U.S. patent application number 10/244065 was filed with the patent office on 2003-05-29 for packaging of immunostimulatory substances into virus-like particles: method of preparation and use.
This patent application is currently assigned to Cytos Biotechnology AG. Invention is credited to Bachmann, Martin, Cielens, Indulis, Lipowsky, Gerd, Maurer, Patrik, Meijerink, Edwin, Pumpens, Paul, Renhofa, Regina, Schwarz, Katrin, Storni, Tazio, Tissot, Alain.
Application Number | 20030099668 10/244065 |
Document ID | / |
Family ID | 26981773 |
Filed Date | 2003-05-29 |
United States Patent
Application |
20030099668 |
Kind Code |
A1 |
Bachmann, Martin ; et
al. |
May 29, 2003 |
Packaging of immunostimulatory substances into virus-like
particles: method of preparation and use
Abstract
The invention relates to the finding that virus like particles
(VLPs) can be loaded with immunostimulatory substances, in
particular with DNA oligonucleotides containing non-methylated C
and G (CpGs). Such CpG-VLPs are dramatically more immunogenic than
their CpG-free counterparts and induce enhanced B and T cell
responses. The immune response against antigens optionally coupled,
fused or attached otherwise to the VLPs is similarly enhanced as
the immune response against the VLP itself. In addition, the T cell
responses against both the VLPs and antigens are especially
directed to the Th1 type. Antigens attached to CpG-loaded VLPs may
therefore be ideal vaccines for prophylactic or therapeutic
vaccination against allergies, tumors and other self-molecules and
chronic viral diseases.
Inventors: |
Bachmann, Martin;
(Winterthur, CH) ; Storni, Tazio; (Viganello,
CH) ; Maurer, Patrik; (Winterthur, CH) ;
Tissot, Alain; (Zurich, CH) ; Schwarz, Katrin;
(Schlieren, CH) ; Meijerink, Edwin; (Zurich,
CH) ; Lipowsky, Gerd; (Zurich, CH) ; Pumpens,
Paul; (Riga, LV) ; Cielens, Indulis; (Riga,
LV) ; Renhofa, Regina; (Riga, LV) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W., SUITE 600
WASHINGTON
DC
20005-3934
US
|
Assignee: |
Cytos Biotechnology AG
|
Family ID: |
26981773 |
Appl. No.: |
10/244065 |
Filed: |
September 16, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60318994 |
Sep 14, 2001 |
|
|
|
60374145 |
Apr 22, 2002 |
|
|
|
Current U.S.
Class: |
424/204.1 ;
514/19.3; 514/292; 514/3.7; 514/4.3; 514/42; 514/44A; 514/54 |
Current CPC
Class: |
A61P 31/06 20180101;
A61P 31/18 20180101; A61P 33/04 20180101; A61P 35/00 20180101; C12N
2795/18122 20130101; A61P 31/12 20180101; A61K 39/001104 20180801;
C12N 2710/22022 20130101; A61K 2039/55555 20130101; C07K 14/005
20130101; C12N 2710/22023 20130101; A61K 2039/57 20130101; A61K
39/001171 20180801; A61K 39/001191 20180801; A61P 33/06 20180101;
A61P 31/04 20180101; A61K 39/001106 20180801; A61K 39/001182
20180801; A61K 39/001186 20180801; A61K 39/39 20130101; C12N 7/00
20130101; A61P 37/02 20180101; A61P 31/22 20180101; A61K 39/001129
20180801; A61K 39/12 20130101; Y02A 50/30 20180101; A61K 39/001156
20180801; A61K 2039/5258 20130101; A61K 39/001151 20180801; A61K
2039/55561 20130101; A61K 2039/6075 20130101; A61P 31/16 20180101;
A61P 31/20 20180101; A61K 39/0011 20130101; A61P 33/00 20180101;
C07K 2319/00 20130101; C12N 2730/10123 20130101; A61K 39/02
20130101; A61P 37/08 20180101; C12N 2795/00034 20130101; A61K
39/001192 20180801; A61P 35/02 20180101; A61P 37/04 20180101; A61K
39/00 20130101; C12N 2730/10122 20130101; A61K 2039/52
20130101 |
Class at
Publication: |
424/204.1 ;
514/42; 514/12; 514/54; 514/8; 514/44; 514/292 |
International
Class: |
A61K 039/12; A61K
038/17; A61K 038/14; A61K 048/00; A61K 031/739; A61K 031/4745 |
Claims
What is claimed is:
1. A composition for enhancing an immune response in an animal
comprising: (a) a virus-like particle; and (b) an immunostimulatory
substance; wherein said immunostimulatory substance is bound to
said virus-like particle.
2. The composition of claim 1 further comprising at least one
antigen, wherein said antigen is bound to said virus-like
particle.
3. The composition of claim 1, wherein said immunostimulatory
substance is a toll-like receptor activating substance.
4. The composition of claim 1, wherein said immunostimulatory
substance is a cytokine secretion inducing substance.
5. The composition of claim 3, wherein said toll-like receptor
activating substance is selected from the group consisting of, or
alternatively consists essentially of: (a) immunostimulatory
nucleic acids; (b) peptidoglycans; (c) lipopolysaccharides; (d)
lipoteichonic acids; (e) imidazoquinoline compounds; (f)
flagellines; (g) lipoproteins; (h) immunostimulatory organic
molecules; (i) unmethylated CpG-containing oligonucleotides; and
(j) any mixtures of at least one substance of (a), (b), (c), (d),
(e), (f), (g), (h) and/or (i).
6. The composition of claim 5, wherein said immunostimulatory
nucleic acid is selected from the group consisting of, or
alternatively consists essentially of: (a) ribonucleic acids; (b)
deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any
mixtures of at least one nucleic acid of (a), (b) and/or (c).
7. The composition of claim 6, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
8. The composition of claim 6, wherein said deoxyribonucleic acid
is selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
9. The composition of claim 1, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
10. The composition of claim 1, wherein said virus-like particle
lacks a lipoprotein-containing envelope.
11. The composition of claim 1, wherein said virus-like particle is
a recombinant virus-like particle.
12. The composition of claim 11, wherein said virus-like particle
is selected from the group consisting of: (a) recombinant proteins
of Hepatitis B virus; (b) recombinant proteins of measles virus;
(c) recombinant proteins of Sinbis virus; (d) recombinant proteins
of Rotavirus; (e) recombinant proteins of Foot-and-Mouth-Disease
virus; (f) recombinant proteins of Retrovirus; (g) recombinant
proteins of Norwalk virus; (h) recombinant proteins of human
Papilloma virus; (i) recombinant proteins of BK virus; (j)
recombinant proteins of bacteriophages; (k) recombinant proteins of
RNA-phages; (1) recombinant proteins of Q.beta.-phage; (m)
recombinant proteins of GA-phage (n) recombinant proteins of
fr-phage; (o) recombinant proteins of AP 205-phage; (p) recombinant
proteins of Ty; and (q) fragments of any of the recombinant
proteins from (a) to (p).
13. The composition of claim 12, wherein said virus-like particle
is the Hepatitis B virus core protein.
14. The composition of claim 12, wherein said virus-like particle
is the BK virus VP 1 protein.
15. The composition of claim 1, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of a
RNA-phage.
16. The composition of claim 15, wherein said RNA-phage is selected
from the group consisting of: (a) bacteriophage Q.beta.; (b)
bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e)
bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h)
bacteriophage MX1; (i) bacteriophage NL95; (k) bacteriophage f2;
(1) bacteriophage PP7; and (m) bacteriophage AP205.
17. The composition of claim 1, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of RNA-phage
Q.beta..
18. The composition of claim 1, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of RNA-phage
AP 205.
19. The composition of claim 9, wherein said unmethylated
CpG-containing oligonucleotide comprises the sequence:
X.sub.1X.sub.2CGX.sub.3X.sub.43'w- herein X.sub.1, X.sub.2,
X.sub.3, and X.sub.4 are any nucleotide.
20. The composition of claim 19, wherein at least one of said
nucleotide X.sub.1, X.sub.2, X.sub.3, and X.sub.4 has a phosphate
backbone modification.
21. The composition of claim 9, wherein said unmethylated
CpG-containing oligonucleotide comprises, or alternatively consists
essentially of, or alternatively consists of the sequence selected
from the group consisting of: (a) TCCATGACGTTCCTGAATAAT; (b)
TCCATGACGTTCCTGACGTT; (c) GGGGTCAACGTTGAGGGGG; (d)
GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and (e) "dsCyCpG-253" as described
in Table 1.
22. The composition of claim 21, wherein said unmethylated
CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
23. The composition of claim 9, wherein said unrmethylated
CpG-containing oligonucleotide is palindromic.
24. The composition of claim 23, wherein said palindromic
unmethylated CpG-containing oligonucleotide comprises, or
alternatively consists essentially of, or alternatively consists of
the sequence GGGGTCAACGTTGAGGGGG.
25. The composition of claim 24, wherein said palindromic
unmethylated CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
26. The composition of claim 1, wherein said immunostimulatory
substance is non-covalently bound to said virus-like particle.
27. The composition of claim 9, wherein said unmethylated
CpG-containing oligonucleotide is non-covalently bound to said
virus-like particle.
28. The composition of claim 5, wherein said immunostimulatory
nucleic acid is bound to a virus-like particle site selected from
the group consisting of an oligonucleotide binding site, a DNA
binding site and a RNA binding site.
29. The composition of claim 9, wherein said unmethylated
CpG-containing oligonucleotide is bound to a virus-like particle
site selected from the group consisting of an oligonucleotide
binding site, a DNA binding site and a RNA binding site.
30. The composition of claim 29, wherein said oligonucleotide
binding site is a non-naturally occurring oligonucleotide binding
site.
31. The composition of claim 29, wherein said virus-like particle
site comprises an arginine-rich repeat.
32. The composition of claim 5, wherein said immunostimulatory
nucleic acid contains one or more phosphorothioate modifications of
the phosphate backbone or wherein each phosphate moiety of said
phosphate backbone of said oligonucleotide is a phosphorothioate
modification.
33. The composition of claim 9, wherein said unmethylated
CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
34. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 6 to about 100,000 nucleotides.
35. The composition of claim 34, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 6 to about 2000 nucleotides.
36. The composition of claim 35, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 20 to about 2000 nucleotides.
37. The composition of claim 36, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 20 to about 300 nucleotides.
38. The composition of claim 37, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises 20 to 100 nucleotides.
39. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 2000
nucleotides.
40. The composition of claim 39, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 1000
nucleotides.
41. The composition of claim 40, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 500
nucleotides.
42. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a recombinant oligonucleotide.
43. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a genomic oligonucleotide.
44. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a synthetic oligonucleotide.
45. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a plasmid-derived oligonucleotide.
46. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a single-stranded oligonucleotide.
47. The composition of claim 5, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide is a double-stranded oligonucleotide.
48. The composition of claim 2, wherein said at least one antigen
or antigenic determinant is bound to said virus-like particle by at
least one covalent bond.
49. The composition of claim 2, wherein said at least one antigen
or antigenic determinant is bound to said virus-like particle by at
least one covalent bond, and wherein said covalent bond is a
non-peptide bond.
50. The composition of claim 2, wherein said at least one antigen
or antigenic determinant is fused to said virus-like particle.
51. The composition of claim 2, wherein said antigen or antigenic
determinant further comprises at least one second attachment site
being selected from the group consisting of: (a) an attachment site
not naturally occurring with said antigen or antigenic determinant;
and (b) an attachment site naturally occurring with said antigen or
antigenic determinant.
52. The composition of claim 2 further comprising an amino acid
linker, wherein said amino acid linker comprises, or alternatively
consists of, said second attachment site.
53. The composition of claim 2, wherein said antigen is selected
from the group consisting of: (a) polypeptides; (b) carbohydrates;
(c) steroid hormones; and (d) organic molecules.
54. The composition of claim 53, wherein said antigen is an organic
molecule.
55. The composition of claim 54, wherein said organic molecule is
selected from the group consisting of: (a) codeine; (b) fentanyl;
(c) heroin; (d) morphium; (e) amphetamine; (f) cocaine; (g)
methylenedioxymethamphetamine- ; (h) methamphetamine; (i)
methylphenidate; (j) nicotine; (k) LSD; (l) mescaline; (m)
psilocybin; and (n) tetrahydrocannabinol.
56. The composition of claim 2, wherein said antigen is a
recombinant antigen.
57. The composition of claim 2, wherein said antigen is derived
from the group consisting of: (a) viruses; (b) bacteria; (c)
parasites; (d) prions; (e) tumors; (f) self-molecules; (g)
non-peptidic hapten molecules (h) allergens; and (i) hormones.
58. The composition of claim 57, wherein said antigen is a tumor
antigen.
59. The composition of claim 58, wherein said tumor antigen is
selected from the group consisting of: (a) Her2; (b) GD2; (c)
EGF-R; (d) CEA; (e) CD52; (f) CD21; (g) human melanoma protein
gp100; (h) human melanoma protein melan-A/MART-1; (i) tyrosinase;
(j) NA 17-A nt protein; (k) MAGE-3 protein; (l) p53 protein; (m)
HPV16 E7 protein; and (n) antigenic fragments of any of the tumor
antigens from (a) to (m).
60. The composition of claim 2, wherein said antigen is bound to
said virus-like particle by way of a linking sequence.
61. The composition of claim 60, wherein said virus-like particle
is the Hepatitis B virus core protein.
62. The composition of claim 60, wherein said virus-like particle
is the BK virus core protein.
63. The composition of claim 2, wherein said antigen is a cytotoxic
T cell epitope, a Th cell epitope or a combination of at least two
of said epitopes, wherein said at least two epitopes are bound
directly or by way of a linking sequence.
64. The composition of claim 63, wherein said cytotoxic T cell
epitope is a viral or a tumor cytotoxic T cell epitope.
65. The composition of claim 63, wherein said antigen is bound to
said virus-like particle by way of a linking sequence.
66. The composition of claim 63, wherein said virus-like particle
is the Hepatitis B virus core protein.
67. The composition of claim 66, wherein said cytotoxic T cell
epitope is fused to the C-terminus of said Hepatitis B virus core
protein.
68. The composition of claim 67, wherein said cytotoxic T cell
epitope is fused to the C-terminus of said Hepatitis B virus core
protein by way of a linking sequence.
69. The composition of claim 63, wherein said virus-like particle
is the BK virus VP 1 protein.
70. The composition of claim 69, wherein said cytotoxic T cell
epitope is fused to the C-terminus of said BK virus VP1
protein.
71. The composition of claim 70, wherein said cytotoxic T cell
epitope is fused to the C-terminus of said BK virus VP1 protein by
way of a linking sequence.
72. A method for enhancing an immune response in an animal
comprising introducing into said animal a composition comprising:
(a) a virus-like particle; and (b) an immunostimulatory substance;
wherein said immunostimulatory substance is bound to said
virus-like particle.
73. The method of claim 72, wherein said composition further
comprises an antigen, wherein said antigen is bound to said
virus-like particle.
74. The method of claim 72, wherein said immunostimulatory
substance is a toll-like receptor activating substance.
75. The method of claim 72, wherein said immunostimulatory
substance is a cytokine secretion inducing substance.
76. The method of claim 74, wherein said toll-like receptor
activating substance is selected from the group consisting of, or
alternatively consists essentially of: (a) immunostimulatory
nucleic acids; (b) peptidoglycans; (c) lipopolysaccharides; (d)
lipoteichonic acids; (e) imidazoquinoline compounds; (f)
flagellines; (g) lipoproteins; (h) immunostimulatory organic
molecules; (i) unmethylated CpG-containing oligonucleotides; and
(j) any mixtures of at least one substance of (a), (b), (c), (d),
(e), (f), (g), (h) and/or (i).
77. The method of claim 76, wherein said immunostimulatory nucleic
acid is selected from the group consisting of, or alternatively
consists essentially of: (a) ribonucleic acids; (b)
deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any
mixtures of at least one nucleic acid of (a), (b) and/or (c).
78. The method of claim 77, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
79. The method of claim 77, wherein said deoxyribonucleic acid is
selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
80. The method of claim 72, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
81. The method of claim 72, wherein said virus-like particle lacks
a lipoprotein-containing envelope.
82. The method of claim 72, wherein said virus-like particle is a
recombinant virus-like particle.
83. The method of claim 82, wherein said virus-like particle is
selected from the group consisting of: (a) recombinant proteins of
Hepatitis B virus; (b) recombinant proteins of measles virus; (c)
recombinant proteins of Sinbis virus; (d) recombinant proteins of
Rotavirus; (e) recombinant proteins of Foot-and-Mouth-Disease
virus; (f) recombinant proteins of Retrovirus; (g) recombinant
proteins of Norwalk virus; (h) recombinant proteins of human
Papilloma virus; (i) recombinant proteins of BK virus; (j)
recombinant proteins of bacteriophages; (k) recombinant proteins of
RNA-phages; (l) recombinant proteins of Q.beta.-phage; (m)
recombinant proteins of GA-phage; (n) recombinant proteins of
fr-phage; (o) recombinant proteins of AP 205-phage; (p) recombinant
proteins of Ty; and (q) fragments of any of the recombinant
proteins from (a) to (p).
84. The method of claim 83, wherein said virus-like particle is the
Hepatitis B virus core protein.
85. The method of claim 83, wherein said virus-like particle is the
BK virus VP 1 protein.
86. The method of claim 72, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of a
RNA-phage.
87. The method of claim 86, wherein said RNA-phage is selected from
the group consisting of: (a) bacteriophage Q.beta.; (b)
bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e)
bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h)
bacteriophage MX1; (i) bacteriophage NL95; (k) bacteriophage f2;
(l) bacteriophage PP7; and (m) bacteriophage AP205.
88. The method of claim 72, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of RNA-phage
Q.beta..
89. The method of claim 72, wherein said virus-like particle
comprises recombinant proteins, or fragments thereof, of RNA-phage
AP 205.
90. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide comprises the sequence:
5'X.sub.1X.sub.2CGX.sub.3X.sub.4 3'wherein X.sub.1, X.sub.2,
X.sub.3, and X.sub.4 are any nucleotide.
91. The method of claim 90, wherein at least one of said nucleotide
X.sub.1, X.sub.2, X.sub.3, and X.sub.4 has a phosphate backbone
modification.
92. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide comprises, or alternatively consists
essentially of, or alternatively consists of the sequence selected
from the group consisting of: (a) TCCATGACGTTCCTGAATAAT; (b)
TCCATGACGTTCCTGACGTT; (c) GGGGTCAACGTTGAGGGGG; (d)
GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and (e) "dsCyCpG-253" as described
in Table 1.
93. The method of claim 92, wherein said unmethylated
CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
94. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide is palindromic.
95. The method of claim 94, wherein said palindromic unmethylated
CpG-containing oligonucleotide comprises, or alternatively consists
essentially of, or alternatively consists of the sequence
GGGGTCAACGTTGAGGGGG.
96. The method of claim 95, wherein said palindromic unmethylated
CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
97. The method of claim 72, wherein said immunostimulatory
substance is non-covalently bound to said virus-like particle.
98. The method of claim 72, wherein said virus-like particle is
produced in a bacterial expression system.
99. The method of claim 72, wherein said virus-like particle is
produced in a yeast expression system.
100. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide is non-covalently bound to said
virus-like particle.
101. The method of claim 72, wherein said immunostimulatory
substance is packaged, preferably enclosed by said virus-like
particle.
102. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide is packaged, preferably enclosed by
said virus-like particle.
103. The method of claim 76, wherein said immunostimulatory nucleic
acid is bound to a virus-like particle site selected from the group
consisting of an oligonucleotide binding site, a DNA binding site
and a RNA binding site
104. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide is bound to a virus-like particle
site selected from the group consisting of an oligonucleotide
binding site, a DNA binding site and a RNA binding site.
105. The method of claim 104, wherein said oligonucleotide binding
site is a non-naturally occurring oligonucleotide binding site.
106. The method of claim 104, wherein said virus-like particle site
comprises an arginine-rich repeat.
107. The method of claim 76, wherein said immunostimulatory nucleic
acid contains one or more phosphorothioate modifications of the
phosphate backbone or wherein each phosphate moiety of said
phosphate backbone of said oligonucleotide is a phosphorothioate
modification.
108. The method of claim 80, wherein said unmethylated
CpG-containing oligonucleotide contains one or more
phosphorothioate modifications of the phosphate backbone or wherein
each phosphate moiety of said phosphate backbone of said
oligonucleotide is a phosphorothioate modification.
109. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 6 to about 100,000 nucleotides.
110. The method of claim 109, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 6 to about 2000 nucleotides.
111. The method of claim 110, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 20 to about 2000 nucleotides.
112. The method of claim 111, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises about 20 to about 300 nucleotides.
113. The method of claim 112, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises 20 to 100 nucleotides.
114. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 2000
nucleotides.
115. The method of claim 114, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 1000
nucleotides.
116. The method of claim 115, wherein said immunostimulatory
nucleic acid, and preferably said unmethylated CpG-containing
oligonucleotide comprises more than 100 to about 500
nucleotides.
117. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a recombinant oligonucleotide.
118. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a genomic oligonucleotide.
119. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a synthetic oligonucleotide.
120. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a plasmid-derived oligonucleotide.
121. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a single-stranded oligonucleotide.
122. The method of claim 76, wherein said immunostimulatory nucleic
acid, and preferably said unmethylated CpG-containing
oligonucleotide is a double-stranded oligonucleotide.
123. The method of claim 73, wherein said at least one antigen or
antigenic determinant is bound to said virus-like particle by at
least one covalent bond.
124. The method of claim 73, wherein said at least one antigen or
antigenic determinant is bound to said virus-like particle by at
least one covalent bond, and wherein said covalent bond is a
non-peptide bond.
125. The method of claim 73, wherein said at least one antigen or
antigenic determinant is fused to said virus-like particle.
126. The method of claim 73, wherein said antigen or antigenic
determinant further comprises at least one second attachment site
selected from the group consisting of: (a) an attachment site not
naturally occurring with said antigen or antigenic determinant; and
(b) an attachment site naturally occurring with said antigen or
antigenic determinant.
127. The method of claim 73, further comprising an amino acid
linker, wherein said amino acid linker comprises, or alternatively
consists of, said second attachment site.
128. The method of claim 73, wherein said antigen is selected from
the group consisting of: (a) polypeptides; (b) carbohydrates; (c)
steroid hormones; and (d) organic molecules.
129. The method of claim 128, wherein said antigen is an organic
molecule.
130. The method of claim 129, wherein said organic molecule is
selected from the group consisting of: (a) codeine; (b) fentanyl;
(c) heroin; (d) morphium; (e) amphetamine; (f) cocaine; (g)
methylenedioxymethamphetamine- ; (h) methamphetamine; (i)
methylphenidate; (j) nicotine; (k) LSD; (l) mescaline; (m)
psilocybin; and (n) tetrahydrocannabinol.
131. The method of claim 73, wherein said antigen is a recombinant
antigen.
132. The method of claim 73, wherein said antigen is derived from
the group consisting of: (a) viruses; (b) bacteria; (c) parasites;
(d) prions; (e) tumors; (f) self-molecules; (g) non-peptidic hapten
molecules (h) allergens; and (i) hormones.
133. The method of claim 132, wherein said antigen is a tumor
antigen.
134. The method of claim 133, wherein said tumor antigen is
selected from the group consisting of: (a) Her2; (b) GD2; (c)
EGF-R; (d) CEA; (e) CD52; (f) CD21; (g) human melanoma protein
gp100; (h) human melanoma protein melan-A/MART-1; (i) tyrosinase;
(j) NA17-A nt protein; (k) MAGE-3 protein; (l) p53 protein; (m)
HPV16 E7 protein; and (m) antigenic fragments of any of the tumor
antigens from (a) to (m).
135. The method of claim 73, wherein said antigen is bound to said
virus-like particle by way of a linking sequence.
136. The method of claim 135, wherein said virus-like particle is
the Hepatitis B virus core protein.
137. The method of claim 135, wherein said virus-like particle is
the BK virus VP1 protein.
138. The method of claim 73, wherein said antigen is a cytotoxic T
cell epitope, a Th cell epitope or a combination of at least two of
said epitopes, wherein said at least two epitopes are linked
directly or by way of a linking sequence.
139. The method of claim 138, wherein said cytotoxic T cell epitope
is a viral or a tumor cytotoxic T cell epitope.
140. The method of claim 138, wherein said antigen is bound to said
virus-like particle by way of a linking sequence.
141. The method of claim 138, wherein said virus-like particle is
the Hepatitis B virus core protein.
142. The method of claim 141, wherein said cytotoxic T cell epitope
is fused to the C-terminus of said Hepatitis B virus core
protein.
143. The method of claim 142, wherein said cytotoxic T cell epitope
is fused to the C-terminus of said Hepatitis B virus core protein
by way of a linking sequence.
144. The method of claim 138, wherein said virus-like particle is a
BK virus VP1 protein.
145. The method of claim 144, wherein said cytotoxic T cell epitope
is fused to the C-terminus of said BK virus VP1 protein.
146. The method of claim 145, wherein said cytotoxic T cell epitope
is fused to the C-terminus of said BK virus VP1 protein by way of a
linking sequence.
147. The method of claim 72, wherein said immune response is an
enhanced B cell response.
148. The method of claim 72, wherein said immune response is an
enhanced T cell response.
149. The method of claim 148, wherein said T cell response is a CTL
response.
150. The method of claim 148, wherein said T cell response is a Th
cell response.
151. The method of claim 150, wherein said Th cell response is a
Th1 cell response.
152. The method of claim 72, wherein said animal is a mammal.
153. The method of claim 152, wherein said mammal is a human.
154. The method of claim 72, wherein said composition is introduced
into said animal subcutaneously, intramuscularly, intravenously,
intranasally or directly into the lymph node.
155. A method of producing a composition for enhancing an immune
response in an animal comprising a virus-like particle and an
immunostimulatory substance bound to said virus-like particle which
comprises: (a) incubating said virus-like particle with said
immunostimulatory substance; (b) adding RNase; and (c) purifying
said composition.
156. The method of claim 155, wherein said immunostimulatory
substance is an immunostimulatory nucleic acid selected from the
group consisting of, or alternatively consists essentially of: (a)
ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic
acids; and (d) any mixtures of at least one nucleic acid of (a),
(b) and/or (c).
157. The method of claim 156, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
158. The method of claim 156, wherein said deoxyribonucleic acid is
selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
159. The method of claim 155, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
160. The method of claim 155, wherein said virus-like particle is
produced in a bacterial expression system.
161. The method of claim 155, wherein said RNase is RNase A.
162. A method of producing a composition for enhancing an immune
response in an animal comprising a virus-like particle and an
immunostimulatory substance bound to said virus-like particle which
comprises: (a) incubating said virus-like particle with RNase; (b)
adding said immunostimulatory substance; and (c) purifying said
composition.
163. The method of claim 162, wherein said immunostimulatory
substance is an immunostimulatory nucleic acid selected from the
group consisting of, or alternatively consists essentially of: (a)
ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic
acids; and (d) any mixtures of at least one nucleic acid of (a),
(b) and/or (c).
164. The method of claim 163, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
165. The method of claim 163, wherein said deoxyribonucleic acid is
selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
166. The method of claim 162, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
167. The method of claim 162, wherein said virus-like particle is
produced in a bacterial expression system.
168. The method of claim 162, wherein said RNase is RNase A.
169. A method of producing a composition for enhancing an immune
response in an animal comprising a virus-like particle and an
immunostimulatory substance bound to said virus-like particle which
comprises: (a) disassembling said virus-like particle; (b) adding
said immunostimulatory substance; and (c) reassembling said
virus-like particle.
170. The method of claim 169, wherein said immunostimulatory
substance is an immunostimulatory nucleic acid selected from the
group consisting of, or alternatively consists essentially of: (a)
ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic
acids; and (d) any mixtures of at least one nucleic acid of (a),
(b) and/or (c).
171. The method of claim 170, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
172. The method of claim 170, wherein said deoxyribonucleic acid is
selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
173. The method of claim 169, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
174. The method of claim 169 further comprising removing nucleic
acids of said disassembled virus-like particle.
175. The method of claim 169 further comprising purifying said
composition after reassembly (c).
176. A method of producing a composition for enhancing an immune
response in an animal comprising a virus-like particle and an
immunostimulatory substance bound to said virus-like particle which
comprises: (a) incubating said virus-like particle with solutions
comprising metal ions capable of hydrolizing the nucleic acids of
said virus-like particle; (b) adding said immunostimulatory
substance; and (c) purifying said composition.
177. The method of claim 176, wherein said immunostimulatory
substance is an immunostimulatory nucleic acid selected from the
group consisting of, or alternatively consists essentially of: (a)
ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic
acids; and (d) any mixtures of at least one nucleic acid of (a),
(b) and/or (c).
178. The method of claim 177, wherein said ribonucleic acid is
poly-(I:C) or a derivative thereof.
179. The method of claim 177, wherein said deoxyribonucleic acid is
selected from the group consisting of, or alternatively consists
essentially of: (a) unmethylated CpG-containing oligonucleotides;
and (b) oligonucleotides free of unmethylated CpG motifs.
180. The method of claim 176, wherein said immunostimulatory
substance is an unmethylated CpG-containing oligonucleotide.
181. The method of claim 176, wherein said metal ions are selected
from the group consisting of: (a) zinc (Zn) ions; (b) copper (Cu)
ions; (c) iron (Fe) ions; and (d) any mixtures of at least one ion
of (a), (b) and/or (c).
182. A vaccine comprising an immunologically effective amount of
the composition of claim 1 together with a pharmaceutically
acceptable diluent, carrier or excipient.
183. The vaccine of claim 182 further comprising an adjuvant.
184. A method of immunizing or treating an animal comprising
administering to said animal an immunologically effective amount of
the vaccine of claim 182.
185. The method of claim 184, wherein said animal is a mammal.
186. The method of claim 185, wherein said mammal is a human.
187. A vaccine comprising an immunologically effective amount of
the composition of claim 2 together with a pharmaceutically
acceptable diluent, carrier or excipient.
188. The vaccine of claim 187 further comprising an adjuvant.
189. A method of immunizing or treating an animal comprising
administering to said animal an immunologically effective amount of
the vaccine of claim 187.
190. The method of claim 189, wherein said animal is a mammal.
191. The method of claim 190, wherein said mammal is a human.
192. A method of immunizing or treating an animal comprising
priming a T cell response in said animal by administering an
immunologically effective amount of the vaccine of claim 182.
193. The method of claim 192, further comprising the step of
boosting the immune response in said animal.
194. The method of claim 193, wherein said boosting is effected by
administering an immunologically effective amount of a vaccine of
claim 182 or an immunologically effective amount of a heterologous
vaccine.
195. The method of claim 194, wherein said heterologous vaccine is
a DNA vaccine.
196. A method of immunizing or treating an animal comprising
boosting a T cell response in said animal by administering an
immunologically effective amount of the vaccine of claim 182.
197. The method of claim 196, further comprising the step of
priming a T cell response in said animal.
198. The method of claim 197, wherein said priming is effected by
administering an immunologically effective amount of a vaccine of
claim 182 or an immunologically effective amount of a heterologous
vaccine.
199. The method of claim 198, wherein said heterologous vaccine is
a DNA vaccine.
200. A method of immunizing or treating an animal comprising
priming a T cell response in said animal by administering an
immunologically effective amount of the vaccine of claim 187.
201. The method of claim 200 further comprising the step of
boosting the immune response in said animal.
202. The method of claim 201, wherein said boosting is effected by
administering an immunologically effective amount of a vaccine of
claim 187 or an immunologically effective amount of a heterologous
vaccine.
203. The method of claim 202, wherein said heterologous vaccine is
a DNA vaccine or a viral vaccine or a canery pox vaccine.
204. A method of immunizing or treating an animal comprising
boosting a T cell response in said animal by administering an
immunologically effective amount of the vaccine of claim 187.
205. The method of claim 204, further comprising the step of
priming a T cell response in said animal.
206. The method of claim 205, wherein said priming is effected by
administering an immunologically effective amount of a vaccine of
claim 187 or an immunologically effective amount of a heterologous
vaccine.
207. The method of claim 206, wherein said heterologous vaccine is
a DNA vaccine or a viral vaccine or a canery pox vaccine.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/318,994, filed Sep. 14, 2001, and U.S.
Provisional Application No. 60/374,145, filed Apr. 22, 2002, each
of which is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention is related to the fields of
vaccinology, immunology and medicine. The invention provides
compositions and methods for enhancing immunological responses
against virus-like particles (VLPs) or against antigens coupled,
fused or attached otherwise to VLPs by packaging immunostimulatory
substances, in particular immunostimulatory nucleic acids, and even
more particular oligonucleotides containing at least one
non-methylated CpG sequence, into the VLPs. The invention can be
used to induce strong and sustained T cell responses particularly
useful for the treatment of tumors and chronic viral diseases as
well as allergies and other chronic diseases.
[0004] 2. Related Art
[0005] The essence of the immune system is built on two separate
foundation pillars: one is specific or adaptive immunity which is
characterized by relatively slow response-kinetics and the ability
to remember; the other is non-specific or innate immunity
exhibiting rapid response-kinetics but lacking memory. Lymphocytes
are the key players of the adaptive immune system. Each lymphocyte
expresses antigen-receptors of unique specificity. Upon recognizing
an antigen via the receptor, lymphocytes proliferate and develop
effector function. Few lymphocytes exhibit specificity for a given
antigen or pathogen, and massive proliferation is usually required
before an effector response can be measured--hence, the slow
kinetics of the adaptive immune system. Since a significant
proportion of the expanded lymphocytes survive and may maintain
some effector function following elimination of the antigen, the
adaptive immune system reacts faster when encountering the antigen
a second time. This is the basis of its ability to remember.
[0006] In contrast to the situation with lymphocytes, where
specificity for a pathogen is confined to few cells that must
expand to gain function, the cells and molecules of the innate
immune system are usually present in massive numbers and recognize
a limited number of invariant features associated with pathogens
(Medzhitov, R. and Janeway, C.A., Jr., Cell 91:295-298 (1997)).
Examples of such patterns include lipopolysaccharides (LPS),
non-methylated CG-rich DNA (CpG) or double stranded RNA, which are
specific for bacterial and viral infections, respectively.
[0007] Most research in immunology has focused on the adaptive
immune system and only recently has the innate immune system
entered the focus of interest. Historically, the adaptive and
innate immune system were treated and analyzed as two separate
entities that had little in common. Such was the disparity that few
researchers wondered why antigens were much more immunogenic for
the specific immune system when applied with adjuvants that
stimulated innate immunity (Sotomayor, E. M., et al., Nat. Med.
5:780 (1999); Diehl, L., et al., Nat. Med. 5:774 (1999); Weigle, W.
O., Adv. Immunol. 30:159 (1980)). However, the answer posed by this
question is critical to the understanding of the immune system and
for comprehending the balance between protective immunity and
autoimmunity.
[0008] Rationalized manipulation of the innate immune system and in
particular activation of APCs involved in T cell priming to
deliberately induce a self-specific T cell response provides a
means for T cell-based tumor-therapy. Accordingly, the focus of
most current therapies is on the use of activated dendritic cells
(DCs) as antigen-carriers for the induction of sustained T cell
responses (Nestle et al., Nat. Med. 4:328 (1998)). Similarly, in
vivo activators of the innate immune system, such as CpGs or
anti-CD40 antibodies, are applied together with tumor cells in
order to enhance their immunogenicity (Sotomayor, E. M., et al.,
Nat. Med. 5:780 (1999); Diehl, L., et al., Nat. Med. 5:774
(1999)).
[0009] Generalized activation of APCs by factors that stimulate
innate immunity may often be the cause for triggering self-specific
lymphocytes and autoimmunity. Activation may result in enhanced
expression of costimulatory molecules or cytokines such as IL-12 or
IFN.alpha.. This view is compatible with the observation that
administration of LPS together with thyroid extracts is able to
overcome tolerance and trigger autoimmune thyroiditis (Weigle, W.
O., Adv. Immunol. 30:159 (1980)). Moreover, in a transgenic mouse
model, it was recently shown that administration of self-peptide
alone failed to cause auto-immunity unless APCs were activated by a
separate pathway (Garza, K. M., et al., J. Exp. Med. 191:2021
(2000)). The link between innate immunity and autoimmune disease is
further underscored by the observation that LPS, viral infections
or generalized activation of APCs delays or prevents the
establishment of peripheral tolerance (Vella, A. T., et al.,
Immunity 2:261 (1995); Ehl, S., et al., J. Exp. Med. 187:763
(1998); Maxwell, J. R., et al., J. Immunol. 162:2024 (1999)). In
this way, innate immunity not only enhances the activation of
self-specific lymphocytes but also inhibits their subsequent
elimination. These findings may extend to tumor biology and the
control of chronic viral diseases.
[0010] Induction of cytotoxic T lymphocyte (CTL) responses after
immunization with minor histocompatibility antigens, such as the
HY-antigen, requires the presence of T helper cells (Th cells)
(Husmann, L. A., and M. J. Bevan, Ann. NY Acad. Sci. 532:158
(1988); Guerder, S., and P. Matzinger, J. Exp. Med. 176:553
(1992)). CTL-responses induced by cross-priming, i.e. by priming
with exogenous antigens that reached the class I pathway, have also
been shown to require the presence of Th cells (Bennett, S. R. M.,
et al., J. Exp. Med. 186:65 (1997)). These observations have
important consequences for tumor therapy where T help may be
critical for the induction of protective CTL responses by tumor
cells (Ossendorp, F., et al., J. Exp. Med. 187:693 (1998)).
[0011] An important effector molecule on activated Th cells is the
CD40-ligand (CD40L) interacting with CD40 on B cells, macrophages
and dendritic cells (DCs) (Foy, T. M., et al., Annu. Rev. Immunol.
14:591 (1996)). Triggering of CD40 on B cells is essential for
isotype switching and the generation of B cell memory (Foy, T. M.,
et al., Ann. Rev. Immunol. 14:591 (1996)). More recently, it was
shown that stimulation of CD40 on macrophages and DCs leads to
their activation and maturation (Cella, M., et al., Curr. Opin.
Immunol. 9:10 (1997); Banchereau, J., and R. M. Steinman Nature
392:245 (1998)). Specifically, DCs upregulate costimulatory
molecules and produce cytokines such as IL-12 upon activation.
Interestingly, this CD40L-mediated maturation of DCs seems to be
responsible for the helper effect on CTL responses. In fact, it has
recently been shown that CD40-triggering by Th cells renders DCs
able to initiate a CTL-response (Ridge, J. P., et al., Nature
393:474 (1998); Bennett, S. R. M., et al., Nature 393:478 (1998);
Schoenenberger, S. P., et al., Nature 393:480 (1998)). This is
consistent with the earlier observation that Th cells have to
recognize their ligands on the same APC as the CTLs, indicating
that a cognate interaction is required (Bennett, S. R. M., et al.,
J. Exp. Med. 186:65 (1997)). Thus CD40L-mediated stimulation by Th
cells leads to the activation of DCs, which subsequently are able
to prime CTL-responses. In the human, type I interferons, in
particular interferon .alpha. and .beta. may be equally important
as IL-12.
[0012] In contrast to these Th-dependent CTL responses, viruses are
often able to induce protective CTL-responses in the absence of T
help (for review, see (Bachmann, M. F., et al., J. Immunol.
161:5791 (1998)). Specifically, lymphocytic choriomeningitis virus
(LCMV) (Leist, T. P., et al., J. Immunol. 138:2278 (1987); Ahmed,
R., et al., J. Virol. 62:2102 (1988); Battegay, M., et al., Cell
Immunol. 167:115 (1996); Borrow, P., et al., J. Exp. Med. 183:2129
(1996); Whitmire, J. K., et al, J. Virol. 70:8375 (1996)),
vesicular stomatitis virus (VSV) (Kundig, T. M., et al., Immunity
5:41 (1996)), influenza virus (Tripp, R. A., et al., J. Immunol.
155:2955 (1995)), vaccinia virus (Leist, T. P., et al., Scand. J.
Immunol. 30:679 (1989)) and ectromelia virus (Buller, R., et al.,
Nature 328:77 (1987)) were able to prime CTL-responses in mice
depleted of CD4.sup.+ T cells or deficient for the expression of
class 11 or CD40. The mechanism for this Th cell independent
CTL-priming by viruses is presently not understood. Moreover, most
viruses do not stimulate completely Th cell independent
CTL-responses, but virus-specific CTL-activity is reduced in
Th-cell deficient mice. Thus, Th cells may enhance anti-viral
CTL-responses but the mechanism of this help is not fully
understood yet. DCs have recently been shown to present influenza
derived antigens by cross-priming (Albert, M. L., et al., J. Exp.
Med. 188:1359 (1998); Albert, M. L., et al., Nature 392:86 (1998)).
It is therefore possible that, similarly as shown for minor
histocompatibility antigens and tumor antigens (Ridge, J. P., et
al., Nature 393:474 (1998); Bennett, S. R. M., et al., Nature
393:478 (1998); Schoenenberger, S. P., et al., Nature 393:480
(1998)), Th cells may assist induction of CTLs via CD40 triggering
on DCs. Thus, stimulation of CD40 using CD40L or anti-CD40
antibodies may enhance CTL induction after stimulation with viruses
or tumor cells.
[0013] However, although CD40L is an important activator of DCs,
there seem to be additional molecules that can stimulate maturation
and activation of DCs during immune responses. In fact, CD40 is not
measurably involved in the induction of CTLs specific for LCMV or
VSV (Ruedl, C., et al., J. Exp. Med. 189:1875 (1999)). Thus,
although VSV-specific CTL responses are partly dependent upon the
presence of CD4+T cells (Kundig, T. M., et al., Immunity 5:41
(1996)), this helper effect is not mediated by CD40L. Candidates
for effector molecules triggering maturation of DCs during immune
responses include Trance and TNFA (Bachmann, M. F., et al., J. Exp.
Med. 189:1025 (1999); Sallusto, F., and A. Lanzavecchia, J Exp Med
179:1109 (1994)).
[0014] It is well established that the administration of purified
proteins alone is usually not sufficient to elicit a strong immune
response; isolated antigen generally must be given together with
helper substances called adjuvants.
[0015] Within these adjuvants, the administered antigen is
protected against rapid degradation, and the adjuvant provides an
extended release of a low level of antigen.
[0016] Unlike isolated proteins, viruses induce prompt and
efficient immune responses in the absence of any adjuvants both
with and without T-cell help (Bachmann & Zinkernagel, Ann. Rev.
Immunol. 15:235-270 (1997)).
[0017] Although viruses often consist of few proteins, they are
able to trigger much stronger immune responses than their isolated
components. For B cell responses, it is known that one crucial
factor for the immunogenicity of viruses is the repetitiveness and
order of surface epitopes. Many viruses exhibit a quasi-crystalline
surface that displays a regular array of epitopes which efficiently
crosslinks epitope-specific immunoglobulins on B cells (Bachmann
& Zinkernagel, Immunol. Today 17:553-558 (1996)). This
crosslinking of surface immunoglobulins on B cells is a strong
activation signal that directly induces cell-cycle progression and
the production of IgM antibodies. Further, such triggered B cells
are able to activate T helper cells, which in turn induce a switch
from IgM to IgG antibody production in B cells and the generation
of long-lived B cell memory--the goal of any vaccination (Bachmann
& Zinkernagel, Ann. Rev. Immunol. 15:235-270 (1997)). Viral
structure is even linked to the generation of anti-antibodies in
autoimmune disease and as a part of the natural response to
pathogens (see Fehr, T., et al., J. Exp. Med. 185:1785-1792
(1997)). Thus, antigens on viral particles that are organized in an
ordered and repetitive array are highly immunogenic since they can
directly activate B cells.
[0018] In addition to strong B cell responses, viral particles are
also able to induce the generation of a cytotoxic T cell response,
another crucial arm of the immune system. These cytotoxic T cells
are particularly important for the elimination of non-cytopathic
viruses such as HIV or Hepatitis B virus and for the eradication of
tumors. Cytotoxic T cells do not recognize native antigens but
rather recognize their degradation products in association with MHC
class I molecules (Townsend & Bodmer, Ann. Rev. Immunol.
7:601-624 (1989)). Macrophages and dendritic cells are able to take
up and process exogenous viral particles (but not their soluble,
isolated components) and present the generated degradation product
to cytotoxic T cells, leading to their activation and proliferation
(Kovacsovics-Bankowski et al., Proc. Natl. Acad. Sci. USA
90:4942-4946 (1993); Bachmann et al., Eur. J. Immunol. 26:2595-2600
(1996)).
[0019] Viral particles as antigens exhibit two advantages over
their isolated components: (1) due to their highly repetitive
surface structure, they are able to directly activate B cells,
leading to high antibody titers and long-lasting B cell memory; and
(2) viral particles, but not soluble proteins, have the potential
to induce a cytotoxic T cell response, even if the viruses are
non-infectious and adjuvants are absent.
[0020] Several new vaccine strategies exploit the inherent
immunogenicity of viruses. Some of these approaches focus on the
particulate nature of the virus particle; for example see Harding,
C.V. and Song, R., (J. Immunology 153:4925 (1994)), which discloses
a vaccine consisting of latex beads and antigen;
Kovacsovics-Bankowski, M., et al. (Proc. Natl. Acad. Sci. USA
90:4942-4946 (1993)), which discloses a vaccine consisting of iron
oxide beads and antigen; U.S. Pat. No. 5,334,394 to Kossovsky, N.,
et al., which discloses core particles coated with antigen; U.S.
Pat. No. 5,871,747, which discloses synthetic polymer particles
carrying on the surface one or more proteins covalently bonded
thereto; and a core particle with a non-covalently bound coating,
which at least partially covers the surface of said core particle,
and at least one biologically active agent in contact with said
coated core particle (see, e.g., WO 94/15585).
[0021] In a further development, virus-like particles (VLPs) are
being exploited in the area of vaccine production because of both
their structural properties and their non-infectious nature. VLPs
are supermolecular structures built in a symmetric manner from many
protein molecules of one or more types. They lack the viral genome
and, therefore, are noninfectious. VLPs can often be produced in
large quantities by heterologous expression and can be easily be
purified.
[0022] In addition, DNA rich in non-methylated CG motifs (CpG), as
present in bacteria and most non-vertebrates, exhibits a potent
stimulatory activity on B cells, dendritic cells and other APC's in
vitro as well as in vivo. Although bacterial DNA is
immunostimulatory across many vertebrate species, the individual
CpG motifs may differ. In fact, CpG motifs that stimulate mouse
immune cells may not necessarily stimulate human immune cells and
vice versa.
[0023] Although DNA oligomers rich in CpG motifs can exhibit
immunostimulatory capacity, their efficiency is often limited,
since they are unstable in vitro and in vivo. Thus, they exhibit
unfavorable pharmacokinetics. In order to render
CpG-oligonucleotides more potent, it is therefore usually necessary
to stabilize them by introducing phosphorothioate modifications of
the phosphate backbone.
[0024] A second limitation for the use of CpG-oligonucleotides to
stimulate immune responses is their lack of specificity, since all
APC's and B cells in contact with CpG-oligonucleotides become
stimulated. Thus, the efficiency and specificity of
CpG-oligonucleotides may be improved by stabilizing them or
packaging them in a way that restricts cellular activation to those
cells that also present the relevant antigen.
[0025] In addition, immunostimulatory CpG-oligodeoxynucleotides
induce strong side effects by causing extramedullary hemopoiesis
accompanied by splenomegaly and lymphadenopathy in mice (Sparwasser
et al., J. Immunol. (1999), 162:2368-74 and Example 18).
[0026] VLPs have been shown to be efficiently presented on MHC
class I molecules as they, presumably after uptake by
macropinocytosis, are efficiently processed and crossprimed onto
MHC class I. The mechanism of crosspriming is not clear to date,
but TAP-dependent and TAP-independent pathways have been
proposed.
[0027] There have been remarkable advances made in vaccination
strategies recently, yet there remains a need for improvement on
existing strategies. In particular, there remains a need in the art
for the development of new and improved vaccines that promote a
strong CTL immune response and anti-pathogenic protection as
efficiently as natural pathogens in the absence of generalized
activation of APCs and other cells.
SUMMARY OF THE INVENTION
[0028] This invention is based on the surprising finding that
immunostimulatory substances such as DNA oligonucleotides can be
packaged into VLPs which renders them more immunogenic.
Unexpectedly, the nucleic acids and oligonucleotides, respectively,
present in VLPs can be replaced specifically by the
immunostimulatory substances and DNA-oligonucleotides containing
CpG motifs, respectively. Surprisingly, these packaged
immunostimulatory substances, in particular immunostimulatory
nucleic acids such as unmethylated CpG-containing oligonucleotides
retained their immunostimulatory capacity without widespread
activation of the innate immune system. The compositions comprising
VLP's and the immunostimulatory substances in accordance with the
present invention, and in particular the CpG-VLPs are dramatically
more immunogenic than their CpG-free counterparts and induce
enhanced B and T cell responses. The immune response against
antigens optionally coupled, fused or attached otherwise to the
VLPs is similarly enhanced as the immune response against the VLP
itself. In addition, the T cell responses against both the VLPs and
antigens are especially directed to the Th1 type. Antigens attached
to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic
or therapeutic vaccination against allergies, tumors and other
self-molecules and chronic viral diseases.
[0029] In a first embodiment, the invention provides a composition
for enhancing an immune response in an animal comprising a
virus-like particle and an immunostimulatory substance, preferably
an immunostimulatory nucleic acid, an even more preferably an
unmethylated CpG-containing oligonucleotide, where the substance,
nucleic acid or oligonucleotide is coupled, fused, or otherwise
attached to or enclosed by, i.e., bound, to the virus-like
particle. In another embodiment, the composition further comprises
an antigen bound to the virus-like particle.
[0030] In a preferred embodiment of the invention, the
immunostimulatory nucleic acids, in particular the unmethylated
CpG-containing oligonucleotides are stabilized by phosphorothioate
modifications of the phosphate backbone. In another preferred
embodiment, the immunostimulatory nucleic acids, in particular the
unmethylated CpG-containing oligonucleotides are packaged into the
VLPs by digestion of RNA within the VLPs and simultaneous addition
of the DNA oligonucleotides containing CpGs of choice. In an
equally preferred embodiment, the VLPs can be disassembled before
they are reassembled in the presence of CpGs.
[0031] In a further preferred embodiment, the immunostimulatory
nucleic acids do not contain CpG motifs but nevertheless exhibit
immunostimulatory activities. Such nucleic acids are described in
WO 01/22972. All sequences described therein are hereby
incorporated by way of reference.
[0032] In a further preferred embodiment, the virus-like particle
is a recombinant virus-like particle. Also preferred, the
virus-like particle is free of a lipoprotein envelope. Preferably,
the recombinant virus-like particle comprises, or alternatively
consists of, recombinant proteins of Hepatitis B virus, BK virus or
other human Polyoma virus, measles virus, Sindbis virus, Rotavirus,
Foot-and-Mouth-Disease virus, Retrovirus, Norwalk virus or human
Papilloma virus, RNA-phages, Q.beta.-phage, GA-phage, fr-phage and
Ty. In a specific embodiment, the virus-like particle comprises, or
alternatively consists of, one or more different Hepatitis B virus
core (capsid) proteins (HBcAgs).
[0033] In a further preferred embodiment, the virus-like particle
comprises recombinant proteins, or fragments thereof, of a
RNA-phage. Preferred RNA-phages are Q.beta.-phage, AP 205-phage,
GA-phage, fr-phage
[0034] In another embodiment, the antigen is a recombinant antigen.
In yet another embodiment, the antigen can be selected from the
group consisting of:
[0035] (1) a polypeptide suited to induce an immune response
against cancer cells; (2) a polypeptide suited to induce an immune
response against infectious diseases;
[0036] (3) a polypeptide suited to induce an immune response
against allergens; (4) a polypeptide suited to induce an improved
response against self-antigens; and
[0037] (5) a polypeptide suited to induce an immune response in
farm animals or pets.
[0038] In yet another embodiment, the antigen can be selected from
the group consisting of: (1) an organic molecule suited to induce
an immune response against cancer cells; (2) an organic molecule
suited to induce an immune response against infectious diseases;
(3) an organic molecule suited to induce an immune response against
allergens; (4) an organic molecule suited to induce an improved
response against self-antigens; (5) an organic molecule suited to
induce an immune response in farm animals or pets; and (6) an
organic molecule suited to induce a response against a drug, a
hormone or a toxic compound.
[0039] In a particular embodiment, the antigen comprises, or
alternatively consists of, a cytotoxic T cell epitope. In a related
embodiment, the virus-like particle comprises the Hepatitis B virus
core protein and the cytotoxic T cell epitope is fused to the
C-terminus of said Hepatitis B virus core protein. In one
embodiment, they are fused by a leucine linking sequence.
[0040] In another aspect of the invention, there is provided a
method of enhancing an immune response in a human or other animal
species comprising introducing into the animal a composition
comprising a virus-like particle and immunostimulatory substance,
preferably an immunostimulatory nucleic acid, an even more
preferably an unmethylated CpG-containing oligonucleotide where the
substance, preferably the nucleic acid, and even more preferally
the oligonucleotide is bound (i.e. coupled, attached or enclosed)
to the virus-like particle. In a further embodiment, the
composition further comprises an antigen bound to the virus-like
particle.
[0041] In yet another embodiment of the invention, the composition
is introduced into an animal subcutaneously, intramuscularly,
intranasally, intradermally, intravenously or directly into a lymph
node. In an equally preferred embodiment, the immune enhancing
composition is applied locally, near a tumor or local viral
reservoir against which one would like to vaccinate.
[0042] In a preferred aspect of the invention, the immune response
is a T cell response, and the T cell response against the antigen
is enhanced. In a specific embodiment, the T cell response is a
cytotoxic T cell response, and the cytotoxic T cell response
against the antigen is enhanced.
[0043] The present invention also relates to a vaccine comprising
an immunologically effective amount of the immune enhancing
composition of the present invention together with a
pharmaceutically acceptable diluent, carrier or excipient. In a
preferred embodiment, the vaccine further comprises at least one
adjuvant, such as incomplete Freund's adjuvant. The invention also
provides a method of immunizing and/or treating an animal
comprising administering to the animal an immunologically effective
amount of the disclosed vaccine.
[0044] In a preferred embodiment of the invention, the
immunostimulatory substance-containing VLPs, preferably the
immunostimulatory nucleic acid-containing VLP's, an even more
preferably the unmethylated CpG-containing oligonucleotide VLPs are
used for vaccination of animals or humans against the VLP itself or
against antigens coupled, fused or attached otherwise to the VLP.
The modified VLPs can be used to vaccinate against tumors, viral
diseases, self-molecules and self antigens, respectively, or
non-peptidic small molecules, for example. The vaccination can be
for prophylactic or therapeutic purposes, or both. Also, the
modified VLPs can be used to vaccinate against allergies in order
to induce immune-deviation.
[0045] In the majority of cases, the desired immune response will
be directed against antigens coupled, fised or attached otherwise
to the immunostimulatory substance-containing VLPs, preferably the
immunostimulatory nucleic acid-containing VLP's, an even more
preferably the unmethylated CpG-containing oligonucleotide VLPs.
The antigens can be peptides, proteins, domains, carbohydrates or
small molecules such as, for example, steroid hormones or drugs,
such as nicotine. Under some conditions, the desired immune
response can be directed against the VLP itself. This latter
application will be used in cases where the VLP originates from a
virus against which one would like to vaccinate.
[0046] The route of injection is preferably subcutaneous or
intramuscular, but it would also be possible to apply the
CpG-containing VLPs intradermally, intranasally, intravenously or
directly into the lymph node. In an equally preferred embodiment,
the CpG-containing antigen-coupled or free VLPs are applied
locally, near a tumor or local viral reservoir against which one
would like to vaccinate.
[0047] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are intended to provide further
explanation of the invention as claimed.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0048] FIG. 1 shows the DNA sequence of the CpG-oligonucleotide (A)
and the DNA sequence of the peptide p33-containing VLP derived from
hepatitis B core (B). The nonameric p33 epitope is genetically
fused to the C-terminus of the hepatitis B core protein at position
185 via a three leucine linking sequence.
[0049] FIG. 2 shows the structure of the p33-VLPs as assessed by
electron microscopy (A) and SDS PAGE (B). Recombinantly produced
wild-type VLPs (composed of HBcAg [aa 1-185] monomers) and p33-VLPs
were loaded onto a Sephacryl S-400 gel filtration column (Amersham
Pharmacia Biotechnology AG) for purification. Pooled fractions were
loaded onto a Hydroxyapatite column. Flow through (which contains
purified HBc capsids) was collected and loaded onto a reducing
SDS-PAGE gel for monomer molecular weight analysis (B).
[0050] FIG. 3 shows p33-VLPs in a native agarose gel
electrophoresis (1% agarose) after control incubation or after
digestion with RNase A upon staining with ethidium bromide (A) or
Coomassie blue (B) in order to assess for the presence of RNA or
protein. Recombinantly produced p33-VLPs were diluted at a final
concentration of 0.5 ug/ul protein in PBS buffer and incubated in
the absence (lane 1) or presence (lane 2) of RNase A (100 ug/ml)
(Sigma, Division of Fluka AG, Switzerland) for 2 h at 37.degree. C.
The samples were subsequently complemented with 6-fold concentrated
DNA-loading buffer (MBS Fermentas GmbH, Heidelberg, Germany) and
run for 30 min at 100 volts in a 1% native agarose gel. The Gene
Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as
reference for p33-VLPs migration velocity (lane M). Arrows are
indicating the presence of RNA packaged in p33-VLPs (A) or p33-VLP
capsids themselves (B). Identical results were obtained in 3
independent experiments.
[0051] FIG. 4 shows p33-VLPs in a native agarose gel
electrophoresis (1% agarose) after control incubation or after
digestion with RNase A in the presence of buffer only or
CpG-containing DNA-oligomers upon staining with ethidium bromide
(A) or Coomassie blue (B) in order to assess for the presence of
RNA/DNA or protein. Recombinant p33-VLPs were diluted at a final
concentration of 0.5 ug/ul protein in PBS buffer and incubated in
the absence (lane 1) or presence (lane 2 and 3) of RNase A (100
ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at
37.degree. C. 5 nmol CpG-oligonucleotides (containing
phosphorothioate modification of the backbone) were added to sample
3 before RNase A digestion. The Gene Ruler marker (MBS Fermentas
GmbH, Heidelberg, Germany) was used as reference for p33-VLPs
migration velocity (lane M). Arrows are indicating the presence of
RNA or CpG-oligonucleotides in p33-VLPs (A) or p33-VLPs capsids
themselves (B). Identical results were obtained when CpG
oligonucleotides with phosphodiester bonds were used for
co-incubation of VLPs with RNase A.
[0052] FIG. 5 shows p33-VLPs in a native agarose gel
electrophoresis (1% agarose) before and after digestion with RNase
A in the presence of CpG-containing DNA-oligomers and subsequent
dialysis (for the elimination of VLP-unbound CpG DNA) upon staining
with ethidium bromide (A) or Coomassie blue (B) in order to assess
for the presence of DNA or protein. Recombinant p33-VLPs were
diluted at a final concentration of 0.5 ug/ul protein in PBS buffer
and incubated in absence (lane 1) or in presence (lanes 2 to 5) of
RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for
2 h at 37.degree. C. 50 nmol CpG-oligonucleotides (containing
phosphorothioate modification of the phosphate backbone: lanes 2
and 3, containing phosphodiester bonds: lanes 4 and 5) were added
to VLPs before RNase A digestion. Treated samples were extensively
dialysed for 24 hours against PBS (4500-fold dilution) with a 300
kDa MWCO dialysis membrane (Spectrum Medical Industries Inc.,
Houston, USA) to eliminate the in excess DNA (lanes 3 and 5). The
Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was
used as reference for p33-VLPs migration velocity (lane M). Arrows
are indicating the presence of RNA or CpG-oligonucleotides in
p33-VLPs (A) or p33-VLP capsids themselves (B).
[0053] FIG. 6 shows p33-VLPs in a native agarose gel
electrophoresis (1% agarose) after control incubation or after
digestion with RNase A where CpG-containing oligonucleotides were
added only after completing the RNA digestion upon staining with
ethidium bromide (A) or Coomassie blue (B) in order to assess for
the presence of RNA/DNA or protein. Recombinant p33-VLPs were
diluted at a final concentration of 0.5 ug/ul protein in PBS buffer
and incubated in the absence (lane 1) or presence (lane 2 and 3) of
RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for
2 h at 37.degree. C. 5 nmol CpG-oligonucleotides (containing
phosphorothioate modification of the phosphate backbone) were added
to sample 3 only after the RNase A digestion. The Gene Ruler marker
(MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for
p33-VLPs migration velocity (lane M). Arrows are indicating the
presence of RNA or CpG-oligonucleotides in p33-VLPs (A) or p33-VLP
capsids themselves (B). Identical results were obtained when CpG
oligonucleotides with phosphodiester bonds were used for reassembly
of VLPs.
[0054] FIG. 7 shows that p33-VLPs packaged with
CpG-oligonucleotides (containing phosphorothioate modification of
the phosphate backbone), are effective at inducing viral
protection. Mice were subcutaneously primed with 100 .mu.g p33-VLP
alone, mixed with 20 nmol CpG-oligonucleotide (p33-VLP+CpG) or
p33-VLP packaged with CpG-oligonucleotide after dialysis of free
CpG-oligonucleotide (p33-VLP/CpG). Untreated naive mice served as
negative control. Twenty-one days later, mice were challenged with
LCMV (200 pfu, intravenously) and viral titers were assessed in the
spleens 5 days later as described in Bachmann, M. F., "Evaluation
of lymphocytic choriomeningitis virus-specific cytotoxic T cell
responses," in Immunology Methods Manual, Lefkowitz, I., ed.,
Academic Press Ltd., New York, N.Y. (1997) p. 1921.
[0055] FIG. 8 shows that p33-VLPs packaged with CpG-oligonucleotide
(containing phosphodiester bonds) are effective at inducing viral
protection. Mice were subcutaneously primed with 100 .mu.g p33-VLP
alone, mixed with 20 nmol CpG-oligonucleotides (p33-VLP+CpG) or
p33-VLPs packaged with CpG-oligonucleotides after dialysis of free
CpG-oligonucleotides) (p33-VLP/CpG). Untreated naive mice served as
negative control. Twenty-one days later, mice were challenged with
LCMV (200 pfu, intravenously) and viral titers were assessed in the
spleens 5 days later as described in Bachmann, M. F., "Evaluation
of lymphocytic choriomeningitis virus-specific cytotoxic T cell
responses," in Immunology Methods Manual, Lefkowitz, I., ed.,
Academic Press Ltd., New York, N.Y. (1997) p. 1921.
[0056] FIG. 9 shows that mice treated with CpG-oligonucleotides
alone are not protected from viral infection. Mice were
subcutaneously primed with 20 nmol CpG-oligonucleotides (CpG), or
left untreated as negative control (naive). Twenty-one days later,
mice were challenged with LCMV (200 pfu, intravenously) and viral
titers were assessed in the spleens 5 days later as described in
Bachmarm, M. F., "Evaluation of lymphocytic choriomeningitis
virus-specific cytotoxic T cell responses," in Immunology Methods
Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, N.Y.
(1997) p. 1921.
[0057] FIG. 10 shows the amino acid sequence of the BKV (AS) VP1
protein (GI:332779). This sequence was expressed in yeast to
produce BKV capsids (Sasnauskas K. et al., J. Biol Chem 380(3):381
(1999); K. et al., Generation of recombinant virus-like particles
of different polyomaviruses in yeast. 3.sup.rd International
Workshop "Virus-like particles as vaccines" Berlin, (2001)).
[0058] FIG. 11 shows the DNA sequence of the 246 bp double stranded
DNA fragment used for packaging and stabilization of BKV VLPs.
[0059] FIG. 12 shows BKV VLPs (15 .mu.g) in a native 0.8% agarose
gel electrophoresis after control incubation or after digestion
with RNase A and subsequent incubation with fluorescent
phosphorothioate (pt) CpG-oligonucleotides. UV excitation leads to
detection of DNA in an ethidium bromide stained gel (A) and to
fluorescence of CpG-FAM oligomers in the absence of ethidium
bromide (B). Lane 1: BKV VLPs untreated; lane 2: BKV VLPs RNase A
treated; lane 3: BKV VLPs RNase A treated with CpG(pt)-FAM; lane 4:
BKV VLPs RNase A treated with CpG(pt)-FAM plus DNaseI treatment;
lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg,
Germany). Arrows are indicating the presence of RNA or CpG-FAM
oligomers in BKV VLPs.
[0060] FIG. 13 shows BKV VLPs (15 .mu.g) in a native 0.8% agarose
gel electrophoresis after control incubation or after digestion
with RNase A and subsequent incubation with double stranded (ds)
DNA (246 bp) upon staining with ethidium bromide (A) or Coomassie
Blue (B). Lane 1: BKV VLPs untreated; lane 2: BKV VLPs RNase A
treated; lane 3: BKV VLPs treated with RNase A and incubated with
ds DNA; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH,
Heidelberg, Germany). Arrows indicate the presence of RNA or ds DNA
in BKV VLPs.
[0061] FIG. 14 shows BKV VLPs (15 .mu.g) in a native 0.8% agarose
gel electrophoresis after control incubation or after digestion
with RNase A and subsequent incubation with CpG-oligonucleotides
(with phosphate--or with phosphorothioate (pt) backbone) upon
staining with ethidium bromide (A) or Coomassie Blue (B). Lane 1:
BKV VLPs stock (PBS/50% glycerol); lane 2: BKV VLPs untreated (PBS
buffer); lane 3: BKV VLPs RNase A treated; lane 4: BKV VLPs RNase A
treated post-dialysis; lane 5: BKV VLPs RNase A treated with
CpG-oligonucleotides; lane 6: BKV VLPs RNase A treated with
CpG(pt)-oligomers; lane 7: BKV VLPs RNase A treated with
CpG(pt)-oligomers post-dialysis; lane M: Gene Ruler 1 kb DNA ladder
(MBI Fermentas GmbH, Heidelberg, Germany). Arrows indicate the
presence of RNA or CpG-oligonucleotides in BKV VLPs.
[0062] FIG. 15 shows mouse IgG1 and IgG2a OD50% antibody titers to
BKV VLPs on day 14 after immunization with BKV VLPs and
phosphorothioate (pt) CpG-oligonucleotides. Lane 1: RNase treated
BKV VLPs; lane 2: RNase treated BKV VLPs in combination with 0.3
nmol CpG(pt)-oligomer; lane 3: RNase treated BKV VLPs in
combination with 20 nmol CpG(pt)-oligomer; lane 4: RNase treated
BKV VLPs containing 0.3 nmol CpG(pt)-oligomer.
[0063] FIG. 16 shows p33-VLPs in a native agarose gel
electrophoresis (1% agarose) after control incubation or after
digestion with RNase A where linear double-stranded DNA (350 base
pairs long) was added only after completing the RNA digestion upon
staining with ethidium bromide (A) or Coomassie blue (B) in order
to assess for the presence of RNA/DNA or protein. Recombinant
p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein
in PBS buffer and incubated in the absence (lane 1) or presence
(lanes 2, 3 and 4) of RNase A (100 ug/ml) (Sigma, Division of Fluka
AG, Switzerland) for 2 h at 37.degree. C. Linear double-stranded
DNA of 350 bp in length was added to sample 3 and 4 only after the
RNase A digestion to a final concentration of 100 ng/ml and
incubated for 3 hours at 37.degree. C. Sample 4 was further
digested with DNase 1 (50 IU/ml)(Sigma, Division of Fluka AG,
Switzerland) for additional 3 hours at 37.degree. C. The Gene Ruler
marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as
reference for p33-VLPs migration velocity (lane M). Arrows are
indicating the presence of RNA/dsDNA free or enclosed in p33-VLPs
(A) and p33-VLPs (B).
[0064] FIG. 17 shows packaging of B-CpG into HBc33 VLPs.
[0065] FIG. 18 shows packaging of NKCpG into HBc33 VLPs.
[0066] FIG. 19 shows packaging of g10gacga-PO into HBc33 VLPs.
[0067] FIG. 20 shows packaging of CyCpG-150 into HBc33 VLPs.
[0068] FIG. 21 shows packaging of NKCpGpt into HBcP1A VLPs.
[0069] FIG. 22 shows coupling of p33 to HBcAg VLPs.
[0070] FIG. 23 shows packaging of B-CpGpt into HBx33 VLPs.
[0071] FIG. 24 shows coupling of p33 to Q.beta. VLPs.
[0072] FIG. 25 shows ionic strength and low protein concentration
allow RNA hydrolysis by RNase A in Q.beta. VLPs.
[0073] FIG. 26 shows ionic strength increases immunostimulatory
nucleic acid packaging into Q.beta. VLPs.
[0074] FIG. 27 shows packaging of B-CpGpt, g10gacga-PO and dsCyCpG
into Qbx33 VLPs.
[0075] FIG. 28 shows SDS-PAGE analysis of the fractions from the
sucrose gradient centrifugation after Q.beta. VLP disassembly and
reassembly in the presence of immunostimulatory nucleic acids.
[0076] FIG. 29 shows electron micrographs of Q.beta. VLP after
disassembly and reassembly in the presence of oligonucleotide
(CpG).sub.20OpA.
[0077] FIG. 30 shows ouchterlony analysis (immunodiffusion) of the
diassembled and reassembled Q.beta. VLP.
[0078] FIG. 31 shows gelelectrophoretic analysis of dissassembled
and reassembled Q.beta. VLP.
[0079] FIG. 32 shows electron micrographs of the dissassembled and
reassembled Q.beta. VLP with the oligonucleotide CyOpA.
[0080] FIG. 33 shows electron micrographs of the purified
dissassembled and reassembled Q.beta. VLP with the different
immunostimulatory nucleic acids.
[0081] FIG. 34 shows SDS-PAGE analysis of the coupling of Q.beta.
VLP reassembled with the oligodeoxynucleotide CyOpA to the p33GGC
peptide.
[0082] FIG. 35 shows packaged oligodeoxynucleotides after
disassembly and reassembly of Q.beta. VLPs and subsequent coupling
to p33 GGC peptide.
[0083] FIG. 36 shows purification of disassembled Q.beta. coat
protein by size exclusion chromatography.
[0084] FIG. 37 shows purification of reassembled Q.beta. VLPs by
size exclusion chromatography.
[0085] FIG. 38 shows electron micrographs of Q.beta. VLPs that were
reassembled in the presence of different oligodeoxynucleotides.
[0086] FIG. 39 shows analysis of the disulfide-bond pattern in
reassembled and purified Q.beta. capsids.
[0087] FIG. 40 shows analysis of nucleic acid content of the
reassembled Q.beta. VLPs by nuclease treatment and agarose
gelelectrophoresis.
[0088] FIG. 41 shows analysis of nucleic acid content of the
reassembled Q.beta. VLPs by proteinase K treatment and
polyacrylamide TBE/Urea gelelectrophoresis.
[0089] FIG. 42 shows electron micrographs AP205 VLP disassembled
and subsequently reassembled in the presence of CyCpG.
[0090] FIG. 43 shows agarose gel-electrophoresis analysis of AP205
VLPs diassembled and reassembled in the presence of CyCpG.
[0091] FIG. 44 shows electron micrograph of disassembled and
reassembled AP205.
[0092] FIG. 45 shows Agarose gel-electrophoresis analysis of AP205
VLPs diassembled and reassembled in the presence of CyCpG.
[0093] FIG. 46 shows SDS-PAGE analysis, of disassembled and
reassembled AP205 VLPs.
[0094] FIG. 47 shows SDS-PAGE analysis of the peptide coupling to
disassembled and reassembled AP205 VLPs.
[0095] FIG. 48 shows free immunostimulatory nucleic acids but not
immunostimulatory nucleic acids packaged in VLPs induce
splenomegaly.
[0096] FIG. 49 shows different immunostimulatory nucleic acids
packaged in VLP fused to antigen result in a potent
antigen-specific CTL response and virus protection.
[0097] FIG. 50 shows the immunostimulatory nucleic acid g10gacga-PS
packaged in VLP fused to antigen result in a potent
antigen-specific CTL response and virus protection.
[0098] FIG. 51 shows immunostimulatory nucleic acids packaged in
HBcAg and Q.beta. VLPs result in a potent antigen-specific CTL
response and virus protection.
[0099] FIG. 52 shows immunostimulatory nucleic acids packaged in
VLPs are even more efficient in inducing CTL responses than VLPs
mixed with immunostimulatory nucleic acids.
[0100] FIG. 53 shows analysis of non-enzymatic RNA hydrolysis of
the RNA in Q.beta. VLPs.
[0101] FIG. 54 shows packaging of oligodeoxynucleotides into
Q.beta. VLPs after non-enzymatic RNA hydrolysis.
[0102] FIG. 55 shows analysis of packaging of oligodeoxynucleotides
into Q.beta. VLPs after non-enzymatic RNA hydrolysis.
DETAILED DESCRIPTION OF THE INVENTION
[0103] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are hereinafter
described.
[0104] 1. Definitions
[0105] Amino acid linker: An "amino acid linker", or also just
termed "linker" within this specification, as used herein, either
associates the antigen or antigenic determinant with the second
attachment site, or more preferably, already comprises or contains
the second attachment site, typically--but not necessarily--as one
amino acid residue, preferably as a cysteine residue. The term
"amino acid linker" as used herein, however, does not intend to
imply that such an amino acid linker consists exclusively of amino
acid residues, even if an amino acid linker consisting of amino
acid residues is a preferred embodiment of the present invention.
The amino acid residues of the amino acid linker are, preferably,
composed of naturally occuring amino acids or unnatural amino acids
known in the art, all-L or all-D or mixtures thereof. However, an
amino acid linker comprising a molecule with a sulhydryl group or
cysteine residue is also encompassed within the invention. Such a
molecule comprise preferably a C1-C6 alkyl-, cycloalkyl (C5,C6),
aryl or heteroaryl moiety. However, in addition to an amino acid
linker, a linker comprising preferably a C1-C6 alkyl-, cycloalkyl-
(C5,C6), aryl- or heteroaryl-moiety and devoid of any amino acid(s)
shall also be encompassed within the scope of the invention.
Association between the antigen or antigenic determinant or
optionally the second attachment site and the amino acid linker is
preferably by way of at least one covalent bond, more preferably by
way of at least one peptide bond.
[0106] Animal: As used herein, the term "animal" is meant to
include, for example, humans, sheep, horses, cattle, pigs, dogs,
cats, rats, mice, mammals, birds, reptiles, fish, insects and
arachnids.
[0107] Antibody: As used herein, the term "antibody" refers to
molecules which are capable of binding an epitope or antigenic
determinant. The term is meant to include whole antibodies and
antigen-binding fragments thereof, including single-chain
antibodies. Most preferably the antibodies are human antigen
binding antibody fragments and include, but are not limited to,
Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain
antibodies, disulfide-linked Fvs (sdFv) and fragments comprising
either a V.sub.L or V.sub.H domain. The antibodies can be from any
animal origin including birds and mammals. Preferably, the
antibodies are human, murine, rabbit, goat, guinea pig, camel,
horse or chicken. As used herein, "human" antibodies include
antibodies having the amino acid sequence of a human immunoglobulin
and include antibodies isolated from human immunoglobulin libraries
or from animals transgenic for one or more human immunoglobulins
and that do not express endogenous immunoglobulins, as described,
for example, in U.S. Pat. No. 5,939,598 by Kucherlapati et al.
[0108] Antigen: As used herein, the term "antigen" refers to a
molecule capable of being bound by an antibody or a T cell receptor
(TCR) if presented by MHC molecules. The term "antigen", as used
herein, also encompasses T-cell epitopes. An antigen is
additionally capable of being recognized by the immune system
and/or being capable of inducing a humoral immune response and/or
cellular immune response leading to the activation of B- and/or
T-lymphocytes. This may, however, require that, at least in certain
cases, the antigen contains or is linked to a Th cell epitope and
is given in adjuvant. An antigen can have one or more epitopes (B-
and T-epitopes). The specific reaction referred to above is meant
to indicate that the antigen will preferably react, typically in a
highly selective manner, with its corresponding antibody or TCR and
not with the multitude of other antibodies or TCRs which may be
evoked by other antigens.
[0109] A "microbial antigen" as used herein is an antigen of a
microorganism and includes, but is not limited to, infectious
virus, infectious bacteria, parasites and infectious fungi. Such
antigens include the intact microorganism as well as natural
isolates and fragments or derivatives thereof and also synthetic or
recombinant compounds which are identical to or similar to natural
microorganism antigens and induce an immune response specific for
that microorganism. A compound is similar to a natural
microorganism antigen if it induces an immune response (humoral
and/or cellular) to a natural microorganism antigen. Such antigens
are used routinely in the art and are well known to the skilled
artisan.
[0110] Examples of infectious viruses that have been found in
humans include but are not limited to: Retroviridae (e.g. human
immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III); and other isolates,
such as HIV-LP); Picomaviridae (e.g. polio viruses, hepatitis A
virus; enteroviruses, human Coxsackie viruses, rhinoviruses,
echoviruses); Calciviridae (e.g. strains that cause
gastroenteritis); Togaviridae (e.g. equine encephalitis viruses,
rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis
viruses, yellow fever viruses); Coronoviridae (e.g. coronaviruses);
Rhabdoviradae (e.g. vesicular stomatitis viruses, rabies viruses);
Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g.
parainfluenza viruses, mumps virus, measles virus, respiratory
syncytial virus); Orthomyxoviridae (e.g. influenza viruses);
Bungaviridae (e.g. Hantaan viruses, bunga viruses, phleboviruses
and Nairo viruses); Arena viridae (hemorrhagic fever viruses);
Reoviridae (e.g. reoviruses, orbiviurses and rotaviruses);
Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida
(parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses);
Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex
virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV),
herpes virus); Poxviridae (variola viruses, vaccinia viruses, pox
viruses); and Iridoviridae (e.g. African swine fever virus); and
unclassified viruses (e.g. the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e. Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0111] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to, Pasteurella species, Staphylococci
species and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to: Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps. (e.g. M.
tuberculosis, M. avium, M intracellulare, M. kansaii, M. gordonae),
Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, Corynebacterium
diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
Actinomyces israelli and Chlamydia.
[0112] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis and Candida
albicans. Other infectious organisms (i.e., protists) include:
Plasmodium such as Plasmodium falciparum, Plasmodium malariae,
Plasmodium ovale, Plasmodium vivax, Toxoplasma gondii and
Shistosoma.
[0113] Other medically relevant microorganisms have been descried
extensively in the literature, e.g., see C. G. A. Thomas, "Medical
Microbiology", Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0114] The compositions and methods of the invention are also
useful for treating cancer by stimulating an antigen-specific
immune response against a cancer antigen. A "tumor antigen" as used
herein is a compound, such as a peptide, associated with a tumor or
cancer and which is capable of provoking an immune response. In
particular, the compound is capable of provoking an immune response
when presented in the context of an MHC molecule. Tumor antigens
can be prepared from cancer cells either by preparing crude
extracts of cancer cells, for example, as described in Cohen, et
al., Cancer Research, 54:1055 (1994), by partially purifying the
antigens, by recombinant technology or by de novo synthesis of
known antigens. Tumor antigens include antigens that are antigenic
portions of or are a whole tumor or cancer polypeptide. Such
antigens can be isolated or prepared recombinantly or by any other
means known in the art. Cancers or tumors include, but are not
limited to, biliary tract cancer; brain cancer; breast cancer;
cervical cancer; choriocarcinoma; colon cancer; endometrial cancer;
esophageal cancer; gastric cancer; intraepithelial neoplasms;
lymphomas; liver cancer; lung cancer (e.g. small cell and non-small
cell); melanoma; neuroblastomas; oral cancer; ovarian cancer;
pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin
cancer; testicular cancer; thyroid cancer; and renal cancer, as
well as other carcinomas and sarcomas.
[0115] Antigenic determinant: As used herein, the term "antigenic
determinant" is meant to refer to that portion of an antigen that
is specifically recognized by either B- or T-lymphocytes.
B-lymphocytes respond to foreign antigenic determinants via
antibody production, whereas T-lymphocytes are the mediator of
cellular immunity. Thus, antigenic determinants or epitopes are
those parts of an antigen that are recognized by antibodies, or in
the context of an MHC, by T-cell receptors.
[0116] Antigen presenting cell: As used herein, the term "antigen
presenting cell" is meant to refer to a heterogenous population of
leucocytes or bone marrow derived cells which possess an
immunostimulatory capacity. For example, these cells are capable of
generating peptides bound to MHC molecules that can be recognized
by T cells. The term is synonymous with the term "accessory cell"
and includes, for example, Langerhans' cells, interdigitating
cells, B cells, macrophages and dendritic cells. Under some
conditions, epithetral cells, endothelial cells and other, non-bone
marrow derived cells may also serve as antigen presenting
cells.
[0117] Association: As used herein, the term "association" as it
applies to the first and second attachment sites, refers to the
binding of the first and second attachment sites that is preferably
by way of at least one non-peptide bond. The nature of the
association may be covalent, ionic, hydrophobic, polar or any
combination thereof, preferably the nature of the association is
covalent.
[0118] Attachment Site, First: As used herein, the phrase "first
attachment site" refers to an element of non-natural or natural
origin, to which the second attachment site located on the antigen
or antigenic determinant may associate. The first attachment site
may be a protein, a polypeptide, an amino acid, a peptide, a sugar,
a polynucleotide, a natural or synthetic polymer, a secondary
metabolite or compound (biotin, fluorescein, retinol, digoxigenin,
metal ions, phenylmethylsulfonylfluori- de), or a combination
thereof, or a chemically reactive group thereof. The first
attachment site is located, typically and preferably on the
surface, of the virus-like particle. Multiple first attachment
sites are present on the surface of virus-like particle typically
in a repetitive configuration.
[0119] Attachment Site, Second: As used herein, the phrase "second
attachment site" refers to an element associated with the antigen
or antigenic determinant to which the first attachment site located
on the surface of the virus-like particle may associate. The second
attachment site of the antigen or antigenic determinant may be a
protein, a polypeptide, a peptide, a sugar, a polynucleotide, a
natural or synthetic polymer, a secondary metabolite or compound
(biotin, fluorescein, retinol, digoxigenin, metal ions,
phenylmethylsulfonylfluoride), or a combination thereof, or a
chemically reactive group thereof. At least one second attachment
site is present on the antigen or antigenic determinant. The term
"antigen or antigenic determinant with at least one second
attachment site" refers, therefore, to an antigen or antigenic
construct comprising at least the antigen or antigenic determinant
and the second attachment site. However, in particular for a second
attachment site, which is of non-natural origin, i.e. not naturally
occurring within the antigen or antigenic determinant, these
antigen or antigenic constructs comprise an "amino acid
linker".
[0120] Bound: As used herein, the term "bound" refers to binding
that may be covalent, e.g., by chemically coupling, or
non-covalent, e.g., ionic interactions, hydrophobic interactions,
hydrogen bonds, etc. Covalent bonds can be, for example, ester,
ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds,
carbon-phosphorus bonds, and the like. The term also includes the
enclosement, or partial enclosement, of a substance. The term
"bound" is broader than and includes terms such as "coupled,"
"fused," "enclosed", "packaged" and "attached." For example, the
immunostimulatory substance such as the unmethylated CpG-containing
oligonucleotide can be enclosed by the VLP without the existence of
an actual binding, neither covalently nor non-covalently.
[0121] Coat protein(s): As used herein, the term "coat protein(s)"
refers to the protein(s) of a bacteriophage or a RNA-phage capable
of being incorporated within the capsid assembly of the
bacteriophage or the RNA-phage. However, when referring to the
specific gene product of the coat protein gene of RNA-phages the
term "CP" is used. For example, the specific gene product of the
coat protein gene of RNA-phage Q.beta. is referred to as "Q.beta.
CP", whereas the "coat proteins" of bacteriophage Q.beta. comprise
the "Q.beta. CP" as well as the Al protein. The capsid of
Bacteriophage Q.beta. is composed mainly of the Q.beta. CP, with a
minor content of the A1 protein. Likewise, the VLP Q.beta. coat
protein contains mainly Q.beta. CP, with a minor content of A1
protein.
[0122] Coupled: As used herein, the term "coupled" refers to
attachment by covalent bonds or by strong non-covalent
interactions. Any method normally used by those skilled in the art
for the coupling of biologically active materials can be used in
the present invention.
[0123] Fusion: As used herein, the term "fusion" refers to the
combination of amino acid sequences of different origin in one
polypeptide chain by in-frame combination of their coding
nucleotide sequences. The term "fusion" explicitly encompasses
internal fusions, i.e., insertion of sequences of different origin
within a polypeptide chain, in addition to fusion to one of its
termini.
[0124] CpG: As used herein, the term "CpG" refers to an
oligonucleotide which contains an unmethylated cytosine, guanine
dinucleotide sequence (e.g.
[0125] "CpG DNA" or DNA containing a cytosine followed by guanosine
and linked by a phosphate bond) and stimulates/activates, e.g. has
a mitogenic effect on, or induces or increases cytokine expression
by, a vertebrate cell. For example, CpGs can be useful in
activating B cells, NK cells and antigen-presenting cells, such as
monocytes, dendritic cells and macrophages, and T cells. The CpGs
can include nucleotide analogs such as analogs containing
phosphorothioester bonds and can be double-stranded or
single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity.
[0126] Epitope: As used herein, the term "epitope" refers to
portions of a polypeptide having antigenic or immunogenic activity
in an animal, preferably a mammal, and most preferably in a human.
An "immunogenic epitope," as used herein, is defined as a portion
of a polypeptide that elicits an antibody response or induces a
T-cell response in an animal, as determined by any method known in
the art. (See, for example, Geysen et al., Proc. Natl. Acad. Sci.
USA 81:3998-4002 (1983)). The term "antigenic epitope," as used
herein, is defined as a portion of a protein to which an antibody
can immunospecifically bind its antigen as determined by any method
well known in the art. Immunospecific binding excludes non-specific
binding but does not necessarily exclude cross-reactivity with
other antigens. Antigenic epitopes need not necessarily be
immunogenic. Antigenic epitopes can also be T-cell epitopes, in
which case they can be bound immunospecifically by a T-cell
receptor within the context of an MHC molecule.
[0127] An epitope can comprise 3 amino acids in a spatial
conformation which is unique to the epitope. Generally, an epitope
consists of at least about 5 such amino acids, and more usually,
consists of at least about 8-10 such amino acids. If the epitope is
an organic molecule, it may be as small as Nitrophenyl.
[0128] Immune response: As used herein, the term "immune response"
refers to a humoral immune response and/or cellular immune response
leading to the activation or proliferation of B- and/or
T-lymphocytes. In some instances, however, the immune responses may
be of low intensity and become detectable only when using at least
one substance in accordance with the invention. "Immunogenic"
refers to an agent used to stimulate the immune system of a living
organism, so that one or more functions of the immune system are
increased and directed towards the immunogenic agent. An
"immunogenic polypeptide" is a polypeptide that elicits a cellular
and/or humoral immune response, whether alone or linked to a
carrier in the presence or absence of an adjuvant.
[0129] Immunization: As used herein, the terms "immunize" or
"immunization" or related terms refer to conferring the ability to
mount a substantial immune response (comprising antibodies or
cellular immunity such as effector CTL) against a target antigen or
epitope. These terms do not require that complete immunity be
created, but rather that an immune response be produced which is
substantially greater than baseline. For example, a mammal may be
considered to be immunized against a target antigen if the cellular
and/or humoral immune response to the target antigen occurs
following the application of methods of the invention.
[0130] Immunostimulatory nucleic acid: As used herein, the term
immunostimulatory nucleic acid refers to a nucleic acid capable of
inducing and/or enhancing an immune response. Immunostimulatory
nucleic acids, as used herein, comprise ribonucleic acids and in
particular deoxyribonucleic acids. Preferably, immunostimulatory
nucleic acids contain at least one CpG motif e.g. a CG dinucleotide
in which the C is unmethylated. The CG dinucleotide can be part of
a palindromic sequence or can be encompassed within a
non-palindromic sequence. Immunostimulatory nucleic acids not
containing CpG motifs as described above encompass, by way of
example, nucleic acids lacking CpG dinucleotides, as well as
nucleic acids containing CG motifs with a methylated CG
dinucleotide. The term "immunostimulatory nucleic acid" as used
herein should also refer to nucleic acids that contain modified
bases such as 4-bromo-cytosine.
[0131] Immunostimulatory substance: As used herein, the term
"immunostimulatory substance" refers to a substance capable of
inducing and/or enhancing an immune response. Immunostimulatory
substances, as used herein, include, but are not limited to,
toll-like receptor activing substances and substances inducing
cytokine secretion. Toll-like receptor activating substances
include, but are not limited to, immunostimulatory nucleic acids,
peptideoglycans, lipopolysaccharides, lipoteichonic acids,
imidazoquinoline compounds, flagellins, lipoproteins, and
immunostimulatory organic substances such as taxol.
[0132] Natural origin: As used herein, the term "natural origin"
means that the whole or parts thereof are not synthetic and exist
or are produced in nature.
[0133] Non-natural: As used herein, the term generally means not
from nature, more specifically, the term means from the hand of
man.
[0134] Non-natural origin: As used herein, the term "non-natural
origin" generally means synthetic or not from nature; more
specifically, the term means from the hand of man.
[0135] Ordered and repetitive antigen or antigenic determinant
array: As used herein, the term "ordered and repetitive antigen or
antigenic determinant array" generally refers to a repeating
pattern of antigen or antigenic determinant, characterized by a
typically and preferably uniform spacial arrangement of the
antigens or antigenic determinants with respect to the core
particle and virus-like particle, respectively. In one embodiment
of the invention, the repeating pattern may be a geometric pattern.
Typical and preferred examples of suitable ordered and repetitive
antigen or antigenic determinant arrays are those which possess
strictly repetitive paracrystalline orders of antigens or antigenic
determinants, preferably with spacings of 0.5 to 30 nanometers,
more preferably 5 to 15 nanometers.
[0136] Oligonucleotide: As used herein, the terms "oligonucleotide"
or "oligomer" refer to a nucleic acid sequence comprising 2 or more
nucleotides, generally at least about 6 nucleotides to about
100,000 nucleotides, preferably about 6 to about 2000 nucleotides,
and more preferably about 6 to about 300 nucleotides, even more
preferably about 20 to about 300 nucleotides, and even more
preferably about 20 to about 100 nucleotides. The terms
"oligonucleotide" or "oligomer" also refer to a nucleic acid
sequence comprising more than 100 to about 2000 nucleotides,
preferably more than 100 to about 1000 nucleotides, and more
preferably more than 100 to about 500 nucleotides.
"Oligonucleotide" also generally refers to any polyribonucleotide
or polydeoxribonucleotide, which may be unmodified RNA or DNA or
modified RNA or DNA. "Oligonucleotide" includes, without
limitation, single- and double-stranded DNA, DNA that is a mixture
of single- and double-stranded regions, single- and double-stranded
RNA, and RNA that is mixture of single- and double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or a mixture of
single- and double-stranded regions. In addition, "oligonucleotide"
refers to triple-stranded regions comprising RNA or DNA or both RNA
and DNA. Further, an oligonucleotide can be synthetic, genomic or
recombinant, e.g., X-DNA, cosmid DNA, artificial bacterial
chromosome, yeast artificial chromosome and filamentous phage such
as M13.
[0137] The term "oligonucleotide" also includes DNAs or RNAs
containing one or more modified bases and DNAs or RNAs with
backbones modified for stability or for other reasons. For example,
suitable nucleotide modifications/analogs include peptide nucleic
acid, inosin, tritylated bases, phosphorothioates,
alkylphosphorothioates, 5-nitroindole deoxyribofuranosyl,
5-methyldeoxycytosine and 5,6-dihydro-5,6-dihydroxyde-
oxythymidine. A variety of modifications have been made to DNA and
RNA; thus, "oligonucleotide" embraces chemically, enzymatically or
metabolically modified forms of polynucleotides as typically found
in nature, as well as the chemical forms of DNA and RNA
characteristic of viruses and cells. Other nucleotide
analogs/modifications will be evident to those skilled in the
art.
[0138] Packaged: The term "packaged" as used herein refers to the
state of an immunostimulatory substance, in particular an
immunostimulatory nucleic acid in relation to the VLP. The term
"packaged" as used herein includes binding that may be covalent,
e.g., by chemically coupling, or non-covalent, e.g., ionic
interactions, hydrophobic interactions, hydrogen bonds, etc.
Covalent bonds can be, for example, ester, ether, phosphoester,
amide, peptide, imide, carbon-sulfur bonds, carbon-phosphorus
bonds, and the like. The term also includes the enclosement, or
partial enclosement, of a substance. The term "packaged" includes
terms such as "coupled, "enclosed" and "attached." For example, the
immunostimulatory substance such as the unmethylated CpG-containing
oligonucleotide can be enclosed by the VLP without the existence of
an actual binding, neither covalently nor non-covalently. In
preferred embodiments, in particular, if immunostimulatory nucleic
acids are the immunostimulatory substances, the term "packaged"
indicates that the nucleic acid in a packaged state is not
accessible to DNAse or RNAse hydrolysis. In preferred embodiments,
the immunostimulatory nucleic acid is packaged inside the VLP
capsids, most preferably in a non-covalent manner.
[0139] The compositions of the invention can be combined,
optionally, with a pharmaceutically-acceptable carrier. The term
"pharmaceutically-accepta- ble carrier" as used herein means one or
more compatible solid or liquid fillers, diluents or encapsulating
substances which are suitable for administration into a human or
other animal. The term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application.
[0140] Organic molecule: As used herein, the term "organic
molecule" refers to any chemical entity of natural or synthetic
origin. In particular the term "organic molecule" as used herein
encompasses, for example, any molecule being a member of the group
of nucleotides, lipids, carbohydrates, polysaccharides,
lipopolysaccharides, steroids, alkaloids, terpenes and fatty acids,
being either of natural or synthetic origin. In particular, the
term "organic molecule" encompasses molecules such as nicotine,
cocaine, heroin or other pharmacologically active molecules
contained in drugs of abuse. In general an organic molecule
contains or is modified to contain a chemical functionality
allowing its coupling, binding or other method of attachment to the
virus-like particle in accordance with the invention.
[0141] Polypeptide: As used herein, the term "polypeptide" refers
to a molecule composed of monomers (amino acids) linearly linked by
amide bonds (also known as peptide bonds). It indicates a molecular
chain of amino acids and does not refer to a specific length of the
product. Thus, peptides, oligopeptides and proteins are included
within the definition of polypeptide. This term is also intended to
refer to post-expression modifications of the polypeptide, for
example, glycosolations, acetylations, phosphorylations, and the
like. A recombinant or derived polypeptide is not necessarily
translated from a designated nucleic acid sequence. It may also be
generated in any manner, including chemical synthesis.
[0142] A substance which "enhances" an immune response refers to a
substance in which an immune response is observed that is greater
or intensified or deviated in any way with the addition of the
substance when compared to the same immune response measured
without the addition of the substance. For example, the lytic
activity of cytotoxic T cells can be measured, e.g. using a
.sup.51Cr release assay, with and without the substance.
[0143] The amount of the substance at which the CTL lytic activity
is enhanced as compared to the CTL lytic activity without the
substance is said to be an amount sufficient to enhance the immune
response of the animal to the antigen. In a preferred embodiment,
the immune response in enhanced by a factor of at least about 2,
more preferably by a factor of about 3 or more. The amount of
cytokines secreted may also be altered.
[0144] Effective Amount: As used herein, the term "effective
amount" refers to an amount necessary or sufficient to realize a
desired biologic effect. An effective amount of the composition
would be the amount that achieves this selected result, and such an
amount could be determined as a matter of routine by a person
skilled in the art. For example, an effective amount for treating
an immune system deficiency could be that amount necessary to cause
activation of the immune system, resulting in the development of an
antigen specific immune response upon exposure to antigen. The term
is also synonymous with "sufficient amount."
[0145] The effective amount for any particular application can vary
depending on such factors as the disease or condition being
treated, the particular composition being administered, the size of
the subject, and/or the severity of the disease or condition. One
of ordinary skill in the art can empirically determine the
effective amount of a particular composition of the present
invention without necessitating undue experimentation.
[0146] Self antigen: As used herein, the tem "self antigen" refers
to proteins encoded by the host's DNA and products generated by
proteins or RNA encoded by the host's DNA are defined as self. In
addition, proteins that result from a combination of two or several
self-molecules or that represent a fraction of a self-molecule and
proteins that have a high homology two self-molecules as defined
above (>95%, preferably >97%, more preferably >99%) may
also be considered self. In a further preferred embodiment of the
present invention, the antigen is a self antigen. Very preferred
embodiments of self-antigens useful for the present invention are
described WO 02/056905, the disclosures of which are herewith
incorporated by reference in its entirety.
[0147] Treatment: As used herein, the terms "treatment", "treat",
"treated" or "treating" refer to prophylaxis and/or therapy. When
used with respect to an infectious disease, for example, the term
refers to a prophylactic treatment which increases the resistance
of a subject to infection with a pathogen or, in other words,
decreases the likelihood that the subject will become infected with
the pathogen or will show signs of illness attributable to the
infection, as well as a treatment after the subject has become
infected in order to fight the infection, e.g., reduce or eliminate
the infection or prevent it from becoming worse.
[0148] Vaccine: As used herein, the term "vaccine" refers to a
formulation which contains the composition of the present invention
and which is in a form that is capable of being administered to an
animal. Typically, the vaccine comprises a conventional saline or
buffered aqueous solution medium in which the composition of the
present invention is suspended or dissolved. In this form, the
composition of the present invention can be used conveniently to
prevent, ameliorate, or otherwise treat a condition. Upon
introduction into a host, the vaccine is able to provoke an immune
response including, but not limited to, the production of
antibodies, cytokines and/or other cellular responses.
[0149] Optionally, the vaccine of the present invention
additionally includes an adjuvant which can be present in either a
minor or major proportion relative to the compound of the present
invention. The term "adjuvant" as used herein refers to
non-specific stimulators of the immune response or substances that
allow generation of a depot in the host which when combined with
the vaccine of the present invention provide for an even more
enhanced immune response. A variety of adjuvants can be used.
Examples include incomplete Freund's adjuvant, aluminum hydroxide
and modified muramyldipeptide. The term "adjuvant" as used herein
also refers to typically specific stimulators of the immune
response which when combined with the vaccine of the present
invention provide for an even more enhanced and typically specific
immune response. Examples include, but limited to, GM-CSF, IL-2,
IL-12, IFN.alpha.. Further examples are within the knowledge of the
person skilled in the art.
[0150] Virus-like particle: As used herein, the term "virus-like
particle" refers to a structure resembling a virus particle but
which has not been demonstrated to be pathogenic. Typically, a
virus-like particle in accordance with the invention does not carry
genetic information encoding for the proteins of the virus-like
particle. In general, virus-like particles lack the viral genome
and, therefore, are noninfectious. Also, virus-like particles can
often be produced in large quantities by heterologous expression
and can be easily purified. Some virus-like particles may contain
nucleic acid distinct from their genome. As indicated, a virus-like
particle in accordance with the invention is non replicative and
noninfectious since it lacks all or part of the viral genome, in
particular the replicative and infectious components of the viral
genome. A virus-like particle in accordance with the invention may
contain nucleic acid distinct from their genome. A typical and
preferred embodiment of a virus-like particle in accordance with
the present invention is a viral capsid such as the viral capsid of
the corresponding virus, bacteriophage, or RNA-phage. The terms
"viral capsid" or "capsid", as interchangeably used herein, refer
to a macromolecular assembly composed of viral protein subunits.
Typically and preferably, the viral protein subunits assemble into
a viral capsid and capsid, respectively, having a structure with an
inherent repetitive organization, wherein said structure is,
typically, spherical or tubular. For example, the capsids of
RNA-phages or HBcAg's have a spherical form of icosahedral
symmetry. The term "capsid-like structure" as used herein, refers
to a macromolecular assembly composed of viral protein subunits
ressembling the capsid morphology in the above defined sense but
deviating from the typical symmetrical assembly while maintaining a
sufficient degree of order and repetitiveness.
[0151] Virus-like particle of a bacteriophage: As used herein, the
term "virus-like particle of a bacteriophage" refers to a
virus-like particle resembling the structure of a bacteriophage,
being non replicative and noninfectious, and lacking at least the
gene or genes encoding for the replication machinery of the
bacteriophage, and typically also lacking the gene or genes
encoding the protein or proteins responsible for viral attachment
to or entry into the host. This definition should, however, also
encompass virus-like particles of bacteriophages, in which the
aforementioned gene or genes are still present but inactive, and,
therefore, also leading to non-replicative and noninfectious
virus-like particles of a bacteriophage.
[0152] VLP of RNA phage coat protein: The capsid structure formed
from the self-assembly of 180 subunits of RNA phage coat protein
and optionally containing host RNA is referred to as a "VLP of RNA
phage coat protein". A specific example is the VLP of Q.beta. coat
protein. In this particular case, the VLP of Q.beta. coat protein
may either be assembled exclusively from Q.beta. CP subunits
(generated by expression of a Q.beta. CP gene containing, for
example, a TAA stop codon precluding any expression of the longer
A1 protein through suppression, see Kozlovska, T. M., et al.,
Intervirology 39: 9-15 (1996)), or additionally contain A1 protein
subunits in the capsid assembly.
[0153] The term "virus particle" as used herein refers to the
morphological form of a virus. In some virus types it comprises a
genome surrounded by a protein capsid; others have additional
structures (e.g., envelopes, tails, etc.).
[0154] Non-enveloped viral particles are made up of a proteinaceous
capsid that surrounds and protects the viral genome. Enveloped
viruses also have a capsid structure surrounding the genetic
material of the virus but, in addition, have a lipid bilayer
envelope that surrounds the capsid. In a preferred embodiment of
the invention, the VLP's are free of a lipoprotein envelope or a
lipoprotein-containing envelope. In a further preferred embodiment,
the VLP's are free of an envelope altogether.
[0155] One, a, or an: When the terms "one," "a," or "an" are used
in this disclosure, they mean "at least one" or "one or more,"
unless otherwise indicated.
[0156] As will be clear to those skilled in the art, certain
embodiments of the invention involve the use of recombinant nucleic
acid technologies such as cloning, polymerase chain reaction, the
purification of DNA and RNA, the expression of recombinant proteins
in prokaryotic and eukaryotic cells, etc. Such methodologies are
well known to those skilled in the art and can be conveniently
found in published laboratory methods manuals (e.g., Sambrook, J.
et al., eds., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989); Ausubel, F. et al., eds., CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John H. Wiley & Sons, Inc. (1997)). Fundamental
laboratory techniques for working with tissue culture cell lines
(Celis, J., ed., CELL BIOLOGY, Academic Press, 2.sup.nd edition,
(1998)) and antibody-based technologies (Harlow, E. and Lane, D.,
"Antibodies: A Laboratory Manual," Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y. (1988); Deutscher, M. P., "Guide to
Protein Purification," Meth. Enzymol. 128, Academic Press San Diego
(1990); Scopes, R. K., "Protein Purification Principles and
Practice," 3.sup.rd ed., Springer-Verlag, New York (1994)) are also
adequately described in the literature, all of which are
incorporated herein by reference.
[0157] 2. Compositions and Methods for Enhancing an Immune
Response
[0158] The disclosed invention provides compositions and methods
for enhancing an immune response against one or more antigens in an
animal.
[0159] Compositions of the invention comprise, or alternatively
consist of, a virus-like particle and an immunostimulatory
substance, preferably an immunostimulatory nucleic acid, and even
more preferably an unmethylated CpG-containing oligonucleotide
where the an immunostimulatory substance, the immunostimulatory
nucleic acid or the oligonucleotide is bound to the virus-like
particle. Furthermore, the invention conveniently enables the
practitioner to construct such a composition for various treatment
and/or prophylactic prevention purposes, which include the
prevention and/or treatment of infectious diseases, as well as
chronic infectious diseases, and the prevention and/or treatment of
cancers, for example.
[0160] Virus-like particles in the context of the present
application refer to structures resembling a virus particle but
which are not pathogenic. In general, virus-like particles lack the
viral genome and, therefore, are noninfectious. Also, virus-like
particles can be produced in large quantities by heterologous
expression and can be easily purified.
[0161] In a preferred embodiment, the virus-like particle is a
recombinant virus-like particle. The skilled artisan can produce
VLPs using recombinant DNA technology and virus coding sequences
which are readily available to the public. For example, the coding
sequence of a virus envelope or core protein can be engineered for
expression in a baculovirus expression vector using a commercially
available baculovirus vector, under the regulatory control of a
virus promoter, with appropriate modifications of the sequence to
allow functional linkage of the coding sequence to the regulatory
sequence. The coding sequence of a virus envelope or core protein
can also be engineered for expression in a bacterial expression
vector, for example.
[0162] Examples of VLPs include, but are not limited to, the capsid
proteins of Hepatitis B virus (Ulrich, et al, Virus Res. 50:141-182
(1998)), measles virus (Warnes, et al., Gene 160:173-178 (1995)),
Sindbis virus, rotavirus (U.S. Pat. Nos. 5,071,651 and 5,374,426),
foot-and-mouth-disease virus (Twomey, et al., Vaccine 13:1603-1610,
(1995)), Norwalk virus (Jiang, X., et al., Science 250:1580-1583
(1990); Matsui, S. M., et al., J Clin. Invest. 87:1456-1461
(1991)), the retroviral GAG protein (PCT Patent Appl. No. WO
96/30523), the retrotransposon Ty protein p1, the surface protein
of Hepatitis B virus (WO 92/11291), human papilloma virus (WO
98/15631), human polyoma virus (Sasnauskas K., et al., Biol. Chem.
380(3):381-386 (1999); Sasnauskas K., et al., Generation of
recombinant virus-like particles of different polyomaviruses in
yeast. 3.sup.rd Interational Workshop "Virus-like particles as
vaccines." Berlin, September 26-29 (2001)), RNA phages, Ty,
fr-phage, GA-phage, AP 205-phage and, in particular,
Q.beta.-phage.
[0163] As will be readily apparent to those skilled in the art, the
VLP of the invention is not limited to any specific form. The
particle can be synthesized chemically or through a biological
process, which can be natural or non-natural. By way of example,
this type of embodiment includes a virus-like particle or a
recombinant form thereof. In a more specific embodiment, the VLP
can comprise, or alternatively consist of, recombinant polypeptides
of Rotavirus; recombinant polypeptides of Norwalk virus;
recombinant polypeptides of Alphavirus; recombinant proteins which
form bacterial pili or pilus-like structures; recombinant
polypeptides of Foot and Mouth Disease virus; recombinant
polypeptides of measles virus, recombinant polypeptides of Sindbis
virus, recombinant polypeptides of Retrovirus; recombinant
polypeptides of Hepatitis B virus (e.g., a HBcAg); recombinant
polypeptides of Tobacco mosaic virus; recombinant polypeptides of
Flock House Virus; recombinant polypeptides of human
Papillomavirus; recombinant polypeptides of Polyoma virus and, in
particular, recombinant polypeptides of human Polyoma virus, and in
particular recombinant polypeptides of BK virus; recombinant
polypeptides of bacteriophages, recombinant polypeptides of RNA
phages; recombinant polypeptides of Ty; recombinant polypeptides of
fr-phage, recombinant polypeptides of GA-phage, recombinant
polypeptides of AP 205-phage and, in particular, recombinant
polypeptides of Q.beta.-phage. The virus-like particle can further
comprise, or alternatively consist of, one or more fragments of
such polypeptides, as well as variants of such polypeptides.
Variants of polypeptides can share, for example, at least 80%, 85%,
90%, 95%, 97%, or 99% identity at the amino acid level with their
wild-type counterparts.
[0164] In a preferred embodiment, the virus-like particle
comprises, consists essentially of, or alternatively consists of
recombinant proteins, or fragments thereof, of a RNA-phage.
Preferably, the RNA-phage is selected from the group consisting of
a) bacteriophage Q.beta.; b) bacteriophage R17; c) bacteriophage
fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2;
g) bacteriophage Ml 1; h) bacteriophage MX1; i) bacteriophage NL95;
k) bacteriophage f2; and 1) bacteriophage PP7.
[0165] In another preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively consists
essentially of, or alternatively consists of recombinant proteins,
or fragments thereof, of the RNA-bacteriophage Q.beta. or of the
RNA-bacteriophage fr.
[0166] In a further preferred embodiment of the present invention,
the recombinant proteins comprise, or alternatively consist
essentially of, or alternatively consist of coat proteins of RNA
phages.
[0167] RNA-phage coat proteins forming capsids or VLPs, or
fragments of the bacteriophage coat proteins compatible with
self-assembly into a capsid or a VLP, are, therefore, further
preferred embodiments of the present invention. Bacteriophage
Q.beta. coat proteins, for example, can be expressed recombinantly
in E. coli. Further, upon such expression these proteins
spontaneously form capsids. Additionally, these capsids form a
structure with an inherent repetitive organization.
[0168] Specific preferred examples of bacteriophage coat proteins
which can be used to prepare compositions of the invention include
the coat proteins of RNA bacteriophages such as bacteriophage
Q.beta. (SEQ ID NO:10; PIR Database, Accession No. VCBPQ.beta.
referring to Q.beta. CP and SEQ ID NO: 11; Accession No. AAA16663
referring to Q.beta. A1 protein), bacteriophage R17 (SEQ ID NO:12;
PIR Accession No. VCBPR7), bacteriophage fr (SEQ ID NO:13; PIR
Accession No. VCBPFR), bacteriophage GA (SEQ ID NO:14; GenBank
Accession No. NP-040754), bacteriophage SP (SEQ ID NO:15; GenBank
Accession No. CAA30374 referring to SP CP and SEQ ID NO: 16;
Accession No. referring to SP A1 protein), bacteriophage MS2 (SEQ
ID NO:17; PIR Accession No. VCBPM2), bacteriophage M11 (SEQ ID
NO:18; GenBank Accession No. AAC06250), bacteriophage MX1 (SEQ ID
NO:19; GenBank Accession No. AAC14699), bacteriophage NL95 (SEQ ID
NO:20; GenBank Accession No. AAC14704), bacteriophage f2 (SEQ ID
NO: 21; GenBank Accession No. P03611), bacteriophage PP7 (SEQ ID
NO: 22). Furthermore, the A1 protein of bacteriophage Q.beta. or
C-terminal truncated forms missing as much as 100, 150 or 180 amino
acids from its C-terminus may be incorporated in a capsid assembly
of Q.beta. coat proteins. Generally, the percentage of Q.beta. A1
protein relative to Q.beta. CP in the capsid assembly will be
limited, in order to ensure capsid formation.
[0169] Q.beta. coat protein has also been found to self-assemble
into capsids when expressed in E. coli (Kozlovska T M. et al., GENE
137: 133-137 (1993)). The obtained capsids or virus-like particles
showed an icosahedral phage-like capsid structure with a diameter
of 25 nm and T=3 quasi symmetry. Further, the crystal structure of
phage Q.beta. has been solved. The capsid contains 180 copies of
the coat protein, which are linked in covalent pentamers and
hexamers by disulfide bridges (Golmohammadi, R. et al., Structure
4: 543-5554 (1996)) leading to a remarkable stability of the capsid
of Q.beta. coat protein. Capsids or VLPs made from recombinant
Q.beta. coat protein may contain, however, subunits not linked via
disulfide links to other subunits within the capsid, or
incompletely linked. Thus, upon loading recombinant Q.beta. capsid
on non-reducing SDS-PAGE, bands corresponding to monomeric Q.beta.
coat protein as well as bands corresponding to the hexamer or
pentamer of Q.beta. coat protein are visible. Incompletely
disulfide-linked subunits could appear as dimer, trimer or even
tetramer bands in non-reducing SDS-PAGE. Q.beta. capsid protein
also shows unusual resistance to organic solvents and denaturing
agents. Surprisingly, we have observed that DMSO and acetonitrile
concentrations as high as 30%, and Guanidinium concentrations as
high as 1 M do not affect the stability of the capsid. The high
stability of the capsid of Q.beta. coat protein is an advantageous
feature, in particular, for its use in immunization and vaccination
of mammals and humans in accordance of the present invention.
[0170] Upon expression in E. coli, the N-terminal methionine of
Q.beta. coat protein is usually removed, as we observed by
N-terminal Edman sequencing as described in Stoll, E. et al. J.
Biol. Chem. 252:990-993 (1977). VLP composed from Q.beta. coat
proteins where the N-terminal methionine has not been removed, or
VLPs comprising a mixture of Q.beta. coat proteins where the
N-terminal methionine is either cleaved or present are also within
the scope of the present invention.
[0171] Further RNA phage coat proteins have also been shown to
self-assemble upon expression in a bacterial host (Kastelein, RA.
et al., Gene 23: 245-254 (1983), Kozlovskaya, T M. et al., Dokl.
Akad. Nauk SSSR 287: 452-455 (1986), Adhin, MR. et al., Virology
170: 238-242 (1989), Ni, CZ., et al., Protein Sci. 5: 2485-2493
(1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)). The
Q.beta. phage capsid contains, in addition to the coat protein, the
so called read-through protein A1 and the maturation protein A2. A1
is generated by suppression at the UGA stop codon and has a length
of 329 aa. The capsid of phage Q.beta. recombinant coat protein
used in the invention is devoid of the A2 lysis protein, and
contains RNA from the host. The coat protein of RNA phages is an
RNA binding protein, and interacts with the stem loop of the
ribosomal binding site of the replicase gene acting as a
translational repressor during the life cycle of the virus. The
sequence and structural elements of the interaction are known
(Witherell, G W. & Uhlenbeck, O C. Biochemistry 28: 71-76
(1989); Lim F. et al., J. Biol. Chem. 271: 31839-31845 (1996)). The
stem loop and RNA in general are known to be involved in the virus
assembly (Golmohammadi, R. et al., Structure 4: 543-5554
(1996)).
[0172] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively consists
essentially of, or alternatively consists of recombinant proteins,
or fragments thereof, of a RNA-phage, wherein the recombinant
proteins comprise, consist essentially of or alternatively consist
of mutant coat proteins of a RNA phage, preferably of mutant coat
proteins of the RNA phages mentioned above. In another preferred
embodiment, the mutant coat proteins of the RNA phage have been
modified by removal of at least one lysine residue by way of
substitution, or by addition of at least one lysine residue by way
of substitution; alternatively, the mutant coat proteins of the RNA
phage have been modified by deletion of at least one lysine
residue, or by addition of at least one lysine residue by way of
insertion.
[0173] In another preferred embodiment, the virus-like particle
comprises, or alternatively consists essentially of, or
alternatively consists of recombinant proteins, or fragments
thereof, of the RNA-bacteriophage Q.beta., wherein the recombinant
proteins comprise, or alternatively consist essentially of, or
alternatively consist of coat proteins having an amino acid
sequence of SEQ ID NO:10, or a mixture of coat proteins having
amino acid sequences of SEQ ID NO:10 and of SEQ ID NO: 11 or
mutants of SEQ ID NO: 11 and wherein the N-terminal methionine is
preferably cleaved.
[0174] In a further preferred embodiment of the present invention,
the virus-like particle comprises, consists essentially of or
alternatively consists of recombinant proteins of Q.beta., or
fragments thereof, wherein the recombinant proteins comprise, or
alternatively consist essentially of, or alternatively consist of
mutant Q.beta. coat proteins. In another preferred embodiment,
these mutant coat proteins have been modified by removal of at
least one lysine residue by way of substitution, or by addition of
at least one lysine residue by way of substitution. Alternatively,
these mutant coat proteins have been modified by deletion of at
least one lysine residue, or by addition of at least one lysine
residue by way of insertion.
[0175] Four lysine residues are exposed on the surface of the
capsid of Q.beta. coat protein. Q.beta. mutants, for which exposed
lysine residues are replaced by arginines can also be used for the
present invention. The following Q.beta. coat protein mutants and
mutant Q.beta. VLPs can, thus, be used in the practice of the
invention: "Q.beta.-240" (Lys13-Arg; SEQ ID NO:23), "Q.beta.-243"
(Asn 10-Lys; SEQ ID NO:24), "Q.beta.-250" (Lys 2-Arg, Lys13-Arg;
SEQ ID NO:25), "Q.beta.-251" (SEQ ID NO:26) and "Q.beta.-259" (Lys
2-Arg, Lys16-Arg; SEQ ID NO:27). Thus, in further preferred
embodiment of the present invention, the virus-like particle
comprises, consists essentially of or alternatively consists of
recombinant proteins of mutant Q.beta. coat proteins, which
comprise proteins having an amino acid sequence selected from the
group of a) the amino acid sequence of SEQ ID NO: 23; b) the amino
acid sequence of SEQ ID NO:24; c) the amino acid sequence of SEQ ID
NO: 25; d) the amino acid sequence of SEQ ID NO:26; and e) the
amino acid sequence of SEQ ID NO: 27. The construction, expression
and purification of the above indicated Q.beta. coat proteins,
mutant Q.beta. coat protein VLPs and capsids, respectively, are
disclosed in pending U.S. application Ser. No. 10/050,902 filed on
Jan. 18, 2002. In particular is hereby referred to Example 18 of
above mentioned application.
[0176] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively consists
essentially of, or alternatively consists of recombinant proteins
of Q.beta., or fragments thereof, wherein the recombinant proteins
comprise, consist essentially of or alternatively consist of a
mixture of either one of the foregoing Q.beta. mutants and the
corresponding A1 protein.
[0177] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively essentially
consists of, or alternatively consists of recombinant proteins, or
fragments thereof, of RNA-phage AP205.
[0178] The AP205 genome consists of a maturation protein, a coat
protein, a replicase and two open reading frames not present in
related phages; a lysis gene and an open reading frame playing a
role in the translation of the maturation gene (Klovins, J., et
al., J. Gen. Virol. 83: 1523-33 (2002)). AP205 coat protein can be
expressed from plasmid pAP283-58 (SEQ ID NO: 79), which is a
derivative of pQb10 (Kozlovska, T. M. et al., Gene 137:133-37
(1993)), and which contains an AP205 ribosomal binding site.
Alternatively, AP205 coat protein may be cloned into pQb185,
downstream of the ribosomal binding site present in the vector.
Both approaches lead to expression of the protein and formation of
capsids as described in the co-pending US provisional patent
application with the title "Molecular Antigen Arrays" (Application
No. 60/396,126) and having been filed on Jul. 17, 2002, which is
incorporated by reference in its entirety. Vectors pQb10 and pQb185
are vectors derived from pGEM vector, and expression of the cloned
genes in these vectors is controlled by the trp promoter
(Kozlovska, T. M. et al., Gene 137:133-37 (1993)). Plasmid
pAP283-58 (SEQ ID NO:79) comprises a putative AP205 ribosomal
binding site in the following sequence, which is downstream of the
XbaI site, and immediately upstream of the ATG start codon of the
AP205 coat protein: tctagaATTTTCTGCGCACCCAT
CCCGGGTGGCGCCCAAAGTGAGGAAAATCACatg. The vector pQb185 comprises a
Shine Delagarno sequence downstream from the XbaI site and upstream
of the start codon (tctagaTTAACCCAACGCGTAGGAGTCAGGCCatg, Shine
Delagarno sequence underlined).
[0179] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively essentially
consists of, or alternatively consists of recombinant coat
proteins, or fragments thereof, of the RNA-phage AP205.
[0180] This preferred embodiment of the present invention, thus,
comprises AP205 coat proteins that form capsids. Such proteins are
recombinantly expressed, or prepared from natural sources. AP205
coat proteins produced in bacteria spontaneously form capsids, as
evidenced by Electron Microscopy (EM) and immunodiffusion. The
structural properties of the capsid formed by the AP205 coat
protein (SEQ ID NO: 80) and those formed by the coat protein of the
AP205 RNA phage are nearly indistinguishable when seen in EM. AP205
VLPs are highly immunogenic, and can be linked with antigens and/or
antigenic determinants to generate vaccine constructs displaying
the antigens and/or antigenic determinants oriented in a repetitive
manner. High titers are elicited against the so displayed antigens
showing that bound antigens and/or antigenic determinants are
accessible for interacting with antibody molecules and are
immunogenic.
[0181] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively essentially
consists of, or alternatively consists of recombinant mutant coat
proteins, or fragments thereof, of the RNA-phage AP205.
[0182] Assembly-competent mutant forms of AP205 VLPs, including
AP205 coat protein with the subsitution of proline at amino acid 5
to threonine (SEQ ID NO: 81), may also be used in the practice of
the invention and leads to a further preferred embodiment of the
invention. These VLPs, AP205 VLPs derived from natural sources, or
AP205 viral particles, may be bound to antigens to produce ordered
repetitive arrays of the antigens in accordance with the present
invention.
[0183] AP205 P5-T mutant coat protein can be expressed from plasmid
pAP281-32 (SEQ ID No. 82), which is derived directly from pQb185,
and which contains the mutant AP205 coat protein gene instead of
the Q.beta. coat protein gene. Vectors for expression of the AP205
coat protein are transfected into E. coli for expression of the
AP205 coat protein.
[0184] Methods for expression of the coat protein and the mutant
coat protein, respectively, leading to self-assembly into VLPs are
described in co-pending U.S. provisional patent application with
the title "Molecular Antigen Arrays" Application No. 60/396,126)
and having been filed on Jul. 17, 2002, which is incorporated by
reference in its entirety. Suitable E. coli strains include, but
are not limited to, E. coli K802, JM 109, RR1. Suitable vectors and
strains and combinations thereof can be identified by testing
expression of the coat protein and mutant coat protein,
respectively, by SDS-PAGE and capsid formation and assembly by
optionally first purifying the capsids by gel filtration and
subsequently testing them in an immunodiffusion assay (Ouchterlony
test) or Electron Microscopy (Kozlovska, T. M. et al., Gene
137:133-37 (1993)).
[0185] AP205 coat proteins expressed from the vectors
pAP.sup.283-58 and AP281-32 may be devoid of the initial Methionine
amino-acid, due to processing in the cytoplasm of E. coli. Cleaved,
uncleaved forms of AP205 VLP, or mixtures thereof are further
preferred embodiments of the invention.
[0186] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively essentially
consists of, or alternatively consists of a mixture of recombinant
coat proteins, or fragments thereof, of the RNA-phage AP205 and of
recombinant mutant coat proteins, or fragments thereof, of the
RNA-phage AP205.
[0187] In a further preferred embodiment of the present invention,
the virus-like particle comprises, or alternatively essentially
consists of, or alternatively consists of fragments of recombinant
coat proteins or recombinant mutant coat proteins of the RNA-phage
AP205.
[0188] Recombinant AP205 coat protein fragments capable of
assembling into a VLP and a capsid, respectively are also useful in
the practice of the invention. These fragments may be generated by
deletion, either internally or at the termini of the coat protein
and mutant coat protein, respectively. Insertions in the coat
protein and mutant coat protein sequence or fusions of antigen
sequences to the coat protein and mutant coat protein sequence, and
compatible with assembly into a VLP, are further embodiments of the
invention and lead to chimeric AP205 coat proteins, and particles,
respectively. The outcome of insertions, deletions and fusions to
the coat protein sequence and whether it is compatible with
assembly into a VLP can be determined by electron microscopy.
[0189] The particles formed by the AP205 coat protein, coat protein
fragments and chimeric coat proteins described above, can be
isolated in pure form by a combination of fractionation steps by
precipitation and of purification steps by gel filtration using
e.g. Sepharose CL-4B, Sepharose CL-2B, Sepharose CL-6B columns and
combinations thereof as described in the co-pending US provisional
patent application with the title "Molecular Antigen Arrays
(Application No. 60/396,126) and having been filed on Jul. 17,
2002, which is incorporated by reference in its entirety. Other
methods of isolating virus-like particles are known in the art, and
may be used to isolate the virus-like particles (VLPs) of
bacteriophage AP205. For example, the use of ultracentrifugation to
isolate VLPs of the yeast retrotransposon Ty is described in U.S.
Pat. No. 4,918,166, which is incorporated by reference herein in
its entirety.
[0190] The crystal structure of several RNA bacteriophages has been
determined (Golmohammadi, R. et al., Structure 4:543-554 (1996)).
Using such information, surface exposed residues can be identified
and, thus, RNA-phage coat proteins can be modified such that one or
more reactive amino acid residues can be inserted by way of
insertion or substitution. As a consequence, those modified forms
of bacteriophage coat proteins can also be used for the present
invention. Thus, variants of proteins which form capsids or
capsid-like structures (e.g., coat proteins of bacteriophage
Q.beta., bacteriophage R17, bacteriophage fr, bacteriophage GA,
bacteriophage SP, and bacteriophage MS2, bacteriophage AP 205) can
also be used to prepare compositions of the present invention.
[0191] Although the sequence of the variants proteins discussed
above will differ from their wild-type counterparts, these variant
proteins will generally retain the ability to form capsids or
capsid-like structures. Thus, the invention further includes
compositions and vaccine compositions, respectively, which further
includes variants of proteins which form capsids or capsid-like
structures, as well as methods for preparing such compositions and
vaccine compositions, respectively, individual protein subunits
used to prepare such compositions, and nucleic acid molecules which
encode these protein subunits. Thus, included within the scope of
the invention are variant forms of wild-type proteins which form
capsids or capsid-like structures and retain the ability to
associate and form capsids or capsid-like structures.
[0192] As a result, the invention further includes compositions and
vaccine compositions, respectively, comprising proteins, which
comprise, or alternatively consist essentially of, or alternatively
consist of amino acid sequences which are at least 80%, 85%, 90%,
95%, 97%, or 99% identical to wild-type proteins which form ordered
arrays and have an inherent repetitive structure, respectively.
[0193] Further included within the scope of the invention are
nucleic acid molecules which encode proteins used to prepare
compositions of the present invention.
[0194] In other embodiments, the invention further includes
compositions comprising proteins, which comprise, or alternatively
consist essentially of, or alternatively consist of amino acid
sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99%
identical to any of the amino acid sequences shown in SEQ ID
NOs:10-27.
[0195] Proteins suitable for use in the present invention also
include C-terminal truncation mutants of proteins which form
capsids or capsid-like structures, or VLPs. Specific examples of
such truncation mutants include proteins having an amino acid
sequence shown in any of SEQ ID NOs:10-27 where 1, 2, 5, 7, 9, 10,
12, 14, 15, or 17 amino acids have been removed from the
C-terminus. Typically, theses C-terminal truncation mutants will
retain the ability to form capsids or capsid-like structures.
[0196] Further proteins suitable for use in the present invention
also include N-terminal truncation mutants of proteins which form
capsids or capsid-like structures. Specific examples of such
truncation mutants include proteins having an amino acid sequence
shown in any of SEQ ID NOs:10-27 where 1, 2, 5, 7, 9, 10, 12, 14,
15, or 17 amino acids have been removed from the N-terminus.
Typically, these N-terminal truncation mutants will retain the
ability to form capsids or capsid-like structures.
[0197] Additional proteins suitable for use in the present
invention include N- and C-terminal truncation mutants which form
capsids or capsid-like structures. Suitable truncation mutants
include proteins having an amino acid sequence shown in any of SEQ
ID NOs:10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids
have been removed from the N-terminus and 1, 2, 5, 7, 9, 10, 12,
14, 15, or 17 amino acids have been removed from the C-terminus.
Typically, these N-terminal and C-terminal truncation mutants will
retain the ability to form capsids or capsid-like structures.
[0198] The invention further includes compositions comprising
proteins which comprise, or alternatively consist essentially of,
or alternatively consist of, amino acid sequences which are at
least 80%, 85%, 90%, 95%, 97%, or 99% identical to the above
described truncation mutants.
[0199] The invention thus includes compositions and vaccine
compositions prepared from proteins which form capsids or VLPs,
methods for preparing these compositions from individual protein
subunits and VLPs or capsids, methods for preparing these
individual protein subunits, nucleic acid molecules which encode
these subunits, and methods for vaccinating and/or eliciting
immunological responses in individuals using these compositions of
the present invention.
[0200] Fragments of VLPs which retain the ability to induce an
immune response can comprise, or alternatively consist of,
polypeptides which are about 15, 20, 25, 30, 35, 40, 45, 50, 55,
60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, 200, 250, 300, 350, 400, 450 or 500 amino acids in
length, but will obviously depend on the length of the sequence of
the subunit composing the VLP. Examples of such fragments include
fragments of proteins discussed herein which are suitable for the
preparation of the immune response enhancing composition.
[0201] In another preferred embodiment of the invention, the VLP's
are free of a lipoprotein envelope or a lipoprotein-containing
envelope. In a further preferred embodiment, the VLP's are free of
an envelope altogether.
[0202] The lack of a lipoprotein envelope or lipoprotein-containing
envelope and, in particular, the complete lack of an envelope leads
to a more defined virus-like particle in its structure and
composition. Such more defined virus-like particles, therefore, may
minimize side-effects. Moreover, the lack of a
lipoprotein-containing envelope or, in particular, the complete
lack of an envelope avoids or minimizes incorporation of
potentially toxic molecules and pyrogens within the virus-like
particle.
[0203] As previously stated, the invention includes virus-like
particles or recombinant forms thereof. Skilled artisans have the
knowledge to produce such particles and attach antigens thereto. By
way of providing other examples, the invention provides herein for
the production of Hepatitis B virus-like particles as virus-like
particles (Example 1).
[0204] In one embodiment, the particles used in compositions of the
invention are composed of a Hepatitis B capsid (core) protein
(HBcAg) or a fragment of a HBcAg which has been modified to either
eliminate or reduce the number of free cysteine residues. Zhou et
al. (J. Virol. 66:5393-5398 (1992)) demonstrated that HBcAgs which
have been modified to remove the naturally resident cysteine
residues retain the ability to associate and form multimeric
structures. Thus, core particles suitable for use in compositions
of the invention include those comprising modified HBcAgs, or
fragments thereof, in which one or more of the naturally resident
cysteine residues have been either deleted or substituted with
another amino acid residue (e.g., a serine residue).
[0205] The HBcAg is a protein generated by the processing of a
Hepatitis B core antigen precursor protein. A number of isotypes of
the HBcAg have been identified and their amino acids sequences are
readily available to those skilled in the art. For example, the
HBcAg protein having the amino acid sequence shown in FIG. 1 is 185
amino acids in length and is generated by the processing of a 212
amino acid Hepatitis B core antigen precursor protein. This
processing results in the removal of 29 amino acids from the
N-terminus of the Hepatitis B core antigen precursor protein.
Similarly, the HBcAg protein that is 185 amino acids in length is
generated by the processing of a 214 amino acid Hepatitis B core
antigen precursor protein.
[0206] In preferred embodiments, vaccine compositions of the
invention will be prepared using the processed form of a HBcAg
(i.e., a HBcAg from which the N-terminal leader sequence of the
Hepatitis B core antigen precursor protein have been removed).
[0207] Further, when HBcAgs are produced under conditions where
processing will not occur, the HBcAgs will generally be expressed
in "processed" form. For example, bacterial systems, such as E.
coli, generally do not remove the leader sequences, also referred
to as "signal peptides," of proteins which are normally expressed
in eukaryotic cells. Thus, when an E. coli expression system
directing expression of the protein to the cytoplasm is used to
produce HBcAgs of the invention, these proteins will generally be
expressed such that the N-terminal leader sequence of the Hepatitis
B core antigen precursor protein is not present.
[0208] The preparation of Hepatitis B virus-like particles, which
can be used for the present invention, is disclosed, for example,
in WO 00/32227, and hereby in particular in Examples 17 to 19 and
21 to 24, as well as in WO 01/85208, and hereby in particular in
Examples 17 to 19, 21 to 24, 31 and 41, and in pending U.S.
application Ser. No. 10/050,902 filed on Jan. 18, 2002. For the
latter application, it is in particular referred to Example 23, 24,
31 and 51. All three documents are explicitly incorporated herein
by reference.
[0209] The present invention also includes HBcAg variants which
have been modified to delete or substitute one or more additional
cysteine residues. Thus, the vaccine compositions of the invention
include compositions comprising HBcAgs in which cysteine residues
not present in the amino acid sequence shown in FIG. 1 have been
deleted.
[0210] It is well known in the art that free cysteine residues can
be involved in a number of chemical side reactions. These side
reactions include disulfide exchanges, reaction with chemical
substances or metabolites that are, for example, injected or formed
in a combination therapy with other substances, or direct oxidation
and reaction with nucleotides upon exposure to UV light. Toxic
adducts could thus be generated, especially considering the fact
that HBcAgs have a strong tendency to bind nucleic acids. The toxic
adducts would thus be distributed between a multiplicity of
species, which individually may each be present at low
concentration, but reach toxic levels when together.
[0211] In view of the above, one advantage to the use of HBcAgs in
vaccine compositions which have been modified to remove naturally
resident cysteine residues is that sites to which toxic species can
bind when antigens or antigenic determinants are attached would be
reduced in number or eliminated altogether.
[0212] A number of naturally occurring HBcAg variants suitable for
use in the practice of the present invention have been identified.
Yuan et al., (J. Virol. 73:10122-10128 (1999)), for example,
describe variants in which the isoleucine residue at position
corresponding to position 97 in SEQ ID NO:28 is replaced with
either a leucine residue or a phenylalanine residue. The amino acid
sequences of a number of HBcAg variants, as well as several
Hepatitis B core antigen precursor variants, are disclosed in
GenBank reports AAF121240 (SEQ ID NO:29), AF121239 (SEQ ID NO:30),
X85297 (SEQ ID NO:31), X02496 (SEQ ID NO:32), X85305 (SEQ ID
NO:33), X85303 (SEQ ID NO:34), AF151735 (SEQ ID NO:35), X85259 (SEQ
ID NO:36), X85286 (SEQ ID NO:37), X85260 (SEQ ID NO:38), X85317
(SEQ ID NO:39), X85298 (SEQ ID NO:40), AF043593 (SEQ ID NO:41),
M20706 (SEQ ID NO:42), X85295 (SEQ ID NO:43), X80925 (SEQ ID
NO:44), X85284 (SEQ ID NO:45), X85275 (SEQ ID NO:46), X72702 (SEQ
ID NO:47), X85291 (SEQ ID NO:48), X65258 (SEQ ID NO:49), X85302
(SEQ ID NO:50), M32138 (SEQ ID NO:51), X85293 (SEQ ID NO:52),
X85315 (SEQ ID NO:53), U95551 (SEQ ID NO:54), X85256 (SEQ ID
NO:55), X85316 (SEQ ID NO:56), X85296 (SEQ ID NO:57), AB033559 (SEQ
ID NO:58), X59795 (SEQ ID NO:59), X85299 (SEQ ID NO:60), X85307
(SEQ ID NO:61), X65257 (SEQ ID NO:62), X85311 (SEQ ID NO:63),
X85301 (SEQ ID NO:64), X85314 (SEQ ID NO:65), X85287 (SEQ ID
NO:66), X85272 (SEQ ID NO:67), X85319 (SEQ ID NO:68), AB010289 (SEQ
ID NO:69), X85285 (SEQ ID NO:70), AB010289 (SEQ ID NO:71), AF121242
(SEQ ID NO:72), M90520 (SEQ ID NO:73), P03153 (SEQ ID NO:74),
AF110999 (SEQ ID NO:75), and M95589 (SEQ ID NO:76), the disclosures
of each of which are incorporated herein by reference. These HBcAg
variants differ in amino acid sequence at a number of positions,
including amino acid residues which corresponds to the amino acid
residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35,
38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80,
81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121,
126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in
SEQ ID NO:77. Further HBcAg variants suitable for use in the
compositions of the invention, and which may be further modified
according to the disclosure of this specification are described in
WO 00/198333, WO 00/177158 and WO 00/214478.
[0213] HBcAgs suitable for use in the present invention can be
derived from any organism so long as they are able to enclose or to
be coupled or otherwise attached to, in particular as long as they
are capable of packaging, an unmethylated CpG-containing
oligonucleotide and induce an immune response.
[0214] As noted above, generally processed HBcAgs (i.e., those
which lack leader sequences) will be used in the vaccine
compositions of the invention. The present invention includes
vaccine compositions, as well as methods for using these
compositions, which employ the above described variant HBcAgs.
[0215] Further included within the scope of the invention are
additional HBcAg variants which are capable of associating to form
dimeric or multimeric structures. Thus, the invention further
includes vaccine compositions comprising HBcAg polypeptides
comprising, or alternatively consisting of, amino acid sequences
which are at least 80%, 85%, 90%, 95%, 97% or 99% identical to any
of the wild-type amino acid sequences, and forms of these proteins
which have been processed, where appropriate, to remove the
N-terminal leader sequence.
[0216] Whether the amino acid sequence of a polypeptide has an
amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99%
identical to one of the wild-type amino acid sequences, or a
subportion thereof, can be determined conventionally using known
computer programs such the Bestfit program. When using Bestfit or
any other sequence alignment program to determine whether a
particular sequence is, for instance, 95% identical to a reference
amino acid sequence, the parameters are set such that the
percentage of identity is calculated over the full length of the
reference amino acid sequence and that gaps in homology of up to 5%
of the total number of amino acid residues in the reference
sequence are allowed.
[0217] The HBcAg variants and precursors having the amino acid
sequences set out in SEQ ID NOs: 29-72 and 73-76 are relatively
similar to each other. Thus, reference to an amino acid residue of
a HBcAg variant located at a position which corresponds to a
particular position in SEQ ID NO:77, refers to the amino acid
residue which is present at that position in the amino acid
sequence shown in SEQ ID NO:77. The homology between these HBcAg
variants is for the most part high enough among Hepatitis B viruses
that infect mammals so that one skilled in the art would have
little difficulty reviewing both the amino acid sequence shown in
SEQ ID NO:77 and in FIG. 1, respectively, and that of a particular
HBcAg variant and identifying "corresponding" amino acid residues.
Furthermore, the HBcAg amino acid sequence shown in SEQ ID NO:73,
which shows the amino acid sequence of a HBcAg derived from a virus
which infect woodchucks, has enough homology to the HBcAg having
the amino acid sequence shown in SEQ ID NO:77 that it is readily
apparent that a three amino acid residue insert is present in SEQ
ID NO:73 between amino acid residues 155 and 156 of SEQ ID
NO:77.
[0218] The invention also includes vaccine compositions which
comprise HBcAg variants of Hepatitis B viruses which infect birds,
as wells as vaccine compositions which comprise fragments of these
HBcAg variants. As one skilled in the art would recognize, one,
two, three or more of the cysteine residues naturally present in
these polypeptides could be either substituted with another amino
acid residue or deleted prior to their inclusion in vaccine
compositions of the invention.
[0219] As discussed above, the elimination of free cysteine
residues reduces the number of sites where toxic components can
bind to the HBcAg, and also eliminates sites where cross-linking of
lysine and cysteine residues of the same or of neighboring HBcAg
molecules can occur. Therefore, in another embodiment of the
present invention, one or more cysteine residues of the Hepatitis B
virus capsid protein have been either deleted or substituted with
another amino acid residue.
[0220] In other embodiments, compositions and vaccine compositions,
respectively, of the invention will contain HBcAgs from which the
C-terminal region (e.g., amino acid residues 145-185 or 150-185 of
SEQ ID NO: 77) has been removed. Thus, additional modified HBcAgs
suitable for use in the practice of the present invention include
C-terminal truncation mutants. Suitable truncation mutants include
HBcAgs where 1, 5, 10, 15, 20, 25, 30, 34, 35, amino acids have
been removed from the C-terminus.
[0221] HBcAgs suitable for use in the practice of the present
invention also include N-terminal truncation mutants. Suitable
truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10,
12, 14, 15, or 17 amino acids have been removed from the
N-terminus.
[0222] Further HBcAgs suitable for use in the practice of the
present invention include N- and C-terminal truncation mutants.
Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10,
12, 14, 15, and 17 amino acids have been removed from the
N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have
been removed from the C-terminus.
[0223] The invention further includes compositions and vaccine
compositions, respectively, comprising HBcAg polypeptides
comprising, or alternatively essentially consisting of, or
alternatively consisting of, amino acid sequences which are at
least 80%, 85%, 90%, 95%, 97%, or 99% identical to the above
described truncation mutants.
[0224] In certain embodiments of the invention, a lysine residue is
introduced into a HBcAg polypeptide, to mediate the binding of the
antigen or antigenic determinant to the VLP of HBcAg. In preferred
embodiments, compositions of the invention are prepared using a
HBcAg comprising, or alternatively consisting of, amino acids
1-144, or 1-149, 1-185 of SEQ ID NO:77, which is modified so that
the amino acids corresponding to positions 79 and 80 are replaced
with a peptide having the amino acid sequence of
Gly-Gly-Lys-Gly-Gly (SEQ ID NO:78). These compositions are
particularly useful in those embodiments where an antigenic
determinant is coupled to a VLP of HBcAg. In further preferred
embodiments, the cysteine residues at positions 48 and 107 of SEQ
ID NO:77 are mutated to serine. The invention further includes
compositions comprising the corresponding polypeptides having amino
acid sequences shown in any of SEQ ID NOs:29-74 which also have
above noted amino acid alterations. Further included within the
scope of the invention are additional HBcAg variants which are
capable of associating to form a capsid or VLP and have the above
noted amino acid alterations. Thus, the invention further includes
compositions and vaccine compositions, respectively, comprising
HBcAg polypeptides which comprise, or alternatively consist of,
amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or
99% identical to any of the wild-type amino acid sequences, and
forms of these proteins which have been processed, where
appropriate, to remove the N-terminal leader sequence and modified
with above noted alterations.
[0225] Compositions or vaccine compositions of the invention may
comprise mixtures of different HBcAgs. Thus, these vaccine
compositions may be composed of HBcAgs which differ in amino acid
sequence. For example, vaccine compositions could be prepared
comprising a "wild-type" HBcAg and a modified HBcAg in which one or
more amino acid residues have been altered (e.g., deleted, inserted
or substituted). Further, preferred vaccine compositions of the
invention are those which present highly ordered and repetitive
antigen arrays.
[0226] As previously disclosed, the invention is based on the
surprising finding that immunostimulatory substances, preferably
immunostimulatory nucleic acids and even more preferably DNA
oligonucleotides can be packaged into VLPs. Unexpectedly, the
nucleic acids present in VLPs can be replaced specifically by the
immunostimulatory substances, preferably by the immunostimulatory
nucleic acids and even more preferably by the DNA-oligonucleotides
containing CpG motifs. As an example, the CpG-VLPs are dramatically
more immunogenic and elicit more specific effects than their
CpG-free counterparts and induce enhanced B and T cell responses.
The immune response against antigens coupled, fused or attached
otherwise to the VLPs is similarly enhanced as the immune response
against the VLP itself. In addition, the T cell responses against
both the VLPs and antigens are especially directed to the Th1 type.
Furthermore, the packaged nucleic acids and CpGs, respectively, are
protected from degradation, i.e., they are more stable. Moreover,
non-specific activation of cells from the innate immune system is
dramatically reduced.
[0227] The innate immune system has the capacity to recognize
invariant molecular pattern shared by microbial pathogens. Recent
studies have revealed that this recognition is a crucial step in
inducing effective immune responses. The main mechanism by which
microbial products augment immune responses is to stimulate APC,
expecially dendritic cells to produce proinflammatory cytokines and
to expres high levels costimulatory molecules for T cells. These
activated dendritic cells subsequently initiate primary T cell
responses and dictate the type of T cell-mediated effector
function.
[0228] Two classes of nucleic acids, namely 1) bacterial DNA that
contains immunostimulatory sequences, in particular unmethylated
CpG dinucleotides within specific flanking bases (referred to as
CpG motifs) and 2) double-stranded RNA synthesized by various types
of viruses represent important members of the microbial components
that enhance immune responses. Synthetic double stranded (ds) RNA
such as polyinosinic-polycytidylic acid (poly I:C) are capable of
inducing dendritic cells to produce proinflammatory cytokines and
to express high levels of costimulatory molecules.
[0229] A series of studies by Tokunaga and Yamamoto et al. has
shown that bacterial DNA or synthetic oligodeoxynucleotides induce
human PBMC and mouse spleen cells to produce type I interferon
(IFN) (reviewed in Yamamoto et al., Springer Semin Immunopathol.
22:11-19). Poly (I:C) was originally synthesized as a potent
inducer of type I IFN but also induces other cytokines such as
IL-12.
[0230] Preferred ribonucleic acid encompass
polyinosinic-polycytidylic acid double-stranded RNA (poly I:C).
Ribonucleic acids and modifications thereof as well as methods for
their production have been described by Levy, H. B (Methods
Enzymol. 1981, 78:242-251), DeClercq, E (Methods Enzymol.
1981,78:227-236) and Torrence, P. F. (Methods Enzymol
1981;78:326-331) and references therein. Ribonucleic acids can be
isolated from organisms. Ribonucleic acids also encompass further
synthetic ribonucleic acids, in particular synthetic poly (I:C)
oligonucleotides that have been rendered nuclease resistant by
modification of the phosphodiester backbone, in particular by
phosphorothioate modifications. In a further embodiment the ribose
backbone of poly (I:C) is replaced by a deoxyribose. Those skilled
in the art know procedures how to synthesize synthetic
oligonucleotides.
[0231] In another preferred embodiment of the invention molecules
that active toll-like receptors (TLR) are enclosed. Ten human
toll-like receptors are known uptodate. They are activated by a
variety of ligands. TLR2 is activated by peptidoglycans,
lipoproteins, lipoteichonic acid and Zymosan; TLR3 is activated by
double-stranded RNA such as poly (I:C); TLR4 is activated by
lipopolysaccharide, lipoteichoic acids and taxol; TLR5 is activated
by bacterial flagella, especially the flagellin protein; TLR6 is
activated by peptidoglycans, TLR7 is activated by imiquimoid and
imidazoquinoline compounds, such as R418 and TLR9 is activated by
bacterial DNA, in particular CpG DNA. Ligands for TLR1, TLR8 and
TLR10 are not known so far. However, recent reports indicate that
same receptors can react with different ligands and that further
receptors are present. The above list of ligands is not exhaustive
and further ligands are within the knowledge of the person skilled
in the art.
[0232] Preferably, the unmethylated CpG-containing oligonucleotide
comprises the sequence:
[0233] 5'X.sub.1X.sub.2CGX.sub.3X.sub.4 3'
[0234] wherein X.sub.1, X.sub.2, X.sub.3 and X.sub.4 are any
nucleotide. In addition, the oligonucleotide can comprise about 6
to about 100,000 nucleotides, preferably about 6 to about 2000
nucleotides, more preferably about 20 to about 2000 nucleotides,
and even more preferably comprises about 20 to about 300
nucleotides. In addition, the oligonucleotide can comprise more
than 100 to about 2000 nucleotides, preferably more than 100 to
about 1000 nucleotides, and more preferably more than 100 to about
500 nucleotides.
[0235] In a preferred embodiment, the CpG-containing
oligonucleotide contains one or more phosphorothioate modifications
of the phosphate backbone. For example, a CpG-containing
oligonucleotide having one or more phosphate backbone modifications
or having all of the phosphate backbone modified and a
CpG-containing oligonucleotide wherein one, some or all of the
nucleotide phosphate backbone modifications are phosphorothioate
modifications are included within the scope of the present
invention.
[0236] The CpG-containing oligonucleotide can also be recombinant,
genomic, synthetic, cDNA, plasmid-derived and single or double
stranded. For use in the instant invention, the nucleic acids can
be synthesized de novo using any of a number of procedures well
known in the art. For example, the b-cyanoethyl phosphoramidite
method (Beaucage, S. L., and Caruthers, M. H., Tet. Let. 22:1859
(1981); nucleoside H-phosphonate method (Garegg et al., Tet. Let.
27:4051-4054 (1986); Froehler et al., Nucl. Acid. Res. 14:5399-5407
(1986); Garegg et al., Tet. Let. 27:4055-4058 (1986), Gaffney et
al., Tet. Let. 29:2619-2622 (1988)). These chemistries can be
performed by a variety of automated oligonucleotide synthesizers
available in the market. Alternatively, CpGs can be produced on a
large scale in plasmids, (see Sambrook, T., et al., "Molecular
Cloning: A Laboratory Manual," Cold Spring Harbor laboratory Press,
New York, 1989) which after being administered to a subject are
degraded into oligonucleotides. Oligonucleotides can be prepared
from existing nucleic acid sequences (e.g., genomic or cDNA) using
known techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
[0237] The immunostimulatory substances, the immunostimulatory
nucleic acids as well as the unmethylated CpG-containing
oligonucleotide can be bound to the VLP by any way known is the art
provided the composition enhances an immune response in an animal.
For example, the oligonucleotide can be bound either covalently or
non-covalently. In addition, the VLP can enclose, fully or
partially, the immunostimulatory substances, the immunostimulatory
nucleic acids as well as the unmethylated CpG-containing
oligonucleotide. Preferably, the immunostimulatory nucleic acid as
well as the unmethylated CpG-containing oligonucleotide can be
bound to a VLP site such as an oligonucleotide binding site (either
naturally or non-naturally occurring), a DNA binding site or a RNA
binding site. In another embodiment, the VLP site comprises an
arginine-rich repeat.
[0238] One specific use for the compositions of the invention is to
activate dendritic cells for the purpose of enhancing a specific
immune response against antigens. The immune response can be
enhanced using ex vivo or in vivo techniques. The ex vivo procedure
can be used on autologous or heterologous cells, but is preferably
used on autologous cells. In preferred embodiments, the dendritic
cells are isolated from peripheral blood or bone marrow, but can be
isolated from any source of dendritic cells. Ex vivo manipulation
of dendritic cells for the purposes of cancer immunotherapy have
been described in several references in the art, including
Engleman, E. G., Cytotechnology 25:1 (1997); Van Schooten, W., et
al., Molecular Medicine Today, June, 255 (1997); Steinman, R. M.,
Experimental Hematology 24:849 (1996); and Gluckman, J. C.,
Cytokines, Cellular and Molecular Therapy 3:187 (1997).
[0239] The dendritic cells can also be contacted with the inventive
compositions using in vivo methods. In order to accomplish this,
the CpGs are administered in combination with the VLP optionally
coupled, fused or otherwise attached to an antigen directly to a
subject in need of immunotherapy. In some embodiments, it is
preferred that the VLPs/CpGs be administered in the local region of
the tumor, which can be accomplished in any way known in the art,
e.g., direct injection into the tumor.
[0240] The inventive composition can further comprise an antigen or
antigenic determinant bound to the virus-like particle. The
invention provides for compositions that vary according to the
antigen or antigenic determinant selected in consideration of the
desired therapeutic effect. Very preferred antigens or antigenic
determinants suitable for use in the present invention are
disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the
disclosures of which are herewith incorporated by reference in
their entireties.
[0241] The antigen can be any antigen of known or yet unknown
provenance.
[0242] It can be isolated from bacteria, viruses or other pathogens
or can be a recombinant antigen obtained from expression of
suitable nucleic acid coding therefor. It can also be isolated from
prions, tumors, self-molecules, non-peptidic hapten molecules,
allergens and hormones. In a preferred embodiment, the antigen is a
recombinant antigen. The selection of the antigen is, of course,
dependent upon the immunological response desired and the host.
[0243] In one embodiment of the immune enhancing composition of the
present invention, the immune response is induced against the VLP
itself. In another embodiment of the invention a virus-like
particle is coupled, fused or otherwise attached to an
antigen/immunogen against which an enhanced immune response is
desired.
[0244] In a further preferred embodiment of the invention, the at
least one antigen or antigenic determinant is fused to the
virus-like particle. As outlined above, a VLP is typically composed
of at least one subunit assembling into a VLP. Thus, in again a
further preferred embodiment of the invention, the antigen or
antigenic determinant is fused to at least one subunit of the
virus-like particle or of a protein capable of being incorporated
into a VLP generating a chimeric VLP-subunit-antigen fusion.
[0245] Fusion of the antigen or antigenic determinant can be
effected by insertion into the VLP subunit sequence, or by fusion
to either the N- or C-terminus of the VLP-subunit or protein
capable of being incorporated into a VLP. Hereinafter, when
referring to fusion proteins of a peptide to a VLP subunit, the
fusion to either ends of the subunit sequence or internal insertion
of the peptide within the subunit sequence are encompassed.
[0246] Fusion may also be effected by inserting antigen or
antigenic determinant sequences into a variant of a VLP subunit
where part of the subunit sequence has been deleted, that are
further referred to as truncation mutants. Truncation mutants may
have N- or C-terminal, or internal deletions of part of the
sequence of the VLP subunit. For example, the specific VLP HBcAg
with, for example, deletion of amino acid residues 79 to 81 is a
truncation mutant with an internal deletion. Fusion of antigens or
antigenic determinants to either the N- or C-terminus of the
truncation mutants VLP-subunits also lead to embodiments of the
invention. Likewise, fusion of an epitope into the sequence of the
VLP subunit may also be effected by substitution, where for example
for the specific VLP HBcAg, amino acids 79-81 are replaced with a
foreign epitope. Thus, fusion, as referred to hereinafter, may be
effected by insertion of the antigen or antigenic determinant
sequence in the sequence of a VLP subunit, by substitution of part
of the sequence of the VLP subunit with the antigen or antigenic
determinant, or by a combination of deletion, substitution or
insertions.
[0247] The chimeric antigen or antigenic determinant -VLP subunit
will be in general capable of self-assembly into a VLP. VLP
displaying epitopes fused to their subunits are also herein
referred to as chimeric VLPs. As indicated, the virus-like particle
comprises or alternatively is composed of at least one VLP subunit.
In a further embodiment of the invention, the virus-like particle
comprises or alternatively is composed of a mixture of chimeric VLP
subunits and non-chimeric VLP subunits, i.e. VLP subunits not
having an antigen fused thereto, leading to so called mosaic
particles. This may be advantageous to ensure formation of, and
assembly to a VLP. In those embodiments, the proportion of chimeric
VLP-subunits may be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90,
95% or higher.
[0248] Flanking amino acid residues may be added to either end of
the sequence of the peptide or epitope to be fused to either end of
the sequence of the subunit of a VLP, or for internal insertion of
such peptidic sequence into the sequence of the subunit of a VLP.
Glycine and serine residues are particularly favored amino acids to
be used in the flanking sequences added to the peptide to be fused.
Glycine residues confer additional flexibility, which may diminish
the potentially destabilizing effect of fusing a foreign sequence
into the sequence of a VLP subunit.
[0249] In a specific embodiment of the invention, the VLP is a
Hepatitis B core antigen VLP. Fusion proteins of the antigen or
antigenic determinant to either the N-terminus of a HBcAg
(Neyrinck, S. et al., Nature Med. 5:1157-1163 (1999)) or insertions
in the so called major immunodominant region (MIR) have been
described (Pumpens, P. and Grens, E., Intervirology 44:98-114
(2001)), WO 01/98333), and are preferred embodiments of the
invention. Naturally occurring variants of HBcAg with deletions in
the MIR have also been described (Pumpens, P. and Grens, E.,
Intervirology 44:98-114 (2001), which is expressly incorporated by
reference in its entirety), and fusions to the N- or C-terminus, as
well as insertions at the position of the MIR corresponding to the
site of deletion as compared to a wt HBcAg are further embodiments
of the invention. Fusions to the C-terminus have also been
described (Pumpens, P. and Grens, E., Intervirology 44:98-114
(2001)). One skilled in the art will easily find guidance on how to
construct fusion proteins using classical molecular biology
techniques (Sambrook, J. et al., eds., Molecular Cloning, A
Laboratory Manual, 2nd. edition, Cold Spring Habor Laboratory
Press, Cold Spring Harbor, N.Y. (1989), Ho et al., Gene 77:51
(1989)). Vectors and plasmids encoding HBcAg and HBcAg fusion
proteins and useful for the expression of a HBcAg and HBcAg fusion
proteins have been described (Pumpens, P. & Grens, E.
Intervirology 44: 98-114 (2001), Neyrinck, S. et al., Nature Med.
5:1157-1163 (1999)) and can be used in the practice of the
invention. An important factor for the optimization of the
efficiency of self-assembly and of the display of the epitope to be
inserted in the MIR of HBcAg is the choice of the insertion site,
as well as the number of amino acids to be deleted from the HBcAg
sequence within the MIR (Pumpens, P. and Grens, E., Intervirology
44:98-114 (2001); EP 0 421 635; U.S. Pat. No. 6,231,864) upon
insertion, or in other words, which amino acids form HBcAg are to
be substituted with the new epitope. For example, substitution of
HBcAg amino acids 76-80, 79-81, 79-80, 75-85 or 80-81 with foreign
epitopes has been described (Pumpens, P. and Grens, E.,
Intervirology 44:98-114 (2001); EP0421635; U.S. Pat. No.
6,231,864). HBcAg contains a long arginine tail (Pumpens, P. and
Grens, E., Intervirology 44:98-114 (2001))which is dispensable for
capsid assembly and capable of binding nucleic acids (Pumpens, P.
and Grens, E., Intervirology 44:98-114 (2001)). HBcAg either
comprising or lacking this arginine tail are both embodiments of
the invention.
[0250] In a further preferred embodiment of the invention, the VLP
is a VLP of a RNA phage. The major coat proteins of RNA phages
spontaneously assemble into VLPs upon expression in bacteria, and
in particular in E. coli. Specific examples of bacteriophage coat
proteins which can be used to prepare compositions of the invention
include the coat proteins of RNA bacteriophages such as
bacteriophage Q.beta. (SEQ ID NO:10; PIR Database, Accession No.
VCBPQ.beta. referring to Q.beta. CP and SEQ ID NO: 11; Accession
No. AAA16663 referring to Q.beta. A1 protein) and bacteriophage fr
(SEQ ID NO: 13; PIR Accession No. VCBPFR).
[0251] In a more preferred embodiment, the at least one antigen or
antigenic determinant is fused to a Q.beta. coat protein. Fusion
protein constructs wherein epitopes have been fused to the
C-terminus of a truncated form of the Al protein of Q.beta., or
inserted within the A1 protein have been described (Kozlovska, T.
M., et al., Intervirology, 39:9-15 (1996)). The A1 protein is
generated by suppression at the UGA stop codon and has a length of
329 aa, or 328 aa, if the cleavage of the N-terminal methionine is
taken into account. Cleavage of the N-terminal methionine before an
alanine (the second amino acid encoded by the Q.beta. CP gene)
usually takes place in E. coli, and such is the case for N-termini
of the Q.beta. coat proteins. The part of the A1 gene, 3' of the
UGA amber codon encodes the CP extension, which has a length of 195
amino acids. Insertion of the at least one antigen or antigenic
determinant between position 72 and 73 of the CP extension leads to
further embodiments of the invention (Kozlovska, T. M., et al.,
Intervirology 39:9-15 (1996)). Fusion of an antigen or antigenic
determinant at the C-terminus of a C-terminally truncated Q.beta.
A1 protein leads to further preferred embodiments of the invention.
For example, Kozlovska et al., (Intervirology, 39: 9-15 (1996))
describe Q.beta. A1 protein fusions where the epitope is fused at
the C-terminus of the Q.beta. CP extension truncated at position
19.
[0252] As described by Kozlovska et al. (Intervirology, 39: 9-15
(1996)), assembly of the particles displaying the fused epitopes
typically requires the presence of both the A1 protein-antigen
fusion and the wt CP to form a mosaic particle. However,
embodiments comprising virus-like particles, and hereby in
particular the VLPs of the RNA phage Q.beta. coat protein, which
are exclusively composed of VLP subunits having at least one
antigen or antigenic determinant fused thereto, are also within the
scope of the present invention.
[0253] The production of mosaic particles may be effected in a
number of ways. Kozlovska et al., Intervirology, 39:9-15 (1996),
describe three methods, which all can be used in the practice of
the invention. In the first approach, efficient display of the
fused epitope on the VLPs is mediated by the expression of the
plasmid encoding the Q.beta. A1 protein fusion having a UGA stop
codong between CP and CP extension in a E. coli strain harboring a
plasmid encoding a cloned UGA suppressor tRNA which leads to
translation of the UGA codon into Trp (pISM3001 plasmid (Smiley B.
K., et al., Gene 134:33-40 (1993))). In another approach, the CP
gene stop codon is modified into UAA, and a second plasmid
expressing the A1 protein-antigen fusion is cotransformed. The
second plasmid encodes a different antibiotic resistance and the
origin of replication is compatible with the first plasmid
(Kozlovska, T. M., et al., Intervirology 39:9-15 (1996)). In a
third approach, CP and the A1 protein-antigen fusion are encoded in
a bicistronic manner, operatively linked to a promoter such as the
Trp promoter, as described in FIG. 1 of Kozlovska et al.,
Intervirology, 39:9-15 (1996).
[0254] In a further embodiment, the antigen or antigenic
determinant is inserted between amino acid 2 and 3 (numbering of
the cleaved CP, that is wherein the N-terminal methionine is
cleaved) of the fr CP, thus leading to an antigen or antigenic
determinant -fr CP fusion protein. Vectors and expression systems
for construction and expression of fr CP fusion proteins
self-assembling to VLP and useful in the practice of the invention
have been described (Pushko P. et al., Prot. Eng. 6:883-891
(1993)). In a specific embodiment, the antigen or antigenic
determinant sequence is inserted into a deletion variant of the fr
CP after amino acid 2, wherein residues 3 and 4 of the fr CP have
been deleted (Pushko P. et al., Prot. Eng. 6:883-891 (1993)).
[0255] Fusion of epitopes in the N-terminal protuberant
.beta.-hairpin of the coat protein of RNA phage MS-2 and subsequent
presentation of the fused epitope on the self-assembled VLP of RNA
phage MS-2 has also been described (WO 92/13081), and fusion of an
antigen or antigenic determinant by insertion or substitution into
the coat protein of MS-2 RNA phage is also falling under the scope
of the invention.
[0256] In another embodiment of the invention, the antigen or
antigenic determinant is fused to a capsid protein of
papillomavirus. In a more specific embodiment, the antigen or
antigenic determinant is fused to the major capsid protein LI of
bovine papillomavirus type 1 (BPV-1). Vectors and expression
systems for construction and expression of BPV-1 fusion proteins in
a baculovirus/insect cells systems have been described (Chackerian,
B. et al., Proc. Natl. Acad. Sci. USA 96:2373-2378 (1999), WO
00/23955). Substitution of amino acids 130-136 of BPV-1 L1 with an
antigen or antigenic determinant leads to a BPV-1 L1-antigen fusion
protein, which is a preferred embodiment of the invention. Cloning
in a baculovirus vector and expression in baculovirus infected Sf9
cells has been described, and can be used in the practice of the
invention (Chackerian, B. et al., Proc. Natl. Acad. Sci. USA
96:2373-2378 (1999), WO 00/23955). Purification of the assembled
particles displaying the fused antigen or antigenic determinant can
be performed in a number of ways, such as for example gel
filtration or sucrose gradient ultracentrifugation (Chackerian, B.
et al., Proc. Natl. Acad. Sci. USA 96:2373-2378 (1999), WO
00/23955).
[0257] In a further embodiment of the invention, the antigen or
antigenic determinant is fused to a Ty protein capable of being
incorporated into a Ty VLP. In a more specific embodiment, the
antigen or antigenic determinant is fused to the p1 or capsid
protein encoded by the TYA gene (Roth, J. F., Yeast 16:785-795
(2000)). The yeast retrotransposons Ty1, 2, 3 and 4 have been
isolated from Saccharomyces Serevisiae, while the retrotransposon
Tf1 has been isolated from Schizosaccharomyces Pombae (Boeke, J. D.
and Sandmeyer, S. B., "Yeast Transposable elements," in The
molecular and Cellular Biology of the Yeast Saccharomyces: Genome
dynamics, Protein Synthesis, and Energetics, p. 193, Cold Spring
Harbor Laboratory Press (1991)). The retrotransposons Ty1 and 2 are
related to the copia class of plant and animal elements, while Ty3
belongs to the gypsy family of retrotransposons, which is related
to plants and animal retroviruses. In the Ty1 retrotransposon, the
p1 protein, also referred to as Gag or capsid protein, has a length
of 440 amino acids. P1 is cleaved during maturation of the VLP at
position 408, leading to the p2 protein, the essential component of
the VLP.
[0258] Fusion proteins to p1 and vectors for the expression of said
fusion proteins in Yeast have been described (Adams, S. E., et al.,
Nature 329:68-70 (1987)). So, for example, an antigen or antigenic
determinant may be fused to p1 by inserting a sequence coding for
the antigen or antigenic determinant into the BamH1 site of the
pMA5620 plasmid (Adams, S. E., et al., Nature 329:68-70 (1987)).
The cloning of sequences coding for foreign epitopes into the
pMA5620 vector leads to expression of fusion proteins comprising
amino acids 1-381 of p1 of Ty1-15, fused C-terminally to the
N-terminus of the foreign epitope. Likewise, N-terminal fusion of
an antigen or antigenic determinant, or internal insertion into the
p1 sequence, or substitution of part of the p1 sequence are also
meant to fall within the scope of the invention. In particular,
insertion of an antigen or antigenic determinant into the Ty
sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of
the Ty protein p1 (EP06771 11) leads to preferred embodiments of
the invention.
[0259] Further VLPs suitable for fusion of antigens or antigenic
determinants are, for example, Retrovirus-like-particles
(WO9630523), HIV2 Gag (Kang, Y. C., et al, Biol. Chem. 380:353-364
(1999)), Cowpea Mosaic Virus (Taylor, K. M. et al., Biol. Chem.
380:387-392 (1999)), parvovirus VP2 VLP (Rueda, P. et al., Virology
263:89-99 (1999)), HBsAg (U.S. Pat. No. 4,722,840,
EP0020416B1).
[0260] Examples of chimeric VLPs suitable for the practice of the
invention are also those described in Intervirology 39:1 (1996).
Further examples of VLPs contemplated for use in the invention are:
HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV,
HIV GAG, Tobacco Mosaic Virus. Virus-like particles of SV-40,
Polyomavirus, Adenovirus, Herpes Simplex Virus, Rotavirus and
Norwalk virus have also been made, and chimeric VLPs of those VLPs
comprising an antigen or antigenic determinant are also within the
scope of the present invention.
[0261] As indicated, embodiments comprising antigens fused to the
virus-like particle by insertion within the sequence of the
virus-like particle building monomer are also within the scope of
the present invention. In some cases, antigens can be inserted in a
form of the virus-like particle building monomer containing
deletions. In these cases, the virus-like particle building monomer
may not be able to form virus-like structures in the absence of the
inserted antigen.
[0262] In some instances, recombinant DNA technology can be
utilized to fuse a heterologous protein to a VLP protein (Kratz,
P.A., et al., Proc. Natl. Acad. Sci. USA 96:1915 (1999)). For
example, the present invention encompasses VLPs recombinantly fused
or chemically conjugated (including both covalently and
non-covalently conjugations) to an antigen (or portion thereof,
preferably at least 10, 20 or 50 amino acids) of the present
invention to generate fusion proteins or conjugates. The fusion
does not necessarily need to be direct, but can occur through
linker sequences. More generally, in the case that epitopes, either
fused, conjugated or otherwise attached to the virus-like particle,
are used as antigens in accordance with the invention, spacer or
linker sequences are typically added at one or both ends of the
epitopes. Such linker sequences preferably comprise sequences
recognized by the proteasome, proteases of the endosomes or other
vesicular compartment of the cell.
[0263] One way of coupling is by a peptide bond, in which the
conjugate can be a contiguous polypeptide, i.e. a fusion protein.
In a fusion protein according to the present invention, different
peptides or polypeptides are linked in frame to each other to form
a contiguous polypeptide. Thus a first portion of the fusion
protein comprises an antigen or immunogen and a second portion of
the fusion protein, either N-terminal or C-terminal to the first
portion, comprises a VLP. Alternatively, internal insertion into
the VLP, with optional linking sequences on both ends of the
antigen, can also be used in accordance with the present
invention.
[0264] When HBcAg is used as the VLP, it is preferred that the
antigen is linked to the C-terminal end of the HBcAg particle. The
hepatitis B core antigen (HBcAg) exhibiting a C-terminal fusion of
the MHC class I restricted peptide p33 derived from lymphocytic
choriomeningitis virus (LCMV) glycoprotein was used as a model
antigen (HBcAg-p33). The 185 amino acids long wild type HBc protein
assembles into highly structured particles composed of 180 subunits
assuming icosahedral geometry. The flexibility of the HBcAg and
other VLPs in accepting relatively large insertions of foreign
sequences at different positions while retaining the capacity to
form structured capsids is well documented in the literature. This
makes the HBc VLPs attractive candidates for the design of
non-replicating vaccines.
[0265] A flexible linker sequence (e.g. a
polyglycine/polyserine-containin- g sequence such as [Gly.sub.4
Ser].sub.2 (Huston et al., Meth. Enzymol 203:46-88 (1991)) can be
inserted into the fusion protein between the antigen and ligand.
Also, the fusion protein can be constructed to contain an "epitope
tag", which allows the fusion protein to bind an antibody (e.g.
monoclonal antibody) for example for labeling or purification
purposes. An example of an epitope tag is a Glu-Glu-Phe tripeptide
which is recognized by the monoclonal antibody YL1/2.
[0266] The invention also relates to the chimeric DNA which
contains a sequence coding for the VLP and a sequence coding for
the antigen/immunogen. The DNA can be expressed, for example, in
insect cells transformed with Baculoviruses, in yeast or in
bacteria. There are no restrictions regarding the expression
system, of which a large selection is available for routine use.
Preferably, a system is used which allows expression of the
proteins in large amounts. In general, bacterial expression systems
are preferred on account of their efficiency. One example of a
bacterial expression system suitable for use within the scope of
the present invention is the one described by Clarke et al., J Gen.
Virol. 71: 1109-1117 (1990); Borisova et al., J. Virol. 67:
3696-3701 (1993); and Studier et al., Methods Enzymol. 185:60-89
(1990). An example of a suitable yeast expression system is the one
described by Emr, Methods Enzymol. 185:231-3 (1990); Baculovirus
systems, which have previously been used for preparing capsid
proteins, are also suitable. Constitutive or inducible expression
systems can be used. By the choice and possible modification of
available expression systems it is possible to control the form in
which the proteins are obtained.
[0267] In a specific embodiment of the invention, the antigen to
which an enhanced immune response is desired is coupled, fused or
otherwise attached in frame to the Hepatitis B virus capsid (core)
protein (HBcAg). However, it will be clear to all individuals in
the art that other virus-like particles can be utilized in the
fusion protein construct of the invention.
[0268] In a further preferred embodiment of the present invention,
the at least one antigen or antigenic determinant is bound to the
virus-like particle by at least one covalent bond. Preferably, the
least one antigen or antigenic determinant is bound to the
virus-like particle by at least one covalent bond, said covalent
bond being a non-peptide bond leading to an antigen or antigenic
determinant array and antigen or antigenic determinant -VLP
conjugate, respectively. This antigen or antigenic determinant
array and conjugate, respectively, has typically and preferably a
repetitive and ordered structure since the at least one antigen or
antigenic determinant is bound to the VLP in an oriented manner.
The formation of a repetitive and ordered antigen or antigenic
determinant -VLP array and conjugate, respectively, is ensured by
an oriented and directed as well as defined binding and attachment,
respectively, of the at least one antigen or antigenic determinant
to the VLP as will become apparent in the following. Furthermore,
the typical inherent highly repetitive and organized structure of
the VLPs advantageously contributes to the display of the antigen
or antigenic determinant in a highly ordered and repetitive fashion
leading to a highly organized and repetitive antigen or antigenic
determinant -VLP array and conjugate, respectively.
[0269] Therefore, the preferred inventive conjugates and arrays,
respectively, differ from prior art conjugates in their highly
organized structure, dimensions, and in the repetitiveness of the
antigen on the surface of the array. The preferred embodiment of
this invention, furthermore, allows expression of the particle in
an expression host guaranteeing proper folding and assembly of the
VLP, to which the antigen is then further coupled
[0270] The present invention discloses methods of binding of
antigen or antigenic determinant to VLPs. As indicated, in one
aspect of the invention, the at least one antigen or antigenic
determinant is bound to the VLP by way of chemical cross-linking,
typically and preferably by using a heterobifunctional
cross-linker. Several hetero-bifunctional cross-linkers are known
to the art. In preferred embodiments, the hetero-bifunctional
cross-linker contains a functional group which can react with
preferred first attachment sites, i.e. with the side-chain amino
group of lysine residues of the VLP or at least one VLP subunit,
and a further functional group which can react with a preferred
second attachment site, i.e. a cysteine residue fused to the
antigen or antigenic determinant and optionally also made available
for reaction by reduction. The first step of the procedure,
typically called the derivatization, is the reaction of the VLP
with the cross-linker. The product of this reaction is an activated
VLP, also called activated carrier. In the second step, unreacted
cross-linker is removed using usual methods such as gel filtration
or dialysis. In the third step, the antigen or antigenic
determinant is reacted with the activated VLP, and this step is
typically called the coupling step. Unreacted antigen or antigenic
determinant may be optionally removed in a fourth step, for example
by dialysis. Several hetero-bifunctional cross-linkers are known to
the art. These include the preferred cross-linkers SMPH (Pierce),
Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB,
Sulfo-SMCC, SVSB, SIA and other cross-linkers available for example
from the Pierce Chemical Company (Rockford, Ill., USA), and having
one functional group reactive towards amino groups and one
functional group reactive towards cysteine residues. The above
mentioned cross-linkers all lead to formation of a thioether
linkage. Another class of cross-linkers suitable in the practice of
the invention is characterized by the introduction of a disulfide
linkage between the antigen or antigenic determinant and the VLP
upon coupling. Preferred cross-linkers belonging to this class
include for example SPDP and Sulfo-LC-SPDP (Pierce). The extent of
derivatization of the VLP with cross-linker can be influenced by
varying experimental conditions such as the concentration of each
of the reaction partners, the excess of one reagent over the other,
the pH, the temperature and the ionic strength. The degree of
coupling, i.e. the amount of antigens or antigenic determinants per
subunits of the VLP can be adjusted by varying the experimental
conditions described above to match the requirements of the
vaccine.
[0271] A particularly favored method of binding of antigens or
antigenic determinants to the VLP, is the linking of a lysine
residue on the surface of the VLP with a cysteine residue on the
antigen or antigenic determinant. In some embodiments, fusion of an
amino acid linker containing a cysteine residue, as a second
attachment site or as a part thereof, to the antigen or antigenic
determinant for coupling to the VLP may be required.
[0272] In general, flexible amino acid linkers are favored.
Examples of the amino acid linker are selected from the group
consisting of: (a) CGG; (b) N-terminal gamma 1-linker; (c)
N-terminal gamma 3-linker; (d) Ig hinge regions; (e) N-terminal
glycine linkers; (f) (G).sub.kC(G).sub.n with n=0-12 and k=0-5; (g)
N-terminal glycine-serine linkers; (h)
(G).sub.kC(G).sub.m(S).sub.l(GGGGS).sub.n with n=0-3, k=0-5,
m=0-10, 1=0-2; (i) GGC; (k) GGC-NH2; (1) C-terminal gamma 1-linker;
(m) C-terminal gamma 3-linker; (n) C-terminal glycine linkers; (o)
(G).sub.nC(G).sub.k with n=0-12 and k=0-5; (p) C-terminal
glycine-serine linkers; (q)
(G).sub.m(S).sub.l(GGGGS).sub.n(G).sub.oC(G).sub.k with n=0-3,
k=0-5, m=0-10, 1=0-2, and o=0-8.
[0273] Further examples of amino acid linkers are the hinge region
of Immunoglobulins, glycine serine linkers (GGGGS).sub.n, and
glycine linkers (G).sub.n all further containing a cysteine residue
as second attachment site and optionally further glycine residues.
Typically preferred examples of said amino acid linkers are
N-terminal gammal: CGDKTHTSPP; C-terminal gamma 1: DKTHTSPPCG;
N-terminal gamma 3: CGGPKPSTPPGSSGGAP; C-terminal gamma 3:
PKPSTPPGSSGGAPGGCG; N-terminal glycine linker: GCGGGG and
C-terminal glycine linker: GGGGCG.
[0274] Other amino acid linkers particularly suitable in the
practice of the invention, when a hydrophobic antigen or antigenic
determinant is bound to a VLP, are CGKKGG, or CGDEGG for N-terminal
linkers, or GGKKGC and GGEDGC, for the C-terminal linkers. For the
C-terminal linkers, the terminal cysteine is optionally
C-terminally amidated.
[0275] In preferred embodiments of the present invention, GGCG, GGC
or GGC-NH2 ("NH2" stands for amidation) linkers at the C-terminus
of the peptide or CGG at its N-terminus are preferred as amino acid
linkers. In general, glycine residues will be inserted between
bulky amino acids and the cysteine to be used as second attachment
site, to avoid potential steric hindrance of the bulkier amino acid
in the coupling reaction. In the most preferred embodiment of the
invention, the amino acid linker GGC-NH2 is fused to the C-terminus
of the antigen or antigenic determinant.
[0276] The cysteine residue present on the antigen or antigenic
determinant has to be in its reduced state to react with the
hetero-bifunctional cross-linker on the activated VLP, that is a
free cysteine or a cysteine residue with a free sulfhydryl group
has to be available. In the instance where the cysteine residue to
function as binding site is in an oxidized form, for example if it
is forming a disulfide bridge, reduction of this disulfide bridge
with e.g. DTT, TCEP or .beta.-mercaptoethanol is required. Low
concentrations of reducing agent are compatible with coupling as
described in WO 02/05690, higher concentrations inhibit the
coupling reaction, as a skilled artisan would know, in which case
the reductand has to be removed or its concentration decreased
prior to coupling, e.g. by dialysis, gel filtration or reverse
phase HPLC.
[0277] Binding of the antigen or antigenic determinant to the VLP
by using a hetero-bifunctional cross-linker according to the
preferred methods described above, allows coupling of the antigen
or antigenic determinant to the VLP in an oriented fashion. Other
methods of binding the antigen or antigenic determinant to the VLP
include methods wherein the antigen or antigenic determinant is
cross-linked to the VLP using the carbodiimide EDC, and NHS. In
further methods, the antigen or antigenic determinant is attached
to the VLP using a homo-bifunctional cross-linker such as
glutaraldehyde, DSG, BM[PEO].sub.4, BS.sup.3, (Pierce Chemical
Company, Rockford, Ill., USA) or other known homo-bifunctional
cross-linkers whith functional groups reactive towards amine groups
or carboxyl groups of the VLP.
[0278] Other methods of binding the VLP to an antigen or antigenic
determinant include methods where the VLP is biotinylated, and the
antigen or antigenic determinant expressed as a streptavidin-fusion
protein, or methods wherein both the antigen or antigenic
determinant and the VLP are biotinylated, for example as described
in WO 00/23955. In this case, the antigen or antigenic determinant
may be first bound to streptavidin or avidin by adjusting the ratio
of antigen or antigenic determinant to streptavidin such that free
binding sites are still available for binding of the VLP, which is
added in the next step. Alternatively, all components may be mixed
in a "one pot" reaction. Other ligand-receptor pairs, where a
soluble form of the receptor and of the ligand is available, and
are capable of being cross-linked to the VLP or the antigen or
antigenic determinant, may be used as binding agents for binding
antigen or antigenic determinant to the VLP. Alternatively, either
the ligand or the receptor may be fused to the antigen or antigenic
determinant, and so mediate binding to the VLP chemically bound or
fused either to the receptor, or the ligand respectively. Fusion
may also be effected by insertion or substitution.
[0279] As already indicated, in a favored embodiment of the present
invention, the VLP is the VLP of a RNA phage, and in a more
preferred embodiment, the VLP is the VLP of RNA phage Q.beta. coat
protein.
[0280] One or several antigen molecules, i.e. one or several
antigens or antigenic determinants, can be attached to one subunit
of the capsid or VLP of RNA phages coat proteins, preferably
through the exposed lysine residues of the VLP of RNA phages, if
sterically allowable. A specific feature of the VLP of the coat
protein of RNA phages and in particular of the Q.beta. coat protein
VLP is thus the possibility to couple several antigens per subunit.
This allows for the generation of a dense antigen array.
[0281] In a preferred embodiment of the invention, the binding and
attachment, respectively, of the at least one antigen or antigenic
determinant to the virus-like particle is by way of interaction and
association, respectively, between at least one first attachment
site of the virus-like particle and at least one second attachment
of the antigen or antigenic determinant.
[0282] VLPs or capsids of Q.beta. coat protein display a defined
number of lysine residues on their surface, with a defined topology
with three lysine residues pointing towards the interior of the
capsid and interacting with the RNA, and four other lysine residues
exposed to the exterior of the capsid. These defined properties
favor the attachment of antigens to the exterior of the particle,
rather than to the interior of the particle where the lysine
residues interact with RNA. VLPs of other RNA phage coat proteins
also have a defined number of lysine residues on their surface and
a defined topology of these lysine residues.
[0283] In further preferred embodiments of the present invention,
the first attachment site is a lysine residue and/or the second
attachment comprises sulfhydryl group or a cysteine residue. In a
very preferred embodiment of the present invention, the first
attachment site is a lysine residue and the second attachment is a
cysteine residue.
[0284] In very preferred embodiments of the invention, the antigen
or antigenic determinant is bound via a cysteine residue, to lysine
residues of the VLP of RNA phage coat protein, and in particular to
the VLP of Q.beta. coat protein.
[0285] Another advantage of the VLPs derived from RNA phages is
their high expression yield in bacteria that allows production of
large quantities of material at affordable cost.
[0286] As indicated, the inventive conjugates and arrays,
respectively, differ from prior art conjugates in their highly
organized structure, dimensions, and in the repetitiveness of the
antigen on the surface of the array. Moreover, the use of the VLPs
as carriers allow the formation of robust antigen arrays and
conjugates, respectively, with variable antigen density. In
particular, the use of VLPs of RNA phages, and hereby in particular
the use of the VLP of RNA phage Q.beta. coat protein allows to
achieve very high epitope density. In particular, a density of more
than 1.5 epitopes per subunit could be reached by coupling the
human A.beta.1-6 peptide to the VLP of Q.beta. coat protein. The
preparation of compositions of VLPs of RNA phage coat proteins with
a high epitope density can be effected using the teaching of this
application. In prefered embodiment of the invention, when an
antigen or antigenic determinant is coupled to the VLP of Q.beta.
coat protein, an average number of antigen or antigenic determinant
per subunit of 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,
1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4 2.5, 2.6, 2.7,
2.8, 2.9, or higher is preferred.
[0287] The second attachment site, as defined herein, may be either
naturally or non-naturally present with the antigen or the
antigenic determinant. In the case of the absence of a suitable
natural occurring second attachment site on the antigen or
antigenic determinant, such a, then non-natural second attachment
has to be engineered to the antigen.
[0288] As described above, four lysine residues are exposed on the
surface of the VLP of Q.beta. coat protein. Typically these
residues are derivatized upon reaction with a cross-linker
molecule. In the instance where not all of the exposed lysine
residues can be coupled to an antigen, the lysine residues which
have reacted with the cross-linker are left with a cross-linker
molecule attached to the .epsilon.-amino group after the
derivatization step. This leads to disappearance of one or several
positive charges, which may be detrimental to the solubility and
stability of the VLP. By replacing some of the lysine residues with
arginines, as in the disclosed Q.beta. coat protein mutants
described below, we prevent the excessive disappearance of positive
charges since the arginine residues do not react with the
cross-linker. Moreover, replacement of lysine residues by arginines
may lead to more defined antigen arrays, as fewer sites are
available for reaction to the antigen.
[0289] Accordingly, exposed lysine residues were replaced by
arginines in the following Q.beta. coat protein mutants and mutant
Q.beta. VLPs disclosed in this application: Q.beta.-240 (Lys13-Arg;
SEQ ID NO:23), Q.beta.-250 (Lys 2-Arg, Lys13-Arg; SEQ ID NO: 25)
and Q.beta.-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO:27). The
constructs were cloned, the proteins expressed, the VLPs purified
and used for coupling to peptide and protein antigens. Q.beta.-251;
(SEQ ID NO: 26) was also constructed, and guidance on how to
express, purify and couple the VLP of Q.beta.-251 coat protein can
be found throughout the application.
[0290] In a further embodiment, we disclose a Q.beta. mutant coat
protein with one additional lysine residue, suitable for obtaining
even higher density arrays of antigens. This mutant Q.beta. coat
protein, Q.beta.-243 (Asn 10-Lys; SEQ ID NO: 24), was cloned, the
protein expressed, and the capsid or VLP isolated and purified,
showing that introduction of the additional lysine residue is
compatible with self-assembly of the subunits to a capsid or VLP.
Thus, antigen or antigenic determinant arrays and conjugates,
respectively, may be prepared using VLP of Q.beta. coat protein
mutants. A particularly favored method of attachment of antigens to
VLPs, and in particular to VLPs of RNA phage coat proteins is the
linking of a lysine residue present on the surface of the VLP of
RNA phage coat proteins with a cysteine residue added to the
antigen. In order for a cysteine residue to be effective as second
attachment site, a sulfhydryl group must be available for coupling.
Thus, a cysteine residue has to be in its reduced state, that is, a
free cysteine or a cysteine residue with a free sulfhydryl group
has to be available. In the instant where the cysteine residue to
function as second attachment site is in an oxidized form, for
example if it is forming a disulfide bridge, reduction of this
disulfide bridge with e.g. DTT, TCEP or .beta.-mercaptoethanol is
required. The concentration of reductand, and the molar excess of
reductand over antigen has to be adjusted for each antigen. A
titration range, starting from concentrations as low as 10 .mu.M or
lower, up to 10 to 20 mM or higher reductand if required is tested,
and coupling of the antigen to the carrier assessed. Although low
concentrations of reductand are compatible with the coupling
reaction as described in WO 02/056905, higher concentrations
inhibit the coupling reaction, as a skilled artisan would know, in
which case the reductand has to be removed or its concentration
decreased, e.g. by dialysis, gel filtration or reverse phase HPLC.
Advantageously, the pH of the dialysis or equilibration buffer is
lower than 7, preferably 6. The compatibility of the low pH buffer
with antigen activity or stability has to be tested.
[0291] Epitope density on the VLP of RNA phage coat proteins can be
modulated by the choice of cross-linker and other reaction
conditions. For example, the cross-linkers Sulfo-GMBS and SMPH
typically allow reaching high epitope density. Derivatization is
positively influenced by high concentration of reactands, and
manipulation of the reaction conditions can be used to control the
number of antigens coupled to VLPs of RNA phage coat proteins, and
in particular to VLPs of Q.beta. coat protein.
[0292] Prior to the design of a non-natural second attachment site
the position at which it should be fused, inserted or generally
engineered has to be chosen. The selection of the position of the
second attachment site may, by way of example, be based on a
crystal structure of the antigen. Such a crystal structure of the
antigen may provide information on the availability of the C- or
N-termini of the molecule (determined for example from their
accessibility to solvent), or on the exposure to solvent of
residues suitable for use as second attachment sites, such as
cysteine residues. Exposed disulfide bridges, as is the case for
Fab fragments, may also be a source of a second attachment site,
since they can be generally converted to single cysteine residues
through mild reduction, with e.g. 2-mercaptoethylamine, TCEP,
.beta.-mercaptoethanol or DTT. Mild reduction conditions not
affecting the immunogenicity of the antigen will be chosen. In
general, in the case where immunization with a self-antigen is
aiming at inhibiting the interaction of this self-antigen with its
natural ligands, the second attachment site will be added such that
it allows generation of antibodies against the site of interaction
with the natural ligands. Thus, the location of the second
attachment site will be selected such that steric hindrance from
the second attachment site or any amino acid linker containing the
same is avoided. In further embodiments, an antibody response
directed at a site distinct from the interaction site of the
self-antigen with its natural ligand is desired. In such
embodiments, the second attachment site may be selected such that
it prevents generation of antibodies against the interaction site
of the self-antigen with its natural ligands.
[0293] Other criteria in selecting the position of the second
attachment site include the oligomerization state of the antigen,
the site of oligomerization, the presence of a cofactor, and the
availability of experimental evidence disclosing sites in the
antigen structure and sequence where modification of the antigen is
compatible with the function of the self-antigen, or with the
generation of antibodies recognizing the self-antigen.
[0294] In very preferred embodiments, the antigen or antigenic
determinant comprises a single second attachment site or a single
reactive attachment site capable of association with the first
attachment sites on the core particle and the VLPs or VLP subunits,
respectively. This further ensures a defined and uniform binding
and association, respectively, of the at least one, but typically
more than one, preferably more than 10, 20, 40, 80, 120 antigens to
the core particle and VLP, respectively. The provision of a single
second attachment site or a single reactive attachment site on the
antigen, thus, ensures a single and uniform type of binding and
association, respectively leading to a very highly ordered and
repetitive array. For example, if the binding and association,
respectively, is effected by way of a lysine- (as the first
attachment site) and cysteine- (as a second attachment site)
interaction, it is ensured, in accordance with this preferred
embodiment of the invention, that only one cysteine residue per
antigen, independent whether this cysteine residue is naturally or
non-naturally present on the antigen, is capable of binding and
associating, respectively, with the VLP and the first attachment
site of the core particle, respectively.
[0295] In some embodiments, engineering of a second attachment site
onto the antigen require the fusion of an amino acid linker
containing an amino acid suitable as second attachment site
according to the disclosures of this invention. Therefore, in a
preferred embodiment of the present invention, an amino acid linker
is bound to the antigen or the antigenic determinant by way of at
least one covalent bond. Preferably, the amino acid linker
comprises, or alternatively consists of, the second attachment
site. In a further preferred embodiment, the amino acid linker
comprises a sulfhydryl group or a cysteine residue. In another
preferred embodiment, the amino acid linker is cysteine. Some
criteria of selection of the amino acid linker as well as further
preferred embodiments of the amino acid linker according to the
invention have already been mentioned above.
[0296] In another specific embodiment of the invention, the
attachment site is selected to be a lysine or cysteine residue that
is fused in frame to the HBcAg. In a preferred embodiment, the
antigen is fused to the C-terminus of HBcAg via a three leucine
linker.
[0297] When an antigen or antigenic determinant is linked to the
VLP through a lysine residue, it may be advantageous to either
substitute or delete one or more of the naturally resident lysine
residues, as well as other lysine residues present in HBcAg
variants.
[0298] In many instances, when the naturally resident lysine
residues are eliminated, another lysine will be introduced into the
HBcAg as an attachment site for an antigen or antigenic
determinant. Methods for inserting such a lysine residue are known
in the art. Lysine residues may also be added without removing
existing lysine residues.
[0299] The C-terminus of the HBcAg has been shown to direct nuclear
localization of this protein. (Eckhardt et al., J. Virol.
65:575-582 (1991)). Further, this region of the protein is also
believed to confer upon the HBcAg the ability to bind nucleic
acids.
[0300] As indicated, HBcAgs suitable for use in the practice of the
present invention also include N-terminal truncation mutants.
Suitable truncation mutants include modified HBcAgs where 1, 2, 5,
7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the
N-terminus. However, variants of virus-like particles containing
internal deletions within the sequence of the subunit composing the
virus-like particle are also suitable in accordance with the
present invention, provided their compatibility with the ordered or
particulate structure of the virus-like particle. For example,
internal deletions within the sequence of the HBcAg are suitable
(Preikschat, P., et al., J. Gen. Virol. 80:1777-1788 (1999)).
[0301] Further HBcAgs suitable for use in the practice of the
present invention include N- and C-terminal truncation mutants.
Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10,
12, 14, 15, and 17 amino acids have been removed from the
N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35, 36, 37, 38, 39 40,
41, 42 or 48 amino acids have been removed from the C-terminus.
[0302] Vaccine compositions of the invention can comprise mixtures
of different HBcAgs. Thus, these vaccine compositions can be
composed of HBcAgs which differ in amino acid sequence. For
example, vaccine compositions could be prepared comprising a
"wild-type" HBcAg and a modified HBcAg in which one or more amino
acid residues have been altered (e.g., deleted, inserted or
substituted). In most applications, however, only one type of a
HBcAg will be used.
[0303] The present invention is applicable to a wide variety of
antigens. In a preferred embodiment, the antigen is a protein,
polypeptide or peptide. In another embodiment the antigen is DNA.
The antigen can also be a lipid, a carbohydrate, or an organic
molecule, in particular a small organic molecule such as
nicotine.
[0304] Antigens of the invention can be selected from the group
consisting of the following: (a) polypeptides suited to induce an
immune response against cancer cells; (b) polypeptides suited to
induce an immune response against infectious diseases; (c)
polypeptides suited to induce an immune response against allergens;
(d) polypeptides suited to induce an immune response in farm
animals or pets; and (e) fragments (e.g., a domain) of any of the
polypeptides set out in (a)-(d).
[0305] Preferred antigens include those from a pathogen (e.g.
virus, bacterium, parasite, fungus) and tumors (especially
tumor-associated antigens or "tumor markers"). Other preferred
antigens are autoantigens.
[0306] In the specific embodiments described in the Examples, the
antigen is the peptide p33 derived from lymphocytic
choriomeningitis virus (LCMV). The p33 peptide represents one of
the best studied CTL epitopes (Pircher et al., "Tolerance induction
in double specific T-cell receptor transgenic mice varies with
antigen," Nature 342:559 (1989); Tissot et al., "Characterizing the
functionality of recombinant T-cell receptors in vitro: a pMHC
tetramer based approach," J Immunol Methods 236:147 (2000);
Bachmann et al., "Four types of Ca2+-signals after stimulation of
naive T cells with T cell agonists, partial agonists and
antagonists," Eur. J. Immunol. 27:3414 (1997); Bachmann et al.,
"Functional maturation of an anti-viral cytotoxic T cell response,"
J. Virol. 71:5764 (1997); Bachmann et al., "Peptide induced
TCR-down regulation on naive T cell predicts agonist/partial
agonist properties and strictly correlates with T cell activation,"
Eur. J. Immunol. 27:2195 (1997); Bachmann et al., "Distinct roles
for LFA-1 and CD28 during activation of naive T cells: adhesion
versus costimulation," Immunity 7:549 (1997)). p33-specific T cells
have been shown to induce lethal diabetic disease in transgenic
mice (Ohashi et al., "Ablation of `tolerance` and induction of
diabetes by virus infection in viral antigen transgenic mice," Cell
65:305 (1991)) as well as to be able to prevent growth of tumor
cells expressing p33 (Kundig et al., "Fibroblasts act as efficient
antigen-presenting cells in lymphoid organs," Science 268:1343
(1995); Speiser et al., "CTL tumor therapy specific for an
endogenous antigen does not cause autoimmune disease," J. Exp. Med.
186:645 (1997)). This specific epitope, therefore, is particularly
well suited to study autoimmunity, tumor immunology as well as
viral diseases.
[0307] In one specific embodiment of the invention, the antigen or
antigenic determinant is one that is useful for the prevention of
infectious disease. Such treatment will be useful to treat a wide
variety of infectious diseases affecting a wide range of hosts,
e.g., human, cow, sheep, pig, dog, cat, other mammalian species and
non-mammalian species as well. Treatable infectious diseases are
well known to those skilled in the art, and examples include
infections of viral etiology such as HIV, influenza, Herpes, viral
hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken
pox, Papilloma virus etc.; or infections of bacterial etiology such
as pneumonia, tuberculosis, syphilis, etc.; or infections of
parasitic etiology such as malaria, trypanosomiasis, leishmaniasis,
trichomoniasis, amoebiasis, etc. Thus, antigens or antigenic
determinants selected for the compositions of the invention will be
well known to those in the medical art; examples of antigens or
antigenic determinants include the following: the HIV antigens
gp140 and gp160; the influenza antigens hemagglutinin, M2 protein
and neuraminidase, Hepatitis B surface antigen or core and
circumsporozoite protein of malaria or fragments thereof.
[0308] As discussed above, antigens include infectious microbes
such as viruses, bacteria and fungi and fragments thereof, derived
from natural sources or synthetically. Infectious viruses of both
human and non-human vertebrates include retroviruses, RNA viruses
and DNA viruses. The group of retroviruses includes both simple
retroviruses and complex retroviruses. The simple retroviruses
include the subgroups of B-type retroviruses, C-type retroviruses
and D-type retroviruses. An example of a B-type retrovirus is mouse
mammary tumor virus (MMTV). The C-type retroviruses include
subgroups C-type group A (including Rous sarcoma virus (RSV), avian
leukemia virus (ALV), and avian mycloblastosis virus (AMV)) and
C-type group B (including murine leukemia virus (MLV), feline
leukemia virus (FeLV), murine sarcoma virus (MSV), gibbon ape
leukemia virus (GALV), spleen necrosis virus (SNV),
reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)).
The D-type retroviruses include Mason-Pfizer monkey virus (MPMV)
and simian retrovirus type 1 (SRV-1). The complex retroviruses
include the subgroups of lentiviruses, T-cell leukemia viruses and
the foamy viruses. Lentiviruses include HIV-1, but also include
HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and
equine infectious anemia virus (EIAV). The T-cell leukemia viruses
include HTLV-1, HTLV-T1, simian T-cell leukemia virus (STLV), and
bovine leukemia virus (BLV). The foamy viruses include human foamy
virus (HFV), simian foamy virus (SFV) and bovine foamy virus
(BFV).
[0309] Examples of RNA viruses that are antigens in vertebrate
animals include, but are not limited to, the following: members of
the family Reoviridae, including the genus Orthoreovirus (multiple
serotypes of both mammalian and avian retroviruses), the genus
Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus,
African horse sickness virus, and Colorado Tick Fever virus), the
genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus,
murine rotavirus, simian rotavirus, bovine or ovine rotavirus,
avian rotavirus); the family Picomaviridae, including the genus
Enterovirus (poliovirus, Coxsackie virus A and B, enteric
cytopathic human orphan (ECHO) viruses, hepatitis A, C, D, E and G
viruses, Simian enteroviruses, Murine encephalomyelitis (ME)
viruses, Poliovirus muris, Bovine enteroviruses, Porcine
enteroviruses, the genus Cardiovirus (Encephalomyocarditis virus
(EMC), Mengovirus), the genus Rhinovirus (Human rhinoviruses
including at least 113 subtypes; other rhinoviruses), the genus
Apthovirus (Foot and Mouth disease (FMDV); the family Calciviridae,
including Vesicular exanthema of swine virus, San Miguel sea lion
virus, Feline picornavirus and Norwalk virus; the family
Togaviridae, including the genus Alphavirus (Eastern equine
encephalitis virus, Semliki forest virus, Sindbis virus,
Chikungunya virus, O'Nyong-Nyong virus, Ross river virus,
Venezuelan equine encephalitis virus, Western equine encephalitis
virus), the genus Flavirius (Mosquito borne yellow fever virus,
Dengue virus, Japanese encephalitis virus, St. Louis encephalitis
virus, Murray Valley encephalitis virus, West Nile virus, Kunjin
virus, Central European tick borne virus, Far Eastern tick borne
virus, Kyasanur forest virus, Louping III virus, Powassan virus,
Omsk hemorrhagic fever virus), the genus Rubivirus (Rubella virus),
the genus Pestivirus (Mucosal disease virus, Hog cholera virus,
Border disease virus); the family Bunyaviridae, including the genus
Bunyvirus (Bunyamwera and related viruses, California encephalitis
group viruses), the genus Phlebovirus (Sandfly fever Sicilian
virus, Rift Valley fever virus), the genus Nairovirus
(Crimean-Congo hemorrhagic fever virus, Nairobi sheep disease
virus), and the genus Uukuvirus (Uukuniemi and related viruses);
the family Orthomyxoviridae, including the genus Influenza virus
(Influenza virus type A, many human subtypes); Swine influenza
virus, and Avian and Equine Influenza viruses; influenza type B
(many human subtypes), and influenza type C (possible separate
genus); the family paramyxoviridae, including the genus
Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus
of mice); forest virus, Sindbis virus, Chikungunya virus,
O'Nyong-Nyong virus, Ross river virus, Venezuelan equine
encephalitis virus, Western equine encephalitis virus), the genus
Flavirius (Mosquito borne yellow fever virus, Dengue virus,
Japanese encephalitis virus, St. Louis encephalitis virus, Murray
Valley encephalitis virus, West Nile virus, Kunjin virus, Central
European tick borne virus, Far Eastern tick borne virus, Kyasanur
forest virus, Louping III virus, Powassan virus, Omsk hemorrhagic
fever virus), the genus Rubivirus (Rubella virus), the genus
Pestivirus (Mucosal disease virus, Hog cholera virus, Border
disease virus); the family Bunyaviridae, including the genus
Bunyvirus (Bunyamwera and related viruses, California encephalitis
group viruses), the genus Phlebovirus (Sandfly fever Sicilian
virus, Rift Valley fever virus), the genus Nairovirus
(Crimean-Congo hemorrhagic fever virus, Nairobi sheep disease
virus), and the genus Uukuvirus (Uukuniemi and related viruses);
the family Orthomyxoviridae, including the genus Influenza virus
(Influenza virus type A, many human subtypes); Swine influenza
virus, and Avian and Equine Influenza viruses; influenza type B
(many human subtypes), and influenza type C (possible separate
genus); the family paramyxoviridae, including the genus
Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus
of mice); the family Rhabdoviridae, including the genus
Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park virus),
the genus Lyssavirus (Rabies virus), fish Rhabdoviruses and
filoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Mouse Hepatitis virus,
Human enteric corona virus, and Feline infectious peritonitis
(Feline coronavirus).
[0310] Illustrative DNA viruses that are antigens in vertebrate
animals include, but are not limited to: the family Poxviridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox,
goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Iridoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine, monkeys and rodents); the
gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A, B, C, D and E and ungrouped; simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses; the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
as Lymphotrophic papilloma virus); the family Parvoviridae
including the genus Adeno-associated viruses, the genus Parvovirus
(Feline panleukopenia virus, bovine parvovirus, canine parvovirus,
Aleutian mink disease virus, etc.). Finally, DNA viruses may
include viruses which do not fit into the above families such as
Kuru and Creutzfeldt-Jacob disease viruses and chronic infectious
neuropathic agents (CHINA virus).
[0311] Each of the foregoing lists is illustrative, and is not
intended to be limiting.
[0312] In a specific embodiment of the invention, the antigen
comprises one or more cytotoxic T cell epitopes, Th cell epitopes,
or a combination of the two epitopes.
[0313] In addition to enhancing an antigen specific immune response
in humans, the methods of the preferred embodiments are
particularly well suited for treatment of other mammals or other
animals, e.g., birds such as hens, chickens, turkeys, ducks, geese,
quail and pheasant. Birds are prime targets for many types of
infections.
[0314] An example of a common infection in chickens is chicken
infectious anemia virus (CIAV). CIAV was first isolated in Japan in
1979 during an investigation of a Marek's disease vaccination break
(Yuasa et al., Avian Dis. 23:366-385 (1979)). Since that time, CIAV
has been detected in commercial poultry in all major poultry
producing countries (van Bulow et al., pp. 690-699 in "Diseases of
Poultry", 9th edition, Iowa State University Press 1991).
[0315] Vaccination of birds, like other vertebrate animals can be
performed at any age. Normally, vaccinations are performed at up to
12 weeks of age for a live microorganism and between 14-18 weeks
for an inactivated microorganism or other type of vaccine. For in
ovo vaccination, vaccination can be performed in the last quarter
of embryo development. The vaccine can be administered
subcutaneously, by spray, orally, intraocularly, intratracheally,
nasally, in ovo or by other methods described herein.
[0316] Cattle and livestock are also susceptible to infection.
Disease which affect these animals can produce severe economic
losses, especially amongst cattle. The methods of the invention can
be used to protect against infection in livestock, such as cows,
horses, pigs, sheep and goats.
[0317] Cows can be infected by bovine viruses. Bovine viral
diarrhea virus (BVDV) is a small enveloped positive-stranded RNA
virus and is classified, along with hog cholera virus (HOCV) and
sheep border disease virus (BDV), in the pestivirus genus. Although
Pestiviruses were previously classified in the Togaviridae family,
some studies have suggested their reclassification within the
Flaviviridae family along with the flavivirus and hepatitis C virus
(HCV) groups.
[0318] Equine herpesviruses (EHV) comprise a group of antigenically
distinct biological agents which cause a variety of infections in
horses ranging from subclinical to fatal disease. These include
Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen in horses.
EHV-1 is associated with epidemics of abortion, respiratory tract
disease, and central nervous system disorders. Other EHV's include
EHV-2, or equine cytomegalovirus, EHV-3, equine coital exanthema
virus, and EHV-4, previously classified as EHV-1 subtype 2.
[0319] Sheep and goats can be infected by a variety of dangerous
microorganisms including visna-maedi.
[0320] Primates such as monkeys, apes and macaques can be infected
by simian immunodeficiency virus. Inactivated cell-virus and
cell-free whole simian immunodeficiency vaccines have been reported
to afford protection in macaques (Stott et al., Lancet 36:1538-1541
(1990); Desrosiers et al., PNAS USA 86:6353-6357 (1989);
Murphey-Corb et al., Science 246:1293-1297 (1989); and Carlson et
al., AIDS Res. Human Retroviruses 6:1239-1246 (1990)). A
recombinant HIV gp120 vaccine has been reported to afford
protection in chimpanzees (Berman et al., Nature 345:622-625
(1990)).
[0321] Cats, both domestic and wild, are susceptible to infection
with a variety of microorganisms. For instance, feline infectious
peritonitis is a disease which occurs in both domestic and wild
cats, such as lions, leopards, cheetahs, and jaguars. When it is
desirable to prevent infection with this and other types of
pathogenic organisms in cats, the methods of the invention can be
used to vaccinate cats to prevent them against infection.
[0322] Domestic cats may become infected with several retroviruses,
including but not limited to feline leukemia virus (FeLV), feline
sarcoma virus (FeSV), endogenous type C oncomavirus (RD-114), and
feline syncytia-forming virus (FeSFV). The discovery of feline
T-lymphotropic lentivirus (also referred to as feline
immunodeficiency) was first reported in Pedersen et al., Science
235:790-793 (1987). Feline infectious peritonitis (FIP) is a
sporadic disease occurring unpredictably in domestic and wild
Felidae. While FIP is primarily a disease of domestic cats, it has
been diagnosed in lions, mountain lions, leopards, cheetahs, and
the jaguar. Smaller wild cats that have been afflicted with FIP
include the lynx and caracal, sand cat and pallas cat.
[0323] Viral and bacterial diseases in fin-fish, shellfish or other
aquatic life forms pose a serious problem for the aquaculture
industry. Owing to the high density of animals in the hatchery
tanks or enclosed marine farming areas, infectious diseases may
eradicate a large proportion of the stock in, for example, a
fin-fish, shellfish, or other aquatic life forms facility.
Prevention of disease is a more desired remedy to these threats to
fish than intervention once the disease is in progress. Vaccination
of fish is the only preventative method which may offer long-term
protection through immunity. Nucleic acid based vaccinations of
fish are described, for example, in U.S. Pat. No. 5,780,448.
[0324] The fish immune system has many features similar to the
mammalian immune system, such as the presence of B cells, T cells,
lymphokines, complement, and immunoglobulins. Fish have lymphocyte
subclasses with roles that appear similar in many respects to those
of the B and T cells of mammals. Vaccines can be administered
orally or by immersion or injection.
[0325] Aquaculture species include but are not limited to fin-fish,
shellfish, and other aquatic animals. Fin-fish include all
vertebrate fish, which may be bony or cartilaginous fish, such as,
for example, salmonids, carp, catfish, yellowtail, seabream and
seabass. Salmonids are a family of fin-fish which include trout
(including rainbow trout), salmon and Arctic char. Examples of
shellfish include, but are not limited to, clams, lobster, shrimp,
crab and oysters. Other cultured aquatic animals include, but are
not limited to, eels, squid and octopi.
[0326] Polypeptides of viral aquaculture pathogens include but are
not limited to glycoprotein or nucleoprotein of viral hemorrhagic
septicemia virus (VHSV); G or N proteins of infectious
hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural
proteins of infectious pancreatic necrosis virus (IPNV); G protein
of spring viremia of carp (SVC); and a membrane-associated protein,
tegumin or capsid protein or glycoprotein of channel catfish virus
(CCV).
[0327] Polypeptides of bacterial pathogens include but are not
limited to an iron-regulated outer membrane protein, (IROMP), an
outer membrane protein (OMP), and an A-protein of Aeromonis
salmonicida which causes furunculosis, p57 protein of Renibacterium
salmoninarum which causes bacterial kidney disease (BKD), major
surface associated antigen (msa), a surface expressed cytotoxin
(mpr), a surface expressed hemolysin (ish), and a flagellar antigen
of Yersiniosis; an extracellular protein (ECP), an iron-regulated
outer membrane protein (IROMP), and a structural protein of
Pasteurellosis; an OMP and a flagellar protein of Vibrosis
anguillarum and V. ordalii; a flagellar protein, an OMP protein,
aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and
surface antigen of Ichthyophthirius; and a structural and
regulatory protein of Cytophaga columnari; and a structural and
regulatory protein of Rickettsia.
[0328] Polypeptides of a parasitic pathogen include but are not
limited to the surface antigens of Ichthyophthirius.
[0329] In another aspect of the invention, there is provided
vaccine compositions suitable for use in methods for preventing
and/or attenuating diseases or conditions which are caused or
exacerbated by "self" gene products (e.g., tumor necrosis factors).
Thus, vaccine compositions of the invention include compositions
which lead to the production of antibodies that prevent and/or
attenuate diseases or conditions caused or exacerbated by "self"
gene products. Examples of such diseases or conditions include
graft versus host disease, IgE-mediated allergic reactions,
anaphylaxis, adult respiratory distress syndrome, Crohn's disease,
allergic asthma, acute lymphoblastic leukemia (ALL), non-Hodgkin's
lymphoma (NHL), Graves' disease, systemic lupus erythematosus
(SLE), inflammatory autoimmune diseases, myasthenia gravis,
immunoproliferative disease lymphadenopathy (IPL),
angioimmunoproliferative lymphadenopathy (AIL), immunoblastive
lymphadenopathy (IBL), rheumatoid arthritis, diabetes, prion
diseases, multiple sclerosis, Alzheimer disease and
osteoporosis.
[0330] In related specific embodiments, compositions of the
invention are an immunotherapeutic that can be used for the
treatment and/or prevention of allergies, cancer or drug
addiction.
[0331] The selection of antigens or antigenic determinants for the
preparation of compositions and for use in methods of treatment for
allergies would be known to those skilled in the medical arts
treating such disorders. Representative examples of such antigens
or antigenic determinants include the following: bee venom
phospholipase A.sub.2, Bet v I (birch pollen allergen), 5 Dol m V
(white-faced hornet venom allergen), and Der p I (House dust mite
allergen), as well as fragments of each which can be used to elicit
immunological responses.
[0332] The selection of antigens or antigenic determinants for
compositions and methods of treatment for cancer would be known to
those skilled in the medical arts treating such disorders (see
Renkvist et al., Cancer. Immunol. Immunother. 50:3-15 (2001) which
is incorporated by reference), and such antigens or antigenic
determinants are included within the scope of the present
invention. Representative examples of such types of antigens or
antigenic determinants include the following: Her2 (breast cancer);
GD2 (neuroblastoma); EGF-R (malignant glioblastoma); CEA (medullary
thyroid cancer); CD52 (leukemia); human melanoma protein gp100;
human melanoma protein gp100 epitopes such as amino acids 154-162
(sequence: KTWGQYWQV), 209-217 (ITDQVPFSV), 280-288 (YLEPGPVTA),
457-466 (LLDGTATLRL) and 476-485 (VLYRYGSFSV); human melanoma
protein melan-A/MART-1; human melanoma protein melan-A/MART-1
epitopes such as amino acids 27-35 (AAGIGILTV) and 32-40
(ILTVILGVL); tyrosinase and tyrosinase related proteins (e.g.,
TRP-1 and TRP-2); tyrosinase epitopes such as amino acids 1-9
(MLLAVLYCL) and 369-377 (YMDGTMSQV); NA17-A nt protein; NA17-A nt
protein epitopes such as amino acids 38-64 (VLPDVFIRC); MAGE-3
protein; MAGE-3 protein epitopes such as amino acids 271-279
(FLWGPRALV); other human tumors antigens, e.g. CEA epitopes such as
amino acids 571-579 (YLSGANLNL); p53 protein; p53 protein epitopes
such as amino acids 65-73 (RMPEAAPPV), 149-157 (STPPPGTRV) and
264-272 (LLGRNSFEV); Her2/neu epitopes such as amino acids 369-377
(KIFGSLAFL) and 654-662 (IISAVVGIL); NY-ESO-1 peptides 157-165 and
157-167, 159-167; HPV16 E7 protein; HPV16 E7 protein epitopes such
as amino acids 86-93 (TLGIVCPI); as well as fragments of each which
can be used to elicit immunological responses.
[0333] The selection of antigens or antigenic determinants for
compositions and methods of treatment for drug addiction, in
particular recreational drug addiction, would be known to those
skilled in the medical arts treating such disorders. Representative
examples of such antigens or antigenic determinants include, for
example, opioids and morphine derivatives such as codeine,
fentanyl, heroin, morphium and opium; stimulants such as
amphetamine, cocaine, MDMA (methylenedioxymethamphetamine),
methamphetamine, methylphenidate and nicotine; hallucinogens such
as LSD, mescaline and psilocybin; as well as cannabinoids such as
hashish and marijuana.
[0334] The selection of antigens or antigenic determinants for
compositions and methods of treatment for other diseases or
conditions associated with self antigens would be also known to
those skilled in the medical arts treating such disorders.
Representative examples of such antigens or antigenic determinants
are, for example, lymphotoxins (e.g. Lymphotoxin .alpha. (LT
.alpha.), Lymphotoxin .beta. (LT .beta.)), and lymphotoxin
receptors, Receptor activator of nuclear factor kappaB ligand
(RANKL), vascular endothelial growth factor (VEGF) and vascular
endothelial growth factor receptor (VEGF-R), Interleukin 17 and
amyloid beta peptide (A.beta..sub.1-42), TN-F.alpha., MIF, MCP-1,
SDF-1, Rank-L, M-CSF, Angiotensin II, Endoglin, Eotaxin, Grehlin,
BLC, CCL21, IL-13, IL-17, IL-5, IL-8, IL-15, Bradykinin, Resistin,
LHRH, GHRH, GIH, CRH, TRH and Gastrin, as well as fragments of each
which can be used to elicit immunological responses.
[0335] In a particular embodiment of the invention, the antigen or
antigenic determinant is selected from the group consisting of: (a)
a recombinant polypeptide of HIV; (b) a recombinant polypeptide of
Influenza virus (e.g., an Influenza virus M2 polypeptide or a
fragment thereof); (c) a recombinant polypeptide of Hepatitis C
virus; (d) a recombinant polypeptide of Hepatitis B virus (e) a
recombinant polypeptide of Toxoplasma; (f) a recombinant
polypeptide of Plasmodium falciparum; (g) a recombinant polypeptide
of Plasmodium vivax; (h) a recombinant polypeptide of Plasmodium
ovale; (i) a recombinant polypeptide of Plasmodium malariae; (j) a
recombinant polypeptide of breast cancer cells; (k) a recombinant
polypeptide of kidney cancer cells; (l) a recombinant polypeptide
of prostate cancer cells; (m) a recombinant polypeptide of skin
cancer cells; (n) a recombinant polypeptide of brain cancer cells;
(o) a recombinant polypeptide of leukemia cells; (p) a recombinant
profiling; (q) a recombinant polypeptide of bee sting allergy; (r)
a recombinant polypeptide of nut allergy; (s) a recombinant
polypeptide of pollen; (t) a recombinant polypeptide of house-dust;
(u) a recombinant polypeptide of cat or cat hair allergy; (v) a
recombinant protein of food allergies; (w) a recombinant protein of
asthma; (x) a recombinant protein of Chlamydia; and (y) a fragment
of any of the proteins set out in (a)-(x).
[0336] In another embodiment of the present invention, the antigen,
being coupled, fused or otherwise attached to the virus-like
particle, is a T cell epitope, either a cytotoxic or a Th cell
epitope. In a further preferred embodiment, the antigen is a
combination of at least two, preferably different, epitopes,
wherein the at least two epitopes are linked directly or by way of
a linking sequence. These epitopes are preferably selected from the
group consisting of cytotoxic and Th cell epitopes.
[0337] It should also be understood that a mosaic virus-like
particle, e.g. a virus-like particle composed of subunits attached
to different antigens and epitopes, respectively, is within the
scope of the present invention. Such a composition of the present
invention can be, for example, obtained by transforming E. coli
with two compatible plasmids encoding the subunits composing the
virus-like particle fused to different antigens and epitopes,
respectively. In this instance, the mosaic virus-like particle is
assembled either directly in the cell or after cell lysis.
Moreover, such an inventive composition can also be obtained by
attaching a mixture of different antigens and epitopes,
respectively, to the isolated virus-like particle.
[0338] The antigen of the present invention, and in particular the
indicated epitope or epitopes, can be synthesized or recombinantly
expressed and coupled to the virus-like particle, or fused to the
virus-like particle using recombinant DNA techniques. Exemplary
procedures describing the attachment of antigens to virus-like
particles are disclosed in WO 00/32227, in WO 01/85208 and in WO
02/056905, the disclosures of which are herewith incorporated by
reference in its entirety
[0339] The invention also provides a method of producing a
composition for enhancing an immune response in an animal
comprising a VLP and an immunostimulatory substance, preferably an
unmethylated CpG-containing oligonucleotide bound to the VLP which
comprises incubating the VLP with the immunostimulatory substance
and oligonucleotide, respectively, adding RNase and purifying said
composition. In an equally preferred embodiment, the method
comprises incubating the VLP with RNase, adding the
immunostimulatory substance and oligonucleotide, respectively, and
purifying the composition. In one embodiment, the VLP is produced
in a bacterial expression system. In another embodiment, the RNase
is RNase A.
[0340] The invention further provides a method of producing a
composition for enhancing an immune response in an animal
comprising a VLP bound to an immunostimulatory substance,
preferably to an unmethylated CpG-containing oligonucleotide which
comprises disassembling the VLP, adding the immunostimulatory
substance and oligonucleotide, respectively, and reassembling the
VLP. The method can further comprise removing nucleic acids of the
disassembled VLP and/or purifying the composition after
reassembly.
[0341] The invention also provides vaccine compositions which can
be used for preventing and/or attenuating diseases or conditions.
Vaccine compositions of the invention comprise, or alternatively
consist of, an immunologically effective amount of the inventive
immune enhancing composition together with a pharmaceutically
acceptable diluent, carrier or excipient. The vaccine can also
optionally comprise an adjuvant.
[0342] The invention further provides vaccination methods for
preventing and/or attenuating diseases or conditions in animals. In
one embodiment, the invention provides vaccines for the prevention
of infectious diseases in a wide range of animal species,
particularly mammalian species such as human, monkey, cow, dog,
cat, horse, pig, etc. Vaccines can be designed to treat infections
of viral etiology such as HIV, influenza, Herpes, viral hepatitis,
Epstein Bar, polio, viral encephalitis, measles, chicken pox, etc.;
or infections of bacterial etiology such as pneumonia,
tuberculosis, syphilis, etc.; or infections of parasitic etiology
such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis,
amoebiasis, etc.
[0343] In another embodiment, the invention provides vaccines for
the prevention of cancer in a wide range of species, particularly
mammalian species such as human, monkey, cow, dog, cat, horse, pig,
etc. Vaccines can be designed to treat all types of cancer
including, but not limited to, lymphomas, carcinomas, sarcomas and
melanomas.
[0344] As would be understood by one of ordinary skill in the art,
when compositions of the invention are administered to an animal,
they can be in a composition which contains salts, buffers,
adjuvants or other substances which are desirable for improving the
efficacy of the composition. Examples of materials suitable for use
in preparing pharmaceutical compositions are provided in numerous
sources including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A,
ed., Mack Publishing Co., (1990)).
[0345] Various adjuvants can be used to increase the immunological
response, depending on the host species, and include but are not
limited to, Freund's (complete and incomplete), mineral gels such
as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are
also well known in the art. Further adjuvants that can be
administered with the compositions of the invention include, but
are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax
100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal
adjuvant technology. The adjuvants can also comprise a mixture of
these substances.
[0346] Compositions of the invention are said to be
"pharmacologically acceptable" if their administration can be
tolerated by a recipient individual. Further, the compositions of
the invention will be administered in a "therapeutically effective
amount" (i.e., an amount that produces a desired physiological
effect).
[0347] The compositions of the present invention can be
administered by various methods known in the art. The particular
mode selected will depend of course, upon the particular
composition selected, the severity of the condition being treated
and the dosage required for therapeutic efficacy. The methods of
the invention, generally speaking, can be practiced using any mode
of administration that is medically acceptable, meaning any mode
that produces effective levels of the active compounds without
causing clinically unacceptable adverse effects. Such modes of
administration include oral, rectal, parenteral, intracistemal,
intravaginal, intraperitoneal, topical (as by powders, ointments,
drops or transdermal patch), bucal, or as an oral or nasal spray.
The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular,
intraperitoneal, intrastemal, subcutaneous and intraarticular
injection and infusion. The composition of the invention can also
be injected directly in a lymph node.
[0348] Components of compositions for administration include
sterile aqueous (e.g., physiological saline) or non-aqueous
solutions and suspensions. Examples of non-aqueous solvents are
propylene glycol, polyethylene glycol, vegetable oils such as olive
oil, and injectable organic esters such as ethyl oleate. Carriers
or occlusive dressings can be used to increase skin permeability
and enhance antigen absorption.
[0349] Combinations can be administered either concomitantly, e.g.,
as an admixture, separately but simultaneously or concurrently; or
sequentially. This includes presentations in which the combined
agents are administered together as a therapeutic mixture, and also
procedures in which the combined agents are administered separately
but simultaneously, e.g., as through separate intravenous lines
into the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0350] Dosage levels depend on the mode of administration, the
nature of the subject, and the quality of the carrier/adjuvant
formulation. Typical amounts are in the range of about 0.1 .mu.g to
about 20 mg per subject. Preferred amounts are at least about 1
.mu.g to about 100 .mu.g per subject. Multiple administration to
immunize the subject is preferred, and protocols are those standard
in the art adapted to the subject in question.
[0351] The compositions can conveniently be presented in unit
dosage form and can be prepared by any of the methods well-known in
the art of pharmacy. Methods include the step of bringing the
compositions of the invention into association with a carrier which
constitutes one or more accessory ingredients. In general, the
compositions are prepared by uniformly and intimately bringing the
compositions of the invention into association with a liquid
carrier, a finely divided solid carrier, or both, and then, if
necessary, shaping the product.
[0352] Compositions suitable for oral administration can be
presented as discrete units, such as capsules, tablets or lozenges,
each containing a predetermined amount of the compositions of the
invention. Other compositions include suspensions in aqueous
liquids or non-aqueous liquids such as a syrup, an elixir or an
emulsion.
[0353] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compositions of the invention
described above, increasing convenience to the subject and the
physician. Many types of release delivery systems are available and
known to those of ordinary skill in the art.
[0354] Other embodiments of the invention include processes for the
production of the compositions of the invention and methods of
medical treatment for cancer and allergies using said
compositions.
[0355] Further aspects and embodiments of the present invention
will become apparent in the following examples and the appended
claims.
[0356] The following examples are illustrative only and are not
intended to limit the scope of the invention as defined by the
appended claims. It will be apparent to those skilled in the art
that various modifications and variations can be made in the
methods of the present invention without departing from the spirit
and scope of the invention. Thus, it is intended that the present
invention cover the modifications and variations of this invention
provided they come within the scope of the appended claims and
their equivalents.
[0357] All patents and publications referred to herein are
expressly incorporated by reference in their entirety.
EXAMPLE 1
Generation of p33-HBcAg VLPs
[0358] The DNA sequence of HBcAg containing peptide p33 from LCMV
is given in FIG. 1B. The p33-HBcAg VLPs (p33-VLPs) were generated
as follows: Hepatitis B clone pEco63 containing the complete viral
genome of Hepatitis B virus was purchased from ATCC. The gene
encoding HBcAg was introduced into the EcoRI/HindIII restriction
sites of expression vector pkk223.3 (Pharmacia) under the control
of a strong tac promoter. The p33 peptide (KAVYNFATM) derived from
lymphocytic choriomeningitis virus (LCMV) was fused to the
C-terminus of HBcAg (1-185) via a three leucine-linker by standard
PCR methods. A clone of E. coli K802 selected for good expression
was transfected with the plasmid, and cells were grown and
resuspended in 5 ml lysis buffer (10 mM Na.sub.2HPO.sub.4, 30 mM
NaCl, 10 mM EDTA, 0.25% Tween-20, pH 7.0). 200 .mu.l of lysozyme
solution (20 mg/ml) was added. After sonication, 4 .mu.l Benzonase
and 10 mM MgCl.sub.2 was added and the suspension was incubation
for 30 minutes at RT, centrifuged for 15 minutes at 15,000 rpm at
4.degree. C. and the supernatant was retained.
[0359] Next, 20% (w/v) (0.2 g/ml lysate) ammonium sulfate was added
to the supernatant. After incubation for 30 minutes on ice and
centrifugation for 15 minutes at 20,000 rpm at 4.degree. C. the
supernatant was discarded and the pellet resuspended in 2-3 ml PBS.
20 ml of the PBS-solution was loaded onto a Sephacryl S-400 gel
filtration column (Amersham Pharmacia Biotechnology AG), fractions
were loaded onto a SDS-Page gel and fractions with purified p33-VLP
capsids were pooled. Pooled fractions were loaded onto a
Hydroxyappatite column. Flow through (which contains purified
p33-VLP capsids) was collected (FIG. 2B). Electron microscopy was
performed according to standard protocols. A representative example
is shown in FIG. 2A.
EXAMPLE 2
CpG-containing oligonucleotides can be packaged into HBcAg VLPs
[0360] Recombinant p33-VLPs were run on a native agarose (1%) gel
electrophoresis and stained with ethidium bromide or Coomassie blue
for the detection of RNA/DNA or protein (FIG. 3). Bacterial
produced VLPs contain high levels of single stranded RNA, which is
presumably binding to the arginine repeats appearing near the
C-terminus of the HBcAg protein and being geographically located
inside the VLPs as shown by X-ray crystallography. The
contaminating RNA can be easily digested and so eliminated by
incubating the VLPs with RNase A. The highly active RNase A enzyme
has a molecular weight of about 14 kDa and is presumably small
enough to enter the VLPs to eliminate the undesired ribonucleic
acids.
[0361] The recombinant p33-VLPs were supplemented with
CpG-oligonucleotides (FIG. 1A) before digestion with RNase A. As
shown in FIG. 4 the presence of CpG-oligonucleotides preserved the
capsid structure as shown by similar migration compared to
untreated p33-VLPs. The CpG-oligonucleotide-containing VLPs were
purified from unbound oligonucleotides via dialysis (4500-fold
dilution in PBS for 24 hours using a 300 kDa MWCO dialysis
membrane) (FIG. 5).
EXAMPLE 3
CpG-Oligonucleotides can be Packaged into VLPs by Removal of the
RNA with RNAse and Subsequent Packaging of Oligonucleotides into
VLPs
[0362] The p33-VLPs (containing bacterial single-stranded RNA) were
first incubated with RNase A to remove the RNA and in a second step
the immunostimulating CpG-oligonucleotides (with normal
phosphodiester bonds but also with phosphorothioate modification of
the phosphate backbone) was supplemented to the samples (FIG. 6).
This experiment clearly shows that the CpG-oligonucleotides are not
absolutely required simultaneously during the RNA degradation
reaction but can be added at a later time.
EXAMPLE 4
VLPs Containing CpG-Oligonucleotides (with Phosphorothioate
Modification of the Phosphate Backbone or Normal Phosphodiester
Bonds) Induce Enhanced Anti-Viral Protection
[0363] Mice were subcutaneously primed with 100 .mu.g
CpG-oligonucleotide containing p33-VLPs. Before immunization,
p33-VLP preparations were extensively purified from unbound
CpG-oligonucleotides via dialysis (see Example 2 and FIG. 5). As
controls mice were subcutaneously primed with 100 .mu.g p33-VLP
alone, mixed with 20 nmol CpG-oligonucleotide, with 20 nmol
CpG-oligonucleotide alone or left untreated. Twenty-one days later,
mice were challenged with LCMV (200 pfu, intravenously) and viral
titers were assessed in the spleens 5 days later as described in
Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis
virus-specific cytotoxic T cell responses," in Immunology Methods
Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, N.Y.
(1997) p. 1921. The results are shown in FIGS. 7, 8 and 9.
EXAMPLE 5
Generation of BKV Polyoma Capsids
[0364] BK virus (BKV) is a non-enveloped double stranded DNA virus
belonging to the polyoma virus subfamily of the papovaviridae. VP1
is the major capsid protein. VP1 has 362 amino acids (FIG. 10) and
is 42 kDa in size. When produced in E. coli, insect cells or yeast
VP1 spontaneously forms capsid structures (Salunke D. M., et al.,
Cell 46(6):895-904 (1986); Sasnauskas, K., et al., Biol. Chem.
380(3):381-6 (1999); Sasnauskas, K., et al., 3.sup.rd International
Workshop "Virus-like particles as vaccines" Berlin, September 26-29
(2001); Touze, A., et al., J Gen Virol. 82(Pt 12):3005-9 (2001).
The capsid is organized in 72 VP1 pentamers forming an icosahedral
structure. The capsids have a diameter of approximately 45 nm.
EXAMPLE 6
Fluorescein Labeled CpG-Containing Oligonucleotides can be Packaged
into BKV VLPs
[0365] VLPs produced in yeast contain small amounts of RNA which
can be easily digested and so eliminated by incubating the VLPs
with RNase A. The highly active RNase A enzyme has a molecular
weight of about 14 kDa and is small enough to enter the VLPs to
eliminate the undesired ribonucleic acids. Recombinantly produced
BKV VLPs were concentrated to 1 mg/ml in PBS buffer pH 7.2 and
incubated in the absence or presence of RNase A (200 .mu.g/ml,
Roche Diagnostics Ltd, Switzerland) for 3 h at 37.degree. C. After
RNase A digestion BKV VLPs were supplemented with 75 nmol/ml
fluorescein labeled phosphorothioate CpG-FAM oligonucleotide and
incubated for 3 h at 37.degree. C. Subsequently BKV VLPs were
subjected to DNaseI digestion for 3 h at 37.degree. C. (40 u/ml
AMPD1, Sigma, Division of Fluka AG, Switzerland) or loaded without
DNaseI digestion. The samples were complemented with 6-fold
concentrated DNA-loading buffer (10 mM Tris pH 7.5, 10% v/v
glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8%
native tris-acetate pH 7.5 agarose gel.
[0366] FIG. 12 shows BKV VLPs in a native 0.8% agarose gel
electrophoresis after control incubation or after digestion with
RNase A and subsequent incubation with fluorescent CpG-FAM
oligonucleotides (oligonucleotide from FIG. 1A with a
5'-fluorescein-label) upon staining with ethidium bromide or
without ethidium bromide staining. In the presence of ethidium
bromide nucleic acids are detected, while in its absence UV
excitation leads to fluorescence of the fluorescein-label in the
CpG-FAM.
[0367] The RNase A digestion leads to a change in migration of the
VLP, visible on Coomassie stained agarose gel, presumably due to
the lack of negative charges from the RNA (FIGS. 13 and 14).
Addition of CpG-oligonucleotide restores the migration of BKV VLPs
and results in a fluorescent band with the same migration as the
RNA band present in untreated VLPs. This clearly shows that CpG-FAM
oligonucleotides have been packaged into VLPs.
EXAMPLE 7
Large Double Stranded Oligonucleotides can be Packaged into BKV
VLPs
[0368] To introduce double stranded (ds) nucleotide sequences, the
RNase A treated recombinant BKV VLPs (Example 6) were supplemented
with 50 .mu.g/ml (ds) DNA fragments (246 bp in length, FIG. 11) and
incubated for 3 h at 37.degree. C. The samples were complemented
with 6-fold concentrated DNA-loading buffer (10 mM Tris pH 8.0, 10%
v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8%
native tris-acetate pH 8.0 agarose gel.
[0369] FIG. 13 shows BKV VLPs (15 .mu.g) in a native 0.8% agarose
gel electrophoresis after control incubation or after digestion
with RNase A and subsequent incubation with (ds) DNA upon staining
with ethidium bromide or Coomassie Blue in order to assess the
presence of RNA/DNA or protein. Packaged DNA molecules are visible
in the presence of ethidium bromide as a band with the same
migration as the VLP band visualized with Coomassie Blue.
[0370] Addition of (ds) DNA restores the migration of BKV VLPs and
results in a DNA band with the same migration as the Coomassie Blue
stained VLPs. This clearly shows that (ds) DNA has been packaged
into BKV VLPs.
EXAMPLE 8
CpG-Containing Oligonucleotides can be Packaged into BKV VLPs.
[0371] To introduce immunostimulatory CpG-oligonucleotides, the
RNase A treated recombinant BKV VLPs (Example 6) were supplemented
with 150 nmol/ml CpG-oligonucleotides with phosphodiester backbone
or with phosphorothioate backbone and incubated for 3 h at
37.degree. C. VLP preparations for mouse immunization were
extensively dialysed (10,000-fold diluted) for 24 h against PBS pH
7.2 with a 300 kDa MWCO dialysis membrane (Spectrum Medical
industries Inc., Houston, USA) to eliminate RNase A and the excess
of CpG-oligonucleotides. The samples were complemented with 6-fold
concentrated DNA-loading buffer (10 mM Tris pH 7.5, 10% v/v
glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8%
native tris-acetate pH 7.5 agarose gel.
[0372] FIG. 14 shows BKV VLPs (15 .mu.g) in a native 0.8% agarose
gel electrophoresis after control incubation or after digestion
with RNase A and subsequent incubation with CpG-oligonucleotides
(with phosphodiester- or with phosphorothioate backbone) upon
staining with ethidium bromide (A) or Coomassie Blue (B) in order
to assess the presence of RNA/DNA or protein and the reduction of
unbound CpG-oligonucleotides after dialysis. Unbound
CpG-oligonucleotides are visible as a low molecular weight ethidium
bromide stained band.
[0373] Addition of CpG-oligonucleotides restores the migration of
BKV VLPs and results in a DNA band with the same migration as the
Coomassie Blue stained VLPs. This clearly shows that
CpG-oligonucleotides are packaged into BKV VLPs.
Example 9
VLPs Containing CpG-Oligonucleotides (with Phosphorothioate
Modification of the Phosphate Backbone) Induce Enhanced Th1
Directed Immune Response
[0374] Female BALB/c mice (three mice per group) were
subcutaneously injected with 10 .mu.g BKV VLPs containing
phosphorothioate CpG-oligonucleotide (FIG. 1A). As controls mice
were subcutaneously injected with either 10 .mu.g of RNase treated
BKV VLPs alone or BKV VLPs mixed with 0.3 nmol or 20 nmol
phosphorothioate CpG-oligonucleotides in 200 .mu.l PBS pH 7.2 or
were left untreated. BKV VLPs were prepared as described in Example
8 and before immunization extensively purified from unbound
CpG-oligonucleotide by dialysis. On day 14 after immunization blood
was taken and IgG1 and IgG2a antibody response to BKV VLPs was
determined.
[0375] FIG. 15 shows IgG1 and IgG2a antibody response to BKV VLPs
on day 14 after immunization. Immunization with RNase A treated BKV
VLPs containing phosphorothioate CpG-oligonucleotides results in a
decreased IgG1 and an increased anti-BKV VLP IgG2a titer as
compared to immunization with the same amount (0.3 nmol) of
CpG-oligonucleotides mixed with BKV VLPs or BKV VLPs alone. Mice
immunized with BKV VLPs mixed with 20 nmol phosphorothioate
CpG-oligonucleotides show very low IgG1 and high IgG2a titers. The
decrease in IgG1 titer and the increase in IgG2a titer as compared
to controls demonstrates a Th1 cell directed immune response
induced by phosphorothioate CpG-oligonucleotides packaged in BKV
VLPs. FIG. 15 clearly demonstrates the higher potency of BKV VLPs
containing CpG-oligonucleotides packaged within the particles as
compared to BKV VLPs simply mixed with CpG-oligonucleotides.
EXAMPLE 10
Linear Double-Stranded DNA (dsDNA) can be Packaged into VLPs by
First RNAse Digestion and Subsequently Addition of dsDNA
[0376] The p33-VLPs preparations (containing bacterial RNA)
(EXAMPLE 1) were first incubated with RNaseA to remove the RNA and
in a second step the linear dsDNA (350 bp long) was supplemented to
the samples (FIG. 16). The migration of the p33-VLPs packaged with
the dsDNA was similar to the one of p33-VLP containing RNA. This
experiment shows that linear dsDNA of at least 350 base pairs in
length can be packaged into the virus-like particles.
EXAMPLE 11
Immunostimulatory Nucleic Acids can be Packaged into HBcAg VLPs
Comprising Fusion Proteins with Antigens
[0377] HBcAg VLPs, when produced in E. coli by expressing the
Hepatitis B core antigen fusion protein HBc33 (Example 1) or the
fusion protein to the peptide P1A (HBcP1A), contain RNA which can
be digested and so eliminated by incubating the VLPs with RNase
A.
[0378] The gene P1A codes for a protein that is expressed by the
mastocytoma tumor cell line P815. The dominant CTL epitope, termed
P1A peptide, binds to MHC class I (Ld) and the complex is
recognized by specific CTL clones (Brandle et al., 1998, Eur. J.
Immunol. 28: 4010-4019). Fusion of peptide P1A-1 (LPYLGWLVF) to the
C-terminus of HBcAg (aa 185, see Example 1) was performed by PCR
using appropriate primers using standard molecular biology
techniques. A three leucine linker was cloned between the HBcAg and
the peptide sequence. Expression was performed as described in
Example 1. The fusion protein of HBcAg with P1A, termed HBcP1A,
formed capsids when expressed in E. coli which could be purified
similar to the procedure described in Example 1.
[0379] Enzymatic RNA hydrolysis: Recombinantly produced HBcAg-p33
(HBc33) and HBcAg-P1A (HBcP1A) VLPs at a concentration of 1.0 mg/ml
in 1 x PBS buffer (KCl 0.2g/L, KH2PO4 0.2g/L, NaCl 8 g/L, Na2HPO4
1.15 g/L) pH 7.4, were incubated in the presence of 300 .mu.g/ml
RNase A (Qiagen AG, Switzerland) for 3 h at 37.degree. C. in a
thermomixer at 650 rpm.
[0380] Packaging of immunostimulatory nucleic acids: After RNA
digestion with RNAse A HBcAg-p33 VLPs were supplemented with 130
nmol/ml CpG-oligonucleotides B-CpG, NKCpG, G10-PO (Table I).
Similarly, the 150mer single-stranded Cyl50-1 and 253mer double
stranded dsCyCpG-253, both containing multiple copies of CpG
motifs, were added at 130 nmol/ml or 1.2 nmol/ml, respectively, and
incubated in a thermomixer for 3 h at 37.degree. C. Double stranded
CyCpG-253 DNA was produced by cloning a double stranded multimer of
CyCpG into the EcoRV site of pBluescript KS-. The resulting
plasmid, produced in E. coli XL1-blue and isolated using the Qiagen
Endofree plasmid Giga Kit, was digested with restriction
endonucleases XhoI and XbaI and resulting restriction products were
separated by agarose electrophoresis. The 253 bp insert was
isolated by electro-elution and ethanol precipitation. Sequence was
verified by sequencing of both strands.
1TABLE I Sequences of immunostimulatory nucleic acids used in the
Examples. Small letters indicate deoxynucleotides connected via
phosphorothioate bonds while larger letters indicate
deoxynucleotides connected via phosphodiester bonds CyCpGpt
tccatgacgttcctgaataat CyCpG TCCATGACGTTCCTGAATAAT B-CpGpt
tccatgacgttcctgacgtt B-CpG TCCATGACGTTCCTGACGTT NKCpGpt
ggGGTCAACGTTGAggggg NKCpG GGGGTCAACGTTGAGGGGG CyCpG-
attattcaggaacgtcatgga rev-pt g10gacga-
GGGGGGGGGGGACGATCGTCGGGGGGGGGG PO(G10-PO) g10gacga-
gggggggggggacgatcgtcgggggggggg PS(G10-PS) (CpG)
CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG 20 OpA CGCGAAATGCA
TGTCAAAGACAGCAT Cy(CpG)20 TCCATGACGTTCCTGAATAATCGCGCGCGCGCGC
GCGCGCGCGCG CGCGCGCGCGCGCG Cy(CpG)20-
TCCATGACGTTCCTGAATAATCGCGCGCGCGCGC OpA GCGCGCGCGCG
CGCGCGCGCGCGCGAAATGCATGTCAAAGACAGC CyOpA TCCATGACGTTCCTGAATAATAAAT-
GCATGTCAA ACAGCAT CyCyCy TCCATGACGTTCCTGAATAATTCCATGACGTTCC
AATAATTCCAT GACGTTCCTGAATAAT Cy150-1
TCCATGACGTTCCTGAATAATTCCATGACGTTCC AATAATTCCAT
GACGTTCCTGAATAATTGGATGACGTTGGTGAAT TTCCATGACGT
TCCTGAATAATTCCATGACGTTCCTGAATAATTC TGACGTTCCTG AATAATTCC dsCyCpG-
CTAGAACTAGTGGATCCCCCGGGCTCCAGGAATT 253 (comple- ATTCATGACTT mentary
CCTGAATAATTCCATGACGTTGGTGAATAATTCC strand GACGTTCCTGA shown)
ATAATTCCATGACGTTCCTGAATAATTCCATGAC TCCTGAATAAT
TCCATGACGTTCCTGAATAATTCCATGACGTTCC AATAATTCCAT
GACGTTCCTGAATAATTCCATGACGTTCCTGAAA TCCAATCAAGC
TTATCGATACCGTCGACC
[0381] DNAse I treatment: Packaged HBcAg-p33 VLPs were subsequently
subjected to DNaseI digestion (5 U/ml) for 3 h at 37.degree. C.
(DNaseI, RNase free Fluka AG, Switzerland) and were extensively
dialysed (2.times. against 200-fold volume) for 24 h against PBS pH
7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical
industries Inc., Houston, USA) to eliminate RNAse A and the excess
of CpG-oligonucleotides.
[0382] Benzonase treatment: Since some single stranded
oligodeoxynucleotides were partially resistant to DNaseI treatment,
Benzonase treatment was used to eliminate free oligonucleotides
from the preparation. 100-120 U/ml Benzonase (Merck KGaA,
Darmstadt, Germany) and 5 mM MgCl.sub.2 were added and incubated
for 3 h at 37.degree. C. before dialysis.
[0383] Dialysis: VLP preparations packaged with immunostimulatroy
nucleic acids used in mouse immunization experiments were
extensively dialysed (2x against 200fold volume) for 24 h against
PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical
Industries, Houston, US) to eliminate added enzymes and free
nucleic acids.
[0384] Analytics of packaging: release of packaged
immunostimulatory nucleic acids: To 50 .mu.l capsid solution 1
.mu.l of proteinase K (600 U/ml, Roche, Mannheim, Germany), 3 .mu.l
10% SDS-solution and 6 .mu.l 10fold proteinase buffer (0.5 M NaCl,
50 mM EDTA, 0.1 M Tris pH 7.4) were added and subsequently
incubated overnight at 37.degree. C. VLPs are completed hydrolysed
under these conditions. Proteinase K was inactivated by heating for
20 min at 65.degree. C. 1 .mu.l RNAse A (Qiagen, 100 .mu.g/ml,
diluted 250 fold) was added to 25 .mu.l of capsid. 2-30 .mu.g of
capsid were mixed with 1 volume of 2.times.loading buffer
(1.times.TBE, 42% w/v urea, 12% w/v Ficoll, 0.01% Bromphenolblue),
heated for 3 min at 95.degree. C. and loaded on a 10% (for
oligonucleotides of about 20 nt length) or 15% (for >than 40 mer
nucleic acids) TBE/urea polyacrylamid gel (Invitrogen).
Alternatively samples were loaded on a 1% agarose gel with
6.times.loading dye (10 mM Tris pH 7.5, 50 mM EDTA, 10% v/v
glycerol, 0.4% orange G). TBE/urea gels were stained with CYBRGold
and agarose gels with stained with ethidium bromide.
[0385] FIGS. 17, 18 and 19 show the packaging of B-CpG, NKCpG and
G10-PO oligonucleotides into HBc33. RNA content in the VLPs was
strongly reduced after RNaseA treatment (FIGS. 17A, 18A, 19A) while
most of the capsid migrated as a a slow migrating smear presumably
due to the removal of the negatively charged RNA (FIGS. 17B, 18B,
19B). After incubation with an excess of oligonucleotid the capsids
contained a higher amount of nucleic acid than the RNAseA treated
capsids and therefore migrated at similar velocity as the untreated
capsids. Additional treatment with DNAse I or Benzonase degraded
the free oligonucleotides while oligonucleotides packaged in the
capsids did not degrade, clearly showing packaging of
oligonucleotides. In some cases packaging of oligonucleotides was
confirmed by proteinase K digestion (as described in Examples 15
and 16) after DNAsel/Benzonase treatment and dialysis. The finding
that oligonucleotides released from the capsid with the procedure
described above were of the same size than the oligonucleotide used
for packaging clearly demonstrated packaging of oligonucleotides
(FIGS. 17C, 18C).
[0386] FIG. 20 shows packaging of a large single-stranded
oligonucleotide Cy150-1 into HBc33. Cy150-1 contains 7.5 repeats of
CyCpG and was synthesized according standard oligonucleotide
synthesis methods (IBA, Gottingen, Germany). RNA content in the
capsid was strongly reduced after RNaseA treatment while most of
the capsid migrated as a slow migrating smear (FIGS. 20A, B).
Capsid were diluted with 4 volumes of water and concentrated to 1
mg/ml. After incubation with an excess of Cyl5O-1 the capsid
contained a bigger amount of nucleic acid and thus migrated at
similar velocity as the untreated capsids. Additional treatment
with DNAseI degraded the free, not packaged oligonucleotides while
oligonucleotides in capsids were not degraded (FIG. 20A). Release
of the DNAsel-resistant nucleic acid from the packaged VLPs by
heating for 3 min at 95.degree. C. in TBE/urea loading buffer
revealed the presence of the 150 mer (FIG. 20C).
[0387] FIG. 21 shows packaging of oligonucleotide NKCpGpt in
HBcP1A. Treatment with RNAse reduced nucleic acid content and
slowed migration of the capsids. Addition of NKCpGpt restored
nucleic acid content in capsids and fast migration.
[0388] FIG. 17 depicts the analysis of B-CpG packaging into HBc33
VLPs on a 1% agarose gel stained with ethidium bromide (A) and
Coomassie Blue (B). Loaded on the gel are 50 .mu.g of the following
samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A;
3. HBc33 VLP treated with RNase A and packaged with B-CpG; 4. HBc33
VLP treated with RNase A, packaged with B-CpG and treated with
DNaseI; 5. HBc33 VLP treated with RNase A, packaged with B-CpG,
treated with DNaseI and dialysed; 6. 1 kb MBI Fermentas DNA ladder.
(C) depicts the analysis of the amount of packaged oligo extracted
from the VLP on a 1.5% agarose gel stained with ethidium bromide:
Loaded on gel are the following samples: 1. 0.5 nmol B-CpG control;
2. 0.5 nmol B-CpG control; 3. B-CpG oligo content HBc33 after
phenol/chloroform extraction; 4. B-CpG oligo content HBc33 after
phenol/chloroform extraction and RNase A treatment; 5. B-CpG oligo
content HBc33 after phenol/chloroform extraction and DNaseI
treatment; 6. empty; 7. MBI Fermentas 100 bp DNA ladder
[0389] FIG. 18 depicts the analysis of NKCpG packaging into HBc33
VLPs on a 1% agarose gel stained with ethidium bromide (A) and
Coomassie Blue (B). Loaded on the gel are 15 .mu.g of the following
samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A;
3. HBc33 VLP treated with RNase A and packaged with NKCpG; 4. HBc33
VLP treated with RNase A, packaged with NKCpG, treated with DNaseI
and dialysed; 5. 1 kb MBI Fermentas DNA ladder. (C) depicts the
analysis of the amount of packaged oligo extracted from the VLP on
a 15% TBE/urea gel stained with CYBR Gold. Loaded on gel are the
following samples: 1. NKCpG oligo content HBc33 after proteinase K
digestion and RNase A treatment; 2. 20 pmol NKCpG control; 3. 10
pmol NKCpG control; 4. 40 pmol NKCpG control
[0390] FIG. 19 depicts the analysis of g10gacga-PO packaging into
HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A)
and Coomassie Blue (B). Loaded on the gel are 15 .mu.g of the
following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP
untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated
with RNase A and packaged with g10gacga-PO; 5. HBc33 VLP treated
with RNase A, packaged with g10gacga-PO, treated with Benzonase and
dialysed.
[0391] FIG. 20 depicts the analysis of CyCpG-150 packaging into
HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A)
and Coomassie Blue (B). Loaded on the gel are 15 .mu.g of the
following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP
untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated
with RNase A and packaged with CyCpG-150; 5. HBc33 VLP treated with
RNase A, packaged with CyCpG-150, treated with DNaseI and dialysed;
6. HBc33 VLP treated with RNase A, packaged with CyCpG-150, treated
with DNaseI and dialysed. (C) depicts the analysis of the amount of
packaged oligo extracted from the VLP on a 10% TBE/urea gel stained
with CYBR Gold. Loaded on gel are the following samples: 1. 20 pmol
CyCpG-150 control; 2. 10 pmol CyCpG-150 control; 3. 4 pmol
CyCpG-150 control; 4. CyCpG-150 oligo content of 4 .mu.g HBc33
after 3 min at 95.degree. C. with 1 volume TBE/urea sample
buffer.
[0392] FIG. 21 depicts the analysis of NKCpGpt packaging into
HBcP1A VLPs on a 1% agarose gel stained with ethidium bromide (A)
and Coomassie Blue (B). Loaded on the gel are 15 .mu.g of the
following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBcP1A VLP
untreated; 3. HBcP1A VLP treated with RNase A; 4. HBcP1A VLP
treated with RNase A and packaged with NKCpGpt.
EXAMPLE 12
Immunostimulatory Nucleic Acids can be Packaged in HBcAg-wt Coupled
with Antigens
[0393] Recombinantly produced HBcAg-wt VLPs were packaged after
coupling with peptide p33 (CGG-KAVYNFATM), derived from lymphocytic
choriomeningitis virus (LCMV). For coupling HBcAg-wt VLPs (2 mg/ml)
were derivatized with 25.times.molar excess of SMPH
(Succinimidyl-6-[(1-maleim- ido-propionamido)hexanoate], Pierce)
for 1 h at 25.degree. C. in a thermomixer. The derivatized VLPs
were dialyzed to Mes buffer (2-(N-morpholino) ethanesulphonic acid)
pH 7.4 for 2.times.2 h using MWCO 10.000 kD dialysis membranes at
4.degree. C. VLPs (50 .mu.M) were subsequently coupled to the
N-terminal cysteine of the p33 peptide (250 .mu.M) during a 2 h
incubation in a thermomixer at 25.degree. C. Samples were dialyzed
(MWCO 300.000) extensively to 1.times.PBS pH 7.4 to eliminate
undesired free peptide.
[0394] FIG. 22 shows SDS-PAGE analysis of HBcAg wt VLPs
derivatization with SMPH and coupling to p33 peptide. Samples were
analysed by 16% SDS PAGE and stained with Coomassie Blue. HBcAg-wt
was visible as a 21 kD protein band. Due to the low molecular
weigth of SMPH is the derivatised product only slightly larger and
can not be distinguished by SDS-PAGE. Peptide alone was visible as
a 3 kD band and coupled product, termed HBx33, showed a strong
secondary band at approximately 24 kD accounting for more than 50%
of total HBcAg-wt.
[0395] Enzymatic RNA hydrolysis: HBx33 VLPs (0.5-1.0 mg/ml,
1.times.PBS buffer pH 7.4) in the presence of RNase A (300
.mu.g/ml, Qiagen AG, Switzerland) were diluted with 4 volumes
H.sub.2O to decrease salt concentration to a final 0.2.times.PBS
concentration and incubated for 3 h at 37.degree. C. in a
thermomixer at 650 rpm.
[0396] Packaging of immunostimulatory nucleic acids: After RNase A
digestion HBx33 VLPs were concentrated using Millipore Microcon or
Centriplus concentrators, then supplemented with 130 nmol/ml
CpG-oligonucleotide B-CpGpt and incubated in a thermomixer for 3 h
at 37.degree. C. in 0.2.times.PBS pH 7.4. Subsequently, reaction
mixtures were subjected to DNaseI digestion (5 U/ml) for 3 h at
37.degree. C. (DNaseI, RNase free Fluka AG, Switzerland). VLP
preparations for mouse immunization were extensively dialysed
(2.times.against 200-fold volume) for 24 h against PBS pH 7.4 with
a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc.,
Houston, USA) to eliminate RNase A and the excess of
CpG-oligonucleotides. FIG. 23 shows that RNAse treatment reduced
the nucleic acid content of the capsids and slowed their migration.
Addition of B-CpGpt restored nucleic acid content and fast
migration of capsids. DNAse I only digested the free
oligonucleotides while the packaged oligonucleotides remained in
the VLP also after dialysis (FIG. 23).
[0397] FIG. 22 depicts the SDS-PAGE analysis of the p33 coupling to
HBc VLPs after Coomassie Blue staining. Loaded on the gel are the
following samples: 1.NEB Prestained Protein Marker, Broad Range (#
7708S), 10 .mu.l; 2. CGG-p33 peptide; 3. HBc VLP derivatized with
SMPH, before dialysis; 4. HBc VLP derivatized with SMPH, after
dialysis; 5. HBc VLP coupled with CGG-p33, supernatant; 6. HBc VLP
coupled with CGG-p33, pellet.
[0398] FIG. 23 depicts the analysis of B-CpGpt packaging into HBx33
VLPs on a 1% agarose gel stained with ethidium bromide (A) and
Coomassic Blue (B). Loaded on the gel are 50 .mu.g of the following
samples: 1. HBx33 VLP untreated; 2. HBx33 VLP treated with RNase A;
3. HBx33 VLP treated with RNase A and packaged with B-CpGpt; 4.
HBx33 VLP treated with RNase A, packaged with B-CpGpt and treated
with DNaseI; 5. HBx33 VLP treated with RNase A, packaged with
B-CpGpt, treated with DNaseI and dialysed; 6. 1 kb MBI Fermentas
DNA ladder
EXAMPLE 13
Immunostimulatory Nucleic Acids can be Packaged into Q.beta. VLPs
Coupled with Antigens
[0399] Coupling of p33 peptides to Q.beta. VLPs:
[0400] Recombinantly produced Q.beta. VLPs were used after coupling
to p33 peptides containing an N-terminal CGG or and C-terminal GGC
extension (CGG-KAVYNFATM and KAVYNFATM-GGC). Recombinantly produced
Q.beta. VLPs were derivatized with a 10 molar excess of SMPH
(Pierce) for 0.5 h at 25.degree. C., followed by dialysis against
20 mM HEPES, 150 mM NaCl, pH 7.2 at 4.degree. C. to remove
unreacted SMPH. Peptides were added in a 5 fold molar excess and
allowed to react for 2 h in a thermomixer at 25.degree. C. in the
presence of 30% acetonitrile. FIG. 24 shows the SDS-PAGE analysis
demonstrating multiple coupling bands consisting of one, two or
three peptides coupled to the Q.beta. monomer (Arrows, FIG.
24).
[0401] Q.beta. VLPs, when produced in E. coli by expressing the
bacteriophage Q.beta. capsid protein, contain RNA which can be
digested and so eliminated by incubating the VLPs with RNase A.
[0402] Low Ionic Strength and Low Q.beta. Concentration Allow RNA
Hydrolysis of Q.beta. VLPs by RNAse A:
[0403] Q.beta. VLPs at a concentration of 1.0 mg/ml in 20 mM
Hepes/150 mM NaCl buffer (HBS) pH 7.4 were either digested directly
by addition of RNase A (300 .mu.g/ml, Qiagen AG, Switzerland) or
were diluted with 4 volumes H.sub.2O to a final 0.2.times.HBS
concentration and then incubated with RNase A (60 .mu.g/ml, Qiagen
AG, Switzerland). Incubation was allowed for 3 h at 37.degree. C.
in a thermomixer at 650 rpm. FIG. 25 demonstrates that in
1.times.HBS only a very weak reduction of RNA content was observed,
while in 0.2.times.HBS most of the RNA were hydrolysed. In
agreement, capsid migration was unchanged after addition of RNAse A
in 1.times.HBS, while migration was slower after addition of RNAse
in 0.2.times.HBS (FIGS. 25B,D).
[0404] Low Ionic Strength Increases Nucleic Acid Packaging in
Q.beta. VLPs:
[0405] After RNase A digestion in 0.2.times.HBS the Q.beta. VLPs
were concentrated to 1 mg/ml using Millipore Microcon or Centriplus
concentrators and aliquots were dialysed against 1.times.HBS or
0.2.times.HBS. Q.beta. VLPs were supplemented with 130 nmol/ml
CpG-oligonucleotide B-CpG and incubated in a thermomixer for 3 h at
37.degree. C. Subsequently Q.beta. VLPs were subjected to Benzonase
digestion (100 U/ml) for 3 h at 37.degree. C. Samples were analysed
on 1% agarose gels after staining with ethidium bromide or
Coomassie Blue. FIG. 26 shows that in 1.times.HBS only a very low
amount of oligonucleotides could be packaged, while in
0.2.times.HBS a strong ethidium bromide stained band was
detectable, which colocalized with the Coomassie blue stain of the
capsids.
[0406] Different Immunostimulatory Nucleic acids can be Packaged in
Q.beta. VLPs:
[0407] After RNase A digestion in 0.2.times.HBS the Q.beta. VLPs
were concentrated to 1 mg/ml using Millipore Microcon or Centriplus
concentrators and supplemented with 130 nmol/ml
CpG-oligonucleotides B-CpGpt, g10gacga and the 253 mer dsCyCpG-253
(Table I) and incubated in a thermomixer for 3 h at 37.degree. C.
Subsequently Q.beta. VLPs were subjected to DNAse I digestion (5
U/ml) or Benzonase digestion (100 U/ml) for 3 h at 37.degree. C.
Samples were analysed on 1% agarose gels after staining with
ethidium bromide or Coomassie Blue. FIG. 27 shows that the
different nucleic acids B-CpGpt, glogacga and the 253mer dsDNA
could be packaged into Qbx33. Packaged nucleic acids were resistant
to DNAse I digestion and remained packaged during dialysis (FIG.
27). Packaging of B-CpGpt was confirmed by release of the nucleic
acid by proteinase K digestion followed by agarose electrophoresis
and ethidium bromide staining (FIG. 27C).
[0408] FIG. 24 depicts the SDS-PAGE analysis of the p33 coupling to
Q.beta. VLPs after Coomassie Blue staining. Loaded are the
following samples: (A) 1. NEB Prestained Protein Marker, Broad
Range (# 7708S), 10 .mu.l; 2. Q.beta. VLP, 14 .mu.g; 3. Q.beta. VLP
derivatized with SMPH, after dialysis; 4. Q.beta. VLP coupled with
CGG-p33, supernatant. (B) 1. NEB Prestained Protein Marker, Broad
Range (# 7708S), 10 .mu.l; 2. Q.beta. VLP, 10 .mu.g; 3. Q.beta. VLP
coupled with GGC-p33, supernatant.
[0409] FIG. 25 depicts the analysis of RNA hydrolysis from Q.beta.
VLPs by RNase A under low and high ionic strength on a 1% agarose
gel stained with ethidium bromide (A, C) and Coomassie Blue (B, D).
Loaded on the gel are the following samples: (A, B) 1. MBI
Fermentas 1 kb DNA ladder; 2. Q.beta. VLP untreated; 3. Q.beta. VLP
treated with RNase A in 1.times.HBS buffer pH 7.2. (C, D) 1. MBI
Fermentas 1 kb DNA ladder; 2. Q.beta. 3 VLP untreated; 3. Q.beta.
VLP treated with RNase A in 0.2.times.HBS buffer pH 7.2.
[0410] FIG. 26 depicts the analysis of B-CpG packaging into Q.beta.
VLPs under low and high ionic strength on a 1% agarose gel stained
with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel
are the following samples: 1. Q.beta. VLP untreated; 2. Q.beta. VLP
treated with RNase A; 3. Q.beta. VLP treated with RNase A and
packaged with B-CpG in 0.2.times.HBS buffer pH 7.2 and treated with
Benzonase; 4. HBx33 VLP treated with RNase A, packaged with B-CpG
in 1.times.HBS buffer pH 7.2 and treated with Benzonase.
[0411] FIG. 27 depicts the analysis of B-CpGpt packaging into Qbx33
VLPs on a 1% agarose gel stained with ethidium bromide (A) and
Coomassie Blue (B). Loaded on the gel are 50 .mu.g of the following
samples: 1. Qbx33 VLP untreated; 2. Qbx33 VLP treated with RNase A;
3. Qbx33 VLP treated with RNase A and packaged with B-CpGpt; 4.
Qbx33 VLP treated with RNase A, packaged with B-CpGpt, treated with
DNaseI and dialysed; 5.1 kb MBI Fermentas DNA ladder. (C) depicts
the analysis of the amount of packaged oligo extracted from the VLP
on a 15% TBE/urea stained with CYBR Gold. Loaded on gel are the
following samples: 1. BCpGpt oligo content of 2 .mu.g Qbx33 VLP
after proteinase K digestion and RNase A treatment; 2. 20 pmol
BCpGpt control; 3. 10 pmol BCpGpt control; 4. 5 pmol BCpGpt
control
[0412] FIG. 27D and E depict the analysis of g10gacga-PO packaging
into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide
(D) and Coomassie Blue (E). Loaded on the gel are 15 .mu.g of the
following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP
untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated
with RNase A and packaged with g10gacga-PO; 5. Qbx33 VLP treated
with RNase A, packaged with g10gacga-PO, treated with Benzonase and
dialysed.
[0413] FIGS. 27E and F depict the analysis of dsCyCpG-253 packaging
into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide
(E) and Coomassie Blue (F). Loaded on the gel are 15 .mu.g of the
following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP
untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated
with RNase A, packaged with dsCyCpG-253 and treated with DNaseI; 5.
Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253, treated
with DNaseI and dialysed.
EXAMPLE 14
Q.beta. Disassembly Reassembly and Packaging of Immunostimulatory
Nucleic Acids
[0414] Disassembly and Reassembly of Q.beta. VLP
[0415] Disassembly: 70 mg of pure lyophilized Q.beta. VLP gave a
protein content of about 35 mg, according to spectrophotometric
determination using the average result obtained with the following
three formulae: 1. (183*OD.sup.230 nm-75.8*OD.sup.260 nm)*volume
(ml)-2. ((OD.sup.235 nm-OD.sup.280
nm)/2.51).times.volume-3.(OD.sup.228.5 nm-OD.sup.234.5
nm)*0.37).times.volume. The pure lyophilized Q.beta. VLP was
solubilized in 7 ml of 6 M GuHCl and incubated overnight at
4.degree. C. The solution was clarified for 15 minutes, at 6000 rpm
(Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the
following steps). A negligible sediment was discarded, and the
supernatant was dialysed 5.times. against 200-300 ml NET buffer (20
mM Tris-HCl, pH 7.8 with 5 mM EDTA and 150 mM NaCl) over 3 days.
Alternatively, the supernatant was dialyzed in a continuous mode
against 1.5 l NET buffer over 3-4 days. The resulting suspension
was centrifuged at 12000 rpm for 20 minutes. The pellet was
resolubilized in 2-3 ml 8 M urea, while the supernatant was
precipitated with solid ammonium sulphate at 60% saturation. A
saturated ammonium sulphate solution was added to the pellet
previously resolubilized in urea to 60% saturation, and the
solution was left to precipitate 4 days at 4.degree. C., with
subsequent centrifugation at 12000 rpm for 20 minutes. This pellet,
and the pellet of the initial supernatant were resolubilized and
joined in a total volume of 3 ml of 7 M urea, 10 mM DTT. This
material was loaded on a Sephadex G75 column, eluted at 2 ml/h with
7 M urea, 10 mM DTT. Two peaks were isolated. A high molecular
weight peak preceded a peak of lower apparent molecular weight.
Calibration of the column with chymotrypsin in the same elution
buffer revealed that the apparent molecular weight of the second
peak is consistent with Q.beta. coat protein being in a dimeric
form. Fractions containing this dimer material were pooled and
precipitated with ammonium sulphate (2 days, at 4.degree. C.). The
pellet was washed with a few droplets of water, centrifuged again,
and solubilized in 2 ml of 7 M urea, 10 mM DTT. This material was
then purified on a short (1.5.times.27 cm) Sepharose 4B column. One
peak eluted from the column and the fractions were pooled, leading
to a protein preparation with a volume of 10 ml, and a ratio of
absorbance at 280 nm vs. 260 nm of 0.68/0.5, yielding about 450
nmol of Q.beta. coat protein (giving a maximum of 2.5 nmol VLP
after reassembly, considering that there are 180 subunits in the
VLP) and a protein concentration of 630 .mu.g/ml (calculated using
the spectrophotometric methods described above).
[0416] Reassembly: .beta.-mercaptoethanol was added to the 10 ml
dimer fraction to a final concentration of 10%, and 300 .mu.l of a
solution of (CpG).sub.20OpA oligodeoxynucleotide, containing 12.3
nmol of oligonucleotide, were added. The reassembly mixture was
first dialyzed against 30 ml NET buffer containing 10%
beta-mercaptoethanol for 2 hours at 4.degree. C., and then dialyzed
in a continuous mode, with a flow of NET buffer of 8 ml/h over 4
days at 4.degree. C. The reassembly mixture was then desalted
against water by dialysis, with 6 buffer exchanges (4.times.100 ml,
2.times.1 liter).
[0417] The ratio of absorbance at 280 nm vs. 260 nm was of
0.167/0.24. The protein was dried by lyophilization. The dried
protein was resolubilized in water and purified by
ultracentrifugation on a sucrose gradient in a Beckman L 8-80
centrifuge, with the SW 50.1 rotor at 22 000 rpm, for 17h at
+4.degree. C. The sucrose gradient purification was performed as
follows. 5 layers of 1 ml of the following sucrose concentrations
(w/v) were dispensed into a centrifuge tube: 50%, 43%, 36%, 29% and
22%. The so formed succession of layers was left standing overnight
at 4.degree. C. 0.5 ml of the protein sample was layered on the
gradient, and centrifuged for 17 h as indicated above. The gradient
was eluted from the bottom of the centrifuge tube, and the 5 ml of
the gradient were divided in 16 fractions of approximatively 300
.mu.l. The fractions in the gradient were analyzed by SDS-PAGE
(FIG. 28) and Ouchterlony assay. Fractions 6-9 contained Q.beta.
coat protein and gave the precipitation band typical of Qp VLP in
an Ouchterlony assay. Fractions 11-15, with a lower apparent
density and containing Q.beta. protein gave no capsid band in the
Ouchterlony assay. The reassembled Q.beta. had the same apparent
density as wt Q.beta. within experimental error. The fractions 6-9
of the sucrose gradient were pooled, dialyzed against water and
lyophilized. This material was then resolubilized for electron
microscopy (EM) analysis (FIG. 29) and Ouchterlony assay (FIG. 30A
and B). The EM procedure was as follows: A suspension of the
proteins was absorbed on carbon-formvar coated grids and stained
with 2% phosphotungstic acid (pH 6,8). The grids were examined with
a JEM 100C (JEOL,Japan) electron microscope at an accelerating
voltage of 80 kV. Photographic records (negatives) were performed
on Kodak electron image film and electron micrographs were obtained
by printing of negatives on Kodak Polymax paper. Both methods
indicate that the reassembled VLPs have the same macromolecular
properties as intact Q.beta. VLP. In addition, the pattern of
disulfide bonds displayed by the purified reassembled Q.beta. VLP
is indistinguishable from the disulfide bond pattern displayed by
the untreated Q.beta. VLP, with the typical pattern of pentamers
and hexamers (FIG. 31A).
[0418] Analysis of nucleic acid content: Reassembled Q.beta. VLP
was digested with pancreatic DNAse I as follows. To 200 .mu.l of a
0.5 mg/ml solution of Qp VLP reassembled with (CpG).sub.20OpA
oligodeoxynucleotide were added 20 .mu.L of a 1 U/.mu.l DNAse I
(Fluka) solution, and 22 .mu.l of DNAse I buffer (20 mM MgCl.sub.2,
200 mM Tris, pH 8.3). The reaction mixture was incubated for 2h30
min. at 37.degree. C. The nucleic acid content of the sample was
subsequently isolated by phenol/chloroform extraction, and loaded
on a 2% agarose gel stained with ethidium bromide (FIG. 31B). A
band of the size of the packaged oligodeoxynucleotide was detected
on the gel. A band migrating at a higher apparent molecular weight
was also visible. We cannot exclude the presence of multimers of
the (CpG).sub.20OpA oligodeoxynucleotide which would lead to a band
at this height. The gel thus shows that DNAse I protected
oligodeoxynucleotides of the right size were present in the
reassembled Q.beta. VLP, since the oligodeoxynuleotides could
subsequently be digested by DNAse I, but not by RNAse A.
Oligodeoxynucleotides could thus be successfully packaged in
Q.beta. VLP after initial disassembly of the VLP, purification of
the disassembled coat protein from nucleic acids and subsequent
reassembly of the VLP in the presence of oligodeoxynucleotide.
[0419] FIG. 28 shows the SDS-PAGE analysis of the fractions from
the sucrose gradient centrifugation. Loaded on the gels were the
following samples. Lane 1-10: fractions 6-15 of the sucrose
gradient ultracentrifugation.
[0420] FIG. 29 shows the EM pictures of (A) intact Q.beta. VLP and
(B) Q.beta. VLP after disassembly and reassembly in the presence of
oligonucleotide (CpG).sub.20OpA, and subsequent purification by
sucrose gradient ultra-centrifugation. A dense overlay of capsids
is observed, and those capsids display the same structural features
and properties as the intact Q.beta. VLPs.
[0421] FIG. 30 shows the Ouchterlony analysis (immunodiffusion) of
the reconstructed Q.beta. VLP. In FIG. 30A, Q.beta. VLP reassembled
with oligonucleotide (CpG)200 pA was loaded next to intact Q.beta.
VLP. The two characteristic precipitation bands are indicated by
black arrows. The two precipitation bands are concurrent,
indicating that the reassembled Q.beta. VLP diffuse as the intact
Q.beta. VLP. In FIG. 30B, sample 1 is Q.beta. VLP reassembled in
the presence of ribosomal RNA, while sample 2 is intact Q.beta. VLP
and sample 3 is Q.beta. VLP reassembled with oligonucleotide
(CpG)20OpA. The precipitation bands are indicated by white
arrows.
[0422] FIG. 31A shows the analysis of the untreated and reassembled
Q.beta. VLP by non-reducing SDS-PAGE. The pentamers and hexamers of
Q.beta. VLP are indicated by arrows.
[0423] FIG. 31B shows the agarose gel electrophoresis analysis of
the nucleotide content extracted after DNAse I digestion of Q.beta.
VLP reassembled with oligonucleotide (CpG)20OpA. The nucleic acid
content was either untreated (lane 1), or subsequently digested
with DNAse I (lane2) or RNAse A (lane 3); 33 .mu.g of reassembled
Q.beta. VLP were loaded on each lane. 300 ng of a 50 bp
oligonucleotide were loaded on lane 4, while 10 .mu.l of the
GeneRuler 100 bp DNA ladder +marker (MBI Fermentas) was loaded on
lane 5.
EXAMPLE 15
Q.beta. Disassembly Reassembly with Different Immunostimulatory
Nucleic Acids
[0424] Disassembly and Reassembly of Q.beta. VLP with
Oligodeoxynucleotides of Various Sequences
[0425] The disassembly of Q.beta. VLP was performed essentially as
described in Example 1, but for the use of 8 M urea instead of 7 M
urea to resuspend the ammonium sulphate pellets.
[0426] The reassembly of Q.beta. VLP with the oligos CyOpA, CyCyCy,
(CpG)20-OpA and CyCpG was performed essentially as described in
Example 1, but for the following variations. A dialysis step
against 10%-mercaptoethanol in NET buffer (20 mM Tris-HCl, pH 7.8
with 5 mM EDTA and 150 mM NaCl) for 1 hour at 4.degree. C. was
added to the procedure before addition of the oligodeoxynucleotide
solution to the dimer solution in the dialysis bag. The
oligodeoxynucleotides were then added to the dimer solutions,
resulting approx. in a ten-fold molar excess of oligonucleotide to
capsid (180 subunits) as described previously. The reassembly
mixture was first dialyzed against 30 ml NET buffer containing 10%
.beta.-mercaptoethanol for 1 hours at 4.degree. C., and then
dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h
over 4 days at 4.degree. C. A sample of the reassembly reaction of
Q.beta. VLP with oligodeoxynucleotide CyOpA was taken for EM
analysis (FIG. 32) at the end of the reassembly reaction. The EM
procedure using phosphotungstic acid and described above was used.
The reassembly mixtures were then desalted against water by
dialysis and dried.
[0427] The dried protein was resolubilized in water and purified by
ultracentrifugation on a sucrose gradient. The purified reassembled
Q.beta. VLPs were also analyzed by EM (FIGS. 33A-D). The electron
micrographs indicate that the reassembled VLPs have the same
macromolecular properties as intact Q.beta. VLP. Purification
notably enriches the preparations for reassembled particles. Thus,
Q.beta. VLP was successfully reassembled with oligodeoxynucleotides
of various lengths and sequences.
[0428] Coupling of the p33 peptide to reassembled Q.beta. VLP:
Q.beta. VLP reassembled with the oligodeoxynucleotide CyOpA was
reacted at a concentration of 1.5 mg/ml, with the cross-linker SMPH
diluted from a stock solution in DMSO at a final concentration of
cross-linker of 536 .mu.M for 35 minutes at 26.degree. C. in 20 mM
Hepes pH 7.4. The derivatized Q.beta. VLP was dialyzed 2.times.2
hours against a thousand volumes of 20 mM Hepes, 150 mM NaCl, pH
7.4. The dialysed derivatized Q.beta. VLP at a concentration of 1.4
mg/ml was subsequently reacted with the p33GGC peptide (sequence:
KAVYNFATMGGC) at a final concentration of peptide of 250 .mu.M for
2 hours at 15.degree. C. in 20 mM Hepes, 150 mM NaCl, pH 7.4. The
gel of FIG. 34 indicates successful coupling of the p33 peptide to
Q.beta. VLP. Coupling bands corresponding to one, respectively two
peptides coupled per subunit are indicated by an arrow in the
Figure.
[0429] Analysis of nucleic acid content: The nucleic acid content
of reassembled and coupled Q.beta. VLP was analysed by proteinase K
digestion, phenol cloroform extraction and subsequent loading of
the extracted oligonucleotide on a TBE/Urea PAGE gel. The analysis
procedure was as follows. 25 .mu.l reassembled Q.beta. VLP (0.5-1
mg/ml) were supplemented with 0.5 .mu.l proteinase K, 1.5 .mu.l 10%
SDS and 3 .mu.l 10.times.proteinase buffer (0.5 M NaCl, 50 mM EDTA,
0.1 M Tris pH 7.4). After incubation overnight at 37.degree. C.,
proteinase K was inactivated by heating 20 min at 65.degree. C. and
the nucleic acid content was extracted from the samples by
1.times.phenol and 1.times.chloroform extraction. Subsequently the
samples were incubated 2 h at 37.degree. C. with 1 .mu.l RNAseA
(Qiagen, 100 .mu.g/ml, diluted 250.times.). The equivalent of 2
.mu.g starting protein was heated 3 min at 95.degree. C. with 1
volume of 2.times.loading buffer (1 ml 10.times.TBE, 4.2 g Urea,
1.2 g Ficoll, 1 ml 0.1%Bromophenolblue, H.sub.2O up to 10 ml) and
loaded on a 15% TBE/Urea polyacrylamide gel (Invitrogen). The gel
was run for 1.5 h at 180 V, and fixed in 10% acetic acid/20%
ethanol and stained with CYBR Gold (Molecular Probes, Eugene,
Oreg., USA). For quantification, 10 and 20 pmol of the
oligonucleotide used for the reassembly were applied on the gel as
a reference. Resistance of the nucleic acid content to RNAse and
its size proved that the packaged nucleic acid was the
oligonucleotide used for reassembly. Quantification of the packaged
oligodeoxynucleotide was performed by comparison of the band
intensity of the extracted oligonucleotide with the band intensity
of a reference amount of the same oligonucleotide loaded on the
same gel. A figure of 1.75 nmol CyOpA/100 .mu.g Q.beta. VLP was
obtained, giving a ratio of 44 oligonucleotides per VLP on
average.
[0430] FIG. 32 depicts the electron micrographs of the reassembly
reaction of Q.beta. VLP with the oligonucleotide CyOpA before
purification. The magnification was 200 000 fold.
[0431] FIGS. 33A-D show the electron micrographs of the purified
reassembly reactions of Q.beta. VLP with the oligodeoxynucleotides
Cy(CpG)20 (A), CyCyCy (B), CyCpG (C) and CyOpA (D). The
magnification was 200 000 fold.
[0432] FIG. 34 depicts the SDS-PAGE analysis of the coupling of
Q.beta. VLP reassembled with the oligodeoxynucleotide CyOpA to the
p33GGC peptide. Loaded on the gel were the following samples: 1.
Prestained Protein Marker, Broad Range (# 7708S) 10 .mu.l; 2.
Q.beta. VLP reassembled with CyOpA [1.5 mg/ml] 10 .mu.l; 3. Q.beta.
VLP reassembled with CyOpA [1.5 mg/ml] and derivatized with SMPH 10
.mu.l; 4. Q.beta. VLP reassembled with CyOpA [1.5 mg/ml],
derivatized with SMPH and coupled with p33-peptide 10 .mu.l; 5.
Q.beta. VLP reassembled with CyOpA [1.5 mg/ml], derivatized with
SMPH and coupled with p33-peptide, 1/5.sup.th vol of the
pellet.
[0433] FIG. 35 depicts the analysis of the extracted packaged
oligodeoxynucleotides by Urea Polyacrylamide gel electrophoresis,
stained with CYBR Gold. The following samples were loaded on the
gel: 1. Q.beta. VLP reassembled with oligonucleotide CyOpA and
coupled to p33 GGC peptide, 2 .mu.g protein loaded on the gel. 2.
Q.beta. VLP reassembled with oligonucleotide CyOpA and coupled to
p33GGC peptide, frozen and thawed before loading on the gel, 2
.mu.g protein. 3. Q.beta. VLP reassembled with oligonucleotide
Cy(CpG).sub.20 and coupled to p33GGC peptide, frozen and thawed
before loading on the gel; 2 .mu.g protein. 4. CyOpA
oligonucleotide, 20 pmol. 5. CyOpA oligonucleotide, 10 pmol.
EXAMPLE 16
Q.beta. Disassembly Reassembly and Packaging
[0434] Disassembly and Reassembly of Q.beta. VLP
[0435] Disassembly: 10 mg Q.beta. VLP (as determined by Bradford
analysis) in 20 mM HEPES, pH 7.4, 150 mM NaCl was precipitated with
solid ammonium sulfate at a final saturation of 60%. Precipitation
was performed over night at 4.degree. C. and precipitated VLPs were
sedimented by centrifugation for 60 minutes at 4.degree. C. (SS-34
rotor). Pellets were resuspended in 1 ml of 6 M Guanidine
hydrochloride (GuHCl) containing 100 mM DTT (final concentration)
and incubated for 8 h at 4.degree. C.
[0436] Purification of Q.beta. coat protein by size exclusion
chromatography: The solution was clarified for 10 minutes at 14000
rpm (Eppendorf 5417 R, in fixed angle rotor F45-30-11, used in all
the following steps) and dialysed against a buffer containing 7 M
urea, 100 mM TrisHCl, pH 8.0, 10 mM DTT (2000 ml) over night.
Dialysis buffer was exchanged once and dialysis continued for
another 2 h. The resulting suspension was centrifuged at 14 000 rpm
for 10 minutes at 4.degree. C. A negligible sediment was discarded,
and the supernatant was kept as "load fraction" containing
dissasembled coat protein and RNA. Protein concentration was
determined by Bradford analysis and 5 mg total protein was applied
onto a HiLoad.TM. Superdex.TM. 75 prep grade column (26/60,
Amersham Biosciences) equilibrated with 7 M urea, 100 mM TrisHCl
and 10 mM DTT. Size exclusion chromatography was performed with the
equilibration buffer (7 M urea, 100 mM TrisHCl pH 8.0, 10 mM DTT)
at 12.degree. C. with a flow-rate of 0.5 ml/min. During the elution
absorbance at 254 nm and 280 nm was monitored. Two peaks were
isolated. A high molecular weight peak preceded a peak of lower
apparent molecular weight. Peaks were collected in fractions of 1.5
ml and aliquots were analysed by SDS-PAGE followed by Coomassie
staining as well as SYBR.RTM. Gold staining (FIG. 36).
[0437] Purification of Q.beta. coat protein by ion exchange
chromatography: Alternatively, the clearified supernatant was
dialysed against a buffer containing 7 M urea, 20 mM MES, 10 mM
DTT, pH 6.0 (2000 ml) over night. Dialysis buffer was exchanged
once and dialysis continued for another 2 h. The resulting
suspension was centrifuged at 14 000 rpm for 10 minutes at
4.degree. C. A negligible sediment was discarded, and the
supernatant was kept as "load fraction" containing disassembled
coat protein and RNA. Protein concentration was determined by
Bradford analysis and 10 mg total protein was diluted to a final
volume of 10 ml with buffer A (see below) and applied with a
flowrate of 1 ml/min to a 1 ml HiTrap.TM. SP HP column (Amersham
Biosciences, Cat. No. 17-1151-01) equilibrated with buffer A: 7 M
urea, 20 mM MES, 10 mM DTT, pH 6.0. The flowthrough which contained
the RNA was collected as one fraction. After the column was
extensively washed with buffer A (30 CV) the bound Q.beta. coat
protein was eluted in a linear gradient from 0%-100% buffer B
(gradient length was 5 CV; buffer A: see above, buffer B: 7 M urea,
20 mM MES, 10 mM DTT, 2 M NaCl, pH 6.0). During the loading, wash
and clution the absorbance at 254 nm and 280 nm was monitored. Peak
fractions of 1 ml were collected and analysed by SDS-PAGE followed
by Coomassie staining as well as SYBR.RTM.Gold staining. Fractions
containing the Q.beta. coat protein but not the RNA were identified
and the pH was adjusted by addition of 100 .mu.l 1 M TrisHCl, pH
8.0.
[0438] Samples containing the Q.beta. coat protein but no RNA were
pooled and dialysed against 0.87 M urea, 100 mM TrisHCl, 10 mM DTT
(2000 ml) over night and buffer was exchanged once and dialysis
continued for another 2 h. The resulting suspension was centrifuged
at 14 000 rpm for 10 minutes at 4.degree. C. A negligible sediment
was discarded, and the supernatant was kept as "disassembled coat
protein". Protein concentration was determined by Bradford
analysis.
[0439] Reassembly: Purified Q.beta. coat protein with a
concentration of 0.5 mg/ml was used for the reassembly of VLPs in
the presence of an oligodeoxynucleotide. For the reassembly
reaction the oligodeoxynucleotide was used in a tenfold excess over
the calculated theoretical amount of Q.beta.-VLP capsids (monomer
concentration divided by 180). After the Q.beta. coat protein was
mixed with the oligodeoxynucleotide to be packaged during the
reassembly reaction, this solution (volume up to 5 ml) was first
dialysed for 2 h against 500 ml NET buffer containing 10%
.beta.-mercaptoethanol at 4.degree. C., then dialyzed in a
continuous mode, with a flow of NET buffer of 8 ml/h over 72 h at
4.degree. C., and finally for another 72 h with the same continous
mode with a buffer composed of 20 mM TrisHCl pH 8.0, 150 mM NaCl.
The resulting suspension was centrifuged at 14 000 rpm for 10
minutes at 4.degree. C. A negligible sediment was discarded, and
the supernatant contained the reassembled and packaged VLPs.
Protein concentration was determined by Bradford analysis and if
needed reassembled and packaged VLPs were concentrated with
centrifugal filter devices (Millipore, UFV4BCC25, 5K NMWL) to a
final proteinconcentration of 3 mg/ml.
[0440] Purification of reassembled and packaged VLPs: Up to 10 mg
total protein was loaded onto a Sepharose.TM. CL-4B column (16/70,
Amersham Biosciences) equilibrated with 20 mM HEPES pH 7.4, 150 mM
NaCl. Size exclusion chromatography was performed with the
equilibration buffer (20 mM HEPES pH 7.4, 150 mM NaCl) at room
temperature with a flow-rate of 0.4 ml/min. During the elution
absorbance at 254 nm and 280 nm was monitored. Two peaks were
isolated. A high molecular weight peak preceded a peak of lower
apparent molecular weight. Fractions of 0.5 ml were collected and
analysed by SDS-PAGE followed by Coomassie blue staining (FIG. 37).
Calibration of the column with intact and highly purified Q.beta.
capsids from E. coli revealed that the apparent molecular weight of
the major first peak was consistent with Q.beta. capsids.
[0441] Analysis of Q.beta. VLPs which had been reassembled in the
presence of oligodeoxynucleotides:
[0442] A) Overall structure of the capsids: Q.beta. VLPs that were
reassembled either in the presence of one of the following
oligodeoxynucleotides (CyOpA, Cy(CpG)200 pA, Cy(CpG)20, CyCyCy,
(CpG)200 pA), or in the presence of tRNA from E. coli (Roche
Molecular Biochemicals, Cat. No. 109541) were analyzed by electron
microscopy (negative staining with uranylacetate pH 4.5) and
compared to intact Q.beta. VLPs purified from E. coli. As a
negative control served a reassembly reaction where nucleic acid
was omitted. Reassembled capsids display the same structural
features and properties as the intact Q.beta. VLPs (FIG. 38).
[0443] B) Hydrodynamic size of reassembled capsids: Q.beta. capsids
which had been reassembled in the presence of oligodeoxynucleotides
were analyzed by dynamic light scattering (DLS) and compared to
intact Q.beta. VLPs which had been purified from E. coli.
Reassembled capsids showed the same hydrodynamic size (which
depends both on mass and conformation) as the intact Q.beta.
VLPs.
[0444] C) Disulfide-bond formation in reassembled capsids:
Reassembled Q.beta. VLPs were analyzed by native polyacrylamid
gelelectrophoresis and compared to intact Q, VLPs which had been
purified from E. coli. Reassembled capsids displayed the same
disulfide-bond pattern as the intact Q.beta. VLPs (FIG. 39).
[0445] D) Analysis of nucleic acid content of the Q.beta. VLPs
which had been reassembled in the presence of oligodeoxynucleotides
by agarose gelelectrophoresis: 5 .mu.g reassembled Q.beta. VLPs
were incubated in total reaction volume of 25 .mu.l either with
0.35 units RNase A (Qiagen, Cat. No. 19101), 15 units DNAse I
(Fluka, Cat. No. 31136), or without any further addition of enzymes
for 3 h at 37.degree. C. Intact Q.beta. VLPs which had been
purified from E. coli served as control and were incubated under
the same conditions as described for the capsids which had been
reassembled in the presence of oligodeoxynucleotides. The reactions
were then loaded on a 0.8% agarose gel that was first stained with
ethidumbromide (FIG. 40A) and subsequently with Coomassie blue
(FIG. 40B). The ethidium bromide stain shows, that none of the
added enzymes could digest the nucleic acid content in the
reassembled Q.beta. capsids showing that the nucleic acid content
(i.e. the oligodeoxynucleotides) is protected. This result
indicates that the added oligodeoxynucleotides were packaged into
the newly formed capsids during the reassembly reaction. In
contrast, the nucleic acid content in the intact Q.beta. VLPs which
had been purified from E. coli was degraded upon addition of RNase
A, indicating that the nucleic acid content in this VLPs consists
of RNA. In addition, both the ethidium bromide stain and the
Coomasie blue stain of the agarose gel shows that the nucleic acid
containing Q.beta. VLPs (reassembled and purified from E. coli,
respectively) are migrating at about the same size, which indicates
that the reassembly reaction led to Q.beta. VLPs of comparable size
to intact Q.beta. VLPs which had been purified from E. coli.
[0446] The gel thus shows that DNAse I protected
oligodeoxynucleotides were present in the reassembled Q.beta. VLP.
Furthermore, after the packaged oligodeoxynuleotides had been
extracted by phenol/chloroform they were digestable by DNAse I, but
not by RNAse A. Oligodeoxynucleotides could thus be successfully
packaged into Q.beta. VLPs after initial disassembly of the VLP,
purification of the disassembled coat protein from nucleic acids
and subsequent reassembly of the VLPs in the presence of
oligodeoxynucleotides.
[0447] E) Analysis of nucleic acid content of the Q.beta. VLPs
which had been reassembled in the presence of oligodeoxynucleotides
by denaturing polyacrylamide TBE-Urea gelelectrophoresis: 40 .mu.g
reassembled Q.beta. VLPs (0.8 mg/ml) were incubated in a total
reaction volume of 60 .mu.l with 0.5 mg/ml proteinase K (PCR-grade,
Roche Molecular Biochemicals, Cat. No. 1964364) and a reaction
buffer according to the manufacturers instructions for 3 h at
37.degree. C. Intact Q.beta. VLPs which had been purified from E.
coli served as control and were incubated with proteinase K under
the same conditions as described for the capsids which had been
reassembled in the presence of oligodeoxynucleotides. The reactions
were then mixed with a TBE-Urea sample buffer and loaded on a 15%
polyacrylamide TBE-Urea gel (Novex.RTM., Invitrogen Cat. No.
EC6885). As a qualitative as well as quantitative standard, 1 pmol,
5 pmol and 10 pmol of the oligodeoxynucleotide which was used for
the reassembling reaction, were loaded onto the same gel. This gel
was fixed with 10% acetic acid, 20% methanol, equilibrated to
neutral pH and stained with SYBR.RTM.-Gold (Molecular Probes Cat.
No. S-11494). The SYBR.RTM.-Gold stain showed (FIG. 41), that the
reassembled Q.beta. capsids contained nucleic acid comigrating with
the oligodeoxynucleotides which were used in the reassembly
reaction. Note that intact Q.beta. VLPs (which had been purified
from E. coli) did not contain a nucleic acid of similar size. Taken
together, analysis of the nucleic acid content of the Q.beta. VLPs
which had been reassembled in the presence of oligodeoxynucleotides
showed that oligodeoxynucleotides were protected from DNase I
digestion, meaning that they were packaged) and that the added
oligodeoxynucleotides could be reisolated by proper means (e.g.
proteinase K digestion of the Q.beta. VLP).
[0448] FIG. 36 shows the purification of disassembled Q.beta. coat
protein by size exclusion chromatography. 5 .mu.l of the indicated
fractions (#) were mixed with sample buffer and loaded onto 16%
Tris-Glycine gels (Novex.RTM. by Invitrogen, Cat. No. EC64952).
After the run was completed the gels were stained first with
Coomassie blue (A) and after documentation the same gels were
stained with SYBR.RTM.-Gold (B). Note that the first high molecular
weight peak (fractions #15-#20) contained no protein but nucleic
acids. On the other hand, the second peak of lower apparent
molecular weight contained disassembled coat protein which was
thereby separated from the nucleic acids.
[0449] FIG. 37 shows the purification of reassembled Q.beta. VLPs
by size exclusion chromatography.
[0450] 10 .mu.l of the indicated fractions (#) were mixed with
sample buffer and loaded onto a 16% Tris-Glycine gel (Novexo by
Invitrogen, Cat. No. EC64952). After the run was completed the gel
was stained with Coomassie blue. Due to the reducing conditions,
disulfide bonds were reduced and the proteinaceous monomer of the
reassembled VLPs is visible as 14 kDa coat protein.
[0451] FIG. 38 shows electron micrographs of Q.beta. VLPs that were
reassembled in the presence of different oligodeoxynucleotides. The
VLPs had been reassembled in the presence of the indicated
oligodeoxynucleotides or in the presence of tRNA but had not been
purified to a homogenous suspension by size exclusion
chromatography. As positive control served preparation of "intact"
Q.beta. VLPs which had been purified from E. coli. Importantly, by
adding any of the indicated nucleic acids during the reassembly
reaction, VLPs of the correct size and conformation could be
formed, when compared to the "positive" control. This implicates
that the reassembly process in general is independent of the
nucleotide sequence and the length of the used
oligodeoxynucleotides. Note that adding of nucleic acids during the
reassembly reaction is required for the formation of Q.beta. VLPs,
since no particles had been formed if nucleic acids were omitted
from the reassembly reaction.
[0452] FIG. 39 shows the analysis of the disulfide-bond pattern in
reassembled and purified Q.beta. capsids. 5 .mu.g of the indicated
capsids were mixed with sample buffer that either contained a
reducing agent or not and loaded onto a 16% Tris-Glycine gel. After
the run was completed the gel was stained with Coomassie blue. When
compared to "intact" capsids purified from E. coli, the reassembled
Q.beta. VLPs displayed the same disulfide bond pattern.
[0453] FIG. 40 shows the analysis of nucleic acid content of the
reassembled Q.beta. VLPs by nuclease treatment and agarose
gelelectrophoresis: 5 .mu.g of reassembled and purified Q.beta.
VLPs and 5 .mu.g of Q.beta. VLPs which had been purified from E.
coli, respectively, were treated as indicated. After this
treatment, samples were mixed with loading dye and loaded onto a
0.8% agarose gel. After the run the gel was stained first with
ethidum bromide (A) and after documentation the same gel was
stained with Coomassie blue (B). Note that the nucleic acid content
of the reassembled and purified Q.beta. VLPs were resistant towards
RNase A digestion while the nucleic acid content of Q.beta. VLPs
purified from E. coli was digested upon incubation with RNase A.
This indicates that the nucleic acid content of the reassembled
Q.beta. capsids consists out of deoxynucleotides which of course
are protected from RNase A digestion. Hence, oligodeoxynucleotides
were packaged into Q.beta. VLPs during the reassembly reaction.
[0454] FIG. 41 shows the analysis of nucleic acid content of the
reassembled Q.beta. VLPs by proteinase K treatment and
polyacrylamide TBEIUrea gelelectrophoresis: The equivalent of 1 ug
Q.beta. VLPs which had been digested by proteinase K-treatment was
mixed with a TBE-Urea sample buffer and loaded on a 15%
polyacrylamide TBE-Urea gel (Novex.RTM., Invitrogen Cat. No.
EC6885). As qualitative as well as quantitative standard, 1 pmol, 5
pmol and 10 pmol of the oligodeoxynucleotide which was used for the
reassembly reaction, was loaded onto the same gel. After the run
was completed, the gel was fixed, equilibrated to neutral pH and
stained with SYBR.RTM.-Gold (Molecular Probes Cat. No. S-11494).
Note that intact Q.beta. VLPs (which had been purified from E.
coli) did not contain nucleic acids of similar size than those
which had been extracted from reassembled Q.beta. capsids. In
addition, nucleic acids isolated from reassembled VLPs were
comigrating with the oligodeoxynucleotides which had been used in
the reassembly reaction. This results confirmed that the used
oligodeoxynucleotides were packaged into reassembled Q.beta.
capsids.
EXAMPLE 17
AP205 Disassembly-Purification-Reassembly and Packaging of
Immunostimulatory Nucleic Acids
[0455] A. Disassembly and Reassembly of AP205 VLP from Material
Able to Reassemble Without Addition of Oligonucleotide
[0456] Disassembly: 40 mg of lyophilized purified AP205 VLP were
resolubilized in 4 ml 6 M GuHCl, and incubated overnight at
4.degree. C. The disassembly mixture was centrifuged at 8000 rpm
(Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the
following steps). The pellet was resolubilized in 7 M urea, while
the supernatant was dialyzed 3 days against NET buffer (20 mM
Tris-HCl, pH 7.8 with 5 mM EDTA and 150 mM NaCl) with 3 changes of
buffer. Alternatively, dialysis was conducted in continuous mode
over 4 days. The dialyzed solution was centrifuged at 8000 rpm for
20 minutes, and the pellet was resolubilized in 7 M urea, while the
supernatant was pelletted with ammonium sulphate (60% saturation),
and resolubilized in a 7 M urea buffer containing 10 mM DTT. The
previous pellets all resolubilized in 7 M urea were joined, and
precipitated with ammonium sulphate (60% saturation), and
resolubilized in a 7 M urea buffer containing 10 mM DTT. The
materials resolubilized in the 7 M urea buffer containing 10 mM DTT
were joined and loaded on a Sephadex G75 column equilibrated and
eluted with the 7 M urea buffer containing 10 mM DTT at 2 ml/h. One
peak eluted from the column. Fractions of 3 ml were collected. The
peak fractions containing AP205 coat protein were pooled and
precipitated with ammonium sulphate (60% saturation). The pellet
was isolated by centrifugation at 8000 rpm, for 20 minutes. It was
resolubilized in 7 M urea, 10 mM DTT, and loaded on a short
Sepharose 4B column (1.5.times.27 cm Sepharose 4B, 2 ml/h, 7 M
urea, 10 mM DTT as elution buffer). Mainly one peak, with a small
shoulder eluted from the column. The fractions containing the AP205
coat protein were identified by SDS-PAGE, and pooled, excluding the
shoulder. This yielded a sample of 10.3 ml. The protein
concentration was estimated spectrophotometrically by measuring an
aliquot of protein diluted 25-fold for the measurement, using the
following formula: (1.55.times.OD280-0.76.-
times.OD260).times.volume. The average concentration was of 1
nmol/ml of VLP (2.6 mg/ml). The ratio of absorbance at 280 nm vs.
260 nm was of 0.12/0.105.
[0457] Reassembly: 1.1 ml beta-mercaptoethanol was added to the
sample, and the following reassembly reactions were set up:
[0458] 1. 1 ml of AP205 coat protein, no nucleic acids
[0459] 2. 1 ml of AP205 coat protein, rRNA (approx. 200 OD260
units, 10 nmol)
[0460] 100. 9 ml of AP205 coat protein, CyCpG (370 ul of 225
pmol/.mu.l solution, i.e. 83 nmol).
[0461] These mixtures were dialyzed 1 hour against 30 ml of NET
buffer containing 10% beta-mercaptoethanol. The mixture containing
no nucleic acids was dialyzed separately. The dialysis was then
pursued in a continuous mode, and 1 l of NET buffer was exchanged
over 3 days. The reaction mixtures were subsequently extensively
dialyzed against water (5 changes of buffer), and lyophilized. They
were resolubilized in water, and analyzed by EM. All mixtures
contained capsids, showing that AP205 VLP reassembly is independent
of the presence of detectable nucleic acids, as measured by agarose
gel electrophoresis using ethidium bromide staining. The EM
analysis of AP205 reassembled with CyCpG is shown on FIG. 42B. The
EM procedure was as follows: A suspension of the proteins was
absorbed on carbon-formvar coated grids and stained with 2%
phosphotungstic acid (pH 6,8). The grids were examined with a JEM
100C (JEOL,Japan) electron microscope at an accelerating voltage of
80 kV. Photographic records (negatives) were performed on Kodak
electron image film and electron micrographs were obtained by
printing of negatives on Kodak Polymax paper. The VLP reassembled
in the presence of the CyCpG was purified over a Sepharose 4B
column (1.times.50 cm), eluted with NET buffer (1 ml/h). The
fractions were analyzed by Ouchterlony assay, and the fractions
containing VLP were pooled. This resulted in a sample of 8 ml,
which was desalted against water by dialysis, and dried. The yield
of capsid was of 10 mg. Analysis of resolubilized material in a
0.6% agarose gel stained with ethidium-bromide showed that the
capsids were empty of nucleic acids. Samples of the reassembly
reaction containing CyCpG taken after the reassembly step and
before extensive dialysis were analysed on a 0.6% agarose gel and
are shown in FIGS. 43A and B. A band migrating at the same height
than intact AP205 VLP and staining both for ethidium-bromide and
Coomassie blue staining could be obtained, showing that AP205 VLP
containing oligodeoxynucleotide had been reassembled. The extensive
dialysis steps following the reassembly procedure are likely to
have led to diffusion of the oligodeoxynucleotide outside of the
VLPs. Significantly, the AP205 VLPs could also be reassembled in
the absence of detectable oligodeoxynucleotide, as measured by
agarose gel electrophoresis using ethidium bromide staining.
Oligodeoxynucleotides could thus be successfully bound to AP205 VLP
after initial disassembly of the VLP, purification of the
disassembled coat protein from nucleic acids and subsequent
reassembly of the VLP in the presence of oligodeoxynucleotide.
[0462] FIG. 42 shows electron micrographs of either intact
recombinant AP205 VLP used for the disassembly step (A), or AP205
VLP disassembled, and subsequently reassembled in the presence of
CyCpG (B).
[0463] FIG. 43 shows the agarose gel-electrophoresis analysis of
the AP205 VLP sample reassembled in the presence of CyCpG, and
taken directly after the reassembly step before dialysis. The gel
on FIG. 43A was stained with ethidium-bromide. AP205 VLP
reassembled with CyCpG was loaded on lane1, while untreated pure
AP205 VLP was loaded on lane 2. The arrow indicates the band of the
reassembled AP205 VLP. The gel on FIG. 43B was stained with
Coomassie-brillant blue. Untreated AP205 VLP was loaded on lane 1,
while AP205 VLP reassembled with CyCpG was loaded on on lane 2.
[0464] B. Reassembly of AP205 VLP Using Disassembled Material Which
Does not Reassemble in the Absence of Added Oligonucleotide
[0465] Disassembly: 100 mg of purified and dried recombinant AP205
VLP (Cytos patent) were used for disassembly as described above.
All steps were performed essentially as described under disassembly
in part A, but for the use of 8 M urea to solublize the pellets of
the ammonium sulphate precipitation steps and the omission of the
gel filtration step using a CL-4B column prior to reassembly. The
pooled fractions of the Sephadex G-75 column contained 21 mg of
protein as determined by spectroscopy using the formula described
in part A. The ratio of absorbance at 280 nm to the absorbance at
260 nm of the sample was of 0.16 to 0.125. The sample was diluted
50 times for the measurement.
[0466] Reassembly: The protein preparation resulting from the
Sephadex G-75 gel filtration purification step was precipitated
with ammonium sulphate at 60% saturation, and the resulting pellet
solubilized in 2 ml 7 M urea, 10 mM DTT. The sample was diluted
with 8 ml of 10% 2-mercaptoethanol in NET buffer, and dialyzed for
1 hour against 40 ml of 10% 2-mercaptoethanol in NET buffer.
Reassembly was initiated by adding 0.4 ml of a CyCpG solution (109
nmol/ml) to the protein sample in the dialysis bag. Dialysis in
continous mode was set up, and NET buffer used as eluting buffer.
Dialysis was pursued for two days and a sample was taken for EM
analysis after completion of this dialysis step (FIG. 44B). The
dialyzed reassembly solution was subsequently dialyzed against 50%
v/v Glycerol in NET buffer, to achieve concentration. One change of
buffer was effected after one day of dialysis. The dialysis was
pursued over a total of three days.
[0467] The dialyzed and concentrated reassembly solution was
purified by gel filtration over a Sepharose 4-B column (1.times.60
cm) at a flow rate of 1 ml/hour, in NET buffer. Fractions were
tested in an Ouchterlony assay, and fractions containing capsids
were dried, resuspended in water, and rechromatographed on the 4-B
column equilibrated in 20 mM Hepes pH 7.6. Using each of the
following three formula:
1.(183*OD.sup.230 nm-75.8*OD.sup.260 nm)*volume(ml)-2. ((OD.sup.235
nm-OD.sup.280 nm)/2.51).times.volume-3. ((OD.sup.228.5 nm31
OD.sup.234.5 nm)*0.37).times.volume
[0468] protein amounts of 6-26 mg of reassembled VLP were
determined.
[0469] The reassembled AP205 VLPs were analyzed by EM as described
above, agarose gel electrophoresis and SDS-PAGE under non-reducing
conditions.
[0470] The EM analysis of disassembled material shows that the
treatment of AP205 VLP with guanidinium-chloride essentially
disrupts the capsid assembly of the VLP. Reassembly of this
disassembled material with an oligonucleotide yielded capsids (FIG.
44B), which were purified and further enriched by gel filtration
(FIG. 44C). Two sizes of particles were obtained; particles of
about 25 nm diameter and smaller particles are visible in the
electron micrograph of FIG. 44C. No reassembly was obtained in the
absence of oligonucleotides. Loading of the reassembled particles
on agarose electrophoresis showed that the reassembled particles
contained nucleic acids. Extraction of the nucleic acid content by
phenol extraction and subsequent loading on an agarose gel stained
with ethidium bromide revealed that the particles contained the
oligonucleotide used for reassembly (FIG. 45A). Identity of the
packaged oligonucleotide was controlled by loading a sample of this
oligonucleotide side to side to the nucleic acid material extracted
from the particles. The agarose gel where the reassembled AP205 VLP
had been loaded and previously stained with ethidium bromide was
subsequently stained with Coomassie blue, revealing comigration of
the oligonucleotide content with the protein content of the
particles (FIG. 45B), showing that the oligonucleotide had been
packaged in the particles.
[0471] Loading of the reassembled AP205 VLP on an SDS-PAGE gel, run
in the absence of reducing agent (FIG. 46) demonstrated that the
reassembled particles have formed disulfide bridges, as is the case
for the untreated AP205 VLP. Moreover, the disulfide bridge pattern
is identical to the untreated particles.
[0472] Depicted on FIG. 44A is an electron micrograph of the
disassembled AP205 VLP protein, while FIG. 44B shows the
reassembled particles before purification. FIG. 3C shows an
electron micrograph of the purified reassembled AP205 VLPs. The
magnigication of FIGS. 3A-C is 200 000.times..
[0473] FIGS. 45A and B show the reassembled AP205 VLPs analyzed by
agarose gel electrophoresis. The samples loaded on the gel from
both figures were, from left to right: untreated AP205 VLP, 3
samples with differing amount of AP205 VLP reassembled with CyCpG
and purified, and untreated Q.beta. VLP. The gel on FIG. 45A was
stained with ethidium bromide, while the same gel was stained with
Coomassie blue in FIG. 45B.
[0474] FIG. 46 depicts an SDS-PAGE analysis of reassembled AP205
VLP, loaded under non-reducing conditions. 5 samples were loaded on
the gel. The samples loaded on the gel are, from left to right:
Protein Marker, untreated wt Q.beta., reassembled wt Q.beta.,
untreated AP205 VLP, reassembled AP205 VLP. The Molecular Weight of
the AP205 VLP subunit is 14.0 kDa, while the molecular weight of
the Q.beta. subunit is 14.3 kDa (both molecular weights calculated
with the N-terminal methionine). The disulfide linked multimers are
each indicated by an arrow on the figure.
[0475] C. Coupling of p33 Epitope (Sequence: H2N-KAVYNFATMGGCCOOH,
with Free N- and C-Termini ) to AP205 VLPs Reassembled with
CyCpG
[0476] Reassembled AP205 VLP obtained as described in part B, and
in 20 mM Hepes, 150 mM NaCl, pH 7.4 was reacted at a concentration
of 1.4 mg/ml with a 5-fold excess of the crosslinker SMPH diluted
from a 50 mM stock in DMSO for 30 minutes at 15.degree. C. The
obtained so-called derivatized AP205 VLP was dialyzed 2.times.2
hours against at least a 1000-fold volume of 20 mM Hepes, 150 mM
NaCl, pH 7.4 buffer. The derivatized AP205 was reacted at a
concentration of 1 mg/ml with either a 2.5-fold, or with a 5-fold
excess of peptide, diluted from a 20 mM stock in DMSO, for 2 hours
at 15.degree. C. The sample was subsequently flash frozen in liquid
nitrogen for storage.
[0477] The result of the coupling reaction is shown in FIG. 6. A
higher degree of coupling could be achieved by using a 5-fold
excess of peptide rather than with a 2.5 fold excess of peptide in
the coupling reaction.
[0478] Depicted on FIG. 47 is the SDS-PAGE analysis of the coupling
reaction. The following samples (from left to right) were loaded on
the gel: protein marker; derivatized AP205 VLP (d); AP205 VLP
coupled with a 2.5-fold excess of peptide, supernatant (s); AP205
VLP coupled with a 2.5-fold excess of peptide, pellet (p); AP205
VLP coupled with a 5-fold excess of peptide, supernatant (s); AP205
VLP coupled with a 5-fold excess of peptide, pellet (p).
EXAMPLE 18
Free Immunostimulatory Nucleic Acids but not Immunostimulatory
Nucleic Acids Packaged in VLPs Induce Splenomegaly
[0479] Mice were left untreated or immunized s.c. with 100 .mu.g
HBc33 alone, 20 nmol CyCpGpt, 100 .mu.g HBc33 mixed with 20 nmol
CyCpGpt, or 100 .mu.g HBc33 packaged with CyCpGpt. Twelve days
later, spleens were isolated and spleen weigths and splenic
cellularity were assessed. CyCpGpt induced a massive increase in
spleen weight and number of cells when given alone (FIG. 48). No
such effect was seen with CyCpGpt packaged in HBc33 although this
composition was able to induce protection against viral challenge
(see EXAMPLE 4).
EXAMPLE 19
In-Vivo Virus Protection Assays
[0480] Vaccinia Protection Assay
[0481] Groups of three female C57B1/6 mice were immunized s.c. with
100 .mu.g VLP coupled or fused to p33 alone, mixed with 20 nmol
immunostimulatory nucleic acid or packaged with immunostimulatory
nucleic acid. To assess antiviral immunity in peripheral tissues,
mice were infected 7-9 days later, i.p., with 1.5.times.10.sup.6
pfu recombinant vaccinia virus expressing the LCMV-glycoprotein
(inclusive of the p33 peptide). Five days later the ovaries were
collected and viral titers determined. Therefore, ovaries were
ground with a homogenizer in Minimum Essential Medium (Gibco)
containing 5% fetal bovine serum and supplemented with glutamine,
Earls's salts and antibiotics
(penicillin/streptomycin/amphotericin). The suspension was titrated
in tenfold dilution steps onto BSC40 cells. After overnight
incubation at 37.degree. C., the adherent cell layer was stained
with a solution consisting of 50% ethanol, 2% crystal violet and
150 mM NaCl for visualization of viral plaques. Non-immunized naive
mice were used as control.
[0482] LCMV Protection Assay
[0483] Groups of three female C57B1/6 mice were immunized s.c. with
100 .mu.g VLP coupled or fused to p33 alone or mixed with
adjuvant/20 nmol CpG oligonucleotide. To examine systemic antiviral
immunity mice were infected i.p. 11-13 days later with 200 pfu
LCMV-WE. Four days later spleens were isolated and viral titers
determined. The spleens were ground with a homogenizer in Minimum
Essential Medium (Gibco) containing 2% fetal bovine serum and
supplemented with glutamine, earls's salts and antibiotics
(penicillin/streptomycin/amphotericin). The suspension was titrated
in tenfold dilution steps onto MC57 cells. After incubation for one
hour the cells were overlayed with DMEM containing 5% Fetal bovine
serum, 1% methyl cellulose, and antibiotics
(penicillin/streptomycin/amph- otericin). Following incubation for
2 days at 37.degree. C. the cells were assessed for LCMV infection
by the intracellular staining procedure (which stains the viral
nucleoprotein): Cells were fixed with 4% Formaldehyde for 30 min
followed by a 20 min lysing step with 1% Triton X-100. Incubation
for 1 hour with 10% fetal bovine serum blocked unspecific binding.
Cells were stained with a rat anti-LCMV-antibody (VL-4) for 1 hour.
A peroxidase-conjugated goat anti-rat-IgG (Jackson ImmunoResearch
Laboratories, Inc) was used as secondary antibody followed by a
colour reaction with ODP substrate according to standard
procedures.
EXAMPLE 20
Different Immunostimulatory Nucleic Acids Packaged in VLP Fused to
Antigen Result in a Potent Antigen-Specific CTL Response and Virus
Protection
[0484] The fusion protein of HBcAg with the peptide p33 (HBc33) was
produced as described in EXAMPLE 1 and packaged with different CpG
nucleic acids as described in EXAMPLE 11.
[0485] 100 .mu.g of vaccines were injected into mice and vaccina
titers in the ovaries after recombinant vaccinia challenge were
detected as described in EXAMPLE 19. Double stranded CyCpGpt
(dsCyCpGpt) was produced by annealing 0.5 mM of DNA
oligonucleotides CyCpGpt and CyCpG-rev-pt (Table I) in 15 mM Tris
pH 7.5 by a 10 min heating step at 80.degree. C. and subsequent
cooling to RT.RTM.. Oligonucleotide hybridization was checked on a
20% TBE polyacrylamid gel (Novex).
[0486] HBc33 capsids containing CyCpG, NKCpG, B-CpG and g10gacga-PS
did induce CTL responses capable of completely inhibition viral
infection (FIG. 49, FIG. 50). Protection was observed with nucleic
acids contained phosphodiester or phosphothioate bonds (pt or PS).
Even a double stranded oligonucleotide dsCyCpGpt was inducing
protection against vaccinia challenge (FIG. 49).
EXAMPLE 21
Immunostimulatory Nucleic Acids Packaged in HBcAg and Q.beta. VLPs
Result in a Potent Antigen-Specific CTL Response and Virus
Protection
[0487] The fusion protein of HBcAg with the peptide p33 (HBc33) was
produced as described in EXAMPLE 1 and packaged with
oligonucleotide B-CpGpt as described in EXAMPLE 11. Peptide p33 was
coupled to the RNA phage Q.beta. and oligonucleotide B-CpGpt were
packaged as described in EXAMPLE 13. 100 .mu.g, 30 .mu.g, 10 .mu.g
or 3 .mu.g of each vaccine was injected into mice and vaccina
titers in the ovaries after recombinant vaccinia challenge were
detected as described in EXAMPLE 19. 100 .mu.g and 30 .mu.g HBc33
and Qbx33 with packaged B-CpG did induce full protection against
viral challenge while at lower concentrations partial or no
protection was observed (FIG. 51).
EXAMPLE 22
Immunostimulatory Nucleic Acids Packaged in VLPs Which are Coupled
to Selfantigens can Overcome Tolerance to Self-Antigens
[0488] Transgenic mice expressing LCMV glycoprotein in pancreatic
.beta. islet cells (Ohasi et al., Cell 65, 305-317 (1991)) were
immunized with 200 pfu LCMV, 100 .mu.g HBc33 mixed with 20 nmol
CyCpGpt, 100 pg HBc33 packaged with CyCpGpt or 100 .mu.g p33
peptide mixed with 20 nmol CyCpGpt as control. Blood glucose levels
were measured every four days with the Glucotrend Plus Glucose test
kit (Roche). Mice with blood glucose levels larger 12 mM were
considered diabetic. Immunization with LCMV induced diabetes in 4/4
animals at day 12. CyCpGpt mixed with HBc33 only caused diabetes in
1/3 mice. Two of three mice immunized with HBc33 in which CyCpGpt
was packaged develop diabetes at day 12, the third mouse at day 16.
Immunization with peptide p33 mixed with CyCpGpt did not induce
diabetes in three mice. This clearly shows that immunostimulatory
nucleic acid packaged into VLP to which antigens are fused are much
more efficient in enhancing a strong CTL response than a mixture of
nucleic acid and antigen. They even induced a stronger response
than antigen fused to VLP and mixed with the immunostimulatory
nucleic acid.
EXAMPLE 23
Immunostimulatory Nucleic Acids Packaged in VLPs-Coupled to
Antigens are Even More Efficient in Inducing Antigen-Specific CD8+T
Cells Than VLPs Mixed with Immunostimulatory Nucleic Acids
[0489] C57BL/6 mice were subcutaneously immunized with 100 .mu.g
HBc33 alone, mixed with CyCpGpt or, alternatively, packaged with
CyCpGpt. Untreated mice served as controls.
[0490] 8 days after immunization blood lymphocytes were
double-stained with PE-labeled p33-tetramers and FITC-coupled
monoclonal anti-CD8 antibodies for p33-specific CD8+ T cell
detection and percentage of p33-specific cells on the total CD8+ T
cell population were determined by FACS analysis. Table II.
Induction of p33-specific CD8+ T cells after vaccination with
p33-VLP mixed or packaged with CpGs. Numbers correspond to means of
frequencies (in percent) and standard deviations.
[0491] HBc33 with packaged CyCpGpt induced a higher frequence of
p33-specific CD8+T cells than HBc33 mixed with CyCpGpt (Table II).
As the amount of packaged oligonucleotide is much lower (about
{fraction (1/20)}) of the amount of oligonucleotide used in the
mixed setting this clearly demonstrates that VLPs with packaged
immunostimulatory nucleic acids are even more efficient in inducing
high numbers of antigen-specific CD8.sup.+ T cells.
EXAMPLE 24
Immunostimulatory Nucleic Acids Packaged in VLPs are Even More
Efficient in Inducing CTL Responses than VLPs Mixed with
Immunostimulatory Nucleic Acids
[0492] Groups of C57BL/6 mice were subcutaneously primed with 100
.mu.g p33-VLP given alone, mixed with 20 nmol CyCpGpt, or,
alternatively, packaged with CyCpGpt. For detection of primary ex
vivo cytotoxicity, effector cell suspensions were prepared from
spleens of vaccinated mice 9 days after priming. EL-4 cells were
pulsed with p33 peptide (10-6 M, 2 h at 37.degree. C. in 2% FCS MEM
medium) and used in a 5 h .sup.51Cr release assay.
2 Frequencies of p33- Mice per Immunization specific CD8.sup.+ T
cells group Untreated 0.2 2 HBc33 0.3 .+-. 0.1 4 HBc33 + CyCpGpt
(mixed) 2.1 .+-. 0.9 5 HBc33/CyCpGpt (packaged) 4.3 .+-. 1.1 5
[0493] FIG. 52 shows the primary ex vivo cytotoxicity of groups of
C57BL/6 mice that were subcutaneously primed with 100 .mu.g p33-VLP
given alone (A), mixed with 20 nmol CyCpGpt (B), or, alternatively,
packaged with CyCpGpt (C). Nine days later spleen cells were tested
for direct ex vivo CTL activity in a 5-h .sup.51Cr-release assay on
p33-pulsed (filled symbols) or on unpulsed (open symbols) EL-4
target cells at the indicated effector to target cell ratios.
Radioactivity in cell culture supernatants was measured in a Cobra
II Counter (Canberra Packard, Downers Growe, Ill.). Spontaneous
release was always <10%. Two dilution series of effector cells
per mouse were performed. In (A) two mice per group were used,
whereas in (B) and (C) data from four mice per group are shown.
[0494] FIG. 52 clearly demonstrates that 100 .mu.g HBc33 alone did
not induce primary in vivo CTL response while the same amount HBc33
mixed with 20 nmol CyCpGpt did induce a significant cytotoxicity.
However, although the amount of packaged oligonucleotide was much
lower (about 1/20) of the amount of oligonucleotide used in the
mixed setting cytotoxicity was enhanced when 100 .mu.g HBc33 with
packaged CyCpGpt were used for immunization (FIG. 52).
EXAMPLE 25
Non-Enzymatic Hydrolysis of the RNA Content of VLPs and Packaging
of Immunostimulatory Nucleic Acids
[0495] ZnSO.sub.4 Dependent Degradation of the Nucleic Acid Content
of a VLP:
[0496] 5 mg Q.beta. VLP (as determined by Bradford analysis) in 20
mM HEPES, pH 7.4, 150 mM NaCl was dialysed either against 2000 ml
of 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl.sub.2
or 2000 ml of 4 mM HEPES, pH 7.4, 30 mM NaCl for 2 h at 4.degree.
C. in SnakeSkin.TM. pleated dialysis tubing (Pierce, Cat. No.
68035). Each of the dialysis buffers was exchanged once and
dialysis was allowed to continue for another 16 h at 4.degree. C.
The dialysed solution was clarified for 10 minutes at 14 000 rpm
(Eppendorf 5417 R, in fixed angle rotor F45-30-1 1, used in all the
following steps) and proteinconcentration was again determined by
Bradford analysis. Q.beta. VLPs in 50 mM TrisHCl pH 8.0, 50 mM
NaCl, 5% glycerol, 10 mM MgCl.sub.2 were diluted with the
corresponding buffer to a final protein concentration of 1 mg/ml
whereas Q.beta. VLPs in 4 mM HEPES pH 7.4, 30 mM NaCl were diluted
with the corresponding buffer to a final protein concentration of
0.5 mg/ml. This capsid-containing solutions were centrifuged again
for 10 minutes at 14 000 rpm at 4.degree. C. The supernatants were
than incubated with ZnSO.sub.4 which was added to a final
concentration of 2.5 mM for 24 h at 60.degree. C. in an Eppendorf
Thermomixer comfort at 550 rpm. After 24 h the solutions were
clarified for 10 minutes at 14000 rpm and the sediment was
discarded. The efficiency of the ZnSO.sub.4-dependent degradation
of nucleic acids was confirmed by agarose gelelectrophoresis (FIG.
53). The supernatants were dialysed against 5000 ml of 4 mM HEPES
pH 7.4, 30 mM NaCl for 2h at 4.degree. C. 5000 ml buffer was
exchanged once and dialysis continued over night at 4.degree. C.
The dialysed solution was clarified for 10 minutes at 14 000 rpm
and 4.degree. C., a negligible sediment was discarded and the
protein concentration of the supernatants were determined by
Bradford analysis.
[0497] Similar results were obtained with copper
chloride/phenanthroline/h- ydrogen peroxide treatment of capsids.
Those skilled in the art know alternative non-enzymatic procedures
for hydrolysis or RNA.
[0498] Packaging of Oligodeoxynucleotides into ZnSO.sub.4-Treated
VLPs:
[0499] ZnSO.sub.4-treated and dialysed Q.beta. capsids with a
protein concentration (as determined by Bradford analysis) beween
0.4 mg/ml and 0.9 mg/ml (which corresponds to a concentration of
capsids of 159 nM and 357.5 nM, respectively) were used for the
packaging of the oligodeoxynucleotides. The oligodeoxynucleotides
were added at a 300-fold molar excess to the of Q.beta.VLP capsids
and incubated for 3 h at 37.degree. C. in an Eppendorf Thermomixer
comfort at 550 rpm. After 3 h the reactions were centrifuged for 10
minutes at 14 000 rpm and 4.degree. C. The supernatants were
dialysed in Spectra/Por.RTM.CE DispoDialyzer with a MWCO 300'000
(Spectrum, Cat. No. 135 526) against 5000 ml of 20 mM HEPES pH 7.4,
150 mM NaCl for 8 h at 4.degree. C. 5000 ml buffer was exchanged
once and dialysis continued over night at 4.degree. C. The protein
concentration of the dialysed samples were determined by Bradford
analysis. Q.beta. capsids and their nucleic acid contents were
analyzed as described in Examples 11 and 13.
[0500] FIG. 53 shows the analysis of ZnSO.sub.4-treated Q.beta.
VLPs by agarose gelelectrophoresis: Q.beta. VLPs which had been
purified from E. coli and dialysed either against buffer 1 (50 mM
TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl.sub.2) or
buffer 2 (4 mM HEPES, pH 7.4, 30 mM NaCl) were incubated either
without or in the presence of 2.5 mM zinc sulfate (ZnSO.sub.4) for
24 hrs at 60.degree. C. After this treatment equal amounts of the
indicated samples (5 .mu.g protein) were mixed with loading dye and
loaded onto a 0.8% agarose gel. After the run the gel was stained
with ethidium bromide. Note that treatment of VLPs with ZnSO.sub.4
causes degradation of the nucleic acid content, while the
mock-treated controls were unaffected.
[0501] FIG. 54 shows the packaging of oligodeoxynucleotides into
ZnSO.sub.4-treated VLPs and analysis of them by agarose
gelelectrophoresis. Q.beta. VLPs which had been treated with 2.5 mM
zinc sulfate (+ZnSO.sub.4) were dialysed against 4 mM HEPES, pH
7.4, 30 mM NaCl and incubated for 3 hrs at 37.degree. C. with an
excess of oligodeoxynucleotides (due to the dialysis the
concentration of ZnSO.sub.4 was decreased by an order of 10.sup.6,
therefore its indicated only in parenthesis) After this incubation
in presence of oligodeoxynucleotides, equal amounts of the
indicated samples (5 .mu.g protein) were mixed with loading dye and
loaded onto a 0.8% agarose gel. After the run the gel was stained
with ethidium bromide. Note that adding of oligodeoxynucleotides to
ZnSO.sub.4-treated Q.beta. VLPs could restore the electrophoretical
behaviour of the so treated capsids when compared to untreated
Q.beta. capsids which had been purified from E. coli.
[0502] FIG. 55 shows the analysis of nucleic acid content of
ZnSO.sub.4- and oligodeoxynucleotide treated Q.beta. VLPs by
Benzonase and proteinase K digestion and polyacrylamide TBE/Urea
gelelectrophoresis: Oligodeoxynucleotides were packaged into
ZnSO.sub.4-treated Q.beta. VLPs as described above. 25 .mu.g of
these VLPs were digested with 25 .mu.l Benzonase (Merck, Cat. No.
1.01694.0001) according to the manufactures instructions. After
heat-inactivation of the nuclease (30 minutes at 80.degree. C.) the
VLPs were treated with Proteinase K (final enzyme concentration was
0.5 mg/ml) according to the manufactures instructions. After 3 hrs
the equivalent of 2 ug Q.beta. VLPs which had been digested by
Benzonase and proteinase K were mixed with TBE-Urea sample buffer
and loaded on a 15% polyacrylamide TBE-Urea gel (Novex.RTM.,
Invitrogen Cat. No. EC6885). The capsids loaded in lane 2 were
treated with 2.5 mM ZnSO.sub.4 in presence of buffer 1 (see above),
while the capsids loaded in lane 3 were treated with 2.5 mM
ZnSO.sub.4 in presence of buffer 2 (see above). As qualitative as
well as quantitative standard, 1 pmol, 5 pmol and 10 pmol of the
oligodeoxynucleotide which was used for the reassembly reaction,
was loaded onto the same gel (lanes 4-6). As control, Q.beta.
capsids which had been purified from E. coli were treated exactly
the same and analyzed on the same polyacrylamide TBE-Urea gel (lane
1). After the run was completed, the gel was fixed, equilibrated to
neutral pH and stained with SYBR-Gold (Molecular Probes Cat. No.
S-11494). Note that intact Q.beta. VLPs (which had been purified
from E. coli) did not contain nucleic acids of similar size than
those which had been extracted from ZnSO.sub.4- and
oligodeoxynucleotide treated Q.beta. capsids. In addition, nucleic
acids isolated from the latter VLPs were comigrating with the
oligodeoxynucleotides which had been used in the reassembly
reaction. This results confirmed that the used
oligodeoxynucleotides were packaged into ZnSO.sub.4-treated Q.beta.
capsids.
EXAMPLE 26
VLPs Containing Containing Immunostimulatory Nucleic Acids Induce T
Cell Responses That can be Boosted by Viral Vectors: LCMV
[0503] Mice were subcutaneously primed with 20 .mu.g p33-VLPs
containing immunostimulatory nucleic acids. Before immunization,
p33-VLP preparations were extensively purified from unbound
CpG-oligonucleotides via dialysis (see Example 2 and FIG. 5). 12
days later, blood was taken and frequencies of p33-specific T cells
were determined by tetramer staining. The mice were boosted with
200 pfu of live LCMV strain WE and frequencies of specific T cells
were determined 5 days later. Frequencies before boost were 3.5%
+/-1.8% and after boost 15.5% +/-1.9%.
EXAMPLE 27
VLPs Containing Immunostimulatory Nucleic Acids Induce T Cell
Responses That can be Boosted by Viral Vectors: Recombinant
Vaccinia Virus
[0504] Mice are subcutaneously primed with 20 .mu.g p33-VLPs
containing immunostimulatory nucleic acids. Before immunization,
p33-VLP preparations are extensively purified from unbound
CpG-oligonucleotides via dialysis (see Example 2 and FIG. 5). 12
days later, blood is taken and frequencies of p33-specific T cells
are determined by tetramer staining. The mice are boosted with 106
pfu of recombinant vaccina virus expressing LCMV-GP and frequencies
of specific T cells are determined 5 days later.
EXAMPLE 28
VLPs Containing Immunostimulatory Nucleic Acids Induce T Cell
Responses That Can Be Boosted by Viral Vectors: Recombinant Canary
Pox Virus
[0505] Mice are subcutaneously primed with 20 .mu.g p33-VLPs
containing immunostimulatory nucleic acids. Before immunization,
p33-VLP preparations are extensively purified from unbound
CpG-oligonucleotides via dialysis (see Example 2 and FIG. 5). 12
days later, blood is taken and frequencies of p33-specific T cells
are determined by tetramer staining. The mice are boosted with 1
pfu of recombinant canary pox virus expressing LCMV-GP and
frequencies of specific T cells are determined 5 days later.
EXAMPLE 29
VLPs Containing Containing Immunostimulatory Nucleic Acids can
Boost T Cell Responses
[0506] Mice are infected intravenously with recombinant vacccina
virus expressing LCMV-GP. 20 days later, blood is taken and
frequencies of p33-specific T cells are determined by tetramer
staining. The mice are boosted the same day with p33-VLP
preparations containing immunostimulatory nucleic acids (see
Example 2 and FIG. 5) and frequencies of specific T cells are
determined 5 days later.
EXAMPLE 30
Packaging of Immunostimulatory Ribonucleic Acids into VLPs
[0507] Immunostimulatory ribonucleic acids such as poly (I:C)
(Sigma) or synthetic double-stranded 30 mer of polyinosinic acid
and polycytidylic acid either with phosphodiester or
phosphorothiate backbone are dissolved in water. Alternatively,
polydeoxyinosinic acid and polydeoxyinosinic acid are used to
prepare a double stranded poly(I:C) analogon. HBc33 VLPs and
Q.beta. VLPs are treated with RNAse as described in Examples 11, 13
or 25 and nucleic acids are added at 1, 10 and 100 nmol/ml in
0.2.times.HBS and incubated for 3 h at 37.degree. C. in a
thermomixer. Excess nucleic acids are removed by enzymatic
hydrolysis or dialysis and analysed as described in Example 11, 13
and 25.
[0508] Alternatively, immunostimulatory ribonucleic acids and their
analoga are packaged during reassembly of Q.beta. coat proteins as
described in Examples 14, 15, 16. Reassembly is performed by adding
.beta.-mercaptoethanol to the 10 ml dimer fraction to a final
concentration of 10%, and 300 .mu.l of a solution of nucleic acid,
resulting in a 1, 10 and 100 molar excess over capsid
concentration, are added. The reassembly mixtures are first
dialyzed against 30 ml NET buffer containing 10%
beta-mercaptoethanol for 2 hours at 4.degree. C., and then dialyzed
in a continuous mode, with a flow of NET buffer of 8 ml/h over 4
days at 4.degree. C. The reassembly mixtures are then desalted
against water by dialysis, with 6 buffer exchanges (4.times.100 ml,
2.times.1 liter). Reassembled Q.beta. VLPs are then isolated by
sucrose gradient centrifugation as described in Example 14 or by
gel filtration as described in Example 16.
Sequence CWU 0
0
* * * * *