U.S. patent application number 10/195071 was filed with the patent office on 2003-05-22 for full-length serine protein kinase in brain and pancreas.
Invention is credited to Fan, Wufang, Jay, Gilbert, Kovacs, Karl F., Shu, Youmin, Zidanic, Michael.
Application Number | 20030096271 10/195071 |
Document ID | / |
Family ID | 25459029 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096271 |
Kind Code |
A1 |
Shu, Youmin ; et
al. |
May 22, 2003 |
Full-length serine protein kinase in brain and pancreas
Abstract
The present invention relates to all facets of novel
polynucleotides, the polypeptides they encode, antibodies and
specific binding partners thereto, and their applications to
research, diagnosis, drug discovery, therapy, clinical medicine,
forensic science, pathology, and medicine, etc. The polynucleotides
are expressed in brain and pancreas and are therefore useful in
variety of ways, including, but not limited to, as molecular
markers, as drug targets, and for detecting, diagnosing, staging,
monitoring, prognosticating, preventing or treating, determining
predisposition to, etc., diseases and conditions, especially
relating to brain and pancreas.
Inventors: |
Shu, Youmin; (Potomac,
MD) ; Fan, Wufang; (Germantown, MD) ; Kovacs,
Karl F.; (Rockville, MD) ; Zidanic, Michael;
(Derwood, MD) ; Jay, Gilbert; (North Bethesda,
MD) |
Correspondence
Address: |
ORIGENE TECHNOLOGIES, INCORPORATED
6 TAFT COURT
SUITE 100
ROCKVILLE
MD
20850
US
|
Family ID: |
25459029 |
Appl. No.: |
10/195071 |
Filed: |
July 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10195071 |
Jul 15, 2002 |
|
|
|
09930181 |
Aug 16, 2001 |
|
|
|
6455292 |
|
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/194; 435/320.1; 435/325; 435/69.1; 435/7.21; 514/1;
536/23.2 |
Current CPC
Class: |
G01N 2333/9121 20130101;
G01N 33/573 20130101; C12N 9/1205 20130101 |
Class at
Publication: |
435/6 ; 435/7.21;
514/1; 435/69.1; 435/194; 435/320.1; 435/325; 536/23.2 |
International
Class: |
A61K 031/00; C12Q
001/68; G01N 033/567; C07H 021/04; C12N 009/12; C12P 021/02; C12N
005/06 |
Claims
1. An isolated polynucleotide KSE336 which codes without
interruption for an amino acid sequence set forth in SEQ ID NO 2 or
SEQ ID NO 4, or a complement thereto.
2. An isolated polynucleotide KSE336 which has 99% or more sequence
identity to a polynucleotide set forth in SEQ ID NO. 1 or 3, or a
complement thereto.
3. An isolated polynucleotide of claim 1, which is SEQ ID NO 1.
4. An isolated polynucleotide of claim 3, which is SEQ ID NO 3.
5. An isolated polynucleotide of claim 1, which has SEQ ID NO 1 or
SEQ IS NO 3, except for a polymorphism of Table 1.
6. An isolated polynucleotide consisting of: a polynucleotide
fragment coding for an amino acid sequence of SEQ ID NO. 6, a
fragment thereof which is specific for KSE336-1, or a complement
thereto.
7. An isolated polypeptide coded for by a polynucleotide of claim
1.
8. A method of treating a disease of brain or pancreas showing
altered expression of KSE336, comprising: administering to a
subject in need thereof a therapeutic agent which is effective for
regulating expression of said KSE336 of claim 1.
9. A method of claim 8, wherein said agent is an antibody or an
antisense which is effective to inhibit translation of said
gene.
10. A method of diagnosing a brain or pancreas disease associated
with abnormal KSE336, or susceptibility to said disease,
comprising: assessing the expression of KSE336 of claim 1 in a
tissue sample comprising pancreas cells, brain cells, or cells
derived from pancreas or brain.
11. A method of claim 10, wherein assessing is: measuring
expression levels of said gene, determining the genomic structure
of said gene, determining the mRNA structure of transcripts from
said gene, or measuring the expression levels of polypeptide coded
for by said gene.
12. A method of claim 1 1, further comprising: comparing said
expression to the expression of said gene of a known normal
tissue.
13. A method of claim 10, wherein said assessing is performed by:
Northern blot analysis, polymerase chain reaction (PCR), reverse
transcriptase PCR, RACE PCR, or in situ hybridization, and using a
polynucleotide probe having a sequence selected from SEQ ID NO 1 or
a complement thereto.
14. A method of claim 10, wherein said disease is astrocytoma,
meningioma, pancreatic adenocarcinoma, insulin-dependent diabetes
mellitus, Beckwith-Wiedemann syndrome, or congenital
hyperinsulinism
15. A method of assessing a therapeutic or preventative
intervention in a subject having a brain or pancreas disease,
comprising, determining the expression levels of KSE336 of claim 1
in a tissue sample comprising brain and pancreas cells, or cells
derived from brain and pancreas.
16. A method for identifying an agent that modulates the expression
of KSE336 in brain or pancreas cells, cells derived from brain and
pancreas, or brain and pancreas progenitor cells, comprising,
contacting a cell population with a test agent under conditions
effective for said test agent to modulate the expression of KSE336
of claim 1 in brain cells, pancreas cells, cells derived from brain
or pancreas cells, or brain or pancreas progenitor cells, and
determining whether said test agent modulates said KSE336.
17. A method of claim 16, wherein said agent is an antisense
polynucleotide to a target polynucleotide sequence selected from
SEQ ID NO 1 which is effective to inhibit translation of said
KSE336.
18. A method of detecting polymorphisms in KSE336 comprising:
comparing the structure of: genomic DNA comprising all or part of
KSE336, mRNA comprising all or part of KSE336, cDNA comprising all
or part of KSE336, or a polypeptide comprising all or part of
KSE336, with the structure of KSE336 of claim 2.
19. A method of claim 18, wherein said polymorphism is a nucleotide
deletion, substitution, inversion, or transposition.
20. A method of advertising KSE336 for sale, commercial use, or
licensing, comprising, displaying in a computer-readable medium a
polynucleotide of claim 1, effective specific fragments thereof, or
complements thereto.
21. An antibody which is specific-for an amino acid sequence
selected from SEQ ID NO 2, 4, or 6.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 09/930,181, filed Aug. 16, 2001, which is hereby incorporated
by reference in its entirety.
DESCRIPTION OF THE DRAWINGS
[0002] SEQ ID NOS. 1 and 2 show the nucleotide and amino acid
sequences of KSE336-1. SEQ ID NOS. 3 and 4 show the nucleotide and
amino acid sequences of KSE336-2. The N-terminal amino acid
sequence of KSE336-1 is shown in SEQ ID NOS 5 and 6. Promoter
sequences for KSE336 are listed in SEQ ID NOS 7-14. SEQ ID NOS. 15
and 16 show substrate for serine kinase activity. The amino acid
sequence of AJ006701 is shown in SEQ ID NO 17 and the amino acid
sequence of AF020089 is shown in SEQ ID NO 18. These are human
cDNAs.
[0003] FIG. 1 shows the expression pattern of KSE 336. 1, adrenal
gland; 2, bone marrow; 3, brain; 4, colon; 5, heart; 6, intestine;
7, kidney; 8, liver; 9, lung; 10, lymph node; 11, lymphocytes; 12,
mammary gland; 13, muscle; 14, ovary; 15, pancreas; 16, pituitary;
17, prostate; 18, skin; 19, spleen; 20, stomach; 21, testis; 22,
thymus; 23, thyroid; 24, uterus.
[0004] FIG. 2 shows sequence comparisons between KSE336-1 (SEQ ID
NO 2), KSE336-2 (SEQ ID NO 4), AJ00601 (SEQ ID NO 17), and AF020089
(SEQ ID NO 18).
DESCRIPTION OF THE INVENTION
[0005] The present invention relates to all facets of novel
polynucleotides, the polypeptides they encode, antibodies and
specific binding partners thereto, and their applications to
research, diagnosis, drug discovery, therapy, clinical medicine,
forensic science and medicine, etc. The polynucleotides are
expressed in brain and pancreas and are therefore useful in variety
of ways, including, but not limited to, as molecular markers, as
drug targets, and for detecting, diagnosing, staging, monitoring,
prognosticating, preventing or treating, determining predisposition
to, etc., diseases and conditions, especially relating to brain and
pancreas. The identification of specific genes, and groups of
genes, expressed in pathways physiologically relevant to brain and
pancreas permits the definition of functional and disease pathways,
and the delineation of targets in these pathways which are useful
in diagnostic, therapeutic, and clinical applications. The present
invention also relates to methods of using the polynucleotides and
related products (proteins, antibodies, etc.) in business and
computer-related methods, e.g., advertising, displaying, offering,
selling, etc., such products for sale, commercial use, licensing,
etc.
[0006] Kinases
[0007] KSE 336 is a protein kinase, exhibiting, e.g., a
serine/threonine activity. Protein kinases are a diverse and large
group of enzymes that catalyze the transfer of a phosphate group.
In most cases, the gamma phosphate of ATP or GTP serves as the
phosphate donor, and a protein alcohol or phenol group acts as the
phosphate acceptor. Protein kinases are ubiquitous in eukaryotes,
playing an important role in development, differentiation, cell
division, cell function, and signaling pathways. Kinases can be
divided into different groups based on sequence homology and
function. These groups include: (1) CMGC, (2) PTK, (3) STE, (4)
Gcyc, (5) AGC, (6) CAMK, and (7) CK1. Thorner et al., Cell
Signaling, Chapter 2, Pages 8-9, New Science Press.
[0008] (1) The CMGC kinases includes cyclin-dependent kinases
(Cdks), MAPKs, glycogen synthase kinases (GSKs), and CTD kinases.
These enzymes phosphorylate serines and threonines at -Ser-Pro- or
-Tbr-Pro-.
[0009] (2) PTK kinases are the tyrosine kinases. These include
receptor kinases having a ligand binding extracellular domain and
an intracellular kinase domain, as well as intracellularly
expressed PTKs.
[0010] (3) The STE group includes homologs of yeast Ste20 (PAK),
Ste11 (MAPKKK), and Ste7 (MAPKK). These are serine/threonine
kinases, some of which have dual specificity. A major group of the
STE kinases are the kinases involved in the mitogen-activated
protein kinase (MAPK) cascade. MAPK cascades play key roles in
relaying various physiological, environmental, or pathological
signals from the environment to the transcriptional machinery in
the nucleus. MAPK is activated by dual phosphorylation of threonine
and tyrosine residues in a TXY motif located between subdomains VII
and VIII of the kinase catalytic domain by MAPK kinase (MAPKK).
MAPKK is, in turn, activated by MAPKK kinase (MAPKKK). The general
path of the cascade can therefore be characterized as:
Stimulus.fwdarw.MAPKKK.fwdarw.MAPKK.fwdarw.MAPK.fwdarw.Response. In
S. cerevisiae, Ste20, Ste11, and Ste7 form a MAPK cascade which
functions in the pheromone-induced signal transmission.
[0011] (4) The Gcyc group most closely resembles the kinase-like
domain found in guanylate cyclases. The specificity of these
enzymes has not been completely characterized.
[0012] (5) The AGC group is made up the PKAs (cAMP-dependent
protein kinase), PTGs (cGMP-dependent kinase), and certain lipid
activated protein kinases (protein kinase C or PKC). They
phosphorylate serine or threonine residues. These enzymes are
comprised of multiple subunits. For example, PKA consists a
catalytic (C) and a regulatory (R) subunit. A PKA can have multiple
regulatory and/or catalytic subunits. For instance, mammalian
5'AMP-activated protein kinase (AMPK) comprises a single catalytic
alpha-subunit and two noncatalytic subunits, beta- and gamma-.
There are multiple isoforms for each subunit. See, e.g., Stapleton
et al., J. Biol. Chem., 271:611-614, 1996.
[0013] (6) The CAMK group of protein kinases comprise
calciumi/calmodulin regulated, cAMP-regulated, and ELKL motif
kinases. These enzymes phosphorylate serine and threonine
residues.
[0014] (7) The CK1 group is so named because its family members
resemble the casein kinase 1. The function of this class has been
difficult to document, but they typically consist of a single
catalytic subunit capable of phosphorylating serine residues. Many
different isoforms for each type have been described.
[0015] KSE336 possesses serine and/or threonine kinase activity
similar to the activity displayed by kinases in groups 1, 3, 5, 6,
and 7. By its amino acid sequence, it is most similar the AGC (5)
group of kinases.
[0016] KSE336
[0017] KSE336 codes for a serine/threonine kinase ("STK"). Two
forms of it have been identified, KSE336-1 (FB1620G06) and KSE336-2
(AB1138D11). KSE336-1 is 668 amino acids, and KSE336-2 is 585 amino
acids. Nucleotide and corresponding amino acid sequences of
KSE336-1 are shown in SEQ ID NOS. 1 and 2, and SEQ ID NOS 3 and 4
for KSE336-2. The serine threonine kinase domain is found at amino
acid positions 19-270 in KSE336-1, and 1-185 in KSE336-2. A protein
kinase active-site signature is found at amino acid positions
137-149 in KSE336-1 and is present in KSE336-2, as well. See, FIG.
2. The two forms differ from each other only at the 5' end. See,
FIG. 2. The open reading frames differ by only 4 base pairs.
Alignment with genomic DNA reveals that this difference is derived
from the exon-intron splicing site as follows:
[0018] Intron 5' donor sequence
[0019] Intron 3' accepter sequence
1
.sub.----------GTAGGT---------------------------------------------
CAG.sub.------------ 1 2
[0020] The KSE336-1 cDNA was derived from a transcript that was
spliced using the first GT as the 5' donor site, while KSE336-2 was
spliced using the second GT as the 5' donor site. As a result,
KSE336-2 has 4 more base pairs than KSE336-1. Since this difference
occurs in coding sequence, a shift in the open reading frame was
observed, as reflected in the different 5' ends. Polymorphisms are
shown in Table 2.
[0021] KSE336 maps to chromosomal band 11p15.5-pter (physical map
from 0.679 to 0.950 Mb; NT.sub.--024164.2; AC074189; BAC clone,
RP11-371C18). Partial clones, AF020089 and AJ006701, have been
identified. See, FIG. 2 for alignment. The present invention
relates to fragments comprising overlapping regions,
non-overlapping regions, regions comprising variations, etc.,
between the different forms of KSE336, and any homologs, truncated
versions, polymorphisms, etc. Examples of sequences related to
KSE36 are shown in FIG. 2. Additional examples are described below.
As an illustration, but not to limit the invention in anyway, the
present invention relates to such fragments as, amino acid
positions 1-71 (SEQ ID NOS 5 and 6) of KSE336-1; amino acid
positions 72-668 of KSE336-1; amino acid positions 1-8 of KSE336-2;
amino acid positions 647-659 of KSE336-1; 640-644 of KSE-1, 660-668
of KSE336-1, etc. Such fragments can comprise, consist of, or
consist essentially of, these sequences.
[0022] The polypeptide coded for by KSE336 exhibits sequence
identity to other STKs. It is related to kinases from other species
are AF240782 (mouse) and AF316542 (Drosophila). It also shares
sequence homology with the catalytic subunits of mammalian
5'AMP-activated protein kinase (AMPK) and yeast SNF1. The SNF1
family of PKAs are involved in glucose metabolism. See, e.g., da
Silva Xavier et al., Proc. Natl. Acad. Sci., 97:4023-4028, 2000.
Mammalian AMPKs appear to be involved in regulating the response to
nutritional stress, e.g., when ATP levels are low. See, e.g.,
Stapleton et al., J. Biol. Chem., 271:611-614, 1996.
[0023] KSE336 is also homologous to HrPOPK-1, an STK whose mRNA is
detected in early ascidian embryos. Sasakura et al., Mech. Dev.,
76:161-163, 1998. Sequence homology is also observed between KSE336
and another STK, SAD-1, a polypeptide which regulates presynaptic
vesicle clustering and axon termination in C. elegans. See, e.g.,
Neuron, 29(1):115-129, 2001.
[0024] KSE336 is predicted to have 19 exons with the following
structure:
2 2 . . 320 (NT_024164) 321 . . 413 (AC074189, RP11-371C18) reverse
orientation 414 . . 504 (NT_024164) 505 . . 641 (NT_024164) 642 . .
758 (AC074189) 759 . . 792 (AC074189) 793 . . 861
(AC091196,RP11-371C18) 862 . . 1008 (AC091196) 1009 . .
1041(NT_024164) 1042 . . 1206(NT_024124) 1207 . . 1304(NT_024124)
1305 . . 1455(NT_024124) 1456 . . 1516(NT_024124) 1517 . .
1724(NT_024124) 1725 . . 1773(NT_024124) 1774 . . 1897(NT_024124)
1898 . . 2078(NT_024124) 2079 . . 2168(NT_024124) 2169 . . 2263
(NT_024124)
[0025] Expression
[0026] As show in FIG. 1, expression of KSE336 is restricted to the
brain and pancreas. The coincidence of brain and pancreas
expression is especially interesting since these cell types utilize
common signaling pathways during development. Components of the
Notch signaling pathway are expressed during both neuronal and
pancreatic cell differentiation (Apelqvist et al., Nature,
400:877-881, 1999; Jensen et al., Nature Genet., 24:36-44, 2000).
Furthermore, embryonic stem (ES) cells which display neuronal cell
markers have been induced to differentiate into insulin-producing
pancreatic islet cells, indicating a close relationship between the
two cell types (Lumelsky et al., Science, 292:1389-1394, 2001).
Additionally, both tissues are exquisitely sensitive to changes in
glucose and ATP levels, a function of cAMP-dependent STKs, such as
SNF1 and AMPK. KSE336 is also expressed in neural stem cells.
[0027] Disease Association
[0028] As indicated by its expression profile, KSE336 has a
functional role in brain and pancreas. When the normal function of
a gene is perturbed, the cells and tissues in which it is expressed
are correspondingly affected, generally in a deleterious way. A
range of different phenotypes are commonly observed, depending on
the nature of the gene mutation and its interaction with other
genetic and environmental factors. The brain and pancreas
phenotypes associated with KSE336 aberrations, include, but are not
limited to, e.g., astrocytoma, meningioma, pancreatic
adenocarcinoma, insulin-dependent diabetes mellitus 2 (IDDM2),
helicoid peripapillary chorioretinal degeneration (also known as
atrophia areata), Beckwith-Wiedemann syndrome (see, e.g., Hoovers
et al., Proc. Natl. Acad. Sci., 92:12456-12460, 1995), and
congenital hyperinsulinism (e.g., Fournet et al., Horm. Res.,
53:Suppl. 1:2-6, 2000).
[0029] In addition to the above-mentioned disorders, KSE336 may be
associated with other conditions, e.g., which result from its
expression in tissues other than brain or pancreas. Such disorders
include, but are not limited to, arthrogryposis multiplex
congenital distal type 2B (AMCD2B; Paris et al., Genomics,
69(2):196-202, 2000), Wilms Tumor2 (WT2; see, e.g., U.S. Pat. No.
5,726,288).
[0030] The chromosomal region in which the KSE336 gene is located
is involved in genomic imprinting, the phenomenon in which
epigenetic modification of a specific parental chromosome in the
gamete or zygote leads to monoallelic or differential expression of
the two alleles of the gene in the offspring's somatic cells. An
example of a disease localized to 11p15 and implicated in defective
genomic imprinting is the Beckwith-Wiedemann syndrome (BWS). BWS is
a disorder of prenatal overgrowth, cancer, and hypoglycemia
(associated with pancreatic islet hyperplasia). It is known to be
transmitted as an autosomal dominant trait, but also occasionally
arises spontaneously. Two separate domains of imprinted genes
appear to be involved in BWS. See, e.g., Lee et al., Proc. Natl.
Acad. Sci., 96:5203-5208, 1999; Maher and Reik, J. Clin. Invest.,
105:247-252, 2000; Feinberg, J. Clin. Invest., 106:739-740, 2000.
About half of patients with BWS showed loss of imprinting (LOI)
with LIT1, but only 20% with IGF2 (Lee et al., Proc. Natl. Acad.
Sci., 96:5203-5208, 1999). Accordingly, nucleic acids of the
present invention, including SNPs and other polymorphisms of it,
can be use as probes to analyze whether a gene has been
imprinted.
[0031] Activity
[0032] By the phrase "serine/threonine kinase activity," it is
meant a catalytic activity in which a gamma phosphate from
adenosine triphosphate (ATP) is transferred to a serine or
threonine residue in a protein substrate. More generally, a "kinase
activity" refers to the ability of an enzyme to catalyze the
transfer of a phosphate from one molecule to another.
[0033] Kinase activity of KSE336, and biologically active fragments
thereof, can be determined routinely using conventional assay
methods. Kinase assays typically comprise the kinase enzyme,
substrates, buffers, and components of a detection system. A
typical kinase assay involves a reaction of a protein kinase sample
with a peptide substrate and a gamma-labeled ATP, such as
.sup.32P-ATP. The resulting labeled phosphoprotein is then
separated from the gamma-labeled ATP. Separation and detection of
the phosphoprotein can be achieved through any suitable method.
When a radioactive label is utilized, the labeled phosphoprotein
can be separated from the unreacted gamma-.sup.32P-ATP using an
affinity membrane or gel electrophoresis, and then visualized on
the gel using autoradiography.
[0034] Non-radioactive methods can also be used. Methods can
utilize an antibody which recognizes the phosphorylated substrate,
e.g., an anti-phosphoserine or anti-phosphothreonine antibody. For
instance, kinase enzyme can incubated with a substrate in the
presence of ATP and kinase buffer under conditions which are
effective for the enzyme to phosphorylate the substrate. The
reaction mixture can be separated, e.g., electrophoretically, and
then phosphorylation of the substrate can be measured by Western
blotting using an anti-phosphoserine or anti-phosphothreonine
antibody. The antibody can be labeled with a detectable label,
e.g., an enzyme, such as HRP, avidin or biotin, chemiluminescent
reagents, etc. Other methods can utilize ELISA formats, affinity
membrane separation, fluorescence polarization assays, luminescent
assays, etc. Kinase assays are available commercially, e.g., Cell
Signaling Corporation (e.g., p44/42 MAP Kinase Assay Kit), AUSA
Universal Protein Kinase Assay Kit, ProMega (e.g., PepTag assays),
SpinZyme colorimetric assays from Pierce, Calbiochem's ELISA-based
kinase assays, Upstate Biotechnology's ELISA-based kits using
chemiluminescent DuoLuX substrate from Vector Laboratories,
PanVera's fluorescent polarization kits, etc.
[0035] For kinase assays, see also, e.g., Kemp et al., "Design and
use of peptide substrates for protein kinases," Methods in
Enzymol., 200:121-34, 1991; Wang et al., "Identification of the
major site of rat prolactin phosphorylation as serine 177," J.
Biol. Chem., 271:2462-9, 1996; Yasuda et al., "A synthetic peptide
substrate for selective assay of protein kinase C," Biochem.
Biophys. Res. Comm., 166:1220-7, 1990; Gonzalez et al., "Use of the
synthetic peptide neurogranin(28-43) as a selective protein kinase
C substrate in assays of tissue homogenates," Anal. Biochem.,
215:184-9, 1993; Parker et al., "Development of high throughput
screening assays using fluorescence polarization: nuclear
receptor-ligand-binding and kinase/phosphatase assays," J. Biomol.
Screen., 5:77-88, April 2000. See, also., U.S. Pat. Nos. 6,203,994,
6,074,861, 6,066,462, 6,004,757, and 5,741,689.
[0036] When a serine/threonine kinase activity is to be detected, a
suitable substrate comprises serine and threonine residues, e.g.,
Elk-1, MBP, histones, such as H3, protamine, protamine sulfate,
neurogranin, glycogen synthase, and fragments and fusion proteins
thereof, HMRSAMSGLHLVKRR (SEQ ID NO 15), LRRASLG (SEQ ID NO 16),
etc. Originally, a consensus PKC phosphorylation motif was
determined to be RXXS/TXRX, where X indicates any amino acid.
Generally, PKCs prefer basic residues at positions -6, -4 and -2 to
the Ser/Thr. cPKCs also preferred basic residues at +2, +3 and +4,
whereas nPKC and aPKCs preferred hydrophobic residues at these
positions. PKCmu deviates from this specificity, having an optimal
motif which differs from other PKCs, with a strong selectivity for
Leu at the -5 position. See, e.g., Toker, Frontiers in Bioscience,
3:d1134-1147, 1998. PKAs can be assayed according to, e.g., Davies
et al., Eur. J. Biochem., 186:123-128, 1989; Roskoski, Methods
Enymol., 99:3-6, 1983; Cob and Corbin, Methods Enzymol.,
159:202-208, 1988. Consensus sequences for KSE336 can be determined
analogously.
[0037] Nucleic Acids
[0038] A mammalian polynucleotide, or fragment thereof, of the
present invention is a polynucleotide having a nucleotide sequence
obtainable from a natural source. It therefore includes
naturally-occurring normal, naturally-occurring mutant, and
naturally-occurring polymorphic alleles (e.g., SNPs),
differentially-spliced transcripts, splice-variants, etc. By the
term "naturally-occurring," it is meant that the polynucleotide is
obtainable from a natural source, e.g., animal tissue and cells,
body fluids, tissue culture cells, forensic samples. Natural
sources include, e.g., living cells obtained from tissues and whole
organisms, tumors, cultured cell lines, including primary and
immortalized cell lines. Naturally-occurring mutations can include
deletions (e.g., a truncated amino- or carboxy-terminus),
substitutions, inversions, or additions of nucleotide sequence.
These genes can be detected and isolated by polynucleotide
hybridization according to methods which one skilled in the art
would know, e.g., as discussed below.
[0039] A polynucleotide according to the present invention can be
obtained from a variety of different sources. It can be obtained
from DNA or RNA, such as polyadenylated mRNA or total RNA, e.g.,
isolated from tissues, cells, or whole organism. The polynucleotide
can be obtained directly from DNA or RNA, from a cDNA library, from
a genomic library, etc. The polynucleotide can be obtained from a
cell or tissue (e.g., from an embryonic or adult tissues) at a
particular stage of development, having a desired genotype,
phenotype, disease status, etc. A polynucleotide which "codes
without interruption" refers to a polynucleotide having a
continuous open reading frame ("ORF") as compared to an ORF which
is interrupted by introns or other noncoding sequences.
[0040] Polynucleotides and polypeptides (including any part of
KSE336) can be excluded as compositions from the present invention
if, e.g., listed in a publicly available databases on the day this
application was filed and/or disclosed in a patent application
having an earlier filing or priority date than this application
and/or conceived and/or reduced to practice earlier than a
polynucleotide in this application. AJ006701 (SEQ ID NO 17) and
AF020089 (SEQ ID NO 18) can be excluded from the present invention,
e.g., KSE336, fragments thereof, wherein such fragment is not
AJ006701 or AF020089.
[0041] As described herein, the phrase "an isolated polynucleotide
which is SEQ ID NO," or "an isolated polynucleotide which is
selected from SEQ ID NO," refers to an isolated nucleic acid
molecule from which the recited sequence was derived (e.g., a cDNA
derived from mRNA; cDNA derived from genomic DNA). Because of
sequencing errors, typographical errors, etc., the actual
naturally-occurring sequence may differ from a SEQ ID listed
herein. Thus, the phrase indicates the specific molecule from which
the sequence was derived, rather than a molecule having that exact
recited nucleotide sequence, analogously to how a culture
depository number refers to a specific cloned fragment in a
cryotube.
[0042] As explained in more detail below, a polynucleotide sequence
of the invention can contain the complete sequence as shown in SEQ
ID NO 1 and 2, degenerate sequences thereof, anti-sense, muteins
thereof, genes comprising said sequences, full-length cDNAs
comprising said sequences, complete genomic sequences, fragments
thereof (e.g., SEQ ID NOS 3 and 4), homologs, primers, nucleic acid
molecules which hybridize thereto, derivatives thereof, etc.
[0043] Genomic
[0044] The present invention also relates genomic DNA from which
the polynucleotides of the present invention can be derived. A
genomic DNA coding for a human, mouse, or other mammalian
polynucleotide, can be obtained routinely, for example, by
screening a genomic library (e.g., a YAC library) with a
polynucleotide of the present invention, or by searching nucleotide
databases, such as GenBank and EMBL, for matches. Promoter and
other regulatory regions can be identified upstream of coding and
expressed RNAs, and assayed routinely for activity, e.g., by
joining to a reporter gene (e.g., CAT, GFP, alkaline phosphatase,
luciferase, galatosidase). A promoter obtained from a brain and
pancreas selective gene can be used, e.g., in gene therapy to
obtain tissue-specific expression of a heterologous gene (e.g.,
coding for a therapeutic product or cytotoxin). Specific genomic
promoter sequences are listed in Table 1.
[0045] Constructs
[0046] A polynucleotide of the present invention can comprise
additional polynucleotide sequences, e.g., sequences to enhance
expression, detection, uptake, cataloging, tagging, etc. A
polynucleotide can include only coding sequence; a coding sequence
and additional non-naturally occurring or heterologous coding
sequence (e.g., sequences coding for leader, signal, secretory,
targeting, enzymatic, fluorescent, antibiotic resistance, and other
functional or diagnostic peptides); coding sequences and non-coding
sequences, e.g., untranslated sequences at either a 5' or 3' end,
or dispersed in the coding sequence, e.g., introns.
[0047] A polynucleotide according to the present invention also can
comprise an expression control sequence operably linked to a
polynucleotide as described above. The phrase "expression control
sequence" means a polynucleotide sequence that regulates expression
of a polypeptide coded for by a polynucleotide to which it is
functionally ("operably") linked. Expression can be regulated at
the level of the mRNA or polypeptide. Thus, the expression control
sequence includes mRNA-related elements and protein-related
elements. Such elements include promoters, enhancers (viral or
cellular), ribosome binding sequences, transcriptional terminators,
etc. An expression control sequence is operably linked to a
nucleotide coding sequence when the expression control sequence is
positioned in such a manner to effect or achieve expression of the
coding sequence. For example, when a promoter is operably linked 5'
to a coding sequence, expression of the coding sequence is driven
by the promoter. Expression control sequences can include an
initiation codon and additional nucleotides to place a partial
nucleotide sequence of the present invention in-frame in order to
produce a polypeptide (e.g., pET vectors from Promega have been
designed to permit a molecule to be inserted into all three reading
frames to identify the one that results in polypeptide expression).
Expression control sequences can be heterologous or endogenous to
the normal gene.
[0048] A polynucleotide of the present invention can also comprise
nucleic acid vector sequences, e.g., for cloning, expression,
amplification, selection, etc. Any effective vector can be used. A
vector is, e.g., a polynucleotide molecule which can replicate
autonomously in a host cell, e.g., containing an origin of
replication. Vectors can be useful to perform manipulations, to
propagate, and/or obtain large quantities of the recombinant
molecule in a desired host. A skilled worker can select a vector
depending on the purpose desired, e.g., to propagate the
recombinant molecule in bacteria, yeast, insect, or mammalian
cells. The following vectors are provided by way of example.
Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, Phagescript,
phiX174, pBK Phagemid, pNH8A, pNH16a, pNH18Z, pNH46A (Stratagene);
Bluescript KS+II (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR54
0, pRIT5 (Pharmacia). Eukaryotic: PWLNEO, pSV2CAT, pOG44, pXTI, pSG
(Stratagene), pSVK3, PBPV, PMSG, pSVL (Pharmacia), pCR2.1/TOPO,
pCRII/TOPO, pCR4/TOPO, pTrcHisB, pCMV6-XL4, etc. However, any other
vector, e.g., plasmids, viruses, or parts thereof, may be used as
long as they are replicable and viable in the desired host. The
vector can also comprise sequences which enable it to replicate in
the host whose genome is to be modified.
[0049] Hybridization
[0050] Polynucleotide hybridization, as discussed in more detail
below, is useful in a variety of applications, including, in gene
detection methods, for identifying mutations, for making mutations,
to identify homologs in the same and different species, to identify
related members of the same gene family, in diagnostic and
prognostic assays, in therapeutic applications (e.g., where an
antisense polynucleotide is used to inhibit expression), etc.
[0051] The ability of two single-stranded polynucleotide
preparations to hybridize together is a measure of their nucleotide
sequence complementarity, e.g., base-pairing between nucleotides,
such as A-T, G-C, etc. The invention thus also relates to
polynucleotides, and their complements, which hybridize to a
polynucleotide comprising a nucleotide sequence as set forth in SEQ
ID NO 1-6 and genomic sequences thereof. A nucleotide sequence
hybridizing to the latter sequence will have a complementary
polynucleotide strand, or act as a template for one in the presence
of a polymerase (i.e., an appropriate polynucleotide synthesizing
enzyme). The present invention includes both strands of
polynucleotide, e.g., a sense strand and an anti-sense strand.
[0052] Hybridization conditions can be chosen to select
polynucleotides which have a desired amount of nucleotide
complementarity with the nucleotide sequences set forth in SEQ ID
NO 1-6 and genomic sequences thereof. A polynucleotide capable of
hybridizing to such sequence, preferably, possesses, e.g., about
70%, 75%, 80%, 85%, 87%, 90%, 92%, 95%, 97%, 99%, or 100%
complementarity, between the sequences. The present invention
particularly relates to polynucleotide sequences which hybridize to
the nucleotide sequences set forth in SEQ ID NO 1-6 or genomic
sequences thereof, under low or high stringency conditions. These
conditions can be used, e.g., to select corresponding homologs in
non-human species.
[0053] Polynucleotides which hybridize to polynucleotides of the
present invention can be selected in various ways. Filter-type
blots (i.e., matrices containing polynucleotide, such as
nitrocellulose), glass chips, and other matrices and substrates
comprising polynucleotides (short or long) of interest, can be
incubated in a prehybridization solution (e.g., 6.times.SSC, 0.5%
SDS, 100 .mu.g/ml denatured salmon sperm DNA, 5.times. Denhardt's
solution, and 50% formamide), at 22-68.degree. C., overnight, and
then hybridized with a detectable polynucleotide probe under
conditions appropriate to achieve the desired stringency. In
general, when high homology or sequence identity is desired, a high
temperature can be used (e.g., 65.degree. C.). As the homology
drops, lower washing temperatures are used. For salt
concentrations, the lower the salt concentration, the higher the
stringency. The length of the probe is another consideration. Very
short probes (e.g., less than 100 base pairs) are washed at lower
temperatures, even if the homology is high. With short probes,
formamide can be omitted. See, e.g., Current Protocols in Molecular
Biology, Chapter 6, Screening of Recombinant Libraries; Sambrook et
al., Molecular Cloning, 1989, Chapter 9.
[0054] For instance, high stringency conditions can be achieved by
incubating the blot overnight (e.g., at least 12 hours) with a long
polynucleotide probe in a hybridization solution containing, e.g.,
about 5.times.SSC, 0.5% SDS, 100 .mu.g/ml denatured salmon sperm
DNA and 50% formamide, at 42.degree. C. Blots can be washed at high
stringency conditions that allow, e.g., for less than 5% bp
mismatch (e.g., wash twice in 0.1% SSC and 0.1% SDS for 30 min at
65.degree. C.), i.e., selecting sequences having 95% or greater
sequence identity.
[0055] Other non-limiting examples of high stringency conditions
includes a final wash at 65.degree. C. in aqueous buffer containing
30 mM NaCl and 0.5% SDS. Another example of high stringent
conditions is hybridization in 7% SDS, 0.5 M NaPO.sub.4, pH 7, 1 mM
EDTA at 50.degree. C., e.g., overnight, followed by one or more
washes with a 1% SDS solution at 42.degree. C. Whereas high
stringency washes can allow for less than 5% mismatch, reduced or
low stringency conditions can permit up to 20% nucleotide mismatch.
Hybridization at low stringency can be accomplished as above, but
using lower formamide conditions, lower temperatures and/or lower
salt concentrations, as well as longer periods of incubation
time.
[0056] Hybridization can also be based on a calculation of melting
temperature (Tm) of the hybrid formed between the probe and its
target, as described in Sambrook et al. Generally, the temperature
Tm at which a short oligonucleotide (containing 18 nucleotides or
fewer) will melt from its target sequence is given by the following
equation: Tm=(number of A's and T's).times.2.degree. C.+(number of
C's and G's).times.4.degree. C. For longer molecules, Tm=81.5+16.6
log.sub.10[Na+]+0.41(% GC)-600/N where [Na+] is the molar
concentration of sodium ions, % GC is the percentage of GC base
pairs in the probe, and N is the length. Hybridization can be
carried out at several degrees below this temperature to ensure
that the probe and target can hybridize. Mismatches can be allowed
for by lowering the temperature even further.
[0057] Stringent conditions can be selected to isolate sequences,
and their complements, which have, e.g., at least about 90%, 95%,
or 97%, nucleotide complementarity between the probe (e.g., a short
polynucleotide of SEQ ID NO 1-6 or genomic sequences thereof) and a
target polynucleotide.
[0058] Other homologs of polynucleotides of the present invention
can be obtained from mammalian and non-mammalian sources according
to various methods. For example, hybridization with a
polynucleotide can be employed to select homologs, e.g., as
described in Sambrook et al., Molecular Cloning, Chapter 11, 1989.
Such homologs can have varying amounts of nucleotide and amino acid
sequence identity and similarity to such polynucleotides of the
present invention. Mammalian organisms include, e.g., mice, rats,
monkeys, pigs, cows, etc. Non-mammalian organisms include, e.g.,
vertebrates, invertebrates, zebra fish, chicken, Drosophila, C.
elegans, Xenopus, yeast such as S. pombe, S. cerevisiae,
roundworms, prokaryotes, plants, Arabidopsis, artemia, viruses,
etc. The degree of nucleotide sequence identity between human and
mouse can be about, e.g. 70% or more, 85% or more for open reading
frames, etc.
[0059] Alignment
[0060] Alignments can be accomplished by using any effective
algorithm. For pairwise alignments of DNA sequences, the methods
described by Wilbur-Lipman (e.g., Wilbur and Lipman, Proc. Natl.
Acad. Sci., 80:726-730, 1983) or Martinez/Needleman-Wunsch (e.g.,
Martinez, Nucleic Acid Res., 11:4629-4634, 1983) can be used. For
instance, if the Martinez/Needleman-Wunsch DNA alignment is
applied, the minimum match can be set at 9, gap penalty at 1.10,
and gap length penalty at 0.33. The results can be calculated as a
similarity index, equal to the sum of the matching residues divided
by the sum of all residues and gap characters, and then multiplied
by 100 to express as a percent. Similarity index for related genes
at the nucleotide level in accordance with the present invention
can be greater than 70%, 80%, 85%, 90%, 95%, 99%, or more. Pairs of
protein sequences can be aligned by the Lipman-Pearson method
(e.g., Lipman and Pearson, Science, 227:1435-1441, 1985) with
k-tuple set at 2, gap penalty set at 4, and gap length penalty set
at 12. Results can be expressed as percent similarity index, where
related genes at the amino acid level in accordance with the
present invention can be greater than 65%, 70%, 75%, 80%, 85%, 90%,
95%, 99%, or more. Various commercial and free sources of alignment
programs are available, e.g., MegAlign by DNA Star, BLAST (National
Center for Biotechnology Information), BCM (Baylor College of
Medicine) Launcher, etc.
[0061] Percent sequence identity can also be determined by other
conventional methods, e.g., as described in Altschul et al., Bull.
Math. Bio. 48: 603-616, 1986 and Henikoff and Henikoff, Proc. Natl.
Acad. Sci. USA 89:10915-10919, 1992.
[0062] Specific Polynucleotide Probes
[0063] A polynucleotide of the present invention can comprise any
continuous nucleotide sequence of SEQ ID NO 1-6, sequences which
share sequence identity thereto, or complements thereof. The term
"probe" refers to any substance that can be used to detect,
identify, isolate, etc., another substance. A polynucleotide probe
is comprised of nucleic acid can be used to detect, identify, etc.,
other nucleic acids, such as DNA and RNA.
[0064] These polynucleotides can be of any desired size that is
effective to achieve the specificity desired. For example, a probe
can be from about 7 or 8 nucleotides to several thousand
nucleotides, depending upon its use and purpose. For instance, a
probe used as a primer PCR can be shorter than a probe used in an
ordered array of polynucleotide probes. Probe sizes vary, and the
invention is not limited in any way by their size, e.g., probes can
be from about 7-2000 nucleotides, 7-1000, 8-700, 8-600, 8-500,
8-400, 8-300, 8-150, 8-100, 8-75, 7-50, 10-25, 14-16, at least
about 8, at least about 10, at least about 15, at least about 25,
etc. The polynucleotides can have non-naturally-occurring
nucleotides, e.g., inosine, AZT, 3TC, etc. The polynucleotides can
have 100% sequence identity or complementarity to a sequence of SEQ
ID NO 1-6, or it can have mismatches or nucleotide substitutions,
e.g., 1, 2, 3, 4, or 5 substitutions. The probes can be
single-stranded or double-stranded.
[0065] In accordance with the present invention, a polynucleotide
can be present in a kit, where the kit includes, e.g., one or more
polynucleotides, a desired buffer (e.g., phosphate, tris, etc.),
detection compositions, RNA or cDNA from different tissues to be
used as controls, libraries, etc. The polynucleotide can be labeled
or unlabeled, with radioactive or non-radioactive labels as known
in the art. Kits can comprise one or more pairs of polynucleotides
for amplifying nucleic acids specific for KSE336, e.g., comprising
a forward and reverse primer effective in PCR. These include both
sense and anti-sense orientations. For instance, in PCR-based
methods (such as RT-PCR), a pair of primers are typically used, one
having a sense sequence and the other having an antisense
sequence.
[0066] Another aspect of the present invention is a nucleotide
sequence that is specific to, or for, a selective polynucleotide.
The phrases "specific for" or "specific to" a polynucleotide have a
functional meaning that the polynucleotide can be used to identify
the presence of one or more target genes in a sample. It is
specific in the sense that it can be used to detect polynucleotides
above background noise ("non-specific binding"). A specific
sequence is a defined order of nucleotides which occurs in the
polynucleotide, e.g., in the nucleotide sequences of SEQ ID NO 1-6.
A probe or mixture of probes can comprise a sequence or sequences
that are specific to a plurality of target sequences, e.g., where
the sequence is a consensus sequence, a functional domain, etc.,
e.g., capable of recognizing a family of related genes. Such
sequences can be used as probes in any of the methods described
herein or incorporated by reference. Both sense and antisense
nucleotide sequences are included. A specific polynucleotide
according to the present invention can be determined routinely.
[0067] A polynucleotide comprising a specific sequence can be used
as a hybridization probe to identify the presence of, e.g., human
or mouse polynucleotide, in a sample comprising a mixture of
polynucleotides, e.g., on a Northern blot. Hybridization can be
performed under high stringent conditions (see, above) to select
polynucleotides (and their complements which can contain the coding
sequence) having at least 90%, 95%, 99%, etc., identity (i.e.,
complementarity) to the probe, but less stringent conditions can
also be used. A specific polynucleotide sequence can also be fused
in-frame, at either its 5' or 3' end, to various nucleotide
sequences as mentioned throughout the patent, including coding
sequences for enzymes, detectable markers, GFP, etc, expression
control sequences, etc.
[0068] A polynucleotide probe, especially one that is specific to a
polynucleotide of the present invention, can be used in gene
detection and hybridization methods as already described. In one
embodiment, a specific polynucleotide probe can be used to detect
whether a particular tissue or cell-type is present in a target
sample. To carry out such a method, a selective polynucleotide can
be chosen which is characteristic of the desired target tissue.
Such polynucleotide is preferably chosen so that it is expressed or
displayed in the target tissue, but not in other tissues which are
present in the sample. For instance, if detection of brain and
pancreas is desired, it may not matter whether the selective
polynucleotide is expressed in other tissues, as long as it is not
expressed in cells normally present in blood, e.g., peripheral
blood mononuclear cells. Starting from the selective
polynucleotide, a specific polynucleotide probe can be designed
which hybridizes (if hybridization is the basis of the assay) under
the hybridization conditions to the selective polynucleotide,
whereby the presence of the selective polynucleotide can be
determined.
[0069] Probes which are specific for polynucleotides of the present
invention can also be prepared using involve transcription-based
systems, e.g., incorporating an RNA polymerase promoter into a
selective polynucleotide of the present invention, and then
transcribing anti-sense RNA using the polynucleotide as a template.
See, e.g., U.S. Pat. No. 5,545,522.
[0070] Polynucleotide Composition
[0071] A polynucleotide according to the present invention can
comprise, e.g., DNA, RNA, synthetic polynucleotide, peptide
polynucleotide, modified nucleotides, dsDNA, ssDNA, ssRNA, dsRNA,
and mixtures thereof. A polynucleotide can be single- or
double-stranded, triplex, DNA:RNA, duplexes, comprise hairpins, and
other secondary structures, etc. Nucleotides comprising a
polynucleotide can be joined via various known linkages, e.g.,
ester, sulfamate, sulfamide, phosphorothioate, phosphoramidate,
methylphosphonate, carbamate, etc., depending on the desired
purpose, e.g., resistance to nucleases, such as RNAse H, improved
in vivo stability, etc. See, e.g., U.S. Pat. No. 5,378,825. Any
desired nucleotide or nucleotide analog can be incorporated, e.g.,
6-mercaptoguanine, 8-oxo-guanine, etc.
[0072] Various modifications can be made to the polynucleotides,
such as attaching detectable markers (avidin, biotin, radioactive
elements, fluorescent tags and dyes, energy transfer labels,
energy-emitting labels, binding partners, etc.) or moieties which
improve hybridization, detection, and/or stability. The
polynucleotides can also be attached to solid supports, e.g.,
nitrocellulose, magnetic or paramagnetic microspheres (e.g., as
described in U.S. Pat. Nos. 5,411,863; 5,543,289; for instance,
comprising ferromagnetic, supermagnetic, paramagnetic,
superparamagnetic, iron oxide and polysaccharide), nylon, agarose,
diazotized cellulose, latex solid microspheres, polyacrylamides,
etc., according to a desired method. See, e.g., U.S. Pat. Nos.
5,470,967, 5,476,925, and 5,478,893.
[0073] Polynucleotide according to the present invention can be
labeled according to any desired method. The polynucleotide can be
labeled using radioactive tracers such as .sup.32P, .sup.35S,
.sup.3H, or .sup.14C, to mention some commonly used tracers. The
radioactive labeling can be carried out according to any method,
such as, for example, terminal labeling at the 3' or 5' end using a
radiolabeled nucleotide, polynucleotide kinase (with or without
dephosphorylation with a phosphatase) or a ligase (depending on the
end to be labeled). A non-radioactive labeling can also be used,
combining a polynucleotide of the present invention with residues
having immunological properties (antigens, haptens), a specific
affinity for certain reagents (ligands), properties enabling
detectable enzyme reactions to be completed (enzymes or coenzymes,
enzyme substrates, or other substances involved in an enzymatic
reaction), or characteristic physical properties, such as
fluorescence or the emission or absorption of light at a desired
wavelength, etc.
[0074] Nucleic Acid Detection Methods
[0075] Another aspect of the present invention relates to methods
and processes for detecting KSE336. Detection methods have a
variety of applications, including for diagnostic, prognostic,
forensic, and research applications. To accomplish gene detection,
a polynucleotide in accordance with the present invention can be
used as a "probe." The term "probe" or "polynucleotide probe" has
its customary meaning in the art, e.g., a polynucleotide which is
effective to identify (e.g., by hybridization), when used in an
appropriate process, the presence of a target polynucleotide to
which it is designed. Identification can involve simply determining
presence or absence, or it can be quantitative, e.g., in assessing
amounts of a gene or gene transcript present in a sample. Probes
can be useful in a variety of ways, such as for diagnostic
purposes, to identify homologs, and to detect, quantitate, or
isolate a polynucleotide of the present invention in a test
sample.
[0076] Assays can be utilized which permit quantification and/or
presence/absence detection of a target nucleic acid in a sample.
Assays can be performed at the single-cell level, or in a sample
comprising many cells, where the assay is "averaging" expression
over the entire collection of cells and tissue present in the
sample. Any suitable assay format can be used, including, but not
limited to, e.g., Southern blot analysis, Northern blot analysis,
polymerase chain reaction ("PCR") (e.g., Saiki et al., Science,
241:53, 1988; U.S. Pat. Nos. 4,683,195, 4,683,202, and 6,040,166;
PCR Protocols. A Guide to Methods and Applications, Innis et al.,
eds., Academic Press, New York, 1990), reverse transcriptase
polymerase chain reaction ("RT-PCR"), anchored PCR, rapid
amplification of CDNA ends ("RACE") (e.g., Schaefer in Gene Cloning
and Analysis. Current Innovations, Pages 99-115, 1997), ligase
chain reaction ("LCR") (EP 320 308), one-sided PCR (Ohara et al.,
Proc. Natl. Acad. Sci., 86:5673-5677, 1989), indexing methods
(e.g., U.S. Pat. No. 5,508,169), in situ hybridization,
differential display (e.g., Liang et al., Nucl. Acid. Res.,
21:3269-3275, 1993; U.S. Pat. Nos. 5,262,311, 5,599,672 and
5,965,409; WO97/18454; Prashar and Weissman, Proc. Natl. Acad.
Sci., 93:659-663, and U.S. Pat. Nos. 6,010,850 and 5,712,126; Welsh
et al., Nucleic Acid Res., 20:4965-4970, 1992, and U.S. Pat. No.
5,487,985) and other RNA fingerprinting techniques, nucleic acid
sequence based amplification ("NASBA") and other transcription
based amplification systems (e.g., U.S. Pat. Nos. 5,409,818 and
5,554,527; WO 88/10315), polynucleotide arrays (e.g., U.S. Pat.
Nos. 5,143,854, 5,424,186; 5,700,637, 5,874,219, and 6,054,270; PCT
WO 92/10092; PCT WO 90/15070), Qbeta Replicase (PCT/US87/00880),
Strand Displacement Amplification ("SDA"), Repair Chain Reaction
("RCR"), nuclease protection assays, subtraction-based methods,
Rapid-Scan.TM., etc. Additional useful methods include, but are not
limited to, e.g., template-based amplification methods, competitive
PCR (e.g., U.S. Pat. No. 5,747,251), redox-based assays (e.g., U.S.
Pat. No. 5,871,918), Taqman-based assays (e.g., Holland et al.,
Proc. Natl. Acad, Sci., 88:7276-7280, 1991; U.S. Pat. Nos.
5,210,015 and 5,994,063), real-time fluorescence-based monitoring
(e.g., U.S. Pat. No. 5,928,907), molecular energy transfer labels
(e.g., U.S. Pat. Nos. 5,348,853, 5,532,129, 5,565,322, 6,030,787,
and 6,117,635; Tyagi and Kramer, Nature Biotech., 14:303-309,
1996). Any method suitable for single cell analysis of gene or
protein expression can be used, including in situ hybridization,
immunocytochemistry, MACS, FACS, flow cytometry, etc. For single
cell assays, expression products can be measured using antibodies,
PCR, or other types of nucleic acid amplification (e.g., Brady et
al., Methods Mol. & Cell. Biol. 2, 17-25, 1990; Eberwine et
al., 1992, Proc. Natl. Acad. Sci., 89, 3010-3014, 1992; U.S. Pat.
No. 5,723,290). These and other methods can be carried out
conventionally, e.g., as described in the mentioned
publications.
[0077] Many of such methods may require that the polynucleotide is
labeled, or comprises a particular nucleotide type useful for
detection. The present invention includes such modified
polynucleotides that are necessary to carry out such methods. Thus,
polynucleotides can be DNA, RNA, DNA:RNA hybrids, PNA, etc., and
can comprise any modification or substituent which is effective to
achieve detection.
[0078] Detection can be desirable for a variety of different
purposes, including research, diagnostic, prognostic, and forensic.
For diagnostic purposes, it may be desirable to identify the
presence or quantity of a polynucleotide sequence in a sample,
where the sample is obtained from tissue, cells, body fluids, etc.
In a preferred method as described in more detail below, the
present invention relates to a method of detecting a polynucleotide
comprising, contacting a target polynucleotide in a test sample
with a polynucleotide probe under conditions effective to achieve
hybridization between the target and probe; and detecting
hybridization.
[0079] Any test sample in which it is desired to identify a
polynucleotide or polypeptide thereof can be used, including, e.g.,
blood, urine, saliva, stool (for extracting nucleic acid, see,
e.g., U.S. Pat. No. 6,177,251), swabs comprising tissue, biopsied
tissue, tissue sections, cultured cells, etc.
[0080] Detection can be accomplished in combination with
polynucleotide probes for other genes, e.g., genes which are
expressed in other disease states, tissues, cells, such as brain,
heart, kidney, spleen, thymus, liver, stomach, small intestine,
colon, muscle, lung, testis, placenta, pituitary, thyroid, skin,
adrenal gland, pancreas, salivary gland, uterus, ovary, prostate
gland, peripheral blood cells (T-cells, lymphocytes, etc.), embryo,
normal breast fat, adult and embryonic stem cells, specific
cell-types, such as endothelial, epithelial, myocytes, adipose,
luminal epithelial, basoepithelial, myoepithelial, stromal cells,
etc.
[0081] Polynucleotides can be used in wide range of methods and
compositions, including for detecting, diagnosing, staging,
grading, assessing, prognosticating, etc. diseases and disorders
associated with KSE336, for monitoring or assessing therapeutic
and/or preventative measures, in ordered arrays, etc. Any method of
detecting genes and polynucleotides of SEQ ID NO 1-6 can be used;
certainly, the present invention is not to be limited how such
methods are implemented.
[0082] Along these lines, the present invention relates to methods
of detecting KSE336 in a sample comprising nucleic acid. Such
methods can comprise one or more the following steps in any
effective order, e.g., contacting said sample with a polynucleotide
probe under conditions effective for said probe to hybridize
specifically to nucleic acid in said sample, and detecting the
presence or absence of probe hybridized to nucleic acid in said
sample, wherein said probe is a polynucleotide which is SEQ ID NO
1-6, a polynucleotide having, e.g., about 70%, 80%, 85%, 90%, 95%,
99%, or more sequence identity thereto, effective or specific
fragments thereof, or complements thereto. The detection method can
be applied to any sample, e.g., cultured primary, secondary, or
established cell lines, tissue biopsy, blood, urine, stool, and
other bodily fluids, for any purpose.
[0083] Contacting the sample with probe can be carried out by any
effective means in any effective environment. It can be
accomplished in a solid, liquid, frozen, gaseous, amorphous,
solidified, coagulated, colloid, etc., mixtures thereof, matrix.
For instance, a probe in an aqueous medium can be contacted with a
sample which is also in an aqueous medium, or which is affixed to a
solid matrix, or vice-versa.
[0084] Generally, as used throughout the specification, the term
"effective conditions" means, e.g., the particular milieu in which
the desired effect is achieved. Such a milieu, includes, e.g.,
appropriate buffers, oxidizing agents, reducing agents, pH,
co-factors, temperature, ion concentrations, suitable age and/or
stage of cell (such as, in particular part of the cell cycle, or at
a particular stage where particular genes are being expressed)
where cells are being used, culture conditions (including
substrate, oxygen, carbon dioxide, etc.). When hybridization is the
chosen means of achieving detection, the probe and sample can be
combined such that the resulting conditions are functional for said
probe to hybridize specifically to nucleic acid in said sample.
[0085] The phrase "hybridize specifically" indicates that the
hybridization between single-stranded polynucleotides is based on
nucleotide sequence complementarity. The effective conditions are
selected such that the probe hybridizes to a preselected and/or
definite target nucleic acid in the sample. For instance, if
detection of a polynucleotide set forth in SEQ ID NO 1-6 is
desired, a probe can be selected which can hybridize to such target
gene under high stringent conditions, without significant
hybridization to other genes in the sample. To detect homologs of a
polynucleotide set forth in SEQ ID NO 1 and 2, the effective
hybridization conditions can be less stringent, and/or the probe
can comprise codon degeneracy, such that a homolog is detected in
the sample.
[0086] As already mentioned, the methods can be carried out by any
effective process, e.g., by Northern blot analysis, polymerase
chain reaction (PCR), reverse transcriptase PCR, RACE PCR, in situ
hybridization, etc., as indicated above. When PCR based techniques
are used, two or more probes are generally used. One probe can be
specific for a defined sequence which is characteristic of a
selective polynucleotide, but the other probe can be specific for
the selective polynucleotide, or specific for a more general
sequence, e.g., a sequence such as polyA which is characteristic of
mRNA, a sequence which is specific for a promoter, ribosome binding
site, or other transcriptional features, a consensus sequence
(e.g., representing a functional domain). For the former aspects,
5' and 3' probes (e.g., polyA, Kozak, etc.) are preferred which are
capable of specifically hybridizing to the ends of transcripts.
When PCR is utilized, the probes can also be referred to as
"primers" in that they can prime a DNA polymerase reaction.
[0087] In addition to testing for the presence or absence of
polynucleotides, the present invention also relates to determining
the amounts at which polynucleotides of the present invention are
expressed in sample and determining the differential expression of
such polynucleotides in samples. Such methods can involve
substantially the same steps as described above for
presence/absence detection, e.g., contacting with probe,
hybridizing, and detecting hybridized probe, but using more
quantitative methods and/or comparisons to standards.
[0088] The amount of hybridization between the probe and target can
be determined by any suitable methods, e.g., PCR, RT-PCR, RACE PCR,
Northern blot, polynucleotide microarrays, Rapid-Scan, etc., and
includes both quantitative and qualitative measurements. For
further details, see the hybridization methods described above and
below. Determining by such hybridization whether the target is
differentially expressed (e.g., up-regulated or down-regulated) in
the sample can also be accomplished by any effective means. For
instance, the target's expression pattern in the sample can be
compared to its pattern in a known standard, such as in a normal
tissue, or it can be compared to another gene in the same sample.
When a second sample is utilized for the comparison, it can be a
sample of normal tissue that is known not to contain diseased
cells. The comparison can be performed on samples which contain the
same amount of RNA (such as polyadenylated RNA or total RNA), or,
on RNA extracted from the same amounts of starting tissue. Such a
second sample can also be referred to as a control or standard.
Hybridization can also be compared to a second target in the same
tissue sample. Experiments can be performed that determine a ratio
between the target nucleic acid and a second nucleic acid (a
standard or control), e.g., in a normal tissue. When the ratio
between the target and control are substantially the same in a
normal and sample, the sample is determined or diagnosed not to
contain cells. However, if the ratio is different between the
normal and sample tissues, the sample is determined to contain
cancer cells. The approaches can be combined, and one or more
second samples, or second targets can be used. Any second target
nucleic acid can be used as a comparison, including "housekeeping"
genes, such as beta-actin, alcohol dehydrogenase, or any other gene
whose expression does not vary depending upon the disease status of
the cell.
[0089] Methods of Identifying Polymorphisms, Mutations, etc., of
KSE336
[0090] Polynucleotides of the present invention can also be
utilized to identify mutant alleles, SNPs, gene rearrangements and
modifications, and other polymorphisms of the wild-type gene.
Mutant alleles, polymorphisms, SNPs, etc., can be identified and
isolated from cancers that are known, or suspected to have, a
genetic component. Identification of such genes can be carried out
routinely (see, above for more guidance), e.g., using PCR,
hybridization techniques, direct sequencing, mismatch reactions
(see, e.g., above), RFLP analysis, SSCP (e.g., Orita et al., Proc.
Natl. Acad. Sci., 86:2766, 1992), etc., where a polynucleotide
having a sequence selected from SEQ ID NO 1 and 2 is used as a
probe. The selected mutant alleles, SNPs, polymorphisms, etc., can
be used diagnostically to determine whether a subject has, or is
susceptible to a disorder associated with KSE336, as well as to
design therapies and predict the outcome of the disorder. Methods
involve, e.g., diagnosing a disorder associated with KSE336,
comprising, detecting the presence of a mutation in a gene
represented by a polynucleotide selected from SEQ ID NO 1 and 2.
The detecting can be carried out by any effective method, e.g.,
obtaining cells from a subject, determining the gene sequence or
structure of a target gene (using, e.g., mRNA, cDNA, genomic DNA,
etc), comparing the sequence or structure of the target gene to the
structure of the normal gene, whereby a difference in sequence or
structure indicates a mutation in the gene in the subject.
Polynucleotides can also be used to test for mutations, SNPs,
polymorphisms, etc., e.g., using mismatch DNA repair technology as
described in U.S. Pat. No. 5,683,877; U.S. Pat. No. 5,656,430; Wu
et al., Proc. Natl. Acad. Sci., 89:8779-8783, 1992.
[0091] The present invention also relates to methods of detecting
polymorphisms in KSE336, comprising, e.g., comparing the structure
of: genomic DNA comprising all or part of KSE336, mRNA comprising
all or part of KSE336, cDNA comprising all or part of KSE336, or a
polypeptide comprising all or part of KSE336, with the structure of
KSE336 set forth in SEQ ID NO 1-6. The methods can be carried out
on a sample from any source, e.g., cells, tissues, body fluids,
blood, urine, stool, hair, egg, sperm, etc.
[0092] These methods can be implemented in many different ways. For
example, "comparing the structure" steps include, but are not
limited to, comparing restriction maps, nucleotide sequences, amino
acid sequences, RFLPs, Dnase sites, DNA methylation fingerprints
(e.g., U.S. Pat. No. 6,214,556), protein cleavage sites, molecular
weights, electrophoretic mobilities, charges, ion mobility, etc.,
between a standard KSE336 and a test KSE336. The term "structure"
can refer to any physical characteristics or configurations which
can be used to distinguish between nucleic acids and polypeptides.
The methods and instruments used to accomplish the comparing step
depends upon the physical characteristics which are to be compared.
Thus, various techniques are contemplated, including, e.g.,
sequencing machines (both amino acid and polynucleotide),
electrophoresis, mass spectrometer (U.S. Pat. Nos. 6,093,541,
6,002,127), liquid chromatography, HPLC, etc.
[0093] To carry out such methods, "all or part" of the gene or
polypeptide can be compared. For example, if nucleotide sequencing
is utilized, the entire gene can be sequenced, including promoter,
introns, and exons, or only parts of it can be sequenced and
compared, e.g., exon 1, exon 2, etc.
[0094] Mutagenesis
[0095] Mutated polynucleotide sequences of the present invention
are useful for various purposes, e.g., to create mutations of the
polypeptides they encode, to identify functional regions of genomic
DNA, to produce probes for screening libraries, etc. Mutagenesis
can be carried out routinely according to any effective method,
e.g., oligonucleotide-directed (Smith, M., Ann. Rev. Genet.
19:423-463, 1985), degenerate oligonucleotide-directed (Hill et
al., Method Enzymology, 155:558-568, 1987), region-specific (Myers
et al., Science, 229:242-246, 1985; Derbyshire et al., Gene,
46:145, 1986; Ner et al., DNA, 7:127, 1988), linker-scanning
(McKnight and Kingsbury, Science, 217:316-324, 1982), directed
using PCR, recursive ensemble mutagenesis (Arkin and Yourvan, Proc.
Natl. Acad. Sci., 89:7811-7815, 1992), random mutagenesis (e.g.,
U.S. Pat. Nos. 5,096,815; 5,198,346; and 5,223,409), site-directed
mutagenesis (e.g., Walder et al., Gene, 42:133, 1986; Bauer et al.,
Gene, 37:73, 1985; Craik, Bio Techniques, Jan. 12-19, 1985; Smith
et al., Genetic Engineering: Principles and Methods, Plenum Press,
1981), phage display (e.g., Lowman et al., Biochem. 30:10832-10837,
1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO
Publication WO 92/06204), etc. Desired sequences can also be
produced by the assembly of target sequences using mutually priming
oligonucleotides (Uhlmann, Gene, 71:29-40, 1988). For directed
mutagenesis methods, analysis of the three-dimensional structure of
the KSE336 polypeptide can be used to guide and facilitate making
mutants which effect polypeptide activity. Sites of
substrate-enzyme interaction or other biological activities can
also be determined by analysis of crystal structure as determined
by such techniques as nuclear magnetic resonance, crystallography
or photoaffinity labeling. See, for example, de Vos et al., Science
255:306-312, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992;
Wlodaver et al., FEBS Lett. 309:59-64, 1992.
[0096] In addition, libraries of KSE336 and fragments thereof can
be used for screening and selection of KSE336 variants. For
instance, a library of coding sequences can be generated by
treating a double-stranded DNA with a nuclease under conditions
where the nicking occurs, e.g., only once per molecule, denaturing
the double-stranded DNA, renaturing it to for double-stranded DNA
that can include sense/antisense pairs from different nicked
products, removing single-stranded portions from reformed duplexes
by treatment with S1 nuclease, and ligating the resulting DNAs into
an expression vecore. By this method, xpression libraries can be
made comprising "mutagenized" KSE336. The entire coding sequence or
parts thereof can be used.
[0097] Polynucleotide Expression, Polypeptides Produced Thereby,
and Specific-Binding Partners Thereto.
[0098] A polynucleotide according to the present invention can be
expressed in a variety of different systems, in vitro and in vivo,
according to the desired purpose. For example, a polynucleotide can
be inserted into an expression vector, introduced into a desired
host, and cultured under conditions effective to achieve expression
of a polypeptide coded for by the polynucleotide, to search for
specific binding partners. Effective conditions include any culture
conditions which are suitable for achieving production of the
polypeptide by the host cell, including effective temperatures, pH,
medium, additives to the media in which the host cell is cultured
(e.g., additives which amplify or induce expression such as
butyrate, or methotrexate if the coding polynucleotide is adjacent
to a dhfr gene), cycloheximide, cell densities, culture dishes,
etc. A polynucleotide can be introduced into the cell by any
effective method including, e.g., naked DNA, calcium phosphate
precipitation, electroporation, injection, DEAE-Dextran mediated
transfection, fusion with liposomes, association with agents which
enhance its uptake into cells, viral transfection. A cell into
which a polynucleotide of the present invention has been introduced
is a transformed host cell. The polynucleotide can be
extrachromosomal or integrated into a chromosome(s) of the host
cell. It can be stable or transient. An expression vector is
selected for its compatibility with the host cell. Host cells
include, mammalian cells, e.g., COS, CV1, BHK, CHO, HeLa, LTK, NIH
3T3, CNS neural stem cells (e.g., U.S. Pat. No. 6,103,530), IMR-32,
A172 (ATCC CRL-1620), T98G (ATCC CRL-1690), CCF-STTGI (ATCC
CRL-1718), DBTRG-05MG (ATCC CRL-2020), PFSK-1 (ATCC CRL-2060),
SK-N-AS and other SK cell lines (ATCC CRL-2137), CHP-212 (ATCC
CRL-2273), RG2 (ATCC CRL-2433), HCN-2 (ATCC CRL-10742), U-87 MG and
other U MG cell lines (ATCC HTB-14), D283 Med (ATCC HTB-185), PC12,
Neuro-2a (ATCC CCL-131), insulinoma cell lines, INS-HI, MIN6N8,
RIN-5AH, RIN-A12, RINm5F, capan-1, capan-2, MIA PaCa-2 (ATCC
CRL-1420), PANC-1 (ATCC CRL-1469), AsPC-1 (ATCC CRL-1682), SU-86.86
(ATCC CRL-1837), CFPAC-1 (ATCC CRL-1918), HPAF-II (ATCC CRL-1937),
TGP61 (ATCC CRL-2135) and other TGP lines, SW 1990 (ATCC CRL-2172),
Mpanc-96 (ATCC CRL-2380), MS1 VEGF (ATCC CRL-2460), Beta-TC-6 (ATCC
CRL-11506), LTPA (ATCC CRL-2389), 266-6 (ATCC CRL-2151), MS1 (ATCC
CRL-2779), SVR (ATCC CRL-2280), NIT-2 (ATCC CRL-2364), alphaTC1
Clone 9 (ATCC CRL-2350), ATCC CRL-1492, BxPC-3 (ATCC CRL-1687),
HPAC (ATCC CRL-2119), U.S. Pat. Nos. 6,110743, 5,928,942,
5,888,816, 5,888,705, and 5,723,333, etc., insect cells, such as
Sf9 (S. frugipeda) and Drosophila, bacteria, such as E. coli,
Streptococcus, bacillus, yeast, such as Sacharomyces, S.
cerevisiae, fungal cells, plant cells, embryonic or adult stem
cells (e.g., mammalian, such as mouse or human), pluripotent cells,
etc.
[0099] Expression control sequences are similarly selected for host
compatibility and a desired purpose, e.g., high copy number, high
amounts, induction, amplification, controlled expression. Other
sequences which can be employed include enhancers such as from
SV40, CMV, RSV, inducible promoters, cell-type specific elements,
or sequences which allow selective or specific cell expression.
Promoters that can be used to drive its expression, include, e.g.,
the endogenous promoter, MMTV, SV40, trp, lac, tac, or T7 promoters
for bacterial hosts; or alpha factor, alcohol oxidase, or PGH
promoters for yeast. RNA promoters can be used to produced RNA
transcripts, such as T7 or SP6. See, e.g., Melton et al.,
Polynucleotide Res., 12(18):7035-7056, 1984; Dunn and Studier. J.
Mol. Bio., 166:477-435, 1984; U.S. Pat. No. 5,891,636; Studier et
al., Gene Expression Technology, Methods in Enzymology, 85:60-89,
1987. In addition, as discussed above, translational signals
(including in-frame insertions) can be included.
[0100] When a polynucleotide is expressed as a heterologous gene in
a transfected cell line, the gene is introduced into a cell as
described above, under effective conditions in which the gene is
expressed. The term "heterologous" means that the gene has been
introduced into the cell line by the "hand-of-man." Introduction of
a gene into a cell line is discussed above. The transfected (or
transformed) cell expressing the gene can be lysed or the cell line
can be used intact.
[0101] For expression and other purposes, a polynucleotide can
contain codons found in a naturally-occurring gene, transcript, or
CDNA, for example, e.g., as set forth in SEQ ID NO 1 and 2, or it
can contain degenerate codons coding for the same amino acid
sequences. For instance, it may be desirable to change the codons
in the sequence to optimize the sequence for expression in a
desired host. See, e.g., U.S. Pat. Nos. 5,567,600 and
5,567,862.
[0102] A polypeptide according to the present invention can be
recovered from natural sources, transformed host cells (culture
medium or cells) according to the usual methods, including,
detergent extraction (e.g., non-ionic detergent, Triton X-100,
CHAPS, octylglucoside, Igepa1 CA-630), ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, hydroxyapatite chromatography, lectin
chromatography, gel electrophoresis. Protein refolding steps can be
used, as necessary, in completing the configuration of the mature
protein. Finally, high performance liquid chromatography (HPLC) can
be employed for purification steps. Another approach is express the
polypeptide recombinantly with an affinity tag (Flag epitope, HA
epitope, myc epitope, 6xHis, maltose binding protein, chitinase,
etc) and then purify by anti-tag antibody-conjugated affinity
chromatography.
[0103] The present invention also relates to antibodies, and other
specific-binding partners, which are specific for polypeptides
encoded by polynucleotides of the present invention, e.g., KSE336.
Antibodies, e.g., polyclonal, monoclonal, recombinant, chimeric,
humanized, single-chain, Fab, and fragments thereof, can be
prepared according to any desired method. See, also, screening
recombinant immunoglobulin libraries (e.g., Orlandi et al., Proc.
Natl. Acad. Sci., 86:3833-3837, 1989; Huse et al., Science,
256:1275-1281, 1989); in vitro stimulation of lymphocyte
populations; Winter and Milstein, Nature, 349: 293-299, 1991. The
antibodies can be IgM, IgG, subtypes, IgG2a, IgG1, etc. Antibodies,
and immune responses, can also be generated by administering naked
DNA See, e.g., U.S. Pat. Nos. 5,703,055; 5,589,466; 5,580,859.
Antibodies can be used from any source, including, goat, rabbit,
mouse, chicken (e.g., IgY; see, Duan, WO/029444 for methods of
making antibodies in avian hosts, and harvesting the antibodies
from the eggs). An antibody specific for a polypeptide means that
the antibody recognizes a defined sequence of amino acids within or
including the polypeptide. Other specific binding partners include,
e.g., aptamers and PNA. antibodies can be prepared against specific
epitopes or domains of KSE336, e.g., SEQ ID NO 4. The preparation
of polyclonal antibodies is well-known to those skilled in the art.
See, for example, Green et al., Production of Polyclonal Antisera,
in IMMUNOCHEMICAL PROTOCOLS (Manson, ed.), pages 1-5 (Humana Press
1992); Coligan et al., Production of Polyclonal Antisera in
Rabbits, Rats, Mice and Hamsters, in CURRENT PROTOCOLS IN
IMMUNOLOGY, section 2.4.1 (1992). The preparation of monoclonal
antibodies likewise is conventional. See, for example, Kohler &
Milstein, Nature 256:495 (1975); Coligan et al., sections
2.5.1-2.6.7; and Harlow et al., ANTIBODIES: A LABORATORY MANUAL,
page 726 (Cold Spring Harbor Pub. 1988).
[0104] Antibodies can also be humanized, e.g., where they are to be
used therapeutically. Humanized monoclonal antibodies are produced
by transferring mouse complementarity determining regions from
heavy and light variable chains of the mouse immunoglobulin into a
human variable domain, and then substituting human residues in the
framework regions of the murine counterparts. The use of antibody
components derived from humanized monoclonal antibodies obviates
potential problems associated with the immunogenicity of murine
constant regions. General techniques for cloning murine
immunoglobulin variable domains are described, for example, by
Orlandi et al., Proc. Nat'l Acad. Sci. USA 86:3833 (1989), which is
hereby incorporated in its entirety by reference. Techniques for
producing humanized monoclonal antibodies are described, for
example, in U.S. Pat. No. 6,054,297, Jones et al., Nature 321: 522
(1986); Riechmann et al., Nature 332: 323 (1988); Verhoeyen et al.,
Science 239: 1534 (1988); Carter et al., Proc. Nat'l Acad. Sci. USA
89: 4285 (1992); Sandhu, Crit. Rev. Biotech. 12: 437 (1992); and
Singer et al., J. Immunol. 150: 2844 (1993).
[0105] Antibodies of the invention also may be derived from human
antibody fragments isolated from a combinatorial immunoglobulin
library. See, for example, Barbas et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 119 (1991); Winter et al., Ann.
Rev. Immunol. 12: 433 (1994). Cloning and expression vectors that
are useful for producing a human immunoglobulin phage library can
be obtained commercially, for example, from STRATAGENE Cloning
Systems (La Jolla, Calif.).
[0106] In addition, antibodies of the present invention may be
derived from a human monoclonal antibody. Such antibodies are
obtained from transgenic mice that have been "engineered" to
produce specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy and light
chain loci are introduced into strains of mice derived from
embryonic stem cell lines that contain targeted disruptions of the
endogenous heavy and light chain loci. The transgenic mice can
synthesize human antibodies specific for human antigens and can be
used to produce human antibody-secreting hybridomas. Methods for
obtaining human antibodies from transgenic mice are described,
e.g., in Green et al., Nature Genet. 7:13 (1994); Lonberg et al.,
Nature 368:856 (1994); and Taylor et al., Int. Immunol. 6:579
(1994).
[0107] Antibody fragments of the present invention can be prepared
by proteolytic hydrolysis of the antibody or by expression in E.
coli of nucleic acid encoding the fragment. Antibody fragments can
be obtained by pepsin or papain digestion of whole antibodies by
conventional methods. For example, antibody fragments can be
produced by enzymatic cleavage of antibodies with pepsin to provide
a 5S fragment denoted F(ab').sub.2. This fragment can be further
cleaved using a thiol reducing agent, and optionally a blocking
group for the sulfhydryl groups resulting from cleavage of
disulfide linkages, to produce 3.5S Fab' monovalent fragments.
Alternatively, an enzymatic cleavage using pepsin produces two
monovalent Fab' fragments and an Fc fragment directly. These
methods are described, for example, by Goldenberg, U.S. Pat. Nos.
4,036,945 and 4,331,647, and references contained therein. These
patents are hereby incorporated in their entireties by reference.
See also Nisoiihoff et al., Arch. Biochem. Biophys. 89:230 (1960);
Porter, Biochem. J. 73:119 (1959); Edelman et al, METHODS IN
ENZYMOLOGY, VOL. 1, page 422 (Academic Press 1967); and Coligan et
al. at sections 2.8.1-2.8.10 and 2.10.1-2.10.4.
[0108] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical, or
genetic techniques can also be used. For example, Fv fragments
comprise an association of V.sub.H and V.sub.L chains. This
association may be noncovalent, as described in Inbar et al., Proc.
Nat'l Acad. Sci. USA 69:2659 (1972). Alternatively, the variable
chains can be linked by an intermolecular disulfide bond or
cross-linked by chemicals such as glutaraldehyde. See, e.g.,
Sandhu, supra. Preferably, the Fv fragments comprise V.sub.H and
V.sub.L chains connected by a peptide linker. These single-chain
antigen binding proteins (sFv) are prepared by constructing a
structural gene comprising nucleic acid sequences encoding the
V.sub.H and V.sub.L domains connected by an oligonucleotide. The
structural gene is inserted into an expression vector, which is
subsequently introduced into a host cell such as E. coli. The
recombinant host cells synthesize a single polypeptide chain with a
linker peptide bridging the two V domains. Methods for producing
sFvs are described, for example, by Whitlow et al., METHODS: A
COMPANION TO METHODS IN ENZYMOLOGY, VOL. 2, page 97 (1991); Bird et
al.,Science 242:423-426 (1988); Ladneret al., U.S. Pat. No.
4,946,778; Pack et al., Bio/Technology 11: 1271-77 (1993); and
Sandhu, supra.
[0109] Another form of an antibody fragment is a peptide coding for
a single complementarity-determining region (CDR). CDR peptides
("minimal recognition units") can be obtained by constructing genes
encoding the CDR of an antibody of interest. Such genes are
prepared, for example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-producing
cells. See, for example, Larrick et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 106 (1991).
[0110] The term "antibody" as used herein includes intact molecules
as well as fragments thereof, such as Fab, F(ab')2, and Fv which
are capable of binding to an epitopic determinant present in Binl
polypeptide. Such antibody fragments retain some ability to
selectively bind with its antigen or receptor. The term "epitope"
refers to an antigenic determinant on an antigen to which the
paratope of an antibody binds. Epitopic determinants usually
consist of chemically active surface groupings of molecules such as
amino acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. Antibodies can be prepared against specific
epitopes or polypeptide domains.
[0111] Antibodies which bind to KSE336 polypeptides of the present
invention can be prepared using an intact polypeptide or fragments
containing small peptides of interest as the immunizing antigen.
For example, it may be desirable to produce antibodies that
specifically bind to the N- or C-terminal domains of KSE336. The
polypeptide or peptide used to immunize an animal which is derived
from translated cDNA or chemically synthesized which can be
conjugated to a carrier protein, if desired. Such commonly used
carriers which are chemically coupled to the immunizing peptide
include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine
serum albumin (BSA), and tetanus toxoid.
[0112] Polyclonal or monoclonal antibodies can be further purified,
for example, by binding to and elution from a matrix to which the
polypeptide or a peptide to which the antibodies were raised is
bound. Those of skill in the art will know of various techniques
common in the immunology arts for purification and/or concentration
of polyclonal antibodies, as well as monoclonal antibodies (See for
example, Coligan, et al., Unit 9, Current Protocols in Immunology,
Wiley Interscience, 1994, incorporated by reference).
[0113] Anti-idiotype technology can also be used to produce
invention monoclonal antibodies which mimic an epitope. For
example, an anti-idiotypic monoclonal antibody made to a first
monoclonal antibody will have a binding domain in the hypervariable
region which is the "image" of the epitope bound by the first
monoclonal antibody.
[0114] Methods of Detecting Polypeptides
[0115] Polypeptides coded for by KSE336 of the present invention
can be detected, visualized, determined, quantitated, etc.
according to any effective method. useful methods include, e.g.,
but are not limited to, immunoassays, RIA (radioimmunassay), ELISA,
(enzyme-linked-immunosorbent assay), immunoflourescence, flow
cytometry, histology, electron microscopy, light microscopy, in
situ assays, immunoprecipitation, Western blot, etc.
[0116] Immunoassays may be carried in liquid or on biological
support. For instance, a sample (e.g., blood, stool, urine, cells,
tissue, body fluids, etc.) can be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support that is capable of
immobilizing cells, cell particles or soluble proteins. The support
may then be washed with suitable buffers followed by treatment with
the detectably labeled KSE336 specific antibody. The solid phase
support can then be washed with a buffer a second time to remove
unbound antibody. The amount of bound label on solid support may
then be detected by conventional means.
[0117] A "solid phase support or carrier" includes any support
capable of binding an antigen, antibody, or other specific binding
partner. Supports or carriers include glass, polystyrene,
polypropylene, polyethylene, dextran, nylon, amylases, natural and
modified celluloses, polyacrylamides, and magnetite. A support
material can have any structural or physical configuration. Thus,
the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads
[0118] One of the many ways in which gene peptide-specific antibody
can be detectably labeled is by linking it to an enzyme and using
it in an enzyme immunoassay (EIA). See, e.g., Voller, A., "The
Enzyme Linked Immunosorbent Assay (ELISA)," 1978, Diagnostic
Horizons 2, 1-7, Microbiological Associates Quarterly Publication,
Walkersville, Md.); Voller, A. et al., 1978, J. Clin. Pathol. 31,
507-520; Butler, J. E., 1981, Meth. Enzymol. 73, 482-523; Maggio,
E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, Fla. The
enzyme which is bound to the antibody will react with an
appropriate substrate, preferably a chromogenic substrate, in such
a manner as to produce a chemical moiety that can be detected, for
example, by spectrophotometric, fluorimetric or by visual means.
Enzymes that can be used to detectably label the antibody include,
but are not limited to, malate dehydrogenase, staphylococcal
nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase,
.alpha.-glycerophosphate, dehydrogenase, triose phosphate
isomerase, horseradish peroxidase, alkaline phosphatase,
asparaginase, glucose oxidase, .beta.-galactosidase, ribonuclease,
urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase
and acetylcholinesterase. The detection can be accomplished by
colorimetric methods that employ a chromogenic substrate for the
enzyme. Detection may also be accomplished by visual comparison of
the extent of enzymatic reaction of a substrate in comparison with
similarly prepared standards.
[0119] Detection may also be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect KSE336
peptides through the use of a radioimmunoassay (RIA). See, e.g.,
Weintraub, B., Principles of Radioimmunoassays, Seventh Training
Course on Radioligand Assay Techniques, The Endocrine Society,
March, 1986. The radioactive isotope can be detected by such means
as the use of a gamma counter or a scintillation counter or by
autoradiography.
[0120] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and
fluorescamine. The antibody can also be detectably labeled using
fluorescence emitting metals such as those in the lanthanide
series. These metals can be attached to the antibody using such
metal chelating groups as diethylenetriaminepentacetic acid (DTPA)
or ethylenediaminetetraacetic acid (EDTA).
[0121] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of useful chemiluminescent labeling
compounds are luminol, isoluminol, theromatic acridinium ester,
imidazole, acridinium salt and oxalate ester.
[0122] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
[0123] Diagnostic
[0124] The present invention also relates to methods and
compositions for diagnosing a brain or pancreas disorder, or
determining whether a subject is susceptible to such a disorder,
using polynucleotides, polypeptides, and specific-binding partners
of the present invention to detect, assess, determine, etc.,
KSE336. In such methods, the gene can serve as a marker for the
disorder, e.g., where the gene, when mutant, is a direct cause of
the disorder; where the gene is affected by another gene(s) which
is directly responsible for the disorder, e.g., when the gene is
part of the same signaling pathway as the directly responsible
gene; and, where the gene is chromosomally linked to the gene(s)
directly responsible for the disorder, and segregates with it. Many
other situations are possible. To detect, assess, determine, etc.,
a probe specific for the gene can be employed as described above
and below. Any method of detecting and/or assessing the gene can be
used, including detecting expression of the gene using
polynucleotides, antibodies, or other specific-binding
partners.
[0125] The present invention relates to methods of diagnosing a
disorder associated with a disorder of KSE336, or determining
whether a subject is susceptible to such a disorder, comprising,
e.g., assessing the expression of KSE336 in a tissue sample
comprising tissue or cells suspected of having the disorder (e.g.,
where the sample comprises brain and pancreas). The phrase
"diagnosing" indicates that it is determined whether the sample has
the disorder. A "disorder" means, e.g., any abnormal condition as
in a disease or malady. "Determining a subject's susceptibility to
a disease or disorder" indicates that the subject is assessed for
whether s/he is predisposed to get such a disease or disorder,
where the predisposition is indicated by abnormal expression of the
gene (e.g., gene mutation, gene expression pattern is not normal,
etc.). Predisposition or susceptibility to a disease may result
when a such disease is influenced by epigenetic, environmental,
etc., factors.
[0126] By the phrase "assessing expression of KSE336," it is meant
that the functional status of the gene is evaluated. This includes,
but is not limited to, measuring expression levels of said gene,
determining the genomic structure of said gene, determining the
mRNA structure of transcripts from said gene, or measuring the
expression levels of polypeptide coded for by said gene. Thus, the
term "assessing expression" includes evaluating the all aspects of
the transcriptional and translational machinery of the gene. For
instance, if a promoter defect causes, or is suspected of causing,
the disorder, then a sample can be evaluated (i.e., "assessed") by
looking (e.g., sequencing or restriction mapping) at the promoter
sequence in the gene, by detecting transcription products (e.g.,
RNA), by detecting translation product (e.g., polypeptide). Any
measure of whether the gene is functional can be used, including,
polypeptide, polynucleotide, and functional assays for the gene's
biological activity.
[0127] In making the assessment, it can be useful to compare the
results to a normal gene, e.g., a gene which is not associated with
the disorder. The nature of the comparison can be determined
routinely, depending upon how the assessing is accomplished. If,
for example, the mRNA levels of a sample is detected, then the mRNA
levels of a normal can serve as a comparison, or a gene which is
known not to be affected by the disorder. Methods of detecting mRNA
are well known, and discussed above, e.g., but not limited to,
Northern blot analysis, polymerase chain reaction (PCR), reverse
transcriptase PCR, RACE PCR, etc. Similarly, if polypeptide
production is used to evaluate the gene, then the polypeptide in a
normal tissue sample can be used as a comparison, or, polypeptide
from a different gene whose expression is known not to be affected
by the disorder. These are only examples of how such a method could
be carried out.
[0128] Assessing the effects of therapeutic and preventative
interventions (e.g., administration of a drug, chemotherapy,
radiation, etc.) on brain and pancreas disorders is a major effort
in drug discovery, clinical medicine, and pharmacogenomics. The
evaluation of therapeutic and preventative measures, whether
experimental or already in clinical use, has broad applicability,
e.g., in clinical trials, for monitoring the status of a patient,
for analyzing and assessing animal models, and in any scenario
involving cancer treatment and prevention. Analyzing the expression
profiles of polynucleotides of the present invention can be
utilized as a parameter by which interventions are judged and
measured. Treatment of a disorder can change the expression profile
in some manner which is prognostic or indicative of the drug's
effect on it. Changes in the profile can indicate, e.g., drug
toxicity, return to a normal level, etc. Accordingly, the present
invention also relates to methods of monitoring or assessing a
therapeutic or preventative measure (e.g., chemotherapy, radiation,
anti-neoplastic drugs, antibodies, etc.) in a subject having a
brain and pancreas disorder, or, susceptible to such a disorder,
comprising, e.g., detecting the expression levels of KSE336. A
subject can be a cell-based assay system, non-human animal model,
human patient, etc. Detecting can be accomplished as described for
the methods above and below. By "therapeutic or preventative
intervention," it is meant, e.g., a drug administered to a patient,
surgery, radiation, chemotherapy, and other measures taken to
prevent, treat, or diagnose a disorder.
[0129] Expression can be assessed in any sample comprising any
tissue or cell type, body fluid, etc., as discussed for other
methods of the present invention, including cells from brain and
pancreas can be used, or cells derived from brain and pancreas. By
the phrase "cells derived from brain and pancreas," it is meant
that the derived cells originate from brain and pancreas, e.g.,
when metastasis from a primary tumor site has occurred, when a
progenitor-type or pluripotent cell gives rise to other cells,
etc.
[0130] Identifying Agent Methods
[0131] The present invention also relates to methods of identifying
agents that modulate the expression of KSE336 expressed in brain
and pancreas cells, comprising, in any effective order, one or more
of the following steps, e.g., contacting a cell population with a
test agent under conditions effective for said test agent to
modulate the expression of KSE336 in said cell population, and
determining whether said test agent modulates said KSE336. An agent
can modulate expression of KSE336 at any level, including
transcription, translation, and/or perdurance of the nucleic acid
or polypeptide (e.g., degradation, stability, etc.) product in the
cell.
[0132] Contacting the cell population with the test agent can be
accomplished by any suitable method and/or means that places the
agent in a position to functionally control expression of the
KSE336 present in cells within the population. Functional control
indicates that the agent can exert its physiological effect on the
cell through whatever mechanism it works. The choice of the method
and/or means can depend upon the nature of the agent and the
condition and type of the cell population (such as, in vivo, in
vitro, organ explants, etc.). For instance, if the cell population
is an in vitro cell culture, the agent can be contacted with the
cells by adding it directly into the culture medium. If the agent
cannot dissolve readily in an aqueous medium, it can be
incorporated into liposomes, or another lipophilic carrier, and
then administered to the cell culture. Contact can also be
facilitated by incorporation of agent with carriers and delivery
molecules and complexes, by injection, by infusion, etc.
[0133] After the agent has been administered in such a way that it
can gain access to the cells, it can be determined whether the test
agent modulates KSE336 expression. Modulation can be of any type,
quality, or quantity, e.g., increase, facilitate, enhance,
up-regulate, stimulate, activate, amplify, augment, induce,
decrease, down-regulate, diminish, lessen, reduce, etc. The
modulatory quantity can also encompass any value, e.g., 1%, 5%,
10%, 50%, 75%, 1-fold, 2-fold, 5-fold, 10-fold, 100-fold, etc. To
modulate KSE336 expression means, e.g., that the test agent has an
effect on its expression, e.g., to effect the amount of
transcription, to effect RNA splicing, to effect translation of the
RNA into polypeptide, to effect RNA or polypeptide stability, to
effect polyadenylation or other processing of the RNA, to effect
post-transcriptional or post-translational processing, etc.
[0134] A test agent can be of any molecular composition, e.g.,
chemical compounds, biomolecules, such as polypeptides, lipids,
nucleic acids (e.g., antisense to a polynucleotide sequence
selected from SEQ ID NO 1 and 2), carbohydrates, antibodies,
ribozymes, double-stranded RNA, etc. For example, if a gene to be
modulated is a cell-surface molecule, a test agent can be an
antibody that specifically recognizes it and leads to some effect
on its expression. An antibody can cause the polypeptide to be
internalized, leading to its down regulation on the surface of the
cell. Such an effect does not have to be permanent, but can require
the presence of the antibody to continue the down-regulatory
effect. Antisense KSE336 can also be used as test agents to
modulate gene expression.
[0135] Markers
[0136] The polynucleotides of the present invention can be used
with other markers, especially brain and pancreas markers, to
identity, detect, stage, diagnosis, determine, prognosticate,
treat, etc., tissue, diseases and conditions, etc, of the brain and
pancreas. Markers can be polynucleotides, polypeptides, antibodies,
ligands, specific binding partners, etc. The targets for such
markers include, but are not limited genes and polypeptides that
are selective for cell types present in the brain and pancreas.
Specific targets include, The targets for such markers include, but
are not limited, presenilins, genes and polypeptides in the
pathways for neurotransmitter synthesis, receptor, metabolism,
etc., (e.g., serotonin, MAO, dopamine, norephinephrine, nitric
oxide, etc.), apolipoprotein A, APP, neuron-specific enolase (NSE),
glial fibrillary acidic protein (GFAP), S100, GAP-43,
neuron-specific beta-III tubulin, Stac (neuron-specific protein
with an SH3 domain, e.g., Genomics, 47:140-2, 1998), myelin basic
protein, etc. vimentin, lannotti et al., Genomics, 46:520-524,
1997), ZG-46p (Chen et al., Eur. J. Cell. Biol., 3:205-214, 1997),
calretinin, islet amyloid pancreatic polypeptide, SLC26A6 (e.g., on
apical surface of pancreatic ductal cells), reg/PSP mutligene
family (e.g., Unno et al. J. Biol. Chem., 268:15974-82, 1993),
pancreatitis-associated proteins (e.g., Dusetti et al., Genomics,
19:108-114, 1994), PANC1A and PANC1B (U.S. Pat. No. 5,840,870),
antibodies (e.g., U.S. Pat. No. 5,888,813 and 5,622,837), INGAP
(U.S. Pat. No. 5,840,531), insulin, glucagons, etc.
[0137] Therapeutics
[0138] Selective polynucleotides, polypeptides, and
specific-binding partners thereto, can be utilized in therapeutic
applications, especially to treat diseases and conditions of brain
and pancreas. Useful methods include, but are not limited to,
immunotherapy (e.g., using specific-binding partners to
polypeptides), vaccination (e.g., using a selective polypeptide or
a naked DNA encoding such polypeptide), protein or polypeptide
replacement therapy, gene therapy (e.g., germ-line correction,
antisense), etc.
[0139] Various immunotherapeutic approaches can be used. For
instance, unlabeled antibody that specifically recognizes a
tissue-specific antigen can be used to stimulate the body to
destroy or attack the cancer, to cause down-regulation, to produce
complement-mediated lysis, to inhibit cell growth, etc., of target
cells which display the antigen, e.g., analogously to how c-erbB-2
antibodies are used to treat breast cancer. In addition, antibody
can be labeled or conjugated to enhance its deleterious effect,
e.g., with radionuclides and other energy emitting entitities,
toxins, such as ricin, exotoxin A (ETA), and diphtheria, cytotoxic
or cytostatic agents, immunomodulators, chemotherapeutic agents,
etc. See, e.g., U.S. Pat. No. 6,107,090.
[0140] An antibody or other specific-binding partner can be
conjugated to a second molecule, such as a cytotoxic agent, and
used for targeting the second molecule to a tissue-antigen positive
cell (Vitetta, E. S. et al., 1993, Immunotoxin therapy, in DeVita,
Jr., V. T. et al., eds, Cancer: Principles and Practice of
Oncology, 4th ed., J. B. Lippincott Co., Philadelphia, 2624-2636).
Examples of cytotoxic agents include, but are not limited to,
antimetabolites, alkylating agents, anthracyclines, antibiotics,
anti-mitotic agents, radioisotopes and chemotherapeutic agents.
Further examples of cytotoxic agents include, but are not limited
to ricin, doxorubicin, daunorubicin, taxol, ethidium bromide,
mitomycin, etoposide, tenoposide, vincristine, vinblastine,
colchicine, dihydroxy anthracin dione, actinomycin D,
1-dehydrotestosterone, diptheria toxin, Pseudomonas exotoxin (PE)
A, PE40, abrin, elongation factor-2 and glucocorticoid. Techniques
for conjugating therapeutic agents to antibodies are well.
[0141] In addition to immunotherapy, polynucleotides and
polypeptides can be used as targets for non-immunotherapeutic
applications, e.g., using compounds which interfere with function,
expression (e.g., antisense as a therapeutic agent), assembly, etc.
RNA interference can be used in vitro and in vivo to silence KSE336
when its expression contributes to a disease (but also for other
purposes, e.g., to identify the gene's function to change a
developmental pathway of a cell, etc.). See, e.g., Sharp and
Zamore, Science, 287:2431-2433, 2001; Grishok et al., Science,
287:2494, 2001.
[0142] Delivery of therapeutic agents can be achieved according to
any effective method, including, liposomes, viruses, plasmid
vectors, bacterial delivery systems, orally, systemically, etc.
[0143] In addition to therapeutics, per se, the present invention
also relates to methods of treating a disease of the brain,
pancreas, or progenitor tissue thereof showing altered expression
of KSE336, comprising, e.g., administering to a subject in need
thereof a therapeutic agent which is effective for regulating
expression of said KSE336 and/or which is effective in treating
said disease. The term "treating" is used conventionally, e.g., the
management or care of a subject for the purpose of combating,
alleviating, reducing, relieving, improving the condition of, etc.,
of a disease or disorder. Various disease can be treated,
including, but not limited to, astrocytoma, meningioma, pancreatic
adenocarcinoma, insulin-dependent diabetes mellitus 2 (IDDM2),
helicoid peripapillary chorioretinal degeneration (also known as
atrophia areata), Beckwith-Wiedemann syndrome, and congenital
hyperinsulinism.
[0144] By the phrase "altered expression," it is meant that the
disease is associated with a mutation in the gene, or any
modification to the gene (or corresponding product) which affects
its normal function. Thus, expression of KSE336 refers to, e.g.,
transcription, translation, splicing, stability of the mRNA or
protein product, activity of the gene product, differential
expression, etc.
[0145] Any agent which "treats" the disease can be used. Such an
agent can be one which regulates the expression of the KSE336.
Expression refers to the same acts already mentioned, e.g.
transcription, translation, splicing, stability of the mRNA or
protein product, activity of the gene product, differential
expression, etc. For instance, if the condition was a result of a
complete deficiency of the gene product, administration of gene
product to a patient would be said to treat the disease and
regulate the gene's expression. Many other possible situations are
possible, e.g., where the gene is aberrantly expressed, and the
therapeutic agent regulates the aberrant expression by restoring
its normal expression pattern.
[0146] Antisense
[0147] Antisense polynucleotide (e.g., RNA) can also be prepared
from a polynucleotide according to the present invention,
preferably an anti-sense to a sequence of SEQ ID NO 1 and 2.
Antisense polynucleotide can be used in various ways, such as to
regulate or modulate expression of the polypeptides they encode,
e.g., inhibit their expression, for in situ hybridization, for
therapeutic purposes, for making targeted mutations (in vivo,
triplex, etc.) etc. For guidance on administering and designing
anti-sense, see, e.g., U.S. Pat. Nos. 6,200,960, 6,200,807,
6,197,584, 6,190,869, 6,190,661, 6,187,587, 6,168,950, 6,153,595,
6,150,162, 6,133,246, 6,117,847, 6,096,722, 6,087,343, 6,040,296,
6,005,095, 5,998,383, 5,994,230, 5,891,725, 5,885,970, and
5,840,708. An antisense polynucleotides can be operably linked to
an expression control sequence. A total length of about 35 bp can
be used in cell culture with cationic liposomes to facilitate
cellular uptake, but for in vivo use, preferably shorter
oligonucleotides are administered, e.g. 25 nucleotides.
[0148] Antisense polynucleotides can comprise modified,
nonnaturally-occurring nucleotides and linkages between the
nucleotides (e.g., modification of the phosphate-sugar backbone;
methyl phosphonate, phosphorothioate, or phosphorodithioate
linkages; and 2'-O-methyl ribose sugar units), e.g., to enhance in
vivo or in vitro stability, to confer nuclease resistance, to
modulate uptake, to modulate cellular distribution and
compartmentalization, etc. Any effective nucleotide or modification
can be used, including those already mentioned, as known in the
art, etc., e.g., disclosed in U.S. Pat. Nos. 6,133,438; 6,127,533;
6,124,445; 6,121,437; 5,218,103 (e.g., nucleoside
thiophosphoramidites); 4,973,679; Sproat et al.,
"2'-O-Methyloligoribonucleotides: synthesis and applications,"
Oligonucleotides and Analogs A Practical Approach, Eckstein (ed.),
IRL Press, Oxford, 1991, 49-86; Iribarren et al., "2'O-Alkyl
Oligoribonucleotides as Antisense Probes," Proc. Natl. Acad. Sci.
USA, 1990, 87, 7747-7751; Cotton et al., "2'-O-methyl, 2'-O-ethyl
oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides
as inhibitors of the in vitro U7 snRNP-dependent mRNA processing
event," Nucl. Acids Res., 1991, 19, 2629-2635.
[0149] Arrays
[0150] The present invention also relates to an ordered array of
polynucleotide probes and specific-binding partners (e.g.,
antibodies) for detecting the expression of KSE336 in a sample,
comprising, one or more polynucleotide probes or specific binding
partners associated with a solid support, wherein each probe is
specific for KSE336, and the probes comprise a nucleotide sequence
of SEQ ID NO 1 and 2 which is specific for said gene, a nucleotide
sequence having sequence identity to SEQ ID NO 1 and 2 which is
specific for said gene or polynucleotide, or complements thereto,
or a specific-binding partner which is specific for KSE336.
[0151] The phrase "ordered array" indicates that the probes are
arranged in an identifiable or position-addressable pattern, e.g.,
such as the arrays disclosed in U.S. Pat. Nos. 6,156,501,
6,077,673, 6,054,270, 5,723,320, 5,700,637, WO09919711, WO00023803.
The probes are associated with the solid support in any effective
way. For instance, the probes can be bound to the solid support,
either by polymerizing the probes on the substrate, or by attaching
a probe to the substrate. Association can be, covalent,
electrostatic, noncovalent, hydrophobic, hydrophilic, noncovalent,
coordination, adsorbed, absorbed, polar, etc. When fibers or hollow
filaments are utilized for the array, the probes can fill the
hollow orifice, be absorbed into the solid filament, be attached to
the surface of the orifice, etc. Probes can be of any effective
size, sequence identity, composition, etc., as already
discussed.
[0152] Ordered arrays can further comprise polynucleotide probes or
specific-binding partners which are specific for other genes,
including genes specific for brain and pancreas or disorders
associated with brain and pancreas.
[0153] Transgenic Animals
[0154] The present invention also relates to transgenic animals
comprising KSE336 genes. Such genes, as discussed in more detail
below, include, but are not limited to, functionally-disrupted
genes, mutated genes, ectopically or selectively-expressed genes,
inducible or regulatable genes, etc. These transgenic animals can
be produced according to any suitable technique or method,
including homologous recombination, mutagenesis (e.g., ENU,
Rathkolb et al., Exp. Physiol., 85(6):635-644, 2000), and the
tetracycline-regulated gene expression system (e.g., U.S. Pat. No.
6,242,667). The term "gene" as used herein includes any part of a
gene, i.e., regulatory sequences, promoters, enhancers, exons,
introns, coding sequences, etc. The KSE336 nucleic acid present in
the construct or transgene can be naturally-occurring wild-type,
polymorphic, or mutated.
[0155] Along these lines, polynucleotides of the present invention
can be used to create transgenic animals, e.g. a non-human animal,
comprising at least one cell whose genome comprises a functional
disruption of KSE336. By the phrases "functional disruption" or
"functionally disrupted," it is meant that the gene does not
express a biologically-active product. It can be substantially
deficient in at least one functional activity coded for by the
gene. Expression of a polypeptide can be substantially absent,
i.e., essentially undetectable amounts are made. However,
polypeptide can also be made, but which is deficient in activity,
e.g., where only an amino-terminal portion of the gene product is
produced.
[0156] The transgenic animal can comprise one or more cells. When
substantially all its cells contain the engineered gene, it can be
referred to as a transgenic animal "whose genome comprises" the
engineered gene. This indicates that the endogenous gene loci of
the animal has been modified and substantially all cells contain
such modification.
[0157] Functional disruption of the gene can be accomplished in any
effective way, including, e.g., introduction of a stop codon into
any part of the coding sequence such that the resulting polypeptide
is biologically inactive (e.g., because it lacks a catalytic
domain, a ligand binding domain, etc.), introduction of a mutation
into a promoter or other regulatory sequence that is effective to
turn it off, or reduce transcription of the gene, insertion of an
exogenous sequence into the gene which inactivates it (e.g., which
disrupts the production of a biologically-active polypeptide or
which disrupts the promoter or other transcriptional machinery),
deletion of sequences from the KSE336 gene, etc. Examples of
transgenic animals having functionally disrupted genes are well
known, e.g., as described in U.S. Pat. Nos. 6,239,326, 6,225,525,
6,207,878, 6,194,633, 6,187,992, 6,180,849, 6,177,610, 6,100,445,
6,087,555, 6,080,910, 6,069,297, 6,060,642, 6,028,244, 6,013,858,
5,981,830, 5,866,760, 5,859,314, 5,850,004, 5,817,912, 5,789,654,
5,777,195, and 5,569,824. A transgenic animal which comprises the
functional disruption can also be referred to as a "knock-out"
animal, since the biological activity of its KSE336 genes has been
"knocked-out." Knock-outs can be homozygous or heterozygous.
[0158] For creating functional disrupted genes, and other gene
mutations, homologous recombination technology is of special
interest since it allows specific regions of the genome to be
targeted. Using homologous recombination methods, genes can be
specifically-inactivated, specific mutations can be introduced, and
exogenous sequences can be introduced at specific sites. These
methods are well known in the art, e.g., as described in the
patents above. See, also, Robertson, Biol. Reproduc.,
44(2):238-245, 1991. Generally, the genetic engineering is
performed in an embryonic stem (ES) cell, or other pluripotent cell
line (e.g., adult stem cells, EG cells), and that
genetically-modified cell (or nucleus) is used to create a whole
organism. Nuclear transfer can be used in combination with
homologous recombination technologies.
[0159] For example, the KSE336 locus can be disrupted in mouse ES
cells using a positive-negative selection method (e.g., Mansour et
al., Nature, 336:348-352, 1988). In this method, a targeting vector
can be constructed which comprises a part of the gene to be
targeted. A selectable marker, such as neomycin resistance genes,
can be inserted into a KSE336 exon present in the targeting vector,
disrupting it. When the vector recombines with the ES cell genome,
it disrupts the function of the gene. The presence in the cell of
the vector can be determined by expression of neomycin resistance.
See, e.g., U.S. Pat. No. 6,239,326. Cells having at least one
functionally disrupted gene can be used to make chimeric and
germline animals, e.g., animals having somatic and/or germ cells
comprising the engineered gene. Homozygous knock-out animals can be
obtained from breeding heterozygous knock-out animals. See, e.g.,
U.S. Pat. No. 6,225,525.
[0160] A transgenic animal, or animal cell, lacking one or more
functional KSE336 genes can be useful in a variety of applications,
including, as an animal model for brain and pancreas diseases, for
drug screening assays (e.g., for kinases other than KSE336; by
making a cell deficient in KSE336, the contribution of other
kinases can be specifically examined), as a source of tissues
deficient in KSE336 activity, and any of the utilities mentioned in
any issued U.S. Patent on transgenic animals, including, U.S. Pat.
Nos. 6,239,326, 6,225,525, 6,207,878, 6,194,633, 6,187,992,
6,180,849, 6,177,610, 6,100,445, 6,087,555, 6,080,910, 6,069,297,
6,060,642, 6,028,244, 6,013,858, 5,981,830, 5,866,760, 5,859,314,
5,850,004, 5,817,912, 5,789,654, 5,777,195, and 5,569,824. For
instance, KSE336 deficient animal cells can be utilized to study
kinase activities. Pancreas and brain cells display a variety of
enzyme activities which are responsive to extracellular and
intracellular signals. By knocking-out protein kinase activity,
e.g., one at a time, the physiological pathways using kinase
activity can be dissected out and identified.
[0161] The present invention also relates to non-human, transgenic
animal whose genome comprises recombinant KSE336 nucleic acid
operatively linked to an expression control sequence effective to
express said coding sequence, e.g., in pancreas and brain. Such a
transgenic animal can also be referred to as a "knock-in" animal
since an exogenous gene has been introduced, stably, into its
genome.
[0162] A recombinant KSE336 nucleic acid refers to a gene which has
been introduced into a target host cell and optionally modified,
such as cells derived from animals, plants, bacteria, yeast, etc. A
recombinant KSE336 includes completely synthetic nucleic acid
sequences, semi-synthetic nucleic acid sequences, sequences derived
from natural sources, and chimeras thereof. "Operable linkage" has
the meaning used through the specification, i.e., placed in a
functional relationship with another nucleic acid. When a gene is
operably linked to an expression control sequence, as explained
above, it indicates that the gene (e.g., coding sequence) is joined
to the expression control sequence (e.g., promoter) in such a way
that facilitates transcription and translation of the coding
sequence. As described above, the phrase "genome" indicates that
the genome of the cell has been modified. In this case, the
recombinant KSE336 has been stably integrated into the genome of
the animal. The KSE336 nucleic acid in operable linkage with the
expression control sequence can also be referred to as a construct
or transgene.
[0163] Any expression control sequence can be used depending on the
purpose. For instance, if selective expression is desired, then
expression control sequences which limit its expression can be
selected. These include, e.g., tissue or cell-specific promoters,
introns, enhancers, etc. For various methods of cell and
tissue-specific expression, see, e.g., U.S. Pat. Nos. 6,215,040,
6,210,736, and 6,153,427. These also include the endogenous
promoter, i.e., the coding sequence can be operably linked to its
own promoter. Inducible and regulatable promoters can also be
utilized.
[0164] The present invention also relates to a transgenic animal
which contains a functionally disrupted and a transgene stably
integrated into the animals genome. Such an animal can be
constructed using combinations any of the above- and
below-mentioned methods. Such animals have any of the
aforementioned uses, including permitting the knock-out of the
normal gene and its replacement with a mutated gene. Such a
transgene can be integrated at the endogenous gene locus so that
the functional disruption and "knock-in" are carried out in the
same step.
[0165] In addition to the methods mentioned above, transgenic
animals can be prepared according to known methods, including,
e.g., by pronuclear injection of recombinant genes into pronuclei
of 1-cell embryos, incorporating an artificial yeast chromosome
into embryonic stem cells, gene targeting methods, embryonic stem
cell methodology, cloning methods, nuclear transfer methods. See,
also, e.g., U.S. Pat. Nos. 4,736,866; 4,873,191; 4,873,316;
5,082,779; 5,304,489; 5,174,986; 5,175,384; 5,175,385; 5,221,778;
Gordon et al., Proc. Natl. Acad. Sci., 77:7380-7384, 1980; Palmiter
et al., Cell, 41:343-345, 1985; Palmiter et al., Ann. Rev. Genet.,
20:465-499, 1986; Askew et al., Mol. Cell. Bio., 13:4115-4124,
1993; Games et al. Nature, 373:523-527, 1995; Valancius and
Smithies, Mol. Cell. Bio., 11:1402-1408, 1991; Stacey et al., Mol.
Cell. Bio., 14:1009-1016, 1994; Hasty et al., Nature, 350:243-246,
1995; Rubinstein et al., Nucl. Acid Res., 21:2613-2617,1993;
Cibelli et al., Science, 280:1256-1258, 1998. For guidance on
recombinase excision systems, see, e.g., U.S. Pat. Nos. 5,626,159,
5,527,695, and 5,434,066. See also, Orban, P.C., et al., "Tissue-
and Site-Specific DNA Recombination in Transgenic Mice," Proc.
Natl. Acad. Sci. USA, 89:6861-6865 (1992); O'Gorman, S., et al.,
"Recombinase-Mediated Gene Activation and Site-Specific Integration
in Mammalian Cells," Science, 251:1351-1355 (1991); Sauer, B., et
al., "Cre-stimulated recombination at loxP-Containing DNA sequences
placed into the mammalian genome," Polynucleotides Research,
17(1):147-161 (1989); Gagneten, S. et al. (1997) Nucl. Acids Res.
25:3326-3331; Xiao and Weaver (1997) Nucl. Acids Res. 25:2985-2991;
Agah, R. et al. (1997) J. Clin. Invest. 100: 169-179; Barlow, C. et
al. (1997) Nucl. Acids Res. 25:2543-2545; Araki, K. et al. (1997)
Nucl. Acids Res. 25:868-872; Mortensen, R. N. et al. (1992) Mol.
Cell. Biol. 12:2391-2395 (G418 escalation method); Lakhlani, P. P.
et al. (1997) Proc. Natl. Acad. Sci. USA 94:9950-9955 ("hit and
run"); Westphal and Leder (1997) Curr. Biol. 7:530-533
(transposon-generated "knock-out" and "knock-in"); Templeton, N. S.
et al. (1997) Gene Ther. 4:700-709 (methods for efficient gene
targeting, allowing for a high frequency of homologous
recombination events, e.g., without selectable markers); PCT
International Publication WO 93/22443 (functionally-disrupted).
[0166] A polynucleotide according to the present invention can be
introduced into any non-human animal, including a non-human mammal,
mouse (Hogan et al., Manipulating the Mouse Embryo: A Laboratory
Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.,
1986), pig (Hammer et al., Nature, 315:343-345, 1985), sheep
(Hammer et al., Nature, 315:343-345, 1985), cattle, rat, or
primate. See also, e.g., Church, 1987, Trends in Biotech. 5:13-19;
Clark et al., Trends in Biotech. 5:20-24, 1987); and DePamphilis et
al., BioTechniques, 6:662-680, 1988. Transgenic animals can be
produced by the methods described in U.S. Pat. No. 5,994,618, and
utilized for any of the utilities described therein.
[0167] The present invention relates to, e.g.,
[0168] a non-human, transgenic mammal whose genome comprises a
functional disruption of KSE336, optionally whose genome further
comprises KSE336 operatively linked to an expression control
sequence effective to express said gene in brain and pancreas
cells, cells derived from brain and pancreas, or brain and pancreas
progenitor cells. and optionally, the expression control sequence
is an inducible promoter;
[0169] a mammalian cell whose genome comprises a functional
disruption of KSE336, and optionally, where the cell is a brain and
pancreas, cell derived from brain and pancreas, or a brain and
pancreas progenitor cell;
[0170] a non-human, transgenic mammal whose genome comprises a
recombinant KSE336 nucleic acid operatively linked to an expression
control sequence effective to express said gene in brain and
pancreas, cells derived from brain and pancreas, or brain and
pancreas progenitor cells, optionally, where the expression control
sequence is an inducible promoter, and optionally, whose genome
further comprises a functional disruption of the endogenous KSE336;
and
[0171] a mammalian cell whose genome comprises a recombinant KSE336
operatively linked to an expression control sequence effective to
express said gene in brain and pancreas cells, cells derived from
brain and pancreas, or brain and pancreas progenitor cells.
[0172] Database
[0173] The present invention also relates to electronic forms of
polynucleotides, polypeptides, etc., of the present invention,
including computer-readable medium (e.g., magnetic, optical, etc.,
stored in any suitable format, such as flat files or hierarchical
files) which comprise such sequences, or fragments thereof,
e-commerce-related means, etc. Along these lines, the present
invention relates to methods of retrieving gene sequences from a
computer-readable medium, comprising, one or more of the following
steps in any effective order, e.g., selecting a cell or gene
expression profile, e.g., a profile that specifies that said gene
is differentially expressed in brain and pancreas, and retrieving
said differentially expressed gene sequences, where the gene
sequences consist of the genes represented by SEQ ID NO 1 and
2.
[0174] A "gene expression profile" means the list of tissues,
cells, etc., in which a defined gene is expressed (i.e, transcribed
and/or translated). A "cell expression profile" means the genes
which are expressed in the particular cell type. The profile can be
a list of the tissues in which the gene is expressed, but can
include additional information as well, including level of
expression (e.g., a quantity as compared or normalized to a control
gene), and information on temporal (e.g., at what point in the
cell-cycle or developmental program) and spatial expression. By the
phrase "selecting a gene or cell expression profile," it is meant
that a user decides what type of gene or cell expression pattern he
is interested in retrieving, e.g., he may require that the gene is
differentially expressed in a tissue, or he may require that the
gene is not expressed in blood, but must be expressed in brain and
pancreas. Any pattern of expression preferences may be selected.
The selecting can be performed by any effective method. In general,
"selecting" refers to the process in which a user forms a query
that is used to search a database of gene expression profiles. The
step of retrieving involves searching for results in a database
that correspond to the query set forth in the selecting step. Any
suitable algorithm can be utilized to perform the search query,
including algorithms that look for matches, or that perform
optimization between query and data. The database is information
that has been stored in an appropriate storage medium, having a
suitable computer-readable format. Once results are retrieved, they
can be displayed in any suitable format, such as HTML.
[0175] For instance, the user may be interested in identifying
genes that are differentially expressed in a brain and pancreas. He
may not care whether small amounts of expression occur in other
tissues, as long as such genes are not expressed in peripheral
blood lymphocytes. A query is formed by the user to retrieve the
set of genes from the database having the desired gene or cell
expression profile. Once the query is inputted into the system, a
search algorithm is used to interrogate the database, and retrieve
results.
[0176] Advertising, Licensing, etc., Methods
[0177] The present invention also relates to methods of
advertising, licensing, selling, purchasing, brokering, etc.,
genes, polynucleotides, specific-binding partners, antibodies,
etc., of the present invention. Methods can comprises, e.g.,
displaying a KSE336 gene, KSE336 polypeptide, or antibody specific
for KSE336 in a printed or computer-readable medium (e.g., on the
Web or Internet), accepting an offer to purchase said gene,
polypeptide, or antibody.
[0178] Other
[0179] A polynucleotide, probe, polypeptide, antibody,
specific-binding partner, etc., according to the present invention
can be isolated. The term "isolated" means that the material is in
a form in which it is not found in its original environment or in
nature, e.g., more concentrated, more purified, separated from
component, etc. An isolated polynucleotide includes, e.g., a
polynucleotide having the sequenced separated from the chromosomal
DNA found in a living animal, e.g., as the complete gene, a
transcript, or a cDNA. This polynucleotide can be part of a vector
or inserted into a chromosome (by specific gene-targeting or by
random integration at a position other than its normal position)
and still be isolated in that it is not in a form that is found in
its natural environment. A polynucleotide, polypeptide, etc., of
the present invention can also be substantially purified. By
substantially purified, it is meant that polynucleotide or
polypeptide is separated and is essentially free from other
polynucleotides or polypeptides, i.e., the polynucleotide or
polypeptide is the primary and active constituent. A polynucleotide
can also be a recombinant molecule. By "recombinant," it is meant
that the polynucleotide is an arrangement or form which does not
occur in nature. For instance, a recombinant molecule comprising a
promoter sequence would not encompass the naturally-occurring gene,
but would include the promoter operably linked to a coding sequence
not associated with it in nature, e.g., a reporter gene, or a
truncation of the normal coding sequence.
[0180] The term "marker" is used herein to indicate a means for
detecting or labeling a target. A marker can be a polynucleotide
(usually referred to as a "probe"), polypeptide (e.g., an antibody
conjugated to a detectable label), PNA, or any effective
material.
[0181] The term "consisting essentially" indicates that a
composition has ingredients that are specifically identified in the
claim but other ingredients may also be present, although not
specifically identified in the claim, so long as those other
unlisted ingredients do not have a material effect on the basic and
novel characteristics of the composition.
[0182] The topic headings set forth above are meant as guidance
where certain information can be found in the application, but are
not intended to be the only source in the application where
information on such topic can be found.
[0183] Reference Materials
[0184] For other aspects of the polynucleotides, reference is made
to standard textbooks of molecular biology. See, e.g., Hames et
al., Polynucleotide Hybridization, IL Press, 1985; Davis et al.,
Basic Methods in Molecular Biology, Elsevir Sciences Publishing,
Inc., New York, 1986; Sambrook et al., Molecular Cloning, CSH
Press, 1989; Howe, Gene Cloning and Manipulation, Cambridge
University Press, 1995; Ausubel et al., Current Protocols in
Molecular Biology, John Wiley & Sons, Inc., 1994-1998. The
preceding description, utilize the present invention to its fullest
extent. The preceding preferred specific embodiments are,
therefore, to be construed as merely illustrative, and not limiting
the remainder of the disclosure in any way whatsoever. The entire
disclosure of all applications, patents and publications, cited
above and in the figures are incorporated by reference in their
entirety.
3TABLE 1 SEQ Start End Nucleotide Sequence ID 34 84
CAACTCCTATCTAAATTTCACCGGCATTGTTT- GCAG 7 AGGCAGGGAAAGGG 441 491
ACTAAAAATAAAAAAAAATTAGCCGGGCGTGGTGGC 8 GGGCACCTGTAGTC 1044 1094
GTGTTCTCTTTATATATTGCTGGAATTGATTTGATG 9 TTTTGTTAAGGGAT 2136 2186
CTACATTCAGCTAAAAATGTCTGCTGTCCCC- ACTCA 10 CAGCAGCAGCAGCG 3226 3276
GCCCTGCAGGGTAAAACCCCCGTCCAGGGCAGCCAT 11 CTGCACCCCCTCGC 3301 23351
CGGGATGCGCCTTAATGGCGGGTCGGGCGGCAGCGG 12 GAGCTCTGCTGCCT 3848 3898
CTGGGGGCGCGGGGCGCGGGGCGCGGGCCTC- GGCGG 13 CGGCGGCGGCGGCG 3860 3910
GGCGCGGGGCGCGGGCCTCGGCGGCGGCGGCGGCGG 14 CGGCGGCGGAAGCC
[0185]
4TABLE 2 Type of Clone seq Genomic Seq. Clone name Polymorphism
(Pos/nt) (Accn#, nt) FB1620G06/ Substitution 92, C NT_024164, T
KSE336-1 Substitution 1248, G NT_024164, A Substitution 1340, C
NT_024164, T Substitution 1353, C NT_024164, G Insertion 1370, C
NT_024164, * Insertion 1443, G NT_024164, * Substitution 1615-1617,
GAG NT_024164, AGT Deletion 2026-2027, * NT_024164, G Substitution
2072, C NT_024164, A Insertion 2206, G NT_024164, * Substitution
2473, C NT_024164, T Insertion 2607, C NT_024164, * Substitution
2611, T NT_024164, C Deletion 2648-2649, * NT_024164, G AB1138D11/
Substitution 1467, C NT_024164, T KSE336-2 Substitution 1480, C
NT_024164, G Insertion 1497, C NT_024164, * Insertion 1570, G
NT_024164, * Substitution 1742-1744, GAG NT_024164, AGT Deletion
2153-2154, * NT_024164, G Substitution 2199, C NT_024164, A
Insertion 2333, G NT_024164, * Substitution 2600, C NT_024164, T
Insertion 2735, C NT_024164, * Deletion 2775-2776, * NT_024164, G
Insertion 3143-3144, CT NT_024164, ** Substitution 3197, C
NT_024164, T Insertion 3211, G NT_024164, *
[0186]
Sequence CWU 1
1
18 1 2908 DNA Homo sapiens CDS (106)..(2112) 1 ggccgggtcg
gcgcggacgg cactcggcgg acgcgggcgg acgctgggcg gcccctccct 60
gcccgcgcgc ccgggcgccc ctggccggcg ccgggcccca gagcg atg aca tcg acg
117 Met Thr Ser Thr 1 ggg aag gac ggc ggc gcg cag cac gcg cag tat
gtt ggg ccc tac cgg 165 Gly Lys Asp Gly Gly Ala Gln His Ala Gln Tyr
Val Gly Pro Tyr Arg 5 10 15 20 ctg gag aag acg ctg ggc aag ggg cag
aca ggt ctg gtg aag ctg ggg 213 Leu Glu Lys Thr Leu Gly Lys Gly Gln
Thr Gly Leu Val Lys Leu Gly 25 30 35 gtt cac tgc gtc acc tgc cag
aag gtg gcc atc aag atc gtc aac cgt 261 Val His Cys Val Thr Cys Gln
Lys Val Ala Ile Lys Ile Val Asn Arg 40 45 50 gag aag ctc agc gag
tcg gtg ctg atg aag gtg gag cgg gag atc gcg 309 Glu Lys Leu Ser Glu
Ser Val Leu Met Lys Val Glu Arg Glu Ile Ala 55 60 65 atc ctg aag
ctc att gag cac ccc cac gtc cta aag ctg cac gac gtt 357 Ile Leu Lys
Leu Ile Glu His Pro His Val Leu Lys Leu His Asp Val 70 75 80 tat
gaa aac aaa aaa tat ttg tac ctg gtg cta gaa cac gtg tca ggt 405 Tyr
Glu Asn Lys Lys Tyr Leu Tyr Leu Val Leu Glu His Val Ser Gly 85 90
95 100 ggt gag ctc ttc gac tac ctg gtg aag aag ggg agg ctg acg cct
aag 453 Gly Glu Leu Phe Asp Tyr Leu Val Lys Lys Gly Arg Leu Thr Pro
Lys 105 110 115 gag gct cgg aag ttc ttc cgg cag atc atc tct gcg ctg
gac ttc tgc 501 Glu Ala Arg Lys Phe Phe Arg Gln Ile Ile Ser Ala Leu
Asp Phe Cys 120 125 130 cac agc cac tcc ata tgc cac agg gat ctg aaa
cct gaa aac ctc ctg 549 His Ser His Ser Ile Cys His Arg Asp Leu Lys
Pro Glu Asn Leu Leu 135 140 145 ctg gac gag aag aac aac atc cgc atc
gca gac ttt ggc atg gcg tcc 597 Leu Asp Glu Lys Asn Asn Ile Arg Ile
Ala Asp Phe Gly Met Ala Ser 150 155 160 ctg cag gtt ggc gac agc ctg
ttg gag acc agc tgt ggg tcc ccc cac 645 Leu Gln Val Gly Asp Ser Leu
Leu Glu Thr Ser Cys Gly Ser Pro His 165 170 175 180 tac gcc tgc ccc
gag gtg atc cgg ggg gag aag tat gac ggc cgg aag 693 Tyr Ala Cys Pro
Glu Val Ile Arg Gly Glu Lys Tyr Asp Gly Arg Lys 185 190 195 gcg gac
gtg tgg agc tgc ggc gtc atc ctg ttc gcc ttg ctg gtg ggg 741 Ala Asp
Val Trp Ser Cys Gly Val Ile Leu Phe Ala Leu Leu Val Gly 200 205 210
gct ctg ccc ttc gac gat gac aac ttg cga cag ctg ctg gag aag gtg 789
Ala Leu Pro Phe Asp Asp Asp Asn Leu Arg Gln Leu Leu Glu Lys Val 215
220 225 aag cgg ggc gtg ttc cac atg ccg cac ttt atc ccg ccc gac tgc
cag 837 Lys Arg Gly Val Phe His Met Pro His Phe Ile Pro Pro Asp Cys
Gln 230 235 240 agt ctg cta cgg ggc atg atc gag gtg gac gcc gca cgc
cgc ctc acg 885 Ser Leu Leu Arg Gly Met Ile Glu Val Asp Ala Ala Arg
Arg Leu Thr 245 250 255 260 cta gag cac att cag aaa cac ata tgg tat
ata ggg ggc aag aat gag 933 Leu Glu His Ile Gln Lys His Ile Trp Tyr
Ile Gly Gly Lys Asn Glu 265 270 275 ccc gaa cca gag cag ccc att cct
cgc aag gtg cag atc cgc tcg ctg 981 Pro Glu Pro Glu Gln Pro Ile Pro
Arg Lys Val Gln Ile Arg Ser Leu 280 285 290 ccc agc ctg gag gac atc
gac ccc gac gtg ctg gac agc atg cac tca 1029 Pro Ser Leu Glu Asp
Ile Asp Pro Asp Val Leu Asp Ser Met His Ser 295 300 305 ctg ggc tgc
ttc cga gac cgc aac aag ctg ctg cag gac ctg ctg tcc 1077 Leu Gly
Cys Phe Arg Asp Arg Asn Lys Leu Leu Gln Asp Leu Leu Ser 310 315 320
gag gag gag aac cag gag aag atg att tac ttc ctc ctc ctg gac cgg
1125 Glu Glu Glu Asn Gln Glu Lys Met Ile Tyr Phe Leu Leu Leu Asp
Arg 325 330 335 340 aaa gaa agg tac ccg agc cag gag gat gag gac ctg
ccc ccc cgg aac 1173 Lys Glu Arg Tyr Pro Ser Gln Glu Asp Glu Asp
Leu Pro Pro Arg Asn 345 350 355 gag ata gac cct ccc cgg aag cgt gtg
gac tcc ccg atg ctg aac cgg 1221 Glu Ile Asp Pro Pro Arg Lys Arg
Val Asp Ser Pro Met Leu Asn Arg 360 365 370 cac ggc aag cgg cgg cca
gaa cgc aag tcc atg gag gtg ctc agc gtg 1269 His Gly Lys Arg Arg
Pro Glu Arg Lys Ser Met Glu Val Leu Ser Val 375 380 385 acg gac ggc
ggc tcc ccg gtg cct gcg cgg cgg gcc att gag atg gcc 1317 Thr Asp
Gly Gly Ser Pro Val Pro Ala Arg Arg Ala Ile Glu Met Ala 390 395 400
cag cac ggc cag agg tct cgg tcc atc agc ggt gcc tcc tca ggc ctt
1365 Gln His Gly Gln Arg Ser Arg Ser Ile Ser Gly Ala Ser Ser Gly
Leu 405 410 415 420 tcc acc agc cca ctc agc agc ccc cgg gtg acc cct
cac ccc tca cca 1413 Ser Thr Ser Pro Leu Ser Ser Pro Arg Val Thr
Pro His Pro Ser Pro 425 430 435 agg ggc agt ccc ctc ccc acc ccc aag
ggg aca cct gtc cac acg cca 1461 Arg Gly Ser Pro Leu Pro Thr Pro
Lys Gly Thr Pro Val His Thr Pro 440 445 450 aag gag agc ccg gct ggc
acg ccc aac ccc acg ccc ccg tcc agc ccc 1509 Lys Glu Ser Pro Ala
Gly Thr Pro Asn Pro Thr Pro Pro Ser Ser Pro 455 460 465 agc gtc gga
ggg gtg ccc tgg agg gcg cgg ctc aac tcc atc aag aac 1557 Ser Val
Gly Gly Val Pro Trp Arg Ala Arg Leu Asn Ser Ile Lys Asn 470 475 480
agc ttt ctg ggc tca ccc cgc ttc cac cgc cgg aaa ctg caa gtt ccg
1605 Ser Phe Leu Gly Ser Pro Arg Phe His Arg Arg Lys Leu Gln Val
Pro 485 490 495 500 acg ccg gag gag atg tcc aac ctg aca cca gag tcg
tcc cca gag ctg 1653 Thr Pro Glu Glu Met Ser Asn Leu Thr Pro Glu
Ser Ser Pro Glu Leu 505 510 515 gcg aag aag tcc tgg ttt ggg aac ttc
atc agc ctg gag aag gag gag 1701 Ala Lys Lys Ser Trp Phe Gly Asn
Phe Ile Ser Leu Glu Lys Glu Glu 520 525 530 cag atc ttc gtg gtc atc
aaa gac aaa cct ctg agc tcc atc aag gct 1749 Gln Ile Phe Val Val
Ile Lys Asp Lys Pro Leu Ser Ser Ile Lys Ala 535 540 545 gac atc gtg
cac gcc ttc ctg tcg att ccc agt ctc agc cac agc gtc 1797 Asp Ile
Val His Ala Phe Leu Ser Ile Pro Ser Leu Ser His Ser Val 550 555 560
atc tcc caa acg agc ttc cgg gcc gag tac aag gcc acg ggg ggg cca
1845 Ile Ser Gln Thr Ser Phe Arg Ala Glu Tyr Lys Ala Thr Gly Gly
Pro 565 570 575 580 gcc gtg ttc cag aag ccg gtc aag ttc cag gtt gat
atc acc tac acg 1893 Ala Val Phe Gln Lys Pro Val Lys Phe Gln Val
Asp Ile Thr Tyr Thr 585 590 595 gag ggt ggg gag gcg cag aag gag aac
ggc atc tac tcc gtc acc ttc 1941 Glu Gly Gly Glu Ala Gln Lys Glu
Asn Gly Ile Tyr Ser Val Thr Phe 600 605 610 acc ctg ctc tca ggc ccc
agc cgt cgc ttc aag agg gtg gtg gag acc 1989 Thr Leu Leu Ser Gly
Pro Ser Arg Arg Phe Lys Arg Val Val Glu Thr 615 620 625 atc cag gcc
cag ctg ctg agc aca cac gac ccg cct gcg gcc cag cac 2037 Ile Gln
Ala Gln Leu Leu Ser Thr His Asp Pro Pro Ala Ala Gln His 630 635 640
ttg tca gac acc act aac tgt atg gaa atg atg acg ggg cgg ctt tcc
2085 Leu Ser Asp Thr Thr Asn Cys Met Glu Met Met Thr Gly Arg Leu
Ser 645 650 655 660 aaa tgt gga att atc ccg aaa agt taa catgtcacct
ccacgaggcc 2132 Lys Cys Gly Ile Ile Pro Lys Ser 665 atcctctgtg
accgaaggca gctgctgcgg acccgccctc cctccgctcc tgctgttgct 2192
gccgggcagt gaggcccagc ccagcgcccc gtccaccccg cggcagctcc tcgcctcact
2252 ccgcacggcc cgtgggagga aggccaggct cgggggagcc tcctccagcc
cggccgaccc 2312 ggactcccgg tcacctgacc cctcagcaag aacagcctgc
ctggtggcct tctggggcca 2372 ggacccctgg tgggcaacgt agccacagga
acaggccccg tccaccgcct ccacgccgca 2432 cctggaggcc tcctcgcagg
cccgtgcccc gcctccctgc cgcgccgcct ccgtgtagtc 2492 ttggcctcct
caggctgcct cccgtcctct cgtctcaccc gcgcctccct tgcctcatct 2552
ggggcggctg tgggctctgg cgctcctctc tggctgaggt ggaaacagag acaccctgtg
2612 gcaccagagc cttcccagca ggccaggccg ctgggctggg atcagtgtta
tttatttgcc 2672 gttttaattt atggattctc cgcacctctg ttcagggaag
ggcggcggcc acatcccctg 2732 ccgtctgcgt gtctcaggca gtgggggggc
tggggccagg gcgccctctg aggacagagc 2792 tggtggggcg cgggggggct
ggcgagctac tgtaaacttt aaagaattcc tgcaagatat 2852 ttttataaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 2908 2 668 PRT
Homo sapiens 2 Met Thr Ser Thr Gly Lys Asp Gly Gly Ala Gln His Ala
Gln Tyr Val 1 5 10 15 Gly Pro Tyr Arg Leu Glu Lys Thr Leu Gly Lys
Gly Gln Thr Gly Leu 20 25 30 Val Lys Leu Gly Val His Cys Val Thr
Cys Gln Lys Val Ala Ile Lys 35 40 45 Ile Val Asn Arg Glu Lys Leu
Ser Glu Ser Val Leu Met Lys Val Glu 50 55 60 Arg Glu Ile Ala Ile
Leu Lys Leu Ile Glu His Pro His Val Leu Lys 65 70 75 80 Leu His Asp
Val Tyr Glu Asn Lys Lys Tyr Leu Tyr Leu Val Leu Glu 85 90 95 His
Val Ser Gly Gly Glu Leu Phe Asp Tyr Leu Val Lys Lys Gly Arg 100 105
110 Leu Thr Pro Lys Glu Ala Arg Lys Phe Phe Arg Gln Ile Ile Ser Ala
115 120 125 Leu Asp Phe Cys His Ser His Ser Ile Cys His Arg Asp Leu
Lys Pro 130 135 140 Glu Asn Leu Leu Leu Asp Glu Lys Asn Asn Ile Arg
Ile Ala Asp Phe 145 150 155 160 Gly Met Ala Ser Leu Gln Val Gly Asp
Ser Leu Leu Glu Thr Ser Cys 165 170 175 Gly Ser Pro His Tyr Ala Cys
Pro Glu Val Ile Arg Gly Glu Lys Tyr 180 185 190 Asp Gly Arg Lys Ala
Asp Val Trp Ser Cys Gly Val Ile Leu Phe Ala 195 200 205 Leu Leu Val
Gly Ala Leu Pro Phe Asp Asp Asp Asn Leu Arg Gln Leu 210 215 220 Leu
Glu Lys Val Lys Arg Gly Val Phe His Met Pro His Phe Ile Pro 225 230
235 240 Pro Asp Cys Gln Ser Leu Leu Arg Gly Met Ile Glu Val Asp Ala
Ala 245 250 255 Arg Arg Leu Thr Leu Glu His Ile Gln Lys His Ile Trp
Tyr Ile Gly 260 265 270 Gly Lys Asn Glu Pro Glu Pro Glu Gln Pro Ile
Pro Arg Lys Val Gln 275 280 285 Ile Arg Ser Leu Pro Ser Leu Glu Asp
Ile Asp Pro Asp Val Leu Asp 290 295 300 Ser Met His Ser Leu Gly Cys
Phe Arg Asp Arg Asn Lys Leu Leu Gln 305 310 315 320 Asp Leu Leu Ser
Glu Glu Glu Asn Gln Glu Lys Met Ile Tyr Phe Leu 325 330 335 Leu Leu
Asp Arg Lys Glu Arg Tyr Pro Ser Gln Glu Asp Glu Asp Leu 340 345 350
Pro Pro Arg Asn Glu Ile Asp Pro Pro Arg Lys Arg Val Asp Ser Pro 355
360 365 Met Leu Asn Arg His Gly Lys Arg Arg Pro Glu Arg Lys Ser Met
Glu 370 375 380 Val Leu Ser Val Thr Asp Gly Gly Ser Pro Val Pro Ala
Arg Arg Ala 385 390 395 400 Ile Glu Met Ala Gln His Gly Gln Arg Ser
Arg Ser Ile Ser Gly Ala 405 410 415 Ser Ser Gly Leu Ser Thr Ser Pro
Leu Ser Ser Pro Arg Val Thr Pro 420 425 430 His Pro Ser Pro Arg Gly
Ser Pro Leu Pro Thr Pro Lys Gly Thr Pro 435 440 445 Val His Thr Pro
Lys Glu Ser Pro Ala Gly Thr Pro Asn Pro Thr Pro 450 455 460 Pro Ser
Ser Pro Ser Val Gly Gly Val Pro Trp Arg Ala Arg Leu Asn 465 470 475
480 Ser Ile Lys Asn Ser Phe Leu Gly Ser Pro Arg Phe His Arg Arg Lys
485 490 495 Leu Gln Val Pro Thr Pro Glu Glu Met Ser Asn Leu Thr Pro
Glu Ser 500 505 510 Ser Pro Glu Leu Ala Lys Lys Ser Trp Phe Gly Asn
Phe Ile Ser Leu 515 520 525 Glu Lys Glu Glu Gln Ile Phe Val Val Ile
Lys Asp Lys Pro Leu Ser 530 535 540 Ser Ile Lys Ala Asp Ile Val His
Ala Phe Leu Ser Ile Pro Ser Leu 545 550 555 560 Ser His Ser Val Ile
Ser Gln Thr Ser Phe Arg Ala Glu Tyr Lys Ala 565 570 575 Thr Gly Gly
Pro Ala Val Phe Gln Lys Pro Val Lys Phe Gln Val Asp 580 585 590 Ile
Thr Tyr Thr Glu Gly Gly Glu Ala Gln Lys Glu Asn Gly Ile Tyr 595 600
605 Ser Val Thr Phe Thr Leu Leu Ser Gly Pro Ser Arg Arg Phe Lys Arg
610 615 620 Val Val Glu Thr Ile Gln Ala Gln Leu Leu Ser Thr His Asp
Pro Pro 625 630 635 640 Ala Ala Gln His Leu Ser Asp Thr Thr Asn Cys
Met Glu Met Met Thr 645 650 655 Gly Arg Leu Ser Lys Cys Gly Ile Ile
Pro Lys Ser 660 665 3 3364 DNA Homo sapiens CDS (482)..(2239) 3
ctcgacgagg cggaggcgtc gccgcgggcc aggcctcgga ctgccgcgtc ggagtggacg
60 cggggggcgg cggcgcgggc ggacgcgggc ggcgcgaagc agcggggccc
gcgggggcgc 120 cccggccggg tcggcgcgga cggcactcgg cggacgcggg
cggacgctgg gcggcccctc 180 cctgcccgcg cgcccgggcg cccctggccg
gcgctgggcc ccagagcgat gacatcgacg 240 gggaaggacg gcggcgcgca
gcacgcgcag tatgttgggc cctaccggct ggagaagacg 300 ctgggcaagg
ggcagacagg tctggtgaag ctgggggttc actgcgtcac ctgccagaag 360
gtggccatca agatcgtcaa ccgtgagaag ctcagcgagt cggtgctgat gaaggtggag
420 cgggagatcg cgatcctgaa gctcattgag cacccccacg tcctaaagct
gcacgacgtt 480 t atg aaa aca aaa aat att tgt agg tac ctg gtg cta
gaa cac gtg tca 529 Met Lys Thr Lys Asn Ile Cys Arg Tyr Leu Val Leu
Glu His Val Ser 1 5 10 15 ggt ggt gag ctc ttc gac tac ctg gtg aag
aag ggg agg ctg acg cct 577 Gly Gly Glu Leu Phe Asp Tyr Leu Val Lys
Lys Gly Arg Leu Thr Pro 20 25 30 aag gag gct cgg aag ttc ttc cgg
cag atc atc tct gcg ctg gac ttc 625 Lys Glu Ala Arg Lys Phe Phe Arg
Gln Ile Ile Ser Ala Leu Asp Phe 35 40 45 tgc cac agc cac tcc ata
tgc cac agg gat ctg aaa cct gaa aac ctc 673 Cys His Ser His Ser Ile
Cys His Arg Asp Leu Lys Pro Glu Asn Leu 50 55 60 ctg ctg gac gag
aag aac aac atc cgc atc gca gac ttt ggc atg gcg 721 Leu Leu Asp Glu
Lys Asn Asn Ile Arg Ile Ala Asp Phe Gly Met Ala 65 70 75 80 tcc ctg
cag gtt ggc gac agc ctg ttg gag acc agc tgt ggg tcc ccc 769 Ser Leu
Gln Val Gly Asp Ser Leu Leu Glu Thr Ser Cys Gly Ser Pro 85 90 95
cac tac gcc tgc ccc gag gtg atc cgg ggg gag aag tat gac ggc cgg 817
His Tyr Ala Cys Pro Glu Val Ile Arg Gly Glu Lys Tyr Asp Gly Arg 100
105 110 aag gcg gac gtg tgg agc tgc ggc gtc atc ctg ttc gcc ttg ctg
gtg 865 Lys Ala Asp Val Trp Ser Cys Gly Val Ile Leu Phe Ala Leu Leu
Val 115 120 125 ggg gct ctg ccc ttc gac gat gac aac ttg cga cag ctg
ctg gag aag 913 Gly Ala Leu Pro Phe Asp Asp Asp Asn Leu Arg Gln Leu
Leu Glu Lys 130 135 140 gtg aag cgg ggc gtg ttc cac atg ccg cac ttt
atc ccg ccc gac tgc 961 Val Lys Arg Gly Val Phe His Met Pro His Phe
Ile Pro Pro Asp Cys 145 150 155 160 cag agt ctg cta cgg ggc atg atc
gag gtg gac gcc gca cgc cgc ctc 1009 Gln Ser Leu Leu Arg Gly Met
Ile Glu Val Asp Ala Ala Arg Arg Leu 165 170 175 acg cta gag cac att
cag aaa cac ata tgg tat ata ggg ggc aag aat 1057 Thr Leu Glu His
Ile Gln Lys His Ile Trp Tyr Ile Gly Gly Lys Asn 180 185 190 gag ccc
gaa cca gag cag ccc att cct cgc aag gtg cag atc cgc tcg 1105 Glu
Pro Glu Pro Glu Gln Pro Ile Pro Arg Lys Val Gln Ile Arg Ser 195 200
205 ctg ccc agc ctg gag gac atc gac ccc gac gtg ctg gac agc atg cac
1153 Leu Pro Ser Leu Glu Asp Ile Asp Pro Asp Val Leu Asp Ser Met
His 210 215 220 tca ctg ggc tgc ttc cga gac cgc aac aag ctg ctg cag
gac ctg ctg 1201 Ser Leu Gly Cys Phe Arg Asp Arg Asn Lys Leu Leu
Gln Asp Leu Leu 225 230 235 240 tcc gag gag gag aac cag gag aag atg
att tac ttc ctc ctc ctg gac 1249 Ser Glu Glu Glu Asn Gln Glu Lys
Met Ile Tyr Phe Leu Leu Leu Asp 245 250 255 cgg aaa gaa agg tac ccg
agc cag gag gat gag gac ctg ccc ccc cgg 1297 Arg Lys Glu Arg Tyr
Pro Ser Gln Glu Asp Glu Asp Leu Pro Pro Arg 260 265 270 aac gag ata
gac cct ccc cgg aag cgt gtg gac tcc ccg atg ctg aac 1345 Asn Glu
Ile Asp Pro Pro Arg
Lys Arg Val Asp Ser Pro Met Leu Asn 275 280 285 cgg cac ggc aag cgg
cgg cca gaa cgc aaa tcc atg gag gtg ctc agc 1393 Arg His Gly Lys
Arg Arg Pro Glu Arg Lys Ser Met Glu Val Leu Ser 290 295 300 gtg acg
gac ggc ggc tcc ccg gtg cct gcg cgg cgg gcc att gag atg 1441 Val
Thr Asp Gly Gly Ser Pro Val Pro Ala Arg Arg Ala Ile Glu Met 305 310
315 320 gcc cag cac ggc cag agg tct cgg tcc atc agc ggt gcc tcc tca
ggc 1489 Ala Gln His Gly Gln Arg Ser Arg Ser Ile Ser Gly Ala Ser
Ser Gly 325 330 335 ctt tcc acc agc cca ctc agc agc ccc cgg gtg acc
cct cac ccc tca 1537 Leu Ser Thr Ser Pro Leu Ser Ser Pro Arg Val
Thr Pro His Pro Ser 340 345 350 cca agg ggc agt ccc ctc ccc acc ccc
aag ggg aca cct gtc cac acg 1585 Pro Arg Gly Ser Pro Leu Pro Thr
Pro Lys Gly Thr Pro Val His Thr 355 360 365 cca aag gag agc ccg gct
ggc acg ccc aac ccc acg ccc ccg tcc agc 1633 Pro Lys Glu Ser Pro
Ala Gly Thr Pro Asn Pro Thr Pro Pro Ser Ser 370 375 380 ccc agc gtc
gga ggg gtg ccc tgg agg gcg cgg ctc aac tcc atc aag 1681 Pro Ser
Val Gly Gly Val Pro Trp Arg Ala Arg Leu Asn Ser Ile Lys 385 390 395
400 aac agc ttt ctg ggc tca ccc cgc ttc cac cgc cgg aaa ctg caa gtt
1729 Asn Ser Phe Leu Gly Ser Pro Arg Phe His Arg Arg Lys Leu Gln
Val 405 410 415 ccg acg ccg gag gag atg tcc aac ctg aca cca gag tcg
tcc cca gag 1777 Pro Thr Pro Glu Glu Met Ser Asn Leu Thr Pro Glu
Ser Ser Pro Glu 420 425 430 ctg gcg aag aag tcc tgg ttt ggg aac ttc
atc agc ctg gag aag gag 1825 Leu Ala Lys Lys Ser Trp Phe Gly Asn
Phe Ile Ser Leu Glu Lys Glu 435 440 445 gag cag atc ttc gtg gtc atc
aaa gac aaa cct ctg agc tcc atc aag 1873 Glu Gln Ile Phe Val Val
Ile Lys Asp Lys Pro Leu Ser Ser Ile Lys 450 455 460 gct gac atc gtg
cac gcc ttc ctg tcg att ccc agt ctc agc cac agc 1921 Ala Asp Ile
Val His Ala Phe Leu Ser Ile Pro Ser Leu Ser His Ser 465 470 475 480
gtc atc tcc caa acg agc ttc cgg gcc gag tac aag gcc acg ggg ggg
1969 Val Ile Ser Gln Thr Ser Phe Arg Ala Glu Tyr Lys Ala Thr Gly
Gly 485 490 495 cca gcc gtg ttc cag aag ccg gtc aag ttc cag gtt gat
atc acc tac 2017 Pro Ala Val Phe Gln Lys Pro Val Lys Phe Gln Val
Asp Ile Thr Tyr 500 505 510 acg gag ggt ggg gag gcg cag aag gag aac
ggc atc tac tcc gtc acc 2065 Thr Glu Gly Gly Glu Ala Gln Lys Glu
Asn Gly Ile Tyr Ser Val Thr 515 520 525 ttc acc ctg ctc tca ggc ccc
agc cgt cgc ttc aag agg gtg gtg gag 2113 Phe Thr Leu Leu Ser Gly
Pro Ser Arg Arg Phe Lys Arg Val Val Glu 530 535 540 acc atc cag gcc
cag ctg ctg agc aca cac gac ccg cct gcg gcc cag 2161 Thr Ile Gln
Ala Gln Leu Leu Ser Thr His Asp Pro Pro Ala Ala Gln 545 550 555 560
cac ttg tca gac acc act aac tgt atg gaa atg atg acg ggg cgg ctt
2209 His Leu Ser Asp Thr Thr Asn Cys Met Glu Met Met Thr Gly Arg
Leu 565 570 575 tcc aaa tgt gga att atc ccg aaa agt taa catgtcacct
ccacgaggcc 2259 Ser Lys Cys Gly Ile Ile Pro Lys Ser 580 585
atcctctgtg accgaaggca gctgctgcgg acccgccctc cctccgctcc tgctgttgct
2319 gccgggcagt gaggcccagc ccagcgcccc gtccaccccg cggcagctcc
tcgcctcact 2379 ccgcacggcc cgtgggagga aggccaggct cgggggagcc
tcctccagcc cggccgaccc 2439 ggactcccgg tcacctgacc cctcagcaag
aacagcctgc ctggtggcct tctggggcca 2499 ggacccctgg tgggcaacgt
agccacagga acaggccccg tccaccgcct ccacgccgca 2559 cctggaggcc
tcctcgcagg cccgtgcccc gcctccctgc cgcgccgcct ccgtgtagtc 2619
ttggcctcct caggctgcct cccgtcctct cgtctcaccc gcgcctccct tgcctcatct
2679 ggggcggctg tgggctctgg cgctcctctc tggctgaggt ggaaacagag
acaccctgcg 2739 gcaccagagc cttcccagca ggccaggccg ctgggctggg
atcagtgtta tttatttgcc 2799 gttttaattt atggattctc cgcacctctg
ttcagggaag ggcggcggcc acatcccctg 2859 ccgtctgcgt gtctcaggca
gtgggggggc tggggccagg gcgccctctg aggacagagc 2919 tggtggggcg
cgggggggct ggcgagctac tgtaaacttt aaagaattcc tgcaagatat 2979
ttttataaac ttttttttct tggtggtttt tggaaaaggg tgtgggggtg ggggcgccgc
3039 tggggcaggg ccaggttttg tgttttagtc ccttgctcct gcttctttct
acacacacat 3099 ctaaagacgg tgcggctcgc tctgtcatgg gttccgtctc
tctctgtgga gaagcagctc 3159 cacctctggg ggggctcggg gcagaggggc
ggtgtctcgt agcgggcggc agcgccagcg 3219 cccctctgtc aggctggggc
aatcttggtt ttgtgtccaa aggtgaaggg gtaggaggag 3279 ggccctcagc
tggccctccc cacacacagg acggcagggg cactgtgagg cttttcttat 3339
taaaatgaaa aaaaaaaaaa aaaaa 3364 4 585 PRT Homo sapiens 4 Met Lys
Thr Lys Asn Ile Cys Arg Tyr Leu Val Leu Glu His Val Ser 1 5 10 15
Gly Gly Glu Leu Phe Asp Tyr Leu Val Lys Lys Gly Arg Leu Thr Pro 20
25 30 Lys Glu Ala Arg Lys Phe Phe Arg Gln Ile Ile Ser Ala Leu Asp
Phe 35 40 45 Cys His Ser His Ser Ile Cys His Arg Asp Leu Lys Pro
Glu Asn Leu 50 55 60 Leu Leu Asp Glu Lys Asn Asn Ile Arg Ile Ala
Asp Phe Gly Met Ala 65 70 75 80 Ser Leu Gln Val Gly Asp Ser Leu Leu
Glu Thr Ser Cys Gly Ser Pro 85 90 95 His Tyr Ala Cys Pro Glu Val
Ile Arg Gly Glu Lys Tyr Asp Gly Arg 100 105 110 Lys Ala Asp Val Trp
Ser Cys Gly Val Ile Leu Phe Ala Leu Leu Val 115 120 125 Gly Ala Leu
Pro Phe Asp Asp Asp Asn Leu Arg Gln Leu Leu Glu Lys 130 135 140 Val
Lys Arg Gly Val Phe His Met Pro His Phe Ile Pro Pro Asp Cys 145 150
155 160 Gln Ser Leu Leu Arg Gly Met Ile Glu Val Asp Ala Ala Arg Arg
Leu 165 170 175 Thr Leu Glu His Ile Gln Lys His Ile Trp Tyr Ile Gly
Gly Lys Asn 180 185 190 Glu Pro Glu Pro Glu Gln Pro Ile Pro Arg Lys
Val Gln Ile Arg Ser 195 200 205 Leu Pro Ser Leu Glu Asp Ile Asp Pro
Asp Val Leu Asp Ser Met His 210 215 220 Ser Leu Gly Cys Phe Arg Asp
Arg Asn Lys Leu Leu Gln Asp Leu Leu 225 230 235 240 Ser Glu Glu Glu
Asn Gln Glu Lys Met Ile Tyr Phe Leu Leu Leu Asp 245 250 255 Arg Lys
Glu Arg Tyr Pro Ser Gln Glu Asp Glu Asp Leu Pro Pro Arg 260 265 270
Asn Glu Ile Asp Pro Pro Arg Lys Arg Val Asp Ser Pro Met Leu Asn 275
280 285 Arg His Gly Lys Arg Arg Pro Glu Arg Lys Ser Met Glu Val Leu
Ser 290 295 300 Val Thr Asp Gly Gly Ser Pro Val Pro Ala Arg Arg Ala
Ile Glu Met 305 310 315 320 Ala Gln His Gly Gln Arg Ser Arg Ser Ile
Ser Gly Ala Ser Ser Gly 325 330 335 Leu Ser Thr Ser Pro Leu Ser Ser
Pro Arg Val Thr Pro His Pro Ser 340 345 350 Pro Arg Gly Ser Pro Leu
Pro Thr Pro Lys Gly Thr Pro Val His Thr 355 360 365 Pro Lys Glu Ser
Pro Ala Gly Thr Pro Asn Pro Thr Pro Pro Ser Ser 370 375 380 Pro Ser
Val Gly Gly Val Pro Trp Arg Ala Arg Leu Asn Ser Ile Lys 385 390 395
400 Asn Ser Phe Leu Gly Ser Pro Arg Phe His Arg Arg Lys Leu Gln Val
405 410 415 Pro Thr Pro Glu Glu Met Ser Asn Leu Thr Pro Glu Ser Ser
Pro Glu 420 425 430 Leu Ala Lys Lys Ser Trp Phe Gly Asn Phe Ile Ser
Leu Glu Lys Glu 435 440 445 Glu Gln Ile Phe Val Val Ile Lys Asp Lys
Pro Leu Ser Ser Ile Lys 450 455 460 Ala Asp Ile Val His Ala Phe Leu
Ser Ile Pro Ser Leu Ser His Ser 465 470 475 480 Val Ile Ser Gln Thr
Ser Phe Arg Ala Glu Tyr Lys Ala Thr Gly Gly 485 490 495 Pro Ala Val
Phe Gln Lys Pro Val Lys Phe Gln Val Asp Ile Thr Tyr 500 505 510 Thr
Glu Gly Gly Glu Ala Gln Lys Glu Asn Gly Ile Tyr Ser Val Thr 515 520
525 Phe Thr Leu Leu Ser Gly Pro Ser Arg Arg Phe Lys Arg Val Val Glu
530 535 540 Thr Ile Gln Ala Gln Leu Leu Ser Thr His Asp Pro Pro Ala
Ala Gln 545 550 555 560 His Leu Ser Asp Thr Thr Asn Cys Met Glu Met
Met Thr Gly Arg Leu 565 570 575 Ser Lys Cys Gly Ile Ile Pro Lys Ser
580 585 5 213 DNA Homo sapiens CDS (1)..(213) 5 atg aca tcg acg ggg
aag gac ggc ggc gcg cag cac gcg cag tat gtt 48 Met Thr Ser Thr Gly
Lys Asp Gly Gly Ala Gln His Ala Gln Tyr Val 1 5 10 15 ggg ccc tac
cgg ctg gag aag acg ctg ggc aag ggg cag aca ggt ctg 96 Gly Pro Tyr
Arg Leu Glu Lys Thr Leu Gly Lys Gly Gln Thr Gly Leu 20 25 30 gtg
aag ctg ggg gtt cac tgc gtc acc tgc cag aag gtg gcc atc aag 144 Val
Lys Leu Gly Val His Cys Val Thr Cys Gln Lys Val Ala Ile Lys 35 40
45 atc gtc aac cgt gag aag ctc agc gag tcg gtg ctg atg aag gtg gag
192 Ile Val Asn Arg Glu Lys Leu Ser Glu Ser Val Leu Met Lys Val Glu
50 55 60 cgg gag atc gcg atc ctg aag 213 Arg Glu Ile Ala Ile Leu
Lys 65 70 6 71 PRT Homo sapiens 6 Met Thr Ser Thr Gly Lys Asp Gly
Gly Ala Gln His Ala Gln Tyr Val 1 5 10 15 Gly Pro Tyr Arg Leu Glu
Lys Thr Leu Gly Lys Gly Gln Thr Gly Leu 20 25 30 Val Lys Leu Gly
Val His Cys Val Thr Cys Gln Lys Val Ala Ile Lys 35 40 45 Ile Val
Asn Arg Glu Lys Leu Ser Glu Ser Val Leu Met Lys Val Glu 50 55 60
Arg Glu Ile Ala Ile Leu Lys 65 70 7 50 DNA Homo sapiens 7
caactcctat ctaaatttca ccggcattgt ttgcagaggc agggaaaggg 50 8 50 DNA
Homo sapiens 8 actaaaaata aaaaaaaatt agccgggcgt ggtggcgggc
acctgtagtc 50 9 50 DNA Homo sapiens 9 gtgttctctt tatatattgc
tggaattgat ttgatgtttt gttaagggat 50 10 50 DNA Homo sapiens 10
ctacattcag ctaaaaatgt ctgctgtccc cactcacagc agcagcagcg 50 11 50 DNA
Homo sapiens 11 gccctgcagg gtaaaacccc cgtccagggc agccatctgc
accccctcgc 50 12 50 DNA Homo sapiens 12 cgggatgcgc cttaatggcg
ggtcgggcgg cagcgggagc tctgctgcct 50 13 50 DNA Homo sapiens 13
ctgggggcgc ggggcgcggg gcgcgggcct cggcggcggc ggcggcggcg 50 14 50 DNA
Homo sapiens 14 ggcgcggggc gcgggcctcg gcggcggcgg cggcggcggc
ggcggaagcc 50 15 15 PRT Homo sapiens 15 His Met Arg Ser Ala Met Ser
Gly Leu His Leu Val Lys Arg Arg 1 5 10 15 16 7 PRT Homo sapiens 16
Leu Arg Arg Ala Ser Leu Gly 1 5 17 603 PRT Homo sapiens 17 Leu Ile
Glu His Pro His Val Leu Lys Leu His Asp Val Tyr Glu Asn 1 5 10 15
Lys Lys Tyr Leu Tyr Leu Val Leu Glu His Val Ser Gly Gly Glu Leu 20
25 30 Phe Asp Tyr Leu Val Lys Lys Gly Arg Leu Thr Pro Lys Glu Ala
Arg 35 40 45 Lys Phe Phe Arg Gln Ile Ile Ser Ala Leu Asp Phe Cys
His Ser His 50 55 60 Ser Ile Cys His Arg Asp Leu Lys Pro Glu Asn
Leu Leu Leu Asp Glu 65 70 75 80 Lys Asn Asn Ile Arg Ile Ala Asp Phe
Gly Met Ala Ser Leu Gln Val 85 90 95 Gly Asp Ser Leu Leu Glu Thr
Ser Cys Gly Ser Pro His Tyr Ala Cys 100 105 110 Pro Glu Val Ile Arg
Gly Glu Lys Tyr Asp Gly Arg Lys Ala Asp Val 115 120 125 Trp Ser Cys
Gly Val Ile Leu Phe Ala Leu Leu Val Gly Ala Leu Pro 130 135 140 Phe
Asp Asp Asp Asn Leu Arg Gln Leu Leu Glu Lys Val Lys Arg Gly 145 150
155 160 Val Phe His Met Pro His Phe Ile Pro Pro Asp Cys Gln Ser Leu
Leu 165 170 175 Arg Gly Met Ser Glu Val Asp Ala Ala Arg Arg Leu Thr
Leu Glu His 180 185 190 Ile Gln Lys His Ile Trp Tyr Ile Gly Gly Lys
Asn Glu Pro Glu Pro 195 200 205 Glu Gln Pro Ile Pro Arg Lys Val Gln
Ile Arg Ser Leu Pro Ser Leu 210 215 220 Glu Asp Ile Asp Pro Asp Val
Leu Asp Ser Met His Ser Leu Gly Cys 225 230 235 240 Phe Arg Asp Arg
Asn Lys Leu Leu Gln Asp Leu Leu Ser Glu Glu Glu 245 250 255 Asn Gln
Glu Lys Met Ile Tyr Phe Leu Leu Leu Asp Arg Lys Glu Arg 260 265 270
Tyr Pro Ser Gln Glu Asp Glu Asp Leu Pro Pro Arg Asn Glu Ile Asp 275
280 285 Pro Pro Arg Lys Arg Val Asp Ser Pro Met Leu Asn Arg His Gly
Lys 290 295 300 Arg Arg Pro Glu Arg Lys Ser Met Glu Val Leu Ser Val
Thr Asp Gly 305 310 315 320 Gly Ser Pro Val Pro Ala Arg Arg Ala Ile
Glu Met Ala Gln His Gly 325 330 335 Gln Arg Ser Arg Ser Ile Ser Gly
Ala Ser Ser Gly Leu Ser Thr Ser 340 345 350 Pro Leu Ser Ser Pro Arg
Val Thr Pro His Pro Ser Pro Arg Gly Ser 355 360 365 Pro Leu Pro Thr
Pro Lys Gly Thr Pro Val His Thr Pro Lys Glu Ser 370 375 380 Pro Ala
Gly Thr Pro Asn Pro Thr Pro Pro Ser Ser Pro Ser Val Gly 385 390 395
400 Gly Val Pro Trp Arg Ala Arg Leu Asn Ser Ile Lys Asn Ser Phe Leu
405 410 415 Gly Ser Pro Arg Phe His Arg Arg Lys Leu Gln Val Pro Thr
Pro Glu 420 425 430 Glu Met Ser Asn Leu Thr Pro Glu Ser Ser Pro Glu
Leu Ala Lys Lys 435 440 445 Ser Trp Phe Gly Asn Phe Ile Ser Leu Glu
Lys Glu Glu Gln Ile Phe 450 455 460 Val Val Ile Lys Asp Lys Pro Leu
Ser Ser Ile Lys Ala Asp Ile Val 465 470 475 480 His Ala Phe Leu Ser
Ile Pro Ser Leu Ser His Ser Val Ile Ser Gln 485 490 495 Thr Ser Phe
Arg Ala Glu Tyr Lys Ala Thr Gly Gly Pro Ala Val Phe 500 505 510 Gln
Lys Pro Val Lys Phe Gln Val Asp Ile Thr Tyr Thr Glu Gly Gly 515 520
525 Glu Ala Gln Lys Glu Asn Gly Ile Tyr Ser Val Thr Phe Thr Leu Leu
530 535 540 Ser Gly Pro Ser Arg Arg Phe Lys Arg Val Val Glu Thr Ile
Gln Ala 545 550 555 560 Gln Leu Leu Ser Thr His Asp Pro Pro Ala Ala
Gln His Leu Ser Glu 565 570 575 Pro Pro Pro Pro Ala Pro Gly Leu Ser
Trp Gly Ala Gly Leu Lys Gly 580 585 590 Gln Lys Val Ala Thr Ser Tyr
Glu Ser Ser Leu 595 600 18 149 PRT Homo sapiens 18 Met Ser Asn Leu
Thr Pro Glu Ser Ser Pro Glu Leu Ala Lys Lys Ser 1 5 10 15 Trp Phe
Gly Asn Phe Ile Ser Leu Glu Lys Glu Glu Gln Ile Phe Val 20 25 30
Val Ile Lys Asp Lys Pro Leu Ser Ser Ile Lys Ala Asp Ile Val His 35
40 45 Ala Phe Leu Ser Ile Pro Ser Leu Ser His Ser Val Ile Ser Gln
Thr 50 55 60 Ser Phe Arg Ala Glu Tyr Lys Ala Thr Gly Gly Pro Ala
Val Phe Gln 65 70 75 80 Lys Pro Val Lys Phe Gln Val Asp Ile Thr Tyr
Thr Glu Gly Gly Glu 85 90 95 Ala Gln Lys Glu Asn Gly Ile Tyr Ser
Val Thr Phe Thr Leu Leu Ser 100 105 110 Gly Pro Ser Arg Arg Phe Lys
Arg Val Val Glu Thr Ile Gln Ala Gln 115 120 125 Leu Leu Ser Thr His
Asp Pro Leu Arg Pro Ser Thr Cys Gln Thr Pro 130 135 140 Leu Thr Val
Trp Lys 145
* * * * *