the coding sequence of SEQ ID NO: 265 shown in FIG.
265.
[0370] FIG. 267 shows a nucleotide sequence (SEQ ID NO: 267) of a
native sequence PRO4353 cDNA, wherein SEQ ID NO: 267 is a clone
designated herein as "DNA80145-2594".
[0371] FIG. 268 shows the amino acid sequence (SEQ ID NO: 268)
derived from the coding sequence of SEQ ID NO: 267 shown in FIG.
267.
[0372] FIG. 269 shows a nucleotide sequence (SEQ ID NO: 269) of a
native sequence PRO1782 cDNA, wherein SEQ ID NO: 269 is a clone
designated herein as "DNA80899-2501".
[0373] FIG. 270 shows the amino acid sequence (SEQ ID NO: 270)
derived from the coding sequence of SEQ ID NO: 269 shown in FIG.
269.
[0374] FIG. 271 shows a nucleotide sequence (SEQ ID NO: 271) of a
native sequence PRO1928 cDNA, wherein SEQ ID NO: 271 is a clone
designated herein as "DNA81754-2532".
[0375] FIG. 272 shows the amino acid sequence (SEQ ID NO: 272)
derived from the coding sequence of SEQ ID NO: 271 shown in FIG.
271.
[0376] FIG. 273 shows a nucleotide sequence (SEQ ID NO: 273) of a
native sequence PRO1865 cDNA, wherein SEQ ID NO: 273 is a clone
designated herein as "DNA81757-2512".
[0377] FIG. 274 shows the amino acid sequence (SEQ ID NO: 274)
derived from the coding sequence of SEQ ID NO: 273 shown in FIG.
273.
[0378] FIG. 275 shows a nucleotide sequence (SEQ ID NO: 275) of a
native sequence PRO4341 cDNA, wherein SEQ ID NO: 275 is a clone
designated herein as "DNA81761-2583".
[0379] FIG. 276 shows the amino acid sequence (SEQ ID NO: 276)
derived from the coding sequence of SEQ ID NO: 275 shown in FIG.
275.
[0380] FIG. 277 shows a nucleotide sequence (SEQ ID NO: 277) of a
native sequence PRO6714 cDNA, wherein SEQ ID NO: 277 is a clone
designated herein as "DNA82358-2738".
[0381] FIG. 278 shows the amino acid sequence (SEQ ID NO: 278)
derived from the coding sequence of SEQ ID NO: 277 shown in FIG.
277.
[0382] FIG. 279 shows a nucleotide sequence (SEQ ID NO: 279) of a
native sequence PRO5723 cDNA, wherein SEQ ID NO: 279 is a clone
designated herein as "DNA82361".
[0383] FIG. 280 shows the amino acid sequence (SEQ ID NO: 280)
derived from the coding sequence of SEQ ID NO: 279 shown in FIG.
279.
[0384] FIG. 281 shows a nucleotide sequence (SEQ ID NO: 281) of a
native sequence PRO3438 cDNA, wherein SEQ ID NO: 281 is a clone
designated herein as "DNA82364-2538".
[0385] FIG. 282 shows the amino acid sequence (SEQ ID NO: 282)
derived from the coding sequence of SEQ ID NO: 281 shown in FIG.
281.
[0386] FIG. 283 shows a nucleotide sequence (SEQ ID NO: 283) of a
native sequence PRO6071 cDNA, wherein SEQ ID NO: 283 is a clone
designated herein as "DNA82403-2959".
[0387] FIG. 284 shows the amino acid sequence (SEQ ID NO: 284)
derived from the coding sequence of SEQ ID NO: 283 shown in FIG.
283.
[0388] FIG. 285 shows a nucleotide sequence (SEQ ID NO: 285) of a
native sequence PRO1801 cDNA, wherein SEQ ID NO: 285 is a clone
designated herein as "DNA83500-2506".
[0389] FIG. 286 shows the amino acid sequence (SEQ ID NO: 286)
derived from the coding sequence of SEQ ID NO: 285 shown in FIG.
285.
[0390] FIG. 287 shows a nucleotide sequence (SEQ ID NO: 287) of a
native sequence PRO4324 cDNA, wherein SEQ ID NO: 287 is a clone
designated herein as "DNA83560-2569".
[0391] FIG. 288 shows the amino acid sequence (SEQ ID NO: 288)
derived from the coding sequence of SEQ ID NO: 287 shown in FIG.
287.
[0392] FIG. 289 shows a nucleotide sequence (SEQ ID NO: 289) of a
native sequence PRO4333 cDNA, wherein SEQ ID NO: 289 is a clone
designated herein as "DNA84210-2576".
[0393] FIG. 290 shows the amino acid sequence (SEQ ID NO: 290)
derived from the coding sequence of SEQ ID NO: 289 shown in FIG.
289.
[0394] FIG. 291 shows a nucleotide sequence (SEQ ID NO: 291) of a
native sequence PRO4405 cDNA, wherein SEQ ID NO: 291 is a clone
designated herein as "DNA84920-2614".
[0395] FIG. 292 shows the amino acid sequence (SEQ ID NO: 292)
derived from the coding sequence of SEQ ID NO: 291 shown in FIG.
291.
[0396] FIG. 293 shows a nucleotide sequence (SEQ ID NO: 293) of a
native sequence PRO4356 cDNA, wherein SEQ ID NO: 293 is a clone
designated herein as "DNA86576-2595".
[0397] FIG. 294 shows the amino acid sequence (SEQ ID NO: 294)
derived from the coding sequence of SEQ ID NO: 293 shown in FIG.
293.
[0398] FIG. 295 shows a nucleotide sequence (SEQ ID NO: 295) of a
native sequence PRO3444 cDNA, wherein SEQ ID NO: 295 is a clone
designated herein as "DNA87997".
[0399] FIG. 296 shows the amino acid sequence (SEQ ID NO: 296)
derived from the coding sequence of SEQ ID NO: 295 shown in FIG.
295.
[0400] FIG. 297 shows a nucleotide sequence (SEQ ID NO: 297) of a
native sequence PRO4302 cDNA, wherein SEQ ID NO: 297 is a clone
designated herein as "DNA92218-2554".
[0401] FIG. 298 shows the amino acid sequence (SEQ ID NO: 298)
derived from the coding sequence of SEQ ID NO: 297 shown in FIG.
297.
[0402] FIG. 299 shows a nucleotide sequence (SEQ ID NO: 299) of a
native sequence PRO4371 cDNA, wherein SEQ ID NO: 299 is a clone
designated herein as "DNA92233-2599".
[0403] FIG. 300 shows the amino acid sequence (SEQ ID NO: 300)
derived from the coding sequence of SEQ ID NO: 299 shown in FIG.
299.
[0404] FIG. 301 shows a nucleotide sequence (SEQ ID NO: 301) of a
native sequence PRO4354 cDNA, wherein SEQ ID NO: 301 is a clone
designated herein as "DNA92256-2596".
[0405] FIG. 302 shows the amino acid sequence (SEQ ID NO: 302)
derived from the coding sequence of SEQ ID NO: 301 shown in FIG.
301.
[0406] FIG. 303 shows a nucleotide sequence (SEQ ID NO: 303) of a
native sequence PRO5725 cDNA, wherein SEQ ID NO: 303 is a clone
designated herein as "DNA92265-2669".
[0407] FIG. 304 shows the amino acid sequence (SEQ ID NO: 304)
derived from the coding sequence of SEQ ID NO: 303 shown in FIG.
303.
[0408] FIG. 305 shows a nucleotide sequence (SEQ ID NO: 305) of a
native sequence PRO4408 cDNA, wherein SEQ ID NO: 305 is a clone
designated herein as "DNA92274-2617".
[0409] FIG. 306 shows the amino acid sequence (SEQ ID NO: 306)
derived from the coding sequence of SEQ ID NO: 305 shown in FIG.
305.
[0410] FIG. 307 shows a nucleotide sequence (SEQ ID NO: 307) of a
native sequence PRO9940 cDNA, wherein SEQ ID NO: 307 is a clone
designated herein as "DNA92282".
[0411] FIG. 308 shows the amino acid sequence (SEQ ID NO: 308)
derived from the coding sequence of SEQ ID NO: 307 shown in FIG.
307.
[0412] FIG. 309 shows a nucleotide sequence (SEQ ID NO: 309) of a
native sequence PRO5737 cDNA, wherein SEQ ID NO: 309 is a clone
designated herein as "DNA92929-2534-1".
[0413] FIG. 310 shows the amino acid sequence (SEQ ID NO: 310)
derived from the coding sequence of SEQ ID NO: 309 shown in FIG.
309.
[0414] FIG. 311 shows a nucleotide sequence (SEQ ID NO: 311) of a
native sequence PRO4425 cDNA, wherein SEQ ID NO: 311 is a clone
designated herein as "DNA93011-2637".
[0415] FIG. 312 shows the amino acid sequence (SEQ ID NO: 312)
derived from the coding sequence of SEQ ID NO: 311 shown in FIG.
311.
[0416] FIG. 313 shows a nucleotide sequence(SEQ ID NO: 313) of a
native sequence PRO4345 cDNA, wherein SEQ ID NO: 313 is a clone
designated herein as "DNA94854-2586".
[0417] FIG. 314 shows the amino acid sequence (SEQ ID NO: 314)
derived from the coding sequence of SEQ ID NO: 313 shown in FIG.
313.
[0418] FIG. 315 shows a nucleotide sequence (SEQ ID NO: 315) of a
native sequence PRO4342 cDNA, wherein SEQ ID NO: 315 is a clone
designated herein as "DNA96787-2534-1".
[0419] FIG. 316 shows the amino acid sequence (SEQ ID NO: 316)
derived from the coding sequence of SEQ ID NO: 315 shown in FIG.
315.
[0420] FIG. 317 shows a nucleotide sequence (SEQ ID NO: 317) of a
native sequence PRO3562 cDNA, wherein SEQ ID NO: 317 is a clone
designated herein as "DNA96791 ".
[0421] FIG. 318 shows the amino acid sequence (SEQ ID NO: 318)
derived from the coding sequence of SEQ ID NO: 317 shown in FIG.
317.
[0422] FIG. 319 shows a nucleotide sequence (SEQ ID NO: 319) of a
native sequence PRO4422 cDNA, wherein SEQ ID NO: 319 is a clone
designated herein as "DNA96867-2620".
[0423] FIG. 320 shows the amino acid sequence (SEQ ID NO: 320)
derived from the coding sequence of SEQ ID NO: 319 shown in FIG.
319.
[0424] FIG. 321 shows a nucleotide sequence (SEQ ID NO: 321) of a
native sequence PRO5776 cDNA, wherein SEQ ID NO: 321 is a clone
designated herein as "DNA96872-2674".
[0425] FIG. 322 shows the amino acid sequence (SEQ ID NO: 322)
derived from the coding sequence of SEQ ID NO: 321 shown in FIG.
321.
[0426] FIG. 323 shows a nucleotide sequence (SEQ ID NO: 323) of a
native sequence PRO4430 cDNA, wherein SEQ ID NO: 323 is a clone
designated herein as "DNA96878-2626".
[0427] FIG. 324 shows the amino acid sequence (SEQ ID NO: 324)
derived from the coding sequence of SEQ ID NO: 323 shown in FIG.
323.
[0428] FIG. 325 shows a nucleotide sequence (SEQ ID NO: 325) of a
native sequence PRO4499 cDNA, wherein SEQ ID NO: 325 is a clone
designated herein as "DNA96889-2641".
[0429] FIG. 326 shows the amino acid sequence (SEQ ID NO: 326)
derived from the coding sequence of SEQ ID NO: 325 shown in FIG.
325.
[0430] FIG. 327 shows a nucleotide sequence (SEQ ID NO: 327) of a
native sequence PRO4503 cDNA, wherein SEQ ID NO: 327 is a clone
designated herein as "DNA100312-2645".
[0431] FIG. 328 shows the amino acid sequence (SEQ ID NO: 328)
derived from the coding sequence of SEQ ID NO: 327 shown in FIG.
327.
[0432] FIG. 329 shows a nucleotide sequence (SEQ ID NO: 329) of a
native sequence PRO10008 cDNA, wherein SEQ ID NO: 329 is a clone
designated herein as "DNA101921".
[0433] FIG. 330 shows the amino acid sequence (SEQ ID NO: 330)
derived from the coding sequence of SEQ ID NO: 329 shown in FIG.
329.
[0434] FIG. 331 shows a nucleotide sequence (SEQ ID NO: 331) of a
native sequence PRO5730 cDNA, wherein SEQ ID NO: 331 is a clone
designated herein as "DNA101926".
[0435] FIG. 332 shows the amino acid sequence (SEQ ID NO: 332)
derived from the coding sequence of SEQ ID NO: 331 shown in FIG.
331.
[0436] FIG. 333 shows a nucleotide sequence (SEQ ID NO: 333) of a
native sequence PRO6008 cDNA, wherein SEQ ID NO: 333 is a clone
designated herein as "DNA102844".
[0437] FIG. 334 shows the amino acid sequence (SEQ ID NO: 334)
derived from the coding sequence of SEQ ID NO: 333 shown in FIG.
333.
[0438] FIG. 335 shows a nucleotide sequence (SEQ ID NO: 335) of a
native sequence PRO4527 cDNA, wherein SEQ ID NO: 335 is a clone
designated herein as "DNA103197".
[0439] FIG. 336 shows the amino acid sequence (SEQ ID NO: 336)
derived from the coding sequence of SEQ ID NO: 335 shown in FIG.
335.
[0440] FIG. 337 shows a nucleotide sequence (SEQ ID NO: 337) of a
native sequence PRO4538 cDNA, wherein SEQ ID NO: 337 is a clone
designated herein as "DNA103208".
[0441] FIG. 338 shows the amino acid sequence (SEQ ID NO: 338)
derived from the coding sequence of SEQ ID NO: 337 shown in FIG.
337.
[0442] FIG. 339 shows a nucleotide sequence (SEQ ID NO: 339) of a
native sequence PRO4553 cDNA, wherein SEQ ID NO: 339 is a clone
designated herein as "DNA103223".
[0443] FIG. 340 shows the amino acid sequence (SEQ ID NO: 340)
derived from the coding sequence of SEQ ID NO: 339 shown in FIG.
339.
[0444] FIG. 341 shows a nucleotide sequence (SEQ ID NO: 341) of a
native sequence PRO6006 cDNA, wherein SEQ ID NO: 341 is a clone
designated herein as "DNA105782-2693".
[0445] FIG. 342 shows the amino acid sequence (SEQ ID NO: 342)
derived from the coding sequence of SEQ ID NO: 341 shown in FIG.
341.
[0446] FIG. 343 shows a nucleotide sequence (SEQ ID NO: 343) of a
native sequence PRO6029 cDNA, wherein SEQ ID NO: 343 is a clone
designated herein as "DNA105849-2704".
[0447] FIG. 344 shows the amino acid sequence (SEQ ID NO: 344)
derived from the coding sequence of SEQ ID NO: 343 shown in FIG.
343.
[0448] FIG. 345 shows a nucleotide sequence (SEQ ID NO: 345) of a
native sequence PRO9821 cDNA, wherein SEQ ID NO: 345 is a clone
designated herein as "DNA108725-2766".
[0449] FIG. 346 shows the amino acid sequence (SEQ ID NO: 346)
derived from the coding sequence of SEQ ID NO: 345 shown in FIG.
345.
[0450] FIG. 347 shows a nucleotide sequence (SEQ ID NO: 347) of a
native sequence PRO9820 cDNA, wherein SEQ ID NO: 347 is a clone
designated herein as "DNA108769-2765".
[0451] FIG. 348 shows the amino acid sequence (SEQ ID NO: 348)
derived from the coding sequence of SEQ ID NO: 347 shown in FIG.
347.
[0452] FIG. 349 shows a nucleotide sequence (SEQ ID NO: 349) of a
native sequence PRO9771 cDNA, wherein SEQ ID NO: 349 is a clone
designated herein as "DNA119498-2965".
[0453] FIG. 350 shows the amino acid sequence (SEQ ID NO: 350)
derived from the coding sequence of SEQ ID NO: 349 shown in FIG.
349.
[0454] FIG. 351 shows a nucleotide sequence (SEQ ID NO: 351) of a
native sequence PRO7436cDNA, wherein SEQ ID NO: 351 is a clone
designated herein as "DNA 19535-2756".
[0455] FIG. 352 shows the amino acid sequence (SEQ ID NO: 352)
derived from the coding sequence of SEQ ID NO: 351 shown in FIG.
351.
[0456] FIG. 353 shows a nucleotide sequence (SEQ ID NO: 353) of a
native sequence PRO10096 cDNA, wherein SEQ ID NO: 353 is a clone
designated herein as "DNA125185-2806".
[0457] FIG. 354 shows the amino acid sequence (SEQ ID NO: 354)
derived from the coding sequence of SEQ ID NO: 353 shown in FIG.
353.
[0458] FIG. 355 shows a nucleotide sequence (SEQ ID NO: 355) of a
native sequence PRO19670 cDNA, wherein SEQ ID NO: 355 is a clone
designated herein as "DNA131639-2874".
[0459] FIG. 356 shows the amino acid sequence (SEQ ID NO: 356)
derived from the coding sequence of SEQ ID NO: 355 shown in FIG.
355.
[0460] FIG. 357 shows a nucleotide sequence (SEQ ID NO: 357) of a
native sequence PRO20044 cDNA, wherein SEQ ID NO: 357 is a clone
designated herein as "DNA139623-2893".
[0461] FIG. 358 shows the amino acid sequence (SEQ ID NO: 358)
derived from the coding sequence of SEQ ID NO: 357 shown in FIG.
357.
[0462] FIG. 359 shows a nucleotide sequence (SEQ ID NO: 359) of a
native sequence PRO9873 cDNA, wherein SEQ ID NO: 359 is a clone
designated herein as "DNA143076-2787".
[0463] FIG. 360 shows the amino acid sequence (SEQ ID NO: 360)
derived from the coding sequence of SEQ ID NO: 359 shown in FIG.
359.
[0464] FIG. 361 shows a nucleotide sequence (SEQ ID NO: 361) of a
native sequence PRO21366 cDNA, wherein SEQ ID NO: 361 is a clone
designated herein as "DNA143276-2975".
[0465] FIG. 362 shows the amino acid sequence (SEQ ID NO: 362)
derived from the coding sequence of SEQ ID NO: 361 shown in FIG.
361.
[0466] FIG. 363 shows a nucleotide sequence (SEQ ID NO: 363) of a
native sequence PRO20040 cDNA, wherein SEQ ID NO: 363 is a clone
designated herein as "DNA164625-2890".
[0467] FIG. 364 shows the amino acid sequence (SEQ ID NO: 364)
derived from the coding sequence of SEQ ID NO: 363 shown in FIG.
363.
[0468] FIG. 365 shows a nucleotide sequence (SEQ ID NO: 365) of a
native sequence PRO21184 cDNA, wherein SEQ ID NO: 365 is a clone
designated herein as "DNA167678-2963".
[0469] FIG. 366 shows the amino acid sequence (SEQ ID NO: 366)
derived from the coding sequence of SEQ ID NO: 365 shown in FIG.
365.
[0470] FIG. 367 shows a nucleotide sequence (SEQ ID NO: 367) of a
native sequence PRO21055 cDNA, wherein SEQ ID NO: 367 is a clone
designated herein as "DNA170021-2923".
[0471] FIG. 368 shows the amino acid sequence (SEQ ID NO: 368)
derived from the coding sequence of SEQ ID NO: 367 shown in FIG.
367.
[0472] FIG. 369 shows a nucleotide sequence (SEQ ID NO: 369) of a
native sequence PRO28631 cDNA, wherein SEQ ID NO: 369 is a clone
designated herein as "DNA170212-3000".
[0473] FIG. 370 shows the amino acid sequence (SEQ ID NO: 370)
derived from the coding sequence of SEQ ID NO: 369 shown in FIG.
369.
[0474] FIG. 371 shows a nucleotide sequence (SEQ ID NO: 371) of a
native sequence PRO21384 cDNA, wherein SEQ ID NO: 371 is a clone
designated herein as "DNA177313-2982".
[0475] FIG. 372 shows the amino acid sequence (SEQ ID NO: 372)
derived from the coding sequence of SEQ ID NO: 371 shown in FIG.
371.
[0476] FIG. 373 shows a nucleotide sequence (SEQ ID NO: 373) of a
native sequence PRO1449 cDNA, wherein SEQ ID NO: 373 is a clone
designated herein as "DNA64908-1163-1".
[0477] FIG. 374 shows the amino acid sequence (SEQ ID NO: 374)
derived from the coding sequence of SEQ ID NO: 373 shown in FIG.
373.
[0478] FIG. 375 shows wholemount in situ hybridization result on
mouse embryos using a mouse orthologue of PRO1449 which has about
78% amino acid identity with PRO1449. The results show that PRO1449
orthologue is expressed in the developing vasculature. The
cross-section further shows expression in endothelial cells and
progenitors of endothelial cells.
[0479] FIG. 376 shows that a PRO1449 orthologue having about 78%
amino acid identity with PRO1449 is expressed in vasculature of
many inflamed and diseased tissues, but is very low, or lacking, in
normal adult vessels.
[0480] FIG. 377 shows that a PRO1449 orthologue having about 78%
amino acid identity with PRO1449 induces ectopic vessels in the
eyes of chicken embryos.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1. Definitions
[0481] The phrases "cardiovascular, endothelial and angiogenic
disorder", "cardiovascular, endothelial and angiogenic
dysfunction", "cardiovascular, endothelial or angiogenic disorder"
and "cardiovascular, endothelial or angiogenic dysfunction" are
used interchangeably and refer in part to systemic disorders that
affect vessels, such as diabetes mellitus, as well as diseases of
the vessels themselves, such as of the arteries, capillaries,
veins, and/or lymphatics. This would include indications that
stimulate angiogenesis and/or cardiovascularization, and those that
inhibit angiogenesis and/or cardiovascularization. Such disorders
include, for example, arterial disease, such as atherosclerosis,
hypertension, inflammatory vasculitides, Reynaud's disease and
Reynaud's phenomenon, aneurysms, and arterial restenosis; venous
and lymphatic disorders such as thrombophlebitis, lymphangitis, and
lymphedema; and other vascular disorders such as peripheral
vascular disease, cancer such as vascular tumors, e.g., hemangioma
(capillary and cavernous), glomus tumors, telangiectasia, bacillary
angiomatosis, hemangioendothelioma, angiosarcoma,
haemangiopericytoma, Kaposi's sarcoma, lymphangioma, and
lymphangiosarcoma, tumor angiogenesis, trauma such as wounds,
burns, and other injured tissue, implant fixation, scarring,
ischemia reperfusion injury, rheumatoid arthritis, cerebrovascular
disease, renal diseases such as acute renal failure, and
osteoporosis. This would also include angina, myocardial
infarctions such as acute myocardial infarctions, cardiac
hypertrophy, and heart failure such as CHF.
[0482] "Hypertrophy", as used herein, is defined as an increase in
mass of an organ or structure independent of natural growth that
does not involve tumor formation. Hypertrophy of an organ or tissue
is due either to an increase in the mass of the individual cells
(true hypertrophy), or to an increase in the number of cells making
up the tissue (hyperplasia), or both. Certain organs, such as the
heart, lose the ability to divide shortly after birth. Accordingly,
"cardiac hypertrophy" is defined as an increase in mass of the
heart, which, in adults, is characterized by an increase in myocyte
cell size and contractile protein content without concomitant cell
division. The character of the stress responsible for inciting the
hypertrophy, (e.g., increased preload, increased afterload, loss of
myocytes, as in myocardial infarction, or primary depression of
contractility), appears to play a critical role in determining the
nature of the response. The early stage of cardiac hypertrophy is
usually characterized morphologically by increases in the size of
myofibrils and mitochondria, as well as by enlargement of
mitochondria and nuclei. At this stage, while muscle cells are
larger than normal, cellular organization is largely preserved. At
a more advanced stage of cardiac hypertrophy, there are
preferential increases in the size or number of specific
organelles, such as mitochondria, and new contractile elements are
added in localized areas of the cells, in an irregular manner.
Cells subjected to long-standing hypertrophy show more obvious
disruptions in cellular organization, including markedly enlarged
nuclei with highly lobulated membranes, which displace adjacent
myofibrils and cause breakdown of normal Z-band registration. The
phrase "cardiac hypertrophy" is used to include all stages of the
progression of this condition, characterized by various degrees of
structural damage of the heart muscle, regardless of the underlying
cardiac disorder. Hence, the term also includes physiological
conditions instrumental in the development of cardiac hypertrophy,
such as elevated blood pressure, aortic stenosis, or myocardial
infarction.
[0483] "Heart failure" refers to an abnormality of cardiac function
where the heart does not pump blood at the rate needed for the
requirements of metabolizing tissues. The heart failure can be
caused by a number of factors, including ischemic, congenital,
rheumatic, or idiopathic forms.
[0484] "Congestive heart failure" (CHF) is a progressive pathologic
state where the heart is increasingly unable to supply adequate
cardiac output (the volume of blood pumped by the heart over time)
to deliver the oxygenated blood to peripheral tissues. As CHF
progresses, structural and hemodynamic damages occur. While these
damages have a variety of manifestations, one characteristic
symptom is ventricular hypertrophy. CHF is a common end result of a
number of various cardiac disorders.
[0485] "Myocardial infarction" generally results from
atherosclerosis of the coronary arteries, often with superimposed
coronary thrombosis. It may be divided into two major types:
transmural infarcts, in which myocardial necrosis involves the full
thickness of the ventricular wall, and subendocardial
(nontransmural) infarcts, in which the necrosis involves the
subendocardium, the intramural myocardium, or both, without
extending all the way through the ventricular wall to the
epicardium. Myocardial infarction is known to cause both a change
in hemodynamic effects and an alteration in structure in the
damaged and healthy zones of the heart. Thus, for example,
myocardial infarction reduces the maximum cardiac output and the
stroke volume of the heart. Also associated with myocardial
infarction is a stimulation of the DNA synthesis occurring in the
interstice as well as an increase in the formation of collagen in
the areas of the heart not affected.
[0486] As a result of the increased stress or strain placed on the
heart in prolonged hypertension due, for example, to the increased
total peripheral resistance, cardiac hypertrophy has long been
associated with "hypertension". A characteristic of the ventricle
that becomes hypertrophic as a result of chronic pressure overload
is an impaired diastolic performance. Fouad et al., J. Am. Coll.
Cardiol., 4: 1500-1506 (1984); Smith et al., J. Am. Coll. Cardiol.,
5: 869-874 (1985). A prolonged left ventricular relaxation has been
detected in early essential hypertension, in spite of normal or
supra normal systolic function. Hartford et al., Hypertension, 6:
329-338 (1984). However, there is no close parallelism between
blood pressure levels and cardiac hypertrophy. Although improvement
in left ventricular function in response to antihypertensive
therapy has been reported in humans, patients variously treated
with a diuretic (hydrochlorothiazide), a .beta.-blocker
(propranolol), or a calcium channel blocker (diltiazem), have shown
reversal of left ventricular hypertrophy, without improvement in
diastolic function. Inouye et al., Am. J. Cardiol., 53: 1583-7
(1984).
[0487] Another complex cardiac disease associated with cardiac
hypertrophy is "hypertrophic cardiomyopathy". This condition is
characterized by a great diversity of morphologic, functional, and
clinical features (Maron et al., N. Engl. J. Med., 316: 780-789
(1987); Spirito et al., N. Engl. J. Med., 320: 749-755 (1989);
Louie and Edwards, Prog. Cardiovasc. Dis., 36: 275-308 (1994);
Wigle et al., Circulation, 92: 1680-1692 (1995)), the heterogeneity
of which is accentuated by the fact that it afflicts patients of
all ages. Spirito et al., N. Engl. J. Med., 336: 775-785 (1997).
The causative factors of hypertrophic cardiomyopathy are also
diverse and little understood. In general, mutations in genes
encoding sarcomeric proteins are associated with hypertrophic
cardiomyopathy. Recent data suggest that .beta.-myosin heavy chain
mutations may account for approximately 30 to 40 percent of cases
of familial hypertrophic cardiomyopathy. Watkins et al., N. Engl.
J. Med., 326: 1108-1114(1992); Schwartz et al, Circulation, 91:
532-540 (1995); Marian and Roberts, Circulation, 92: 1336-1347
(1995); Thierfelder et al., Cell, 77: 701-712 (1994); Watkins et
al., Nat. Gen., 11: 434-437 (1995). Besides .beta.-myosin heavy
chain, other locations of genetic mutations include cardiac
troponin T, alpha topomyosin, cardiac myosin binding protein C,
essential myosin light chain, and regulatory myosin light chain.
See, Malik and Watkins, Curr. Opin. Cardiol., 12: 295-302
(1997).
[0488] Supravalvular "aortic stenosis" is an inherited vascular
disorder characterized by narrowing of the ascending aorta, but
other arteries, including the pulmonary arteries, may also be
affected. Untreated aortic stenosis may lead to increased
intracardiac pressure resulting in myocardial hypertrophy and
eventually heart failure and death. The pathogenesis of this
disorder is not fully understood, but hypertrophy and possibly
hyperplasia of medial smooth muscle are prominent features of this
disorder. It has been reported that molecular variants of the
elastin gene are involved in the development and pathogenesis of
aortic stenosis. U.S. Pat. No. 5,650,282 issued Jul. 22, 1997.
[0489] "Valvular regurgitation" occurs as a result of heart
diseases resulting in disorders of the cardiac valves. Various
diseases, like rheumatic fever, can cause the shrinking or pulling
apart of the valve orifice, while other diseases may result in
endocarditis, an inflammation of the endocardium or lining membrane
of the atrioventricular orifices and operation of the heart.
Defects such as the narrowing of the valve stenosis or the
defective closing of the valve result in an accumulation of blood
in the heart cavity or regurgitation of blood past the valve. If
uncorrected, prolonged valvular stenosis or insufficiency may
result in cardiac hypertrophy and associated damage to the heart
muscle, which may eventually necessitate valve replacement.
[0490] The treatment of all these, and other cardiovascular,
endothelial and angiogenic disorders, which may or may not be
accompanied by cardiac hypertrophy, is encompassed by the present
invention.
[0491] The terms "cancer", "cancerous", and "malignant" refer to or
describe the physiological condition in mammals that is typically
characterized by unregulated cell growth. Examples of cancer
include but are not limited to, carcinoma including adenocarcinoma,
lymphoma, blastoma, melanoma, sarcoma, and leukemia. More
particular examples of such cancers include squamous cell cancer,
small-cell lung cancer, non-small cell lung cancer,
gastrointestinal cancer, Hodgkin's and non-Hodgkin's lymphoma,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer such as hepatic carcinoma and hepatoma, bladder
cancer, breast cancer, colon cancer, colorectal cancer, endometrial
carcinoma, salivary gland carcinoma, kidney cancer such as renal
cell carcinoma and Wilms' tumors, basal cell carcinoma, melanoma,
prostate cancer, vulval cancer, thyroid cancer, testicular cancer,
esophageal cancer, and various types of head and neck cancer. The
preferred cancers for treatment herein are breast, colon, lung,
melanoma, ovarian, and others involving vascular tumors as noted
above.
[0492] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., .sup.131I, .sup.125I, .sup.90Y, and
.sup.186Re), chemotherapeutic agents, and toxins such as
enzymatically active toxins of bacterial, fungal, plant, or animal
origin, or fragments thereof.
[0493] A "chemotherapeutic agent" is a chemical compound useful in
the treatment of cancer. Examples of chemotherapeutic agents
include alkylating agents, folic acid antagonists, anti-metabolites
of nucleic acid metabolism, antibiotics, pyrimidine analogs,
5-fluorouracil, cisplatin, purine nucleosides, amines, amino acids,
triazol nucleosides, or corticosteroids. Specific examples include
Adriamycin, Doxorubicin, 5-Fluorouracil, Cytosine arabinoside
("Ara-C"), Cyclophosphamide, Thiotepa, Busulfan, Cytoxin, Taxol,
Toxotere, Methotrexate, Cisplatin, Melphalan, Vinblastine,
Bleomycin, Etoposide, Ifosfamide, Mitomycin C, Mitoxantrone,
Vincreistine, Vinorelbine, Carboplatin, Teniposide, Daunomycin,
Carminomycin, Aminopterin, Dactinomycin, Mitomycins, Esperamicins
(see U.S. Pat. No. 4,675,187), Melphalan, and other related
nitrogen mustards. Also included in this definition are hormonal
agents that act to regulate or inhibit hormone action on tumors,
such as tamoxifen and onapristone.
[0494] A "growth-inhibitory agent" when used herein refers to a
compound or composition that inhibits growth of a cell, such as an
Wnt-overexpressing cancer cell, either in vitro or in vivo. Thus,
the growth-inhibitory agent is one which significantly reduces the
percentage of malignant cells in S phase. Examples of
growth-inhibitory agents include agents that block cell cycle
progression (at a place other than S phase), such as agents that
induce G1 arrest and M-phase arrest. Classical M-phase blockers
include the vincas (vincristine and vinblastine), taxol, and topo
II inhibitors such as doxorubicin, daunorubicin, etoposide, and
bleomycin. Those agents that arrest G1 also spill over into S-phase
arrest, for example, DNA alkylating agents such as tamoxifen,
prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate,
5-fluorouracil, and ara-C. Further information can be found in The
Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1,
entitled "Cell cycle regulation, oncogenes, and antineoplastic
drugs" by Murakami et al. (W B Saunders: Philadelphia, 1995),
especially p. 13. Additional examples include tumor necrosis factor
(TNF), an antibody capable of inhibiting or neutralizing the
angiogenic activity of acidic or basic FGF or hepatocyte growth
factor (HGF), an antibody capable of inhibiting or neutralizing the
coagulant activities of tissue factor, protein C, or protein S
(see, WO 91/01753, published Feb. 21, 1991), or an antibody capable
of binding to HER2 receptor (WO 89/06692), such as the 4D5 antibody
(and functional equivalents thereof) (e.g., WO 92/22653).
[0495] "Treatment" is an intervention performed with the intention
of preventing the development or altering the pathology of a
cardiovascular, endothelial, and angiogenic disorder. The concept
of treatment is used in the broadest sense, and specifically
includes the prevention (prophylaxis), moderation, reduction, and
curing of cardiovascular, endothelial, and angiogenic disorders of
any stage. Accordingly, "treatment" refers to both therapeutic
treatment and prophylactic or preventative measures, wherein the
object is to prevent or slow down (lessen) or ameliorate a
cardiovascular, endothelial, and angiogenic disorder such as
hypertrophy. Those in need of treatment include those already with
the disorder as well as those prone to have the disorder or those
in whom the disorder is to be prevented. The disorder may result
from any cause, including idiopathic, cardiotrophic, or myotrophic
causes, or ischemia or ischemic insults, such as myocardial
infarction.
[0496] "Chronic" administration refers to administration of the
agent(s) in a continuous mode as opposed to an acute mode, so as to
maintain the initial effect, such as an anti-hypertrophic effect,
for an extended period of time.
[0497] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as dogs, horses,
cats, cows, sheep, pigs, etc. Preferably, the mammal is human.
[0498] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0499] The phrase "cardiovascular, endothelial or angiogenic
agents" refers generically to any drug that acts in treating
cardiovascular, endothelial, and angiogenic disorders. Examples of
cardiovascular agents are those that promote vascular homeostasis
by modulating blood pressure, heart rate, heart contractility, and
endothelial and smooth muscle biology, all of which factors have a
role in cardiovascular disease. Specific examples of these include
angiotensin-II receptor antagonists; endothelin receptor
antagonists such as, for example, BOSENTAN.TM. and MOXONODIN.TM.;
interferon-gamma (IFN-.gamma.); des-aspartate-angiotensin I;
thrombolytic agents, e.g., streptokinase, urokinase, t-PA, and a
t-PA variant specifically designed to have longer half-life and
very high fibrin specificity, TNK t-PA (a T103N, N117Q,
KHRR(296-299)AAAA t-PA variant, Keyt et al., Proc. Natl. Acad. Sci.
USA, 91: 3670-3674 (1994)); inotropic or hypertensive agents such
as digoxigenin and .beta.-adrenergic receptor blocking agents, e g,
propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol,
penbutolol, acetobutolol, atenolol, metoprolol, and carvedilol;
angiotensin converting enzyme (ACE) inhibitors, e.g., quinapril,
captopril, enalapril, ramipril, benazepril, fosinopril, and
lisinopril; diuretics, e g., chlorothiazide, hydrochlorothiazide,
hydroflumethazide, methylchlothiazide, benzthiazide,
dichlorphenamide, acetazolamide, and indapamide; and calcium
channel blockers, e.g., diltiazem, nifedipine, verapamil,
nicardipine. One preferred category of this type is a therapeutic
agent used for the treatment of cardiac hypertrophy or of a
physiological condition instrumental in the development of cardiac
hypertrophy, such as elevated blood pressure, aortic stenosis, or
myocardial infarction.
[0500] "Angiogenic agents" and "endothelial agents" are active
agents that promote angiogenesis and/or endothelial cell growth,
or, if applicable, vasculogenesis. This would include factors that
accelerate wound healing, such as growth hormone, insulin-like
growth factor-I (IGF-I), VEGF, VIGF, PDGF, epidermal growth factor
(EGF), CTGF and members of its family, FGF, and TGF-.alpha. and
TGF-.beta..
[0501] "Angiostatic agents" are active agents that inhibit
angiogenesis or vasculogenesis or otherwise inhibit or prevent
growth of cancer cells. Examples include antibodies or other
antagonists to angiogenic agents as defined above, such as
antibodies to VEGF. They additionally include cytotherapeutic
agents such as cytotoxic agents, chemotherapeutic agents,
growth-inhibitory agents, apoptotic agents, and other agents to
treat cancer, such as anti-HER-2, anti-CD20, and other bioactive
and organic chemical agents.
[0502] In a pharmacological sense, in the context of the present
invention, a "therapeutically effective amount" of an active agent
such as a PRO polypeptide or agonist or antagonist thereto or an
anti-PRO antibody, refers to an amount effective in the treatment
of a cardiovascular, endothelial or angiogenic disorder in a mammal
and can be determined empirically.
[0503] As used herein, an "effective amount" of an active agent
such as a PRO polypeptide or agonist or antagonist thereto or an
anti-PRO antibody, refers to an amount effective for carrying out a
stated purpose, wherein such amounts may be determined empirically
for the desired effect.
[0504] The terms "PRO polypeptide" and "PRO" as used herein and
when immediately followed by a numerical designation refer to
various polypeptides, wherein the complete designation (i.e.,
PRO/number) refers to specific polypeptide sequences as described
herein. The terms "PRO/number polypeptide" and "PRO/number" wherein
the term "number" is provided as an actual numerical designation as
used herein encompass native sequence polypeptides and polypeptide
variants (which are further defined herein). The PRO polypeptides
described herein may be isolated from a variety of sources, such as
from human tissue types or from another source, or prepared by
recombinant or synthetic methods.
[0505] A "native sequence PRO polypeptide" comprises a polypeptide
having the same amino acid sequence as the corresponding PRO
polypeptide derived from nature. Such native sequence PRO
polypeptides can be isolated from nature or can be produced by
recombinant or synthetic means. The term "native sequence PRO
polypeptide" specifically encompasses naturally-occurring truncated
or secreted forms of the specific PRO polypeptide (e.g., an
extracellular domain sequence), naturally-occurring variant forms
(e.g., alternatively spliced forms) and naturally-occurring allelic
variants of the polypeptide. In various embodiments of the
invention, the native sequence PRO polypeptides disclosed herein
are mature or full-length native sequence polypeptides comprising
the full-length amino acids sequences shown in the accompanying
figures. Start and stop codons are shown in bold font and
underlined in the figures. However, while the PRO polypeptide
disclosed in the accompanying figures are shown to begin with
methionine residues designated herein as amino acid position 1 in
the figures, it is conceivable and possible that other methionine
residues located either upstream or downstream from the amino acid
position 1 in the figures may be employed as the starting amino
acid residue for the PRO polypeptides.
[0506] The PRO polypeptide "extracellular domain" or "ECD" refers
to a form of the PRO polypeptide which is essentially free of the
transmembrane and cytoplasmic domains. Ordinarily, a PRO
polypeptide ECD will have less than 1% of such transmembrane and/or
cytoplasmic domains and preferably, will have less than 0.5% of
such domains. It will be understood that any transmembrane domains
identified for the PRO polypeptides of the present invention are
identified pursuant to criteria routinely employed in the art for
identifying that type of hydrophobic domain. The exact boundaries
of a transmembrane domain may vary but most likely by no more than
about 5 amino acids at either end of the domain as initially
identified herein. Optionally, therefore, an extracellular domain
of a PRO polypeptide may contain from about 5 or fewer amino acids
on either side of the transmembrane domain/extracellular domain
boundary as identified in the Examples or specification and such
polypeptides, with or without the associated signal peptide, and
nucleic acid encoding them, are comtemplated by the present
invention.
[0507] The approximate location of the "signal peptides" of the
various PRO polypeptides disclosed herein are shown in the present
specification and/or the accompanying figures. It is noted,
however, that the C-terminal boundary of a signal peptide may vary,
but most likely by no more than about 5 amino acids on either side
of the signal peptide C-terminal boundary as initially identified
herein, wherein the C-terminal boundary of the signal peptide may
be identified pursuant to criteria routinely employed in the art
for identifying that type of amino acid sequence element (e.g.,
Nielsen et al., Prot. Eng., 10:1-6 (1997) and von Heinje et al.,
Nucl. Acids Res., 14:4683-4690 (1986)). Moreover, it is also
recognized that, in some cases, cleavage of a signal sequence from
a secreted polypeptide is not entirely uniform, resulting in more
than one secreted species. These mature polypeptides, where the
signal peptide is cleaved within no more than about 5 amino acids
on either side of the C-terminal boundary of the signal peptide as
identified herein, and the polynucleotides encoding them, are
contemplated by the present invention.
[0508] "PRO polypeptide variant" means an active PRO polypeptide as
defined above or below having at least about 80% amino acid
sequence identity with a full-length native sequence PRO
polypeptide sequence as disclosed herein, a PRO polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a PRO polypeptide, with or without the
signal peptide, as disclosed herein or any other fragment of a
full-length PRO polypeptide sequence as disclosed herein. Such PRO
polypeptide variants include, for instance, PRO polypeptides
wherein one or more amino acid residues are added, or deleted, at
the N- or C-terminus of the full-length native amino acid sequence.
Ordinarily, a PRO polypeptide variant will have at least about 80%,
81%, 82%, 83%, 84% 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97% or 98% amino acid sequence identity and
alternatively at least about 99% amino acid sequence identity to a
full-length native sequence PRO polypeptide sequence as disclosed
herein, a PRO polypeptide sequence lacking the signal peptide as
disclosed herein, an extracellular domain of a PRO polypeptide,
with or without the signal peptide, as disclosed herein or any
other specifically defined fragment of a full-length PRO
polypeptide sequence as disclosed herein. Ordinarily, PRO variant
polypeptides are at least about 10, 20, 30, 40, 50, 60, 70, 80, 90,
100, 150 or 200 amino acids in length and alternatively at least
about 300 amino acids in length, or more.
[0509] "Percent (%) amino acid sequence identity" with respect to
the PRO polypeptide sequences identified herein is defined as the
percentage of amino acid residues in a candidate sequence that are
identical with the amino acid residues in a PRO sequence, after
aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity, and not considering
any conservative substitutions as part of the sequence identity.
Alignment for purposes of determining percent amino acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign
(DNASTAR) software. Those skilled in the art can determine
appropriate parameters for measuring alignment, including any
algorithms needed to achieve maximal alignment over the full-length
of the sequences being compared. For purposes herein, however, %
amino acid sequence identity values are obtained as described below
by using the sequence comparison computer program ALIGN-2, wherein
the complete source code for the ALIGN-2 program is provided in
Table 1. The ALIGN-2 sequence comparison computer program was
authored by Genentech, Inc., and the source code shown in Table 1
has been filed with user documentation in the U.S. Copyright
Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No. TXU510087. The ALIGN-2 program is
publicly available through Genentech, Inc., South San Francisco,
Calif. or may be compiled from the source code provided in Table 1.
The ALIGN-2 program should be compiled for use on a UNIX operating
system, preferably digital UNIX V4.0D. All sequence comparison
parameters are set by the ALIGN-2 program and do not vary.
[0510] For purposes herein, the % amino acid sequence identity of a
given amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows:
100 times the fraction {fraction (X/Y)}
[0511] where X is the number of amino acid residues scored as
identical matches by the sequence alignment program ALIGN-2 in that
program's alignment of A and B, and where Y is the total number of
amino acid residues in B. It will be appreciated that where the
length of amino acid sequence A is not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will
not equal the % amino acid sequence identity of B to A. As examples
of % amino acid sequence identity calculations, Tables 2-3
demonstrate how to calculate the % amino acid sequence identity of
the amino acid sequence designated "Comparison Protein" to the
amino acid sequence designated "PRO".
[0512] Unless specifically stated otherwise, all % amino acid
sequence identity values used herein are obtained as described
above using the ALIGN-2 sequence comparison computer program.
However, % amino acid sequence identity may also be determined
using the sequence comparison program NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res., 25:3389-3402 (1997)). The NCBI-BLAST2 sequence
comparison program may be downloaded from
http://www.ncbi.nlm.nih.gov. or otherwise obtained from the
National Institute of Health, Bethesda, Md. NCBI-BLAST2 uses
several search parameters, wherein all of those search parameters
are set to default values including, for example, unmask=yes,
strand=all, expected occurrences=10, minimum low complexity
length=15/5, multi-pass e-value=0.01, constant for multi-pass=25,
dropoff for final gapped alignment=25 and scoring
matrix=BLOSUM62.
[0513] In situations where NCBI-BLAST2 is employed for amino acid
sequence comparisons, the % amino acid sequence identity of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows:
100 times the fraction {fraction (X/Y)}
[0514] where X is the number of amino acid residues scored as
identical matches by the sequence alignment program NCBI-BLAST2 in
that program's alignment of A and B, and where Y is the total
number of amino acid residues in B. It will be appreciated that
where the length of amino acid sequence A is not equal to the
length of amino acid sequence B, the % amino acid sequence identity
of A to B will not equal the % amino acid sequence identity of B to
A.
[0515] In addition, % amino acid sequence identity may also be
determined using the WU-BLAST-2 computer program (Altschul et al.,
Methods in Enzymology, 266:460-480 (1996)). Most of the WU-BLAST-2
search parameters are set to the default values. Those not set to
default values, i.e., the adjustable parameters, are set with the
following values: overlap span=1, overlap fraction=0.125, word
threshold (T)=11, and scoring matrix=BLOSUM62. For purposes herein,
a % amino acid sequence identity value is determined by dividing
(a) the number of matching identical amino acids residues between
the amino acid sequence of the PRO polypeptide of interest having a
sequence derived from the native PRO polypeptide and the comparison
amino acid sequence of interest (i.e., the sequence against which
the PRO polypeptide of interest is being compared which may be a
PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the
total number of amino acid residues of the PRO polypeptide of
interest. For example, in the statement "a polypeptide comprising
an amino acid sequence A which has or having at least 80% amino
acid sequence identity to the amino acid sequence B", the amino
acid sequence A is the comparison amino acid sequence of interest
and the amino acid sequence B is the amino acid sequence of the PRO
polypeptide of interest.
[0516] "PRO variant polynucleotide" or "PRO variant nucleic acid
sequence" means a nucleic acid molecule which encodes an active PRO
polypeptide as defined below and which has at least about 80%
nucleic acid sequence identity with a nucleotide acid sequence
encoding a full-length native sequence PRO polypeptide sequence as
disclosed herein, a full-length native sequence PRO polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a PRO polypeptide, with or without the
signal peptide, as disclosed herein or any other fragment of a
full-length PRO polypeptide sequence as disclosed herein.
Ordinarily, a PRO variant polynucleotide will have at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97% or 98% nucleic acid sequence identity and
alternatively at least about 99% nucleic acid sequence identity
with a nucleic acid sequence encoding a full-length native sequence
PRO polypeptide sequence as disclosed herein, a full-length native
sequence PRO polypeptide sequence lacking the signal peptide as
disclosed herein, an extracellular domain of a PRO polypeptide,
with or without the signal sequence, as disclosed herein or any
other fragment of a full-length PRO polypeptide sequence as
disclosed herein. Variants do not encompass the native nucleotide
sequence.
[0517] Ordinarily, PRO variant polynucleotides are at least about
30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 450, or 600
nucleotides in length and alternatively at least about 900
nucleotides in length, or more.
[0518] "Percent (%) nucleic acid sequence identity" with respect to
the PRO polypeptide-encoding nucleic acid sequences identified
herein is defined as the percentage of nucleotides in a candidate
sequence that are identical with the nucleotides in a PRO
polypeptide-encoding nucleic acid sequence, after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity. Alignment for purposes of
determining percent nucleic acid sequence identity can be achieved
in various ways that are within the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2,
ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Those skilled in the
art can determine appropriate parameters for measuring alignment,
including any algorithms needed to achieve maximal alignment over
the full-length of the sequences being compared. For purposes
herein, however, % nucleic acid sequence identity values are
obtained as described below by using the sequence comparison
computer program ALIGN-2, wherein the complete source code for the
ALIGN-2 program is provided in Table 1. The ALIGN-2 sequence
comparison computer program was authored by Genentech, Inc., and
the source code shown in Table 1 has been filed with user
documentation in the U.S. Copyright Office, Washington D.C., 20559,
where it is registered under U.S. Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through
Genentech, Inc., South San Francisco, Calif. or may be compiled
from the source code provided in Table 1. The ALIGN-2 program
should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.0D. All sequence comparison parameters are set by
the ALIGN-2 program and do not vary.
[0519] For purposes herein, the % nucleic acid sequence identity of
a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can alternatively be phrased as a
given nucleic acid sequence C that has or comprises a certain %
nucleic acid sequence identity to, with, or against a given nucleic
acid sequence D) is calculated as follows:
100 times the fraction {fraction (W/Z)}
[0520] where W is the number of nucleotides scored as identical
matches by the sequence alignment program ALIGN-2 in that program's
alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated that where the length of
nucleic acid sequence C is not equal to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not
equal the % nucleic acid sequence identity of D to C. As examples
of % nucleic acid sequence identity calculations, Tables 4-5
demonstrate how to calculate the % nucleic acid sequence identity
of the nucleic acid sequence designated "Comparison DNA" to the
nucleic acid sequence designated "PRO-DNA".
[0521] Unless specifically stated otherwise, all % nucleic acid
sequence identity values used herein are obtained as described
above using the ALIGN-2 sequence comparison computer program.
However, % nucleic acid sequence identity may also be determined
using the sequence comparison program NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res., 25:3389-3402 (1997)). The NCBI-BLAST2 sequence
comparison program may be downloaded from
http://www.ncbi.nlm.nih.gov. or otherwise obtained from the
National Institute of Health, Bethesda, Md. NCBI-BLAST2 uses
several search parameters, wherein all of those search parameters
are set to default values including, for example, unmask=yes,
strand=all, expected occurrences=10, minimum low complexity
length=15/5, multi-pass e-value=0.01, constant for multi-pass=25,
dropoff for final gapped alignment=25 and scoring
matrix=BLOSUM62.
[0522] In situations where NCBI-BLAST2 is employed for sequence
comparisons, the % nucleic acid sequence identity of a given
nucleic acid sequence C to, with, or against a given nucleic acid
sequence D (which can alternatively be phrased as a given nucleic
acid sequence C that has or comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid
sequence D) is calculated as follows:
100 times the fraction {fraction (W/Z)}
[0523] where W is the number of nucleotides scored as identical
matches by the sequence alignment program NCBI-BLAST2 in that
program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated that where the length of
nucleic acid sequence C is not equal to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not
equal the % nucleic acid sequence identity of D to C.
[0524] In addition, % nucleic acid sequence identity values may
also be generated using the WU-BLAST-2 computer program (Altschul
et al., Methods in Enzymology, 266:460-480 (1996)). Most of the
WU-BLAST-2 search parameters are set to the default values. Those
not set to default values, i.e., the adjustable parameters, are set
with the following values: overlap span=1, overlap fraction=0.125,
word threshold (T)=11, and scoring matrix=BLOSUM62. For purposes
herein, a % nucleic acid sequence identity value is determined by
dividing (a) the number of matching identical nucleotides between
the nucleic acid sequence of the PRO polypeptide-encoding nucleic
acid molecule of interest having a sequence derived from the native
sequence PRO polypeptide-encoding nucleic acid and the comparison
nucleic acid molecule of interest (i.e., the sequence against which
the PRO polypeptide-encoding nucleic acid molecule of interest is
being compared which may be a variant PRO polynucleotide) as
determined by WU-BLAST-2 by (b) the total number of nucleotides of
the PRO polypeptide-encoding nucleic acid molecule of interest. For
example, in the statement "an isolated nucleic acid molecule
comprising a nucleic acid sequence A which has or having at least
80% nucleic acid sequence identity to the nucleic acid sequence B",
the nucleic acid sequence A is the comparison nucleic acid molecule
of interest and the nucleic acid sequence B is the nucleic acid
sequence of the PRO polypeptide-encoding nucleic acid molecule of
interest.
[0525] In other embodiments, PRO variant polynucleotides are
nucleic acid molecules that encode an active PRO polypeptide and
which are capable of hybridizing, preferably under stringent
hybridization and wash conditions, to nucleotide sequences encoding
the full-length PRO polypeptide as shown in the specification
herein and accompanying figures. PRO variant polypeptides may be
those that are encoded by a PRO variant polynucleotide.
[0526] "Isolated", when used to describe the various polypeptides
disclosed herein, means a polypeptide that has been identified and
separated and/or recovered from a component of its natural
environment. Preferably, the isolated polypeptide is free of
association with all components with which it is naturally
associated. Contaminant components of its natural environment are
materials that would typically interfere with diagnostic or
therapeutic uses for the polypeptide, and may include enzymes,
hormones, and other proteinaceous or non-proteinaceous solutes. In
preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least 15 residues of N-terminal or
internal amino acid sequence by use of a spinning cup sequenator,
or (2) to homogeneity by SDS-PAGE under non-reducing or reducing
conditions using Coomassie blue or, preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one component of the PRO natural
environment will not be present. Ordinarily, however, isolated
polypeptide will be prepared by at least one purification step.
[0527] An "isolated" nucleic acid molecule encoding a PRO
polypeptide or an "isolated" nucleic acid molecule encoding an
anti-PRO antibody is a nucleic acid molecule that is identified and
separated from at least one contaminant nucleic acid molecule with
which it is ordinarily associated in the natural source of the
PRO-encoding nucleic acid or the natural source of the
anti-PRO-encoding nucleic acid. Preferably, the isolated nucleic
acid is free of association with all components with which it is
naturally associated. An isolated PRO-encoding nucleic acid
molecule or an isolated anti-PRO-encoding nucleic acid molecule is
other than in the form or setting in which it is found in nature.
Isolated nucleic acid molecules therefore are distinguished from
the PRO-encoding nucleic acid molecule or from the
anti-PRO-encoding nucleic acid molecule as it exists in natural
cells. However, an isolated nucleic acid molecule encoding a PRO
polypeptide or an isolated nucleic acid molecule encoding an
anti-PRO antibody includes PRO-nucleic acid molecules or
anti-PRO-nucleic acid molecules contained in cells that ordinarily
express PRO polypeptides or anti-PRO antibodies where, for example,
the nucleic acid molecule is in a chromosomal location different
from that of natural cells.
[0528] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize, for example, promoters,
polyadenylation signals, and enhancers.
[0529] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a PRO polypeptide if it is expressed as a
preprotein that participates in the secretion of the polypeptide; a
promoter or enhancer is operably linked to a coding sequence if it
affects the transcription of the sequence; or a ribosome binding
site is operably linked to a coding sequence if it is positioned so
as to facilitate translation. Generally, "operably linked" means
that the DNA sequences being linked are contiguous, and, in the
case of a secretory leader, contiguous and in the same reading
frame. However, enhancers do not have to be contiguous. Linking is
accomplished by ligation at convenient restriction sites. If such
sites do not exist, synthetic oligonucleotide adaptors or linkers
are used in accordance with conventional practice.
[0530] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature that can
be used. As a result, it follows that higher relative temperatures
would tend to make the reaction conditions more stringent, while
lower temperatures less so. For additional details and explanation
of stringency of hybridization reactions, see, Ausubel et al.,
Current Protocols in Molecular Biology (Wiley Interscience
Publishers, 1995).
[0531] "Stringent conditions" or "high-stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example, 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42.degree. C.; or
(3) employ 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium
citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm
DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree.
C., with washes at 42.degree. C. in 0.2.times.SSC (sodium
chloride/sodium citrate) and 50% formamide at 55.degree. C.,
followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0532] "Moderately-stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual (New York: Cold Spring Harbor Press, 1989), and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength, and % SDS) less stringent than those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0533] The modifier "epitope-tagged" when used herein refers to a
chimeric polypeptide comprising a PRO polypeptide fused to a "tag
polypeptide". The tag polypeptide has enough residues to provide an
epitope against which an antibody can be made, yet is short enough
such that it does not interfere with activity of the polypeptide to
which it is fused. The tag polypeptide preferably also is fairly
unique so that the antibody does not substantially cross-react with
other epitopes. Suitable tag polypeptides generally have at least
six amino acid residues and usually between about 8 and 50 amino
acid residues (preferably, between about 10 and 20 amino acid
residues).
[0534] "Active" or "activity" in the context of PRO variants refers
to form(s) of PRO proteins that retain the biologic and/or
immunologic activities of a native or naturally-occurring PRO
polypeptide.
[0535] "Biological activity" in the context of a molecule that
antagonizes a PRO polypeptide that can be identified by the
screening assays disclosed herein (e.g., an organic or inorganic
small molecule, peptide, etc.) is used to refer to the ability of
such molecules to bind or complex with the PRO polypeptide
identified herein, or otherwise interfere with the interaction of
the PRO polypeptide with other cellular proteins or otherwise
inhibits the transcription or translation of the PRO polypeptide.
Particularly preferred biological activity includes cardiac
hypertrophy, activity that acts on systemic disorders that affect
vessels, such as diabetes mellitus, as well as diseases of the
arteries, capillaries, veins, and/or lymphatics, and cancer.
[0536] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes one or more of the biological activities of a native
PRO polypeptide disclosed herein, for example, if applicable, its
mitogenic or angiogenic activity. Antagonists of a PRO polypeptide
may act by interfering with the binding of a PRO polypeptide to a
cellular receptor, by incapacitating or killing cells that have
been activated by a PRO polypeptide, or by interfering with
vascular endothelial cell activation after binding of a PRO
polypeptide to a cellular receptor. All such points of intervention
by a PRO polypeptide antagonist shall be considered equivalent for
purposes of this invention. The antagonists inhibit the mitogenic,
angiogenic, or other biological activity of PRO polypeptides, and
thus are useful for the treatment of diseases or disorders
characterized by undesirable excessive neovascularization,
including by way of example tumors, and especially solid malignant
tumors, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic
and other retinopathies, retrolental fibroplasia, age-related
macular degeneration, neovascular glaucoma, hemangiomas, thyroid
hyperplasias (including Grave's disease), corneal and other tissue
transplantation, and chronic inflammation. The antagonists also are
useful for the treatment of diseases or disorders characterized by
undesirable excessive vascular permeability, such as edema
associated with brain tumors, ascites associated with malignancies,
Meigs' syndrome, lung inflammation, nephrotic syndrome, pericardial
effusion (such as that associated with pericarditis), and pleural
effusion. In a similar manner, the term "agonist" is used in the
broadest sense and includes any molecule that mimics a biological
activity of a native PRO polypeptide disclosed herein. Suitable
agonist or antagonist molecules specifically include agonist or
antagonist antibodies or antibody fragments, fragments, or amino
acid sequence variants of native PRO polypeptides, peptides, small
organic molecules, etc.
[0537] A "small molecule" is defined herein to have a molecular
weight below about 500 daltons.
[0538] The term "PRO polypeptide receptor" as used herein refers to
a cellular receptor for a PRO polypeptide, ordinarily a
cell-surface receptor found on vascular endothelial cells, as well
as variants thereof that retain the ability to bind a PRO
polypeptide.
[0539] "Antibodies" (Abs) and "immunoglobulins" (Igs) are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules that lack antigen specificity. Polypeptides of the latter
kind are, for example, produced at low levels by the lymph system
and at increased levels by myelomas. The term "antibody" is used in
the broadest sense and specifically covers, without limitation,
intact monoclonal antibodies, polyclonal antibodies, multispecific
antibodies (e.g., bispecific antibodies) formed from at least two
intact antibodies, and antibody fragments, so long as they exhibit
the desired biological activity.
[0540] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain
(V.sub.H) followed by a number of constant domains. Each light
chain has a variable domain at one end (V.sub.L) and a constant
domain at its other end; the constant domain of the light chain is
aligned with the first constant domain of the heavy chain, and the
light-chain variable domain is aligned with the variable domain of
the heavy chain. Particular amino acid residues are believed to
form an interface between the light- and heavy-chain variable
domains.
[0541] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody to and for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity-determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework regions (FR). The variable domains of native heavy and
light chains each comprise four FR regions, largely adopting a
.beta.-sheet configuration, connected by three CDRs, which form
loops connecting, and in some cases forming part of, the 62 -sheet
structure. The CDRs in each chain are held together in close
proximity by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies. See, Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages
647-669 (1991). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector
functions, such as participation of the antibody in
antibody-dependent cellular toxicity.
[0542] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen-binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng., 8(10): 1057-1062 (1995));
single-chain antibody molecules; and multispecific antibodies
formed from antibody fragments.
[0543] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize readily. Pepsin treatment
yields an F(ab').sub.2 fragment that has two antigen-combining
sites and is still capable of cross-linking antigen.
[0544] "Fv" is the minimum antibody fragment that contains a
complete antigen-recognition and -binding site.
[0545] This region consists of a dimer of one heavy- and one
light-chain variable domain in tight, non-covalent association. It
is in this configuration that the three CDRs of each variable
domain interact to define an antigen-binding site on the surface of
the V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody.
[0546] However, even a single variable domain (or half of an Fv
comprising only three CDRs specific for an antigen) has the ability
to recognize and bind antigen, although at a lower affinity than
the entire binding site.
[0547] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab' fragments differ from Fab fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments that have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0548] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa (.kappa.) and lambda (.lambda.), based on the
amino acid sequences of their constant domains.
[0549] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG, and IgM; and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called .alpha., .delta., .epsilon.,
.gamma., and .mu., respectively. The subunit structures and
three-dimensional configurations of different classes of
immunoglobulins are well known.
[0550] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally-occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations that typically include different
antibodies directed against different determinants (epitopes), each
monoclonal antibody is directed against a single determinant on the
antigen. In addition to their specificity, the monoclonal
antibodies are advantageous in that they are synthesized by the
hybridoma culture, uncontaminated by other immunoglobulins. The
modifier "monoclonal" indicates the character of the antibody as
being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example,. the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature, 256: 495 (1975), or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in Clackson et al., Nature, 352:
[0551] 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597
(1991), for example.
[0552] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity. U.S. Pat. No. 4,816,567; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984).
[0553] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains, or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) that contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a CDR of the recipient are replaced by
residues from a CDR of a non-human species (donor antibody) such as
mouse, rat or rabbit having the desired specificity, affinity, and
capacity. In some instances, Fv FR residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Furthermore, humanized antibodies may comprise residues that are
found neither in the recipient antibody nor in the imported CDR or
framework sequences. These modifications are made to further refine
and maximize antibody performance. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin sequence. The humanized antibody
preferably also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al, Nature, 321:
522-525 (1986); Reichmann et al., Nature, 332: 323-329 (1988); and
Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992). The humanized
antibody includes a PRIMATIZED.TM. antibody wherein the
antigen-binding region of the antibody is derived from an antibody
produced by immunizing macaque monkeys with the antigen of
interest.
[0554] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of an antibody, wherein these domains
are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains that enables the sFv to form the
desired structure for antigen binding. For a review of sFv see,
Pluckthun in The Pharmacology of Monoclonal Antibodies, Vol. 113,
Rosenburg and Moore, eds. (Springer-Verlag: New York, 1994), pp.
269-315.
[0555] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993).
[0556] An "isolated" antibody is one that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nonreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells, since at
least one component of the antibody's natural environment will not
be present. Ordinarily, however, isolated antibody will be prepared
by at least one purification step.
[0557] An antibody that "specifically binds to" or is "specific
for" a particular polypeptide or an epitope on a particular
polypeptide is one that binds to that particular polypeptide or
epitope on a particular polypeptide without substantially binding
to any other polypeptide or polypeptide epitope.
[0558] The word "label" when used herein refers to a detectable
compound or other composition that is conjugated directly or
indirectly to the antibody so as to generate a "labeled" antibody.
The label may be detectable by itself (e.g., radioisotope labels or
fluorescent labels) or, in the case of an enzymatic label, may
catalyze chemical alteration of a substrate compound or composition
that is detectable. Radionuclides that can serve as detectable
labels include, for example, I-131, I-123, I-125, Y-90, Re-188,
At-211, Cu-67, Bi-212, and Pd-109. The label may also be a
non-detectable entity such as a toxin.
[0559] By "solid phase" is meant a non-aqueous matrix to which an
antibody of the present invention can adhere.
[0560] Examples of solid phases encompassed herein include those
formed partially or entirely of glass (e.g., controlled pore
glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and silicones. In certain
embodiments, depending on the context, the solid phase can comprise
the well of an assay plate; in others it is a purification column
(e.g., an affinity chromatography column). This term also includes
a discontinuous solid phase of discrete particles, such as those
described in U.S. Pat. No. 4,275,149.
[0561] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant that is useful for delivery
of a drug (such as the PRO polypeptide or antibodies thereto
disclosed herein) to a mammal. The components of the liposome are
commonly arranged in a bilayer formation, similar to the lipid
arrangement of biological membranes.
[0562] As used herein, the term "immunoadhesin" designates
antibody-like molecules that combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity that is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD, or IgM.
[0563] As shown below, Table 1 provides the complete source code
for the ALIGN-2 sequence comparison computer program. This source
code may be routinely compiled for use on a UNIX operating system
to provide the ALIGN-2 sequence comparison computer program.
[0564] In addition, Tables 2-5 show hypothetical exemplifications
for using the below described method to determine % amino acid
sequence identity (Tables 2-3) and % nucleic acid sequence identity
(Tables 4-5) using the ALIGN-2 sequence comparison computer
program, wherein "PRO" represents the amino acid sequence of a
hypothetical PRO polypeptide of interest, "Comparison Protein"
represents the amino acid sequence of a polypeptide against which
the "PRO" polypeptide of interest is being compared, "PRO-DNA"
represents a hypothetical PRO-encoding nucleic acid sequence of
interest, "Comparison DNA" represents the nucleotide sequence of a
nucleic acid molecule against which the "PRO-DNA" nucleic acid
molecule of interest is being compared, "X", "Y", and "Z" each
represent different hypothetical amino acid residues and "N", "L"
and "V" each represent different hypothetical nucleotides.
1TABLE 2 PRO XXXXXXXXXXXXXXX (Length = 15 amino acids) Comparison
XXXXXYYYYYYY (Length = 12 amino acids) Protein % amino acid
sequence identity = (the number of identically matching amino acid
residues between the two polypeptide sequences as determined by
ALIGN-2) divided by (the total number of amino acid residues of the
PRO polypeptide) = 5 divided by 15 = 33.3%
[0565]
2TABLE 3 PRO XXXXXXXXXX (Length = 10 amino acids) Comparison
XXXXXYYYYYYZZYZ (Length = 15 amino acids) Protein % amino acid
sequence identity = (the number of identically matching amino acid
residues between the two polypeptide sequences as determined by
ALIGN-2) divided by (the total number of amino acid residues of the
PRO polypeptide) = 5 divided by 10 = 50%
[0566]
3TABLE 4 PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison NNNNNNLLLLLLLLLL (Length = 16 nucleotides) DNA % nucleic
acid sequence identity = (the number of identically matching
nucleotides between the two nucleic acid sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA
nucleic acid sequence) = 6 divided by 14 = 42.9%
[0567]
4TABLE 5 PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides) Comparison
DNA NNNNLLLVV (Length = 9 nucleotides) % nucleic acid sequence
identity = (the number of identically matching nucleotides between
the two nucleic acid sequences as determined by ALIGN-2) divided by
(the total number of nucleotides of the PRO-DNA nucleic acid
sequence) = 4 divided by 12 = 33.3%
5.2. Compositions and Methods of the Invention
[0568] 5.2.1. PRO Variants
[0569] In addition to the full-length native sequence PRO
polypeptides described herein, it is contemplated that PRO variants
can be prepared. PRO variants can be prepared by introducing
appropriate nucleotide changes into the PRO DNA, and/or by
synthesis of the desired PRO polypeptide. Those skilled in the art
will appreciate that amino acid changes may alter
post-translational processes of the PRO polypeptide such as
changing the number or position of glycosylation sites or altering
the membrane anchoring characteristics.
[0570] Variations in the native full-length sequence PRO
polypeptide or in various domains of the PRO polypeptide described
herein, can be made, for example, using any of the techniques and
guidelines for conservative and non-conservative mutations set
forth, for instance, in U.S. Pat. No. 5,364,934. Variations may be
a substitution, deletion or insertion of one or more codons
encoding the PRO polypeptide that results in a change in the amino
acid sequence of the PRO polypeptide as compared with the native
sequence PRO polypeptide. Optionally the variation is by
substitution of at least one amino acid with any other amino acid
in one or more of the domains of the PRO polypeptide. Guidance in
determining which amino acid residue may be inserted, substituted
or deleted without adversely affecting the desired activity may be
found by comparing the sequence of the PRO polypeptide with that of
homologous known protein molecules and minimizing the number of
amino acid sequence changes made in regions of high homology. Amino
acid substitutions can be the result of replacing one amino acid
with another amino acid having similar structural and/or chemical
properties, such as the replacement of a leucine with a serine,
i.e., conservative amino acid replacements. Insertions or deletions
may optionally be in the range of about 1 to 5 amino acids. The
variation allowed may be determined by systematically making
insertions, deletions or substitutions of amino acids in the
sequence and testing the resulting variants for activity exhibited
by the full-length or mature native sequence.
[0571] In particular embodiments, conservative substitutions of
interest are shown in Table 6 under the heading of preferred
substitutions. If such substitutions result in a change in
biological activity, then more substantial changes, denominated
exemplary substitutions in Table 6, or as further described below
in reference to amino acid classes, are introduced and the products
screened.
5 TABLE 6 Original Exemplary Preferred Residue Substitutions
Substitutions Ala (A) val; leu; ile val Arg (R) lys; gln; asn lys
Asn (N) gln; his; lys; arg gln Asp (D) glu glu Cys (C) ser ser Gln
(Q) asn asn Glu (E) asp asp Gly (G) pro; ala ala His (H) asn; gln;
lys; arg arg Ile (I) leu; val; met; ala; phe; leu norleucine Leu
(L) norleucine; ile; val; ile met; ala; phe Lys (K) arg; gln; asn
arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr; phe
tyr Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu; met; phe; leu
ala; norleucine
[0572] Substantial modifications in function or immunological
identity of the PRO polypeptide are accomplished by selecting
substitutions that differ significantly in their effect on
maintaining (a) the structure of the polypeptide backbone in the
area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or hydrophobicity of the molecule at
the target site, or (c) the bulk of the side chain. Naturally
occurring residues are divided into groups based on common
side-chain properties:
[0573] (1) hydrophobic: norleucine, met, ala, val, leu, ile;
[0574] (2) neutral hydrophilic: cys, ser, thr;
[0575] (3) acidic: asp, glu;
[0576] (4) basic: asn, gln, his, lys, arg;
[0577] (5) residues that influence chain orientation: gly, pro;
and
[0578] (6) aromatic: trp, tyr, phe.
[0579] Non-conservative substitutions will entail exchanging a
member of one of these classes for another class. Such substituted
residues also may be introduced into the conservative substitution
sites or, more preferably, into the remaining (non-conserved)
sites.
[0580] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al. Gene, 34:315 (1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the PRO variant DNA.
[0581] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence. Among
the preferred scanning amino acids are relatively small, neutral
amino acids. Such amino acids include alanine, glycine, serine, and
cysteine. Alanine is typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to alter the main-chain conformation
of the variant [Cunningham and Wells, Science, 244: 1081-1085
(1989)]. Alanine is also typically preferred because it is the most
common amino acid. Further, it is frequently found in both buried
and exposed positions [Creighton, The Proteins, (W. H. Freeman
& Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine
substitution does not yield adequate amounts of variant, an
isoteric amino acid can be used.
[0582] 5.2.2. Modifications of PRO Polypeptides
[0583] Covalent modifications of PRO polypeptides are included
within the scope of this invention. One type of covalent
modification includes reacting targeted amino acid residues of a
PRO polypeptide with an organic derivatizing agent that is capable
of reacting with selected side chains or the N- or C-terminal
residues of the PRO polypeptide. Derivatization with bifunctional
agents is useful, for instance, for crosslinking the PRO
polypeptide to a water-insoluble support matrix or surface for use
in the method for purifying anti-PRO antibodies, and vice-versa.
Commonly used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl)di- thio]propioimidate.
[0584] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W. H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0585] Another type of covalent modification of the PRO polypeptide
included within the scope of this invention comprises altering the
native glycosylation pattern of the polypeptide. "Altering the
native glycosylation pattern" is intended for purposes herein to
mean deleting one or more carbohydrate moieties found in the native
sequence PRO polypeptide (either by removing the underlying
glycosylation site or by deleting the glycosylation by chemical
and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the native sequence PRO polypeptide.
In addition, the phrase includes qualitative changes in the
glycosylation of the native proteins, involving a change in the
nature and proportions of the various carbohydrate moieties
present.
[0586] Addition of glycosylation sites to the PRO polypeptide may
be accomplished by altering the amino acid sequence. The alteration
may be made, for example, by the addition of, or substitution by,
one or more serine or threonine residues to the native sequence PRO
polypeptide (for O-linked glycosylation sites). The PRO amino acid
sequence may optionally be altered through changes at the DNA
level, particularly by mutating the DNA encoding the PRO
polypeptide at preselected bases such that codons are generated
that will translate into the desired amino acids.
[0587] Another means of increasing the number of carbohydrate
moieties on the PRO polypeptide is by chemical or enzymatic
coupling of glycosides to the polypeptide. Such methods are
described in the art, e.g., in WO 87/05330 published Sep. 11, 1987,
and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306
(1981).
[0588] Removal of carbohydrate moieties present on the PRO
polypeptide may be accomplished chemically or enzymatically or by
mutational substitution of codons encoding for amino acid residues
that serve as targets for glycosylation. Chemical deglycosylation
techniques are known in the art and described, for instance, by
Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by
Edge et al., Anal. Biochem., 118:131 (1981).
[0589] Enzymatic cleavage of carbohydrate moieties on polypeptides
can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.,
138:350 (1987).
[0590] Another type of covalent modification of the PRO polypeptide
comprises linking the PRO polypeptide to one of a variety of
nonproteinaceous polymers, e.g., polyethylene glycol (PEG),
polypropylene glycol, or polyoxyalkylenes, in the manner set forth
in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
[0591] The PRO polypeptide of the present invention may also be
modified in a way to form a chimeric molecule comprising the PRO
polypeptide fused to another, heterologous polypeptide or amino
acid sequence.
[0592] In one embodiment, such a chimeric molecule comprises a
fusion of the PRO polypeptide with a protein transduction domain
which targets the PRO polypeptide for delivery to various tissues
and more particularly across the brain blood barrier, using, for
example, the protein transduction domain of human immunodeficiency
virus TAT protein (Schwarze et al., 1999, Science 285:
1569-72).
[0593] In another embodiment, such a chimeric molecule comprises a
fusion of the PRO polypeptide with a tag polypeptide which provides
an epitope to which an anti-tag antibody can selectively bind. The
epitope tag is generally placed at the amino- or carboxyl-terminus
of the PRO polypeptide. The presence of such epitope-tagged forms
of the PRO polypeptide can be detected using an antibody against
the tag polypeptide. Also, provision of the epitope tag enables the
PRO polypeptide to be readily purified by affinity purification
using an anti-tag antibody or another type of affinity matrix that
binds to the epitope tag. Various tag polypeptides and their
respective antibodies are well known in the art. Examples include
poly-histidine (poly-His) or poly-histidine-glycine (poly-His-gly)
tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et
al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the
8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al.,
Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes
Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et
al., Protein Engineering, 3(6):547-553 (1990)]. Other tag
polypeptides include the Flag-peptide [Hopp et al., BioTechnology,
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science, 255:192-194 (1992)]; an .alpha.-tubulin epitope peptide
[Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and the
T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl.
Acad. Sci. USA, 87:6393-6397 (1990)].
[0594] In an alternative embodiment, the chimeric molecule may
comprise a fusion of the PRO polypeptide with an immunoglobulin or
a particular region of an immunoglobulin. For a bivalent form of
the chimeric molecule (also referred to as an"immunoadhesin"), such
a fusion could be to the Fc region of an IgG molecule. The Ig
fusions preferably include the substitution of a soluble
(transmembrane domain deleted or inactivated) form of a PRO
polypeptide in place of at least one variable region within an Ig
molecule. In a particularly preferred embodiment, the
immunoglobulin fusion includes the hinge, CH2 and CH3, or the
hinge, CH1, CH2 and CH3 regions of an IgG1 molecule. For the
production of immunoglobulin fusions see also, U.S. Pat. No.
5,428,130 issued Jun. 27, 1995.
[0595] 5.2.3. Preparation of the PRO Polypeptide
[0596] The present invention provides newly identified and isolated
nucleotide sequences encoding polypeptides referred to in the
present application as PRO polypeptides. In particular, cDNAs
encoding PRO polypeptides have been identified and isolated, as
disclosed in further detail in the Examples below. It is noted that
proteins produced in separate expression rounds may be given
different PRO numbers but the UNQ number is unique for any given
DNA and the encoded protein, and will not be changed. However, for
sake of simplicity, in the present specification the protein
encoded by the PRO DNA as well as all further native homologues and
variants included in the foregoing definition of PRO polypeptides,
will be referred to as"PRO" regardless of their origin or mode of
preparation.
[0597] The description below relates primarily to production of PRO
polypeptides by culturing cells transformed or transfected with a
vector containing nucleic acid encoding PRO polypeptides. It is, of
course, contemplated that alternative methods that are well known
in the art may be employed to prepare the PRO polypeptide. For
instance, the PRO polypeptide sequence, or portions thereof, may be
produced by direct peptide synthesis using solid-phase techniques.
See, e.g., Stewart et al., Solid-Phase Peptide Synthesis (W. H.
Freeman Co.: San Francisco, Calif., 1969); Merrifield, J. Am. Chem.
Soc., 85: 2149-2154 (1963). In vitro protein synthesis may be
performed using manual techniques or by automation. Automated
synthesis maybe accomplished, for instance, with an Applied
Biosystems Peptide Synthesizer (Foster City, Calif.) using
manufacturer's instructions. Various portions of the PRO
polypeptide may be chemically synthesized separately and combined
using chemical or enzymatic methods to produce the full-length PRO
polypeptide.
[0598] 5.2.3.1. Isolation of DNA Encoding PRO Polypeptides
[0599] DNA encoding the PRO polypeptide may be obtained from a cDNA
library prepared from tissue believed to possess the mRNA encoding
the PRO polypeptide and to express it at a detectable level.
Accordingly, DNAs encoding the human PRO polypeptide can be
conveniently obtained from cDNA libraries prepared from human
tissues, such as described in the Examples. The gene encoding the
PRO polypeptide may also be obtained from a genomic library or by
oligonucleotide synthesis.
[0600] Libraries can be screened with probes (such as antibodies to
the PRO polypeptide or oligonucleotides of at least about 20-80
bases) designed to identify the gene of interest or the protein
encoded by it. Screening the cDNA or genomic library with the
selected probe may be conducted using standard procedures, such as
described in Sambrook et al., supra. An alternative means to
isolate the gene encoding the PRO polypeptide is to use PCR
methodology. Sambrook et al., supra; Dieffenbach et al., PCR
Primer: A Laboratory Manual (New York: Cold Spring Harbor
Laboratory Press, 1995).
[0601] The Examples below describe techniques for screening a cDNA
library. The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation, or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0602] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined through sequence
alignment using computer software programs such as ALIGN, DNAstar,
and INHERIT, which employ various algorithms to measure
homology.
[0603] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0604] 5.2.3.2. Selection and Transformation of Host Cells
[0605] Host cells are transfected or transformed with expression or
cloning vectors described herein for PRO polypeptide production and
cultured in conventional nutrient media modified as appropriate for
inducing promoters, selecting transformants, or amplifying the
genes encoding the desired sequences. The culture conditions, such
as media, temperature, pH, and the like, can be selected by the
skilled artisan without undue experimentation. In general,
principles, protocols, and practical techniques for maximizing the
productivity of cell cultures can be found in Mammalian Cell
Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press,
1991) and Sambrook et al., supra.
[0606] Methods of transfection are known to the ordinarily skilled
artisan, for example, CaPO.sub.4 treatment and electroporation.
Depending on the host cell used, transformation is performed using
standard techniques appropriate to such cells. The calcium
treatment employing calcium chloride, as described in Sambrook et
al., supra, or electroporation is generally used for prokaryotes or
other cells that contain substantial cell-wall barriers. Infection
with Agrobacterium tumefaciens is used for transformation of
certain plant cells, as described by Shaw et al , Gene, 23: 315
(1983) and WO 89/05859 published Jun. 29, 1989. For mammalian cells
without such cell walls, the calcium phosphate precipitation method
of Graham and van der Eb, Virology, 52:456-457 (1978) can be
employed. General aspects of mammalian cell host system
transformations have been described in U.S. Pat. No. 4,399,216.
Transformations into yeast are typically carried out according to
the method of Van Solingen et al., J. Bact., 130: 946 (1977) and
Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76: 3829 (1979).
However, other methods for introducing DNA into cells, such as by
nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells, or polycations, e.g., polybrene or
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see, Keown et al., Methods in
Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336:
348-352 (1988).
[0607] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include, but are not limited to,
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325); and K5772 (ATCC 53,635). Other suitable prokaryotic
host cells include Enterobacteriaceae such as Escherichia, e.g., E.
coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B
licheniformis(e.g., B. licheniformis 41P disclosed in DD 266,710
published Apr. 12, 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. These examples are illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host
because it is a common host strain for recombinant DNA product
fermentations. Preferably, the host cell secretes minimal amounts
of proteolytic enzymes. For example, strain W3110 may be modified
to effect a genetic mutation in the genes encoding proteins
endogenous to the host, with examples of such hosts including E.
coli W3110 strain 1A2, which has the complete genotype tonA; E.
coli W3110 strain 9E4, which has the complete genotype tonA ptr3;
E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete
genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT kan.sup.r; E.
coli W3110 strain 37D6, which has the complete genotype tonA ptr3
phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kan.sup.r; E. coli W3110
strain40B4, which is strain 37D6 with a non-kanamycin resistant
degP deletion mutation; and an E. coli strain having mutant
periplasmic protease disclosed in U.S. Pat. No. 4,946,783 issued
Aug. 7, 1990. Alternatively, in vitro methods of cloning, e.g., PCR
or other nucleic acid polymerase reactions, are suitable.
[0608] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for vectors encoding the PRO polypeptide. Saccharomyces cerevisiae
is a commonly used lower eukaryotic host microorganism. Others
include Schizosaccharomyces pombe (Beach and Nurse, Nature, 290:
140 [1981]; EP 139,383 published May 2, 1985); Kluyveromyces hosts
(U.S. Pat. No. 4,943,529; Fleer et al., Bio/Technology, 9: 968-975
(1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574;
Louvencourt et al., J. Bacteriol., 737 [1983]), K. fragilis (ATCC
12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178),
K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den
Berg et al., Bio/Technology, 8: 135 (1990)), K. thermotolerans, and
K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070;
Sreekrishna et al., J. Basic Microbiol., 28: 265-278 [1988]);
Candida; Trichoderma reesia (EP 244,234); Neurospora crassa (Case
et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]);
Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538
published Oct. 31, 1990); and filamentous fungi such as, e.g.,
Neurospora, Penicillium, Tolypocladium (WO 91/00357 published Jan.
10, 1991), and Aspergillus hosts such as A. nidulans (Ballance et
al., Biochem. Biophys. Res. Commun., 112: 284-289 [1983]; Tilbumn
et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Acad.
Sci. USA, 81: 1470-1474 [1984]) and A. niger (Kelly and Hynes, EMBO
J., 4: 475-479 [1985]). Methylotropic yeasts are suitable herein
and include, but are not limited to, yeast capable of growth on
methanol selected from the genera consisting of Hansenula, Candida,
Kloeckera, Pichia, Saccharomyces,
[0609] Torulopsis, and Rhodotorula. A list of specific species that
are exemplary of this class of yeasts may be found in C. Anthony,
The Biochemistry of Methylotrophs, 269 (1982).
[0610] Suitable host cells for the expression of nucleic acid
encoding glycosylated PRO polypeptides are derived from
multicellular organisms. Examples of invertebrate cells include
insect cells such as Drosophila S2 and Spodoptera Sf9, as well as
plant cells. Examples of useful mammalian host cell lines include
Chinese hamster ovary (CHO) and COS cells. More specific examples
include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL
1651); human embryonic kidney line (293 or 293 cells subcloned for
growth in suspension culture, Graham et al., J. Gen. Virol., 36: 59
(1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin,
Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells
(TM4, Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells
(W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse
mammary tumor (MMT 060562, ATCC CCL51). The selection of the
appropriate host cell is deemed to be within the skill in the
art.
[0611] 5.2.3.3. Selection and Use of a Replicable Vector
[0612] The nucleic acid (e.g., cDNA or genomic DNA) encoding the
PRO polypeptide may be inserted into a replicable vector for
cloning (amplification of the DNA) or for expression. Various
vectors are publicly available. The vector may, for example, be in
the form of a plasmid, cosmid, viral particle, or phage. The
appropriate nucleic acid sequence may be inserted into the vector
by a variety of procedures. In general, DNA is inserted into an
appropriate restriction endonuclease site(s) using techniques known
in the art. Vector components generally include, but are not
limited to, one or more of a signal sequence if the sequence is to
be secreted, an origin of replication, one or more marker genes, an
enhancer element, a promoter, and a transcription termination
sequence. Construction of suitable vectors containing one or more
of these components employs standard ligation techniques that are
known to the skilled artisan.
[0613] The PRO polypeptide may be produced recombinantly not only
directly, but also as a fusion polypeptide with a heterologous
polypeptide, which may be a signal sequence or other polypeptide
having a specific cleavage site at the N-terminus of the mature
protein or polypeptide. In general, the signal sequence may be a
component of the vector, or it may be a part of the DNA encoding
the PRO polypeptide that is inserted into the vector. The signal
sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase, penicillinase,
lpp, or heat-stable enterotoxin II leaders. For yeast secretion the
signal sequence may be, e.g., the yeast invertase leader, alpha
factor leader (including Saccharomyces and Kluyveromyces
.alpha.-factor leaders, the latter described in U.S. Pat. No.
5,010,182), or acid phosphatase leader, the C. albicans
glucoamylase leader (EP 362,179 published Apr. 4, 1990), or the
signal described in WO 90/13646 published Nov. 15, 1990. In
mammalian cell expression, mammalian signal sequences may be used
to direct secretion of the protein, such as signal sequences from
secreted polypeptides of the same or related species, as well as
viral secretory leaders.
[0614] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the
2.mu. plasmid origin is suitable for yeast, and various viral
origins (SV40, polyoma, adenovirus, VSV, or BPV) are useful for
cloning vectors in mammalian cells.
[0615] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0616] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the nucleic acid encoding the PRO polypeptide such as
DHFR or thymidine kinase. An appropriate host cell when wild-type
DHFR is employed is the CHO cell line deficient in DHFR activity,
prepared and propagated as described by Urlaub et al., Proc. Natl.
Acad. Sci. USA, 77: 4216 (1980). A suitable selection gene for use
in yeast is the trp1 gene present in the yeast plasmid YRp7.
Stinchcomb et al., Nature, 282: 39 (1979); Kingsman et al., Gene,
7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980). The trp1
gene provides a selection marker for a mutant strain of yeast
lacking the ability to grow in tryptophan, for example, ATCC No.
44076 or PEP4-1. Jones, Genetics, 85: 12 (1977).
[0617] Expression and cloning vectors usually contain a promoter
operably linked to the nucleic acid sequence encoding the PRO
polypeptide to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are well known. Promoters suitable
for use with prokaryotic hosts include the .beta.-lactamase and
lactose promoter systems (Chang et al., Nature, 275: 615 (1978);
Goeddel et al., Nature, 281: 544 (1979)), alkaline phosphatase, a
tryptophan (trp) promoter system (Goeddel, Nucleic Acids Res., 8:
4057 (1980); EP 36,776), and hybrid promoters such as the tac
promoter (deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25
(1983)). Promoters for use in bacterial systems also will contain a
Shine-Dalgarno (S. D.) sequence operably linked to the DNA encoding
the PRO polypeptide.
[0618] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman
et al., J. Biol. Chem., 255: 2073 (1980)) or other glycolytic
enzymes (Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland,
Biochemistry, 17: 4900 (1978)), such as enolase,
glyceralde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0619] Other yeast promoters that are inducible promoters having
the additional advantage of transcription controlled by growth
conditions are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionem,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0620] PRO nucleic acid transcription from vectors in mammalian
host cells is controlled, for example, by promoters obtained from
the genomes of viruses such as polyoma virus, fowlpox virus (UK
2,211,504 published Jul. 5, 1989), adenovirus (such as Adenovirus
2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus, and Simian Virus 40 (SV40); by
heterologous mammalian promoters, e.g., the actin promoter or an
immunoglobulin promoter; and by heat-shock promoters, provided such
promoters are compatible with the host cell systems.
[0621] Transcription of a DNA encoding the PRO polypeptide by
higher eukaryotes may be increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300 bp, that act on a promoter to increase
its transcription. Many enhancer sequences are now known from
mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein,
and insulin). Typically, however, one will use an enhancer from a
eukaryotic cell virus. Examples include the SV40 enhancer on the
late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus enhancers.
The enhancer may be spliced into the vector at a position 5' or 3'
to the sequence coding for PRO polypeptides, but is preferably
located at a site 5' from the promoter.
[0622] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding the PRO
polypeptide.
[0623] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of the PRO polypeptide in recombinant
vertebrate cell culture are described in Gething et al., Nature,
293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP
117,060; and EP 117,058.
[0624] 5.2.3.4. Detecting Gene Amplification/Expression
[0625] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA (Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0626] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal. Conveniently, the antibodies may be prepared against
a native-sequence PRO polypeptide or against a synthetic peptide
based on the DNA sequences provided herein or against exogenous
sequence fused to DNA encoding the PRO polypeptide and encoding a
specific antibody epitope.
[0627] 5.2.3.5. Purification of PRO Polypeptides
[0628] Forms of PRO polypeptides may be recovered from culture
medium or from host cell lysates. If membrane-bound, it can be
released from the membrane using a suitable detergent solution
(e.g., TRITON-X.TM. 100) or by enzymatic cleavage. Cells employed
in expression of nucleic acid encoding the PRO polypeptide can be
disrupted by various physical or chemical means, such as
freeze-thaw cycling, sonication, mechanical disruption, or
cell-lysing agents. It may be desired to purify the PRO polypeptide
from recombinant cell proteins or polypeptides. The following
procedures are exemplary of suitable purification procedures: by
fractionation on an ion-exchange column; ethanolprecipitation;
reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE;
ammonium sulfate precipitation; gel filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal chelating columns to bind epitope-tagged
forms of the PRO polypeptide. Various methods of protein
purification may be employed and such methods are known in the art
and described, for example, in Deutscher, Methods in Enzymology,
182 (1990); Scopes, Protein Purification: Principles and Practice
(Springer-Verlag: New York, 1982). The purification step(s)
selected will depend, for example, on the nature of the production
process used and the particular PRO polypeptide produced.
[0629] 5.2.4. Uses of PRO Polypeptides
[0630] 5.2.4.1. Assays for Cardiovascular, Endothelial, and
Angiogenic Activity
[0631] Various assays can be used to test the polypeptide herein
for cardiovascular, endothelial, and angiogenic activity. Such
assays include those provided in the Examples below.
[0632] Assays for testing for endothelin antagonist activity, as
disclosed in U.S. Pat. No. 5,773,414, include a rat heart ventricle
binding assay where the polypeptide is tested for its ability to
inhibit iodinized endothelin-1 binding in a receptor assay, an
endothelin receptor binding assay testing for intact cell binding
of radiolabeled endothelin-1using rabbit renal artery vascular
smooth muscle cells, an inositol phosphate accumulation assay where
functional activity is determined in Rat-1 cells by measuring
intra-cellular levels of second messengers, an arachidonic acid
release assay that measures the ability of added compounds to
reduce endothelin-stimulated arachidonic acid release in cultured
vascular smooth muscles, in vitro (isolated vessel) studies using
endothelium from male New Zealand rabbits, and in vivo studies
using male Sprague-Dawley rats.
[0633] Assays for tissue generation activity include, without
limitation, those described in WO 95/16035 (bone, cartilage,
tendon); WO 95/05846 (nerve, neuronal), and WO 91/07491 (skin,
endothelium).
[0634] Assays for wound-healing activity include, for example,
those described in Winter, Epidermal Wound Healing, Maibach, H I
and Rovee, D T, eds. (Year Book Medical Publishers, Inc., Chicago),
pp. 71-112, as modified by the article of Eaglstein and Mertz, J.
Invest. Dermatol., 71: 382-384 (1978).
[0635] An assay to screen for a test molecule relating to a PRO
polypeptide that binds an endothelin B.sub.1 (ETB.sub.1) receptor
polypeptide and modulates signal transduction activity involves
providing a host cell transformed with a DNA encoding endothelin
B.sub.1 receptor polypeptide, exposing the cells to the test
candidate, and measuring endothelin B.sub.1 receptor signal
transduction activity, as described, e.g., in U.S. Pat. No.
5,773,223.
[0636] There are several cardiac hypertrophy assays. In vitro
assays include induction of spreading of adult rat cardiac
myocytes. In this assay, ventricular myocytes are isolated from a
single (male Sprague-Dawley) rat, essentially following a
modification of the procedure described in detail by Piper et al.,
"Adult ventricular rat heart muscle cells" in Cell Culture
Techniques in Heart and Vessel Research, H. M. Piper, ed. (Berlin:
Springer-Verlag, 1990), pp. 36-60. This procedure permits the
isolation of adult ventricular myocytes and the long-term culture
of these cells in the rod-shaped phenotype. Phenylephrine and
Prostaglandin F.sub.2.alpha. (PGF.sub.2.alpha.) have been shown to
induce a spreading response in these adult cells. The inhibition of
myocyte spreading induced by PGF.sub.2.alpha. or PGF.sub.2.alpha.
analogs (e g., fluprostenol) and phenylephrine by various potential
inhibitors of cardiac hypertrophy is then tested.
[0637] One example of an in vivo assay is a test for inhibiting
cardiac hypertrophy induced by fluprostenol in vivo.
[0638] This pharmacological model tests the ability of the PRO
polypeptide to inhibit cardiac hypertrophy induced in rats (e.g.,
male Wistar or Sprague-Dawley) by subcutaneous injection of
fluprostenol (an agonist analog of PGF.sub.2.alpha.). It is known
that rats with pathologic cardiac hypertrophy induced by myocardial
infarction have chronically elevated levels of extractable
PGF.sub.2.alpha. in their myocardium. Lai et al., Am. J. Physiol.
(Heart Circ. Physiol.), 271: H2197-H2208 (1996). Accordingly,
factors that can inhibit the effects of fluprostenol on myocardial
growth in vivo are potentially useful for treating cardiac
hypertrophy. The effects of the PRO polypeptide on cardiac
hypertrophy are determined by measuring the weight of heart,
ventricles, and left ventricle (normalized by body weight) relative
to fluprostenol-treated rats not receiving the PRO polypeptide.
[0639] Another example of an in vivo assay is the pressure-overload
cardiac hypertrophy assay. For in vivo testing it is common to
induce pressure-overload cardiac hypertrophy by constriction of the
abdominal aorta of test animals. In a typical protocol, rats (e.g.,
male Wistar or Sprague-Dawley) are treated under anesthesia, and
the abdominal aorta of each rat is narrowed down just below the
diaphragm. Beznak M., Can. J. Biochem. Physiol., 33: 985-94 (1955).
The aorta is exposed through a surgical incision, and a blunted
needle is placed next to the vessel. The aorta is constricted with
a ligature of silk thread around the needle, which is immediately
removed and which reduces the lumen of the aorta to the diameter of
the needle. This approach is described, for example, in Rossi et
al., Am. Heart J., 124: 700-709 (1992) and O'Rourke and Reibel,
P.S.E.M.B., 200: 95-100 (1992).
[0640] In yet another in vivo assay, the effect on cardiac
hypertrophy following experimentally induced myocardial infarction
(MI) is measured. Acute MI is induced in rats by left coronary
artery ligation and confirmed by electrocardiographic examination.
A sham-operated group of animals is also prepared as control
animals. Earlier data have shown that cardiac hypertrophy is
present in the group of animals with MI, as evidenced by an 18%
increase in heart weight-to-body weight ratio. Lai et al., supra.
Treatment of these animals with candidate blockers of cardiac
hypertrophy, e.g., the PRO polypeptide, provides valuable
information about the therapeutic potential of the candidates
tested. One further such assay test for induction of cardiac
hypertrophy is disclosed in U.S. Pat. No. 5,773,415, using
Sprague-Dawley rats.
[0641] For cancer, a variety of well-known animal models can be
used to further understand the role of the genes identified herein
in the development and pathogenesis of tumors, and to test the
efficacy of candidate therapeutic agents, including antibodies and
other antagonists of native PRO polypeptides, such as
small-molecule antagonists. The in vivo nature of such models makes
them particularly predictive of responses in human patients. Animal
models of tumors and cancers (e.g., breast cancer, colon cancer,
prostate cancer, lung cancer, etc.) include both non-recombinant
and recombinant (transgenic) animals. Non-recombinant animal models
include, for example, rodent, e.g., murine models. Such models can
be generated by introducing tumor cells into syngeneic mice using
standard techniques, e.g., subcutaneous injection, tail vein
injection, spleen implantation, intraperitoneal implantation,
implantation under the renal capsule, or orthopin implantation,
e.g., colon cancer cells implanted in colonic tissue. See, e.g.,
PCT publication No. WO 97/33551, published Sep. 18, 1997. Probably
the most often used animal species in oncological studies are
immunodeficient mice and, in particular, nude mice. The observation
that the nude mouse with thymic hypo/aplasia could successfully act
as a host for human tumor xenografts has lead to its widespread use
for this purpose. The autosomal recessive nu gene has been
introduced into a very large number of distinct congenic strains of
nude mouse, including, for example, ASW, A/He, AKR, BALB/c, B10.LP,
C17, C3H, C57BL, C57, CBA, DBA, DDD, I/st, NC, NFR, NFS, NFS/N,
NZB, NZC, NZW, P, RIII, and SJL. In addition, a wide variety of
other animals with inherited immunological defects other than the
nude mouse have been bred and used as recipients of tumor
xenografts. For further details see, e.g., The Nude Mouse in
Oncology Research, E. Boven and B. Winograd, eds. (CRC Press, Inc.,
1991).
[0642] The cells introduced into such animals can be derived from
known tumor/cancer cell lines, such as any of the above-listed
tumor cell lines, and, for example, the B104-1-1 cell line (stable
NIH-3T3 cell line transfected with the neu protooncogene);
ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); or a
moderately well-differentiated grade II human colon adenocarcinoma
cell line, HT-29 (ATCC HTB-38); or from tumors and cancers. Samples
of tumor or cancer cells can be obtained from patients undergoing
surgery, using standard conditions involving freezing and storing
in liquid nitrogen. Karmali et al., Br. J. Cancer, 48: 689-696
(1983).
[0643] Tumor cells can be introduced into animals such as nude mice
by a variety of procedures. The subcutaneous (s.c.) space in mice
is very suitable for tumor implantation. Tumors can be transplanted
s.c. as solid blocks, as needle biopsies by use of a trochar, or as
cell suspensions. For solid-block or trochar implantation, tumor
tissue fragments of suitable size are introduced into the s.c.
space. Cell suspensions are freshly prepared from primary tumors or
stable tumor cell lines, and injected subcutaneously. Tumor cells
can also be injected as subdermal implants. In this location, the
inoculum is deposited between the lower part of the dermal
connective tissue and the s.c. tissue.
[0644] Animal models of breast cancer can be generated, for
example, by implanting rat neuroblastoma cells (from which the neu
oncogene was initially isolated), or neu-transformed NIH-3T3 cells
into nude mice, essentially as described by Drebin et al. Proc.
Nat. Acad. Sci. USA, 83: 9129-9133 (1986).
[0645] Similarly, animal models of colon cancer can be generated by
passaging colon cancer cells in animals, e.g., nude mice, leading
to the appearance of tumors in these animals. An orthotopic
transplant model of human colon cancer in nude mice has been
described, for example, by Wang et al, Cancer Research, 54:
4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684
(1995). This model is based on the so-called"METAMOUSE.TM." sold by
AntiCancer, Inc., (San Diego, Calif.).
[0646] Tumors that arise in animals can be removed and cultured in
vitro. Cells from the in vitro cultures can then be passaged to
animals. Such tumors can serve as targets for further testing or
drug screening. Alternatively, the tumors resulting from the
passage can be isolated and RNA from pre-passage cells and cells
isolated after one or more rounds of passage analyzed for
differential expression of genes of interest. Such passaging
techniques can be performed with any known tumor or cancer cell
lines.
[0647] For example, Meth A, CMS4, CMS5, CMS21, and WEHI-164 are
chemically induced fibrosarcomas of BALB/c female mice (DeLeo et
al., J. Exp. Med., 146: 720 (1977)), which provide a highly
controllable model system for studying the anti-tumor activities of
various agents. Palladino et al., J. Immunol., 138: 4023-4032
(1987). Briefly, tumor cells are propagated in vitro in cell
culture. Prior to injection into the animals, the cell lines are
washed and suspended in buffer, at a cell density of about
10.times.10.sup.6 to 10.times.10.sup.7 cells/ml. The animals are
then infected subcutaneously with 10 to 100 .mu.l of the cell
suspension, allowing one to three weeks for a tumor to appear.
[0648] In addition, the Lewis lung (3LL) carcinoma of mice, which
is one of the most thoroughly studied experimental tumors, can be
used as an investigational tumor model. Efficacy in this tumor
model has been correlated with beneficial effects in the treatment
of human patients diagnosed with small-cell carcinoma of the lung
(SCCL). This tumor can be introduced in normal mice upon injection
of tumor fragments from an affected mouse or of cells maintained in
culture. Zupi et al., Br. J. Cancer, 41: suppl. 4, 30 (1980).
Evidence indicates that tumors can be started from injection of
even a single cell and that a very high proportion of infected
tumor cells survive. For further information about this tumor model
see, Zacharski, Haemostasis, 16: 300-320 (1986).
[0649] One way of evaluating the efficacy of a test compound in an
animal model with an implanted tumor is to measure the size of the
tumor before and after treatment. Traditionally, the size of
implanted tumors has been measured with a slide caliper in two or
three dimensions. The measure limited to two dimensions does not
accurately reflect the size of the tumor; therefore, it is usually
converted into the corresponding volume by using a mathematical
formula. However, the measurement of tumor size is very inaccurate.
The therapeutic effects of a drug candidate can be better described
as treatment-induced growth delay and specific growth delay.
Another important variable in the description of tumor growth is
the tumor volume doubling time. Computer programs for the
calculation and description of tumor growth are also available,
such as the program reported by Rygaard and Spang-Thomsen, Proc.
6th Int. Workshop on Immune-Deficient Animals, Wu and Sheng eds.
(Basel, 1989), p. 301. It is noted, however, that necrosis and
inflammatory responses following treatment may actually result in
an increase in tumor size, at least initially. Therefore, these
changes need to be carefully monitored, by a combination of a
morphometric method and flow cytometric analysis.
[0650] Further, recombinant (transgenic) animal models can be
engineered by introducing the coding portion of the PRO gene
identified herein into the genome of animals of interest, using
standard techniques for producing transgenic animals. Animals that
can serve as a target for transgenic manipulation include, without
limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs,
and non-human primates, e.g., baboons, chimpanzees and monkeys.
Techniques known in the art to introduce a transgene into such
animals include pronucleic microinjection (U.S. Pat. No.
4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82:
6148-615 (1985)); gene targeting in embryonic stem cells (Thompson
et al., Cell, 56: 313-321 (1989)); electroporation of embryos (Lo,
Mol. Cell. Biol., 3: 1803-1814 (1983)); and sperm-mediated gene
transfer. Lavitrano et al., Cell, 57: 717-73 (1989). For a review,
see for example, U.S. Pat. No. 4,736,866.
[0651] For the purpose of the present invention, transgenic animals
include those that carry the transgene only in part of their cells
("mosaic animals"). The transgene can be integrated either as a
single transgene, or in concatamers, e.g., head-to-head or
head-to-tail tandems. Selective introduction of a transgene into a
particular cell type is also possible by following, for example,
the technique of Lasko et al., Proc. Natl. Acad. Sci. USA, 89:
6232-636 (1992). The expression of the transgene in transgenic
animals can be monitored by standard techniques. For example,
Southern blot analysis or PCR amplification can be used to verify
the integration of the transgene. The level of mRNA expression can
then be analyzed using techniques such as in situ hybridization,
Northern blot analysis, PCR, or immunocytochemistry. The animals
are further examined for signs of tumor or cancer development.
[0652] Alternatively, "knock-out" animals can be constructed that
have a defective or altered gene encoding a PRO polypeptide
identified herein, as a result of homologous recombination between
the endogenous gene encoding the PRO polypeptide and altered
genomic DNA encoding the same polypeptide introduced into an
embryonic cell of the animal. For example, cDNA encoding a
particular PRO polypeptide can be used to clone genomic DNA
encoding that polypeptide in accordance with established
techniques. A portion of the genomic DNA encoding a particular PRO
polypeptide can be deleted or replaced with another gene, such as a
gene encoding a selectable marker that can be used to monitor
integration. Typically, several kilobases of unaltered flanking DNA
(both at the 5' and 3' ends) are included in the vector. See, e.g.,
Thomas and Capecchi, Cell, 51: 503 (1987) for a description of
homologous recombination vectors. The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced DNA has homologously recombined with the
endogenous DNA are selected. See, e.g., Li et al., Cell, 69: 915
(1992). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse or rat) to form aggregation chimeras. See,
e g , Bradley, in Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach, E. J. Robertson, ed. (IRL: Oxford, 1987), pp.
113-152. A chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal and the embryo brought to term
to create a "knock-out" animal. Progeny harboring the homologously
recombined DNA in their germ cells can be identified by standard
techniques and used to breed animals in which all cells of the
animal contain the homologously recombined DNA. Knockout animals
can be characterized, for instance, by their ability to defend
against certain pathological conditions and by their development of
pathological conditions due to absence of the PRO polypeptide.
[0653] The efficacy of antibodies specifically binding the PRO
polypeptides identified herein, and other drug candidates, can be
tested also in the treatment of spontaneous animal tumors. A
suitable target for such studies is the feline oral squamous cell
carcinoma (SCC). Feline oral SCC is a highly invasive, malignant
tumor that is the most common oral malignancy of cats, accounting
for over 60% of the oral tumors reported in this species. It rarely
metastasizes to distant sites, although this low incidence of
metastasis may merely be a reflection of the short survival times
for cats with this tumor. These tumors are usually not amenable to
surgery, primarily because of the anatomy of the feline oral
cavity. At present, there is no effective treatment for this tumor.
Prior to entry into the study, each cat undergoes complete clinical
examination and biopsy, and is scanned by computed tomography (CT).
Cats diagnosed with sublingual oral squamous cell tumors are
excluded from the study. The tongue can become paralyzed as a
result of such tumor, and even if the treatment kills the tumor,
the animals may not be able to feed themselves. Each cat is treated
repeatedly, over a longer period of time. Photographs of the tumors
will be taken daily during the treatment period, and at each
subsequent recheck. After treatment, each cat undergoes another CT
scan. CT scans and thoracic radiograms are evaluated every 8 weeks
thereafter. The data are evaluated for differences in survival,
response, and toxicity as compared to control groups. Positive
response may require evidence of tumor regression, preferably with
improvement of quality of life and/or increased life span.
[0654] In addition, other spontaneous animal tumors, such as
fibrosarcoma, adenocarcinoma, lymphoma, chondroma, or
leiomyosarcoma of dogs, cats, and baboons can also be tested. Of
these, mammary adenocarcinoma in dogs and cats is a preferred model
as its appearance and behavior are very similar to those in humans.
However, the use of this model is limited by the rare occurrence of
this type of tumor in animals.
[0655] Other in vitro and in vivo cardiovascular, endothelial, and
angiogenic tests known in the art are also suitable herein.
[0656] 5.2.4.2. Tissue Distribution
[0657] The results of the cardiovascular, endothelial, and
angiogenic assays herein can be verified by further studies, such
as by determining mRNA expression in various human tissues.
[0658] As noted before, gene amplification and/or gene expression
in various tissues may be measured by conventional Southern
blotting, Northern blotting to quantitate the transcription of mRNA
(Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)), dot
blotting (DNA analysis), or in situ hybridization, using an
appropriately labeled probe, based on the sequences provided
herein. Alternatively, antibodies may be employed that can
recognize specific duplexes, including DNA duplexes, RNA duplexes,
and DNA-RNA hybrid duplexes or DNA-protein duplexes.
[0659] Gene expression in various tissues, alternatively, may be
measured by immunological methods, such as immunohistochemical
staining of tissue sections and assay of cell culture or body
fluids, to quantitate directly the expression of gene product.
Antibodies useful for immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be
prepared in any mammal. Conveniently, the antibodies may be
prepared against a native-sequence PRO polypeptide or against a
synthetic peptide based on the DNA sequences provided herein or
against exogenous sequence fused to PRO DNA and encoding a specific
antibody epitope. General techniques for generating antibodies, and
special protocols for in situ hybridization are provided
hereinbelow.
[0660] 5.2.4.3. Antibody Binding Studies
[0661] The results of the cardiovascular, endothelial, and
angiogenic study can be further verified by antibody binding
studies, in which the ability of anti-PRO antibodies to inhibit the
effect of the PRO polypeptides on endothelial cells or other cells
used in the cardiovascular, endothelial, and angiogenic assays is
tested. Exemplary antibodies include polyclonal, monoclonal,
humanized, bispecific, and heteroconjugate antibodies, the
preparation of which will be described hereinbelow.
[0662] Antibody binding studies may be carried out in any known
assay method, such as competitive binding assays, direct and
indirect sandwich assays, and immunoprecipitation assays. Zola,
Monoclonal Antibodies: A Manual of Techniques (CRC Press, Inc.,
1987), pp. 147-158.
[0663] Competitive binding assays rely on the ability of a labeled
standard to compete with the test sample analyte for binding with a
limited amount of antibody. The amount of target protein in the
test sample is inversely proportional to the amount of standard
that becomes bound to the antibodies. To facilitate determining the
amount of standard that becomes bound, the antibodies preferably
are insolubilized before or after the competition, so that the
standard and analyte that are bound to the antibodies may
conveniently be separated from the standard and analyte that remain
unbound.
[0664] Sandwich assays involve the use of two antibodies, each
capable of binding to a different immunogenic portion, or epitope,
of the protein to be detected. In a sandwich assay, the test sample
analyte is bound by a first antibody that is immobilized on a solid
support, and thereafter a second antibody binds to the analyte,
thus forming an insoluble three-part complex. See, e.g., U.S. Pat.
No. 4,376,110. The second antibody may itself be labeled with a
detectable moiety (direct sandwich assays) or may be measured using
an anti-immunoglobulin antibody that is labeled with a detectable
moiety (indirect sandwich assay). For example, one type of sandwich
assay is an ELISA assay, in which case the detectable moiety is an
enzyme.
[0665] For immunohistochemistry, the tissue sample may be fresh or
frozen or may be embedded in paraffin and fixed with a preservative
such as formalin, for example.
[0666] 5.2.4.4. Cell-based Tumor Assays
[0667] Cell-based assays and animal models for cardiovascular,
endothelial, and angiogenic disorders, such as tumors, can be used
to verify the findings of a cardiovascular, endothelial, and
angiogenic assay herein, and further to understand the relationship
between the genes identified herein and the development and
pathogenesis of undesirable cardiovascular, endothelial, and
angiogenic cell growth. The role of gene products identified herein
in the development and pathology of undesirable cardiovascular,
endothelial, and angiogenic cell growth, e.g., tumor cells, can be
tested by using cells or cells lines that have been identified as
being stimulated or inhibited by the PRO polypeptide herein. Such
cells include, for example, those set forth in the Examples
below.
[0668] In a different approach, cells of a cell type known to be
involved in a particular cardiovascular, endothelial, and
angiogenic disorder are transfected with the cDNAs herein, and the
ability of these cDNAs to induce excessive growth or inhibit growth
is analyzed. If the cardiovascular, endothelial, and angiogenic
disorder is cancer, suitable tumor cells include, for example,
stable tumor cell lines such as the B104-1-1 cell line (stable
NIH-3T3 cell line transfected with the neu protooncogene) and
ras-transfected NIH-3T3 cells, which can be transfected with the
desired gene and monitored for tumorigenic growth. Such transfected
cell lines can then be used to test the ability of poly- or
monoclonal antibodies or antibody compositions to inhibit
tumorigenic cell growth by exerting cytostatic or cytotoxic
activity on the growth of the transformed cells, or by mediating
antibody-dependent cellular cytotoxicity (ADCC). Cells transfected
with the coding sequences of the genes identified herein can
further be used to identify drug candidates for the treatment of
cardiovascular, endothelial, and angiogenic disorders such as
cancer.
[0669] In addition, primary cultures derived from tumors in
transgenic animals (as described above) can be used in the
cell-based assays herein, although stable cell lines are preferred.
Techniques to derive continuous cell lines from transgenic animals
are well known in the art. See, e.g., Small et al., Mol. Cell.
Biol., 5: 642-648 (1985).
[0670] 5.2.4.5. Gene Therapy
[0671] Described below are methods and compositions whereby disease
symptoms may be ameliorated. Certain diseases are brought about, at
least in part, by an excessive level of gene product, or by the
presence of a gene product exhibiting an abnormal or excessive
activity. As such, the reduction in the level and/or activity of
such gene products would bring about the amelioration of such
disease symptoms.
[0672] Alternatively, certain other diseases are brought about, at
least in part, by the absence or reduction of the level of gene
expression, or a reduction in the level of a gene product's
activity. As such, an increase in the level of gene expression
and/or the activity of such gene products would bring about the
amelioration of such disease symptoms.
[0673] In some cases, the up-regulation of a gene in a disease
state reflects a protective role for that gene product in
responding to the disease condition. Enhancement of such a target
gene's expression, or the activity of the target gene product, will
reinforce the protective effect it exerts. Some disease states may
result from an abnormally low level of activity of such a
protective gene. In these cases also, an increase in the level of
gene expression and/or the activity of such gene products would
bring about the amelioration of such disease symptoms.
[0674] The PRO polypeptides described herein and polypeptidyl
agonists and antagonists may be employed in accordance with the
present invention by expression of such polypeptides in vivo, which
is often referred to as gene therapy.
[0675] There are two major approaches to getting the nucleic acid
(optionally contained in a vector) into the patient's cells: in
vivo and ex vivo. For in vivo delivery the nucleic acid is injected
directly into the patient, usually at the sites where the PRO
polypeptide is required, i.e., the site of synthesis of the PRO
polypeptide, if known, and the site (e.g., wound) where biological
activity of the PRO polypeptide is needed. For ex vivo treatment,
the patient's cells are removed, the nucleic acid is introduced
into these isolated cells, and the modified cells are administered
to the patient either directly or, for example, encapsulated within
porous membranes that are implanted into the patient (see, e.g.,
U.S. Pat. Nos. 4,892,538 and 5,283,187). There are a variety of
techniques available for introducing nucleic acids into viable
cells. The techniques vary depending upon whether the nucleic acid
is transferred into cultured cells in vitro, or transferred in vivo
in the cells of the intended host. Techniques suitable for the
transfer of nucleic acid into mammalian cells in vitro include the
use of liposomes, electroporation, microinjection, transduction,
cell fusion, DEAE-dextran, the calcium phosphate precipitation
method, etc. Transduction involves the association of a
replication-defective, recombinant viral (preferably retroviral)
particle with a cellular receptor, followed by introduction of the
nucleic acids contained by the particle into the cell. A commonly
used vector for ex vivo delivery of the gene is a retrovirus.
[0676] The currently preferred in vivo nucleic acid transfer
techniques include transfection with viral or non-viral vectors
(such as adenovirus, lentivirus, Herpes simplex I virus, or
adeno-associated virus (AAV)) and lipid-based systems (useful
lipids for lipid-mediated transfer of the gene are, for example,
DOTMA, DOPE, and DC-Chol; see, e.g., Tonkinson et al., Cancer
Investigation, 14(1): 54-65 (1996)). The most preferred vectors for
use in gene therapy are viruses, most preferably adenoviruses, AAV,
lentiviruses, or retroviruses. A viral vector such as a retroviral
vector includes at least one transcriptional promoter/enhancer or
locus-defining element(s), or other elements that control gene
expression by other means such as alternate splicing, nuclear RNA
export, or post-translational modification of messenger. In
addition, a viral vector such as a retroviral vector includes a
nucleic acid molecule that, when transcribed in the presence of a
gene encoding the PRO polypeptide, is operably linked thereto and
acts as a translation initiation sequence. Such vector constructs
also include a packaging signal, long terminal repeats (LTRs) or
portions thereof, and positive and negative strand primer binding
sites appropriate to the virus used (if these are not already
present in the viral vector). In addition, such vector typically
includes a signal sequence for secretion of the PRO polypeptide
from a host cell in which it is placed. Preferably the signal
sequence for this purpose is a mammalian signal sequence, most
preferably the native signal sequence for the PRO polypeptide.
Optionally, the vector construct may also include a signal that
directs polyadenylation, as well as one or more restriction sites
and a translation termination sequence. By way of example, such
vectors will typically include a 5' LTR, a tRNA binding site, a
packaging signal, an origin of second-strand DNA synthesis, and a
3' LTR or a portion thereof. Other vectors can be used that are
non-viral, such as cationic lipids, polylysine, and dendrimers.
[0677] In some situations, it is desirable to provide the nucleic
acid source with an agent that targets the target cells, such as an
antibody specific for a cell-surface membrane protein or the target
cell, a ligand for a receptor on the target cell, etc. Where
liposomes are employed, proteins that bind to a cell-surface
membrane protein associated with endocytosis may be used for
targeting and/or to facilitate uptake, e.g., capsid proteins or
fragments thereof tropic for a particular cell type, antibodies for
proteins that undergo internalization in cycling, and proteins that
target intracellular localization and enhance intracellular
half-life. The technique of receptor-mediated endocytosis is
described, for example, by Wu et al., J. Biol. Chem., 262:
4429-4432(1987); and Wagner et al, Proc. Natl. Acad. Sci. USA, 87:
3410-3414 (1990). For a review of the currently known gene marking
and gene therapy protocols, see, Anderson et al., Science, 256:
808-813 (1992). See also WO 93/25673 and the references cited
therein.
[0678] Suitable gene therapy and methods for making retroviral
particles and structural proteins can be found in, e.g., U.S. Pat.
No. 5,681,746.
[0679] 5.2.4.6. Use of Gene as a Diagnostic
[0680] This invention is also related to the use of the gene
encoding the PRO polypeptide as a diagnostic. Detection of a
mutated form of the PRO polypeptide will allow a diagnosis of a
cardiovascular, endothelial, and angiogenic disease or a
susceptibility to a cardiovascular, endothelial, and angiogenic
disease, such as a tumor, since mutations in the PRO polypeptide
may cause tumors.
[0681] Individuals carrying mutations in the genes encoding a human
PRO polypeptide may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy,
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature, 324: 163-166 (1986)) prior to analysis. RNA or cDNA
may also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding the PRO polypeptide can
be used to identify and analyze the PRO polypeptide mutations. For
example, deletions and insertions can be detected by a change in
size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to
radiolabeled RNA encoding the PRO polypeptide, or alternatively,
radiolabeled antisense DNA sequences encoding the PRO polypeptide.
Perfectly matched sequences can be distinguished from mismatched
duplexes by RNase A digestion or by differences in melting
temperatures.
[0682] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamidine gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures. See, e.g., Myers
et al., Science 230: 1242 (1985).
[0683] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method, for example, Cotton et al., Proc.
Natl. Acad. Sci. USA, 85: 4397-4401 (1985).
[0684] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing, or the use of restriction
enzymes, e.g., restriction fragment length polymorphisms (RFLP),
and Southern blotting of genomic DNA.
[0685] 5.2.4.7. Use to Detect PRO Polypeptide Levels
[0686] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0687] Expression of nucleic acid encoding the PRO polypeptide may
be linked to vascular disease or neovascularization associated with
tumor formation. If the PRO polypeptide has a signal sequence and
the mRNA is highly expressed in endothelial cells and to a lesser
extent in smooth muscle cells, this indicates that the PRO
polypeptide is present in serum. Accordingly, an anti-PRO
polypeptide antibody could be used to diagnose vascular disease or
neovascularization associated with tumor formation, since an
altered level of this PRO polypeptide may be indicative of such
disorders.
[0688] A competition assay may be employed wherein antibodies
specific to the PRO polypeptide are attached to a solid support and
the labeled PRO polypeptide and a sample derived from the host are
passed over the solid support and the amount of label detected
attached to the solid support can be correlated to a quantity of
the PRO polypeptide in the sample.
[0689] 5.2.4.8. Chromosome Mapping
[0690] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0691] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
for the 3'-untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0692] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes, and preselection
by hybridization to construct chromosome-specific cDNA
libraries.
[0693] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 500 or 600 bases; however, clones larger than
2,000 bp have a higher likelihood of binding to a unique
chromosomal location with sufficient signal intensity for simple
detection. FISH requires use of the clones from which the gene
encoding the PRO polypeptide was derived, and the longer the
better. For example, 2,000 bp is good, 4,000 bp is better, and more
than 4,000 is probably not necessary to get good results a
reasonable percentage of the time. For a review of this technique,
see, Verma et al., Human Chromosomes: a Manual of Basic Techniques
(Pergamon Press, New York, 1988).
[0694] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available
online through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region is then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0695] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0696] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0697] 5.2.4.9. Screening Assays for Drug Candidates
[0698] This invention encompasses methods of screening compounds to
identify those that mimic the PRO polypeptide (agonists) or prevent
the effect of the PRO polypeptide (antagonists). Screening assays
for antagonist drug candidates are designed to identify compounds
that bind or complex with the PRO polypeptide encoded by the genes
identified herein, or otherwise interfere with the interaction of
the encoded polypeptides with other cellular proteins. Such
screening assays will include assays amenable to high-throughput
screening of chemical libraries, making them particularly suitable
for identifying small molecule drug candidates.
[0699] The assays can be performed in a variety of formats,
including protein-protein binding assays, biochemical screening
assays, immunoassays, and cell-based assays, which are well
characterized in the art.
[0700] All assays for antagonists are common in that they call for
contacting the drug candidate with a PRO polypeptide encoded by a
nucleic acid identified herein under conditions and for a time
sufficient to allow these two components to interact.
[0701] In binding assays, the interaction is binding and the
complex formed can be isolated or detected in the reaction mixture.
In a particular embodiment, the PRO polypeptide encoded by the gene
identified herein or the drug candidate is immobilized on a solid
phase, e.g., on a microtiter plate, by covalent or non-covalent
attachments.
[0702] Non-covalent attachment generally is accomplished by coating
the solid surface with a solution of the PRO polypeptide and
drying. Alternatively, an immobilized antibody, e.g., a monoclonal
antibody, specific for the PRO polypeptide to be immobilized can be
used to anchor it to a solid surface. The assay is performed by
adding the non-immobilized component, which may be labeled by a
detectable label, to the immobilized component, e.g., the coated
surface containing the anchored component. When the reaction is
complete, the non-reacted components are removed, e.g., by washing,
and complexes anchored on the solid surface are detected. When the
originally non-immobilized component carries a detectable label,
the detection of label immobilized on the surface indicates that
complexing occurred. Where the originally non-immobilized component
does not carry a label, complexing can be detected, for example, by
using a labeled antibody specifically binding the immobilized
complex.
[0703] If the candidate compound interacts with but does not bind
to a particular PRO polypeptide encoded by a gene identified
herein, its interaction with that polypeptide can be assayed by
methods well known for detecting protein-protein interactions. Such
assays include traditional approaches, such as, e.g.,
cross-linking, co-immunoprecipitation, and co-purification through
gradients or chromatographic columns. In addition, protein-protein
interactions can be monitored by using a yeast-based genetic system
described by Fields and co-workers (Fields and Song, Nature
(London), 340: 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci.
USA, 88: 9578-9582 (1991)) as disclosed by Chevray and Nathans,
Proc. Natl. Acad. Sci. USA, 89: 5789-5793 (1991). Many
transcriptional activators, such as yeast GAL4, consist of two
physically discrete modular domains, one acting as the DNA-binding
domain, the other one functioning as the transcription-activation
domain. The yeast expression system described in the foregoing
publications (generally referred to as the"two-hybrid system")
takes advantage of this property, and employs two hybrid proteins,
one in which the target protein is fused to the DNA-binding domain
of GAL4, and another, in which candidate activating proteins are
fused to the activation domain. The expression of a GAL1-lacZ
reporter gene under control of a GAL4-activated promoter depends on
reconstitution of GAL4 activity via protein-protein interaction.
Colonies containing interacting polypeptides are detected with a
chromogenic substrate for .beta.-galactosidase. A complete kit
(MATCHMAKER.TM.) for identifying protein-protein interactions
between two specific proteins using the two-hybrid technique is
commercially available from Clontech. This system can also be
extended to map protein domains involved in specific protein
interactions as well as to pinpoint amino acid residues that are
crucial for these interactions.
[0704] Compounds that interfere with the interaction of a gene
encoding a PRO polypeptide identified herein and other intra- or
extracellular components can be tested as follows: usually a
reaction mixture is prepared containing the product of the gene and
the intra- or extracellular component under conditions and for a
time allowing for the interaction and binding of the two products.
To test the ability of a candidate compound to inhibit binding, the
reaction is run in the absence and in the presence of the test
compound. In addition, a placebo may be added to a third reaction
mixture, to serve as positive control. The binding (complex
formation) between the test compound and the intra- or
extracellular component present in the mixture is monitored as
described hereinabove. The formation of a complex in the control
reaction(s) but not in the reaction mixture containing the test
compound indicates that the test compound interferes with the
interaction of the test compound and its reaction partner.
[0705] If the PRO polypeptide has the ability to stimulate the
proliferation of endothelial cells in the presence of the
co-mitogen ConA, then one example of a screening method takes
advantage of this ability. Specifically, in the proliferation
assay, human umbilical vein endothelial cells are obtained and
cultured in 96-well flat-bottomed culture plates (Costar,
Cambridge, Mass.) and supplemented with a reaction mixture
appropriate for facilitating proliferation of the cells, the
mixture containing Con-A (Calbiochem, La Jolla, Calif.). Con-A and
the compound to be screened are added and after incubation at
37.degree. C., cultures are pulsed with .sup.3-H-thymidine and
harvested onto glass fiber filters (phD; Cambridge Technology,
Watertown, Mass.). Mean .sup.3-H-thymidine incorporation (cpm) of
triplicate cultures is determined using a liquid scintillation
counter (Beckman Instruments, Irvine, Calif.). Significant
.sup.3-(H)-thymidine incorporation indicates stimulation of
endothelial cell proliferation.
[0706] To assay for antagonists, the assay described above is
performed; however, in this assay the PRO polypeptide is added
along with the compound to be screened and the ability of the
compound to inhibit .sup.3-(H)thymidine incorporation in the
presence of the PRO polypeptide indicates that the compound is an
antagonist to the PRO polypeptide. Alternatively, antagonists may
be detected by combining the PRO polypeptide and a potential
antagonist with membrane-bound PRO polypeptide receptors or
recombinant receptors under appropriate conditions for a
competitive inhibition assay. The PRO polypeptide can be labeled,
such as by radioactivity, such that the number of PRO polypeptide
molecules bound to the receptor can be used to determine the
effectiveness of the potential antagonist. The gene encoding the
receptor can be identified by numerous methods known to those of
skill in the art, for example, ligand panning and FACS sorting.
Coligan et al., Current Protocols in Immun., 1(2): Chapter 5
(1991). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell responsive to the PRO
polypeptide and a cDNA library created from this RNA is divided
into pools and used to transfect COS cells or other cells that are
not responsive to the PRO polypeptide. Transfected cells that are
grown on glass slides are exposed to the labeled PRO polypeptide.
The PRO polypeptide can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and incubation, the slides are
subjected to autoradiographic analysis. Positive pools are
identified and sub-pools are prepared and re-transfected using an
interactive sub-pooling and re-screening process, eventually
yielding a single clone that encodes the putative receptor.
[0707] As an alternative approach for receptor identification, the
labeled PRO polypeptide can be photoaffinity-linked with cell
membrane or extract preparations that express the receptor
molecule. Cross-linked material is resolved by PAGE and exposed to
X-ray film. The labeled complex containing the receptor can be
excised, resolved into peptide fragments, and subjected to protein
micro-sequencing. The amino acid sequence obtained from
micro-sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify the
gene encoding the putative receptor.
[0708] In another assay for antagonists, mammalian cells or a
membrane preparation expressing the receptor would be incubated
with the labeled PRO polypeptide in the presence of the candidate
compound. The ability of the compound to enhance or block this
interaction could then be measured.
[0709] The compositions useful in the treatment of cardiovascular,
endothelial, and angiogenic disorders include, without limitation,
antibodies, small organic and inorganic molecules, peptides,
phosphopeptides, antisense and ribozyme molecules, triple-helix
molecules, etc., that inhibit the expression and/or activity of the
target gene product.
[0710] More specific examples of potential antagonists include an
oligonucleotide that binds to the fusions of immunoglobulin with a
PRO polypeptide, and, in particular, antibodies including, without
limitation, poly- and monoclonal antibodies and antibody fragments,
single-chain antibodies, anti-idiotypic antibodies, and chimeric or
humanized versions of such antibodies or fragments, as well as
human antibodies and antibody fragments. Alternatively, a potential
antagonist may be a closely related protein, for example, a mutated
form of the PRO polypeptide that recognizes the receptor but
imparts no effect, thereby competitively inhibiting the action of
the PRO polypeptide.
[0711] Another potential PRO polypeptide antagonist is an antisense
RNA or DNA construct prepared using antisense technology, where,
e.g., an antisense RNA or DNA molecule acts to block directly the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense technology can be used to control
gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are based on binding of a polynucleotide
to DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes the mature PRO polypeptides
herein, is used to design an antisense RNA oligonucleotide of from
about 10 to 40 base pairs in length. A DNA oligonucleotide is
designed to be complementary to a region of the gene involved in
transcription (triple helix--see, Lee et al., Nucl. Acids Res.,
6:3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et
al., Science, 251:1360 (1991)), thereby preventing transcription
and the production of the PRO polypeptide. A
sequence"complementary" to a portion of an RNA, as referred to
herein, means a sequence having sufficient complementarity to be
able to hybridize with the RNA, forming a stable duplex; in the
case of double-stranded antisense nucleic acids, a single strand of
the duplex DNA may thus be tested, or triplex helix formation may
be assayed. The ability to hybridize will depend on both the degree
of complementarity and the length of the antisense nucleic acid.
Generally, the longer the hybridizing nucleic acid, the more base
mismatches with an RNA it may contain and still form a stable
duplex (or triplex, as the case may be). One skilled in the art can
ascertain a tolerable degree of mismatch by use of standard
procedures to determine the melting point of the hybridized
complex. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into the PRO
polypeptide (antisense--Okano, Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression
(CRC Press: Boca Raton, Fla., 1988).
[0712] The antisense oligonucleotides can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g,
Letsinger, et al., 1989, Proc. Natl. Acad. Sci. U.S.A 86:6553-6556;
Lemaitre, et al., 1987, Proc. Natl. Acad. Sci. USA. 84:648-652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents
(see, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549).
To this end, the oligonucleotide may be conjugated to another
molecule, e.g., a peptide, hybridization triggered cross-linking
agent, transport agent, hybridization-triggered cleavage agent,
etc.
[0713] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including but
not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomet-
hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyammomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopenten- yladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid(v), 2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0714] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including but not
limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0715] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group consisting of a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or
analog thereof.
[0716] In yet another embodiment, the antisense oligonucleotide is
an .alpha.-anomeric oligonucleotide. An .alpha.-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gautier, et al., 1987, Nucl.
Acids Res. 15:6625-6641). The oligonucleotide is a
2'-0-methylribonucleotide (Inoue, et al., 1987, Nucl. Acids Res.
15:6131-6148), or a chimeric RNA-DNA analogue (Inoue, et al., 1987,
FEBS Lett. 215:327-330).
[0717] Oligonucleotides of the invention may be synthesized by
standard methods known in the art, e.g., by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein, et al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin, et al., 1988, Proc. Natl. Acad. Sci.
U.S.A. 85:7448-7451), etc.
[0718] The oligonucleotides described above can also be delivered
to cells such that the antisense RNA or DNA may be expressed in
vivo to inhibit production of the PRO polypeptide. When antisense
DNA is used, oligodeoxyribonucleotides derived from the
translation-initiation site, e.g., between about -10 and +10
positions of the target gene nucleotide sequence, are
preferred.
[0719] Antisense RNA or DNA molecules are generally at least about
5 bases in length, about 10 bases in length, about 15 bases in
length, about 20 bases in length, about 25 bases in length, about
30 bases in length, about 35 in length, about 40 bases in length,
about 45 bases in length, about 50 bases in length, about 55 bases
in length, about 60 bases in length, about 65 bases in length,
about 70 bases in length, about 75 bases in length, about 80 in
length, about 85 bases in length, about 90 bases in length, about
95 bases in length, about 100 bases in length, or more.
[0720] Potential antagonists further include small molecules that
bind to the active site, the receptor binding site, or growth
factor or other relevant binding site of the PRO polypeptide,
thereby blocking the normal biological activity of the PRO
polypeptide. Examples of small molecules include, but are not
limited to, small peptides or peptide-like molecules, preferably
soluble peptides, and synthetic non-peptidyl organic or inorganic
compounds.
[0721] Additional potential antagonists are ribozymes, which are
enzymatic RNA molecules capable of catalyzing the specific cleavage
of RNA. Ribozymes act by sequence-specific hybridization to the
complementary target RNA, followed by endonucleolytic cleavage.
Specific ribozyme cleavage sites within a potential RNA target can
be identified by known techniques. For further details see, e.g.,
Rossi, Current Biology, 4: 469-471 (1994), and PCT publication No.
WO 97/33551 (published Sep. 18, 1997).
[0722] While ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy target gene mRNAs, the
use of hammerhead ribozymes is preferred. Hammerhead ribozymes
cleave mRNAs at locations dictated by flanking regions which form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Myers,
1995, Molecular Biology and Biotechnology: A Comprehensive Desk
Reference, VCH Publishers, New York, (see especially FIG. 4, page
833) and in Haseloff and Gerlach, 1988, Nature, 334:585-591, which
is incorporated herein by reference in its entirety.
[0723] Preferably the ribozyme is engineered so that the cleavage
recognition site is located near the 5' end of the target gene
mRNA, i.e., to increase efficiency and minimize the intracellular
accumulation of non-functional mRNA transcripts.
[0724] The ribozymes of the present invention also include RNA
endoribonucleases (hereinafter"Cech-type ribozymes") such as the
one which occurs naturally in Tetrahymena thermophila (known as the
IVS, or L-19 IVS RNA) and which has been extensively described by
Thomas Cech and collaborators (Zaug, et al., 1984, Science,
224:574-578; Zaug and Cech, 1986, Science, 231:470-475; Zaug, et
al., 1986, Nature, 324:429-433; published International patent
application No. WO 88/04300 by University Patents Inc.; Been and
Cech, 1986, Cell, 47:207-216). The Cech-type ribozymes have an
eight base pair active site that hybridizes to a target RNA
sequence whereafter cleavage of the target RNA takes place. The
invention encompasses those Cech-type ribozymes that target eight
base-pair active site sequences that are present in the target
gene.
[0725] As in the antisense approach, the ribozymes can be composed
of modified oligonucleotides (e.g., for improved stability,
targeting, etc.) and should be delivered to cells that express the
target gene in vivo. A preferred method of delivery involves using
a DNA construct "encoding" the ribozyme under the control of a
strong constitutive pol III or pol II promoter, so that transfected
cells will produce sufficient quantities of the ribozyme to destroy
endogenous target gene messages and inhibit translation. Because
ribozymes, unlike antisense molecules, are catalytic, a lower
intracellular concentration is required for efficiency.
[0726] Nucleic acid molecules in triple-helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple-helix formation via Hoogsteen
base-pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g., PCT publication No. WO 97/33551, supra.
[0727] These small molecules can be identified by any one or more
of the screening assays discussed hereinabove and/or by any other
screening techniques well known for those skilled in the art.
[0728] 5.2.4.10. Types of Cardiovascular, Endothelial, and
Angiogenic Disorders to be Treated
[0729] The PRO polypeptides, or agonists or antagonists thereto,
that have activity in the cardiovascular, angiogenic, and
endothelial assays described herein, and/or whose gene product has
been found to be localized to the cardiovascular system, are likely
to have therapeutic uses in a variety of cardiovascular,
endothelial, and angiogenic disorders, including systemic disorders
that affect vessels, such as diabetes mellitus. Their therapeutic
utility could include diseases of the arteries, capillaries, veins,
and/or lymphatics. Examples of treatments hereunder include
treating muscle wasting disease, treating osteoporosis, aiding in
implant fixation to stimulate the growth of cells around the
implant and therefore facilitate its attachment to its intended
site, increasing IGF stability in tissues or in serum, if
applicable, and increasing binding to the IGF receptor (since IGF
has been shown in vitro to enhance human marrow erythroid and
granulocytic progenitor cell growth).
[0730] The PRO polypeptides or agonists or antagonists thereto may
also be employed to stimulate erythropoiesis or granulopoiesis, to
stimulate wound healing or tissue regeneration and associated
therapies concerned with re-growth of tissue, such as connective
tissue, skin, bone, cartilage, muscle, lung, or kidney, to promote
angiogenesis, to stimulate or inhibit migration of endothelial
cells, and to proliferate the growth of vascular smooth muscle and
endothelial cell production. The increase in angiogenesis mediated
by the PRO polypeptide or agonist would be beneficial to ischemic
tissues and to collateral coronary development in the heart
subsequent to coronary stenosis. Antagonists are used to inhibit
the action of such polypeptides, for example, to limit the
production of excess connective tissue during wound healing or
pulmonary fibrosis if the PRO polypeptide promotes such production.
This would include treatment of acute myocardial infarction and
heart failure.
[0731] Moreover, the present invention provides the treatment of
cardiac hypertrophy, regardless of the underlying cause, by
administering a therapeutically effective dose of the PRO
polypeptide, or agonist or antagonist thereto. If the objective is
the treatment of human patients, the PRO polypeptide preferably is
recombinant human PRO polypeptide (rhPRO polypeptide). The
treatment for cardiac hypertrophy can be performed at any of its
various stages, which may result from a variety of diverse
pathologic conditions, including myocardial infarction,
hypertension, hypertrophic cardiomyopathy, and valvular
regurgitation. The treatment extends to all stages of the
progression of cardiac hypertrophy, with or without structural
damage of the heart muscle, regardless of the underlying cardiac
disorder.
[0732] The decision of whether to use the molecule itself or an
agonist thereof for any particular indication, as opposed to an
antagonist to the molecule, would depend mainly on whether the
molecule herein promotes cardiovascularization, genesis of
endothelial cells, or angiogenesis or inhibits these conditions.
For example, if the molecule promotes angiogenesis, an antagonist
thereof would be useful for treatment of disorders where it is
desired to limit or prevent angiogenesis. Examples of such
disorders include vascular tumors such as haemangioma, tumor
angiogenesis, neovascularization in the retina, choroid, or cornea,
associated with diabetic retinopathy or premature infant
retinopathy or macular degeneration and proliferative
vitreoretinopathy, rheumatoid arthritis, Crolm's disease,
atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis
associated with neovascularization, restenosis subsequent to
balloon angioplasty, scar tissue overproduction, for example, that
seen in a keloid that forms after surgery, fibrosis after
myocardial infarction, or fibrotic lesions associated with
pulmonary fibrosis.
[0733] If, however, the molecule inhibits angiogenesis, it would be
expected to be used directly for treatment of the above
conditions.
[0734] On the other hand, if the molecule stimulates angiogenesis
it would be used itself (or an agonist thereof) for indications
where angiogenesis is desired such as peripheral vascular disease,
hypertension, inflammatory vasculitides, Reynaud's disease and
Reynaud's phenomenon, aneurysms, arterial restenosis,
thrombophlebitis, lymphangitis, lymphedema, wound healing and
tissue repair, ischemia reperfusion injury, angina, myocardial
infarctions such as acute myocardial infarctions, chronic heart
conditions, heart failure such as congestive heart failure, and
osteoporosis.
[0735] If, however, the molecule inhibits angiogenesis, an
antagonist thereof would be used for treatment of those conditions
where angiogenesis is desired.
[0736] Specific types of diseases are described below, where the
PRO polypeptide herein or agonists or antagonists thereof may serve
as useful for vascular-related drug targeting or as therapeutic
targets for the treatment or prevention of the disorders.
Atherosclerosis is a disease characterized by accumulation of
plaques of intimal thickening in arteries, due to accumulation of
lipids, proliferation of smooth muscle cells, and formation of
fibrous tissue within the arterial wall. The disease can affect
large, medium, and small arteries in any organ. Changes in
endothelial and vascular smooth muscle cell function are known to
play an important role in modulating the accumulation and
regression of these plaques.
[0737] Hypertension is characterized by raised vascular pressure in
the systemic arterial, pulmonary arterial, or portal venous
systems. Elevated pressure may result from or result in impaired
endothelial function and/or vascular disease
[0738] Inflammatory vasculitides include giant cell arteritis,
Takayasu's arteritis, polyarteritis nodosa (including the
microangiopathic form), Kawasaki's disease, microscopic
polyangiitis, Wegener's granulomatosis, and a variety of
infectious-related vascular disorders (including Henoch-Schonlein
prupura). Altered endothelial cell function has been shown to be
important in these diseases.
[0739] Reynaud's disease and Reynaud's phenomenon are characterized
by intermittent abnormal impairment of the circulation through the
extremities on exposure to cold. Altered endothelial cell function
has been shown to be important in this disease.
[0740] Aneurysms are saccular or fusiform dilatations of the
arterial or venous tree that are associated with altered
endothelial cell and/or vascular smooth muscle cells.
[0741] Arterial restenosis (restenosis of the arterial wall) may
occur following angioplasty as a result of alteration in the
function and proliferation of endothelial and vascular smooth
muscle cells.
[0742] Thrombophlebitis and lymphangitis are inflammatory disorders
of veins and lymphatics, respectively, that may result from, and/or
in, altered endothelial cell function. Similarly, lymphedema is a
condition involving impaired lymphatic vessels resulting from
endothelial cell function.
[0743] The family of benign and malignant vascular tumors are
characterized by abnormal proliferation and growth of cellular
elements of the vascular system. For example, lymphangiomas are
benign tumors of the lymphatic system that are congenital, often
cystic, malformations of the lymphatics that usually occur in
newborns. Cystic tumors tend to grow into the adjacent tissue.
Cystic tumors usually occur in the cervical and axillary region.
They can also occur in the soft tissue of the extremities. The main
symptoms are dilated, sometimes reticular, structured lymphatics
and lymphocysts surrounded by connective tissue. Lymphangiomas are
assumed to be caused by improperly connected embryonic lymphatics
or their deficiency. The result is impaired local lymph drainage.
Griener et al., Lymphology, 4: 140-144 (1971).
[0744] Another use for the PRO polypeptides herein or agonists or
antagonists thereto is in the prevention of tumor angiogenesis,
which involves vascularization of a tumor to enable it to growth
and/or metastasize. This process is dependent on the growth of new
blood vessels. Examples of neoplasms and related conditions that
involve tumor angiogenesis include breast carcinomas, lung
carcinomas, gastric carcinomas, esophageal carcinomas, colorectal
carcinomas, liver carcinomas, ovarian carcinomas, thecomas,
arrhenoblastomas, cervical carcinomas, endometrial carcinoma,
endometrial hyperplasia, endometriosis, fibrosarcomas,
choriocarcinoma, head and neck cancer, nasopharyngeal carcinoma,
laryngeal carcinomas, bepatoblastoma, Kaposi's sarcoma, melanoma,
skin carcinomas, hemangioma, cavernous hemangioma,
hemangioblastoma, pancreas carcinomas, retinoblastoma, astrocytoma,
glioblastoma, Schwannoma, oligodendroglioma, medulloblastoma,
neuroblastomas, rhabdomyosarcoma, osteogenic sarcoma,
leiomyosarcomas, urinary tract carcinomas, thyroid carcinomas,
Wilm's tumor, renal cell carcinoma, prostate carcinoma, abnormal
vascular proliferation associated with phakomatoses, edema (such as
that associated with brain tumors), and Meigs' syndrome.
[0745] Age-related macular degeneration (AMD) is a leading cause of
severe visual loss in the elderly population. The exudative form of
AMD is characterized by choroidal neovascularization and retinal
pigment epithelial cell detachment. Because choroidal
neovascularization is associated with a dramatic worsening in
prognosis, the PRO polypeptide or agonist or antagonist thereto is
expected to be useful in reducing the severity of AMD.
[0746] Healing of trauma such as wound healing and tissue repair is
also a targeted use for the PRO polypeptides herein or their
agonists or antagonists. Formation and regression of new blood
vessels is essential for tissue healing and repair. This category
includes bone, cartilage, tendon, ligament, and/or nerve tissue
growth or regeneration, as well as wound healing and tissue repair
and replacement, and in the treatment of burns, incisions, and
ulcers. A PRO polypeptide or agonist or antagonist thereof that
induces cartilage and/or bone growth in circumstances where bone is
not normally formed has application in the healing of bone
fractures and cartilage damage or defects in humans and other
animals. Such a preparation employing a PRO polypeptide or agonist
or antagonist thereof may have prophylactic use in closed as well
as open fracture reduction and also in the improved fixation of
artificial joints. De novo bone formation induced by an osteogenic
agent contributes to the repair of congenital, trauma-induced, or
oncologic, resection-induced craniofacial defects, and also is
useful in cosmetic plastic surgery.
[0747] PRO polypeptides or agonists or antagonists thereto may also
be useful to promote better or faster closure of non-healing
wounds, including without limitation pressure ulcers, ulcers
associated with vascular insufficiency, surgical and traumatic
wounds, and the like.
[0748] It is expected that a PRO polypeptide or agonist or
antagonist thereto may also exhibit activity for generation or
regeneration of other tissues, such as organs (including, for
example, pancreas, liver, intestine, kidney, skin, or endothelium),
muscle (smooth, skeletal, or cardiac), and vascular (including
vascular endothelium) tissue, or for promoting the growth of cells
comprising such tissues. Part of the desired effects may be by
inhibition or modulation of fibrotic scarring to allow normal
tissue to regenerate.
[0749] A PRO polypeptide herein or agonist or antagonist thereto
may also be useful for gut protection or regeneration and treatment
of lung or liver fibrosis, reperfusion injury in various tissues,
and conditions resulting from systemic cytokine damage. Also, the
PRO polypeptide or agonist or antagonist thereto may be useful for
promoting or inhibiting differentiation of tissues described above
from precursor tissues or cells, or for inhibiting the growth of
tissues described above.
[0750] A PRO polypeptide or agonist or antagonist thereto may also
be used in the treatment of periodontal diseases and in other
tooth-repair processes. Such agents may provide an environment to
attract bone-forming cells, stimulate growth of bone-forming cells,
or induce differentiation of progenitors of bone-forming cells. A
PRO polypeptide herein or an agonist or an antagonist thereto may
also be useful in the treatment of osteoporosis or osteoarthritis,
such as through stimulation of bone and/or cartilage repair or by
blocking inflammation or processes of tissue destruction
(collagenase activity, osteoclast activity, etc.) mediated by
inflammatory processes, since blood vessels play an important role
in the regulation of bone turnover and growth.
[0751] Another category of tissue regeneration activity that may be
attributable to the PRO polypeptide herein or agonist or antagonist
thereto is tendon/ligament formation. A protein that induces
tendon/ligament-like tissue or other tissue formation in
circumstances where such tissue is not normally formed has
application in the healing of tendon or ligament tears,
deformities, and other tendon or ligament defects in humans and
other animals. Such a preparation may have prophylactic use in
preventing damage to tendon or ligament tissue, as well as use in
the improved fixation of tendon or ligament to bone or other
tissues, and in repairing defects to tendon or ligament tissue. De
novo tendon/ligament-like tissue formation induced by a composition
of the PRO polypeptide herein or agonist or antagonist thereto
contributes to the repair of congenital, trauma-induced, or other
tendon or ligament defects of other origin, and is also useful in
cosmetic plastic surgery for attachment or repair of tendons or
ligaments. The compositions herein may provide an environment to
attract tendon- or ligament-forming cells, stimulate growth of
tendon- or ligament-forming cells, induce differentiation of
progenitors of tendon- or ligament-forming cells, or induce growth
of tendon/ligament cells or progenitors ex vivo for return in vivo
to effect tissue repair. The compositions herein may also be useful
in the treatment of tendinitis, carpal tunnel syndrome, and other
tendon or ligament defects. The compositions may also include an
appropriate matrix and/or sequestering agent as a carrier as is
well known in the art.
[0752] The PRO polypeptide or its agonist or antagonist may also be
useful for proliferation of neural cells and for regeneration of
nerve and brain tissue, i.e., for the treatment of central and
peripheral nervous system disease and neuropathies, as well as
mechanical and traumatic disorders, that involve degeneration,
death, or trauma to neural cells or nerve tissue. More
specifically, a PRO polypeptide or its agonist or antagonist may be
used in the treatment of diseases of the peripheral nervous system,
such as peripheral nerve injuries, peripheral neuropathy and
localized neuropathies, and central nervous system diseases, such
as Alzheimer's, Parkinson's disease, Huntington's disease,
amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further
conditions that may be treated in accordance with the present
invention include mechanical and traumatic disorders, such as
spinal cord disorders, head trauma, and cerebrovascular diseases
such as stroke. Peripheral neuropathies resulting from chemotherapy
or other medical therapies may also be treatable using a PRO
polypeptide herein or agonist or antagonist thereto.
[0753] Ischemia-reperfusion injury is another indication.
Endothelial cell dysfunction may be important in both the
initiation of, and in regulation of the sequelae of events that
occur following ischemia-reperfusion injury.
[0754] Rheumatoid arthritis is a further indication. Blood vessel
growth and targeting of inflammatory cells through the vasculature
is an important component in the pathogenesis of rheumatoid and
sero-negative forms of arthritis.
[0755] A PRO polypeptide or its agonist or antagonist may also be
administered prophylactically to patients with cardiac hypertrophy,
to prevent the progression of the condition, and avoid sudden
death, including death of asymptomatic patients. Such preventative
therapy is particularly warranted in the case of patients diagnosed
with massive left ventricular cardiac hypertrophy (a maximal wall
thickness of 35 mm or more in adults, or a comparable value in
children), or in instances when the hemodynamic burden on the heart
is particularly strong.
[0756] A PRO polypeptide or its agonist or antagonist may also be
useful in the management of atrial fibrillation, which develops in
a substantial portion of patients diagnosed with hypertrophic
cardiomyopathy.
[0757] Further indications include angina, myocardial infarctions
such as acute myocardial infarctions, and heart failure such as
congestive heart failure. Additional non-neoplastic conditions
include psoriasis, diabetic and other proliferative retinopathies
including retinopathy of prematurity, retrolental fibroplasia,
neovascular glaucoma, thyroid hyperplasias (including Grave's
disease), corneal and other tissue transplantation, chronic
inflammation, lung inflammation, nephrotic syndrome, preeclampsia,
ascites, pericardial effusion (such as that associated with
pericarditis), and pleural effusion.
[0758] In view of the above, the PRO polypeptides or agonists or
antagonists thereof described herein, which are shown to alter or
impact endothelial cell function, proliferation, and/or form, are
likely to play an important role in the etiology and pathogenesis
of many or all of the disorders noted above, and as such can serve
as therapeutic targets to augment or inhibit these processes or for
vascular-related drug targeting in these disorders.
[0759] 5.2.4.11. Administration Protocols, Schedules, Doses, and
Formulations
[0760] The molecules herein and agonists and antagonists thereto
are pharmaceutically useful as a prophylactic and therapeutic agent
for various disorders and diseases as set forth above.
[0761] Therapeutic compositions of the PRO polypeptides or agonists
or antagonists are prepared for storage by mixing the desired
molecule having the appropriate degree of purity with optional
pharmaceutically acceptable carriers, excipients, or stabilizers
(Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed.
(1980)), in the form of lyophilized formulations or aqueous
solutions. Acceptable carriers, excipients, or stabilizers are
nontoxic to recipients at the dosages and concentrations employed,
and include buffers such as phosphate, citrate, and other organic
acids; antioxidants including ascorbic acid and methionine;
preservatives (such as octadecyldimethylbenzyl ammonium chloride;
hexamethonium chloride; benzalkonium chloride, benzethonium
chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as
methyl or propyl paraben; catechol; resorcinol; cyclohexanol;
3-pentanol; and m-cresol); low molecular weight (less than about 10
residues) polypeptides; proteins, such as serum albumin, gelatin,
or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g., Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.TM., PLURONICS.TM. or
polyethylene glycol (PEG).
[0762] Additional examples of such carriers include ion exchangers,
alumina, aluminum stearate, lecithin, serum proteins, such as human
serum albumin, buffer substances such as phosphates, glycine,
sorbic acid, potassium sorbate, partial glyceride mixtures of
saturated vegetable fatty acids, water, salts, or electrolytes such
as protamine sulfate, disodium hydrogen phosphate, potassium
hydrogen phosphate, sodium chloride, zinc salts, colloidal silica,
magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based
substances, and polyethylene glycol. Carriers for topical or
gel-based forms of agonist or antagonist include polysaccharides
such as sodium carboxymethylcellulose or methylcellulose,
polyvinylpyrrolidone, polyacrylates,
polyoxyethylene-polyoxypropylene-blo- ck polymers, polyethylene
glycol, and wood wax alcohols. For all administrations,
conventional depot forms are suitably used. Such forms include, for
example, microcapsules, nano-capsules, liposomes, plasters,
inhalation forms, nose sprays, sublingual tablets, and
sustained-release preparations. The PRO polypeptides or agonists or
antagonists will typically be formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml.
[0763] Another formulation comprises incorporating a PRO
polypeptide or agonist or antagonist thereof into formed articles.
Such articles can be used in modulating endothelial cell growth and
angiogenesis. In addition, tumor invasion and metastasis may be
modulated with these articles.
[0764] PRO polypeptides or agonists or antagonists to be used for
in vivo administration must be sterile. This is readily
accomplished by filtration through sterile filtration membranes,
prior to or following lyophilization and reconstitution. PRO
polypeptides ordinarily will be stored in lyophilized form or in
solution if administered systemically. If in lyophilized form, the
PRO polypeptide or agonist or antagonist thereto is typically
formulated in combination with other ingredients for reconstitution
with an appropriate diluent at the time for use. An example of a
liquid formulation of a PRO polypeptide or agonist or antagonist is
a sterile, clear, colorless unpreserved solution filled in a
single-dose vial for subcutaneous injection. Preserved
pharmaceutical compositions suitable for repeated use may contain,
for example, depending mainly on the indication and type of
polypeptide:
[0765] a) PRO polypeptide or agonist or antagonist thereto;
[0766] b) a buffer capable of maintaining the pH in a range of
maximum stability of the polypeptide or other molecule in solution,
preferably about 4-8;
[0767] c) a detergent/surfactant primarily to stabilize the
polypeptide or molecule against agitation-induced aggregation;
[0768] d) an isotonifier;
[0769] e) a preservative selected from the group of phenol, benzyl
alcohol and a benzethonium halide, e.g., chloride; and
[0770] f) water.
[0771] If the detergent employed is non-ionic, it may, for example,
be polysorbates (e.g., POLYSORBATE.TM. (TWEEN.TM.) 20, 80, etc.) or
poloxamers (e.g., POLOXAMER.TM. 188). The use of non-ionic
surfactants permits the formulation to be exposed to shear surface
stresses without causing denaturation of the polypeptide. Further,
such surfactant-containing formulations may be employed in aerosol
devices such as those used in a pulmonary dosing, and needleless
jet injector guns (see, e.g., EP 257,956).
[0772] An isotonifier may be present to ensure isotonicity of a
liquid composition of the PRO polypeptide or agonist or antagonist
thereto, and includes polyhydric sugar alcohols, preferably
trihydric or higher sugar alcohols, such as glycerin, erythritol,
arabitol, xylitol, sorbitol, and mannitol. These sugar alcohols can
be used alone or in combination. Alternatively, sodium chloride or
other appropriate inorganic salts may be used to render the
solutions isotonic.
[0773] The buffer may, for example, be an acetate, citrate,
succinate, or phosphate buffer depending on the pH desired. The pH
of one type of liquid formulation of this invention is buffered in
the range of about 4 to 8, preferably about physiological pH.
[0774] The preservatives phenol, benzyl alcohol and benzethonium
halides, e.g., chloride, are known antimicrobial agents that may be
employed.
[0775] Therapeutic PRO polypeptide compositions generally are
placed into a container having a sterile access port, for example,
an intravenous solution bag or vial having a stopper pierceable by
a hypodermic injection needle. The formulations are preferably
administered as repeated intravenous (i.v.), subcutaneous (s.c.),
or intramuscular (i.m.) injections, or as aerosol formulations
suitable for intranasal or intrapulmonary delivery (for
intrapulmonary delivery see, e.g., EP 257,956).
[0776] PRO polypeptides can also be administered in the form of
sustained-released preparations. Suitable examples of
sustained-release preparations include semipermeable matrices of
solid hydrophobic polymers containing the protein, which matrices
are in the form of shaped articles, e.g., films, or microcapsules.
Examples of sustained-release matrices include polyesters,
hydrogels (e.g., poly(2-hydroxyethyl-methacr- ylate) as described
by Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and
Langer, Chem. Tech., 12: 98-105 (1982) or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of
L-glutamic acid and gamma ethyl-L-glutamate (Sidman et al.,
Biopolymers, 22: 547-556(1983)), non-degradable ethylene-vinyl
acetate (Langer et al., supra), degradable lactic acid-glycolic
acid copolymers such as the Lupron Depot.TM. (injectable
microspheres composed of lactic acid-glycolic acid copolymer and
leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid (EP
133,988).
[0777] While polymers such as ethylene-vinyl acetate and lactic
acid-glycolic acid enable release of molecules for over 100 days,
certain hydrogels release proteins for shorter time periods. When
encapsulated proteins remain in the body for a long time, they may
denature or aggregate as a result of exposure to moisture at
37.degree. C., resulting in a loss of biological activity and
possible changes in immunogenicity. Rational strategies can be
devised for protein stabilization depending on the mechanism
involved. For example, if the aggregation mechanism is discovered
to be intermolecular S--S bond formation through thio-disulfide
interchange, stabilization may be achieved by modifying sulfhydryl
residues, lyophilizing from acidic solutions, controlling moisture
content, using appropriate additives, and developing specific
polymer matrix compositions.
[0778] Sustained-release PRO polypeptide compositions also include
liposomally entrapped PRO polypeptides. Liposomes containing the
PRO polypeptide are prepared by methods known per se: DE 3,218,121;
Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688-3692 (1985);
Hwang et al, Proc. Natl. Acad. Sci. USA, 77: 4030-4034 (1980); EP
52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese
patent application 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP 102,324. Ordinarily the liposomes are of the
small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. % cholesterol, the selected
proportion being adjusted for the optimal therapy.
[0779] The therapeutically effective dose of a PRO polypeptide or
agonist or antagonist thereto will, of course, vary depending on
such factors as the pathological condition to be treated (including
prevention), the method of administration, the type of compound
being used for treatment, any co-therapy involved, the patient's
age, weight, general medical condition, medical history, etc., and
its determination is well within the skill of a practicing
physician. Accordingly, it will be necessary for the therapist to
titer the dosage and modify the route of administration as required
to obtain the maximal therapeutic effect. If the PRO polypeptide
has a narrow host range, for the treatment of human patients
formulations comprising human PRO polypeptide, more preferably
native-sequence human PRO polypeptide, are preferred. The clinician
will administer the PRO polypeptide until a dosage is reached that
achieves the desired effect for treatment of the condition in
question. For example, if the objective is the treatment of CHF,
the amount would be one that inhibits the progressive cardiac
hypertrophy associated with this condition. The progress of this
therapy is easily monitored by echo cardiography. Similarly, in
patients with hypertrophic cardiomyopathy, the PRO polypeptide can
be administered on an empirical basis.
[0780] With the above guidelines, the effective dose generally is
within the range of from about 0.001 to about 1.0 mg/kg, more
preferably about 0.01-1.0 mg/kg, most preferably about 0.01-0.1
mg/kg.
[0781] For non-oral use in treating human adult hypertension, it is
advantageous to administer the PRO polypeptide in the form of an
injection at about 0.01 to 50 mg, preferably about 0.05 to 20 mg,
most preferably 1 to 20 mg, per kg body weight, 1 to 3 times daily
by intravenous injection. For oral administration, a molecule based
on the PRO polypeptide is preferably administered at about 5 mg to
1 g, preferably about 10 to 100 mg, per kg body weight, 1 to 3
times daily. It should be appreciated that endotoxin contamination
should be kept minimally at a safe level, for example, less than
0.5 ng/mg protein. Moreover, for human administration, the
formulations preferably meet sterility, pyrogenicity, general
safety, and purity as required by FDA Office and Biologics
standards.
[0782] The dosage regimen of a pharmaceutical composition
containing the PRO polypeptide to be used in tissue regeneration
will be determined by the attending physician considering various
factors that modify the action of the polypeptides, e.g., amount of
tissue weight desired to be formed, the site of damage, the
condition of the damaged tissue, the size of a wound, type of
damaged tissue (e.g., bone), the patient's age, sex, and diet, the
severity of any infection, time of administration, and other
clinical factors. The dosage may vary with the type of matrix used
in the reconstitution and with inclusion of other proteins in the
pharmaceutical composition. For example, the addition of other
known growth factors, such as IGF-I, to the final composition may
also affect the dosage. Progress can be monitored by periodic
assessment of tissue/bone growth and/or repair, for example,
X-rays, histomorphometric determinations, and tetracycline
labeling.
[0783] The route of PRO polypeptide or antagonist or agonist
administration is in accord with known methods, e.g., by injection
or infusion by intravenous, intramuscular, intracerebral,
intraperitoneal, intracerobrospinal, subcutaneous, intraocular,
intraarticular, intrasynovial, intrathecal, oral, topical, or
inhalation routes, or by sustained-release systems as noted below.
The PRO polypeptide or agonist or antagonists thereof also are
suitably administered by intratumoral, peritumoral, intralesional,
or perilesional routes, to exert local as well as systemic
therapeutic effects. The intraperitoneal route is expected to be
particularly useful, for example, in the treatment of ovarian
tumors.
[0784] If a peptide or small molecule is employed as an antagonist
or agonist, it is preferably administered orally or non-orally in
the form of a liquid or solid to mammals.
[0785] Examples of pharmacologically acceptable salts of molecules
that form salts and are useful hereunder include alkali metal salts
(e.g., sodium salt, potassium salt), alkaline earth metal salts
(e.g., calcium salt, magnesium salt), ammonium salts, organic base
salts (e.g., pyridine salt, triethylamine salt), inorganic acid
salts (e.g., hydrochloride, sulfate, nitrate), and salts of organic
acid (e.g., acetate, oxalate, p-toluenesulfonate).
[0786] For compositions herein that are useful for bone, cartilage,
tendon, or ligament regeneration, the therapeutic method includes
administering the composition topically, systemically, or locally
as an implant or device. When administered, the therapeutic
composition for use is in a pyrogen-free, physiologically
acceptable form. Further, the composition may desirably be
encapsulated or injected in a viscous form for delivery to the site
of bone, cartilage, or tissue damage. Topical administration may be
suitable for wound healing and tissue repair.
[0787] Preferably, for bone and/or cartilage formation, the
composition would include a matrix capable of delivering the
protein-containing composition to the site of bone and/or cartilage
damage, providing a structure for the developing bone and cartilage
and preferably capable of being resorbed into the body. Such
matrices may be formed of materials presently in use for other
implanted medical applications.
[0788] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance, and
interface properties. The particular application of the
compositions will define the appropriate formulation. Potential
matrices for the compositions may be biodegradable and chemically
defined calcium sulfate, tricalcium phosphate, hydroxyapatite,
polylactic acid, polyglycolic acid, and polyanhydrides. Other
potential materials are biodegradable and biologically
well-defined, such as bone or dermal collagen. Further matrices are
comprised of pure proteins or extracellular matrix components.
Other potential matrices are nonbiodegradable and chemically
defined, such as sintered hydroxyapatite, bioglass, aluminates, or
other ceramics. Matrices may be comprised of combinations of any of
the above-mentioned types of material, such as polylactic acid and
hydroxyapatite or collagen and tricalcium phosphate. The
bioceramics may be altered in composition, such as in
calcium-aluminate-phosphate and processing to alter pore size,
particle size, particle shape, and biodegradability.
[0789] One specific embodiment is a 50:50 (mole weight) copolymer
of lactic acid and glycolic acid in the form of porous particles
having diameters ranging from 150 to 800 microns. In some
applications, it will be useful to utilize a sequestering agent,
such as carboxymethyl cellulose or autologous blood clot, to
prevent the polypeptide compositions from disassociating from the
matrix.
[0790] One suitable family of sequestering agents is cellulosic
materials such as alkylcelluloses (including
hydroxyalkylcelluloses), including methylcellulose, ethylcellulose,
hydoxyethylcellulose, hydroxypropylcellulose,
hydroxypropylmethylcellulose, and carboxymethylcellulose, one
preferred being cationic salts of carboxymethylcellulose (CMC).
Other preferred sequestering agents include hyaluronic acid, sodium
alginate, poly(ethylene glycol), polyoxyethylene oxide,
carboxyvinyl polymer, and poly(vinyl alcohol). The amount of
sequestering agent useful herein is 0.5-20 wt %, preferably 1-10 wt
%, based on total formulation weight, which represents the amount
necessary to prevent desorption of the polypeptide (or its
antagonist) from the polymer matrix and to provide appropriate
handling of the composition, yet not so much that the progenitor
cells are prevented from infiltrating the matrix, thereby providing
the polypeptide (or its antagonist) the opportunity to assist the
osteogenic activity of the progenitor cells.
[0791] 5.2.4.12. Combination Therapies
[0792] The effectiveness of the PRO polypeptide or an agonist or
antagonist thereof in preventing or treating the disorder in
question may be improved by administering the active agent serially
or in combination with another agent that is effective for those
purposes, either in the same composition or as separate
compositions.
[0793] For example, for treatment of cardiac hypertrophy, PRO
polypeptide therapy can be combined with the administration of
inhibitors of known cardiac myocyte hypertrophy factors, e.g.,
inhibitors of .alpha.-adrenergic agonists such as phenylephrine;
endothelin-1 inhibitors such as BOSENTAN.TM. and MOXONODIN.TM.;
inhibitors to CT-1 (U.S. Pat. No. 5,679,545); inhibitors to LIF;
ACE inhibitors; des-aspartate-angiotensin I inhibitors (U.S. Pat.
No. 5,773,415), and angiotensin II inhibitors.
[0794] For treatment of cardiac hypertrophy associated with
hypertension, the PRO polypeptide can be administered in
combination with .alpha.-adrenergic receptor blocking agents, e.g.,
propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol,
penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol; ACE
inhibitors, e.g., quinapril, captopril, enalapril, ramipril,
benazepril, fosinopril, or lisinopril; diuretics, e.g.,
chlorothiazide, hydrochlorothiazide, hydroflumethazide,
methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide,
or indapamide; and/or calcium channel blockers, e.g., diltiazem,
nifedipine, verapamil, or nicardipine. Pharmaceutical compositions
comprising the therapeutic agents identified herein by their
generic names are commercially available, and are to be
administered following the manufacturers' instructions for dosage,
administration, adverse effects, contraindications, etc. See, e.g.,
Physicians' Desk Reference (Medical Economics Data Production Co.:
Montvale, N.J., 1997), 51th Edition.
[0795] Preferred candidates for combination therapy in the
treatment of hypertrophic cardiomyopathy are
.beta.-adrenergic-blocking drugs (e.g., propranolol, timolol,
tertalolol, carteolol, nadolol, betaxolol, penbutolol,
acetobutolol, atenolol, metoprolol, or carvedilol), verapamil,
difedipine, or diltiazem. Treatment of hypertrophy associated with
high blood pressure may require the use of antihypertensive drug
therapy, using calcium channel blockers, e.g., diltiazem,
nifedipine, verapamil, or nicardipine; .alpha.-adrenergic blocking
agents; diuretics, e.g., chlorothiazide, hydrochlorothiazide,
hydroflumethazide, methylchlothiazide, benzthiazide,
dichlorphenamide, acetazolamide, or indapamide; and/or
ACE-inhibitors, e.g., quinapril, captopril, enalapril, ramipril,
benazepril, fosinopril, or lisinopril.
[0796] For other indications, PRO polypeptides or their agonists or
antagonists may be combined with other agents beneficial to the
treatment of the bone and/or cartilage defect, wound, or tissue in
question. These agents include various growth factors such as EGF,
PDGF, TGF-.alpha. or TGF-.beta., IGF, FGF, and CTGF.
[0797] In addition, PRO polypeptides or their agonists or
antagonists used to treat cancer may be combined with cytotoxic,
chemotherapeutic, or growth-inhibitory agents as identified above.
Also, for cancer treatment, the PRO polypeptide or agonist or
antagonist thereof is suitably administered serially or in
combination with radiological treatments, whether involving
irradiation or administration of radioactive substances.
[0798] The effective amounts of the therapeutic agents administered
in combination with the PRO polypeptide or agonist or antagonist
thereof will be at the physician's or veterinarian's discretion.
Dosage administration and adjustment is done to achieve maximal
management of the conditions to be treated. For example, for
treating hypertension, these amounts ideally take into account use
of diuretics or digitalis, and conditions'such as hyper- or
hypotension, renal impairment, etc. The dose will additionally
depend on such factors as the type of the therapeutic agent to be
used and the specific patient being treated. Typically, the amount
employed will be the same dose as that used, if the given
therapeutic agent is administered without the PRO polypeptide.
[0799] 5.2.4.13. Articles of Manufacture
[0800] An article of manufacture such as a kit containing the PRO
polypeptide or agonists or antagonists thereof useful for the
diagnosis or treatment of the disorders described above comprises
at least a container and a label. Suitable containers include, for
example, bottles, vials, syringes, and test tubes. The containers
may be formed from a variety of materials such as glass or plastic.
The container holds a composition that is effective for diagnosing
or treating the condition and may have a sterile access port (for
example, the container may be an intravenous solution bag or a vial
having a stopper pierceable by a hypodermic injection needle). The
active agent in the composition is the PRO polypeptide or an
agonist or antagonist thereto. The label on, or associated with,
the container indicates that the composition is used for diagnosing
or treating the condition of choice. The article of manufacture may
further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as phosphate-buffered
saline, Ringer's solution, and dextrose solution. It may further
include other materials desirable from a commercial and user
standpoint, including other buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use. The
article of manufacture may also comprise a second or third
container with another active agent as described above.
[0801] 5.2.5. Antibodies
[0802] Some of the most promising drug candidates according to the
present invention are antibodies and antibody fragments that may
inhibit the production or the gene product of the genes identified
herein and/or reduce the activity of the gene products.
[0803] 5.2.5.1. Polyclonal Antibodies
[0804] Methods of preparing polyclonal antibodies are known to the
skilled artisan. Polyclonal antibodies can be raised in a mammal,
for example, by one or more injections of an immunizing agent and,
if desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the
PRO polypeptide or a fusion protein thereof. It may be useful to
conjugate the immunizing agent to a protein known to be immunogenic
in the mammal being immunized. Examples of such immunogenic
proteins include, but are not limited to, keyhole limpet
hemocyanin, serum albumin, bovine thyroglobulin, and soybean
trypsin inhibitor. Examples of adjuvants that may be employed
include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A or synthetic trehalose dicorynomycolate).
The immunization protocol may be selected by one skilled in the art
without undue experimentation.
[0805] 5.2.5.2. Monoclonal Antibodies
[0806] The anti-PRO antibodies may, alternatively, be monoclonal
antibodies. Monoclonal antibodies may be prepared using hybridoma
methods, such as those described by Kohler and Milstein, Nature,
256:495 (1975). In a hybridoma method, a mouse, hamster, or other
appropriate host animal is typically immunized with an immunizing
agent to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically bind to the immunizing
agent. Alternatively, the lymphocytes may be immunized in
vitro.
[0807] The immunizing agent will typically include the PRO
polypeptide or a fusion protein thereof. Generally, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell. Goding,
Monoclonal Antibodies: Principles and Practice (New York: Academic
Press, 1986), pp. 59-103. Immortalized cell lines are usually
transformed mammalian cells, particularly myeloma cells of rodent,
bovine, and human origin. Usually, rat or mouse myeloma cell lines
are employed. The hybridoma cells may be cultured in a suitable
culture medium that preferably contains one or more substances that
inhibit the growth or survival of the unfused, immortalized cells.
For example, if the parental cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture
medium for the hybridomas typically will include hypoxanthine,
aminopterin, and thymidine ("HAT medium"), which substances prevent
the growth of HGPRT-deficient cells.
[0808] Preferred immortalized cell lines are those that fuse
efficiently, support stable high-level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Manassas, Va. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies. Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications (Marcel Dekker, Inc.: New
York, 1987) pp. 51-63.
[0809] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the PRO polypeptide. Preferably, the binding
specificity of monoclonal antibodies produced by the hybridoma
cells is determined by immunoprecipitation or by an in vitro
binding assay, such as radioimmunoassay (RIA) or enzyme-linked
immunoabsorbent assay (ELISA). Such techniques and assays are known
in the art. The binding affinity of the monoclonal antibody can,
for example, be determined by the Scatchard analysis of Munson and
Pollard, Anal. Biochem., 107:220 (1980).
[0810] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods. Goding, supra. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0811] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0812] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy- and light-chain
constant domains in place of the homologous murine sequences (U.S.
Pat. No. 4,816,567; Morrison et al., supra) or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0813] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fe region so as to
prevent heavy-chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0814] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly Fab fragments, can be accomplished using routine
techniques known in the art.
[0815] 5.2.5.3. Human and Humanized Antibodies
[0816] The anti-PRO antibodies may further comprise humanized
antibodies or human antibodies. Humanized forms of non-human (e.g.,
murine) antibodies are chimeric immunoglobulins, immunoglobulin
chains, or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2,
or other antigen-binding subsequences of antibodies) that contain
minimal sequence derived from non-human immunoglobulin. Humanized
antibodies include human immunoglobulins (recipient antibody) in
which residues from a CDR of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat, or rabbit having the desired specificity, affinity, and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues that are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin, and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody
preferably also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. Jones et al., Nature, 321: 522-525 (1986);
Riechmann et al., Nature, 332: 323-329 (1988); Presta, Curr. Op.
Struct. Biol., 2:593-596 (1992).
[0817] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source that is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al, Nature,
321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988);
Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Pat. No. 4,816,567), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized antibodies are typically human antibodies in
which some CDR residues and possibly some FR residues are
substituted by residues from analogous sites in rodent
antibodies.
[0818] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries.
Hoogenboom and Winter, J. Mol. Biol., 227: 381(1991); Marks et al.,
J. Mol. Biol., 222: 581(1991). The techniques of Cole et al. and
Boemer et al. are also available for the preparation of human
monoclonal antibodies. Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol., 147(1): 86-95 (1991). Similarly, human antibodies can be
made by introducing human immunoglobulin loci into transgenic
animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge,
human antibody production is observed that closely resembles that
seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire. This approach is described, for
example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825;
5,625,126; 5,633,425; and 5,661,016, and in the following
scientific publications: Marks et al., Bio/Technology, 10: 779-783
(1992); Lonberg et al., Nature, 368: 856-859 (1994); Morrison,
Nature, 368: 812-813 (1994); Fishwild et al., Nature Biotechnology,
14: 845-851 (1996); Neuberger, Nature Biotechnology, 14: 826
(1996); Lonberg and Huszar, Intern. Rev. Immunol., 13: 65-93
(1995).
[0819] 5.2.5.4. Bispecific Antibodies
[0820] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for the PRO polypeptide, the other one is for any
other antigen, and preferably for a cell-surface protein or
receptor or receptor subunit.
[0821] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities. Milstein and Cuello, Nature, 305: 537-539
(1983). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published May 13,
1993, and in Traunecker et al., EMBO J., 10: 3655-3659 (1991).
[0822] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant-domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH 1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. For further details of generating bispecific
antibodies, see, for example, Suresh et al., Methods in Enzymology,
121: 210 (1986).
[0823] 5.2.5.5. Heteroconjugate Antibodies
[0824] Heteroconjugate antibodies are composed of two covalently
joined antibodies. Such antibodies have, for example, been proposed
to target immune-system cells to unwanted cells (U.S. Pat. No.
4,676,980), and for treatment of HIV infection. WO 91/00360; WO
92/200373; EP 03089. It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving crosslinking agents. For
example, immunotoxins may be constructed using a disulfide-exchange
reaction or by forming a thioether bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0825] 5.2.5.6. Effector Function Engineering
[0826] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance, e.g., the
effectiveness of the antibody in treating cancer. For example,
cysteine residue(s) may be introduced into the Fc region, thereby
allowing interchain disulfide bond formation in this region. The
homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See, Caron et al., J. Exp. Med., 176: 1191-1195 (1992) and Shopes,
J. Immunol., 148: 2918-2922 (1992). Homodimeric antibodies with
enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al.,
Cancer Research, 53: 2560-2565 (1993). Alternatively, an antibody
can be engineered that has dual Fc regions and may thereby have
enhanced complement lysis and ADCC capabilities. See, Stevenson et
al., Anti-Cancer Drug Design, 3: 219-230 (1989).
[0827] 5.2.5.7. Immunoconjugates
[0828] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, toxin (e.g., an enzymatically active toxin
of bacterial, fungal, plant, or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
[0829] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof that can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fiordii proteins,
dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and
PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin, and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y, and .sup.186Re.
[0830] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein-coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCl), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutaraldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science, 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See, WO94/11026.
[0831] In another embodiment, the antibody may be conjugated to a
"receptor" (such as streptavidin) for utilization in tumor
pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g., avidin) that is conjugated to a
cytotoxic agent (e.g., a radionucleotide).
[0832] 5.2.5.8. Immunoliposomes
[0833] The antibodies disclosed herein may also be formulated as
immunoliposomes. Liposomes containing the antibody are prepared by
methods known in the art, such as described in Epstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc.
Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045
and 4,544,545. Liposomes with enhanced circulation time are
disclosed in U.S. Pat. No. 5,013,556.
[0834] Particularly useful liposomes can be generated by the
reverse-phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange
reaction. A chemotherapeutic agent (such as Doxorubicin) is
optionally contained within the liposome. See, Gabizon et al., J.
National Cancer Inst., 81(19): 1484 (1989).
[0835] 5.2.5.9. Pharmaceutical Compositions of Antibodies
[0836] Antibodies specifically binding a PRO polypeptide identified
herein, as well as other molecules identified by the screening
assays disclosed hereinbefore, can be administered for the
treatment of various disorders as noted above and below in the form
of pharmaceutical compositions.
[0837] If the PRO polypeptide is intracellular and whole antibodies
are used as inhibitors, internalizing antibodies are preferred.
However, lipofections or liposomes can also be used to deliver the
antibody, or an antibody fragment, into cells. Where antibody
fragments are used, the smallest inhibitory fragment that
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable-region sequences of
an antibody, peptide molecules can be designed that retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA,
90: 7889-7893 (1993).
[0838] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise an agent that enhances its function, such
as, for example, a cytotoxic agent, cytokine, chemotherapeutic
agent, or growth-inhibitory agent. Such molecules are suitably
present in combination in amounts that are effective for the
purpose intended.
[0839] The active ingredients may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles, and nanocapsules) or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences,
supra.
[0840] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0841] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g., films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.TM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37.degree. C., resulting in a
loss of biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0842] 5.2.5.10. Methods of Treatment Using the Antibody
[0843] It is contemplated that the antibodies to a PRO polypeptide
may be used to treat various cardiovascular, endothelial, and
angiogenic conditions as noted above.
[0844] The antibodies are administered to a mammal, preferably a
human, in accord with known methods, such as intravenous
administration as a bolus or by continuous infusion over a period
of time, by intramuscular, intraperitoneal, intracerobrospinal,
subcutaneous, intra-articular, intrasynovial, intrathecal, oral,
topical, or inhalation routes. Intravenous administration of the
antibody is preferred.
[0845] Other therapeutic regimens may be combined with the
administration of the antibodies of the instant invention as noted
above. For example, if the antibodies are to treat cancer, the
patient to be treated with such antibodies may also receive
radiation therapy. Alternatively, or in addition, a
chemotherapeutic agent may be administered to the patient.
Preparation and dosing schedules for such chemotherapeutic agents
may be used according to manufacturers' instructions or as
determined empirically by the skilled practitioner. Preparation and
dosing schedules for such chemotherapy are also described in
Chemotherapy Service, Ed., M. C. Perry (Williams & Wilkins:
Baltimore, Md., 1992). The chemotherapeutic agent may precede, or
follow administration of the antibody, or may be given
simultaneously therewith. The antibody may be combined with an
anti-estrogen compound such as tamoxifen or EVISTA.TM. or an
anti-progesterone such as onapristone (see, EP 616812) in dosages
known for such molecules.
[0846] If the antibodies are used for treating cancer, it may be
desirable also to administer antibodies against other
tumor-associated antigens, such as antibodies that bind to one or
more of the ErbB2, EGFR, ErbB3, ErbB4, or VEGF receptor(s). These
also include the agents set forth above. Also, the antibody is
suitably administered serially or in combination with radiological
treatments, whether involving irradiation or administration of
radioactive substances. Alternatively, or in addition, two or more
antibodies binding the same or two or more different antigens
disclosed herein may be co-administered to the patient. Sometimes,
it may be beneficial also to administer one or more cytokines to
the patient. In a preferred embodiment, the antibodies herein are
co-administered with a growth-inhibitory agent. For example, the
growth-inhibitory agent may be administered first, followed by an
antibody of the present invention. However, simultaneous
administration or administration of the antibody of the present
invention first is also contemplated. Suitable dosages for the
growth-inhibitory agent are those presently used and may be lowered
due to the combined action (synergy) of the growth-inhibitory agent
and the antibody herein.
[0847] In one embodiment, vascularization of tumors is attacked in
combination therapy. The anti-PRO polypeptide antibody and another
antibody (e.g., anti-VEGF) are administered to tumor-bearing
patients at therapeutically effective doses as determined, for
example, by observing necrosis of the tumor or its metastatic foci,
if any. This therapy is continued until such time as no further
beneficial effect is observed or clinical examination shows no
trace of the tumor or any metastatic foci. Then TNF is
administered, alone or in combination with an auxiliary agent such
as alpha-, beta-, or gamma-interferon, anti-HER2 antibody,
heregulin, anti-heregulin antibody, D-factor, interleukin-1 (IL-1),
interleukin-2 (IL-2), granulocyte-macrophage colony stimulating
factor (GM-C SF), or agents that promote microvascular coagulation
in tumors, such as anti-protein C antibody, anti-protein S
antibody, or C4b binding protein (see, WO 91/01753, published Feb.
21, 1991), or heat or radiation.
[0848] Since the auxiliary agents will vary in their effectiveness,
it is desirable to compare their impact on the tumor by matrix
screening in conventional fashion. The administration of anti-PRO
polypeptide antibody and TNF is repeated until the desired clinical
effect is achieved. Alternatively, the anti-PRO polypeptide
antibody is administered together with TNF and, optionally
auxiliary agent(s). In instances where solid tumors are found in
the limbs or in other locations susceptible to isolation from the
general circulation, the therapeutic agents described herein are
administered to the isolated tumor or organ. In other embodiments,
a FGF or PDGF antagonist, such as an anti-FGF or an anti-PDGF
neutralizing antibody, is administered to the patient in
conjunction with the anti-PRO polypeptide antibody. Treatment with
anti-PRO polypeptide antibodies preferably may be suspended during
periods of wound healing or desirable neovascularization.
[0849] For the prevention or treatment of cardiovascular,
endothelial, and angiogenic disorder, the appropriate dosage of an
antibody herein will depend on the type of disorder to be treated,
as defined above, the severity and course of the disease, whether
the antibody is administered for preventive or therapeutic
purposes, previous therapy, the patient's clinical history and
response to the antibody, and the discretion of the attending
physician. The antibody is suitably administered to the patient at
one time or over a series of treatments.
[0850] For example, depending on the type and severity of the
disorder, about 1 .mu.g/kg to 50 mg/kg (e.g., 0. 1-20 mg/kg) of
antibody is an initial candidate dosage for administration to the
patient, whether, for example, by one or more separate
administrations, or by continuous infusion. A typical daily or
weekly dosage might range from about 1 .mu.g/kg to 100 mg/kg or
more, depending on the factors mentioned above. For repeated
administrations over several days or longer, depending on the
condition, the treatment is repeated or sustained until a desired
suppression of disorder symptoms occurs. However, other dosage
regimens may be useful. The progress of this therapy is easily
monitored by conventional techniques and assays, including, for
example, radiographic tumor imaging.
[0851] 5.2.5.11. Articles of Manufacture with Antibodies
[0852] An article of manufacture containing a container with the
antibody and a label is also provided. Such articles are described
above, wherein the active agent is an anti-PRO antibody.
[0853] 5.2.5.12. Diagnosis and Prognosis of Tumors using
Antibodies
[0854] If the indication for which the antibodies are used is
cancer, while cell-surface proteins, such as growth receptors over
expressed in certain tumors, are excellent targets for drug
candidates or tumor (e.g., cancer) treatment, the same proteins
along with PRO polypeptides find additional use in the diagnosis
and prognosis of tumors. For example, antibodies directed against
the PRO polypeptides may be used as tumor diagnostics or
prognostics.
[0855] For example, antibodies, including antibody fragments, can
be used qualitatively or quantitatively to detect the expression of
genes including the gene encoding the PRO polypeptide. The antibody
preferably is equipped with a detectable, e.g., fluorescent label,
and binding can be monitored by light microscopy, flow cytometry,
fluorimetry, or other techniques known in the art. Such binding
assays are performed essentially as described above.
[0856] In situ detection of antibody binding to the marker gene
products can be performed, for example, by immunofluorescence or
immunoelectron microscopy. For this purpose, a histological
specimen is removed from the patient, and a labeled antibody is
applied to it, preferably by overlaying the antibody on a
biological sample. This procedure also allows for determining the
distribution of the marker gene product in the tissue examined. It
will be apparent to those skilled in the art that a wide variety of
histological methods are readily available for in situ
detection.
[0857] The following Examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0858] The disclosures of all patent and literature references
cited in the present specification are hereby incorporated by
reference in their entirety.
6. EXAMPLES
[0859] Commercially available reagents referred to in the Examples
were used according to manufacturers instructions unless otherwise
indicated. The source of those cells identified in the following
Examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, Manassas, Va.
Unless otherwise noted, the present invention uses standard
procedures of recombinant DNA technology, such as those described
hereinabove and in the following textbooks: Sambrook et al., supra;
Ausubel et al., Current Protocols in Molecular Biology (Green
Publishing Associates and Wiley Interscience, N.Y., 1989); Innis et
al., PCR Protocols: A Guide to Methods and Aplications (Academic
Press, Inc.: N.Y., 1990); Harlow et al., Antibodies: A Laboratory
Manual (Cold Spring Harbor Press: Cold Spring Harbor, 1988); Gait,
Oligonucleotide Synthesis (IRL Press: Oxford, 1984); Freshney,
Animal Cell Culture, 1987; Coligan et al., Current Protocols in
Immunology, 1991.
6.1. Example 1
Extracellular Domain Homology Screening to Identify Novel
Polypeptides and cDNA Encoding Therefor
[0860] The extracellular domain (ECD) sequences (including the
secretion signal sequence, if any) from about 950 known secreted
proteins from the Swiss-Prot public database were used to search
EST databases. The EST databases included public databases (e.g.,
Dayhoff, GenBank), and proprietary databases (e.g. LIFESEQ.RTM.,
Incyte Pharmaceuticals, Palo Alto, Calif.). The search was
performed using the computer program BLAST or BLAST-2 (Altschul et
al., Methods in Enzymology, 266:460-480 (1996)) as a comparison of
the ECD protein sequences to a 6 frame translation of the EST
sequences. Those comparisons with a BLAST score of 70 (or in some
cases, 90) or greater that did not encode known proteins were
clustered and assembled into consensus DNA sequences with the
program "phrap" (Phil Green, University of Washington, Seattle,
Wash.).
[0861] Using this extracellular domain homology screen, consensus
DNA sequences were assembled relative to the other identified EST
sequences using phrap. In addition, the consensus DNA sequences
obtained were often (but not always) extended using repeated cycles
of BLAST or BLAST-2 and phrap to extend the consensus sequence as
far as possible using the sources of EST sequences discussed
above.
[0862] Based upon the consensus sequences obtained as described
above, oligonucleotides were then synthesized and used to identify
by PCR a cDNA library that contained the sequence of interest and
for use as probes to isolate a clone of the full-length coding
sequence for a PRO polypeptide. Forward and reverse PCR primers
generally range from 20 to 30 nucleotides and are often designed to
give a PCR product of about 100-1000 bp in length. The probe
sequences are typically 40-55 bp in length. In some cases,
additional oligonucleotides are synthesized when the consensus
sequence is greater than about 1-1.5 kbp. In order to screen
several libraries for a full-length clone, DNA from the libraries
was screened by PCR amplification, as per Ausubel et al., Current
Protocols in Molecular Biology, with the PCR primer pair. A
positive library was then used to isolate clones encoding the gene
of interest using the probe oligonucleotide and one of the primer
pairs.
[0863] The cDNA libraries used to isolate the cDNA clones were
constructed by standard methods using commercially available
reagents such as those from Invitrogen, San Diego, Calif. The cDNA
was primed with oligo dT containing a NotI site, linked with blunt
to SalI hemikinased adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRKB or pRKD;
pRK5B is a precursor of pRK.sup.5D that does not contain the SfiI
site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the
unique XhoI and NotI sites.
6.2. Example 2
Isolation of cDNA Clones by Amylase Screening
[0864] 6.2.1. Preparation of Oligo dT Primed cDNA Library
[0865] mRNA was isolated from a human tissue of interest using
reagents and protocols from Invitrogen, San Diego, Calif. (Fast
Track 2). This RNA was used to generate an oligo dT primed cDNA
library in the vector pRK5D using reagents and protocols from Life
Technologies, Gaithersburg, Md. (Super Script Plasmid System). In
this procedure, the double stranded cDNA was sized to greater than
1000 bp and the SalI/NotI linkered cDNA was cloned into XhoI/NotI
cleaved vector. pRK5D is a cloning vector that has an sp6
transcription initiation site followed by an SfiI restriction
enzyme site preceding the Xhol/NotI cDNA cloning sites.
[0866] 6.2.2. Preparation of Random Primed cDNA Library
[0867] A secondary cDNA library was generated in order to
preferentially represent the 5' ends of the primary cDNA clones.
Sp6 RNA was generated from the primary library (described above),
and this RNA was used to generate a random primed cDNA library in
the vector pSST-AMY.0 using reagents and protocols from Life
Technologies (Super Script Plasmid System, referenced above). In
this procedure the double stranded cDNA was sized to 500-1000 bp,
Tinkered with blunt to NotI adaptors, cleaved with SfiI, and cloned
into SfiI/NotI cleaved vector. pSST-AMY.0 is a cloning vector that
has a yeast alcohol dehydrogenase promoter preceding the cDNA
cloning sites and the mouse amylase sequence (the mature sequence
without the secretion signal) followed by the yeast alcohol
dehydrogenase terminator, after the cloning sites. Thus, cDNAs
cloned into this vector that are fused in frame with amylase
sequence will lead to the secretion of amylase from appropriately
transfected yeast colonies.
[0868] 6.2.3. Transformation and Detection
[0869] DNA from the library described in paragraph 2 above was
chilled on ice to which was added electrocompetent DH10B bacteria
(Life Technologies, 20 ml). The bacteria and vector mixture was
then electroporated as recommended by the manufacturer.
Subsequently, SOC media (Life Technologies, 1 ml) was added and the
mixture was incubated at 37.degree. C. for 30 minutes. The
transformants were then plated onto 20 standard 150 mm LB plates
containing ampicillin and incubated for 16 hours (37.degree. C.).
Positive colonies were scraped off the plates and the DNA was
isolated from the bacterial pellet using standard protocols, e.g.,
CsCl-gradient. The purified DNA was then carried on to the yeast
protocols below.
[0870] The yeast methods were divided into three categories: (1)
Transformation of yeast with the plasmid/cDNA combined vector; (2)
Detection and isolation of yeast clones secreting amylase; and (3)
PCR amplification of the insert directly from the yeast colony and
purification of the DNA for sequencing and further analysis.
[0871] The yeast strain used was HD56-5A (ATCC-90785). This strain
has the following genotype: MAT alpha, ura3-52, leu2-3, leu2-112,
his3-11, his3-15, MAL.sup.+, SUC.sup.+, GAL.sup.+. Preferably,
yeast mutants can be employed that have deficient
post-translational pathways. Such mutants may have translocation
deficient alleles in sec71, sec72, sec62, with truncated sec71
being most preferred. Alternatively, antagonists (including
antisense nucleotides and/or ligands) which interfere with the
normal operation of these genes, other proteins implicated in this
post translation pathway (e.g., SEC61p, SEC72p, SEC62p, SEC63p,
TDJ1p or SSA1p-4p) or the complex formation of these proteins may
also be preferably employed in combination with the
amylase-expressing yeast.
[0872] Transformation was performed based on the protocol outlined
by Gietz et al., Nucl. Acid. Res., 20:1425 (1992). Transformed
cells were then inoculated from agar into YEPD complex media broth
(100 ml) and grown overnight at 30.degree. C. The YEPD broth was
prepared as described in Kaiser et al., Methods in Yeast Genetics,
Cold Spring Harbor Press, Cold Spring Harbor, N.Y., p. 207 (1994).
The overnight culture was then diluted to about 2.times.10.sup.6
cells/ml (approx. OD.sub.600=0.1) into fresh YEPD broth (500 ml)
and regrown to .times.10.sup.7 cells/ml (approx.
OD.sub.600=0.4-0.5).
[0873] The cells were then harvested and prepared for
transformation by transfer into GS3 rotor bottles in a Sorval GS3
rotor at 5,000 rpm for 5 minutes, the supernatant discarded, and
then resuspended into sterile water, and centrifuged again in 50 ml
falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge. The
supernatant was discarded and the cells were subsequently washed
with LiAc/TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM
Li.sub.2OOCCH.sub.3), and resuspended into LiAc/TE (2.5 ml).
[0874] Transformation took place by mixing the prepared cells (100
.mu.l) with freshly denatured single stranded salmon testes DNA
(Lofstrand Labs, Gaithersburg, Md.) and transforming DNA (1 .mu.g,
vol. <10 .mu.l) in microfuge tubes. The mixture was mixed
briefly by vortexing, then 40% PEG/TE (600 .mu.l, 40% polyethylene
glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li.sub.2OOCCH.sub.3,
pH 7.5) was added. This mixture was gently mixed and incubated at
30.degree. C. while agitating for 30 minutes. The cells were then
heat shocked at 42.degree. C. for 15 minutes the reaction vessel
centrifuged in a microfuge at 12,000 rpm for 5-10 seconds, decanted
and resuspended into TE (500 .mu.l, 10 mM Tris-HCl, 1 mM EDTA pH
7.5) followed by recentrifugation. The cells were then diluted into
TE (1 ml) and aliquots (200 .mu.l) were spread onto the selective
media previously prepared in 150 mm growth plates (VWR).
[0875] Alternatively, instead of multiple small reactions, the
transformation was performed using a single, large scale reaction,
wherein reagent amounts were scaled up accordingly.
[0876] The selective media used was a synthetic complete dextrose
agar lacking uracil (SCD-Ura) prepared as described in Kaiser et
al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold
Spring Harbor, N.Y., p. 208-210 (1994). Transformants were grown at
30.degree. C. for 2-3 days.
[0877] The detection of colonies secreting amylase was performed by
including red starch in the selective growth media. Starch was
coupled to the red dye (Reactive Red-120, Sigma) as per the
procedure described by Biely et al., Anal. Biochem., 172:176-179
(1988). The coupled starch was incorporated into the SCD-Ura agar
plates at a final concentration of 0.15% (w/v), and was buffered
with potassium phosphate to a pH of 7.0 (50-100 mM final
concentration).
[0878] The positive colonies were picked and streaked across fresh
selective media (onto 150 mm plates) in order to obtain well
isolated and identifiable single colonies. Well isolated single
colonies positive for amylase secretion were detected by direct
incorporation of red starch into buffered SCD-Ura agar. Positive
colonies were determined by their ability to break down starch
resulting in a clear halo around the positive colony visualized
directly.
[0879] 6.2.4. Isolation of DNA by PCR Amplification
[0880] When a positive colony was isolated, a portion of it was
picked by a toothpick and diluted into sterile water (30 .mu.l) in
a 96 well plate. At this time, the positive colonies were either
frozen and stored for subsequent analysis or immediately amplified.
An aliquot of cells (5 .mu.l) was used as a template for the PCR
reaction in a 25 .mu.l volume containing: 0.5 .mu.l Klentaq
(Clontech, Palo Alto, Calif.); 4.0 .mu.l 10 mM dNTP's (Perkin
Elmer-Cetus); 2.5 .mu.l Kentaq buffer (Clontech); 0.25 .mu.l
forward oligo 1; 0.25 .mu.l reverse oligo 2; 12.5 .mu.l distilled
water. The sequence of the forward oligonucleotide 1 was:
[0881] 5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID
NO: 382)
[0882] The sequence of reverse oligonucleotide 2 was:
[0883] 5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID NO:
383)
[0884] PCR was then performed as follows:
6 a. Denature 92.degree. C., 5 minutes b. 3 cycles of: Denature
92.degree. C., 30 seconds Anneal 59.degree. C., 30 seconds Extend
72.degree. C., 60 seconds c. 3 cycles of: Denature 92.degree. C.,
30 seconds Anneal 57.degree. C., 30 seconds Extend 72.degree. C.,
60 seconds d. 25 cycles of: Denature 92.degree. C., 30 seconds
Anneal 55.degree. C., 30 seconds Extend 72.degree. C., 60 seconds
e. Hold 4.degree. C.
[0885] The underlined regions of the oligonucleotides annealed to
the ADH promoter region and the amylase region, respectively, and
amplified a 307 bp region from vector pSST-AMY.0 when no insert was
present. Typically, the first 18 nucleotides of the 5' end of these
oligonucleotides contained annealing sites for the, sequencing
primers. Thus, the total product of the PCR reaction from an empty
vector was 343 bp. However, signal sequence-fused cDNA resulted in
considerably longer nucleotide sequences.
[0886] Following the PCR, an aliquot of the reaction (5 .mu.l) was
examined by agarose gel electrophoresis in a 1% agarose gel using a
Tris-Borate-EDTA (TBE) buffering system as described by Sambrook et
al., supra. Clones resulting in a single strong PCR product larger
than 400 bp were further analyzed by DNA sequencing after
purification with a 96 Qiaquick PCR clean-up column (Qiagen Inc.,
Chatsworth, Calif.).
6.3. Example 3
Isolation of cDNA Clones Using Signal Algorithm Analysis
[0887] Various polypeptide-encoding nucleic acid sequences were
identified by applying a proprietary signal sequence finding
algorithm developed by Genentech, Inc., (South San Francisco,
Calif.) upon ESTs as well as clustered and assembled EST fragments
from public (e.g., GenBank) and/or private (LIFESEQ.RTM., Incyte
Pharmaceuticals, Inc., Palo Alto, Calif.) databases. The signal
sequence algorithm computes a secretion signal score based on the
character of the DNA nucleotides surrounding the first and
optionally the second methionine codon(s) (ATG) at the 5'-end of
the sequence or sequence fragment under consideration. The
nucleotides following the first ATG must code for at least 35
unambiguous amino acids without any stop codons. If the first ATG
has the required amino acids, the second is not examined. If
neither meets the requirement, the candidate sequence is not
scored. In order to determine whether the EST sequence contains an
authentic signal sequence, the DNA and corresponding amino acid
sequences surrounding the ATG codon are scored using a set of seven
sensors (evaluation parameters) known to be associated with
secretion signals. Use of this algorithm resulted in the
identification of numerous polypeptide-encoding nucleic acid
sequences.
6.4. Example 4
Isolation of cDNA Clones Encoding Human PRO Polypeptides
[0888] Using the techniques described in Examples 1 to 3 above,
numerous full-length cDNA clones were identified as encoding PRO
polypeptides as disclosed herein. These cDNAs were then deposited
under the terms of the Budapest Treaty with the American Type
Culture Collection, 10801 University Blvd., Manassas, Va.
20110-2209, USA (ATCC) as shown in Table 7 below.
7 TABLE 7 Material ATCC Dep. No. Deposit Date 23330-1390 209775
Apr. 14, 1998 23339-1130 209282 Sep. 18, 1997 26846-1397 203406
Oct. 27, 1998 26847-1395 209772 Apr. 14, 1998 27865-1091 209296
Sep. 23, 1997 30868-1156 1437-PTA Mar. 2, 2000 30871-1157 209380
Oct. 16, 1997 32286-1191 209385 Oct. 16, 1997 33089-1132 209262
Sep. 16, 1997 33092-1202 209420 Oct. 28, 1997 33100-1159 209377
Oct. 16, 1997 33223-1136 209264 Sep. 16, 1997 34392-1170 209526
Dec. 10, 1997 34431-1177 209399 Oct. 17, 1997 34433-1308 209719
Mar. 31, 1998 34434-1139 209252 Sep. 16, 1997 35600-1162 209370
Oct. 16, 1997 35673-1201 209418 Oct. 28, 1997 35880-1160 209379
Oct. 16, 1997 35918-1174 209402 Oct. 17, 1997 36350-1158 209378
Oct. 16, 1997 36638-1056 209456 Nov. 12, 1997 38268-1188 209421
Oct. 28, 1997 40370-1217 209485 Nov. 21, 1997 40628-1216 209432
Nov. 7, 1997 43316-1237 209487 Nov. 21, 1997 44196-1353 209847 May
6, 1998 45409-2511 203579 Jan. 12, 1999 45419-1252 209616 Feb. 5,
1998 46777-1253 209619 Feb. 5, 1998 48336-1309 209669 Mar. 11, 1998
48606-1479 203040 Jul. 1, 1998 49435-1219 209480 Nov. 21, 1997
49631-1328 209806 Apr. 28, 1998 50919-1361 209848 May 6, 1998
50920-1325 209700 Mar. 26, 1998 50921-1458 209859 May 12, 1998
52758-1399 209773 Apr. 14, 1998 53517-1366-1 209802 Apr. 23, 1998
53915-1258 209593 Jan. 21, 1998 53974-1401 209774 Apr. 14, 1998
53987-1438 209858 May 12, 1998 56047-1456 209948 Jun. 9, 1998
56050-1455 203011 Jun. 23, 1998 56110-1437 203113 Aug. 11, 1998
56405-1357 209849 May 6, 1998 56433-1406 209857 May 12, 1998
56439-1376 209864 May 12, 1998 56529-1647 203293 Sep. 29, 1998
56865-1491 203022 Jun. 23, 1998 56965-1356 209842 May 6, 1998
57033-1403-1 209905 May 27, 1998 57037-1444 209903 May 27, 1998
57039-1402 209777 Apr. 14, 1998 57689-1385 209869 May 14, 1998
57690-1374 209950 Jun. 9, 1998 57694-1341 203017 Jun. 23, 1998
57695-1340 203006 Jun. 23, 1998 57699-1412 203020 Jun. 23, 1998
57700-1408 203583 Jan. 12, 1999 57708-1411 203021 Jun. 23, 1998
57838-1337 203014 Jun. 23, 1998 58847-1383 209879 May 20, 1998
58852-1637 203271 Sep. 22, 1998 58853-1423 203016 Jun. 23, 1998
59212-1627 203245 Sep. 9, 1998 59220-1514 209962 Jun. 9, 1998
59493-1420 203050 Jul. 1, 1998 59497-1496 209941 Jun. 4, 1998
59586-1520 203288 Sep. 29, 1998 59588-1571 203106 Aug. 11, 1998
59620-1463 209989 Jun. 16, 1998 59622-1334 209984 Jun. 16, 1998
59777-1480 203111 Aug. 11, 1998 59848-1512 203088 Aug. 4, 1998
59849-1504 209986 Jun. 16, 1998 60621-1516 203091 Aug. 4, 1998
60622-1525 203090 Aug. 4, 1998 60764-1533 203452 Nov. 10, 1998
60783-1611 203130 Aug. 18, 1998 61755-1554 203112 Aug. 11, 1998
62306-1570 203254 Sep. 9, 1998 62312-2558 203836 Mar. 9, 1999
62814-1521 203093 Aug. 4, 1998 62872-1509 203100 Aug. 4, 1998
64883-1526 203253 Sep. 9, 1998 64886-1601 203241 Sep. 9, 1998
64889-1541 203250 Sep. 9, 1998 64896-1539 203238 Sep. 9, 1998
64897-1628 203216 Sep. 15, 1998 64903-1553 203223 Sep. 15, 1998
64908-1163-1 203243 Sep. 9, 1998 64950-1590 203224 Sep. 15, 1998
65402-1540 203252 Sep. 9, 1998 65404-1551 203244 Sep. 9, 1998
65405-1547 203476 Nov. 17, 1998 65410-1569 203231 Sep. 15, 1998
65412-1523 203094 Aug. 4, 1998 66307-2661 431-PTA Jul. 27, 1999
66526-1616 203246 Sep. 9, 1998 66659-1593 203269 Sep. 22, 1998
66660-1585 203279 Sep. 22, 1998 66667-1596 203267 Sep. 22, 1998
66672-1586 203265 Sep. 22, 1998 66675-1587 203282 Sep. 22, 1998
67300-1605 203163 Aug. 25, 1998 68818-2536 203657 Feb. 9, 1999
68862-2546 203652 Feb. 9, 1999 68872-1620 203160 Aug. 25, 1998
71290-1630 203275 Sep. 22, 1998 73736-1657 203466 Nov. 17, 1998
73739-1645 203270 Sep. 22, 1998 73742-1662 203316 Oct. 6, 1998
76385-1692 203664 Feb. 9, 1999 76393-1664 203323 Oct. 6, 1998
76399-1700 203472 Nov. 17, 1998 76400-2528 203573 Jan. 12, 1999
76510-2504 203477 Nov. 17, 1998 76529-1666 203315 Oct. 6, 1998
76532-1702 203473 Nov. 17, 1998 76541-1675 203409 Oct. 27, 1998
77503-1686 203362 Oct. 20, 1998 77624-2515 203553 Dec, 22, 1998
79230-2525 203549 Dec. 22, 1998 79862-2522 203550 Dec. 22, 1998
80145-2594 204-PTA Jun. 8, 1999 80899-2501 203539 Dec. 15, 1998
81754-2532 203542 Dec. 15, 1998 81757-2512 203543 Dec. 15, 1998
81761-2583 203862 Mar. 23, 1999 82358-2738 510-PTA Aug. 10, 1999
82364-2538 203603 Jan. 20, 1999 82403-2959 2317-PTA Aug. 1, 2000
83500-2506 203391 Oct. 29, 1998 83560-2569 203816 Mar. 2, 1999
84210-2576 203818 Mar. 2, 1999 84920-2614 203966 Apr. 27, 1999
86576-2595 203868 Mar. 23, 1999 92218-2554 203834 Mar. 9, 1999
92233-2599 134-PTA May 25, 1999 92256-2596 203891 Mar. 30, 1999
92265-2669 256-PTA Jun. 22, 1999 92274-2617 203971 Apr. 27, 1999
92929-2534-1 203586 Jan. 12, 1999 93011-2637 20-PTA May 4, 1999
94854-2586 203864 Mar. 23, 1999 96787-2534-1 203589 Jan. 12, 1999
96867-2620 203972 Apr. 27, 1999 96872-2674 550-PTA Aug. 17, 1999
96878-2626 23-PTA May 4, 1999 96889-2641 119-PTA May 25, 1999
100312-2645 44-PTA May 11, 1999 105782-2693 387-PTA Jul. 20, 1999
105849-2704 473-PTA Aug. 3, 1999 108725-2766 863-PTA Oct. 19, 1999
108769-2765 861-PTA Oct. 19, 1999 119498-2965 2298-PTA Jul. 25,
2000 119535-2756 613-PTA Aug. 31, 1999 125185-2806 1031-PTA Dec. 7,
1999 131639-2874 1784-PTA Apr. 25, 2000 139623-2893 1670-PTA Apr.
11, 2000 143076-2787 1028-PTA Dec. 7, 1999 143276-2975 2387-PTA
Aug. 8, 2000 164625-2890 1535-PTA Mar. 21, 2000 167678-2963
2302-PTA Jul. 25, 2000 170021-2923 1906-PTA May 23, 2000
170212-3000 2583-PTA Oct. 10, 2000 177313-2982 2251-PTA Jul. 19,
2000
[0889] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposits will be made available by ATCC under the
terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn. 122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn. 1.14
with particular reference to 886 OG 638).
[0890] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
6.5 Example 5
Isolation of cDNA Clones Encoding Human PRO1873, PRO7223, PRO7248,
PRO730. PRO532, PRO7261, PRO734, PRO771, PRO2010, PRO5723, PRO3444.
PRO9940, PRO3562, PRO10008, PRO5730, PRO6008, PRO4527. PRO4538 and
PRO4553
[0891] DNA molecules encoding the PRO1873, PRO7223, PRO7248,
PRO730, PRO532, PRO7261, PRO734, PRO771, PRO2010, PRO5723, PRO3444,
PRO9940, PRO3562, PRO10008, PRO5730, PRO6008, PRO4527, PRO4538 and
PRO4553 polypeptides shown in the accompanying figures were
obtained through GenBank.
6.6. Example 6
Use of PRO as a Hybridization Probe
[0892] The following method describes use of a nucleotide sequence
encoding PRO as a hybridization probe.
[0893] DNA comprising the coding sequence of full-length or mature
PRO (as shown in accompanying figures) or a fragment thereof is
employed as a probe to screen for homologous DNAs (such as those
encoding naturally-occurring variants of PRO) in human tissue cDNA
libraries or human tissue genomic libraries.
[0894] Hybridization and washing of filters containing either
library DNAs is performed under the following high-stringency
conditions. Hybridization of radiolabeled probe derived from the
gene encoding PRO polypeptide to the filters is performed in a
solution of 50% formamide, 5.times.SSC, 0. 1% SDS, 0. 1% sodium
pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2.times.Denhardt's
solution, and 10% dextran sulfate at 42.degree. C. for 20 hours.
Washing of the filters is performed in an aqueous solution of
0.1.times.SSC and 0.1% SDS at 42.degree. C.
[0895] DNAs having a desired sequence identity with the DNA
encoding full-length native sequence can then be identified using
standard techniques known in the art.
6.7. Example 7
Expression of PRO in E. coli
[0896] This example illustrates preparation of an unglycosylated
form of PRO by recombinant expression in E. coli.
[0897] The DNA sequence encoding PRO is initially amplified using
selected PCR primers. The primers should contain restriction enzyme
sites which correspond to the restriction enzyme sites on the
selected expression vector. A variety of expression vectors may be
employed. An example of a suitable vector is pBR322 (derived from
E. coli; see, Bolivar et al., Gene, 2:95 (1977)) which contains
genes for ampicillin and tetracycline resistance. The vector is
digested with restriction enzyme and dephosphorylated. The PCR
amplified sequences are then ligated into the vector. The vector
will preferably include sequences which encode for an antibiotic
resistance gene, a trp promoter, a poly-His leader (including the
first six STII codons, poly-His sequence, and enterokinase cleavage
site), the PRO coding region, lambda transcriptional terminator,
and an argU gene.
[0898] The ligation mixture is then used to transform a selected E.
coli strain using the methods described in Sambrook et al., supra.
Transformants are identified by their ability to grow on LB plates
and antibiotic resistant colonies are then selected. Plasmid DNA
can be isolated and confirmed by restriction analysis and DNA
sequencing.
[0899] Selected clones can be grown overnight in liquid culture
medium such as LB broth supplemented with antibiotics. The
overnight culture may subsequently be used to inoculate a larger
scale culture. The cells are then grown to a desired optical
density, during which the expression promoter is turned on.
[0900] After culturing the cells for several more hours, the cells
can be harvested by centrifugation. The cell pellet obtained by the
centrifugation can be solubilized using various agents known in the
art, and the solubilized PRO protein can then be purified using a
metal chelating column under conditions that allow tight binding of
the protein.
[0901] PRO may be expressed in E. coli in a poly-His tagged form,
using the following procedure. The DNA encoding PRO is initially
amplified using selected PCR primers. The primers will contain
restriction enzyme sites which correspond to the restriction enzyme
sites on the selected expression vector, and other useful sequences
providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column, and proteolytic removal
with enterokinase. The PCR-amplified, poly-His tagged sequences are
then ligated into an expression vector, which is used to transform
an E. coli host based on strain 52 (W3110 fuhA(tonA) lon galE
rpoHts(htpRts) clpP(lacIq). Transformants are first grown in LB
containing 50 mg/ml carbenicillin at 30.degree. C. with shaking
until an OD.sub.600 of 3-5 is reached. Cultures are then diluted
50-100 fold into CRAP media (prepared by mixing 3.57 g
(NH.sub.4).sub.2SO.sub.4, 0.71 g sodium citrate.cndot.2H.sub.2O,
1.07 g KCl, 5.36 g Difco yeast extract, 5.36 sheffield hycase SF in
500 ml water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose
and 7 mM MgSO.sub.4) and grown for approximately 20-30 hours at
30.degree. C. with shaking. Samples are removed to verify
expression by SDS-PAGE analysis, and the bulk culture is
centrifuged to pellet the cells. Cell pellets are frozen until
purification and refolding.
[0902] E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets)
is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH
8 buffer. Solid sodium sulfite and sodium tetrathionate is added to
make final concentrations of 0.1 M and 0.02 M, respectively, and
the solution is stirred overnight at 4.degree. C. This step results
in a denatured protein with all cysteine residues blocked by
sulfitolization. The solution is centrifuged at 40,000 rpm in a
Beckman Ultracentifuge for 30 min. The supernatant is diluted with
3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM
Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.
The clarified extract is loaded onto a 5 ml Qiagen Ni.sup.2+-NTA
metal chelate column equilibrated in the metal chelate column
buffer. The column is washed with additional buffer containing 50
mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein is
eluted with buffer containing 250 mM imidazole. Fractions
containing the desired protein are pooled and stored at 4.degree.
C. Protein concentration is estimated by its absorbance at 280 nm
using the calculated extinction coefficient based on its amino acid
sequence.
[0903] The proteins are refolded by diluting the sample slowly into
freshly prepared refolding buffer consisting of: 20 mM Tris, pH
8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM
EDTA. Refolding volumes are chosen so that the final protein
concentration is between 50 to 100 micrograms/ml. The refolding
solution is stirred gently at 4.degree. C. for 12-36 hours. The
refolding reaction is quenched by the addition of TFA to a final
concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution is filtered through a
0.22 micron filter and acetonitrile is added to 2-10% final
concentration. The refolded protein is chromatographed on a Poros
R1/H reversed phase column using a mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of
fractions with A.sub.280 absorbance are analyzed on SDS
polyacrylamide gels and fractions containing homogeneous refolded
protein are pooled. Generally, the properly refolded species of
most proteins are eluted at the lowest concentrations of
acetonitrile since those species are the most compact with their
hydrophobic interiors shielded from interaction with the reversed
phase resin. Aggregated species are usually eluted at higher
acetonitrile concentrations. In addition to resolving misfolded
forms of proteins from the desired form, the reversed phase step
also removes endotoxin from the samples.
[0904] Fractions containing the desired folded PRO polypeptide are
pooled and the acetonitrile removed using a gentle stream of
nitrogen directed at the solution. Proteins are formulated into 20
mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by
dialysis or by gel filtration using G25 Superfine (Pharmacia)
resins equilibrated in the formulation buffer and sterile
filtered.
[0905] Many of the PRO polypeptides disclosed herein were
successfully expressed as described above.
6.8. Example 8
Expression of PRO in Mammalian Cells
[0906] This example illustrates preparation of a potentially
glycosylated form of PRO by recombinant expression in mammalian
cells.
[0907] The vector, pRK5 (see EP 307,247, published Mar. 15, 1989),
is employed as the expression vector. Optionally, the PRO DNA is
ligated into pRK5 with selected restriction enzymes to allow
insertion of the PRO DNA using ligation methods such as described
in Sambrook et al., supra. The resulting vector is called
pRK5-PRO.
[0908] In one embodiment, the selected host cells may be 293 cells.
Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue
culture plates in medium such as DMEM supplemented with fetal calf
serum and optionally, nutrient components and/or antibiotics. About
10 .mu.g pRK5-PRO DNA is mixed with about 1 .mu.g DNA encoding the
VA RNA gene [Thimmappaya et al., Cell, 31:543 (1982)] and dissolved
in 500 .mu.l of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl.sub.2. To
this mixture is added, dropwise, 500 .mu.l of 50 mM HEPES (pH
7.35), 280 mM NaCl, 1.5 mM NaPO.sub.4, and a precipitate is allowed
to form for 10 minutes at 25.degree. C. The precipitate is
suspended and added to the 293 cells and allowed to settle for
about four hours at 37.degree. C. The culture medium is aspirated
off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The
293 cells are then washed with serum free medium, fresh medium is
added and the cells are incubated for about 5 days.
[0909] Approximately 24 hours after the transfections, the culture
medium is removed and replaced with culture medium (alone) or
culture medium containing 200 .mu.Ci/ml .sup.35S-cysteine and 200
.mu.Ci/ml .sup.3S-methionine. After a 12 hour incubation, the
conditioned medium is collected, concentrated on a spin filter, and
loaded onto a 15% SDS gel. The processed gel may be dried and
exposed to film for a selected period of time to reveal the
presence of the PRO polypeptide. The cultures containing
transfected cells may undergo further incubation (in serum free
medium) and the medium is tested in selected bioassays.
[0910] In an alternative technique, PRO may be introduced into 293
cells transiently using the dextran sulfate method described by
Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981). 293
cells are grown to maximal density in a spinner flask and 700 .mu.g
pRK5-PRO DNA is added. The cells are first concentrated from the
spinner flask by centrifugation and washed with PBS. The
DNA-dextran precipitate is incubated on the cell pellet for four
hours. The cells are treated with 20% glycerol for 90 seconds,
washed with tissue culture medium, and re-introduced into the
spinner flask containing tissue culture medium, 5 .mu.g/ml bovine
insulin and 0.1 .mu.g/ml bovine transferrin. After about four days,
the conditioned media is centrifuged and filtered to remove cells
and debris. The sample containing expressed PRO can then be
concentrated and purified by any selected method, such as dialysis
and/or column chromatography.
[0911] In another embodiment, PRO can be expressed in CHO cells.
The pRK5-PRO can be transfected into CHO cells using known reagents
such as CaPO.sub.4 or DEAE-dextran. As described above, the cell
cultures can be incubated, and the medium replaced with culture
medium (alone) or medium containing a radiolabel such as
.sup.35S-methionine. After determining the presence of a PRO
polypeptide, the culture medium may be replaced with serum free
medium. Preferably, the cultures are incubated for about 6 days,
and then the conditioned medium is harvested. The medium containing
the expressed PRO polypeptide can then be concentrated and purified
by any selected method.
[0912] Epitope-tagged PRO may also be expressed in host CHO cells.
The PRO may be subcloned out of the pRK5 vector. The subclone
insert can undergo PCR to fuse in frame with a selected epitope tag
such as a poly-His tag into a Baculovirus expression vector. The
poly-His tagged PRO insert can then be subcloned into a SV40 driven
vector containing a selection marker such as DHFR for selection of
stable clones. Finally, the CHO cells can be transfected (as
described above) with the SV40 driven vector. Labeling may be
performed, as described above, to verify expression. The culture
medium containing the expressed poly-His tagged PRO can then be
concentrated and purified by any selected method, such as by
Ni.sup.2+-chelate affinity chromatography.
[0913] PRO may also be expressed in CHO and/or COS cells by a
transient expression procedure or in CHO cells by another stable
expression procedure.
[0914] Stable expression in CHO cells is performed using the
following procedure. The proteins are expressed as an IgG construct
(immunoadhesin), in which the coding sequences for the soluble
forms (e.g., extracellular domains) of the respective proteins are
fused to an IgG 1 constant region sequence containing the hinge,
CH2 and CH2 domains and/or as a poly-His tagged form.
[0915] Following PCR amplification, the respective DNAs are
subcloned in a CHO expression vector using standard techniques as
described in Ausubel et al., Current Protocols of Molecular
Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression
vectors are constructed to have compatible restriction sites 5' and
3' of the DNA of interest to allow the convenient shuttling of
cDNA's. The vector used in expression in CHO cells is as described
in Lucas et al., Nucl. Acids Res., 24:9 (1774-1779 (1996), and uses
the SV40 early promoter/enhancer to drive expression of the cDNA of
interest and dihydrofolate reductase (DHFR). DHFR expression
permits selection for stable maintenance of the plasmid following
transfection.
[0916] Twelve micrograms of the desired plasmid DNA is introduced
into approximately 10 million CHO cells using commercially
available transfection reagents Superfect.RTM. (Qiagen),
Dosper.RTM. or Fugene.RTM. (Boehringer Mannheim). The cells are
grown as described in Lucas et al., supra. Approximately
3.times.10.sup.7 cells are frozen in an ampule for further growth
and production as described below.
[0917] The ampules containing the plasmid DNA are thawed by
placement into a water bath and mixed by vortexing. The contents
are pipetted into a centrifuge tube containing 10 ml of media and
centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated
and the cells are resuspended in 10 ml of selective media (0.2
.mu.m filtered PS20 with 5% 0.2 .mu.m diafiltered fetal bovine
serum). The cells are then aliquoted into a 100 ml spinner
containing 90 ml of selective media. After 1-2 days, the cells are
transferred into a 250 ml spinner filled with 150 ml selective
growth medium and incubated at 37.degree. C. After another 2-3
days, 250 ml, 500 ml and 2000 ml spinners are seeded with
3.times.10.sup.5 cells/ml. The cell media is exchanged with fresh
media by centrifugation and resuspension in production medium.
Although any suitable CHO media may be employed, a production
medium described in U.S. Pat. No. 5,122,469, issued Jun. 16, 1992
may actually be used. A 3L production spinner is seeded at
1.2.times.10.sup.6 cells/ml. On day 0, the cell number and pH is
determined. On day 1, the spinner is sampled and sparging with
filtered air is commenced. On day 2, the spinner is sampled, the
temperature shifted to 33.degree. C., and ml of 500 g/L glucose and
0.6 ml of 10% antifoam (e.g., 35% polydimethylsiloxane emulsion,
Dow Corning 365 Medical Grade Emulsion) taken. Throughout the
production, the pH is adjusted as necessary to keep it at around
7.2. After 10 days, or until the viability drops below 70%, the
cell culture is harvested by centrifugation and filtering through a
0.22 .mu.m filter. The filtrate is either stored at 4.degree. C. or
immediately loaded onto columns for purification.
[0918] For the poly-His tagged constructs, the proteins are
purified using a Ni.sup.2+-NTA column (Qiagen). Before
purification, imidazole is added to the conditioned media to a
concentration of 5 mM. The conditioned media is pumped onto a 6 ml
Ni.sup.2+-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer
containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5
ml/min. at 4.degree. C. After loading, the column is washed with
additional equilibration buffer and the protein eluted with
equilibration buffer containing 0.25 M imidazole. The highly
purified protein is subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a
25 ml G25 Superfine (Pharmacia) column and stored at -80.degree.
C.
[0919] Immunoadhesin (Fc-containing) constructs are purified from
the conditioned media as follows. The conditioned medium is pumped
onto a 5 ml Protein A column (Pharmacia) which has been
equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading,
the column is washed extensively with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is
immediately neutralized by collecting 1 ml fractions into tubes
containing 275 .mu.l of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into storage buffer as described
above for the poly-His tagged proteins. The homogeneity is assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing
by Edman degradation.
[0920] Many of the PRO polypeptides disclosed herein were
successfully expressed as described above.
6.9. Example 9
Expression of PRO in Yeast
[0921] The following method describes recombinant expression of PRO
in yeast.
[0922] First, yeast expression vectors are constructed for
intracellular production or secretion of PRO from the ADH2/GAPDH
promoter. DNA encoding PRO and the promoter is inserted into
suitable restriction enzyme sites in the selected plasmid to direct
intracellular expression of PRO. For secretion, DNA encoding PRO
can be cloned into the selected plasmid, together with DNA encoding
the ADH2/GAPDH promoter, a native PRO signal peptide or other
mammalian signal peptide, or, for example, a yeast alpha-factor or
invertase secretory signal/leader sequence, and linker sequences
(if needed) for expression of PRO.
[0923] Yeast cells, such as yeast strain AB110, can then be
transformed with the expression plasmids described above and
cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by precipitation with 10%
trichloroacetic acid and separation by SDS-PAGE, followed by
staining of the gels with Coomassie Blue stain.
[0924] Recombinant PRO can subsequently be isolated and purified by
removing the yeast cells from the fermentation medium by
centrifugation and then concentrating the medium using selected
cartridge filters. The concentrate containing PRO may further be
purified using selected column chromatography resins.
[0925] Many of the PRO polypeptides disclosed herein were
successfully expressed as described above.
6.10. Example 10
Expression of PRO in Baculovirus-infected Insect Cells
[0926] The following method describes recombinant expression in
Baculovirus-infected insect cells.
[0927] The sequence coding for PRO is fused upstream of an epitope
tag contained within a baculovirus expression vector. Such epitope
tags include poly-His tags and immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids
derived from commercially available plasmids such as pVL 1393
(Novagen). Briefly, the sequence encoding PRO or the desired
portion of the coding sequence of PRO (such as the sequence
encoding the extracellular domain of a transmembrane protein or the
sequence encoding the mature protein if the protein is
extracellular) is amplified by PCR with primers complementary to
the 5' and 3' regions. The 5' primer may incorporate flanking
(selected) restriction enzyme sites. The product is then digested
with those selected restriction enzymes and subcloned into the
expression vector.
[0928] Recombinant baculovirus is generated by co-transfecting the
above plasmid and BaculoGold.TM. virus DNA (Pharmingen) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4-5 days
of incubation at 28.degree. C., the released viruses are harvested
and used for further amplifications. Viral infection and protein
expression are performed as described by O'Reilley et al.,
Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford
University Press (1994).
[0929] Expressed poly-His tagged PRO can then be purified, for
example, by Ni.sup.2+-chelate affinity chromatography as follows.
Extracts are prepared from recombinant virus-infected Sf9 cells as
described by Rupert et al., Nature, 362:175-179 (1993). Briefly,
Sf9 cells are washed, resuspended in sonication buffer (25 ml
Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM EDTA; 10% glycerol; 0.1%
NP-40; 0.4 M KCl), and sonicated twice for 20 seconds on ice. The
sonicates are cleared by centrifugation, and the supernatant is
diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl,
10% glycerol, pH 7.8) and filtered through a 0.45 .mu.m filter. A
Ni.sup.2+-NTA agarose column (commercially available from Qiagen)
is prepared with a bed volume of 5 ml, washed with 25 ml of water
and equilibrated with 25 ml of loading buffer. The filtered cell
extract is loaded onto the column at 0.5 ml per minute. The column
is washed to baseline A.sub.280 with loading buffer, at which point
fraction collection is started. Next, the column is washed with a
secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol,
pH 6.0), which elutes nonspecifically bound protein. After reaching
A.sub.280baseline again, the column is developed with a 0 to 500 mM
imidazole gradient in the secondary wash buffer. One ml fractions
are collected and analyzed by SDS-PAGE and silver staining or
Western blot with Ni.sup.2+-NTA-conjugated to alkaline phosphatase
(Qiagen). Fractions containing the eluted His.sub.10-tagged PRO are
pooled and dialyzed against loading buffer.
[0930] Alternatively, purification of the IgG tagged (or Fc tagged)
PRO can be performed using known chromatography techniques,
including for instance, Protein A or protein G column
chromatography.
[0931] Following PCR amplification, the respective coding sequences
are subcloned into a baculovirus expression vector (pb.PH.IgG for
IgG fusions and pb.PH.His.c for poly-His tagged proteins), and the
vector and Baculogold.RTM. baculovirus DNA (Pharmingen) are
co-transfected into 105 Spodoptera frugiperda ("Sf9") cells (ATCC
CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His
are modifications of the commercially available baculovirus
expression vector pVL1393 (Pharmingen), with modified polylinker
regions to include the His or Fc tag sequences. The cells are grown
in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone). Cells
are incubated for 5 days at 28.degree. C. The supernatant is
harvested and subsequently used for the first viral amplification
by infecting Sf9 cells in Hink's TNM-FH medium supplemented with
10% FBS at an approximate multiplicity of infection (MOI) of 10.
Cells are incubated for 3 days at 28.degree. C. The supernatant is
harvested and the expression of the constructs in the baculovirus
expression vector is determined by batch binding of 1 ml of
supernatant to 25 ml of Ni.sup.2+-NTA beads (QIAGEN) for histidine
tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for
IgG tagged proteins followed by SDS-PAGE analysis comparing to a
known concentration of protein standard by Coomassie blue
staining.
[0932] The first viral amplification supernatant is used to infect
a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium
(Expression Systems LLC) at an approximate MOI of 0.1. Cells are
incubated for 3 days at 28.degree. C. The supernatant is harvested
and filtered. Batch binding and SDS-PAGE analysis is repeated, as
necessary, until expression of the spinner culture is
confirmed.
[0933] The conditioned medium from the transfected cells (0.5 to 3
L) is harvested by centrifugation to remove the cells and filtered
through 0.22 micron filters. For the poly-His tagged constructs,
the protein construct is purified using a Ni.sup.2+-NTA column
(Qiagen). Before purification, imidazole is added to the
conditioned media to a concentration of 5 mM. The conditioned media
is pumped onto a 6 ml Ni.sup.2+-NTA column equilibrated in 20 mM
Repes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a
flow rate of 4-5 m/min. at 4.degree. C. After loading, the column
is washed with additional equilibration buffer and the protein
eluted with equilibration buffer containing 0.25 M imidazole. The
highly purified protein is subsequently desalted into a storage
buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8,
with a 25 ml G25 Superfine (Pharmacia) column and stored at
-80.degree. C.
[0934] Immunoadhesin (Fc containing) constructs of proteins are
purified from the conditioned media as follows.
[0935] The conditioned media is pumped onto a 5 ml Protein A column
(Pharmacia) which has been equilibrated in 20 mM Na phosphate
buffer, pH 6.8. After loading, the column is washed extensively
with equilibration buffer before elution with 100 mM citric acid,
pH 3.5. The eluted protein is immediately neutralized by collecting
1 ml fractions into tubes containing 275 ml of 1 M Tris buffer, pH
9. The highly purified protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins.
The homogeneity of the proteins is verified by SDS polyacrylamide
gel (PEG) electrophoresis and N-terminal amino acid sequencing by
Edman degradation.
[0936] Alternatively, a modified baculovirus procedure may be used
incorporating high-5 cells. In this procedure, the DNA encoding the
desired sequence is amplified with suitable systems, such as Pfu
(Stratagene), or fused upstream (5'-of) of an epitope tag contained
with a baculovirus expression vector. Such epitope tags include
poly-His tags and immunoglobulin tags (like Fc regions of IgG). A
variety of plasmids may be employed, including plasmids derived
from commercially available plasmids such as pIE1-1 (Novagen). The
pIE1-1 and pIE1-2 vectors are designed for constitutive expression
of recombinant proteins from the baculovirus ie1 promoter in
stably-transformed insect cells (1). The plasmids differ only in
the orientation of the multiple cloning sites and contain all
promoter sequences known to be important for ie1-mediated gene
expression in uninfected insect cells as well as the hr5 enhancer
element. pIE1-1 and pIE1-2 include the translation initiation site
and can be used to produce fusion proteins. Briefly, the desired
sequence or the desired portion of the sequence (such as the
sequence encoding the extracellular domain of a transmembrane
protein) is amplified by PCR with primers complementary to the 5'
and 3' regions. The 5' primer may incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those
selected restriction enzymes and subcloned into the expression
vector. For example, derivatives of pIE1-1 can include the Fc
region of human IgG (pb.PH.IgG) or an 8 histidine (pb.PH.His) tag
downstream (3'-of) the desired sequence. Preferably, the vector
construct is sequenced for confirmation.
[0937] High-5 cells are grown to a confluency of 50% under the
conditions of, 27.degree. C., no CO.sub.2, NO pen/strep. For each
150 mm plate, 30 .mu.g of pIE based vector containing the sequence
is mixed with 1 ml Ex-Cell medium (Media:Ex-Cell 401+1/100 L-Glu
JRH Biosciences #14401-78P (note: this media is light sensitive)),
and in a separate tube, 100 .mu.l of CellFectin (CellFECTIN
(GibcoBRL #10362-010) (vortexed to mix)) is mixed with 1 ml of
Ex-Cell medium. The two solutions are combined and allowed to
incubate at room temperature for 15 minutes. 8 ml of Ex-Cell media
is added to the 2 ml of DNA/CellFECTIN mix and this is layered on
high-5 cells that have been washed once with Ex-Cell media. The
plate is then incubated in darkness for 1 hour at room temperature.
The DNA/CellFECTIN mix is then aspirated, and the cells are washed
once with Ex-Cell to remove excess CellFECTIN, 30 ml of fresh
Ex-Cell media is added and the cells are incubated for 3 days at
28.degree. C. The supernatant is harvested and the expression of
the sequence in the baculovirus expression vector is determined by
batch binding of 1 ml of supernatent to 25 ml of Ni.sup.2+-NTA
beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose
CL-4B beads (Pharmacia) for IgG tagged proteins followed by
SDS-PAGE analysis comparing to a known concentration of protein
standard by Coomassie blue staining.
[0938] The conditioned media from the transfected cells (0.5 to 3
L) is harvested by centrifugation to remove the cells and filtered
through 0.22 micron filters. For the poly-His tagged constructs,
the protein comprising the sequence is purified using a
Ni.sup.2+-NTA column (Qiagen). Before purification, imidazole is
added to the conditioned media to a concentration of 5 mM. The
conditioned media is pumped onto a 6 ml Ni.sup.2+-NTA column
equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 48.degree. C.
After loading, the column is washed with additional equilibration
buffer and the protein eluted with equilibration buffer containing
0.25 M imidazole. The highly purified protein is then subsequently
desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl
and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia)
column and stored at -80.degree. C.
[0939] Immunoadhesin (Fe containing) constructs of proteins are
purified from the conditioned media as follows. The conditioned
media is pumped onto a 5 ml Protein A column (Pharmacia) which had
been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After
loading, the column is washed extensively with equilibration buffer
before elution with 100 mM citric acid, pH 3.5. The eluted protein
is immediately neutralized by collecting 1 ml fractions into tubes
containing 275 ml of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into storage buffer as described
above for the poly-His tagged proteins. The homogeneity of the
sequence is assessed by SDS polyacrylamide gels and by N-terminal
amino acid sequencing by Edman degradation and other analytical
procedures as desired or necessary.
[0940] Many of the PRO polypeptides disclosed herein were
successfully expressed as described above.
6.11. Example 11
Preparation of Antibodies that Bind PRO
[0941] This example illustrates preparation of monoclonal
antibodies which can specifically bind the PRO polypeptide or an
epitope on the PRO polypeptide without substantially binding to any
other polypeptide or polypeptide epitope.
[0942] Techniques for producing the monoclonal antibodies are known
in the art and are described, for instance, in Goding, supra.
Immunogens that may be employed include purified PRO, fusion
proteins containing PRO, and cells expressing recombinant PRO on
the cell surface. Selection of the immunogen can be made by the
skilled artisan without undue experimentation.
[0943] Mice, such as Balbic, are immunized with the PRO immunogen
emulsified in complete Freund's adjuvant and injected
subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the immunogen is emulsified in MPL-TDM
adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) and
injected into the animal's hind foot pads. The immunized mice are
then boosted 10 to 12 days later with additional immunogen
emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice may also be boosted with additional immunization
injections. Serum samples may be periodically obtained from the
mice by retro-orbital bleeding for testing in ELISA assays to
detect anti-PRO antibodies.
[0944] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of PRO. Three to four days later, the mice
are sacrificed and the spleen cells are harvested. The spleen cells
are then fused (using 35% polyethylene glycol) to a selected murine
myeloma cell line such as P3X63AgU.1, available from ATCC, No. CRL
1597. The fusions generate hybridoma cells which can then be plated
in 96 well tissue culture plates containing HAT (hypoxanthine,
aminopterm, and thymidine) medium to inhibit proliferation of
non-fused cells, myeloma hybrids, and spleen cell hybrids.
[0945] The hybridoma cells will be screened in an ELISA for
reactivity against PRO. Determination of "positive" hybridoma cells
secreting the desired monoclonal antibodies against PRO is within
the skill in the art.
[0946] The positive hybridoma cells can be injected
intraperitoneally into syngeneic Balbic mice to produce ascites
containing the anti-PRO monoclonal antibodies. Alternatively, the
hybridoma cells can be grown in tissue culture flasks or roller
bottles. Purification of the monoclonal antibodies produced in the
ascites can be accomplished using ammonium sulfate precipitation,
followed by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
6.12. Example 12
Purification of PRO Polypeptides Using Specific Antibodies
[0947] Native or recombinant PRO polypeptides may be purified by a
variety of standard techniques in the art of protein purification.
For example, pro-PRO polypeptide, mature PRO polypeptide, or
pre-PRO polypeptide is purified by immunoaffinity chromatography
using antibodies specific for the PRO polypeptide of interest. In
general, an immunoaffinity column is constructed by covalently
coupling the anti-PRO polypeptide antibody to an activated
chromatographic resin.
[0948] Polyclonal immunoglobulins are prepared from immune sera
either by precipitation with ammonium sulfate or by purification on
immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway,
N.J.). Likewise, monoclonal antibodies are prepared from mouse
ascites fluid by ammonium sulfate precipitation or chromatography
on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a chromatographic resin such as
CnBr-activated SEPHAROSEM (Pharmacia LKB Biotechnology). The
antibody is coupled to the resin, the resin is blocked, and the
derivative resin is washed according to the manufacturer's
instructions.
[0949] Such an immunoaffinity column is utilized in the
purification of PRO polypeptide by preparing a fraction from cells
containing PRO polypeptide in a soluble form. This preparation is
derived by solubilization of the whole cell or of a subcellular
fraction obtained via differential centrifugation by the addition
of detergent or by other methods well known in the art.
Alternatively, soluble PRO polypeptide containing a signal sequence
may be secreted in useful quantity into the medium in which the
cells are grown.
[0950] A soluble PRO polypeptide-containing preparation is passed
over the immunoaffinity column, and the column is washed under
conditions that allow the preferential absorbance of PRO
polypeptide (e.g., high ionic strength buffers in the presence of
detergent). Then, the column is eluted under conditions that
disrupt antibody/PRO polypeptide binding (e.g., a low pH buffer
such as approximately pH 2-3, or a high concentration of a
chaotrope such as urea or thiocyanate ion), and PRO polypeptide is
collected.
6.13. Example 13
Drug Screening
[0951] This invention is particularly useful for screening
compounds by using PRO polypeptides or binding fragment thereof in
any of a variety of drug screening techniques. The PRO polypeptide
or fragment employed in such a test may either be free in solution,
affixed to a solid support, borne on a cell surface, or located
intracellularly. One method of drug screening utilizes eukaryotic
or prokaryotic host cells which are stably transformed with
recombinant nucleic acids expressing the PRO polypeptide or
fragment. Drugs are screened against such transformed cells in
competitive binding assays. Such cells, either in viable or fixed
form, can be used for standard binding assays. One may measure, for
example, the formation of complexes between PRO polypeptide or a
fragment and the agent being tested. Alternatively, one can examine
the diminution in complex formation between the PRO polypeptide and
its target cell or target receptors caused by the agent being
tested.
[0952] Thus, the present invention provides methods of screening
for drugs or any other agents which can affect a PRO
polypeptide-associated disease or disorder. These methods comprise
contacting such an agent with an PRO polypeptide or fragment
thereof and assaying (I) for the presence of a complex between the
agent and the PRO polypeptide or fragment, or (ii) for the presence
of a complex between the PRO polypeptide or fragment and the cell,
by methods well known in the art. In such competitive binding
assays, the PRO polypeptide or fragment is typically labeled. After
suitable incubation, free PRO polypeptide or fragment is separated
from that present in bound form, and the amount of free or
uncomplexed label is a measure of the ability of the particular
agent to bind to PRO polypeptide or to interfere with the PRO
polypeptide/cell complex.
[0953] Another technique for drug screening provides high
throughput screening for compounds having suitable binding affinity
to a polypeptide and is described in detail in WO 84/03564,
published on Sep. 13, 1984. Briefly stated, large numbers of
different small peptide test compounds are synthesized on a solid
substrate, such as plastic pins or some other surface. As applied
to a PRO polypeptide, the peptide test compounds are reacted with
PRO polypeptide and washed. Bound PRO polypeptide is detected by
methods well known in the art. Purified PRO polypeptide can also be
coated directly onto plates for use in the aforementioned drug
screening techniques. In addition, non-neutralizing antibodies can
be used to capture the peptide and immobilize it on the solid
support.
[0954] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding PRO polypeptide specifically compete with a test compound
for binding to PRO polypeptide or fragments thereof. In this
manner, the antibodies can be used to detect the presence of any
peptide which shares one or more antigenic determinants with PRO
polypeptide.
6.14. Example 14
Rational Drug Design
[0955] The goal of rational drug design is to produce structural
analogs of biologically active polypeptide of interest (i.e., a PRO
polypeptide) or of small molecules with which they interact, e.g.,
agonists, antagonists, or inhibitors. Any of these examples can be
used to fashion drugs which are more active or stable forms of the
PRO polypeptide or which enhance or interfere with the function of
the PRO polypeptide in vivo (cf., Hodgson, Bio/Technology, 9: 19-21
(1991)).
[0956] In one approach, the three-dimensional structure of the PRO
polypeptide, or of an PRO polypeptide-inhibitor complex, is
determined by x-ray crystallography, by computer modeling or, most
typically, by a combination of the two approaches. Both the shape
and charges of the PRO polypeptide must be ascertained to elucidate
the structure and to determine active site(s) of the molecule. Less
often, useful information regarding the structure of the PRO
polypeptide may be gained by modeling based on the structure of
homologous proteins. In both cases, relevant structural information
is used to design analogous PRO polypeptide-like molecules or to
identify efficient inhibitors. Useful examples of rational drug
design may include molecules which have improved activity or
stability as shown by Braxton and Wells, Biochemistry, 31:7796-7801
(1992) or which act as inhibitors, agonists, or antagonists of
native peptides as shown by Athauda et al., J. Biochem.,
113:742-746 (1993).
[0957] It is also possible to isolate a target-specific antibody,
selected by functional assay, as described above, and then to solve
its crystal structure. This approach, in principle, yields a
pharmacore upon which subsequent drug design can be based. It is
possible to bypass protein crystallography altogether by generating
anti-idiotypic antibodies (anti-ids) to a functional,
pharmacologically active antibody. As a mirror image of a mirror
image, the binding site of the anti-ids would be expected to be an
analog of the original receptor. The anti-id could then be used to
identify and isolate peptides from banks of chemically or
biologically produced peptides. The isolated peptides would then
act as the pharmacore.
[0958] By virtue of the present invention, sufficient amounts of
the PRO polypeptide may be made available to perform such
analytical studies as X-ray crystallography. In addition, knowledge
of the PRO polypeptide amino acid sequence provided herein will
provide guidance to those employing computer modeling techniques in
place of or in addition to x-ray crystallography.
6.15. Example 15
Stimulation of Endothelial Cell Proliferation (Assay 8)
[0959] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to stimulate adrenal
cortical capillary endothelial cell (ACE) growth. PRO polypeptides
testing positive in this assay would be expected to be useful for
the therapeutic treatment of conditions or disorders where
angiogenesis would be beneficial including, for example, wound
healing, and the like (as would agonists of these PRO
polypeptides). Antagonists of the PRO polypeptides testing positive
in this assay would be expected to be useful for the therapeutic
treatment of cancerous tumors.
[0960] Bovine adrenal cortical capillary endothelial (ACE) cells
(from primary culture, maximum of 12-14 passages) were plated in
96-well plates at 500 cells/well per 100 microliter. Assay media
included low glucose DMEM, 10% calf serum, 2 mM glutamine, and
1.times.penicillin/streptomycin- /fungizone. Control wells included
the following: (1) no ACE cells added; (2) ACE cells alone; (3) ACE
cells plus VEGF (5 ng/ml); and (4) ACE cells plus FGF (5 ng/ml).
The control or test sample, (in 100 microliter volumes), was then
added to the wells (at dilutions of 1%, 0.1% and 0.01%,
respectively). The cell cultures were incubated for 6-7 days at
37.degree. C./5% CO.sub.2. After the incubation, the media in the
wells was aspirated, and the cells were washed 1.times. with PBS.
An acid phosphatase reaction mixture (100 microliter; 0.1M sodium
acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate)
was then added to each well. After a 2 hour incubation at
37.degree. C., the reaction was stopped by addition of 10
microliters 1N NaOH. Optical density (OD) was measured on a
microplate reader at 405 nm.
[0961] The activity of a PRO polypeptide was calculated as the fold
increase in proliferation (as determined by the acid phosphatase
activity, OD 405 nm) relative to (1) cell only background, and (2)
relative to maximum stimulation by VEGF. VEGF (at 3-10 ng/ml) and
FGF (at 1-5 ng/ml) were employed as an activity reference for
maximum stimulation. Results of the assay were considered
"positive" if the observed stimulation was .gtoreq.50% increase
over background. VEGF (5 ng/ml) control at 1% dilution gave 1.24
fold stimulation; FGF (5 ng/ml) control at 1% dilution gave 1.46
fold stimulation.
[0962] PRO21 tested positive in this assay.
6.16. Example 16
Inhibition of Vascular Endothelial Growth Factor (VEGF) Stimulated
Proliferation of Endothelial Cell Growth (Assay 9)
[0963] The ability of various PRO polypeptides to inhibit VEGF
stimulated proliferation of endothelial cells was tested.
Polypeptides testing positive in this assay are useful for
inhibiting endothelial cell growth in mammals where such an effect
would be beneficial, e.g., for inhibiting tumor growth.
[0964] Specifically, bovine adrenal cortical capillary endothelial
cells (ACE) (from primary culture, maximum of 12-14 passages) were
plated in 96-well plates at 500 cells/well per 100 microliter.
Assay media included low glucose DMEM, 10% calf serum, 2 mM
glutamine, and 1.times.penicillin/streptomycin/fungizone. Control
wells included the following: (1) no ACE cells added; (2) ACE cells
alone; (3) ACE cells plus 5 ng/ml FGF; (4) ACE cells plus 3 ng/ml
VEGF; (5) ACE cells plus 3 ng/ml VEGF plus 1 ng/ml TGF-beta; and
(6) ACE cells plus 3 ng/ml VEGF plus 5 ng/ml LIF. The test samples,
poly-his tagged PRO polypeptides (in 100 microliter volumes), were
then added to the wells (at dilutions of 1%, 0.1% and 0.01%,
respectively). The cell cultures were incubated for 6-7 days at
37.degree. C./5% CO.sub.2. After the incubation, the media in the
wells was aspirated, and the cells were washed 1.times. with PBS.
An acid phosphatase reaction mixture (100 microliter; 0.1M sodium
acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate)
was then added to each well. After a 2 hour incubation at
37.degree. C., the reaction was stopped by addition of 10
microliters 1N NaOH. Optical density (OD) was measured on a
microplate reader at 405 nm.
[0965] The activity of PRO polypeptides was calculated as the
percent inhibition of VEGF (3 ng/ml) stimulated proliferation (as
determined by measuring acid phosphatase activity at OD 405 run)
relative to the cells without stimulation. TGF-beta was employed as
an activity reference at 1 ng/ml, since TGF-beta blocks 70-90% of
VEGF-stimulated ACE cell proliferation. The results are indicative
of the utility of the PRO polypeptides in cancer therapy and
specifically in inhibiting tumor angiogenesis. Numerical values
(relative inhibition) are determined by calculating the percent
inhibition of VEGF stimulated proliferation by the PRO polypeptides
relative to cells without stimulation and then dividing that
percentage into the percent inhibition obtained by TGF-.beta. at 1
ng/ml which is known to block 70-90% of VEGF stimulated cell
proliferation. The results are considered positive if the PRO
polypeptide exhibits 30% or greater inhibition of VEGF stimulation
of endothelial cell growth (relative inhibition 30% or
greater).
[0966] PRO247, PRO720 and PRO4302 tested positive in this
assay.
6.17. Example 17
Enhancement of Heart Neonatal Hypertrophy Induced by LIF+ET-1
(Assay 75)
[0967] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to enhance neonatal heart
hypertrophy induced by LIF and endothelin-1 (ET-1). A test compound
that provides a positive response in the present assay would be
useful for the therapeutic treatment of cardiac insufficiency
diseases or disorders characterized or associated with an undesired
level of hypertrophy of the cardiac muscle.
[0968] Cardiac myocytes from 1-day old Harlan Sprague Dawley rats
(180 .mu.l at 7.5.times.10.sup.4/ml, serum <0.1, freshly
isolated) are introduced on day 1 to 96-well plates previously
coated with DMEM/F12+4% FCS. Test PRO polypeptide samples or growth
medium alone (negative control) are then added directly to the
wells on day 2 in 20 .mu.l volume. LIF+ET-1 are then added to the
wells on day 3. The cells are stained after an additional 2 days in
culture and are then scored visually the next day. A positive in
the assay occurs when the PRO polypeptide treated myocytes obtain a
score greater than zero. A score of zero represents non-responsive
cells whereas scores of 1 or 2 represent enhancement (i.e. they are
visually larger on the average or more numerous than the untreated
myocytes).
[0969] PRO21 polypeptides tested positive in this assay.
6.18. Example 18
Detection of Endothelial Cell Apoptosis (FACS) (Assay 96)
[0970] The ability of PRO polypeptides of the present invention to
induce apoptosis in endothelial cells was tested in human venous
umbilical vein endothelial cells (HUVEC, Cell Systems) in
gelatinized T175 flasks using HUVEC cells below passage 10. PRO
polypeptides testing positive in this assay are expected to be
useful for therapeutically treating conditions where apoptosis of
endothelial cells would be beneficial including, for example, the
therapeutic treatment of tumors.
[0971] On day one, the cells were split [420,000 cells per
gelatinized 6 cm dishes--(11.times.10.sup.3cells/cm.sup.2 Falcon,
Primaria)] and grown in media containing serum (CS-C, Cell System)
overnight or for 16 hours to 24 hours.
[0972] On day 2, the cells were washed 1.times. with 5 ml PBS; 3 ml
of 0% serum medium was added with VEGF (100 ng/ml); and 30 .mu.l of
the PRO test compound (final dilution 1%) or 0% serum medium
(negative control) was added. The mixtures were incubated for 48
hours before harvesting.
[0973] The cells were then harvested for FACS analysis. The medium
was aspirated and the cells washed once with PBS. 5 ml of
1.times.trypsin was added to the cells in a T-175 flask, and the
cells were allowed to stand until they were released from the plate
(about 5-10 minutes). Trypsinization was stopped by adding 5 ml of
growth media. The cells were spun at 1000 rpm for 5 minutes at
4.degree. C. The media was aspirated and the cells were resuspended
in 10 ml of 10% serum complemented medium (Cell Systems), 5 .mu.l
of Annexin-FITC (BioVison) added and chilled tubes were submitted
for FACS. A positive result was determined to be enhanced apoptosis
in the PRO polypeptide treated samples as compared to the negative
control.
[0974] PRO4302 polypeptide tested positive in this assay.
6.19. Example 19
Induction of c-fos in HUVEC Cells (Assay 123)
[0975] This assay is designed to determine whether PRO polypeptides
show the ability to induce c-fos in HUVEC cells. PRO polypeptides
testing positive in this assay would be expected to be useful for
the therapeutic treatment of conditions or disorders where
angiogenesis would be beneficial including, for example, wound
healing, and the like (as would agonists of these PRO
polypeptides). Antagonists of the PRO polypeptides testing positive
in this assay would be expected to be useful for the therapeutic
treatment of cancerous tumors.
[0976] Human venous umbilical vein endothelial cells (HUVEC, Cell
Systems) in growth media (50% Ham's F12 w/o GHT: low glucose, and
50% DMEM without glycine: with NaHCO3, 1% glutamine, 10 mM HEPES,
10% FBS, 10 ng/ml bFGF) were plated on 96-well microtiter plates at
a cell density of 5.times.10.sup.3cells/well. The day after plating
(day 2), the cells were starved for 24 hours by removing the growth
media and replacing with serum free media. On day 3, the cells are
treated with 100 .mu.l/well test samples and controls (positive
control=growth media; negative control=Protein 32 buffer=10 mM
HEPES, 140 mM NaCl, 4% (w/v) mannitol, pH 6.8). One plate of cells
was incubated for 30 minutes at 37.degree. C., in 5% CO.sub.2.
Another plate of cells was incubated for 60 minutes at 37.degree.
C., in 5% CO.sub.2. The samples were removed, and RNA was harvested
using the RNeasy 96 kit (Qiagen). Next, the RNA was assayed for
c-fos, egr-1 and GAPDH induction using Taqman.
[0977] The measure of activity of the fold increase over the
negative control (Protein 32/HEPES buffer described above) value
was by obtained by calculating the fold increase of the ratio of
c-fos to GAPDH in test samples as compared to the negative control.
The results are considered positive if the PRO polypeptide exhibits
at least a two-fold value over the negative buffer control.
[0978] PRO1376 polypeptide tested positive in this assay.
6.20. Example 20
Normal Human Iliac Artery Endothelial Cell Proliferation (Assay
138)
[0979] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to modulate proliferation
of human iliac artery endothelial cells in culture and, therefore,
function as useful growth or inhibitory factors.
[0980] On day 0, human iliac artery endothelial cells (from cell
lines, maximum of 12-14 passages) were plated in 96-well plates at
1000 cells/well per 100 microliter and incubated overnight in
complete media [epithelial cell growth media (EGM, Clonetics), plus
supplements: human epithelial growth factor (hEGF), bovine brain
extract (BBE), hydrocortisone, GA-1000, and fetal bovine serum
(FBS, Clonetics)]. On day 1, complete media was replaced by basal
media [EGM plus 1% FBS] and addition of PRO polypeptides at 1%,
0.1% and 0.01% . On day 7, an assessment of cell proliferation was
performed by Alamar Blue assay followed by Crystal Violet. Results
are expressed as % of the cell growth observed with control
buffer.
[0981] The following PRO polypeptides stimulated proliferation in
this assay: PRO214, PRO256, PRO363, PRO365, PRO791, PRO836,
PRO1025, PRO1186, PRO1192, PRO1272, PRO1306, PRO1325, PRO1329,
PRO1376, PRO1411, PRO1508, PRO1787, PRO1868, PRO4324, PRO4333,
PRO4408, PRO4499, PRO9821, PRO9873, PRO10008, PRO10096, PRO19670,
PRO20040, PRO20044 and PRO21384.
[0982] The following PRO polypeptides inhibited proliferation in
this assay: PRO238, PRO1029, PRO1274, PRO1279, PRO1419, PRO1890,
PRO6006 and PRO28631.
6.21. Example 21
Pooled Human Umbilical Vein Endothelial Cell Proliferation (Assay
139)
[0983] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to modulate proliferation
of pooled human umbilical vein endothelial cells in culture and,
therefore, function as useful growth or inhibitory factors.
[0984] On day 0, pooled human umbilical vein endothelial cells
(from cell lines, maximum of 12-14 passages) were plated in 96-well
plates at 1000 cells/well per 100 microliter and incubated
overnight in complete media [epithelial cell growth media (EGM,
Clonetics), plus supplements: human epithelial growth factor
(hEGF), bovine brain extract (BBE), hydrocortisone, GA-1000, and
fetal bovine serum (FBS, Clonetics)]. On day 1, complete media was
replaced by basal media [EGM plus 1% FBS] and addition of PRO
polypeptides at 1%, 0.1% and 0.01%. On day 7, an assessment of cell
proliferation was performed by Alamar Blue assay followed by
Crystal Violet. Results are expresses as % of the cell growth
observed with control buffer.
[0985] The following PRO polypeptides stimulated proliferation in
this assay: PRO181, PRO205, PRO221, PRO231, PRO238, PRO241, PRO247,
PRO256, PRO258, PRO263, PRO265, PRO295, PRO321, PRO322, PRO337,
PRO363, PRO533, PRO697, PRO725, PRO771, PRO788, PRO819, PRO828,
PRO846, PRO865, PRO1005, PRO1006, PRO1025, PRO1054, PRO1071,
PRO1079, PRO1080, PRO1114, PRO1131, PRO1155, PRO1160, PRO1192,
PRO1244, PRO1272, PRO1273, PRO1279, PRO1283, PRO1286, PRO1306,
PRO1309, PRO1325, PRO1329, PRO1347, PRO1356, PRO1376, PRO1382,
PRO1412, PRO1550, PRO1556, PRO1760, PRO1787, PRO1801, PRO1868,
PRO1887, PRO3438, PRO3444, PRO4324, PRO4341, PRO4342, PRO4353,
PRO4354, PRO4356, PRO4371, PRO4422, PRO4425, PRO5723, PRO5737,
PRO6029, PRO6071, PRO10096 and PRO21055.
[0986] The following PRO polypeptides inhibited proliferation in
this assay: PRO229, PRO444, PRO827, PRO1007, PRO1075, PRO1184,
PRO1190, PRO1195, PRO1419, PRO1474, PRO1477, PRO1488, PRO1782,
PRO4302, PRO4405, PRO5725, PRO5776, PRO7436, PRO9771, PRO10008 and
PRO21384.
6.22. Example 22
Human Coronary Artery Smooth Muscle Cell Proliferation (Assay
140)
[0987] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to modulate proliferation
of human coronary artery smooth muscle cells in culture and,
therefore, function as useful growth or inhibitory factors.
[0988] On day 0, human coronary artery smooth muscle cells (from
cell lines, maximum of 12-14 passages) were plated in 96-well
plates at 1000 cells/well per 100 microliter and incubated
overnight in complete media [smooth muscle growth media (SmGM,
Clonetics), plus supplements: insulin, human epithelial growth
factor (hEGF), human fibroblast growth factor (hFGF), GA-1000, and
fetal bovine serum (FBS, Clonetics)]. On day 1, complete media was
replaced by basal media [SmGM plus 1% FBS] and addition of PRO
polypeptides at 1%, 0.1% and 0.01%. On day 7, an assessment of cell
proliferation was performed by Alamar Blue assay followed by
Crystal Violet. Results are expresses as % of the cell growth
observed with control buffer.
[0989] The following PRO polypeptides stimulated proliferation in
this assay: PRO162, PRO182, PRO204, PRO221, PRO230, PRO256, PRO258,
PRO533, PRO697, PRO725, PRO738, PRO826, PRO836, PRO840, PRO846,
PRO865, PRO982, PRO1025, PRO1029, PRO1071, PRO1083, PRO1134,
PRO1160, PRO1182, PRO1184, PRO1186, PRO1192, PRO1274, PRO1279,
PRO1283, PRO1306, PRO1308, PRO1325, PRO1337, PRO1338, PRO1343,
PRO1376, PRO1387, PRO1411, PRO1412, PRO1415, PRO1434, PRO1474,
PRO1550, PRO1556, PRO1567, PRO1600, PRO1754, PRO1758, PRO1760,
PRO1787, PRO1865, PRO1868, PRO1917, PRO1928, PRO3438, PRO3562,
PRO4333, PRO4345, PRO4353, PRO4354, PRO4408, PRO4430, PRO4503,
PRO6714, PRO9771, PRO9820, PRO9940, PRO10096, PRO21055, PRO21184
and PRO21366.
[0990] The following PRO polypeptides inhibited proliferation in
this assay: PRO181, PRO195, PRO1080, PRO1265, PRO1309, PRO1488,
PRO4302, PRO4405 and PRO5725.
6.23. Example 23
Microarray Analysis to Detect Overexpression of PRO Polypeptides in
HUVEC Cells Treated with Growth Factors
[0991] This assay is designed to determine whether PRO polypeptides
of the present invention show the ability to induce angiogenesis by
stimulating endothelial cell tube formation in HUVEC cells.
[0992] Nucleic acid microarrays, often containing thousands of gene
sequences, are useful for identifying differentially expressed
genes in tissues exposed to various stimuli (e.g., growth factors)
as compared to their normal, unexposed counterparts. Using nucleic
acid microarrays, test and control mRNA samples from test and
control tissue samples are reverse transcribed and labeled to
generate cDNA probes. The cDNA probes are then hybridized to an
array of nucleic acids immobilized on a solid support. The array is
configured such that the sequence and position of each member of
the array is known. Hybridization of a labeled probe with a
particular array member indicates that the sample from which the
probe was derived expresses that gene. If the hybridization signal
of a probe from a test (exposed tissue) sample is greater than
hybridization signal of a probe from a control (normal, unexposed
tissue) sample, the gene or genes overexpressed in the exposed
tissue are identified. The implication of this result is that an
overexpressed protein in an exposed tissue may be involved in the
functional changes within the tissue following exposure to the
stimuli (e.g., tube formation).
[0993] The methodology of hybridization of nucleic acids and
microarray technology is well known in the art. In the present
example, the specific preparation of nucleic acids for
hybridization and probes, slides, and hybridization conditions are
all detailed in U.S. Provisional Patent Application Serial No.
60/193,767, filed on Mar. 31, 2000 and which is herein incorporated
by reference.
[0994] In the present example, HUVEC cells grown in either collagen
gels or fibrin gels were induced to form tubes by the addition of
various growth factors. Specifically, collagen gels were prepared
as described previously in Yang et al., American J. Pathology,
1999, 155(3):887-895 and Xin et al., American J. Pathology, 2001,
158(3):1111-1120. Following gelation of the HUVEC cells,
1.times.basal medium containing M199 supplemented with 1% FBS,
1.times.ITS, 2 mM L-glutamine, 50 .mu.g/ml ascorbic acid, 26.5 mM
NaHCO.sub.3, 100 U/ml penicillin and 100 U/ml streptomycin was
added. Tube formation was elicited by the inclusion in the culture
media of either a mixture of phorbol myrsitate acetate (50 nM),
vascular endothelial cell growth factor (40 ng/ml) and basic
fibroblast growth factor (40 ng/ml) ("PMA growth factor mix") or
hepatocyte growth factor (40 ng/ml) and vascular endothelial cell
growth factor (40 ng/ml) (HGF/VEGF mix) for the indicated period of
time. Fibrin Gels were prepared by suspending Huvec
(4.times.10.sup.5 cells/ml) in M199 containing 1% fetal bovine
serum (Hyclone) and human fibrinogen (2.5 mg/ml). Thrombin (50
U/ml) was then added to the fibrinogen suspension at a ratio of 1
part thrombin solution:30 parts fibrinogen suspension. The solution
was then layered onto 10 cm tissue culture plates (total volume: 15
ml/plate) and allowed to solidify at 37.degree. C. for 20 min.
Tissue culture media (10 ml of BM containing PMA (50 nM), bFGF (40
ng/ml) and VEGF (40 ng/ml)) was then added and the cells incubated
at 37.degree. C. in 5% CO.sub.2 in air for the indicated period of
time.
[0995] Total RNA was extracted from the HUVEC cells incubated for
0, 4, 8, 24, 40 and 50 hours in the different matrix and media
combinations using a TRIzol extraction followed by a second
purification using RNAeasy Mini Kit (Qiagen). The total RNA was
used to prepare cRNA which was then hybridized to the
microarrays.
[0996] In the present experiments, nucleic acid probes derived from
the herein described PRO polypeptide-encoding nucleic acid
sequences were used in the creation of the microarray and RNA from
the HUVEC cells described above were used for the hybridization
thereto. Pairwise comparisons were made using time 0 chips as a
baseline. Three replicate samples were analyzed for each
experimental condition and time. Hence there were 3 time 0 samples
for each treatment and 3 replicates of each successive time point.
Therefore, a 3 by 3 comparison was performed for each time point
compared against each time 0 point. This resulted in 9 comparisons
per time point. Only those genes that had increased expression in
all three non-time-0 replicates in each of the different matrix and
media combinations as compared to any of the three time zero
replicates were considered positive. Although this stringent method
of data analysis does allow for false negatives, it minimizes false
positives.
[0997] PRO178, PRO195, PRO228, PRO301, PRO302, PRO532, PRO724,
PRO730, PRO734, PRO793, PRO871, PRO938, PRO1012, PRO1120, PRO1139,
PRO1198, PRO1287, PRO1361, PRO1864, PRO1873, PRO2010, PRO3579,
PRO4313, PRO4527, PRO4538, PRO4553, PRO4995, PRO5730, PRO6008,
PRO7223,
[0998] PRO7248 and PRO7261 tested positive in this assay.
6.24. Example 24
In situ Hybridization
[0999] In situ hybridization is a powerful and versatile technique
for the detection and localization of nucleic acid sequences within
cell or tissue preparations. It may be useful, for example, to
identify sites of gene expression, analyze the tissue distribution
of transcription, identify and localize viral infection, follow
changes in specific mRNA synthesis, and aid in chromosome
mapping.
[1000] In situ hybridization was performed following an optimized
version of the protocol by Lu and Gillett, Cell Vision, 1: 169-176
(1994), using PCR-generated .sup.33P-labeled riboprobes. Briefly,
formalin-fixed, paraffin-embedded human tissues were sectioned,
deparaffinized, deproteinated in proteinase K (20 g/ml) for 15
minutes at 37.degree. C., and further processed for in situ
hybridization as described by Lu and Gillett, supra. A
(.sup.33-P)UTP-labeled antisense riboprobe was generated from a PCR
product and hybridized at 55.degree. C. overnight. The slides were
dipped in Kodak NTB2.TM. nuclear track emulsion and exposed for 4
weeks.
[1001] 6.24.1. .sup.33P-Riboprobe Synthesis
[1002] 6.0 .mu.l (125 mCi) of .sup.33P-UTP (Amersham BF 1002, SA
<2000 Ci/mmol) were speed-vacuum dried. To each tube containing
dried .sup.33P-UTP, the following ingredients were added:
[1003] 2.0 .mu.l 5.times.transcription buffer
[1004] 1.0 .mu.l DTT (100 mM)
[1005] 2.0 .mu.l NTP mix (2.5 mM: 10 .mu.l each of 10 mM GTP, CTP
& ATP+10 .mu.l H.sub.2O)
[1006] 1.0 .mu.l UTP (50 .mu.M)
[1007] 1.0 .mu.l RNAsin
[1008] 1.0 .mu.l DNA template (1 .mu.g)
[1009] 1.0 .mu.l H.sub.2O
[1010] 1.0 .mu.l RNA polymerase (for PCR products T3=AS, T7=S,
usually)
[1011] The tubes were incubated at 37.degree. C. for one hour. A
total of 1.0 .mu.l RQ1 DNase was added, followed by incubation at
37.degree. C. for 15 minutes. A total of 90 .mu.l TE (10 mM Tris pH
7.6/1 mM EDTA pH 8.0and the mixture was pipetted onto DE81 paper.
The remaining solution was loaded in a MICROCON-50.TM.
ultrafiltration unit, and spun using program 10 (6 minutes). The
filtration unit was inverted over a second tube and spun using
program 2 (3 minutes). After the final recovery spin, a total of
100 .mu.l TE was added, then 1 .mu.l of the final product was
pipetted on DE81 paper and counted in 6 ml of BIOFLUOR II.TM..
[1012] The probe was run on a TBE/urea gel. A total of 1-3 .mu.l of
the probe or 5 .mu.l of RNA Mrk III was added to 3 .mu.l of loading
buffer. After heating on a 95.degree. C. heat block for three
minutes, the gel was immediately placed on ice. The wells of gel
were flushed, and the sample was loaded and run at 180-250 volts
for 45 minutes. The gel was wrapped in plastic wrap (SARAN.TM.
brand) and exposed to XAR film with an intensifying screen in a
-70.degree. C. freezer one hour overnight.
[1013] 6.24.2. .sup.33P-Hybridization
[1014] 6.24.2.1. Pretreatment of Frozen Sections
[1015] The slides were removed from the freezer, placed on aluminum
trays, and thawed at room temperature for 5 minutes. The trays were
placed in a 55.degree. C. incubator for five minutes to reduce
condensation. The slides were fixed for 10 minutes in 4%
paraformaldehyde on ice in the fume hood, and washed in
0.5.times.SSC for 5 minutes, at room temperature (25 ml
20.times.SSC+975 ml SQ H.sub.2O). After deproteination in 0.5
.mu.g/ml proteinase K for 10 minutes at 37.degree. C. (12.5 .mu.l
of 10 mg/ml stock in 250 ml prewarmed RNAse-free RNAse buffer), the
sections were washed in 0.5.times.SSC for 10 minutes at room
temperature. The sections were dehydrated in 70%, 95%, and 100%
ethanol, 2 minutes each.
[1016] 6.24.2.2. Pretreatment of Paraffin-embedded sections
[1017] The slides were deparaffinized, placed in SQ H.sub.2O, and
rinsed twice in 2.times.SSC at room temperature, for 5 minutes each
time. The sections were deproteinated in 20 .mu.g/ml proteinase K
(500 .mu.l of 10 mg/ml in 250 ml RNase-free RNase buffer;
37.degree. C., 15 minutes) for human embryo tissue, or
8.times.proteinase K (100 .mu.l in 250 ml Rnase buffer, 37.degree.
C., 30 minutes) for formalin tissues. Subsequent rinsing in
0.5.times.SSC and dehydration were performed as described
above.
[1018] 6.24.2.3. Prehybridization
[1019] The slides were laid out in a plastic box lined with Box
buffer (4.times.SSC, 50% formamide)--saturated filter paper. The
tissue was covered with 50 .mu.l of hybridization buffer (3.75 g
dextran sulfate+6 ml SQ H.sub.2O), vortexed, and heated in the
microwave for 2 minutes with the cap loosened. After cooling on
ice, 18.75 ml formamide, 3.75 ml 20.times.SSC, and 9 ml SQ H.sub.2O
were added, and the tissue was vortexed well and incubated at
42.degree. C. for 1-4 hours.
[1020] 6.24.2.4. Hybridization
[1021] 1.0.times.10.sup.6 cpm probe and 1.0 .mu.l tRNA (50 mg/ml
stock) per slide were heated at 95.degree. C. for 3 minutes. The
slides were cooled on ice, and 48 .mu.l hybridization buffer was
added per slide. After vortexing, 50 .mu.l .sup.33P mix was added
to 50 .mu.l prehybridization on the slide. The slides were
incubated overnight at 55.degree. C.
[1022] 6.24.2.5. Washes
[1023] Washing was done for 2.times.10 minutes with 2.times.SSC,
EDTA at room temperature (400 ml 20.times.SSC+16 ml 0.25 M EDTA,
V.sub.f=4L), followed by RNAseA treatment at 37.degree. C. for 30
minutes (500 .mu.l of 10 mg/ml in 250 ml Rnase buffer=20 .mu.g/ml),
The slides were washed 2.times.10 minutes with 2.times.SSC, EDTA at
room temperature. The stringency wash conditions were as follows: 2
hours at 55.degree. C., 0.1.times.SSC, EDTA (20 ml 20.times.SSC+16
ml EDTA, V.sub.f=4L).
[1024] 6.24.2.6. Oligonucleotides
[1025] In situ analysis was performed on three of the DNA sequences
disclosed herein. The primers used to generate the probes and/or
the probes employed for these analyses are as follows:
8 DNA33100-p1: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG GTG GAG
GTG GAA CAG AAA3' (SEQ ID NO:375) DNA33100-p2: 5'CTA TGA AAT TAA
CCC TCA CTA AAG GGA CAC AGA CAG AGC CCC ATA CGC3' (SEQ ID NO:376)
DNA34431-p1: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG GGA AAT CCG
GAT GTC TC3' (SEQ ID NO:377) DNA34431-p2: 5'CTA TGA AAT TAA CCC TCA
CTA AAG GGA GTA AGG GGA TGC CAC CGA GTA3' (SEQ ID NO:378)
DNA38268-p1: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CTA CCC GCA
GGA GGA GG3' (SEQ ID NO:379) DNA38268-p2: 5'CTA TGA AAT TAA CCC TCA
CTA AAG GGA TCC CAG GTG ATG AGG TCC AGA3' (SEQ ID NO:380) DNA64908
probe:
5'CCATCTCGGAGACCTTTGTGCAGCGTGTATACCAGCCTTACCTCACCACTTGCGACGGACACAGAGCC
(SEQ ID NO:381) TGCAGCACCTACCGAACCATCTACCGGACTGCCTATCGCCGTAGCCCTG-
GGGTGACTCCCGCAAGCCTCG CTATGCTTGCTGCCCTGGTTGGAAGAGGACCAGTG-
GGCTCCCTGGGGCTTGTGGAGCAGCAATATGCCAG
CCTCCATGTGGGAATGGAGGGAGTTGCATCCGCCCAGGACACTGCCGCTGCCCTGTGGGATGGCAGGGAG
ATACTTGCCAGACAGATGTTGATGAATGCAGTACAGGAGAGGCCAGTTGTCCCCAGCGC-
TGTGTCAATAC TGTGGGAAGTTACTGGTGCCAGGGATGGGAGGGACAAAGCCCATC-
TGCAGATGGGACGCGCTGCCTGTCT AAGGAGGGGCCCTCCCGGTGGCCCCAACCCC-
ACAGCAGGAGTGGACAGCA3'
[1026] 6.24.2.7. Results
[1027] In situ analysis was performed and the results from these
analyses are as follows:
[1028] 6.24.2.7.1. DNA33100-1159 (PRO229) (Scavenger-R/CD6
homologTNF motif)
[1029] A specific positive signal was observed in mononuclear
phagocytes (macrophages) of fetal and adult spleen, liver, lymph
node and thymus. All other tissues were negative.
[1030] 6.24.2.7.2. DNA34431-1177 (PRO263) (CD44)
[1031] A specific positive signal was observed in human fetal
tissues and placenta over mononuclear cells, with strong expression
in epithelial cells of the adrenal cortex. All adult tissues were
negative.
[1032] 6.24.2.7.3. DNA38268-1188 (PRO295) (Integrin)
[1033] A specific positive signal was observed in human fetal
ganglion cells, fetal neurons, adult adrenal medulla and adult
neurons. All other tissues were negative.
[1034] 6.24.2.7.4. DNA64908-1163-1 (PRO1449)
[1035] A specific positive signal was observed in the developing
vasculature (from E7-E11), in endothelial cells and in progenitors
of endothelial cells in wholemount in situ hybridizations of mouse
embryos (FIG. 375). Specific expression was also observed in a
subset of blood vessels and epidermis from E12 onward. A mouse
orthologue of PRO1449 which has about 78% amino acid identity with
PRO1449 was used as the probe.
[1036] In normal adult tissues, expression was low to absent. When
present, expression was confined to the vasculature (FIG. 376).
FIG. 376 further shows that highest expression in adult tissues was
observed regionally in vessels running within the white matter of
the brain. Elevated expression was also observed in vasculature of
many inflamed and diseased tissues, including, but not limited to,
tumor vasculature.
[1037] Following electroporation of the mouse orthologue of PRO1449
into the choroid layer in the eyes of chicken embryos, new vessel
formation was observed in the electroporated eye (top right), but
not in the control side from the same embryo (top left), or an
embryo that was electroporated with a control cDNA (bottom right)
(FIG. 377). cl 6.25. Example 25
Inhibition of Basic Fibroblast Growth Factor (bFGF) Stimulated
Proliferation of Endothelial Cell Growth
[1038] The ability of various PRO polypeptides to inhibit bFGF
stimulated proliferation of endothelial cells was tested.
Polypeptides testing positive in this assay are useful for
inhibiting endothelial cell growth in mammals where such an effect
would be beneficial, e.g., for inhibiting tumor growth.
[1039] Specifically, human venous umbilical vein endothelial cells
(HUVEC, Cell Systems) in epithelial cell growth media (EGM,
Clonetics) were plated on 96-well microtiter plates at a cell
density of 5.times.10.sup.3 cells/well in a volume of 100
.mu.l/well. The day after plating (day 2), the cells were starved
for 24 hours by removing the growth media and replacing with
starving media (M199 supplemented with 1% FBS, 2 mM L-glutamine,
100 U/ml penicillin and 100 U/ml streptomycin). On day 5, the cells
are treated with either: (1) M199 with 10% FB M199 with 1% FBS; (3)
M199 with 1% FBS and 20 ng/ml bFGF; (4) M199 with 1% FBS and 20
ng/ml bFGF and PRO polypeptide (500 nM); (5) M199 with 1% FBS and
20 ng/ml bFGF and PRO polypeptide (50 nM); or (6) M199 with 1% FBS
and 20 ng/ml bFGF and PRO polypeptide (5 nM). On day 8, an
assessment of cell proliferation was performed by Alamar Blue
assay. Optical density (OD) was measured on a microplate reader at
excitation 530 and emission at 590 nm.
[1040] The activity of PRO polypeptides was calculated as the
percent inhibition of bFGF stimulated proliferation relative to the
cells without stimulation. The results are indicative of the
utility of the PRO polypeptides in cancer therapy and specifically
in inhibiting tumor angiogenesis. Numerical values (relative
inhibition) are determined by calculating the percent inhibition of
bFGF stimulated proliferation by the PRO polypeptides relative to
cells without stimulation. The results are considered positive if
the PRO polypeptide exhibits 30% or greater inhibition of bFEGF
stimulation of endothelial cell growth.
[1041] PRO5725 tested positive in this assay.
[1042] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct(s) deposited, since the deposited embodiment(s)
is/are intended as single illustration(s) of certain aspects of the
invention and any constructs that are functionally equivalent are
within the scope of this invention. The deposit of material(s)
herein does not constitute an admission that the written
description herein contained is inadequate to enable the practice
of any aspect of the invention, including the best mode thereof,
nor is it to be construed as limiting the scope of the claims to
the specific illustrations that it represents. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and fall within the scope of the
appended claims.
Sequence CWU 0
0
* * * * *
References