U.S. patent application number 09/905253 was filed with the patent office on 2003-05-22 for natural ligand of g protein coupled receptor chemr23 and uses thereof.
Invention is credited to Communi, David, Detheux, Michel, Parmentier, Marc, Vandenbogaerde, Ann, Wittamer, Valerie.
Application Number | 20030096299 09/905253 |
Document ID | / |
Family ID | 26973689 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096299 |
Kind Code |
A1 |
Wittamer, Valerie ; et
al. |
May 22, 2003 |
Natural ligand of G protein coupled receptor ChemR23 and uses
thereof
Abstract
The invention relates to the identification of TIG2, the
polypeptide product of Tazarotene-Induced Gene 2, as a natural
ligand of the ChemR23 G protein coupled receptor (GPCR). The
invention encompasses the use of the interaction of ChemR23
polypeptides and TIG2 polypeptides as the basis of screening assays
for agents that modulate the activity of the ChemR23 receptor. The
invention also encompasses diagnostic assays based upon the
ChemR23/TIG2 interaction, as well as kits for performing diagnostic
and screening assays.
Inventors: |
Wittamer, Valerie;
(Waterloo, BE) ; Communi, David; (Braine le
Chateau, BE) ; Vandenbogaerde, Ann; (Munchen, DE)
; Detheux, Michel; (Mons, BE) ; Parmentier,
Marc; (Linkebeek, BE) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Family ID: |
26973689 |
Appl. No.: |
09/905253 |
Filed: |
July 13, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60303858 |
Jul 9, 2001 |
|
|
|
Current U.S.
Class: |
435/7.1 |
Current CPC
Class: |
A61P 25/16 20180101;
A61P 37/02 20180101; A61P 19/08 20180101; A61P 25/18 20180101; A61P
35/04 20180101; C07K 16/2866 20130101; A61K 38/00 20130101; A61P
43/00 20180101; A01K 2217/075 20130101; C07K 14/475 20130101; C12Q
2600/158 20130101; G01N 2333/726 20130101; A61P 9/02 20180101; A61P
33/00 20180101; A61P 17/06 20180101; A61P 25/24 20180101; A61P
25/28 20180101; A61P 35/00 20180101; A61P 37/06 20180101; A61P 9/00
20180101; A61P 31/04 20180101; A61P 15/06 20180101; A61P 13/08
20180101; A61P 17/00 20180101; A61P 1/08 20180101; A61P 9/12
20180101; A61P 3/00 20180101; C07K 14/705 20130101; C07K 16/24
20130101; A61P 25/06 20180101; A61P 19/00 20180101; A61P 29/00
20180101; A61P 9/08 20180101; G01N 33/566 20130101; A61P 3/04
20180101; A61P 17/04 20180101; A61P 19/10 20180101; A61P 25/14
20180101; A61P 7/10 20180101; C12Q 1/6876 20130101; A61P 9/04
20180101; A61P 17/02 20180101; A61P 31/12 20180101; A61P 37/08
20180101; C12Q 2600/136 20130101; A61P 15/00 20180101; A61P 9/10
20180101; G01N 2500/02 20130101; A61P 3/10 20180101; C07K 2317/34
20130101 |
Class at
Publication: |
435/7.1 |
International
Class: |
G01N 033/53 |
Claims
1. A method of identifying an agent that modulates the function of
ChemR23, said method comprising: a) contacting a ChemR23
polypeptide with a TIG2 polypeptide in the presence and absence of
a candidate modulator under conditions permitting the binding of
said TIG2 polypeptide to said ChemR23 polypeptide; and b) measuring
the binding of said ChemR23 polypeptide to said TIG2 polypeptide,
wherein a decrease in binding in the presence of said candidate
modulator, relative to the binding in the absence of said candidate
modulator, identifies said candidate modulator as an agent that
modulates the function of ChemR23.
2. A method of detecting the presence, in a sample, of an agent
that modulates the function of ChemR23 in a sample, said method
comprising: a) contacting a ChemR23 polypeptide with a TIG2
polypeptide in the presence and absence of said sample under
conditions permitting the binding of said TIG2 polypeptide to said
ChemR23 polypeptide; and b) measuring the binding of said ChemR23
polypeptide to said TIG2 polypeptide, wherein a decrease in binding
in the presence of said sample, relative to the binding in the
absence of said candidate modulator, indicates the presence, in
said sample of an agent that modulates the function of ChemR23.
3. A method of identifying an agent that modulates the function of
ChemR23, said method comprising: a) contacting a ChemR23
polypeptide with a TIG2 polypeptide in the presence and absence of
a candidate modulator; and b) measuring a signaling activity of
said ChemR23 polypeptide, wherein a change in the activity in the
presence of said candidate modulator relative to the activity in
the absence of said candidate modulator identifies said candidate
modulator as an agent that modulates the function of ChemR23.
4. A method of identifying an agent that modulates the function of
ChemR23, said method comprising: a) contacting a ChemR23
polypeptide with a candidate modulator; b) measuring a signaling
activity of said ChemR23 polypeptide in the presence of said
candidate modulator; and c) comparing said activity measured in the
presence of said candidate modulator to said activity measured in a
sample in which said ChemR23 polypeptide is contacted with a TIG2
polypeptide at its EC.sub.50, wherein said candidate modulator is
identified as an agent that modulates the function of ChemR23 when
the amount of said activity measured in the presence of said
candidate modulator is at least 50% of the amount induced by said
TIG2 polypeptide present at its EC.sub.50.
5. A method of detecting the presence, in a sample, of an agent
that modulates the function of ChemR23, said method comprising: a)
contacting a ChemR23 polypeptide with TIG2 polypeptide in the
presence and absence of said sample; b) measuring a signaling
activity of said ChemR23 polypeptide; and c) comparing the amount
of said activity measured in a reaction containing ChemR23 and TIG2
polypeptides without said sample to the amount of said activity
measured in a reaction containing ChemR23, TIG2 and said sample,
wherein a change in said activity in the presence of said sample
relative to the activity in the absence of said sample indicates
the presence, in said sample, of an agent that modulates the
function of ChemR23.
6. A method of detecting the presence, in a sample, of an agent
that modulates the function of ChemR23, said method comprising: a)
contacting a ChemR23 polypeptide with said sample; b) measuring a
signaling activity of said ChemR23 polypeptide in the presence of
said sample; and c) comparing said activity measured in the
presence of said sample to said activity measured in a reaction in
which said ChemR23 polypeptide is contacted with a TIG2 polypeptide
present at its EC.sub.50, wherein an agent that modulates the
function of ChemR23 is detected if the amount of said activity
measured in the presence of said sample is at least 50% of the
amount induced by said TIG2 polypeptide present at its
EC.sub.50.
7. The method of any one of claims 1-5 wherein said TIG2
polypeptide is detectably labeled.
8. The method of claim 7 wherein said TIG2 polypeptide is
detectably labeled with a moiety selected from the group consisting
of a radioisotope, a fluorophore, a quencher of fluorescence, an
enzyme, an affinity tag, and an epitope tag.
9. The method of any one of claims 1-6 wherein said contacting is
performed in or on a cell expressing said ChemR23 polypeptide.
10. The method of any one of claims 1-6 wherein said contacting is
performed in or on synthetic liposomes.
11. The method of any one of claims 1-6 wherein said contacting is
performed in or on virus-induced budding membranes containing a
ChemR23 polypeptide.
12. The method of any one of claims 1-6 wherein said method is
performed using a membrane fraction from cells expressing said
ChemR23 polypeptide.
13. The method of either of claims 1 or 2 wherein said measuring is
performed using a method selected from label displacement, surface
plasmon resonance, fluorescence resonance energy transfer,
fluorescence quenching, and fluorescence polarization.
14. The method of any one of claims 1-6 wherein said agent is
selected from the group consisting of a peptide, a polypeptide, an
antibody or antigen-binding fragment thereof, a lipid, a
carbohydrate, a nucleic acid, and a small organic molecule.
15. The method of any one of claims 3-6 wherein said step of
measuring a signaling activity of said Chem23 polypeptide comprises
detecting a change in the level of a second messenger.
16. The method of either of claims 3-6 wherein the step of
measuring a signaling activity comprises measurement of guanine
nucleotide binding or exchange, adenylate cyclase activity, cAMP,
Protein Kinase C activity, phosphatidylinosotol breakdown,
diacylglycerol, inositol triphosphate, intracellular calcium,
arachinoid acid, MAP kinase activity, tyrosine kinase activity, or
reporter gene expression.
17. The method of claim 16 wherein said measuring a signaling
activity comprises using an aequorin-based assay.
18. A method of modulating the activity of a ChemR23 polypeptide in
a cell, said method comprising the step of delivering to said cell
an agent that modulates the activity of a ChemR23 polypeptide, such
that the activity of ChemR23 is modulated.
19. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
contacting a tissue sample with an antibody specific for a ChemR23
polypeptide; b) detecting binding of said antibody to said tissue
sample; and c) comparing the binding detected in step (b) with a
standard, wherein a difference in binding relative to said standard
is diagnostic of a disease or disorder characterized by
dysregulation of ChemR23.
20. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
contacting a tissue sample with an antibody specific for a TIG2
polypeptide; b) detecting binding of said antibody to said tissue
sample; and c) comparing the binding detected in step (b) with a
standard, wherein a difference in binding relative to said standard
is diagnostic of a disease or disorder characterized by
dysregulation of ChemR23.
21. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
contacting a tissue sample with an antibody specific for a ChemR23
polypeptide and an antibody specific for a TIG2 polypeptide; b)
detecting binding of said antibodies to said tissue sample; and c)
comparing the binding detected in step (b) with a standard, wherein
a difference in the binding of either antibody or both, relative to
said standard, is diagnostic of a disease or disorder characterized
by dysregulation of ChemR23.
22. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
isolating nucleic acid from a tissue sample; b) amplifying a
ChemR23 polynucleotide, using said nucleic acid as a template; and
c) comparing the amount of amplified ChemR23 polynucleotide
produced in step (b) with a standard, wherein a difference in said
amount of amplified ChemR23 polynucleotide relative to said
standard is diagnostic of a disease or disorder characterized by
dysregulation of ChemR23.
23. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
isolating nucleic acid from a tissue sample; b) amplifying a
ChemR23 polynucleotide, using said nucleic acid as a template; and
c) comparing the sequence of said amplified ChemR23 polynucleotide
produced in step (b) with a standard, wherein a difference in said
sequence, relative to said standard is diagnostic of a disease or
disorder characterized by dysregulation of ChemR23.
24. The method of claim 23 wherein said standard is SEQ ID NO:
1.
25. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
isolating nucleic acid from a tissue sample, b) amplifying a TIG2
polynucleotide, using said nucleic acid as a template; and c)
comparing the amount of amplified TIG2 polynucleotide produced in
step (b) with a standard, wherein a difference in said amount of
amplified TIG2 polynucleotide relative to said standard is
diagnostic of a disease or disorder characterized by dysregulation
of ChemR23.
26. A method of diagnosing a disease or disorder characterized by
dysregulation of ChemR23 signaling, said method comprising: a)
isolating nucleic acid from a tissue sample; b) amplifying a TIG2
polynucleotide, using said nucleic acid as a template; and c)
comparing the sequence of said amplified TIG2 polynucleotide
produced in step (b) with a standard, wherein a difference in said
sequence, relative to said standard is diagnostic of a disease or
disorder characterized by dysregulation of ChemR23.
27. The method of claim 23 or claim 26 wherein the step of
comparing the sequence comprises minisequencing.
28. The method of claim 26 wherein said standard is SEQ ID NO:
7.
29. The method of claim 22 or claim 25 wherein said comparing the
amount is performed on a microarray.
30. The method of claim 23 or claim 26 wherein said comparing the
sequence is performed on a microarray.
31. A composition comprising an isolated ChemR23 polypeptide and an
isolated TIG2 polypeptide.
32. An antibody specific for a Chem R23 polypeptide.
33. An antibody specific for a TIG2 polypeptide.
34. A kit for screening for agents that modulate the signaling
activity of ChemR23, said kit comprising an isolated ChemR23
polypeptide and packaging materials therefor.
35. The kit of claim 34, further comprising a TIG2 polypeptide.
36. A kit for screening for agents that modulate the signaling
activity of ChemR23, said kit comprising an isolated polynucleotide
encoding a ChemR23 polypeptide and packaging materials
therefor.
37. The kit of claim 36, further comprising an isolated
polynucleotide encoding a TIG2 polypeptide.
38. A kit for screening for agents that modulate the signaling
activity of ChemR23, said kit comprising a cell transformed with a
polynucleotide encoding a ChemR23 polypeptide and packaging
materials therefor.
39. A kit for the diagnosis of a disease or disorder characterized
by dysregulation of ChemR23 signaling, said kit comprising an
isolated ChemR23 polypeptide and packaging materials therefor.
40. The kit of claim 39, further comprising a TIG2 polypeptide.
41. A kit for the diagnosis of a disease or disorder characterized
by dysregulation of ChemR23 signaling, said kit comprising an
isolated polynucleotide encoding a ChemR23 polypeptide and
packaging materials therefor.
42. The kit of claim 41, further comprising an isolated
polynucleotide encoding a TIG2 polypeptide.
43. A kit for the diagnosis of a disease or disorder characterized
by dysregulation of ChemR23 signaling, said kit comprising a cell
transformed with a polynucleotide encoding a ChemR23 polypeptide
and packaging materials therefor.
44. A non-human mammal having-a homozygous null mutation in the
gene encoding ChemR23.
45. A non-human mammal transgenic for a ChemR23 polynucleotide.
46. A non-human mammal transgenic for a TIG2 polynucleotide.
Description
[0001] This application claims priority to U.S. Provisional No:
______, filed Jul. 19, 2001.
FIELD OF THE INVENTION
[0002] The invention-relates to the identification of the natural
ligand for the orphan G-Protein Coupled Rcceptor (GPCR) ChemR23 and
uses thereof.
BACKGROUND OF THE INVENTION
[0003] G-protein coupled receptors (GPCRs) are proteins responsible
for transducing a signal within a cell. GPCRs have usually seven
transmembrane domains. Upon binding of a ligand to an
extra-cellular portion or fragment of a GPCR, a signal is
transduced within the cell that results in a change in a biological
or physiological property or behaviour of the cell. GPCRs, along
with G-poteins and effectors (intracellular enzymes and channels
modulated by G-proteins), are the components of a modular signaling
system that connects the state of intra-cellular second messengers
to extra-cellular inputs.
[0004] GPCR genes and gene products can modulate various
physiological processes and are potential causative agents of
disease. The GPCRs seem to be of critical importance to both the
central nervous system and peripheral physiological processes.
[0005] The GPCR protein superfamily is represented in five
families: Family I, receptors typified by rhodopsin and the
beta2-adrenergic receptor and currently represented by over 200
unique members; Family II, the parathyroid
hormone/calcitonin/secretin receptor family; Family III, the
metabotropic glutamate receptor family, Family IV, the CAMP
receptor family, important in the chemotaxis and development of D.
discoideum; and Family V, the fungal mating pheromone receptor such
as STE2.
[0006] G proteins represent a family of heterotrimeric proteins
composed of .alpha., .beta. and .gamma. subunits, that bind guanine
nucleotides. These proteins are usually linked to cell surface
receptors (receptors containing seven transmembrane domains) for
signal transduction. Indeed, following ligand binding to the GPCR,
a conformational change is transmitted to the G protein, which
causes the .alpha.-subunit to exchange a bound GDP molecule for a
GTP molecule and to dissociate from the .beta..gamma.-subunits.
[0007] The GTP-bound form of the .alpha., .beta. and
.gamma.-subunits typically functions as an effector-modulating
moiety, leading to the production of second messengers, such as
cAMP (e.g. by activation of adenyl cyclase), diacylglycerol or
inositol phosphates.
[0008] Greater than 20 different types of .alpha.-subunits are
known in humans. These subunits associate with a small pool of
.beta. and .gamma. subunits. Examples of mammalian G proteins
include Gi, Go, Gq, Gs and Gt. G proteins are described extensively
in Lodish et al., Molecular Cell Biology (Scientific American Books
Inc., New York, N.Y., 1995; and also by Downes and Gautam, 1999,
The G-Protein Subunit Gene Families. Genomics 62:544-552), the
contents of both of which are incorporated herein by reference.
[0009] Known and uncharacterized GPCRs currently constitute major
targets for drug action and development. There are ongoing efforts
to identify new G protein coupled receptors which can be used to
screen for new agonists and antagonists having potential
prophylactic and therapeutical properties.
[0010] More than 300 GPCRs have been cloned to date, excluding the
family of olfactory receptors. Mechanistically, approximately
50-60% of all clinically relevant drugs act by modulating the
functions of various GPCRs (Cudermann et al., J Mol. Med.,
73:51-63, 1995).
[0011] ChemR23, also called Dez [Sequence ID Nos: 1 (human
polynucleotide sequence, FIG. 1); 2 (human amino acid sequence,
FIG. 2); 3 (mouse polynucleotide sequence, FIG. 3); 4 (mouse amino
acid sequence, FIG. 3); 5 (rat polynucleotide sequence; FIG. 4);
and 6 (rat amino acid sequence, FIG. 4)] has been described as an
orphan G protein coupled receptor related to GPR-1 (38% overall
amino acid identity), C3a receptor (38%), C5a anaphylatoxin
receptor (36%) and formyl Met-Leu-Phe receptors (35%). ChemR23 is
more distantly related to the chemokine receptors subfamily
(Methner A, Hermey G, Schinke B, Hermans-Borgmeyer I. (1997)
Biochem Biophys Res Commun 233:336-42; Samson M, Edinger A L,
Stordeur P, Rucker J, Verhasselt V, Sharron M, Govaerts C,
Mollereau C, Vassart G, Doms R W, Parmentier M. (1998) Eur J
Immunol 28:1689-700). ChemR23 transcripts were found to be abundant
in monocyte-derived dendritic cells and macrophages, with or
without treatment with LPS. Low expression can also be detected by
reverse transcription-PCR in CD4+ T lymphocytes. In situ
hybridization experiments also showed that the receptor was
differentially regulated during development, with a prominent
expression in developing osseous and cartilaginous tissues. It was
also detectable in the adult parathyroid glands, indicating a
possible function in phosphocalic metabolism.
[0012] The gene encoding ChemR23 was assigned by radiation hybrid
mapping to the q21.2-21.3 region of human chromosome 12, outside
the gene clusters identified so far for chemoattractant receptors.
ChemR23 was tested in fusion assays for potential coreceptor
activity by a range of HIV-1, HIV-2 and SIV viral strains. Several
SIV strains (SIVmac316, SIVmac239, SIVmac17E-Fr and SIVsm62A), as
well as a primary HIV-1 strain (92UG024-2) efficiently used ChemR23
as a co-receptor. This receptor therefore appears to be a
coreceptor for immunodeticiency viruses that does not belong to the
chemokine receptor family. It is also a putative chemoattractant
receptor and it could play an important role in the recruitment or
trafficking of leukocyte cell populations.
[0013] TIG2 (Tazarotene-induced gene 2 [Sequence ID Nos: 7 (human
TIG2 polynucleotide sequence, FIG. 6); 8 (human amino acid
sequence, FIG. 6); 9 (mouse polynucleotide sequence, FIG. 7); and
10 (mouse amino acid sequence, FIG. 7)] was identified as a cDNA,
the expression of which is up-regulated by the treatment of skin
raft cultures by the retinoic acid receptor (RAR)
beta/gamma-selective anti-psoriatic synthetic retinoid, tazarotene
[AGN 190168/ethyl 6-[2-(4,4-dimethylthiochroman-6-yl)-ethynyl]
nicotinate] (Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C,
Malhotra M, Teng M, Duvic M, Chandraratna R A. (1997) J Invest
Dermatol 109: 91-5). The retinoid-mediated up-regulation in the
expression of TIG2 was confirmed by Northern blot analysis. The
TIG2 cDNA is 830 bp long and encodes a putative protein product of
164 amino acids. TIG2 is expressed and induced by tazarotene in
culture only when keratinocytes and fibroblasts form a tissue-like
3-dimensional structure. RAR-specific retinoids were also shown to
increase TIG2 mRNA levels. In contrast, neither RXR-specific
retinoids nor 1,25-dihydroxyvitamin D3 increased TIG2 levels in
these cells. TIG2 is also expresssed at high levels in nonlesional
psoriatic skin but at lower levels in the psoriatic lesion and its
expression is up-regulated in psoriatic lesions after topical
application of tazarotene. In addition, TIG2 has been shown to be
dramatically upregulated by 1,25 dihydroxyvitamin D3 and
dexamethasone in osteoclast-supporting stromal cells (Adams AE,
Abu-Amer Y, Chappel J, Stueckle S, Ross F P, Teitelbaum S L, Suva L
J. (1999) J Cell Biochem 74: 587-95).
SUMMARY OF THE INVENTION
[0014] The invention relates to the identification of TIG2, the
polypeptide product of Tazarotene-Induced Gene 2, as a natural
ligand of the ChemR23 GPCR. The invention encompasses the use of
the interaction of ChemR23 polypeptides and TIG2 polypeptides as
the basis of screening assays for agents that modulate the activity
of the ChemR23 receptor. The invention also encompasses diagnostic
assays based upon the ChemR23/TIG2 interaction, as well as kits for
performing diagnostic and screening assays.
[0015] The invention encompasses a method of identifying an agent
that modulates the function of ChemR23, the method comprising: a)
contacting a ChemR23 polypeptide with a TIG2 polypeptide in the
presence and absence of a candidate modulator under conditions
permitting the binding of the TIG2 polypeptide to the ChemR23
polypeptide; and b) measuring the binding of the ChemR23
polypeptide to the TIG2 polypeptide, wherein a decrease in binding
in the presence of the candidate modulator, relative to the binding
in the absence of the candidate modulator, identifies the candidate
modulator as an agent that modulates the function of ChemR23.
[0016] The invention further encompasses a method of detecting the
presence, in a sample, of an agent that modulates the function of
ChemR23 in a sample, the method comprising a) contacting a ChemR23
polypeptide with a TIG2 polypeptide in the presence and absence of
the sample under conditions permitting the binding of the TIG2
polypeptide to the ChemR23 polypeptide; and b) measuring the
binding of the ChemR23 polypeptide to the TIG2 polypeptide, wherein
a decrease in binding in the presence of the sample, relative to
the binding in the absence of the candidate modulator, indicates
the presence, in the sample of an agent that modulates the function
of ChemR23.
[0017] In a preferred embodiment of either of the preceding
methods, the measuring is performed using a method selected from
label displacement, surface plasmon resonance, fluorescence
resonance energy transfer, fluorescence quenching, and fluorescence
polarization.
[0018] The invention further encompasses a method of identifying an
agent that modulates the function of ChemR23, the method
comprising: a) contacting a ChemR23 polypeptide with a TIG2
polypeptide in the presence and absence of a candidate modulator;
and b) measuring a signaling activity of the ChemR23 polypeptide,
wherein a change in the activity in the presence of the candidate
modulator relative to the activity in the absence of the candidate
modulator identifies the candidate modulator as an agent that
modulates the function of ChemR23.
[0019] The invention further encompasses a method of identifying an
agent that modulates the function of ChemR23, the method
comprising: a) contacting a ChemR23 polypeptide with a candidate
modulator; b) measuring a signaling activity of the ChemR23
polypeptide in the presence of the candidate modulator; and c)
comparing the activity measured in the presence of the candidate
modulator to the activity measured in a sample in which the ChemR23
polypeptide is contacted with a TIG2 polypeptide at its EC.sub.50,
wherein the candidate modulator is identified as an agent that
modulates the function of ChemR23 when the amount of the activity
measured in the presence of the candidate modulator is at least 50%
of the amount induced by the TIG2 polypeptide present at its
EC.sub.50.
[0020] The invention further encompasses a method of detecting the
presence, in a sample, of an agent that modulates the function of
ChemR23, the method comprising: a) contacting a ChemR23 polypeptide
with TIG2 polypeptide in the presence and absence of the sample; b)
measuring a signaling activity of the ChemR23 polypeptide; and c)
comparing the amount of the activity measured in a reaction
containing ChemR23 and TIG2 polypeptides without the sample to the
amount of the activity measured in a reaction containing ChemR23,
TIG2 and the sample, wherein a change in the activity in the
presence of the sample relative to the activity in the absence of
the sample indicates the presence, in the sample, of an agent that
modulates the function of ChemR23.
[0021] The invention further encompasses a method of detecting the
presence, in a sample, of an agent that modulates the function of
ChemR23, the method comprising: a) contacting a ChemR23 polypeptide
with the sample; b) measuring a signaling activity of the ChemR23
polypeptide in the presence of the sample; and c) comparing the
activity measured in the presence of the sample to the activity
measured in a reaction in which the ChemR23 polypeptide is
contacted with a TIG2 polypeptide present at its EC.sub.50, wherein
an agent that modulates the function of ChemR23 is detected if the
amount of the activity measured in the presence of the sample is at
least 50% of the amount induced by the TIG2 polypeptide present at
its EC.sub.50.
[0022] In a preferred embodiment of each of the preceding methods,
the TIG2 polypeptide is detectably labeled. It is preferred that
the TIG2 polypeptide is detectably labeled with a moiety selected
from the group consisting of a radioisotope, a fluorophore, a
quencher of fluorescence, an enzyme, an affinity tag, and an
epitope tag.
[0023] In one embodiment of any of the preceding methods, the
contacting is performed in or on a cell expressing the ChemR23
polypeptide.
[0024] In another embodiment of any of the preceding methods, the
contacting is performed in or on synthetic liposomes (see Tajib et
al., 2000, Nature Biotechnology, 18: 649-654, which is incorporated
herein by reference) or virus-induced budding membranes containing
a ChemR23 polypeptide. (see WO0102551, 2001, incorporated herein by
reference).
[0025] In another embodiment of any of the preceding methods, the
method is performed using a membrane fraction from cells expressing
the ChemR23 polypeptide.
[0026] In another embodiment, the agent is selected from the group
consisting of a peptide, a polypeptide, an antibody or
antigen-binding fragment thereof, a lipid, a carbohydrate, a
nucleic acid, and a small organic molecule.
[0027] In another embodiment, the step of measuring a signaling
activity of the ChemR23 polypeptide comprises detecting a change in
the level of a second messenger.
[0028] In another embodiment, the step of measuring a signaling
activity comprises measurement of guanine nucleotide binding or
exchange, adenylate cyclase activity, cAMP, Protein Kinase C
activity, phosphatidylinosotol breakdown, diacylglycerol, inositol
triphosphate, intracellular calcium, arachinoid acid, MAP kinase
activity, tyrosine kinase activity, or reporter gene
expression.
[0029] In a preferred embodiment, the measuring a signaling
activity comprises using an aequorin-based assay.
[0030] The invention further encompasses a method of modulating the
activity of a ChemR23 polypeptide in a cell, the method comprising
the step of delivering to the cell an agent that modulates the
activity of a ChemR23 polypeptide, such that the activity of
ChemR23 is modulated.
[0031] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) contacting a tissue sample
with an antibody specific for a ChemR23 polypeptide; b) detecting
binding of the antibody to the tissue sample; and c) comparing the
binding detected in step (b) with a standard, wherein a difference
in binding relative to the standard is diagnostic of a disease or
disorder characterized by dysregulation of ChemR23.
[0032] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) contacting a tissue sample
with an antibody specific for a TIG2 polypeptide; b) detecting
binding of the antibody to the tissue sample; and c) comparing the
binding detected in step (b) with a standard, wherein a difference
in binding relative to the standard is diagnostic of a disease or
disorder characterized by dysregulation of ChemR23.
[0033] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) contacting a tissue sample
with an antibody specific for a ChemR23 polypeptide and an antibody
specific for a TIG2 polypeptide; b) detecting binding of the
antibodies to the tissue sample; and c) comparing the binding
detected in step (b) with a standard, wherein a difference in the
binding of either antibody or both, relative to the standard, is
diagnostic of a disease or disorder characterized by dysregulation
of ChemR23.
[0034] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) isolating nucleic acid from a
tissue sample; b) amplifying a ChemR23 polynucleotide, using the
nucleic acid as a template; and c) comparing the amount of
amplified ChemR23 polynucleotide produced in step (b) with a
standard, wherein a difference in the amount of amplified ChemR23
polynucleotide relative to the standard is diagnostic of a disease
or disorder characterized by dysregulation of ChemR23. In a
preferred embodiment, the step of amplifying comprises RT/PCR. In
another preferred embodiment, the step of comparing the amount is
performed on a microarray.
[0035] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) isolating nucleic acid from a
tissue sample; b) amplifying a ChemR23 polynucleotide, using the
nucleic acid as a template; and c) comparing the sequence of the
amplified ChemR23 polynucleotide produced in step (b) with a
standard, wherein a difference in the sequence, relative to the
standard is diagnostic of a disease or disorder characterized by
dysregulation of ChemR23. In a preferred embodiment, the step of
amplifying comprises RT/PCR. In another preferred embodiment, the
standard is SEQ ID NO: 1. In another preferred embodiment, the step
of comparing the sequence comprises minisequencing. In another
preferred embodiment, the step of comparing the sequence is
performed on a microarray.
[0036] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) isolating nucleic acid from a
tissue sample; b) amplifying a TIG2 polynucleotide, using the
nucleic acid as a template; and c) comparing the amount of
amplified TIG2 polynucleotide produced in step (b) with a standard,
wherein a difference in the amount of amplified TIG2 polynucleotide
relative to the standard is diagnostic of a disease or disorder
characterized by dysregulation of ChemR23. In a preferred
embodiment, the step of amplifying comprises RT/PCR. In another
preferred embodiment, the step of comparing the amount is performed
on a microarray.
[0037] The invention further encompasses a method of diagnosing a
disease or disorder characterized by dysregulation of ChemR23
signaling, the method comprising: a) isolating nucleic acid from a
tissue sample; b) amplifying a TIG2 polynucleotide, using the
nucleic acid as a template; and c) comparing the sequence of the
amplified TIG2 polynucleotide produced in step (b) with a standard,
wherein a difference in the sequence, relative to the standard is
diagnostic of a disease or disorder characterized by dysregulation
of ChemR23. In a preferred embodiment, the step of amplifying
comprises RT/PCR. In another preferred embodiment, the standard is
SEQ ID NO: 7. In another preferred embodiment, the step of
comparing the sequence comprises minisequencing. In another
preferred embodiment, the step of comparing the sequence is
performed on a microarray.
[0038] The invention further encompasses a composition comprising
an isolated ChemR23 polypeptide and an isolated TIG2
polypeptide.
[0039] The invention further encompasses an antibody specific for a
ChemR23 polypeptide or a TIG2 polypeptide.
[0040] The invention further encompasses a kit for screening for
agents that modulate ChemR23 signaling, or for the diagnosis of a
disease or disorder characterized by dysregulation of a ChemR23
polypeptide, the kit comprising an isolated ChemR23 polypeptide and
packaging materials therefor. In a preferred embodiment, the kit
further comprises a TIG2 polypeptide. Diagnostic kits according to
the invention permit the determination of whether, for example, a
tissue sample or an extract prepared from a tissue sample has an
elevated level or activity of TIG2 or ChemR23. The kits also permit
the identification of mutations in genes encoding ChemR23 or TIG2
and detection of abnormal levels of nucleic acids encoding ChemR23
or TIG2.
[0041] The invention further encompasses a kit for screening for
agents that modulate ChemR23 signaling, or for the diagnosis of a
disease or disorder characterized by dysregulation of a ChemR23
polypeptide, the kit comprising an isolated polynucleotide encoding
a ChemR23 polypeptide and packaging materials therefor. In a
preferred embodiment, the kit further comprises an isolated
polynucleotide encoding a TIG2 polypeptide.
[0042] The invention further encompasses a kit for screening for
agents that modulate ChemR23 signaling, or for the diagnosis of a
disease or disorder characterized by dysregulation of a ChemR23
polypeptide, the kit comprising a cell transformed with a
polynucleotide encoding a ChemR23 polypeptide and packaging
materials therefor. In a preferred embodiment, the kit further
comprises an isolated polynucleotide encoding a TIG2 polypeptide or
a cell comprising a polynucleotide encoding a TIG2 polypeptide.
[0043] The invention further encompasses a non-human mammal having
a homozygous null mutation in the gene encoding ChemR23.
[0044] The invention further encompasses a non-human mammal
transgenic for a ChemR23 polynucleotide.
[0045] The invention further encompasses a non-human mammal
transgenic for a TIG2 polynucleotide.
[0046] As used herein, the term "ChemR23 polypeptide" refers to a
polypeptide having two essential properties: 1) a ChemR23
polypeptide has at least 70% amino acid identity, and preferably
80%, 90%, 95% or higher, including 100% amino acid identity, to SEQ
ID NO: 2; and 2) a ChemR23 polypeptide has ChemR23 activity, i.e.,
the polypeptide binds a TIG2 polypeptide or a functional fragment
thereof. Optimally, a "ChemR23 polypeptide" also has ChemR23
signaling activity as defined herein.
[0047] As used herein, the term "ChemR23 polynucleotide" refers to
a polynucleotide that encodes a ChemR23 polypeptide as defined
herein.
[0048] As used herein, the term "ChemR23 activity" refers to
specific binding of a TIG2 polypeptide or a functional fragment
thereof by a ChemR23 polypeptide.
[0049] As used herein, the term "ChemR23 signaling activity" refers
to the initiation or propagation of signaling by a ChemR23
polypeptide. ChemR23 signaling activity is monitored by measuring a
detectable step in a signaling cascade by assaying one or more of
the following: stimulation of GDP for GTP exchange on a G protein;
alteration of adenylate cyclase activity; protein kinase C
modulation; phosphatidylinositol breakdown (generating second
messengers diacylglycerol, and inositol triphosphate);
intracellular calcium flux; activation of MAP kinases; modulation
of tyrosine kinases; or modulation of gene or reporter gene
activity. A detectable step in a signaling cascade is considered
initiated or mediated if the measurable activity is altered by 10%
or more above or below a baseline established in the substantial
absence of a TIG2 polypeptide relative to any of the ChemR23
activity assays described herein below. The measurable activity can
be measured directly, as in, for example, measurement of cAMP or
diacylglycerol levels. Alternatively, the measurable activity can
be measured indirectly, as in, for example, a reporter gene
assay.
[0050] As used herein, the term "detectable step" refers to a step
that can be measured, either directly, e.g., by measurement of a
second messenger or detection of a modified (e.g., phosphorylated)
protein, or indirectly, e.g., by monitoring a downstream effect of
that step. For example, adenylate cyclase activation results in the
generation of cAMP. The activity of adenylate cyclase can be
measured directly, e.g., by an assay that monitors the production
of cAMP in the assay, or indirectly, by measurement of actual
levels of cAMP.
[0051] As used herein, the term "isolated" refers to a population
of molecules, e.g., polypeptides or polynucleotides, the
composition of which is less than 50% (by weight), preferably less
than 40% and most preferably 2% or less, contaminating molecules of
an unlike nature. When the term "isolated" is applied to a ChemR23
polypeptide, it is specifically meant to encompass a ChemR23
polypeptide that is associated with or embedded in a lipid
membrane.
[0052] As used herein, the term "TIG2 polypeptide" refers to a
polypeptide having at least 31% identity (or higher identity, such
as 45%, 55%, 65%, 75%, 85%, 95% or even 100%) to the polypeptide
represented by SEQ ID NO: 8 that specifically binds to and
activates a signaling activity of a ChemR23 polypeptide having the
sequence of SEQ ID NO: 2. The term "specifically binds" means that
the TIG2 polypeptide has an EC.sub.50, IC.sub.50, or a K.sub.d of
100 nM or less. "TIG2 polypeptide" also refers to a fragment of a
polypeptide meeting the preceding definition, wherein the fragment
retains at least 50% of the binding activity and level of signaling
activation of the full length polypeptide of SEQ ID NO:8. A TIG2
polypeptide can comprise additions, insertions, deletions or
substitutions relative to SEQ ID NO: 8, as long as the resulting
polypeptide retains at least 50% of the binding activity and level
of signaling activation of the full length polypeptide represented
by SEQ ID NO: 8. In addition to the sequences necessary for binding
to ChemR23 and activating a ChemR23 signaling actitity, a TIG2
polypeptide can comprise additional sequences, as in for example, a
TIG2 fusion protein. Non-limiting examples of fusion partners
include glutathione-S-transferas- e (GST), maltose binding protein,
alkaline pnosphatase, thioredoxin, green fluorescent protein (GFP),
histidine tags (e.g., 6.times. or greater His), or epitope tags
(e.g., Myc tag, FLAG tag).
[0053] As used herein, the term "TIG2 polynucleotide" refers to a
polynucleotide that encodes a TIG2 polypeptide as defined herein,
or the complement thereof.
[0054] As used herein, the terms "candidate compound" and
"candidate modulator" refer to a composition being evaluated for
the ability to modulate ligand binding to a ChemR23 polypeptide or
the ability to modulate an activity of a ChemR23 polypeptide.
Candidate modulators can be natural or synthetic compounds,
including, for example, small molecules, compounds contained in
extracts of animal, plant, bacterial or fungal cells, as well as
conditioned medium from such cells.
[0055] As used herein, the term "small molecule" refers to a
compound having molecular mass of less than 3000 Daltons,
preferably less than 2000 or 1500, still more preferably less than
1000, and most preferably less than 600 Daltons. A "small organic
molecule" is a small molecule that comprises carbon.
[0056] As used herein, the term "change in binding" or "change in
activity" and the equivalent terms "difference in binding" or
"difference in activity" refer to an at least 10% increase or
decrease in binding, or signaling activity in a given assay.
[0057] As used herein, the term "conditions permitting the binding
of TIG2 to ChemR23" refers to conditions of, for example,
temperature, salt concentration, pH and protein concentration under
which TIG2 binds ChemR23. Exact binding conditions will vary
depending upon the nature of the assay, for example, whether the
assay uses viable cells or only membrane fraction of cells.
However, because ChemR23 is a cell surface protein, and because
TIG2 is a secreted polypeptide that interacts with ChemR23 on the
cell surface, favored conditions will generally include
physiological salt (90 mM) and pH (about 7.0 to 8.0). Temperatures
for binding can vary from 15.degree. C. to 37.degree. C., but will
preferably be between room temperature and about 30.degree. C. The
concentration of TIG2 and ChemR23 polypeptide in a binding reaction
will also vary, but will preferably be about 0.1 pM(e.g., in a
reaction with radiolabeled tracer TIG2, where the concentration is
generally below the K.sub.d) to 1 .mu.M (e.g., TIG2 as competitor).
As an example, for a binding assay using ChemR23-expressing cells
and purified, recombinant, labeled TIG2 polypeptide, binding is
performed using 0.1 nM labeled TIG2, 100 nM cold TIG2, and 25,000
cells at 27.degree. C. in 250 .mu.l of a binding buffer consisting
of 50 mM HEPES (pH 7.4), 1 mM CaCl.sub.2, and 0.5% Fatty acid free
BSA.
[0058] As used herein, the term "sample" refers to the source of
molecules being tested for the presence of an agent that modulates
binding to or signaling activity of a ChemR23 polypeptide. A sample
can be an environmental sample, a natural extract of animal, plant
yeast or bacterial cells or tissues, a clinical sample, a synthetic
sample, or a conditioned medium from recombinant cells or a
fermentation processe. The term "tissue sample" refers to a tissue
that is tested for the presence, abundance, quality or an activity
of a ChemR23 polypeptide, a TIG2 polypeptide, a nucleic acid
encoding a ChemR23 or TIG2 polypeptide, or an agent that modifies
the ligand binding or activity of a ChemR23 polypeptide.
[0059] As used herein, a "tissue" is an aggregate of cells that
perform a particular function in an organism. The term "tissue" as
used herein refers to cellular material from a particular
physiological region. The cells in a particular tissue can comprise
several different cell types. A non-limiting example of this would
be brain tissue that further comprises neurons and glial cells, as
well as capillary endothelial cells and blood cells, all contained
in a given tissue section or sample. In addition to solid tissues,
the term "tissue" is also intended to encompass non-solid tissues,
such as blood.
[0060] As used herein, the term "membrane fraction" refers to a
preparation of cellular lipid membranes comprising a ChemR23
polypeptide. As the term is used herein, a "membrane fraction" is
distinct from a cellular homogenate, in that at least a portion
(i.e., at least 10%, and preferably more) of
non-membrane-associated cellular constituents has been removed. The
term "membrane associated" refers to those cellular constituents
that are either integrated into a lipid membrane or are physically
associated with a component that is integrated into a lipid
membrane.
[0061] As used herein, the term "decrease in binding" refers to a
decrease of at least 10% in the binding of a TIG2 polypeptide or
other agonist to a ChemR23 polypeptide as measured in a binding
assay as described herein.
[0062] As used herein, the term "second messenger" refers to a
molecule, generated or caused to vary in concentration by the
activation of a G-Protein Coupled Receptor, that participates in
the transduction of a signal from that GPCR. Non-limiting examples
of second messengers include cAMP, diacylglycerol, inositol
triphosphates and intracellular calcium. The term "change in the
level of a second messenger" refers to an increase or decrease of
at least 10% in the detected level of a given second messenger
relative to the amount detected in an assay performed in the
absence of a candidate modulator.
[0063] As used herein, the term "aequorin-based assay" refers to an
assay for GPCr activity that measures intracellular calcium flux
induced by activated GPCRs, wherein intracellular calcium flux is
measured by the luminescence of aequorin expressed in the cell.
[0064] As used herein, the term "binding" refers to the physical
association of a ligand (e.g., a TIG2 polypcptide) with a receptor
(e.g., ChemR23). As the term is used herein, binding is "specific"
if it occurs with an EC.sub.50 or a K.sub.d of 100 nM or less,
generally in the range of 100 nM to 10 pM. For example, binding is
specific if the EC.sub.50 or K.sub.d is 100 nM, 50 nM, 10 nM, 1 nM,
950 pM, 900 pM, 850 pM, 800 pM, 750 pM, 700 pM, 650 pM, 600 pM, 550
pM, 500 pM, 450 pM, 400 pM, 350 pM, 300 pM, 250 pM, 200 pM, 150 pM,
100 pM, 75 pM, 50 pM, 25 pM or 10 pM or less.
[0065] As used herein, the term "EC.sub.50," refers to that
concentration of an agent at which a given activity, including
binding of a TIG2 polypeptide or other ligand and a functional
activity of a ChemR23 polypeptide, is 50% of the maximum for that
ChemR23 activity measurable using the same assay. Stated
differently, the "EC.sub.50" is the concentration of agent that
gives 50% activation, when 100% activation is set at the amount of
activity that does not increase with the addition of more agonist.
It should be noted that the "EC.sub.50 of a TIG2 polypeptide" will
vary with the identity of the TIG2 polypeptide; for example,
variant TIG2 polypeptides (i.e., those containing insertions,
deletions, substitutions or fusions with other polypeptides,
including TIG2 molecules from species other than humans and
variants of them that satisfy the definition of TIG2 polypeptide
set forth above) can have EC.sub.50 values higher than, lower than
or the same as wild-type TIG2. Therefore, where a TIG2 variant
sequence differs from wild-type TIG2 of SEQ ID NO:8, one of the
skill in the art can determine the EC.sub.50 for that variant
according to conventional methods. The EC.sub.50 of a given TIG2
polypeptide is measured by performing an assay for an activity of a
fixed amount of ChemR23 polypeptide in the presence of doses of the
TIG2 polypeptide that increase at least until the ChemR23 response
is saturated or maximal, and then plotting the measured ChemR23
activity versus the concentration of TIG2 polypeptide.
[0066] As used herein, the term "IC.sub.50" is the concentration of
an antagonist or inverse agonist that reduces the maximal
activation of a ChemR23 receptor by 50%.
[0067] As used herein, the term "detectably labeled" refers to the
property of a molecule, e.g., a TIG2 polypeptide or other ChemR23
ligand, that has a structural modification that incorporates a
functional group (label) that can be readily detected. Detectable
labels include but are not limited to fluorescent compounds,
isotopic compounds, chemiluminescent compounds, quantum dot labels,
biotin, enzymes, electron-dense reagents, and haptens or proteins
for which antisera or monoclonal antibodies are available The
various means of detection include but are not limited to
spectroscopic, photochemical, radiochemical, biochemical,
immunochemical, or chemical means.
[0068] As used herein, the term "affinity tag" refers to a label,
attached to a molecule of interest (e.g., a TIG2 polypeptide or
other ChemR23 ligand), that confers upon the labeled molecule the
ability to be specifically bound by a reagent that binds the label.
Affinity tags include, but are not limited to an epitope for an
antibody (known as "epitope tags"), biotin, 6.times.His, and GST.
Affinity tags can be used for the detection, as well as for the
purification of the labeled species.
[0069] As used herein, the term "decrease in binding" refers to a
decrease of at least 10% in the amount of binding detected in a
given assay with a known or suspected modulator of ChemR23 relative
to binding detected in an assay lacking that known or suspected
modulator.
[0070] As used herein, the term "delivering," when used in
reference to a drug or agent, means the addition of the drug or
agent to an assay mixture, or to a cell in culture. The term also
refers to the administration of the drug or agent to an animal.
Such administration can be, for example, by injection (in a
suitable carrier, e.g., sterile saline or water) or by inhalation,
or by an oral, transdermal, rectal, vaginal, or other common route
of drug administration.
[0071] As used herein, the term "effective amount" refers to that
amount of a drug or ChemR23 modulating agent that results in a
change in a ChemR23 activity as defined herein (i.e., at least 10%
increase or decrease in a ChemR23 activity).
[0072] As used herein, the term "standard" refers to a sample taken
from an individual who is not affected by a disease or disorder
characterized by dysregulation of ChemR23 or TIG2 activity. The
"standard" is used as a reference for the comparison of ChemR23 or
TIG2 polypeptide or mRNA levels and quality (i.e., mutant vs.
wild-type), as well as for the comparison of ChemR23
activities.
[0073] As used herein, the term "amplifying," when applied to a
nucleic acid sequence, refers to a process whereby one or more
copies of a nucleic acid sequence is generated from a template
nucleic acid. A preferred method of "amplifying" is PCR or
RT/PCR.
[0074] As used herein, the term "substantial absence" refers to a
level of an activating or inhibiting factor that is below the level
necessary to activate or inhibit GPCR function by at least 10% as
measured by a given assay disclosed herein or known in the art.
[0075] As used herein, the term "G-Protein coupled receptor," or
"GPCR" refers to a membrane-associated polypeptide with 7 alpha
helical transmembrane domains. Functional GPCR's associate with a
ligand or agonist and also associate with and activate G-proteins.
ChemR23 is a GPCR.
[0076] As used herein, the term "agent that modulates the function
of a ChemR23 polypeptide" is a molecule or compound that increases
or decreases ChemR23 activity, including compounds that change the
binding of TIG2 polypeptides or other agonists, and compounds that
change ChemR23 downstream signaling activities.
[0077] As used herein, the term "transgenic animal" refers to any
animal, preferably a non-human mammal, bird, fish or an amphibian,
in which one or more of the cells of the animal contain
heterologous nucleic acid introduced by way of human intervention,
such as by transgenic techniques well known in the art. The nucleic
acid is introduced into the cell, directly or indirectly by
introduction into a precursor of the cell, by way of deliberate
genetic manipulation, such as by microinjection or by infection
with a recombinant virus. The term genetic manipulation does not
include classical cross-breeding, or in vitro fertilization, but
rather is directed to the introduction of a recombinant DNA
molecule. This molecule may be integrated within a chromosome, or
it may be extra-chromosomally replicating DNA. In the typical
transgenic animals described herein, the transgene causes cells to
express a recombinant form of one of the subject polypeptide, e.g.
either agonistic or antagonistic forms. However, transgenic animals
in which the recombinant gene is silent are also contemplated, as
for example, the FLP or CRE recombinase dependent constructs
described below. Moreover, "transgenic animal" also includes those
recombinant animals in which gene disruption of one or more genes
is caused by human intervention, including both recombination and
antisense techniques.
[0078] As used herein, the term "antibody" is the conventional
immunoglobulin molecule, as well as fragments thereof which are
also specifically reactive with one of the subject polypeptides.
Antibodies can be fragmented using conventional techniques and the
fragments screened for utility in the same manner as described
herein below for whole antibodies. For example, F(ab).sub.2
fragments can be generated by treating antibody with pepsin. The
resulting F(ab).sub.2 fragment can be treated to reduce disulfide
bridges to produce Fab fragments. The antibody of the present
invention is further intended to include bispecific, single-chain,
and chimeric and humanized molecules having affinity for a
polypeptide conferred by at least one CDR region of the antibody.
In preferred embodiments, the antibodies, the antibody further
comprises a label attached thereto and able to be detected, (e.g.,
the label can be a radioisotope, fluorescent compound,
chemiluminescent compound, enzyme, or enzyme co-factor).
[0079] As used herein, the term "null mutation" refers to an
insertion, deletion, or substitution that modifies the chromosomal
sequences encoding a polypeptide, such that the polypeptide is not
expressed.
BRIEF DESCRIPTION OF THE FIGURES
[0080] FIG. 1 shows the nucleotide (SEQ ID NO: 1) and deduced amino
acid sequence of human ChemR23/Dezb/CMKRL1.
[0081] FIG. 2 shows the amino acid sequence of human
ChemR23/Dezb/CMKRL1 (SEQ ID NO: 2). The seven predicted
transmembrane domains are underlined. The consensus sequence for
N-linked glycosylation (N-X-S/T) in the N terminus is bold, and the
potential site of phosphorylation by PKC (S/T-X-R/K) in the C
terminus is italicized.
[0082] FIG. 3 shows the nucleotide (SEQ ID NO:3) and deduced amino
acid (SEQ ID NO: 4) sequences of mouse Dez, the mouse orthologue of
ChemR23.
[0083] FIG. 4 shows that nucleotide (SEQ ID NO: 5) and deduced
amino acid (SEQ ID NO: 6) sequences of rat G-Protein-Coupled
Chemoattractant-1, the rat orthologue of ChemR23/Dezb/CMKRL1.
[0084] FIG. 5 shows the structural similarities between the amino
acid sequences of ChemR23/Dezb/CMKRL1 and the sequences of AT2,
C3a, c5a, and fMLP receptors and selected chemokine receptor
sequences performed using the ClustaiX algorithm. The dendrogram
shown was constructed using the TreeView Algorithm.
[0085] FIG. 6 shows the nucleotide (SEQ ID NO: 7) and deduced amino
acid (SEQ ID NO: 8) sequences of human TIG2.
[0086] FIG. 7 shows the nucleotide (SEQ ID NO: 9) and deduced amino
acid (SEQ ID NO: 10) sequences of mouse TIG2.
[0087] FIG. 8 shows an alignment of the human and mouse TIG2 amino
acid sequences. Identical amino acids are conservatove
substitutions are boxed.
[0088] FIG. 9 shows an alignment of human, mouse, rat, sus, bos,
and Gallus gallus TIG2 sequences. The figure provides the percent
amino acid identity across any two species listed.
[0089] FIG. 10 shows a partial chromatogram of the fifth step of
purification of TIG2 from ascitic fluid. The active fractions
(eluted with approximately 28% CH.sub.3CN) of the previous step
were diluted 6 fold with 0.1% TFA in H.sub.2O and directly loaded
onto a C18 reverse phase column (1 mm.times.50 mm, Vydac)
pre-equilabrated with 5% CH.sub.3CN/0.1% TFA in H.sub.2O at a
flow-rate of 0.1 ml/min. at room temperature. A 5-95% gradient of
CH.sub.3CN in 0.1%TFA was applied with a 0.3%/min slope between 25
and 45%. The activity was eluted at 40% CH.sub.3CN (indicated by
the black horizontal line).
[0090] FIG. 11 shows the identification of a specific response for
Chemr23 following screening of HPLC fractions obtained from the
fractionation of human ovary ascites. The difierent fractions
obtained following fractionation of human ovary ascites were
diluted fivefold in the assay buffer and tested in an aequorin
assay using a cell line expressing ChemR23 (open circles) or cell
lines expressing unrelated receptors (closed triangles and
squares). The response obtained for each fraction was normalized
using the ATP response of each cell line.
[0091] FIG. 12 shows the activation of ChemR23 by conditioned
medium of 293T cells transiently transfected with TIG2. 293T cells
were transiently transfected with pCDNA3-TIG2 or with pCDNA3 alone
(mock transfected). Increasing volumes of the supernatant collected
4 days after transfection were analyzed using a Microlumat in an
aequorin-based assay with CHO cells expressing ChemR23. The assay
was preformed in triplicate, and SD is indicated. A representative
experiment is shown.
[0092] FIG. 13 shows the characterization of antibodies directed
against ChemR23 by flow cytometry.
DETAILED DESCRIPTION OF THE INVENTION
[0093] The invention relates to the discovery that TIG2 polypeptide
is a natural ligand for the orphan ChemR23 GPCR. The interaction is
useful for screening assays for agents that modulate the
interaction and thus the function of ChemR23. The known ligand and
its interaction with the receptor also provides for the diagnosis
of conditions involving dysregulated receptor activity.
[0094] I. Assays For The Identification Of Agents That Modulate The
Activity Of ChemR23.
[0095] Agents that modulate the activity of ChemR23 can be
identified in a number of ways that take advantage of the
interaction of the receptor with TIG2. For example, the ability to
reconstitute ChemR23/TIG2 binding either in vitro, on cultured
cells or in vivo provides a target for the identification of agents
that disrupt that binding. Assays based on disruption of binding
can identify agents, such as small organic molecules, from
libraries or collections of such molecules. Alternatively, such
assays can identify agents in samples or extracts from natural
sources, e.g., plant, fungal or bacterial extracts or even in human
tissue samples (e.g., tumor tissue). In one aspect, the extracts
can be made from cells expressing a library of variant nucleic
acids, peptides or polypeptides, including, for example, variants
of TIG2 polypeptide itself. Modulators of ChemR23/TIG2 binding can
then be screened using a binding assay or a functional assay that
measures downstream signaling through the receptor. Both binding
assays and functional assays are:validated using TIG2
polypeptide.
[0096] Another approach that uses the ChemR23/TIG2 interaction more
directly to identify agents that modulate ChemR23 function measures
changes in ChemR23 downstream signaling induced by candidate agents
or candidate modulators. These functional assays can be performed
in isolated cell membrane fractions or on cells expressing the
receptor on their surfaces.
[0097] The following description provides methods for both binding
and functional assays based upon the interaction of ChemR23 and
TIG2.
[0098] A. ChemR23 Polypeptides.
[0099] Assays using the interaction of ChemR23 and TIG2 require a
source of ChemR23 polypeptide. The polynucleotide and polypeptide
sequence of human ChemR23 are presented herein as SEQ ID NOs: 1 and
2. The human ChemR23 polynucleotide sequence is also available at
GenBank Accession No. Y14838, and was reported in Samson et al.,
1998, Eur. J. Immunol. 28: 1689-1700, incorporated herein by
reference. ChemR23 polypeptide sequence is also recorded at
accession Nos. O75748 and CAA75112 in the Swissprot database.
Related sequences include those for CMKRL1 (GenBank Accession Nos.
XM.sub.--006864 and NM004072 (nucleotide sequences) and Swissprot
Accession No. Q99788 (polypeptide sequence)), human DEZb (GenBank
Accession No. U79527 (nucleotide sequence)), human DEZa (GenBank
Accession No. U79526 (nucleotide sequence), mouse DEZ (GenBank
Accession No. U79525 (nucleotide sequence) and Swissprot Accession
No. P97468 (polypeptide sequence)), and rat ChemR23 (GenBank
Accession No. AJ002745 (nucleotide sequence) and Swissprot
Accession No. 035786 (polypeptide sequence).
[0100] One skilled in the art can readily amplify a ChemR23
sequence from a sample containing mRNA encoding the protein through
basic PCR and molecular cloning techniques using primers or probes
designed from the known sequences.
[0101] The expression of recombinant polypeptides is well known in
the art. Those skilled in the art can readily select vectors and
expression control sequences for the expression of ChemR23
polypeptides useful according to the invention in eukaryotic or
prokaryotic cells. ChemR23 must be associated with cell membrane or
detergents like synthetic liosomes in order to have binding or
signaling function. Methods for the preparation of cellular
membrane fractions are well known in the art, e.g., the method
reported by Hubbard & Cohn, 1975; J. Cell Biol. 64: 461-479,
which is incorporated herein by reference. In order to produce
membranes comprising ChemR23, one need only apply such techniques
to cells endogenously or recombinantly expressing ChemR23.
Alternatively, membrane-free ChemR23 can be integrated into
membrane preparations by dilution of detergent solution of the
polypeptide (see, e.g., Salamon et al., 1996, Biophys. J.
71:283-294, which is incorporated herein by reference).
[0102] B. TIG2 Polypeptides.
[0103] Human TIG2 polynucleotide and polypeptide sequences are
presented herein as SEQ ID Nos 7 and 8, respectively. TIG2
sequences are also available from GenBank (e.g., Human
polynucleotide sequences include Accession Nos. XM 004765, U77594,
NM 002889, human polypeptide sequence is available at Accession
Nos. Q99969, BAA76499, AAB47975, NP002880, and XP004765; Gallus
gallus polynucleotide sequences include Accession Nos. BG713704,
BG713660 and BG713614; mouse polynucleotide sequences include
BF020273, AW113641 and bf018000; rat polynucleotide sequences
include AW915104; Sus scrofa polynucleotide sequences include
BF078978 and BF713092 (overlapping ESTs, last 7 amino acids of TIG2
sequence in BF713092); and Bos taurus polynucleotide sequences
include BG691132). An alignment of TIG2 sequences is presented in
FIG. 9.
[0104] As with ChemR23, TIG2 polynucleotides can be cloned through
standard PCR and molecular cloning techniques using the known
sequences as a source of amplification primers or probes.
Similarly, cloned TIG2 polypeptides can be expressed in eukaryotic
or prokaryotic cells as known in the art. As a non-limiting
example, a mammalian TIG2 expression vector system can comprise a
bicistronic expression vector containing the promoter of human
EF1.alpha. (described by Mishizuma & Nagata, 1990, Nucl. Acids
Res. 18: 5322), a polylinker, the ECMV internal ribosome entry
site.(IRES, described by Ghattas et al., 1991, Mol. Cell. Biol. 11:
5848-5859) and the neomycin resistance gene followed by an SV40
polyA signal. A TIG2 expression construct for expression in yeast
is described in Example 4.
[0105] TIG2 can also be expressed in vitro through in vitro
transcription and translation. Further, if desired for a given
assay or technique, TIG2 polypeptides useful according to the
invention can be produced as fusion proteins or tagged proteins.
For example, either full length TIG2 or a portion thereof (i.e., at
least 10 amino acids, preferably at least 20 amino acids or more,
up to one amino acid less than full length TIG2) can be fused to
Glutathione-S-Transferase (GST), secreted alkaline phosphatasc
(SEAP), a FLAG tag, a Myc tag, or a 6.times.-His peptide to
facilitate the purification or detection of the TIG2 polypeptide.
Methods and vectors for the production of tagged or fusion proteins
are well known in the art, as are methods of isolating and
detecting such fused or tagged proteins.
[0106] Recombinant TIG2 polypeptides can be used in purified form.
Alternatively, conditioned medium from TIG2 transfected cells can
be used. The amounts of TIG2 necessary in a given binding or
functional assay according to the invention will vary depending
upon the assay, but will generally use 1 pM to 1 nM of labeled and
10 pM to 1 .mu.M of unlabeled TIG2 per assay. The affinities and
EC.sub.50s of tagged TIG2 polypeptides for ChemR23 may vary
relative to those of full length wild type TIG2 polypeptide, and
the amount necessary for a given assay can therefore be adjusted
relative to the wild-type values. If necessary for a given assay,
TIG2 can be labeled by incorporation of radiolabeled amino acids in
the medium during synthesis, e.g., .sup.35S-Met, .sup.14C-Leu, or
others as appropriate. Methods of chemical labeling with .sup.125I
are known in the art. Fluorescent labels can also be attached to
TIG2 polypeptides or to other ChemR23 ligands using standard
labeling techniques.
[0107] C. Assays to Identify Modulators of ChemR23 Activity
[0108] The discovery that TIG2 is a ligand of the ChemR23 receptor
permits screening assays to identify agonists, antagonists and
inverse agonists of receptor activity. The screening assays will
have two general approaches.
[0109] 1) Ligand binding assays, in which cells expressing ChemR23,
membrane extracts from such cells, or immobilized lipid membranes
comprising ChemR23 are exposed to a labeled TIG2 polypeptide and
candidate compound. Following incubation, the reaction mixture is
measured for specific binding of the labeled TIG2 polypeptide to
the ChemR23 receptor. Compounds that interfere with or displace
labeled TIG2 polypeptide can be agonists, antagonists or inverse
agonists of ChemR23 activity. Functional analysis can be performed
on positive compounds to determine which of these categories they
fit.
[0110] 2) Functional assays, in which a signaling activity of
ChemR23 is measured.
[0111] a) For agonist screening, cells expressing ChemR23 or
membranes prepared from them are incubated with candidate compound,
and a signaling activity of ChemR23 is measured. The assays are
validated using a TIG2 polypeptide as agonist, and the activity
induced by compounds that modulate receptor activity is compared to
that induced by TIG2. An agonist or partial agonist will have a
maximal biological activity corresponding to at least 10% of the
maximal activity of wild type human TIG2 when the agonist or
partial agonist is present at 10 .mu.M or less, and preferably will
have 50%, 75%, 100% or more, including 2-fold, 5-fold, 10-fold or
more activity than wild-type human TIG2.
[0112] b) For antagonist or inverse agonist screening, cells
expressing ChemR23 or membranes isolated from them are assayed for
signaling activity in the presence of a TIG2 polypeptide with or
without a candidate compound. Antagonists or inverse agonists will
reduce the level of TIG2-stimulated receptor activity by at least
10%, relative to reactions lacking the antagonist or inverse
agonist.
[0113] c) For inverse agonist screening, cells expressing
constitutive ChemR23 activity or membranes isolated from them are
used in a functional assay that measures an activity of the
receptor in the presence and absence of a candidate compound.
Inverse agonists are those compounds that reduce the constitutive
activity of the receptor by at least 10%. Overexpression of ChemR23
(i.e., expression of 5-fold or higher excess of ChemR23 polypeptide
relative to the level naturally expressed in macro phages in vivo)
may lead to constitutive activation. Chem R23 can be overexpressed
by placing it under the control of a strong constitutive promoter,
e.g., the CMV early promoter. Alternatively, certain mutations of
conserved GPCR amino acids or amino acid domains tend to lead to
constitutive activity. See for example: Kjelsberg et al., 1992, J.
Biol. Chem. 267:1430; McWhinney et al., 2000. J. Biol. Chem.
275:2087; Ren et al., 1993, J. Biol. Chem. 268:16483; Samama et
al., 1993, J. Biol. Chem 268:4625; Parma et al., 1993, Nature
365:649; Parma et al., 1998, J. Pharmacol. Exp. Ther. 286:85; and
Parent et al., 1996, J. Biol. Chem. 271:7949.
Ligand Binding and Displacement Assays
[0114] One can use ChemR23 polypeptides expressed on a cell, or
isolated membranes containing receptor polypeptides, along with a
TIG2 polypeptide in order to screen for compounds that inhibit the
binding of TIG2 to ChemR23. When identified in an assay that
measures binding or TIG2 polypeptide displacement alone, compounds
will have to be subjected to functional testing to determine
whether they act as agonists, antagonists or inverse agonists.
[0115] For displacement experiments, cells expressing a ChemR23
polypeptide (generally 25,000 cells per assay or 1 to 100 .mu.g of
membrane extracts) are incubated in binding buffer (e.g., 50 mM
Hepes pH 7.4; 1 mM CaCl.sub.2; 0.5% Bovine Serum Albumin (BSA)
Fatty Acid-Free; and 0 5 mM MgCl.sub.2) for 1.5 hrs (at, for
example, 27.degree. C.) with labeled TIG2 polypeptide in the
presence or absence of increasing concentrations of a candidate
modulator. To validate and calibrate the assay, control competition
reactions using increasing concentrations of unlabeled TIG2
polypeptide can be performed. After incubation, cells are washed
extensively, and bound, labeled TIG2 is measured as appropriate for
the given label (e.g., scintillation counting, enzyme assay,
fluorescence, etc.). A decrease of at least 10% in the amount of
labeled TIG2 polypeptide bound in the presence of candidate
modulator indicates displacement of binding by the candidate
modulator. Candidate modulators are considered to bind specifically
in this or other assays described herein if they displace 50% of
labeled TIG2 (sub-saturating TIG2 dose) at a concentration of 10
.mu.M or less (i.e., EC.sub.50 is 10 .mu.M or less).
[0116] Alternatively, binding or displacement of binding can be
monitored by surface plasmon resonance (SPR). Surface plasmon
resonance assays can be used as a quantitative method to measure
binding between two molecules by the change in mass near an
immobilized sensor caused by the binding or loss of binding of a
TIG2 polypeptide from the aqueous phase to a ChemR23 polypeptide
immobilized in a membrane on the sensor. This change in mass is
measured as resonance units versus time after injection or removal
of the TIG2 polypeptide or candidate modulator and is measured
using a Biacore Biosensor (Biacore AB). ChemR23 can be immobilized
on a sensor chip (for example, research grade CM5 chip; Biacore AB)
in a thin film lipid membrane according to methods described by
Salamon et al. (Salamon et al., 1996, Biophys J. 71: 283-294;
Salamon et al., 2001, Biophys. J. 80: 1557-1567; Salamon et al.,
1999, Trends Biochem. Sci. 24: 213-219, each of which is
incorporated herein by reference.). Sarrio et al. demonstrated that
SPR can be used to detect ligand binding to the GPCR A(1) adenosine
receptor immobilized in a lipid layer on the chip (Sarrio et al.,
2000, Mol. Cell. Biol. 20. 5164-5174, incorporated herein by
reference). Conditions for TIG2 binding to ChemR23 in an SPR assay
can be fine-tuned by one of skill in the art using the conditions
reported by Sarrio et al. as a starting point.
[0117] SPR can assay for modulators of binding in at least two
ways. First, a TIG2 polypeptide can be pre-bound to immobilized
ChemR23 polypeptide, followed by injection of candidate modulator
at approximately 10 .mu.l/min flow rate and a concentration ranging
from 1 nM to 100 .mu.M, preferably about 1 .mu.M. Displacement of
the bound TIG2 can be quantitated, permitting detection of
modulator binding. Alternatively, the membrane-bound ChemR23
polypeptide can be pre-incubated with candidate modulator and
challenged with a TIG2 polypeptide. A difference in TIG2 binding to
the ChemR23 exposed to modulator relative to that on a chip not
pre-exposed to modulator will demonstrate binding. In either assay,
a decrease of 10% or more in the amount of a TIG2 polypeptide bound
is in the presence of candidate modulator, relative to the amount
of a TIG2 polypeptide bound in the absence of candidate modulator
indicates that the candidate modulator inhibits the interaction of
ChemR23 and TIG2.
[0118] Another method of measuring inhibition of binding of a TIG2
polypeptide to ChemR23 uses fluorescence resonance energy transfer
(FRET). FRET is a quantum mechanical phenomenon that occurs between
a fluorescence donor (D) and a fluorescence acceptor (A) in close
proximity to each other (usually<100 A of separation) if the
emission spectrum of D overlaps with the excitation spectrum of A.
The molecules to be tested, e.g., a TIG2 polypeptide and a ChemR23
polypeptide, are labeled with a complementary pair of donor and
acceptor fluorophores. While bound closely together by the
ChemR23:TIG2 interaction, the fluorescence emitted upon excitation
of the donor fluorophore will have a different wavelength than that
emitted in response to that excitation wavelength when the
polypeptides are not bound, providing for quantitation of bound
versus unbound polypeptides by measurement of emission intensity at
each wavelength. Donor:Acceptor pairs of fluorophores with which to
label the polypeptides are well known in the art. Of particular
interest are variants of the A. Victoria GFP known as Cyan FP (CFP,
Donor(D)) and Yellow FP (YFP, Acceptor(A)). The GFP variants can be
made as fusion proteins with the respective members of the binding
pair to serve as D-A pairs in a FRET scheme to measure
protein-protein interaction. Vectors for the expression of GFP
variants as fusions are known in the art. As an example, a CFP-TIG2
fusion and a YFP-ChemR23 fusion can be made. The addition of a
candidate modulator to the mixture of labeled TIG2 and ChemR23
proteins will result in an inhibition of energy transfer evidenced
by, for example, a decrease in YFP fluorescence relative to a
sample without the candidate modulator. In an assay using FRET for
the detection of ChemR23:TIG2 interaction, a 10% or greater
decrease in the intensity of fluorescent emission at the acceptor
wavelength in samples containing a candidate modulator, relative to
samples without the candidate modulator, indicates that the
candidate modulator inhibits ChemR23:TIG2 interaction.
[0119] A variation on FRET uses fluorescence quenching to monitor
molecular interactions. One molecule in the interacting pair can be
labeled with a fluorophore, and the other with a molecule that
quenches the fluorescence of the fluorophore when brought into
close apposition with it. A change in fluorescence upon excitation
is indicative of a change in the association of the molecules
tagged with the fluorophore:quencher pair. Generally, an increase
in fluorescence of the labeled ChemR23 polypeptide is indicative
that the TIG2 polypeptide bearing the quencher has been displaced.
For quenching assays, a 10% or greater increase in the intensity of
fluorescent emission in samples containing a candidate modulator,
relative to samples without the candidate modulator, indicates that
the candidate modulator inhibits ChemR23:TIG2 interaction.
[0120] In addition to the surface plasmon resonance and FRET
methods, fluorescence polarization measurement is useful to
quantitate protein-protein binding. The fluorescence polarization
value for a fluorescently-tagged molecule depends on the rotational
correlation time or tumbling rate. Protein complexes, such as those
formed by ChemR23 associating with a fluorescently labeled TIG2
polypeptide, have higher polarization values than uncomplexed,
labeled TIG2. The inclusion of a candidate inhibitor of the
ChemR23:TIG2 interaction results in a decrease in fluorescence
polarization, relative to a mixture without the candidate
inhibitor, if the candidate inhibitor disrupts or inhibits the
interaction of ChemR23 with TIG2. Fluorescence polarization is well
suited for the identification of small molecules that disrupt the
formation of polypeptide or protein complexes. A decrease of 10% or
more in fluorescence polarization in samples containing a candidate
modulator, relative to fluorescence polarization in a sample
lacking the candidate modulator, indicates that the candidate
modulator inhibits ChemR23:TIG2 interaction.
[0121] Another alternative for monitoring ChemR23:TIG2 interactions
uses a biosensor assay. ICS biosensors have been described by AMBRI
(Australian Membrane Biotechnology Research Institute;
http//www.ambri.com.au/). In this technology, the association of
macromolecules such as ChemR23 and TIG2, is coupled to the closing
of gramacidin-facilitated ion channels in suspended membrane
bilayers and thus to a measurable change in the admittance (similar
to impedence) of the biosensor. This approach is linear over six
orders of magnitude of admittance change and is ideally suited for
large scale, high throughput screening of small molecule
combinatorial libraries. A 10% or greater change (increase or
decrease) in admittance in a sample containing a candidate
modulator, relative to the admittance of a sample lacking the
candidate modulator, indicates that the candidate modulator
inhibits the interaction of ChemR23 and TIG2.
[0122] It is important to note that in assays of protein-protein
interaction, it is possible that a modulator of the interaction
need not necessarily interact directly with the domain(s) of the
proteins that physically interact. It is also possible that a
modulator will interact at a location removed from the site of
protein-protein interaction and cause, for example, a
conformational change in the ChemR23 polypeptide. Modulators
(inhibitors or agonists) that act in this manner are nonetheless of
interest as agents to modulate the activity of ChemR23.
[0123] It should be understood that any of the binding assays
described herein can be performed with a non-TIG2 ligand (for
example, agonist, antagonist, etc.) of ChemR23, e.g., a small
molecule identified as described herein. In practice, the use of a
small molecule ligand or other non-TIG2 ligand has the benefit that
non-polypeptide chemical compounds are generally cheaper and easier
to produce in purified form than polypeptides such as TIG2. Thus, a
non-TIG2 ligand is better suited to high-throughput assays for the
identification of agonists, antagonists or inverse agonists than
full length TIG2. This advantage in no way erodes the importance of
assays using TIG2, however, as such assays are well suited for the
initial identification of non-TIG2 ligands.
[0124] Any of the binding assays described can be used to determine
the presence of an agent in a sample, e.g., a tissue sample, that
binds to the ChemR23 receptor molecule, or that affects the binding
of TIG2 to the receptor. To do so, ChemR23 polypeptide is reacted
With TIG2 polypeptide or another ligand in the presence or absence
of the sample, and TIG2 or ligand birding is measured as
appropriate for the binding assay being used. A decrease of 10% or
more in the binding of TIG2 or other ligand indicates that the
sample contains an agent that modulates TIG2 or ligand binding to
the receptor polypeptide.
Functional Assays of Receptor Activity
[0125] i. GTPase/GTP Binding Assays:
[0126] For GPCRs such as ChemR23, a measure of receptor activity is
the binding of GTP by cell membranes containing receptors. In the
method described by Traynor and Nahorski, 1995, Mol. Pharmacol. 47:
848-854, incorporated herein by reference, one essentially measures
G-protein coupling to membranes by measuring the binding of labeled
GTP. For GTP binding assays, membranes isolated from cells
expressing the receptor are incubated in a buffer containing 20 mM
HEPES, pH 7.4, 100 mM NaCl, and 10 mM MgCl2, 80 pM
.sup.35S-GTP.gamma.S and 3 .mu.M GDP. The assay mixture is
incubated for 60 minutes at 30.degree. C., after which unbound
labeled GTP is removed by filtration onto GF/B filters. Bound,
labeled GTP is measured by liquid scintillation counting. In order
to assay for modulation of TIG2-induced ChemR23 activity, membranes
prepared from cells expressing a ChemR23 polypeptide are mixed with
a TIG2 polypeptide, and the GTP binding assay is performed in the
presence and absence of a candidate modulator of ChemR23 activity.
A decrease of 10% or more in labeled GTP binding as measured by
scintillation counting in an assay of this kind containing
candidate modulator, relative to an assay without the modulator,
indicates that the candidate modulator inhibits ChemR23
activity.
[0127] A similar GTP-binding assay can be performed without TIG2 to
identify compounds that act as agonists. In this case,
TIG2-stimulated GTP binding is used as a standard. A compound is
considered an agonist if it induces at least 50% of the level of
GTP binding induced by full length wild-type TIG2 when the compound
is present at 1 .mu.M or less, and preferably will induce a level
the same as or higher than that induced by TIG2.
[0128] GTPase activity is measured by incubating the membranes
containing a ChemR23 polypeptide with .gamma..sup.32P-GTP. Active
GTPase will release the label as inorganic phosphate, which is
detected by separation of free inorganic phosphate in a 5%
suspension of activated charcoal in 20 mM H.sub.3PO.sub.4, followed
by scintillation counting. Controls include assays using membranes
isolated from cells not expressing ChemR23 (mock-transfected), in
order to exclude possible non-specific effects of the candidate
compound.
[0129] In order to assay for the effect of a candidate modulator on
ChemR23-regulated GTPase activity, membrane samples are incubated
with a TIG2 polypeptide, with and without the modulator, followed
by the GTPase assay. A change (increase or decrease) of 10% or more
in the level of GTP binding or GTPase activity relative to samples
without modulator is indicative of ChemR23 modulation by a
candidate modulator.
[0130] ii. Downstream Pathway Activation Assays:
[0131] a. Calcium flux--The Aequorin-based Assay.
[0132] The aequorin assay takes advantage of the responsiveness of
mitochondrial apoaequorin to intracellular calcium release induced
by the activation of GPCRs (Stables et al., 1997, Anal. Biochem.
252:115-126; Detheux et al., 2000, J. Exp. Med., 192 1501-1508;
both of which are incorporated herein by reference). Briefly,
ChemR23-expressing clones are transfected to coexpress
mitochondrial apoaequorin and G.alpha.16. Cells are incubated with
5 .mu.M Coelenterazine H (Molecular Probes) for 4 hours at room
temperature, washed in DMEM-F12 culture medium and resuspended at a
concentration of 0.5.times.10.sup.6 cells/ml. Cells are then mixed
with test agonist peptides and light emission by the aequorin is
recorded with a luminometer for 30 sec. Results are expressed as
Relative Light Units (RLU). Controls include assays using membranes
isolated from cells not expressing ChemR23 (mock-transfected), in
order to exclude possible non-specific effects of the candidate
compound.
[0133] Aequorin activity or intracellular calcium levels are
"changed" if light intensity increases or decreases by 10% or more
in a sample of cells, expressing a ChemR23 polypeptide and treated
with a candidate modulator, relative to a sample of cells
expressing the ChemR23 polypeptide but not treated with the
candidate modulator or relative to a sample of cells not expressing
the ChemR23 polypeptide (mock-transfected cells) but treated with
the candidate modulator.
[0134] When performed in the absence of a TIG2 polypeptide, the
assay can be used to identify an agonist of ChemR23 activity. When
the assay is performed in the presence of a TIG2 polypeptide, it
can be used to assay for all antagonist.
[0135] b. Adenylate Cyclase Assay:
[0136] Assays for adenylate cyclase activity are described by
Kenimer & Nirenberg, 1981, Mol. Pharmacol. 20: 585-591,
incorporated herein by reference. That assay is a modification of
the assay taught by Solomon et al., 1974, Anal. Biochem. 58:
541-548, also incorporated herein by reference. Briefly, 100 .mu.l
reactions contain 50 mM Tris-Hcl (pH 7.5), 5 mM MgCl.sub.2, 20 mM
creatine phosphate (disodium salt), 10 units (71 .mu.g of protein)
of creatine phosphokinase, 1 mM .alpha.-.sup.32P-ATP (tetrasodium
salt, 2 .mu.Ci), 0.5 mM cyclic AMP, G-.sup.3H-labeled cyclic AMP
(approximately 10,000 cpm), 0.5 mM Ro20-1724, 0.25% ethanol, and
50-200 .mu.g of protein homogenate to be tested (i.e., homogenate
from cells expressing or not expressing a ChemR23 polypeptide,
treated or not treated with a TIG2 polypeptide with or without a
candidate modualtor). Reaction mixtures are generally incubated at
37.degree. C. for 6 minutes. Following incubation, reaction
mixtures are deproteinized by the addition of 0.9 ml of cold 6%
trichloroacetic acid. Tubes are centrifuged at 1800.times.g for 20
minutes and each supernatant solution is added to a Dowex AG50W-X4
column. The cAMP fraction from the column is eluted with 4 ml of
0.1 mM imidazole-HCl (pH 7.5) into a counting vial. Assays should
be performed in triplicate. Control reactions should also be
performed using protein homogenate from cells that do not express a
ChemR23 polypeptide.
[0137] According to the invention, adenylate cyclase activity is
"changed" if it increases or decreases by 10% or more in a sample
taken from cells treated with a candidate modulator of ChemR23
activity, relative to a similar sample of cells not treated with
the candidate modulator or relative to a sample of cells not
expressing the ChemR23 polypeptide (mock-transfected cells) but
treated with the candidate modulator.
[0138] c. cAMP Assay:
[0139] Intracellular or extracellular cAMP is measured using a cAMP
radioininunoassay (RIA) or cAMP binding proteirt according to
methods widely known in the art. For example, Horton &
Baxendale, 1995, Methods Mol. Biol. 41: 91-105, which is
incorporated herein by reference, describes an RIA for cAMP.
[0140] A number of kits for the measurement of cAMP are
commercially available, such as the High Efficiency Fluorescence
Polarization-based homogeneous assay marketed by LJL Biosystems and
NEN Life Science Products. Control reactions should be performed
using extracts of mock-transfected cells to exclude possible
non-specific effects of some candidate modulators.
[0141] The level of cAMP is "changed" if the level of cAMP detected
in cells, expressing a ChemR23 polypeptide and treated with a
candidate modulator of ChemR23 activity (or in extracts of such
cells), using the RIA-based assay of Horton & Baxendale, 1995,
supra, increases or decreases by at least 10% relative to the cAMP
level in similar cells not treated with the candidate
modulator.
[0142] d. Phospholipid Breakdown, DAG Production and Inositol
Triphosphate Levels:
[0143] Receptors that activate the breakdown of phospholipids can
be monitored for changes due to the activity of known or suspected
modulators of ChemR23 by monitoring phospholipid breakdown, and the
resulting production of second messengers DAG and/or inositol
triphosphate (IP.sub.3). Methods of measuring each of these are
described in Phospholipid Signaling Protocols, edited by Ian M.
Bird. Totowa, N.J., Humana Press, 1998, which is incorporated
herein by reference. See also Rudolph et al., 1999, J. Biol. Chem.
274: 11824-11831, incorporated herein by reference, which also
describes an assay for phosphatidylinositol breakdown. Assays
should be performed using cells or extracts of cells expressing
ChemR23, treated or not treated with a TIG2 polypeptide with or
without a candidate modulator. Control reactions should be
performed using mock-transfected cells, or extracts from them in
order to exclude possible non-specific effects of some candidate
modulators.
[0144] According to the invention, phosphatidylinositol breakdown,
and diacylglycerol and/or inositol triphosphate levels are
"changed" if they increase or decrease by at least 10% in a sample
from cells expressing a ChemR23 polypeptide and treated with a
candidate modulator, relative to the level observed in a sample
from cells expressing a ChemR23 polypeptide that is not treated
with the candidate modulator.
[0145] e. PKC Activation Assays:
[0146] Growth factor receptor tyrosine kinases tend to signal via a
pathway involving activation of Protein Kinase C (PKC), which is a
family of phospholipid- and calcium-activated protein kinases. PKC
activation ultimately results in the transcription of an array of
proto-oncogene transcription factor-encoding genes, including
c-fos, c-myc and c-jun, proteases, protease inhibitors, including
collagenase type I and plasminogen activator inhibitor, and
adhesion molecules, including intracellular adhesion molecule I
(ICAM I). Assays designed to detect increases in gene products
induced by PKC can be used to monitor PKC activation and thereby
receptor activity. In addition, the activity of receptors that
signal via PKC can be monitored through the use of reporter gene
constructs driven by the control sequences of genes activated by
PKC activation. This type of reporter gene-based assay is discussed
in more detail below.
[0147] For a more direct measure of PKC activity, the method of
Kikkawa et al., 1982, J. Biol. Chem. 257: 13341, incorporated
herein by reference, can be used. This assay measures
phosphorylation of a PKC substrate peptide, which is subsequently
separated by binding to phosphocellulose paper. This PKC assay
system can be used to measure activity of purified kinase, or the
activity in crude cellular extracts. Protein kinase C sample can be
diluted in 20 nm HEPES/2 mM DTT immediately prior to assay.
[0148] The substrate for the assay is the peptide Ac-FKKSFKL-NH2,
derived from the myristoylated alanine-rich protein kinase C
substrate protein (MARCKS). The K.sub.m of the enzyme for this
peptide is approximately 50 .mu.M. Other basic, protein kinase
C-selective peptides known in the art can also be used, at a
concentration of at least 2-3 times their K.sub.m. Cofactors
required for the assay include calcium, magnesium, ATP,
phosphatidylserine and diacylglycerol. Depending upon the intent of
the user, the assay can be performed to determine the amount of PKC
present (activating conditions) or the amount of active PCK present
(non-activating conditions). For most purposes according to the
invention, non-activating conditions will be used, such that the
PKC that is active in the sample when it is isolated is measured,
rather than measuring the PKC that can be activated. For
non-activating conditions, calcium is omitted in the assay in favor
of EGTA.
[0149] The assay is performed in a mixture containing 20 mM HEPES,
pH 7.4, 1-2 mM DTT, 5 mM MgCl.sub.2, 100 .mu.M ATP, .about.1 .mu.Ci
.gamma.-.sup.32P-ATP, 100 .mu.g/ml peptide substrate (.about.100
.mu.M), 140 .mu.M /3.8 .mu.M phosphatidylserine/diacylglycerol
membranes, and 100 .mu.M calcium (or 500 .mu.M EGTA). 48 .mu.l of
sample, diluted in 20 mM HEPES, pH 7.4, 2 mM DTT is used in a final
reaction volume of 80 .mu.l. Reactions are performed at 30.degree.
C. for 5-10 minutes, followed by addition of 25 .mu.l of 100 mM
ATP, 100 mM EDTA, pH 8.0, which stops the reactions.
[0150] After the reaction is stopped, a portion (85 .mu.l) of each
reaction is spotted onto a Whatman P81 cellulose phosphate filter,
followed by washes: four times 500 ml in 0.4% phosphoric acid,
(5-10 min per wash); and a final wash in 500 ml 95% EtOH, for 2-5
min. Bound radioactivity is measured by scintillation counting.
Specific activity (cpm/nmol) of the labeled ATP is determined by
spotting a sample of the reaction onto P81 paper and counting
without washing. Units of PKC activity, defined as nmol phosphate
transferred per min, are calculated as follows: 1 The activity , in
UNITS ( nmol / min ) is : = ( cpm on paper ) .times. ( 105 l total
/ 85 l spotted ) ( assay time , min ) ( specific activity of ATP
cpm / nmol ) .
[0151] An alternative assay can be performed using a Protein Kinase
C Assay Kit sold by PanVera (Cat. #P2747).
[0152] Assays are performed on extracts from cells expressing a
ChemR23 polypeptide, treated or not treated with a TIG2 polypeptide
with or without a candidate modulator. Control reactions should be
performed using mock-transfected cells, or extracts from them in
order to exclude possible non-specific effects of some candidate
modulators.
[0153] According to the invention, PKC activity is "changed" by a
candidate modulator when the units of PKC measured by either assay
described above increase or decrease by at least 10%, in extracts
from cells expressing ChemR23 and treated with a candidate
modulator, relative to a reaction performed on a similar sample
from cells not treated with a candidate modulator.
[0154] f. Kinase Assays:
[0155] MAP kinase activity can be assayed using any of several kits
available commercially, for example, the p38 MAP Kinase assay kit
sold by New England Biolabs (Cat #9820) or the FlashPlate.TM. MAP
Kinase assays sold by Perkin-Elmer Life Sciences.
[0156] MAP Kinase activity is "changed" if the level of activity is
increased or decreased by 10% or more in a sample from cells,
expressing a ChemR23 polypeptide, treated with a candidate
modulator relative to MAP kinase activity in a sample from similar
cells not treated with the candidate modulator.
[0157] Direct assays for tyrosine kinase activity using known
synthetic or natural tyrosine kinase substrates and labeled
phosphate are well known, as are similar assays for other types of
kinases (e.g., Ser/Thr kinases). Kinase assays can be performed
with both purified kinases and crude extracts prepared from cells
expressing a ChemR23 polypeptide, treated with or without a TIG2
polypeptide, with or without a candidate modulator. Control
reactions should be performed using mock-transfected cells, or
extracts from them in order to exclude possible non-specific
effects of some candidate modulators. Substrates can be either full
length protein or synthetic peptides representing the substrate.
Pinna & Ruzzene (1996, Biochem. Biophys. Acta 1314: 191-225,
incorporated herein by reference) list a number of phosphorylation
substrate sites useful for measuring kinase activities. A number of
kinase substrate peptides are commercially available. One that is
particularly useful is the "Src-related peptide," RRLIEDAEYAARG
(SEQ ID NO: 11; available from Sigma #A7433), which is a substrate
for many receptor and nonreceptor tyrosine kinases. Because the
assay described below requires binding of peptide substrates to
filters, the peptide substrates should have a net positive charge
to facilitate binding. Generally, peptide substrates should have at
least 2 basic residues and a free amino terminus. Reactions
generally use a peptide concentration of 0.7-1.5 mM.
[0158] Assays are generally carried out in a 25 .mu.l volume
comprising 5 .mu.l of 5.times.kinase buffer (5 mg/ml, BSA, 150 mM
Tris-Cl (pH 7.5), 100 mM MgCl.sub.2; depending upon the exact
kinase assayed for, MnCl.sub.2 can be used in place of or in
addition to the MgCl.sub.2), 5 .mu.l of 1.0 mM ATP (0.2 mM final
concentration), .gamma.-32P-ATP (100-500 cpm/pmol), 3 .mu.l of 10
mM peptide substrate (1.2 mM final concentration), cell extract
containing kinase to be tested (cell extracts used for kinase
assays should contain a phosphatase inhibitor (e.g. 0.1-1 mM sodium
orthovanadate)), and H.sub.2O to 25 .mu.l. Reactions are performed
at 30.degree. C., and are initiated by the addition of the cell
extract.
[0159] Kinase reactions are performed for 30 seconds to about 30
minutes, followed by the addition of 45 .mu.l of ice-cold 10%
trichloroacetic acid (TCA). Samples are spun for 2 minutes in a
microcentrifuge, and 35 .mu.l of the supernatant is spotted onto
Whatman P81 cellulose phosphate filter circles. The filters are
washed three times with 500 ml cold 0.5% phosphoric acid, followed
by one wash with 200 ml of acetone at room temperature for 5
minutes. Filters are dried and incorporated 32P is measured by
scintillation counting. The specific activity of ATP in the kinase
reaction (e.g., in cpm/pmol) is determined by spotting a small
sample (2-5 .mu.l) of the reaction onto a P81 filter circle and
counting directly, without washing. Counts per minute obtained in
the kinase reaction (minus blank) are then divided by the specific
activity to determine the moles of phosphate transferred in the
reaction.
[0160] Tyrosine kinase activity is "changed" if the level of kinase
activity is increased or decreased by 10% or more in a sample from
cells, expressing a ChemR23 polypeptide, treated with a candidate
modulator relative to kinase activity in a sample from similar
cells not treated with the candidate modulator.
[0161] g. Transcriptional Reporters for Downstream Pathway
Activation:
[0162] The intracellular signal initiated by binding of an agonist
to a receptor, e.g., ChemR23, sets in motion a cascade of
intracellular events, the ultimate consequence of which is a rapid
and detectable change in the transcription or translation of one or
more genes. The activity of the receptor can therefore be monitored
by measuring the expression of a reporter gene driven by control
sequences responsive to ChemR23 activation.
[0163] As used herein "promoter" refers to the transcriptional
control elements necessary for receptor-mediated regulation of gene
expression, including not only the basal promoter, but also any
enhancers or transcription-factor binding sites necessary for
receptor-regulated expression. By selecting promoters that are
responsive to the intracellular signals resulting from agonist
binding, and operatively linking the selected promoters to reporter
genes whose transcription, translation or ultimate activity is
readily detectable and measurable, the transcription based reporter
assay provides a rapid indication of whether a given receptor is
activated.
[0164] Reporter genes such as luciferase, CAT, GFP,
.beta.-lactamase or .beta.-galactosidase are well known in the art,
as are assays for the detection of their products.
[0165] Genes particularly well suited for monitoring receptor
activity are the "immediate early" genes, which are rapidly
induced, generally within minutes of contact between the receptor
and the effector protein or ligand. The induction of immediate
early gene transcription does not require the synthesis of new
regulatory proteins. In addition to rapid responsiveness to ligand
binding, characteristics of preferred genes useful to make reporter
constructs include: low or undetectable expression in quiescent
cells; induction that is transient and independent of new protein
synthesis; subsequent shut-off of transcription requires new
protein synthesis; and mRNAs transcribed from these genes have a
short half-life. It is preferred, but not necessary that a
transcriptional control element have all of these properties for it
to be useful.
[0166] An example of a gene that is responsive to a number of
different stimuli is the c-fos proto-oncogene. The c-fos gene is
activated in a protein-synthesis-independent manner by growth
factors, hormones, differentiation-specific agents, stress, and
other known inducers of cell surface proteins. The induction of
c-fos expression is extremely rapid, often occurring within minutes
of receptor stimulation. This characteristic makes the c-fos
regulatory regions particularly attractive for use as a reporter of
receptor activation.
[0167] The c-fos regulatory elements include (see, Verma et al.,
1987, Cell 51: 513-514): a TATA box that is required for
transcription initiation; two upstream elements for basal
transcription, and an enhancer, which includes an element with dyad
symmetry and which is required for induction by TPA, serum, EGF,
and PMA.
[0168] The 20 bp c-fos transcriptional enhancer element located
between -317 and -298 bp upstream from the c-fos mRNA cap site, is
essential for serum induction in serum starved NIH 3T3 cells. One
of the two upstream elements is located at -63 to -57 and it
resembles the consensus sequence for cAMP regulation.
[0169] The transcription factor CREB (cyclic AMP responsive element
binding protein) is, as the name implies, responsive to levels of
intracellular cAMP. Therefore, the activation of a receptor that
signals via modulation of cAMP levels can be monitored by measuring
either the binding of the transcription factor, or the expression
of a reporter gene linked to a CREB-binding element (termed the
CRE, or cAMP response element). The DNA sequence of the CRE is
TGACGTCA (SEQ ID NO: 12). Reporter constructs responsive to CREB
binding activity are described in U.S. Pat. No. 5,919,649.
[0170] Other promoters and transcriptional control elements, in
addition to the c-fos elements and CREB-responsive constructs,
include the vasoactive intestinal peptide (VIP) gene promoter (cAMP
responsive; Fink et al., 1988, Proc. Natl. Acad. Sci.
85:6662-6666); the somatostatin gene promoter (cAMP responsive;
Montminy et al., 1986, Proc. Natl. Acad. Sci. 8.3:6682-6686); the
proenkephalin promoter (responsive to cAMP, nicotinic agonists, and
phorbol esters; Comb et al., 1986, Nature 323:353-356); the
phosphoenolpyruvate carboxy-kinase (PEPCK) gene promoter (cAMP
responsive; Short et al., 1986, J. Biol. Chem. 261:9721-9726).
[0171] Additional examples of transcriptional control elements that
are responsive to changes in GPCR activity include, but are not
limited to those responsive to the AP-1 transcription factor and
those responsive to NF-.kappa.B activity. The consensus AP-1
binding site is the palindrome TGA(C/G)TCA (Lee et al., 1987,
Nature 325: 368-372; Lee et al., 1987, Cell 49: 741-752). The AP-1
site is also responsible for mediating induction by tumor promoters
such as the phorbol ester 12-O-tetradecanoylphorbol-.beta.-acetate
(TPA), and are therefore sometimes also referred to as a TRE, for
TPA-response element. AP-1 activates numerous genes that are
involved in the early response of cells to growth stimuli. Examples
of AP-1-responsive genes include, but are not limited to the genes
for Fos and Jun (which proteins themselves make up AP-1 activity),
Fos-related antigens (Fra) 1 and 2, I.kappa.B.alpha., omithine
decarboxylase, and annexins I and II.
[0172] The NF-.kappa.B binding element has the consensus sequence
GGGGACTTTCC. A large number of genes have been identified as
NF-.kappa.B responsive, and their control elements can be linked to
a reporter gene to monitor GPCR activity. A small sample of the
genes responsive to NF-.kappa.B includes those encoding IL-1.beta.
(Hiscott et al., 1993, Mol. Cell. Biol. 13: 6231-6240), TNF-.alpha.
(Shakhov et al., 1990, J. Exp. Med. 171: 35-47), CCR5 (Liu et al.,
1998, AIDS Res. Hum. Retroviruses 14: 1509-1519), P-selectin (Pan
& McEver, 1995, J. Biol. Chem. 270: 23077-23083), Fas ligand
(Matsui et al., 1998, J. Immunol. 161: 3469-3473), GM-CSF (Schreck
& Baeuerle, 1990, Mol. Cell. Biol. 10: 1281-1286) and
I.kappa.B.alpha. (Haskill et al., 1991, Cell 65: 1281-1289). Each
of these references is incorporated herein by reference. Vectors
encoding NF-.kappa.B-responsive reporters are also known in the art
or can be readily made by one of skill in the art using, for
example, synthetic NF-.kappa.B elements and a minimal promoter, or
using the NF-.kappa.B-responsive sequences of a gene known to be
subject to NF-.kappa.B regulation. Further, NF-.kappa.B responsive
reporter constructs are commercially available from, for example,
CLONTECH.
[0173] A given promoter construct should be tested by exposing
ChemR23-expressing cells, transfected with the construct, to a TIG2
polypeptide. An increase of at least two-fold in the expression of
reporter in response to TIG2 polypeptide indicates that the
reporter is an indicator of ChemR23 activity.
[0174] In order to assay ChemR23 activity with a TIG2-responsive
transcriptional reporter construct, cells that stably express a
ChemR23 polypeptide are stably transfected with the reporter
construct. To screen for agonists, the cells are left untreated,
exposed to candidate modulators, or exposed to a a TIG2
polypeptide, and expression of the reporter is measured. The
TIG2-treated cultures serve as a standard for the level of
transcription induced by a known agonist. An increase of at least
50% in reporter expression in the presence of a candidate modulator
indicates that the candidate is a modulator of ChemR23 activity. An
agonist will induce at least as much, and preferably the same
amount or more, reporter expression than the TIG2 polypeptide. This
approach can also be used to screen for inverse agonists where
cells express a ChemR23 polypeptide at levels such that there is an
elevated basal activity of the reporter in the absence of TIG2 or
another agonist. A decrease in reporter activity of 10% or more in
the presence of a candidate modulator, relative to its absence,
indicates that the compound is an inverse agonist.
[0175] To screen for antagonists, the cells expressing ChemR23 and
carrying the reporter construct are exposed to a TIG2 polypeptide
(or another agonist) in the presence and absence of candidate
modulator. A decrease of 10% or more in reporter expression in the
presence of candidate modulator, relative to the absence of the
candidate modulator, indicates that the candidate is a modulator of
ChemR23 activity.
[0176] Controls for transcription assays include cells not
expressing ChemR23 but carrying the reporter construct, as well as
cells with a promoterless reporter construct. Compounds that are
identified as modulators of ChemR23-regulated transcription should
also be analyzed to determine whether they affect transcription
driven by other regulatory sequences and by other receptors, in
order to determine the specificity and spectrum of their
activity.
[0177] The transcriptional reporter assay, and most cell-based
assays, are well suited for screening expression libraries for
proteins for those that modulate ChemR23 activity. The libraries
can be, for example, cDNA libraries from natural sources, e.g.,
plants, animals, bacteria, etc., or they can be libraries
expressing randomly or systematically mutated variants of one or
more polypeptides. Genomic libraries in viral vectors can also be
used to express the mRNA content of one cell or tissue, in the
different libraries used for screening of ChemR23.
[0178] Any of the assays of receptor activity, including the
GTP-binding, GTPase, adenylate cyclase, cAMP,
phospholipid-breakdown, diacylglyceorl, inositol triphosphate, PKC,
kinase and transcriptional reporter assays, can be used to
determine the presence of an agent in a sample, e.g., a tissue
sample, that affects the activity of the ChemR23 receptor molecule.
To do so, ChemR23 polypeptide is assayed for activity in the
presence and absence of the sample or an extract of the sample. An
increase in ChemR23 activity in the presence of the sample or
extract relative to the absence of the sample indicates that the
sample contains an agonist of the receptor activity. A decrease in
receptor activity in the presence of TIG2 or another agonist and
the sample, relative to receptor activity in the presence of TIG2
polypeptide alone, indicates that the sample contains an antagonist
of ChemR23 activity. If desired, samples can then be fractionated
and further tested to isolate or purify the agonist or antagonist.
The amount of increase or decrease in measured activity necessary
for a sample to be said to contain a modulator depends upon the
type of assay used. Generally, a 10% or greater change (increase or
decrease) relative to an assay performed in the absence of a sample
indicates the presence of a modulator in the sample. One exception
is the transcriptional reporter assay, in which at least a two-fold
increase or 10% decrease in signal is necessary for a sample to be
said to contain a modulator. It is preferred that an agonist
stimulates at least 50%, and preferably 75% or 100% or more, e.g.,
2-fold, 5-fold, 10-fold or greater receptor activation than
wild-type TIG2.
[0179] Other functional assays include, for example,
microphysiometer or biosensor assays (see Hafner, 2000, Biosens.
Bioelectron. 15: 149-158, incorporated herein by reference).
[0180] II. Diagnostic Assays Based upon the Interaction of ChemR23
and TIG2:
[0181] Signaling through GPCRs is instrumental in the pathology of
a large number of diseases and disorders. ChemR23, which is
expressed in cells of the lymphocyte lineages and which has been
shown to act as a co-receptor for immunodeficiency viruses can have
a role in immune processes, disorders or diseases. The ChemR23
expression pattern also includes bone and cartilage, indicating
that this receptor can play a role in diseases, disorders or
processes (e.g., fracture healing) affecting these tissues.
Expression in adult parathyroid suggests possible importance in
phosphocalic metabolism.
[0182] Because of its expression in cells of the lymphocyte
lineages, ChemR23 can be involved in the body's response to viral
infections or in diseases induced by various viruses, including HIV
types I and II, or bacteria. The expression pattern of ChemR23 and
the knowledge with respect to disorders generally mediated by GPCRs
suggests that ChemR23 can be involved in disturbances of cell
migration, cancer, development of tumours and tumour metastasis,
inflammatory and neo-plastic processes, wound and bone healing and
dysfunction of regulatory growth functions, diabetes, obesity,
anorexia, bulimia, acute heart failure, hypotension, hypertension,
urinary retention, osteoporosis, angina pectoris, myocardial
infarction, restenosis, atherosclerosis, diseases characterised by
excessive smooth muscle cell proliferation, aneurysms, diseases
characterised by loss of smooth muscle cells or reduced smooth
muscle cell proliferation, stroke, ischemia, ulcers, allergies,
benign prostatic hypertrophy, migraine, vomiting, psychotic and
neurological disorders, including anxiety, schizophrenia, manic
depression, depression, delirium, dementia and severe mental
retardation, degenerative diseases, neurodegenerative diseases such
as Alzheimer's disease or Parkinson's disease, and dyskinasias,
such as Huntington's disease or Gilles de la Tourett's syndrome and
other related diseases.
[0183] The interaction of ChemR23 with TIG2 can be used as the
basis of assays for the diagnosis or monitoring of diseases,
disorders or processes involving ChemR23 signaling. Diagnostic
assays for ChemR23-related diseases or disorders can have several
different forms. First, diagnostic assays can measure the amount of
ChemR23 and/or TIG2 polypeptide, genes or mRNA in a sample of
tissue. Assays that measure the amount of mRNA encoding either or
both of these polypeptides also fit in this category. Second,
assays can evaluate the qualities of the receptor or the ligand.
For example, assays that determine whether an individual expresses
a mutant or variant form of either ChemR23 or TIG2, or both, can be
used diagnostically. Third, assays that measure one or more
activities of ChemR23 polypeptide can be used diagnostically.
[0184] A. Assays that measure the amount of ChemR23 or TIG2
[0185] ChemR23 and TIG2 levels can be measured and compared to
standards in order to determine whether an abnormal level of the
receptor or its ligand is present in a sample, either of which
indicate probable dysregulation of ChemR23 signaling. Polypeptide
levels are measured, for example, by immunohistochemistry using
antibodies specific for the polypeptide. A sample isolated from an
individual suspected of suffering from a disease or disorder
characterized by ChemR23 activity is contacted with an antibody for
ChemR23 or TIG2, and binding of the antibody is measured as known
in the art (e.g., by measurement of the activity of an enzyme
conjugated to a secondary antibody).
[0186] Another approach to the measurement of ChemR23 and/or TIG2
polypeptide levels uses flow cytometry analysis of cells from an
affected tissue. Methods of flow cytometry, including the
fluorescent labeling of antibodies specific for ChemR23 or TIG2,
are well known in the art. Other approaches include
radioimmunoassay or ELISA. Methods for each of these are also well
known in the art.
[0187] The amount of binding detected is compared to the binding in
a sample of similar tissue from a healthy individual, or from a
site on the affected individual that is not so affected. An
increase of 10% or more relative to the standard is diagnostic for
a disease or disorder characterized by ChemR23 dysregulation.
[0188] ChemR23 and TIG2 expression can also be measured by
determining the amount of mRNA encoding either or both of the
polypeptides in a sample of tissue. mRNA can be quantitated by
quantitative or semi-quantitative PCR. Methods of "quantitative"
amplification are well known to those of skill in the art, and
primer sequences for the amplification of both ChemR23 and TIG2 are
disclosed herein. A common method of quantitative PCR involves
simultaneously co-amplifying a known quantity of a control sequence
using the same primers. This provides an internal standard that can
be used to calibrate the PCR reaction. Detailed protocols for
quantitative PCR are provided in PCR Protocols, A Guide to Methods
and Applications, Innis et al., Academic Press, Inc. N.Y., (1990),
which is incorporated herein by reference. An increase of 10% or
more in the amount of mRNA encoding ChemR23 or TIG2 in a sample,
relative to the amount expressed in a sample of like tissue from a
healthy individual or in a sample of tissue from an unaffected
location in an affected individual is diagnostic for a disease or
disorder characterized by dysregulation of ChemR23 signaling.
[0189] B. Qualitative Assays
[0190] Assays that evaluate whether or not the ChemR23 polypeptide
or the mRNA encoding it are wild-type or not can be used
diagnostically. In order to diagnose a disease or disorder
characterized by ChemR23 or TIG2 dysregulation in this manner, RNA
isolated from a sample is used as a template for PCR amplification
of TIG2 and/or ChemR23. The amplified sequences are then either
directly sequenced using standard methods, or are first cloned into
a vector, followed by sequencing. A difference in the sequence that
changes one or more encoded amino acids relative to the sequence of
wild-type ChemR23 or TIG2 can be diagnostic of a disease or
disorder characterized by dysregulation of ChemR23 signaling. It
can be useful, when a change in coding sequence is identified in a
sample, to express the variant receptor or ligand and compare its
activity to that of wild type ChemR23 or TIG2. Among other
benefits, this approach can provide novel mutants, including
constitutively active and null mutants.
[0191] In addition to standard sequencing methods, amplified
sequences can be assayed for the presence of specific mutations
using, for example, hybridization of molecular beacons that
discriminate between wild-type and variant sequences. Hybridization
assays that discriminate on the basis of changes as small as one
nucleotide are well known in the art. Alternatively, any of a
number of "minisequencing" assays can be performed, including,
those described, for example, in U.S. Pat. Nos. 5,888,819,
6,004,744 and 6,013,431 (incorporated herein by reference). These
assays and others known in the art can determine the presence, in a
given sample, of a nucleic acid with a known polymorphism.
[0192] If desired, array or microarray-based methods can be used to
analyze the expression or the presence of mutation, in ChemR23 or
TIG2 sequences. Array-based methods for minisequencing and for
quantitation of nucleic acid expression are well known in the
art.
[0193] C. Functional Assays.
[0194] Diagnosis of a disease or disorder characterized by the
dysregulation of ChemR23 signaling can also be performed using
functional assays. To do so, cell membranes or cell extracts
prepared from a tissue sample are used in an assay of ChemR23
activity as described herein (e.g., ligand binding assays, the
GTP-binding assay, GTPase assay, adenylate cyclase assay, cAMP
assay, phospbolipid breakdown, diacyl glycerol or inositol
triphosphate assays, PKC activation assay, or kinase assay). The
activity detected is compared to that in a standard sample taken
from a healthy individual or from an unaffected site on the
affected individual. As an alternative, a sample or extract of a
sample can be applied to cells expressing ChemR23, followed by
measurement of ChemR23 signaling activity relative to a standard
sample. A difference of 10% or more in the activity measured in any
of these assays, relative to the activity of the standard, is
diagnostic for a disease or disorder characterized by dysregulation
of ChemR23 signaling.
Modulation of ChemR23 Activity in a Cell According to the
Invention
[0195] The discovery of TIG2 as a ligand of ChemR23 provides
methods of modulating the activity of a ChemR23 polypeptide in a
cell. ChemR23 activity is modulated in a cell by delivering to that
cell an agent that modulates the function of a ChemR23 polypeptide.
This modulation can be performed in cultured cells as part of an
assay for the identification of additional modulating agents, or,
for example, in an animal, including a human. Agents include TIG2
polypeptides as defined herein, as well as additional modulators
identified using the screening methods described herein.
[0196] An agent can be delivered to a cell by adding it to culture
medium. The amount to deliver will vary with the identity of the
agent and with the purpose for which it is delivered. For example,
in a culture assay to identify antagonists of ChemR23 activity, one
will preferably add an amount of TIG2 polypeptide that
half-maximally activates the receptors (e.g., approximately
EC.sub.50), preferably without exceeding the dose required for
receptor saturation. This dose can be determined by titrating the
amount of TIG2 polypeptide to determine the point at which further
addition of TIG2 has no additional effect on ChemR23 activity.
[0197] When a modulator of ChemR23 activity is administered to an
animal for the treatment of a disease or disorder, the amount
administered can be adjusted by one of skill in the art on the
oasis of the desired outcome. Successful treatment is achieved when
one or more measurable aspects of the pathology (e.g., tumor cell
growth, accumulation of inflammatory cells) is changed by at least
10% relative to the value for that aspect prior to treatment.
Candidate Modulators Useful According to the Invention
[0198] Candidate modulators can be screened from large libraries of
synthetic or natural compounds. Numerous means are currently used
for random and directed synthesis of saccharide, peptide, lipid,
carbohydrate, and nucleic acid based compounds. Synthetic compound
libraries are commercially available from a number of companies
including, for example, Maybridge Chemical Co. (Trevillet,
Cornwall, UK), Comgenex (Princeton, N.J.), Brandon Associates
(Merrimack, N.H.), and Microsource (New Milford, Conn.). A rare
chemical library is available from Aldrich (Milwaukee, Wis.).
Combinatorial libraries of small organic molecules are available
and can be prepared. Alternatively, libraries of natural compounds
in the form of bacterial, fungal, plant and animal extracts are
available from e.g., Pan Laboratories (Bothell, Wash.) or
MycoSearch (N.C.), or are readily produceable by methods well known
in the art. Additionally, natural and synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical, and biochemical means.
[0199] As noted previously herein, candidate modulators can also be
variants of known polypeptides (e.g., TIG2, antibodies) or nucleic
acids (e.g., aptamers) encoded in a nucleic acid library. Cells
(e.g., bacteria, yeast or higher eukaryotic cells) transformed with
the library can be grown and prepared as extracts, which are then
applied in ChemR23 binding assays or functional assays of ChemR23
activity.
Antibodies Useful According to the Invention
[0200] The invention provides for antibodies to ChemR23 and TIG2.
Antibodies can be made using standard protocols known in the art
(See, for example, Antibodies: A Laboratory Manual ed. by Harlow
and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a
mouse, hamster, or rabbit can be immunized with an immunogenic form
of the peptide (e.g., a ChemR23 or TIG2 polypeptide or an antigenic
fragment which is capable of eliciting an antibody response, or a
fusion protein as described herein above). Immunogens for raising
antibodies are prepared by mixing the polypeptides (e.g., isolated
recombinant polypeptides or synthetic peptides) with adjuvants.
Alternatively, ChemR23 or TIG2 polypeptides or peptides are made as
fusion proteins to larger immunogenic proteins. Polypeptides can
also be covalently linked to other larger immunogenic proteins,
such as keyhole limpet hemocyanin. Alternatively, plasmid or viral
vectors encoding ChemR23 or TIG2, or a fragment of these proteins,
can be used to express the polypeptides and generate an immune
response in an animal as described in Costagliola et al., 2000, J.
Clin. Invest. 105:803-811, which is incorporated herein by
reference. In order to raise antibodies, immunogens are typically
administered intradermally, subcutaneously, or intramuscularly to
experimental animals such as rabbits, sheep, and mice. In addition
to the antibodies discussed above, genetically engineered antibody
derivatives can be made, such as single chain antibodies.
[0201] The progress of immunization can be monitored by detection
of antibody titers in plasma or serum. Standard ELISA, flow
cytometry or other immunoassays can also be used with the immunogen
as antigen to assess the levels of antibodies. Antibody
preparations can be simply serum from an immunized animal, or if
desired, polyclonal antibodies can be isolated from the serum by,
for example, affinity chromatography using immobilized
immunogen.
[0202] To produce monoclonal antibodies, antibody-producing
splenocytes can be harvested from an immunized animal and fused by
standard somatic cell fusion procedures with immortalizing cells
such as myeloma cells to yield hybridoma cells. Such techniques are
well known in the art, and include, for example, the hybridoma
technique (originally developed by Kohler and Milstein, (1975)
Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar
et al., (1983) Immunology Today, 4: 72), and the EBV-hybridoma
technique to produce human monoclonal antibodies (Cole et al.,
(1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc.
pp. 77-96). Hybridoma cells can be screened immunochemically for
production of antibodies specifically reactive with a TIG2 or
ChemR23 peptide or polypeptide, and monoclonal antibodies isolated
from the media of a culture comprising such hybridoma cells.
Transgenic Animals Useful According to the Invention
[0203] Transgenic animals expressing ChemR23 or TIG2 or variants
thereo f are useful to study the signaling through ChemR23, as well
as for the study of drugs or agents that modulate the activity of
ChemR23. A transgenic animal is a non-human animal containing at
least one foreign gene, called a transgene, which is part of its
genetic material. Preferably, the transgene is contained in the
animal's germ line such that it can be transmitted to the animal's
offspring. A number of techniques may be used to introduce the
transgene into an animal's genetic material, including, but not
limited to, microinjection of the transgene into pronuclei of
fertilized eggs and manipulation of embryonic stem cells (U.S. Pat.
No. 4,873,191 by Wagner and Hoppe; Palmiter and Brinster, 1986,
Ann. Rev. Genet., 20:465-499; French Patent Application 2593827
published Aug. 7, 1987, all of which are incorporated herein by
reference). Transgenic animals can carry the transgene in all their
cells or can be genetically mosaic.
[0204] According to the method of conventional transgenesis,
additional copies of normal or modified genes are injected into the
male pronucleus of the zygote and become integrated into the
genomic DNA of the recipient mouse. The transgene is transmitted in
a Mendelian manner in established transgenic strains. Transgenes
can be constitutively expressed or can be tissue specific or even
responsive to an exogenous drug, e.g., Tetracycline. A transgenic
animal expressing one transgene can be crossed to a second
transgenic animal expressing a second transgene such that their
offspring will carry and express both transgenes.
Knock-Out Animals
[0205] Animals bearing a homozygous deletion in the chromosomal
sequences encoding either ChemR23 or TIG2 or variants can be used
to study the function of the receptor and ligand. Of particular
interest is whether a TIG2 knockout has a distinct phenotype, which
may point to whether TIG2 is the only ligand that binds ChemR23 or
if it is a member of a family. Of further particular interest is
the identification of identification of ChemR23/TIG2 in specific
physiological and/or pathological processes.
[0206] i. Standard Knock Out Animals
[0207] Knock out animals are produced by the method of creating
gene deletions with homoiologous recombination. This technique is
based on the development of embryonic stem (ES) cells that are
derived from embryos, are maintained in culture and have the
capacity to participate in the development of every tissue in the
animals when introduced into a host blastocyst. A knock out animal
is produced by directing homologous recombination to a specific
target gene in the ES cells, thereby producing a null allele of the
gene. The technology for making knock-out animals is well described
(see, for example, Huszar et al., 1997, Cell, 88:131; and
Ohki-Hamazaki et al., 1997, Nature, 390:165, both of which are
incorporated herein by reference). One of skill in the art can
generate a homozygous ChemR23 or TIG2 knock-out animal (e.g., a
mouse) using the sequences for ChemR23 and TIG2 (disclosed herein
and known in the art) to make the gene targeting construct.
[0208] ii. Tissue Specific Knock Out
[0209] The method of targeted homologous recombination has been
improved by the development of a system for site-specific
recombination based on the bacteriophage P1 site specific
recombinase Cre. The Cre-loxP site-specific DNA recombinase from
bacteriophage P1 is used in transgenic mouse assays in order to
create gene knockouts restricted to defined tissues or
developmental stages. Regionally restricted genetic deletion, as
opposed to global gene knockout, has the advantage that a phenotype
can be attributed to a particular cell/tissue (Marth, 1996, Clin.
Invest. 97: 1999). In the Cre-loxP system one transgenic mouse
strain is engineered such that loxP sites flank one or more exons
of the gene of interest. Homozygotes for this so called `floxed
gene` are crossed with a second transgenic mouse that expresses the
Cre gene tinder control of a cell/tissue type transcriptional
promoter. Cre protein then excises DNA between loxP recognition
sequences and effectively removes target gene function (Sauer,
1998, Methods, 14:381). There are now many in vivo examples of this
method, including, for instance, the inducible inactivation of
mammary tissue specific genes (Wagner et al., 1997, Nucleic Acids
Res., 25:4323). One of skill in the art can therefore generate a
tissue-specific knock-out animal in which ChemR23 or TIG2 is
homozygously eliminated in a chosen tissue or cell type.
Kits Useful According to the Invention
[0210] The invention provides for kits useful for screening for
modulators of ChemR23 activity, as well as kits useful for
diagnosis of diseases or disorders characterized by dysregulation
of ChemR23 signaling. Kits useful according to the invention can
include an isolated ChemR23 polypeptide (including a membrane-or
cell-associated ChemR23 polypeptide, e.g., on isolated membranes,
cells expressing ChemR23, or, on an SPR chip) and an isolated TIG2
polypeptide. A kit can also comprise an antibody specific for
ChemR23 and/or an antibody for TIG2. Alternatively, or in addition,
a kit can contain cells transformed to express a ChemR23
polypeptide and/or cells transformed to express a TIG2 polypeptide.
In a further embodiment, a kit according to the invention can
contain a polynucleotide encoding a ChemR23 polypeptide and/or a
polynucleotide encoding a TIG2 polypeptide. In a still further
embodiment, a kit according to the invention may comprise the
specific primers useful for amplification of ChemR23 or TIG2 as
described below. All kits according to the invention will comprise
the stated items or combinations of items and packaging materials
therefor. Kits will also include instructions for use.
EXAMPLES
[0211] In the following examples, all chemicals are obtained from
Sigma, unless stated. The cell culture media are from Gibco BRL and
the peptides are from Bachem.
Example 1
Cloning of Human ChemR23 Receptor
[0212] Human ChemR23 was cloned as described in Samson et al.
(1998) (SEQ ID Nos 1 and 2). As an example of one set of steps one
could use to clone other ChemR23 polypeptides useful according to
the invention, the method is described here. In order to clone the
ChemR23 sequence, a classical cloning procedure was performed on
human genomic DNA. A clone, designated HOP 102, was amplified from
human genomic DNA by using degenerate oligonucleotides. HOP 102
shared 45-50% identity with fMLP and C5a receptors and somewhat
lower similarities with the family of chemokine receptors. This
partial clone was used as a probe to screen a human genomic library
and three overlapping lambda clones were isolated. A restriction
map of the clones was established and a 1.7 kb XbaI fragment was
subcloned in pBS SK+ (Stratagene) and sequenced on both strands.
The sequence was found to include the HOP 102 probe entirely, with
100% identity. This novel gene was named ChemR23 (GenBank Accession
No. Y14838).
[0213] Amplification of coding sequence of ChemR23 resulted in a
fragment of 1.1 kb. This fragment was subcloned into the pCDNA3
(Invitrogen) vector and sequenced on both strands.
Example 2
Purification of the Natural Ligand of ChemR23 and Identification of
TIG2
[0214] Approximately one liter of a human ascitic fluid from a
patient with ovarian cancer was prefiltered and then filtered
successively through 0.45 and 0.22 .mu.m Millex filters
(Millipore).
[0215] In step 1, the ascite was directly loaded onto a C18
reverse-phase column (10 mm.times.100 mm POROS 20 R2 beads, Applied
Biosystems) pre-equilibrated with 5% CH.sub.3CN/0.1% TFA at a
flow-rate of 20 ml/min at room temperature. A 5-95% gradient of
CH.sub.3CN in 0.1% TFA was then applied with a slope of 6%/min.
5-milliliter fractions were collected, and 20 .mu.l of each
fraction was set aside and assayed for [Ca.sup.2+] transients in
ChemR23-expressing CHO cells.
[0216] In step 2, the active fractions (approx. 10 fractions
eluting between 25 and 40% CH.sub.3CN) were pooled, adjusted at pH
5, filtered through a 20 .mu.m Millex filter (Millipore), diluted
3-fold in acetate buffer at pH 4.8 and then applied to a
cation-exchange HPLC column (Polycat 9.6 mm.times.250 mm, Vydac)
pre-equilibrated with acetate buffer at pH 4.8 and 4.degree. C. A
0-1M gradient of NaCl in acetate buffer at pH 4.8 was applied with
10%/min at a flow-rate of 4 ml/min. 1-milliliter fractions were
collected and a 25 .mu.l-aliquot from each fraction was used for
the [Ca.sup.2+] assay after desalting on a 10 kDa-cut-off membrane
(Ultrafree, Millipore).
[0217] In step 3, the active fractions (eluted with approx. 700 mM
NaCl) were pooled and desalted onto a 10 kDa-cut-off Ultrafree
membrane to approx. 10 mM NaCl concentration. The eluates from
distinct cation-exchange HPLC runs were pooled and loaded onto a
second cation-exchange HPLC column (Polycat 2.1 mm.times.250 mm,
Vydac) pre-equilibrated with acetate buffer at pH 4.8 and 4.degree.
C. A 0-1 M gradient of NaCl in acetate buffer at pH 4.8 was applied
at a flow-rate of 1 ml/min. with a slope of 2%/min. 0.5-milliliter
fractions were collected and a 20 .mu.l-aliquot from each fraction
was used for intracellular calcium assay after desalting onto a 10
kDa-cut-off Ultrafree membrane.
[0218] In step 4, the active fractions were pooled, diluted 8-fold
with H.sub.2O/0.1% H.sub.3PO.sub.4 and loaded onto an analytical
C18 reverse-phase column (4.6 mm.times.250 mm, Vydac)
pre-equilibrated with 5% CH.sub.3CN/0.1% H.sub.3PO.sub.4 at a
flow-rate of 1 ml/min at room temperature. A 5-95% gradient of
CH.sub.3CN in 0.1% H.sub.3PO.sub.4 was applied with a 0.3%/min.
gradient between 25 and 40% of CH.sub.3CN. Individual UV absorption
peaks (214 nm) were collected manually, and approx. 5% from each
fraction volume was assayed for biological activity.
[0219] In step 5, the active peaks (approximately 28% CH.sub.3CN)
were diluted 6-fold with H.sub.2O/0.1% TFA and directly loaded onto
a second C18 reverse-phase column (1 mm.times.50 mm, Vydac)
pre-equilibrated with 5% CH.sub.3CN/0.1% TFA at a flow-rate of 0.1
ml/min. at room temperature. A 5-95% gradient of CH.sub.3CN in 0.1%
TFA was applied with a 0.3%/min. gradient between 30 and 45% of
CH.sub.3CN. The final peak was collected manually at 40% CH.sub.3CN
and analysed by mass spectrometry. 800 ml of ovarian cancer ascites
fluid yielded 50 fmoles of TIG2.
[0220] The active fraction was completely dried in a speed-vac and
resuspended in 10 .mu.l of 0.1M Tris at pH 8.7. After boiling the
sample during 15 min at 95.degree. C., the sample was incubated at
37.degree. C. overnight in the presence of 250 ng of modified
trypsin (Promega). The digested sample was then purified by
solid-phase extraction onto a C18 ZipTip (Millipore). The eluted
sample (1.5 .mu.l in 70% CH.sub.3CN/0.1% TFA) was applied onto a
MALDI target in the presence of 120 mg/ml dihydroxy-benzoic acid
matrix and then analysed on a MALDI-Q-TOF prototype (Micromass).
Direct monoisotopic mass fingerprinting allowed to identify 7
tryptic peptides, i.e. 63 amino acids with a sequence recovery of
38.7%.
[0221] Table 1: Sequences of Peptides Found in Monoisotopic Mass
Fingerprinting
[0222] The two peptides indicated with an asterisk were
microsequenced by MS/MS fragmentation. The position of the peptides
is defined in comparison with TIG2 amino acid sequence (Seq ID No
5)
1 Residues # Sequence M + H 72-78 [Seq Id. No. 13] 835.41 (K)
LQQTSCR (K) 81-88 [Seq. Id. No. 14] 1033.51 (R) DWKKPECK (V) 29-39*
[Seq. Id. No. 15] 1270.68 (R) GLQVALEEFHK (H) 98-109 [Seq. Id. No.
16] 1279.64 (K) CLACIKLGSEDK (V) 114-125* [Seq. Id No. 17] 1407.78
(R) LVHCPIETQVLR (E) 28-39 [Seq. Id. No. 18] 1426.78 (R)
RGLQVALEEFHK (H) 126-137 [Seq. Id. No. 19] 1472.64 (R) EAEEHQETQCLR
(V)
Example 3
Cloning and Recombinant Expression of Human TIG2
[0223] In order to clone the TIG2 sequence (FIG. 6, GenBank
Accession No. Q99969) a polymerase chain reaction (PCR) was
performed on kidney cDNA (Clontech Laboratories). Primers were
synthesized based upon the human TIG2 sequence and were as
follows:
2 hTig2 fw: 5' CAGGAATTCAGCATGCGACGGCTG SEQ ID NO:20 CTGA 3' hTig2
rv: 5' GCTCTAGATTAGCTGCGGGGCAGG SEQ ID NO:21 GCCTT 3'
[0224] Amplification was performed with Qiagen Taq polymerase in
the conditions described by the supplier and with the following
cycles: 3 min at 94.degree. C., 35 cycles of 1 min at 94.degree.
C., 90 sec 58.degree. C. and 90 sec at 72.degree. C., followed by a
final incubation of 10 min at 72.degree. C. The amplification
resulted in a fragment of 500 bp containing the entire coding
sequence of the Tig2 gene. This fragment was subcloned into the
vector pCDNA3 (Invitrogen) for DNA sequencing analysis. Maxiprep
(Quiagen) DNA was used in transient transfections of HEK293 cells
expressing large T antigen (293T) and COS-7 cells using Fugene6 in
10 cm plates. In parallel, transfections were performed in the same
cell lines with the expression vector alone (Mock transfected). 24
h after transfection, the medium was replaced by 9 ml DMEM-F12, 1%
BSA, and 3 ml of supernatant were collected each 24 h for three
days (48, 72 and 96 h post transfection). CHO cells were
transfected with the same plasmid and transfected cells were
selected with G418. The activity of the conditioned medium was
verified on ChemR23 expressing cells using the aequorin assay.
Example 4
Recombinant Expression of TIG2 in Yeasts
[0225] The coding sequences of human and mouse TIG2 are amplified
by PCR using the following primers (Two different primers are used
for amplification of 5' end of human TIG2 to take into account the
different predictions of the signal peptide of this protein):
3 mTig2f: 5' TCTCTCGAGAAAAGAGAGGCTGAAGC SEQ ID NO:22
TACACGTGGGACAGAGCCCGAA 3' hTig2af: 5' TCTCTCGAGAAAAGAGAGGCTGAAGC
SEQ ID NO:23 TGGCGTCGCCGAGCTCACGGAA 3' hTig2bf: 5'
TCTCTCGAGAAAAGAGAGGCTGAAGC SEQ ID NO:24 TGTGGGCGTCGCCGAGCTCACG 3'
mTig2r: 5' AGGGAATTCTTATTTGGTTCTCAGGG SEQ ID NO:25 CCCT 3' hTig2r:
5' AGGGAATTCTTAGCTGCGGGGCAGGG SEQ ID NO:26 CCTT 3'
[0226] The amplified TIG2 sequences are cloned, sequenced and
inserted in pPIC9K, a multicopy Pichia expression plasmid
(InVitrogen) containing the signals directing secretion of
expressed proteins. Following transformation, Pichia pastoris cells
are selected using G418 antibiotic. After selection, 20 clones are
analyzed for their expression and the clone with the highest
expression is amplified for large scale expression in shaker
flasks. The medium is collected, centrifuged and used for partial
purification with a protocol derived from the one used for TIG2
initial purification (see above).
Example 5
Recombinant Expression of Chimaeric TIG2 Fused with Secreted
Alkaline Phosphatase (SEAP)
[0227] The coding sequences of mouse and human TIG2 are amplified
by PCR, cloned and sequenced. PCR and sequencing primers are as
follows:
4 (SEQ ID NO:27) mTig2f: CAGGAATTCGCCATGAAGTGCTTGCTGA (SEQ ID
NO:28) hTig2f: CAGGAATTCAGCATGCGACGGCTGCTGA (SEQ ID NO:29) mTig2r:
GCTCTAGATTTGGTTCTCAGGGCC- CTGGA (SEQ ID NO:30) hTig2r:
GCTCTAGAGCTGCGGGGCAGGGCCTTGGA
[0228] The cloned TIG2 sequences are then subcloned into the
mammalian bicistronic expression vector, pEFIN, to obtain a fusion
protein with TIG2 linked at its carboxy terminal end to secreted
alkaline phosphatase, tagged with six histidine residues (His6).
Mammalian cells, including COS-7, HEK-293 expressing the large T
antigen (293 T) and CHO-K1 cells, are transfected with this plasmid
using Fugene 6.TM. and incubated for 3-4 days in complete Ham's F12
medium (Nutrient Mixture Ham's F12 (Life Technologies) containing
10% fetal bovine serum; 100 IU/ml penicillin, 100 .mu.g/ml
streptomycin and 2.5 .mu.g/ml fungizone (Amphotericin B). The
supernatant containing TIG2-SEAP-His6 is collected after
centrifugation, filtered (0.45 .mu.m) and stored at 4.degree. C.
after adding 20 mM Hepes (pH 7.4) and 0.02% sodium azide.
[0229] For one-step affinity purification of the TIG2 fusion
protein, the supeniatant is applied to 1 ml of Hisbond resin
(Qiagen). After washing, bound TIG2-SEAP-His6 is eluted with a
gradient of imidazol. The concentration of isolated TIG2-SEAP-His6
is determined by a sandwich type enzyme-linked immunosorbent assay.
Briefly microtiter plates are coated with anti-placental alkaline
phosphatase antibody. After blocking with 1 mg/ml bovine serum
albumin (BSA) in phosphate buffered saline, the samples are
titrated and incubated for 1 h at room temperature. After washing,
plates are incubated with biotinylated rabbit anti-placental
alkaline phosphatase diluted 1:500 for 1 h at room temperature,
washed again, and incubated with peroxidasc-conjugated streptavidin
for 30 min. After washing, bound peroxidase is reacted with
3,3',5,5'-tetramethylbenz- idine. The reaction is stopped by adding
1 N H.sub.2SO.sub.4, and absorbance at 450 nm is measured. Alkaline
phosphatase activity is determined by a chemiluminescent assay
using the Great Escape.TM. detection kit (Clontech). Purified
placental alkaline phophatase is used to generate a standard curve.
The enzymatic activity is expressed as relative light
units/sec.
Example 6
Functional Assay for ChemR23
[0230] ChemR23 expressing clones have been obtained by transfection
of CHO-K1 cells to coexpressing mitochondrial apoaequorin and
G.alpha.16, limiting dilution and selection by northern blotting.
Positive clones were used for screening with human ovarian cancer
ascites extracts prepared as described above. A functional assay
based on the luminescence of mitochondrial aequorin intracellular
Ca.sup.2+ release (Stables et al., 1997, Anal. Biochem.
252:115-126; incorporated herein by reference) was performed as
described (Detheux et al., 2000, J. Exp. Med., 192 1501-1508;
incorporated herein by reference). Briefly, cells were collected
from plates in PBS containing 5 mM EDTA, pelleted and resuspended
at 5.times.10.sup.6 cells/ml in DMEM-F12 medium. Cells were
incubated with 5 .mu.M Coelenterazine H (Molecular Probes) for 4
hours at room temperature. Cells were then washed in DMEM-F12
medium and resuspended at a concentration of 0.5.times.10.sup.6
cells/ml. Cells were then mixed with test agonist peptides or
plates containing tissue extracts and the light emission was
recorded for 30 sec using a Microlumat luminometer (Perkin Elmer).
Results are expressed as Relative Light Units (RLU).
Example 7
Activation of Cells Expressing ChemR23 by Recombinant TIG2
[0231] The conditioned medium of COS-7, CHO-K1 and 293 T cells
transfected with pCDNA3 encoding TIG2 or pCDNA3 alone, was
collected and used for aequorin assays on CHO cells expressing
ChemR23. Results are shown in FIG. 12. Increasing amounts of
conditioned supernatant resulted in an increase in luminescence in
aequorin system cells expressing ChemR23.
Example 8
Production of Antibodies Specific for ChemR23
[0232] Antibodies directed against ChemR23 were produced by
repeated injections of plasmids encoding ChemR23 into mice. Sera
were collected starting after the second injection and the titre
and specificity of the antibodies was assessed by flow
cytofluorometry with CHO-K1 cells transfected with the ChemR23 cDNA
and CHO-K1 cells transfected with the cDNA of unrelated GPCR cDNA.
Several sera were positive and were used for immunohistochemistry
and other related applications, including flow cytometry analysis
of human primary cells.
[0233] Monoclonal antibodies were obtained from immune mice by
standard hybridoma technology using the NSO murine myeloma cell
line as immortal partner. Supernatants were tested for anti ChemR23
antibody activity using the test used for assessing the antisera.
Cells from the positive wells were expanded and frozen and the
supernatants collected.
[0234] FIG. 13 shows the results of experiments to characterize the
antibodies raised against ChemR23. A mixture of recombinant cells
made up of 2/3 recombinant ChemR23 CHO cells and 1/3
mock-transfected CHO cells (negative control) was reacted with
either a supernatant of cells expressing the anti ChemR235C 1H2
monoclonal antibody (thick line) or a supernatant from cells with
no known antibody activity (thin line, grey filling). After
staining with FITC labeled anti mouse Ig these preparations were
analyzed by flow cytofluorometry. Results are displayed as a
histogram of the number of cells (Events axis) expressing a given
fluorescence (FL1-H axis). Monoclonal 5C 1H2 allowed the
discrimination of the ChemR23 recombinant sub-population of cells
from the negative control cells, as evidenced by the relative
proportions of both types of cells. The background fluorescence of
the assay is given by the second staining (grey filling).
Example 9
Binding Displacement Assay
[0235] For displacement experiments, ChemR23-CHO-K1 cells (25,000
cells/tube) are incubated for 90 min. at 27.degree. C. with 1 nM of
SEAP-HIS6 or TIG2-SEAP-HIS6 in the presence of increasing
concentrations of unlabeled TIG2 in 250 .mu.l of binding buffer (50
mM Hepes pH 7.4; 1 mM Ca Cl.sub.2; 0.5% Bovine Serum Albumin (BSA)
Fatty Acid-Free; 5 mM MgCl.sub.2). For saturation experiments,
ChemR23-CHO-K1 cells (25,000 cells/tube) are incubated for 90 min
at 27.degree. C. with increasing concentrations of TIG2-SEAP-HIS6
in the presence or absence of 1 .mu.M unlabeled TIG2. After
incubation, cells are washed 5 times and lysed in 50 .mu.l of 10 mM
Tris-HCl (pH 8.0), 1% triton X100. Samples are heated at 65.degree.
C. for 10 min to inactivate cellular phosphatases. Lysates are
collected by centrifugation, and alkaline phosphatase activity in
25 .mu.l of lysate is determined by the chemiluminescence assay
described above.
Sequence CWU 1
1
38 1 1112 DNA Homo sapiens 1 atggaggatg aagattacaa cacttccatc
agttacggtg atgaataccc tgattattta 60 gactccattg tggttttgga
ggacttatcc cccttggaag ccagggtgac caggatcttc 120 ctggtggtgg
tctacagcat cgtctgcttc ctcgggattc tgggcaatgg tctggtgatc 180
atcattgcca ccttcaagat gaagaagaca gtgaacatgg tctggttcct caacctggca
240 gtggcagatt tcctgttcaa cgtcttcctc ccaatccata tcacctatgc
cgccatggac 300 taccactggg ttttcgggac agccatgtgc aagatcagca
acttccttct catccacaac 360 atgttcacca gcgtcttcct gctgaccatc
atcagctctg accgctgcat ctctgtgctc 420 ctccctgtct ggtcccagaa
ccaccgcagc gttcgcctgg cttacatggc ctgcatggtc 480 atctgggtcc
tggctttctt cttgagttcc ccatctctcg tcttccggga cacagccaac 540
ctgcatggga aaatatcctg cttcaacaac ttcagcctgt ccacacctgg gtcttcctcg
600 tggcccactc actcccaaat ggaccctgtg gggtatagcc ggcacatggt
ggtgactgtc 660 acccgcttcc tctgtggctt cctggtccca gtcctcatca
tcacagcttg ctacctcacc 720 atcgtctgca aactgcagcg caaccgcctg
gccaagacca agaagccctt caagattatt 780 gtgaccatca tcattacctt
cttcctctgc tggtgcccct accacacact caacctccta 840 gagctccacc
acactgccat gcctggctct gtcttcagcc tgggtttgcc cctggccact 900
gcccttgcca ttgccaacag ctgcatgaac cccattctgt atgttttcat ggtcaggact
960 tcaagaagtt caaggtggcc ctcttctctc gcctggtcaa tgctctaagt
gaagatacag 1020 gccactcttc ctaccccagc catagaagct ttaccaagat
gtcaatgaat gagaggactt 1080 ctatgaatga gagggagacc ggcatgcttt ga 1112
2 371 PRT Homo sapiens 2 Met Glu Asp Glu Asp Tyr Asn Thr Ser Ile
Ser Tyr Gly Asp Glu Tyr 1 5 10 15 Pro Asp Tyr Leu Asp Ser Ile Val
Val Leu Glu Asp Leu Ser Pro Leu 20 25 30 Glu Ala Arg Val Thr Arg
Ile Phe Leu Val Val Val Tyr Ser Ile Val 35 40 45 Cys Phe Leu Gly
Ile Leu Gly Asn Gly Leu Val Ile Ile Ile Ala Thr 50 55 60 Phe Lys
Met Lys Lys Thr Val Asn Met Val Trp Phe Leu Asn Leu Ala 65 70 75 80
Val Ala Asp Phe Leu Phe Asn Val Phe Leu Pro Ile His Ile Thr Tyr 85
90 95 Ala Ala Met Asp Tyr His Trp Val Phe Gly Thr Ala Met Cys Lys
Ile 100 105 110 Ser Asn Phe Leu Leu Ile His Asn Met Phe Thr Ser Val
Phe Leu Leu 115 120 125 Thr Ile Ile Ser Ser Asp Arg Cys Ile Ser Val
Leu Leu Pro Val Trp 130 135 140 Ser Gln Asn His Arg Ser Val Arg Leu
Ala Tyr Met Ala Cys Met Val 145 150 155 160 Ile Trp Val Leu Ala Phe
Phe Leu Ser Ser Pro Ser Leu Val Phe Arg 165 170 175 Asp Thr Ala Asn
Leu His Gly Lys Ile Ser Cys Phe Asn Asn Phe Ser 180 185 190 Leu Ser
Thr Pro Gly Ser Ser Ser Trp Pro Thr His Ser Gln Met Asp 195 200 205
Pro Val Gly Tyr Ser Arg His Met Val Val Thr Val Thr Arg Phe Leu 210
215 220 Cys Gly Phe Leu Val Pro Val Leu Ile Ile Thr Ala Cys Tyr Leu
Thr 225 230 235 240 Ile Val Cys Lys Leu Gln Arg Asn Arg Leu Ala Lys
Thr Lys Lys Pro 245 250 255 Phe Lys Ile Ile Val Thr Ile Ile Ile Thr
Phe Phe Leu Cys Trp Cys 260 265 270 Pro Tyr His Thr Leu Asn Leu Leu
Glu Leu His His Thr Ala Met Pro 275 280 285 Gly Ser Val Phe Ser Leu
Gly Leu Pro Leu Ala Thr Ala Leu Ala Ile 290 295 300 Ala Asn Ser Cys
Met Asn Pro Ile Leu Tyr Val Phe Met Gly Gln Asp 305 310 315 320 Phe
Lys Lys Phe Lys Val Ala Leu Phe Ser Arg Leu Val Asn Ala Leu 325 330
335 Ser Glu Asp Thr Gly His Ser Ser Tyr Pro Ser His Arg Ser Phe Thr
340 345 350 Lys Met Ser Ser Met Asn Glu Arg Thr Ser Met Asn Glu Arg
Glu Thr 355 360 365 Gly Met Leu 370 3 1116 DNA Mus musculus 3
atggagtacg acgcttacaa cgactccggc atctatgatg atgagtactc tgatggcttt
60 ggctactttg tggacttgga ggaggcgagt ccgtgggagg ccaaggtggc
cccggtcttc 120 ctggtggtga tctacagctt ggtgtgcttc ctcggtctcc
taggcaacgg cctggtgatt 180 gtcatcgcca ccttcaagat gaagaagacc
gtgaacactg tgtggtttgt caacctggct 240 gtggccgact tcctgttcaa
catctttttg ccgatgcaca tcacctacgc ggccatggac 300 taccactggg
tgttcgggaa ggccatgtgc aagatcagca acttcttgct cagccacaac 360
atgtacacca gcgtcttcct gctgactgtc atcagctttg accgctgcat ctccgtgctg
420 ctccccgtct ggtcccagaa ccaccgcagc atcgcgctgg cctacatgac
ctgctcggcc 480 gtctgggtcc tggctttctt cttgagctcc ccgtcccttg
tcttccggga caccgccaac 540 attcatggga agataacctg cttcaacaac
ttcagcttgg ccgcgcctga gtcctcccca 600 catcccgccc actcgcaagt
agtttccaca gggtacagca gacacgtggc ggtcactgtc 660 acccgcttcc
tttgcggctt cctgatcccc gtcttcatca tcacggcctg ctaccttacc 720
atcgtcttca agctgcagcg caaccgcctg gccaagaaca agaagccctt caagatcatc
780 atcaccatca tcatcacctt cttcctctgc tggtgcccct accacaccct
ctacctgctg 840 gagctccacc acacagctgt gccaagctct gtcttcagcc
tggggctacc cctggccacg 900 gccgtcgcca tcgccaacag ctgcatgaac
cccattctgt acgtcttcat gggccacgac 960 ttcagaaaat tcaaggtggc
cctcttctcc cgcctggcca acgccctgag tgaggacaca 1020 ggcccctcct
cctaccccag tcacaggagc ttcaccaaga tgtcgtcttt gaatgagaag 1080
gcttcggtga atgagaagga gaccagtacc ctctga 1116 4 371 PRT Mus musculus
4 Met Glu Tyr Asp Ala Tyr Asn Asp Ser Gly Ile Tyr Asp Asp Glu Tyr 1
5 10 15 Ser Asp Gly Phe Gly Tyr Phe Val Asp Leu Glu Glu Ala Ser Pro
Trp 20 25 30 Glu Ala Lys Val Ala Pro Val Phe Leu Val Val Ile Tyr
Ser Leu Val 35 40 45 Cys Phe Leu Gly Leu Leu Gly Asn Gly Leu Val
Ile Val Ile Ala Thr 50 55 60 Phe Lys Met Lys Lys Thr Val Asn Thr
Val Trp Phe Val Asn Leu Ala 65 70 75 80 Val Ala Asp Phe Leu Phe Asn
Ile Phe Leu Pro Met His Ile Thr Tyr 85 90 95 Ala Ala Met Asp Tyr
His Trp Val Phe Gly Lys Ala Met Cys Lys Ile 100 105 110 Ser Asn Phe
Leu Leu Ser His Asn Met Tyr Thr Ser Val Phe Leu Leu 115 120 125 Thr
Val Ile Ser Phe Asp Arg Cys Ile Ser Val Leu Leu Pro Val Trp 130 135
140 Ser Gln Asn His Arg Ser Ile Arg Leu Ala Tyr Met Thr Cys Ser Ala
145 150 155 160 Val Trp Val Leu Ala Phe Phe Leu Ser Ser Pro Ser Leu
Val Phe Arg 165 170 175 Asp Thr Ala Asn Ile His Gly Lys Ile Thr Cys
Phe Asn Asn Phe Ser 180 185 190 Leu Ala Ala Pro Glu Ser Ser Pro His
Pro Ala His Ser Gln Val Val 195 200 205 Ser Thr Gly Tyr Ser Arg His
Val Ala Val Thr Val Thr Arg Phe Leu 210 215 220 Cys Gly Phe Leu Ile
Pro Val Phe Ile Ile Thr Ala Cys Tyr Leu Thr 225 230 235 240 Ile Val
Phe Lys Leu Gln Arg Asn Arg Leu Ala Lys Asn Lys Lys Pro 245 250 255
Phe Lys Ile Ile Ile Thr Ile Ile Ile Thr Phe Phe Leu Cys Trp Cys 260
265 270 Pro Tyr His Thr Leu Tyr Leu Leu Glu Leu His His Thr Ala Val
Pro 275 280 285 Ser Ser Val Phe Ser Leu Gly Leu Pro Leu Ala Thr Ala
Val Ala Ile 290 295 300 Ala Asn Ser Cys Met Asn Pro Ile Leu Tyr Val
Phe Met Gly His Asp 305 310 315 320 Phe Arg Lys Phe Lys Val Ala Leu
Phe Ser Arg Leu Ala Asn Ala Leu 325 330 335 Ser Glu Asp Thr Gly Pro
Ser Ser Tyr Pro Ser His Arg Ser Phe Thr 340 345 350 Lys Met Ser Ser
Leu Asn Glu Lys Ala Ser Val Asn Glu Lys Glu Thr 355 360 365 Ser Thr
Leu 370 5 1116 DNA Rattus norvegicus 5 atggagtacg agggttacaa
cgactccagc atctacggtg aggagtattc tgacggctcg 60 gactacatcg
tggacttgga ggaggcgggt ccactggagg ccaaggtggc cgaggtcttc 120
ctggtggtaa tctacagctt ggtgtgcttc ctcgggatcc taggcaatgg cctggtgatt
180 gtcatcgcca ccttcaagat gaagaagacg gtgaacaccg tgtggtttgt
caacctggcc 240 gtggctgact tcctgttcaa catcttcttg cccatccaca
tcacctatgc cgctatggac 300 taccactggg tgttcgggaa agccatgtgc
aagattagta gctttctgct aagccacaac 360 atgtacacca gcgtcttcct
gctcactgtc atcagcttcg accgctgcat ctccgtgctc 420 ctccccgtct
ggtcccagaa ccaccgcagc gtgcgtctgg cctacatgac ctgcgtggtt 480
gtctgggtct ggctttcttc tgagtctccc ccgtccctcg tcttcggaca cgtcagcacc
540 agccacggga agataacctg cttcaacaac ttcagcctgg cggcgcccga
gcctttctct 600 cattccaccc acccgcgaac agacccggta gggtacagca
gacatgtggc ggtcaccgtc 660 acccgcttcc tctgtggctt cctgatcccc
gtcttcatca tcacggcctg ttacctcacc 720 atcgtcttca agttgcagcg
caaccgccag gccaagacca agaagccctt caagatcatc 780 atcaccatca
tcatcacctt cttcctctgc tggtgcccct accacacact ctacctgctg 840
gagctccacc acacggctgt gccagcctct gtcttcagcc tgggactgcc cctggccaca
900 gccgtcgcca tcgccaacag ctgtatgaac cccatcctgt acgtcttcat
gggccacgac 960 ttcaaaaaat tcaaggtggc ccttttctcc cgcctggtga
atgccctgag cgaggacaca 1020 ggaccctcct cctaccccag tcacaggagc
ttcaccaaga tgtcctcatt gattgagaag 1080 gcttcagtga atgagaaaga
gaccagcacc ctctga 1116 6 371 PRT Rattus norvegicus 6 Met Glu Tyr
Glu Gly Tyr Asn Asp Ser Ser Ile Tyr Gly Glu Glu Tyr 1 5 10 15 Ser
Asp Gly Ser Asp Tyr Ile Val Asp Leu Glu Glu Ala Gly Pro Leu 20 25
30 Glu Ala Lys Val Ala Glu Val Phe Leu Val Val Ile Tyr Ser Leu Val
35 40 45 Cys Phe Leu Gly Ile Leu Gly Asn Gly Leu Val Ile Val Ile
Ala Thr 50 55 60 Phe Lys Met Lys Lys Thr Val Asn Thr Val Trp Phe
Val Asn Leu Ala 65 70 75 80 Val Ala Asp Phe Leu Phe Asn Ile Phe Leu
Pro Ile His Ile Thr Tyr 85 90 95 Ala Ala Met Asp Tyr His Trp Val
Phe Gly Lys Ala Met Cys Lys Ile 100 105 110 Ser Ser Phe Leu Leu Ser
His Asn Met Tyr Thr Ser Val Phe Leu Leu 115 120 125 Thr Val Ile Ser
Phe Asp Arg Cys Ile Ser Val Leu Leu Pro Val Trp 130 135 140 Ser Gln
Asn His Arg Ser Val Arg Leu Ala Tyr Met Thr Cys Val Val 145 150 155
160 Val Trp Val Trp Leu Ser Ser Glu Ser Pro Pro Ser Leu Val Phe Gly
165 170 175 His Val Ser Thr Ser His Gly Lys Ile Thr Cys Phe Asn Asn
Phe Ser 180 185 190 Leu Ala Ala Pro Glu Pro Phe Ser His Ser Thr His
Pro Arg Thr Asp 195 200 205 Pro Val Gly Tyr Ser Arg His Val Ala Val
Thr Val Thr Arg Phe Leu 210 215 220 Cys Gly Phe Leu Ile Pro Val Phe
Ile Ile Thr Ala Cys Tyr Leu Thr 225 230 235 240 Ile Val Phe Lys Leu
Gln Arg Asn Arg Gln Ala Lys Thr Lys Lys Pro 245 250 255 Phe Lys Ile
Ile Ile Thr Ile Ile Ile Thr Phe Phe Leu Cys Trp Cys 260 265 270 Pro
Tyr His Thr Leu Tyr Leu Leu Glu Leu His His Thr Ala Val Pro 275 280
285 Ala Ser Val Phe Ser Leu Gly Leu Pro Leu Ala Thr Ala Val Ala Ile
290 295 300 Ala Asn Ser Cys Met Asn Pro Ile Leu Tyr Val Phe Met Gly
His Asp 305 310 315 320 Phe Lys Lys Phe Lys Val Ala Leu Phe Ser Arg
Leu Val Asn Ala Leu 325 330 335 Ser Glu Asp Thr Gly Pro Ser Ser Tyr
Pro Ser His Arg Ser Phe Thr 340 345 350 Lys Met Ser Ser Leu Ile Glu
Lys Ala Ser Val Asn Glu Lys Glu Thr 355 360 365 Ser Thr Leu 370 7
492 DNA Homo sapiens 7 atgcgacggc tgctgatccc tctggccctg tggctgggtg
cggtgggcgt gggcgtcgcc 60 gagctcacgg aagcccagcg ccggggcctg
caggtggccc tggaggaatt tcacaagcac 120 ccgcccgtgc agtgggcctt
ccaggagacc agtgtggaga gcgccgtgga cacgcccttc 180 ccagctggaa
tatttgtgag gctggaattt aagctgcagc agacaagctg ccggaagagg 240
gactggaaga aacccgagtg caaagtcagg cccaatggga ggaaacggaa atgcctggcc
300 tgcatcaaac tgggctctga ggacaaagtt ctgggccggt tggtccactg
ccccatagag 360 acccaagttc tgcgggaggc tgaggagcac caggagaccc
agtgcctcag ggtgcagcgg 420 gctggtgagg acccccacag cttctacttc
cctggacagt tcgccttctc caaggccctg 480 ccccgcagct aa 492 8 163 PRT
Homo sapiens 8 Met Arg Arg Leu Leu Ile Pro Leu Ala Leu Trp Leu Gly
Ala Val Gly 1 5 10 15 Val Gly Val Ala Glu Leu Thr Glu Ala Gln Arg
Arg Gly Leu Gln Val 20 25 30 Ala Leu Glu Glu Phe His Lys His Pro
Pro Val Gln Trp Ala Phe Gln 35 40 45 Glu Thr Ser Val Glu Ser Ala
Val Asp Thr Pro Phe Pro Ala Gly Ile 50 55 60 Phe Val Arg Leu Glu
Phe Lys Leu Gln Gln Thr Ser Cys Arg Lys Arg 65 70 75 80 Asp Trp Lys
Lys Pro Glu Cys Lys Val Arg Pro Asn Gly Arg Lys Arg 85 90 95 Lys
Cys Leu Ala Cys Ile Lys Leu Gly Ser Glu Asp Lys Val Leu Gly 100 105
110 Arg Leu Val His Cys Pro Ile Glu Thr Gln Val Leu Arg Glu Ala Glu
115 120 125 Glu His Gln Glu Thr Gln Cys Leu Arg Val Gln Arg Ala Gly
Glu Asp 130 135 140 Pro His Ser Phe Tyr Phe Pro Gly Gln Phe Ala Phe
Ser Lys Ala Leu 145 150 155 160 Pro Arg Ser 9 489 DNA Mus musculus
9 atgaagtgct tgctgatctc cctagcccta tggctgggca cagtgggcac acgtgggaca
60 gagcccgaac tcagcgagac ccagcgcagg agcctacagg tggctctgga
ggagttccac 120 aaacacccac ctgtgcagtt ggccttccaa gagatcggtg
tggacagagc tgaagaagtg 180 ctcttctcag ctggcacctt tgtgaggttg
gaatttaagc tccagcagac caactgcccc 240 aagaaggact ggaaaaagcc
ggagtgcaca atcaaaccaa acgggagaag gcggaaatgc 300 ctggcctgca
ttaaaatgga ccccaagggt aaaattctag gccggatagt ccactgccca 360
attctgaagc aagggcctca ggatcctcag gagttgcaat gcattaagat agcacaggct
420 ggcgaagacc cccacggcta cttcctacct ggacagtttg ccttctccag
ggccctgaga 480 accaaataa 489 10 162 PRT Mus musculus 10 Met Lys Cys
Leu Leu Ile Ser Leu Ala Leu Trp Leu Gly Thr Val Gly 1 5 10 15 Thr
Arg Gly Thr Glu Pro Glu Leu Ser Glu Thr Gln Arg Arg Ser Leu 20 25
30 Gln Val Ala Leu Glu Glu Phe His Lys His Pro Pro Val Gln Leu Ala
35 40 45 Phe Gln Glu Ile Gly Val Asp Arg Ala Glu Glu Val Leu Phe
Ser Ala 50 55 60 Gly Thr Phe Val Arg Leu Glu Phe Lys Leu Gln Gln
Thr Asn Cys Pro 65 70 75 80 Lys Lys Asp Trp Lys Lys Pro Glu Cys Thr
Ile Lys Pro Asn Gly Arg 85 90 95 Arg Arg Lys Cys Leu Ala Cys Ile
Lys Met Asp Pro Lys Gly Lys Ile 100 105 110 Leu Gly Arg Ile Val His
Cys Pro Ile Leu Lys Gln Gly Pro Gln Asp 115 120 125 Pro Gln Glu Leu
Gln Cys Ile Lys Ile Ala Gln Ala Gly Glu Asp Pro 130 135 140 His Gly
Tyr Phe Leu Pro Gly Gln Phe Ala Phe Ser Arg Ala Leu Arg 145 150 155
160 Thr Lys 11 13 PRT Artificial Sequence Src-related peptide
kinase substrate 11 Arg Arg Leu Ile Glu Asp Ala Glu Tyr Ala Ala Arg
Gly 1 5 10 12 8 DNA Artificial Sequence CREB binding site 12
tgacgtca 8 13 9 PRT Homo sapiens 13 Lys Leu Gln Gln Thr Ser Cys Arg
Lys 1 5 14 10 PRT Homo sapiens 14 Arg Asp Trp Lys Lys Pro Glu Cys
Lys Lys 1 5 10 15 13 PRT Homo sapiens 15 Arg Gly Leu Gln Val Ala
Leu Glu Glu Phe His Lys His 1 5 10 16 14 PRT Homo sapiens 16 Lys
Cys Leu Ala Cys Ile Lys Leu Gly Ser Glu Asp Lys Val 1 5 10 17 14
PRT Homo sapiens 17 Arg Leu Val His Cys Pro Ile Glu Thr Gln Leu Val
Arg Glu 1 5 10 18 14 PRT Homo sapiens 18 Arg Arg Gly Leu Gln Val
Ala Leu Glu Glu Phe His Lys His 1 5 10 19 14 PRT Homo sapiens 19
Arg Glu Ala Glu Glu His Gln Glu Thr Gln Cys Leu Arg Val 1 5 10 20
28 DNA Homo sapiens 20 caggaattca gcatgcgacg gctgctga 28 21 29 DNA
Homo sapiens 21 gctctagatt agctgcgggg cagggcctt 29 22 48 DNA Mus
musculus 22 tctctcgaga aaagagaggc tgaagctaca cgtgggacag agcccgaa 48
23 48 DNA Homo sapiens 23 tctctcgaga aaagagaggc tgaagctggc
gtcgccgagc tcacggaa 48 24 48 DNA Homo sapiens 24 tctctcgaga
aaagagaggc tgaagctgtg ggcgtcgccg agctcacg 48 25 30 DNA Mus musculus
25 agggaattct tatttggttc tcagggccct 30 26 30 DNA Homo sapiens 26
agggaattct tagctgcggg gcagggcctt 30 27 28 DNA Mus musculus 27
caggaattcg ccatgaagtg cttgctga
28 28 28 DNA Homo sapiens 28 caggaattca gcatgcgacg gctgctga 28 29
29 DNA Mus musculus 29 gctctagatt tggttctcag ggccctgga 29 30 29 DNA
Homo sapiens 30 gctctagagc tgcggggcag ggccttgga 29 31 18 PRT Homo
sapiens 31 His Ser Phe Tyr Phe Pro Gly Gln Phe Ala Phe Ser Lys Ala
Leu Pro 1 5 10 15 Arg Ser 32 15 PRT Rattus norvegicus 32 Arg Ile
Tyr Phe Phe Pro Gly Gln Phe Ala Phe Ser Arg Ala Leu 1 5 10 15 33 18
PRT Mus musculus 33 His Gly Tyr Phe Leu Pro Gly Gln Phe Ala Phe Ser
Arg Ala Leu Arg 1 5 10 15 Thr Lys 34 18 PRT Sus scrofa 34 His Ser
Tyr Tyr Phe Pro Gly Gln Phe Ala Phe Phe Lys Ala Leu Pro 1 5 10 15
Pro Ser 35 15 PRT Bos taurus 35 His Ser Tyr Tyr Leu Pro Gly Gln Phe
Ala Phe Ile Lys Ala Leu 1 5 10 15 36 16 PRT Gallus gallus 36 Asp
Val Leu Tyr Leu Pro Gly Met Phe Ala Phe Ser Lys Gly Leu Pro 1 5 10
15 37 7 PRT Artificial Sequence Substrate peptide for Protein
Kinase C 37 Phe Lys Lys Ser Phe Lys Leu 1 5 38 11 DNA Artificial
Sequence Consensus NF-kappa B binding site 38 ggggactttc c 11
* * * * *