U.S. patent application number 10/293400 was filed with the patent office on 2003-05-29 for recombinant adeno-associated vector-mediated delivery of b-domain-deleted factor viii constructs for the treatment of hemophilia.
Invention is credited to Colosi, Peter C., Couto, Linda B., Qian, Xiaobing.
Application Number | 20030099618 10/293400 |
Document ID | / |
Family ID | 23868326 |
Filed Date | 2003-05-29 |
United States Patent
Application |
20030099618 |
Kind Code |
A1 |
Couto, Linda B. ; et
al. |
May 29, 2003 |
Recombinant adeno-associated vector-mediated delivery of
B-domain-deleted factor VIII constructs for the treatment of
hemophilia
Abstract
One form of a composition has two types of recombinant
adeno-associated virus. The first type encodes a portion of Factor
VIII operably linked to an expression control element; and the
second type encodes a different portion of Factor VIII operably
linked to an expression control element. The first and second
nucleotide sequences collectively encode a functional Factor VIII
protein. Another form of the composition is a recombinant
adeno-associated virus containing a nucleotide sequence encoding
functional Factor VIII light or heavy chain operably linked to a
tissue-specific promoter.
Inventors: |
Couto, Linda B.;
(Pleasanton, CA) ; Colosi, Peter C.; (Alameda,
CA) ; Qian, Xiaobing; (Alameda, CA) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET
FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Family ID: |
23868326 |
Appl. No.: |
10/293400 |
Filed: |
November 12, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10293400 |
Nov 12, 2002 |
|
|
|
10007968 |
Nov 16, 2001 |
|
|
|
10007968 |
Nov 16, 2001 |
|
|
|
09740211 |
Dec 18, 2000 |
|
|
|
09740211 |
Dec 18, 2000 |
|
|
|
09470618 |
Dec 22, 1999 |
|
|
|
6200560 |
|
|
|
|
09470618 |
Dec 22, 1999 |
|
|
|
09364862 |
Jul 30, 1999 |
|
|
|
6221349 |
|
|
|
|
60125974 |
Mar 24, 1999 |
|
|
|
60104994 |
Oct 20, 1998 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/456 |
Current CPC
Class: |
C12N 2830/85 20130101;
C12N 2799/025 20130101; C12N 2830/42 20130101; C12N 2830/008
20130101; C12N 15/86 20130101; A61K 38/37 20130101; C07K 14/755
20130101; A61K 48/00 20130101; C12N 2750/14143 20130101; A61P 7/04
20180101 |
Class at
Publication: |
424/93.2 ;
435/456 |
International
Class: |
A61K 048/00; C12N
015/861 |
Claims
What is claimed is:
1. A method of treating hemophilia in a mammal, comprising:
providing a pharmaceutical composition comprising recombinant
adeno-associated virus virions, said virions comprising a
nucleotide sequence encoding a Factor VIII protein lacking at least
a portion of the B domain, said nucleotide sequence operably linked
to expression control elements; and administering said
pharmaceutical composition to a mammal under conditions that result
in the expression of the Factor VIII protein at a level that
provides a therapeutic effect in said mammal.
2. The method of claim 9, wherein said Factor VIII protein is
expressed in the liver.
3. The method of claim 9, wherein said recombinant adeno-associated
virus virions are administered to the liver.
4. The method of claim 9, wherein said expression control elements
comprise a tissue-specific promoter.
5. The method of claim 12 wherein said expression control elements
comprise a liver-specific promoter.
6. The method of claim 9 wherein said expression control elements
comprise a human growth hormone polyadenylation sequence.
7. The method of claim 9, wherein said recombinant adeno-associated
virus virions are administered via intravenous administration.
8. The method of claim 15, wherein said intravenous administration
is via the portal vein.
9. The method of claim 9, wherein said recombinant adeno-associated
virus virions are administered via intraarterial
administration.
10. The method of claim 17, wherein said recombinant
adeno-associated virus virions are administered via the hepatic
artery.
11. The method of claim 9, wherein said nucleotide sequence
encoding Factor VIII comprises a light chain and a heavy chain and
wherein said light chain and heavy chain are operably linked by a
junction.
12. The method of claim 19, wherein said nucleotide sequence is SEQ
ID 13, such that said junction has the amino acid sequence
Ser-Phe.
13. The method of claim 19, wherein said nucleotide sequence is SEQ
ID 14, such that said junction has the amino acid sequence
Ser-Phe-Ser-Gln-Asn-Pro-Pro-Val-Leu-Lys-Arg-His-Gln-Arg.
14. The method of claim 19, wherein said expression control
elements comprise a liver-specific promoter, and wherein said
recombinant adeno-associated virus virions are administered to the
liver of said mammal.
Description
RELATED APPLICATIONS
[0001] This Application is a Continuation of U.S. application Ser.
No. 10/007,968, filed Nov. 16, 2001, now abandoned, which is a
divisional of U.S. application Ser. No. 09/740,211, filed Dec. 18,
2000, which is a continuation of U.S. application Ser. No.
09/470,618, filed Dec. 22, 1999, which is a continuation-in-part of
U.S. application Ser. No. 09/364,862, filed Jul. 30, 1999, which
claims benefit under 35 U.S.C. .sctn.119(e) of U.S. Provisional
Application Nos. 60/125,974 and 60/104,994, filed Mar. 24, 1999 and
Oct. 20, 1998, respectively. All of these prior applications are
hereby incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to AAV vectors suitable for
hemophilia gene therapy. More particularly, these AAV vectors are
suitable for delivering nucleic acids encoding Factor VIII into a
recipient subject suffering from hemophilia A, such that the
subject's blood is able to clot.
DESCRIPTION OF THE RELATED ART
[0003] Hemophilia is a genetic disease characterized by a blood
clotting deficiency. In hemophilia A (classic hemophilia, Factor
VIII deficiency), an X-chromosome-linked genetic defect disrupts
the gene encoding Factor VIII, a plasma glycoprotein, which is a
key component in the blood clotting cascade. Human Factor VIII is
synthesized as a single chain polypeptide, with a predicted
molecular weight of 265 kDa. The Factor VIII gene codes for 2351
amino acids, and the protein has six domains, designated from the
amino to the carboxy terminus as A1-A2-B-A3-C1-C2 (Wood et al.,
Nature 312:330 [1984]; Vehar et al., Nature 312:337 [1984]; and
Toole et al., Nature 312:342 [1984]). Human Factor VIII is
processed within the cell to yield a heterodimer primarily
comprised of a heavy chain of 200 kDa containing the A1, A2, and B
domains and an 80 kDa light chain containing the A3, C1, and C2
domains (Kaufman et al., J. Biol. Chem., 263:6352-6362 [1988]).
Both the single chain polypeptide and the heterodimer circulate in
the plasma as inactive precursors (Ganz et al., Eur. J. Biochem.,
170:521-528 [1988]). Activation of Factor VIII in plasma is
initiated by thrombin cleavage between the A2 and B domains, which
releases the B domain and results in a heavy chain consisting of
the A1 and A2 domains. The 980 amino acid B domain is deleted in
the activated procoagulant form of the protein. Additionally, in
the native protein, two polypeptide chains ("a" and "b"), flanking
the B domain, are bound to a divalent calcium cation. Hemophilia
may result from point mutations, deletions, or mutations resulting
in a stop codon (See, Antonarakis et al., Mol. Biol. Med., 4:81
[1987]).
[0004] The disease is relatively rare, afflicting approximately one
in 10,000 males. Hemophilia in females is extremely rare, although
it may occur in female children of an affected father and carrier
mother, as well as in females with X-chromosomal abnormalities
(e.g., Turner syndrome, X mosaicism, etc.). The severity of each
patient's disease is broadly characterized into three
groups--"mild," "moderate," and "severe," depending on the severity
of the patient's symptoms and circulating Factor VIII levels. While
normal levels of Factor VIII range between 50 and 200 ng/mL plasma,
mildly affected patients have 6-60% of this value, and moderately
affected patients have 1-5% of this value. Severely affected
hemophiliacs have less than 1% of normal Factor VIII levels.
[0005] While hemophiliacs clearly require clotting factor after
surgery or severe trauma, on a daily basis, spontaneous internal
bleeding is a greater concern. Hemophiliacs experience spontaneous
hemorrhages from early infancy, as well as frequent spontaneous
hemarthroses and other hemorrhages requiring clotting factor
replacement. Without effective treatment, chronic hemophilic
arthropathy occurs by young adulthood. Severely affected patients
are prone to serious hemorrhages that may dissect through tissue
planes, ultimately resulting in death due to compromised vital
organs.
[0006] Hematomas are commonly observed in moderately and severely
affected hemophiliacs. In these patients, hematomas have a tendency
to progressively enlarge and dissect in all directions. Some of
these hematomas expand locally, resulting in local compression of
adjacent organs, blood vessels, and nerves. A rare, yet often
fatal, complication of abdominal hematomas is the perforation and
drainage of the hematoma into the colon, resulting in infection and
septicemia. Intracranial and/or extracranial hemorrhage also
represent very dangerous bleeding situations. While subcutaneous
hematomas may dissect into muscle, pharyngeal and retropharyngeal
hematomas (e.g., complicating bacterial or viral pharyngitis) may
enlarge and obstruct the airway, sometimes resulting in a
life-threatening situation that requires administration of a
sufficient dose of Factor VIII concentrate to normalize the Factor
VIII level.
[0007] In addition to hematomas, hemarthroses are commonly observed
in hemophiliacs, with bleeding into the joint accounting for
approximately 75% of hemophilic bleeding. Repeated hemorrhaging
into the joints eventually results in extensive destruction of
articular cartilage, synovial hyperplasia, and other reactive
changes in adjacent tissues and bone. A major complication of
repeated hemarthroses is joint deformity, which is often
accompanied by muscle atrophy and soft tissue contractures;
osteoporosis and cystic areas in the subchondral bone may also
develop, along with progressive loss of joint space.
[0008] Other symptoms are often observed in hemophiliacs, including
hematuria and mucous membrane bleeding. Hematuria is experienced by
virtually all severely affected hemophiliacs sometime during their
lifetimes, and mucous membrane bleeding is common in hemophiliacs.
Bone cysts (pseudotumors) are rare, but dangerous complications of
hemophilic bleeding. In many of these cases, immediate treatment is
necessary.
[0009] In the early 1980s, many severely affected hemophiliacs were
treated with Factor VIII concentrate about three times weekly.
Unfortunately, these concentrates transmitted viruses, such as
hepatitis B and/or C, and human immunodeficiency virus (HIV). In
the United States and Western Europe, at least 75% of Factor VIII
concentrate recipients have been reported to have anti-HIV
antibodies (See, Schrier and Leung, supra). Some of these patients
also developed HIV-associated immune thrombocytopenia, a very
serious complication in hemophiliacs. In spite of antiviral therapy
(e.g., with zidovudine and pentamidine prophylaxis), which has
tended to slow disease progression, full-blown AIDS (acquired
immunodeficiency syndrome) occurs at an inexorable rate in
hemophiliacs infected with HIV. Indeed, this has reversed the
improvement in the life expectancy of hemophiliacs, which peaked at
66 years of age during the 1970s, and has dropped to 49 years (See,
Schrier and Leung, supra). The development of virus-free
preparations and recombinant Factor VIII has helped control
infectious viral contamination.
[0010] However, for hemophiliacs, the availability of viral-free
concentrates and recombinant Factor VIII, while significant, is but
part of the solution. In order to prevent spontaneous internal
bleeding episodes, patients suffering from hemophilia A must
consistently have serum Factor VIII levels of about 1%, and
preferably 5%. Currently, the cost of viral-free concentrates and
recombinant Factor VIII make it prohibitively expensive to
administer the clotting factor prophylactically or on a maintenance
basis. Indeed, most hemophiliacs in the U.S. do not receive
recombinant Factor VIII therapy on a maintenance basis, but only
receive it prior to activities or events which might cause bleeding
(e.g., surgery), or as a treatment for spontaneous bleeding.
[0011] Moreover, even if cost effective preparations of recombinant
or virus-free Factor VIII were available, a steady state level of
Factor VIII cannot be achieved by its daily administration. At
best, patients receive widely varying levels of Factor VIII.
Immediately following the administration, the levels are
super-physiological, while prior to administration the levels are
sub-physiological. Thus, there remains a need for methods and
compositions that are relatively economic, yet effective in the
treatment and prevention of bleeding in hemophiliacs, particularly
spontaneous bleeds. Furthermore, there is a need in the art for
methods and compositions for long term delivery of clotting factors
(e.g., Factor VIII) which more closely mimic the steady state
physiological levels observed in normal individuals.
SUMMARY OF THE INVENTION
[0012] The present invention provides improved viral vectors
suitable for gene therapy to treat hemophilia. In particular, the
present invention provides AAV vectors and methods for treating
hemophilia A by delivering nucleic acids coding for the clotting
protein Factor VIII. The present invention also provides
pharmaceutical compositions comprising such AAV vectors, as well as
methods for making and using the vectors.
[0013] The present invention is particularly suited for use in
hemophilia A gene therapy. Accordingly, in one embodiment of the
invention, at least one AAV vector containing a nucleic acid
molecule encoding Factor VIII is operably linked to control
sequences that direct expression of Factor VIII in a suitable
recipient cell. The AAV vectors are then introduced into a
recipient cell of the subject, under conditions that result in
expression of Factor VIII. The subject, therefore, has a continuous
supply of Factor VIII available to clot blood during bleeding
episodes.
[0014] Using the methods of the present invention, long term
expression of therapeutic levels of Factor VIII have been achieved
in vivo. In one embodiment, animals were administered, via the
portal vein, two AAV vectors: one carrying the DNA sequence coding
for the heavy chain of Factor VIII and the other carrying the DNA
sequence coding for the light chain of Factor VIII. Blood samples
were collected periodically and assayed for Factor VIII activity.
Reproducibly, animals expressed between 600 and 900 ng/ml of
biologically active Factor VIII, levels that are well above the
normal physiological levels of approximately 200 ng/ml.
Furthermore, these levels have been sustained for over 13 months
without a decrease in Factor VIII levels or activity. In a related
embodiment, a B-domain deleted form of Factor VIII was cloned into
a single AAV vector and shown to express biologically active Factor
VIII.
[0015] It is not intended, however, that the present invention be
limited to specific embodiments. Many different forms of
recombinant Factor VIII have been made and tested both in vitro and
in vivo, using a variety of different control and regulatory
sequences. Any DNA sequence coding for biologically active Factor
VIII can be expressed using the AAV vectors and methods taught in
the present invention. Therefore, the present invention encompasses
any AAV vector or vectors containing Factor VIII sequences that
produce biologically active Factor VIII protein in vitro or in
vivo.
[0016] For example, in some embodiments, the AAV vector contains
the first 57 base pairs of the Factor VIII heavy chain which
encodes the 10 amino acid signal sequence, as well as the human
growth hormone (hGH) polyadenylation sequence. In some alternative
embodiments, the vector also contains the A1 and A2 domains, as
well as 5 amino acids from the N-terminus of the B domain, and/or
85 amino acids of the C-terminus of the B domain, as well as the
A3, C1, and C2 domains. In yet other embodiments, the nucleic acids
coding for Factor VIII heavy chain and light chain were cloned into
a single vector separated by 42 nucleic acids coding for 14 amino
acids of the B domain.
[0017] The present invention also provides methods for
administering the above-described vectors. For example, it is
intended that the present invention encompass methods suitable for
delivery of the AAV vectors to the livers of recipient patients or
test animals. It is not intended that the present invention be
limited to any particular route of administration. However, in
preferred embodiments, the AAV vectors of the present invention are
successfully administered via the portal or arterial
vasculature.
[0018] These and other embodiments of the invention will readily
occur to those of ordinary skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 provides a schematic representation of the Factor
VIII protein.
[0020] FIG. 2 provides a schematic representation of a B-domain
deleted form of Factor VIII protein.
[0021] FIG. 3 provides a schematic representation of a B-domain
deleted Factor VIII AAV construct (AAV-F8-1) from internal terminal
repeat (ITR to ITR), including control sequences.
[0022] FIG. 4 provides a schematic representation of a B-domain
deleted Factor VIII AAV construct (PVM4.1c-F8AB) from internal
terminal repeat (ITR to ITR), including control sequences.
[0023] FIG. 5 provides the sequence of pAAV-F8-1 (ITR to ITR), with
the plasmid backbone omitted.
[0024] FIG. 6 provides the sequence of pVm4.1cF8.DELTA.B (ITR to
ITR), with the plasmid backbone omitted.
[0025] FIG. 7 provides a map of rAAV-hFVIII-HC and rAAV-hFVIII-LC
vectors.
[0026] FIG. 8 provides a graph demonstrating the expression of
various human FVIII constructs in mouse plasma.
[0027] FIG. 9 provides Southern blot analyses of liver DNA using
probes specific for (A) the light chain of hFVIII, and (B) the
heavy chain of hFVIII.
[0028] FIG. 10 provides Southern blot analyses of DNA from
different tissues using probes specific for (A) the light chain of
hFVIII, and (B) the heavy chain of hFVIII.
[0029] FIG. 11 provides Northern blot analyses of liver RNA using
probes specific for (A) the light chain of hFVIII, and (B) the
heavy chain of hFVIII.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0030] The present invention relates to improved viral vectors
useful for expressing gene products at high levels in human cells.
In particular, the present invention provides AAV vectors suitable
for gene therapy. These vectors are capable of delivering nucleic
acid containing constructs which result in the production of Factor
VIII protein in a host. The present invention also provides
pharmaceutical compositions comprising such AAV vectors, as well as
methods for making and using the constructs.
[0031] The AAV vectors and rAAV virions of the present invention
can be produced using standard methodology known to those of skill
in the art. The methods generally involve the steps of: (1)
introducing an AAV vector into a host cell; (2) introducing an AAV
helper construct into the host cell, where the helper construct
includes AAV coding regions capable of being expressed in the host
cell to complement AAV helper functions missing from the AAV
vector; (3) introducing one or more helper viruses and/or accessory
function vectors into the host cell, wherein the helper virus
and/or accessory function vectors provide accessory functions
capable of supporting efficient recombinant AAV ("rAAV") virion
production in the host cell; and (4) culturing the host cell to
produce rAAV virions. The AAV vector, AAV helper construct and the
helper virus or accessory function vector(s) can be introduced into
the host cell either simultaneously or serially, using standard
transfection techniques.
[0032] Unless otherwise indicated, the practice of the present
invention employs conventional methods of virology, microbiology,
molecular biology and recombinant DNA techniques within the skill
of the art, including those described in such references as
Sambrook et al. (eds.) Molecular Cloning: A Laboratory Manual;
Glover (ed.) DNA Cloning: A Practical Approach, Vols. I and II;
Gait (ed.) Oligonucleotide Synthesis; Hames and Higgins (eds.)
Nucleic Acid Hybridization; Hames and Higgins (eds.) Transcription
and Translation; Tijessen (ed.) CRC Handbook of Parvoviruses, Vols.
I and II; and Fields and Knipe (eds.) Fundamental Virology, 2nd
Edition, Vols. I and II.
Definitions
[0033] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0034] As used herein, the terms "gene transfer" and "gene
delivery" refer to methods or systems for reliably inserting a
particular nucleotide sequence (e.g., DNA) into targeted cells. In
particularly preferred embodiments, the nucleotide sequence
comprises at least a portion of Factor VIII.
[0035] As used herein, the terms "vector," and "gene transfer
vector" refer to any genetic element, such as a plasmid, phage,
transposon, cosmid, chromosome, virus, virion, etc., which is
capable of replication when associated with the proper control
sequences and/or which can transfer nucleic acid sequences between
cells. Thus, the term includes cloning and expression vectors, as
well as viral vectors.
[0036] Gene transfer vectors may include transcription sequences
such as polyadenylation sites, selectable markers or reporter
genes, enhancer sequences, and other control sequences which allow
for the induction of transcription. Such control sequences are
described more fully below.
[0037] The term "expression vector" as used herein refers to a
recombinant DNA molecule containing a desired coding sequence and
appropriate nucleic acid sequences necessary for the expression of
the operably linked coding sequence in a particular host organism.
Nucleic acid sequences necessary for expression in prokaryotes
usually include a promoter, an operator (optional), and a ribosome
binding site, as well as other sequences. Eukaryotic cells are
generally known to utilize promoters (constitutive, inducible or
tissue specific), enhancers, and termination and polyadenylation
signals, although some elements may be deleted and other elements
added without sacrificing the necessary expression.
[0038] As used herein, the terms "host" and "expression host" refer
to organisms and/or cells which harbor an exogenous DNA sequence
(e.g., via transfection), an expression vector or vehicle, as well
as organisms and/or cells that are suitable for use in expressing a
recombinant gene or protein. It is not intended that the present
invention be limited to any particular type of cell or organism.
Indeed, it is contemplated that any suitable organism and/or cell
will find use in the present invention as a host.
[0039] As used herein, the terms "viral replicons" and "viral
origins of replication" refer to viral DNA sequences that allow for
the extrachromosomal replication of a vector in a host cell
expressing the appropriate replication factors. In some
embodiments, vectors which contain either the SV40 or polyoma virus
origin of replication replicate to high copy number, while vectors
which contain the replicons from bovine papillomavirus or
Epstein-Barr virus replicate extrachromosomally at low copy number
may be utilized in other embodiments.
[0040] As used herein, the term "AAV vector" refers to a vector
having functional or partly functional ITR sequences. The ITR
sequences may be derived from an adeno-associated virus serotype,
including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5,
AAV-X7, etc. The ITRs, however, need not be the wild-type
nucleotide sequences, and may be altered (e.g., by the insertion,
deletion or substitution of nucleotides), so long as the sequences
retain function provide for functional rescue, replication and
packaging. AAV vectors can have one or more of the AAV wild-type
genes deleted in whole or part, preferably the rep and/or cap genes
but retain functional flanking ITR sequences. Functional ITR
sequences are necessary for the rescue, replication and packaging
of the AAV virion. Thus, an "AAV vector" is defined herein to
include at least those sequences required in cis for replication
and packaging (e.g., functional ITRs) of the virus.
[0041] As used herein, the term "ITR" refers to inverted terminal
repeats. The terms "adeno-associated virus inverted terminal
repeats" or "AAV ITRs" refer to the art-recognized palindromic
regions found at each end of the AAV genome which function together
in cis as origins of DNA replication and as packaging signals for
the virus. For use in some embodiments of the present invention,
flanking AAV ITRs are positioned 5' and 3' of one or more selected
heterologous nucleotide sequences. Optionally, the ITRs together
with the rep coding region or the Rep expression product provide
for the integration of the selected sequences into the genome of a
target cell.
[0042] As used herein, the term "AAV rep coding region" refers to
the art-recognized region of the AAV genome which encodes the
replication proteins Rep 78, Rep 68, Rep 52 and Rep 40. These Rep
expression products have been shown to possess many functions,
including recognition, binding and nicking of the AAV origin of DNA
replication, DNA helicase activity and modulation of transcription
from AAV (or other heterologous) promoters. The Rep expression
products are collectively required for replicating the AAV genome.
Muzyczka (Muzyczka, Curr. Top. Microbiol. Immunol., 158:97-129
[1992]) and Kotin (Kotin, Hum. Gene Ther., 5:793-801 [1994])
provide additional descriptions of the AAV rep coding region, as
well as the cap coding region described below. Suitable homologues
of the AAV rep coding region include the human herpesvirus 6
(HHV-6) rep gene which is also known to mediate AAV-2 DNA
replication (Thomson et al., Virol., 204:304-311 [1994]).
[0043] As used herein, the term "AAV cap coding region" refers to
the art-recognized region of the AAV genome which encodes the
capsid proteins VP1, VP2, and VP3, or functional homologues
thereof. These cap expression products supply the packaging
functions which are collectively required for packaging the viral
genome.
[0044] As used herein, the term "AAV helper function" refers to AAV
coding regions capable of being expressed in the host cell to
complement AAV viral functions missing from the AAV vector.
Typically, the AAV helper functions include the AAV rep coding
region and the AAV cap coding region. An "AAV helper construct" is
a vector containing AAV coding regions required to complement AAV
viral functions missing from the AAV vector (e.g., the AAV rep
coding region and the AAV cap coding region).
[0045] As used herein, the terms "accessory functions" and
"accessory factors" refer to functions and factors that are
required by AAV for replication, but are not provided by the AAV
virion (or rAAV virion) itself. Thus, these accessory functions and
factors must be provided by the host cell, a virus (e.g.,
adenovirus or herpes simplex virus), or another expression vector
that is co-expressed in the same cell. Generally, the E1, E2A, E4
and VA coding regions of adenovirus are used to supply the
necessary accessory function required for AAV replication and
packaging (Matsushita et al., Gene Therapy 5:938 [1998]).
[0046] As used herein, the term "wild type" ("wt") refers to a gene
or gene product which has the characteristics of that gene or gene
product when isolated from a naturally occurring source. A
wild-type gene is that which is most frequently observed in a
population and is thus arbitrarily designed the "normal" or
"wild-type" form of the gene. In contrast, the term "modified" or
"mutant" refers to a gene or gene product which displays
modifications in sequence and or functional properties (i.e.,
altered characteristics) when compared to the wild-type gene or
gene product. It is noted that naturally-occurring mutants can be
isolated; these are identified by the fact that they have altered
characteristics when compared to the wild-type gene or gene
product.
[0047] As used herein, the term "AAV virion" refers to a complete
virus particle, such as a "wild-type" (wt) AAV virus particle
(comprising a linear, single-stranded AAV nucleic acid genome
associated with an AAV capsid protein coat). In this regard,
single-stranded AAV nucleic acid molecules of either complementary
sense (e.g., "sense" or "antisense" strands), can be packaged into
any one AAV virion and both strands are equally infectious.
[0048] As used herein, the terms "recombinant AAV virion," and
"rAAV virion" refer to an infectious viral particle containing a
heterologous DNA molecule of interest (e.g., Factor VIII sequence)
which is flanked on both sides by AAV ITRs. In some embodiments of
the present invention, an rAAV virion is produced in a suitable
host cell which contains an AAV vector, AAV helper functions and
accessory functions introduced therein. In this manner, the host
cell is rendered capable of encoding AAV polypeptides that are
required for packaging the AAV vector containing a recombinant
nucleotide sequence of interest, such as at least a portion of
Factor VIII or portions of Factor VIII domains, into recombinant
virion particles for subsequent gene delivery.
[0049] As used herein, the term "transfection" refers to the uptake
of foreign DNA by a cell, and a cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are generally known in the art
(See e.g., Graham et al., Virol., 52:456 [1973]; Sambrook et al.,
Molecular Cloning, a Laboratory Manual, Cold Spring Harbor
Laboratories, New York [1989]; Davis et al., Basic Methods in
Molecular Biology, Elsevier, [1986]; and Chu et al., Gene 13:197
[1981]. Such techniques can be used to introduce one or more
exogenous DNA moieties, such as a gene transfer vector and other
nucleic acid molecules, into suitable recipient cells.
[0050] As used herein, the terms "stable transfection" and "stably
transfected" refers to the introduction and integration of foreign
DNA into the genome of the transfected cell. The term "stable
transfectant" refers to a cell which has stably integrated foreign
DNA into the genomic DNA.
[0051] As used herein, the term "transient transfection" or
"transiently transfected" refers to the introduction of foreign DNA
into a cell where the foreign DNA fails to integrate into the
genome of the transfected cell. The foreign DNA persists in the
nucleus of the transfected cell for several days. During this time
the foreign DNA is subject to the regulatory controls that govern
the expression of endogenous genes in the chromosomes. The term
"transient transfectant" refers to cells which have taken up
foreign DNA but have failed to integrate this DNA.
[0052] As used herein, the term "transduction" denotes the delivery
of a DNA molecule to a recipient cell either in vivo or in vitro,
via a replication-defective viral vector, such as via a recombinant
AAV virion.
[0053] As used herein, the term "recipient cell" refers to a cell
which has been transfected or transduced, or is capable of being
transfected or transduced, by a nucleic acid construct or vector
bearing a selected nucleotide sequence of interest (i.e., Factor
VIII). The term includes the progeny of the parent cell, whether or
not the progeny are identical in morphology or in genetic make-up
to the original parent, so long as the selected nucleotide sequence
is present.
[0054] The term "heterologous" as it relates to nucleic acid
sequences such as coding sequences and control sequences, denotes
sequences that are not normally joined together, and/or are not
normally associated with a particular cell. Thus, a "heterologous"
region of a nucleic acid construct or a vector is a segment of
nucleic acid within or attached to another nucleic acid molecule
that is not found in association with the other molecule in nature.
For example, a heterologous region of a nucleic acid construct
could include a coding sequence flanked by sequences not found in
association with the coding sequence in nature. Another example of
a heterologous coding sequence is a construct where the coding
sequence itself is not found in nature (e.g., synthetic sequences
having codons different from the native gene). Similarly, a cell
transfected with a construct which is not normally present in the
cell would be considered heterologous for purposes of this
invention. Allelic variation or naturally occurring mutational
events do not give rise to heterologous DNA, as used herein.
[0055] As used herein, "coding sequence" or a sequence which
"encodes" a particular antigen, is a nucleic acid sequence which is
transcribed (in the case of DNA) and translated (in the case of
mRNA) into a polypeptide in vitro or in vivo, when placed under the
control of appropriate regulatory sequences. The boundaries of the
coding sequence are determined by a start codon at the 5' (amino)
terminus and a translation stop codon at the 3' (carboxy) terminus.
A coding sequence can include, but is not limited to, cDNA from
prokaryotic or eukaryotic mRNA, genomic DNA sequences from
prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A
transcription termination sequence will usually be located 3' to
the coding sequence.
[0056] As used herein, the term "nucleic acid" sequence refers to a
DNA or RNA sequence. The term captures sequences that include any
of the known base analogues of DNA and RNA such as, but not limited
to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine,
aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxymethylaminomethyluracil, dihydrouracil, inosine,
N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiour- acil,
beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0057] As used herein, the term "recombinant DNA molecule" as used
herein refers to a DNA molecule which is comprised of segments of
DNA joined together by means of molecular biological
techniques.
[0058] As used herein, the term "regulatory element" refers to a
genetic element which controls some aspect of the expression of
nucleic acid sequences. For example, a promoter is a regulatory
element which facilitates the initiation of transcription of an
operably linked coding region. Other regulatory elements are
splicing signals, polyadenylation signals, termination signals,
etc. (defined infra).
[0059] The term DNA "control sequences" refers collectively to
regulatory elements such as promoter sequences, polyadenylation
signals, transcription termination sequences, upstream regulatory
domains, origins of replication, internal ribosome entry sites
("IRES"), enhancers, and the like, which collectively provide for
the replication, transcription and translation of a coding sequence
in a recipient cell. Not all of these control sequences need always
be present so long as the selected coding sequence is capable of
being replicated, transcribed and translated in an appropriate
recipient cell.
[0060] Transcriptional control signals in eukaryotes generally
comprise "promoter" and "enhancer" elements. Promoters and
enhancers consist of short arrays of DNA sequences that interact
specifically with cellular proteins involved in transcription
(Maniatis et al., Science 236:1237 [1987]). Promoter and enhancer
elements have been isolated from a variety of eukaryotic sources
including genes in yeast, insect and mammalian cells and viruses
(analogous control sequences, i.e., promoters, are also found in
prokaryotes). The selection of a particular promoter and enhancer
depends on what cell type is to be used to express the protein of
interest (i.e., Factor VIII). Some eukaryotic promoters and
enhancers have a broad host range while others are functional in a
limited subset of cell types (See e.g., Voss et al., Trends
Biochem. Sci., 11:287 [1986]; and Maniatis et al., supra, for
reviews). For example, the SV40 early gene enhancer is very active
in a wide variety of cell types from many mammalian species and has
been widely used for the expression of proteins in mammalian cells
(Dijkema et al., EMBO J. 4:761 [1985]). Two other examples of
promoter and enhancer elements active in a broad range of mammalian
cell types are those from the human elongation factor 1a gene
(Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; Kim et al., Gene
91:217 [1990]; and Mizushima and Nagata, Nucl. Acids. Res., 18:5322
[1990]) and the long terminal repeats of the Rous sarcoma virus
(Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777 [1982]) and the
human cytomegalovirus (Boshart et al., Cell 41:521 [1985]).
Promoters and enhances can be found naturally alone or together.
For example, the long terminal repeats of retroviruses contain both
promoter and enhancer functions Moreover, generally promoters and
enhances act independently of the gene being transcribed or
translated. Thus, the enhancer and promoter may be "endogenous" or
"exogenous" or "heterologous." An "endogenous" enhancer/promoter is
one which is naturally linked with a given gene in the genome. An
"exogenous" or "heterologous" enhancer and promoter is one which is
placed in juxtaposition to a gene by means of genetic manipulation
(i.e., molecular biological techniques) such that transcription of
that gene is directed by the linked enhancer/promoter.
[0061] As used herein, the term "tissue specific" refers to
regulatory elements or control sequences, such as a promoter,
enhancers, etc., wherein the expression of the nucleic acid
sequence is substantially greater in a specific cell type(s) or
tissue(s). In particularly preferred embodiments, the albumin
promoter and the transthyretin promoter display increased
expression of FVIII in hepatocytes, as compared to other cell
types. It is not intended, however, that the present invention be
limited to the albumin or transthyretin promoters or to
hepatic-specific expression, as other tissue specific regulatory
elements, or regulatory elements that display altered gene
expression patterns, are contemplated.
[0062] The presence of "splicing signals" on an expression vector
often results in higher levels of expression of the recombinant
transcript. Splicing signals mediate the removal of introns from
the primary RNA transcript and consist of a splice donor and
acceptor site (Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York
[1989], pp. 16.7-16.8). A commonly used splice donor and acceptor
site is the splice junction from the 16S RNA of SV40.
[0063] Efficient expression of recombinant DNA sequences in
eukaryotic cells requires expression of signals directing the
efficient termination and polyadenylation of the resulting
transcript. Transcription termination signals are generally found
downstream of the polyadenylation signal and are a few hundred
nucleotides in length. The term "poly A site" or "poly A sequence"
as used herein denotes a DNA sequence which directs both the
termination and polyadenylation of the nascent RNA transcript.
Efficient polyadenylation of the recombinant transcript is
desirable as transcripts lacking a poly A tail are unstable and are
rapidly degraded. The poly A signal utilized in an expression
vector may be "heterologous" or "endogenous." An endogenous poly A
signal is one that is found naturally at the 3' end of the coding
region of a given gene in the genome. A heterologous poly A signal
is one which is one which is isolated from one gene and placed 3'
of another gene. A commonly used heterologous poly A signal is the
SV40 poly A signal. The SV40 poly A signal is contained on a 237 bp
BamHI/BclI restriction fragment and directs both termination and
polyadenylation (Sambrook et al., supra, at 16.6-16.7).
[0064] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control sequences operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control sequences need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0065] term "isolated" when used in relation to a nucleic acid, as
in "an isolated oligonucleotide" or "isolated polynucleotide"
refers to a nucleic acid sequence that is identified and separated
from at least one contaminant nucleic acid with which it is
ordinarily associated in its natural source. Isolated nucleic acid
is such present in a form or setting that is different from that in
which it is found in nature. In contrast, non-isolated nucleic
acids are nucleic acids such as DNA and RNA found in the state they
exist in nature. For example, a given DNA sequence (e.g., a gene)
is found on the host cell chromosome in proximity to neighboring
genes; RNA sequences, such as a specific mRNA sequence encoding a
specific protein, are found in the cell as a mixture with numerous
other mRNAs which encode a multitude of proteins. The isolated
nucleic acid, oligonucleotide, or polynucleotide may be present in
single-stranded or double-stranded form. When an isolated nucleic
acid, oligonucleotide or polynucleotide is to be utilized to
express a protein, the oligonucleotide or polynucleotide will
contain at a minimum the sense or coding strand (i.e., the
oligonucleotide or polynucleotide may single-stranded), but may
contain both the sense and anti-sense strands (i.e., the
oligonucleotide or polynucleotide may be double-stranded).
[0066] As used herein, the term "purified" or "to purify" refers to
the removal of contaminants from a sample. For example, antibodies
may be purified by removal of contaminating non-immunoglobulin
proteins; they may also purified by the removal of immunoglobulin
that does not bind the antigen of interest (e.g., at least a
portion of Factor VIII). The removal of non-immunoglobulin proteins
and/or the removal of immunoglobulins that do not bind the antigen
of interest (e.g., at least a portion of Factor VIII) results in an
increase in the percent of desired antigen-reactive immunoglobulins
in the sample. In another example, recombinant polypeptides of
Factor VIII are expressed in bacterial host cells and the
polypeptides are purified by the removal of host cell proteins; the
percent of recombinant polypeptides is thereby increased in the
sample.
[0067] As used herein, the term "chimeric protein" refers to two or
more coding sequences obtained from different genes, that have been
cloned together and that, after translation, act as a single
polypeptide sequence. Chimeric proteins are also referred to as
"hybrid proteins." As used herein, the term "chimeric protein"
refers to coding sequences that are obtained from different species
of organisms, as well as coding sequences that are obtained from
the same species of organisms.
[0068] A "composition comprising a given polynucleotide sequence"
as used herein refers broadly to any composition containing the
given polynucleotide sequence. The composition may comprise an
aqueous solution.
[0069] As used herein, the term "at risk" is used in references to
individuals who are at risk for experiencing hemorrhagic episodes.
In particularly preferred embodiments, the individuals are
hemophiliacs with mild, moderate, or severe hemophilia.
[0070] As used herein, the term "subject" refers to any animal
(i.e., vertebrates and invertebrates), while the term "vertebrate
subject" refers to any member of the subphylum Chordata. It is
intended that the term encompass any member of this subphylum,
including, but not limited to humans and other primates, rodents
(e.g., mice, rats, and guinea pigs), lagamorphs (e.g., rabbits),
bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g.,
goats), porcines (e.g., swine), equines (e.g., horses), canines
(e.g., dogs), felines (e.g., cats), domestic fowl (e.g., chickens,
turkeys, ducks, geese, other gallinaceous birds, etc.), as well as
feral or wild animals, including, but not limited to, such animals
as ungulates (e.g., deer), bear, fish, lagamorphs, rodents, birds,
etc. It is not intended that the term be limited to a particular
age or sex. Thus, adult and newborn subjects, as well as fetuses,
whether male or female, are encompassed by the term.
[0071] As defined herein, a "therapeutically effective amount" or
"therapeutic effective dose" is an amount or dose of AAV vector or
virions capable of producing sufficient amounts of Factor VIII to
decrease the time it takes for a subject's blood to clot.
Generally, severe hemophiliacs having less than 1% of normal levels
of FVIII have a whole blood clotting time of greater than 60
minutes as compared to approximately 10 minutes for
non-hemophiliacs.
[0072] The present invention relates to AAV vectors suitable for
hemophilia A gene therapy. More particularly, these AAV vectors are
suitable for delivering nucleic acids encoding Factor VIII into a
recipient host suspected of suffering from a blood clotting
disorder. Using the nucleic acid as a template, the host produces
Factor VIII, such that the subject's blood is able to clot. The
present invention also provides pharmaceutical compositions
comprising such AAV vectors, as well as methods for making and
using the constructs.
[0073] I. AAV Vectors
[0074] Adeno-associated virus (AAV) is a non-pathogenic,
replication-defective, helper-dependent parvovirus (or
"dependovirus" or "adeno-satellite virus"). There are at least six
recognized serotypes, designated as AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV-X7, etc. Culture and serologic evidence indicates that
human infection occurs with AAV-2 and AAV-3. Although 85% of the
human population is seropositive for AAV-2, the virus has never
been associated with disease in humans. Recombinant AAV (rAAV)
virions are of interest as vectors for gene therapy because of
their broad host range, excellent safety profile, and duration of
transgene expression in infected hosts. One remarkable feature of
recombinant AAV (rAAV) virions is the prolonged expression achieved
after in vivo administration.
[0075] AAV vectors of the present invention may be constructed
using known techniques to provide, as operatively linked components
in the direction of transcription, (a) control sequences including
a transcriptional initiation and termination regions, and (b) a
nucleotide sequence encoding at least a portion of Factor VIII. The
control sequences are selected to be functional in a targeted
recipient cell. The resulting construct which contains the
operatively linked components is bounded (5' and 3') with
functional AAV ITR sequences.
[0076] The nucleotide sequences of AAV ITR regions are known (See
e.g., Kotin, Hum. Gene Ther., 5:793-801 [1994]; Berns,
"Parvoviridae and Their Replication" in Fields and Knipe (eds),
Fundamental Virology, 2nd Edition, for the AAV-2 sequence). AAV
ITRs used in the vectors of the invention need not have a wild-type
nucleotide sequence, and may be altered (e.g., by the insertion,
deletion or substitution of nucleotides). Additionally, AAV ITRs
may be derived from any of several AAV serotypes, including without
limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
Furthermore, 5' and 3' ITRs which flank a selected nucleotide
sequence in an AAV vector need not necessarily be identical or
derived from the same AAV serotype or isolate, so long as they
function as intended.
[0077] A. Control Sequences
[0078] In some embodiments of the present invention, heterologous
control sequences are employed with the vectors. Useful
heterologous control sequences generally include those derived from
sequences encoding mammalian or viral genes. Examples include, but
are not limited to, the SV40 early promoter, mouse mammary tumor
virus LTR promoter, adenovirus major late promoter (Ad MLP), a
herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV)
promoter such as the CMV immediate early promoter region (CMVIE), a
rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid
promoters, and the like. In addition, sequences derived from
nonviral genes, such as the murine metallothionein gene, also find
use herein. Such promoter sequences are commercially available
(e.g., from Stratagene).
[0079] It is contemplated that in some embodiments, tissue-specific
expression may be desirable (e.g., expression of biologically
active Factor VIII by hepatocytes). It is not intended that the
present invention be limited to expression of biologically active
Factor VIII by any particular cells or cell types. However, as
hepatocytes (i.e., liver cells) are the cells that normally
synthesized Factor VIII (See, Kaufman, Ann. Rev. Med., 43:325
[1992]), it is contemplated that in some particularly preferred
embodiments, the compositions of the present invention be
administered to the liver.
[0080] In preferred embodiments, expression is achieved by coupling
the coding sequence for Factor VIII with heterologous control
sequences derived from genes that are specifically transcribed by a
selected tissue type. A number of tissue-specific promoters have
been described above which enable directed expression in selected
tissue types. However, control sequences used in the present AAV
vectors can also comprise control sequences normally associated
with the selected nucleic acid sequences.
[0081] B. Construction of AAV Factor VIII Vectors
[0082] AAV vectors that contain a control sequence and a nucleotide
sequence of interest (i.e., at least a portion of the sequence
encoding Factor VIII), bounded by AAV ITRs (i.e., AAV vectors), can
be constructed by directly inserting selected sequences into an AAV
genome with the major AAV open reading frames ("ORFs") excised.
Other portions of the AAV genome can also be deleted, so long as a
sufficient portion of the ITRs remain to allow for replication and
packaging functions. These constructs can be designed using
techniques well known in the art (See e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941, all of which are herein incorporated by
reference); International Publication Nos. WO 92/01070 and WO
93/03769; Lebkowski et al., Mol. Cell. Biol., 8:3988-3996 [1988];
Vincent et al., Vaccines 90 [Cold Spring Harbor Laboratory Press,
1990]; Carter, Curr. Opin. Biotechnol., 3:533-539 [1992]; Muzyczka,
Curr. Top. Microbiol. Immunol., 158:97-129 [1992]; Kotin, Hum. Gene
Ther., 5:793-801 [1994]; Shelling and Smith, Gene Ther., 1:165-169
[1994]; and Zhou et al., J. Exp. Med., 179:1867-1875 [1994]).
[0083] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al., supra. For example, ligations can be accomplished
in 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 33 .mu.g/ml
BSA, 10 mM-50 mM NaCl, and either 40 .mu.M ATP, 0.01-0.02 (Weiss)
units T4 DNA ligase at 0.degree. C. (for "sticky end" ligation) or
1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for
"blunt end" ligation). Intermolecular "sticky end" ligations are
usually performed at 30-100 .mu.g/ml total DNA concentrations
(5-100 nM total end concentration). AAV vectors which contain ITRs
have been described in (e.g., U.S. Pat. No. 5,139,941, herein
incorporated by reference). In particular, several AAV vectors are
described therein which are available from the American Type
Culture Collection ("ATCC") under Accession Numbers 53222, 53223,
53224, 53225 and 53226.
[0084] Additionally, chimeric genes can be produced synthetically
to include AAV ITR sequences arranged 5' and 3' of a selected
nucleic acid sequence. The complete chimeric sequence is assembled
from overlapping oligonucleotides prepared by standard methods (See
e.g., Edge, Nature 292:756 [1981]; Nambair et al., Science 223:1299
[1984]; and Jay et al., J. Biol. Chem., 259:6311 [1984]).
[0085] Moreover, it is not intended that the present invention be
limited to any specific Factor VIII sequence. Many natural and
recombinant forms of Factor VIII have been isolated and assayed
both in vitro and in vivo, using a variety of different regulatory
elements and control sequences. Therefore, any known, or later
discovered, DNA sequence coding for biologically active Factor VIII
can be expressed, alone or in combination with at least one
additional vector, using the AAV vectors and methods taught in the
present invention. Examples of naturally occurring and recombinant
forms of Factor VIII can be found in the patent and scientific
literature including, U.S. Pat. No. 5,563,045, U.S. Pat. No.
5,451,521, U.S. Pat. No. 5,422,260, U.S. Pat. No. 5,004,803, U.S.
Pat. No. 4,757,006, U.S. Pat. No. 5,661,008, U.S. Pat. No.
5,789,203, U.S. Pat. No. 5,681,746, U.S. 5,595,886, U.S. Pat. No.
5,045,455, U.S. Pat. No. 5,668,108, U.S. Pat. No. 5,633,150, U.S.
Pat. No. 5,693,499, U.S. Pat. No. 5,587,310, U.S. Pat. No.
5,171,844, U.S. Pat. No. 5,149,637, U.S. Pat. No. 5,112,950, U.S.
Pat. No. 4,886,876, WO 94/11503, WO 87/07144, WO 92/16557, WO
91/09122, WO 97/03195, WO 96/21035, WO 91/07490, EP 0 672 138, EP 0
270 618, EP 0 182 448, EP 0 162 067, EP 0 786 474, EP 0 533 862, EP
0 506 757, EP 0 874 057, EP 0 795 021, EP 0 670 332, EP 0 500 734,
EP 0 232 112, EP 0 160 457, Sanberg et al., XXth Int. Congress of
the World Fed. Of Hemophilia (1992), and Lind et al., Eur. J.
Biochem., 232:19 (1995).
[0086] Nucleic acid sequences coding for the above-described Factor
VIII can be obtained using recombinant methods, such as by
screening cDNA and genomic libraries from cells expressing Factor
VIII or by deriving the sequence from a vector known to include the
same. Furthermore, the desired sequence can be isolated directly
from cells and tissues containing the same, using standard
techniques, such as phenol extraction and PCR of cDNA or genomic
DNA (See e.g., Sambrook et al., supra, for a description of
techniques used to obtain and isolate DNA). Nucleotide sequences
encoding an antigen of interest (i.e., Factor VIII sequence) can
also be produced synthetically, rather than cloned. The complete
sequence can be assembled from overlapping oligonucleotides
prepared by standard methods and assembled into a complete coding
sequence (See e.g., Edge, Nature 292:756 [1981]; Nambair et al.,
Science 223:1299 [1984]; and Jay et al., J. Biol. Chem., 259:6311
[1984]).
[0087] Although it is not intended that the present invention be
limited to any particular methods for assessing the production of
biologically active Factor VIII, such methods as immunoassays
(e.g., ELISA) and biological activity assays are contemplated
(e.g., coagulation activity assays).
[0088] Furthermore, while in particularly preferred embodiments,
human Factor VIII is encompassed by the present invention, it is
not intended that the present invention be limited to human Factor
VIII. Indeed, it is intended that the present invention encompass
Factor VIII from animals other than humans, including but not
limited to companion animals (e.g., canines, felines, and equines),
livestock (e.g., bovines, caprines, and ovines), laboratory animals
(e.g., rodents such as murines, as well as lagamorphs), and
"exotic" animals (e.g., marine mammals, large cats, etc.).
[0089] II. Virion Production
[0090] Producing AAV Factor VIII vectors and rAAV Factor VIII
virions of the present invention generally involve the steps of:
(1) introducing an AAV vector containing the Factor VIII gene into
a host cell; (2) introducing an AAV helper construct into the host
cell, where the helper construct includes AAV coding regions
capable of being expressed in the host cell to complement AAV
helper functions missing from the AAV vector; (3) introducing one
or more helper viruses and/or accessory function vectors into the
host cell, wherein the helper virus and/or accessory function
vectors provide accessory functions capable of supporting efficient
recombinant AAV ("rAAV") virion production in the host cell; and
(4) culturing the host cell to produce rAAV virions.
[0091] The above-described vectors and constructs can be introduced
into a cell using standard methodology known to those of skill in
the art (e.g., transfection). A number of transfection techniques
are generally known in the art (See e.g., Graham et al., Virol.,
52:456 [1973], Sambrook et al. supra, Davis et al., supra, and Chu
et al., Gene 13:197
[0092] Particularly suitable transfection methods include calcium
phosphate co-precipitation (Graham et al., Virol., 52:456-467
[1973]), direct micro-injection into cultured cells (Capecchi, Cell
22:479-488 [1980]), electroporation (Shigekawa et al., BioTechn.,
6:742-751 [1988]), liposome-mediated gene transfer (Mannino et al.,
BioTechn., 6:682-690 [1988]) lipid-mediated transduction (Felgner
et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 [1987]), and
nucleic acid delivery using high-velocity microprojectiles (Klein
et al., Nature 327:70-73 [1987]).
[0093] For the purposes of the invention, suitable host cells for
producing rAAV virions include microorganisms, yeast cells, insect
cells, and mammalian cells, that can be, or have been, used as
recipients of a heterologous DNA molecule. The term includes the
progeny of the original cell which has been transfected. Thus, as
indicated above, a "host cell" as used herein generally refers to a
cell which has been transfected with an exogenous DNA sequence.
Cells from the stable human cell line, 293 (ATCC Accession No.
CRL1573) are preferred in the practice of the present invention.
Particularly, the human cell line 293 is a human embryonic kidney
cell line that has been transformed with adenovirus type-5 DNA
fragments (Graham et al., J. Gen. Virol., 36:59 [1977]), and
expresses the adenoviral E1a and E1b genes (Aiello et al., Virol.,
94:460 [1979]). The 293 cell line is readily transfected, and
provides a particularly convenient platform in which to produce
rAAV virions.
[0094] Host cells containing the above-described AAV vectors must
be rendered capable of providing AAV helper functions in order to
replicate and encapsidate the nucleotide sequences flanked by the
AAV ITRs to produce rAAV virons. AAV helper functions are generally
AAV-derived coding sequences which can be expressed to provide AAV
gene products that, in turn, function in trans for productive AAV
replication. AAV helper functions are used herein to complement
necessary AAV functions that are missing from the AAV vectors.
Thus, AAV helper functions include one, or both of the major AAV
ORFs, namely the rep and cap coding regions, or functional
homologues thereof.
[0095] AAV helper functions are introduced into the host cell by
transfecting the host cell with an AAV helper construct either
prior to, or concurrently with, the transfection of the AAV vector.
AAV helper constructs are thus used to provide at least transient
expression of AAV rep and/or cap genes to complement missing AAV
functions that are necessary for productive AAV infection. AAV
helper constructs lack AAV ITRs and can neither replicate nor
package themselves.
[0096] In preferred embodiments, these constructs are in the form
of a vector, including, but not limited to, plasmids, phages,
transposons, cosmids, viruses, or virions. A number of AAV helper
constructs have been described, such as the commonly used plasmids
pAAV/Ad and pIM29+45 which encode both Rep and Cap expression
products (See e.g., Samulski et al., J. Virol,. 63:3822-3828
[1989]; and McCarty et al., J. Virol., 65:2936-2945
[0097] A number of other vectors have been described which encode
Rep and/or Cap expression products (See e.g., U.S. Pat. No.
5,139,941, herein incorporated by reference).
[0098] Both AAV vectors and AAV helper constructs can be
constructed to contain one or more optional selectable markers.
Suitable markers include genes which confer antibiotic resistance
or sensitivity to, impart color to, or change the antigenic
characteristics of those cells which have been transfected with a
nucleic acid construct containing the selectable marker when the
cells are grown in an appropriate selective medium. Several
selectable marker genes that are useful in the practice of the
invention include the gene encoding aminoglycoside
phosphotranferase (APH) that allows selection in mammalian cells by
conferring resistance to G418 (Sigma). Other suitable markers are
known to those of skill in the art.
[0099] The host cell (or packaging cell) must also be rendered
capable of providing non-AAV derived functions, or "accessory
functions," in order to produce rAAV virions. Accessory functions
are non-AAV derived viral and/or cellular functions upon which AAV
is dependent for its replication. Thus, accessory functions include
at least those non-AAV proteins and RNAs that are required in AAV
replication, including those involved in activation of AAV gene
transcription, stage specific AAV mRNA splicing, AAV DNA
replication, synthesis of rep and cap expression products and AAV
capsid assembly. Viral-based accessory functions can be derived
from any of the known helper viruses.
[0100] Particularly, accessory functions can be introduced into and
then expressed in host cells using methods known to those of skill
in the art. Commonly, accessory functions are provided by infection
of the host cells with an unrelated helper virus. A number of
suitable helper viruses are known, including adenoviruses;
herpesviruses such as herpes simplex virus types 1 and 2; and
vaccinia viruses. Nonviral accessory functions will also find use
herein, such as those provided by cell synchronization using any of
various known agents (See e.g., Buller et al., J. Virol.,
40:241-247 [1981]; McPherson et al., Virol., 147:217-222 [1985];
and Schlehofer et al., Virol., 152:110-117 [1986]).
[0101] Alternatively, accessory functions can be provided using an
accessory function vector. Accessory function vectors include
nucleotide sequences that provide one or more accessory functions.
An accessory function vector is capable of being introduced into a
suitable host cell in order to support efficient AAV virion
production in the host cell. Accessory function vectors can be in
the form of a plasmid, phage, virus, transposon or cosmid.
Accessory vectors can also be in the form of one or more linearized
DNA or RNA fragments which, when associated with the appropriate
control sequences and enzymes, can be transcribed or expressed in a
host cell to provide accessory functions.
[0102] Nucleic acid sequences providing the accessory functions can
be obtained from natural sources, such as from the genome of
adenovirus, or constructed using recombinant or synthetic methods
known in the art. In this regard, adenovirus-derived accessory
functions have been widely studied, and a number of adenovirus
genes involved in accessory functions have been identified and
partially characterized (See e.g., Carter, "Adeno-Associated Virus
Helper Functions," in CRC Handbook of Parvoviruses, Vol. I (P.
Tijssen, ed.) [1990], and Muzyczka, Curr. Top. Microbiol. Immun.,
158:97-129 [1992]). Specifically, early adenoviral gene regions
E1a, E2a, E4, VAI RNA and, possibly, E1b are thought to participate
in the accessory process (Janik et al., Proc. Natl. Acad. Sci. USA
78:1925-1929 [1981]). Herpesvirus-derived accessory functions have
been described (See e.g., Young et al., Prog. Med. Virol., 25:113
[1979]). Vaccinia virus-derived accessory functions have also been
described (See e.g., Carter, supra., and Schlehofer et al., Virol.,
152:110-117 [1986]).
[0103] As a consequence of the infection of the host cell with a
helper virus, or transfection of the host cell with an accessory
function vector, accessory functions are expressed which
transactivate the AAV helper construct to produce AAV Rep and/or
Cap proteins. The Rep expression products direct excision of the
recombinant DNA (including the DNA of interest encoding at least a
portion of Factor VIII) from the AAV vector. The Rep proteins also
serve to duplicate the AAV genome. The expressed Cap proteins
assemble into capsids, and the recombinant AAV genome is packaged
into the capsids. Thus, productive AAV replication ensues, and the
DNA is packaged into rAAV virions.
[0104] Following recombinant AAV replication, rAAV virions can be
purified from the host cell using a variety of conventional
purification methods, such as CsCl gradients. Further, if helper
virus infection is employed to express the accessory functions,
residual helper virus can be inactivated, using known methods. For
example, adenovirus can be inactivated by heating to temperatures
of approximately 60.degree. C. for approximately 20 minutes or
more, as appropriate. This treatment selectively inactivates the
helper adenovirus which is heat labile, while preserving the rAAV
which is heat stable.
[0105] III. Pharmaceutical Compositions
[0106] The resulting rAAV virions are then ready for use in
pharmaceutical compositions which can be delivered to a subject, so
as to allow production of biologically active Factor VIII.
Pharmaceutical compositions comprise sufficient genetic material
that allows the recipient to produce a therapeutically effective
amount of Factor VIII so as to reduce, stop and/or prevent
hemorrhage. The compositions may be administered alone or in
combination with at least one other agent, such as stabilizing
compound, which may be administered in any sterile, biocompatible
pharmaceutical carrier, including, but not limited to, saline,
buffered saline, dextrose, and water. The compositions may be
administered to a patient alone, or in combination with other
agents, clotting factors or factor precursors, drugs or hormones.
In preferred embodiments, the pharmaceutical compositions also
contain a pharmaceutically acceptable excipient. Such excipients
include any pharmaceutical agent that does not itself induce an
immune response harmful to the individual receiving the
composition, and which may be administered without undue toxicity.
Pharmaceutically acceptable excipients include, but are not limited
to, liquids such as water, saline, glycerol, sugars and ethanol.
Pharmaceutically acceptable salts can be included therein, for
example, mineral acid salts such as hydrochlorides, hydrobromides,
phosphates, sulfates, and the like; and the salts of organic acids
such as acetates, propionates, malonates, benzoates, and the like.
Additionally, auxiliary substances, such as wetting or emulsifying
agents, pH buffering substances, and the like, may be present in
such vehicles. A thorough discussion of pharmaceutically acceptable
excipients is available in Remington's Pharmaceutical Sciences
(Mack Pub. Co., N.J. [1991]).
[0107] Pharmaceutical formulations suitable for parenteral
administration may be formulated in aqueous solutions, preferably
in physiologically compatible buffers such as Hanks's solution,
Ringer's solution, or physiologically buffered saline. Aqueous
injection suspensions may contain substances which increase the
viscosity of the suspension, such as sodium carboxymethyl
cellulose, sorbitol, or dextran. Additionally, suspensions of the
active compounds may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty
oils such as sesame oil, or synthetic fatty acid esters, such as
ethyl oleate or triglycerides, or liposomes. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
[0108] For topical or nasal administration, penetrants appropriate
to the particular barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art.
[0109] The pharmaceutical compositions of the present invention may
be manufactured in a manner that is known in the art (e.g., by
means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping,
or lyophilizing processes).
[0110] The pharmaceutical composition may be provided as a salt and
can be formed with many acids, including but not limited to,
hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic,
etc. Salts tend to be more soluble in aqueous or other protonic
solvents than are the corresponding free base forms. In other
cases, the preferred preparation may be a lyophilized powder which
may contain any or all of the following: 1-50 mM histidine, 0.1%-2%
sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is
combined with buffer prior to use.
[0111] After pharmaceutical compositions have been prepared, they
can be placed in an appropriate container and labeled for
treatment. For administration of Factor VIII-containing vectors,
such labeling would include amount, frequency, and method of
administration.
[0112] Pharmaceutical compositions suitable for use in the
invention include compositions wherein the active ingredients are
contained in an effective amount to achieve the intended purpose.
Determining a therapeutic effective dose is well within the
capability of those skilled in the art using the techniques taught
in the present invention, such as ELISA and ChromZ FVIII
coagulation activity assay, and other techniques known in the art.
Therapeutic doses will depend on, among other factors, the age and
general condition of the subject, the severity of hemophilia, and
the strength of the control sequences. Thus, a therapeutically
effective amount in humans will fall in a relatively broad range
that can be determined through clinical trials.
[0113] It is intended that the dosage treatment and regimen used
with the present invention will vary, depending upon the subject
and the preparation to be used. Thus, the dosage treatment may be a
single dose schedule or a multiple dose schedule. Moreover, the
subject may be administered as many doses as appropriate to achieve
or maintain the desired blood clotting time.
[0114] Direct delivery of the pharmaceutical compositions in vivo
will generally be accomplished via injection using a conventional
syringe, although other delivery methods such as
convention-enhanced delivery are envisioned (See e.g., U.S. Pat.
No. 5,720,720, incorporated herein by reference). In this regard,
the compositions can be delivered subcutaneously, epidermally,
intradermally, intrathecally, intraorbitally, intramucosally (e.g.,
nasally, rectally and vaginally), intraperitoneally, intravenously,
intraarterially, orally, or intramuscularly. Other modes of
administration include oral and pulmonary administration,
suppositories, and transdermal applications. In particularly
preferred embodiments, the compositions are administered
intravenously in the portal vasculature or hepatic artery
[0115] One skilled in the art will recognize that the methods and
compositions described above are also applicable to a range of
other treatment regimens known in the art. For example, the methods
and compositions of the present invention are compatible with ex
vivo therapy (e.g., where cells are removed from the body,
incubated with the AAV vector and the treated cells are returned to
the body).
[0116] IV. Administration
[0117] AAV vector can be administered to any tissue suitable for
the expression of Factor VIII. In a preferred embodiments, the AAV
vectors of the present invention are successfully administered via
the portal vasculature or hepatic artery where it is thought,
without being bound by theory, that the vector transduces
hepatocytes. Current approaches to targeting genes to the liver
have focused upon ex vivo gene therapy. Ex vivo liver-directed gene
therapy involves the surgical removal of liver cells, transduction
of the liver cells in vitro (e.g., infection of the explanted cells
with recombinant retroviral vectors) followed by injection of the
genetically modified liver cells into the liver or spleen of the
patient. A serious drawback for ex vivo gene therapy of the liver
is the fact that hepatocyctes cannot be maintained and expanded in
culture. Therefore, the success of ex vivo liver-directed gene
therapy depends upon the ability to efficiently and stably engraft
the genetically modified (i.e., transduced) hepatocytes and their
progeny. It has been reported that even under optimal conditions,
autologous modified liver cells injected into the liver or spleen
which engraft represent only a small percentage (less than 10%) of
the total number of cells in the liver. Ectopic engraftment of
transduced primary hepatocytes into the peritoneal cavity has been
tried, in order to address the problem of engraftment in the
liver.
[0118] Given the problems associated with ex vivo liver-directed
gene therapy, in vivo approaches have been investigated for the
transfer of genes into hepatocytes, including the use of
recombinant retroviruses, recombinant adenoviruses, liposomes and
molecular conjugates. While these in vivo approaches do not suffer
from the drawbacks associated with ex vivo liver-directed gene
therapy, they do not provide a means to specifically target
hepatocytes. In addition, several of these approaches require
performance of a partial hepatectomy, in order to achieve prolonged
expression of the transferred genes in vivo. Adenovirus and
molecular conjugate based delivery methods also result in liver
toxicity and inflammation which is an undesirable feature of Factor
VIII gene therapy. The present invention provides compositions and
methods for the long-term expression of biologically active Factor
VIII. It is contemplated that the present invention will bypass the
need for partial hepatectomy, while allowing expression of Factor
VIII in concentrations that are therapeutic in vivo. The present
invention further provides gene therapy compositions and methods
that target hepatocytes for the production of Factor VIII by
treated individuals.
[0119] Other tissues, however, may be suitable for the expression
of Factor VIII even if they are not the tissue that normally
synthesizes the protein. Muscle cells, for example, have been shown
to express biologically active blood clotting Factor IX even though
it is normally synthesized in the liver.
[0120] Finally, the AAV vectors may contain any nucleic acid
sequences coding for biologically active Factor VIII. Additionally,
the AAV vectors may contain a nucleic acid coding for fragments of
Factor VIII which is itself not biologically active, yet when
administered into the subject improves or restores the blood
clotting time. For example, as discussed above, the Factor VIII
protein comprises two polypeptide chains: a heavy chain and a light
chain separated by a B-domain which is cleaved during processing.
As demonstrated by the present invention, co-transducing recipient
cells with the Factor VIII heavy and light chains leads to the
expression of biologically active Factor VIII. Because, however,
most hemophiliacs contain a mutation or deletion in only one of the
chains (e.g., heavy or light chain), it may be possible to
administer only the chain defective in the patient and allow the
patient to supply the other chain. In this case, the AAV vector
would fall within the scope of the invention even though the single
chain (i.e., heavy or light) would not be biologically active until
it was administered into a subject which can supply the second
chain, thus forming biologically active Factor VIII.
[0121] V. Factor VIII Assays
[0122] As described in the Experimental section below, there are
many ways to assay Factor VIII expression and activity. Although
the present invention is not limited to immunoassay methods, the
present invention also provides methods for detecting Factor VIII
expression comprising the steps of: a) providing a sample suspected
of containing Factor VIII, and a control containing a known amount
of known Factor VIII; and b) comparing the test sample with the
known control, to determine the relative concentration of Factor
VIII in the sample. Thus, the methods are capable of identifying
samples (e.g., patient samples) with sufficient or insufficient
quantities of Factor VIII. In addition, the methods may be
conducted using any suitable means to determine the relative
concentration of Factor VIII in the test and control samples,
including but not limited to means selected from the group
consisting of Western blot analysis, Northern blot analysis,
Southern blot analysis, denaturing polyacrylamide gel
electrophoresis (e.g., SDS-PAGE), reverse transcriptase-coupled
polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent
assay (ELISA), radioimmunoassay (RIA), and fluorescent immunoassay
(IFA). Thus, the methods may be conducted to determine the presence
of normal Factor VIII sequences in the genome of the animal source
of the test sample, or the expression of Factor VIII (mRNA or
protein), as well as detect the presence of abnormal or mutated
Factor VIII gene sequences in the test samples.
[0123] In one preferred embodiment, the presence of Factor VIII is
detected by immunochemical analysis. For example, the
immunochemical analysis can comprise detecting binding of an
antibody specific for an epitope of Factor VIII. In one another
preferred embodiment of the method, the antibody comprises
polyclonal antibodies, while in another preferred embodiment, the
antibody comprises monoclonal antibodies.
[0124] It is further contemplated that antibodies directed against
at least a portion of Factor VIII will be used in methods known in
the art relating to the localization and structure of Factor VIII
(e.g., for Western blotting), measuring levels thereof in
appropriate biological samples, etc. The antibodies can be used to
detect Factor VIII in a biological sample from an individual (e.g.,
an individual treated using the methods and/or compositions of the
present invention). The biological sample can be a biological
fluid, including, but not limited to, blood, serum, plasma,
interstitial fluid, urine, cerebrospinal fluid, synovial fluid, and
the like. In particular, the antigen can be detected from cellular
sources, including, but not limited to, hepatocytes. For example,
cells can be obtained from an individual and lysed (e.g., by
freeze-thaw cycling, or treatment with a mild cytolytic detergent
including, but not limited to, TRITON X-100, digitonin, NONIDET P
(NP)-40, saponin, and the like, or combinations thereof, See, e.g.,
International Patent Publication WO 92/08981).
[0125] The biological samples can then be tested directly for the
presence of the Factor VIII using an appropriate strategy (e.g.,
ELISA or RIA) and format (e.g., microwells, dipstick [e.g., as
described in International Patent Publication WO 93/03367], etc.).
Alternatively, proteins in the sample can be size separated (e.g.,
by polyacrylamide gel electrophoresis (PAGE), with or without
sodium dodecyl sulfate (SDS), and the presence of Factor VIII
detected by immunoblotting [e.g., Western blotting]).
Immunoblotting techniques are generally more effective with
antibodies generated against a peptide corresponding to an epitope
of a protein, and hence, are particularly suited to the present
invention. In another preferred embodiment, the level of Factor
VIII is assayed using the whole-blood clotting time and activated
parial thromboplastin time (aPTT) of the subject's blood using
techniques well known in the art (Herzog et al., Nature Medicine
5:56 [1999]).
[0126] The foregoing explanations of particular assay systems are
presented herein for purposes of illustration only, in fulfillment
of the duty to present an enabling disclosure of the invention. It
is to be understood that the present invention contemplates a
variety of immunochemical assay protocols within its spirit and
scope. Indeed, other methods such as biological assays to determine
the presence and activity of Factor VIII are also encompassed by
the present invention.
[0127] Thus, in addition to the immunoassay systems described
above, other assay systems, such as those designed to measure
and/or detect Fraction VIII and/or clotting ability of a subject's
blood are also encompassed by the present invention (e.g., the
ChromZ FVIII coagulation activity [FVIII-c] assay [Helena
Labs]).
Experimental
[0128] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0129] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
[0130] In the experimental disclosure which follows, the following
abbreviations apply: N (Normal); M (Molar); mM (millimolar); .mu.M
(micromolar); g (grams); mg (milligrams); .mu.g (micrograms); ng
(nanograms); l or L (liters); ml (milliliters); .mu.l
(microliters); cm (centimeters); mm (millimeters); .mu.m
(micrometers); nm (nanometers); mU (milliunits); .sup.51Cr
(Chromium 51); .mu.Ci (microcurie); EC (degrees Centigrade); hFVIII
(human factor VIII); FVIII (factor VIII); pH (hydrogen ion
concentration); JRH grade; NaCl (sodium chloride); HCl
(hydrochloric acid); OD (optical density); bp (base pair(s)); ATP
(adenosine 5'-triphosphate); PCR (polymerase chain reaction); DNA
(deoxyribonucleic acid); cDNA (complementary DNA); AAV
(adeno-associated virus); rAAV (recombinant adeno-associated
virus); ITR (inverted terminal repeat); FCS or FBS (fetal calf
serum; fetal bovine serum); CFA (complete Freund's adjuvant); BSA
(bovine serum albumin); ATCC (American Type Culture Collection,
Rockville, Md.); Sigma (Sigma Aldrich, St. Louis, Mo.); Biodesign
International (Biodesign International, Kennebunk, Mich.); Baxter
Hyland (Baxter Healthcare Corp., Biotech Group--Hyland Division,
Hayward, Calif.); Helena Labs (Helena Laboratories, Beaumont,
Tex.); American Diagnostica (American Diagnostica, Greenwich,
Conn.); Accurate Chemical (Accurate Chemical and Scientific Corp.,
Westbury, N.Y.); Molecular Probes (Molecular Probes, Eugene,
Oreg.); Vysis (Vysis, Downer Grove, Ill.); Tel-Test (Tel-Test,
Inc., Friendswood, Tex.); Molecular Dynamics (Molecular Dynamics,
Sunnyvale, Calif.); NUNC (Naperville, Ill.); and Stratagene
(Stratagene Cloning Systems, La Jolla, Calif.); Affinity
Biologicals (Affinity Biologicals, Inc., Hamilton, Ontario); and
Biodesign (Biodesign International, Kennebunkport, Me.).
EXAMPLE 1
Dual Vector Plasmid Construction
[0131] The heavy and light chains of human Factor VIII (hFVIII)
were assembled according to those reported by Yonemura et al
(Yonemura et al., Prot. Engineer., 6:669-674 [1993]) and cloned as
expression cassettes into AAV vectors. Both vectors contain the
promoter and the first non-coding intron (from -573 to +985) from
the human elongation factor 1.alpha. (EF1.alpha.) gene (Uetsuki et
al, J. Biol. Chem., 264:5791-5798 [1989]; and Kim et al., Gene
9:217-223 [1990]). Each vector also contains the first 57 base
pairs of the FVIII heavy chain encoding the 19 amino acid signal
sequence. The heavy chain construct encodes the A1 and A2 domains
and 5 amino acids from the N terminus of the B domain. The light
chain vector encodes 85 amino acids of the carboxy terminal B
domain, in addition to the A3, C1, and C2 domains. Both vectors
utilize the human growth hormone (hGH) polyadenylation signal. The
expression cassettes were inserted between AAV ITRs. The initial
cloning step involved deleting 854 bp of EF1.alpha. sequences
between the SpeI and XcmI sites of pVm4.1e-hFIX (Nakai et al.,
Blood 91:1-9 [1998]), and religating to create
pVm4.1e.delta.D-hFIX.
[0132] This construct was then digested with EcoRI, which released
the hFIX cDNA, and was ligated to an oligonucleotide containing
MfeI ends (EcoRI-compatible) and an internal ClaI restriction site,
creating pVm4.1e.delta.D-linker. The heavy and light chain
fragments, including the hGH polyadenylation sequences were
isolated from pVm4.1cFVIII-HC and pVm4.1cFVIII-LC, respectively as
ClaI-BstEII fragments. These fragments were cloned between the
corresponding sites in the pVm4.1e.delta.D-linker, creating
plasmids pVm4.1e.delta.D-FVIII-HC (also, rAAV-hFVIII-HC) and
pVm4.1e.delta.D-FVIII-LC (also, rAAV-hFVIII-LC).
[0133] FIG. 7 provides a map of the constructs. In this figure, the
upper line in each panel represents the gene structure of the
vectors, and the lower line represents the structure of the hFVIII
protein domains encoded by the vectors (ITR, AAV inverted terminal
repeat; EF1.alpha. Pro/Intron 1, human polypeptide elongation
factor 1.alpha. gene promoter and first intron; hFVIII-HC human
FVIII cDNA; HFVIII-LC, human FVIII cDNA; hGH PA, human growth
hormone polyadenylation signal; SS, human FVIII signal sequence;
A1, A2, "B", A3, C1, C2, complete and incomplete (") protein
domains of the hFVIII protein).
EXAMPLE 2
[0134] Single Vector Plasmid Construction
[0135] The plasmid pAAV-F8-1 construct containing both the light
and heavy chains of factor VIII was constructed as follows. A PCR
fragment, Z8, containing cloning sites, 5 '-splicing donor site of
a synthetic intron based on EF1.alpha. and immunoglobulin G (IgG)
intron sequences, Kozak sequence and the first 16 nucleotides of
the human blood coagulation factor VIII (FVIII) coding sequence was
generated using oligonucleotides Z8S and Z8A. The sequences of the
nucleic acids is shown below:
[0136] Oligonucleotide Z8S:
[0137] 5'
cccaagcttgcggccgcccgggtgccgcccctaggcaggtaagtgccgtgtgtggttcc 3' (SEQ
ID NO: 1)
[0138] Oligonucleotide Z8A:
[0139] 5'
ccgctcgagcagagctctatttgcatggtggaatcgatgccgcgggaaccacacacggc 3' (SEQ
ID NO: 2)
[0140] PCR fragment Z8:
[0141] 5'
cccaagcttgcggccgcccgggtgccgcccctaggcaggtaagtgccgtgtgtggttcccgcgg-
ca tcgattccaccatgcaaatagagctctgctcgagcgg 3' (SEQ ID NO: 3)
[0142] Nucleic acid Z8 was inserted into pZERO-2 (Invitrogen)
between HindIII and XhoI sites to create pZ8. A PCR fragment, INT3,
containing the branching point, the polypyrimidine tract, and the
3' splicing acceptor site of the synthetic intron was generated
using oligonucleotides INT3S and INT3A whose sequence is shown
below.
[0143] Oligonucleotide INT3S:
[0144] 5' ttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattactga
3' (SEQ ID NO: 4)
[0145] Oligonucleotide INT3A:
[0146] 5' gaatcgatacctgtggagaaaaagaaaaagtggatgtcagtgtcagtaattcaaggc
3' (SEQ ID NO: 5)
[0147] PCR Fragment INT3:
[0148]
ccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattactgacactgacatccac-
t ttttctttttctccacaggtatcgattc 3' (SEQ ID NO: 6)
[0149] 3 inserted between the SacII and ClaI sites of pZ8 to create
pZ8.I. Therefore, Z8.I contains the entire synthetic intron between
AvrII and ClaI sites. A hFVIII cDNA fragment having SacI and XhoI
restriction sites was inserted between the SacI and XhoI sites of
pZ8.I to create pZ8.I.dB. Therefore, pZ8.I.dB contains a synthetic
intron and the entire coding sequence of hFVIII.
[0150] A PCR fragment, EG3, containing three HNF-3 binding sites
and -54 to +8 of mouse albumin gene was generated using
oligonucleotides EG3S and EG3A with modifications to eliminate
linker sequences. The sequences of EG3S and EG3A are as
follows:
[0151] Oligonucleotide EG3S:
[0152] 5 '
agggaatgtttgttcttaaataccatccagggaatgtttgttcttaaataccatccagggaat-
gtttgttctt aaataccatctacagttattggttaaa 3' (SEQ ID NO: 7)
[0153] Oligonucleotide EG3A:
[0154] 5'
ggaaaggtgatctgtgtgcagaaagactcgctctaatatacttctttaaccaataactg 3' (SEQ
ID NO: 8)
[0155] PCR Fragment EG3:
[0156] 5'
agggaatgtttgttcttaaataccatccagggaatgtttgttcttaaataccatccagggaatg-
tttgttctt
aaataccatctacagttattggttaaagaagtatattagagcgagtctttctgcacacagatca-
cctttcc 3' (SEQ ID NO: 9)
[0157] EG3 was then phosphorylated using T4 polynucleotide kinase
and inserted into the SmaI site of pZ8.I.dB to create pZ8.I.dB.egg.
A DNA fragment, SPA, containing an efficient synthetic polyA signal
based on rabbit .beta.-globin sequences (Genes and Develop.,
3:1019) was generated by hybridizing two oligonucleotides SPA.S and
SPA.A.
[0158] Oligonucleotide SPA.S:
[0159] 5'
tcgagaataaaagatcagagctctagagatctgtgtgttggttttttgtgtgcggccgc 3' (SEQ
ID NO: 10)
[0160] Oligonucleotide SPA.A:
[0161] 5 '
tcgagcggccgcacacaaaaaaccaacacacagatctctagagctctgatcttttattc 3' (SEQ
ID NO: 11)
[0162] PCR Fragment SPA:
[0163] 5 '
tcgagaataaaagatcagagctctagagatctgtgtgttggttttttgtgtgcggccgctcga 3'
(SEQ ID NO: 12)
[0164] SPA was inserted into the XhoI site of pZero-2 to create
pZero-2.SPA. SPA was excised from a pZero-2.SPA clone and inserted
into the XhoI site of pZ8.I.dB.egg to create pZ8.I.dB.egg.A.
pAAV-CMV-FIX9 was digested with ClaI, blunted with T4 polymerase
and religated to create pAAV(Cla.sup.-)-CMV-FIX9.
[0165] The entire expression cassette containing HNF-3.albumin
promoter-synthetic intron-hFVIII-synthetic poly A signal was
excised from pZ8.I.dB.egg.A using NotI and ligated to the plasmid
backbone and AAV ITRs from pAAV (Cla-)-CMV-FIX9 to create
pAAV-F8-1. The nucleotide sequence of the vector from ITR to ITR
(i.e., excluding plasmid backbone) is shown in SEQ ID NO 13.
EXAMPLE 3
Virion Production
[0166] AAV vectors were produced from these plasmids using the Ad
free system as previously described in U.S. Pat. No. 5,858,351;
U.S. Pat. No. 5,846,528; U.S. Pat. No. 5,622,856; and Matsushita et
al., Gene Ther 5:938 (1998) all of which are hereby incorporated by
reference. Briefly, 293 cells (ATCC, catalog number CRL-1573) were
seeded in 10 cm dishes at a density of 3.times.10.sup.6 cells per
dish in 10 ml medium and incubated at 37.degree. C. with CO.sub.2
and humidity. After an overnight incubation, cells were
approximately seventy to eighty percent confluent.
[0167] The cells were then transfected with DNA by the calcium
phosphate method, as is well known in the art. Briefly, 7 .mu.g of
AAV vector containing the Factor VIII coding region, 7 .mu.g of
pladeno5 which supplies the accessory functions, and 7 .mu.g of
1909 AAV helper were added to a 3 ml sterile, polystyrene snap cap
tube using sterile pipette tips. Then, 1.0 ml of 300 mM CaCl.sub.2
(JRH grade) was added to each tube and mixed by pipetting up and
down. An equal volume of 2.times.HBS (274 mM NaCl, 10 mM KCl, 42 mM
HEPES, 1.4 mM Na.sub.2PO.sub.4, 12 mM dextrose, pH 7.05, JRH grade)
was added with a 2 ml pipette, and the solution was pipetted up and
down three times. The DNA mixture was immediately added to the
cells, one drop at a time, evenly throughout the 10 cm dish. The
cells were then incubated at 37.degree. C. with CO.sub.2 and
humidity for six hours. A granular precipitate was visible in the
transfected cell cultures. After six hours, the DNA mixture was
removed from the cells, which were provided with fresh medium and
incubated for 72 hours.
[0168] After 72 hours, the cells were harvested, pelleted, and
resuspended in 1 ml TBS/1% BSA. Freeze/thaw extracts were prepared
by repeatedly (three times) freezing the cell suspension on dry ice
and thawing at 37.degree. C. Viral preps were stored at -80.degree.
C. and titered by dot blot assay prior to the first round of
infection.
EXAMPLE 4
In Vitro Cell Transduction
[0169] Cells from the stable human cell line, 293 (ATCC No.
CRL1573) were seeded in six-well plates (i.e., plates having six
wells for cell growth) at a density of 5.times.10.sup.5 cells/well.
When the monolayers reached 80-90% confluence, they were infected
with rAAV virions AAV-e.delta.D-FVIII-HC, AAV-e.delta.D-FVIII-LC,
an equal ratio of AAV-e.delta.D-FVIII-HC and
AAV-e.delta.D-FVIII-LC, or AAV-e.delta.D-FIX at MOIs of
3.times.10.sup.3 and 3.times.10.sup.4. Eighteen hours post
infection, the media were replaced with DMEM/10% heat inactivated
FBS. The media were collected later for analysis by ELISA (as
described below) for FVIII light chain antigen levels, and by the
ChromZ FVIII as coagulation activity (FVIII-c) assay (Helena Labs)
for biological activity, using the manufacturer's instructions and
as described in Example 6.
EXAMPLE 5
Single Chain Factor VIII Infectivity Assay
[0170] In this Example, the infectivity of single chain Factor VIII
was investigated. To determine the infectivity of rAAV-hF8-1,
HepG2, 293, and H2.35 cells were infected with rAAV-hF8-1 and a
control vector rAAV-hF8L at an MOI of 1.times.10.sup.4 viral
particles per cell. Recombinant AAV DNA in infected cells was
isolated by Hirt extraction and run on an alkaline agarose gel.
Southern blot analysis using an human F8 probe showed that similar
amounts of rAAV-hF8-1 and rAAV-hF8L were isolated from uncoated
virus in the infected cells. An infectious center assay (ICA) known
in the art (See e.g., Snyder, Current Protocols in Genetics,
Chapter 12, John Wiley & Sons [1997]) was used to further
characterize the infectivity of rAAV-hF8-1. In this assay, the
infectious particle to total particle ratio of rAAV-F8-1 and that
of a control rAAV vector with the genome size of 4645 nucleotides
was determined. The results indicated that rAAV-hF8-1 had an
infectious particle to total particle ratio that was comparable to
the control vector at approximately 1:1000. Taken together, these
results indicate rAAV-hF8-1 has similar infectivity as rAAV vectors
with the genome size of wild-type AAV.
EXAMPLE 6
Factor VIII Protein Expression Assay
[0171] An ELISA specific for the light chain of FVIII was used to
determine FVIII light chain antigen levels in the 293 cells, as
well as the injected animals (described below). NUNC Maxisorb 96
well plates were coated with 50 .mu.l of a 1:500 dilution of the
light chain specific antibody, N77110 (Biodesign International) in
a coating buffer overnight at 4.degree. C. The plate was washed
three times with wash buffer (PBS, 0.05% Tween 20) and blocked with
200 .mu.l blocking buffer (PBS, 10% horse serum, 0.05% Tween 20) at
room temperature for 1 hour. The plate was washed three times and
standards and samples were applied. Bioclate recombinant human
FVIII (Baxter Hyland) was used as the standard, and was diluted in
blocking buffer to concentrations ranging from 320 ng/ml to 10
ng/ml.
[0172] For analysis of transduced culture supernatants, the
standards contained 50% media, and for analysis of mouse plasma,
the standards were diluted into 10%, in normal pooled mouse plasma
(Sigma). A standard assay reference plasma (SARP; Helena Labs) was
also included in the assay. Following the loading of the standards
and samples (95 .mu.l/well), the plate was incubated at room
temperature for 2 hours, and washed five times with wash buffer
(200 .mu.l/well). A 1:200 dilution of a horseradish
peroxidase-conjugated light chain specific antibody, ESH8-HRP,
(American Diagnostica) was added (100 .mu.l/well), and the plate
was incubated for 1 hour at room temperature. The plates were then
washed four times with wash buffer, and the antigen was detected
using an ABTS peroxidase substrate kit (BioRad) according to the
manufacturer's instructions. The results are shown in Table 1 of
Example 7, below.
EXAMPLE 7
Factor VIII Biological Activity Assay
[0173] The ChromZ FVIII coagulation activity (FVIII-c) assay
(Helena Labs, Beaumont, Tex.) was used to detect biologically
active FVIII in the 293 cells infected as described in Example 4.
Bioclate recombinant human FVIII (Baxter Hyland) was used as a
standard to analyze transfected culture supernatants. The standards
were diluted in plasma dilution buffer (supplied in kit) in the
range of 10 ng/ml to 0.313 ng/ml, and were made 2.5% in media.
Because this assay can detect both human and murine FVIII activity,
it was modified to deplete biologically active human Factor VIII in
the mouse plasma. Mouse plasma was pre-incubated with an antibody
specific for human FVIII prior to performing the assay. The
difference in FVIII activity between the untreated plasma sample
and the antibody treated sample represent the amount of
biologically active human FVIII in the plasma. The standard used in
the assay was normal pooled human plasma (FACT; obtained from
George King Biomedical). Serial dilutions of FACT were made in
FVIII deficient plasma from undiluted (200 ng/ml) to 6.25 ng/ml.
The standards (10 .mu.l) were incubated at 37.degree. C. for 15
min., with or without the addition of 2 .mu.l antibody N77110.
Similarly, mouse plasma samples were diluted in FVIII deficient
plasma and 10 .mu.l of these diluted samples were incubated with or
without 2 .mu.l of N77110 at 37.degree. C. for 15 min., and
immediately placed on ice. Thus, all incubations with antibody were
done in a background of 100% plasma. The antibody adsorbed and
non-adsorbed FACT standards, as well as the mouse plasma samples
were diluted 1:20 in plasma detection buffer provided in the ChromZ
kit. Thus, the final concentration of the FACT standards used in
the assay ranged from 10 ng/ml to 0.313 ng/ml.
[0174] Twenty five microliters of these dilutions were added to a
chilled 96 well plate. With the plate on ice, 25 .mu.l of FIXa
reagent and 50 .mu.l of FX were added, and the plate was incubated
at 37.degree. C. for 15 min. Substrate (50 .mu.l) was added and the
plate was incubated for an additional 3 min at 37.degree. C. The
reaction was stopped with the addition of 25 .mu.l 50% acetic acid
and the optical density at 405 nm was measured.
[0175] As shown below in Table 1, infection of 293 cells with
AAV-e.delta.D-FVIII-HC resulted in no antigen production, as well
as no biologically-active protein. Cells infected with
AAV-e.delta.D-FVIII-LC produced FVIII light chain, but no
biologically active protein. However, cells transduced with both
vectors produced FVIII light chain and biologically active FVIII in
a dose-dependent manner. Transduction of cells with the negative
control vector, AAV-e.delta.D-FIX, resulted in no antigen nor any
biologically active FVIII. It was assumed that equal amounts of
heavy and light chains were produced in transduced cells. The
activity units were converted to nanograms using the definition of
one unit being equal to the amount of FVIII in 1 ml of normal
pooled human plasma, or 200 ng.
1TABLE 1 In Vitro Production of Biologically Active Human Factor
VIII From Two rAAV Vectors ELISA ChromZ Vector MOI (ng/ml) (mU/ml)
(ng/ml) AAV-e.delta.D-FVIII-HC and 3 .times. 10.sup.3 24 35 7.1
AAV-e.delta.D-FVIII-LC AAV-e.delta.D-FVIII-HC and 3 .times.
10.sup.4 121 440 87.9 AAV-e.delta.D-FVIII-LC AAV-e.delta.D-FVIII-HC
3 .times. 10.sup.3 0 0 0 AAV-e.delta.D-FVIII-HC 3 .times. 10.sup.4
0 0 0 AAV-e.delta.D-FVIII-LC 3 .times. 10.sup.3 20.5 0 0
AAV-e.delta.D-FVIII-LC 3 .times. 10.sup.4 96.9 0 0 AAV-hFIX 3
.times. 10.sup.3 0 0 0 AAV-hFIX 3 .times. 10.sup.4 0 0 0 No Vector
0 0 0
EXAMPLE 8
Immunofluorescent Staining of FVIII Heavy and Light Chains
[0176] In these experiments, 293 cells transduced as described
above were analyzed using immunofluorescent staining. 293 cells
were plated on rat tail collagen-coated two-well culture slides at
a density of 4.times.10.sup.5 cells per well. Forty-eight hours
later, the cells were transduced at an MOI of 3.times.10.sup.4
particles per cell of rAAV-hFVIII-HC and rAAV-hFVIII-LC.
Forty-eight hours post-transduction, the cells were fixed in situ
with acetone, blocked with 2% BSA, and stained with a fluorescently
labelled anti-hFVIII light chain antibody and a fluorescently
labelled anti-hFVIII heavy chain antibody. The anti-hFVIII light
chain antibody used was ESH-4 monoclonal antibody (American
Diagnostica), fluorescently labelled with alexa-488 (Molecular
Probes), according to the manufacturer's instructions. The
anti-hFVIII heavy chain antibody used was MAS530P monoclonal
antibody (Accurate Chemical) fluorescently labelled with alexa-594
(Molecular Probes), according to the manufacturer's instructions.
The cells were counter-stained with DAPI. The images were collected
using a Zeiss Axioskop fluorescence microscope equipped with
separate filters for DAPI, FITC, and rhodamine signals and a CCD
camera. Image analysis was performed using Quips imaging software
(Vysis).
[0177] As indicated above, infection of cells with either
rAAV-e.delta.D-FVIII-HC or AAV-e.delta.D-FVIII-LC, followed by
staining with antibodies to both chains resulted in production of
the individual chains of human FVIII. Immunofluorescent staining of
cells co-infected with both vectors demonstrated that although some
cells express only the heavy or light chain of hFVIII, many
co-expressed both chains of human FVIII.
EXAMPLE 9
In Vitro Expression of Factor VIII Using Single Construct
[0178] Table 2 shows that two single vector constructs containing
the heavy and the light chain of Factor VIII driven by different
promoters express biologically active Factor VIII. The constructs
pAAV-hF8-1 (SEQ ID NO: 13), and pVm4.1cF8.DELTA.B (SEQ ID NO: 14)
were transfected into 293 cells. Following transfection, the cells
were allowed to express factor VIII for 48-72 hours. Factor VIII in
the culture media was assayed by the ChromZ FVIII coagulation
activity (FVIII-c) assay, as per the manufacturer's
instructions.
2TABLE 2 In Vitro Production of Biologically Active FVIII ELISA
ChromZ Construct(s) (ng/ml) (ng/ml) Control -- 0 pAAV-hF8-1 -- 4.9
pVm4.1cF8.DELTA.B -- 46
EXAMPLE 10
Factor VIII Expression Using Tissue Specific Promoters
[0179] In these experiments, different promoters and enhancer
elements were used to drive expression of a Factor VII coding
sequence. Expression of Factor VIII was compared in 293 cells and
HepG2 cells using different promoters. The pAAVeF8.DELTA.B contains
an EF-1.alpha. promoter with a hGH intron, Factor VIII with a
B-domain deletion (F8.DELTA.B) and a polyA. As described
previously, pAAV-hF8-1 uses the HNF-3 albumin promoter with a
minimal intron followed by F8.DELTA.B and a minimal polyA. The
construct pAAV-c8 uses the CMV enhancer-promoter and the
F8.DELTA.B. pAAV8b1 contains the HNF-3 albumin promoter followed by
the CMV/B-globin intron with the F8.DELTA.B and a minimal poly A
site. Table 3 describes Factor VIII expression using the albumin
promoter relative to the control plasmid pV4.1 eF8.DELTA.B in HepG2
and 293 cells. These data show increased expression of Factor VIII
in HepG2 liver cells with the albumin promoter as compared to
Factor VIII expression in 293 cells.
3TABLE 3 Relative Tissue Specificity of Promoters Plasmid Construct
HepG2 Cells 293 Cells pAAV-hF8-1 6.2 0.6 pAAV8b1 6.7 1.0 pAAVc8
30.0 41.0 pV4.1eF8.DELTA.B 100 100
[0180] Next, several promoters derived from the transthyretin (TTR)
gene promoter were transfected into HepG2 cells. TTR is an abundant
serum protein and the gene enhancer-promoter contains well known
liver-specific transcription factor binding sites (Samadani et al.,
Gene Expression 6:23 [1996]; Yan et al., EMBO 9:869 [1990]; Costa
and Grayson, Nuc. Acids Res., 19:4139 [1991]; Costa et al., Mol.
Cell. Bio., 6:4697 [1986]). The constructs were made by replacing
the HNF-3 albumin promoter in pAAV-hF8-1 with various lengths of
the TTR promoter-enhancer. The TTR enhancer-promoter was modified
by replacing the weak affinity binding sites with the strong
affinity binding sites to create pAAV-hF8-2. The
pAAV-hF8-TTR-E-L-P202 construct contains the full TTR promoter with
a linker between the enhancer and the promoter. The remaining
constructs are 5' deletions: pAAV-hF8-TTR-E-P202 has the promoter
and enhancer with no linker; pAAV-hF8-TTR-E-P197 has a 5 base pair
deletion from the promoter; pAAV-hF8-TTR-E-P151 has a 50 base pair
deletion; pAAV-hF8-TTR-P202 lacks the TTR enhancer and
pAAV-hF8-TTR(X) has a 65 base pair deletion in the enhancer. The
control plasmid, pAAV-hF8-1, expressed approximately 4.6 mU/ml.
Table 4 shows the fold-increase in Factor VIII activity using the
TTR promoter series relative to the control plasmid.
4TABLE 4 Factor VIII Expression Using TTR-Derived Promoters
Relative Factor Plasmid Construct VIII Activity pAAV-hF8-STTR 3.16
pAAV-hF8-TTR-E-L-P202 8.86 pAAV-hF8-TTR-E-P202 6.1
pAAV-hF8-TTR-EP197 7.3 pAAV-hF8-TTR-E-P151 13.3 pAAV-hF8-TTR-P202
2.3
EXAMPLE 11
In Vivo Expression of Factor VIII
[0181] In order to test the feasibility of the AAV vector approach
of the present invention in vivo, three groups of five C57BL/6 mice
were injected via the portal vein with either 3.times.10.sup.11
particles of AAV-e.delta.D-FVIII-HC, 3.times.10.sup.11 particles of
AAV-e.delta.D-FVIII-LC, or 3.times.10.sup.11 particles of both
AAV-e.delta.D-FVIII-HC and AAV-e.delta.D-FVIII-LC. In addition, a
group of four animals was injected with 3.times.10.sup.11 particles
of AAV-e.delta.D-FIX. It has been shown that this strain of mice
does not elicit an immune response to human FVIII when the gene is
delivered to the liver via an adenoviral vector (Connelly et al.,
Blood 87:4671-4677 [1996]). As indicated by the results shown
below, the data obtained during these experiments demonstrate the
feasibility of producing biologically active FVIII using two AAV
vectors to independently deliver the heavy and light chains of
FVIII.
[0182] Blood samples were collected in sodium citrate via the
retro-orbital plexus at biweekly intervals for the first 2 months
and at monthly intervals thereafter for 6 months and at 11 months.
Very high levels of FVIII light chain were expressed in animals
injected with AAV-e.delta.D-FVIII-LC alone or both vectors as shown
in FIG. 8.
[0183] In order to assess the amount of biologically active human
FVIII produced in the animals, a modified ChromZ assay was used.
Since this assay detects both human and murine FVIII, the amount of
FVIII present in- the plasma before and after adsorption to an
antibody specific to human FVIII was determined. The amount of
FVIII remaining in the plasma after adsorption represented the
amount of active murine FVIII and the difference represented the
amount of active human FVIII. Control experiments demonstrated that
the antibody could remove 80-90% of the human FVIII from a mouse
plasma sample when the sample was spiked with up to 32 ng of human
FVIII. The modified ChromZ assay indicated that only those animals
injected with both vectors produced biologically active FVIII, as
indicated in Table 5. The results shown in Table 5 are those from
plasma collected 8 weeks post-injection, although similar results
were obtained at 10 weeks and 5 months post-injection. One of the
five animals co-injected with both the heavy and light chain vector
did not express VIII, presumably due to an inefficient injection,
and was omitted from the analysis. Animals injected with both
vectors produced over 2 .mu.g/ml hFVIII light chain as measured by
ELISA. The ChromZ assay indicated that a total of 600-900 ng/ml of
active hFVIII was detected in the plasma. The contribution from
murine Factor VIII was approximately 400-500 ng/ml, indicating that
about 230-430 ng/ml of active human Factor VIII was present in the
plasma. Although only a fraction of the total protein was found to
be active, the animals produced physiological levels of the active
protein (i.e., 200 ng/ml). The animals were found to have
maintained these physiological levels of active protein for more
than 11 months, without waning. Similar analyses performed on
animals injected with the light chain vector alone, the heavy chain
vector alone, or the HFIX vector demonstrated no biologically
active human FVIII in the plasma of these animals.
5TABLE 5 Biological Activity of Human Factor VIII In Vivo Total
FVIII Murine Human ELISA (-Ab) FVIII (+Ab) FVIII Construct(s) Used
(ng/ml) (Units) (Units) (ng/ml) AAV-e.delta.D-FVIII-HC 2288 3.9 2.2
342 and AAV-e.delta.D-FVIII-LC* AAV-e.delta.D-FVIII-LC* 3329 1.4
1.6 0 AAV-e.delta.D-FVIII-HC 0 1.6 1.6 0 AAV-e.delta.D-FIX 0 1.4
2.0 0 *Average of three animals.
EXAMPLE 12
Gene Transfer and Vector Expression in Tissues
[0184] In these experiments, evidence of gene transfer to liver was
obtained by Southern Blot analysis following isolation of DNA from
one animal of each experimental group sacrificed 8 weeks
post-injection (i.e., as described in Example 11). In addition, DNA
was obtained from other tissues in order to determine the degree of
vector expression in organs other than the liver.
[0185] Twenty micrograms of DNA was digested with BglII, separated
using a 1% agarose gel, and hybridized with a .sup.32P-labelled
1126 bp AlwNI fragment encoding the A1 and A2 domains of hFVIII
(heavy chain probe), or a .sup.32P-labelled 1456 bp NdeI-EcoRI
fragment encoding the A3, C1 an C2 domains of hFVIII (light chain
probe). Copy number controls were generated by spiking
Bg/II-digested naive mouse liver DNA with BlgII-digested heavy or
light chain plasmid DNA (pVm4.1e.delta.D-hFVIII-H- C and
pVm4.1e.delta.D-hFVIII-LC, respectively), at ratios of 10, 5, 1,
01, and 0.01 copies per diploid genome. The hybridized membranes
were analyzed using a Storm 860 phosphoimager (Molecular Dynamics),
and quantitation of vector copy number was evaluated using
ImageQuaNT software (Molecular Dynamics). Autoradiography of the
hybridized membranes was also performed. Total RNA was isolated
from liver tissue using the RNA Stat extraction kit (Tel-Test). As
describe briefly below, Northern blot analysis was also performed
on 10 .mu.g RNA using methods known in the art, in conjunction with
the .sup.32P-labelled probes specific to the heavy and light chains
of hFVIII described above and autoradiography was performed on the
hybridized membranes.
[0186] Following digestion of liver DNA with BglII and
hybridization with an hFVIII light chain probe described below,
using methods known in the art, a band at the predicted size of
3015 bp was detected in animals injected with rAAV-hFVIII-LC, or
both the heavy and light chain vectors. This band was not observed
in the DNA of animals injected with the heavy chain vector alone or
the hFIX vector, as shown in FIG. 9A (rAAV-hFVIII-LC, lane 1;
rAAV-hFIX, lane 2; rAAV-hFVIII-HC, lane 3; both rAAV-hFVIII-LC and
rAAV-hFVIII-HC, lane 4; copy number controls were generated by
spiking BglII digested naive mouse liver DNA with the corresponding
plasmids at ratios of 10, 5, 1, 0.1, and 0.01 copies per diploid
genome, lanes 5-9). Phosphoimage analysis revealed that the light
chain vector was present at approximately 2.4 and 1.5 copies per
diploid genome in animals injected with the light chain vector
alone or both vectors, respectively. When BglII-digested DNA was
hybridized with an hFVIII heavy chain probe, the expected band of
2318 bp was observed in animals injected with the heavy chain
vector alone or both vectors, but was not detected in animals
injected with the light chain vector alone or the hFIX vector, as
shown in FIG. 9B. The copy number in animals injected with the
heavy chain vector alone and both vectors was 1.1 and 1.7 vector
copies per diploid genome, respectively.
[0187] The results of hybridization of DNA extracted from the
spleen, kidney and heart tissue with either an hFVIII light chain
probe or a heavy chain probe indicated that these tissues contained
less than 1 copy of vector sequences per 10 diploid genomes,
demonstrating that the vector distributes primarily to the liver
following intra-portal injection, as shown in FIGS. 10A and
10B.
[0188] Human FVIII gene expression in the liver of the mice was
also assessed by Northern blot analysis on RNA isolated from
animals sacrificed 8 weeks post-injection (as described above).
hFVIII light chain transcripts of the predicted size (2.7 kb) were
observed in animals injected with the light chain vector alone or
both vectors, as shown in FIG. 11A. Similarly, the expected hFVIII
heavy chain transcripts (2.7 kb) were detected in animals that were
injected with the heavy chain vector alone or both vectors, as
shown in FIG. 11B. Since the heavy and light chain DNA sequences
were shown by Southern blot analysis to be present at approximately
the same copy number (1.7 and 1.5 copies per diploid genome,
respectively), in an animal injected with both vectors, these
results demonstrate that both the heavy and light chains of hFVIII
are expressed in the liver in approximately equivalent amounts.
EXAMPLE 13
In vivo Expression of Factor VIII Using Single Vectors
[0189] Several groups comprising four C57BL/6 mice were injected
via the portal vein with 3.times.10.sup.11 particles of
AAV-hF8-STTR, 3.times.10.sup.11 particles of AAV-hF8-hAAT-137, or
3.times.10.sup.11 particles of AAV-hF8-HNF3-alb-original. As
discussed above, AAV-hF8-STTR contains modified sequences from the
transthyretin gene promoter. AAV-hF8-hAAT-137 contains 137 base
pairs of the human,-antitrypsin promoter. See De Simone et al.,
EMBO J., 6:2759-2766 (1987). AAV-hF8-HNF3-alb-original, like
AAV-F8-1, contains three HNF3 binding sites and 54 base pairs of
the albumin promoter.
[0190] Expression of Factor VIII was measured at 4 weeks by human
Factor VIII-specific ELISA (Affinity Biologicals). Even at this
early time-point, several of these mice expressed between 2 and 20
ng/ml of human Factor VIII. Table 6 shows expression levels at 4
weeks post-infection for selected animals.
6TABLE 6 Factor VIII Expression at 4 Weeks rAAV Factor VIII Levels
(ng/ml) rAAV-hF8-STTR (mouse #1) 4.3 rAAV-hF8-STTR (mouse #2) 2.4
rAAV-hF8-hAAT-137 (mouse #1) 10.5 rAAV-hF8-hAAT-137 (mouse #2) 20.4
rAAV-hF8-HNF3-alb-original 2.2 (mouse #1)
[0191] rAAV-hF8-hAAT-137 produced expression levels of as much as
10 to 20 ng/ml, which represent 20% to 40% of normal human levels
of Factor VIII. These data therefore show the in vivo expression of
therapeutically effective amounts of human Factor VIII using
Sequence CWU 1
1
15 1 59 DNA Artificial Sequence Oligonucleotide Z8S 1 cccaagcttg
cggccgcccg ggtgccgccc ctaggcaggt aagtgccgtg tgtggttcc 59 2 59 DNA
Artificial Sequence Oligonucleotide Z8A 2 ccgctcgagc agagctctat
ttgcatggtg gaatcgatgc cgcgggaacc acacacggc 59 3 103 DNA Artificial
Sequence PCR fragment Z8 3 cccaagcttg cggccgcccg ggtgccgccc
ctaggcaggt aagtgccgtg tgtggttccc 60 gcggcatcga ttccaccatg
caaatagagc tctgctcgag cgg 103 4 57 DNA Artificial Sequence
Oligonucleotide INT3S 4 ttcccgcggg cctggcctct ttacgggtta tggcccttgc
gtgccttgaa ttactga 57 5 57 DNA Artificial Sequence Oligonucleotide
INT3A 5 gaatcgatac ctgtggagaa aaagaaaaag tggatgtcag tgtcagtaat
tcaaggc 57 6 99 DNA Artificial Sequence PCR fragment INT3 6
ttcccgcggg cctggcctct ttacgggtta tggcccttgc gtgccttgaa ttactgacac
60 tgacatccac tttttctttt tctccacagg tatcgattc 99 7 100 DNA
Artificial Sequence Oligonucleotide EG3S 7 agggaatgtt tgttcttaaa
taccatccag ggaatgtttg ttcttaaata ccatccaggg 60 aatgtttgtt
cttaaatacc atctacagtt attggttaaa 100 8 59 DNA Artificial Sequence
Oligonucleotide EG3A 8 ggaaaggtga tctgtgtgca gaaagactcg ctctaatata
cttctttaac caataactg 59 9 144 DNA Artificial Sequence PCR fragment
EG3 9 agggaatgtt tgttcttaaa taccatccag ggaatgtttg ttcttaaata
ccatccaggg 60 aatgtttgtt cttaaatacc atctacagtt attggttaaa
gaagtatatt agagcgagtc 120 tttctgcaca cagatcacct ttcc 144 10 59 DNA
Artificial Sequence Oligonucleotide SPA.S 10 tcgagaataa aagatcagag
ctctagagat ctgtgtgttg gttttttgtg tgcggccgc 59 11 59 DNA Artificial
Sequence Oligonucleotide SPA.A 11 tcgagcggcc gcacacaaaa aaccaacaca
cagatctcta gagctctgat cttttattc 59 12 63 DNA Artificial Sequence
PCR fragment SPA 12 tcgagaataa aagatcagag ctctagagat ctgtgtgttg
gttttttgtg tgcggccgct 60 cga 63 13 11933 DNA Artificial Sequence
Vector from ITR to ITR 13 cagctgcgcg ctcgctcgct cactgaggcc
gcccgggcaa agcccgggcg tcgggcgacc 60 tttggtcgcc cggcctcagt
gagcgagcga gcgcgcagag agggagtggc caactccatc 120 actaggggtt
cctgcggccg cccagggaat gtttgttctt aaataccatc cagggaatgt 180
ttgttcttaa ataccatcca gggaatgttt gttcttaaat accatctaca gttattggtt
240 aaagaagtat attagagcga gtctttctgc acacagatca cctttccggg
tgccgcccct 300 aggcaggtaa gtgccgtgtg tggttcccgc gggcctggcc
tctttacggg ttatggccct 360 tgcgtgcctt gaattactga cactgacatc
cactttttct ttttctccac aggtatcgat 420 tccaccatgc aaatagagct
ctccacctgc ttctttctgt gccttttgcg attctgcttt 480 agtgccacca
gaagatacta cctgggtgca gtggaactgt catgggacta tatgcaaagt 540
gatctcggtg agctgcctgt ggacgcaaga tttcctccta gagtgccaaa atcttttcca
600 ttcaacacct cagtcgtgta caaaaagact ctgtttgtag aattcacgga
tcaccttttc 660 aacatcgcta agccaaggcc accctggatg ggtctgctag
gtcctaccat ccaggctgag 720 gtttatgata cagtggtcat tacacttaag
aacatggctt cccatcctgt cagtcttcat 780 gctgttggtg tatcctactg
gaaagcttct gagggagctg aatatgatga tcagaccagt 840 caaagggaga
aagaagatga taaagtcttc cctggtggaa gccatacata tgtctggcag 900
gtcctgaaag agaatggtcc aatggcctct gacccactgt gccttaccta ctcatatctt
960 tctcatgtgg acctggtaaa agacttgaat tcaggcctca ttggagccct
actagtatgt 1020 agagaaggga gtctggccaa ggaaaagaca cagaccttgc
acaaatttat actacttttt 1080 gctgtatttg atgaagggaa aagttggcac
tcagaaacaa agaactcctt gatgcaggat 1140 agggatgctg catctgctcg
ggcctggcct aaaatgcaca cagtcaatgg ttatgtaaac 1200 aggtctctgc
caggtctgat tggatgccac aggaaatcag tctattggca tgtgattgga 1260
atgggcacca ctcctgaagt gcactcaata ttcctcgaag gtcacacatt tcttgtgagg
1320 aaccatcgcc aggcgtcctt ggaaatctcg ccaataactt tccttactgc
tcaaacactc 1380 ttgatggacc ttggacagtt tctactgttt tgtcatatct
cttcccacca acatgatggc 1440 atggaagctt atgtcaaagt agacagctgt
ccagaggaac cccaactacg aatgaaaaat 1500 aatgaagaag cggaagacta
tgatgatgat cttactgatt ctgaaatgga tgtggtcagg 1560 tttgatgatg
acaactctcc ttcctttatc caaattcgct cagttgccaa gaagcatcct 1620
aaaacttggg tacattacat tgctgctgaa gaggaggact gggactatgc tcccttagtc
1680 ctcgcccccg atgacagaag ttataaaagt caatatttga acaatggccc
tcagcggatt 1740 ggtaggaagt acaaaaaagt ccgatttatg gcatacacag
atgaaacctt taagactcgt 1800 gaagctattc agcatgaatc aggaatcttg
ggacctttac tttatgggga agttggagac 1860 acactgttga ttatatttaa
gaatcaagca agcagaccat ataacatcta ccctcacgga 1920 atcactgatg
tccgtccttt gtattcaagg agattaccaa aaggtgtaaa acatttgaag 1980
gattttccaa ttctgccagg agaaatattc aaatataaat ggacagtgac tgtagaagat
2040 gggccaacta aatcagatcc tcggtgcctg acccgctatt actctagttt
cgttaatatg 2100 gagagagatc tagcttcagg actcattggc cctctcctca
tctgctacaa agaatctgta 2160 gatcaaagag gaaaccagat aatgtcagac
aagaggaatg tcatcctgtt ttctgtattt 2220 gatgagaacc gaagctggta
cctcacagag aatatacaac gctttctccc caatccagct 2280 ggagtgcagc
ttgaggatcc agagttccaa gcctccaaca tcatgcacag catcaatggc 2340
tatgtttttg atagtttgca gttgtcagtt tgtttgcatg aggtggcata ctggtacatt
2400 ctaagcattg gagcacagac tgacttcctt tctgtcttct tctctggata
taccttcaaa 2460 cacaaaatgg tctatgaaga cacactcacc ctattcccat
tctcaggaga aactgtcttc 2520 atgtcgatgg aaaacccagg tctatggatt
ctggggtgcc acaactcaga ctttcggaac 2580 agaggcatga ccgccttact
gaaggtttct agttgtgaca agaacactgg tgattattac 2640 gaggacagtt
atgaagatat ttcagcatac ttgctgagta aaaacaatgc cattgaacca 2700
agaagcttcg aaataactcg tactactctt cagtcagatc aagaggaaat tgactatgat
2760 gataccatat cagttgaaat gaagaaggaa gattttgaca tttatgatga
ggatgaaaat 2820 cagagccccc gcagctttca aaagaaaaca cgacactatt
ttattgctgc agtggagagg 2880 ctctgggatt atgggatgag tagctcccca
catgttctaa gaaacagggc tcagagtggc 2940 agtgtccctc agttcaagaa
agttgttttc caggaattta ctgatggctc ctttactcag 3000 cccttatacc
gtggagaact aaatgaacat ttgggactcc tggggccata tataagagca 3060
gaagttgaag ataatatcat ggtaactttc agaaatcagg cctctcgtcc ctattccttc
3120 tattctagcc ttatttctta tgaggaagat cagaggcaag gagcagaacc
tagaaaaaac 3180 tttgtcaagc ctaatgaaac caaaacttac ttttggaaag
tgcaacatca tatggcaccc 3240 actaaagatg agtttgactg caaagcctgg
gcttatttct ctgatgttga cctggaaaaa 3300 gatgtgcact caggcctgat
tggacccctt ctggtctgcc acactaacac actgaaccct 3360 gctcatggga
gacaagtgac agtacaggaa tttgctctgt ttttcaccat ctttgatgag 3420
accaaaagct ggtacttcac tgaaaatatg gaaagaaact gcagggctcc ctgcaatatc
3480 cagatggaag atcccacttt taaagagaat tatcgcttcc atgcaatcaa
tggctacata 3540 atggatacac tacctggctt agtaatggct caggatcaaa
ggattcgatg gtatctgctc 3600 agcatgggca gcaatgaaaa catccattct
attcatttca gtggacatgt gttcactgta 3660 cgaaaaaaag aggagtataa
aatggcactg tacaatctct atccaggtgt ttttgagaca 3720 gtggaaatgt
taccatccaa agctggaatt tggcgggtgg aatgccttat tggcgagcat 3780
ctacatgctg ggatgagcac actttttctg gtgtacagca ataagtgtca gactcccctg
3840 ggaatggctt ctggacacat tagagatttt cagattacag cttcaggaca
atatggacag 3900 tgggccccaa agctggccag acttcattat tccggatcaa
tcaatgcctg gagcaccaag 3960 gagccctttt cttggatcaa ggtggatctg
ttggcaccaa tgattattca cggcatcaag 4020 acccagggtg cccgtcagaa
gttctccagc ctctacatct ctcagtttat catcatgtat 4080 agtcttgatg
ggaagaagtg gcagacttat cgaggaaatt ccactggaac cttaatggtc 4140
ttctttggca atgtggattc atctgggata aaacacaata tttttaaccc tccaattatt
4200 gctcgataca tccgtttgca cccaactcat tatagcattc gcagcactct
tcgcatggag 4260 ttgatgggct gtgatttaaa tagttgcagc atgccattgg
gaatggagag taaagcaata 4320 tcagatgcac agattactgc ttcatcctac
tttaccaata tgtttgccac ctggtctcct 4380 tcaaaagctc gacttcacct
ccaagggagg agtaatgcct ggagacctca ggtgaataat 4440 ccaaaagagt
ggctgcaagt ggacttccag aagacaatga aagtcacagg agtaactact 4500
cagggagtaa aatctctgct taccagcatg tatgtgaagg agttcctcat ctccagcagt
4560 caagatggcc atcagtggac tctctttttt cagaatggca aagtaaaggt
ttttcaggga 4620 aatcaagact ccttcacacc tgtggtgaac tctctagacc
caccgttact gactcgctac 4680 cttcgaattc acccccagag ttgggtgcac
cagattgccc tgaggatgga ggttctgggc 4740 tgcgaggcac aggacctcta
ctgactcgag aataaaagat cagagctcta gagatctgtg 4800 tgttggtttt
ttgtgtgcgg ccgcaggaac ccctagtgat ggagttggcc actccctctc 4860
tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg
4920 cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct gcaggacatg
tgagcaaaag 4980 gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct
ggcgtttttc cataggctcc 5040 gcccccctga cgagcatcac aaaaatcgac
gctcaagtca gaggtggcga aacccgacag 5100 gactataaag ataccaggcg
tttccccctg gaagctccct cgtgcgctct cctgttccga 5160 ccctgccgct
taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 5220
atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
5280 tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat
cgtcttgagt 5340 ccaacccggt aagacacgac ttatcgccac tggcagcagc
cactggtaac aggattagca 5400 gagcgaggta tgtaggcggt gctacagagt
tcttgaagtg gtggcctaac tacggctaca 5460 ctagaaggac agtatttggt
atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 5520 ttggtagctc
ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 5580
agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
5640 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
agattatcaa 5700 aaaggatctt cacctagatc cttttaaatt aaaaatgaag
ttttaaatca atctaaagta 5760 tatatgagta aacttggtct gacagttacc
aatgcttaat cagtgaggca cctatctcag 5820 cgatctgtct atttcgttca
tccatagttg cctgactccc cgtcgtgtag ataactacga 5880 tacgggaggg
cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac 5940
cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
6000 ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct
agagtaagta 6060 gttcgccagt taatagtttg cgcaacgttg ttgccattgc
tacaggcatc gtggtgtcac 6120 gctcgtcgtt tggtatggct tcattcagct
ccggttccca acgatcaagg cgagttacat 6180 gatcccccat gttgtgcaaa
aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 6240 gtaagttggc
cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 6300
tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
6360 aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat
aataccgcgc 6420 cacatagcag aactttaaaa gtgctcatca ttggaaaacg
ttcttcgggg cgaaaactct 6480 caaggatctt accgctgttg agatccagtt
cgatgtaacc cactcgtgca cccaactgat 6540 cttcagcatc ttttactttc
accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 6600 ccgcaaaaaa
gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 6660
aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
6720 tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg
ccacctgacg 6780 tctaagaaac cattattatc atgacattaa cctataaaaa
taggcgtatc acgaggccct 6840 ttcgtctcgc gcgtttcggt gatgacggtg
aaaacctctg acacatgcag ctcccggaga 6900 cggtcacagc ttgtctgtaa
gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag 6960 cgggtgttgg
cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga 7020
gagtgcacca taaaattgta aacgttaata ttttgttaaa attcgcgtta aatttttgtt
7080 aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat
aaatcaaaag 7140 aatagcccga gatagggttg agtgttgttc cagtttggaa
caagagtcca ctattaaaga 7200 acgtggactc caacgtcaaa gggcgaaaaa
ccgtctatca gggcgatggc ccactacgtg 7260 aaccatcacc caaatcaagt
tttttggggt cgaggtgccg taaagcacta aatcggaacc 7320 ctaaagggag
cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg 7380
aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc
7440 gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtac
tatggttgct 7500 ttgacgtatg cggtgtgaaa taccgcacag atgcgtaagg
agaaaatacc gcatcaggcc 7560 gtaacctgtc ggatcaccgg aaaggacccg
taaagtgata atgattatca tctacatatc 7620 acaacgtgcg tggaggccat
caaaccacgt caaataatca attatgacgc aggtatcgta 7680 ttaattgatc
tgcatcaact taacgtaaaa acaacttcag acaatacaaa tcagcgacac 7740
tgaatacggg gcaacctcat gtcaacgaag aacagaaccc gcagaacaac aacccgcaac
7800 atccgctttc ctaaccaaat gattgaacaa attaacatcg ctcttgagca
aaaagggtcc 7860 gggaatttct cagcctgggt cattgaagcc tgccgtcgga
gactaacgtc agaaaagaga 7920 gcatatacat caattaaaag tgatgaagaa
tgaacatccc gcgttcttcc ctccgaacag 7980 gacgatattg taaattcact
taattacgag ggcattgcag taattgagtt gcagttttac 8040 cactttcctg
acagtgacag actgcgtgtt ggctctgtca cagactaaat agtttgaatg 8100
attagcagtt atggtgatca gtcaaccacc agggaataat ccttcatatt attatcgtgc
8160 ttcaccaacg ctgcctcaat tgctctgaat gcttccagag acaccttatg
ttctatacat 8220 gcaattacaa catcagggta actcatagaa atggtgctat
taagcatatt ttttacacga 8280 atcagatcca cggagggatc atcagcagat
tgttctttat tcattttgtc gctccatgcg 8340 cttgctcttc atctagcggt
taaaatatta cttcaaatct ttctgtatga agatttgagc 8400 acgttggcct
tacatacatc tgtcggttgt atttccctcc agaatgccag caggaccgca 8460
ctttgttacg caaccaatac tattaagtga aaacattcct aatatttgac ataaatcatc
8520 aacaaaacac aaggaggtca gaccagattg aaacgataaa aacgataatg
caaactacgc 8580 gccctcgtat cacatggaag gttttaccaa tggctcaggt
tgccattttt aaagaaatat 8640 tcgatcaagt gcgaaaagat ttagactgtg
aattgtttta ttctgaacta aaacgtcaca 8700 acgtctcaca ttatatttac
tatctagcca cagataatat tcacatcgtg ttagaaaacg 8760 ataacaccgt
gttaataaaa ggacttaaaa aggttgtaaa tgttaaattc tcaagaaaca 8820
cgcatcttat agaaacgtcc tatgataggt tgaaatcaag agaaatcaca tttcagcaat
8880 acagggaaaa tcttgctaaa gcaggagttt tccgatgggt tacaaatatc
catgaacata 8940 aaagatatta ctataccttt gataattcat tactatttac
tgagagcatt cagaacacta 9000 cacaaatctt tccacgctaa atcataacgt
ccggtttctt ccgtgtcagc accggggcgt 9060 tggcataatg caatacgtgt
acgcgctaaa ccctgtgtgc atcgttttaa ttattcccgg 9120 acactcccgc
agagaagttc cccgtcaggg ctgtggacat agttaatccg ggaatacaat 9180
gacgattcat cgcacctgac atacattaat aaatattaac aatatgaaat ttcaactcat
9240 tgtttagggt ttgtttaatt ttctacacat acgattctgc gaacttcaaa
aagcatcggg 9300 aataacacca tgaaaaaaat gctactcgct actgcgctgg
ccctgcttat tacaggatgt 9360 gctcaacaga cgtttactgt tcaaaacaaa
ccggcagcag tagcaccaaa ggaaaccatc 9420 acccatcatt tcttcgtttc
tggaattggg cagaagaaaa ctgtcgatgc agccaaaatt 9480 tgtggcggcg
cagaaaatgt tgttaaaaca gaaacccagc aaacattcgt aaatggattg 9540
ctcggtttta ttactttagg catttatact ccgctggaag cgcgtgtgta ttgctcacaa
9600 taattgcatg agttgcccat cgcgatatgg gcaactctat ctgcactgct
cattaatata 9660 cttctgggtt ccttccagtt gtttttgcat agtgatcagc
ctctctctga gggtgaaata 9720 atcccgttca gcggtgtctg ccagtcgggg
ggaggctgca ttatccacgc cggaggcggt 9780 ggtggcttca cgcactgact
gacagactgc tttgatgtgc aaccgacgac gaccagcggc 9840 aacatcatca
cgcagagcat cattttcagc tttagcatca gctaactcct tcgtgtattt 9900
tgcatcgagc gcagcaacat cacgctgacg catctgcatg tcagtaattg ccgcgttcgc
9960 cagcttcagt tctctggcat ttttgtcgcg ctgggctttg taggtaatgg
cgttatcacg 10020 gtaatgatta acagcccatg acaggcagac gatgatgcag
ataaccagag cggagataat 10080 cgcggtgact ctgctcatac atcaatctct
ctgaccgttc cgcccgcttc tttgaatttt 10140 gcaatcaggc tgtcagcctt
atgctcgaac tgaccataac cagcgcccgg cagtgaagcc 10200 cagatattgc
tgcaacggtc gattgcctga cggatatcac cacgatcaat cataggtaaa 10260
gcgccacgct ccttaatctg ctgcaatgcc acagcgtcct gacttttcgg agagaagtct
10320 ttcaggccaa gctgcttgcg gtaggcatcc caccaacggg aaagaagctg
gtagcgtccg 10380 gcgcctgttg atttgagttt tgggtttagc gtgacaagtt
tgcgagggtg atcggagtaa 10440 tcagtaaata gctctccgcc tacaatgacg
tcataaccat gatttctggt tttctgacgt 10500 ccgttatcag ttccctccga
ccacgccagc atatcgagga acgccttacg ttgattattg 10560 atttctacca
tcttctactc cggctttttt agcagcgaag cgtttgataa gcgaaccaat 10620
cgagtcagta ccgatgtagc cgataaacac gctcgttata taagcgagat tgctacttag
10680 tccggcgaag tcgagaaggt cacgaatgaa ccaggcgata atggcgcaca
tcgttgcgtc 10740 gattactgtt tttgtaaacg caccgccatt atatctgccg
cgaaggtacg ccattgcaaa 10800 cgcaaggatt gccccgatgc cttgttcctt
tgccgcgaga atggcggcca acaggtcatg 10860 tttttctggc atcttcatgt
cttaccccca ataaggggat ttgctctatt taattaggaa 10920 taaggtcgat
tactgataga acaaatccag gctactgtgt ttagtaatca gatttgttcg 10980
tgaccgatat gcacgggcaa aacggcagga ggttgttagc gcgacctcct gccacccgct
11040 ttcacgaagg tcatgtgtaa aaggccgcag cgtaactatt actaatgaat
tcaggacaga 11100 cagtggctac ggctcagttt gggttgtgct gttgctgggc
ggcgatgacg cctgtacgca 11160 tttggtgatc cggttctgct tccggtattc
gcttaattca gcacaacgga aagagcactg 11220 gctaaccagg ctcgccgact
cttcacgatt atcgactcaa tgctcttacc tgttgtgcag 11280 atataaaaaa
tcccgaaacc gttatgcagg ctctaactat tacctgcgaa ctgtttcggg 11340
attgcatttt gcagacctct ctgcctgcga tggttggagt tccagacgat acgtcgaagt
11400 gaccaactag gcggaatcgg tagtaagcgc cgcctctttt catctcacta
ccacaacgag 11460 cgaattaacc catcgttgag tcaaatttac ccaattttat
tcaataagtc aatatcatgc 11520 cgttaatatg ttgccatccg tggcaatcat
gctgctaacg tgtgaccgca ttcaaaatgt 11580 tgtctgcgat tgactcttct
ttgtggcatt gcaccaccag agcgtcatac agcggcttaa 11640 cagtgcgtga
ccaggtgggt tgggtaaggt ttgggattag catcgtcaca gcgcgatatg 11700
ctgcgcttgc tggcatcctt gaatagccga cgcctttgca tcttccgcac tctttctcga
11760 caactctccc ccacagctct gttttggcaa tatcaaccgc acggcctgta
ccatggcaat 11820 ctctgcatct tgcccccggc gtcgcggcac tacggcaata
atccgcataa gcgaatgttg 11880 cgagcacttg cagtaccttt gccttagtat
ttccttcaag ctgcccctgc agg 11933 14 4999 DNA Artificial Sequence
Vector construct 14 cgcccctgca ggcagctgcg cgctcgctcg ctcactgagg
ccgcccgggc aaagcccggg 60 cgtcgggcga cctttggtcg cccggcctca
gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg
ttcctgcggc cgcacgcgtg gtggcgcggg gtaaactggg 180 aaagtgatgt
cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 240
gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccccg cggcaggtaa
300 gtgccaggga atgtttgttc ttaaatacca tcgctccagg gaatgtttgt
tcttaaatac 360 catctactga cactgacatc cactttttct ttttctccac
aggtatcgat ccaccatgca 420 aatagagctc tccacctgct tctttctgtg
ccttttgcga ttctgcttta gtgccaccag 480 aagatactac ctgggtgcag
tggaactgtc atgggactat atgcaaagtg atctcggtga 540 gctgcctgtg
gacgcaagat ttcctcctag agtgccaaaa tcttttccat tcaacacctc 600
agtcgtgtac aaaaagactc tgtttgtaga attcacggat caccttttca acatcgctaa
660 gccaaggcca ccctggatgg gtctgctagg tcctaccatc caggctgagg
tttatgatac 720 agtggtcatt acacttaaga acatggcttc ccatcctgtc
agtcttcatg ctgttggtgt 780 atcctactgg aaagcttctg agggagctga
atatgatgat cagaccagtc aaagggagaa 840 agaagatgat aaagtcttcc
ctggtggaag ccatacatat gtctggcagg tcctgaaaga 900 gaatggtcca
atggcctctg acccactgtg ccttacctac tcatatcttt ctcatgtgga 960
cctggtaaaa gacttgaatt caggcctcat tggagcccta ctagtatgta gagaagggag
1020 tctggccaag gaaaagacac agaccttgca caaatttata ctactttttg
ctgtatttga 1080 tgaagggaaa agttggcact cagaaacaaa gaactccttg
atgcaggata gggatgctgc 1140 atctgctcgg gcctggccta aaatgcacac
agtcaatggt tatgtaaaca ggtctctgcc 1200 aggtctgatt ggatgccaca
ggaaatcagt ctattggcat gtgattggaa tgggcaccac 1260 tcctgaagtg
cactcaatat tcctcgaagg tcacacattt cttgtgagga accatcgcca 1320
ggcgtccttg gaaatctcgc caataacttt ccttactgct caaacactct tgatggacct
1380 tggacagttt
ctactgtttt gtcatatctc ttcccaccaa catgatggca tggaagctta 1440
tgtcaaagta gacagctgtc cagaggaacc ccaactacga atgaaaaata atgaagaagc
1500 ggaagactat gatgatgatc ttactgattc tgaaatggat gtggtcaggt
ttgatgatga 1560 caactctcct tcctttatcc aaattcgctc agttgccaag
aagcatccta aaacttgggt 1620 acattacatt gctgctgaag aggaggactg
ggactatgct cccttagtcc tcgcccccga 1680 tgacagaagt tataaaagtc
aatatttgaa caatggccct cagcggattg gtaggaagta 1740 caaaaaagtc
cgatttatgg catacacaga tgaaaccttt aagactcgtg aagctattca 1800
gcatgaatca ggaatcttgg gacctttact ttatggggaa gttggagaca cactgttgat
1860 tatatttaag aatcaagcaa gcagaccata taacatctac cctcacggaa
tcactgatgt 1920 ccgtcctttg tattcaagga gattaccaaa aggtgtaaaa
catttgaagg attttccaat 1980 tctgccagga gaaatattca aatataaatg
gacagtgact gtagaagatg ggccaactaa 2040 atcagatcct cggtgcctga
cccgctatta ctctagtttc gttaatatgg agagagatct 2100 agcttcagga
ctcattggcc ctctcctcat ctgctacaaa gaatctgtag atcaaagagg 2160
aaaccagata atgtcagaca agaggaatgt catcctgttt tctgtatttg atgagaaccg
2220 aagctggtac ctcacagaga atatacaacg ctttctcccc aatccagctg
gagtgcagct 2280 tgaggatcca gagttccaag cctccaacat catgcacagc
atcaatggct atgtttttga 2340 tagtttgcag ttgtcagttt gtttgcatga
ggtggcatac tggtacattc taagcattgg 2400 agcacagact gacttccttt
ctgtcttctt ctctggatat accttcaaac acaaaatggt 2460 ctatgaagac
acactcaccc tattcccatt ctcaggagaa actgtcttca tgtcgatgga 2520
aaacccaggt ctatggattc tggggtgcca caactcagac tttcggaaca gaggcatgac
2580 cgccttactg aaggtttcta gttgtgacaa gaacactggt gattattacg
aggacagtta 2640 tgaagatatt tcagcatact tgctgagtaa aaacaatgcc
attgaaccaa gaagcttctc 2700 ccagaatcca ccagtcttga aacgccatca
acgcgaaata actcgtacta ctcttcagtc 2760 agatcaagag gaaattgact
atgatgatac catatcagtt gaaatgaaga aggaagattt 2820 tgacatttat
gatgaggatg aaaatcagag cccccgcagc tttcaaaaga aaacacgaca 2880
ctattttatt gctgcagtgg agaggctctg ggattatggg atgagtagct ccccacatgt
2940 tctaagaaac agggctcaga gtggcagtgt ccctcagttc aagaaagttg
ttttccagga 3000 atttactgat ggctccttta ctcagccctt ataccgtgga
gaactaaatg aacatttggg 3060 actcctgggg ccatatataa gagcagaagt
tgaagataat atcatggtaa ctttcagaaa 3120 tcaggcctct cgtccctatt
ccttctattc tagccttatt tcttatgagg aagatcagag 3180 gcaaggagca
gaacctagaa aaaactttgt caagcctaat gaaaccaaaa cttacttttg 3240
gaaagtgcaa catcatatgg cacccactaa agatgagttt gactgcaaag cctgggctta
3300 tttctctgat gttgacctgg aaaaagatgt gcactcaggc ctgattggac
cccttctggt 3360 ctgccacact aacacactga accctgctca tgggagacaa
gtgacagtac aggaatttgc 3420 tctgtttttc accatctttg atgagaccaa
aagctggtac ttcactgaaa atatggaaag 3480 aaactgcagg gctccctgca
atatccagat ggaagatccc acttttaaag agaattatcg 3540 cttccatgca
atcaatggct acataatgga tacactacct ggcttagtaa tggctcagga 3600
tcaaaggatt cgatggtatc tgctcagcat gggcagcaat gaaaacatcc attctattca
3660 tttcagtgga catgtgttca ctgtacgaaa aaaagaggag tataaaatgg
cactgtacaa 3720 tctctatcca ggtgtttttg agacagtgga aatgttacca
tccaaagctg gaatttggcg 3780 ggtggaatgc cttattggcg agcatctaca
tgctgggatg agcacacttt ttctggtgta 3840 cagcaataag tgtcagactc
ccctgggaat ggcttctgga cacattagag attttcagat 3900 tacagcttca
ggacaatatg gacagtgggc cccaaagctg gccagacttc attattccgg 3960
atcaatcaat gcctggagca ccaaggagcc cttttcttgg atcaaggtgg atctgttggc
4020 accaatgatt attcacggca tcaagaccca gggtgcccgt cagaagttct
ccagcctcta 4080 catctctcag tttatcatca tgtatagtct tgatgggaag
aagtggcaga cttatcgagg 4140 aaattccact ggaaccttaa tggtcttctt
tggcaatgtg gattcatctg ggataaaaca 4200 caatattttt aaccctccaa
ttattgctcg atacatccgt ttgcacccaa ctcattatag 4260 cattcgcagc
actcttcgca tggagttgat gggctgtgat ttaaatagtt gcagcatgcc 4320
attgggaatg gagagtaaag caatatcaga tgcacagatt actgcttcat cctactttac
4380 caatatgttt gccacctggt ctccttcaaa agctcgactt cacctccaag
ggaggagtaa 4440 tgcctggaga cctcaggtga ataatccaaa agagtggctg
caagtggact tccagaagac 4500 aatgaaagtc acaggagtaa ctactcaggg
agtaaaatct ctgcttacca gcatgtatgt 4560 gaaggagttc ctcatctcca
gcagtcaaga tggccatcag tggactctct tttttcagaa 4620 tggcaaagta
aaggtttttc agggaaatca agactccttc acacctgtgg tgaactctct 4680
agacccaccg ttactgactc gctaccttcg aattcacccc cagagttggg tgcaccagat
4740 tgccctgagg atggaggttc tgggctgcga ggcacaggac ctctactgac
tcgagcctaa 4800 taaaggaaat ttattttcat tgcaatagtg tgttggtttt
ttgtgtgcgg ccgcaggaac 4860 ccctagtgat ggagttggcc actccctctc
tgcgcgctcg ctcgctcact gaggccgggc 4920 gaccaaaggt cgcccgacgc
ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc 4980 gcagctgcct
gcaggacat 4999 15 14 PRT Artificial Sequence Factor VIII protein 15
Ser Phe Ser Gln Asn Pro Pro Val Leu Lys Arg His Gln Arg 1 5 10
* * * * *