U.S. patent application number 10/216705 was filed with the patent office on 2003-05-22 for recombinant collagens and derived proteins produced by plants, methods of obtaining such and their uses.
This patent application is currently assigned to Meristem Therapeutics S.A.. Invention is credited to Bournat, Philippe, Comte, Jeanne, Exposito, Jean-Yves, Garrone, Robert, Gruber, Veronique, Merot, Bertrand, Ruggiero, Florence.
Application Number | 20030096973 10/216705 |
Document ID | / |
Family ID | 9499306 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096973 |
Kind Code |
A1 |
Gruber, Veronique ; et
al. |
May 22, 2003 |
Recombinant collagens and derived proteins produced by plants,
methods of obtaining such and their uses
Abstract
The invention concerns the use of a recombinant nucleotide
sequence containing a cDNA coding for one or several mammal
collagen chains or derived proteins and elements enabling a plant
cell to produce the collagen chain(s) or derived proteins, coded by
said cDNA, particularly a transcription promoter and terminator
identified by the transcription machinery of the plant cells, for
transforming the plant cells so as to obtain from these cells, or
plants obtained from them, the collagen chain(s) or derived
proteins.
Inventors: |
Gruber, Veronique;
(Chamalieres, FR) ; Exposito, Jean-Yves;
(Bonnefamille, FR) ; Ruggiero, Florence;
(Villeurbanne, FR) ; Comte, Jeanne; (Sainte Foy
les Lyon, FR) ; Garrone, Robert; (Bron, FR) ;
Merot, Bertrand; (Volvic, FR) ; Bournat,
Philippe; (Clermont-Ferrand, FR) |
Correspondence
Address: |
HOFFMANN & BARON, LLP
6900 JERICHO TURNPIKE
SYOSSET
NY
11791
US
|
Assignee: |
Meristem Therapeutics S.A.
|
Family ID: |
9499306 |
Appl. No.: |
10/216705 |
Filed: |
August 9, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10216705 |
Aug 9, 2002 |
|
|
|
09331347 |
Aug 17, 1999 |
|
|
|
09331347 |
Aug 17, 1999 |
|
|
|
PCT/FR97/02331 |
Dec 17, 1997 |
|
|
|
Current U.S.
Class: |
530/356 ;
435/320.1; 435/468; 530/354; 536/23.5; 800/288; 800/295; 800/305;
800/317.3; 800/320.1; 800/320.2 |
Current CPC
Class: |
C07K 14/78 20130101;
A61P 17/02 20180101; A61P 19/00 20180101; C12N 15/8257 20130101;
A61P 25/00 20180101 |
Class at
Publication: |
530/356 ;
536/23.5; 435/320.1; 435/468; 800/288; 800/295; 530/354; 514/2;
800/305; 800/317.3; 800/320.1; 800/320.2; 514/401 |
International
Class: |
A01N 037/18; A61K
038/00; C07H 021/04; A01H 001/00; C12N 015/82; C12N 015/87; A01H
009/00; A01H 011/00; A01H 005/00; C12N 015/00; C12N 015/09; C12N
015/63; C12N 015/70; C12N 015/74; C09H 003/00; C09H 003/02; A61K
038/17; C07K 001/00; C09H 001/00; C07K 014/00; C07K 016/00; C07K
017/00; A61K 031/415; A01N 043/50 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 17, 1996 |
FR |
96/16224 |
Claims
1. Use of a recombinant nucleotide sequence containing firstly a
cDNA coding for one or more mammalian collagen chains or the
derived proteins, and secondly the elements enabling a plant cell
to produce the collagen chain or chains or the derived proteins,
encoded by said cDNA, in particular a promoter and a transcription
terminator recognised by the transcriptional machinery of the plant
cells, for the transformation of plant cells with a view to
obtaining, from these cells, or from the plants obtained from the
latter, the collagen chain or chains or the derived proteins.
2. Recombinant nucleotide sequence, characterised in that it
contains firstly the sequence coding for one or more collagen
chains or the derived proteins, and secondly the elements enabling
a plant cell to produce the collagen chain or chains or the derived
proteins encoded by said sequence, in particular a promoter and a
transcription terminator recognised by the transcriptional
machinery of the plant cells.
3. Vector, in particular a plasmid vector, containing a nucleotide
sequence according to claim 2, inserted at a site that is
non-essential for its replication.
4. Host cell, in particular any bacterium such as Agrobacterium
tumefaciens, transformed by a vector in accordance with claim
3.
5. Method of obtaining one or more collagen chains or the derived
polypeptides, characterised in that it entails: transformation of
plant cells, in particular using a host cell according to claim 4,
itself transformed by a vector according to claim 3, such as to
incorporate into the genome of these cells a recombinant sequence
in accordance with claim 2, optionally, obtaining transformed
plants from the above-mentioned transformed cells, collecting the
collagen chain or chains or the derived recombinant polypeptides
produced in said above-mentioned transformed cells or plants in
particular by extraction, possibly followed by purification.
6. Plants, plant extracts or parts of plants, in particular leaves
and/or fruits and/or seeds and/or plant cells, genetically
transformed, characterised in that they contain one (or more)
recombinant nucleotide sequence(s) according to claim 2,
incorporated in stable manner into their genome, these plants being
chosen in particular from among colza, tobacco, maize, pea, tomato,
carrot, wheat, barley, potato, soybean, sunflower, lettuce, rice,
alfalfa and beetroot.
7. Collagen chain or derived protein characterised in that it is
obtained according to the method of claim 5.
8. Collagen or derived protein, characterised in that it is
obtained in accordance with the method of claim 5.
9. Product, in particular gelatin, characterised in that it is
obtained from collagen chains, collagen or their derived proteins
in accordance with claims 7 or 8.
10. Plants, plant extracts or parts of plants, in particular leaves
and/or fruits and/or seeds and/or plant cells, genetically
transformed, characterised in that they contain collagen chains,
collagen or the derived proteins in accordance with claims 7 or 8,
these plants being chosen in particular from among colza, tobacco,
maize, pea, tomato, carrot, wheat, barley, potato, soybean,
sunflower, lettuce, rice, alfalfa and beetroot.
11. Use of plants, plant extracts or parts of plants in accordance
with claim 6 or 10, and/or of products in accordance with claims 7
to 9, to obtain pharmaceutical, medical, odontological, cosmetic or
biotechnological compositions.
12. Biomaterial and pharmaceutical, medical, odontological,
cosmetic or biotechnological composition, characterised in that
they comprise plants, plant extracts or parts of plants in
accordance with claim 6 or 10 and/or products according to claims 7
to 9.
Description
[0001] The present invention relates to the production by plants of
recombinant collagens, in particular Type 1 homocatenary collagen
[.alpha.I (I).sub.3] and other polypeptide derivatives, and their
uses.
[0002] Patent WO 9603051 is known to the prior art which concerns
the production of collagen in the milk of transgenic animals.
[0003] Collagen is an extracellular fibrous animal protein, widely
found in animal tissues (recently detected in some mushrooms also).
Some organs contain high quantities thereof: skin (at the dermis),
tendons, bones. It is in fact a polymer whose remarkable properties
are due both to the triple coil characteristics of some domains of
its molecule and to the regularity of its supramolecular
assemblies. It is involved in the organisation of the extracellular
matrix grouping together twenty or so different molecules, called
"types" that are identified by Roman figures (currently from I to
XIX). The characteristic triple coil domain is formed by the
coiling of three peptides, or .alpha. chains, arranged in a left
wound coil and derived from a single conformation, the .alpha. coil
of collagen. This specific conformation results from the repetition
of a triplet of amino acids, Gly-X-Y in which X is frequently
represented by proline and Y by hydroxyproline. These amino acids
give stability to this type of coil. In a collagen molecule, the
three .alpha. chains (identified by an index in Arabic figures)
arranged in a right wound supercoil may be identical (.alpha.1 (or
alpha1)), of two types (.alpha.1 and .alpha.2) or all different
(.alpha.1, .alpha.2, .alpha.3). Collagen molecules therefore
comprise helical domains (or collagen domains) and non-helical
domains. They associate to form homo or heterotype polymers. Thus
the collagen fibrils which form the essential part of the dermis
are mostly made up of type I collagen [.alpha.1 (I).sub.2 .alpha.2
(I)] associated with collagens of type III [.alpha.1 (III).sub.3),
of type V [.alpha.1 (V).sub.2 .alpha.2 (V)] and covered by
collagens of type XII (.alpha.1 (XII).sub.3) and/or XIV [.alpha.1
(XIV).sub.3]. Variants may exist: for example a homocatenary
collagen of type 1 [.alpha.1 (I).sub.3] is found in embryo tissues.
During the biosynthesis of collagen some prolyl and lysil residues
are hydroxylated, an addition of galactose possibly supplemented
with a glucose may be made on some hydroxyl residues and
conventional N and O glycosylations may occur on the non-helical
domains. The recognition of the three chains forming a molecule and
the start of their assembly are under the control of the C-terminal
end (C-propeptide). Type I collagen undergoes enzymatic cutting of
its non-helical ends subsequent to the previously cleaved peptide
signal, the N and C-terminal propeptides are excised during
maturation of the collagen leaving short, non-helical terminal
extensions (telopeptides). It is these cleaved molecules which
group together in arranged polymers (collagen fibrils) and which
during the course of time undergo cross-linking via the
hydroxylysyl residues of a molecule and the telopeptides of an
adjacent molecule. The mechanical and biological properties of
collagen have long been put to use; when cross-linked in
irreversible manner (tanning process) it gives leather; when
denatured by heating it gives rise to gelatin and glues. But it was
only in the last decade that collagen truly provided biomaterials
for pharmaceutical use (haemostatic compresses, sponges, dressings
in particular healing dressings), medical use (prostheses such as
cardiac valves, tendons and ligaments, skin substitutes, filling
agents), odontological use (gum implants) and cosmetic use
(additive, microcontainer for perfumed substances).
[0004] Later improved knowledge of this protein and of purification
methods have led to the preparation of bovine and human placenta
collagens in pre-defined form: gel, sponge, powder, suture and
microsphere for example. Engineering of the extracellular matrices
is also applied to the production of organoids containing
transfected cells for gene therapy applications for example. The
collagen mainly used is type I (generally associated with type III)
for reasons of abundant availability and low purification costs,
and the main sources have been bovine (skins unfit for tanning)
ovine (hide and intestine) and human (placenta). This last source
was exclusively reserved for pharmaceutical or medical
applications.
[0005] Although the very useful mechanical and biological
properties of collagen are clearly recognised, the use of this
protein is questioned owing to the possible risks of contamination
by non-conventional infectious agents. While the risks raised by
bacterial or viral contamination can be fully controlled, this is
not the case for those associated with agents of prion type. These
infectious agents which appear to have a protein nature take part
in the development of degenerative animal encephalopathy (sheep
trembling disease, bovine spongiform encephalopathy) and human
encephalopathy (Creutzfeld-Jacob disease, Gerstmann-Straussler
syndrome, kuru). The long time of onset for their possible
expression means that formal controls are difficult to conduct.
These risks have already virtually frozen all marketing of human
collagen, and the regulations laid down for the animal collagens
concerned complicate purification processes and increase their
cost.
[0006] Faced with these difficulties and radical deterioration in
the image of mammalian collagen, one solution is the production of
recombinant collager which could be easily purified in a system
that is not likely to give rise to pathogenic risks for man and
whose industrial cost is not prohibitive. The inventors have
therefore discovered and developed a production of collagen in
plant species. For example we have been able to produce a human
collagen of type I. Its molecule comprises a long, unbroken triple
coil and is sparingly immunogenic after purification. The inventors
have for example caused expression of the .alpha.1 (I) chain in
order to obtain .alpha.1 (I).sub.3 homocatenary molecules similar
to those which exist in some tissues, especially embryo
tissues.
[0007] Animal cells are, in theory, more adapted to the expression
of mammalian genes. Their use however raises problems of protein
maturation. The enzymatic equipment which carries out
post-translational maturation differs from one tissue, organ or
species to another. For example, it has been reported that
post-translational maturation of a plasma protein may differ
according to whether it is obtained from human blood or produced by
a recombinant cell such as Chinese hamster ovary cells or in the
milk of a transgenic animal. Moreover, the low levels of expression
obtained with mammalian cells involve large volumes of in vitro
cultures at high cost. With the production of recombinant proteins
in the milk of transgenic animals (mice, ewes and cows) it is
possible to reduce production costs and to overcome problems of
expression level. However problems remain in respect of ethics and
viral and subviral contamination (prions).
[0008] For these reasons, the transgenesis of mammalian genes in a
plant cell could offer a pathway for the production in great
quantities of new recombinant proteins at reduced production cost
and with no risk of viral or subviral contamination. In 1983,
several laboratories discovered that it is possible to transfer a
heterologous gene into the genome of a plant cell, and to
regenerate transgenic plants from these genetically modified cells.
All the plants cells then have the genetically modified character
transmitted to their descent by sexual fertilisation.
[0009] Through this work several teams have focused their attention
on the production of recombinant mammalian proteins in plant cells
or in transgenic plants (Barta et al., 1986; Marx et al., 1982).
One of the first truly significant results in this area was the
production of antibodies in transgenic tobacco plants. To express a
heterologous protein in the grain, where plants stock proteins,
Vandekerckhove's team fused the sequence coding for leu-enkephaline
to the gene coding for the 2S albumin of Arabidopsis thaliana. With
this construct, transgenic Arabidopsis plants were produced which
express leu-enkephaline specifically in the grains at expression
levels in the region of 0.1% of total proteins. In 1990, the human
albumin serum gene was transferred to tobacco and potato cells.
Irrespective of the origin of the peptide signals (human or plant),
levels of human albumin serum in the region of 0.02% of total
proteins were obtained in particular in potato plant leaves. Other
recombinant mammalian proteins have also been produced in plants:
the surface antigen of hepatitis B, interferons, an
anti-Streptococcus mutans mouse antibody, a caries agent, fragments
of anti-cancer cell scFV antibodies, an anti-herpes antibody,
cholera toxin and the human epidermal growth factor (E.G.F.). All
this research has led to showing that the production of recombinant
mammalian proteins in plant cells is possible, and that the
mechanisms of protein synthesis from DNA sequences are similar in
animal cells and plant cells. Numerous differences exist
nonetheless between plant and animal cells, in particular in
respect of the maturation of polymannosodic glycanns into complex
glycanns, or at the cleavage sites of the peptide signals which
means that it is not possible to guarantee that active or
sufficiently active mammalian proteins can be obtained through
plant cell transformation.
[0010] The inventors have discovered that the use of plant cells,
transformed by an appropriate recombinant nucleotide sequence, can
lead to obtaining collagen, in particular recombinant type I
homotrimeric collagen [.alpha.1 (I)].sub.3.
[0011] Another purpose of the invention is to provide the tools to
implement such process, in particular new recombinant nucleotide
sequences, cells of genetically transformed plants, plants or parts
of plants (in particular leaves, stalks, fruits, seeds or grains,
roots) that are genetically transformed, and fragments of these
genetically transformed plants or parts of plants.
[0012] A further purpose of the invention is to provide new
collagens produced by plants, in particular type I homotrimeric
collagen [.alpha.1 (I)].sub.3.
[0013] A further purpose of the invention is to provide new protein
compositions able to be used for the implementation or supply of
pharmaceutical, medical, odontological, cosmetic, biochemical or
industrial compositions.
DETAILED DESCRIPTION OF THE INVENTION
[0014] The invention concerns:
[0015] the use of a recombinant nucleotide sequence containing
firstly a cDNA coding for one or more chains of mammalian collagen,
in particular the one whose cDNA is that of the .alpha.1 collagen
chain, or the derived proteins (by derived protein is meant any
protein having at least 70% homology to the reference protein, in
particular at least 80%, for example between 85 and 100% homology),
and secondly the elements enabling a plant cell to produce the
chain or chains of collagen or the derived proteins encoded by said
cDNA, in particular a promoter and a transcription terminator
recognised by the transcriptional machinery of the plant cells, for
the transformation of plant cells with a view to obtaining from
these cells or plants obtained from the latter, the chain or chains
of collagen or the derived proteins, possibly in triple coil
form,
[0016] a recombinant nucleotide sequence characterised in that it
contains firstly the sequence coding for one or more chains of
mammalian collagen, in particular that of the .alpha.1 collagen
chain, or the derived proteins, and secondly the elements enabling
a plant cell to produce the chain or chains of collagen or the
derived proteins encoded by said sequence, possibly in triple coil
form, in particular a promoter and a transcription terminator
recognised by the transcriptional machinery of the plant cells,
[0017] a vector, in particular a plasmid, containing a nucleotide
sequence of the invention inserted at a site that is non-essential
for its replication,
[0018] a host cell, in particular any bacterium such as
Agrobacterium tumefaciens, transformed by a vector of the
invention,
[0019] a method of obtaining one or more collagen chains or derived
polypeptides, optionally in triple coil form, characterised in that
it entails:
[0020] the transformation of plant cells, in particular using a
host cell of the invention, itself transformed by a vector of the
invention, such as to incorporate into the genome of these cells a
recombinant sequence of the invention,
[0021] optionally obtaining transformed plants from the
above-mentioned transformed cells,
[0022] collecting the recombinant chain or chains of collagen or
derived polypeptides produced in said above-mentioned transformed
plant cells, in particular by extraction, optionally followed by
purification,
[0023] a plant, plant extract or plant part, in particular
genetically transformed leaves and/or fruits and/or seeds and/or
plant cells, characterised in that it contains one (or more)
recombinant nucleotide sequence(s) of the invention incorporated
into their genome in stable manner, these plants being chosen in
particular from colza, tobacco, maize, pea, tomato, carrot, wheat,
barley, potato, soybean, sunflower, lettuce, rice, alfalfa and
beetroot.
[0024] one or more collagen chains or derived proteins
characterised in that it is obtained in accordance with the method
of the invention,
[0025] a collagen (in particular a collagen of type 1, II, III, IV
or V) or a derived protein, characterised in that it is obtained in
accordance with the method of the invention,
[0026] a product, in particular gelatin, characterised in that it
is obtained from the collagen chains, collagen or their derived
proteins of the invention,
[0027] a plant, plant extract or plant part, in particular
genetically transformed leaves and/or fruits and/or seeds and/or
plant cells, characterised in that they contain collagen chains,
collagen or the derived proteins according to the invention, these
plants being chosen in particular from colza, tobacco, maize, pea,
tomato, carrot, wheat, barley, potato, soybean, sunflower, lettuce,
rice, alfalfa and beetroot.
[0028] the use of plants, plant extracts or plant parts of the
invention, and/or proteins (collagen chains, collagen or derived
proteins) of the invention to obtain pharmaceutical, medical,
odontological, cosmetic or biotechnological compositions,
[0029] a Biomaterial and a pharmaceutical, medical, odontological,
cosmetic or biotechnological composition, characterised in that it
comprises plants, plant extracts, plant parts or collagen chains,
collagen or the derived protein of the invention,
[0030] One pharmaceutical composition of the invention particularly
comprises any composition of the invention forming (or entering
into the production of) a composition enabling the prevention or
treatment of any pathology connected with collagen malfunctioning,
or a compress for wound healing, a haemostat dressing, bedsore
dressing, haemostat powder; or a dressing for burns.
[0031] One medical composition of the invention comprises in
particular any composition of the invention forming (or entering
into the production of) a corneal coating device, a coagulant film
for organ resection (liver in particular), a filling material for
the prevention of adhesions and fistulae, a composition for the
fabrication of vascular and cardiac prostheses(valves), a
guide-duct for nerve regeneration, bone and intra-body filling
material, a container-releaser of active substances (hormones,
growth factors, antibiotics, anticancer drugs, anti-inflammatories
for example), a compression device (for example to reduce urinary
incontinence), a skin substitute, surgical suture thread, an
injectable material for cosmetic surgery (filling of skin
depressions or face remodelling for example).
[0032] One odontological composition of the invention comprises in
particular any composition of the invention forming (or entering
into the production of) a gum dressing or a filling material.
[0033] One cosmetic composition of the invention comprises in
particular any composition of the invention forming (or entering
into the produciton of) a preparation additive (creams, ointments,
make-up, liniments).
[0034] One medical composition of the invention comprises in
particular any composition of the invention forming (or entering
into the production of) a system for: covering cell culture dishes
and bottles.
[0035] The invention also relates to a product, in particular
gelatin, characterised in that it is obtained from collagen chains,
collagen or their derived proteins according to the invention.
[0036] Gelatin is normally prepared from collagen by heating animal
tissues (in particular skin and bones) in water and then drying
(Parkany M, 1984). This preparation destroys the secondary
structure of collagen and therefore leads to major changes in the
product's solubility and mechanical properties. Gelatin is the
major constituent of glue. In cold water, it swells and is
insoluble. In warm water it dissolves to give a very viscous
solution which gels after cooling when the gelatin content is more
than 1%. To prepare surgical prostheses, solutions containing 10 to
35% gelatin are used.
[0037] Gelatin's property of being soluble in warm water makes it
useful for numerous food and industrial applications. It is often
prepared in powder from or in thin sheets. Depending upon the
desired mechanical properties, glycerol, sorbitol or cross-linking
agents may for example be added during the preparation of gelatin
slabs.
[0038] Gelatin is also used in the biomedical sphere, for sponges
for example.
[0039] Advantageously, the recombinant nucleotide sequences of the
invention contain one (or more) sequence(s) coding for a peptide
responsible for addressing recombinant polypeptides to a determined
compartment of the plant cell, in particular into the endoplasmic
reticulum or the vacuoles, or even outside the cell in the
pectocellulose wall, or in the extracellular space also called the
apoplasm.
[0040] Among the transcription terminators able to be used for the
transformation of plant cells under the present invention, mention
may be made of the polyA 35S terminator of the Cauliflower Mosaic
Virus (CaMV), or the polyA Nos terminator which corresponds to the
3' region non-coding for the nopaline synthase gene of the Ti
plasmid of Agrobacterium tumefaciens, nopaline strain.
[0041] In this respect, the object of the invention is any
recombinant nucleotide sequence such as described above containing,
upstream from said cDNA or its derived sequence, the polyA 35S
terminator of CaMV or the polyA NOS terminator of Agrobacterium
tumefaciens.
[0042] Among the transcription promoters able to be used for the
transformation of plant cells under the present invention, the
following may be cited:
[0043] the 35S (P35S) promoter, or advantageously the double
constitutive 35S promoter (Pd35S) of CaMV, these promoters allowing
expression of the recombinant polypeptides of the invention in the
entire plant obtained from cells transformed according to the
invention, and are described in the article by Kay et al.,
1987,
[0044] the PCRU promoter of the radish cruciferin gene allowing the
expression of the recombinant polypeptides of the invention solely
in the seeds (or grains) of the plant obtained from the cells
transformed according to the invention, and described in the
article by Depigny-This et al., 1992?
[0045] the PGEA1 and PGEA6 promoters corresponding to the 5' region
non-coding for the genes of the reserve protein of grains, GEA1 and
GEA6 respectively, of Arabidopsis thaliana (Gaubier et al., 1993)
and allowing specific expression in the grains,
[0046] the PSP super-promoter chimeric promoter (Ni M. et al.,
1995), formed by the fusion of triple repetition of a
transcriptional activator element of the promoter for the octopine
synthase gene of Agrobacterium tumefaciens, of a transcriptional
activator element of the promoter for the mannopine synthase gene,
and of the mannopine synthase promoter of Agrobacterium
tumefaciens,
[0047] the actin promoter of rice followed by the actin intron of
rice (APR-AIR) contained in the pActI-F4 plasmid described by
McElroy et al. (1991),
[0048] the HMGW (High Molecular Weight Glutenine) promoter of
barley (Anderson O. D. et al., 1989),
[0049] the promoter of the .gamma.zein gene of maize (P.gamma.zein)
contained in the p.gamma.63 plasmid described by Reina et al.,
(1990), and allowing expression in maize seed albumen.
[0050] In this respect, the object of the invention is any
recombinant nucleotide sequence such as described above, containing
upstream from said cDNA or its derived sequence the double 35S
constitutive promoter (Pd35S) of CaMV, or the PCRU promoter of the
radish cruciferin gene, or the PGEA1 or pGEA6 promoters of
Arabidopsis thaliana, or the PSP super-promoter of Agrobacterium
tumefaciens, or the APR-AIR promoter of rice, the HMGW promoter of
barley or the p.gamma.zein promoter of maize.
[0051] The sequences coding for an addressing peptide used for the
present invention may be of plant, human or animal origin.
[0052] Among the sequences coding for an addressing peptide of
plant origin, the following may be cited:
[0053] the nucleotide sequence of 69 nucleotides (given in the
following examples) coding for the prepeptide (peptide signal) of
23 amino acids of sporamine A in sweet potato, this peptide signal
allowing entry of the recombinant polypeptides of the invention
into the secretion system of the plant cells transformed according
to the invention (namely, chiefly in the endoplasmic
reticulum).
[0054] the nucleotide sequence of 42 nucleotides (given in the
following examples) coding for the vacuole addressing N-terminal
propeptide of 14 amino acids of sweet potato sporamine A, allowing
the accumulation of the recombinant polypeptides of the invention
in the vacuoles of the plant cells transformed according to the
invention,
[0055] the nucleotide sequence of 111 nucleotides (given in the
following examples) coding for the prepropeptide of 37 amino acids
of sporamine A made up of, from the N-terminal part towards the
C-terminal part, the 23 amino acids of the above-mentioned peptide
signal, followed by the 14 amino acids of the above-mentioned
propeptide, this prepropeptide permitting entry of the recombinant
polypeptides of the invention into the secretion system and their
accumulation in the vacuoles of the plant cells transformed
according to the invention,
[0056] the three above-mentioned sequences being described in the
articles by Murakami et al., 1986 and Matsuoka et al., 1991,
[0057] the carboxyterminal propeptide of barley lectin described in
particular in the articles by Schroeder et al., 1993 and Bednarek
et al., 1991,
[0058] and the PRS (Pathogenesis Related Protein, Cornelissen et
al. 1986) permitting secretion.
[0059] Mention may also be made, among the sequences coding for an
addressing peptide, of that coding for the KDEL, SEKDEL and HDEL
peptides and allowing addressing in the endoplasmic reticulum.
[0060] A further object of the invention is any recombinant
nucleotide sequence such as described above, containing a sequence
coding for all or part of a vacuole-addressing peptide, in
particular that of sporamine A in sweet potato, this sequence
coding for a vacuole-addressing peptide being situated, in said
recombinant nucleotide sequence, between the sequence coding for a
peptide signal and that coding for said cDNA or its derived
sequence, such that the first N-terminal amino acid of the
vacuole-addressing peptide is bound to the last C-terminal amino
acid of the peptide signal, and that the last C-terminal amino acid
of said addressing peptide is bound to the first N-terminal amino
acid of the polypeptide encoded by said cDNA or its derived
sequence, in the protein encoded by said recombinant nucleotide
sequence.
[0061] Yet a further object of the invention is any recombinant
nucleotide sequence such as described above, containing a sequence
coding for all or part of a vacuole-addressing peptide, in
particular that of barley lectin, this sequence coding for a
vacuole-addressing peptide being situated, in said recombinant
nucleotide sequence, downstream from the sequence coding for said
cDNA or its derived sequence, such that the first N-terminal amino
acid of the vacuole-addressing peptide is bound to the last
C-terminal amino acid of the polypeptide encoded by said cDNA or
its derived sequence, in the protein encoded by said recombinant
nucleotide sequence.
DETAILED DESCRIPTION OF THE FIGURES
[0062] FIG. 1: Immunotransfer showing an example of positive
results derived from the screening of plants transformed by
constructs pBIOC706 (denoted 706, plant n.sup.o45, lanes 2,3) and
pBIOC707 (denoted 707, plant n.sup.o2, lanes 4,5). These results
are to be compared with those obtained with the non-transformed
control plants (lanes 6, 7). Lane 1 shows the electrophoretic
migration of the control collagen I: the band corresponding to
.alpha.2 (I) migrates at the 116 KDa band of standard molecular
weights, the .alpha.1 (I) band migrates slightly overhead. Lanes 2,
4, 6 correspond to the extraction supernatants in an acid medium,
lanes 3, 5 and 7 correspond to the residues. Construct pBIOC706
generates a major band recognised by the anti-collagen I antibody,
migrating exactly at the level of the control .alpha.1 (I) band
(lane 1): construct pBIOC707 generates a major band migrating at
140 KDa. It appears however that acid medium extraction is
incomplete since the same bands are found in the corresponding
extraction residues (lane 3 for pBIOC706, lane 5 for pBIOC707). The
lanes corresponding to the control plant (lanes 6 and 7) are
negative.
[0063] FIG. 2: Immunotransfer showing some examples of positive
plants transformed by constructs pBIOC706 (plant n.sup.o40: lanes
2, 3 and n.sup.o45: lanes 4, 5) and pBIOC707 (plant n.sup.o1: lanes
6, 7; plant n.sup.o2: lanes 8,9; plant n.sup.o14: lanes 10, 11)
extracted in a neutral medium. Lane 1 shows the electrophoretic
migration of the control collagen I: the band corresponding to
.alpha.2 (I) migrates at the 116 KDa band of standard molecular
weights, band .alpha.1 (I) migrates slightly above. Lanes 2, 4, 6 8
and 10 correspond to the extraction supernatants in a neutral
medium, lanes 3, 5, 7, 9 and 11 correspond to the residues. Plants
40 and 45 (construct pBIOC706) generate two major bands recognised
by the anti-collagen I antibody, migrating respectively at the
.alpha.1 (I) control band (lane 1) and at 140 KDa. Plants 1, 2 and
14 (construct pBIOC707) generate 2 major bands migrating
respectively at 140 KDa and 160 KDa. Extraction in a neutral medium
appears to be complete since no band is found in the corresponding
extraction residues (lanes 3 and 5 for pBIOC706, lanes 7, 9 and 11
for pBIOC707). The lanes corresponding to the control plant (not
shown) are negative. All the positive plants display the same
electrophoretic tracing.
[0064] FIG. 3: Immunotransfer showing changes in the
electrophoretic tracings of positive plants transformed by
constructs pBIOC707 (panel A and B) and pBIOC706 (panel C) in the
presence (+) or absence (-) of a reducing agent (DTT). Lanes 1 and
8 show the electrophoretic tracing of the collagen I control. Panel
A: plant n.sup.o2 extracted in an acid medium. The single band
after reduction (lane 2) observed after extraction in an acid
medium shows slightly faster migration in the absence of a reducing
agent (lane 3). This result suggests that the band observed
corresponds to the .alpha.1 (I) chain comprising the N-propeptide
(presence of intrachain disulfide bonds. Panel B: plant n.sup.o2
(lanes 4 and 5) and plant n.sup.o1 (lanes 6 and 7) extracted in a
neutral medium. In the absence of a reducing agent (lanes 5 and 7)
the upper band, migrating at 160 KDa in the presence of a reducing
agent (lanes 4 and 6) is found at the .gamma. bands (3 associated
.alpha. chains). The band migrating at 140 KDa in the presence of a
reducing agent, migrates slightly faster in the absence of a
reducer as seen in panel A. Panel C: plant n.sup.o40 (lanes 9 and
10) and plant n.sup.o45 (lanes 11 and 12) extracted in a neutral
medium. Here again, only the migration of the upper band undergoes
change in the absence of a reducing agent and is found as a major
band, as seen for panel B, at the level of bands .gamma.. These
results indicate that the upper band for each of the constructs
pBIOC706 and pBIOC707 comprises the C-propeptide. Therefore, the
interchain disulfide bonds made between the C-propeptides of the
native molecule were able to be made in the plant. Bonding of the
C-propeptides is known to allow correct arrangement of the 3 chains
and thereby initiate the formation of the triple coil. The lower
bands (140 KDa for construct pBIOC707 and 120 KDa for construct
pBIOC706) would therefore appear to result from the cleavage of the
C-propeptide domain of the recombinant .alpha.1 (I) chain. This
cleavage is an important stage in the maturation of native collagen
since it is necessary for polymerisation into collagen fibre.
[0065] FIGS. 4 and 5: show the fragments used by the
pBIOC21-collagen constructs.
[0066] FIG. 6:
[0067] Part A: Trypsin digestion of collagen extracted from plants
transformed with construct pBIOC76(plant 45) analysed by
electrophoresis on 6% acrylamide gel. Lane 1: non-digested
collagen. Lane 2: collagen digested by trypsin at 25.degree. C.,
the band corresponding to collagen is still present denoting the
triple coil structure of the extracted collagen. Lane 3: collagen
denatured by heat (50.degree. C., 20 minutes) then digested by
trypsin, the band corresponding to the collagen disappears denoting
the efficiency of trypsin when collagen is denatured.
[0068] Part B: Micrograph of a replica obtained after shade
rotation of the collagen purified from plant 45. The collagen
molecules are seen in rod form 280 to 300 nm long and 1.4 nm in
diameter, characteristic of the triple coil folding of the entire
central domain of collagen I. Magnification: .times.75 000.
[0069] FIG. 7: ADEFG construct, complete pro.alpha.1 (I): protein
and nucleic sequence.
PREPARATION I
Cloning of cDNA Coding for the Entire Human pro.alpha.1 (I)
Chain
[0070] 1/Preparation of a MG-63 cDNA Bank
[0071] The MG-63 cells (N.sup.oATCC-CRL 1427) are derived from a
human osteosarcoma. Approximately 28 million MG-63 cells cultivated
in DMEM medium (Dulbecco's modified Eagle medium, Sigma.TM.) are
detached from the culture dishes by treatment with 0.25% trypsin,
0.05% EDTA (Ethylenediaminetetra-acetic acid). The cells are
centrifuged at 1000 g for 10 min at 4.degree. C., and the cell
residue is treated with the RNA-Plus.TM. kit (BIOPROBE.TM. Systems)
to purify total RNA. This manipulation was conducted following the
instructions given by BIOPROBE.TM.. A quantity of 950 .mu.g total
RNA was purified in this way.
[0072] The poly(A)+ RNAs were separated by chromatography on an
oligo-dT cellulose column (Boehringer Mannheim) following the
technique described by Aviv et al., (1972). A 0.1 N soda suspension
containing 0.2 g oligo dT cellulose was deposited in a column. The
column was washed with 3 ml sterile milli-Q water, then with 15 ml
of 1.times.carrier buffer (20 mM Tris-Cl, pH 7.6; 0.5 M NaCl; 1 mM
EDTA, pH8; 0.1% sodium lauryl sarcosinate). The effluent of the
column equilibrated in this manner then has a pH of less than
8.
[0073] To a solution of total RNA (950 .mu.g) incubated 5 min at
65.degree. C. is added one volume of 2.times.carrier buffer (40 mM
Tris-Cl, pH 7.6; 1 M NaCl; 2 mM EDTA, pH 8; 0.2% sodium lauryl
sarcosinate). This mixture is cooled to room temperature before
being deposited in the oligo dT cellulose column. The eluate is
collected, incubated 5 min at 65.degree. C., cooled to room
temperature and passed again through the oligo-dT cellulose column.
The column is then washed with 10 ml of 1.times.carrier buffer (20
mM Tris-Cl, pH 7.6; 0.5 M NaCl; 1 mM EDTA, pH 8; 0.1% sodium lauryl
sarcosinate), which enables RNA poly(A)- elution, the RNA poly(A)+
remaining fixed to the dT cellulose matrix at their poly-adenylated
3' end. To the oligo dT-RNA poly(A)+ column are then added 2 ml of
detachment buffer (10 mM Tris-Cl, pH 7.6; 1 mM EDTA, pH 8; 0.05%
lauryl sulfate), and the eluate of RNA poly(A)+ is adjusted to 0.3
M in sodium acetate, pH 5.2 To this solution are added 2.2 volumes
of 100% ethanol, and the RNA poly(A)+ are precipitated for 24 hours
at -20.degree. C.
[0074] After precipitation, the solution is centrifuged at 12000 g
for 30 min at 4.degree. C. The residue of RNA poly(A)+ is washed
with 10 ml 70% ethanol, lyophilised and collected with 50 .mu.l
sterile milli-Q water. The concentration of this poly(A)+ RNA
fraction is 1.2 mg/ml.
[0075] To form the cDNA bank, we used kits marketed by Amersham.
These kits were:
[0076] cDNA synthesis system plus, RPN 1256
[0077] cDNA rapid adaptator ligation module, RPN 1712
[0078] cDNA rapid cloning module, RPN 1716
[0079] lambda-DNA in vitro packaging module, RPN 1717
[0080] Each stage was conducted following the manufacturer's
protocol.
[0081] The RNA poly(A)+ solution was incubated 5 min at 65.degree.
C., then cooled in ice to remove the secondary structures present
in some RNAs. This solution is divided into two fractions, and
after pairing either by dT primer (12-18 mer) or random primers
(hexanucleotides) with the RNA poly(A)+, synthesis of the first DNA
strand (complementary to the RNA matrix) is conducted by reverse
transcriptase. Ribonuclease H and DNA polymerase I of Escherichia
coli are added to the RNA/DNA hybrid mixture. Ribonuclease H allows
random cutting of the RNA strand in a RNA/DNA complex. DNA
polymerase adds nucleotides to the free --OH 3' ends created by
ribonuclease H through its 5'-3' polymerase activity. The 5'-3'
exonuclease activity of DNA polymerase I allows removal of the
ribonucleotide at 5' and to continue the synthesis of the second
cDNA strand. After inactivating the enzymes by treatment at
70.degree. C. for 10 min, the addition of T4 DNA polymerase yields
blunt-ended double strand DNAs through its 3'-5' exonuclease
activity. EcoRI adaptators are then ligated to the blunt ends of
the cDNAs (complementary DNA). The free adaptators are removed on a
column supplied by Amersham.TM., and the EcoRI-adapted cDNAs are
ligated in the EcoRI site of the MOSElox lambda vector. After
ligation, in vitro encapsidation is conducted, which is the last
stage before obtaining the cDNA bank. Approximately 800000
independent cDNA clones are obtained in this manner.
[0082] 2/Cloning of cDNA Coding for the Human pro.alpha.1 (I)
Chain.
[0083] a/Preparation of ER1647 Bacteria able to be Phage
Infected.
[0084] This bacterial strain is recD-, mrc A-(Amersham.TM.). These
bacteria are held in 1.5% L-broth/agar dishes (L-broth: per litre,
10 g tryptone, 5 g yeast extracts, 10 g NaCl) supplemented with
tetracycline (50 .mu.g/ml). One ER1647 colony is seeded in 10 ml of
L-broth/tetracycline (50 .mu.g/ml), and the culture is made under
stirring at 37.degree. C. for 8 hours. The ER1647 culture is then
centrifuged at 4.degree. C. for 10 min at 3000 g, and the bacterial
residue is re-suspended in 2 ml of cold 10 mM MgSO4.
[0085] b/Preparation of Nitro-cellulose Replicas:
[0086] For screening, 4 dishes (12.times.12 cm) 1.5% L-broth/agar
of 25000 independent cDNA clones are made. For this purpose, 25000
phages from the cDNA bank are added to 250 .mu.l of E1647 bacteria
treated with 10 mM MgSO4. They are incubated at 37.degree. C. for
15 min, the time needed for efficient infection of the bacteria.
After adding 7 ml of 0.7% L-broth/agarose medium (Sigma.TM.)
maintained in liquid state at 45.degree. C., the set-up is
deposited on culture dishes (12.times.12 cm).
[0087] These dishes are incubated at 37.degree. C. for 7-8 hours,
the time needed for the onset of lysis plaques. They can then be
used for the transfer of DNA from the lysis plaques onto
nitro-cellulose replicas. The nitro-cellulose used is Hybond-C by
Amersham.TM.. For each dish, two replicas are made by simple lysis
plaque/nitrocellulose replica contact. The contact time is 2 min
for the first replica, and 4 min for the second. The DNA of phages
present on the replicas is denatured for 4 min in a solution of 0.5
M soda, 1.5 M NaCl. The soda is then neutralised by two successive
baths of 3 min in a solution of 1.5 M NaCl, 0.5 M Tris-Cl pH 7. The
nitro-cellulose replicas are rinsed in a SSC 2.times.solution (0.3
M NaCl, 30 mM trisodic nitrate), dried on Whatman 3MM paper, and
the denatured phage DNA is fixed on the nitro-celllulose replicas
by incubation for 2 hours at 80.degree. C.
[0088] c/Preparation of Specific Probes of Human Type I
Collagen
[0089] Two synthetic oligonucleotides are used to obtain probes
specific to the pro.alpha.1 (I) chain.
[0090] Oligonucleotide BIOC5, 5'-CTCGGGTTTCCACACGT-3',
complementary sequence to nucleotides 152 to 178 specific to the
pro.alpha.1 (I) chain.
[0091] Oligonucleotide BIOC7, 5'-GCAAGACAGTGATTGAA-3', sequence
4268 to 4274 specific to the chain pro[.alpha.1 (I).
[0092] These oligonucleotides are labelled with 32P, using gamma
P32ATP at 3000 Ci/mmol (Amersham.TM.) and T4 polynucleotide Kinase
(Promega).
1 Labelling conditions, 50 ng BIOC5 or BIOC7 10.0 .mu.l H20 milli-Q
4.5 .mu.l gamma 32PATP, 50 .mu.Cl 5.0 .mu.l T4 Polynucleotide
kinase (10 .mu./.mu.l; Promega TM) 0.5 .mu.l
[0093] This mixture is incubated for 30 min at 37.degree. C. The
reaction is halted by adding 1 ml 0.5 M EDTA, pH 8.
[0094] d/Hybridisation of Nitro-cellulose Replicas
[0095] The nitro-cellulose replicas are deposited in 50 ml of a
prehybridisation solution, and incubated at 50.degree. C. for 15
min.
[0096] Prehybridisation Solution:
[0097] 6.times.SSC (0.3 M NaCl, 90 mM trisodic citrate) 0.1% lauryl
sulfate
[0098] 0.05% sodium pyrophosphate
[0099] 0.02% polyvinypyrolidone
[0100] 0.02% bovine serum albumin
[0101] 0.02% Ficoll 400
[0102] Salmon sperm denatured DNA at 100 .mu.g/ml (Boehringer
Mannheim).
[0103] Both probes BIOC5 and BIOC7 are then added and hybridisation
is conducted for 2 hours at 45.degree. C. After hybridisation, the
nitro-cellulose replicas undergo three successive baths of 15 min
in order to remove aspecific hybridisations.
[0104] First bath: 6.times.SSC (0.9 M NaCl, 90 M trisodic citrate),
0.05% sodium phyrophosphate, 15 min at room temperature.
[0105] Second bath: 3.times.SSC (0.45 M NaCl, 45 mM trisodic
citrate), 0.05% sodium pyrophosphate, 15 min at room
temperature.
[0106] Third bath: 6.times.SSC (0.9 M NaCl, 90 mM trisodic
citrate), 0.05% sodium pyrophosphate, 15 min at 45.degree. C.
[0107] The filters are then deposited on a plastic sheet, wrapped
in a transparent plastic film and exposed to autoradiography at
-80.degree. C. for 24 hours in the presence of a film.
[0108] This operation enabled us to obtain several duplicate
positive clones. Each positive lysis plaque in the two replicas is
collected using a Pasteur pipette and deposited in 1 ml of SM
buffer (100 mM NaCl, 8 mM MgSO4, 50 mM Tris-Cl pH 7.5, 0.01%
gelatin).
[0109] With a second screening it was possible to purify the
different positive clones, the conditions of hybridisation and
washing of the nitro-cellulose replicas being the same as for the
first screening. The clones purified during this second screening
are collected and deposited in 500 .mu.l of SM.
[0110] e/Automatic Sub-cloning of cDNA Clones into Plasmids Using
the cre-1ox System.
[0111] The bacteriophage lambda vector MOSE1ox comprises an
internal plasmid flanked at its two ends by the 1ox sites of 34 bp,
derived from the P1 bacteriophage. Therefore, plasmid sub-clones
may be obtained by infecting a bacterial strain expressing P1 cre
recombinase which recognises the 1ox sequences surrounding the
plasmid internal to the MOSE1ox lambda bacteriophage and which will
enable excision of the plasmid by specific recombination at the 1ox
sequences.
[0112] In our case, we used the bacterial strain BM25.8 which is
lysogenic to P1 and lambda-imm434kan, both these plasmids being
maintained by adding kanamycine (50 .mu.g/ml) and chloramphenicol
(50 .mu.g/ml) to the growth medium of strain BMB25.8.
[0113] In practice, 10 ml of L-broth supplemented with kanamycine
and chloramphenicol (50 .mu.g/ml) are seeded with BM25.8 bacteria
and incubated at 37.degree. C. under shaking. When the DO600 of
this culture is 0.9, incubation is halted and the bacteria can be
stored for 3 days at 4.degree. C.
[0114] An aliquot of the phage suspension of positive cDNA clones
(10 .mu.l) is placed in contact with 200 .mu.l of BM25.8 bacteria,
and the mixture incubated at 37.degree. C. for 15 min in order to
obtain efficient infection. The mixture is then deposited in a 1.5%
L-broth/agar dish supplemented with ampicillin (50 .mu.g/ml), and
the dishes are incubated at 37.degree. C. for 12 hours. The
presence of ampicillin allows selection of those bacteria which
have incorporated a bacteriophage, and more especially those in
which a specific cre-1ox recombination has occurred, the resulting
plasmid having an ampicillin-resistant gene, and the cDNA insert at
the EcoRI cloning site.
[0115] f/Characterization of alpha22 and 1alpha3 cDNA Clones
[0116] Two of the positive complementary DNA clones were given
subsequent use. These are the alpha22 and 1alpha3 cDNA clones.
[0117] To sequence these clones, 3 ml of L-broth supplemented with
ampicillin (50 .mu.g/ml) are seeded either with alpha22 or with
1alpha3. These mixtures are incubated overnight under shaking at
37.degree. C.
[0118] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) which permits
purification of the supercoiled plasmid DNA. This manipulation is
conducted in accordance with the manufacturer's instructions.
Approximately 10 .mu.g of plasmid DNA is purified with this kit if
the plasmid used is the MOSE1ox plasmid.
[0119] The last stage is to sequence the two ends of the alpha22
and 1alpha33 cDNA clones, in order to determine the information
they hold.
[0120] To conduct 2 sequencing reactions, 40 .mu.l DNA, namely 7-8
.mu.g, purified with the Wizard system are denatured by adding 10
.mu.l 2N NaOH and incubated 10 min at room temperature. After
neutralisation through the addition of 12 .mu.l 3 M sodium acetate
pH 5.2, the monocatenary DNA is precipitated through the addition
of 2.5 volumes ethanol 100 and incubation at -20.degree. C. for 30
min. After precipitation, the DNA is centrifuged at 4.degree. C.
for 10 min at 12 000 g, washed with 1 ml ethanol 70, freeze dried
and collected in 20 .mu.l milli-Q water.
[0121] The sequencing reactions were conducted with the "T7
sequencing" kit (Pharmacia) which uses the chain termination
technique and T7 DNA polymerase. The radio-element is
[.alpha.-35S]-dATP (Amersham.TM.) at 1350 Ci/mmol. The sequencing
reactions were conducted following the recommendations made by the
manufacturer.
[0122] Principle. After pairing a primer on a monocatenary DNA
matrix, an elongation reaction is conducted with T7 DNA polymerase
in the presence of dGTP, dTTP, dCTP and 35-SdATP. With the addition
of an excess of the 4 cold dNTPs, and of ddATP (dideoxyadenosine
triphosphate) or of ddGTP or ddCTP or ddTTP, it is possible to
conduct 4 termination reactions separately. When a ddNTP is
incorporated, the absence of the hydroxyl group blocks the
elongation reaction.
[0123] In our case, the primers used are the oligonucleotides T7
gene 10 and T7 terminator (Amersham.TM.) which are localised either
side of the alpha22 and 1alpha33 cDNA clones.
2 T7 gene primer, 5'-TGAGGTTGTAGAAGTTCCG-3' T7 terminator primer,
5'-GCTAGTTATTGCTCAGCGG-3'
[0124] Analysis of the sequences is conducted on
polyacrylamide-urea gel (6%-7M).
[0125] Sequencing gel.
[0126] The initial solution is: 39.6 g urea, 8.25 ml 10.times.TBE
(0.9 M Tris borate, 20 mM EDTA, pH 8), 12.32 ml 40% acrylamide (38
g acrylamide, 2 g bis-acrylamide, to final volume 82.5 ml milli-Q
water).
[0127] After dissolution of the urea, 400 .mu.l of 10% ammonium
persulfate and 66 .mu.l TEMED (N N, N', N'-tetramethyl-ethylene
diamine) are added and the gel is poured. After polymerisation, the
gel is preheated for 30 min at 60 kW. The samples are then
deposited and subjected to separation under a power of 60 kW. After
electrophoresis, the gel is transferred onto Whatman 3 MM paper,
vacuum dried for 30 min at 80.degree. C., and subjected to direct
autoradiography at ambient temperature. On reading the sequences it
was confirmed that the alpha22 and 1alpha3 cDNA clones code for the
human pro.alpha.1 (I) chain.
[0128] More precisely, the 1alpha3 cDNA clone comprises 83 bp of
the untranslated 5' part and the first 1920 bases coding for the
human pro.alpha.1 (I) chain. The alpha22 cDNA clone comprises the
sequence coding for amino acids 171 to 1454 of the human
pro.alpha.1 (I) chain and approximately 500 bp of the untranslated
3' region.
[0129] The conformity of the gene obtained was verified in relation
to described sequences (LI S-W, 1994).
PREPARATION II
Cloning DNA Fragments Required for Producing the Constructs of the
Invention
[0130] 1/Fragment A
[0131] Fragment A has 4 nucleotides (-4 to -1) upstream from the
initiator codon of ATG translation, the entire sequence coding for
the peptide signal (nucleotides 1 to 66) and for the
amino-propeptide domain (nucleotides 67 to 479) of the human
pro.alpha.1 (I) chain. Nucleotides 474, 475 and 477, CTT, are
substituted by the GCA bases which allows creation of a NheI
restriction site (GCTAGC) from position 474 to 479. This creation
of the NheI site leads to substitution of the Asn and Phe amino
acids by a lysine and a leucine at position 158 and 159 of the
human pro.alpha.1 (I) chain.
[0132] Amplification of Fragment A
[0133] Two synthetic oligonucleotides were used.
[0134] Sense oligonucleotide BIOC85,
[0135] 5'TATCCGCGGAAGCTTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTG C-3'
[0136] This oligonucleotide comprises at 5' (underlined
nucleotides) the sequences permitting the creation of two
restriction sites, SacII (CCGCGG) and HindIII (AAGCTT) which will
be used as cloning sites. Following these two sites are included
nucleotides -4 to -1 and 1 to 31 specific to the sequence encoding
the human pro.alpha. (I) chain.
[0137] Antisense oligonucleotide, BIOC83,
[0138] 5'TATTCTAGAGCTAGCTTTCCTCCGAGGCCAGGGGGTCCGGGAGGT-3'
[0139] At 5' this oligonucleotide has the sequences (underlined
nucleotides) permitting the creation of restriction sites XbaI
(TCTAGA) and NheI (GCTAGC). The XbaI site will be used to clone
fragment A, whereas the NheI site, described in the informative
section, is used to delimit the sequence coding for the
amino-propeptide domain. Following these two sites is the
complementary sequence to nucleotides 445 to 474 of the sequence
encoding the human pro.alpha.1 (I) chain.
[0140] The DNA matrix used is the 1alpha3 cDNA clone which
comprises 83 bp of the untranslated 5' part and the first 1920
bases coding for the human pro.alpha.1 (I) chain.
[0141] To obtain fragment A, the amplification conditions by PCR
(Polymerase Chain Reaction) were:
3 25 cycles: Denaturation 30 s at 94.degree. C. Pairing 30 s at
55.degree. C. Elongation 30 s at 72.degree. C.
[0142] On completion of the 25 cycles, an additional extension of 5
min at 72.degree. C. is conducted.
[0143] Initial Solution:
[0144] 75 mM Tris-Cl pH 9.0 (at 25.degree. C.)
[0145] 20 mM (NH4) 2SO4
[0146] 0.01% (Weight:volume) Tween 20
[0147] 1.5 mM MgCl2
[0148] BIOC85, 0.5 mM
[0149] BIOC83, 0.5 mM
[0150] each dNTP, 0.2 mM
[0151] matrix, 1 ng 1alpha3 cDNA clone
[0152] 0.25 unit DNA polymerase)
[0153] Cloning Fragment A
[0154] After amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2). After two
minutes' centrifugation at 10000 g, the aqueous phase is collected
and extracted with one volume chloroform/isoamyl alcohol (ratio
24/1). After centrifuging for a few seconds at 10000 g, the aqueous
phase is collected, adjusted to a NaCl concentration of 0.2 M and
two volumes alcohol 100 are added. The DNA is precipitated for 2
hours at -20.degree. C., then centrifuged at 4.degree. C. for 10
min at 12000 g. The DNA residue is washed in 1 ml ethanol 70,
freeze dried, and resuspended in 34 .mu.l sterile milli-Q
water.
[0155] To this DNA solution are added 4 .mu.l C digestion buffer
(Promega.TM.), 1 .mu.l SacII restriction endo-nuclease (10 u/.mu.l;
Promega.TM.) and 1 .mu.l Xbal enzyme (12 u/.nu.l; Promega).
Digestion is carried out for 2 hours at 37.degree. C.
[0156] Following enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 2% Nu-Sieve GTG agarose gel
having a low melting point (FMC)at a constant voltage of 60 volts.
The electrophoresis buffer is 0.5.times.TBE (45 mM Tris borate, 1
mM EDTA (ethylenediaminetetra-acet- ic acid) pH 8). After
migration, the gel is stained for 15 min in a solution of
0.5.times.TBE containing 40 ng/ml ethidium bromide.
[0157] The band corresponding to fragment A is cut under UV,
deposited in 350 .mu.l of a solution of 20 mM Tris pH 8, 1 mM EDTA
pH 8, and incubated for 5 min at 65.degree. C. After dissolution of
the agarose, the sample is extracted with one volume of phenol and
centrifuged for 5 min at 10000 g. The aqueous phase is collected,
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) and centrifuged for 2 min at 10000 g. The aqueous phase is
extracted with chloroform/isoamyl alcohol (ratio 24/1) and
centrifuged for a few seconds at 10000 g. The aqueous phase is
collected, adjusted to a final NaCl concentration of 0.2 M and
precipitated 16 hours at -20.degree. C. after addition of two
volumes ethanol 100.
[0158] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed with 1 ml ethanol 70, lyophilised and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analysed on 2% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of the purified
solution of fragment A SacII/XbaI at 30 ng/.mu.l.
[0159] The plasmid used to clone fragment A is the pBluescript II
SK(+) vector available from Stratagene.TM.. This plasmid comprises
an ampicillin-resistant gene.
[0160] A quantity of 200 ng of the pBluescript II SK(+) plasmid is
subjected to digestion by the SacII and XbaI restriction
endonucleases. This digestion is conducted in a volume of 20 .mu.l
in the presence of 2 .mu.l C buffer (Promega.TM.), 1 .mu.l SacII
enzyme (10 u/.mu.l; Promega.TM.) and 1 .mu.l XbaI enzyme (12
u/.mu.l; Promega.TM.) for 2 hours at 37.degree. C. After digestion,
2 .mu.l carrier buffer (30% sucrose, 0.25% bromophenol blue) are
added to the mixture and analysed on 0.8% Sea-plaque GTG agarose
gel (FMC, Rockland) at a constant voltage of 60 volts, the
electrophoresis buffer being 0.5.times.TBE. After electrophoresis,
the gel is stained for 15 min in a 40 ng/ml solution of ethidium
bromide. The DNA band corresponding to pBluescript II SK(+)
linearized by SacII and XbaI is collected and deposited in 350
.mu.l of a solution of 20 mM Tris pH 8, 1 mM EDTA pH 8. This sample
is incubated for 5 min at 65.degree. C., extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) and centrifuged for 2 min at 10000 g. The
aqueous phase is extracted with chloroform/isoamyl alcohol (ratio
24/1) and centrifuged for a few seconds at 10000 g. The aqueous
phase is collected, adjusted to a final NaCl concentration of 0.2 M
and precipitated 16 hours at -20.degree. C. after addition of two
volumes ethanol 100.
[0161] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, lyophilised and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pBluescript II SK(+) SacII/XbaI.
[0162] Ligation of fragment A (SacII/XbaI) to the plasmid
pBluescript II SK(+) (SacII/XbaI) is conducted for 4 hours at room
temperature.
[0163] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris). The genotype of this strain is: supE
44 .DELTA.-lacU 169(.o slashed.80 lacZ.DELTA.M15) hsdR 17 recA endA
1 gyrA 96 thi-1 relA 1. To obtain competent bacteria, 5 ml of
exponential phase culture (DO600 of 0.7) are centrifuged at 1500 g
for 15 min at 4.degree. C. The bacterial residue is then
resuspended in 500 .mu.l cold 100 mM CaCl2. For transformation, 10
.mu.l of the ligation mixture is mixed with 200 .mu.l competent
DH5-Alpha bacteria, and the sample is placed at 4.degree. C. for 30
min. After heat shock at 42.degree. C. for 40 s, 500 .mu.l L-broth
(10 g tryptone, 5 g yeast extract, 10 g NaCl, per litre of medium)
are added, and the mixture is incubated for 30 min at 37.degree.
C.
[0164] This mixture, together with 20 .mu.l IPTG
(Isopropylthyo-beta-D-gal- actoside; 200 mM) and 20 .mu.l X-Gal (4
chloro-3 indolyl-beta-D galactoside; 20 mg/ml) are then deposited
on a L-Broth-agar dish (L-broth plus 1.5% agar) supplemented with
ampicillin (50 .mu.g/ml), and the dish is incubated for 15 hours at
37.degree. C. With the addition of IPTG and X-Gal it is possible to
use the stain test to determine which plasmids have incorporated an
insert.
[0165] The DH5-Alpha bacterial strain is Lac-, and produces a
non-functional form of beta-galactosidase. The Bluescript II SK(+)
vector has a DNA segment of the lactose operon of Escherichia coli
which codes for the amino-terminal part of this enzyme. Synthesis
induction by IPTG permits alpha complementation which restores the
activity of this galactosidase. In the presence of a galactose
analogue, X-Gal, the bacteria produce blue pigments which lead to
the formation of a stained bacterial colony. The pBluescript II
SK(+) vector has a multiple cloning region (comprising sites
SacII/XbaI) situated in the LacZ gene. Insertion of fragment A into
this cloning region deletes the alpha complementation, which leads
to the formation of white bacterial colonies.
[0166] Several white colonies are tested. For testing, they
deposited individually in 3 ml L-broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0167] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega) which permits purification of
the supercoiled plasmid DNA. This manipulation is conducted
according to the manufacturer's instructions. Approximately 10
.mu.g plasmid DNA is purified with this kit, if the plasmid used is
pBluescript II SK(+).
[0168] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the restriction endonucleases SacII and
XbaI, in order to verify cloning of fragment A. After
electrophoresis, the gel is stained for 15 min in a 40 ng/ml
ethidium bromide solution and the presence of fragment A is
verified under UV illumination.
[0169] The last stage is to verify the integrity of the sequence of
fragment A, since the PCR amplification technique (Polymerase Chain
Reaction) can cause mutations.
[0170] The sequencing reactions conduced with the "T7 sequencing
kit" (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase (cf PREPARATION 1) permits validation of the
integrity of the sequence of fragment A.
[0171] 2/Fragment B
[0172] Fragment B has 3 bases (TAA) upstream from the sequence
coding for the PRS peptide signal (PATHOGENESIS-RELATED PROTEIN S)
(nucleotides 1 to 75) and bases 67 to 77 of the sequence coding for
the amino-terminal part of the amino-propeptide domain of the human
pro.alpha.1 (I) chain. Nucleotides 73, 74 and 77, GAG, are
substituted by bases CTC, which enables creation of a NheI
restriction site (GCTAGC) at position 72 to 77. This creation of
the NheI site leads to substitution of the Glu and Gly amino acids
by a leucine and an alanine at positions 25 and 26 of the human
pro.alpha.1 (I) chain.
[0173] Amplification of Fragment B
[0174] Three synthetic nucleotides (BIOC95 and BIOC93 and 045) were
used.
[0175] Matrix oligonucleotide, 045,
4 5'-TAAATGAACTTCCTCAAAAGTTTCCCCTTTTATGCCTTCCTTTGTTT
TGGCCAATACTTTGTAGCTGTTACTCATGCTGCC-3'
[0176] This oligonucleotide comprises in bold print the sequence
corresponding to that of the peptide signal of PRS
(PATHOGENESIS-RELATED PROTEIN S). It will serve as DNA matrix
during PCR amplification (Polymerase Chain Reaction) of fragment
B.
[0177] Sense oligonucleotide, BIO95,
[0178] 5'-TATCCGCGGAAGCTTTAAATGAACTTCCTCAAAAGTTTCCCC-3'
[0179] At 5' this oligonucleotide has the sequences (underlined
nucleotides) permitting creation of two restriction sites, SacII
(CCGCGG) and HindIII (AAGCTT) which will be used as cloning sites.
Following these two sites are included nucleotides -3 to -1 and 1
to 24 specific to the sequence coding for the peptide signal of
PRS(PATHOGENIC-RELATED PROTEIN S).
[0180] Antisense oligonucleotide, BIOC93,
[0181] 5'-ATGCTAGCTCTTGAGCATGAGTAACAGCTACAAAGTA-3'
[0182] At 5' this oligonucleotide has the sequence (underlined
nucleotides) permitting creation of the restriction site NheI
(GCTAGC). The NheI site described in the information section serves
to delimit the sequence coding for the amino-propeptide domain.
After the NheI site comes the sequence complementary to nucleotides
67 to 71 of the sequence encoding the human pro.alpha.1 (I) chain
and 52 to 75 of the sequence coding for the PRS
(PATHOGENESIS-RELATED PROTEIN S) peptide signal.
[0183] Cloning of Fragment B
[0184] After PCR amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2), as
described in preparation II1. The DNA residue is washed with 1 ml
ethanol 70, freeze-dried and resuspended in 40 .mu.l sterile
milli-Q water.
[0185] An aliquot of 4 .mu.l, together with 500 ng of HindIII-EcoRI
fragments of lambda phage (Promega.TM.) are analysed on 2% type II
agarose gel (Sigma YM), which enabled us to estimate the
concentration of the purified solution of fragment B at 20
ng/.mu.l.
[0186] The plasmid used to clone fragment B is the pBluescript
SK(+) vector available from Stratagene. This plasmid comprises an
ampicillin-resistant gene.
[0187] A quantity of 200 ng of the plasmid pBluescript II SK(+) is
subjected to digestion by the restriction endonuclease EcoRV
(GATATC), to obtain a linearized vector with blunt ends. After
digestion, 80 .mu.l of TE (10 mM Tris, 1 mM EDTA, pH 8) are added
and the solution is extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as described in
preparation II1.
[0188] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze-dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pBluescript II SK(+) EcoRV.
[0189] Ligation of fragment B to the plasmid pBluescript II SK(+)
(EcoRV) is conducted for 4 hours at ambient temperature.
[0190] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris) cf. above.
[0191] Several white colonies are tested. For this testing they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated under shaking
overnight at 37.degree. C.
[0192] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0193] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the restriction endonucleases BamHI and
HindIII in order to verify cloning of fragment B. The restriction
sites BamHI and HindIII are localised either side of the EcoRV
cloning site. After electrophoresis, the gel is stained for 15 min
in a 40 ng/ml solution of ethidium bromide, and the presence of
fragment B is verified under UV illumination.
[0194] The sequencing reactions conducted with the "T7 sequencing"
kit (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase (cf. PREPARATION I) permit validation of the
integrity of the sequence of fragment B.
[0195] 3/Fragment C
[0196] Fragment C has virtually all the sequence coding for the
amino-propeptide domain (nucleotides 72 to 479) of the human
pro.alpha.1 (I) chain. Nucleotides 73, 74 and 77, GAG, are
substituted by the bases CTC, which permits creation of a NheI
restriction site (GCTAGC) at position 72 to 77. This creation of
the NheI site leads to substitution of the Glu and Gly amino acids
by a leucine and an alanine at position 25 and 26 of the human
pro.alpha.1 (I) chain. Nucleotides 474, 475 and 477, CTT, are
substituted by bases GCA, which permits creation of a NheI
restriction site (GCTAGC) at position 474 to 479. This creation of
the NheI site leads to substitution of amino acids Asn and Phe by a
lysine and a leucine at position 158 and 159 of the human
pro.alpha.1 (I) chain.
[0197] Amplification of Fragment C
[0198] Two synthetic oligonucleotides were used.
[0199] Sense oligonucleotide, BIOC855,
[0200] 5'-ATGCTAGCCCAAGTCGAGGGCCAAGACGAAG-3'
[0201] At 5' this oligonucleotide comprises the sequence
(underlined nucleotides) permitting creation of a NheI restriction
site (GCTAGC) which will be used as a cloning site. The NheI site,
described in the information section, serves to delimit the
sequence coding for the amino-propeptide domain (amino-terminal
end). Following this site nucleotides 78 to 100 are included,
specific to the sequence encoding the human pro.alpha.1 (I)
chain.
[0202] Antisense oligonucleotide, BIOC83,
[0203] 5'-TATTCTAGAGCTAGCTTTCCTCCGAGGCCAGGGGGTCCGGGAGGT-3'
[0204] At 5' this oligonucleotide comprises the sequences
(underlined nucleotides) permitting creation of the XbaI (TCTAGA)
and NheI (GCTAGC) restriction sites. The XbaI site used during
cloning of fragment A will not be used for fragment C. Site NheI,
described in the information section, serves to delimit the
sequence coding for the amino-propeptide domain (carboxy-terminal
end). Following after these two sites is the sequence complementary
to nucleotides 445 to 474 of the sequence encoding the human
pro.alpha.1 (I) chain.
[0205] The DNA matrix used is the 1alpha3 cDNA clone which
comprises 83 bp of the untranslated 5' part and the first 1920
bases coding for the human pro.alpha.1 (I) chain.
[0206] Cloning of Fragment C
[0207] After amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as
described in preparation II1. The DNA residue is washed in 1 ml
ethanol 70, freeze-dried and resuspended in 40 ml sterile milli-Q
water.
[0208] An aliquot of 4 .mu.l, together with 500 ng of the
HindIII-EcoRI fragments of lambda phage (Promega.TM.) are analysed
on 2% type II agarose gel (Sigma.TM.), which enabled us to estimate
the concentration of the purified solution of fragment C at 20
ng/.mu.l.
[0209] The plasmid used to clone fragment C is the pBluescript II
SK(+) vector available from Stratagene.TM. (La jolla). This plasmid
comprises an ampicillin-resistant gene.
[0210] A quantity of 200 ng of the pBluescript II SK(+) plasmid is
subjected to digestion by the restriction endonuclease EcoRV
(GATATC), which leads to obtaining a linearized vector with blunt
ends. After digestion, 80 .mu.l of TE (10 mM Tris, 1 mM EDTA, pH 8)
are added and the solution is extracted with one volume
phenol/chloroform.isoamyl alcohol (ratio 50/48/2) as described in
PREPARATION II1.
[0211] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml 70 ethanol, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pBluescript II SK(+) EcoRV.
[0212] Ligation of fragment C to the plasmid pBluescript II SK (+)
(EcoRV) is conducted for 4 hours at ambient temperature.
[0213] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0214] Several white colonies are tested. For this testing, they
are deposited individually in 3 ml L-Broth supplemented with
ampicillin (50 .mu.g/ml), and these cultures are incubated
overnight under shaking at 37.degree. C.
[0215] To purify the plasmid DNA, the culture is first centrifuged
at 15000 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0216] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the restriction endonucleases BamHI and
HindIII, in order to verify cloning of fragment C. The restriction
sites BamHI and HindIII are localized either side of the EcoRV
cloning site. After electrophoresis; the gel is stained for 15 min
in a 40 ng/ml solution of ethidium bromide, and the presence of
fragment C is verified under UV illumination.
[0217] The sequencing reactions conducted with the "T7 sequencing"
kit (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase (cf. PREPARATION I) permits validation of the
integrity of the sequence of fragment C.
[0218] 4/Fragment D
[0219] Fragment D comprises the entire sequence coding for the
amino-telopeptide domain (nucleotides 474 to 534) and the sequence
coding for the amino-terminal part of the helical region
(nucleotides 535 to 1920) of the human pro.alpha.1 (I) chain.
Nucleotides 474, 475 and 477, CTT, are substituted by bases GCA,
which permits creation of a NheI restriction site (GCTAGC) at
position 474 to 479. This creation of the NheI site leads to
substitution of amino acids Asn and Phe by a lysine and a leucine
at position 158 and 159 of the human pro.alpha.1 (I) chain. A
DraIII restriction site is localized at position 1709 to 171
(CACCTGGTG), whereas a BamHI site due to the lambda plasmid MoSE1ox
(Amersham.TM.) is situated at the 3' end.
[0220] Amplification of Fragment D
[0221] Two synthetic oligonucleotides were used.
[0222] Sense oligonucleotide, BIOC65,
[0223] 5'-TATTCTAGAGCTAGCTCCCCAGCTGTCTTATGGCTATGATGAG-3'
[0224] At 5' this oligonucleotide comprises the sequence
(underlined nucleotides) permitting creation of the XbaI (TCTAGA)
and NheI (GCTAGC) restriction sites. The XbaI site will be used for
cloning fragment D, whereas the NheI site, described in the
information section, serves to delimit the sequence coding for the
amino-propeptide domain. Following after these two sites is the
sequence (nucleotides 480 to 507) coding for the start of the
amino-telopeptide domain of the human pro.alpha.1 (I) chain.
[0225] Antisense oligonucleotide, T7 gene 10 primer,
[0226] 5'-CTGAGGTTGTAGAAGTTCCG-3'
[0227] This oligonucleotide is localized just downstream from the
3' end of the 1alpha3 cDNA clone, and from a BamHI restriction site
(GGATTC) which will be used for cloning fragment D.
[0228] The DNA matrix used is the 1alpha3 cDNA clone which
comprises 83 bp of the untranslated 5' part and the first 1920
bases coding for the human pro.alpha.1 (I) chain.
[0229] Cloning Fragment D
[0230] After amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as in
PREPARATION II1. The DNA residue is washed in 1 ml ethanol 70,
freeze dried and resuspended in 34 ml sterile milli-Q water.
[0231] Digestion with Bam HI XbaI is conducted for 2 hours at
37.degree. C. in a final volume of 40 .mu.l.
[0232] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 0.8% SeaPlaque-GTG agarose
gel with a low melting point (FMC, Rockland) at a constant voltage
of 60 volts. The electrophoresis buffer is 0.5.times.TBE (45 mM
Tris borate, 1 mM EDTA (ethylenediaminetetra-acetic acid), pH8).
After migration, the gel is stained for 15 min in a 0.5.times.TBE
solution containing 40 ng/ml ethidium bromide.
[0233] The band corresponding to fragment D is cut under UV
illumination, deposited in 350 .mu.l of a solution of 20 mM Tris pH
8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), as described for preparation II1.
[0234] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phase
(Promega.TM.) are analyzed on 0.8% type II agarose gel (Sigma.TM.)
which enabled us to estimate the concentration of the purified
solution of fragment D BamHI/XbaI at 50 ng/.mu.l.
[0235] The plasmid used to clone fragment D is the PUC18 vector
marketed by Promega (.TM.). This plasmid comprises an
ampicillin-resistant gene.
[0236] A quantity of 200 ng of pUC 18 plasmid is subjected to
digestion by the restriction endonucleases BamHI and XbaI for 2
hours at 37.degree. C. After digestion, 2 .mu.l carrier buffer (30%
sucrose, 0.25% bromophenol blue) are added to the mixture and
analyzed on 0.8% Seaplaque-GTG agarose gel (FMC, Rockland). The DNA
band corresponding to pUC 18 linearized by BamHI and XbaI is
collected and deposited in 350 .mu.l of a solution of 20 mM Tris pH
8, 1 mM EDTA pH 8. This sample is incubated for 5 min at 65.degree.
C., extracted with one volume of phenol and centrifuged for 5 min
at 10000 g. The aqueous phase is collected, extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as
described in PREPARATION II1.
[0237] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pUC18 BamHI/XbaI.
[0238] Ligation of fragment D (BamHI/XbaI) to-plasmid pUC18
(BamHI/XbaI) is conducted for 4 hours at ambient temperature.
[0239] For transformation, the competent bacteria used are
DH5-alpha (Gibco BRL, Paris).
[0240] Several white colonies are tested. For this testing, they
are deposited individually in 3 ml L-Broth supplement with
ampicillin (50 .mu.g/ml), and these cultures are incubated
overnight under shaking at 37.degree. C.
[0241] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) to purify the supercoiled
plasmid DNA. This manipulation is conducted following the
manufacturer's instructions. Approximately 10 .mu.g plasmid DNA is
purified with this kit if the plasmid used is pUC18.
[0242] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion with the BamHI and XbaI restriction
endonucleases in order to verify the cloning of fragment D. After
electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide, and the presence of fragment D is
verified under UV illumination.
[0243] The sequencing reactions made with the "T7 sequencing" kit
(Pharmacia.TM.) which uses the chain termination technique and T7
DNA polymerase (cf. PREPARATION I) permits validation of the
integrity of the sequence of fragment D.
[0244] 5/Fragment E
[0245] Frgament E lies between sites DraIII (CACCTGGTG, nucleotides
1709 to 1717) and BamHI (GGATCC, nucleotides 2803 to 2808) present
in the alpha22 cDNA clone. This fragment codes for amino acids 567
to 936 lying in the central helical domain of the human pro.alpha.1
(I) chain.
[0246] 6/Fragment F
[0247] Fragment F lies between sites BamHI (GGATCC, nucleotides
2803 to 2808) and EcoRI (GAATTC, nucleotides 4357 to 4362) present
in the alpha22 cDNA clone. This fragment codes for amino acids 936
to 1192 lying in the central helical domain and 1193 to 1454 in the
carboxy-propeptide domain of the human pro.alpha.1 (I) chain.
[0248] 7/Fragment G
[0249] Fragment G comprises the sequence (nucleotides 4040 to 4392)
coding for the carboxy-terminal part of the carboxy-propeptide
domain (amino acids 1346 to 1464) of the human pro.alpha.1 (I)
chain. This fragment also comprises the TAA nucleotides (stop
codon, bases 4393 to 4395) coupled to a HinIII (AAGCTT) restriction
site.
[0250] Amplification of Fragment G
[0251] Two synthetic oligonucleotides were used.
[0252] Sense oligonucleotide, BIOC25,
[0253] 5'-TATCTGCAGATGTGGCCATCCAGCTGACCT-3'-3'
[0254] At 5' this oligonucleotide comprises the sequence
(underlined nucleotides permitting creation of the PstI (CTGCAG)
restriction site which will be used as a cloning site. Following
after this site, are nucleotides 4040 to 4060 specific to the
sequence encoding the human pro.alpha.1 (I) chain.
[0255] Antisense oligonucleotide, BIOC23,
[0256] 5'-TATAAGCTTACAGGAAGCAGACAGGGCCAA-3'
[0257] At 5' this oligonucleotide comprises the sequence(underlined
nucleotides) permitting creation of the HindIII (AAGCTT)
restriction site. The bold print denotes the sequence complementary
to the TAA stop codon, followed by the complementary strand of
nucleotides 4373 to 4392 of the sequence coding for the human
pro.alpha.1 (I) chain.
[0258] The DNA matrix used is the alpha22 cDNA clone which
comprises the sequence coding for amino acids 171 to 1454 of the
human pro.alpha.1 (I) chain and approximately 500 bp of the
untranslated 3' region.
[0259] Cloning of Fragment G
[0260] After amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2). The DNA
residue is washed in 1 ml ethanol 70, freeze dried and resuspended
in 35 .mu.l sterile milli-Q water.
[0261] Digestion by Pst1 is conducted for 2 hours at 37.degree. C.
in the final volume of 40 .mu.l.
[0262] Subsequent to enzymatic digestion, 60 .mu.l TE buffer (10 mM
Tris, 1 mM EDTA, pH 8) are added to the DNA solution, which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) as described for PREPARATION II1.
[0263] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml 70 ethanol, freeze dried and
collected in 35 ml sterile milli-Q water. Digestion by HindIII is
conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0264] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 2% Nu Sieve-GTG agarose gel
with a low melting point (FMC, Rockland) cf. PREPARATION II2.
[0265] The band corresponding to fragment G is cut under UV
illumination, deposited in 350 .mu.l of a solution of 20 mM Tris pH
8, 1 mM EDTA pH8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described for PREPARATION II1.
[0266] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 2% type II agarose gel (Sigma.TM.)
which enabled us to estimate the concentration of the purified
solution of fragment G HindIII/PstI at 30 ng/.mu.l.
[0267] The plasmid used to clone fragment G is the pBluescript II
SK(+) vector available from Stratagene. This plasmid comprises an
ampicillin-resistant gene. 200 ng of the pBluescript II SK (+)
plasmid is subjected to digestion by the PstI restriction
endonuclease in a final volume of 20 .mu.l for 2 hours at
37.degree. C. After digestion, 80 .mu.l TE buffer (10 mM Tris, 1 mM
EDTA, pH 8) are added to DNA solution which is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as
described for PREPARATION II1.
[0268] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion by Hind III
is conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0269] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland), cf. PREPARATION II4. The
DNA band corresponding to the pBluescript SK (+) plasmid linearized
by HindIII and PstI is collected and deposited in 350 .mu.l of a
solution of 20 mM Tris pH 8, 1 mM EDTA pH 8. This sample is
incubated for 5 min at 65.degree. C., extracted with one volume of
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described for PREPARATION II1.
[0270] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/.mu.l solution of the plasmid pBluescript II SK (+)
HindIII/PstI.
[0271] Ligation of fragment G (HindIII/PstI) to the plasmid
pBluescript II SK(+) (HindIII/PstI) is conducted for 4 hours at
room temperature.
[0272] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0273] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0274] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (PROMEGA.TM.) following the
manufacturer's instructions.
[0275] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII and BamHI restriction
endonucleases in order to verify cloning of fragment G.
[0276] After electrophoresis, the gel is stained for 15 min in a 40
ng/ml solution of ethidium bromide, and the presence of fragment G
is verified under UV illumination.
[0277] The-sequencing reactions made with the "T7 sequencing" kit
(Pharmacia.TM.) which uses the chain termination technique and T7
DNA polymerase (cf. PREPARATION 1) permit validation of the
integrity of the sequence of fragment G.
[0278] 8/Fragment H
[0279] Fragment H comprises the sequence (nucleotides 4031 to 4383)
coding for the carboxy-terminal part of the carboxy-propeptide
domain (amino acids 1343 to 1461) of the human pro.alpha.1 (I)
chain. This fragment also comprises the TAA nucleotides (stop
codon, bases 4384 to 4386) coupled to a HindIII (AAGCTT)
restriction site. Upstream from the stop codon lie the codons Lys,
Asp, Glu, Leu, site of retention in the endoplasmic reticulum.
[0280] b/Amplification of Fragment H
[0281] Two synthetic oligonucleotides were used.
[0282] Sense oligonucleotide, BIOC25,
[0283] 5'-TATCTGCAGATGTGGCCATCCAGCTGACCT-3'-3'
[0284] At 5' this oligonucleotide comprises the sequence
(underlined nucleotides) permitting creation of the PstI (CTGCAG)
restriction site which will be used as a cloning site. Following
after this site lie nucleotides 4031 to 4051 specific to the
sequence coding for the human pro.alpha.1 (I) chain.
[0285] Antisense oligonucleotide, BIOCKDEL,
5 5' TATAAGCTTATAGCTCATCTTTCAGGAAGCAGACAGGGCCAACGTCG AAGC-3'
[0286] At 5' this oligonucleotide comprises the sequence
(underligned nucleotides) permitting creation of the HindIII
(AAGCTT) restriction site. The bold print indicates the sequence
complementary to the TAA stop codon and to the KDEL amino acids,
followed by the complementary strand of nucleotides 4353 to 4383 of
the sequence coding for the human pro.alpha.1 (I) chain.
[0287] The DNA matrix used is the alpha22 cDNA clone which
comprises 110 bp of the untranslated 5' part and the first 1911
bases coding for the human pro.alpha.1 (I) chain.
[0288] Cloning of Fragment H
[0289] After amplification, the solution is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as
described for PREPARATION II1. The DNA residue is washed in 1 ml
ethanol 70, freeze dried and resuspended in 36 .mu.l sterile
milli-Q water.
[0290] Digestion by PstI is conducted for 2 hours at 37.degree. C.
in a final volume of 40 .mu.l.
[0291] Subsequent to enzymatic digestion, 60 .mu.l of TE buffer (10
mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) as described for PREPARATION II1.
[0292] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 35 .mu.l sterile milli-Q. Digestion by HIND III is
conducted for 2 hours at 37.degree. C. in a final volume of 40
.mu.l.
[0293] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 2% Nu sieve-GTG agarose gel
with low melting point (FMC, Rockland) as described for PREPATION
II1.
[0294] The band corresponding to fragment H is cut under UV
illumination, deposited in 350 .mu.l of a solution of 20 mM Tris pH
8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described for PREPARATION II1.
[0295] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 2% type agarose gel (Sigma.TM.) which
enabled us to estimate the concentration of the purified solution
of fragment H HindIII/PstI at 20 ng/.mu.l.
[0296] The plasmid used to clone fragment H is the pBluescript II
SK(+) plasmid available from Stratagene.TM.. This plasmid comprises
an ampicillin-resistant gene.
[0297] 200 ng of the pBluescript II SK(+) plasmid is subjected to
digestion by the PstI restriction endonuclease, in a volume of 20
.mu.l for 2 hours at 37.degree. C. After digestion, 80 .mu.l of TE
buffer (10 mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution
which is extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described for PREPARATION II1.
[0298] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion by HINDIII
is conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0299] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland), cf. PREPARATION II4. The
DNA band corresponding to pBluescript II SK(+) linearized by
HindIII and PstI is collected and deposited in 350 .mu.l of a
solution of 20 mM Tris pH 8, 1 mM EDTA pH 8. This sample is
incubated for 5 min at 65.degree. C., extracted with one volume of
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described for PREPARATION II1.
[0300] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pBluescript II SK(+)
HindIII/PstI.
[0301] Ligation of fragment H (HindIII/PstI) to the plasmid
pBluescript II SK(+) (HindIII/PstI) is conducted for 4 hours at
room temperature.
[0302] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0303] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0304] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0305] An aliquot (2 m.mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII and BamHI restriction
endonucleases in order to verify cloning of fragment H. After
electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide, and the presence of fragment H is
verified under UV illumination.
[0306] The last stage is to verify the integrity of the sequence of
fragment H, since the PCR (polymerase chain reaction) technique for
amplification may give rise to mutations. The sequencing reactions
made with the "T7 sequencing" kit (Pharmacia.TM.) which uses the
chain termination technique and T7 DNA polymerase (cf. PREPARATION
1) permit validation of the integrity of sequence of fragment
G.
EXAMPLE 1
Construction of Chimeric Genes Coding for the Recombinant Protein
of Human Collagen and Allowing Expression in Tobacco Leaves and the
Grains of Tobacco or Colza
[0307] 1/Obtaining Fragments FG and FH
[0308] This stage consists of cloning fragment BamHI/EcoRI of 1554
bp (nucleotides 2803 to 4357) of the alpha22 clone between sites
BamHI (of the pBluescript II SK(+) vector) and EcoRI (fragment G or
H) of the clone pBluescript II SK(+)-fragment G or H. This leads to
obtaining clones pBluescript II SK(+)-FG and pBluescript II
SK(+)-FH which comprise, between sites BamHI and HindIII, the
sequence coding for amino acids 936 to 1192 of the central helical
domain, the entire carboxy-propeptide domain (amino acids 1193 to
1464) of the human pro.alpha.1 (I) chain and the TAA stop codon
coupled to the HindIII restriction site. In respect of clone
pBluescript II SK(+)-fragment FH, 4 codons specific to the KDEL
sequence (Lys, Asp, Glu, Leu) are inserted between the sequence
coding for the carboxy-propeptide domain and the TAA stop
codon.
[0309] Cloning Fragment F (BamHI/EcoEI) with the EcoRI/HindIII Part
of Fragment G or H.
[0310] Approximately 1 .mu.g of the alpha22 cDNA clone are digested
by the restriction endonuclease BamHI for 90 min at 37.degree. C.
The conditions used are: 1 .mu.g alpha22, 2 .mu.l E digestion
buffer (Promega.TM.), 1 .mu.l BamHI restriction endonuclease (12
u/.mu.l; Promega.TM.) to a final volume of 20 .mu.l milli-Q H20.
Digestion is conducted for 2 hours at 37.degree. C.
[0311] Subsequent to enzymatic digestion, 80 .mu.l TE buffer (10 mM
Tris, 1 mM EDTA, PH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) as described in PREPARATION II1.
[0312] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 35 .mu.l sterile milli-Q water. Digestion by PstI is
conducted for 2 hours at 37.degree. C. in a final volume of 40
.mu.l.
[0313] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 1% Seaplaque-GTG agarose
gel with low melting point (FMC, Rockland) at a constant voltage of
60 volts. The electrophoresis buffer is 0.5.times.TBE (45 mM Tris
borate, 1 mM EDTA (ethylenediaminetetra-acetic acid) pH 8). After
migration, the gel is stained for 15 min in a 0.5.times.TBE
solution containing 40 ng/ml ethidium bromide.
[0314] The band corresponding to the BamHI/EcoRI fragment of 1554
bp is cut under UV illumination, deposited in 350 .mu.l of a
solution of 20 mM Tris pH 8, 1 mM EDTA pH 8, and incubated for 5
min at 65.degree. C. After dissolution of the agarose, the sample
is extracted with one volume phenol and centrifuged for 5 min at
10000 g. The aqueous phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as described in
PREPARATION II1.
[0315] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 1% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of the purified
solution of the BamHI/EcoRI fragment of clone alpha22 cDNA at 12
ng/.mu.l.
[0316] The plasmid used to clone the BamHI/EcoRI fragment of the
alpha 22 cDNA clone is the clone pBluescript II SK(+)-fragment G or
H digested by the BamHI and EcoRI enzymes. This clone comprises an
ampicillin-resistant gene.
[0317] 500 ng of the plasmid pBluescript II SK(+)-fragment G or H
is subjected to digestion by the BamHI restriction endonuclease, in
a volume of 20 .mu.l for 2 hours at 37.degree. C. After digestion,
80 .mu.l of TE buffer (10 mM Tris, 1 mM EDTA, pH 8) are added to
the DNA solution which is extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) as described in
PREPARATION II1.
[0318] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion by EGRI is
conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0319] After digestion, 4 .mu.l of carrier buffer (30% sucrose,
0.25% bromophenol blue) are added to the mixture and analyzed on
0.8% Seaplaque GTG agarose gel (FMC, Rockland), cf. PREPARATION
II4. The DNA band corresponding to pBluescript II SK(+)-fragment G
or H digested by BamHI and EcoRI is collected and deposited in 350
.mu.l of a solution of 20 mM Tris, 1 mM EDTA pH 8. This sample is
incubated for 5 min at 65.degree. C., extracted with one volume of
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) as described in PREPARATION II1.
[0320] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 20
ng/ml solution of the plasmid pBluescript II SK (+)-fragment G or H
(BamHI/EcoRI).
[0321] Ligation of the BamHI/EcoRI fragment of the alpha22 cDNA
clone to the clone pBluescript II SK(+)-fragment G or H
(BamHI/EcoRI) is conducted for 4 hours at room temperature.
[0322] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0323] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0324] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0325] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII and BamHI restriction
endonucleases, in order to verify cloning of the BamHI/EcoRI
fragment of the alpha22 cDNa clone to clone pBluescript II
SK(+)-fragment G or H (BamHI/EcoRI). The HindIII restriction site
is coupled to the TAA stop codon at 3' of the EcoRI site.
[0326] After electrophoresis, the gel is stained for 15 min in a 40
ng/ml solution of ethidium bromide, and the presence of the
BamHI/HindIII fragment of 1596 bp for the FG fragment and of 1608
bp for the FH fragment is verified under UV illumination.
[0327] The sequencing reactions made with the "T7 sequencing" kit
(Pharmacia.TM.) which uses the chain termination technique and T7
DNA polymerase permit validation of the integrity of the clones
pBluescript II SK(+)-fragment FG and pBluescript II SK(+)-fragment
FH.
[0328] 2/Obtaining Fragment DE
[0329] This stage consists of cloning fragment DraIII/BamHI
(nucleotides 1714 to 2803) of 1809 bp of the alpha22 clone between
sites DraIII (of fragment D) and BamHI (of plasmid pUC18) of clone
pUC118-fragment D. This leads to obtaining clone pIC8-DE which
comprises between sites XbaI and BamHI the sequence coding for
amino acids 160 to 179 of the amino-telopeptide domain, amino acids
180 to 936 of the central helical region of the human pro.alpha.1
(I) chain.
[0330] Cloning Fragment E (DraIII/BamHI) with the DraII/BamHI Part
of Fragment D.
[0331] Approximately 1 .mu.g of the alpha22 cDNA clone are digested
by the restriction endonuclease BamHI for 90 min at 37.degree.
C.
[0332] Subsequent to enzymatic digestion, 80 .mu.l TE buffer (10 mM
Tris, 1 mM EDTA, pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) and centrifuged for 2 min at 10000 g. The aqueous phase is
extracted with chloroform/isoamyl alcohol (ratio 24/1) and
centrifuged for a few seconds at 10000 g. The aqueous phase is
collected, adjusted to a final NaCl concentration of 0.2 M, and
precipitated for 16 hours at -20.degree. C. after addition of two
volumes ethanol 100.
[0333] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 35 .mu.l sterile milli-Q water. Digestion by DraIII is
conducted for 2 hours at 37.degree. C. in a final volume of 40
.mu.l.
[0334] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 1% Seaplaque-GTG agarose
gel with low melting point (FMC, Rockland), cf. EXAMPLE I1.
[0335] The band corresponding to fragment DraIII/BamHI of 1089 bp
of the alpha22 cDNA clone is cut under UV, deposited in 350 .mu.l
of a solution of 20 mM Tris pH 8, 1 mM EDTA pH 8, and incubated for
5 min at 65.degree. C. After dissolution of the agarose, the sample
is extracted with one volume phenol and centrifuged for 5 min at
10000 g. The aqueous phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) cf. PREPARATION
II1.
[0336] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot (2 .mu.l),
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 2% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of the purified
solution of fragment DRaIII/BamHI of the alpha22 cDNA clone at 20
ng/.mu.l.
[0337] The plasmid used to clone the DraIII/BamHI fragment of the
alpha22 vDNA clone is the clone pUC18-fragment D clone digested by
the DraIII and BamHI enzymes. This clone comprises an
ampicillin-resistant gene.
[0338] 500 ng of the plasmid pUC18-fragment D is subjected to
digestion by the BamHI restriction endonuclease in a volume of 20
.mu.l for 2 hours at 37.degree. C. After digestion, 80 .mu.l of TE
buffer (10 mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution
which is extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) cf. PREPARATION II1.
[0339] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion by DraIII is
conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0340] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland). The DNA band
corresponding to pUC18-fragment D digested by DraIII and BamHI is
collected and deposited in 350 .mu.l of a solution of 20 mM Tris pH
8 and 1 mM EDTA pH 8. This sample is incubated for 5 min at
65.degree. C., extracted with one volume of phenol ad centrifuged
for 5 min at 10000 g. The aqueous phase is collected, extracted
with one volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2),
cf. PREPARATION II1.
[0341] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 20
ng/ml solution of the plasmid pUC18-fragment D (DraIII/BamJI).
[0342] Ligation of fragment DraIII/BamHI of the alpha22 cDNA clone
to the clone pUC18-fragment D (DraIII/BamHI) is conducted for 4
hours at room temperature.
[0343] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0344] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0345] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0346] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the XbaI and BamHI restriction endonucleases
in order to verify cloning of fragment DraIII/BamHI of the alpha
cDNA clone to the clone pUC18-fragment D (DraIII/BamHI). The XbaI
restriction site is situated at 5' of the clone pUC18-fragment D.
After electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide, and the presence of the BamHI/XbaI
fragment of 2336 bp is verified under UV illumination.
[0347] The sequencing reactions were made with the "T7 sequencing"
kit (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase which permitted validation of the integrity of
the clone pUC18-fragment DE.
[0348] 3/Obtaining Fragments DEFG and DEFH
[0349] This stage consists of cloning the XbaI/BamHI fragment
(nucleotides 474 to 2803) of 2329 bp of the clone pUC18-fragment DE
between sites XbaI (of the pBluescript II SK(+) plasmid) and BamHI
(of the FG or FH fragment) of the clone pBluescript II
SK(+)-fragment FG or FH. This leads to obtaining clones pBluescript
II SK(+)-fragment DEFG and pBluescript II SK(+)-fragment DEFH which
comprise, between sites XbaI and HindIII, the sequence coding for
amino acids 160 to 179 of the amino-telopeptide domain, the entire
central helical region (amino acids 180 to 1 192), the entire
carboxy-propeptide domain (amino acids 1193 to 1464) of the human
pro.alpha.1 (I) chain, and the TAA stop codon coupled to the
HindIII restriction site. In respect of the clone pBluescript II
SK(+)-fragment DEFH, 4 specific codons of the KDEL sequence (Lys,
Asp, Glu, Leu) are inserted between the sequence coding for the
carboxy-propeptide domain and the TAA stop codon.
[0350] Cloning Fragment DE (XbaI/BamHI) with the BamHI/HindIII Part
of Fragment FG or FH.
[0351] Approximately 1 g of the clone pUC18-fragment DE are
digested by the BamHI restriction endonuclease for 90 min at
37.degree. C.
[0352] Subsequent to enzymatic digestion, 80 .mu.l of TE buffer (10
mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2), cf. PREPARATION II1.
[0353] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 35 .mu.l sterile milli-Q water. Digestion by XbaI is
conducted for 2 hours at 37.degree. C. in a final volume of 20
.mu.l.
[0354] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 1% Seaplaque-GTG agarose
gel (FMC, Rockland) with low melting point, cf. EXAMPLE I1.
[0355] The band corresponding to the XbaI/BamHI fragment of 2329 bp
is cut under UV, deposited in 350 .mu.l of a solution of 20 mM Tris
pH 8 and 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C.
After dissolution of the agarose, the sample is extracted with one
volume of phenol and centrifuged for 5 min at 10000 g. The aqueous
phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf. PREPARATION
II1.
[0356] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 1% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of purified solution
of the XbaI/BamHI fragment of clone pUC18-fragment DE at 20
ng/.mu.l.
[0357] The plasmid used to clone the XbaI/BamHI fragment of the
clone puC18-fragment DE is the clone pBluescript II SK(+)-fragment
FG or FH digested by the enzymes XbaI and BamHI. This clone
comprises an ampicillin-resistant gene.
[0358] 500 ng of the plasmid pBluescript II SK(+)-fragment FG or FH
are submitted to digestion by the BamHI restriction endonuclease
for 2 hours at 37.degree. C. After digestion, 80 .mu.l TE buffer
(10 mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution which
is extracted with one volume phenol/chloroform/isoamyl alcohol
(ratio 50/48/2), cf. PREPARATION II1.
[0359] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion by baI is
conducted for 2 hours at 37.degree. C.
[0360] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland). The DNA band
corresponding to pBluescript II SK(+)fragment FG or FH digested by
XbaI and BamHI is collected and deposited in 350 .mu.l of a
solution of 20 mM Tris pH 8 and 1 mm EDTA pH 8. This sample is
incubated for 5 min at 65.degree. C., extracted with one volume of
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), cf. PREPARATION II1.
[0361] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze-dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 20
ng/ml solution of plasmid pBluescript II SK(+)-fragment FG or FH
(XbaI/BamHI).
[0362] Ligation of the XbaI/Bam-HI fragment of the clone
pUC18-fragment DE to the clone pBluescript II SK(+)-fragment FG or
FH (XbaI/BamHI) is conducted for 4 hours at room temperature.
[0363] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0364] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0365] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0366] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the XbaI and HindIII restriction
endonucleases in order to verify cloning of the XbaI/BamHI fragment
of the clone pUC18-fragment DE to the clone pBluescipt II
SK(+)-fragment FG or FH (BamHI/HindIII). After electrophoresis, the
gel is stained for 15 min in a 40 ng/ml solution of ethidium
bromide, and the presence of the XbaI/HindIII fragment of
approximately 3900 bp is verified under UV illumination.
[0367] The sequencing reactions were conducted with the "T7
sequencing" kit (Pharmacia.TM.) which uses the chain termination
technique and T7 DNA polymerase and permitted validation of the
integrity of the clones pBluescript II SK(+)-fragment DEFG and
pBluescript II SK(+)-fragment DEFH.
[0368] 4/Obtaining Fragments ADEFG and ADEFH, Complete cDNA Clones
Specific to the Human pro.alpha.1 (I) Chain.
[0369] This stage consists of cloning the SacII/NheI fragment
(nucleotides -4 to 479) of 495 bp of the clone pBluescript II
SK(+)-fragment A between sites SacII (of plasmid pBluescript II
SK(+)) and NheI (of fragment DEFG or DEFH) of the clone pBluescript
II SK(+)-fragment DEFG or DEFH. This leads to obtaining clones
pBluescript II SK(+)-fragment ADEFG and pBluescript II
SK(+)-fragment ADEFH which comprise, between sites SacII and
HindIII, the sequence coding for the entire human pro.alpha.1 (I)
chain, and the TAA stop codon coupled to the HindIII restriction
site. Another HindIII site is localized just after the SacII site
which will allow removal of fragments ADEFG and ADEFH by simple
digestion with the HindIII restriction endonuclease. In respect of
clone pBluescript II SK(+)-fragment ADEFH, 4 codons specific to the
KDEL sequence (Lys, Asp, Glu, Leu) are inserted between the
sequence coding for the carboxy-propeptide domain and the TAA stop
codon. The NheI site leads to substitution of amino acids Asn and
Phe by a lysine and a leucine at position 158 and 159 of the human
pro.alpha.1 (I) chain.
[0370] Cloning Fragment A (SacII/NheI) with the NheI/HindIII Part
of Fragment DEFG or DEFH.
[0371] Approximately 1 .mu.l of the clone pBluescript II
SK(+)-fragment A are digested by the SacII restriction endonuclease
for 90 min at 37.degree. C.
[0372] Subsequent to enzymatic digestion, 80 .mu.l of TE buffer (10
mM Tris, 1 mM EDTA, pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2), cf. PREPARATION II1.
[0373] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 35 .mu.l sterile milli-Q water. To this DNA solution
are added 4 .mu.l digestion B buffer (Promega.TM.), 1 .mu.l of the
NheI restriction endonuclease (12 u/.mu.l); Promega.TM.). Digestion
is conducted for 2 hours at 37.degree. C.
[0374] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 2% NueSieve-GTG agarose gel
with low melting point (FMC, Rockland) at a constant voltage of 60
volts. The electrophoresis buffer is 0.5.times.TBE (45 mM Tris
borate, 1 mM EDTA (ethylenediaminetetra-acetic acid, pH 8). After
migration the gel is stained for 15 min in a 0.5.times.TBE solution
containing 40 ng/ml ethidium bromide.
[0375] The band corresponding to fragment SacII/NheI of 495 bp is
cut under UV, deposited in 350 .mu.l of a solution of 20 MM Tris pH
8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), cf. PREPARATION II1.
[0376] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 2% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of the purified
solution of the SacII/NheI fragment of the clone pBluescript II
SK(+)-fragment A at 5 ng/.mu.l.
[0377] The plasmid used to clone the SacII/NheI fragment of the
clone pBluescript II SK(+)-fragment A is the clone pBluescript II
SK(+)-fragment DEFG or DEFH digested by the enzymes SacII and NheI.
This clone comprises an ampicillin-resistant gene.
[0378] 500 ng of the plasmid pBluescript II SK (+)-fragment DEFG or
DEFH are submitted to digestion by the SacII restriction
endonuclease in a volume of 20 .mu.l for 2 hours at 37.degree. C.
After digestion, 80 .mu.l TE buffer (10 mM Tris, 1 mM EDTA, pH 8)
are added to the DNA solution which is extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf. PREPARATION
II1.
[0379] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion with NhcI is
conducted for 2 hours at 37.degree. C.
[0380] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland), cf. PREPARATION II4. The
DNA band corresponding to pBluescript II SK(+)-fragment DEFG or
DEFH digested by SacII and NheI is collected and deposited in 350
.mu.l of a solution of 20 mM Tris pH 8, 1 mM EDTA pH 8. This sample
is incubated for 5 min at 65.degree. C., extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected and extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf. PREPARATION
II1.
[0381] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 20
ng/ml solution of the plasmid pBluescript II SK(+)-fragment DEFG or
DEFH (SacII/NheI).
[0382] Ligation of the SacII/NheI fragment of clone pBluescript II
SK(+)-fragment A to the clone pBluescript II SK(+)-fragment DEFG or
DEFH (SacII/NheI) is conducted for 4 hours at ambient
temperature.
[0383] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0384] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0385] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0386] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII restriction endonuclease in
order to verify cloning of the SacII/HneI fragment of the clone
pBluescript II SK(+)-fragment A to the clone pBluescript II
SK(+)-fragment DEFG or DEFH (NheI/HindIII). Visualisation of a
HindIII fragment of 4400 bp validates these clonings. After
electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide and the presence of the
HindIII/HindIII fragment of 4400 bp is verified under UV.
[0387] The sequencing reactions were conducted with the "T7
sequencing kit" (Pharmacia.TM.) which uses the chain termination
technique and T7 DNA polymerase, and permitted validation of the
integrity of clone pBluescript II SK(+)-fragment ADEFG and clone
pBluescript II SK(+)-fragment ADEFH.
[0388] It is recalled that the clone pBluescript II SK(+)-fragment
ADEFG comprises, between these two HindIII sites, the entirety of
the sequence coding for the human pro.alpha.1 (I) chain.
[0389] The clone pBluescript II SK(+)-fragment ADEFH comprises,
between these two HindIII sites, the entirety of the sequence
encoding the human pro.alpha.1 (I) chain. Also, at the
carboxy-terminal part of this chain it generates the retention
sequence in the endoplasmic reticulum Lys-Asp-Glu-Leu.
[0390] 5/Obtaining Fragment BDEFG, cDNA Clone Coding for the PRS
Plant Peptide Signal and the Entirety of the Human pro.alpha.1 (I)
Chain with the Exception of the Amino-propeptide Domain.
[0391] This stage consists of cloning the SacII/NheI fragment
(nucleotides -3 to 75) of 90 p of the clone pBluescript II
SK(+)-fragment B between sites SacII (of the plasmid pBluescript II
SK(+)) and NheI (of fragment DEFG) of the clone pBluescript II
SK(+)-fragment DEFG. This leads to obtaining clone pBluescript II
SK(+)-fragment BDEFG which comprises between sites SacII and
HindIII the sequence coding for the plant PRS peptide signal, the
entirety of the human pro.alpha.1 (I) chain with the exception of
the amino-propeptide domain, and the TAA stop codon coupled to the
HindIII restriction site. Another HindIII site is localized just
after the SacII site, which will enable removal of the BDEFG
fragment by simple digestion with the HindIII restriction
endonuclease. The NheI site leads to substitution of amino acids
Glu and Gly by a leucine and an alanine at position 25 and 26 of
the human pro.alpha.1 (I) chain.
[0392] The plant PRS (Pathogenesis-Related Protein S) peptide
signal replaces the peptide signal particular to the human
pro.alpha.1 (I) chain.
[0393] Cloning Fragment B (SacII/NheI) with the NheI/HindIII Part
of Fragment DEFG
[0394] Approximately 2 .mu.g of the clone pBluescript II
SK(+)-fragment B are digested by the SacII restriction endonuclease
for 90 min at 37.degree. C.
[0395] Subsequent to enzymatic digestion, 80 .mu.l of TE buffer (10
m M Tris, 1 mM EDTA, pH8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2), cf. PREPARATION II1.
[0396] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 34 .mu.l sterile milli-Q water. Digestion by NhcI is
conducted for 2 hours at 37.degree. C.
[0397] Subsequent to enzymatic digestion, 8 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analyzed by electrophoresis on 2% NueSieve-GTG agarose gel
(FMC, Rockland) with low melting point, cf. PREPARATION II1.
[0398] The band corresponding to fragment SacII/NheI of 90 bp is
cut under UV, deposited in 350 .mu.l of a solution of 20 mM Tris
pH8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), cf. PREPARATION II1.
[0399] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analyzed on 2% type II agarose gel (Sigma.TM.)
which enabled us to estimate the concentration of the purified
solution of the SacII/NheI fragment of the clone pBluescript II
SK(+)-fragment B at 1 ng/.mu.l.
[0400] The plasmid used to clone the SacII/HneI fragment of the
clone pBluescript II SK(+)-fragment B is the clone pBluescript II
SK(+)-fragment DEFG digested by the enzymes SacII and NheI. This
clone comprises an ampicillin-resistant.
[0401] 500 ng of the plasmid pBluescript II SK(+)-fragment DEFG is
subjected to digestion by the SacII restriction endonuclease in a
volume of 20 .mu.l for 2 hours at 37.degree. C. After digestion, 80
.mu.l TE buffer (10 mM Tris, 1 mM EDTA, pH 8) are added to the DNA
solution which is extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf. PREPARATION
II1.
[0402] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. Digestion with NhcI is
conducted for 2 hours at 37.degree. C.
[0403] After digestion, 4 .mu.l carrier buffer (30% sucrose, 0.25%
bromophenol blue) are added to the mixture and analyzed on 0.8%
Seaplaque GTG agarose gel (FMC, Rockland), cf. PREPARATION II4. The
DNA band corresponding to pBluescript II SK(+)-fragment DEFG
digested by SacII and NheI is collected and deposited in 350 .mu.l
of a solution of 20 mM Tris pH 8, 1 mM EDTA pH 8. This sample is
incubated for 5 min at 65.degree. C., extracted with one volume of
phenol and centrifuged for 5 min at 10000 g. The aqueous phase is
collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), cf. PREPARATION II1.
[0404] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 20
ng/ml solution of the plasmid pBluescript II SK(+)-fragment DEFG
(SacII/NheI).
[0405] Ligation of the SacII/NheI fragment of clone pBluescript II
SK(+)-fragment B to the clone pBluescript II SK(+)-fragment DEFG
(SacII/NheI) is conducted for 4 hours at ambient temperature.
[0406] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0407] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0408] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0409] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII restriction endonuclease in
order to verify cloning of fragment SacII/NheI of the clone
pBluescript SK(+)-fragment B to the clone pBluescript II
SK(+)-fragment DEFG (NheI/HindIII). Visualisation of a HindIII
fragment of 4000 bp validates these clonings. After
electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide, and the presence of the
HindIII/HindIII fragment of 4000 bp is verified under UV
illumination.
[0410] The sequencing reactions were conducted with the "T7
sequencing" kit (Pharmacia.TM.) which uses the chain termination
technique and T7 DNA polymerase, and permitted validation of the
integrity of the clone pBluescript II SK(+)-fragment BDEFG.
[0411] It is recalled that the clone pBluescript II SK(+)-fragment
BDEFG comprises between these two HindIII sites the sequence coding
for the plant PRS peptide signal and the entirety of the human
pro.alpha.1 (I) chain with the exception of the amino-propeptide
domain.
[0412] Creation of the NheI site leads to substitution of amino
acids Glu and Gly by a leucine and an alanine at position 25 and 26
of the human pro.alpha.1 (I) chain.
[0413] 6/Obtaining Fragment BCDEFG, cDNA Clone Coding for the Plant
PRS Peptide Signal and the Entirety of the Human pro.alpha.1 (I)
Chain
[0414] This stage consists of cloning fragment NheI/NheI
(nucleotides 72 to 479) of 402 bp of the clone pBluescript SK
II(+)-fragment C into the NheI site (of fragment BDEGH) of the
clone pBluescript II SK(+)-fragment BDEFG. This leads to obtaining
the clone pBluescript II SK(+)-fragment BCDEFG which comprises
between sites SacII and HindIII the sequence coding for the plant
PRS peptide signal, the entirety of the human pro.alpha.1 (I) chain
and the TAA stop codon coupled to the HindIII restriction site.
Another HindIII site is localised just after the SacII site which
will enable removal of fragment BCDEFG by simple digestion with the
HindIII restriction endonuclease. The NnheI sites lead to
substitution of amino acids Glu and Gly by a leucine and an alanine
at position 25 and 26 of the human pro.alpha.1 (I) chain, and
substitution of amino acids Asn and Phe by a lysine and a leucine
at position 158 and 159 of the human pro.alpha.1 (I) chain.
[0415] The plant PRS peptide signal replaces the peptide signal
particular to the human pro.alpha.1 (I) chain.
[0416] Cloning Fragment C NheI/NheI) into the NheI Site of Fragment
BDEFG
[0417] Approximately 1 .mu.g of the clone pBluescript II
SK(+)-fragment C are digested by the NheI restriction endonuclease
for 90 min at 37.degree. C.
[0418] Subsequent to enzymatic digestion, 4 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 2% NueSieve-GTG agarose gel
with low melting point (FMC, Rockland), cf. PREPARATION II1.
[0419] The band corresponding to fragment NheI/NheI of 402 bp is
cut under UV, deposited in 350 .mu.l of a solution of 20 mM Tris pH
8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2), cf. PREPARATION II1.
[0420] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analysed on 2% type II agarose gel (Sigma.TM.)
which enabled us to estimate the concentration of the purified
solution of the NheI/NheI fragment of the clone pBluescript II
SK(+)-fragment C at 5 ng/.mu.l.
[0421] The plasmid used to clone fragment NheI/NheI of the clone
pbluescript II SK(+)-fragment C is the clone pBluescript II
SK(+)-fragment BDEFG linearized by the enzyme NheI. This clone
comprises an ampicillin-resistant gene.
[0422] 250 ng of the plasmid pBluescript II SK(+)-fragment BDEFG is
subjected to digestion by the NheI restriction endonuclease, in a
volume of 20 .mu.l for 2 hours at 37.degree. C. After digestion, 80
.mu.l TE buffer (10 mM Tris, 1 mM EDTA pH 8) are added to the DNA
solution which is extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/21), cf. PREPARATION
II1.
[0423] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. To this DNA solution
are added 2 .mu.l 10.times.buffer of calf intestine alkaline
phosphatase (CIP, Promega.TM.), 1 .mu.l CIP (1 u/.mu.l;
Promega.TM.). Dephosphorylation is conducted for 1 hour at
37.degree. C. This stage will prevent self-ligation of this clone
during the ligation stage.
[0424] After digestion, 80 .mu.l TE buffer (10 mM Tris, 1 mM EDTA,
pH 8) are added to the DNA solution which is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf.
PREPARATION II1.
[0425] After centrifuging at 4' c. for 10 min at 12000 g, the DNA
residue is washed in 1 ml ethanol 70, freeze-dried and collected in
20 .mu.l sterile milli-Q water in order to obtain a 10 ng/ml
solution of the plasmid pBluescript SK II(+)-fragment BDEFG (HneI,
dephosphorylated).
[0426] Ligation of fragment NheI/NheI of the clone pBluescript SK
II(+)-fragment C to the clone pBluescript II SK(+)-fragment BDEFG
(NheI, dephosphorylated) is conducted for 4 hours at room
temperature.
[0427] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0428] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml), and these cultures are incubated overnight under
shaking at 37.degree. C.
[0429] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C. and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions.
[0430] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the NheI restriction endonuclease in order
to verify cloning of fragment NheI/NheI of the clone pBluescript II
SK(+)-fragment C to the clone pBluescript II SK(+)-fragment BDEFG
(NheI). Visualisation of a NheI fragment of 402 bp validates
cloning. After electrophoresis, the gel is stained for 15 min in a
40 ng/ml solution of ethidium bromide and the presence of the NheI
fragment of 402 bp is verified under UV illumination.
[0431] The sequencing reactions were conducted with the "T7
sequencing" kit (Pharmacia.TM.) which uses the chain termination
technique and T7 DNA polymerase, and permitted validation of the
integrity of the clone pBluescript II SK(+)-fragment BCDEFG.
[0432] It is recalled that the clone pBluescript II SK(+)-fragment
BCDEFG comprises between these two HindIII sites the sequence
coding for the plant PRS peptide signal and the entirety of the
human pro.alpha.1 (I) chain.
[0433] Creation of the Nhe sites leads to substitution of amino
acids Glu and Gly by a leucine and an alanine at position 25 and 26
of the human pro.alpha.1 (I) chain, and substitution of amino acids
Asn and Phe by a lysine and leucine at position 158 and 159 of the
human pro.alpha.1 (I) chain.
[0434] 7/Obtaining the 4 Constructs pBIOC21-recombinant Human
Collagen.
[0435] Construction of the different plasmids via the use of
recombinant DNA techniques is derived from pBIOC4. The binary
plasmid is derived from pGA442 (An, 1986). The plasmid derived from
pBIOC4 and containing the "PD35S-T35S" expression cassette is the
plasmid pBIOC21.
[0436] The various elements permitting reproduction of these
constructs are for example given in the description in patent
application WO9633277 which is incorporated by reference.
[0437] Obtaining the four constructs pBIOC21-recombinant human
collagen consisted of passing the 4 constructs of the plasmid
pBluescript II SK(+) to the plasmid pBIOC21.
[0438] Plasmid pBIOC21 is used to allow expression of the
recombinant collagen in the leaves and grains of tobacco or colza.
It provides the following regulatory sequences:
[0439] a) the double constitutive promoter 35S (PD35S) of the
Cauliflower Mosaic Virus (CaMV). It corresponds to duplication of
the sequence activating transcription situated upstream from the
TATA element of the natural 35S promoter.
[0440] b) the transcription terminator sequence, terminator polyA
35S, which corresponds to the 3' sequence non-coding for the
sequence of the CaMV circular bicatenary DNA virus producing
transcript 35S.
[0441] Cloning Fragments (HindIII/HindIII) of the pBluescript
Constructs into the HindIII Cloning Site of Vector pBIOC21.
[0442] Approximately 1 .mu.g of the clone pBluescript II
SK(+)-fragment ADEFG or ADEFH or BDEFG or BCDEFG are digested by
the HindIII restriction endonuclease for 90 min at 37.degree.
C.
[0443] Subsequent to enzymatic digestion, 4 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 0.8% Seaplaque-GTG agarose
gel (FMC, Rockland) having a low melting point, cf. PREPARATION
II4.
[0444] The band corresponding to fragment HindIII/HindIII of 4400
bp is cut under UV, deposited in 350 .mu.l of a solution of 20 mM
Tris pH 8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C.
After dissolution of the agarose, the sample is extracted with one
volume of phenol and centrifuged for 5 min at 10000 g. The aqueous
phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf. PREPARATION
II1.
[0445] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analysed on 0.8% type II agarose gel (Sigma.TM.),
which enabled us to estimate the concentration of the purified
solution of fragment HindIII/HindIII of the clone pBluescript II
SK(+)-fragment ADEFG or ADEFH or BDEFG or BCDEFG at 25
ng/.mu.l.
[0446] The plasmid used to clone fragment HindIII/HindIII of the
clone pBluescript II SK(+)-fragment ADEFG or ADEFH or BDEFG or
BCDEFG is the clone pBIOC21 linearized by the HindIII enzyme. This
clone comprises a tetracycline-resistant gene.
[0447] 1 .mu.g of the pBIOC21 plasmid is subjected to digestion by
the HindIII restriction endonuclease, in a volume of 20 .mu.l for 2
hours at 37.degree. C. After digestion, 80 .mu.l TE buffer (10 mM
Tris, 1 mM EDTA, pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2), cf. PREPARATION II1.
[0448] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. To this DNA solution
is added 2 .mu.l of 10.times.buffer of calf intestine alkaline
phosphatase (CIP, Promega.TM.), 1 .mu.l CIP (1 u/.mu.l;
Promega.TM.). Dephosphorylation is conducted for 1 hour at
37.degree. C. This stage prevents self-ligation of this clone
during the ligation stage.
[0449] After digestion, 80 .mu.l TE buffer (10 mM Tris, 1 mM EDTA,
pH 8) are added to the DNA solution which is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2), cf.
PREPARATION II1.
[0450] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 40
ng/ml solution of the plasmid pBIOC21(HindIII,
dephosphorylated).
[0451] Ligation of fragment HindIII/HindIII of the clone
pBluescript II SK(+)-fragment ADEFG or ADEFH or BDEFG or BCDEFG to
the clone pBIOC21 (HindIII, dephosphorylated) is conducted for 4
hours at room temperature.
[0452] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0453] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with
tetracycline (40 .mu.g/ml), and these cultures are incubated
overnight under shaking at 37.degree. C.
[0454] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) following the
manufacturer's instructions. Approximately 1-2 .mu.g of plasmid DNA
is purified with this kit if the plasmid used is pBIOC21.
[0455] An aliquot (5 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the KpnI restriction endonuclease in order
to verify orientation of the cloning of fragment HindIII of the
clone pBluescript II SK(+)-fragment ADEFG or ADEFH or BCDEFG to the
clone pBIOC21 (HindIII). Visualisation of a KpnI fragment of 950 bp
is specific to correct orientation. This KpnI fragment of 950 bp
results from a KpnI restriction site at position 2.8 kb of vector
pBIOC21 and from a KpnI site at position 137 of the sequence coding
for the human pro[.alpha.1 (I) chain. After electrophoresis, the
gel is stained for 15 min in a 40 ng/ml solution of ethidium
bromide, and the presence of the KpnI fragment of 950 bp is
verified under UV.
[0456] For construct pBIOC21-fragment BDEFG, we used the NheI
enzyme and compared its digestion mode with vector pBIOC21-fragment
BCDEFG digested by NheI. The only difference is the presence of a
supernumerary NheI/NheI fragment for vector pBIOC21-fragment
BCDEFG.
[0457] The sequencing reactions were conducted with the "T7
sequencing" kit (Pharmacia.TM.) which uses the chain termination
technique and T7 DNA polymerase, and permitted validation of the
integrity of the 4 pBIOC221 constructs made.
[0458] The sequences of the 4 constructs will now be given. In each
case, the peptide signal of plant PRS or the human pro.alpha.1 (I)
chain are underlined, the substitutions of amino acids due to the
creation of one or two NheI restriction sites are given in bold
print as is the retention sequence in the endoplasmic reticulum
KDEL. The amino- and carboxy-proteinase recognition sites are
outlined.
[0459] The pBIOC21-collagen constructs obtained in this way (FIGS.
5 and 6) will be denoted hereafter:
[0460] pBIOC704 for the construct containing fragment ADEFG
[0461] pBIOC705 for the construct containing fragment ADEFH
[0462] pBIOC706 for the construct containing fragment BDEFG
[0463] pBIOC707 for the construct containing fragment BCDEFG
[0464] The plasmid DNA of the binary plasmids pBIOC704, pBIOC705,
pBIOC706 and pBIOC797 was inserted by direct transformation into
strain LBA4404 of Agrobacterium Tumerfaciens using Holsters' method
(1978). The validity of the clones selected is verified by
enzymatic digestion of the inserted plasmid DNA.
[0465] Restoring Amino Acids Asn and Phe at Position 158 and 159 of
the Human pro.alpha.1 (I) Chain in Clones ADEFG, ADEFH and
BCDEFG.
[0466] All these clones are included in the pBluescript II SK(+)
vector (Stratagene.TM.). The operation consists of exchanging the
sequence lying between sites KpnI (bases 137 to 142) and DraIII
(bases 1709 to 1720) of these constructs by the KpnI-DraIII
sequence of the 1alpha3 cDNA clone. This operation leads to
restoring amino acids 158 and 159 of the pro.alpha.1 (I) chain (Asn
and Phe). This operation was conducted since Morikawa (1980) showed
that residue 159 (Phe) localised three amino acids upstream from
the Pro-Gln cleavage site seemed to play an important role in the
aminoproteinase cutting of the pro.alpha.1 (I) chain.
[0467] 1/Elimination of the KpnI Restriction Site from the pUC18
Vector.
[0468] Vector pUC18 was used since it does not have an internal
DraIII restriction site, unlike the pBluescript II SK(+) vector.
Elimination of the KpnI restriction site will permit use of enzymes
DraIII and KpnI with a view to exchanging the recombinant
KpnI-DraIII fragments of clones ADEFG or ADEFH or BCDEFG for the
wildtype fragment KpnI-DraIII of clone 1alpha3 cDNA.
[0469] For this purpose, 100 ng of pUC18 vector are digested by the
KpnI restriction endonuclease (Promega.TM.) following the
manufacturer's instructions. The vector linearized into KpnI was
then treated with the Mung Bean nuclease (Promega.TM.) following
the manufacturer's instructions in order to obtain a vector pUC18
KpnI with blunt ends. The ligation, transformation and sequencing
stages of the clones obtained are conducted as described in the
part concerning PREPARATION II.
[0470] 2/Transfer of Fragments ADEFG, ADEFH and BCDEFG into the
Vector pUC18 Minus KpnI.
[0471] For this purpose 200 g of the constructs pBluescript II
SK(+)-ADEFG or ADEFH or BCDEFG are digested by the HindIII
restriction endonuclease (Promega.TM.) following the manufacturer's
instructions.
[0472] Subsequent to enzymatic digestion, 4 82 l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 0.8% Seaplaque-GTG agarose
gel (FMC,.TM.) having a low melting point at a constant voltage of
60 volts. The electrophoresis buffer is 0.5.times.TBE (45 mM Tris
borate, 1 mM EDTA (ethylenediaminetetra-acetic acid), pH 8). After
migration the gel is stained for 15 min in a solution of
0.5.times.TBE containing 40 ng/ml ethidium bromide.
[0473] The band corresponding to fragment ADEFG or ADEFH or BCDEFG
is cut under UV, deposited in 350 .mu.l of a solution of 20 mM Tris
pH 8, 1 mM EDTA pH 8, and incubated for 5 min at 65.degree. C.
After dissolution of the agarose, the sample is extracted with one
volume of phenol and centrifuged for 5 min at 10000 g. The aqueous
phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) and centrifuged
for 2 min at 10000 g. The aqueous phase is extracted with
chloroform/isoamyl alcohol (ratio 24/1) and centrifuged for a few
seconds at 10000 g. The aqueous phase is collected, adjusted to a
final NaCl concentration of 0.2 M, and precipitated for 16 hours at
-20.degree. C. after addition of two volumes ethanol 100.
[0474] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
together with 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega,.TM.) are analysed on 0.8% type II agarose gel (Sigma.TM.)
which enabled us to estimate the concentration of the purified
solution of fragment D BamHI/XbaI at 5 ng/.mu.l.
[0475] The plasmid used to clone fragment HINDIII of the clone
pBluescript II SK(+)-fragment ADEFG or ADEFH or BCDEFG is the clone
pUC18 minus KpnI linearized by the HindIII enzyme. This clone
comprises an ampicillin-resistant gene.
[0476] 250 ng of the plasmid pUC18minusKpnI are subjected to
digestion by the HindIII restriction endonuclease following the
manufacturer's instructions. Subsequent to this digestion the DNA
is treated with calf intestine alkaline phosphatase (CIP,
Promega.TM.) following the manufacturer's instructions. This stage
will prevent self ligation of this clone during the ligation
stage.
[0477] After digestion, 80 .mu.l of TE buffer (10 mM Tris, 1 mM
EDTA, pH 8) are added to the DNA solution which is extracted with
one volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) and
centrifuged for 2 min at 10000 g. The aqueous phase is extracted
with chloroform/isoamyl alcohol (ratio 24/1) and centrifuged for a
few seconds at 10000 g. The aqueous phase is collected, adjusted to
a final NaCl concentration of 0.2 M and precipitated 16 hours at
-20.degree. C. after addition of two volumes ethanol 100.
[0478] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 10
ng/ml solution of the plasmid pUC18minusKpnI (HindIII,
dephosphorylated).
[0479] Ligation of fragment HindIII of the clone pBluescript II
SK(+)-fragment ADEFG or ADEFH or BCDEFG to the vector pUC18
minusKpnI (HindIII, dephosphorylated) is conducted for 4 hours at
ambient temperature.
[0480] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL,.TM.).
[0481] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml) and these cultures are incubated overnight under
shaking at 37.degree. C.
[0482] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C. and the bacterial residue is
treated with the Wizard kit (Promega.TM.) which permits
purification of the supercoiled plasmid DNA. This manipulation is
conducted following the manufacturer's instructions. Approximately
10 mg of plasmid DNA is purified with this kit if the plasmid used
is pUC18.
[0483] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the HindIII restriction endonuclease in
order to verify cloning of the HindIII fragment of clone
pBluescript II SK (+)-fragment ADEFG or ADEFH or BCDEFG to the
clone pUC18minusKpnI(HindIII). After electrophoresis the gel is
stained for 15 min in a 40 ng/ml solution of ethidium bromide, and
the presence of the HindIII fragment of 4400 bp is verified under
UV.
[0484] The sequencing reactions conducted with the "T7 sequencing"
kit (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase (cf. PREPARATION 1) permits validation of the
integrity of cloning.
[0485] 3/Exchange of Recombinant Fragments KpnI-DraIII of Clones
ADEFG, ADEFH and BCDEFG by the Wildtype Fragment KpnI-DraIII of
Clone 1alpha3 cDNA.
[0486] For this purpose 500 ng of the clone 1alpha3 cDNA are
digested by the restriction endonucleases KpnI(Promega.TM.) and
DraIII (Boehringer Mannheim) following the manufacturer's
instructions.
[0487] Subsequent to enzymatic digestion 4 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 0.8% Seaplaque-GTG agarose
gel (FMC, Rockland.TM.) having a low melting point at constant
voltage of 60 volts. The electrophoresis buffer is 0.5.times.TBE
(45 mM Tris borate, 1 mM EDTA (ethylenediaminetetra-acetic acid),
pH 8). After migration the gel is stained for 15 min in a solution
of 0.5.times.TBE containing 40 ng/ml of ethidium bromide.
[0488] The band corresponding to fragment KpnI-DraIII is cut under
UV, deposited in 350 .mu.l of a solution of 20 mM Tris pH 8, 1 mM
EDTA pH 8 and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) and centrifuged for 2 min at 10000 g. The
aqueous phase is extracted with - chloroform/isoamyl alcohol (ratio
24/1) and centrifuged for a few seconds at 10000 g. The aqueous
phase is collected, adjusted to a final NaCl concentration of 0.2 M
and precipitated for 16 hours at -20.degree. C. after addition of
two volumes ethanol 100.
[0489] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l
and 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analysed on 0.8% type II agarose gel (Sigma)
which enabled us to estimate the concentration of the purified
solution of fragment KpnI-DraIII of the 1alpha3 cDNA clone at 5
mg/.mu.l.
[0490] The plasmid used to clone fragment KpnI-DraIII of clone
1alpha3 cDNA is the clone pUC18minusKpnI-fragment ADEFG or ADEFH or
BCDEFG digested by enzymes KpnI-DraIII. This clone comprises an
ampicillin-resistant gene.
[0491] 250 ng of the plasmid pUC18 minusKpnI-fragment ADEFG or
ADEFH or BCDEFG is subjected to digestion by restriction
endonucleases KnpI and DraIII following the manufacturer's
instructions.
[0492] Subsequent to enzymatic digestion, 4 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis of 0.8% SeaPlaque-GTG agarose
gel (FMC,.TM.) having a low melting point at a constant voltage of
60 volts. The electrophoresis buffer is 0.5.times.TBE (45 mM Tris
borate, 1 mM EDTA (ethylenediaminetetra-acetic acid), pH8). After
migration, the gel is stained for 15 min in a solution of
0.5.times.TBE containing 40 ng/ml ethidium bromide.
[0493] The band corresponding to the vector pUC18
minusKpnI-fragment ADEFG or ADEFH or BCDEFG KpnI-DraIII is cut
under UV, deposited in 350 .mu.l of a solution of 20 mM Tris pH 8,
1 mM EDTA pH 8 and incubated for 5 min at 65.degree. C. After
dissolution of the agarose, the sample is extracted with one volume
of phenol and centrifuged for 5 min at 10000 g. The aqueous phase
is collected, extracted with one volume phenol/chloroform/isoamyl
alcohol (ratio 50/48/2) and centrifuged for 2 min at 10000 g. The
aqueous phase is extracted with chloroform/isoamyl alcohol (ratio
24/1) and centrifuged for a few seconds at 10000 g. The aqueous
phase is collected, adjusted to a final NaCl concentration of 0.2M
and precipitated for 16 hours at -20.degree. C. after addition of
two volumes ethanol 100.
[0494] After centrifuging at 4.degree. C. for 10 min at 12000 g the
DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
and 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega.TM.) are analysed on 0.8% type II agarose gel (Sigma)
which enabled us to estimate the concentration of the purified
solution of the vector pUC18 minusKpnI-fragment ADEFG or ADEFH or
BCDEFG KpnI-DraIII at 8 ng/.mu.l.
[0495] Ligation of fragment KpnI-DraIII of the 1alpha3 cDNA clone
to the vector pUC18 minusKpnI-fragment ADEFG or ADEFH or BCDEFG
KpnI-DraIII is conducted for 4 hours at room temperature.
[0496] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0497] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with ampicillin
(50 .mu.g/ml) and these cultures are incubated overnight under
shaking at 37.degree. C.
[0498] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C. and the bacterial residue is
treated with the Wizard kit (Promega,.TM.) which permits
purification of the supercoiled plasmid DNA. This manipulation is
conducted following the manufacturer's instructions. Approximately
10 .mu.g plasmid DNA is purified with this kit if the plasmid used
is pUC18.
[0499] An aliquot (2 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the NheI restriction endonuclease in order
to verify cloning of fragment KpnI-DraII of clone 1alpha33 cDNA to
the clone pUC18 minusKpnI-fragment ADEFG or ADEFH or BCDEFG
KpnI-DraIII. Exchange of recombinant fragment KpnI-DraIII by the
wildtype fragment leads to elimination of a NheI restriction site.
After electrophoresis, the gel is stained for 15 min in a 40 ng/ml
solution of ethidium bromide, and elimination of the NheI
restriction site is verified under UV illumination.
[0500] The sequencing reactions conducted with the "T7 sequencing"
kit (Pharmacia tM) which uses the chain termination technique and
T7 DNA polymerase (cf. PREPARATION I) permits validation of cloning
integrity.
[0501] The fragments obtained are ADEFGphe159, ADEFHphe159 and
BCDEFGphe159.
[0502] 4/Obtaining Constructs pBIOC21-recombinant Human Collagen
phe159.
[0503] This stage consists of passing the 3 constructs of plasmid
pUC18 minusKpnI to plasmid pBIOC21.
[0504] Plasmid pBIOC21 is used to enable expression of recombinant
collagen in the leaves of tobacco or colza. It provides the
following regulatory sequences:
[0505] a) the double-35S constitutive promoter (PD35S) of CaMV.
This corresponds to duplication of the sequence activating
transcription upstream from the TAT element of the natural 35S
promoter.
[0506] b) the transcription terminator sequence, terminator polyA
35S, which corresponds to the 3' sequence non-coding for the
sequence of the circular bicatenary DNA cauliflower mosaic virus
producing transcript 35S.
[0507] Construction of the different plasmids via the use of
recombinant DNA techniques is derived from pBIOC4. The binary
plasmid derives from pGA442 (AN, 1986). The plasmid derived
from-pBIOC4 and containing the "PD35S-TS5S" expression cassette is
plasmid pBIOC21.
[0508] The various elements permitting reproduction of these
constructs are for example contained in the description in patent
application WO9633277 which is incorporated by reference.
[0509] Cloning of Fragments (HindIII/HINDIII) of Constructs
pUC18minusKpnI into the HindIII Cloning Site of the pBIOC21
Vector.
[0510] Approximately 1 .mu.g of the clone pUC18 minusKpnI-fragment
ADEFGphe159 or BCDEFGphe150 are digested by the HindIII restriction
endonuclease following the manufacturer's instructions.
[0511] Subsequent to enzymatic digestion, 4 .mu.l stop buffer (30%
sucrose, 0.25% bromophenol blue) are added to the DNA solution
which is analysed by electrophoresis on 0.8% SeaPlaque-GTG agarose
gel having a low melting point (FMC, Rockland) at a constant
voltage of 60 volts. The electrophoresis buffer is 0.5.times.TBE
(45 mM Tris borate, 1 mM EDTA (ethylenediaminetetra-acetic acid, pH
8). After migration the gel is stained for 15 min in a solution of
0.5.times.TBE containing 40 ng/ml ethidium bromide.
[0512] The band corresponding to fragment HindIII/HindIII of 4400
bp is cut under UV, deposited in 350 .mu.l of a solution of 20 mM
Tris pH8, 1 mM EDTA pH8 and incubated for 5 min at 65.degree. C.
After dissolution of the agarose, the sample is extracted with one
volume of phenol and centrifuged for 5 min at 10000 g. The aqueous
phase is collected, extracted with one volume
phenol/chloroform/isoamyl alcohol (ratio 50/48/2) and centrifuged
for 2 min at 10000 g. The aqueous phase is extracted with
chloroform/isoamyl alcohol (ratio 24/1) and centrifuged for a few
seconds at 10000 g. The aqueous phase is collected, adjusted to a
final NaCl concentration of 0.2 M, and precipitated for 16 hours at
-20.degree. C. after addition of two volumes ethanol 100.
[0513] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water. An aliquot of 2 .mu.l,
and 500 ng of the HindIII-EcoRI fragments of lambda phage
(Promega,.TM.) are analysed on 0.8% type II agarose gel
(Sigma.TM.), which enabled us to estimate the concentration of the
purified solution of fragment HindIII/HindIII of clone pUC18
minusKpnI-fragment ADEFGphe159 or ADEFH159 or BCDEFGphe159 at 25
ng/.mu.l.
[0514] The plasmid used to clone fragment HindIII/HindIII of clone
pUC18minusKpnI-fragment ADEFGphe 159 or ADEFHphe159 or BCDEFGphe159
is the pBIOC21 clone linearized by the HindIII enzyme. This clone
comprises a tetracycline-resistant gene.
[0515] 1 .mu.g of plasmid pBIOC21 is subjected to digestion by the
HindIII restriction endonuclease. This digestion is conducted in a
volume of 20 .mu.l in the presence of 2 .mu.l B buffer
(Promega,.TM.), 1 .mu.l HindIII enzyme (12 u/.mu.l; Promega.TM.)
for 2 hours at 37.degree. C. After digestion, 80 .mu.l TE buffer
(10 mM Tris, 1 mM EDTA pH 8) are added to the DNA solution which is
extracted with one volume phenol/chloroform/isoamyl alcohol (ratio
50/48/2) and centrifuged for 2 min at 10000 g. The aqueous phase is
extracted with chloroform/isoamyl alcohol (ratio 42/1) and
centrifuged for a few second at 10000 g. The aqueous phase is
collected, adjusted to a final NaCl concentration of 0.2 M and
precipitated for 16 hours at -20.degree. C. after addition of two
volumes ethanol 100.
[0516] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml of ethanol 70, freeze dried and
collected in 17 .mu.l sterile milli-Q water. To this DNA solution
are added 2 .mu.l 10.times.buffer of calf intestine alkaline
phosphatase (CIP, Promega,.TM.), 1 .mu.l CIP (1 u/.mu.l;
Promega,.TM.). Dephosphorylation is conducted for 1 hour at
37.degree. C. This stage prevents self-ligation of this clone
during the ligation stage.
[0517] After digestion, 80 .mu.l TE buffer (10 mM Tris, 1 mM EDTA,
pH 8) are added to the DNA solution which is extracted with one
volume phenol/chloroform/isoamyl alcohol (ratio 50/48/2) and
centrifuged for 2 min at 10000 g. The aqueous phase is extracted
with chloroform/isoamyl alcohol (ratio 24/1) and centrifuged for a
few seconds at 10000 g. The aqueous phase is collected, adjusted to
a final NaCl concentration of 0.2 M and precipitated for 16 hours
at -20.degree. C. after addition of two volumes ethanol 100.
[0518] After centrifuging at 4.degree. C. for 10 min at 12000 g,
the DNA residue is washed in 1 ml ethanol 70, freeze dried and
collected in 20 .mu.l sterile milli-Q water in order to obtain a 40
ng/ml solution of the plasmid pBIOC21 (HindIII,
dephosphorylated).
[0519] Ligation of fragment HindIII/HindIII of the clone
pUC18minusKpnI-fragment ADEFGphe159 or ADEFHphe159 or BCDEFGphe159
to the clone pBIOC21 (HindIII, dephosphorylated) is conducted for 4
hours at room temperature.
[0520] For transformation, the competent bacteria used are
DH5-Alpha (Gibco BRL, Paris).
[0521] Several white colonies are tested. For testing, they are
deposited individually in 3 ml L-Broth supplemented with
tetracycline (40 .mu.g/ml), and these cultures are incubated
overnight under shaking at 37.degree. C.
[0522] To purify the plasmid DNA, the culture is first centrifuged
at 1500 g for 10 min at 4.degree. C., and the bacterial residue is
treated with the Wizard kit (Promega.TM.) which permits
purification of the supercoiled plasmid DNA. This manipulation is
conducted following the manufacturer's instructions. Approximately
1-2 .mu.g plasmid DAN can be purified with this kit if the plasmid
used is pBIOC21.
[0523] An aliquot (5 .mu.l out of the 60 obtained) is subjected to
enzymatic digestion by the KpnI restriction endonuclease in order
to verify the cloning orientation of the HindIII fragment of clone
pUC18minusKpnI-fragment ADEFGphe159 or ADEFH159 or BCEDFGphe159 to
the clone pBIOC21 (HindIII). Detection of a KpnI fragment of 950 bp
is specific to proper orientation. This KpnI fragment of 950 bp
results from a KpnI restriction site at position 2.8 kb of the
vector pBIOC21 and from a KpnI site at position 137 of the sequence
coding for the human pro.alpha.1 (I) chain. After electrophoresis,
the gel is stained for 15 min in a 40 ng/ml solution of ethidium
bromide, and the presence of the KpnI fragment of 950 bp is
verified under UV illumination.
[0524] The sequencing reactions conducted with the "T7 sequencing"
kit (Pharmacia.TM.) which uses the chain termination technique and
T7 DNA polymerase (cf. PREPARATION I) permits validation of cloning
integrity.
[0525] The pBIOC21-collagen constructs obtained in this way shall
be designated as follows:
[0526] pBIOC708 for the construct containing the fragment
ADEFGphe159
[0527] pBIOC709 for the construct containing fragment
ADEFHphe159,
[0528] pBIOC710 for the construct containing fragment
BCDEFHphe159.
EXAMPLE 2
Construction of Chimeric Genes Coding for the Recombinant Protein
of Human Collagen and Permitting Expression in Maize Seeds
[0529] Constitutive expression in maize seeds of the cDNA coding
for the human collagen pro-[.alpha.1 (I) chain required the
following regulatory sequences:
[0530] 1. the maize zein gene promoter (Pzein) contained in plasmid
p63. This permits expression in the albumin of maize seeds;
[0531] 2. the transcription terminator sequence, terminator polyA
NOS, which corresponds to the 3' region non-coding for the nopaline
synthase gene of the Ti plasmid of Agrobacterium tumefaciens,
nopaline strain.
[0532] The different elements which permit the reproduction of
these constructs are for example contained in the description in
patent application WO909633277 which is incorporated by
reference.
[0533] Fragments ADEFG, ADEFH, BDEFG and BCDEFG were isolated from
the plasmids by digestion with HindIII, purified by electrophoresis
on 0.8% agarose gel, electroeluted, subjected to alcohol
precipitation and dried. These DNA fragments were then treated with
the Klenow enzyme (New England Biolabs.TM.) following the
manufacturer's instructions, subjected to phenol-chloroform
extraction, alcohol precipitation and collected in 10 .mu.l
H20.
[0534] The p63 plasmid was double digested by SacI and BamHI,
purified by electrophoresis on 0.8% agarose gel, electroeluted,
subjected to alcohol precipitation and dried. It was then treated
with the T4 polymerase enzyme (New England Biolabs.TM.) and
dephosphorylated with calf intestine alkaline phosphatase enzyme
(Boehringer Mannheim) following the manufacturer's
instructions.
[0535] Each ADEFG, ADEFH, BDEFG and BCDEFG fragment obtained as
described above was ligated to plasmid p63 treated as described
above.
[0536] Ligation and transformation of the competent Escherichia
coli bacteria, strain DH5a were conducted using standard methods.
The plasmids obtained are denoted pBIOC700, pBIOC701, pBIOC702 and
pBIOC703 respectively, and respectively contain fragments ADEFG,
ADEFH, BDEFG and BCDEFG.
[0537] Amino acids Asn and Phe at positions 158 and 159 of the
human pro.alpha.1 (I) chain were restored into clones ADEFG, ADEFH
and BCDEFG to obtain ADEFGphe159, ADEFHphe159 and BCDEFHphe159
respectively. This modification is described in example 1.
[0538] Fragments ADEFGphe159, ADEFHphe159 and BCDEFHphe159 were
isolated from the plasmids by digestion with HindIII, purified by
electrophoresis on 0.8% agarose gel, electroeluted, subjected to
alcohol precipitation and collected in 10 .mu.l H20. The fragments
thus prepared were ligated to plasmid p63 treated as described
above. The plasmids obtained are denoted pBIOC711, pBIOC712 and
pBIOC713, and respectively contain fragments ADEFGphe159,
ADEFHphe159 and BCDEFHphe159.
EXAMPLE 3
Obtaining Transgenic Colza Plants
[0539] Grains of Spring rape (Brassica napus cv WESTAR or Limagrain
lines) are disinfected for 40 minutes in a 15% Domestos.TM.
solution. After rinsing 4 times in sterile water, the grains are
left to germinate, 20 grains per pot 7 cm in diameter and 10 cm
high, on Murashige and Skoog mineral medium (Sigma M 5519) with 30
g/l sucrose and solidified with 5 g/l agargel. These pots are
placed in a culture chamber at 26.degree. C. with a photoperiod of
16 h/8 h under a light intensity in the region of 80 .mu.E m.sup.-2
S.sup.-1.
[0540] After germinating for 5 days, the cotyledons are collected
in sterile manner, cutting each petiole approximately 1 mm above
the cotyledon node.
[0541] At the same time a preculture of Agrobacterium tumefaciens
strain LBA4404 containing the plasmids is grown in a 50 ml
erlenmeyer tube for 36 h at 28.degree. C. in 10 ml 2YT bacterium
medium supplemented with antibiotics appropriate for the selection
of the strain used.
[0542] This preculture is used for 1% seeding of a new bacterial
culture made under the same conditions. After 14 h the culture is
centrifuged for 15 min at 3000 g and the bacteria are collected in
an equivalent volume of liquid germination medium. This suspension
is spread into petri dishes 5 cm in diameter to a density of 5
ml/dish.
[0543] The cut end of the petiole is immersed for a few seconds in
the solution of agrobacteria prepared in this way, then the petiole
is planted a few millimetres deep into the regeneration medium.
This medium has the same basic composition as the germination
medium with, in addition, 4 mg/l of benzyl-amino-purine (BAP) a
phytohormone which promotes bud neoformation. Ten explants
(cotyledon with petiole) are cultured per Petri dish 9 cm in
diameter.
[0544] After 2 days' co-culture under the same environmental
conditions as for germination, the explants are replanted into
phytatrays (Sigma reference P1552) containing the preceding medium
supplemented with a selective agent: 45 mg/l kanamycine sulfate
(Sigma, reference K4000) and a bacteriostatic: mixture of 1/6 (by
weight) of potassium salt of clavulanic acid and 5/6 sodium salt of
amoxicillin (injectable Augmentin.TM.) to 600 mg/l.
[0545] The explants are replanted two consecutive times at a 3-week
interval in sterile manner in a fresh medium under the same
conditions.
[0546] The green buds which appear at the end of the second or
third replanting are separated from the explant and cultured
separately in transparent pots 5 cm in diameter and 10 cm high
containing an identical medium to the previous one but without BAP.
After 3 week's culture, the stalk of the transformed bud is cut and
the bud is replanted in a pot of fresh medium. After three to four
weeks, the roots have sufficiently developed to allow
acclimatisation of the seedling in a phytotron. Any buds that are
not green or have not taken root are removed. These seedlings are
then transplanted into square pots with 7 cm sides filled with
compost soil (NF standard U4451: 40% brown peat: 30% sifted
heath-mould: 30% sand) saturated in water. After two weeks'
phytotron acclimatisation (temperature 21.degree. C., photoperiod
16 h/8 h and 84% relative humidity) the seedlings are transferred
to pots 12 cm in diameter filled with the same compost soil
enriched with slow release fertiliser and transferred to a
greenhouse (class S2) regulated at 18.degree. C. with two daily
water sprinklings lasting 2 minutes.
[0547] As soon as the flowers appear they are packed in sachets
such as to prevent cross-fertilisation.
[0548] When the siliquae reach maturity they are harvested, dried
and threshed. The grains obtained are used to titre biochemical
activity. Selection of transgenic descent is made by germination on
a medium containing kanamycine sulfate to the proportion of 100 to
150 mg/l (according to genotype). Operating conditions are
identical to those described above except that germination is
conducted in glass tubes with a single grain per tube. Only those
seedlings which develop secondary roots during the first three
weeks are acclimatised in a phytotron before being transferred to a
greenhouse.
EXAMPLE 4
Obtaining Transgenic Tobacco Plants
[0549] The tobacco plants used for transformation experiments
(Nicotiana tabacum var. Xanthi NC and PBD6) are cultured in vitro
in a Marashige and Skoog basic medium (1962) supplemented with
vitamins described by Gamborg et al. (1968, Sigma reference M0404),
20 g/l sucrose and 8 g/l agar. The pH of the medium is adjusted to
5.8 with a potash solution before autoclaving at 120.degree. C. for
20 min. Inter-node cuttings are taken from the tobacco plants every
30 days and planted in this MS20 proliferation medium.
[0550] All in vitro cultures are conducted in an air-conditioned
enclosure under the following conditions:
[0551] light intensity of 30.mu. E.m.sup.-2,s.sup.-1; photoperiod
of 16 h;
[0552] thermoperiod of 26.degree. C. during the daytime, 24.degree.
C. at night.
[0553] The transformation technique used is derived from that
described by Holsters et al. (1985).
[0554] A preculture of Agrobacterium tumefaciens, LBA4404 strain,
containing the plasmids is made for 48 h at 28.degree. C. under
stirring in an LB medium supplemented with appropriate antibiotics
(rifampicin and tetracycline). The preculture is then diluted to
{fraction (1/50)} in the same medium and cultured under the same
conditions. After one night, the culture is centrifuged (10 min.,
3000 g), the bacteria are recovered in an equivalent volume of
liquid MS30 medium (30 g/l sucrose) and this suspension is diluted
to {fraction (1/10)}.
[0555] Explants of approximately 1 cm.sup.2 are cut from the leaves
of the above-described seedlings. They are then placed in contact
with the bacterial suspension for 1 h, quickly dried on filter
paper and placed on a co-culture medium (solid MS30).
[0556] After 2 days, the explants are transferred to Petri dishes
on the MS30 regeneration medium, containing a selective agent,
kanamycine (200 mg/l), a bacteriostatic, augmentin (400 mg/l) and
the hormones necessary for bud induction (BAP, 1 mg/l and ANA, 0.1
mg/l). The explants are replanted onto the same medium after 2
weeks' culture. After 2 additional weeks, the buds are replanted
into Petri dishes on a development medium made up of MS20 medium
supplemented with kanamycine and augmentin. After 15 days, one half
of the buds are transplanted. Root growth requires approximately 20
days after which the seedlings can be cloned by inter-node
propagation or transferred to a greenhouse.
EXAMPLE 5
Obtaining Transgenic Maize Plants
Obtaining Transgenic Maize Plants
[0557] a) Obtaining Maize Calli and their Use as a Target for
Genetic Transformation.
[0558] The genetic transformation of maize, irrespective of the
method used (electroporation, Agrobacterium, microfibres, particle
gun) generally requires the use of fast division undifferentiated
cells which have maintained the ability to regenerate full plants.
This type of cell makes up the friable embryogenous callus
(so-called type II) of maize.
[0559] These calli are obtained from immature embryo of genotype HI
II or (A188.times.B73) using the method and media described by
Armstrong (1994). The calli obtained in this way are multiplied and
maintained by successive transplanting every fifteen days onto the
initiation medium.
[0560] Seedlings are then regenerated from these calli by modifying
the hormonal and osmotic equilibrium of the cells in accordance
with the method described by Vain et al. (1989). These plants are
then acclimatised in a greenhouse where they can be cross-bred or
self-fertilised.
[0561] b) Use of a Particle Gun for the Genetic Transformation of
Maize
[0562] The preceding paragraph describes how to obtain and
regenerate the cell lines needed for transformation; here a genetic
transformation method is described leading to stable incorporation
of the modified genes into the plant genome. This method is based
on the use of a particle gun; the target cells are callus fragments
described in paragraph 1. These fragments with a surface area of 10
to 20 mm.sup.2 were deposited, 4 h before bombardment, in the
centre of a Petri dish, 16 fragments per dish, containing a culture
medium identical to the initiation medium supplemented with 0.2 M
mannitol+0.2 M sorbitol. The plasmids carrying the genes to be
incorporated are purified on a Qiagen.TM. column following the
manufacturer's instructions. They are then precipitated onto
tungsten particles (M10) according to the protocol described by
Klein (1987 327 :70-73). The particles coated in this way are gun
sprayed onto the target cells.
[0563] The bombarded callus dishes are sealed and cultured in the
dark at 27.degree. C. The first transplanting is made 24 h later,
and then every fifteen days for 3 months onto an identical medium
to the initiation medium supplemented with a selective agent whose
type and concentration may vary according to the gene used (see
paragraph 3). Suitable selective agents are generally active
compounds of some herbicides (Basta.RTM., Round-up.RTM.) or certain
antibiotics (Hydromycine, Kanamycine..).
[0564] After 3 months, and sometimes earlier, calli are obtained
whose growth is not inhibited by the selection agent, and are
usually and chiefly made up of cells resulting from the division of
a cell having incorporated into its genetic inheritance one or more
copies of the selection gene. The incidence rate of obtaining such
calli is approximately 0.8 callus per bombarded dish.
[0565] These calli are identified, individualised, amplified, then
cultured such as to regenerate seedlings (cf. paragraph a). In
order to avoid any interference with non-transformed cells, all
these operations are conducted on culture media containing the
selective agent.
[0566] The plants regenerated in this manner are acclimatised and
cultured in a greenhouse where they can be cross-bred or
self-fertilised.
EXAMPLE 6
Extraction and Screening
Extraction from Tobacco Plants that are Genetically Transformed in
Accordance with the Invention
[0567] 45 plants numbered 1 to 22 at the time of transfection with
the pBIOC707 construct (comprising the N-propeptide, the major
triple coil and the C-propeptide) and from 23 to 45 at the time of
transfection with the pBIOC706 construct (comprising the major
triple coil and the C-propeptide) are cut and weighed and frozen in
liquid nitrogen. The different plants are then crushed in liquid
nitrogen using a homogenizer for 2 min in order to obtain a fine
powder, then stored until required for use at -20.degree. C.
[0568] Extraction with Acetic Acid:
[0569] The powder obtained for each plant, including
non-transformed control plants, is collected in a 0.5 M solution of
acetic acid containing 200 mM NaCl and protease inhibitors: 1 mM
phenyl methyl sulfonide (PMSF), 1 mM N-ethyl maleimide (NEM), 2.5
mM ethylenediaminetetra-acetic acid (EDTA) to a proportion of 1
gram of powder per 4 ml of solution. The mixture is shaken at
4.degree. C. for 60 hours. After centrifuging each sample at 20000
g(12148 rotor, Sigma.TM.) for 30 minutes at 4.degree. C., the
residues are washed twice in distilled water and stored at
-20.degree. C. An aliquot (100 .mu.l) of the supernatants is
collected to conduct protein titration on the total extract. The
remaining supernatants are stored at -20.degree. C.
[0570] Protein Titration of the Total Extract:
[0571] The collected aliquots of 100 .mu.l for the acid-soluble
extract and 20 .mu.l for the neutral buffer extract are titrated
using a ready prepared Coomassie solution. Titration is conducted
in multi-well trays and results are read using a plate reader (SLT
Lab Instruments, Austria) at a wavelength of 620 nm. A template
range is made with a 100 .mu.g/ml BSA solution from 0 to 10
.mu.g/well: 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 .mu.l are
deposited in each well and completed if necessary to a final volume
of 100 .mu.l. The different samples are also deposited in the wells
and completed if necessary to 100 .mu.l in the extraction buffer.
References are made per 100 .mu.l distilled water for the template
range and per 100 .mu.l extraction buffer for the samples. 100
.mu.l of reagent are then added to each well and the values read
immediately. The values obtained for each reference are
respectively deducted from the values obtained for the template
range and those of samples. A template curve is plotted and the
protein concentration of the samples is deduced from this
tracing.
[0572] Screening of Positives:
[0573] Screening is Conducted in Two Manners:
[0574] 1. Plant screening (after crushing and extraction) by gel
electrophoresis followed by immunotransfer. The control collagen
used is collagen I extracted from human or bovine tissue with
acetic acid and purified by salt precipitation. The molecular form
of collagen I that is most widely found in tissues is the
heterotrimer containing two chains .alpha.1 and .alpha.2: [.alpha.1
(I) 2.alpha.2 (I). In this case the chain of interest .alpha.1
migrates slightly above 116 KDa, it only contains the major triple
coil and the telopeptides; the N and C-propeptides were cleaved
during maturation of the collagen and are therefore no longer
present.
[0575] 2. Screening of positives by indirect immunofluorescence on
frozen sections of the different plants.
[0576] In both cases, the antibody used is a polyclonal antibody
made in rabbit specific to collagen I; it recognises human and
bovine collagen I and chains .alpha.1 (I) and .alpha.2 (I)
indifferently (reference 20121, Institut Pasteur, Lyon). Another
antibody may also be used: a Sp1D8 monoclonal antibody (Hybridoma
Bank, USA) directed against the cleavage site of the type I
N-propeptide. These two antibodies may be used on denatured
collagen I (after gel electrophoresis and protein transfer) and on
native collagen (by immunofluorescence).
[0577] 1. Screening after Electrophoresis Analysis of Plants
Followed by Immunotransfer
[0578] Analytical Method
[0579] Screening is made on the acetic acid extracts. The
supernatants and residues are analysed.
[0580] Electrophoresis
[0581] 500 .mu.l of supernatants, i.e. 15 to 25 .mu.g of total
proteins, are precipitated by the addition of 50 .mu.l 100%
trichloroacetic acid for 30 minutes at room temperature. The
samples are centrifuged at 20000 g for 15 minutes at 4.degree. C.,
the residues washed twice in 100% cold ethanol. The precipitates
are collected in 20 .mu.l carrier buffer (60 mM Tris-Hcl, pH 6.8)
containing 2% sodium dodecyl sulfate, 10% glycerol, 0.002%
bromophenol blue) in the presence of final 10 mM dithiothreitol
(DTT) reducing agent, then denatured for 3 minutes at 100.degree.
C.
[0582] The Residues:
[0583] The residues, washed in distilled water to prevent the
presence of acid and salts derived from the extraction buffer, are
collected in 50 .mu.l distilled water, 10 .mu.l of the suspension
are collected to which are added 20 .mu.l carrier buffer
concentrated 3 times (180 mM Tris-Hcl pH 6.8 containing 6% sodium
dodecyl sulfate, 30% glycerol, 0.006% bromophneol blue) in the
presence of final 10 mM dithiothreitol (DTT) reducing agent, then
denatured for 3 minutes at 100.degree. C.
[0584] The different samples are deposited on 6% acrylamide gel in
a solution of 0.4 M Tris-HCl pH 8.8 containing 0.1% sodium dodecyl
sulfate with a 4% concentration gel in a solution of 0.4% Tris-HCl
pH 6.8 containing 0.1% sodium dodecyl sulfate. On each gel three
wells are reserved respectively for the standard molecular weights
(6H Sigma.TM.), control collagen I (bovine or human, 3 .mu.g/well)
and the sample corresponding to the non-transformed plant.
Migration takes place in a migration buffer of 0.025 M Tris-0.2
lycine containing 0.1% sodium dodecyl sulfate under a voltage of
100 volts in the concentration gel, increased to 200 volts for the
separation gel.
[0585] Immunotransfer:
[0586] After migration, the gels are spotted on a poly(vinylidene
difluoride) membrane (Immobilon-P, Millipore.TM.) previously
moistened with 100% methanol then soaked in the CAPS transfer
buffer (10 mM cyclohexylamino-l-propanesulfonic acid, pH 11, 5%
methanol). The gel and membrane are placed in a transfer apparatus
(Biorad.TM.) and subjected to a voltage of 60 volts for 16 hours,
cooled by a cold water circulation system.
[0587] To verify transfer efficiency, the gels are stained blue
with Coomassie R-250 (0.2% solution in 40% methanol and 10% acid)
for 30 minutes. They are then selectively discoloured in a solution
of 15% methanol and 7.5% acetic acid and those proteins that are
not or only partially transferred are detected by the presence of
bands remaining on the gel. Also, the membranes are stained with
Ponceau S (0.2% in 1% acetic acid) for 10 minutes then discoloured
in distilled water. The different proteins that are properly
transferred are detected, the lane corresponding to molecular
weight standards is excised, air dried and stored between two
sheets of filter paper. The remainder of the membranes is entirely
discoloured.
[0588] The membranes are then saturated for one hour in 10% skimmed
milk powder then quickly rinsed in 25 mM Tris-HCl pH 7.4, 150 mM
NaCl, 2.5 mM KCl (TBS). The membranes are subsequently incubated
with the polyclonal antibodies directed against the major triple
coil of bovine collagen I made in rabbit diluted to 1:400 in TBS
buffer containing 0.05% Tween 20 (TTBS), 1% bovine serum albumin
for 2 hours at room temperature. After incubating with the
antibodies the membranes are rinsed 6 times for 5 minutes in TTBS,
then incubated with the conjugate diluted to 1:2000 (anti-IgC of
rabbit made in pig, coupled to alkaline phosphatase (Dako.TM.,
Denmark) for 1 hour at room temperature. The membranes are again
rinsed in TTBS (6 times 5 minutes) then developed with APColor kit
reagents (Biorad.TM.). The lanes having one or more bands with the
expected molecular weights correspond to the positives, and the
corresponding plant numbers are recorded. All the positives are
subjected to a second screening (gel+immunotransfer).
[0589] Results:
[0590] pBIOC706
[0591] The pBIOC706 construct has 40% positives in the form of a
major band migrating at the level of the control .alpha.1 (I)
chain. This result suggests that the C-propeptide (approximately 30
KDa) of the recombinant .alpha.1 (I) chain has been cleaved. The
lanes corresponding to the non-transformed control plant show no
band developed by the anti-collagen I antibody.
[0592] plants 23, 25, 28, 32, 36, 38, 39, 40, 45 are identified as
positive, plants 40 and 45 are determined as being the most
productive through their presence in the supernatants and their
abundance in the residues.
[0593] pBIOC707
[0594] The pBIOC707 construct shows 27% positives in the form of a
major band migrating above the control alpha1 (I) chain
corresponding to a molecular weight of approximately 140 KDa. The
expected molecular mass for the entire recombinant chain being
approximately 160 KDa, this result suggests that the N-propeptide
(approximately 20 KDa) or C-propeptide (approximately 30 KDa) of
the recombinant .alpha.1 (I) chain has been cleaved. The lanes
corresponding to the non-transformed control plant show no band
developed by the anti-collagen I antibody.
[0595] plants 1, 2, 14, 16, 17, 19 are identified as positive,
plants 1, 2 and 14 are determined as being the most productive
through their presence in the supernatants and abundance in the
residues (FIG. 2).
[0596] 2. Immunofluorescence:
[0597] Analytical Method
[0598] The plant leaves are coated in a cold inclusion medium
(Tissue-Tek, Miles, USA) and frozen on the cryostat platinum cooled
to -30.degree. C.
[0599] Histological slides treated with aminoalkylsilane are
prepared using the following method:
[0600] Immersion in a 2% solution of 3-aminopropyltriethoxysilanel
in acetone, for 5 seconds
[0601] Washing in acetone, 2.times. 1 minute
[0602] Washing in distilled water
[0603] Drying overnight at 42.degree. C.
[0604] Freezing 7 .mu.m sections are taken of all plants using a
cryostat and deposited on the treated slides. The slides are then
treated as follows:
[0605] Rinsing the slides in a phosphate buffer (PBS for phosphate
buffer saline, 137 mM NaCl, 2.7 mM KCl, 10 mM sodium phosphate, pH
7.2).
[0606] blocking aspecific sites by incubation of the slides in PBS
containing 1% bovine serum albumin (BSA),
[0607] Incubation in the anti-collagen I antibodies (reference
20121, Institut Pasteur, Lyon) diluted to 1:50 in 1% PBS-BSA for 2
hours at room temperature. Control slides are made in which the
anti-collagen I antibodies are replaced by PBS alone or by a
polyclonal antibody specific to collagen IV.
[0608] Rinsing in PBS, 3 times 10 minutes,
[0609] Incubation in the conjugate (rabbit anti-IgG made in goat
coupled to fluoresceine isothiocyanate (Biosys.TM., France) diluted
to 1:300 in 1% PBS-BSA for 1 h at room temperature. During
incubation and up until the time of observation, the slides are
placed in the dark.
[0610] Rinsing with PBS, 3 times 10 minutes
[0611] Treatment of the slides with 0.3% Eriochrome Black T in PBS
to mask autofluorescence of the samples, for 1 minute;
[0612] Vigorous rinsing in PBS
[0613] Mounting cover glasses on slides with one drop of
PBS-glycerol 1:1.
[0614] Slide observation is made using an epifluroescence Zeiss.TM.
Universal microscope fitted with the Zeiss.TM. filter exciter BP
430-490.
[0615] Results
[0616] Slide observation enabled us to draw the following
conclusions:
[0617] the clusters formed by the chloroplasts autofluorescence to
red but do not hinder observation of the yellowish-green
fluorescence of the positive plants,
[0618] Yellowish-green autofluorescence is also observed on
particular plant structures that are well delimited (channels).
[0619] The positive plants are however easily identifiable through
the presence of small highly coloured clusters in the cells. In the
plants corresponding to construct pBIOC706 (.alpha.1+C-pro) is also
seen a diffuse filanentous network which appears to be localized in
the extracellular part of the leaf.
[0620] Perfect correspondence is noted between the positive plants
determined by the gel+transfer method and by immunofluorescence
especially for those most positive, that is to say 1, 2, 14, 40 and
45.
[0621] Extraction in Neutral Buffer:
[0622] In order to improve extraction, extraction in a neutral
medium is also used for tissue collagen and procollagen (collagen
molecule still containing N- and C-propeptides) is conducted on the
residues of the positives from the preceding extraction: 1, 2, 14,
40 and 45.
[0623] The residues derived from extraction in an acid medium of
each plant including non-transformed control plants are washed in
distilled water two times before being collected in a buffer of 50
mM Tris-Hcl pH 7.4 containing 150 mM NaCl and protease inhibitors:
1 mM phenyl methyl sulfonide (PMSF), 1 mM N-ethyl maleimide (NEM),
2.5 mM ethylenediaminetetra-acetic acid (EDTA) to the proportion of
1 gram initial powder per 4 ml of solution. The mixture is shaken
at 4.degree. C. for 60 hours. After centrifuging each sample at
20000 g (rotor 12148, Sigma.TM.) for 30 minutes at 4.degree. C.,
the residues are washed 2 times in distilled water and stored at
-20.degree. C. An aliquot of the supernatants (20 .mu.l) is
collected to carry out protein titration on the total extract. The
remainder of the supernatants is stored at -20.degree. C.
[0624] Analytical Method
[0625] cf. above
[0626] Results
[0627] 1. Lanes Corresponding to the Plants Transformed with
Construct pBIOC706:
[0628] For plants 40 and 45 the major band observed in the
supernatants after extraction in an acid medium is found migrating
at the .alpha.1 chain of control collagen I, but also another band
of equal intensity migrating at approximately 140 KDa. This result
indicates the presence of a complete recombinant .alpha.1 (I) chain
corresponding to the pBIOC706 construct, since the upper band
corresponds to the expected molecular mass for the recombinant
.alpha.1 (I) chain comprising the C-propeptide.
[0629] 2. Lanes Corresponding to the Plants Transformed with the
Construct pBIOC707:
[0630] For each plant (1, 2 and 14) the major band observed in the
supernatants after extraction in an acid medium is found migrating
at approximately 140 KDa, but another band of equal intensity is
also found migrating at approximately 160 KDa. This result
indicates the presence of a complete recombinant .alpha.1 (I) chain
for construct pBIOC707, since the upper band corresponds to the
expected molecular mass for the recombinant .alpha.1 (I) chain
comprising the N- and C-propeptides.
[0631] For the two constructs pBIOC706 and pBIOC707, the lanes
corresponding to the residues after extraction and centrifuging of
the samples no longer show any lane developed by the anti-collagen
I antibody, demonstrating the efficiency of extraction in a neutral
pH (FIG. 3).
EXAMPLE 7
Collagen Conformity
Determination of the Presence of the N- and C-terminal Propeptides
in the Recombinant .alpha.1 (I) Chains Extracted in an Acid
Medium:
[0632] Extraction of the plants transformed with the pBIOC707
construct in an acid medium only permits extraction of a single
band migrating slightly above the control .alpha.1 (I) band. The
expected molecular mass for the entire recombinant polypeptide
being 160 KDa, the assumption of cleaving during maturation of the
recombinant .alpha.1 (I) chain is a considered possibility. The
same applies to construct pBIOC706 for which a major band is
observed at the level of control band .alpha.1 (I). This migration
can only be attributed to cleavage of part of the recombinant
chain. To give support to our assumption that the major bands
obtained for constructs pBIOC706 and pBIOC707 correspond to the
recombinant .alpha.1 (I) chains whose C-propeptide may have been
cleaved during the production of the collagen chains, gel
electrophoresis in the presence or absence of a reducing medium is
conducted on a positive plant of each construct and analysed after
immunotransfer. Since the N-propeptide, if it is properly folded,
comprises intrachain bonding between the cysteines, whereas the
cysteines of the C-propeptide are interchain bonded, a process
which initiates the formation of the triple coil.
[0633] Analytical Method
[0634] times 500 .mu.l of plant 2 (positive of construct pBIOC707)
and 40 (positive of pBIOC706 construct) are precipitated with the
addition of 50 .mu.l 100% trichloroacetic acid (TCA) for 30 minutes
at room temperature. The samples are centrifuged at 20000 g for 15
minutes at 4.degree. C. (rotor 12148, Sigma.TM.), the residues are
washed twice in cold 100% ethanol. The precipitates are then
collected in 20 .mu.l carrier buffer (60 mM Tris-Hcl pH 6.8
containing 2% sodium dodecyl sulfate, 10% glycerol, 0.002%
bromophenol blue) by alternating a lane in the presence of final 10
mM DTT and a lane without DTT, then denatured for 3 minutes at
100.degree. C. The gels are analysed after immunotransfer.
[0635] Results
[0636] After transfer and development with the anti-collagen I
antibodies (reference 20121, Institut Pasteur, Lyon) it is observed
that the recombinant-chain of plant 2 migrates in the presence of a
reducing agent slightly more slowly than the recombinant chain in
the absence of a reducing agent. This slight difference in
migration is not observed in the recombinant chain of plant 40
(N-propeptide deleted construct). It is deduced that this
difference in migration is due to the correct folding of the
N-propeptide permitting intrachain bonding of the cysteines. The
C-propeptide is therefore apparently absent from the two
recombinant polypeptides (FIG. 4, part A).
[0637] Presence of Interchain Bonding Between the Cysteines of the
C-propeptide:
[0638] Gel electrophoresis in the presence or absence of a reducing
agent is conducted on samples extracted in a neutral pH for which
two major bands are obtained of which the upper band must comprise
the C-propeptide. This upper band migrates at the molecular mass
expected for the non-cleaved polypeptide whether in respect of
construct pBIOC706 (major triple coil+C-propeptide) or pBIOC707
(N-propeptide+major triple coil+C-propeptide), that is to say at
140 KDa and 160 KDa respectively. For bonding between the cysteines
of three chains, a necessary stage for initiation of the formation
of the triple coil, migration of the non-reduced upper band should
migrate at the level of bands .gamma. of the control collagen I
corresponding to migration of three non-dissociated chains
(approximately 300 KDa).
[0639] Analytical Method
[0640] Tests were conducted on plants 1, 2 and 14 (construct
pBIOC707) and plants 40 and 45 (construct pBIOC706) extracted in a
neutral buffer. 2 times 150 .mu.l of each sample, that is to say
7.5 .mu.g to 11 .mu.g of total proteins per test sample, are
collected and precipitated with 15 .mu.l 100% trichloroacetic acid
(TCA) as described previously. A sample series is then collected in
20 .mu.l carrier buffer in the absence of a reducing agent, the
other series in 20 .mu.l carrier buffer in the presence of 10 mM
DTT. On each gel two wells are respectively reserved for standard
molecular weights (6H Sigma.TM.), control collagen I (bovine or
human, 3 .mu.g/well). Migration takes place in a migration buffer
(0.025 M Tris-0.2 M glycine) containing 0.1% sodium dodecyl sulfate
under a voltage of 100 volts in the concentration gel, increased to
200 volts for the separation gel.
[0641] Immunotransfer:
[0642] Cf. above under Screening through plant analysis by
electrophoresis followed by immunotransfer.
[0643] Results
[0644] 1. Lanes Corresponding to the Plants Transformed with
Construct pBIOC707:
[0645] In the presence of the reducing agent, for each plant 1, 2
and 14 two major bands are found one migrating in the region of 140
KDa, the other in the region of 160 KDa. In the absence of a
reducing agent, the band at 140 KDa migrates slightly faster
(intrachain bonding of the cysteines contained in the N-pro giving
it a more compact structure and therefore migrating faster in the
gel than the non-folded reduced form). The band at 160 KDa in the
absence of a reducing agent disappears and a major band appears
migrating in the region of 300 KDa (slightly above bands .gamma. of
control collagen I). This result indicates the presence of
interchain bonding between the cysteines of the C-propeptide of the
recombinant .alpha.1 (I) chain (FIG. 4 part B).
[0646] 2. Lanes Corresponding to the Plants Transformed with
Construct pBIOC706:
[0647] In the presence of the reducing agent, for plants 40 and 45
two major bands are found, one migrating at the .alpha.1 chain of
the control collagen I, the other in the region of 140 KDa. In the
absence of reducing agent, migration of the lower band is not
modified (confirming the absence of the C-propeptide). The band at
140 KDa in the absence of a reducing agent partly disappears and a
major band appears migrating in the region of 300 KDa (at the
.gamma. bands of the control collagen I). This result indicates the
presence of interchain bonding between the cysteines of the
C-propeptide of the recombinant .alpha.1 (I) chain (FIG. 4 part
C).
EXAMPLE 8
Formation of the Triple Coil
[0648] Proteolytic Digestion
[0649] Careful digestion with trypsin or pepsin can indicate the
formation of a triple coil and therefore of the homotrimer
[.alpha.1 (I) 3, since the N and C-terminal ends are sensitive to
proteases whereas the central part of the molecule, when the triple
coil is formed, is resistant. Digestion conditions are chosen
allowing digestion of the denatured collagen I without impairing
native collagen I. The samples extracted in a neutral medium are
digested by trypsin with an enzyme-substrate ratio of 1:20 at
25.degree. C. for 10 minutes. The reaction is halted through the
addition of 10% final TCA followed by two washings in cold 100%
ethanol. The samples are collected in sample buffer containing 10
mM DTT, heated to 100.degree. C. for 3 minutes and deposited on 6%
electrophoresis gel. The gels are stained with Coomassie's blue or
immunotransferred and developed by anti-collagen I antibodies
(reference 20121, Institut Pasteur, Lyon) as described previously.
The plants for which the triple coil was formed will permit
observation of a single band migrating at the control .alpha.1 (I)
chain.
[0650] Triple coil formation may also be demonstrated by use of
pepsin. In this case, the samples are dialysed against 0.5 M acetic
acid, 200 mM NaCl, pH 2/5, then subjected to pepsin digestion. The
digestion conditions used are those which permit complete digestion
of the denatured control collagen I. The reaction is halted by
neutralising the digestion medium. The samples are then
precipitated with 10% final TCA and treated as described above.
[0651] Digestion with proteases may also be used to determine the
denaturing temperature of recombinant collagen and therefore the
stability of the triple coil formed in the plants. In this case the
samples are digested by trypsin at increasing reaction temperatures
(from 25.degree. C. to 45.degree. C.) then treated as described
above. The onset of bands corresponding to proteolytic degradation
indicates the denaturing temperature of recombinant collagen. The
temperature of native collagen is 41.degree. C.; that of the
recombinant .alpha.1 (I) homotrimer made in eukaryotic cells is
similar to that of control collagen I but nonetheless the
homotrimer is partly cleaved on and after a temperature of
38.degree. C. (Geddis et al., 1993).
[0652] After trypsin digestion of the collagen extracted from the
plants transformed with constructs pBIOC707 and pBIOC706 as
described previously, a band is seen to persist migrating at the
.alpha.1 (I) chain of control collagen I. This result demonstrates
that the homotrimeric collagen extracted from the transformed
plants is folded into a triple coil (FIG. 1, part A).
[0653] Shade Rotation
[0654] Formation of the triple coil can also be demonstrated by
observation under a transmission electron microscope of replicas of
molecules obtained after shade rotation. This is possible because
the collagen molecule, when it is folded into a triple coil, has
the characteristic shape of a rod 300 nm in length and 1.4 run in
diameter. Only the chains .alpha.1 (I) cannot be identified by this
technique. The samples at a concentration of 10 to 20 .mu.g/ml are
dialysed against 200 mM ammonium bicarbonate overnight at 4.degree.
C. then mixed to a ratio of 1:1 with glycerol. 5 .mu.l are
deposited on a freshly split mica sheet 1 cm.sup.2 in size, then
placed in an evaporator (Med 10, Balzers.TM.). Approximately 2 nm
of platinum-carbon are evaporated over the samples at an angle of
8.degree. under a vacuum of 2.10.sup.-6 Torr, followed by carbon
evaporation at 90.degree. for a few seconds. The replicas are
detached by penetration of the micas at 45.degree. in a container
of filtered distilled water and they are assembled onto electron
microscope grids (600 mesh size, copper). Observation is made under
a transmission microscope (CM120, Philipps.TM.).
[0655] Formation of a triple coil was confirmed by observations
under electron microscope of collagen purified from positive plants
after shade rotation. The molecules observed have the
characteristic shape of rods 300 nm in length (FIG. 6 part B). The
absence will be noted of a globular domain at one of the 2 ends of
the triple coil confirming cleavage of the C-propeptide.
EXAMPLE 9
Ultrastructure of the Transformed Plants
[0656] A leaf fragment of each positive transformed plant and of a
non-transformed control are fixed in a fixing mixture of 2%
glutaraldehyde, 0.5% paraformaldehyde in a 0.1 M citrate-phosphate
buffer for 8 hours at room temperature. During fixation and
subsequently if required, the samples are placed under a vacuum
bell for degasing. The samples are rinsed in the citrate-phosphate
buffer with several 15 minute baths then post-fixed in a 2% osmic
acid solution in the 0.1 M citrate-phosphate buffer for 2 hours at
room temperature. The samples are then dehydrated with successive
ethanol baths from 30.degree. to 100.degree.. The absolute ethanol
is replaced by a bath of pure propylene oxide renewed twice.
Substitution is made in baths containing a mixture of pure
propylene oxide and Epoxy resin to the proportion of 1 volume per 3
volumes respectively, then 1:1 and finally 3:1. Impregnation is
made in the pure Epoxy resin overnight and may be continued by
changing the baths until complete immersion of the samples. The
samples are then inserted in the capsules and left to polymerise
for 3 days at 60.degree. C. Ultrafine sections are taken,
contrasted with 7% uranyl acetate in methanol for 10 minutes then
with lead citrate for 5 minutes. Observations are made under a
transmission electron microscope (CM120, Philipps.TM.).
EXAMPLE 10
Purification of the Recombinant Collagen
[0657] The recombinant collagen is purified from plant extracts
using its particular physico-chemical properties. The acid causes
precipitation of many proteins and the electrophoretic tracings
obtained from the extraction of control plants in an acid medium
show that few endogenous proteins are extracted. Also,
chlorophyllis not present in these extracts. Since collagen is
soluble in acid, the different extracts are dialysed against 0.5 M
acetic acid when they are not directly extracted in an acid medium.
After centrifuging to remove insoluble material, the collagen is
purified by fraction precipitation with salts in an acid medium: at
0.7 M NaCl in 0.5 M acetic acid, then after centrifuging the
supernatant is filtered, precipitated with 0.9 NaCl in 0.5 M acetic
acid, again centrifuged to obtain the precipitate in the residue.
The 0.7 and 0.9 M precipitates containing the sample are collected
in 0.5 M acetic acid then subjected to electrophoresis on 6%
acrylamide. Purity of the fractions is estimated after staining the
gels with Coomassie's blue. For those samples estimated to be
insufficiently pure, a second precipitation cycle with salts may be
conducted after dialysis of the fraction against 0.5 M acetic acid
to remove residual salt traces. Should an additional purification
stage be required, an ion exchange column is used with a NaCl
gradient of 0 to 0.5 M for elution. The fractions are then
subjected to gel electrophoresis as described previously.
[0658] Results show that most of the plant proteins are eliminated
by a precipitation stage with 0.4 M NaCl. After precipitation with
0.7 M followed by 0.9 M NaCl as indicated in example 10, the
homotrimeric collagen is observed to be 80-90% pure in the 0.9 M
NaCl precipitate.
[0659] A heparin bonding site situated on heterotrimeric collagen
has been described in the literature (San Antonio et al., 1994, J.
Cell Biol., 125:1179-1188). Such sites are responsible for the
fixation of proteoglycanns present in the extracellular matrix, but
also for cell adhesion via receptors of membrane proteoglycann
type. These interactions therefore ensure cohesion of the collagen
network. Persistence of this site on the homotrimer is analysed by
fixing the homotrimer on a heparin affinity column under
physiological conditions of pH (7.4) and ion strength (0.15 M
NaCl). This method can serve as a second purification stage.
EXAMPLE 11
Amino Acid Composition and Microsequencing
[0660] The different products obtained after extraction of
transformed plants are vacuum hydrolysed with 6N HCl at 115.degree.
C. for 24 hours in a PicoTag system (Waters,.TM.). The amino acid
composition is determined using an automatic Beckman.TM. analyser.
With this analysis it is possible in particular to verify the level
of hydroxylated proline, as proline hydroxylation guarantees the
stability of the triple coil.
[0661] Microsequencing is conducted using Edman's method with
apparatus permitting automatic N-terminal sequencing of proteins
(Applied Biosystems 473 A protein sequencer.TM.). The recombinant
collagens or procollagens may be loaded into the apparatus in 2
manners:
[0662] after purification, the protein is in the form of a
concentrated solution. The protein is fixed by hydrophobic bonds on
a fibreglass pellet treated with polybrene. The glass pellet is
placed directly in the apparatus.
[0663] after electrophoresis and electrotransfer, the bands of
interest are identified after staining with 0.02% Ponceau's red in
0.1% acetic acid and discolouring with filtered distilled water,
cut with a scalpel and then placed in a cell appropriate for the
apparatus.
[0664] According to the principle of Edman's method, each cycle
releases an amino acid in the form of a phenylthiohydantoine-amino
acid complex. They are successively and automatically injected into
the high pressure chromatography column (HPLC) in reverse phase and
detected by UV absorbency at 269 nm. By comparison between their
retention times and standard spectra, it is possible to determine
cycle per cycle the N-terminal sequence of the analysed
protein.
[0665] The collagen obtained by precipitation with 0.9 M NaCl is
subjected to an additional purification stage (reverse phase
chromatographic column (C8) HPLC) before proceeding with amino acid
analysis. The analysis obtained conforms to the above-described
analysis with cDNA of the human .alpha.1 (I) chain, in particular
for the characteristic residues of collagen, Glycine and
Proline:
6 Glycine (Pro + OHPro) Proline .alpha.1 (I) predicted cDNA 32.8%
22.7% .alpha.1 (I) extracted from plants 28.4% 20.6%
[0666] Also, to verify whether cleavage of the plant peptide signal
present in constructs pBIOC707 and pBIOC706 occurred properly, and
to ensure also that no proteolytic degradation occurred at the
N-terminal end during extraction, each of the lower bands observed
on electrophoresis gel for the collagen extracted from plants
transformed with constructs pBIOC707 and pBIOC706 was subjected to
N-terminal sequencing by Edman degradation after
electrotransfer.
[0667] The sequences obtained are: ELAPQLSY for the collagen
corresponding to construct pBIOC706 and AQVEGQDE for construct
pBIOC707. These results show that cleavage of the peptide signal
did actually occur and also confirm that the N-terminal ends (the
N-telopeptide for construct pBIOC706 and the N-propeptide for
construct pBIOC707) are intact. Also, all results (examples 6, 7, 8
and 11) show that the collagen extracted from mature plants
corresponds to a homotrimeric collagen whose C-propeptide is
cleaved.
EXAMPLE 12
Accumulation of Collagen in Mature Plants
[0668] The young, transformed plants which proved to be positive by
immunotransfer were brought to maturity. The plant leaves were
picked and either directly frozen and cold crushed, or freeze
dried. Irrespective of the storage method used for the leaves
(freezing or freeze drying) the collagen is easily extracted in an
acid medium using the conditions described in example 6. After
extraction, a single major band is found for each of the extracts
obtained from the plants transformed with constructs pBIOC707 and
pBIOC706. In each case this band corresponds to the homotrimer
after cleaving of the C-propeptide (see example 6). Furthermore, it
is shown that the collagen can accumulate in mature plants and
thereby generate a substantial quantity of collagen per gram of
fresh weight. A young plant (plant 45 for example) can provide an
extract containing approximately 6-8 .mu.g/ml of homotrimeric
collagen, whereas on reaching maturity the same plant can allow
extraction of 40-50 .mu.g/ml, i.e. 0.5 mg/g fresh weight. The
collagen molecule containing the N- and C-propeptides is called
procollagen, and the name pN-collagen and pC-collagen is given to
those molecules containing either one of the terminal domains.
Finally the collagen is in the molecular form which only contains
the triple coil domain and corresponds in animal tissue to the
mature form. Consequently, the extracted products are identified as
pN-collagen (construct pBIOC707) and collagen (construct
pBIOC706).
EXAMPLE 13
Fibrillogenesis and Adhesion Test
[0669] The purified collagen is diluted to 0.2-0.5 mg/ml in 0.1 M
acetic acid, then dialysed against a phosphate buffer saline (PBS),
pH 7.4 at 4.degree. C. overnight. The sample is then placed in a
waterbath and the temperature progressively increased up to
30.degree. C. and stabilised at this temperature for 2 hours. The
formation of fibres is observed under an electron microscope after
negative or positive staining of the samples. Fibre formation
kinetics is observed by turbidimetry using a spectrophotometer,
since fibre formation modifies optic density (Wood and Keech, 1960,
Biochem.J., 75:588-598).
[0670] Collagen I is an adhesive protein, that is to say that
numerous cell types are able to recognise it and to fix themselves
on it in specific manner via membrane receptors. It is possible to
test the adhesive properties of a protein using a microplate
colorimetric test (Aumailley et al., 1989, Exp. Cell Res.
181,463-474).
[0671] The extracted collagen is adsorbed overnight at 4.degree. C.
on multi-well trays then placed in contact with a cell suspension
at 37.degree. C. for 20 to 30 minutes. The non-adherent cells are
removed by washing, the adherent cells are fixed with 1%
glutaraldehyde, then stained with 0.1% crystal violet. After
vigorous washing of the trays, the colouring agent fixed by the
adherent cells is solubilised in X100 Triton. The trays are read
off using a ELISA reader at 570 nm, the optic density value relates
to the number of adherent cells.
BIBLIOGRAPHICAL REFERENCES
[0672] Armstrong et al., (Maize Handbook; (1994) M. Freeling, V.
Walbot Eds.; pp. 665-671).
[0673] An et al., Plant Physiol,81, 301-305 (1986)
[0674] Anderson O. D. and Greene F. C., T.A.G., 77,
689-700(1989).
[0675] Barta et al., Plant Mol. Biol., 6, 347-357 (1986).
[0676] Bednarek et al., Plant cell 3, 1195-1206 (1991).
[0677] Cornelissen et al., Nature, 321, 531-532 (1986).
[0678] Depigny-This et al., Plant Mol. Biol., 20, 467-479
(1992).
[0679] Gaubier et al., Mol. Gen. Genet., 238, 409-418 (1993).
[0680] Gedis et al., Matrix, 13, 399-405 (1993).
[0681] Holsters et al., Mol Gen Genet, 163, 181-187 (1978).
[0682] Horsch R. B. et al., Science, 227, 1229-1231 (1985).
[0683] Kay et al., Science, 236, 1299-1302 (1987).
[0684] Li S-W et al., Matrix Biology 14, 593-595 (1994).
[0685] McEleroy et al., Mol Gen Genet, 231, 150-160 (1991).
[0686] Marx, Science, 216, 1305-1307 (1982).
[0687] Matsuoka K, Proc. Natl Acad Sci USA, 88, 834-838 (1991).
[0688] Morikawa et al., Biochemistry 19, 2646-2650 (1980).
[0689] Murakami et al., Plant Mol. Biol., 7, 343-355 (1986).
[0690] Ni et al., Plant J., 7, 661-676 (1995).
[0691] Parkany M, Molecular Biomaterials G. W. Hastings, P.
Ducheyne eds., CRC Press, Boca Raton, 111-117 (1984).
[0692] Reina et al., Nucleic Acid Research, 18, 6426 (1990).
[0693] Schroeder M. R. et al., Plant Physiol, 101, 451-458
(1993).
[0694] Vain P. et al., Plant Cell Tissue and Organ Culture 18,
143-151 (1989).
Sequence CWU 1
1
22 1 4 PRT Unknown peptide localization sequence 1 Lys Asp Glu Leu
1 2 6 PRT Unknown peptide localization sequence 2 Ser Glu Lys Asp
Glu Leu 1 5 3 4 PRT Unknown peptide localization sequence 3 His Asp
Glu Leu 1 4 17 DNA Artificial Sequence oligonucleotide BIOC5 4
ctcgggtttc cacacgt 17 5 17 DNA Artificial Sequence oligonucleotide
BIOC7 5 gcaagacagt gattgaa 17 6 19 DNA Artificial Sequence T7 gene
primer 6 tgaggttgta gaagttccg 19 7 19 DNA Artificial Sequence T7
terminator primer 7 gctagttatt gctcagcgg 19 8 50 DNA Artificial
Sequence sense oligonucleotide, BIOC85 8 tatccgcgga agcttagaca
tgttcagctt tgtggacctc cggctcctgc 50 9 45 DNA Artificial Sequence
antisense oligonucleotide, BIOC83 9 tattctagag ctagctttcc
tccgaggcca gggggtccgg gaggt 45 10 81 DNA Artificial Sequence matrix
oligonucleotide, 045 10 taaatgaact tcctcaaaag tttccccttt tatgccttcc
tttgttttgg ccaatacttt 60 gtagctgtta ctcatgctgc c 81 11 42 DNA
Artificial Sequence sense oligonucleotide, BIO95 11 tatccgcgga
agctttaaat gaacttcctc aaaagtttcc cc 42 12 37 DNA Artificial
Sequence antisense oligonucleotide, BIOC93 12 atgctagctc ttgagcatga
gtaacagcta caaagta 37 13 31 DNA Artificial Sequence sense
oligonucleotide, BIOC855 13 atgctagccc aagtcgaggg ccaagacgaa g 31
14 43 DNA Artificial Sequence sense oligonucleotide, BIOC65 14
tattctagag ctagctcccc agctgtctta tggctatgat gag 43 15 20 DNA
Artificial Sequence antisense oligonucleotide, T7 gene 10 primer 15
ctgaggttgt agaagttccg 20 16 30 DNA Artificial Sequence sense
oligonucleotide, BIOC25 16 tatctgcaga tgtggccatc cagctgacct 30 17
30 DNA Artificial Sequence antisense oligonucleotide, BIOC23 17
tataagctta caggaagcag acagggccaa 30 18 51 DNA Artificial Sequence
antisense oligonucleotide, BIOCKDEL 18 tataagctta tagctcatct
ttcaggaagc agacagggcc aacgtcgaag c 51 19 8 PRT Unknown peptide
fragment from plant collagen 19 Glu Leu Ala Pro Gln Leu Ser Tyr 1 5
20 8 PRT Unknown peptide fragment from plant collagen 20 Ala Gln
Val Glu Gly Gln Asp Glu 1 5 21 1464 PRT Homo sapiens 21 Met Phe Ser
Phe Val Asp Leu Arg Leu Leu Leu Leu Leu Ala Ala Thr 1 5 10 15 Ala
Leu Leu Thr His Gly Gln Glu Glu Gly Gln Val Glu Gly Gln Asp 20 25
30 Glu Asp Ile Pro Pro Ile Thr Cys Val Gln Asn Gly Leu Arg Tyr His
35 40 45 Asp Arg Asp Val Trp Lys Pro Glu Pro Cys Arg Ile Cys Val
Cys Asp 50 55 60 Asn Gly Lys Val Leu Cys Asp Asp Val Ile Cys Asp
Glu Thr Lys Asn 65 70 75 80 Cys Pro Gly Ala Glu Val Pro Glu Gly Glu
Cys Cys Pro Val Cys Pro 85 90 95 Asp Gly Ser Glu Ser Pro Thr Asp
Gln Glu Thr Thr Gly Val Glu Gly 100 105 110 Pro Lys Gly Asp Thr Gly
Pro Arg Gly Pro Arg Gly Pro Ala Gly Pro 115 120 125 Pro Gly Arg Asp
Gly Ile Pro Gly Gln Pro Gly Leu Pro Gly Pro Pro 130 135 140 Gly Pro
Pro Gly Pro Pro Gly Pro Pro Gly Leu Gly Gly Lys Leu Ala 145 150 155
160 Pro Gln Leu Ser Tyr Gly Tyr Asp Glu Lys Ser Thr Gly Gly Ile Ser
165 170 175 Val Pro Gly Pro Met Gly Pro Ser Gly Pro Arg Gly Leu Pro
Gly Pro 180 185 190 Pro Gly Ala Pro Gly Pro Gln Gly Phe Gln Gly Pro
Pro Gly Glu Pro 195 200 205 Gly Glu Pro Gly Ala Ser Gly Pro Met Gly
Pro Arg Gly Pro Pro Gly 210 215 220 Pro Pro Gly Lys Asn Gly Asp Asp
Gly Glu Ala Gly Lys Pro Gly Arg 225 230 235 240 Pro Gly Glu Arg Gly
Pro Pro Gly Pro Gln Gly Ala Arg Gly Leu Pro 245 250 255 Gly Thr Ala
Gly Leu Pro Gly Met Lys Gly His Arg Gly Phe Ser Gly 260 265 270 Leu
Asp Gly Ala Lys Gly Asp Ala Gly Pro Ala Gly Pro Lys Gly Glu 275 280
285 Pro Gly Ser Pro Gly Glu Asn Gly Ala Pro Gly Gln Met Gly Pro Arg
290 295 300 Gly Leu Pro Gly Glu Arg Gly Arg Pro Gly Ala Pro Gly Pro
Ala Gly 305 310 315 320 Ala Arg Gly Asn Asp Gly Ala Thr Gly Ala Ala
Gly Pro Pro Gly Pro 325 330 335 Thr Gly Pro Ala Gly Pro Pro Gly Phe
Pro Gly Ala Val Gly Ala Lys 340 345 350 Gly Glu Ala Gly Pro Gln Gly
Pro Arg Gly Ser Glu Gly Pro Gln Gly 355 360 365 Val Arg Gly Glu Pro
Gly Pro Pro Gly Pro Ala Gly Ala Ala Gly Pro 370 375 380 Ala Gly Asn
Pro Gly Ala Asp Gly Gln Pro Gly Ala Lys Gly Ala Asn 385 390 395 400
Gly Ala Pro Gly Ile Ala Gly Ala Pro Gly Phe Pro Gly Ala Arg Gly 405
410 415 Pro Ser Gly Pro Gln Gly Pro Gly Gly Pro Pro Gly Pro Lys Gly
Asn 420 425 430 Ser Gly Glu Pro Gly Ala Pro Gly Ser Lys Gly Asp Thr
Gly Ala Lys 435 440 445 Gly Glu Pro Gly Pro Val Gly Val Gln Gly Pro
Pro Gly Pro Ala Gly 450 455 460 Glu Glu Gly Lys Arg Gly Ala Arg Gly
Glu Pro Gly Pro Thr Gly Leu 465 470 475 480 Pro Gly Pro Pro Gly Glu
Arg Gly Gly Pro Gly Ser Arg Gly Phe Pro 485 490 495 Gly Ala Asp Gly
Val Ala Gly Pro Lys Gly Pro Ala Gly Glu Arg Gly 500 505 510 Ser Pro
Gly Pro Ala Gly Pro Lys Gly Ser Pro Gly Glu Ala Gly Arg 515 520 525
Pro Gly Glu Ala Gly Leu Pro Gly Ala Lys Gly Leu Thr Gly Ser Pro 530
535 540 Gly Ser Pro Gly Pro Asp Gly Lys Thr Gly Pro Pro Gly Pro Ala
Gly 545 550 555 560 Gln Asp Gly Arg Pro Gly Pro Pro Gly Pro Pro Gly
Ala Arg Gly Gln 565 570 575 Ala Gly Val Met Gly Phe Pro Gly Pro Lys
Gly Ala Ala Gly Glu Pro 580 585 590 Gly Lys Ala Gly Glu Arg Gly Val
Pro Gly Pro Pro Gly Ala Val Gly 595 600 605 Pro Ala Gly Lys Asp Gly
Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro 610 615 620 Ala Gly Pro Ala
Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro 625 630 635 640 Gly
Phe Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly 645 650
655 Lys Pro Gly Glu Gln Gly Val Pro Gly Asp Leu Gly Ala Pro Gly Pro
660 665 670 Ser Gly Ala Arg Gly Glu Arg Gly Phe Pro Gly Glu Arg Gly
Val Gln 675 680 685 Gly Pro Pro Gly Pro Ala Gly Pro Arg Gly Ala Asn
Gly Ala Pro Gly 690 695 700 Asn Asp Gly Ala Lys Gly Asp Ala Gly Ala
Pro Gly Ala Pro Gly Ser 705 710 715 720 Gln Gly Ala Pro Gly Leu Gln
Gly Met Pro Gly Glu Arg Gly Ala Ala 725 730 735 Gly Leu Pro Gly Pro
Lys Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly 740 745 750 Ala Asp Gly
Ser Pro Gly Lys Asp Gly Val Arg Gly Leu Thr Gly Pro 755 760 765 Ile
Gly Pro Pro Gly Pro Ala Gly Ala Pro Gly Asp Lys Gly Glu Ser 770 775
780 Gly Pro Ser Gly Pro Ala Gly Pro Thr Gly Ala Arg Gly Ala Pro Gly
785 790 795 800 Asp Arg Gly Glu Pro Gly Pro Pro Gly Pro Ala Gly Phe
Ala Gly Pro 805 810 815 Pro Gly Ala Asp Gly Gln Pro Gly Ala Lys Gly
Glu Pro Gly Asp Ala 820 825 830 Gly Ala Lys Gly Asp Ala Gly Pro Pro
Gly Pro Ala Gly Pro Ala Gly 835 840 845 Pro Pro Gly Pro Ile Gly Asn
Val Gly Ala Pro Gly Ala Lys Gly Ala 850 855 860 Arg Gly Ser Ala Gly
Pro Pro Gly Ala Thr Gly Phe Pro Gly Ala Ala 865 870 875 880 Gly Arg
Val Gly Pro Pro Gly Pro Ser Gly Asn Ala Gly Pro Pro Gly 885 890 895
Pro Pro Gly Pro Ala Gly Lys Glu Gly Gly Lys Gly Pro Arg Gly Glu 900
905 910 Thr Gly Pro Ala Gly Arg Pro Gly Glu Val Gly Pro Pro Gly Pro
Pro 915 920 925 Gly Pro Ala Gly Glu Lys Gly Ser Pro Gly Ala Asp Gly
Pro Ala Gly 930 935 940 Ala Pro Gly Thr Pro Gly Pro Gln Gly Ile Ala
Gly Gln Arg Gly Val 945 950 955 960 Val Gly Leu Pro Gly Gln Arg Gly
Glu Arg Gly Phe Pro Gly Leu Pro 965 970 975 Gly Pro Ser Gly Glu Pro
Gly Lys Gln Gly Pro Ser Gly Ala Ser Gly 980 985 990 Glu Arg Gly Pro
Pro Gly Pro Met Gly Pro Pro Gly Leu Ala Gly Pro 995 1000 1005 Pro
Gly Glu Ser Gly Arg Glu Gly Ala Pro Gly Ala Glu Gly Ser 1010 1015
1020 Pro Gly Arg Asp Gly Ser Pro Gly Ala Lys Gly Asp Arg Gly Glu
1025 1030 1035 Thr Gly Pro Ala Gly Pro Pro Gly Ala Pro Gly Ala Pro
Gly Ala 1040 1045 1050 Pro Gly Pro Val Gly Pro Ala Gly Lys Ser Gly
Asp Arg Gly Glu 1055 1060 1065 Thr Gly Pro Ala Gly Pro Ala Gly Pro
Val Gly Pro Ala Gly Ala 1070 1075 1080 Arg Gly Pro Ala Gly Pro Gln
Gly Pro Arg Gly Asp Lys Gly Glu 1085 1090 1095 Thr Gly Glu Gln Gly
Asp Arg Gly Ile Lys Gly His Arg Gly Phe 1100 1105 1110 Ser Gly Leu
Gln Gly Pro Pro Gly Pro Pro Gly Ser Pro Gly Glu 1115 1120 1125 Gln
Gly Pro Ser Gly Ala Ser Gly Pro Ala Gly Pro Arg Gly Pro 1130 1135
1140 Pro Gly Ser Ala Gly Ala Pro Gly Lys Asp Gly Leu Asn Gly Leu
1145 1150 1155 Pro Gly Pro Ile Gly Pro Pro Gly Pro Arg Gly Arg Thr
Gly Asp 1160 1165 1170 Ala Gly Pro Val Gly Pro Pro Gly Pro Pro Gly
Pro Pro Gly Pro 1175 1180 1185 Pro Gly Pro Pro Ser Ala Gly Phe Asp
Phe Ser Phe Leu Pro Gln 1190 1195 1200 Pro Pro Gln Glu Lys Ala His
Asp Gly Gly Arg Tyr Tyr Arg Ala 1205 1210 1215 Asp Asp Ala Asn Val
Val Arg Asp Arg Asp Leu Glu Val Asp Thr 1220 1225 1230 Thr Leu Lys
Ser Leu Ser Gln Gln Ile Glu Asn Ile Arg Ser Pro 1235 1240 1245 Glu
Gly Ser Arg Lys Asn Pro Ala Arg Thr Cys Arg Asp Leu Lys 1250 1255
1260 Met Cys His Ser Asp Trp Lys Ser Gly Glu Tyr Trp Ile Asp Pro
1265 1270 1275 Asn Gln Gly Cys Asn Leu Asp Ala Ile Lys Val Phe Cys
Asn Met 1280 1285 1290 Glu Thr Gly Glu Thr Cys Val Tyr Pro Thr Gln
Pro Ser Val Ala 1295 1300 1305 Gln Lys Asn Trp Tyr Ile Ser Lys Asn
Pro Lys Asp Lys Arg His 1310 1315 1320 Val Trp Phe Gly Glu Ser Met
Thr Asp Gly Phe Gln Phe Glu Tyr 1325 1330 1335 Gly Gly Gln Gly Ser
Asp Pro Ala Asp Val Ala Ile Gln Leu Thr 1340 1345 1350 Phe Leu Arg
Leu Met Ser Thr Glu Ala Ser Gln Asn Ile Thr Tyr 1355 1360 1365 His
Cys Lys Asn Ser Val Ala Tyr Met Asp Gln Gln Thr Gly Asn 1370 1375
1380 Leu Lys Lys Ala Leu Leu Leu Lys Gly Ser Asn Glu Ile Glu Ile
1385 1390 1395 Arg Ala Glu Gly Asn Ser Arg Phe Thr Tyr Ser Val Thr
Val Asp 1400 1405 1410 Gly Cys Thr Ser His Thr Gly Ala Trp Gly Lys
Thr Val Ile Glu 1415 1420 1425 Tyr Lys Thr Thr Lys Thr Ser Arg Leu
Pro Ile Ile Asp Val Ala 1430 1435 1440 Pro Leu Asp Val Gly Ala Pro
Asp Gln Glu Phe Gly Phe Asp Val 1445 1450 1455 Gly Pro Val Cys Phe
Leu 1460 22 4409 DNA Homo sapiens 22 aagcttagac atgttcagct
ttgtggacct ccggctcctg ctcctcttag cggccaccgc 60 cctcctgacg
cacggccaag aggaaggcca agtcgagggc caagacgaag acatcccacc 120
aatcacctgc gtacagaacg gcctcaggta ccatgaccga gacgtgtgga aacccgagcc
180 ctgccggatc tgcgtctgcg acaacggcaa ggtgttgtgc gatgacgtga
tctgtgacga 240 gaccaagaac tgccccggcg ccgaagtccc cgagggcgag
tgctgtcccg tctgccccga 300 cggctcagag tcacccaccg accaagaaac
caccggcgtc gagggaccca agggagacac 360 tggcccccga ggcccaaggg
gacccgcagg cccccctggc cgagatggca tccctggaca 420 gcctggactt
cccggacccc ccggaccccc cggacctccc ggaccccctg gcctcggagg 480
aaagctagct ccccagctgt cttatggcta tgatgagaaa tcaaccggag gaatttccgt
540 gcctggcccc atgggtccct ctggtcctcg tggtctccct ggcccccctg
gtgcacctgg 600 tccccaaggc ttccaaggtc cccctggtga gcctggcgag
cctggagctt caggtcccat 660 gggtccccga ggtcccccag gtccccctgg
aaagaatgga gatgatgggg aagctggaaa 720 acctggtcgt cctggtgagc
gtgggcctcc tgggcctcag ggtgctcgag gattgcccgg 780 aacagctggc
ctccctggaa tgaagggaca cagaggtttc agtggtttgg atggtgccaa 840
gggagatgct ggtcctgctg gtcctaaggg tgagcctggc agccctggtg aaaatggagc
900 tcctggtcag atgggccccc gtggcctgcc tggtgagaga ggtcgccctg
gagcccctgg 960 ccctgctggt gctcgtggaa atgatggtgc tactggtgct
gccgggcccc ctggtcccac 1020 cggccccgct ggtcctcctg gcttccctgg
tgctgttggt gctaagggtg aagctggtcc 1080 ccaagggccc cgaggctctg
aaggtcccca gggtgtgcgt ggtgagcctg gtccccctgg 1140 ccctgctggt
gctgctggcc ctgctggaaa ccctggtgct gatggacagc ctggtgctaa 1200
aggtgccaat ggtgctcctg gtattgctgg tgctcctggc ttccctggtg cccgaggccc
1260 ctctggaccc cagggccccg gcggccctcc tggtcccaag ggtaacagcg
gtgaacctgg 1320 tgctcctggc agcaaaggag acactggtgc taagggagag
cctggccctg ttggtgttca 1380 aggaccccct ggccctgctg gagaggaagg
aaagcgagga gctcgaggtg aacccggacc 1440 cactggcctg cccggacccc
ctggcgagcg tggtggacct ggtagccgtg gtttccctgg 1500 cgcagatggt
gttgctggtc ccaagggtcc cgctggtgaa cgtggttctc ctggccccgc 1560
tggccccaaa ggatctcctg gtgaagctgg tcgtcccggt gaagctggtc tgcctggtgc
1620 caagggtctg actggaagcc ctggcagccc tggtcctgat ggcaaaactg
gcccccctgg 1680 tcccgccggt caagatggtc gccccggacc cccaggccca
cctggtgccc gtggtcaggc 1740 tggtgtgatg ggattccctg gacctaaagg
tgctgctgga gagcccggca aggctggaga 1800 gcgaggtgtt cccggacccc
ctggcgctgt cggtcctgct ggcaaagatg gagaggctgg 1860 agctcaggga
ccccctggcc ctgctggtcc cgctggcgag agaggtgaac aaggccctgc 1920
tggctccccc ggattccagg gtctccctgg tcctgctggt cctccaggtg aagcaggcaa
1980 acctggtgaa cagggtgttc ctggagacct tggcgcccct ggcccctctg
gagcaagagg 2040 cgagagaggt ttccctggcg agcgtggtgt gcaaggtccc
cctggtcctg ctggaccccg 2100 aggggccaac ggtgctcccg gcaacgatgg
tgctaagggt gatgctggtg cccctggagc 2160 tcccggtagc cagggcgccc
ctggccttca gggaatgcct ggtgaacgtg gtgcagctgg 2220 tcttccaggg
cctaagggtg acagaggtga tgctggtccc aaaggtgctg atggctctcc 2280
tggcaaagat ggcgtccgtg gtctgaccgg ccccattggt cctcctggcc ctgctggtgc
2340 ccctggtgac aagggtgaaa gtggtcccag cggccctgct ggtcccactg
gagctcgtgg 2400 tgcccccgga gaccgtggtg agcctggtcc ccccggccct
gctggctttg ctggcccccc 2460 tggtgctgac ggccaacctg gtgctaaagg
cgaacctggt gatgctggtg ccaaaggcga 2520 tgctggtccc cctgggcctg
ccggacccgc tggaccccct ggccccattg gtaatgttgg 2580 tgctcctgga
gccaaaggtg ctcgcggcag cgctggtccc cctggtgcta ctggtttccc 2640
tggtgctgct ggccgagtcg gtcctcctgg cccctctgga aatgctggac cccctggccc
2700 tcctggtcct gctggcaaag aaggcggcaa aggtccccgt ggtgagactg
gccctgctgg 2760 acgtcctggt gaagttggtc cccctggtcc ccctggccct
gctggcgaga aaggatcccc 2820 tggtgctgat ggtcctgctg gtgctcctgg
tactcccggg cctcaaggta ttgctggaca 2880 gcgtggtgtg gtcggcctgc
ctggtcagag aggagagaga ggcttccctg gtcttcctgg 2940 cccctctggt
gaacctggca aacaaggtcc ctctggagca agtggtgaac gtggtccccc 3000
cggtcccatg ggcccccctg gattggctgg accccctggt gaatctggac gtgagggggc
3060 tcctggtgcc gaaggttccc ctggacgaga cggttctcct ggcgccaagg
gtgaccgtgg 3120 tgagaccggc cccgctggac cccctggtgc tcctggtgct
cctggtgccc ctggccccgt 3180 tggccctgct ggcaagagtg gtgatcgtgg
tgagactggt cctgctggtc ccgccggtcc 3240 cgtcggcccc gctggcgccc
gtggccccgc cggaccccaa ggcccccgtg gtgacaaggg 3300 tgagacaggc
gaacagggcg acagaggcat aaagggtcac cgtggcttct ctggcctcca 3360
gggtccccct ggccctcctg gctctcctgg tgaacaaggt ccctctggag cctctggtcc
3420 tgctggtccc cgaggtcccc ctggctctgc tggtgctcct ggcaaagatg
gactcaacgg 3480 tctccctggc cccattgggc cccctggtcc tcgcggtcgc
actggtgatg ctggtcctgt 3540 tggtcccccc ggccctcctg gacctcctgg
tccccctggt cctcccagcg ctggtttcga 3600 cttcagcttc ctgccccagc
cacctcaaga gaaggctcac gatggtggcc gctactaccg 3660 ggctgatgat
gccaatgtgg ttcgtgaccg tgacctcgag gtggacacca ccctcaagag 3720
cctgagccag cagatcgaga acatccggag cccagaggga agccgcaaga accccgcccg
3780 cacctgccgt gacctcaaga
tgtgccactc tgactggaag agtggagagt actggattga 3840 ccccaaccaa
ggctgcaacc tggatgccat caaagtcttc tgcaacatgg agactggtga 3900
gacctgcgtg taccccactc agcccagtgt ggcccagaag aactggtaca tcagcaagaa
3960 ccccaaggac aagaggcatg tctggttcgg cgagagcatg accgatggat
tccagttcga 4020 gtatggcggc cagggctccg accctgccga tgtggccatc
cagctgacct tcctgcgcct 4080 gatgtccacc gaggcctccc agaacatcac
ctaccactgc aagaacagcg tggcctacat 4140 ggaccagcag actggcaacc
tcaagaaggc cctgctcctc aagggctcca acgagatcga 4200 gatccgcgcc
gagggcaaca gccgcttcac ctacagcgtc actgtcgatg gctgcacgag 4260
tcacaccgga gcctggggca agacagtgat tgaatacaaa accaccaaga cctcccgcct
4320 gcccatcatc gatgtggccc ccttggacgt tggtgcccca gaccaggaat
tcggcttcga 4380 cgttggccct gtctgcttcc tgtaagctt 4409
* * * * *