U.S. patent application number 10/225261 was filed with the patent office on 2003-05-29 for kunitz domain polypeptide zkun11.
Invention is credited to Holloway, James L..
Application Number | 20030100070 10/225261 |
Document ID | / |
Family ID | 26867358 |
Filed Date | 2003-05-29 |
United States Patent
Application |
20030100070 |
Kind Code |
A1 |
Holloway, James L. |
May 29, 2003 |
Kunitz domain polypeptide Zkun11
Abstract
Members of the serine protease family play a role in carefully
controlled processes, such as blood coagulation, fibrinolysis,
complement activation, fertilization, and hormone production. The
enzymatic activity of the serine proteases is regulated in part by
protease inhibitors that comprise a Kunitz domain. Zkun11 is a new
member of the Kunitz domain protein family.
Inventors: |
Holloway, James L.;
(Seattle, WA) |
Correspondence
Address: |
Phillip B.C. Jones, J.D., Ph.D.
ZymoGenetics, Inc.
1201 Eastlake Avenue East
Seattle
WA
98102
US
|
Family ID: |
26867358 |
Appl. No.: |
10/225261 |
Filed: |
August 20, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10225261 |
Aug 20, 2002 |
|
|
|
09740510 |
Dec 18, 2000 |
|
|
|
60171722 |
Dec 22, 1999 |
|
|
|
Current U.S.
Class: |
435/69.2 ;
435/184; 435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
C07K 14/8117 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
435/69.2 ;
435/184; 435/320.1; 435/325; 536/23.2 |
International
Class: |
C12P 021/02; C12N
005/06; C07H 021/04; C12N 009/99 |
Claims
I claim:
1. An isolated polypeptide, comprising an amino acid sequence that
is at least 70% identical to the amino acid sequence of SEQ ID
NO:2, wherein the isolated polypeptide comprises an amino acid
sequence with the structure: C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C
(SEQ ID NO:5), where "X" is any amino acid residue and the values
in parentheses indicate the number of such variable residues.
2. The isolated polypeptide of claim 1, wherein the isolated
polypeptide comprises an amino acid sequence that is at least 80%
identical to the amino acid sequence of SEQ ID NO:2.
3. The isolated polypeptide of claim 1, wherein the isolated
polypeptide has an amino acid sequence that is at least 90%
identical to the amino acid sequence of SEQ ID NO:2.
4. The isolated polypeptide of claim1, wherein the polypeptide is a
serine protease inhibitor.
5. The isolated polypeptide of claim 1, comprising the amino acid
sequence of SEQ ID NO:2.
6. The isolated polypeptide of claim 5, consisting of the amino
acid sequence of SEQ ID NO:2.
7. An isolated polypeptide, comprising a Kunitz domain amino acid
sequence, wherein the Kunitz domain amino acid sequence shares a
percent identity with the amino acid sequence of SEQ ID NO:2,
wherein the percent identity is selected from the group consisting
of 70%, 80%, 85%, and at least 90%, and wherein the isolated
polypeptide comprises an amino acid sequence with the structure:
C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C (SEQ ID NO:5), where "X" is
any amino acid residue and the values in parentheses indicate the
number of such variable residues.
8. The isolated polypeptide of claim 7, further comprising a second
Kunitz domain amino acid sequence, wherein the first and second
Kunitz domain sequences are separated by a linker that comprises at
least about ten amino acid residues.
9. The isolated polypeptide of claim 8, wherein the linker
comprises about 20 or about 40 amino acid residues.
10. The isolated polypeptide of claim 8, wherein the linker
comprises about 60 or about 80 amino acid residues.
11. An isolated nucleic acid molecule selected from the group
consisting of: (a) a nucleic acid molecule comprising the
nucleotide sequence of SEQ ID NO:3, and (b) a nucleic acid molecule
that remains hybridized following stringent wash conditions to a
nucleic acid molecule consisting of a nucleotide sequence that is
either the nucleotide sequence of SEQ ID NO:1, or the complement of
the nucleotide sequence of SEQ ID NO:1.
12. The isolated nucleic acid molecule of claim 11, wherein any
difference between the amino acid sequence encoded by the nucleic
acid molecule and the corresponding amino acid sequence of SEQ ID
NO:2 is due to a conservative amino acid substitution.
13. The isolated nucleic acid molecule of claim 11, comprising the
nucleotide sequence of SEQ ID NO:1.
14. A vector, comprising the isolated nucleic acid molecule of
claim 13.
15. An expression vector, comprising the isolated nucleic acid
molecule of claim 13, a transcription promoter, and a transcription
terminator, wherein the promoter is operably linked with the
nucleic acid molecule, and wherein the nucleic acid molecule is
operably linked with the transcription terminator.
16. A recombinant host cell comprising the expression vector of
claim 15, wherein the host cell is selected from the group
consisting of bacterium, yeast cell, avian cell, fungal cell,
insect cell, mammalian cell, and plant cell.
17. A method of using the expression vector of claim 15 to produce
a protein that comprises the amino acid sequence of SEQ ID NO:2,
comprising culturing recombinant host cells that comprise the
expression vector and that produce the protein.
18. An antibody or antibody fragment that specifically binds with
the polypeptide of claim 6.
19. The antibody of claim 18, wherein the antibody is selected from
the group consisting of: (a) polyclonal antibody, (b) murine
monoclonal antibody, (c) humanized antibody derived from (b), and
(d) human monoclonal antibody.
20. An anti-idiotype antibody that specifically binds with the
antibody, or anti-idiotype antibody, of claim 18.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
application No. 60/171,722 (filed Dec. 22, 1999), the contents of
which are incorporated by reference.
TECHNICAL FIELD
[0002] The present invention relates generally to a new gene that
encodes an enzyme inhibitor. In particular, the present invention
relates to a novel protein, designated "Zkun11," and to nucleic
acid molecules encoding Zkun11.
BACKGROUND OF THE INVENTION
[0003] In animals, proteinases are important in wound healing,
extracellular matrix destruction, tissue reorganization, and in
cascades leading to blood coagulation, fibrinolysis, and complement
activation. Proteinases are released by inflammatory cells for
destruction of pathogens or foreign materials, and by normal and
cancerous cells as they move through their surroundings.
[0004] The activity of proteinases is regulated by inhibitors
(Roberts et al., Critical Reviews in Eukaryotic Gene Expression
5:385 (1995)). One family of proteinase inhibitors, the Kunitz
inhibitors, includes inhibitors of trypsin, chymotrypsin, lastase,
kallikrein, plasmin, coagulation factors XIa and IXa, and cathepsin
G. These inhibitors thus regulate a variety of physiological
processes, including blood coagulation, fibrinolysis, and
inflammation.
[0005] Proteinase inhibitors regulate the proteolytic activity of
target proteinases by occupying the active site and thereby
preventing occupation by normal substrates. Although proteinase
inhibitors fall into several unrelated structural classes, they all
possess an exposed loop (variously termed an "inhibitor loop," a
"reactive core," a "reactive site," or a "binding loop"), which is
stabilized by intermolecular interactions between residues flanking
the loop and the protein core (Bode and Huber, Eur. J. Biochem.
204:433 (1992)). Interaction between inhibitor and enzyme produces
a stable complex, which disassociates very slowly, releasing either
uncleaved inhibitor, or a modified inhibitor that is cleaved at the
scissile bond of the binding loop.
[0006] One class of proteinase inhibitors, the Kunitz inhibitors,
are generally basic, low molecular weight proteins comprising one
or more inhibitory domains ("Kunitz domains"). The Kunitz domain is
a folding domain of approximately 50-60 residues, which forms a
central anti-parallel beta sheet and a short C-terminal helix. This
characteristic domain comprises six cysteine residues that form
three disulfide bonds, resulting in a double-loop structure.
Between the N-terminal region and the first beta strand resides the
active inhibitory binding loop. This binding loop is disulfide
bonded through the P2 Cys residue to the hairpin loop formed
between the last two beta strands. Isolated Kunitz domains from a
variety of proteinase inhibitors have been shown to have inhibitory
activity (see, for example, Petersen et al., Eur. J. Biochem.
125:310 (1996); Wagner et al., Biochem. Biophys. Res. Comm.
186:1138 (1992); Dennis et al., J. Biol. Chem.
270:25411(1995)).
[0007] Proteinase inhibitors comprising one or more Kunitz domains
include tissue factor pathway inhibitor (TFPI), tissue factor
pathway inhibitor 2 (TFPI-2), amyloid .beta.-protein precursor
(A.beta.PP), aprotinin, and placental bikunin. TFPI, an extrinsic
pathway inhibitor and a natural anticoagulant, contains three
tandemly linked Kunitz inhibitor domains. The amino-terminal Kunitz
domain inhibits factor VIIa, plasmin, and cathepsin G; the second
domain inhibits factor Xa, trypsin, and chymotrypsin; and the third
domain has no known activity (Petersen et al., Eur. J. Biochem.
125:310 (1996)). TFPI-2 has been shown to be an inhibitor of the
amidolytic and proteolytic activities of human factor VIIa-tissue
factor complex, factor XIa, plasma kallikrein, and plasmin
(Sprecher et al., Proc. Nat'l Acad. Sci. USA 91:3353 (1994);
Petersen et al., Biochem. 35:266 (1996)). The ability of TFPI-2 to
inhibit the factor VIIa-tissue factor complex and its relatively
high levels of transcription in umbilical vein endothelial cells,
placenta and liver suggests a specialized role for this protein in
hemostasis (Sprecher et al., Proc. Nat'l Acad. Sci. USA 91:3353
(1994)).
[0008] Aprotinin (bovine pancreatic trypsin inhibitor) is a broad
spectrum Kunitz-type serine proteinase inhibitor that has been
shown to prevent activation of the clotting cascade. Aprotinin is a
moderate inhibitor of plasma kallikrein and plamin, and blockage of
fibrinolysis and extracorporeal coagulation have been detected in
patients given aprotinin during open heart surgery (Davis and
Whittington, Drugs 49:954 (1995); Dietrich et al., Thorac.
Cardiovasc. Surg. 37:92 (1989)). Aprotinin has also been used in
the treatment of septic shock, adult respiratory distress syndrome,
acute pancreatitis, hemorrhagic shock, and other conditions
(Westaby, Ann. Thorac. Surg. 55:1033 (1993); Wachtfogel et al., J.
Thorac. Cardiovasc. Surg. 106:1 (1993)). The clinical utility of
aprotinin is believed to arise from its inhibitory activity towards
plasma kallikrein or plasmin (Dennis et al., J. Biol. Chem.
270:25411 (1995)). Placental bikunin is a serine proteinase
inhibitor containing two Kunitz domains (Delaria et al., J. Biol.
Chem. 272:12209 (1997)). Individual Kunitz domains of bikunin have
been expressed and shown to be potent inhibitors of trypsin,
chymotrypsin, plasmin, factor XIa, and tissue and plasma kallikrein
(Delaria et al., J. Biol. Chem. 272:12209 (1997)).
[0009] Known Kunitz-type inhibitors lack specificity and may have
low potency. Lack of specificity can result in undesirable side
effects, such as nephrotoxicity that occurs after repeated
injections of high doses of aprotinin. These limitations may be
overcome by preparing isolated Kunitz domains, which may have fewer
side effects than traditional anticoagulants. Hence, there is a
need in the art for additional Kunitz-type proteinase
inhibitors.
BRIEF SUMMARY OF THE INVENTION
[0010] The present invention provides a novel Kunitz inhibitor
protein, designated "Zkun11." The present invention also provides
Zkun11 variant polypeptides and Zkun11 fusion proteins, as well as
nucleic acid molecules encoding such polypeptides and proteins, and
methods for using these nucleic acid molecules and amino acid
sequences.
DESCRIPTION OF THE INVENTION
[0011] 1. Overview
[0012] The present invention provides nucleic acid molecules that
encode a new human Kunitz inhibitor protein, designated as
"Zkun11." An illustrative nucleotide sequence that encodes Zkun11
is provided by SEQ ID NO:1. The encoded polypeptide has the
following amino acid sequence: CNYPLKKGTC NSYLTRFYYN TLTFLCEPFV
FSGCGGNRNN FKQKYFCEKM C (SEQ ID NO:2).
[0013] Sequence analysis revealed that Zkun11 can be represented by
the following Kunitz domain sequence:
C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C (SEQ ID NO:5), where "X" is
any amino acid residue and the values in parentheses indicate the
number of such variable residues. Referring to SEQ ID NO:2,
disulfide bonds are predicted to be formed by paired cysteine
residues Cys1 to Cys52, Cys10 to Cys34, and Cys26 to Cys47. Amino
acid substitutions can be made within the Zkun11 sequence so long
as the conserved cysteine residues are retained and the higher
order structure is not disrupted.
[0014] Example 1 illustrates that the Zkun11 gene is expressed
differentially. For example, the Zkun11 gene is expressed in
prostate tissue, but is not expressed in a variety of tissues
including adrenal gland, bladder, colon, kidney, liver, ovary,
pituitary, placenta, rectum, spleen, stomach, and testis. Thus,
prostate tissue can be distinguished from other tissues identified
herein, using nucleic acid molecules that encode Zkun11, as well as
Zkun11 polypeptides, and antibodies (or antibody fragments) to
Zkun11 polypeptides.
[0015] As detailed below, the present invention provides isolated
polypeptides having an amino acid sequence that is at least 70%, at
least 80%, or at least 90% identical to the amino acid sequence of
SEQ ID NO:2, wherein such isolated polypeptides specifically bind
with an antibody that specifically binds with a polypeptide having
the amino acid sequence of SEQ ID NO:2. Typically, such isolated
polypeptides comprise an amino acid sequence with the structure:
C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C (SEQ ID NO:5), where "X" is
any amino acid residue and the values in parentheses indicate the
number of such variable residues. An illustrative polypeptide is a
polypeptide that comprises the amino acid sequence of SEQ ID
NO:2.
[0016] The present invention also provides isolated polypeptides,
comprising a Kunitz domain amino acid sequence, wherein the Kunitz
domain amino acid sequence shares a percent identity with the amino
acid sequence of SEQ ID NO:2, wherein the percent identity is
selected from the group consisting of 70%, 80%, 85%, and at least
90%, and wherein the isolated polypeptide comprises an amino acid
sequence with the structure: C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C
(SEQ ID NO:5), where "X" is any amino acid residue and the values
in parentheses indicate the number of such variable residues.
Isolated polypeptides can further comprise a second Kunitz domain
amino acid sequence, wherein the first and second Kunitz domain
sequences are separated by a linker that comprises at least about
ten amino acid residues. Such linkers can comprise, for example,
about 20, about 40, about 60, or about 80, amino acid residues.
Additional Kunitz domain inhibitors can be added in a similar
manner.
[0017] Particular polypeptides of the present invention can also be
characterized by serine protease inhibitory activity. Moreover,
peptides and polypeptides of the present invention can further
comprise an affinity tag.
[0018] The present invention further provides antibodies and
antibody fragments that specifically bind with such polypeptides.
Exemplary antibodies include polyclonal antibodies, murine
monoclonal antibodies, humanized antibodies derived from murine
monoclonal antibodies, and human monoclonal antibodies.
Illustrative antibody fragments include F(ab').sub.2, F(ab).sub.2,
Fab', Fab, Fv, scFv, and minimal recognition units. The present
invention also includes anti-idiotype antibodies that bind with
such antibodies and antibody fragments, as well as compositions
comprising a carrier and a peptide, polypeptide, antibody, or
anti-idiotype antibody described herein.
[0019] The present invention also provides isolated nucleic acid
molecules that encode a Zkun11 polypeptide, wherein the nucleic
acid molecule is selected from the group consisting of: a nucleic
acid molecule comprising the nucleotide sequence of SEQ ID NO:3; a
nucleic acid molecule encoding the amino acid sequence of SEQ ID
NO:2; and a nucleic acid molecule that remains hybridized following
stringent wash conditions to a nucleic acid molecule consisting of
the nucleotide sequence of SEQ ID NO:1, or to the complement of the
nucleotide sequence of SEQ ID NO:1.
[0020] Illustrative nucleic acid molecules include those in which
any difference between the amino acid sequence encoded by the
nucleic acid molecule and the corresponding amino acid sequence of
SEQ ID NO:2 is due to a conservative amino acid substitution. The
present invention further contemplates isolated nucleic acid
molecules that comprise, or consist of, the nucleotide sequence of
SEQ ID NO:1.
[0021] The present invention also includes vectors and expression
vectors comprising such nucleic acid molecules. Such expression
vectors may comprise a transcription promoter, and a transcription
terminator, wherein the promoter is operably linked with the
nucleic acid molecule, and wherein the nucleic acid molecule is
operably linked with the transcription terminator. The present
invention further includes recombinant host cells comprising these
vectors and expression vectors. Illustrative host cells include
bacterial, yeast, fungal, avian, insect, mammalian, and plant
cells. Recombinant host cells comprising such expression vectors
can be used to produce Zkun11 polypeptides by culturing such
recombinant host cells that comprise the expression vector and that
produce the Zkun11 protein, and, optionally, isolating the Zkun11
protein from the cultured recombinant host cells. The present
invention further includes products made by such processes.
[0022] The present invention also contemplates methods for
detecting the presence of Zkun11 RNA in a biological sample,
comprising the steps of (a) contacting a Zkun11 nucleic acid probe
under hybridizing conditions with either (i) test RNA molecules
isolated from the biological sample, or (ii) nucleic acid molecules
synthesized from the isolated RNA molecules, wherein the probe has
a nucleotide sequence comprising a portion of the nucleotide
sequence of SEQ ID NO:1, or its complement, and (b) detecting the
formation of hybrids of the nucleic acid probe and either the test
RNA molecules or the synthesized nucleic acid molecules, wherein
the presence of the hybrids indicates the presence of Zkun11 RNA in
the biological sample. An example of a biological sample is a human
biological sample, such as a biopsy or autopsy specimen.
[0023] The present invention further provides methods for detecting
the presence of Zkun11 polypeptide in a biological sample,
comprising the steps of: (a) contacting the biological sample with
an antibody or an antibody fragment that specifically binds with a
polypeptide having the amino acid sequence of SEQ ID NO:2, wherein
the contacting is performed under conditions that allow the binding
of the antibody or antibody fragment to the biological sample, and
(b) detecting any of the bound antibody or bound antibody fragment.
Such an antibody or antibody fragment may further comprise a
detectable label selected from the group consisting of
radioisotope, fluorescent label, chemiluminescent label, enzyme
label, bioluminescent label, and colloidal gold. An example of a
biological sample is a human biological sample, such as a biopsy or
autopsy specimen.
[0024] The present invention also provides kits for performing
these detection methods. For example, a kit for detection of Zkun11
gene expression may comprise a container that comprises a nucleic
acid molecule, wherein the nucleic acid molecule is selected from
the group consisting of (a) a nucleic acid molecule comprising the
nucleotide sequence of SEQ ID NO:1, (b) a nucleic acid molecule
comprising the complement of the nucleotide sequence of SEQ ID
NO:1, (c) a nucleic acid molecule that is a fragment of (a)
consisting of at least eight nucleotides, and (d) a nucleic acid
molecule that is a fragment of (b) consisting of at least eight
nucleotides. Such a kit may also comprise a second container that
comprises one or more reagents capable of indicating the presence
of the nucleic acid molecule. On the other hand, a kit for
detection of Zkun11 protein may comprise a container that comprises
an antibody, or an antibody fragment, that specifically binds with
a polypeptide having the amino acid sequence of SEQ ID NO:2.
[0025] The present invention also provides fusion proteins,
comprising a Zkun11 polypeptide moiety. Such fusion proteins can
further comprise an immunoglobulin moiety. In such fusion proteins,
the immunoglobulin moiety may be an immunoglobulin heavy chain
constant region, such as a human F.sub.c fragment. The present
invention further includes isolated nucleic acid molecules that
encode such fusion proteins.
[0026] These and other aspects of the invention will become evident
upon reference to the following detailed description. In addition,
various references are identified below and are incorporated by
reference in their entirety.
[0027] 2. Definitions
[0028] In the description that follows, a number of terms are used
extensively. The following definitions are provided to facilitate
understanding of the invention.
[0029] As used herein, "nucleic acid" or "nucleic acid molecule"
refers to polynucleotides, such as deoxyribonucleic acid (DNA) or
ribonucleic acid (RNA), oligonucleotides, fragments generated by
the polymerase chain reaction (PCR), and fragments generated by any
of ligation, scission, endonuclease action, and exonuclease action.
Nucleic acid molecules can be composed of monomers that are
naturally-occurring nucleotides (such as DNA and RNA), or analogs
of naturally-occurring nucleotides (e.g., .alpha.-enantiomeric
forms of naturally-occurring nucleotides), or a combination of
both. Modified nucleotides can have alterations in sugar moieties
and/or in pyrimidine or purine base moieties. Sugar modifications
include, for example, replacement of one or more hydroxyl groups
with halogens, alkyl groups, amines, and azido groups, or sugars
can be functionalized as ethers or esters. Moreover, the entire
sugar moiety can be replaced with sterically and electronically
similar structures, such as aza-sugars and carbocyclic sugar
analogs. Examples of modifications in a base moiety include
alkylated purines and pyrimidines, acylated purines or pyrimidines,
or other well-known heterocyclic substitutes. Nucleic acid monomers
can be linked by phosphodiester bonds or analogs of such linkages.
Analogs of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the
like. The term "nucleic acid molecule" also includes so-called
"peptide nucleic acids," which comprise naturally-occurring or
modified nucleic acid bases attached to a polyamide backbone.
Nucleic acids can be either single stranded or double stranded.
[0030] The term "complement of a nucleic acid molecule" refers to a
nucleic acid molecule having a complementary nucleotide sequence
and reverse orientation as compared to a reference nucleotide
sequence. For example, the sequence 5' ATGCACGGG 3' is
complementary to 5' CCCGTGCAT 3'.
[0031] The term "contig" denotes a nucleic acid molecule that has a
contiguous stretch of identical or complementary sequence to
another nucleic acid molecule. Contiguous sequences are said to
"overlap" a given stretch of a nucleic acid molecule either in
their entirety or along a partial stretch of the nucleic acid
molecule.
[0032] The term "degenerate nucleotide sequence" denotes a sequence
of nucleotides that includes one or more degenerate codons as
compared to a reference nucleic acid molecule that encodes a
polypeptide. Degenerate codons contain different triplets of
nucleotides, but encode the same amino acid residue (i.e., GAU and
GAC triplets each encode Asp).
[0033] The term "structural gene" refers to a nucleic acid molecule
that is transcribed into messenger RNA (mRNA), which is then
translated into a sequence of amino acids characteristic of a
specific polypeptide.
[0034] An "isolated nucleic acid molecule" is a nucleic acid
molecule that is not integrated in the genomic DNA of an organism.
For example, a DNA molecule that encodes a growth factor that has
been separated from the genomic DNA of a cell is an isolated DNA
molecule. Another example of an isolated nucleic acid molecule is a
chemically-synthesized nucleic acid molecule that is not integrated
in the genome of an organism. A nucleic acid molecule that has been
isolated from a particular species is smaller than the complete DNA
molecule of a chromosome from that species.
[0035] A "nucleic acid molecule construct" is a nucleic acid
molecule, either single- or double-stranded, that has been modified
through human intervention to contain segments of nucleic acid
combined and juxtaposed in an arrangement not existing in
nature.
[0036] "Linear DNA" denotes non-circular DNA molecules having free
5' and 3' ends. Linear DNA can be prepared from closed circular DNA
molecules, such as plasmids, by enzymatic digestion or physical
disruption.
[0037] "Complementary DNA (cDNA)" is a single-stranded DNA molecule
that is formed from an mRNA template by the enzyme reverse
transcriptase. Typically, a primer complementary to portions of
mRNA is employed for the initiation of reverse transcription. Those
skilled in the art also use the term "cDNA" to refer to a
double-stranded DNA molecule consisting of such a single-stranded
DNA molecule and its complementary DNA strand. The term "cDNA" also
refers to a clone of a cDNA molecule synthesized from an RNA
template.
[0038] A "promoter" is a nucleotide sequence that directs the
transcription of a structural gene. Typically, a promoter is
located in the 5' non-coding region of a gene, proximal to the
transcriptional start site of a structural gene. Sequence elements
within promoters that function in the initiation of transcription
are often characterized by consensus nucleotide sequences. These
promoter elements include RNA polymerase binding sites, TATA
sequences, CAAT sequences, differentiation-specific elements (DSEs;
McGehee et al., Mol. Endocrinol. 7:551 (1993)), cyclic AMP response
elements (CREs), serum response elements (SREs; Treisman, Seminars
in Cancer Biol. 1:47 (1990)), glucocorticoid response elements
(GREs), and binding sites for other transcription factors, such as
CRE/ATF (O'Reilly et al., J. Biol. Chem. 267:19938 (1992)), AP2 (Ye
et al., J. Biol. Chem. 269:25728 (1994)), SP1, cAMP response
element binding protein (CREB; Loeken, Gene Expr. 3:253 (1993)) and
octamer factors (see, in general, Watson et al., eds., Molecular
Biology of the Gene, 4th ed. (The Benjamin/Cummings Publishing
Company, Inc. 1987), and Lemaigre and Rousseau, Biochem. J. 303:1
(1994)). If a promoter is an inducible promoter, then the rate of
transcription increases in response to an inducing agent. In
contrast, the rate of transcription is not regulated by an inducing
agent if the promoter is a constitutive promoter. Repressible
promoters are also known.
[0039] A "core promoter" contains essential nucleotide sequences
for promoter function, including the TATA box and start of
transcription. By this definition, a core promoter may or may not
have detectable activity in the absence of specific sequences that
may enhance the activity or confer tissue specific activity.
[0040] A "regulatory element" is a nucleotide sequence that
modulates the activity of a core promoter. For example, a
regulatory element may contain a nucleotide sequence that binds
with cellular factors enabling transcription exclusively or
preferentially in particular cells, tissues, or organelles. These
types of regulatory elements are normally associated with genes
that are expressed in a "cell-specific," "tissue-specific," or
"organelle-specific" manner. For example, the Zkun11 regulatory
element preferentially induces gene expression in spleen, thymus,
spinal cord, and lymph node tissues, as opposed to placenta, lung,
and liver tissues.
[0041] An "enhancer" is a type of regulatory element that can
increase the efficiency of transcription, regardless of the
distance or orientation of the enhancer relative to the start site
of transcription.
[0042] "Heterologous DNA" refers to a DNA molecule, or a population
of DNA molecules, that does not exist naturally within a given host
cell. DNA molecules heterologous to a particular host cell may
contain DNA derived from the host cell species (i.e., endogenous
DNA) so long as that host DNA is combined with non-host DNA (i.e.,
exogenous DNA). For example, a DNA molecule containing a non-host
DNA segment encoding a polypeptide operably linked to a host DNA
segment comprising a transcription promoter is considered to be a
heterologous DNA molecule. Conversely, a heterologous DNA molecule
can comprise an endogenous gene operably linked with an exogenous
promoter. As another illustration, a DNA molecule comprising a gene
derived from a wild-type cell is considered to be heterologous DNA
if that DNA molecule is introduced into a mutant cell that lacks
the wild-type gene.
[0043] A "polypeptide" is a polymer of amino acid residues joined
by peptide bonds, whether produced naturally or synthetically.
Polypeptides of less than about 10 amino acid residues are commonly
referred to as "peptides."
[0044] A "protein" is a macromolecule comprising one or more
polypeptide chains. A protein may also comprise non-peptidic
components, such as carbohydrate groups. Carbohydrates and other
non-peptidic substituents may be added to a protein by the cell in
which the protein is produced, and will vary with the type of cell.
Proteins are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are generally
not specified, but may be present nonetheless.
[0045] A peptide or polypeptide encoded by a non-host DNA molecule
is a "heterologous" peptide or polypeptide.
[0046] An "integrated genetic element" is a segment of DNA that has
been incorporated into a chromosome of a host cell after that
element is introduced into the cell through human manipulation.
Within the present invention, integrated genetic elements are most
commonly derived from linearized plasmids that are introduced into
the cells by electroporation or other techniques. Integrated
genetic elements are passed from the original host cell to its
progeny.
[0047] A "cloning vector" is a nucleic acid molecule, such as a
plasmid, cosmid, or bacteriophage, which has the capability of
replicating autonomously in a host cell. Cloning vectors typically
contain one or a small number of restriction endonuclease
recognition sites that allow insertion of a nucleic acid molecule
in a determinable fashion without loss of an essential biological
function of the vector, as well as nucleotide sequences encoding a
marker gene that is suitable for use in the identification and
selection of cells transformed with the cloning vector. Marker
genes typically include genes that provide tetracycline resistance
or ampicillin resistance.
[0048] An "expression vector" is a nucleic acid molecule encoding a
gene that is expressed in a host cell. Typically, an expression
vector comprises a transcription promoter, a gene, and a
transcription terminator. Gene expression is usually placed under
the control of a promoter, and such a gene is said to be "operably
linked to" the promoter. Similarly, a regulatory element and a core
promoter are operably linked if the regulatory element modulates
the activity of the core promoter.
[0049] A "recombinant host" is a cell that contains a heterologous
nucleic acid molecule, such as a cloning vector or expression
vector. In the present context, an example of a recombinant host is
a cell that produces Zkun11 from an expression vector. In contrast,
Zkun11 can be produced by a cell that is a "natural source" of
Zkun11, and that lacks an expression vector.
[0050] "Integrative transformants" are recombinant host cells, in
which heterologous DNA has become integrated into the genomic DNA
of the cells.
[0051] A "fusion protein" is a hybrid protein expressed by a
nucleic acid molecule comprising nucleotide sequences of at least
two genes. For example, a fusion protein can comprise at least part
of a Zkun11 polypeptide fused with a polypeptide that binds an
affinity matrix. Such a fusion protein provides a means to isolate
large quantities of Zkun11 using affinity chromatography.
[0052] The term "receptor" denotes a cell-associated protein that
binds to a bioactive molecule termed a "ligand." This interaction
mediates the effect of the ligand on the cell. Receptors can be
membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid
stimulating hormone receptor, beta-adrenergic receptor) or
multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3
receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor
and IL-6 receptor). Membrane-bound receptors are characterized by a
multi-domain structure comprising an extracellular ligand-binding
domain and an intracellular effector domain that is typically
involved in signal transduction. In certain membrane-bound
receptors, the extracellular ligand-binding domain and the
intracellular effector domain are located in separate polypeptides
that comprise the complete functional receptor.
[0053] In general, the binding of ligand to receptor results in a
conformational change in the receptor that causes an interaction
between the effector domain and other molecule(s) in the cell,
which in turn leads to an alteration in the metabolism of the cell.
Metabolic events that are often linked to receptor-ligand
interactions include gene transcription, phosphorylation,
dephosphorylation, increases in cyclic AMP production, mobilization
of cellular calcium, mobilization of membrane lipids, cell
adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids.
[0054] The term "secretory signal sequence" denotes a nucleotide
sequence that encodes a peptide (a "secretory peptide") that, as a
component of a larger polypeptide, directs the larger polypeptide
through a secretory pathway of a cell in which it is synthesized.
The larger polypeptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
[0055] An "isolated polypeptide" is a polypeptide that is
essentially free from contaminating cellular components, such as
carbohydrate, lipid, or other proteinaceous impurities associated
with the polypeptide in nature. Typically, a preparation of
isolated polypeptide contains the polypeptide in a highly purified
form, i.e., at least about 80% pure, at least about 90% pure, at
least about 95% pure, greater than 95% pure, or greater than 99%
pure. One way to show that a particular protein preparation
contains an isolated polypeptide is by the appearance of a single
band following sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis of the protein preparation and Coomassie Brilliant
Blue staining of the gel. However, the term "isolated" does not
exclude the presence of the same polypeptide in alternative
physical forms, such as dimers or alternatively glycosylated or
derivatized forms.
[0056] The terms "amino-terminal" and "carboxyl-terminal" are used
herein to denote positions within polypeptides. Where the context
allows, these terms are used with reference to a particular
sequence or portion of a polypeptide to denote proximity or
relative position. For example, a certain sequence positioned
carboxyl-terminal to a reference sequence within a polypeptide is
located proximal to the carboxyl terminus of the reference
sequence, but is not necessarily at the carboxyl terminus of the
complete polypeptide.
[0057] The term "expression" refers to the biosynthesis of a gene
product. For example, in the case of a structural gene, expression
involves transcription of the structural gene into mRNA and the
translation of mRNA into one or more polypeptides.
[0058] The term "splice variant" is used herein to denote
alternative forms of RNA transcribed from a gene. Splice variation
arises naturally through use of alternative splicing sites within a
transcribed RNA molecule, or less commonly between separately
transcribed RNA molecules, and may result in several mRNAs
transcribed from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term splice
variant is also used herein to denote a polypeptide encoded by a
splice variant of an mRNA transcribed from a gene.
[0059] As used herein, the term "immunomodulator" includes
cytokines, stem cell growth factors, lymphotoxins, co-stimulatory
molecules, hematopoietic factors, and synthetic analogs of these
molecules.
[0060] The term "complement/anti-complement pair" denotes
non-identical moieties that form a non-covalently associated,
stable pair under appropriate conditions. For instance, biotin and
avidin (or streptavidin) are prototypical members of a
complement/anti-complement pair. Other exemplary
complement/anti-complement pairs include receptor/ligand pairs,
antibody/antigen (or hapten or epitope) pairs, sense/antisense
polynucleotide pairs, and the like. Where subsequent dissociation
of the complement/anti-complement pair is desirable, the
complement/anti-complem- ent pair preferably has a binding affinity
of less than 10.sup.9 M.sup.-1.
[0061] An "anti-idiotype antibody" is an antibody that binds with
the variable region domain of an immunoglobulin. In the present
context, an anti-idiotype antibody binds with the variable region
of an anti-Zkun11 antibody, and thus, an anti-idiotype antibody
mimics an epitope of Zkun11. Particular Zkun11 anti-idiotype
antibodies possess serine protease inhibitor activity.
[0062] An "antibody fragment" is a portion of an antibody such as
F(ab').sub.2, F(ab).sub.2, Fab', Fab, and the like. Regardless of
structure; an antibody fragment binds with the same antigen that is
recognized by the intact antibody. For example, an anti-Zkun11
monoclonal antibody fragment binds with an epitope of Zkun11.
[0063] The term "antibody fragment" also includes a synthetic or a
genetically engineered polypeptide that binds to a specific
antigen, such as polypeptides consisting of the light chain
variable region, "Fv" fragments consisting of the variable regions
of the heavy and light chains, recombinant single chain polypeptide
molecules in which light and heavy variable regions are connected
by a peptide linker ("scFv proteins"), and minimal recognition
units consisting of the amino acid residues that mimic the
hypervariable region.
[0064] A "chimeric antibody" is a recombinant protein that contains
the variable domains and complementary determining regions derived
from a rodent antibody, while the remainder of the antibody
molecule is derived from a human antibody.
[0065] "Humanized antibodies" are recombinant proteins in which
murine complementarity determining regions of a monoclonal antibody
have been transferred from heavy and light variable chains of the
murine immunoglobulin into a human variable domain.
[0066] As used herein, a "therapeutic agent" is a molecule or atom,
which is conjugated to an antibody moiety to produce a conjugate,
which is useful for therapy. Examples of therapeutic agents include
drugs, toxins, immunomodulators, chelators, boron compounds,
photoactive agents or dyes, and radioisotopes.
[0067] A "detectable label" is a molecule or atom, which can be
conjugated to an antibody moiety to produce a molecule useful for
diagnosis. Examples of detectable labels include chelators,
photoactive agents, radioisotopes, fluorescent agents, paramagnetic
ions, or other marker moieties.
[0068] The term "affinity tag" is used herein to denote a
polypeptide segment that can be attached to a second polypeptide to
provide for purification or detection of the second polypeptide or
provide sites for attachment of the second polypeptide to a
substrate. In principal, any peptide or protein for which an
antibody or other specific binding agent is available can be used
as an affinity tag. Affinity tags include a poly-histidine tract,
protein A (Nilsson et al., EMBO J. 4:1075 (1985); Nilsson et al.,
Methods Enzymol. 198:3 (1991)), glutathione S transferase (Smith
and Johnson, Gene 67:31 (1988)), Glu-Glu affinity tag (Grussenmeyer
et al., Proc. Natl. Acad. Sci. USA 82:7952 (1985)), substance P,
FLAG peptide (Hopp et al., Biotechnology 6:1204 (1988)),
streptavidin binding peptide, or other antigenic epitope or binding
domain. See, in general, Ford et al., Protein Expression and
Purification 2:95 (1991). Nucleic acid molecules encoding affinity
tags are available from commercial suppliers (e.g., Pharmacia
Biotech, Piscataway, N.J.).
[0069] A "naked antibody" is an entire antibody, as opposed to an
antibody fragment, which is not conjugated with a therapeutic
agent. Naked antibodies include both polyclonal and monoclonal
antibodies, as well as certain recombinant antibodies, such as
chimeric and humanized antibodies.
[0070] As used herein, the term "antibody component" includes both
an entire antibody and an antibody fragment.
[0071] In eukaryotes, RNA polymerase II catalyzes the transcription
of a structural gene to produce mRNA. A nucleic acid molecule can
be designed to contain an RNA polymerase II template in which the
RNA transcript has a sequence that is complementary to that of a
specific mRNA. The RNA transcript is termed an "anti-sense RNA" and
a nucleic acid molecule that encodes the anti-sense RNA is termed
an "anti-sense gene." Anti-sense RNA molecules are capable of
binding to mRNA molecules, resulting in an inhibition of mRNA
translation.
[0072] An "anti-sense oligonucleotide specific for Zkun11" or an
"Zkun11 anti-sense oligonucleotide" is an oligonucleotide having a
sequence (a) capable of forming a stable triplex with a portion of
the Zkun11 gene, or (b) capable of forming a stable duplex with a
portion of an mRNA transcript of the Zkun11 gene.
[0073] A "ribozyme" is a nucleic acid molecule that contains a
catalytic center. The term includes RNA enzymes, self-splicing
RNAs, self-cleaving RNAs, and nucleic acid molecules that perform
these catalytic functions. A nucleic acid molecule that encodes a
ribozyme is termed a "ribozyme gene."
[0074] An "external guide sequence" is a nucleic acid molecule that
directs the endogenous ribozyme, RNase P, to a particular species
of intracellular mRNA, resulting in the cleavage of the mRNA by
RNase P. A nucleic acid molecule that encodes an external guide
sequence is termed an "external guide sequence gene."
[0075] The term "variant Zkun11 gene" refers to nucleic acid
molecules that encode a polypeptide having an amino acid sequence
that is a modification of SEQ ID NO:2. Such variants include
naturally-occurring polymorphisms of Zkun11 genes, as well as
synthetic genes that contain conservative amino acid substitutions
of the amino acid sequence of SEQ ID NO:2. Additional variant forms
of Zkun11 genes are nucleic acid molecules that contain insertions
or deletions of the nucleotide sequences described herein. A
variant Zkun11 gene can be identified by determining whether the
gene hybridizes with a nucleic acid molecule having the nucleotide
sequence of SEQ ID NO:1, or its complement, under stringent
conditions.
[0076] Alternatively, variant Zkun11 genes can be identified by
sequence comparison. Two amino acid sequences have "100% amino acid
sequence identity" if the amino acid residues of the two amino acid
sequences are the same when aligned for maximal correspondence.
Similarly, two nucleotide sequences have "100% nucleotide sequence
identity" if the nucleotide residues of the two nucleotide
sequences are the same when aligned for maximal correspondence.
Sequence comparisons can be performed using standard software
programs such as those included in the LASERGENE bioinformatics
computing suite, which is produced by DNASTAR (Madison, Wis.).
Other methods for comparing two nucleotide or amino acid sequences
by determining optimal alignment are well-known to those of skill
in the art (see, for example, Peruski and Peruski, The Internet and
the New Biology: Tools for Genomic and Molecular Research (ASM
Press, Inc. 1997), Wu et al. (eds.), "Information Superhighway and
Computer Databases of Nucleic Acids and Proteins," in Methods in
Gene Biotechnology, pages 123-151 (CRC Press, Inc. 1997), and
Bishop (ed.), Guide to Human Genome Computing, 2nd Edition
(Academic Press, Inc. 1998)). Particular methods for determining
sequence identity are described below.
[0077] Regardless of the particular method used to identify a
variant Zkun11 gene or variant Zkun11 polypeptide, a variant gene
or polypeptide encoded by a variant gene may be characterized by at
least one of: the ability to bind specifically to an anti-Zkun11
antibody, and serine protease inhibitor activity.
[0078] The term "allelic variant" is used herein to denote any of
two or more alternative forms of a gene occupying the same
chromosomal locus. Allelic variation arises naturally through
mutation, and may result in phenotypic polymorphism within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered amino acid
sequence. The term allelic variant is also used herein to denote a
protein encoded by an allelic variant of a gene.
[0079] The term "ortholog" denotes a polypeptide or protein
obtained from one species that is the functional counterpart of a
polypeptide or protein from a different species. Sequence
differences among orthologs are the result of speciation.
[0080] "Paralogs" are distinct but structurally related proteins
made by an organism. Paralogs are believed to arise through gene
duplication. For example, .alpha.-globin, .beta.-globin, and
myoglobin are paralogs of each other.
[0081] The present invention includes functional fragments of
Zkun11 genes. Within the context of this invention, a "functional
fragment" of a Zkun11 gene refers to a nucleic acid molecule that
encodes a portion of a Zkun11 polypeptide, which specifically binds
with an anti-Zkun11 antibody or possesses serine protease inhibitor
activity. For example, a functional fragment of a Zkun11 gene
described herein comprises a portion of the nucleotide sequence of
SEQ ID NO:1, and encodes a polypeptide that specifically binds with
an anti-Zkun11 antibody.
[0082] Due to the imprecision of standard analytical methods,
molecular weights and lengths of polymers are understood to be
approximate values. When such a value is expressed as "about" X or
"approximately" X, the stated value of X will be understood to be
accurate to .+-.10%.
[0083] 3. Production of Nucleic Acid Molecules That Encode
Zkun11
[0084] Nucleic acid molecules encoding a human Zkun11 gene can be
obtained by screening a human cDNA or genomic library using
polynucleotide probes based upon SEQ ID NO:1. These techniques are
standard and well-established.
[0085] As an illustration, a nucleic acid molecule that encodes a
human Zkun11 gene can be isolated from a human cDNA library. In
this case, the first step would be to prepare the cDNA library
using methods well-known to those of skill in the art. In general,
RNA isolation techniques must provide a method for breaking cells,
a means of inhibiting RNase-directed degradation of RNA, and a
method of separating RNA from DNA, protein, and polysaccharide
contaminants. For example, total RNA can be isolated by freezing
tissue in liquid nitrogen, grinding the frozen tissue with a mortar
and pestle to lyse the cells, extracting the ground tissue with a
solution of phenol/chloroform to remove proteins, and separating
RNA from the remaining impurities by selective precipitation with
lithium chloride (see, for example, Ausubel et al. (eds.), Short
Protocols in Molecular Biology, 3.sup.rd Edition, pages 4-1 to 4-6
(John Wiley & Sons 1995) ["Ausubel (1995)"]; Wu et al., Methods
in Gene Biotechnology, pages 33-41 (CRC Press, Inc. 1997) ["Wu
(1997)"]). Alternatively, total RNA can be by extracting ground
tissue with guanidinium isothiocyanate, extracting with organic
solvents, and separating RNA from contaminants using differential
centrifugation (see, for example, Chirgwin et al., Biochemistry
18:52 (1979); Ausubel (1995) at pages 4-1 to 4-6; Wu (1997) at
pages 33-41).
[0086] In order to construct a cDNA library, poly(A).sup.+ RNA must
be isolated from a total RNA preparation. Poly(A).sup.+ RNA can be
isolated from total RNA using the standard technique of
oligo(dT)-cellulose chromatography (see, for example, Aviv and
Leder, Proc. Nat'l Acad. Sci. USA 69:1408 (1972); Ausubel (1995) at
pages 4-11 to 4-12).
[0087] Double-stranded cDNA molecules are synthesized from
poly(A).sup.+ RNA using techniques well-known to those in the art.
(see, for example, Wu (1997) at pages 41-46). Moreover,
commercially available kits can be used to synthesize
double-stranded cDNA molecules. For example, such kits are
available from Life Technologies, Inc. (Gaithersburg, Md.),
CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Promega
Corporation (Madison, Wis.) and STRATAGENE (La Jolla, Calif.).
[0088] Various cloning vectors are appropriate for the construction
of a cDNA library. For example, a cDNA library can be prepared in a
vector derived from bacteriophage, such as a .lambda.gt10 vector.
See, for example, Huynh et al., "Constructing and Screening cDNA
Libraries in .lambda.gt10 and .lambda.gt11," in DNA Cloning: A
Practical Approach Vol. I, Glover (ed.), page 49 (IRL Press, 1985);
Wu (1997) at pages 47-52.
[0089] Alternatively, double-stranded cDNA molecules can be
inserted into a plasmid vector, such as a PBLUESCRIPT vector
(STRATAGENE; La Jolla, Calif.), a LAMDAGEM-4 (Promega Corp.) or
other commercially available vectors. Suitable cloning vectors also
can be obtained from the American Type Culture Collection
(Manassas, Va.).
[0090] To amplify the cloned cDNA molecules, the cDNA library is
inserted into a prokaryotic host, using standard techniques. For
example, a cDNA library can be introduced into competent E. coli
DH5 cells, which can be obtained, for example, from Life
Technologies, Inc. (Gaithersburg, Md.).
[0091] A human genomic library can be prepared by means well-known
in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6;
Wu (1997) at pages 307-327). Genomic DNA can be isolated by lysing
tissue with the detergent Sarkosyl, digesting the lysate with
proteinase K, clearing insoluble debris from the lysate by
centrifugation, precipitating nucleic acid from the lysate using
isopropanol, and purifying resuspended DNA on a cesium chloride
density gradient.
[0092] DNA fragments that are suitable for the production of a
genomic library can be obtained by the random shearing of genomic
DNA or by the partial digestion of genomic DNA with restriction
endonucleases. Genomic DNA fragments can be inserted into a vector,
such as a bacteriophage or cosmid vector, in accordance with
conventional techniques, such as the use of restriction enzyme
digestion to provide appropriate termini, the use of alkaline
phosphatase treatment to avoid undesirable joining of DNA
molecules, and ligation with appropriate ligases. Techniques for
such manipulation are well-known in the art (see, for example,
Ausubel (1995) at pages 5-1 to 5-6; Wu (1997) at pages
307-327).
[0093] Nucleic acid molecules that encode a human Zkun11 gene can
also be obtained using the polymerase chain reaction (PCR) with
oligonucleotide primers having nucleotide sequences that are based
upon the nucleotide sequences of the human Zkun11 gene, as
described herein. General methods for screening libraries with PCR
are provided by, for example, Yu et al., "Use of the Polymerase
Chain Reaction to Screen Phage Libraries," in Methods in Molecular
Biology, Vol. 15: PCR Protocols: Current Methods and Applications,
White (ed.), pages 211-215 (Humana Press, Inc. 1993). Moreover,
techniques for using PCR to isolate related genes are described by,
for example, Preston, "Use of Degenerate Oligonucleotide Primers
and the Polymerase Chain Reaction to Clone Gene Family Members," in
Methods in Molecular Biology, Vol. 15: PCR Protocols: Current
Methods and Applications, White (ed.), pages 317-337 (Humana Press,
Inc. 1993).
[0094] Alternatively, human genomic libraries can be obtained from
commercial sources such as Research Genetics (Huntsville, Ala.) and
the American Type Culture Collection (Manassas, Va.).
[0095] A library containing cDNA or genomic clones can be screened
with one or more polynucleotide probes based upon SEQ ID NO:1,
using standard methods (see, for example, Ausubel (1995) at pages
6-1 to 6-11).
[0096] Anti-Zkun11 antibodies, produced as described below, can
also be used to isolate DNA sequences that encode human Zkun11
genes from cDNA libraries. For example, the antibodies can be used
to screen .lambda.gt11 expression libraries, or the antibodies can
be used for immunoscreening following hybrid selection and
translation (see, for example, Ausubel (1995) at pages 6-12 to
6-16; Margolis et al., "Screening .lambda. expression libraries
with antibody and protein probes," in DNA Cloning 2: Expression
Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford
University Press 1995)).
[0097] As an alternative, a Zkun11 gene can be obtained by
synthesizing nucleic acid molecules using mutually priming long
oligonucleotides and the nucleotide sequences described herein
(see, for example, Ausubel (1995) at pages 8-8 to 8-9). Established
techniques using the polymerase chain reaction provide the ability
to synthesize DNA molecules at least two kilobases in length (Adang
et al., Plant Molec. Biol. 21:1131 (1993), Bambot et al., PCR
Methods and Applications 2:266 (1993), Dillon et al., "Use of the
Polymerase Chain Reaction for the Rapid Construction of Synthetic
Genes," in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications, White (ed.), pages 263-268,
(Humana Press, Inc. 1993), and Holowachuk et al., PCR Methods Appl.
4:299 (1995)).
[0098] The nucleic acid molecules of the present invention can also
be synthesized with "gene machines" using protocols such as the
phosphoramidite method. If chemically-synthesized double stranded
DNA is required for an application such as the synthesis of a gene
or a gene fragment, then each complementary strand is made
separately. The production of short genes (60 to 80 base pairs) is
technically straightforward and can be accomplished by synthesizing
the complementary strands and then annealing them. For the
production of longer genes (>300 base pairs), however, special
strategies may be required, because the coupling efficiency of each
cycle during chemical DNA synthesis is seldom 100%. To overcome
this problem, synthetic genes (double-stranded) are assembled in
modular form from single-stranded fragments that are from 20 to 100
nucleotides in length. For reviews on polynucleotide synthesis,
see, for example, Glick and Pasternak, Molecular Biotechnology,
Principles and Applications of Recombinant DNA (ASM Press 1994),
Itakura et al., Annu. Rev. Biochem. 53:323 (1984), and Climie et
al., Proc. Nat'l Acad. Sci. USA 87:633 (1990).
[0099] The sequence of a Zkun11 cDNA or Zkun11 genomic fragment can
be determined using standard methods. Zkun11 polynucleotide
sequences disclosed herein can also be used as probes or primers to
clone 5' non-coding regions of a Zkun11 gene. Promoter elements
from a Zkun11 gene can be used to direct the expression of
heterologous genes in, for example, transgenic animals or patients
undergoing gene therapy. The identification of genomic fragments
containing a Zkun11 promoter or regulatory element can be achieved
using well-established techniques, such as deletion analysis (see,
generally, Ausubel (1995)).
[0100] Cloning of 5' flanking sequences also facilitates production
of Zkun11 proteins by "gene activation," as disclosed in U.S. Pat.
No. 5,641,670. Briefly, expression of an endogenous Zkun11 gene in
a cell is altered by introducing into the Zkun11 locus a DNA
construct comprising at least a targeting sequence, a regulatory
sequence, an exon, and an unpaired splice donor site. The targeting
sequence is a Zkun11 5' non-coding sequence that permits homologous
recombination of the construct with the endogenous Zkun11 locus,
whereby the sequences within the construct become operably linked
with the endogenous Zkun11 coding sequence. In this way, an
endogenous Zkun11 promoter can be replaced or supplemented with
other regulatory sequences to provide enhanced, tissue-specific, or
otherwise regulated expression.
[0101] 4. Production of Zkun11 Variants
[0102] The present invention provides a variety of nucleic acid
molecules, including DNA and RNA molecules that encode the Zkun11
polypeptides disclosed herein. Those skilled in the art will
readily recognize that, in view of the degeneracy of the genetic
code, considerable sequence variation is possible among these
polynucleotide molecules. SEQ ID NO:3 is a degenerate nucleotide
sequence that encompasses all nucleic acid molecules that encode
the Zkun11 polypeptide of SEQ ID NO:2. Those skilled in the art
will recognize that the degenerate sequence of SEQ ID NO:3 also
provides all RNA sequences encoding SEQ ID NO:2, by substituting U
for T. Thus, the present invention contemplates Zkun11
polypeptide-encoding nucleic acid molecules comprising nucleotides
1 to 153 of SEQ ID NO:1, and their RNA equivalents.
[0103] Table 1 sets forth the one-letter codes used within SEQ ID
NO:3 to denote degenerate nucleotide positions. "Resolutions" are
the nucleotides denoted by a code letter. "Complement" indicates
the code for the complementary nucleotide(s). For example, the code
Y denotes either C or T, and its complement R denotes A or G, A
being complementary to T, and G being complementary to C.
1TABLE 1 Nucleotide Resolution Complement Resolution A A T T C C G
G G G C C T T A A R A.vertline.G Y C.vertline.T Y C.vertline.T R
A.vertline.G M A.vertline.C K G.vertline.T K G.vertline.T M
A.vertline.C S C.vertline.G S C.vertline.G W A.vertline.T W
A.vertline.T H A.vertline.C.vertline.T D A.vertline.G.vertline.T B
C.vertline.G.vertline.T V A.vertline.C.vertline.G V
A.vertline.C.vertline.G B C.vertline.G.vertline.T D
A.vertline.G.vertline.T H A.vertline.C.vertline.T N
A.vertline.C.vertline.G.vertlin- e.T N
A.vertline.C.vertline.G.vertline.T
[0104] The degenerate codons used in SEQ ID NO:3, encompassing all
possible codons for a given amino acid, are set forth in Table
2.
2TABLE 2 One Amino Letter Degenerate Acid Code Codons Codon Cys C
TGC TGT TGY Ser S AGC AGT TCA TCC TCG TCT WSN Thr T ACA ACC ACG ACT
ACN Pro P CCA CCC CCG CCT CCN Ala A GCA GCC GCG GCT GCN Gly G GGA
GGC GGG GGT GGN Asn N AAC AAT AAY Asp D GAC GAT GAY Glu E GAA GAG
GAR Gln Q CAA CAG CAR His H CAC CAT CAY Arg R AGA AGG CGA CGC CGG
CGT MGN Lys K AAA AAG AAR Met M ATG ATG Ile I ATA ATC ATT ATH Leu L
CTA CTC CTG CTT TTA TTG YTN Val V GTA GTC GTG GTT GTN Phe F TTC TTT
TTY Tyr Y TAC TAT TAY Trp W TGG TGG Ter . TAA TAG TGA TRR
Asn.vertline.Asp B RAY Glu.vertline.Gin Z SAR Any X NNN
[0105] One of ordinary skill in the art will appreciate that some
ambiguity is introduced in determining a degenerate codon,
representative of all possible codons encoding an amino acid. For
example, the degenerate codon for serine (WSN) can, in some
circumstances, encode arginine (AGR), and the degenerate codon for
arginine (MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding phenylalanine
and leucine. Thus, some polynucleotides encompassed by the
degenerate sequence may encode variant amino acid sequences, but
one of ordinary skill in the art can easily identify such variant
sequences by reference to the amino acid sequence of SEQ ID NOs:2
and 3. Variant sequences can be readily tested for functionality as
described herein.
[0106] Different species can exhibit "preferential codon usage." In
general, see, Grantham et al., Nuc. Acids Res. 8:1893 (1980), Haas
et al. Curr. Biol. 6:315 (1996), Wain-Hobson et al., Gene 13:355
(1981), Grosjean and Fiers, Gene 18:199 (1982), Holm, Nuc. Acids
Res. 14:3075 (1986), Ikemura, J. Mol. Biol. 158:573 (1982), Sharp
and Matassi, Curr. Opin. Genet. Dev. 4:851 (1994), Kane, Curr.
Opin. Biotechnol. 6:494 (1995), and Makrides, Microbiol. Rev.
60:512 (1996). As used herein, the term "preferential codon usage"
or "preferential codons" is a term of art referring to protein
translation codons that are most frequently used in cells of a
certain species, thus favoring one or a few representatives of the
possible codons encoding each amino acid (see Table 2). For
example, the amino acid threonine (Thr) may be encoded by ACA, ACC,
ACG, or ACT, but in mammalian cells ACC is the most commonly used
codon; in other species, for example, insect cells, yeast, viruses
or bacteria, different Thr codons may be preferential. Preferential
codons for a particular species can be introduced into the
polynucleotides of the present invention by a variety of methods
known in the art. Introduction of preferential codon sequences into
recombinant DNA can, for example, enhance production of the protein
by making protein translation more efficient within a particular
cell type or species. Therefore, the degenerate codon sequence
disclosed in SEQ ID NO:3 serves as a template for optimizing
expression of polynucleotides in various cell types and species
commonly used in the art and disclosed herein. Sequences containing
preferential codons can be tested and optimized for expression in
various species, and tested for functionality as disclosed
herein.
[0107] The present invention further provides variant polypeptides
and nucleic acid molecules that represent counterparts from other
species (orthologs). These species include, but are not limited to
mammalian, avian, amphibian, reptile, fish, insect and other
vertebrate and invertebrate species. Of particular interest are
Zkun11 polypeptides from other mammalian species, including
porcine, ovine, bovine, canine, feline, equine, and other primate
polypeptides. Orthologs of human Zkun11 can be cloned using
information and compositions provided by the present invention in
combination with conventional cloning techniques. For example, a
cDNA can be cloned using mRNA obtained from a tissue or cell type
that expresses Zkun11 as disclosed herein. Suitable sources of mRNA
can be identified by probing northern blots with probes designed
from the sequences disclosed herein. A library is then prepared
from mRNA of a positive tissue or cell line.
[0108] A Zkun11-encoding cDNA can then be isolated by a variety of
methods, such as by probing with a complete or partial human cDNA
or with one or more sets of degenerate probes based on the
disclosed sequences. A cDNA can also be cloned using the polymerase
chain reaction with primers designed from the representative human
Zkun11 sequences disclosed herein. Within an additional method, the
cDNA library can be used to transform or transfect host cells, and
expression of the cDNA of interest can be detected with an antibody
to Zkun11 polypeptide. Similar techniques can also be applied to
the isolation of genomic clones.
[0109] Those skilled in the art will recognize that the sequence
disclosed in SEQ ID NO:1 represents a single allele of human
Zkun11, and that allelic variation and alternative splicing are
expected to occur. Allelic variants of this sequence can be cloned
by probing cDNA or genomic libraries from different individuals
according to standard procedures. Allelic variants of the
nucleotide sequence shown in SEQ ID NO:1, including those
containing silent mutations and those in which mutations result in
amino acid sequence changes, are within the scope of the present
invention, as are proteins which are allelic variants of SEQ ID
NO:2. cDNA molecules generated from alternatively spliced mRNAs,
which retain the properties of the Zkun11 polypeptide are included
within the scope of the present invention, as are polypeptides
encoded by such cDNAs and mRNAs. Allelic variants and splice
variants of these sequences can be cloned by probing cDNA or
genomic libraries from different individuals or tissues according
to standard procedures known in the art.
[0110] Within certain embodiments of the invention, the isolated
nucleic acid molecules can hybridize under stringent conditions to
nucleic acid molecules comprising nucleotide sequences disclosed
herein. For example, such nucleic acid molecules can hybridize
under stringent conditions to nucleic acid molecules consisting of
the nucleotide sequence of SEQ ID NO:1, or to nucleic acid
molecules consisting of a nucleotide sequence complementary to SEQ
ID NO:1. In general, stringent conditions are selected to be about
5.degree. C. lower than the thermal melting point (T.sub.m) for the
specific sequence at a defined ionic strength and pH. The T.sub.m
is the temperature (under defined ionic strength and pH) at which
50% of the target sequence hybridizes to a perfectly matched
probe.
[0111] A pair of nucleic acid molecules, such as DNA-DNA, RNA-RNA
and DNA-RNA, can hybridize if the nucleotide sequences have some
degree of complementarity. Hybrids can tolerate mismatched base
pairs in the double helix, but the stability of the hybrid is
influenced by the degree of mismatch. The T.sub.m of the mismatched
hybrid decreases by 1.degree. C. for every 1-1.5% base pair
mismatch. Varying the stringency of the hybridization conditions
allows control over the degree of mismatch that will be present in
the hybrid. The degree of stringency increases as the hybridization
temperature increases and the ionic strength of the hybridization
buffer decreases. Stringent hybridization conditions encompass
temperatures of about 5-25.degree. C. below the T.sub.m of the
hybrid and a hybridization buffer having up to 1 M Na.sup.+. Higher
degrees of stringency at lower temperatures can be achieved with
the addition of formamide which reduces the T.sub.m of the hybrid
about 1.degree. C. for each 1% formamide in the buffer solution.
Generally, such stringent conditions include temperatures of
20-70.degree. C. and a hybridization buffer containing up to
6.times.SSC and 0-50% formamide. A higher degree of stringency can
be achieved at temperatures of from 40-70.degree. C. with a
hybridization buffer having up to 4.times.SSC and from 0-50%
formamide. Highly stringent conditions typically encompass
temperatures of 42-70.degree. C. with a hybridization buffer having
up to 1.times.SSC and 0-50% formamide. Different degrees of
stringency can be used during hybridization and washing to achieve
maximum specific binding to the target sequence. Typically, the
washes following hybridization are performed at increasing degrees
of stringency to remove non-hybridized polynucleotide probes from
hybridized complexes.
[0112] The above conditions are meant to serve as a guide and it is
well within the abilities of one skilled in the art to adapt these
conditions for use with a particular polypeptide hybrid. The
T.sub.m for a specific target sequence is the temperature (under
defined conditions) at which 50% of the target sequence will
hybridize to a perfectly matched probe sequence. Those conditions
which influence the T.sub.m include, the size and base pair content
of the polynucleotide probe, the ionic strength of the
hybridization solution, and the presence of destabilizing agents in
the hybridization solution. Numerous equations for calculating
T.sub.m are known in the art, and are specific for DNA, RNA and
DNA-RNA hybrids and polynucleotide probe sequences of varying
length (see, for example, Sambrook et al., Molecular Cloning: A
Laboratory Manual, Second Edition (Cold Spring Harbor Press 1989);
Ausubel et al., (eds.), Current Protocols in Molecular Biology
(John Wiley and Sons, Inc. 1987); Berger and Kimmel (eds.), Guide
to Molecular Cloning Techniques, (Academic Press, Inc. 1987); and
Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)). Sequence
analysis software such as OLIGO 6.0 (LSR; Long Lake, Minn.) and
Primer Premier 4.0 (Premier Biosoft International; Palo Alto,
Calif.), as well as sites on the Internet, are available tools for
analyzing a given sequence and calculating T.sub.m based on user
defined criteria. Such programs can also analyze a given sequence
under defined conditions and identify suitable probe sequences.
Typically, hybridization of longer polynucleotide sequences, >50
base pairs, is performed at temperatures of about 20-25.degree. C.
below the calculated T.sub.m. For smaller probes, <50 base
pairs, hybridization is typically carried out at the T.sub.m or
5-10.degree. C. below. This allows for the maximum rate of
hybridization for DNA-DNA and DNA-RNA hybrids.
[0113] The length of the polynucleotide sequence influences the
rate and stability of hybrid formation. Smaller probe sequences,
<50 base pairs, reach equilibrium with complementary sequences
rapidly, but may form less stable hybrids. Incubation times of
anywhere from minutes to hours can be used to achieve hybrid
formation. Longer probe sequences come to equilibrium more slowly,
but form more stable complexes even at lower temperatures.
Incubations are allowed to proceed overnight or longer. Generally,
incubations are carried out for a period equal to three times the
calculated Cot time. Cot time, the time it takes for the
polynucleotide sequences to reassociate, can be calculated for a
particular sequence by methods known in the art.
[0114] The base pair composition of polynucleotide sequence will
effect the thermal stability of the hybrid complex, thereby
influencing the choice of hybridization temperature and the ionic
strength of the hybridization buffer. A-T pairs are less stable
than G-C pairs in aqueous solutions containing sodium chloride.
Therefore, the higher the G-C content, the more stable the hybrid.
Even distribution of G and C residues within the sequence also
contribute positively to hybrid stability. In addition, the base
pair composition can be manipulated to alter the T.sub.m of a given
sequence. For example, 5-methyldeoxycytidine can be substituted for
deoxycytidine and 5-bromodeoxuridine can be substituted for
thymidine to increase the T.sub.m, whereas
7-deazz-2'-deoxyguanosine can be substituted for guanosine to
reduce dependence on T.sub.m.
[0115] The ionic concentration of the hybridization buffer also
affects the stability of the hybrid. Hybridization buffers
generally contain blocking agents such as Denhardt's solution
(Sigma Chemical Co., St. Louis, Mo.), denatured salmon sperm DNA,
tRNA, milk powders (BLOTTO), heparin or SDS, and a Na.sup.+ source,
such as SSC (1.times.SSC: 0.15 M sodium chloride, 15 mM sodium
citrate) or SSPE (1.times.SSPE: 1.8 M NaCl, 10 mM
NaH.sub.2PO.sub.4, 1 mM EDTA, pH 7.7). By decreasing the ionic
concentration of the buffer, the stability of the hybrid is
increased. Typically, hybridization buffers contain from between 10
mM-1 M Na.sup.+. The addition of destabilizing or denaturing agents
such as formamide, tetralkylammonium salts, guanidinium cations or
thiocyanate cations to the hybridization solution will alter the
T.sub.m of a hybrid. Typically, formamide is used at a
concentration of up to 50% to allow incubations to be carried out
at more convenient and lower temperatures. Formamide also acts to
reduce non-specific background when using RNA probes.
[0116] As an illustration, a nucleic acid molecule encoding a
variant Zkun11 polypeptide can be hybridized with a nucleic acid
molecule having the nucleotide sequence of SEQ ID NO:1 (or its
complement) at 42.degree. C. overnight in a solution comprising 50%
formamide, 5.times.SSC (1.times.SSC: 0.15 M sodium chloride and 15
mM sodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution (100.times.Denhardt's solution: 2%
(w/v) Ficoll 400, 2% (w/v) polyvinylpyrrolidone, and 2% (w/v)
bovine serum albumin, 10% dextran sulfate, and 20 .mu.g/ml
denatured, sheared salmon sperm DNA. One of skill in the art can
devise variations of these hybridization conditions. For example,
the hybridization mixture can be incubated at a higher temperature,
such as about 65.degree. C., in a solution that does not contain
formamide. Moreover, premixed hybridization solutions are available
(e.g., EXPRESSHYB Hybridization Solution from CLONTECH
Laboratories, Inc.), and hybridization can be performed according
to the manufacturer's instructions.
[0117] Following hybridization, the nucleic acid molecules can be
washed to remove non-hybridized nucleic acid molecules under
stringent conditions, or under highly stringent conditions. Typical
stringent washing conditions include washing in a solution of
0.5.times.-2.times.SSC with 0.1% sodium dodecyl sulfate (SDS) at
55-65.degree. C. As an illustration, certain nucleic acid molecules
encoding a variant Zkun11 polypeptide remain hybridized following
stringent washing conditions with a nucleic acid molecule
consisting of the nucleotide sequence of SEQ ID NO:1 (or its
complement), in which the wash stringency is equivalent to
0.5.times.-2.times.SSC with 0.1% SDS at 55-65.degree. C., including
0.5.times.SSC with 0.1% SDS at 55.degree. C., or 2.times.SSC with
0.1% SDS at 65.degree. C. One of skill in the art can readily
devise equivalent conditions, for example, by substituting the SSPE
for SSC in the wash solution.
[0118] Typical highly stringent washing conditions include washing
in a solution of 0.1.times.-0.2.times.SSC with 0.1% sodium dodecyl
sulfate (SDS) at 50-65.degree. C. For example, certain nucleic acid
molecules encoding a variant Zkun11 polypeptide remain hybridized
following stringent washing conditions with a nucleic acid molecule
consisting of the nucleotide sequence of SEQ ID NO:1 (or its
complement), in which the wash stringency is equivalent to
0.1.times.-0.2.times.SSC with 0.1% SDS at 50-65.degree. C.,
including 0.1.times.SSC with 0.1% SDS at 50.degree. C., or
0.2.times.SSC with 0.1% SDS at 65.degree. C.
[0119] The present invention also provides isolated Zkun11
polypeptides that have a substantially similar sequence identity to
the polypeptide of SEQ ID NO:2, or orthologs. The term
"substantially similar sequence identity" is used herein to denote
polypeptides having 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%
sequence identity to the sequence shown in SEQ ID NO:2.
[0120] The present invention also contemplates Zkun11 variant
nucleic acid molecules that can be identified using two criteria: a
determination of the similarity between the encoded polypeptide
with the amino acid sequence of SEQ ID NO:2, and a hybridization
assay, as described above. Such Zkun11 variants include nucleic
acid molecules (1) that remain hybridized following stringent
washing conditions with a nucleic acid molecule consisting of the
nucleotide sequence of SEQ ID NO:1 (or its complement), in which
the wash stringency is equivalent to 0.5.times.-2.times.SSC with
0.1% SDS at 55-65.degree. C., and (2) that encode a polypeptide
having 70%, 80%, 90%, 95% 96%, 97%, 98% or 99% sequence identity to
the amino acid sequence of SEQ ID NO:2.
[0121] Alternatively, Zkun11 variants can be characterized as
nucleic acid molecules (1) that remain hybridized following highly
stringent washing conditions with a nucleic acid molecule
consisting of the nucleotide sequence of SEQ ID NO:1 (or its
complement), in which the wash stringency is equivalent to
0.1.times.-0.2.times.SSC with 0.1% SDS at 50-65.degree. C., and (2)
that encode a polypeptide having 70%, 80%, 90%, 95%, 96%, 97%, 98%
or 99% sequence identity to the amino acid sequence of SEQ ID
NO:2.
[0122] The present invention also includes Zkun11 variants that
possess serine protease inhibitor activity. Moreover, particular
Zkun11 variants are characterized using hybridization analysis with
a reference nucleic acid molecule that is a fragment of a nucleic
acid molecule consisting of the nucleotide sequence of SEQ ID NO:1,
or its complement.
[0123] Percent sequence identity is determined by conventional
methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603
(1986), and Henikoff and Henikoff, Proc. Nat'l Acad. Sci. USA
89:10915 (1992). Briefly, two amino acid sequences are aligned to
optimize the alignment scores using a gap opening penalty of 10, a
gap extension penalty of 1, and the "BLOSUM62" scoring matrix of
Henikoff and Henikoff (ibid.) as shown in Table 3 (amino acids are
indicated by the standard one-letter codes). The percent identity
is then calculated as: ([Total number of identical matches]/[length
of the longer sequence plus the number of gaps introduced into the
longer sequence in order to align the two sequences])(100).
3 TABLE 3 A R N D C Q E G H I L K M F P S T W Y V A 4 R -1 5 N -2 0
6 D -2 -2 1 6 C 0 -3 -3 -3 9 Q -1 1 0 0 -3 5 E -1 0 0 2 -4 2 5 G 0
-2 0 -1 -3 -2 -2 6 H -2 0 1 -1 -3 0 0 -2 8 I -1 -3 -3 -3 -1 -3 -3
-4 -3 4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 K -1 2 0 -1 -3 1 1 -2 -1
-3 -2 5 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 F -2 -3 -3 -3 -2 -3 -3
-3 -1 0 0 -3 0 6 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 S 1
-1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1
-1 -1 -1 -2 -1 1 5 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3
-2 11 Y -2 -2 -1 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 V 0 -3
-3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4
[0124] Those skilled in the art appreciate that there are many
established algorithms available to align two amino acid sequences.
The "FASTA" similarity search algorithm of Pearson and Lipman is a
suitable protein alignment method for examining the level of
identity shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative Zkun11 variant. The FASTA
algorithm is described by Pearson and Lipman, Proc. Nat'l Acad.
Sci. USA 85:2444 (1988), and by Pearson, Meth. Enzymol. 183:63
(1990). Briefly, FASTA first characterizes sequence similarity by
identifying regions shared by the query sequence (e.g., SEQ ID
NO:2) and a test sequence that have either the highest density of
identities (if the ktup variable is 1) or pairs of identities (if
ktup=2), without considering conservative amino acid substitutions,
insertions, or deletions. The ten regions with the highest density
of identities are then rescored by comparing the similarity of all
paired amino acids using an amino acid substitution matrix, and the
ends of the regions are "trimmed" to include only those residues
that contribute to the highest score. If there are several regions
with scores greater than the "cutoff" value (calculated by a
predetermined formula based upon the length of the sequence and the
ktup value), then the trimmed initial regions are examined to
determine whether the regions can be joined to form an approximate
alignment with gaps. Finally, the highest scoring regions of the
two amino acid sequences are aligned using a modification of the
Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol.
Biol. 48:444 (1970); Sellers, SIAM J. Appl. Math. 26:787 (1974)),
which allows for amino acid insertions and deletions. Illustrative
parameters for FASTA analysis are: ktup=1, gap opening penalty=10,
gap extension penalty=1, and substitution matrix=BLOSUM62. These
parameters can be introduced into a FASTA program by modifying the
scoring matrix file ("SMATRIX"), as explained in Appendix 2 of
Pearson, Meth. Enzymol. 183:63 (1990).
[0125] FASTA can also be used to determine the sequence identity of
nucleic acid molecules using a ratio as disclosed above. For
nucleotide sequence comparisons, the ktup value can range between
one to six, preferably from three to six, most preferably three,
with other parameters set as described above.
[0126] The present invention includes nucleic acid molecules that
encode a polypeptide having a conservative amino acid change,
compared with the amino acid sequence of SEQ ID NO:2. That is,
variants can be obtained that contain one or more amino acid
substitutions of SEQ ID NO:2, in which an alkyl amino acid is
substituted for an alkyl amino acid in a Zkun11 amino acid
sequence, an aromatic amino acid is substituted for an aromatic
amino acid in a Zkun11 amino acid sequence, a sulfur-containing
amino acid is substituted for a sulfur-containing amino acid in a
Zkun11 amino acid sequence, a hydroxy-containing amino acid is
substituted for a hydroxy-containing amino acid in a Zkun11 amino
acid sequence, an acidic amino acid is substituted for an acidic
amino acid in a Zkun11 amino acid sequence, a basic amino acid is
substituted for a basic amino acid in a Zkun11 amino acid sequence,
or a dibasic monocarboxylic amino acid is substituted for a dibasic
monocarboxylic amino acid in a Zkun11 amino acid sequence.
[0127] Among the common amino acids, for example, a "conservative
amino acid substitution" is illustrated by a substitution among
amino acids within each of the following groups: (1) glycine,
alanine, valine, leucine, and isoleucine, (2) phenylalanine,
tyrosine, and tryptophan, (3) serine and threonine, (4) aspartate
and glutamate, (5) glutamine and asparagine, and (6) lysine,
arginine and histidine.
[0128] The BLOSUM62 table is an amino acid substitution matrix
derived from about 2,000 local multiple alignments of protein
sequence segments, representing highly conserved regions of more
than 500 groups of related proteins (Henikoff and Henikoff, Proc.
Nat'l Acad. Sci. USA 89:10915 (1992)). Accordingly, the BLOSUM62
substitution frequencies can be used to define conservative amino
acid substitutions that may be introduced into the amino acid
sequences of the present invention. Although it is possible to
design amino acid substitutions based solely upon chemical
properties (as discussed above), the language "conservative amino
acid substitution" preferably refers to a substitution represented
by a BLOSUM62 value of greater than -1. For example, an amino acid
substitution is conservative if the substitution is characterized
by a BLOSUM62 value of 0, 1, 2, or 3. According to this system,
preferred conservative amino acid substitutions are characterized
by a BLOSUM62 value of at least 1 (e.g., 1, 2 or 3), while more
preferred conservative amino acid substitutions are characterized
by a BLOSUM62 value of at least 2 (e.g., 2 or 3).
[0129] Particular variants of Zkun11 are characterized by having
greater than 96%, at least 97%, at least 98%, or at least 99%
sequence identity to the corresponding amino acid sequence (e.g.,
SEQ ID NO:2), wherein the variation in amino acid sequence is due
to one or more conservative amino acid substitutions.
[0130] Conservative amino acid changes in a Zkun11 gene can be
introduced by substituting nucleotides for the nucleotides recited
in SEQ ID NO:1. Such "conservative amino acid" variants can be
obtained, for example, by oligonucleotide-directed mutagenesis,
linker-scanning mutagenesis, mutagenesis using the polymerase chain
reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22;
and McPherson (ed.), Directed Mutagenesis: A Practical Approach
(IRL Press 1991)).
[0131] The proteins of the present invention can also comprise
non-naturally occurring amino acid residues. Non-naturally
occurring amino acids include, without limitation,
trans-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline,
trans-4-hydroxyproline, N-methylglycine, allo-threonine,
methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine,
nitroglutamine, homoglutamine, pipecolic acid, thiazolidine
carboxylic acid, dehydroproline, 3- and 4-methylproline,
3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine,
3-azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenylalanine.
Several methods are known in the art for incorporating
non-naturally occurring amino acid residues into proteins. For
example, an in vitro system can be employed wherein nonsense
mutations are suppressed using chemically aminoacylated suppressor
tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA
are known in the art. Transcription and translation of plasmids
containing nonsense mutations is typically carried out in a
cell-free system comprising an E. coli S30 extract and commercially
available enzymes and other reagents. Proteins are purified by
chromatography. See, for example, Robertson et al., J. Am. Chem.
Soc. 113:2722 (1991), Ellman et al., Methods Enzymol. 202:301
(1991), Chung et al., Science 259:806 (1993), and Chung et al.,
Proc. Nat'l Acad. Sci. USA 90:10145 (1993).
[0132] In a second method, translation is carried out in Xenopus
oocytes by microinjection of mutated mRNA and chemically
aminoacylated suppressor tRNAs (Turcatti et al., J. Biol. Chem.
271:19991 (1996)). Within a third method, E. coli cells are
cultured in the absence of a natural amino acid that is to be
replaced (e.g., phenylalanine) and in the presence of the desired
non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine,
3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine).
The non-naturally occurring amino acid is incorporated into the
protein in place of its natural counterpart. See, Koide et al.,
Biochem. 33:7470 (1994). Naturally occurring amino acid residues
can be converted to non-naturally occurring species by in vitro
chemical modification. Chemical modification can be combined with
site-directed mutagenesis to further expand the range of
substitutions (Wynn and Richards, Protein Sci. 2:395 (1993)).
[0133] A limited number of non-conservative amino acids, amino
acids that are not encoded by the genetic code, non-naturally
occurring amino acids, and unnatural amino acids may be substituted
for Zkun11 amino acid residues.
[0134] Essential amino acids in the polypeptides of the present
invention can be identified according to procedures known in the
art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081 (1989), Bass et
al., Proc. Nat'l Acad. Sci. USA 88:4498 (1991), Coombs and Corey,
"Site-Directed Mutagenesis and Protein Engineering," in Proteins:
Analysis and Design, Angeletti (ed.), pages 259-311 (Academic
Press, Inc. 1998)). In the latter technique, single alanine
mutations are introduced at every residue in the molecule, and the
resultant mutant molecules are tested for biological activity as
disclosed below to identify amino acid residues that are critical
to the activity of the molecule. See also, Hilton et al., J. Biol.
Chem. 271:4699 (1996). The identities of essential amino acids can
also be inferred from analysis of homologies with other serine
protease inhibitors.
[0135] The location of Zkun11 activity subdomains can also be
determined by physical analysis of structure, as determined by such
techniques as nuclear magnetic resonance, crystallography, electron
diffraction or photoaffinity labeling, in conjunction with mutation
of putative contact site amino acids. See, for example, de Vos et
al., Science 255:306 (1992), Smith et al., J. Mol. Biol. 224:899
(1992), and Wlodaver et al., FEBS Lett. 309:59 (1992). Moreover,
Zkun11 labeled with biotin or FITC can be used for expression
cloning of Zkun11 substrates and inhibitors.
[0136] Multiple amino acid substitutions can be made and tested
using known methods of mutagenesis and screening, such as those
disclosed by Reidhaar-Olson and Sauer (Science 241:53 (1988)) or
Bowie and Sauer (Proc. Nat'l Acad. Sci. USA 86:2152 (1989)).
Briefly, these authors disclose methods for simultaneously
randomizing two or more positions in a polypeptide, selecting for
functional polypeptide, and then sequencing the mutagenized
polypeptides to determine the spectrum of allowable substitutions
at each position. Other methods that can be used include phage
display (e.g., Lowman et al., Biochem. 30:10832 (1991), Ladner et
al., U.S. Pat. No. 5,223,409, Huse, international publication No.
WO 92/06204, and region-directed mutagenesis (Derbyshire et al.,
Gene 46:145 (1986), and Ner et al., DNA 7:127, (1988)).
[0137] Variants of the disclosed Zkun11 nucleotide and polypeptide
sequences can also be generated through DNA shuffling as disclosed
by Stemmer, Nature 370:389 (1994), Stemmer, Proc. Nat'l Acad. Sci.
USA 91:10747 (1994), and international publication No. WO 97/20078.
Briefly, variant DNAs are generated by in vitro homologous
recombination by random fragmentation of a parent DNA followed by
reassembly using PCR, resulting in randomly introduced point
mutations. This technique can be modified by using a family of
parent DNAs, such as allelic variants or DNAs from different
species, to introduce additional variability into the process.
Selection or screening for the desired activity, followed by
additional iterations of mutagenesis and assay provides for rapid
"evolution" of sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
[0138] Mutagenesis methods as disclosed herein can be combined with
high-throughput, automated screening methods to detect activity of
cloned, mutagenized polypeptides in host cells. Mutagenized DNA
molecules that encode biologically active polypeptides, or
polypeptides that bind with anti-Zkun11 antibodies, can be
recovered from the host cells and rapidly sequenced using modern
equipment. These methods allow the rapid determination of the
importance of individual amino acid residues in a polypeptide of
interest, and can be applied to polypeptides of unknown
structure.
[0139] The present invention also includes "functional fragments"
of Zkun11 polypeptides and nucleic acid molecules encoding such
functional fragments. Routine deletion analyses of nucleic acid
molecules can be performed to obtain functional fragments of a
nucleic acid molecule that encodes a Zkun11 polypeptide. As an
illustration, DNA molecules having the nucleotide sequence of SEQ
ID NO:1 can be digested with Bal31 nuclease to obtain a series of
nested deletions. One alternative to exonuclease digestion is to
use oligonucleotide-directed mutagenesis to introduce deletions or
stop codons to specify production of a desired fragment.
Alternatively, particular fragments of a Zkun11 gene can be
synthesized using the polymerase chain reaction.
[0140] As an illustration, studies on the truncation at either or
both termini of interferons have been summarized by Horisberger and
Di Marco, Pharmac. Ther. 66:507 (1995). Moreover, standard
techniques for functional analysis of proteins are described by,
for example, Treuter et al., Molec. Gen. Genet. 240:113 (1993),
Content et al., "Expression and preliminary deletion analysis of
the 42 kDa 2-5A synthetase induced by human interferon," in
Biological Interferon Systems, Proceedings of ISIR-TNO Meeting on
Interferon Systems, Cantell (ed.), pages 65-72 (Nijhoff 1987),
Herschman, "The EGF Receptor," in Control of Animal Cell
Proliferation, Vol. 1, Boynton et al., (eds.) pages 169-199
(Academic Press 1985), Coumailleau et al., J. Biol. Chem. 270:29270
(1995); Fukunaga et al., J. Biol. Chem. 270:25291 (1995); Yamaguchi
et al., Biochem. Pharmacol. 50:1295 (1995), and Meisel et al.,
Plant Molec. Biol. 30:1(1996).
[0141] The present invention also contemplates functional fragments
of a Zkun11 gene that has amino acid changes, compared with the
amino acid sequence of SEQ ID NO:2. A variant Zkun11 gene can be
identified on the basis of structure by determining the level of
identity with nucleotide and amino acid sequences of SEQ ID NOs:1
and 2, as discussed above. An alternative approach to identifying a
variant gene on the basis of structure is to determine whether a
nucleic acid molecule encoding a potential variant Zkun11 gene can
hybridize to a nucleic acid molecule having the nucleotide sequence
of SEQ ID NO:1, as discussed above.
[0142] The present invention also provides polypeptide fragments or
peptides comprising an epitope-bearing portion of a Zkun11
polypeptide described herein. Such fragments or peptides may
comprise an "immunogenic epitope," which is a part of a protein
that elicits an antibody response when the entire protein is used
as an immunogen. Immunogenic epitope-bearing peptides can be
identified using standard methods (see, for example, Geysen et al.,
Proc. Nat'l Acad. Sci. USA 81:3998 (1983)).
[0143] In contrast, polypeptide fragments or peptides may comprise
an "antigenic epitope," which is a region of a protein molecule to
which an antibody can specifically bind. Certain epitopes consist
of a linear or contiguous stretch of amino acids, and the
antigenicity of such an epitope is not disrupted by denaturing
agents. It is known in the art that relatively short synthetic
peptides that can mimic epitopes of a protein can be used to
stimulate the production of antibodies against the protein (see,
for example, Sutcliffe et al., Science 219:660 (1983)). Antibodies
that recognize short linear epitopes are particularly useful in
analytic and diagnostic applications that use denatured protein,
such as Western analysis, or in the analysis of fixed cells or
tissue samples. Antibodies to linear epitopes are also useful for
detecting fragments of Zkun11, such as might occur in body fluids
or culture media. Accordingly, antigenic epitope-bearing peptides
and polypeptides of the present invention are useful to raise
antibodies that bind with the polypeptides described herein.
[0144] Antigenic epitope-bearing peptides and polypeptides can
contain at least four to ten amino acids, at least ten to fifteen
amino acids, or about 15 to about 30 amino acids of SEQ ID NO:2.
Such epitope-bearing peptides and polypeptides can be produced by
fragmenting a Zkun11 polypeptide, or by chemical peptide synthesis,
as described herein. Moreover, epitopes can be selected by phage
display of random peptide libraries (see, for example, Lane and
Stephen, Curr. Opin. Immunol. 5:268 (1993), and Cortese et al.,
Curr. Opin. Biotechnol. 7:616 (1996)). Standard methods for
identifying epitopes and producing antibodies from small peptides
that comprise an epitope are described, for example, by Mole,
"Epitope Mapping," in Methods in Molecular Biology, Vol. 10, Manson
(ed.), pages 105-116 (The Humana Press, Inc. 1992), Price,
"Production and Characterization of Synthetic Peptide-Derived
Antibodies," in Monoclonal Antibodies: Production, Engineering, and
Clinical Application, Ritter and Ladyman (eds.), pages 60-84
(Cambridge University Press 1995), and Coligan et al. (eds.),
Current Protocols in Immunology, pages 9.3.1-9.3.5 and pages
9.4.1-9.4.11 (John Wiley & Sons 1997).
[0145] For any Zkun11 polypeptide, including variants and fusion
proteins, one of ordinary skill in the art can readily generate a
fully degenerate polynucleotide sequence encoding that variant
using the information set forth in Tables 1 and 2 above. Moreover,
those of skill in the art can use standard software to devise
Zkun11 variants based upon the nucleotide and amino acid sequences
described herein. Accordingly, the present invention includes a
computer-readable medium encoded with a data structure that
provides at least one of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.
Suitable forms of computer-readable media include magnetic media
and optically-readable media. Examples of magnetic media include a
hard or fixed drive, a random access memory (RAM) chip, a floppy
disk, digital linear tape (DLT), a disk cache, and a ZIP disk.
Optically readable media are exemplified by compact discs (e.g.,
CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable),
and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM,
and DVD+RW).
[0146] 5. Production of Zkun11 Fusion Proteins
[0147] Fusion proteins of Zkun11 can be used to express Zkun11 in a
recombinant host, and to isolate expressed Zkun11. One type of
fusion protein comprises a peptide that guides a Zkun11 polypeptide
from a recombinant host cell. To direct a Zkun11 polypeptide into
the secretory pathway of a eukaryotic host cell, a secretory signal
sequence (also known as a signal peptide, a leader sequence, prepro
sequence or pre sequence) is provided in the Zkun11 expression
vector. While the secretory signal sequence may be derived from
Zkun11, a suitable signal sequence may also be derived from another
secreted protein or synthesized de novo. The secretory signal
sequence is operably linked to a Zkun11-encoding sequence such that
the two sequences are joined in the correct reading frame and
positioned to direct the newly synthesized polypeptide into the
secretory pathway of the host cell. Secretory signal sequences are
commonly positioned 5' to the nucleotide sequence encoding the
polypeptide of interest, although certain secretory signal
sequences may be positioned elsewhere in the nucleotide sequence of
interest (see, e.g., Welch et al., U.S. Pat. No. 5,037,743; Holland
et al., U.S. Pat. No. 5,143,830).
[0148] While the secretory signal sequence of Zkun11 or another
protein produced by mammalian cells (e.g., tissue-type plasminogen
activator signal sequence, as described, for example, in U.S. Pat.
No. 5,641,655) is useful for expression of Zkun11 in recombinant
mammalian hosts, a yeast signal sequence is preferred for
expression in yeast cells. Examples of suitable yeast signal
sequences are those derived from yeast mating phermone
.alpha.-factor (encoded by the MF.alpha.1 gene), invertase (encoded
by the SUC2 gene), or acid phosphatase (encoded by the PHO5 gene).
See, for example, Romanos et al., "Expression of Cloned Genes in
Yeast," in DNA Cloning 2: A Practical Approach, 2.sup.nd Edition,
Glover and Hames (eds.), pages 123-167 (Oxford University Press
1995).
[0149] In bacterial cells, it is often desirable to express a
heterologous protein as a fusion protein to decrease toxicity,
increase stability, and to enhance recovery of the expressed
protein. For example, Zkun11 can be expressed as a fusion protein
comprising a glutathione S-transferase polypeptide. Glutathione
S-transferease fusion proteins are typically soluble, and easily
purifiable from E. coli lysates on immobilized glutathione columns.
In similar approaches, a Zkun11 fusion protein comprising a maltose
binding protein polypeptide can be isolated with an amylose resin
column, while a fusion protein comprising the C-terminal end of a
truncated Protein A gene can be purified using IgG-Sepharose.
Established techniques for expressing a heterologous polypeptide as
a fusion protein in a bacterial cell are described, for example, by
Williams et al., "Expression of Foreign Proteins in E. coli Using
Plasmid Vectors and Purification of Specific Polyclonal
Antibodies," in DNA Cloning 2: A Practical Approach, 2.sup.nd
Edition, Glover and Hames (Eds.), pages 15-58 (Oxford University
Press 1995). In addition, commercially available expression systems
are available. For example, the PINPOINT Xa protein purification
system (Promega Corporation; Madison, Wis.) provides a method for
isolating a fusion protein comprising a polypeptide that becomes
biotinylated during expression with a resin that comprises
avidin.
[0150] Peptide tags that are useful for isolating heterologous
polypeptides expressed by either prokaryotic or eukaryotic cells
include polyHistidine tags (which have an affinity for
nickel-chelating resin), c-myc tags, calmodulin binding protein
(isolated with calmodulin affinity chromatography), substance P,
the RYIRS tag (which binds with anti-RYIRS antibodies), the Glu-Glu
tag, and the FLAG tag (which binds with anti-FLAG antibodies). See,
for example, Luo et al., Arch. Biochem. Biophys. 329:215 (1996),
Morganti et al., Biotechnol. Appl. Biochem. 23:67 (1996), and Zheng
et al., Gene 186:55 (1997). Nucleic acid molecules encoding such
peptide tags are available, for example, from Sigma-Aldrich
Corporation (St. Louis, Mo.).
[0151] Another form of fusion protein comprises a Zkun11
polypeptide and an immunoglobulin heavy chain constant region,
typically an F.sub.c fragment, which contains two constant region
domains and a hinge region but lacks the variable region. As an
illustration, Chang et al., U.S. Pat. No. 5,723,125, describe a
fusion protein comprising a human interferon and a human
immunoglobulin Fc fragment, in which the C-terminal of the
interferon is linked to the N-terminal of the Fc fragment by a
peptide linker moiety. An example of a peptide linker is a peptide
comprising primarily a T cell inert sequence, which is
immunologically inert. An exemplary peptide linker has the amino
acid sequence: GGSGG SGGGG SGGGG S (SEQ ID NO:4). In such a fusion
protein, an illustrative Fc moiety is a human .gamma.4 chain, which
is stable in solution and has little or no complement activating
activity. Accordingly, the present invention contemplates a Zkun11
fusion protein that comprises a Zkun11 moiety and a human Fc
fragment, wherein the C-terminus of the Zkun11 moiety is attached
to the N-terminus of the Fc fragment via a peptide linker, such as
a peptide consisting of the amino acid sequence of SEQ ID NO:4. The
Zkun11 moiety can be a Zkun11 molecule or a fragment thereof.
[0152] In another variation, a Zkun11 fusion protein comprises an
IgG sequence, a Zkun11 moiety covalently joined to the
aminoterminal end of the IgG sequence, and a signal peptide that is
covalently joined to the aminoterminal of the Zkun11 moiety,
wherein the IgG sequence consists of the following elements in the
following order: a hinge region, a CH.sub.2 domain, and a CH.sub.3
domain. Accordingly, the IgG sequence lacks a CH.sub.1 domain. The
Zkun11 moiety displays a Zkun11 activity, as described herein, such
as the ability to bind with a Zkun11 antibody or the ability to
inhibit serine protease activity. This general approach to
producing fusion proteins that comprise both antibody and
nonantibody portions has been described by LaRochelle et al., EP
742830 (WO 95/21258).
[0153] Fusion proteins comprising a Zkun11 moiety and an Fc moiety
can be used, for example, as an in vitro assay tool. For example,
the presence of a Zkun11 target enzyme in a biological sample can
be detected using a Zkun11-antibody fusion protein, in which the
Zkun11 moiety is used to target the enzyme, and a macromolecule,
such as Protein A or anti-Fc antibody, is used to detect the bound
fusion protein-enzyme complex. Furthermore, such fusion proteins
can be used to identify molecules that interfere with the binding
of Zkun11 and a substrate for the cognate enzyme.
[0154] Moreover, using methods described in the art, hybrid Zkun11
proteins can be constructed using regions or domains of the
inventive Zkun11 in combination with those of other Kunitz
inhibitor proteins, or heterologous proteins (see, for example,
Picard, Cur. Opin. Biology 5:511 (1994)). These methods allow the
determination of the biological importance of larger domains or
regions in a polypeptide of interest. Such hybrids may alter
reaction kinetics, binding, constrict or expand the substrate
specificity, or alter tissue and cellular localization of a
polypeptide, and can be applied to polypeptides of unknown
structure. As an illustration, polypeptides can be devised that
comprise a Zkun11 polypeptide, or variant, thereof, and one or more
Kunitz domains separated by amino acid linkers.
[0155] Such linkers can comprise any amino acids, so long as the
higher order structure of the Kunitz domains is not disrupted. For
example, the linkers can comprise about 5, about 10, about 20,
about 40, about 60, about 80, about 100, or more amino acid
residues.
[0156] Fusion proteins can be prepared by methods known to those
skilled in the art by preparing each component of the fusion
protein and chemically conjugating the components. Alternatively, a
polynucleotide encoding both components of the fusion protein in
the proper reading frame can be generated using known techniques
and expressed by the methods described herein. General methods for
enzymatic and chemical cleavage of fusion proteins are described,
for example, by Ausubel (1995) at pages 16-19 to 16-25.
[0157] 6. Zkun11 Analogs and Zkun11 Inhibitors
[0158] One general class of Zkun11 analogs are variants having an
amino acid sequence that is a mutation of the amino acid sequence
disclosed herein. Another general class of Zkun11 analogs is
provided by anti-idiotype antibodies, and fragments thereof, as
described below. Moreover, recombinant antibodies comprising
anti-idiotype variable domains can be used as analogs (see, for
example, Monfardini et al., Proc. Assoc. Am. Physicians 108:420
(1996)). Since the variable domains of anti-idiotype Zkun11
antibodies mimic Zkun11, these domains can provide Zkun11 activity.
Methods of producing anti-idiotypic catalytic antibodies are known
to those of skill in the art (see, for example, Joron et al., Ann.
N Y Acad. Sci. 672:216 (1992), Friboulet et al., Appl. Biochem.
Biotechnol. 47:229 (1994), and Avalle et al., Ann. N Y Acad.Sci.
864:118 (1998)).
[0159] Another approach to identifying Zkun11 analogs is provided
by the use of combinatorial libraries. Methods for constructing and
screening phage display and other combinatorial libraries are
provided, for example, by Kay et al., Phage Display of Peptides and
Proteins (Academic Press 1996), Verdine, U.S. Pat. No. 5,783,384,
Kay, et. al, U.S. Pat. No. 5,747,334, and Kauffman et al., U.S.
Pat. No. 5,723,323.
[0160] Serine proteases can be used to produce labeled polypeptide
fragments from a labeled protein substrate. Therefore, an
illustrative in vitro use of Zkun11 and its analogs is to control
the generation of such proteolysis cleavage products. Serine
proteases are also used in cleaning solutions, such as solutions to
clean and to disinfect contact lenses (see, for example, Aaslyng et
al., U.S. Pat. No. 5,985,629). Such cleaning solutions also include
protease inhibitors.
[0161] In addition, Zkun11 proteins may be used in the laboratory
or commercial preparation of proteins from cultured cells. The
proteins can be used alone to inhibit specific proteolysis or can
be combined with other proteinase inhibitors to provide a
"cocktail" with a broad spectrum of activity. Of particular
interest is the inhibition of cellular proteases, which can be
release during cell lysis. Zkun11 proteins can also be used in the
laboratory as a tissue culture additive to prevent cell detachment.
Those of skill in the art can devise other uses for molecules
having Zkun11 activity.
[0162] The activity of Zkun11 molecules of the present invention
can be measured using a variety of assays that measure serine
protease activity. For example, Zkun11 activity can be assessed by
measuring inhibition in a standard in vitro serine protease assay
(see, for example, Stief and Heimburger, U.S. Pat. No. 5,057,414
(1991)). Those of skill in the art are aware of a variety of
substrates suitable for in vitro assays, such as
Suc-Ala-Ala-Pro-Phe-pNA, fluorescein mono-p-guanidinobenzoate
hydrochloride, benzyloxycarbonyl-L-Arginyl-S-benzylester,
Nalpha-Benzoyl-L-arginine ethyl ester hydrochloride, and the like.
In addition, protease assay kits available from commercial sources,
such as Calbiochem.RTM. (San Diego, Calif.). For general
references, see Barrett (Ed.), Methods in Enzymology, Proteolytic
Enzymes: Serine and Cysteine Peptidases (Academic Press Inc. 1994),
and Barrett et al., (Eds.), Handbook of Proteolytic Enzymes
(Academic Press Inc. 1998).
[0163] Solution in vitro assays can be used to identify a Zkun11
target enzyme. Solid phase systems can also be used to identify a
Zkun11 target enzyme. For example, a Zkun11 polypeptide or Zkun11
fusion protein can be immobilized onto the surface of a receptor
chip of a commercially available biosensor instrument (BIACORE,
Biacore AB; Uppsala, Sweden). The use of this instrument is
disclosed, for example, by Karlsson, Immunol. Methods 145:229
(1991), and Cunningham and Wells, J. Mol. Biol. 234:554 (1993).
[0164] In brief, a Zkun11 polypeptide or fusion protein is
covalently attached, using amine or sulfhydryl chemistry, to
dextran fibers that are attached to gold film within a flow cell. A
test sample is then passed through the cell. If a Zkun11 target
enzyme is present in the sample, it will bind to the immobilized
polypeptide or fusion protein, causing a change in the refractive
index of the medium, which is detected as a change in surface
plasmon resonance of the gold film. This system allows the
determination on- and off-rates, from which binding affinity can be
calculated, and assessment of the stoichiometry of binding, as well
as the kinetic effects of Zkun11 mutation. This system can also be
used to identify other substrates for the Zkun11 target enzyme, and
to examine antibody-antigen interactions, and the interactions of
other complement/anti-complement pairs.
[0165] 7. Production of Zkun11 Polypeptides in Cultured Cells
[0166] The polypeptides of the present invention, including
full-length polypeptides, functional fragments, and fusion
proteins, can be produced in recombinant host cells following
conventional techniques. To express a Zkun11 gene, a nucleic acid
molecule encoding the polypeptide must be operably linked to
regulatory sequences that control transcriptional expression in an
expression vector and then, introduced into a host cell. In
addition to transcriptional regulatory sequences, such as promoters
and enhancers, expression vectors can include translational
regulatory sequences and a marker gene, which is suitable for
selection of cells that carry the expression vector.
[0167] Expression vectors that are suitable for production of a
foreign protein in eukaryotic cells typically contain (1)
prokaryotic DNA elements coding for a bacterial replication origin
and an antibiotic resistance marker to provide for the growth and
selection of the expression vector in a bacterial host; (2)
eukaryotic DNA elements that control initiation of transcription,
such as a promoter; and (3) DNA elements that control the
processing of transcripts, such as a transcription
termination/polyadenylation sequence. As discussed above,
expression vectors can also include nucleotide sequences encoding a
secretory sequence that directs the heterologous polypeptide into
the secretory pathway of a host cell. For example, a Zkun11
expression vector may comprise a Zkun11 gene and a secretory
sequence derived from a Zkun11 gene or another secreted gene.
[0168] Zkun11 proteins of the present invention may be expressed in
mammalian cells. Examples of suitable mammalian host cells include
African green monkey kidney cells (Vero; ATCC CRL 1587), human
embryonic kidney cells (293-HEK; ATCC CRL 1573), baby hamster
kidney cells (BHK-21, BHK-570; ATCC CRL 8544, ATCC CRL 10314),
canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary
cells (CHO-K1; ATCC CCL61; CHO DG44 (Chasin et al., Som. Cell.
Molec. Genet. 12:555, 1986)), rat pituitary cells (GH1; ATCC
CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E;
ATCC CRL 1548) SV40-transformed monkey kidney cells (COS-1; ATCC
CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
[0169] For a mammalian host, the transcriptional and translational
regulatory signals may be derived from viral sources, such as
adenovirus, bovine papilloma virus, simian virus, or the like, in
which the regulatory signals are associated with a particular gene
which has a high level of expression. Suitable transcriptional and
translational regulatory sequences also can be obtained from
mammalian genes, such as actin, collagen, myosin, and
metallothionein genes.
[0170] Transcriptional regulatory sequences include a promoter
region sufficient to direct the initiation of RNA synthesis.
Suitable eukaryotic promoters include the promoter of the mouse
metallothionein I gene (Hamer et al., J. Molec. Appl. Genet. 1:273
(1982)), the TK promoter of Herpes virus (McKnight, Cell 31:355
(1982)), the SV40 early promoter (Benoist et al., Nature 290:304
(1981)), the Rous sarcoma virus promoter (Gorman et al., Proc.
Nat'l Acad. Sci. USA 79:6777 (1982)), the cytomegalovirus promoter
(Foecking et al., Gene 45:101 (1980)), and the mouse mammary tumor
virus promoter (see, generally, Etcheverry, "Expression of
Engineered Proteins in Mammalian Cell Culture," in Protein
Engineering: Principles and Practice, Cleland et al. (eds.), pages
163-181 (John Wiley & Sons, Inc. 1996)).
[0171] Alternatively, a prokaryotic promoter, such as the
bacteriophage T3 RNA polymerase promoter, can be used to control
Zkun11 gene expression in mammalian cells if the prokaryotic
promoter is regulated by a eukaryotic promoter (Zhou et al., Mol.
Cell. Biol. 10:4529 (1990), and Kaufman et al., Nucl. Acids Res.
19:4485 (1991)).
[0172] An expression vector can be introduced into host cells using
a variety of standard techniques including calcium phosphate
transfection, liposome-mediated transfection,
microprojectile-mediated delivery, electroporation, and the like.
The transfected cells can be selected and propagated to provide
recombinant host cells that comprise the expression vector stably
integrated in the host cell genome. Techniques for introducing
vectors into eukaryotic cells and techniques for selecting such
stable transformants using a dominant selectable marker are
described, for example, by Ausubel (1995) and by Murray (ed.), Gene
Transfer and Expression Protocols (Humana Press 1991).
[0173] For example, one suitable selectable marker is a gene that
provides resistance to the antibiotic neomycin. In this case,
selection is carried out in the presence of a neomycin-type drug,
such as G-418 or the like. Selection systems can also be used to
increase the expression level of the gene of interest, a process
referred to as "amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of the
selective agent and then increasing the amount of selective agent
to select for cells that produce high levels of the products of the
introduced genes. An exemplary amplifiable selectable marker is
dihydrofolate reductase, which confers resistance to methotrexate.
Other drug resistance genes (e.g., hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can also be
used. Alternatively, markers that introduce an altered phenotype,
such as green fluorescent protein, or cell surface proteins (e.g.,
CD4, CD8, Class I MHC, and placental alkaline phosphatase) may be
used to sort transfected cells from untransfected cells by such
means as FACS sorting or magnetic bead separation technology.
[0174] Zkun11 polypeptides can also be produced by cultured cells
using a viral delivery system. Exemplary viruses for this purpose
include adenovirus, herpesvirus, vaccinia virus and
adeno-associated virus (AAV). Adenovirus, a double-stranded DNA
virus, is currently the best studied gene transfer vector for
delivery of heterologous nucleic acid (for a review, see Becker et
al., Meth. Cell Biol. 43:161 (1994), and Douglas and Curiel,
Science & Medicine 4:44 (1997)). Advantages of the adenovirus
system include the. accommodation of relatively large DNA inserts,
the ability to grow to high-titer, the ability to infect a broad
range of mammalian cell types, and flexibility that allows use with
a large number of available vectors containing different
promoters.
[0175] By deleting portions of the adenovirus genome, larger
inserts (up to 7 kb) of heterologous DNA can be accommodated. These
inserts can be incorporated into the viral DNA by direct ligation
or by homologous recombination with a co-transfected plasmid. An
option is to delete the essential E1 gene from the viral vector,
which results in the inability to replicate unless the E1 gene is
provided by the host cell. For example, adenovirus vector infected
human 293 cells (ATCC Nos. CRL-1573, 45504, 45505) can be grown as
adherent cells or in suspension culture at relatively high cell
density to produce significant amounts of protein (see Garnier et
al., Cytotechnol. 15:145 (1994)).
[0176] Zkun11 genes may also be expressed in other higher
eukaryotic cells, such as avian, fungal, insect, yeast, or plant
cells. The baculovirus system provides an efficient means to
introduce cloned Zkun11 genes into insect cells. Suitable
expression vectors are based upon the Autographa californica
multiple nuclear polyhedrosis virus (AcMNPV), and contain
well-known promoters such as Drosophila heat shock protein (hsp) 70
promoter, Autographa californica nuclear polyhedrosis virus
immediate-early gene promoter (ie-1) and the delayed early 39K
promoter, baculovirus p10 promoter, and the Drosophila
metallothionein promoter. A second method of making recombinant
baculovirus utilizes a transposon-based system described by Luckow
(Luckow, et al., J. Virol. 67:4566 (1993)). This system, which
utilizes transfer vectors, is sold in the BAC-to-BAC kit (Life
Technologies, Rockville, Md.). This system utilizes a transfer
vector, PFASTBAC (Life Technologies) containing a Tn7 transposon to
move the DNA encoding the Zkun11 polypeptide into a baculovirus
genome maintained in E. coli as a large plasmid called a "bacmid."
See, Hill-Perkins and Possee, J. Gen. Virol. 71:971 (1990),
Bonning, et al., J. Gen. Virol. 75:1551 (1994), and Chazenbalk, and
Rapoport, J. Biol. Chem. 270:1543 (1995). In addition, transfer
vectors can include an in-frame fusion with DNA encoding an epitope
tag at the C- or N-terminus of the expressed Zkun11 polypeptide,
for example, a Glu-Glu epitope tag (Grussenmeyer et al., Proc.
Nat'l Acad. Sci. 82:7952 (1985)). Using a technique known in the
art, a transfer vector containing a Zkun11 gene is transformed into
E. coli, and screened for bacmids which contain an interrupted lacZ
gene indicative of recombinant baculovirus. The bacmid DNA
containing the recombinant baculovirus genome is then isolated
using common techniques.
[0177] The illustrative PFASTBAC vector can be modified to a
considerable degree. For example, the polyhedrin promoter can be
removed and substituted with the baculovirus basic protein promoter
(also known as Pcor, p6.9 or MP promoter) which is expressed
earlier in the baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins (see, for example,
Hill-Perkins and Possee, J. Gen. Virol. 71:971 (1990), Bonning, et
al., J. Gen. Virol. 75:1551 (1994), and Chazenbalk and Rapoport, J.
Biol. Chem. 270:1543 (1995). In such transfer vector constructs, a
short or long version of the basic protein promoter can be used.
Moreover, transfer vectors can be constructed which replace the
native Zkun11 secretory signal sequences with secretory signal
sequences derived from insect proteins. For example, a secretory
signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey
bee Melittin (Invitrogen Corporation; Carlsbad, Calif.), or
baculovirus gp67 (PharMingen: San Diego, Calif.) can be used in
constructs to replace the native Zkun11 secretory signal
sequence.
[0178] The recombinant virus or bacmid is used to transfect host
cells. Suitable insect host cells include cell lines derived from
IPLB-Sf-21, a Spodoptera frugiperda pupal ovarian cell line, such
as Sf9 (ATCC CRL 1711), Sf21AE, and Sf21 (Invitrogen Corporation;
San Diego, Calif.), as well as Drosophila Schneider-2 cells, and
the HIGH FIVEO cell line (Invitrogen) derived from Trichoplusia ni
(U.S. Pat. No. 5,300,435). Commercially available serum-free media
can be used to grow and to maintain the cells. Suitable media are
Sf900 II.TM. (Life Technologies) or ESF 921.TM. (Expression
Systems) for the Sf9 cells; and Ex-cellO405.TM. (JRH Biosciences,
Lenexa, Kans.) or Express FiveO.TM. (Life Technologies) for the T.
ni cells. When recombinant virus is used, the cells are typically
grown up from an inoculation density of approximately
2-5.times.10.sup.5 cells to a density of 1-2.times.10.sup.6 cells
at which time a recombinant viral stock is added at a multiplicity
of infection (MOI) of 0.1 to 10, more typically near 3.
[0179] Established techniques for producing recombinant proteins in
baculovirus systems are provided by Bailey et al., "Manipulation of
Baculovirus Vectors," in Methods in Molecular Biology, Volume 7:
Gene Transfer and Expression Protocols, Murray (ed.), pages 147-168
(The Humana Press, Inc. 1991), by Patel et al., "The baculovirus
expression system," in DNA Cloning 2: Expression Systems, 2nd
Edition, Glover et al. (eds.), pages 205-244 (Oxford University
Press 1995), by Ausubel (1995) at pages 16-37 to 16-57, by
Richardson (ed.), Baculovirus Expression Protocols (The Humana
Press, Inc. 1995), and by Lucknow, "Insect Cell Expression
Technology," in Protein Engineering: Principles and Practice,
Cleland et al. (eds.), pages 183-218 (John Wiley & Sons, Inc.
1996).
[0180] Fungal cells, including yeast cells, can also be used to
express the genes described herein. Yeast species of particular
interest in this regard include Saccharomyces cerevisiae, Pichia
pastoris, and Pichia methanolica. Suitable promoters for expression
in yeast include promoters from GAL1 (galactose), PGK
(phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOX1
(alcohol oxidase), HIS4 (histidinol dehydrogenase), and the like.
Many yeast cloning vectors have been designed and are readily
available. These vectors include YIp-based vectors, such as YIp5,
YRp vectors, such as YRp17, YEp vectors such as YEp13 and YCp
vectors, such as YCp19. Methods for transforming S. cerevisiae
cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Pat. No.
4,599,311, Kawasaki et al., U.S. Pat. No. 4,931,373, Brake, U.S.
Pat. No. 4,870,008, Welch et al., U.S. Pat. No. 5,037,743, and
Murray et al., U.S. Pat. No. 4,845,075. Transformed cells are
selected by phenotype determined by the selectable marker, commonly
drug resistance or the ability to grow in the absence of a
particular nutrient (e.g., leucine). An illustrative vector system
for use in Saccharomyces cerevisiae is the POT1 vector system
disclosed by Kawasaki et al. (U.S. Pat. No. 4,931,373), which
allows transformed cells to be selected by growth in
glucose-containing media. Additional suitable promoters and
terminators for use in yeast include those from glycolytic enzyme
genes (see, e.g., Kawasaki, U.S. Pat. No. 4,599,311, Kingsman et
al., U.S. Pat. No. 4,615,974, and Bitter, U.S. Pat. No. 4,977,092)
and alcohol dehydrogenase genes. See also U.S. Pat. Nos. 4,990,446,
5,063,154, 5,139,936, and 4,661,454.
[0181] Transformation systems for other yeasts, including Hansenula
polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis,
Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia
methanolica, Pichia guillermondii and Candida maltosa are known in
the art. See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459 (1986), and Cregg, U.S. Pat. No. 4,882,279. Aspergillus
cells may be utilized according to the methods of McKnight et al.,
U.S. Pat. No. 4,935,349. Methods for transforming Acremonium
chrysogenum are disclosed by Sumino et al., U.S. Pat. No.
5,162,228. Methods for transforming Neurospora are disclosed by
Lambowitz, U.S. Pat. No. 4,486,533.
[0182] For example, the use of Pichia methanolica as host for the
production of recombinant proteins is disclosed by Raymond, U.S.
Pat. No. 5,716,808, Raymond, U.S. Pat. No. 5,736,383, Raymond et
al., Yeast 14:11-23 (1998), and in international publication Nos.
WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565. DNA
molecules for use in transforming P. methanolica will commonly be
prepared as double-stranded, circular plasmids, which can be
linearized prior to transformation. For polypeptide production in
P. methanolica, the promoter and terminator in the plasmid can be
that of a P. methanolica gene, such as a P. methanolica alcohol
utilization gene (AUG1 or AUG2). Other useful promoters include
those of the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To facilitate
integration of the DNA into the host chromosome, the entire
expression segment of the plasmid can be flanked at both ends by
host DNA sequences. An illustrative, selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21),
and which allows ade2 host cells to grow in the absence of adenine.
For large-scale, industrial processes where it is desirable to
minimize the use of methanol, host cells can be used in which both
methanol utilization genes (AUG1 and AUG2) are deleted. For
production of secreted proteins, host cells can be used that are
deficient in vacuolar protease genes (PEP4 and PRB1).
Electroporation is used to facilitate the introduction of a plasmid
containing DNA encoding a polypeptide of interest into P.
methanolica cells. P. methanolica cells can be transformed by
electroporation using an exponentially decaying, pulsed electric
field having a field strength of from 2.5 to 4.5 kV/cm, preferably
about 3.75 kV/cm, and a time constant (t) of from 1 to 40
milliseconds, most preferably about 20 milliseconds.
[0183] Expression vectors can also be introduced into plant
protoplasts, intact plant tissues, or isolated plant cells. Methods
for introducing expression vectors into plant tissue include the
direct infection or co-cultivation of plant tissue with
Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA
injection, electroporation, and the like. See, for example, Horsch
et al., Science 227:1229 (1985), Klein et al., Biotechnology 10:268
(1992), and Miki et al., "Procedures for Introducing Foreign DNA
into Plants," in Methods in Plant Molecular Biology and
Biotechnology, Glick et al. (eds.), pages 67-88 (CRC Press,
1993).
[0184] Alternatively, Zkun11 genes can be expressed in prokaryotic
host cells. Suitable promoters that can be used to express Zkun11
polypeptides in a prokaryotic host are well-known to those of skill
in the art and include promoters capable of recognizing the T4, T3,
Sp6 and T7 polymerases, the P.sub.R and P.sub.L promoters of
bacteriophage lambda, the trp, recA, heat shock, lacUV5, tac,
lpp-lacSpr, phoA, and lacZ promoters of E. coli, promoters of B.
subtilis, the promoters of the bacteriophages of Bacillus,
Streptomyces promoters, the int promoter of bacteriophage lambda,
the bla promoter of pBR322, and the CAT promoter of the
chloramphenicol acetyl transferase gene. Prokaryotic promoters have
been reviewed by Glick, J. Ind. Microbiol. 1:277 (1987), Watson et
al., Molecular Biology of the Gene, 4th Ed. (Benjamin Cummins
1987), and by Ausubel et al. (1995).
[0185] Useful prokaryotic hosts include E. coli and Bacillus
subtilus. Suitable strains of E. coli include BL21(DE3),
BL21(DE3)pLysS, BL21(DE3)pLysE, DH1, DH4I, DH5, DH5I, DH5IF',
DH5IMCR, DH10B, DH10B/p3, DH11S, C600, HB101, JM101, JM105, JM109,
JM110, K38, RR1, Y1088, Y1089, CSH18, ER1451, and ER1647 (see, for
example, Brown (ed.), Molecular Biology Labfax (Academic Press
1991)). Suitable strains of Bacillus subtilus include BR151, YB886,
MI119, MI120, and B170 (see, for example, Hardy, "Bacillus Cloning
Methods," in DNA Cloning: A Practical Approach, Glover (ed.) (IRL
Press 1985)).
[0186] When expressing a Zkun11 polypeptide in bacteria such as E.
coli, the polypeptide may be retained in the cytoplasm, typically
as insoluble granules, or may be directed to the periplasmic space
by a bacterial secretion sequence. In the former case, the cells
are lysed, and thegranules are recovered and denatured using, for
example, guanidine isothiocyanate or urea. The denatured
polypeptide can then be refolded and dimerized by diluting the
denaturant, such as by dialysis against a solution of urea and a
combination of reduced and oxidized glutathione, followed by
dialysis against a buffered saline solution. In the latter case,
the polypeptide can be recovered from the periplasmic space in a
soluble and functional form by disrupting the cells (by, for
example, sonication or osmotic shock) to release the contents of
the periplasmic space and recovering the protein, thereby obviating
the need for denaturation and refolding.
[0187] Methods for expressing proteins in prokaryotic hosts are
well-known to those of skill in the art (see, for example, Williams
et al., "Expression of foreign proteins in E. coli using plasmid
vectors and purification of specific polyclonal antibodies," in DNA
Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.),
page 15 (Oxford University Press 1995), Ward et al., "Genetic
Manipulation and Expression of Antibodies," in Monoclonal
Antibodies: Principles and Applications, page 137 (Wiley-Liss, Inc.
1995), and Georgiou, "Expression of Proteins in Bacteria," in
Protein Engineering: Principles and Practice, Cleland et al.
(eds.), page 101 (John Wiley & Sons, Inc. 1996)).
[0188] Standard methods for introducing expression vectors into
bacterial, yeast, insect, and plant cells are provided, for
example, by Ausubel (1995).
[0189] General methods for expressing and recovering foreign
protein produced by a mammalian cell system are provided by, for
example, Etcheverry, "Expression of Engineered Proteins in
Mammalian Cell Culture," in Protein Engineering: Principles and
Practice, Cleland et al. (eds.), pages 163 (Wiley-Liss, Inc. 1996).
Standard techniques for recovering protein produced by a bacterial
system is provided by, for example, Grisshammer et al.,
"Purification of over-produced proteins from E. coli cells," in DNA
Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.),
pages 59-92 (Oxford University Press 1995). Established methods for
isolating recombinant proteins from a baculovirus system are
described by Richardson (ed.), Baculovirus Expression Protocols
(The Humana Press, Inc. 1995).
[0190] As an alternative, polypeptides of the present invention can
be synthesized by exclusive solid phase synthesis, partial solid
phase methods, fragment condensation or classical solution
synthesis. These synthesis methods are well-known to those of skill
in the art (see, for example, Merrifield, J. Am. Chem. Soc. 85:2149
(1963), Stewart et al., "Solid Phase Peptide Synthesis" (2nd
Edition), (Pierce Chemical Co. 1984), Bayer and Rapp, Chem. Pept.
Prot. 3:3 (1986), Atherton et al., Solid Phase Peptide Synthesis: A
Practical Approach (IRL Press 1989), Fields and Colowick,
"Solid-Phase Peptide Synthesis," Methods in Enzymology Volume 289
(Academic Press 1997), and Lloyd-Williams et al., Chemical
Approaches to the Synthesis of Peptides and Proteins (CRC Press,
Inc. 1997)). Variations in total chemical synthesis strategies,
such as "native chemical ligation" and "expressed protein ligation"
are also standard (see, for example, Dawson et al., Science 266:776
(1994), Hackeng et al., Proc. Nat'l Acad. Sci. USA 94:7845 (1997),
Dawson, Methods Enzymol. 287: 34 (1997), Muir et al, Proc. Nat'l
Acad. Sci. USA 95:6705 (1998), Severinov and Muir, J. Biol. Chem.
273:16205 (1998), and Kochendoerfer and Kent, Curr. Opin. Chem.
Biol. 3:665 (1999)).
[0191] 8. Isolation of Zkun11 Polypeptides
[0192] The polypeptides of the present invention can be purified to
at least about 80% purity, to at least about 90% purity, to at
least about 95% purity, or greater than 95% purity with respect to
contaminating macromolecules, particularly other proteins and
nucleic acids, and free of infectious and pyrogenic agents. The
polypeptides of the present invention may also be purified to a
pharmaceutically pure state, which is greater than 99.9% pure.
Certain purified polypeptide preparations are substantially free of
other polypeptides, particularly other polypeptides of animal
origin.
[0193] Fractionation and/or conventional purification methods can
be used to obtain preparations of Zkun11 purified from natural
sources, and recombinant Zkun11 polypeptides and fusion Zkun11
polypeptides purified from recombinant host cells. In general,
ammonium sulfate precipitation and acid or chaotrope extraction may
be used for fractionation of samples. Exemplary purification steps
may include hydroxyapatite, size exclusion, FPLC and reverse-phase
high performance liquid chromatography. Suitable chromatographic
media include derivatized dextrans, agarose, cellulose,
polyacrylamide, specialty silicas, and the like. PEL DEAE, QAE and
Q derivatives are preferred. Exemplary chromatographic media
include those media derivatized with phenyl, butyl, or octyl
groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl
650 (Toso Haas, Montgomeryville, Pa.), Octyl-Sepharose (Pharmacia)
and the like; or polyacrylic resins, such as Amberchrom CG 71 (Toso
Haas) and the like. Suitable solid supports include glass beads,
silica-based resins, cellulosic resins, agarose beads, cross-linked
agarose beads, polystyrene beads, cross-linked polyacrylamide
resins and the like that are insoluble under the conditions in
which they are to be used. These supports may be modified with
reactive groups that allow attachment of proteins by amino groups,
carboxyl groups, sulfhydryl groups, hydroxyl groups and/or
carbohydrate moieties.
[0194] Examples of coupling chemistries include cyanogen bromide
activation, N-hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, hydrazide activation, and carboxyl and amino
derivatives for carbodiimide coupling chemistries. These and other
solid media are well known and widely used in the art, and are
available from commercial suppliers. Selection of a particular
method for polypeptide isolation and purification is a matter of
routine design and is determined in part by the properties of the
chosen support. See, for example, Affinity Chromatography:
Principles & Methods (Pharmacia LKB Biotechnology 1988), and
Doonan, Protein Purification Protocols (The Humana Press 1996).
[0195] Additional variations in Zkun11 isolation and purification
can be devised by those of skill in the art. For example,
anti-Zkun11 antibodies, obtained as described below, can be used to
isolate large quantities of protein by immunoaffinity
purification.
[0196] The polypeptides of the present invention can also be
isolated by exploitation of particular properties. For example,
immobilized metal ion adsorption (IMAC) chromatography can be used
to purify histidine-rich proteins, including those comprising
polyhistidine tags. Briefly, a gel is first charged with divalent
metal ions to form a chelate (Sulkowski, Trends in Biochem. 3:1
(1985)). Histidine-rich proteins will be adsorbed to this matrix
with differing affinities, depending upon the metal ion used, and
will be eluted by competitive elution, lowering the pH, or use of
strong chelating agents. Other methods of purification include
purification of glycosylated proteins by lectin affinity
chromatography and ion exchange chromatography (M. Deutscher,
(ed.), Meth. Enzymol. 182:529 (1990)). Within additional
embodiments of the invention, a fusion of the polypeptide of
interest and an affinity tag (e.g., maltose-binding protein, an
immunoglobulin domain) may be constructed to facilitate
purification.
[0197] Zkun11 polypeptides or fragments thereof may also be
prepared through chemical synthesis, as described above. Zkun11
polypeptides may be monomers or multimers; glycosylated or
non-glycosylated; PEGylated or non-PEGylated; and may or may not
include an initial methionine amino acid residue.
[0198] The present invention also contemplates chemically modified
Zkun11 compositions, in which a Zkun11 polypeptide is linked with a
polymer. Typically, the polymer is water soluble so that the Zkun11
conjugate does not precipitate in an aqueous environment, such as a
physiological environment. An example of a suitable polymer is one
that has been modified to have a single reactive group, such as an
active ester for acylation, or an aldehyde for alkylation, In this
way, the degree of polymerization can be controlled. An example of
a reactive aldehyde is polyethylene glycol propionaldehyde, or
mono-(C.sub.1-C.sub.10) alkoxy, or aryloxy derivatives thereof
(see, for example, Harris, et al., U.S. Pat. No. 5,252,714). The
polymer may be branched or unbranched. Moreover, a mixture of
polymers can be used to produce Zkun11 conjugates.
[0199] Zkun11 conjugates used for therapy can comprise
pharmaceutically acceptable water-soluble polymer moieties.
Suitable water-soluble polymers include polyethylene glycol (PEG),
monomethoxy-PEG, mono-(C.sub.1-C.sub.10)alkoxy-PEG, aryloxy-PEG,
poly-(N-vinyl pyrrolidone)PEG, tresyl monomethoxy PEG, PEG
propionaldehyde, bis-succinimidyl carbonate PEG, propylene glycol
homopolymers, a polypropylene oxide/ethylene oxide co-polymer,
polyoxyethylated polyols (e-g., glycerol), polyvinyl alcohol,
dextran, cellulose, or other carbohydrate-based polymers. Suitable
PEG may have a molecular weight from about 600 to about 60,000,
including, for example, 5,000, 12,000, 20,000 and 25,000. A Zkun11
conjugate can also comprise a mixture of such water-soluble
polymers. Anti-Zkun11 antibodies or anti-idiotype antibodies can
also be conjugated with a water-soluble polymer.
[0200] The present invention contemplates compositions comprising a
peptide or polypeptide described herein. Such compositions can
further comprise a carrier. The carrier can be a conventional
organic or inorganic carrier. Examples of carriers include water,
buffer solution, alcohol, propylene glycol, macrogol, sesame oil,
corn oil, and the like.
[0201] Peptides and polypeptides of the present invention comprise
at least six, at least nine, or at least 15 contiguous amino acid
residues of SEQ ID NO:2. Within certain embodiments of the
invention, the polypeptides comprise 10, 20, 30, 40, or more
contiguous residues of these amino acid sequences. Nucleic acid
molecules encoding such peptides and polypeptides are useful as
polymerase chain reaction primers and probes.
[0202] In addition to the uses described above, polynucleotides and
polypeptides of the present invention are useful as educational
tools in laboratory practicum kits for courses related to genetics
and molecular biology, protein chemistry, and antibody production
and analysis. Due to its unique polynucleotide and polypeptide
sequences, molecules of Zkun11 can be used as standards or as
"unknowns" for testing purposes. For example, Zkun11
polynucleotides can be used as an aid, such as, for example, to
teach a student how to prepare expression constructs for bacterial,
viral, or mammalian expression, including fusion constructs,
wherein Zkun11 is the gene to be expressed; for determining the
restriction endonuclease cleavage sites of the polynucleotides;
determining mRNA and DNA localization of Zkun11 polynucleotides in
tissues (i.e., by northern and Southern blotting as well as
polymerase chain reaction); and for identifying related
polynucleotides and polypeptides by nucleic acid hybridization. As
an illustration, students will find that HinfI digestion of a
nucleic acid molecule consisting of the nucleotide sequence of SEQ
ID NO:1 provides fragments of about 48 base pairs, and 105 base
pairs.
[0203] Zkun11 polypeptides can be used as an aid to teach
preparation of antibodies; identifying proteins by western
blotting; protein purification; determining the weight of expressed
Zkun11 polypeptides as a ratio to total protein expressed;
identifying peptide cleavage sites; coupling amino and carboxyl
terminal tags; amino acid sequence analysis, as well as, but not
limited to monitoring biological activities of both the native and
tagged protein (i.e., protease inhibition) in vitro and in vivo.
For example, students will find that digestion of unglycosylated
Zkun11 with V8 in ammonium acetate yields fragments having
approximate molecular weights of 3256, 2442, and 380, whereas
digestion of unglycosylated Zkun11 with clostripain yields
fragments having approximate molecular weights of 1860, 2535, and
1682.
[0204] Zkun11 polypeptides can also be used to teach analytical
skills such as mass spectrometry, circular dichroism, to determine
conformation, especially of the four alpha helices, x-ray
crystallography to determine the three-dimensional structure in
atomic detail, nuclear magnetic resonance spectroscopy to reveal
the structure of proteins in solution. For example, a kit
containing the Zkun11 can be given to the student to analyze. Since
the amino acid sequence would be known by the instructor, the
protein can be given to the student as a test to determine the
skills or develop the skills of the student, the instructor would
then know whether or not the student has correctly analyzed the
polypeptide. Since every polypeptide is unique, the educational
utility of Zkun11 would be unique unto itself.
[0205] The antibodies which bind specifically to Zkun11 can be used
as a teaching aid to instruct students how to prepare affinity
chromatography columns to purify Zkun11, cloning and sequencing the
polynucleotide that encodes an antibody and thus as a practicum for
teaching a student how to design humanized antibodies. The Zkun11
gene, polypeptide, or antibody would then be packaged by reagent
companies and sold to educational institutions so that the students
gain skill in art of molecular biology. Because each gene and
protein is unique, each gene and protein creates unique challenges
and learning experiences for students in a lab practicum. Such
educational kits containing the Zkun11 gene, polypeptide, or
antibody are considered within the scope of the present
invention.
[0206] 9. Production of Antibodies to Zkun11 Proteins
[0207] Antibodies to Zkun11 can be obtained, for example, using as
an antigen the product of a Zkun11 expression vector or Zkun11
isolated from a natural source. Particularly useful anti-Zkun11
antibodies "bind specifically" with Zkun11. Antibodies are
considered to be specifically binding if the antibodies exhibit at
least one of the following two properties: (1) antibodies bind to
Zkun11 with a threshold level of binding activity, and (2)
antibodies do not significantly cross-react with polypeptides
related to Zkun11.
[0208] With regard to the first characteristic, antibodies
specifically bind if they bind to a Zkun11 polypeptide, peptide or
epitope with a binding affinity (K.sub.a) of 10.sup.6 M.sup.-1 or
greater, preferably 10.sup.7 M.sup.-1 or greater, more preferably
10.sup.8 M.sup.-1 or greater, and most preferably 10.sup.9 M.sup.-1
or greater. The binding affinity of an antibody can be readily
determined by one of ordinary skill in the art, for example, by
Scatchard analysis (Scatchard, Ann. NY Acad. Sci. 51:660 (1949)).
With regard to the second characteristic, antibodies do not
significantly cross-react with related polypeptide molecules, for
example, if they detect Zkun11, but not known related polypeptides
using a standard Western blot analysis. Examples of known related
polypeptides are orthologs and proteins from the same species that
are members of a protein family. For example, specifically-binding
anti-Zkun11 antibodies bind with Zkun11, but not with known Kunitz
inhibitor proteins.
[0209] Anti-Zkun11 antibodies can be produced using antigenic
Zkun11 epitope-bearing peptides and polypeptides. Antigenic
epitope-bearing peptides and polypeptides of the present invention
contain a sequence of at least nine, or between 15 to about 30
amino acids contained within SEQ ID NO:2. However, peptides or
polypeptides comprising a larger portion of an amino acid sequence
of the invention, containing from 30 to 40 amino acids, or any
length up to and including the entire amino acid sequence of a
polypeptide of the invention, also are useful for inducing
antibodies that bind with Zkun11. It is desirable that the amino
acid sequence of the epitope-bearing peptide is selected to provide
substantial solubility in aqueous solvents (i.e., the sequence
includes relatively hydrophilic residues, while hydrophobic
residues are preferably avoided). Moreover, amino acid sequences
containing proline residues may be also be desirable for antibody
production.
[0210] As an illustration, potential antigenic sites in Zkun11 were
identified using the Jameson-Wolf method, Jameson and Wolf, CABIOS
4:181, (1988), as implemented by the PROTEAN program (version 3.14)
of LASERGENE (DNASTAR; Madison, Wis.). Default parameters were used
in this analysis.
[0211] The Jameson-Wolf method predicts potential antigenic
determinants by combining six major subroutines for protein
structural prediction. Briefly, the Hopp-Woods method, Hopp et al.,
Proc. Nat'l Acad. Sci. USA 78:3824 (1981), was first used to
identify amino acid sequences representing areas of greatest local
hydrophilicity (parameter: seven residues averaged). In the second
step, Emini's method, Emini et al., J. Virology 55:836 (1985), was
used to calculate surface probabilities (parameter: surface
decision threshold (0.6)=1). Third, the Karplus-Schultz method,
Karplus and Schultz, Naturwissenschaften 72:212 (1985), was used to
predict backbone chain flexibility (parameter: flexibility
threshold (0.2)=1). In the fourth and fifth steps of the analysis,
secondary structure predictions were applied to the data using the
methods of Chou-Fasman, Chou, "Prediction of Protein Structural
Classes from Amino Acid Composition," in Prediction of Protein
Structure and the Principles of Protein Conformation, Fasman (ed.),
pages 549-586 (Plenum Press 1990), and Garnier-Robson, Garnier et
al., J. Mol. Biol. 120:97 (1978) (Chou-Fasman parameters:
conformation table=64 proteins; .alpha. region threshold=103;
.beta. region threshold=105; Garnier-Robson parameters: .alpha. and
.beta. decision constants=0). In the sixth subroutine, flexibility
parameters and hydropathy/solvent accessibility factors were
combined to determine a surface contour value, designated as the
"antigenic index." Finally, a peak broadening function was applied
to the antigenic index, which broadens major surface peaks by
adding 20, 40, 60, or 80% of the respective peak value to account
for additional free energy derived from the mobility of surface
regions relative to interior regions. This calculation was not
applied, however, to any major peak that resides in a helical
region, since helical regions tend to be less flexible.
[0212] The results of this analysis indicated that amino acid
residues 4 to 10 ("antigenic peptide 1"), and amino acid residues
35 to 43 ("antigenic peptide 2"), of SEQ ID NO:2 would provide
suitable antigenic peptides. The present invention contemplates the
use of any one of antigenic peptides 1 and 2 to generate antibodies
to Zkun11. The present invention also contemplates polypeptides
comprising at least one of these antigenic peptides.
[0213] Polyclonal antibodies to recombinant Zkun11 protein or to
Zkun11 isolated from natural sources can be prepared using methods
well-known to those of skill in the art. Antibodies can also be
generated using a Zkun11-glutathione transferase fusion protein,
which is similar to a method described by Burrus and McMahon, Exp.
Cell. Res. 220:363 (1995). General methods for producing polyclonal
antibodies are described, for example, by Green et al., "Production
of Polyclonal Antisera," in Immunochemical Protocols (Manson, ed.),
pages 1-5 (Humana Press 1992), and Williams et al., "Expression of
foreign proteins in E. coli using plasmid vectors and purification
of specific polyclonal antibodies," in DNA Cloning 2: Expression
Systems, 2nd Edition, Glover et al. (eds.), page 15 (Oxford
University Press 1995).
[0214] The immunogenicity of a Zkun11 polypeptide can be increased
through the use of an adjuvant, such as alum (aluminum hydroxide)
or Freund's complete or incomplete adjuvant. Polypeptides useful
for immunization also include fusion polypeptides, such as fusions
of Zkun11 or a portion thereof with an immunoglobulin polypeptide
or with maltose binding protein. The polypeptide immunogen may be a
full-length molecule or a portion thereof. If the polypeptide
portion is "hapten-like," such portion may be advantageously joined
or linked to a macromolecular carrier (such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for
immunization.
[0215] Although polyclonal antibodies are typically raised in
animals such as horse, cow, dog, chicken, rat, mouse, rabbit, goat,
guinea pig, or sheep, an anti-Zkun11 antibody of the present
invention may also be derived from a subhuman primate antibody.
General techniques for raising diagnostically and therapeutically
useful antibodies in baboons may be found, for example, in
Goldenberg et al., international patent publication No. WO
91/11465, and in Losman et al., Int. J. Cancer 46:310 (1990).
[0216] Alternatively, monoclonal anti-Zkun11 antibodies can be
generated. Rodent monoclonal antibodies to specific antigens may be
obtained by methods known to those skilled in the art (see, for
example, Kohler et al., Nature 256:495 (1975), Coligan et al.
(eds.), Current Protocols in Immunology, Vol. 1, pages 2.5.1-2.6.7
(John Wiley & Sons 1991) ["Coligan"], Picksley et al.,
"Production of monoclonal antibodies against proteins expressed in
E. coli," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover
et al. (eds.), page 93 (Oxford University Press 1995)).
[0217] Briefly, monoclonal antibodies can be obtained by injecting
mice with a composition comprising a Zkun11 gene product, verifying
the presence of antibody production by removing a serum sample,
removing the spleen to obtain B-lymphocytes, fusing the
B-lymphocytes with myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce antibodies to
the antigen, culturing the clones that produce antibodies to the
antigen, and isolating the antibodies from the hybridoma
cultures.
[0218] In addition, an anti-Zkun11 antibody of the present
invention may be derived from a human monoclonal antibody. Human
monoclonal antibodies are obtained from transgenic mice that have
been engineered to produce specific human antibodies in response to
antigenic challenge. In this technique, elements of the human heavy
and light chain locus are introduced into strains of mice derived
from embryonic stem cell lines that contain targeted disruptions of
the endogenous heavy chain and light chain loci. The transgenic
mice can synthesize human antibodies specific for human antigens,
and the mice can be used to produce human antibody-secreting
hybridomas. Methods for obtaining human antibodies from transgenic
mice are described, for example, by Green et al., Nature Genet.
7:13 (1994), Lonberg et al., Nature 368:856 (1994), and Taylor et
al., Int. Immun. 6:579 (1994).
[0219] Monoclonal antibodies can be isolated and purified from
hybridoma cultures by a variety of well-established techniques.
Such isolation techniques include affinity chromatography with
Protein-A Sepharose, size-exclusion chromatography, and
ion-exchange chromatography (see, for example, Coligan at pages
2.7.1-2.7.12 and pages 2.9.1-2.9.3; Baines et al., "Purification of
Immunoglobulin G (IgG)," in Methods in Molecular Biology, Vol. 10,
pages 79-104 (The Humana Press, Inc. 1992)).
[0220] For particular uses, it may be desirable to prepare
fragments of anti-Zkun11 antibodies. Such antibody fragments can be
obtained, for example, by proteolytic hydrolysis of the antibody.
Antibody fragments can be obtained by pepsin or papain digestion of
whole antibodies by conventional methods. As an illustration,
antibody fragments can be produced by enzymatic cleavage of
antibodies with pepsin to provide a 5S fragment denoted
F(ab').sub.2. This fragment can be further cleaved using a thiol
reducing agent to produce 3.5S Fab' monovalent fragments.
Optionally, the cleavage reaction can be performed using a blocking
group for the sulfhydryl groups that result from cleavage of
disulfide linkages. As an alternative, an enzymatic cleavage using
pepsin produces two monovalent Fab fragments and an Fc fragment
directly. These methods are described, for example, by Goldenberg,
U.S. Pat. No. 4,331,647, Nisonoff et al., Arch Biochem. Biophys.
89:230 (1960), Porter, Biochem. J. 73:119 (1959), Edelman et al.,
in Methods in Enzymology Vol. 1, page 422 (Academic Press 1967),
and by Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
[0221] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0222] For example, Fv fragments comprise an association of V.sub.H
and V.sub.L chains. This association can be noncovalent, as
described by Inbar et al., Proc. Nat'l Acad. Sci. USA 69:2659
(1972). Alternatively, the variable chains can be linked by an
intermolecular disulfide bond or cross-linked by chemicals such as
glutaraldehyde (see, for example, Sandhu, Crit. Rev. Biotech.
12:437 (1992)).
[0223] The Fv fragments may comprise V.sub.H and V.sub.L chains
which are connected by a peptide linker. These single-chain antigen
binding proteins (scFv) are prepared by constructing a structural
gene comprising DNA sequences encoding the V.sub.H and V.sub.L
domains which are connected by an oligonucleotide. The structural
gene is inserted into an expression vector which is subsequently
introduced into a host cell, such as E. coli. The recombinant host
cells synthesize a single polypeptide chain with a linker peptide
bridging the two V domains. Methods for producing scFvs are
described, for example, by Whitlow et al., Methods: A Companion to
Methods in Enzymology 2:97 (1991) (also see, Bird et al., Science
242:423 (1988), Ladner et al., U.S. Pat. No. 4,946,778, Pack et
al., Bio/Technology 11:1271 (1993), and Sandhu, supra).
[0224] As an illustration, a scFV can be obtained by exposing
lymphocytes to Zkun11 polypeptide in vitro, and selecting antibody
display libraries in phage or similar vectors (for instance,
through use of immobilized or labeled Zkun11 protein or peptide).
Genes encoding polypeptides having potential Zkun11 polypeptide
binding domains can be obtained by screening random peptide
libraries displayed on phage (phage display) or on bacteria, such
as E. coli. Nucleotide sequences encoding the polypeptides can be
obtained in a number of ways, such as through random mutagenesis
and random polynucleotide synthesis. These random peptide display
libraries can be used to screen for peptides which interact with a
known target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic macromolecule, or
organic or inorganic substances. Techniques for creating and
screening such random peptide display libraries are known in the
art (Ladner et al., U.S. Pat. No. 5,223,409, Ladner et al., U.S.
Pat. No. 4,946,778, Ladner et al., U.S. Pat. No. 5,403,484, Ladner
et al., U.S. Pat. No. 5,571,698, and Kay et al., Phage Display of
Peptides and Proteins (Academic Press, Inc. 1996)) and random
peptide display libraries and kits for screening such libraries are
available commercially, for instance from CLONTECH Laboratories,
Inc. (Palo Alto, Calif.), Invitrogen Inc. (San Diego, Calif.), New
England Biolabs, Inc. (Beverly, Mass.), and Pharmacia LKB
Biotechnology Inc. (Piscataway, N.J.). Random peptide display
libraries can be screened using the Zkun11 sequences disclosed
herein to identify proteins which bind to Zkun11.
[0225] Another form of an antibody fragment is a peptide coding for
a single complementarity-determining region (CDR). CDR peptides
("minimal recognition units") can be obtained by constructing genes
encoding the CDR of an antibody of interest. Such genes are
prepared, for example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-producing cells
(see, for example, Larrick et al., Methods: A Companion to Methods
in Enzymology 2:106 (1991), Courtenay-Luck, "Genetic Manipulation
of Monoclonal Antibodies," in Monoclonal Antibodies: Production,
Engineering and Clinical Application, Ritter et al. (eds.), page
166 (Cambridge University Press 1995), and Ward et al., "Genetic
Manipulation and Expression of Antibodies," in Monoclonal
Antibodies: Principles and Applications, Birch et al., (eds.), page
137 (Wiley-Liss, Inc. 1995)).
[0226] Alternatively, an anti-Zkun11 antibody may be derived from a
"humanized" monoclonal antibody. Humanized monoclonal antibodies
are produced by transferring mouse complementary determining
regions from heavy and light variable chains of the mouse
immunoglobulin into a human variable domain. Typical residues of
human antibodies are then substituted in the framework regions of
the murine counterparts. The use of antibody components derived
from humanized monoclonal antibodies obviates potential problems
associated with the immunogenicity of murine constant regions.
General techniques for cloning murine immunoglobulin variable
domains are described, for example, by Orlandi et al., Proc. Nat'l
Acad. Sci. USA 86:3833 (1989). Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones et al.,
Nature 321:522 (1986), Carter et al., Proc. Nat'l Acad. Sci. USA
89:4285 (1992), Sandhu, Crit. Rev. Biotech. 12:437 (1992), Singer
et al., J. Immun. 150:2844 (1993), Sudhir (ed.), Antibody
Engineering Protocols (Humana Press, Inc. 1995), Kelley,
"Engineering Therapeutic Antibodies," in Protein Engineering:
Principles and Practice, Cleland et al. (eds.), pages 399-434 (John
Wiley & Sons, Inc. 1996), and by Queen et al., U.S. Pat. No.
5,693,762 (1997).
[0227] Polyclonal anti-idiotype antibodies can be prepared by
immunizing animals with anti-Zkun11 antibodies or antibody
fragments, using standard techniques. See, for example, Green et
al., "Production of Polyclonal Antisera," in Methods In Molecular
Biology: Immunochemical Protocols, Manson (ed.), pages 1-12 (Humana
Press 1992). Also, see Coligan at pages 2.4.1-2.4.7. Alternatively,
monoclonal anti-idiotype antibodies can be prepared using
anti-Zkun11 antibodies or antibody fragments as immunogens with the
techniques, described above. As another alternative, humanized
anti-idiotype antibodies or subhuman primate anti-idiotype
antibodies can be prepared using the above-described techniques.
Methods for producing anti-idiotype antibodies are described, for
example, by Irie, U.S. Pat. No. 5,208,146, Greene, et. al., U.S.
Pat. No. 5,637,677, and Varthakavi and Minocha, J. Gen. Virol.
77:1875 (1996).
[0228] Anti-idiotype Zkun11 antibodies, as well as Zkun11
polypeptides. can be used to identify and to isolate Zkun11
substrates and inhibitors. For example, proteins and peptides of
the present invention can be immobilized on a column and used to
bind substrate and inhibitor proteins from biological samples that
are run over the column (Hermanson et al. (eds.), Immobilized
Affinity Ligand Techniques, pages 195-202 (Academic Press 1992)).
Radiolabeled or affinity labeled Zkun11 polypeptides can also be
used to identify or to localize Zkun11 substrates and inhibitors in
a biological sample (see, for example, Deutscher (ed.), Methods in
Enzymol., vol. 182, pages 721-37 (Academic Press 1990); Brunner et
al., Ann. Rev. Biochem. 62:483 (1993); Fedan et al., Biochem.
Pharmacol. 33:1167 (1984)).
[0229] 10. Use of Zkun11 Nucleotide Sequences to Detect Zkun11 Gene
Expression and to Examine Zkun11 Gene Structure
[0230] Nucleic acid molecules can be used to detect the expression
of a Zkun11 gene in a biological sample. Such probe molecules
include double-stranded nucleic acid molecules comprising the
nucleotide sequence of SEQ ID NO:1, or a fragment thereof, as well
as single-stranded nucleic acid molecules having the complement of
the nucleotide sequence of SEQ ID NO:1, or a portion thereof. As
used herein, the term "portion" refers to at least eight
nucleotides to at least 20 or more nucleotides. Probe molecules may
be DNA, RNA, oligonucleotides, and the like. Certain probes bind
with regions of a Zkun11 gene that have a low sequence similarity
to comparable regions in other serine protease inhibitors.
[0231] In a basic assay, a single-stranded probe molecule is
incubated with RNA, isolated from a biological sample, under
conditions of temperature and ionic strength that promote base
pairing between the probe and target Zkun11 RNA species. After
separating unbound probe from hybridized molecules, the amount of
hybrids is detected.
[0232] Well-established hybridization methods of RNA detection
include northern analysis and dot/slot blot hybridization (see, for
example, Ausubel (1995) at pages 4-1 to 4-27, and Wu et al. (eds.),
"Analysis of Gene Expression at the RNA Level," in Methods in Gene
Biotechnology, pages 225-239 (CRC Press, Inc. 1997)). Nucleic acid
probes can be detectably labeled with radioisotopes such as
.sup.32P or .sup.35S. Alternatively, Zkun11 RNA can be detected
with a nonradioactive hybridization method (see, for example, Isaac
(ed.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes
(Humana Press, Inc. 1993)). Typically, nonradioactive detection is
achieved by enzymatic conversion of chromogenic or chemiluminescent
substrates. Illustrative nonradioactive moieties include biotin,
fluorescein, and digoxigenin.
[0233] Zkun11 oligonucleotide probes are also useful for in vivo
diagnosis. As an illustration, .sup.18F-labeled oligonucleotides
can be administered to a subject and visualized by positron
emission tomography (Tavitian et al., Nature Medicine 4:467
(1998)).
[0234] Numerous diagnostic procedures take advantage of the
polymerase chain reaction (PCR) to increase sensitivity of
detection methods. Standard techniques for performing PCR are
well-known (see, generally, Mathew (ed.), Protocols in Human
Molecular Genetics (Humana Press, Inc. 1991), White (ed.), PCR
Protocols: Current Methods and Applications (Humana Press, Inc.
1993), Cotter (ed.), Molecular Diagnosis of Cancer (Humana Press,
Inc. 1996), Hanausek and Walaszek (eds.), Tumor Marker Protocols
(Humana Press, Inc. 1998), Lo (ed.), Clinical Applications of PCR
(Humana Press, Inc. 1998), and Meltzer (ed.), PCR in Bioanalysis
(Humana Press, Inc. 1998)).
[0235] One variation of PCR for diagnostic assays is reverse
transcriptase-PCR (RT-PCR). In the RT-PCR technique, RNA is
isolated from a biological sample, reverse transcribed to cDNA, and
the cDNA is incubated with Zkun11 primers (see, for example, Wu et
al. (eds.), "Rapid Isolation of Specific cDNAs or Genes by PCR," in
Methods in Gene Biotechnology, pages 15-28 (CRC Press, Inc. 1997)).
PCR is then performed and the products are analyzed using standard
techniques.
[0236] As an illustration, RNA is isolated from biological sample
using, for example, the guanidinium-thiocyanate cell lysis
procedure described above. Alternatively, a solid-phase technique
can be used to isolate mRNA from a cell lysate. A reverse
transcription reaction can be primed with the isolated RNA using
random oligonucleotides, short homopolymers of dT, or Zkun11
anti-sense oligomers. Oligo-dT primers offer the advantage that
various mRNA nucleotide sequences are amplified that can provide
control target sequences. Zkun11 sequences are amplified by the
polymerase chain reaction using two flanking oligonucleotide
primers that are typically 20 bases in length.
[0237] PCR amplification products can be detected using a variety
of approaches. For example, PCR products can be fractionated by gel
electrophoresis, and visualized by ethidium bromide staining.
Alternatively, fractionated PCR products can be transferred to a
membrane, hybridized with a detectably-labeled Zkun11 probe, and
examined by autoradiography. Additional alternative approaches
include the use of digoxigenin-labeled deoxyribonucleic acid
triphosphates to provide chemiluminescence detection, and the
C-TRAK colorimetric assay.
[0238] Another approach for detection of Zkun11 expression is
cycling probe technology, in which a single-stranded DNA target
binds with an excess of DNA-RNA-DNA chimeric probe to form a
complex, the RNA portion is cleaved with RNAase H, and the presence
of cleaved chimeric probe is detected (see, for example, Beggs et
al., J. Clin. Microbiol. 34:2985 (1996), Bekkaoui et al.,
Biotechniques 20:240 (1996)). Alternative methods for detection of
Zkun11 sequences can utilize approaches such as nucleic acid
sequence-based amplification, cooperative amplification of
templates by cross-hybridization, and the ligase chain reaction
(see, for example, Marshall et al., U.S. Pat. No. 5,686,272 (1997),
Dyer et al., J. Virol. Methods 60:161 (1996), Ehricht et al., Eur.
J. Biochem. 243:358 (1997), and Chadwick et al., J. Virol. Methods
70:59 (1998)). Other standard methods are known to those of skill
in the art.
[0239] Zkun11 probes and primers can also be used to detect and to
localize Zkun11 gene expression in tissue samples. Methods for such
in situ hybridization are well-known to those of skill in the art
(see, for example, Choo (ed.), In Situ Hybridization Protocols
(Humana Press, Inc. 1994), Wu et al. (eds.), "Analysis of Cellular
DNA or Abundance of mRNA by Radioactive In Situ Hybridization
(RISH)," in Methods in Gene Biotechnology, pages 259-278 (CRC
Press, Inc. 1997), and Wu et al. (eds.), "Localization of DNA or
Abundance of mRNA by Fluorescence In Situ Hybridization (RISH)," in
Methods in Gene Biotechnology, pages 279-289 (CRC Press, Inc.
1997)). Various additional diagnostic approaches are well-known to
those of skill in the art (see, for example, Mathew (ed.),
Protocols in Human Molecular Genetics (Humana Press, Inc. 1991),
Coleman and Tsongalis, Molecular Diagnostics (Humana Press, Inc.
1996), and Elles, Molecular Diagnosis of Genetic Diseases (Humana
Press, Inc., 1996)).
[0240] Zkun11 nucleotide sequences can also be used in
linkage-based testing for various diseases, and to determine
whether a subject's chromosomes contain a mutation in the Zkun11
gene. Detectable chromosomal aberrations at the Zkun11 gene locus
include, but are not limited to, aneuploidy, gene copy number
changes, insertions, deletions, restriction site changes and
rearrangements. Of particular interest are genetic alterations that
inactivate a Zkun11 gene.
[0241] Aberrations associated with a Zkun11 locus can be detected
using nucleic acid molecules of the present invention by employing
molecular genetic techniques, such as restriction fragment length
polymorphism analysis, short tandem repeat analysis employing PCR
techniques, amplification-refractory mutation system analysis,
single-strand conformation polymorphism detection, RNase cleavage
methods, denaturing gradient gel electrophoresis,
fluorescence-assisted mismatch analysis, and other genetic analysis
techniques known in the art (see, for example, Mathew (ed.),
Protocols in Human Molecular Genetics (Humana Press, Inc. 1991),
Marian, Chest 108:255 (1995), Coleman and Tsongalis, Molecular
Diagnostics (Human Press, Inc. 1996), Elles (ed.) Molecular
Diagnosis of Genetic Diseases (Humana Press, Inc. 1996), Landegren
(ed.), Laboratory Protocols for Mutation Detection (Oxford
University Press 1996), Birren et al. (eds.), Genome Analysis, Vol.
2: Detecting Genes (Cold Spring Harbor Laboratory Press 1998),
Dracopoli et al. (eds.), Current Protocols in Human Genetics (John
Wiley & Sons 1998), and Richards and Ward, "Molecular
Diagnostic Testing," in Principles of Molecular Medicine, pages
83-88 (Humana Press, Inc. 1998)).
[0242] The protein truncation test is also useful for detecting the
inactivation of a gene in which translation-terminating mutations
produce only portions of the encoded protein (see, for example,
Stoppa-Lyonnet et al., Blood 91:3920 (1998)). According to this
approach, RNA is isolated from a biological sample, and used to
synthesize cDNA. PCR is then used to amplify the Zkun11 target
sequence and to introduce an RNA polymerase promoter, a translation
initiation sequence, and an in-frame ATG triplet. PCR products are
transcribed using an RNA polymerase, and the transcripts are
translated in vitro with a T7-coupled reticulocyte lysate system.
The translation products are then fractionated by SDS-PAGE to
determine the lengths of the translation products. The protein
truncation test is described, for example, by Dracopoli et al.
(eds.), Current Protocols in Human Genetics, pages 9.11.1-9.11.18
(John Wiley & Sons 1998).
[0243] The chromosomal location of the Zkun11 gene can be
determined using radiation hybrid mapping, which is a somatic cell
genetic technique developed for constructing high-resolution,
contiguous maps of mammalian chromosomes (Cox et al., Science
250:245 (1990)). Partial or full knowledge of a gene's sequence
allows one to design PCR primers suitable for use with chromosomal
radiation hybrid mapping panels. Radiation hybrid mapping panels
are commercially available which cover the entire human genome,
such as the Stanford G3 RH Panel and the GeneBridge 4 RH Panel
(Research Genetics, Inc., Huntsville, Ala.). These panels enable
rapid, PCR-based chromosomal localizations and ordering of genes,
sequence-tagged sites (STSs), and other nonpolymorphic and
polymorphic markers within a region of interest. This includes
establishing directly proportional physical distances between newly
discovered genes of interest and previously mapped markers.
[0244] The present invention also contemplates kits for performing
a diagnostic assay for Zkun11 gene expression or to analyze the
Zkun11 locus of a subject. Such kits comprise nucleic acid probes,
such as double-stranded nucleic acid molecules comprising the
nucleotide sequence of SEQ ID NO:1, or a fragment thereof, as well
as single-stranded nucleic acid molecules having the complement of
the nucleotide sequence of SEQ ID NO:1, or a fragment thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the like.
Kits may comprise nucleic acid primers for performing PCR.
[0245] Such a kit can contain all the necessary elements to perform
a nucleic acid diagnostic assay described above. A kit will
comprise at least one container comprising a Zkun11 probe or
primer. The kit may also comprise a second container comprising one
or more reagents capable of indicating the presence of Zkun11
sequences. Examples of such indicator reagents include detectable
labels such as radioactive labels, fluorochromes, chemiluminescent
agents, and the like. A kit may also comprise a means for conveying
to the user that the Zkun11 probes and primers are used to detect
Zkun11 gene expression. For example, written instructions may state
that the enclosed nucleic acid molecules can be used to detect
either a nucleic acid molecule that encodes Zkun11, or a nucleic
acid molecule having a nucleotide sequence that is complementary to
a Zkun11-encoding nucleotide sequence, or to analyze chromosomal
sequences associated with the Zkun11 locus. The written material
can be applied directly to a container, or the written material can
be provided in the form of a packaging insert.
[0246] 11. Use of Anti-Zkun11 Antibodies to Detect Zkun11
Protein
[0247] The present invention contemplates the use of anti-Zkun11
antibodies to screen biological samples in vitro for the presence
of Zkun11. In one type of in vitro assay, anti-Zkun11 antibodies
are used in liquid phase. For example, the presence of Zkun11 in a
biological sample can be tested by mixing the biological sample
with a trace amount of labeled Zkun11 and an anti-Zkun11 antibody
under conditions that promote binding between Zkun11 and its
antibody. Complexes of Zkun11 and anti-Zkun11 in the sample can be
separated from the reaction mixture by contacting the complex with
an immobilized protein which binds with the antibody, such as an Fc
antibody or Staphylococcus protein A. The concentration of Zkun11
in the biological sample will be inversely proportional to the
amount of labeled Zkun11 bound to the antibody and directly related
to the amount of free labeled Zkun11. Illustrative biological
samples include blood, urine, saliva, tissue biopsy, and autopsy
material.
[0248] Alternatively, in vitro assays can be performed in which
anti-Zkun11 antibody is bound to a solid-phase carrier. For
example, antibody can be attached to a polymer, such as
aminodextran, in order to link the antibody to an insoluble support
such as a polymer-coated bead, a plate or a tube. Other suitable in
vitro assays will be readily apparent to those of skill in the
art.
[0249] In another approach, anti-Zkun11 antibodies can be used to
detect Zkun11 in tissue sections prepared from a biopsy specimen.
Such immunochemical detection can be used to determine the relative
abundance of Zkun11 and to determine the distribution of Zkun11 in
the examined tissue. General immunochemistry techniques are well
established (see, for example, Ponder, "Cefl Marking Techniques and
Their Application," in Mammalian Development: A Practical Approach,
Monk (ed.), pages 115-38 (IRL Press 1987), Coligan at pages
5.8.1-5.8.8, Ausubel (1995) at pages 14.6.1 to 14.6.13 (Wiley
Interscience 1990), and Manson (ed.), Methods In Molecular Biology,
Vol.10: Immunochemical Protocols (The Humana Press, Inc.
1992)).
[0250] Immunochemical detection can be performed by contacting a
biological sample with an anti-Zkun11 antibody, and then contacting
the biological sample with a detectably labeled molecule which
binds to the antibody. For example, the detectably labeled molecule
can comprise an antibody moiety that binds to anti-Zkun11 antibody.
Alternatively, the anti-Zkun11 antibody can be conjugated with
avidin/streptavidin (or biotin) and the detectably labeled molecule
can comprise biotin (or avidin/streptavidin). Numerous variations
of this basic technique are well-known to those of skill in the
art.
[0251] Alternatively, an anti-Zkun11 antibody can be conjugated
with a detectable label to form an anti-Zkun11 immunoconjugate.
Suitable detectable labels include, for example, a radioisotope, a
fluorescent label, a chemiluminescent label, an enzyme label, a
bioluminescent label or colloidal gold. Methods of making and
detecting such detectably-labeled immunoconjugates are well-known
to those of ordinary skill in the art, and are described in more
detail below.
[0252] The detectable label can be a radioisotope that is detected
by autoradiography. Isotopes that are particularly useful for the
purpose of the present invention are .sup.3H, .sup.125I, .sup.131I,
.sup.35S and .sup.14C.
[0253] Anti-Zkun11 immunoconjugates can also be labeled with a
fluorescent compound. The presence of a fluorescently-labeled
antibody is determined by exposing the immunoconjugate to light of
the proper wavelength and detecting the resultant fluorescence.
Fluorescent labeling compounds include fluorescein isothiocyanate,
rhodamine, phycoerytherin, phycocyanin, allophycocyanin,
o-phthaldehyde and fluorescamine.
[0254] Alternatively, anti-Zkun11 immunoconjugates can be
detectably labeled by coupling an antibody component to a
chemiluminescent compound. The presence of the
chemiluminescent-tagged immunoconjugate is determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of chemiluminescent labeling compounds
include luminol, isoluminol, an aromatic acridinium ester, an
imidazole, an acridinium salt and an oxalate ester.
[0255] Similarly, a bioluminescent compound can be used to label
anti-Zkun11 immunoconjugates of the present invention.
Bioluminescence is a type of chemiluminescence found in biological
systems in which a catalytic protein increases the efficiency of
the chemiluminescent reaction. The presence of a bioluminescent
protein is determined by detecting the presence of luminescence.
Bioluminescent compounds that are useful for labeling include
luciferin, luciferase and aequorin.
[0256] Alternatively, anti-Zkun11 immunoconjugates can be
detectably labeled by linking an anti-Zkun11 antibody component to
an enzyme. When the anti-Zkun11-enzyme conjugate is incubated in
the presence of the appropriate substrate, the enzyme moiety reacts
with the substrate to produce a chemical moiety, which can be
detected, for example, by spectrophotometric, fluorometric or
visual means. Examples of enzymes that can be used to detectably
label polyspecific immunoconjugates include .beta.-galactosidase,
glucose oxidase, peroxidase and alkaline phosphatase.
[0257] Those of skill in the art will know of other suitable
labels, which can be employed in accordance with the present
invention. The binding of marker moieties to anti-Zkun11 antibodies
can be accomplished using standard techniques known to the art.
Typical methodology in this regard is described by Kennedy et al.,
Clin. Chim. Acta 70:1 (1976), Schurs et al., Clin. Chim. Acta 81:1
(1977), Shih et al., Int'l J. Cancer 46:1101 (1990), Stein et al.,
Cancer Res. 50:1330 (1990), and Coligan, supra.
[0258] Moreover, the convenience and versatility of immunochemical
detection can be enhanced by using anti-Zkun11 antibodies that have
been conjugated with avidin, streptavidin, and biotin (see, for
example, Wilchek et al. (eds.), "Avidin-Biotin Technology," Methods
In Enzymology, Vol. 184 (Academic Press 1990), and Bayer et al.,
"Immunochemical Applications of Avidin-Biotin Technology," in
Methods In Molecular Biology, Vol. 10, Manson (ed.), pages 149-162
(The Humana Press, Inc. 1992).
[0259] Methods for performing immunoassays are well-established.
See, for example, Cook and Self, "Monoclonal Antibodies in
Diagnostic Immunoassays," in Monoclonal Antibodies: Production,
Engineering, and Clinical Application, Ritter and Ladyman (eds.),
pages 180-208, (Cambridge University Press, 1995), Perry, "The Role
of Monoclonal Antibodies in the Advancement of Immunoassay
Technology," in Monoclonal Antibodies: Principles and Applications,
Birch and Lennox (eds.), pages 107-120 (Wiley-Liss, Inc. 1995), and
Diamandis, Immunoassay (Academic Press, Inc. 1996).
[0260] In a related approach, biotin- or FITC-labeled Zkun11 can be
used to identify cells that bind Zkun11. Such can binding can be
detected, for example, using flow cytometry.
[0261] The present invention also contemplates kits for performing
an immunological diagnostic assay for Zkun11 gene expression. Such
kits comprise at least one container comprising an anti-Zkun11
antibody, or antibody fragment. A kit may also comprise a second
container comprising one or more reagents capable of indicating the
presence of Zkun11 antibody or antibody fragments. Examples of such
indicator reagents include detectable labels such as a radioactive
label, a fluorescent label, a chemiluminescent label, an enzyme
label, a bioluminescent label, colloidal gold, and the like. A kit
may also comprise a means for conveying to the user that Zkun11
antibodies or antibody fragments are used to detect Zkun11 protein.
For example, written instructions may state that the enclosed
antibody or antibody fragment can be used to detect Zkun11. The
written material can be applied directly to a container, or the
written material can be provided in the form of a packaging
insert.
[0262] 12. Therapeutic Uses of Polypeptides Having Zkun11
Activity
[0263] The present invention includes the use of proteins,
polypeptides, and peptides having Zkun11 activity (such as Zkun11
polypeptides, anti-idiotype anti-Zkun11 antibodies, and Zkun11
fusion proteins) to a subject who lacks an adequate amount of this
serine protease inhibitor. These molecules can be administered to
any subject in need of treatment, and the present invention
contemplates both veterinary and human therapeutic uses.
Illustrative subjects include mammalian subjects, such as farm
animals, domestic animals, and human patients.
[0264] For example, the Zkun11 proteins are contemplated for use in
the treatment or prevention of conditions associated with excessive
proteinase activity, such as an excess of trypsin, chymotrypsins A
and B, plasmin, subtilisin, enterokinase, kallikrein, elastase,
cathepsin G, acrosin, proteinase-3, thrombin, factor VIIa, factor
IXa, factor Xa, factor XIa, factor XIIa, or matrix
metalloproteinases. Such conditions include, but are not limited
to, acute pancreatitis, cardiopulmonary bypass-induced pulmonary
injury, allergy-induced protease release, deep vein thrombosis,
myocardial infarction, shock (including septic shock),
hyperfibrinolytic hemorrhage, emphysema, rheumatoid arthritis,
adult respiratory distress syndrome, chronic inflammatory bowel
disease, psoriasis, and other inflammatory conditions. Zkun11
proteins are also contemplated for use in preservation of platelet
function, organ preservation, and wound healing.
[0265] Zkun11 proteins may be useful in the treatment of conditions
arising from an imbalance in hemostasis, including acquired
coagulopathies, primary fibrinolysis and fibrinolysis due to
cirrhosis, and complications from high-dose thrombolytic therapy.
Acquired coagulopathies can result from liver disease, uremia,
acute disseminated intravascular coagulation, post-cardiopulmonary
bypass, massive transfusion, or Warfarin overdose (Humphries,
Transfusion Medicine 1:1181 (1994)). A deficiency or dysfunction in
any of the procoagulant mechanisms predisposes a subject to either
spontaneous hemorrhage or excess blood loss associated with trauma
or surgery. Acquired coagulopathies usually involve a combination
of deficiencies, such as deficiencies of a plurality of coagulation
factors, or platelet dysfunction. In addition, subjects with liver
disease commonly experience increased fibrinolysis due to an
inability to maintain normal levels of .alpha..sub.2-antiplasmin or
decreased hepatic clearance of plasminogen activators (Shuman,
"Hemorrhagic Disorders," in Bennet and Plum (Eds.), Cecil Textbook
of Medicine, 20th Ed. (W. B. Saunders Co. 1996)).
[0266] Primary fibrinolysis results from a massive release of
plasminogen activator. Conditions associated with primary
fibrinolysis include carcinoma of the prostate, acute promyelocytic
leukemia, hemangiomas, and sustained release of plasminogen
activator by endothelial cells due to injection of venoms. The
condition becomes critical when enough plasmin is activated to
deplete the circulating level of .alpha..sub.2-antiplasmi- n
(Shuman, "Hemorrhagic Disorders," in Bennet and Plum (Eds.), Cecil
Textbook of Medicine, 20th Ed. (W. B. Saunders Co. 1996)). Data
suggest that plasmin on endothelial cells may be related to the
pathophysiology of bleeding or rethrombosis observed in patients
undergoing high-dose thrombolytic therapy for thrombosis. Plasmin
may cause further damage to the thrombogenic surface of blood
vessels after thrombolysis, which may result in rethrombosis
(Okajima, J. Lab. Clin. Med. 126:1377 (1995)).
[0267] Additional antithrombotic uses of Zkun11 proteins include
treatment or prevention of deep vein thrombosis, pulmonary
embolism, and post-surgical thrombosis.
[0268] Zkun11 proteins may also be used within methods for
inhibiting blood coagulation in mammals, such as in the treatment
of disseminated intravascular coagulation. In this way, Zkun11
proteins can substitute for anticoagulants such as heparin,
coumarin, and anti-thrombin imi. Such methods will generally
include administration of the protein in an amount sufficient to
produce a clinically significant inhibition of blood coagulation.
Such amounts will vary with the nature of the condition to be
treated, but can be predicted on the basis of known assays and
experimental animal models.
[0269] Zkun11 proteins may also find therapeutic use in the
blockage of proteolytic tissue degradation. Proteolysis of
extracellular matrix, connective tissue, and other tissues and
organs is an element of many diseases. This tissue destruction is
beleived to be initiated when plasmin activates one or more matrix
metalloproteinases (e.g., collagenase and metallo-elastases).
Inhibition of plasmin by Zkun11 proteins may thus be beneficial in
the treatment of these conditions.
[0270] Matrix metalloproteinases (MMPs) are believed to play a role
in metastases of cancers, abdominal aortic aneurysm, multiple
sclerosis, rheumatoid arthritis, osteoarthritis, trauma and
hemorrhagic shock, and cornial ulcers. MMPs produced by tumor cells
break down and remodel tissue matrices during the process of
metastatic spread. There is evidence to suggest that MMP inhibitors
block this activity (Brown, Advan. Enzyme Regul. 35:293 (1995)).
Abdominal aortic aneurysm is characterized by the degradation of
extracellular matrix and loss of structural integrity of the aortic
wall. Data suggest that plasmin may be important in the sequence of
events leading to this destruction of aortic matrix (Jean-Claude et
al., Surgery 116:472 (1994)). Proteolytic enzymes are also believed
to contribute to the inflammatory tissue damage of multiple
sclerosis (Gijbels, J. Clin. Invest. 94:2177 (1994)). Rheumatoid
arthritis is a chronic, systemic inflammatory disease predominantly
affecting joints and other connective tissues, wherein
proliferating inflammatory tissue (panus) may cause joint
deformities and dysfunction (see, Arnett, in Cecil Textbook of
Medicine, ibid.). Osteoarthritis is a chronic disease causing
deterioration of the joint cartilage and other joint tissues and
the formation of new bone (bone spurs) at the margins of the
joints. There is evidence that MMPs participate in the degradation
of collagen in the matrix of osteoarthritic articular cartilage.
Inhition of MMPs results in the inhibition of the removal of
collagen from cartilage matrix (Spirito, Inflam. Res. 44 (supp.
2):S131 (1995); O'Byrne, Inflam. Res. 44 (supp. 2):S117 (1995);
Karran, Ann. Rheumatic Disease 54:662 (1995)).
[0271] Zkun11 proteins may also be useful in the treatment of
trauma and hemorrhagic shock. Data suggest that administration of
an MMP inhibitor after hemorrhage improves cardiovascular response,
hepatocellular function, and microvascular blood flow in various
organs (Wang, Shock 6:377 (1996)). Corneal ulcers, which can result
in blindness, manifest as a breakdown of the collagenous stromal
tissue. Damage due to thermal or chemical injury to corneal
surfaces often results in a chronic wound-healing situation. There
is direct evidence for the role of MMPs in basement membrane
defects associated with failure to re-epithelialize in cornea or
skin (Fini, Am. J. Pathol. 149:1287 (1996)).
[0272] The Zkun11 proteins of the present invention may be combined
with other therapeutic agents to augment the activity (e.g.,
antithrombotic or anticoagulant activity) of such agents. For
example, a Zkun11 protein may be used in combination with tissue
plasminogen activator in thrombolytic therapy.
[0273] Generally, the dosage of administered polypeptide, protein
or peptide will vary depending upon such factors as the subject's
age, weight, height, sex, general medical condition and previous
medical history. Typically, it is desirable to provide the
recipient with a dosage of a molecule having Zkun11 activity, which
is in the range of from about 10 .mu.g/kg to 10 mg/kg body weight,
100 .mu.g/kg to 5 mg/kg body weight, or 100 .mu.g/kg to 1 mg/kg
body weight, although a lower or higher dosage also may be
administered as circumstances dictate.
[0274] Administration of a molecule having Zkun11 activity to a
subject can be intravenous, intraarterial, intraperitoneal,
intramuscular, subcutaneous, intrapleural, intrathecal, by
perfusion through a regional catheter, or by direct intralesional
injection. When administering therapeutic proteins by injection,
the administration may be by continuous infusion or by single or
multiple boluses.
[0275] A pharmaceutical composition comprising a protein,
polypeptide, or peptide having Zkun11 activity can be formulated
according to known methods to prepare pharmaceutically useful
compositions, whereby the therapeutic proteins are combined in a
mixture with a pharmaceutically acceptable carrier. A composition
is said to be a "pharmaceutically acceptable carrier" if its
administration can be tolerated by a recipient patient. Sterile
phosphate-buffered saline is one example of a pharmaceutically
acceptable carrier. Other suitable carriers are well-known to those
in the art. See, for example, Gennaro (ed.), Remington's
Pharmaceutical Sciences, 19th Edition (Mack Publishing Company
1995).
[0276] For purposes of therapy, molecules having Zkun11 activity
and a pharmaceutically acceptable carrier are administered to a
patient in a therapeutically effective amount. A combination of a
protein, polypeptide, or peptide having Zkun11 activity and a
pharmaceutically acceptable carrier is said to be administered in a
"therapeutically effective amount" if the amount administered is
physiologically significant. An agent is physiologically
significant if its presence results in a detectable change in the
physiology of a recipient patient.
[0277] A pharmaceutical composition comprising molecules having
Zkun11 activity can be furnished in liquid form, or in solid form.
Liquid forms, including liposome-encapsulated formulations, are
illustrated by injectable solutions and oral suspensions. Exemplary
solid forms include capsules, tablets, and controlled-release
forms, such as a miniosmotic pump or an implant. Other dosage forms
can be devised by those skilled in the art, as shown, for example,
by Ansel and Popovich, Pharmaceutical Dosage Forms and Drug
Delivery Systems, 5.sup.th Edition (Lea & Febiger 1990),
Gennaro (ed.), Remington's Pharmaceutical Sciences, 19.sup.th
Edition (Mack Publishing Company 1995), and by Ranade and
Hollinger, Drug Delivery Systems (CRC Press 1996).
[0278] As an illustration, Zkun11 pharmaceutical compositions may
be supplied as a kit comprising a container that comprises Zkun11.
Zkun11 can be provided in the form of an injectable solution for
single or multiple doses, or as a sterile powder that will be
reconstituted before injection. Such a kit may further comprise
written information on indications and usage of the pharmaceutical
composition. Moreover, such information may include a statement
that the Zkun11 composition is contraindicated in patients with
known hypersensitivity to Zkun11.
[0279] 13. Therapeutic Uses of Zkun11 Nucleotide Sequences
[0280] The present invention includes the use of Zkun11 nucleotide
sequences to provide Zkun11 to a subject in need of such treatment,
as discussed above. In addition, a therapeutic expression vector
can be provided that inhibits Zkun11 gene expression, such as an
anti-sense molecule, a ribozyme, or an external guide sequence
molecule.
[0281] There are numerous approaches to introduce a Zkun11 gene to
a subject, including the use of recombinant host cells that express
Zkun11, delivery of naked nucleic acid encoding Zkun11, use of a
cationic lipid carrier with a nucleic acid molecule that encodes
Zkun11, and the use of viruses that express Zkun11, such as
recombinant retroviruses, recombinant adeno-associated viruses,
recombinant adenoviruses, and recombinant Herpes simplex viruses
(see, for example, Mulligan, Science 260:926 (1993), Rosenberg et
al., Science 242:1575 (1988), LaSalle et al., Science 259:988
(1993), Wolff et al., Science 247:1465 (1990), Breakfield and
Deluca, The New Biologist 3:203 (1991)). In an ex vivo approach,
for example, cells are isolated from a subject, transfected with a
vector that expresses a Zkun11 gene, and then transplanted into the
subject.
[0282] In order to effect expression of a Zkun11 gene, an
expression vector is constructed in which a nucleotide sequence
encoding a Zkun11 gene is operably linked to a core promoter, and
optionally a regulatory element, to control gene transcription. The
general requirements of an expression vector are described
above.
[0283] Alternatively, a Zkun11 gene can be delivered using
recombinant viral vectors, including for example, adenoviral
vectors (e.g., Kass-Eisler et al., Proc. Nat'l Acad. Sci. USA
90:11498 (1993), Kolls et al., Proc. Nat'l Acad. Sci. USA 91:215
(1994), Li et al., Hum. Gene Ther. 4:403 (1993), Vincent et al.,
Nat. Genet. 5:130 (1993), and Zabner et al., Cell 75:207 (1993)),
adenovirus-associated viral vectors (Flotte et al., Proc. Nat'l
Acad. Sci. USA 90:10613 (1993)), alphaviruses such as Semliki
Forest Virus and Sindbis Virus (Hertz and Huang, J. Vir. 66:857
(1992), Raju and Huang, J. Vir. 65:2501 (1991), and Xiong et al.,
Science 243:1188 (1989)), herpes viral vectors (e.g., U.S. Pat.
Nos. 4,769,331, 4,859,587, 5,288,641 and 5,328,688), parvovirus
vectors (Koering et al., Hum. Gene Therap. 5:457 (1994)), pox virus
vectors (Ozaki et al., Biochem. Biophys. Res. Comm. 193:653 (1993),
Panicali and Paoletti, Proc. Nat'l Acad. Sci. USA 79:4927 (1982)),
pox viruses, such as canary pox virus or vaccinia virus
(Fisher-Hoch et al., Proc. Nat'l Acad. Sci. USA 86:317 (1989), and
Flexner et al., Ann. N.Y. Acad. Sci. 569:86 (1989)), and
retroviruses (e.g., Baba et al., J. Neurosurg 79:729 (1993), Ram et
al., Cancer Res. 53:83 (1993), Takamiya et al., J. Neurosci. Res
33:493 (1992), Vile and Hart, Cancer Res. 53:962 (1993), Vile and
Hart, Cancer Res. 53:3860 (1993), and Anderson et al., U.S. Pat.
No. 5,399,346). Within various embodiments, either the viral vector
itself, or a viral particle which contains the viral vector may be
utilized in the methods and compositions described below.
[0284] As an illustration of one system, adenovirus, a
double-stranded DNA virus, is a well-characterized gene transfer
vector for delivery of a heterologous nucleic acid molecule (for a
review, see Becker et al., Meth. Cell Biol. 43:161 (1994); Douglas
and Curiel, Science & Medicine 4:44 (1997)). The adenovirus
system offers several advantages including: (i) the ability to
accommodate relatively large DNA inserts, (ii) the ability to be
grown to high-titer, (iii) the ability to infect a broad range of
mammalian cell types, and (iv) the ability to be used with many
different promoters including ubiquitous, tissue specific, and
regulatable promoters. In addition, adenoviruses can be
administered by intravenous injection, because the viruses are
stable in the bloodstream.
[0285] Using adenovirus vectors where portions of the adenovirus
genome are deleted, inserts are incorporated into the viral DNA by
direct ligation or by homologous recombination with a
co-transfected plasmid. In an exemplary system, the essential E1
gene is deleted from the viral vector, and the virus will not
replicate unless the E1 gene is provided by the host cell. When
intravenously administered to intact animals, adenovirus primarily
targets the liver. Although an adenoviral delivery system with an
E1 gene deletion cannot replicate in the host cells, the host's
tissue will express and process an encoded heterologous protein.
Host cells will also secrete the heterologous protein if the
corresponding gene includes a secretory signal sequence. Secreted
proteins will enter the circulation from tissue that expresses the
heterologous gene (e.g., the highly vascularized liver).
[0286] Moreover, adenoviral vectors containing various deletions of
viral genes can be used to reduce or eliminate immune responses to
the vector. Such adenoviruses are E1-deleted, and in addition,
contain deletions of E2A or E4 (Lusky et al., J. Virol. 72:2022
(1998); Raper et al., Human Gene Therapy 9:671 (1998)). The
deletion of E2b has also been reported to reduce immune responses
(Amalfitano et al., J. Virol. 72:926 (1998)). By deleting the
entire adenovirus genome, very large inserts of heterologous DNA
can be accommodated. Generation of so called "gutless"
adenoviruses, where all viral genes are deleted, are particularly
advantageous for insertion of large inserts of heterologous DNA
(for a review, see Yeh. and Perricaudet, FASEB J. 11:615
(1997)).
[0287] High titer stocks of recombinant viruses capable of
expressing a therapeutic gene can be obtained from infected
mammalian cells using standard methods. For example, recombinant
HSV can be prepared in Vero cells, as described by Brandt et al.,
J. Gen. Virol. 72:2043 (1991), Herold et al., J. Gen. Virol.
75:1211 (1994), Visalli and Brandt, Virology 185:419 (1991), Grau
et al., Invest. Ophthalmol. Vis. Sci. 30:2474 (1989), Brandt et
al., J. Virol. Meth. 36:209 (1992), and by Brown and MacLean
(eds.), HSV Virus Protocols (Humana Press 1997).
[0288] Alternatively, an expression vector comprising a Zkun11 gene
can be introduced into a subject's cells by lipofection in vivo
using liposomes. Synthetic cationic lipids can be used to prepare
liposomes for in vivo transfection of a gene encoding a marker
(Felgner et al., Proc. Nat'l Acad. Sci. USA 84:7413 (1987); Mackey
et al., Proc. Nat'l Acad. Sci. USA 85:8027 (1988)). The use of
lipofection to introduce exogenous genes into specific organs in
vivo has certain practical advantages. Liposomes can be used to
direct transfection to particular cell types, which is particularly
advantageous in a tissue with cellular heterogeneity, such as the
pancreas, liver, kidney, and brain. Lipids may be chemically
coupled to other molecules for the purpose of targeting. Targeted
peptides (e.g., hormones or neurotransmitters), proteins such as
antibodies, or non-peptide molecules can be coupled to liposomes
chemically.
[0289] Electroporation is another alternative mode of
administration of a Zkun11 nucleic acid molecules. For example,
Aihara and Miyazaki, Nature Biotechnology 16:867 (1998), have
demonstrated the use of in vivo electroporation for gene transfer
into muscle.
[0290] In an alternative approach to gene therapy, a therapeutic
gene may encode a Zkun11 anti-sense RNA that inhibits the
expression of Zkun11. Methods of preparing anti-sense constructs
are known to those in the art. See, for example, Erickson et al.,
Dev. Genet. 14:274 (1993) [transgenic mice], Augustine et al., Dev.
Genet. 14:500 (1993) [murine whole embryo culture], and Olson and
Gibo, Exp. Cell Res. 241:134 (1998) [cultured cells]. Suitable
sequences for Zkun11 anti-sense molecules can be derived from the
nucleotide sequences of Zkun11 disclosed herein.
[0291] Alternatively, an expression vector can be constructed in
which a regulatory element is operably linked to a nucleotide
sequence that encodes a ribozyme. Ribozymes can be designed to
express endonuclease activity that is directed to a certain target
sequence in a mRNA molecule (see, for example, Draper and Macejak,
U.S. Pat. No. 5,496,698, McSwiggen, U.S. Pat. No. 5,525,468,
Chowrira and McSwiggen, U.S. Pat. No. 5,631,359, and Robertson and
Goldberg, U.S. Pat. No. 5,225,337). In the context of the present
invention, ribozymes include nucleotide sequences that bind with
Zkun11 mRNA.
[0292] In another approach, expression vectors can be constructed
in which a regulatory element directs the production of RNA
transcripts capable of promoting RNase P-mediated cleavage of mRNA
molecules that encode a Zkun11 gene. According to this approach, an
external guide sequence can be constructed for directing the
endogenous ribozyme, RNase P, to a particular species of
intracellular mRNA, which is subsequently cleaved by the cellular
ribozyme (see, for example, Altman et al., U.S. Pat. No. 5,168,053,
Yuan et al., Science 263:1269 (1994), Pace et al., international
publication No. WO 96/18733, George et al., international
publication No. WO 96/21731, and Werner et al., international
publication No. WO 97/33991). Preferably, the external guide
sequence comprises a ten to fifteen nucleotide sequence
complementary to Zkun11 mRNA, and a 3'-NCCA nucleotide sequence,
wherein N is preferably a purine. The external guide sequence
transcripts bind to the targeted mRNA species by the formation of
base pairs between the mRNA and the complementary external guide
sequences, thus promoting cleavage of mRNA by RNase P at the
nucleotide located at the 5'-side of the base-paired region.
[0293] In general, the dosage of a composition comprising a
therapeutic vector having a Zkun11 nucleotide acid sequence, such
as a recombinant virus, will vary depending upon such factors as
the subject's age, weight, height, sex, general medical condition
and previous medical history. Suitable routes of administration of
therapeutic vectors include intravenous injection, intraarterial
injection, intraperitoneal injection, intramuscular injection,
intratumoral-injection, and injection into a cavity that contains a
tumor.
[0294] A composition comprising viral vectors, non-viral vectors,
or a combination of viral and non-viral vectors of the present
invention can be formulated according to known methods to prepare
pharmaceutically useful compositions, whereby vectors or viruses
are combined in a mixture with a pharmaceutically acceptable
carrier. As noted above, a composition, such as phosphate-buffered
saline is said to be a "pharmaceutically acceptable carrier" if its
administration can be tolerated by a recipient subject. Other
suitable carriers are well-known to those in the art (see, for
example, Remington's Pharmaceutical Sciences, 19th Ed. (Mack
Publishing Co. 1995), and Gilman's the Pharmacological Basis of
Therapeutics, 7th Ed. (MacMillan Publishing Co. 1985)).
[0295] For purposes of therapy, a therapeutic gene expression
vector, or a recombinant virus comprising such a vector, and a
pharmaceutically acceptable carrier are administered to a subject
in a therapeutically effective amount. A combination of an
expression vector (or virus) and a pharmaceutically acceptable
carrier is said to be administered in a "therapeutically effective
amount" if the amount administered is physiologically significant.
An agent is physiologically significant if its presence results in
a detectable change in the physiology of a recipient subject.
[0296] When the subject treated with a therapeutic gene expression
vector or a recombinant virus is a human, then the therapy is
preferably somatic cell gene therapy. That is, the preferred
treatment of a human with a therapeutic gene expression vector or a
recombinant virus does not entail introducing into cells a nucleic
acid molecule that can form part of a human germ line and be passed
onto successive generations (i.e., human germ line gene
therapy).
[0297] 14. Production of Transgenic Mice
[0298] Transgenic mice can be engineered to over-express the Zkun11
gene in all tissues or under the control of a tissue-specific or
tissue-preferred regulatory element. These over-producers of Zkun11
can be used to characterize the phenotype that results from
over-expression, and the transgenic animals can serve as models for
human disease caused by excess Zkun11. Transgenic mice that
over-express Zkun11 also provide model bioreactors for production
of Zkun11 in the milk or blood of larger animals. Methods for
producing transgenic mice are well-known to those of skill in the
art (see, for example, Jacob, "Expression and Knockout of
Interferons in Transgenic Mice," in Overexpression and Knockout of
Cytokines in Transgenic Mice, Jacob (ed.), pages 111-124 (Academic
Press, Ltd. 1994), Monastersky and Robl (eds.), Strategies in
Transgenic Animal Science (ASM Press 1995), and Abbud and Nilson,
"Recombinant Protein Expression in Transgenic Mice," in Gene
Expression Systems: Using Nature for the Art of Expression,
Fernandez and Hoeffler (eds.), pages 367-397 (Academic Press, Inc.
1999)).
[0299] For example, a method for producing a transgenic mouse that
expresses a Zkun11 gene can begin with adult, fertile males (studs)
(B6C3f1, 2-8 months of age (Taconic Farms, Germantown, N.Y.)),
vasectomized males (duds) (B6D2f1, 2-8 months, (Taconic Farms)),
prepubescent fertile females (donors) (B6C3f1, 4-5 weeks, (Taconic
Farms)) and adult fertile females (recipients) (B6D2f1, 2-4 months,
(Taconic Farms)). The donors are acclimated for one week and then
injected with approximately 8 IU/mouse of Pregnant Mare's Serum
gonadotrophin (Sigma Chemical Company; St. Louis, Mo.) I.P., and
46-47 hours later, 8 IU/mouse of human Chorionic Gonadotropin (hCG
(Sigma)) I.P. to induce superovulation. Donors are mated with studs
subsequent to hormone injections. Ovulation generally occurs within
13 hours of hCG injection. Copulation is confirmed by the presence
of a vaginal plug the morning following mating.
[0300] Fertilized eggs are collected under a surgical scope. The
oviducts are collected and eggs are released into urinanalysis
slides containing hyaluronidase (Sigma). Eggs are washed once in
hyaluronidase, and twice in Whitten's W640 medium (described, for
example, by Menino and O'Claray, Biol. Reprod. 77:159 (1986), and
Dienhart and Downs, Zygote 4:129 (1996)) that has been incubated
with 5% CO.sub.2, 5% O.sub.2, and 90% N.sub.2 at 37.degree. C. The
eggs are then stored in a 37.degree. C./5% CO.sub.2 incubator until
microinjection.
[0301] Ten to twenty micrograms of plasmid DNA containing a Zkun11
encoding sequence is linearized, gel-purified, and resuspended in
10 mM Tris-HCl (pH 7.4), 0.25 mM EDTA (pH 8.0), at a final
concentration of 5-10 nanograms per microliter for microinjection.
For example, the Zkun11 encoding sequences can encode the amino
acid residues of SEQ ID NO:2.
[0302] Plasmid DNA is microinjected into harvested eggs contained
in a drop of W640 medium overlaid by warm, CO.sub.2-equilibrated
mineral oil. The DNA is drawn into an injection needle (pulled from
a 0.75 mm ID, 1 mm OD borosilicate glass capillary), and injected
into individual eggs. Each egg is penetrated with the injection
needle, into one or both of the haploid pronuclei.
[0303] Picoliters of DNA are injected into the pronuclei, and the
injection needle withdrawn without coming into contact with the
nucleoli. The procedure is repeated until all the eggs are
injected. Successfully microinjected eggs are transferred into an
organ tissue-culture dish with pre-gassed W640 medium for storage
overnight in a 37.degree. C./5% CO.sub.2 incubator.
[0304] The following day, two-cell embryos are transferred into
pseudopregnant recipients. The recipients are identified by the
presence of copulation plugs, after copulating with vasectomized
duds. Recipients are anesthetized and shaved on the dorsal left
side and transferred to a surgical microscope. A small incision is
made in the skin and through the muscle wall in the middle of the
abdominal area outlined by the ribcage, the saddle, and the hind
leg, midway between knee and spleen. The reproductive organs are
exteriorized onto a small surgical drape. The fat pad is stretched
out over the surgical drape, and a baby serrefine (Roboz,
Rockville, Md.) is attached to the fat pad and left hanging over
the back of the mouse, preventing the organs from sliding back
in.
[0305] With a fine transfer pipette containing mineral oil followed
by alternating W640 and air bubbles, 12-17 healthy two-cell embryos
from the previous day's injection are transferred into the
recipient. The swollen ampulla is located and holding the oviduct
between the ampulla and the bursa, a nick in the oviduct is made
with a 28 g needle close to the bursa, making sure not to tear the
ampulla or the bursa.
[0306] The pipette is transferred into the nick in the oviduct, and
the embryos are blown in, allowing the first air bubble to escape
the pipette. The fat pad is gently pushed into the peritoneum, and
the reproductive organs allowed to slide in. The peritoneal wall is
closed with one suture and the skin closed with a wound clip. The
mice recuperate on a 37.degree. C. slide warmer for a minimum of
four hours.
[0307] The recipients are returned to cages in pairs, and allowed
19-21 days gestation. After birth, 19-21 days postpartum is allowed
before weaning. The weanlings are sexed and placed into separate
sex cages, and a 0.5 cm biopsy (used for genotyping) is snipped off
the tail with clean scissors.
[0308] Genomic DNA is prepared from the tail snips using, for
example, a QIAGEN DNEASY kit following the manufacturer's
instructions. Genomic DNA is analyzed by PCR using primers designed
to amplify a Zkun11 gene or a selectable marker gene that was
introduced in the same plasmid. After animals are confirmed to be
transgenic, they are back-crossed into an inbred strain by placing
a transgenic female with a wild-type male, or a transgenic male
with one or two wild-type female(s). As pups are born and weaned,
the sexes are separated, and their tails snipped for
genotyping.
[0309] To check for expression of a transgene in a live animal, a
partial hepatectomy is performed. A surgical prep is made of the
upper abdomen directly below the zyphoid process. Using sterile
technique, a small 1.5-2 cm incision is made below the sternum and
the left lateral lobe of the liver exteriorized. Using 4-0 silk, a
tie is made around the lower lobe securing it outside the body
cavity. An atraumatic clamp is used to hold the tie while a second
loop of absorbable Dexon (American Cyanamid; Wayne, N.J.) is placed
proximal to the first tie. A distal cut is made from the Dexon tie
and approximately 100 mg of the excised liver tissue is placed in a
sterile petri dish. The excised liver section is transferred to a
14 ml polypropylene round bottom tube and snap frozen in liquid
nitrogen and then stored on dry ice. The surgical site is closed
with suture and wound clips, and the animal's cage placed on a
37.degree. C. heating pad for 24 hours post operatively. The animal
is checked daily post operatively and the wound clips removed 7-10
days after surgery. The expression level of Zkun11 mRNA is examined
for each transgenic mouse using an RNA solution hybridization assay
or polymerase chain reaction.
[0310] In addition to producing transgenic mice that over-express
Zkun11, it is useful to engineer transgenic mice with either
abnormally low or no expression of the gene. Such transgenic mice
provide useful models for diseases associated with a lack of
Zkun11. As discussed above, Zkun11 gene expression can be inhibited
using antisense genes, ribozyme genes, or external guide sequence
genes. To produce transgenic mice that under-express the Zkun11
gene, such inhibitory sequences are targeted to Zkun11 mRNA.
Methods for producing transgenic mice that have abnormally low
expression of a particular gene are known to those in the art (see,
for example, Wu et al., "Gene Underexpression in Cultured Cells and
Animals by Antisense DNA and RNA Strategies," in Methods in Gene
Biotechnology, pages 205-224 (CRC Press 1997)).
[0311] An alternative approach to producing transgenic mice that
have little or no Zkun11 gene expression is to generate mice having
at least one normal Zkun11 allele replaced by a nonfunctional
Zkun11 gene. One method of designing a nonfunctional Zkun11 gene is
to insert another gene, such as a selectable marker gene, within a
nucleic acid molecule that encodes Zkun11. Standard methods for
producing these so-called "knockout mice" are known to those
skilled in the art (see, for example, Jacob, "Expression and
Knockout of Interferons in Transgenic Mice," in Overexpression and
Knockout of Cytokines in Transgenic Mice, Jacob (ed.), pages
111-124 (Academic Press, Ltd. 1994), and Wu et al., "New Strategies
for Gene Knockout," in Methods in Gene Biotechnology, pages 339-365
(CRC Press 1997)).
[0312] The present invention, thus generally described, will be
understood more readily by reference to the following example,
which is provided by way of illustration and is not intended to be
limiting of the present invention.
EXAMPLE 1
Expression of the Zkun11 Gene
[0313] A panel of cDNA molecules from human tissues was screened
for Zkun11 expression using PCR. The panel included 78 marathon
cDNA and cDNA samples from various normal and cancerous human
tissues and cell lines. The marathon cDNA molecules were produced
using the MARATHON-READY kit (CLONTECH Laboratories, Inc.; Palo
Alto, Calif.) and quality control tested with clathrin primers
ZC21195 (5' GAGGAGACCATAACCCCCGACAG 3'; SEQ ID NO:6) and ZC21196
(5' CATAGCTCCCACCACACGATTTT 3'; SEQ ID NO:7), and then diluted
based on the intensity of the clathrin band.
[0314] To assure quality of the panel samples, three tests for
quality control were run. First, to assess the RNA quality used for
the libraries, the cDNA molecules were tested for average insert
size by PCR with vector oligonucleotides that were specific for the
vector sequences for an individual cDNA library. Second,
standardization of the concentration of the cDNA in panel samples
was achieved using standard PCR methods to amplify full length
alpha tubulin or G3PDH cDNA using a 5' vector oligonucleotide
ZC14063 (5' CACCAGACATAATAGCTGACAGACT 3'; SEQ ID NO:8) and 3' alpha
tubulin specific oligo primer ZC17574 (5' GGTRTTGCTCAGCATGCACAC 3';
SEQ ID NO:9) or 3' G3PDH specific oligonucleotide primer ZC17600
(5' CATGTAGGCCATGAGGTCCACCAC 3'; SEQ ID NO:10). Third, a sample was
sequenced to check for possible ribosomal or mitochondrial DNA
contamination.
[0315] The panel was set up in a 96-well format that included a
human genomic DNA (CLONTECH; Palo Alto, Calif.) positive control
sample. Each well contained approximately 0.2-100 pg/.mu.l of cDNA.
To amplify Zkun11 sequences, the PCR reactions were set up using
oligonucleotides ZC37136 (5' CCTCTGAAGAAGGGCACCTGTAAT 3'; SEQ ID
NO:11) and ZC37138 (5'GCCTCCACAGCCACTGAAGACA 3'; SEQ ID NO:12),
TAKARA EX TAQ (Takara Shuzo Co. Ltd.; Nagoya, Japan), and Rediload
dye (Research Genetics, Inc.; Huntsville, Ala.). The amplification
was carried out as follows: 1 cycle at 94.degree. C. for 2 minutes,
35 cycles of 94.degree. C. for 30 seconds, 63.1.degree. C. for 30
seconds and 72.degree. C. for 30 seconds, followed by 1 cycle at
72.degree. C. for 5 minutes. About 10 .mu.l of the PCR reaction
product was fractionated using standard agarose gel electrophoresis
in a 4% agarose gel. The predicted DNA fragment size of about 99
base pairs was observed in genomic and prostate samples. In
contrast, expression products were not detected using the following
tissues: adrenal gland, bladder, bone marrow, cervix, colon,
kidney, liver, lung, lymph node, mammary gland, ovary, pituitary,
placenta, rectum, spleen, stomach, and testis.
[0316] The DNA fragments from genomic and prostate samples were
excised and purified using a Gel Extraction Kit (QIAGEN;
Chatsworth, Calif.) according to manufacturer's instructions.
Fragments were confirmed by sequencing to show that they were
indeed Zkun11 sequences.
[0317] From the foregoing, it will be appreciated that, although
specific embodiments of the invention have been described herein
for purposes of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
Accordingly, the invention is not limited except as by the appended
claims.
Sequence CWU 1
1
12 1 153 DNA Homo sapiens CDS (1)...(153) 1 tgc aac tat cct ctg aag
aag ggc acc tgt aat tca tat ttg acc aga 48 Cys Asn Tyr Pro Leu Lys
Lys Gly Thr Cys Asn Ser Tyr Leu Thr Arg 1 5 10 15 ttc tac tac aac
act ttg aca ttt tta tgt gag ccc ttt gtc ttc agt 96 Phe Tyr Tyr Asn
Thr Leu Thr Phe Leu Cys Glu Pro Phe Val Phe Ser 20 25 30 ggc tgt
gga ggc aac aga aac aac ttt aaa cag aaa tat ttc tgt gaa 144 Gly Cys
Gly Gly Asn Arg Asn Asn Phe Lys Gln Lys Tyr Phe Cys Glu 35 40 45
aaa atg tgt 153 Lys Met Cys 50 2 51 PRT Homo sapiens 2 Cys Asn Tyr
Pro Leu Lys Lys Gly Thr Cys Asn Ser Tyr Leu Thr Arg 1 5 10 15 Phe
Tyr Tyr Asn Thr Leu Thr Phe Leu Cys Glu Pro Phe Val Phe Ser 20 25
30 Gly Cys Gly Gly Asn Arg Asn Asn Phe Lys Gln Lys Tyr Phe Cys Glu
35 40 45 Lys Met Cys 50 3 153 DNA Artificial Sequence This
degenerate nucleotide sequence encodes the amino acid sequence of
SEQ ID NO2. 3 tgyaaytayc cnytnaaraa rggnacntgy aaywsntayy
tnacnmgntt ytaytayaay 60 acnytnacnt tyytntgyga rccnttygtn
ttywsnggnt gyggnggnaa ymgnaayaay 120 ttyaarcara artayttytg
ygaraaratg tgy 153 4 16 PRT Artificial Sequence Peptide linker. 4
Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5
10 15 5 51 PRT Artificial Sequence motif. 5 Cys Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Xaa Cys
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa 35 40 45
Xaa Xaa Cys 50 6 23 DNA Artificial Sequence PCR primer. 6
gaggagacca taacccccga cag 23 7 23 DNA Artificial Sequence PCR
primer. 7 catagctccc accacacgat ttt 23 8 25 DNA Artificial Sequence
PCR primer. 8 caccagacat aatagctgac agact 25 9 21 DNA Artificial
Sequence PCR primer. 9 ggtrttgctc agcatgcaca c 21 10 24 DNA
Artificial Sequence PCR primer. 10 catgtaggcc atgaggtcca ccac 24 11
24 DNA Artificial Sequence PCR primer. 11 cctctgaaga agggcacctg
taat 24 12 22 DNA Artificial Sequence PCR primer. 12 gcctccacag
ccactgaaga ca 22
* * * * *