U.S. patent application number 09/888413 was filed with the patent office on 2003-05-22 for high throughput assay system.
Invention is credited to Felder, Stephen, Kris, Richard M..
Application Number | 20030096232 09/888413 |
Document ID | / |
Family ID | 25393133 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096232 |
Kind Code |
A1 |
Kris, Richard M. ; et
al. |
May 22, 2003 |
High throughput assay system
Abstract
The present invention relates to compositions, apparatus and
methods useful for concurrently performing multiple, high
throughput, biological or chemical assays, using repeated arrays of
probes. A combination of the invention comprises a surface, which
comprises a plurality of test regions, at least two of which, and
in a preferred embodiment, at least twenty of which, are
substantially identical, wherein each of the test regions comprises
an array of generic anchor molecules. The anchors are associated
with bifunctional linker molecules, each containing a portion which
is specific for at least one of the anchors and a portion which is
a probe specific for a target of interest. The resulting array of
probes is used to analyze the presence or test the activity of one
or more target molecules which specifically interact with the
probes. In a preferred embodiment, a sample to be tested is
subjected to a nuclease protection procedure before it is contacted
with a combination of the invention.
Inventors: |
Kris, Richard M.; (Tucson,
AZ) ; Felder, Stephen; (Tucson, AZ) |
Correspondence
Address: |
MILLEN, WHITE, ZELANO & BRANIGAN, P.C.
2200 CLARENDON BLVD.
SUITE 1400
ARLINGTON
VA
22201
US
|
Family ID: |
25393133 |
Appl. No.: |
09/888413 |
Filed: |
June 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09888413 |
Jun 26, 2001 |
|
|
|
09337325 |
Jun 21, 1999 |
|
|
|
6238869 |
|
|
|
|
09337325 |
Jun 21, 1999 |
|
|
|
09218166 |
Dec 22, 1998 |
|
|
|
09218166 |
Dec 22, 1998 |
|
|
|
09109076 |
Jul 2, 1998 |
|
|
|
6232066 |
|
|
|
|
60068291 |
Dec 19, 1997 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.1; 435/91.2 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C40B 40/06 20130101; B01J 2219/00722 20130101; B01J 2219/00527
20130101; B01J 2219/00315 20130101; C40B 60/14 20130101; B01J
2219/00626 20130101; B01J 2219/00605 20130101; B01J 2219/00659
20130101; G16B 25/00 20190201; B01J 2219/0063 20130101; B01J
2219/00612 20130101; B01J 2219/00621 20130101; B01J 2219/00662
20130101; B01J 2219/0061 20130101; C12Q 1/6837 20130101; B01J
2219/00547 20130101; B01J 2219/00702 20130101; B01J 2219/00608
20130101; C40B 70/00 20130101; B01J 2219/00585 20130101; B01J
2219/00596 20130101; B01J 2219/00644 20130101; C12Q 1/6837
20130101; C12Q 2521/307 20130101; C12Q 1/6816 20130101; C12Q
2521/307 20130101; C12Q 2561/108 20130101; C12Q 2565/519 20130101;
C12Q 1/6837 20130101; C12Q 2527/119 20130101; C12Q 2537/125
20130101; C12Q 2561/108 20130101; C12Q 2563/107 20130101; C12Q
1/6837 20130101; C12Q 2565/513 20130101; C12Q 2537/125
20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
What is claimed is:
1. A method of detecting at least one nucleic acid target,
comprising contacting a sample which may comprise said target(s)
with a nuclease protection fragment(s) specific for and which binds
to said target(s), exposing the sample to a nuclease effective to
digest single stranded nucleic acid, and contacting the resultant
sample with a combination which comprises, before the addition of
said sample, i) a surface comprising multiple spatially discrete
regions, at least two of which are substantially identical, each
region comprising ii) at least two different loci of
oligonucleotide anchors, each anchor in association with iii) a
bifunctional linker which has a first portion that is specific for
the oligonucleotide anchor, and a second portion that comprises a
probe which is specific for said nuclease protection fragment(s),
under conditions effective for said nuclease protection fragment(s)
to bind to said combination, wherein at least one locus in at least
one of said regions is a "mixed locus," which comprises about 2 to
about 4 different anchors, each having a specificity for a
different bifunctional linker, and wherein two or more of said
different anchors located in said mixed locus are each in
association with about 2 to about 4 different bifunctional linkers,
having different target specificities, hybridizing said bound
protection fragments with specific detection linkers, at least one
of which is a "blocked" detection linker and wherein at least one
of said detection linkers is specific for a first protection
fragment which is associated with a first of said about 2 to about
4 different bifunctional linkers, detecting said detection linkers
with a specific reporter reagent which comprises an enzyme that
generates a chemiluminescent signal, stopping said signal by
adjusting the pH of the reaction mixture, hybridizing said bound
protection fragments with specific detection linkers, at least one
of which is a "blocked" detection linker and wherein at least one
of said detection linkers is specific for a second protection
fragment which is associated with a second of said about 2 to about
4 different bifunctional linkers, and detecting said detection
linkers with a specific reporter reagent which comprises an enzyme
that generates a chemiluminescent signal.
Description
[0001] This application is a C.I.P. of U.S. application Ser. No.
09/337,325, filed on Jun. 21, 1999, which is a C.I.P. of U.S.
application Ser. No. 09/218,166, filed on Dec. 22, 1998, which is a
C.I.P. of U.S. application Ser. No. 09/109,076, filed on Jul. 2,
1998. This application claims priority of provisional application
No. 60/068,291, filed Dec. 19, 1997.
FIELD OF THE INVENTION
[0002] This invention relates, e.g., to compositions, apparatus and
methods useful for concurrently performing multiple biological or
chemical assays, using repeated arrays of probes. A plurality of
regions each contains an array of generic anchor molecules. The
anchors are associated with bifunctional linker molecules, each
containing a portion which is specific for at least one of the
anchors and a portion which is a probe specific for a target of
interest. The resulting array of probes is used to analyze the
presence of one or more target molecules which interact
specifically with the probes. The invention relates to diverse
fields distinguished by the nature of the molecular interaction,
including but not limited to pharmaceutical drug discovery,
molecular biology, biochemistry, pharmacology and medical
diagnostic technology.
BACKGROUND OF THE INVENTION
[0003] Pluralities of molecular probes arranged on surfaces or
"chips" have been used in a variety of biological and chemical
assays. Assays are performed to determine if target molecules of
interest interact with any of the probes. After exposing the probes
to target molecules under selected test conditions, detection
devices determine whether a target molecule has interacted with a
given probe.
[0004] These systems are useful in a variety of screening
procedures for obtaining information about either the probes or the
target molecules. For example, they have been used to screen for
peptides or potential drugs which bind to a receptor of interest,
among others; to screen samples for the presence of, for example,
genetic mutations, allelic variants in a population, or a
particular pathogen or strain of pathogen, among many others; to
study gene expression, for example to identify the mRNAs whose
expression is correlated with a particular physiological condition,
developmental stage, or disease state, etc.
DESCRIPTION OF THE INVENTION
[0005] This invention provides compositions, apparatus and methods
for concurrently performing multiple biological or chemical assays,
and allows for high throughput analysis of multiple samples--for
example, multiple patient samples to be screened in a diagnostic
assay, or multiple potential drugs or therapeutic agents to be
tested in a method of drug discovery. A combination is provided
which is useful for the detection of one or more targets in a
sample. This combination comprises a surface comprising a plurality
of spatially discrete regions, which can be termed test regions and
which can be wells, at least two of which are substantially
identical. Each surface comprises at least two, preferably at least
twenty or more, e.g., at least about 25, 50, 96, 864, or 1536,
etc., of such substantially identical regions. Each test region
defines a space for the introduction of a sample containing (or
potentially containing) one or more targets and contains a
biological or chemical array. (Phrases such as "sample containing a
target" or "detecting a target in a sample" are not meant to
exclude samples or determinations (detection attempts) where no
target is contained or detected. In a general sense, this invention
involves arrays to determine whether a target is contained in a
sample irrespective of whether it is or is not detected.) This
array comprises generic "anchors," each in association with a
bifunctional linker molecule which has a first portion that is
specific for the anchor and a second portion that comprises a probe
which is specific for at least one of the target(s). The
combination of this invention is placed in contact with a sample
containing one or more targets, which optionally react with a
detector molecule(s), and is then interrogated by a detection
device which detects reactions between target molecules and probes
in the test regions, thereby generating results of the assay.
[0006] The invention provides methods and compositions particularly
useful for high throughput biological assays. In especially
preferred embodiments, the invention can be used for high
throughput screening for drug discovery. For example, a high
throughput assay can be run in many (100 for example) 96-well
microplates at one time. Each well of a plate can have, e.g., 36
different tests performed in it by using an array of about 36
anchor and linker pairs. That is, 100 plates, with 96 wells per
plate, and each with 36 tests per well, can allow for a total of
345,000 tests; for example, each of 9,600 different drug candidates
can be tested simultaneously for 36 different parameters or assays.
High throughput assays provide much more information for each drug
candidate than do assays which test only one parameter at a time.
For example, it is possible in a single initial high throughput
screening assay to determine whether a drug candidate is selective,
specific and/or nontoxic. Non-high throughput methods necessitate
extensive follow-up assays to test such parameters for each drug
candidate of interest. Several types of high throughput screening
assays are described, e.g., in Examples 15-17. The ability to
perform simultaneously a wide variety of biological assays and to
do very many assays at once (i.e., in very high throughput) are two
important advantages of the invention.
[0007] In one embodiment, for example, using 96-well DNA Bind
plates (Coming Costar) made of polystyrene with a derivatized
surface for the attachment of primary amines, such as amino acids
or modified oligonucleotides, a collection of 36 different
oligonucleotides can be spotted onto the surface of every well of
every plate to serve as anchors. The anchors can be covalently
attached to the derivatized polystyrene, and the same 36 anchors
can be used for all screening assays. For any particular assay, a
given set of linkers can be used to program the surface of each
well to be specific for as many as 36 different targets or assay
types of interest, and different test samples can be applied to
each of the 96 wells in each plate. The same set of anchors can be
used multiple times to re-program the surface of the wells for
other targets and assays of interest, or it can be re-used multiple
times with the same set of linkers. This flexibility and
reusability represent further advantages of the invention.
[0008] One embodiment of the invention is a combination useful for
the detection of one or more target(s) in a sample, which
comprises, before the addition of said sample,
[0009] a) a surface, comprising multiple spatially discrete
regions, at least two of which are substantially identical, each
region comprising
[0010] b) at least eight different oligonucleotide anchors, each in
association with
[0011] c) a bifunctional linker which has a first portion that is
specific for the oligonucleotide anchor, and a second portion that
comprises a probe which is specific for said target(s).
[0012] Another embodiment of the invention is a combination useful
for the detection of one or more target(s) in a sample, which
comprises, before the addition of said sample,
[0013] a) a surface, comprising multiple spatially discrete
regions, at least two of which are substantially identical, each
region comprising
[0014] b) at least eight different anchors, each in association
with
[0015] c) a bifunctional linker which has a first portion that is
specific for the anchor, and a second portion that comprises a
probe which is specific for said target(s).
[0016] Another embodiment of the invention is a method for
detecting at least one target, which comprises contacting a sample
which may comprise the target(s) with a combination as described
above, under conditions effective for said target(s) to bind to
said combination. Another embodiment is a method for determining an
RNA expression pattern, which comprises incubating a sample which
comprises as target(s) at least two RNA molecules with a
combination as described above, wherein at least one probe of the
combination is a nucleic acid (e.g., oligonucleotide) which is
specific (i.e. selective) for at least one of the RNA targets,
under conditions which are effective for specific hybridization of
the RNA target(s) to the probe(s). Another embodiment is a method
for identifying an agent (or condition(s)) that modulates an RNA
expression pattern, which is the method described above for
determining an RNA expression pattern, further comprising comparing
the RNA expression pattern produced in the presence of said agent
(or condition(s)) to the RNA expression pattern produced under a
different set of conditions.
[0017] By way of example, FIGS. 1 and 2 illustrate a combination of
the invention and a method of using it to detect an mRNA target.
The surface of the invention, shown in FIG. 2, contains 15
identical test regions; in an especially preferred embodiment of
the invention, each of these test regions is a well in a microtiter
plate. Each of the test regions contains six different anchors,
here indicated as numbers 1-6. FIG. 1 schematically illustrates one
of those anchors, anchor 1, which, in a most preferred embodiment
of the invention, is an oligonucleotide. To anchor 1 is attached a
linker molecule, linker 1, which comprises two portions. The first
portion, which is specific for the anchor, is in this illustration
an oligonucleotide which can hybridize specifically to the anchor.
The second portion, which is a probe specific for the target of
interest--here, target mRNA 1--is in this illustration an
oligonucleotide which can hybridize to that target. Although not
illustrated in this figure, each of the remaining five anchors can
hybridize to its own linker via the anchor-specific portion; each
linker can contain a probe portion specific for, e.g., an mRNA
different from (or the same as) mRNA 1. This illustrated
combination can be used to assay as many as 15 different samples at
the same time for the presence of mRNA 1 (or, simultaneously, for
mRNA targets which are specified (programmed) by the other five
probes in the array). To perform the assay, each sample, which in
this example can be an RNA extract from, say, one of 15 independent
cell lines, is added in a small volume to one of the regions, or
wells, and incubated under conditions effective for hybridization
of the probe and the target. In order to determine if mRNA 1 is
present in a sample, a detection device which can recognize
patterns, and/or can interrogate specific locations within each
region for the presence of a signal, is employed. If the cell lines
are incubated under conditions in which their mRNAs are labeled in
vivo with a tag, and if mRNA 1 is present in a sample, the detector
will detect a signal emanating from the tagged mRNA at the location
defined by anchor/probe complex 1. Alternatively, the mRNA can be
directly labeled in vitro, before or after being added to the
regions (wells). Alternatively, as is illustrated in FIG. 1, mRNA
can be tagged indirectly, before or after it has hybridized to the
probe, e.g., by incubating the RNA with a tagged "detector"
oligonucleotide (target-specific reporter oligonucleotide) which is
complementary to a sequence other than that recognized by the
probe. In the illustrated example, 15 samples can be analyzed
simultaneously. Because at least 20 or more, e.g., as many as 1536
or more, samples can be analyzed simultaneously with this
invention, it is a very high throughput assay system.
[0018] As used herein, "target" refers to a substance whose
presence, activity and/or amount is desired to be determined and
which has an affinity for a given probe. Targets can be man-made or
naturally-occurring substances. Also, they can be employed in their
unaltered state or as aggregates with other species. Targets can be
attached, covalently or noncovalently, to a binding member, either
directly or via a specific binding substance. Examples of targets
which can be employed in this invention include, but are not
limited to, receptors (on vesicles, lipids, cell membranes or a
variety of other receptors); ligands, agonists or antagonists which
bind to specific receptors; polyclonal antibodies, monoclonal
antibodies and antisera reactive with specific antigenic
determinants (such as on viruses, cells or other materials); drugs;
nucleic acids or polynucleotides (including mRNA, tRNA, rRNA,
oligonucleotides, DNA, viral RNA or DNA, ESTs, cDNA, PCR-amplified
products derived from RNA or DNA, and mutations, variants or
modifications thereof); proteins (including enzymes, such as those
responsible for cleaving neurotransmitters, proteases, kinases and
the like); substrates for enzymes; peptides; cofactors; lectins;
sugars; polysaccharides; cells (which can include cell surface
antigens); cellular membranes; organelles; etc., as well as other
such molecules or other substances which can exist in complexed,
covalently bonded crosslinked, etc. form. As used herein, the terms
nucleic acid, polynucleotide, polynucleic acid and oligonucleotide
are interchangeable. Targets can also be referred to as
anti-probes.
[0019] As used herein, a "probe" is a substance, e.g., a molecule,
that can be specifically recognized by a particular target. The
types of potential probe/target or target/probe binding partners
include receptor/ligand; ligand/antiligand; nucleic acid
(polynucleotide) interactions, including DNA/DNA, DNA/RNA, PNA
(peptide nucleic acid)/nucleic acid; enzymes, other catalysts, or
other substances, with substrates, small molecules or effector
molecules; etc. Examples of probes that are contemplated by this
invention include, but are not limited to, organic and inorganic
materials or polymers, including metals, chelating agents or other
compounds which interact specifically with metals, plastics,
agonists and antagonists for cell membrane receptors, toxins and
venoms, viral epitopes, hormones (e.g., opioid peptides, steroids,
etc.), hormone receptors, lipids (including phospholipids),
peptides, enzymes (such as proteases or kinases), enzyme
substrates, cofactors, drugs, lectins, sugars, nucleic acids
(including oligonucleotides, DNA, RNA, PNA or modified or
substituted nucleic acids), oligosaccharides, proteins, enzymes,
polyclonal and monoclonal antibodies, single chain antibodies, or
fragments thereof. Probe polymers can be linear or cyclic. Probes
can distinguish between phosphorylated and non-phosphorylated
proteins, either by virtue of differential activity or differential
binding. Probes such as lectins can distinguish among glycosylated
proteins. As used herein, the terms nucleic acid, polynucleotide,
polynucleic acid and oligonucleotide are interchangeable. Any of
the substances described above as "probes" can also serve as
"targets," and vice-versa.
[0020] Any compatible surface can be used in conjunction with this
invention. The surface (usually a solid) can be any of a variety of
organic or inorganic materials or combinations thereof, including,
merely by way of example, plastics such as polypropylene or
polystyrene; ceramic; silicon; (fused) silica, quartz or glass,
which can have the thickness of, for example, a glass microscope
slide or a glass cover slip; paper, such as filter paper;
diazotized cellulose; nitrocellulose filters; nylon membrane; or
polyacrylamide or other type of gel pad, e.g., an aeropad or
aerobead, made of an aerogel, which is, e.g., a highly porous
solid, including a film, which is prepared by drying of a wet gel
by any of a variety of routine, conventional methods. Substrates
that are transparent to light are useful when the method of
performing an assay involves optical detection. The surface can be
of any thickness or opacity which is compatible with, e.g.,
conventional methods of detection. For example, the surface can be
a thick bottom, clearplate, or an opaque plate. In a preferred
embodiment, the surface is the plastic surface of a multiwell,
e.g., tissue culture dish, for example a 24-, 96-, 256-, 384-, 864-
or 1536-well plate (e.g., a modified plate such as a Coming Costar
DNA Bind plate). Anchors can be associated, e.g., bound, directly
with a surface, or can be associated with one type of surface,
e.g., glass, which in turn is placed in contact with a second
surface, e.g., within a plastic "well" in a microtiter dish. The
shape of the surface is not critical. It can, for example, be a
flat surface such as a square, rectangle, or circle; a curved
surface; or a three dimensional surface such as a bead, particle,
strand, precipitate, tube, sphere; etc.
[0021] The surface comprises regions which are spatially discrete
and addressable or identifiable. Each region comprises a set of
anchors. How the regions are separated, their physical
characteristics, and their relative orientation to one another are
not critical. In one embodiment, the regions can be separated from
one another by any physical barrier which is resistant to the
passage of liquids. For example, in a preferred embodiment, the
regions can be wells of a multiwell (e.g., tissue culture) dish,
for example a 24-, 96-, 256-, 384-, 864- or 1536-well plate.
Alternatively, a surface such as a glass surface can be etched out
to have, for example, 864 or 1536 discrete, shallow wells.
Alternatively, a surface can comprise regions with no separations
or wells, for example a flat surface, e.g., piece of plastic, glass
or paper, and individual regions can further be defined by
overlaying a structure (e.g,. a piece of plastic or glass) which
delineates the separate regions. Optionally, a surface can already
comprise one or more arrays of anchors, or anchors associated with
linkers, before the individual regions are delineated. In another
embodiment, arrays of anchors within each region can be separated
from one another by blank spaces on the surface in which there are
no anchors, or by chemical boundaries, such as wax or silicones, to
prevent spreading of droplets.
[0022] In yet another embodiment, the regions can be defined as
tubes or fluid control channels, e.g., designed for flow-through
assays, as disclosed, for example, in Beattie et al (1995). Clin.
Chem. 4, 700-706. Tubes can be of any size, e.g., capillaries or
wider bore tubes; can allow the flow of liquids; or can be
partially or completely filled with a gel, e.g., agarose or
polyacrylamide, through which compounds can be transported (passed
through, flowed through, pumped through), e.g., by electrophoresis;
or with a space filling matrix of channels, e.g., of linear
channels, as described, e.g., in Albota et al. (1998). Science 281,
1653-1656; Cumpston et al. (1998). Mat. Res. Soc. Symp. Proc. 488,
217-225; and/or Cumpston et al. (1999). Nature 398, 51-54. In such
a space-filling matrix, liquid and/or molecules therein can not
only follow in direction perpendicular to the wall of the tube, but
can also diffuse laterally. In a preferred embodiment, a tube is
filled with a gel or space-filling matrix; the gel or space-filling
matrix is activated for the binding of anchors, and different
anchors are passed through sequentially, allowing the formation of
a an array (e.g., a linear array) of anchors within the gel; and
linkers, targets, etc. are passed through in succession. The array
may be linear, 2- or 3-dimensional.
[0023] A plurality of assays can be performed in a single tube. For
example, a single array of anchors, or of anchors in association
with linkers, in a tube can be re-used (e.g., stripped and re-used,
or reprogrammed) in sequential assays with the same or different
samples. In another embodiment, a plurality of tubes is used in a
single assay, e.g., a sample of interest is analyzed in a plurality
of tubes containing different arrays. The anchors and anchor/linker
associations in the tubes can be any of the types described
elsewhere herein.
[0024] Regions within or on, etc. a surface can also be defined by
modification of the surface itself. For example, a plastic surface
can comprise portions made of modified or derivatized plastic,
which can serve, e.g., as sites for the addition of specific types
of polymers (e.g., PEG can be attached to a polystyrene surface and
then derivatized with carboxyl or amino groups, double bonds,
aldehydes, and the like). Alternatively, a plastic surface can
comprise molded structures such as protrusions or bumps, which can
serve as platforms for the addition of anchors. In another
embodiment, regions can be gel pads, e.g., polyacrylamide gel pads
or aeropads, which are arrayed in a desired pattern on a surface
such as, e.g., glass, or are sandwiched between two surfaces, such
as, e.g., glass and a quartz plate. Anchors, linkers, etc. can be
immobilized on the surface of such pads, or can be imbedded within
them. A variety of other arrangements of gel pads on surfaces will
be evident to one of skill in the art, and can be produced by
routine, conventional methods. The relative orientation of the test
regions can take any of a variety of forms including, but not
limited to, parallel or perpendicular arrays within a square or
rectangular or other surface, radially extending arrays within a
circular or other surface, or linear arrays, etc.
[0025] The spatially discrete regions of the invention are present
in multiple copies. That is, there are at least two, preferably at
least twenty, or at least about 24, 50, 96, 256, 384, 864, 1536,
2025, or more, etc., substantially identical, spatially discrete
(separated) regions. Increasing numbers of repeated regions can
allow for assays of increasingly higher throughput. Substantially
identical regions, as used herein, refers to regions which contain
identical or substantially identical arrays of anchors and/or
anchor/linker complexes. Substantially identical, as used herein,
means that an array or region is intended to serve essentially the
same function as another array or region in the context of
analyzing a target in accordance with this invention. Differences
not essentially affecting function, i.e., detectability of targets,
are along the line of small nucleotide imperfections
(omissions/inserts/substitutions) or oligo imperfections (poor
surface binding), etc., which do not within assay accuracy
significantly affect target determination results.
[0026] Of course, one of skill in the art will recognize that not
all of the regions on a surface need to be substantially identical
to one another. For example, if two different sets of arrays are to
be tested in parallel, it might be advantageous to include both
sets of arrays on a single surface. For example, the two different
sets of arrays can be arranged in alternating striped patterns, to
facilitate comparison between them. In another embodiment, the
practitioner may wish to include regions which can be detected in a
distinguishable manner from the other regions on the surface and
can thereby be used as a "registration region(s)." For example, a
registration region can comprise oligonucleotides or peptides which
display a distinctive pattern of fluorescent molecules that can be
recognized by a scanning detection device as a "starting point" for
aligning the locations of the regions on a surface.
[0027] The size and physical spacing of the test regions are not
limiting. Typical regions are of an area of about 1 to about 700
mm.sup.2, preferably 1 to about 40 mm.sup.2, and are spaced about
0.5 to about 5 mm apart, and are routinely selected depending on
the areas involved. In a preferred embodiment, the regions are
spaced approximately 5 mm apart. For example, each region could
comprise a rectangular grid, with, for example, 8 rows and 6
columns, of roughly circular spots of anchors which are about 100
micrometers in diameter and 500 micrometers apart; such a region
would cover about a 20 millimeter square area. Larger and smaller
region areas and spacings are included.
[0028] The regions can also be further subdivided such that some or
all anchors within a region are physically separated from
neighboring anchors by means, e.g., of an indentation or dimple.
For example, the number of subdivisions (subregions) in a region
can range from about 10 to about 100 or more or less. In one
embodiment, a region which is a well of a 1536-well dish can be
further subdivided into smaller wells, e.g., about 4 to about 900,
preferably about 16 to about 36 wells, thereby forming an array of
wells-within-wells. See FIG. 4. Such a dimpled surface reduces the
tolerance required for physically placing a single anchor (or group
of anchors) into each designated space (locus), and the size of the
areas containing anchors is more uniform, thereby facilitating the
detection of targets which bind to the probe.
[0029] The term "anchor" as used herein refers to any entity or
substance, e.g., molecule, which is associated with (e.g.,
immobilized on, or attached either covalently or non-covalently to)
the surface, or which is a portion of such surface (e.g.,
derivatized portion of a plastic surface), and which can undergo
specific interaction or association with a linker or other
substance as described herein. The portion of an anchor which
associates with, e.g., a linker molecule, can be associated with
the surface directly, or the anchor can comprise an intermediate
"spacer" moiety. Such a spacer can be of any material, e.g., any of
a variety of materials which are conventional in the art. In one
embodiment, the spacer is a linear carbon molecule having, e.g.,
about 5-20 Cs, preferably about 12 Cs. In another embodiment, the
spacer is a nucleic acid (of any of the types describes elsewhere
herein) which does not undergo specific interaction or association
with, e.g., a linker molecule.
[0030] The term "anchor" as used herein can also refer to a group
of substantially identical anchors. See, e.g., FIG. 7, which
schematically represents a test region comprising 3 anchors (A, B
and C), each of which is present in multiple copies (a "group").
The location of each group of anchors is termed herein a "locus."
As is well known in the art, the number of individual anchor
molecules present at a locus is limited only by physical
constraints introduced by, e.g., the size of the anchors. For
example, a locus which is, e.g., about 25-200 .mu.m in diameter,
can comprise millions of anchors.
[0031] As used herein, an "anchor/linker complex" exists when an
anchor and a linker have combined through molecular association in
a specific manner. The interaction with the linker can be either
irreversible, such as via certain covalent bonds, or reversible,
such as via nucleic acid hybridization.
[0032] In a preferred embodiment, the anchor is a nucleic acid,
which can be of any length (e.g., an oligonucleotide) or type
(e.g., DNA, RNA, PNA, or a PCR product of an RNA or DNA molecule).
The nucleic acid can be modified or substituted (e.g., comprising
non naturally occurring nucleotides such as, e.g., inosine; joined
via various known linkages such as sulfamate, sulfamide,
phosphorothionate, methylphosphonate, carbamate, etc.; or a
semisynthetic molecule such as a DNA-streptavidin conjugate, etc.).
Single stranded nucleic acids are preferred.
[0033] A nucleic acid anchor can be of any length which is
compatible with the invention. For example, the anchor can be an
oligonucleotide, ranging from about 8 to about 50 nucleotides in
length, preferably about 10, 15, 20, 25 or 30 nucleotides. In
another embodiment, the anchor can be as long as about 50 to about
300 nucleotides in length, or longer or shorter, preferably about
200 to about 250 nucleotides. For example, an anchor can comprise
about 150 to about 200 nucleotides of "spacer" nucleic acid, as
described above, and, adjacent to the spacer, a shorter sequence
of, e.g., about 10, 15, 20, 25 or 30 nucleotides which is designed
to interact with a linker molecule ("linker-specific sequence").
Such spacers can be of any length or type of nucleic acid, and can
have any base composition which is functional in the invention. In
a preferred embodiment, the spacers of each of the anchors at a
locus, and/or of the anchors in different loci within a region, are
substantially identical; the anchors thus differ from one another
primarily with regard to their linker-specific sequences.
[0034] Spacers can impart advantages to anchors, allowing for
improved performance. For example, the linker-specific portions of
such an anchor lie further away from the surface, and therefore are
less physically constrained and subject to less steric hindrance,
than if they were closer to the surface. This facilitates, for
example, the association of a plurality of different linkers (e.g.,
about 2 to about 100), having different target specificities, with
the anchors at a given locus. As is discussed in more detail below,
an individual anchor can comprises (in addition to a spacer) a
plurality of linker-specific sequences which are arranged, e.g., in
a tandem linear fashion; this allows for the association of a
plurality of different types of linkers with at least one such
anchor at a given locus. Also discussed in more detail below is
another way in which a plurality of different types of linkers can
be associated with the anchors at a given locus: at a "mixed
locus," two or more anchors are each associated with a different
linker, having a different target specificity. Because of the
physical flexibility of anchors comprising spacers, the anchors at
a given locus can readily bind to a plurality of different linker
molecules without being physically constrained by adjacent anchor
molecules. An advantage of binding a plurality of linker molecules
to the anchors at a given locus is that it allows for the detection
of an increased number of targets at a particular locus. In one
embodiment, the plurality of linkers bound at a given locus have
probes which are specific for different portions of the same target
nucleic acid of interest (e.g., to different oligonucleotide
sequences within the nucleic acid). This allows for amplified
detection of the target compared to detection with a single probe.
In another embodiment, the plurality of linkers have probes which
are specific for different, e.g. unrelated, targets. This allows
for the detection of a plurality of different targets within a
particular locus. A further advantage of anchors comprising spacers
is that they can more readily accommodate linkers which are
associated with relatively large molecules such as, e.g., proteins,
and/or which bind to relatively large targets such as, e.g.,
proteins, membranes or cells.
[0035] The base composition of a nucleic acid anchor is not
necessarily constrained. Any base composition of the anchors is
acceptable, provided that the anchors are functional for the
purpose of the invention. For example, single stranded nucleic acid
anchors at a locus, or at different loci in a region, can comprise
partially or completely random sequences (e.g., randomly generated
sequences, for example with no restrictions on the relative amounts
of A, G, T and/or C). In one embodiment, the anchors are not
"sequence isomers" (e.g., "random sequence isomers"), i.e.,
oligonucleotides having identical amounts of G, C, A and T, but
arranged in different relative orders. That is, the anchors in, for
example, the different loci of a region do not conform to the
equation G.sub.n C.sub.n A.sub.m T.sub.m, where n and m are
integers. See, e.g., the anchors shown in Example 1, which are not
random sequence isomers. In the anchors of the invention, the
amounts of G and C do not need to be approximately the same, nor do
the relative amounts of A and T. Furthermore, the net relative
amounts of G, C, A and T are not necessarily constrained. For
example, the base composition of the anchors in a region can range
from being relatively GC rich (i.e., greater than 50% G+C), to
having equal amounts of G, C, A and T, to being relatively AT rich
(i.e., greater than 50% A+T). In one embodiment, the anchors are
randomly generated, e.g., in a manner such that no constraints are
placed on the relative amounts of G, C, A and T.
[0036] Anchors comprising a nucleic acid spacer and one or more
linker-specific portions are unlikely to conform to any particular
constraints on base compostion. For example, if the anchors located
at different loci in a region have spacers which are substantially
identical, e.g., a substantially identical 25-mer or a 200-mer, but
each anchor has a different linker-specific moiety (e.g., a
25-mer), even if the linker-specific moieties meet specific
requirements (e.g., the number of As and Gs are approximately
equal; the number of Ts and Cs are approximately equal; the oligo
conforms to the equation G.sub.n C.sub.n A.sub.m T.sub.m; and/or
that the G+C content meets a particular requirement), the anchors
as a whole will not meet those particular requirements. Similarly,
even if the linker-specific moieties of anchors at different loci
in a region are substantially different from one another (e.g.,
each linker-specific moiety has a sequence which differs by at
least about 20%, or 50%, or 80% from each other linker-specific
moiety in the region), the net sequence identities of the anchors,
considering the entire length of the nucleic acid, may be far less.
For example, if each of the anchors comprises a substantially
identical 250-mer spacer, and a 25-mer linker-specific moiety which
is 100% different from every other linker-specific moiety in the
region, the anchors will still differ from one another by only
10%.
[0037] An anchor can also be a peptide or a protein. For example,
it can be a polyclonal or monoclonal antibody molecule or fragment
thereof, or single chain antibody or fragment thereof, which binds
specifically to the portion of a linker that is an antigen or an
anti-antibody molecule; in the obverse, the anchor can be a
peptide, and the portion of the linker which binds to it can be an
antibody or the like. In another embodiment, the anchor can be a
lectin (such as concanavalin A or agglutinins from organisms such
as Limulus, peanut, mung bean, Phaseolus, wheat germ, etc.) which
is specific for a particular carbohydrate. In another embodiment,
the anchor can comprise an organic molecule, such as a modified or
derivatized plastic polymer which can serve, e.g., as the stage for
specific solid phase chemical synthesis of an oligonucleotide. In
this case, the derivatized plastic can be distributed as an array
of discrete, derivatized, loci which are formed integrally into the
plastic surface of a combination during the manufacturing process.
In another embodiment, the anchor can take advantage of specific or
preferential binding between metal ions, e.g., Ni, Zn, Ca, Mg, etc.
and particular proteins or chelating agents. For example, the
anchor can be polyhistidine, and the anchor-specific portion of the
linker can be nickel, which is attached via a nickel chelating
agent to a target-specific probe. Alternatively, the chelating
agent can be the anchor and the polyhistidine the probe-related
portion. Alternatively, the anchor can comprise an inorganic
substance. For example, it can comprise a metal such as calcium or
magnesium, and the anchor-specific portion of the linker can be a
preferential chelating agent, such as EDTA or EGTA, respectively,
which is attached to a target-specific probe. One of skill in the
art will recognize that a wide range of other types of molecules
can also serve as anchors, such as those general types also
discussed in conjunction with probes and targets.
[0038] An anchor can also be a hybrid structure, such as a DNA
duplex, or a duplex comprising, e.g., DNA and protein which
interact specifically in any of the ways described elsewhere
herein. For example, the "base moiety" of a duplex anchor (the
portion which is in direct contact with the surface) can comprise
an optionally modified single stranded nucleic acid; preferably,
the base moiety also comprises a spacer, e.g., a linear carbon
spacer as described above. In one embodiment, a second single
stranded nucleic acid is associated with (e.g., hybridized to) this
base moiety, to form an anchor which comprises at least a partially
double stranded (duplex) nucleic acid. For example, the base moiety
can comprise a linear carbon spacer which is attached to the
surface at one end, and at the other end is attached to a single
stranded DNA oligonucleotide of about 10-100 nucleotides,
preferably about 25 nucleotides; and the second moiety of the
duplex can comprise a sequence which is complementary to at least a
portion of the base moiety, (e.g., to the terminal about 40
nucleotides), followed by an optional spacer (e.g., about 5-15,
preferably about 10 nucleotides), followed by a linker-specific
sequence (e.g., a sequence of about 8 to about 50 nucleotides,
preferably about 15, 20, 25 or 30 nucleotides, most preferably
about 25 nucleotides in length).
[0039] The relative lengths and base compositions of the
complementary portions of an anchor duplex and of its
linker-specific sequence(s) can be varied to suit the needs of an
assay, using optimization procedures which are conventional in the
art. For example, sequences can be selected such that linkers can
be dissociated from (e.g., melted apart from) duplex anchor
molecules under conditions in which the duplex anchors, themselves,
remain intact. The remaining arrays of duplex anchors can then be
re-used, if desired, to hybridize to the same or different linker
molecules. Alternatively, sequences can be selected such that both
the anchor/linker hybrids and the two complementary portions of the
duplex anchors are dissociated under the same conditions, leaving
behind only the base moieties in contact with the surface. In one
embodiment, all or substantially all of the base moieties in a
particular locus or in all the loci of a region are identical, or
substantially identical. The arrays of base moieties remaining
after such a dissociation can be re-used (e.g., for hybridization
to linker molecules) only if the complementary portions of the
duplex anchors are first added back, a process which requires
knowledge of the sequence of the base moiety that is involved in
duplex formation. The ability to manufacture arrays of anchors
which either can or cannot be re-used by a user unfamiliar with the
sequence of the base moieties, represents an advantage of employing
such hybrid anchors. For example, a manufacturer can prevent
unauthorized re-use of its arrays. The prevention of such re-use
can also, e.g., forestall problems of degraded performance or
unreliability occasioned by excessive use.
[0040] In one embodiment, the group of anchors at a given locus
within a region are substantially identical (e.g., are specific for
the "anchor-specific" portion of one type of linker, or for one
target, only). See, e.g., FIG. 7. In another embodiment, a
plurality of different anchors, having specificities for a
plurality of different linkers and/or for a plurality of different
targets, can be present at a given locus, called a "mixed locus,"
e.g., a plurality of about 2 to about 100, for example at least
about 2, at least about 4 or at least about 10. An advantage of
mixed loci is that they allow for the detection of an increased
number of different targets at a particular locus. In one
embodiment, each mixed locus contains one anchor which is the same
in every, or at least several, loci. For instance, an anchor which
is the same in more than one locus can be used for quality
assurance and/or control or for signal normalization.
[0041] Of course, "mixed loci" are also advantageous for surfaces
having only a single (non-repeated) region. The anchors in each of
the loci of such a single region can interact with linkers, or
directly with targets of interest.
[0042] The number of anchors (i.e., groups of anchors at individual
loci) in a test region can be at least two, preferably between
about 8 and about 900 (more or less being included), more
preferably between about 8 and about 300, and most preferably
between about 30 and about 100 (e.g., about 64). In some preferred
embodiments, there are about 16, 36, 45 or 100 anchors/test region
for a surface with 96 test regions (e.g., wells), or about 9, 16 or
25 anchors/test region for a surface with 384 test regions (e.g.,
wells). In a most preferred embodiment, each anchor in a test
region has a different specificity from every other anchor in the
array. However, two or more of the anchors can share the same
specificity and all of the anchors can be identical. In one
embodiment, in which a combination of the invention comprises a
very large number of test regions (e.g., about 864, 1536, or more),
so that a large number of test samples can be processed at one
time, it might of interest to test those samples for only a limited
number (e.g., about 2, 4, 6 or 9) of parameters. In other words,
for combinations comprising a very large number of regions, it
might be advantageous to have only about 2 to 9 anchors per
region.
[0043] The physical spacing and relative orientation of the anchors
(i.e., groups of anchors at individual loci) in or on a test region
are not limiting. Typically, the distance between the anchors is
about 0.003 to about 5 mm or less, preferably between about 0.03
and about 1. Larger and smaller anchor spacings (and areas) are
included. The anchors can be arranged in any orientation relative
to one another and to the boundaries of the region. For example,
they can be arranged in a two-dimensional orientation, such as a
square, rectangular, hexagonal or other array, or a circular array
with anchors emanating from the center in radial lines or
concentric rings. The anchors can also be arranged in a
one-dimensional, linear array. For example, oligonucleotides can be
hybridized to specific positions along a DNA or RNA sequence to
form a supramolecular array, or in a linear arrangement in a flow
through gel, or on the surface of a flow through device or
structures within a flow through device Alternatively, the anchors
can be laid down in a "bar-code"-like formation. (See FIG. 6). For
example, anchors can be laid down as long lines parallel to one
another. The spacing between or the width of each long line can be
varied in a regular way to yield a simple, recognizable pattern
much like a bar-code, e.g., the first and third lines can be twice
as large as the rest, lines can be omitted, etc. An extra empty
line can be placed after the last line to demarcate one test
region, and the bar code pattern can be repeated in succeeding test
regions.
[0044] The pattern of anchors does not need to be in strict
registry with the positions of the separated assay wells (test
regions) or separate assay droplets. The term "assay positions"
will be used to refer to the positions of the assay surface where
assay samples are applied. (These can be defined by the position of
separate droplets of assay sample or by the position of walls or
separators defining individual assay wells on a multi-well plate
for example.) The anchor pattern itself (e.g., a "bar code"-like
pattern of oligonucleotide anchors) is used to define where exactly
each separate anchor is positioned by pattern recognition--just as
each line of a barcode is recognized by its position relative to
the remaining lines. Hence the first anchor need not be at one edge
or one corner of each assay position. The first anchor will be
found by pattern recognition, rather than position relative to the
assay position. As long as the area used by each assay position
(the area of the droplet or the area of the well for example) is
large enough to be certain to contain at least one whole unit of
the repeating pattern of anchors, then each assay point will test
the sample for that assay position for all of the targets specified
by the (bar-coded) pattern wherever the pattern lies within the
area of the assay position.
[0045] The anchors do not need to be arranged in a strict or even
fixed pattern within each test region. For example, each anchor can
be attached to a particle, bead, or the like, which assumes a
random position within a test region. The location of each anchor
can be determined by the use, e.g., of a detectable tag. For
example, the linker molecule specific for each type of anchor can
be labeled with a different fluorescent, luminescent etc. tag, and
the position of a particle comprising a particular linker/anchor
pair can be identified by the nature of the signal emanating from
the linker, e.g., the excitation or emission spectrum. One skilled
in the art can prepare a set of linkers with a variety of such
attached tags, each with a distinguishable spectrum. Alternatively,
the anchors can be labeled directly. For example, each type of
anchor can be labeled with a tag which fluoresces with a different
spectrum from the tags on other types of anchors. Alternatively,
the particles, beads or the like can be different from one another
in size or shape. Any of the labeling and detection methods
described herein can be employed. For example, fluorescence can be
measured by a CCD-based imaging system, by a scanning fluorescence
microscope or Fluorescence Activated Cell Sorter (FACS).
[0046] An anchor can interact or become associated specifically
with one portion--the anchor-specific portion--of a linker
molecule. By the terms "interact" or "associate", it is meant
herein that two substances or compounds (e.g., anchor and
anchor-specific portion of a linker, a probe and its target, or a
target and a target-specific reporter) are bound (e.g., attached,
bound, hybridized, joined, annealed, covalently linked, or
otherwise associated) to one another sufficiently that the intended
assay can be conducted. By the terms "specific" or "specifically",
it is meant herein that two components (e.g., anchor and
anchor-specific region of a linker, a probe and its target, or a
target and a target-specific reporter) bind selectively to each
other and, in the absence of any protection technique, not
generally to other components unintended for binding to the subject
components. The parameters required to achieve specific
interactions can be determined routinely, e.g., using conventional
methods in the art.
[0047] For nucleic acids, for example, one of skill in the art can
determine experimentally the features (such as length, base
composition, and degree of complementarity) that will enable a
nucleic acid (e.g., an oligonucleotide anchor) to hybridize to
another nucleic acid (e.g., the anchor-specific portion of a
linker) under conditions of selected stringency, while minimizing
non-specific hybridization to other substances or molecules (e.g.,
other oligonucleotide linkers). Typically, the DNA or other nucleic
acid sequence of an anchor, a portion of a linker, or a detector
oligonucleotide will have sufficient complementarity to its binding
partner to enable it to hybridize under selected stringent
hybridization conditions, and the T.sub.m will be about 10.degree.
to 20.degree. C. above room temperature (e.g., about 37.degree.
C.). In general, an oligonucleotide anchor can range from about 8
to about 50 nucleotides in length, preferably about 15, 20, 25 or
30 nucleotides. As used herein, "high stringent hybridization
conditions" means any conditions in which hybridization will occur
when there is at least 95%, preferably about 97 to 100%, nucleotide
complementarity (identity) between the nucleic acids. However,
depending on the desired purpose, hybridization conditions can be
selected which require less complementarity, e.g., about 90%, 85%,
75%, 50%, etc. Among the hybridization reaction parameters which
can be varied are salt concentration, buffer, pH, temperature, time
of incubation, amount and type of denaturant such as formamide,
etc. (see, e.g., Sambrook et al. (1989). Molecular Cloning: A
Laboratory Manual (2d ed.) Vols. 1-3, Cold Spring Harbor Press, New
York; Hames et al. (1985). Nucleic Acid Hybridization, IL Press;
Davis et al (1986), Basic Methods in Molecular Biology, Elsevir
Sciences Publishing, Inc., New York). For example, nucleic acid
(e.g., linker oligonucleotides) can be added to a test region
(e.g., a well of a multiwell plate--in a preferred embodiment, a 96
or 384 or greater well plate), in a volume ranging from about 0.1
to about 100 or more .mu.l (in a preferred embodiment, about 1 to
about 50 .mu.l, most preferably about 40 .mu.l), at a concentration
ranging from about 0.01 to about 5 .mu.M (in a preferred
embodiment, about 0.1 .mu.M), in a buffer such as, for example,
6.times.SSPE-T (0.9 M NaCl, 60 mM NaH.sub.2PO.sub.4, 6 mM EDTA and
0.05% Triton X-100), and hybridized to a binding partner (e.g., an
oligonucleotide anchor on the surface) for between about 10 minutes
and about at least 3 hours (in a preferred embodiment, at least
about 15 minutes) at a temperature ranging from about 4.degree. C.
to about 37.degree. C. (in a preferred embodiment, at about room
temperature). Conditions can be chosen to allow high throughput. In
one embodiment of the invention, the reaction conditions can
approximate physiological conditions.
[0048] The design of other types of substances or molecules (e.g.,
polypeptides, lectins, etc.) which can, e.g., serve as anchors or
as portions of linkers, and the reaction conditions required to
achieve specific interactions with their binding partners, are
routine and conventional in the art (e.g., as described in Niemeyer
et al (1994). Nucl. Acids Res. 22, 5530-5539; Fodor et al (1996).
U.S. Pat. No. 5,510,270; Pirrung et al (1992), U.S. Pat. No.
5,143,854). Among the incubation parameters are buffer, salt
concentration, pH, temperature, time of incubation, presence of
carrier and/or agents or conditions to reduce non-specific
interactions, etc. For example, to a test region (e.g., a well of a
multiwell plate--in a preferred embodiment, a 96 or 384 or greater
well plate) which contains, as anchors, antibodies, can be added
anti-antibodies (e.g., antigens or antibody-specific secondary
antibodies) in a volume ranging from about 0.1 to about 100 or more
.mu.l (in a preferred embodiment, about 1 to about 50 .mu.l, most
preferably about 40 .mu.l), at a concentration ranging from about
10 pM to about 10 nM (in a preferred embodiment, about 1 nM), in a
buffer such as, for example, 6.times.SSPE-T, PBS or physiological
saline, and incubated with the anchors on the surface for between
about 10 minutes and at least about 3 hours (in a preferred
embodiment, at least about 15 minutes), at a temperature ranging
from about 4.degree. C. to about 45.degree. C. (in a preferred
embodiment, about 4.degree. C.). For peptide anchors, a length of
about 5 to about 20 amino acids is preferred.
[0049] In some embodiments of the invention, each anchor in an
array can interact with the anchor-specific portion of its
corresponding linker to substantially the same degree as do the
other anchors in the array, under selected reaction conditions.
This can insure that the anchors specify a substantially uniform
array of linkers and, therefore, probes.
[0050] The anchors (i.e., groups of anchors at individual loci)
within a test region can be a "generic" set, each anchor of which
can interact with one or more of a variety of different linkers,
each having a portion specific to such anchor but with differing
"probe" portions; thus, a single array of generic anchors can be
used to program or define a varied set of probes. The flexible
nature of such a generic assay of anchors can be illustrated with
reference to FIGS. 1 and 2. FIG. 2 illustrates a surface which
comprises 15 test regions, each of which contains an array of 6
different anchors, which in this example can be oligonucleotides.
FIG. 1 schematically illustrates one of these (oligonucleotide)
anchors, anchor 1, which is in contact with linker 1, which
comprises one portion that is specific for anchor 1 and a second
portion that is specific for target mRNA 1. Alternatively, one
could substitute, e.g., a linker 2, which, like linker 1, comprises
a portion that is specific for anchor 1, but which comprises a
second portion that is specific for target mRNA 2 instead of target
mRNA 1. Thus, anchor 1 can be used to specify (or program, or
define, or determine) probes for either of two or more different
target mRNAs. The process of generating and attaching a high
resolution pattern (array) of oligonucleotides or peptides can be
expensive, time-consuming and/or physically difficult. The ability
to use a pre-formed array of anchors to program a wide variety of
probe arrays is one advantage of this invention.
[0051] Although the generic anchors illustrated in FIG. 2 define a
pattern of oligonucleotide probes, the identical anchor array could
also be used to program an array of other probes, for example
receptor proteins (see, e.g., FIG. 3). Clearly, many permutations
are possible, given the range of types of anchor/linker
interactions, e.g., even more complex layers of "sandwiched" or
"piggybacked" probes such as protein/antibody combinations. For
example, in one embodiment a generic set of anchors can be
associated (covalently or non-covalently) with a set of linkers to
form a modified array of "conjugated" anchors, as is described in
more detail below. Thus, the surface of anchors per this invention,
itself, offers novel advantages.
[0052] In one embodiment of the invention, anchors can interact
reversibly with linkers; thus, a generic set of anchors can be
re-used to program a varied set of probes. For example, an
oligonucleotide anchor can be separated from the oligonucleotide
portion of a linker by, for example, a heating step that causes the
two oligonucleotides to dissociate, and can then be rebound to a
second linker. The ability to re-use anchor arrays, which can be
expensive, time-consuming and/or physically difficult to make, is
another advantage of the invention.
[0053] An anchor does not necessarily have to interact with a
linker. For example, an anchor can be coupled (directly or
indirectly) to a detectable molecule, such as a fluorochrome, and
can thereby serve to localize a spot within a grid, e.g., for
purpose of registration between the test surface and the detector.
Alternatively, an anchor can be labeled with a known amount of a
detectable molecule so as to serve as internal quantitation marker,
e.g., for purposes of calibration.
[0054] The term "linker" as used herein refers to a bifunctional
substance which comprises a first portion (or moiety or part) that
is specific for a chosen (designated) anchor or subset of the
anchors ("anchor-specific") and a second portion that comprises a
probe which is specific for a target of interest
("target-specific"). The two portions of the linker can be attached
via covalent or noncovalent linkages, and can be attached directly
or through an intermediate (e.g., a spacer).
[0055] The chemical nature of the anchor-specific portion of the
linker is, of course, a function of the anchor or anchors with
which it interacts. For example, if the anchor is an
oligonucleotide, the portion of the linker which interacts with it
can be, for example, a peptide which binds specifically to the
oligonucleotide, or a nucleic acid which can hybridize efficiently
and specifically to it under selected stringent hybridization
conditions. The nucleic acid can be, e.g., an oligonucleotide, DNA,
RNA, PNA, PCR product, or substituted or modified nucleic acid
(e.g., comprising non naturally-occurring nucleotides such as,
e.g., inosine; joined via various known linkages such as sulfamate,
sulfamide, phosphorothionate, methylphosphonate, carbamate; or a
semisynthetic molecule such as a DNA-streptavidin conjugate, etc.).
Single strand moieties are preferred. The portion of a linker which
is specific for an oligonucleotide anchor can range from about 8 to
about 50 nucleotides in length, preferably about 15, 20, 25 or 30
nucleotides. If the anchor is an antibody, the portion of the
linker which interacts with it can be, e.g., an anti-antibody, an
antigen, or a smaller fragment of one of those molecules, which can
interact specifically with the anchor. Substances or molecules
which interact specifically with the other types of anchors
described above, and which can serve as the anchor-specific portion
of a linker, are well-known in the art and can be designed using
conventional procedures (e.g., see above).
[0056] The chemical nature of the target-specific portion of the
linker is, of course, a function of the target for which it is a
probe and with which it interacts. For example, if the target is a
particular mRNA, the target-specific portion of the linker can be,
e.g., an oligonucleotide which binds specifically to the target but
not to interfering RNAs or DNAs, under selected hybridization
conditions. One of skill in the art can, using art-recognized
methods, determine experimentally the features of an
oligonucleotide that will hybridize optimally to the target, with
minimal hybridization to non-specific, interfering DNA or RNA
(e.g., see above). In general, the length of an oligonucleotide
probe used to distinguish a target mRNA present in a background of
a large excess of untargeted RNAs can range from about 8 to about
50 nucleotides in length, preferably about 18, 20, 22 or 25
nucleotides. An oligonucleotide probe for use in a biochemical
assay in which there is not a large background of competing targets
can be shorter. Using art-recognized procedures (e.g., the computer
program BLAST), the sequences of oligonucleotide probes can be
selected such that they are mutually unrelated and are dissimilar
from potentially interfering sequences in known genetics databases.
The selection of hybridization conditions that will allow specific
hybridization of an oligonucleotide probe to an RNA can be
determined routinely, using art-recognized procedures (e.g., see
above). For example, target RNA [e.g., total RNA or mRNA extracted
from tissues or cells grown (and optionally treated with an agent
of interest) in any vessel, such as the well of a multiwell
microtiter plate (e.g., 96 or 384 or more wells)] can be added to a
test region containing a oligonucleotide probe array (see above) in
a buffer such as 6.times.SSPE-T or others, optionally containing an
agent to reduce non-specific binding (e.g., about 0.5 mg/ml
degraded herring or salmon sperm DNA, or yeast RNA), and incubated
at an empirically determined temperature for a period ranging from
between about 10 minutes and at least 18 hours (in a preferred
embodiment, about 3 hours). The stringency of the hybridization can
be the same as, or less than, the stringency employed to associate
the anchors with the anchor-specific portion of the linkers. The
design and use of other types of probes are also routine in the
art, e.g., as discussed above.
[0057] In one embodiment, all, or substantially all, of the linkers
associated with the anchors at a given locus contain an identical
(or substantially identical) probe, which is specific for a single,
specific target of interest. In another embodiment, one or more of
the linkers associated with the anchors at a given locus comprises
a plurality of different probes, and thus is specific for a
plurality of different targets. These probes can be situated in the
linker as part of a branched structure, or preferably, can be
aligned in a linear relationship; and they can be of the same
material (e.g., are all nucleic acid or are all peptide sequences),
or combinations of various materials. In effect, having multiple
probes on each linker increases the number of targets which can be
detected at a particular locus. In one embodiment, a plurality of
probes on given linker are all specific for a particular target of
interest (e.g., they are specific for different portions of a
single mRNA of interest, or are specific for nuclease protection
fragments corresponding to different portions of that mRNA); this
allows for increased sensitivity of an assay for the target, e.g.,
a target which is present in a sample at low abundance. The number
of probes on a linker can be, e.g., about 2-50, preferably about 2,
4 or 10.
[0058] Of course, linkers which comprise such a plurality of
different probes are also advantageous for use with surfaces that
contain only a single (non-repeated) region.
[0059] The anchor-specific and the target-specific portions of a
linker can be joined (attached, linked) by any of a variety of
covalent or non-covalent linkages, the nature of which is not
essential to the invention. The two portions can be joined directly
or through an intermediate molecule. In one embodiment, in which
both portions of the linker are oligonucleotides, they can be
joined by covalent linkages such as phosphodiester bonds to form a
single, colinear nucleic acid. In another embodiment, in which the
anchor-specific portion is an oligonucleotide and the
target-specific portion is a receptor, for example a receptor
protein, the two portions can be joined via the interaction of
biotin and streptavidin molecules, an example of which is
illustrated in FIG. 3. Many variations of such linkages are known
(e.g., see Niemeyer et al (1994). NAR 22, 5530-5539).
Alternatively, the two portions can be joined directly, e.g., an
oligonucleotide can be amidated and then linked directly (e.g.,
crosslinked) to a peptide or protein via an amide bond, or joined
to a membrane component via an amide bond or a lipid attachment.
Methods to form such covalent or noncovalent bonds are conventional
and are readily optimized by one of skill in the art. Spacer
sequences (e.g., nucleic acid) can also be present between the
anchor-specific and target-specific portions of a linker.
[0060] After two substances are associated (e.g., by incubation of
two nucleic acids, two proteins, a protein plus a nucleic acid, or
others) to form a complex (such as, e.g., an anchor/linker
complex), the resulting complex can be optionally treated (e.g.,
washed) to remove unbound substances (e.g., linkers), using
conditions which are determined empirically to leave specific
interactions intact, but to remove non-specifically bound material.
For example, reaction mixtures can be washed between about one and
ten times or more under the same or somewhat more stringent
conditions than those used to achieve the complex (e.g.,
anchor/linker complex).
[0061] One of skill in the art will recognize that a variety of
types of sandwiches of anchors and linkers can be generated. For
example, to an array of anchors (e.g., anchors having substantially
identical sequences), one can attach a first set of linkers, each
of which has a first moiety that is specific for the anchor and a
second moiety that is specific for one of a second set of linkers,
and so forth. In effect, this second layer of a sandwich allows one
to convert a first set of anchors (e.g., identical
oligonucleotides) to a different array having a different set of
specificities, of "conjugated" anchors. The various sets of linkers
and anchors can be associated to one another covalently or
non-covalently, as desired.
[0062] The combinations of this invention can be manufactured
routinely, using conventional technology.
[0063] Some of the surfaces which can be used in the invention are
readily available from commercial suppliers. In a preferred
embodiment, the surface is a 96-, 384- or 1536-well microtiter
plate such as modified plates sold by Corning Costar.
Alternatively, a surface comprising wells which, in turn, comprise
indentations or "dimples" can be formed by micromachining a
substance such as aluminum or steel to prepare a mold, then
microinjecting plastic or a similar material into the mold to form
a structure such as that illustrated in FIG. 4. Alternatively, a
structure such as that shown in FIG. 4, comprised of glass,
plastic, ceramic, or the like, can be assembled, e.g., from three
pieces such as those illustrated in FIG. 5: a first section, called
a well separator (FIG. 5a), which will form the separations between
the sample wells; a second section, called a subdivider (FIG. 5b),
which will form the subdivisions, or dimples, within each test
well; and a third section, called a base (FIG. 5c), which will form
the base of the plate and the lower surface of the test wells. The
separator can be, for example, a piece of material, e.g., silicone,
with holes spaced throughout, so that each hole will form the walls
of a test well when the three pieces are joined. The subdivider can
be, for example, a thin piece of material, e.g., silicone, shaped
in the form of a screen or fine meshwork. The base can be a flat
piece of material, e.g., glass, in, for example, the shape of the
lower portion of a typical microplate used for a biochemical assay.
The top surface of the base can be flat, as illustrated in FIG. 5c,
or can be formed with indentations that will align with the
subdivider shape to provide full subdivisions, or wells, within
each sample well. The three pieces can be joined by standard
procedures, for example the procedures used in the assembly of
silicon wafers.
[0064] Oligonucleotide anchors, linker moieties, or detectors can
be synthesized by conventional technology, e.g., with a commercial
oligonucleotide synthesizer and/or by ligating together
subfragments that have been so synthesized. Nucleic acids which are
too long to be comfortably synthesized by such methods can be
generated by amplification procedures, e.g., PCR, using
conventional procedures. In one embodiment of the invention,
preformed nucleic acid anchors, such as oligonucleotide anchors,
can be situated on or within the surface of a test region by any of
a variety of conventional techniques, including photolithographic
or silkscreen chemical attachment, disposition by ink jet
technology, capillary, screen or fluid channel chip,
electrochemical patterning using electrode arrays, contacting with
a pin or quill, or denaturation followed by baking or
UV-irradiating onto filters (see, e.g., Rava et al (1996). U.S.
Pat. No. 5,545,531; Fodor et al (1996). U.S. Pat. No. 5,510,270;
Zanzucchi et al (1997). U.S. Pat. No. 5,643,738; Brennan (1995).
U.S. Pat. No. 5,474,796; PCT WO 92/10092; PCT WO 90/15070). Anchors
can be placed on top of the surface of a test region or can be, for
example in the case of a polyacrylamide gel pad, imbedded within
the surface in such a manner that some of the anchor protrudes from
the surface and is available for interactions with the linker. In a
preferred embodiment, preformed oligonucleotide anchors are
derivatized at the 5' end with a free amino group; dissolved at a
concentration routinely determined empirically (e.g., about 1
.mu.M) in a buffer such as 50 mM phosphate buffer, pH 8.5 and 1 mM
EDTA; and distributed with a Pixus nanojet dispenser (Cartesian
Technologies) in droplets of about 10.4 nanoliters onto specific
locations within a test well whose upper surface is that of a
fresh, dry DNA Bind plate (Coming Costar). Depending on the
relative rate of oligonucleotide attachment and evaporation, it may
be required to control the humidity in the wells during
preparation. In another embodiment, oligonucleotide anchors can be
synthesized directly on the surface of a test region, using
conventional methods such as, e.g., light-activated deprotection of
growing oligonucleotide chains (e.g., in conjunction with the use
of a site directing "mask") or by patterned dispensing of nanoliter
droplets of deactivating compound using a nanojet dispenser.
Deprotection of all growing sequences that are to receive a single
nucleotide can be done, for example, and the nucleotide then added
across the surface. In another embodiment, oligonucleotide anchors
are attached to the surface via the 3' ends of the
oligonucleotides, using conventional methodology.
[0065] Peptides, proteins, lectins, chelation embodiments, plastics
and other types of anchors or linker moieties can also be routinely
generated, and anchors can be situated on or within surfaces, using
appropriate available technology (see, e.g., Fodor et al (1996).
U.S. Pat. No. 5,510,270; Pirrung et al (1992). U.S. Pat. No.
5,143,854; Zanzucchi et al (1997). U.S. Pat. No. 5,643,738; Lowe et
al (1985). U.S. Pat. No. 4,562,157; Niemeyer et al (1994). NAR 22,
5530-5539).
[0066] In some embodiments of the invention, the disclosed
combinations are used in a variety of screening procedures and/or
to obtain information about the level, activity or structure of the
probes or target molecules. Such assays are termed Multi Array
Plate Screen (MAPS) methods or assays, and the surfaces comprising
arrays of anchors or anchors plus probes which are used for the
assays are termed MAPS arrays or MAPS plates.
[0067] The components of a reaction mixture, assay, or screening
procedure can be assembled in any order. For example, the anchors,
linkers and targets can be assembled sequentially; or targets and
linkers, in the presence or absence of reporters, can be assembled
in solution and then contacted with the anchors.
[0068] One embodiment of the invention relates to a method of
detecting at least one target, comprising
[0069] a) contacting a sample which may comprise said target(s)
with a bifunctional linker which has a first portion that is
specific for an oligonucleotide anchor and a second portion that
comprises a probe which is specific for said target(s), under
conditions effective to obtain a first hybridization product
between said target(s) and said linker,
[0070] b) contacting said first hybridization product with a
combination under conditions effective to obtain a second
hybridization product between said first hybridization product and
said combination, wherein said combination comprises, before the
addition of said first hybridization product,
[0071] 1) a surface comprising multiple spatially discrete regions,
at least two of which are substantially identical, each region
comprising
[0072] 2) at least 8 different oligonucleotide anchors,
[0073] c) contacting said first hybridization product or said
second hybridization product with a labeled detector probe, and
[0074] d) detecting said detection probe.
[0075] Each of the assays or procedures described below can be
performed in a high throughput manner, in which a large number of
samples (e.g., as many as about 864, 1036, 1536, 2025 or more,
depending on the number of regions in the combination) are assayed
on each plate or surface rapidly and concurrently. Further, many
plates or surfaces can be processed at one time. For example, in
methods of drug discovery, a large number of samples, each
comprising a drug candidate (e.g., a member of a combinatorial
chemistry library, such as variants of small molecules, peptides,
oligonucleotides, or other substances), can be added to separate
regions of a combination as described or can be added to biological
or biochemical samples that are then added to separate regions of a
combination, and incubated with probe arrays located in the
regions; and assays can be performed on each of the samples. With
the recent advent and continuing development of high-density
microplates, DNA spotting tools and of methods such as laser
technology to generate and collect data from even denser
microplates, robotics, improved dispensers, sophisticated detection
systems and data-management software, the methods of this invention
can be used to screen or analyze thousands or tens of thousands or
more of compounds per day.
[0076] For example, in embodiments in which the probes are
oligonucleotides, the assay can be a diagnostic nucleic acid or
polynucleotide screen (e.g., a binding or other assay) of a large
number of samples for the presence of genetic variations or defects
(e.g., polymorphisms or specific mutations associated with diseases
such as cystic fibrosis. See, e.g., Iitia et al (1992). Molecular
and Cellular Probes 6, 505-512)); pathogenic organisms (such as
bacteria, viruses, and protozoa, whose hosts are animals, including
humans, or plants), or mRNA transcription patterns which are
diagnostic of particular physiological states or diseases. Nucleic
acid probe arrays comprising portions of ESTs (including
full-length copies) can be used to evaluate transcription patterns
produced by cells from which the ESTs were derived (or others).
Nucleic acid probes can also detect peptides, proteins, or protein
domains which bind specifically to particular nucleic acid
sequences (and vice-versa).
[0077] Similarly, in embodiments in which the probes are
antigen-binding molecules (e.g., antibodies), the assay can be a
screen for variant proteins, or for protein expression patterns
which are diagnostic for particular physiological states or disease
conditions. See, e.g., FIGS. 40 and 41 for illustrations of the
types of molecules which can be detected.
[0078] In another embodiment, the combinations of the invention can
be used to monitor biochemical reactions such as, e.g.,
interactions of proteins, nucleic acids, small molecules, or the
like--for example the efficiency or specificity of interactions
between antigens and antibodies; or of receptors (such as purified
receptors or receptors bound to cell membranes) and their ligands,
agonists or antagonists; or of enzymes (such as proteases or
kinases) and their substrates, or increases or decreases in the
amount of substrate converted to a product; as well as many others.
Such biochemical assays can be used to characterize properties of
the probe or target, or as the basis of a screening assay. For
example, to screen samples for the presence of particular proteases
(e.g., proteases involved in blood clotting such as proteases Xa
and VIIa), the samples can be assayed on combinations in which the
probes are fluorogenic substrates specific for each protease of
interest. If a target protease binds to and cleaves a substrate,
the substrate will fluoresce, usually as a result, e.g., of
cleavage and separation between two energy transfer pairs, and the
signal can be detected. In another example, to screen samples for
the presence of a particular kinase(s) (e.g., Src, tyrosine kinase,
or ZAP70), samples containing one or more kinases of interest can
be assayed on combinations in which the probes are peptides which
can be selectively phosphorylated by one of the kinases of
interest. Using art-recognized, routinely determinable conditions,
samples can be incubated with the array of substrates, in an
appropriate buffer and with the necessary cofactors, for an
empirically determined period of time. (In some assays, e.g., for
biochemical studies of factors that regulate the activity of
kinases of interest, the concentration of each kinase can be
adjusted so that each substrate is phosphorylated at a similar
rate.) After treating (e.g., washing) each reaction under
empirically determined conditions to remove kinases and undesired
reaction components (optionally), the phosphorylated substrates can
be detected by, for example, incubating them with detectable
reagents such as, e.g., fluorescein-labeled anti-phosphotyrosine or
anti-phosphoserine antibodies (e.g., at a concentration of about 10
nM, or more or less), and the signal can be detected. In another
example, binding assays can be performed. For example, SH2 domains
such as GRB2 SH2 or ZAP70 SH2 can be assayed on probe arrays of
appropriate phosphorylated peptides; or blood sera can be screened
on probe arrays of particular receptors for the presence of immune
deficiencies. Also, enzyme-linked assays can be performed in such
an array format. Combinations of the invention can also be used to
detect mutant enzymes, which are either more or less active than
their wild type counterparts, or to screen for a variety of agents
including herbicides or pesticides.
[0079] Of course, MAPS assays can be used to quantitate (measure,
quantify) the amount of active target in a sample, provided that
probe is not fully occupied, that is, not more than about 90% of
available probe sites are bound (or reacted or hybridized) with
target. Under these conditions, target can be quantitated because
having more target will result in having more probe bound. On the
other hand, under conditions where more than about 90% of available
probe sites are bound, having more target present would not
substantially increase the amount of target bound to probe. Any of
the heretofore-mentioned types of targets can be quantitated in
this manner. For example, Example 6 describes the quantitation of
oligonucleotide targets. Furthermore, it demonstrates that even if
a target is present in large excess (e.g., if it is present in such
large amounts that it saturates the amount of available probe in a
MAPS probe array), by adding known amounts of unlabeled target to
the binding mixture, one can "shift the sensitivity" of the
reaction in order to allow even such large amounts of target to be
quantitated.
[0080] In another embodiment, combinations of the invention can be
used to screen for agents which modulate the interaction of a
target and a given probe. An agent can modulate the target/probe
interaction by interacting directly or indirectly with either the
probe, the target, or a complex formed by the target plus the
probe. The modulation can take a variety of forms, including, but
not limited to, an increase or decrease in the binding affinity of
the target for the probe, an increase or decrease in the rate at
which the target and the probe bind, a competitive or
non-competitive inhibition of the binding of the probe to the
target, or an increase or decrease in the activity of the probe or
the target which can, in some cases, lead to an increase or
decrease in the probe/target interaction. Such agents can be
man-made or naturally-occurring substances. Also, such agents can
be employed in their unaltered state or as aggregates with other
species; and they can be attached, covalently or noncovalently, to
a binding member, either directly or via a specific binding
substance. For example, to identify potential "blood thinners," or
agents which interact with one of the cascade of proteases which
cause blood clotting, cocktails of the proteases of interest can be
tested with a plurality of candidate agents and then tested for
activity as described above. Other examples of agents which can be
employed by this invention are very diverse, and include pesticides
and herbicides. Examples 16 and 17 describe high throughput assays
for agents which selectively inhibit specific kinases, or for
selective inhibitors of the interaction between SH2 domains and
phosphorylated peptides.
[0081] In another embodiment, the combinations of the invention can
be used to screen for agents which modulate a pattern of gene
expression. Arrays of oligonucleotides can be used, for example, to
identify mRNA species whose pattern of expression from a set of
genes is correlated with a particular physiological state or
developmental stage, or with a disease condition ("correlative"
genes, RNAs, or expression patterns). By the terms "correlate" or
"correlative," it is meant that the synthesis pattern of RNA is
associated with the physiological condition of a cell, but not
necessarily that the expression of a given RNA is responsible for
or is causative of a particular physiological state. For example, a
small subset of mRNAs can be identified which are expressed,
upconverted and/or downconverted in cells which serve as a model
for a particular disease state; this altered pattern of expression
as compared to that in a normal cell, which does not exhibit a
pathological phenotype, can serve as a indicator of the disease
state ("indicator" genes, RNAs, or expression patterns). The terms
"correlative" and "indicator" can be used interchangeably. For
example, cells treated with a tumor promoter such as phorbol
myristate might exhibit a pattern of gene expression which mimics
that seen in the early stages of tumor growth. In another model for
cancer, mouse insulinoma cells (e.g., cell line TGP61), when
infected with adenovirus, exhibit an increase in the expression of,
e.g., c-Jun and MIP-2, while the expression of housekeeping genes
such as GAPDH and L32 remains substantially unaffected.
[0082] Agents which, after contacting a cell from a disease model,
either directly or indirectly, and either in vivo or in vitro
(e.g., in tissue culture), modulate the indicator expression
pattern, might act as therapeutic agents or drugs for organisms
(e.g., human or other animal patients, or plants) suffering from
the disease. Agents can also modulate expression patterns by
contacting the nucleic acid directly, e.g., in an in vitro (test
tube) expression system. As used herein, "modulate" means to cause
to increase or decrease the amount and/or activity of a molecule or
the like which is involved in a measurable reaction. The
combinations of the invention can be used to screen for such
agents. For example, a series of cells (e.g., from a disease model)
can be contacted with a series of agents (e.g., for a period of
time ranging from about 10 minutes to about 48 hours or more) and,
using routine, art-recognized methods (e.g., commercially available
kits), total RNA or mRNA extracts can be made. If it is desired to
amplify the amount of RNA, standard procedures such as RT-PCR
amplification can be used (see, e.g., Innis et al eds., (1996) PCR
Protocols: A Guide to Methods in Amplification, Academic Press, New
York). The extracts (or amplified products from them) can be
allowed to contact (e.g., incubate with) a plurality of
substantially identical arrays which comprise probes for
appropriate indicator RNAs, and those agents which are associated
with a change in the indicator expression pattern can be
identified. Example 15 describes a high throughput assay to screen
for compounds which may alter the expression of genes that are
correlative with a disease state.
[0083] Similarly, agents can be identified which modulate
expression patterns associated with particular physiological states
or developmental stages. Such agents can be man-made or
naturally-occurring substances, including environmental factors
such as substances involved in embryonic development or in
regulating physiological reactions, or substances important in
agribusiness such as pesticides or herbicides. Also, such agents
can be employed in their unaltered state or as aggregates with
other species; and they can be attached, covalently or
noncovalently, to a binding member, either directly or via a
specific binding substance.
[0084] Another embodiment of the invention is a kit useful for the
detection of at least one target in a sample, which comprises:
[0085] a) a surface, comprising multiple spatially discrete
regions, at least two of which are substantially identical, each
region comprising at least eight different anchors
(oligonucleotide, or one of the other types described herein),
and
[0086] b) a container comprising at least one bifunctional linker
molecule, which has a first portion specific for at least one of
said anchor(s) and a second portion that comprises a probe which is
specific for at least one of said target(s).
[0087] In one embodiment, there is provided a surface as in a)
above and a set of instructions for attaching to at least one of
said anchors a bifunctional linker molecule, which has a first
portion specific for at least one of said anchor(s) and a second
portion that comprises a probe which is specific for at least one
target. The instructions can include, for example (but are not
limited to), a description of each of the anchors on the surface,
an indication of how many anchors there are and where on the
surface they are located, and a protocol for specifically attaching
(associating, binding, etc.) the linkers to the anchors. For
example, if the anchors are oligonucleotides, the instructions can
include the sequence of each anchor, from which a practitioner can
design complementary anchor-specific moieties of linkers to
interact specifically with (e.g., hybridize to) the anchors; if the
anchors are peptides, the instructions can convey information
about, e.g., antibodies which will interact specifically with the
peptides. The instructions can also include a protocol for
associating the anchors and linkers, e.g., conditions and reagents
for hybridization (or other type of association) such as
temperature and time of incubation, conditions and reagents for
removing unassociated molecules (e.g., washes), and the like.
Furthermore, the instructions can include information on the
construction and use of any of the types of control linkers
discussed herein, and of methods, e.g., to quantitate, normalize,
"fine-tune" or calibrate assays to be performed with the
combinations. The instructions can encompass any of the parameters,
conditions or embodiments disclosed in this application, all of
which can be performed routinely, with conventional procedures, by
one of skill in the art.
[0088] As discussed elsewhere in this application, a practitioner
can attach to a surface of the invention comprising a given array
(or arrays) of anchors, a wide variety of types of linkers, thereby
programming any of a wide variety of probe arrays. Moreover, a
practitioner can remove a given set of linkers from a surface of
the invention and add to it another set of linkers (either the same
or different from the first set), allowing a given surface to be
reused many times. This flexibility and reusability constitute
further advantages of the invention.
[0089] In another embodiment, combinations of the invention can be
used to map ESTs (Expressed Sequence Tags). That is, MAPS assays
can be used to determine which, if any, of a group of ESTs were
generated from different (or partially overlapping) portions of the
same gene(s), and which, if any, are unique. FIGS. 18, 19, 20 and
21 illustrate such an assay, in this example an assay to determine
which, if any, of 16 ESTs are "linked" to a common gene. A first
step of the assay (see FIG. 18) is to assemble arrays in which each
of the ESTs to be mapped is represented by at least one
oligonucleotide probe that corresponds to it. A number of arrays
equal to (or greater than) the number of ESTs to be mapped are
distributed in separate regions (e.g., wells) of a surface; in the
illustrated example, the surface of the combination comprises 16
wells, each of which contains an array of 16 different EST-specific
oligonucleotides, numbered 1-16. An oligonucleotide which
"corresponds to" an EST (is "EST-specific") is one that is
sufficiently complementary to an EST such that, under selected
stringent hybridization conditions, the oligonucleotide will
hybridize specifically to that EST, but not to other, unrelated
ESTs. An EST-corresponding oligonucleotide of this type can bind
specifically (under optimal conditions) to the coding or non-coding
strand of a cDNA synthesized from the gene from which the EST was
originally generated or to an mRNA synthesized from the gene from
which the EST was originally generated. Factors to be considered in
designing oligonucleotides, and hybridization parameters to be
optimized in order to achieve specific hybridization, are discussed
elsewhere in this application. In order to assemble the arrays,
linker molecules are prepared, each of which comprises a moiety
specific for one of the anchors of a generic array plus a moiety
comprising an oligonucleotide probe that corresponds to one of the
ESTs to be mapped; and the linkers are attached to anchors as
described elsewhere in this application. In a subsequent step, an
aliquot of a sample comprising a mixture of nucleic acids (e.g.,
mRNA or single stranded or denatured cDNA), which may contain
sequences that are complementary to one or more of the
oligonucleotide probes, is added to each of the regions (wells)
which comprises a probe array; the mixture is then incubated under
routinely determined optimal conditions, thereby permitting nucleic
acid to bind to complementary probes. If several of the
EST-specific probes are complementary to different portions of a
single nucleic acid, that nucleic acid will bind to each of the
loci in the array at which one of those probes is located.
[0090] In a subsequent step, a different detector oligonucleotide
(in the illustrated example, detectors #1 to 16) is added to each
region (well) (see FIG. 19). A detector oligonucleotide is designed
for each of the ESTs to be mapped. Each EST-specific detector
corresponds to a different (at least partially non-overlapping)
portion of the EST than does the probe oligonucleotide, so that the
probe and the detector oligonucleotides do not interfere with one
another. Consider, for example, the ESTs depicted in FIG. 21, which
correspond to ESTs 1, 2 and 6 of FIGS. 18-20. FIG. 21 indicates
that ESTs #1 and #2 were both obtained from gene X (they are
"linked"), whereas EST #6 was obtained from a different, unrelated
gene. If aliquots of a sample containing a mixture of mRNAs,
including one generated from gene X, are incubated with the probe
arrays shown in FIGS. 18-20, the gene X mRNA will, under optimal
conditions, hybridize at the loci with probes 1 and 2, but not at
those with probe 6. (Of course, each mRNA must be added in molar
excess over the sum of the probes to which it can hybridize.) If
detector oligonucleotide 1 is added to region (well) 1, it will
hybridize to the gene X mRNA which is bound at loci 1 and 2 of the
probe array, but not at locus 6. Similarly, if detector
oligonucleotide 2 is added to another well--say, well #2--it will
also bind at loci 1 and 2, but not 6. In this fashion, one can
determine in a high throughput manner which of the ESTs are linked,
i.e. code for portions of the same gene, and which ESTs are unique.
For the hypothetical example shown in FIG. 20, the first 3 ESTs
encode portions of the same gene, the last 5 ESTs encode portions
of another gene, and the remaining ESTs appear not to be linked.
Conditions of hybridization, optional wash steps, methods of
detection, and the like are discussed elsewhere in this application
with regard to other MAPS assays. In order to confirm the linkage
data obtained by the MAPS assay, one could perform PCR reactions
using pairs of EST-specific oligonucleotide probes as sense and
anti-sense primers. Every pair of linked ESTs should yield a PCR
product. Note that this pairwise PCR test could be performed to
determine linkage directly without using the Linkage MAPS assay;
however, many reactions would be required, and each EST primer
would have to be synthesized as both sense and anti-sense strands.
For the illustrated example, 180 such reactions would be
required.
[0091] In one aspect, the invention relates to a method of
determining which of a plurality of ESTs are complementary to a
given nucleic acid, comprising,
[0092] a) incubating an immobilized array of oligonucleotide
probes, at least one of which corresponds to each of said ESTs,
with a test sample which may contain said given nucleic acid, to
obtain a hybridization product between said oligonucleotide probes
and said nucleic acid,
[0093] b) incubating said hybridization product with a detector
oligonucleotide, which corresponds to an EST to which one of said
oligonucleotide probes corresponds, but which is specific for a
different portion of the EST than is said oligonucleotide probe,
and
[0094] c) detecting which oligonucleotide probes of said array are
labeled by said detector oligonucleotide,
[0095] wherein said array of oligonucleotide probes is immobilized
on a region of a combination, wherein said combination
comprises
[0096] 1) a surface comprising a number of spatially discrete,
substantially identical, regions equal to the number of ESTs to be
studied, each region comprising
[0097] 2) a number of different anchors equal to the number of ESTs
to be studied, each anchor in association with
[0098] 3) a bifunctional linker which has a first portion that is
specific for the anchor, and a second portion that comprises an
oligonucleotide probe which corresponds to at least one of said
ESTs.
[0099] In another aspect, the invention relates to a method as
above, wherein of said ESTs may be complementary to said nucleic
acid, and wherein each of said ESTs comprises two different
oligonucleotide sequences, the first of which defines an
oligonucleotide probe corresponding to said EST, and the second of
which defines a detector oligonucleotide corresponding to said EST,
comprising,
[0100] a) contacting a sample which comprises molecules of said
nucleic acid with at least one region of a combination, wherein
said region comprises an array of oligonucleotide probes, at least
one of which corresponds to each of said ESTs,
[0101] b) incubating said sample with said region, thereby
permitting molecules of said nucleic acid to bind to said
EST-corresponding oligonucleotide probes which are complementary to
portions of said nucleic acid,
[0102] c) incubating said region comprising molecules of said
nucleic acid bound to one or more of said EST-corresponding
oligonucleotide probes with a detector oligonucleotide which
corresponds to an EST to which a given one of the oligonucleotide
probes of said array corresponds, thereby binding detector
oligonucleotides to nucleic acid molecules which have bound to said
given oligonucleotide probe or to other oligonucleotide probes
which are complementary to said nucleic acid,
[0103] d) detecting the presence of said detector oligonucleotides,
thereby identifying which EST-corresponding oligonucleotide probes
of said array are complementary to portions of a nucleic acid which
binds to said given oligonucleotide EST-corresponding probe,
thereby identifying which ESTs are complementary to said given
nucleic acid wherein said array of oligonucleotide probes is
immobilized on a region of a combination, wherein said combination
comprises
[0104] 1) a surface comprising a number of spatially discrete,
substantially identical regions equal to the number of ESTs to be
studied, each region comprising
[0105] 2) a number of different anchors equal to the number of ESTs
to be studied, each anchor in association with
[0106] 3) a bifunctional linker which has a first portion that is
specific for the anchor, and a second portion that comprises an
oligonucleotide probe which corresponds to at least one of said
ESTs.
[0107] The components of an EST mapping assay can be assembled in
any order. For example, the anchors, linkers and ESTs can be
assembled sequentially; or linkers and ESTs, in the presence or
absence of reporters, can be assembled in solution and then added
to the anchors.
[0108] In another aspect, the invention relates to a method of
determining which of a plurality of ESTs are complementary to a
given nucleic acid, comprising,
[0109] a) incubating a collection of bifunctional oligonucleotide
linker molecules, each of which comprises a first portion which is
a probe that corresponds to at least one of said ESTs, and a second
portion which is specific for an anchor oligonucleotide, with a
test sample which may contain said given nucleic acid, to obtain a
first hybridization product between said oligonucleotide probes and
said nucleic acid,
[0110] b) incubating said first hybridization product with an
immobilized array of anchor oligonucleotides, wherein each anchor
oligonucleotide corresponds to the anchor-specific portion of at
least one of said linker molecules, to form a second hybridization
product comprising said anchors, said oligonucleotide probes and
said nucleic acid, and
[0111] c) incubating either said first or said second hybridization
product with a detector oligonucleotide, which corresponds to an
EST to which one of said oligonucleotide probes corresponds, but
which is specific for a different portion of the EST than is said
oligonucleotide probe, and
[0112] d) detecting which oligonucleotide probes of said array are
labeled by said detector oligonucleotide,
[0113] wherein said array of anchor oligonucleotides is immobilized
on a region of a combination, wherein said combination
comprises
[0114] 1) a surface comprising a number of spatially discrete,
substantially identical, regions equal to the number of ESTs to be
studied, each region comprising
[0115] 2) a number of different anchors equal to the number of ESTs
to be studied.
[0116] Of course, the above methods for mapping ESTs can be used to
map test sequences (e.g., polynucleotides) onto any nucleic acid of
interest. For example, one can determine if two or more cloned DNA
fragments or cDNAs map to the same genomic DNA. Such a procedure
could aid, for example, in the structural elucidation of long,
complex genes. In a similar manner, one can determine if one or
more spliced out sequences or coding sequences map to the same
genomic DNA. Such a determination could be used, for example, in a
diagnostic test to distinguish between a normal and a disease
condition which are characterized by differential splicing
patterns. Many other applications of the mapping method will be
evident to one of skill in the art.
[0117] In another aspect, the invention relates to a method of
determining which of a plurality of polynucleotides are
complementary to a given nucleic acid,
[0118] wherein one or more of said polynucleotides may be
complementary to said nucleic acid, and wherein each of said
polynucleotides comprises two different oligonucleotide sequences,
the first of which defines an oligonucleotide probe corresponding
to said polynucleotide, and the second of which defines a detector
oligonucleotide corresponding to said polynucleotide,
comprising,
[0119] a) contacting a sample which comprises molecules of said
nucleic acid with at least one region of a combination, wherein
said region comprises an array of oligonucleotide probes, at least
one of which corresponds to each of said polynucleotides,
[0120] b) incubating said sample with said region, thereby
permitting molecules of said nucleic acid to bind to said
polynucleotide-correspondi- ng oligonucleotide probes which are
complementary to portions of said nucleic acid,
[0121] c) incubating said region comprising molecules of said
nucleic acid bound to one or more of said
polynucleotide-corresponding oligonucleotide probes with a detector
oligonucleotide which corresponds to a polynucleotide to which a
given one of the oligonucleotide probes of said array corresponds,
thereby binding detector oligonucleotides to nucleic acid molecules
which have bound to said given oligonucleotide probe or to other
oligonucleotide probes which are complementary to said nucleic
acid,
[0122] d) detecting the presence of said detector oligonucleotides,
thereby identifying which polynucleotide-corresponding
oligonucleotide probes of said array are complementary to portions
of a nucleic acid which binds to said given oligonucleotide
polynucleotide-corresponding probe, thereby identifying which
polynucleotides are complementary to said given nucleic acid,
[0123] wherein said array of oligonucleotide probes is immobilized
on a region of a combination, wherein said combination
comprises
[0124] 1) a surface comprising a number of spatially discrete,
substantially identical, regions equal to the number of
polynucleotides to be studied, each region comprising
[0125] 2) a number of different anchors equal to the number of
polynucleotides to be studied, each anchor in association with
[0126] 3) a bifunctional linker which has a first portion that is
specific for the anchor, and a second portion that comprises an
oligonucleotide probe which corresponds to at least one of said
polynucleotides.
[0127] In another aspect of the invention, the above methods to map
ESTs or other polynucleotides further comprise removing unbound
portions of the sample between one or more of the steps.
[0128] In another embodiment of the invention, one or more RNA
targets of interest (e.g., mRNA, or other types of RNA) are
converted into cDNAs by reverse transcriptase, and these cDNAs are
then hybridized to a probe array. This type of assay is illustrated
schematically in FIG. 8. RNA extracts (or purified mRNA) are
prepared from cells or tissues as described herein. Reverse
transcriptase and oligonucleotide primers which are specific for
the RNAs of interest are then added to the RNA sample, and, using
art-recognized conditions and procedures, which can be routinely
determined and optimized, the first strands of cDNAs are generated.
The term "specific" primer refers to one that is sufficiently
complementary to an mRNA of interest to bind to it under selected
stringent hybridization conditions and be recognized by reverse
transcriptase, but which does not bind to undesired nucleic acid
(see above for a discussion of appropriate reaction conditions to
achieve specific hybridization). Residual RNA--mRNAs which were not
recognized by the specific primers, and/or other types of
contaminating RNAs in an RNA extract, such as tRNA or rRNA--can be
removed by any of a variety of ribonucleases or by chemical
procedures, such as treatment with alkali, leaving behind the
single strand cDNA, which is subsequently placed in contact with a
MAPS probe array. The use of reverse transcriptase in this method
minimizes the need for extensive handling of RNA, which can be
sensitive to degradation by nucleases and thus difficult to work
with. Furthermore, the additional specificity engendered by the
specific reverse transcriptase primers imparts an added layer of
specificity to the assay.
[0129] Optionally, the cDNAs described above can be amplified
before hybridization to the probe array to increase the signal
strength. The oligonucleotide reverse transcriptase primers
described above can comprise, at their 5' ends, sequences (which
can be about 22-27 nucleotides long) that specify initiation sites
for an RNA polymerase (e.g., T7, T3 or SP2 polymerase, or the
like). In the example shown in FIG. 8, a T7 promoter sequence has
been added to the reverse transcriptase primer. The polymerase
recognition site becomes incorporated into the cDNA and can then
serve as a recognition site for multiple rounds of transcription by
the appropriate RNA polymerase (in vitro transcription, or IVT).
Optionally, the mRNAs so generated can be amplified further, using
PCR and appropriate primers, or the cDNA, itself, can be so
amplified. Procedures for transcription and PCR are routine and
well-known in the art.
[0130] The flexibility of PCR allows for many variations in the
methods of the invention. In one embodiment, one or both of the PCR
primers which are used to amplify a target can comprise a chemical
modification which allows the resulting PCR product to attach,
specifically or non-specifically, to a solid support. Such chemical
modifications include, for example, 5' amidation which allows
binding to surfaces such as Costar's DNA Bind Plates, (e.g., which
are modified with N-oxysuccinimide ester, or maleic anhydride
coated plates such as Reacti-Bind plates from Pierce, Rockford,
Ill.). Methods for generating oligonucleotides comprising such
chemical modifications are routine and conventional in the art. A
PCR product comprising such a modified primer can be attached to
any desired support, including a solid support, e.g., the inner
walls of a microtiter well, a bead (e.g., a non-magnetic or
magnetic bead), or any of the types of surfaces described herein.
Of course, a PCR primer can also be attached to a support before a
PCR reaction is initiated. Several cycles of PCR can be repeated
without washing but with an excess of bound primer, so that the
resulting PCR product remains attached to the support. The
attachment of an amplified target sequence to a support can
facilitate the washing (or purification) of the target, either
before it is contacted with (e.g., hybridized to) a surface
comprising anchors and/or linkers, or after it has been contacted
with and then released from such a surface.
[0131] In another embodiment, one or both of the PCR primers used
to amplify a target can comprise one or more restriction enzyme
sites, allowing the introduction of restriction sites adjacent to
either end of, or flanking, a target sequence of interest.
Restriction sites can be added to an amplified target by PCR either
before or after it has contacted (e.g., hybridized to) a surface
comprising anchors and/or linkers. Restriction site(s) introduced
in this manner can, for example, facilitate the cloning of an
amplified target by providing cloning sites which flank the target
sequence. Restriction sites can also facilitate the purification of
an amplified sequence. For example, one or more restriction sites
can be placed in a PCR primer between a target specific sequence
and a chemical modification which allows attachment to a support.
After a target has been PCR amplified, using the modified PCR
primer, and has bound to a support via the chemical modification,
it can be washed and then cleaved at the restriction site(s)
adjacent to the target sequence, thereby releasing the washed
target. See, e.g., FIG. 23.
[0132] Of course, cleavable sites other than restriction enzyme
sites can also be used in the methods described above, e.g., a
peptide which can be cleaved by a specific protease, or another
component which can be cleaved and/or released by physical,
chemical or other means.
[0133] In another embodiment, one or both of the PCR primers used
to amplify a target can comprise a sequence (which is not
necessarily present in the target) that is specific for, e.g., a
target-specific reporter or a detection linker.
[0134] Of course, the above-described primer modifications can be
used together in any desired combination, and can be added to an
amplified product at any stage of an assay. Examples 21 and 22
demonstrate protocols in which several of the primer modifications
described above are incorporated into an amplified target.
[0135] The above-described methods, in which mRNA targets are
converted to cDNA with reverse transcriptase and/or are amplified
by PCR before assaying on MAPS plates, can be used instead of the
standard MAPS assay procedure for any of the RNA-based assays
described above.
[0136] Nucleic acids used in the methods of the invention, e.g.,
targets, oligonucleotides involved in the detection of a target, or
nuclease protection fragments (described elsewhere herein) can be
amplified by any of a variety of conventional enzymatic procedures,
including PCR and ligase reactions. One such amplification method
is Transcription-Mediated Amplification (see, e.g., Abe et al.
(1993). J. Clin. Microbiol. 31, 3270-3274). See also Example 32 and
FIGS. 36-39 and 42.
[0137] In another embodiment of the invention, one or more nucleic
acid targets of interest are hybridized to specific polynucleotide
protection fragments and subjected to a nuclease protection
procedure, and those protection fragments which have hybridized to
the target(s) of interest are assayed on MAPS plates. Of course,
such "MAPS plates" can contain anchors which are not associated
with linkers (e.g., which can be associated directly with a target
or nuclease protection fragment of interest); the advantages of
nuclease protection as used in conjunction with any type of probe
array will be evident to one of skill in the art from this
specification and any of its ancestors to which benefit is claimed.
If the target of interest is an RNA and the protection fragment is
DNA, a Nuclease Protection/MAPS Assay (NPA-MAPS) can reduce the
need for extensive handling of RNA, which can be sensitive to
degradation by contaminating nucleases and thus difficult to work
with. Treatment of a sample with a nuclease protection procedure
also allows for a sample with reduced viscosity. Nuclease
protection of a sample can allow for greater sensitivity and
reproducibility in an assay. See, e.g., Example 30, which
illustrates the sensitivity and reproducibility of a typical assay
in which a sample is treated with a nuclease protection procedure.
An advantage of the invention is that assays can be sensitive
enough that amplification of the target (e.g., by PCR) is not
necessary in order to detect a signal. In an NPA-MAPS assay, the
probes in the probe array are oligonucleotides of the same
strandedness as the nucleic acid targets of interest, rather than
being complementary to them, as in a standard MAPS assay. One
example of an NPA-MAPS assay is schematically represented in FIG.
9.
[0138] In an NPA-MAPS assay, the target of interest can be any
nucleic acid, e.g., genomic DNA, cDNA, viral DNA or RNA, rRNA,
tRNA, mRNA, oligonucleotides, nucleic acid fragments, modified
nucleic acids, synthetic nucleic acids, or the like. In a preferred
embodiment of the invention, the procedure is used to assay for one
or more mRNA targets which are present in a tissue or cellular RNA
extract. A sample which contains the target(s) of interest is first
hybridized under selected stringent conditions (see above for a
discussion of appropriate reaction conditions to achieve specific
hybridization) to an excess of one or more specific protection
fragment(s). A protection fragment is a polynucleotide, which can
be, e.g., RNA, DNA (including a PCR product), PNA or modified or
substituted nucleic acid, that is specific for a portion of a
nucleic acid target of interest. By "specific" protection fragment,
it is meant a polynucleotide which is sufficiently complementary to
its intended binding partner to bind to it under selected stringent
conditions, but which will not bind to other, unintended nucleic
acids. A protection fragment can be at least 10 nucleotides in
length, preferably 50 to about 100, or about as long as a full
length cDNA. In a preferred embodiment, the protection fragments
are single stranded DNA oligonucleotides. Protection fragments
specific for as many as 100 targets or more can be included in a
single hybridization reaction. After hybridization, the sample is
treated with a cocktail of one or more nucleases so as to destroy
nucleic acid other than the protection fragment(s) which have
hybridized to the nucleic acid(s) of interest and (optionally) the
portion(s) of nucleic acid target which have hybridized and been
protected from nuclease digestion during the nuclease protection
procedure (are in a duplexed hybrid). For example, if the sample
comprises a cellular extract, unwanted nucleic acids, such as
genomic DNA, tRNA, rRNA and mRNA's other than those of interest,
can be substantially destroyed in this step. Any of a variety of
nucleases can be used, including, e.g., pancreatic RNAse, mung bean
nuclease, S1 nuclease, RNAse A, Ribonuclease T1, Exonuclease III,
Exonuclease VII, RNAse CLB, RNAse PhyM, RNAse U2, or the like,
depending on the nature of the hybridized complexes and of the
undesirable nucleic acids present in the sample. RNAse H can be
particularly useful for digesting residual RNA bound to a DNA
protection fragment. Reaction conditions for these enzymes are
well-known in the art and can be optimized empirically. Also,
chemical procedures can be used, e.g., alkali hydrolysis of RNA. As
required, the samples can be treated further by well-known
procedures in the art to remove unhybridized material and/or to
inactivate or remove residual enzymes (e.g., phenol extraction,
precipitation, column filtration, etc.). The process of
hybridization, followed by nuclease digestion and (optionally)
chemical degradation, is called a nuclease protection procedure; a
variety of nuclease protection procedures have been described (see,
e.g., Lee et al (1987). Meth. Enzymol. 152, 633-648. Zinn et al
(1983). Cell 34, 865-879.). Samples treated by nuclease protection,
followed by an (optional) procedure to inactivate nucleases, are
placed in contact with a MAPS probe array and the usual steps of a
MAPS assay are carried out. Bound protection fragments can be
detected by, e.g., hybridization to labeled target-specific
reporters, as described herein for standard MAPS assays, or the
protection fragments, themselves, can be labeled, covalently or
non-covalently, with a detectable molecule.
[0139] If desired, one or more controls can be included for
normalizing an NPA-MAPS assay. For example, one or more protection
fragments corresponding to a nucleic acid which is expected to be
present in each of a series of samples in a substantially constant
amount (e.g., a constitutively produced mRNA, a portion of a
genomic DNA, a tRNA or rRNA) can be used. The ability to detect and
quantify an internal normalization control, e.g., genomic DNA, in
an assay for measuring nucleic acids which are present in variable
amounts (e.g., mRNAs), is an advantage of using protection
fragments in the assays.
[0140] Because the amount of the normalization standard(s) may be
lower than that of expressed mRNAs of interest, the assay may be
adjusted so the signals corresponding to the expressed genes do not
swamp out the signal(s) corresponding to the normalization
standard(s). Methods of adjusting the signal levels are
conventional and will be evident to one of skill in the art. For
example, any of the methods described herein for balancing signal
intensities (e.g., signal attenuation, fine-tuning) can be used
(e.g., using blocked linkers; labeling the signal moiety designed
to detect the normalization standard at a greater level than that
designed to detect the mRNA; placing at a locus designated for
detecting a normalization standard a plurality of linkers which are
specific for different portions of the normalization nucleic acid,
or for protection fragments that correspond to different portions
of that nucleic acid, etc.). The normalization standard(s) and the
nucleic acid targets (e.g., mRNAs) of interest can be detected
simultaneously or sequentially, e.g., by any of the methods
described elsewhere herein. Example 28 and FIG. 29 illustrate a
typical experiment in which internal DNA normalization standards
are used in an assay of mRNAs.
[0141] In a preferred embodiment, the protection fragment is
directly labeled, e.g., rather than being labeled by hybridization
to a target-specific reporter. For example, the reporter is bound
to the protection fragment through a ligand-antiligand interaction,
e.g., a streptavidin enzyme complex is added to a biotinylated
protection oligonucleotide. In another example, the protection
fragment is modified chemically, (e.g., by direct coupling of
horseradish peroxidase (HRP) or of a fluorescent dye) and this
chemical modification is detected, either with the nucleic acid
portion of the protection fragment or without it, (e.g., after
cleavage of the modification by, for example, an enzymatic or
chemical treatment). In any of the above methods, a protection
fragment can be labeled before or after it has hybridized to a
corresponding linker molecule.
[0142] In order to control that the nuclease protection procedure
has worked properly, i.e. that non-hybridized nucleic acids have
been digested as desired, one can design one or more protection
fragments to contain overhanging (non-hybridizing) segments that
should be cleaved by the nucleases if the procedure works properly.
The presence or absence of the overhanging fragments can be
determined by hybridization with a complementary, labeled,
detection probe, or the overhanging portion of the protection
fragment, itself, can be labeled, covalently or non-covalently,
with a detectable molecule. This control can be performed before
the sample is placed in contact with the probe array, or as a part
of the MAPS assay, itself. An example of such a control assay is
described in Example 15. Of course, because different labels can be
easily distinguished (e.g., fluors with different absorption
spectra), several differently labeled oligonucleotides can be
included in a single assay. Further, the standard nuclease
protection assay as analyzed by gel electrophoresis can be used
during assay development to verify that the protection fragments
are processed as expected.
[0143] Other controls for correct nuclease digestion will be
evident to one of skill in the art. For example, one can include in
an assay a nuclease protection fragment which is known not to have
specificity for any nucleic acid in the sample (e.g., in an assay
for plant nucleic acids, one can include a protection fragment
specific for an animal gene which is known to be absent in
plants).
[0144] After detection of targets, the detection probe (e.g.,
HRP-labeled) signal can be eliminated (e.g. denatured, killed,
quenched, suppressed, blocked), plates washed to remove any
resulting reagents, agents, or buffers which might interfere in the
next step (e.g., denaturing regent), and then the overhang can be
detected with a different detection probe (e.g., also HRP-labeled).
The use of signal denaturation followed by addition of a different
detection probe with the same signaling moiety can be used at
various stages of the assay. Utilization of two different
flourescent probes and dual color detection can be used without
denaturation or signal blocking.
[0145] In one embodiment of the invention, as was noted above, an
oligonucleotide probe is used to screen for a nucleic acid which
comprises one or more polymorphisms. In a preferred embodiment, the
nucleic acid (e.g., a DNA, such as a genomic DNA, or an RNA, such
as an mRNA) comprises one or more SNPs. Routine, art-recognized
procedures can be used to carry out the procedure. For example, to
screen for a DNA comprising a known SNP, or an mRNA expressed from
such a DNA, a "SNP-specific" protection fragment is hybridized to a
sample comprising nucleic acids which may comprise that SNP. By
"SNP-specific" protection fragment is meant in this context a
protection fragment which comprises the altered base of the SNP or,
if an mRNA is to be analyzed, the reverse complement of such a
sequence. The sample is then treated with one or more appropriate
nucleases which, under appropriate, empirically determinable
conditions, digest unhybridized single stranded nucleic acid and
cleave double stranded (duplex) nucleic acid (e.g., DNA-DNA
hybrids, DNA-RNA hybrids, or the like) at the site of a mismatch
(e.g., a single base mismatch). Appropriate nucleases include,
e.g., SI or RHAse H. If a nucleic acid which comprises a SNP is
present in the sample and hybridizes to the SNP-specific protection
fragment, the protection fragment will survive the digestion
procedure intact, and can be subjected to a MAPS assay and detected
by a detection probe or detection oligonucleotide which is specific
for a sequence of the protection fragment. Nucleic acids which do
not comprise the SNP will be cleaved at the site of the mismatch
between the SNP-specific protection fragment and the corresponding
wild type sequence in the nucleic acid. If desired, a portion of
the protection fragment which lies either distal to or proximal to
the site of cleavage can be removed, using conventional methods
(e.g., heat denaturation, enzymatic cleavage, etc.) An assay can be
designed either so that the cleaved molecules (or portions thereof)
will not bind to linkers, or so that such cleaved molecules, even
if a portion thereof binds to a linker, will not be detected by an
appropriately designed detection probe or detection
oligonucleotide. Example 29 and FIGS. 30 and 31 illustrate, i.a.,
that assays of the invention can detect a single base mismatch in
an expressed SNP. Example 32 (FIG. 41) illustrates an assay for the
detection of SNPs, which is applicable, e.g., to the detection of
SNPs in genomic DNA.
[0146] NPA-MAPS assays can be used to quantitate the amount of a
target in a sample. If protection fragment is added at a large
enough molar excess over the target to drive the hybridization
reaction to completion, the amount of protection fragment remaining
after the nuclease protection step will reflect how much target was
present in the sample. One example of such a quantitation reaction
is described in Examples 12 and 13.
[0147] In one embodiment of the invention, different types of
targets in a sample, e.g., various combinations of DNA, RNA,
intracellular proteins and secreted proteins, can be assayed with a
single probe array. See FIGS. 40 and 41 for examples of such
assays.
[0148] NPA-MAPS assays can be used to implement any of the methods
described above that use standard MAPS assays.
[0149] In a preferred embodiment, the polynucleotide protection
fragments are measured by the mass spectrometer rather than on MAPS
plates. In a most preferred embodiment, none of the polynucleotides
are bound (attached) to a solid surface during the hybridization or
nuclease digestion steps. After hybridization, the hybridized
target can be degraded, e.g., by nucleases or by chemical
treatments, leaving the protection fragment in direct proportion to
how much fragment had been hybridized to target. Alternatively, the
sample can be treated so as to leave the (single strand) hybridized
portion of the target, or the duplex formed by the hybridized
target and the protection fragment, to be further analyzed. The
samples to be analyzed are separated from the rest of the
hybridization and nuclease mixture (for example by ethanol
precipitation or by adsorption or affinity chromatography, etc.),
eluted or solubilized, and injected into the mass spectrometer by
loop injection for high throughput. In a preferred embodiment, the
samples to be analyzed (e.g., protection fragments) are adsorbed to
a surface and analyzed by laser desorption, using well-known
methods in the art. For highest sensitivity Fourier Transform Mass
Spectrometry (FTMS) (or other similar advanced technique) may be
used, so that femtomoles or less of each protection fragment can be
detected.
[0150] The protection fragments that are to be detected within one
(or more) samples can be designed to give a unique signal for the
mass spectrometer used. In one embodiment, the protection fragments
each have a unique molecular weight after hybridization and
nuclease treatment, and their molecular weights and characteristic
ionization and fragmentation pattern will be sufficient to measure
their concentration. To gain more sensitivity or to help in the
analysis of complex mixtures, the protection fragments can be
modified (e.g., derivatized) with chemical moieties designed to
give clear unique signals. For example each protection fragment can
be derivatized with a different natural or unnatural amino acid
attached through an amide bond to the oligonucleotide strand at one
or more positions along the hybridizing portion of the strand. With
a mass spectrometer of appropriate energy, fragmentation occurs at
the amide bonds, releasing a characteristic proportion of the amino
acids. This kind of approach in which chemical moieties of moderate
size (roughly 80 to 200 molecular weight) are used as mass
spectrometric tags is desirable, because molecules of this size are
generally easier to detect. In another example, the chemical
modification is an organic molecule with a defined mass
spectrometric signal, such as a tetraalkylammonium group which can,
for example, derivatize another molecule such as, e.g., an amino
acid. In another example, positive or negative ion signals are
enhanced by reaction with any of a number of agents. For example,
to enhance positive ion detection, one can react a pyrylium salt
(such as, e.g., 2-4-dithenyl, 6-ethyl pyrylium tetrafluoroborate,
or many others) with an amine to form a pyridinium salt; any of a
number of other enhancing agents can be used to form other
positively charged functional groups (see, e.g., Quirke et al
(1994). Analytical Chemistry 66, 1302-1315). Similarly, one can
react any of a number of art-recognized agents to form negative ion
enhancing species. The chemical modification can be detected, of
course, either after having been cleaved from the nucleic acid, or
while in association with the nucleic acid. By allowing each
protection fragment to be identified in a distinguishable manner,
it is possible to assay (e.g., to screen) for a large number of
different targets (e.g., for 2, 6, 10, 16 or more different
targets) in a single assay. Many such assays can be performed
rapidly and easily. Such an assay or set of assays can be
conducted, therefore, with high throughput as defined herein.
[0151] Regardless of whether oligonucleotides are detected directly
by their mass or if unique molecular tags are used, the signals for
each molecule to be detected can be fully characterized in pure
preparations of known concentration. This will allow for the signal
to be quantified (measured, quantitated) accurately. For any
molecule to be detected by mass spectrometry, the intensity and
profile cannot be predicted with accuracy. The tendency of the
molecule to be ionized, the sensitivity of all chemical bonds
within the molecule to fragmentation, the degree to which each
fragment is multiply charged or singly charged, are all too complex
to be predicted. However, for a given instrument with fixed energy
and sample handling characteristics the intensity and profile of
the signal is very reproducible. Hence for each probe the signal
can be characterized with pure standards, and the experimental
signals interpreted quantitatively with accuracy.
[0152] In one aspect, the invention relates to a method to detect
one or more nucleic acids of interest, comprising subjecting a
sample comprising the nucleic acid(s) of interest to nuclease
protection with one or more protection fragments, and detecting the
hybridized duplex molecules, or the protected nucleic acid, or the
protection fragment, with mass spectrometry.
[0153] Methods of analyzing nucleic acids by mass spectrometry are
well-known in the art. See, e.g., Alper et al (1998). Science 279,
2044-2045 and Koster, U.S. Pat. No. 5,605,798.
[0154] In addition to the variety of high throughput assays
described above, many others will be evident to one of skill in the
art.
[0155] An advantage of using multiprobe assays is the ability to
include a number of "control" probes in each probe array which are
subject to the same reaction conditions as the actual experimental
probes. For example, each region in the array can comprise positive
and/or negative controls. The term, a "positive control probe," is
used herein to mean a control probe that is known, e.g., to
interact substantially with the target, or to interact with it in a
quantitatively or qualitatively known manner, thereby acting as a(n
internal) standard for the probe/target interaction. Such a probe
can control for hybridization efficiency, for example. The term, a
"negative control probe," is used herein to mean a control probe
which is known not to interact substantially with the target. Such
a probe can control for hybridization specificity, for example. As
examples of the types of controls which can be employed, consider
an assay in which an array of oligonucleotide probes is used to
screen for agents which modulate the expression of a set of
correlative genes for a disease. As an internal normalization
control for variables such as the number of cells lysed for each
sample, the recovery of mRNA, or the hybridization efficiency, a
probe array can comprise probes which are specific for one or more
basal level or constitutive house-keeping genes, such as structural
genes (e.g., actin, tubulin, or others) or DNA binding proteins
(e.g., transcription regulation factors, or others), whose
expression is not expected to be modulated by the agents being
tested. Furthermore, to determine whether the agents being tested
result in undesired side effects, such as cell death or toxicity, a
probe array can comprise probes which are specific for genes that
are known to be induced as part of the apoptosis (programmed cell
death) process, or which are induced under conditions of cell
trauma (e.g., heat shock proteins) or cell toxicity (e.g., p450
genes).
[0156] Other control probes can be included in an array to "fine
tune" the sensitivity of an assay. For example, consider an assay
for an agent which modulates the production of mRNAs associated
with a particular disease state. If previous analyses have
indicated that one of the correlative mRNAs (say, mRNA-A) in this
set is produced in such high amounts compared to the others that
its signal swamps out the other mRNAs, the linkers can be adjusted
to "fine tune" the assay so as to equalize the strengths of the
signals. "Blocked linkers," which comprise the anchor-specific
oligonucleotide sequence designated for the mRNA-A target, but
which lack the probe-specific sequence, can be added to dilute the
pool of target-specific linkers and thus to reduce the sensitivity
of the assay to that mRNA. The appropriate ratios of blocked and
unblocked linkers can be determined with routine, conventional
methods by one of skill in the art.
[0157] The "fine tuning" of an assay for a particular target by
diluting an active element with an inactive element can also be
done at other steps in the assay. For example, it can be done at
the level of detection by diluting a labeled, target-specific
reporter with an "inactive" target-specific reporter, e.g., one
with the same target-specific moiety (e.g., an oligonucleotide
sequence) but without a signaling entity, or with an inactivated or
inactive form of the signaling entity. The term "signaling entity,"
as used herein, refers to a label, tag, molecule, or any substance
which emits a detectable signal or is capable of generating such a
signal, e.g., a fluorescent molecule, luminescence enzyme, or any
of the variety of signaling entities which are disclosed herein).
In an especially preferred embodiment, the "fine tuning" can be
done at the step of contacting a target-containing complex with a
detection linker (detection linkers are described below, e.g., in
the section concerning complex sandwich-type detection methods,
Example 23, and FIG. 24). A set of detection linkers can be
designed, e.g., to fine tune the sensitivity for each individual
target in an assay. For example, if a particular target is known to
be present in a sample at very high levels, the detection linker
for that target can be diluted with an empirically-determinable
amount of "blocked detection linker," comprising the
target-specific moiety (e.g., oligonucleotide sequence) but no
moiety specific for a reporter reagent, or comprising the
target-specific moiety and a reporter reagent-specific moiety which
is pre-bound to an inactive reporter reagent. That is, instead of
comprising a moiety specific for a reporter reagent, that moiety
can be absent, or prevented (e.g., blocked) from interacting with
(e.g., hybridizing to) the reporter reagent. Such fine tuning is
sometimes referred to herein as signal "attenuation." FIG. 28
illustrates an experiment in which such signal attenuation was
performed.
[0158] Samples to be tested in an assay of the invention can
comprise any of the targets described above, or others. Liquid
samples to be assayed can be of any volume appropriate to the size
of the test region, ranging from about 100 nanoliters to about 100
microliters. In a preferred embodiment, liquid drops of about 1
microliter are applied to each well of a 1536 well microtiter dish.
Samples can be placed in contact with the probe arrays by any of a
variety of methods suitable for high throughput analysis, e.g., by
pipetting, inkjet based dispensing or by use of a replicating pin
tool. Samples are incubated under conditions (e.g., salt
concentration, pH, temperature, time of incubation, etc.--see
above) effective for achieving binding or other stable interaction
of the probe and the target. These conditions are routinely
determinable. After incubation, the samples can optionally be
treated (e.g., washed) to remove unbound target, using conditions
which are determined empirically to leave specific interactions
intact, but to remove non-specifically bound material. For example,
samples can be washed between about one and ten times or more under
the same or somewhat more stringent conditions than those used to
achieve the probe/target binding.
[0159] Samples containing target RNA, e.g., mRNA, rRNA, tRNA, viral
RNA or total RNA, can be prepared by any of a variety of
procedures. For example, in vitro cell cultures from which mRNA is
to be extracted can be plated on the regions of a surface, such as
in individual wells of a microtiter plate. Optionally, these cells,
after attaining a desired cell density, can be treated with an
agent of interest, such as a stimulating agent or a potential
therapeutic agent, which can be added to the cells by any of a
variety of means, e.g., with a replicating pin tool (such as the 96
or 384 pin tools available from Beckman), by pipetting or by
ink-jet dispensing, and incubated with the cells for any
appropriate time period, e.g., between about 15 minutes and about
48 hours, depending upon the assay. Total RNA, mRNA, etc. extracts
from tissues or cells from an in vitro or in vivo source can be
prepared using routine, art-recognized methods (e.g., commercially
available kits).
[0160] In one embodiment, cells are lysed (or permeabilized), in
the presence or absence of nuclease protection fragment(s), and the
crude lysate is used directly (e.g., in the well of a microtiter
plate), without further purification from, e.g., other cellular
components. If the cells are lysed in the absence of nuclease
protection fragments, such protection fragments can optionally be
added subsequently to the lysate.
[0161] In a preferred embodiment, e.g., in which nuclease
protection fragments are detected, samples are prepared by
contacting cells of interest (e.g., cells on the surface of a well
of a microtiter plate; cells in a tissue or whole organism sample;
or the like) with an aqueous medium (lysis solution) which
comprises a surfactant or detergent (e.g., SDS, e.g., at about
0.01% to about 0.5% w/v) and an agent (e.g., formamide (e.g., at
about 8-about 60%, v/v), guanidium HCl (e.g., at about 0.1-about
6M), guanidium isothyocyanate (e.g., at about 0.05-about 8M) or
urea (e.g., at about 40-about 46%, w/v, or about 7M)), which, alone
or in combination with one or more other agents, can act as a
chaotropic agent. The aqueous medium can be buffered by any
standard buffer. In a preferred embodiment, the buffer is about
0.5-6.times.SSC, more preferably about 3.times.SSC. Optionally, the
aqueous medium can also comprise tRNA at an appropriate
concentration, e.g., about 0.1-2.0 mg/ml, preferably about 0.5
mg/ml. Nuclease protection fragments may also be added to the
aqueous medium before it is added to the cells. The optimal
concentration of each protection fragment can be determined
empirically, using conventional methods. In a preferred embodiment,
the concentration of each protection fragment is about 3 to about
300 pM, more preferably about 30 pM.
[0162] Cells are incubated in the aqueous solution until the cells
become permeabilized and/or lysed, and DNA and/or mRNA is released
from the cells into the aqueous medium. Cells are incubated in the
aqueous medium for an empirically determinable period of time
(e.g., about 1 min to about 60 min), at an empirically determinable
optimizable temperature (e.g., about 37.degree. C. to about
115.degree. C., preferably about 90.degree. C. to about 115.degree.
C.)
[0163] For example, in one embodiment, in which both DNA and RNA
are released from the cells in a denatured form capable of binding
to a protection fragment, the cells are incubated for about 1 min
to about 60 min, preferably about 5 to about 20 min, in the aqueous
medium at about 90.degree. to about 115.degree. C., preferably
about 105.degree. C. If desired, e.g., when it is desirable to
assay for DNA in the absence of RNA, any of a variety of
conventional ribonucleases can be included in the incubation
mixture. Selection of an appropriate ribonuclease, and optimization
of digestion conditions, are conventional and readily determined by
a skilled worker.
[0164] In another embodiment, mRNA can be prepared by incubating
cells for about 5 to about 20 min, preferably about 10 min, in an
aqueous medium at about 90.degree. to about 100.degree. C.,
preferably about 95.degree. C., optionally in the presence of one
or more protection fragments. In this case, mRNA is substantially
released from the cells in a denatured form capable of binding to a
protection fragment, and DNA remains substantially inside or
attached to the cells, or is unavailable to a probe by virtue of
its double-stranded nature, or is released from the cells, but in a
form which is not able to bind to a protection fragment (e.g., is
not denatured). Without wishing to be bound to any particular
mechanism, it appears that, as the nucleic acid is released from
the lysed/permeabilized cells, it is sufficiently denatured to
allow it to bind to a protection fragment to form a stable duplex
which is resistant to degradation by endogenous or exogenous
reagents or enzymes, and proteins within the cell (e.g., nucleases)
are denatured and/or inactivated.
[0165] Following preparation of a nucleic acid of interest by the
above procedure, the sample can be diluted, in the appropriate
volume, so that the aqueous medium does not inhibit the function of
exogenously added proteins such as, e.g., nucleases (e.g., S1
nuclease), polymerases (e.g., polymerases required for PCR
reactions), or binding proteins (e.g., streptavidin). The amounts
of dilution, and the identity and amounts of the components to be
used in the aqueous solution, as described above, can be determined
empirically, using conventional methods.
[0166] For any of the methods of this invention, targets can be
labeled (tagged) by any of a variety of procedures which are
well-known in the art and/or which are described elsewhere herein
(e.g., for the detection of nuclease protection fragments). For
example, the target molecules can be coupled directly or indirectly
with chemical groups that provide a signal for detection, such as
chemiluminescent molecules, or enzymes which catalyze the
production of chemiluminsecent molecules, or fluorescent molecules
like fluorescein or cy5, or a time resolved fluorescent molecule
like one of the chelated lanthanide metals, or a radioactive
compound. Alternatively, the targets can be labeled after they have
reacted with the probe by one or more labeled target-specific
reporters (e.g., antibodies, oligonucleotides as shown in FIG. 1,
or any of the general types of molecules discussed above in
conjunction with probes and targets).
[0167] One type of fluorescent molecule can be an "upconverting
phosphore," i.e., a fluor which absorbs and is excited at a long
wavelength (e.g, IR), then emits at a shorter wavelength (e.g.,
visible light). Because upconverting phosphores absorb at a longer
wavelength than do most potentially interfering materials present
in a typical sample to be analyzed, upconverting phosphores allow a
reduction in interference caused by material in the sample,
compared to phosphores which absorb at a lower wavelength. The
narrow emission spectrum of most upconverting phosphores also
allows the simultaneous detection of a large number of different
upconverting phosphores. Upconverting phosphores are well-known and
conventional in the art, and include, e.g., rare earth metal ions
such as, e.g., Ytterbium (Yb), Erbium (Er), Thulium (Tm) and
Praseodymium (Pr), particularly in the form of an oxysulfide salt.
As many as 80 or more independently detectable upconverting
phosphores have been described. (See, e.g., Biological Agent
Detection and Identification, Apr. 27-30, 1999, DARPA, Biological
Warfare Defense, Defense Sciences Office. The phosphores can
optionally be attached to any surface, e.g., to a microsphere or a
latex bead. Like other fluorescent labels, upconverting phosphores
can be detected by energy transfer to (or modulation by) the label
on a sufficiently close linker, target or reporter. Furthermore, as
with other signaling entities disclosed herein, upconverting
phosphores can be used to quantitate the amount of a target, and
can be used in any of the variety of procedures described herein,
e.g., to detect nuclease protection fragments.
[0168] Of course, upconverting phosphores can also be used to
detect targets which are distributed in any other fashion on a
surface, e.g., targets (including nuclease protection fragments)
which are bound directly to a surface, bound directly to an array
of different oligonucleotides on a surface, or bound via
bifunctional linkers to anchors (different or substantially
identical) which are distributed substantially evenly, or in any
desired organization or pattern, on a surface. Any surface can be
used, e.g., a flow-through system, or a solid surface such as,
e.g., a bead. Beads used in any of the assays of the invention can
be of any type, e.g., made of any material, magnetic and/or
non-magnetic; and the beads used in a single assay can be of
substantially the same, or different, sizes and/or shapes.
[0169] A variety of more complex sandwich-type detection procedures
can also be employed. For example, a target can be hybridized to a
bifunctional molecule containing a first moiety which is specific
for the target and a second moiety which can be recognized by a
common (i.e., the same) reporter reagent, e.g., a labeled
polynucleotide, antibody or the like. The bifunctional molecules
can be designed so that any desired number of common reporters can
be used in each assay.
[0170] For any of the methods of this invention, a variety of
complex sandwich-type detection procedures can be employed to label
(tag) targets. For example, a target can interact with, e.g.,
hybridize to, a bifunctional (or multifunctional) molecule (a
"detection linker") containing a first moiety that is specific for
the target and a second moiety that is specific for a "reporter
reagent." The term "specific for" has the meaning as used herein
with respect to the interactions of, e.g., probes and targets. The
term "reporter reagent," as used herein, refers to a labeled
polynucleotide, antibody or any of the general types of molecules
discussed herein in conjunction with probes and targets. These two
moieties of a detection linker can recognize (interact or associate
with) their respective binding partners in any of the manners
discussed above in conjunction, e.g., with probes and targets. A
detection linker can also comprise other sequences, e.g., sequences
that are specific for a target but are different from
(non-overlapping with) the target-specific moiety of the
corresponding anchor-bound linker. Any sequence present in a
detection linker can serve as a recognition sequence for a
detection probe or a reporter agent. In a preferred embodiment, a
detection linker is a polynucleotide.
[0171] Detection linkers can be designed so that any desired number
of common reporter reagents can be used in an assay. For example, a
set of detection linkers can be designed such that each detection
linker is specific for a different target, but comprises a binding
site for the same (common), or for one of a limited number of,
reporter reagents. The ability to use a limited number of (e.g.,
one) reporter reagents to label a variety of targets in a single
assay provides the advantage of reduced cost and lower backgrounds.
Of course, detection linker/reporter reagent combinations can be
used to detect targets which are distributed in any fashion on a
surface, e.g., as described above for the types of target
arrangements that can be detected by upconverting phosphores.
[0172] In a most preferred embodiment, detection linkers can be
designed to detect nuclease protection fragments in such a way that
protection fragments which have been cleaved by a nuclease from
control "overhang" sequences during a nuclease protection procedure
(as described, e.g., in Example 15) are preferentially labeled.
This type of detection procedure is illustrated schematically in
FIG. 24. In this embodiment, a detection linker comprises a first
moiety that is specific for a target and a second moiety that is
specific for the common control overhang sequence which, in a
preferred embodiment, is present on substantially all of the
nuclease protection fragments at the start of an assay. If, as
desired, the control overhang sequence has been cleaved from a
nuclease protection fragment during a nuclease protection reaction,
the target-specific moiety of the detection linker will hybridize
to the cleaved protection fragment, but the control
overhang-specific moiety of the detection linker will be unbound
and will remain available for further hybridization. If, on the
other hand, the control overhang-specific sequence is not cleaved
from a protection fragment, e.g., because of incomplete nuclease
digestion during a nuclease protection procedure, both the
target-specific and the control overhang-specific moieties of the
detection linker will hybridize to the protection fragment and will
not be available for further hybridization. In a preferred
embodiment, complexes comprising nuclease protection fragments and
bound detection linkers are then hybridized in a further step to a
reporter reagent which comprises a signaling entity (e.g., a
fluorochrome, hapten, enzyme, or any other molecule bearing a
detectable signal or signal-generating entity, as described herein)
and an moiety (e.g., an oligonucleotide) which is specific for the
control overhang-specific moiety of a detection linker. The
reporter reagent will preferentially bind to and label those
complexes in which the control overhang sequence of the nuclease
protection fragment has been cleaved off, (i.e., a complex in which
the control overhang-specific moiety of the detection linker is
available for further hybridization to the reporter reagent.)
[0173] Numerous other variations of sandwich detection procedures
will be evident to one of skill in the art.
[0174] Methods by which targets can be incubated with a
target-specific reporter(s), or target/detection linker complexes
can be incubated with reporter reagents, under conditions effective
for achieving binding or other stable interaction, are routinely
determinable (see above). For example, fluorescent oligonucleotide
reporters (at a concentration of about 10 nM to about 1 .mu.M or
more, preferably about 30 nM, in a buffer such as 6.times.SSPE-T or
others) can be incubated with the bound targets for between about
15 minutes to 2 hours or more (preferably about 30 to 60 minutes),
at a temperature between about 15.degree. C. and about 45.degree.
C. (preferably about room temperature). After incubation, the
samples can optionally be treated (e.g., washed) to remove unbound
target-specific reporters, using conditions which are determined
empirically to leave specific interactions intact, but to remove
non-specifically bound material. For example, samples can be washed
between about one and ten times or more under the same or somewhat
more stringent conditions than those used to achieve the
target/reporter binding.
[0175] Tagging with a target-specific reporter(s) can provide an
additional layer of specificity to the initial hybridization
reaction, e.g., in the case in which a target-specific
oligonucleotide reporter is targeted to a different portion of the
sequence of a target nucleic acid than is the probe
oligonucleotide, or in which probe and reporter antibodies
recognize different epitopes of a target antigen. Furthermore,
tagging with target-specific reporters can allow for "tuning" the
sensitivity of the reaction. For example, if a target mRNA which is
part of a correlative expression pattern is expressed at very low
levels, the level of signal can be enhanced (signal amplification)
by hybridizing the bound target to several (e.g., about two to
about five or more) target-specific oligonucleotide reporters, each
of which hybridizes specifically to a different portion of the
target mRNA.
[0176] The ability to detect two types of labels independently
allows for an additional type of control in MAPS assays. Some
(e.g., about 10 to about 100%) of the linkers designated for a
particular anchor locus (FIG. 7 shows 3 typical anchor loci, each
comprising a plurality of substantially identical anchors (A, B or
C)) can have a label (e.g., a fluor) attached to one end. For
example, a rhodamine or Cy5 fluor can be attached at the 5' end of
the linker. Such modified linkers are termed "control linkers."
After a mixture of linkers and control linkers has been associated
with anchors and a sample containing a target has been incubated
with the resulting probe array, a target-specific reporter bearing
a different fluor (e.g., fluorescein or another detection label
such as a chemiluminescent one) can be used (or the target can be
directly labeled with a fluor or other detection label); and the
ratio of the two signals can be determined. The presence of control
linkers permits calibration of the number of functional (e.g., able
to interact with linkers) anchors within and between test regions
(i.e. tests the capacity of each locus of the array to bind target,
for purposes of normalizing signals), serves as a basis for
quantitation of the amount of bound target, aids in localization of
the anchor loci and/or provides a positive control, e.g., in cases
in which there is no signal as a result of absence of target in a
sample. In one embodiment of the invention, two different labels
(e.g., fluorophores) can also be used to detect two different
populations of target molecules; however, the ability to recognize
the presence of targets by spatial resolution of signals allows the
use of a single type of label for different target molecules.
[0177] The ability to detect labels independently (e.g.,
fluorescent labels which emit at distinguishable wavelengths, such
as, e.g., fluorescein and rhodamine, or different upconverting
phosphores) allows additional flexibility in the methods of the
invention. For example, each of two or more targets can be labeled,
directly or indirectly, with its own, uniquely detectable, label.
This allows for the detection of targets on the basis of features
specific to the labels (e.g., color of the emission) in addition to
(or instead of), e.g., identifying the position of a localized
target on a surface, or identifying a target by virtue of the size
of a bead to which it is localized. In another embodiment of the
invention, a multiplicity of targets can be detected independently
at a single locus within a region. For example, two or more (e.g.,
2, 3, 4, 5, 6 or more) targets can be detected at a locus which is
defined by a single group of (substantially identical) anchors.
That is, a set of linkers can be used, each of which has an
anchor-specific portion specific for the same anchor plus a
target-specific portion specific for a different target. If a set
of, e.g., four such linkers is used, all four can bind to members
of the group of anchors at a single locus, allowing four different
targets to bind at that locus. If each of these targets is labeled
(directly or indirectly) with a different, distinguishable, label,
an investigator can determine the presence of each of the four
targets at the locus independently. Therefore, an array of, e.g.,
five anchors (groups of anchors) in a region can be used in the
scenario described above to detect as many as twenty different
targets. Such an assay is illustrated in Example 24 and FIG. 25.
Similarly, a plurality of targets, e.g., as many as 80 or more, can
be detected independently when a single type of anchor is
distributed, not at a single locus, but evenly, or in any desired
fashion, on a solid surface such as, e.g., a bead or a flow through
apparatus; and other aspects such as bead size or scatter can be
used to provide information about target identity or groups of
targets.
[0178] The association of multiple linkers (e.g., ranging from
about two to about 50 or more), having different target
specificities, with the anchors at a given locus (either a group of
substantially identical anchors or a "mixed locus"), sometimes
referred to herein as "mixed linkers," forms the basis for other
embodiments of the invention, which will be evident to those of
skill in the art. For example, at a given locus the anchors can be
bound to a mixture of linkers which are specific for a plurality of
different protection fragments, each of which corresponds to (is
specific for) a different portion of a nucleic acid (e.g., an mRNA)
of interest. The presence of such a plurality of different linkers
at a locus allows for considerably increased sensitivity in the
detection of a target (e.g., an mRNA) of interest, e.g., one
present at low abundance in a sample. Each locus can be designed so
that the number of linkers corresponding to different portions of
an mRNA designated for that locus is inversely proportional (in an
empirically determinable fashion) to the abundance of that mRNA in
the sample. For example, if one mRNA of interest is found in a
preliminary experiment to be present in a sample in large excess
over a second mRNA of interest, the relative number of linkers
corresponding to different portions of the two mRNAs can be
adjusted so that the relative intensities of the signals
corresponding to each mRNA are substantially the same. That is, the
signal intensities can be adjusted so that the signal corresponding
to the first mRNA does not swamp out the signal corresponding to
the second mRNA. In this manner, one can adjust an assay to allow
for simultaneous detection of a plurality of mRNAs which are
present in widely different amounts in a sample, balancing the
signal intensity corresponding to each mRNA.
[0179] In another embodiment of the invention, as was noted above,
a given locus can comprise linkers which are specific for a
plurality of unrelated or different targets or protection
fragments, allowing for the detection of a greatly increased number
of targets or protection fragments with a single array of anchors.
If, for example, each locus of an array of 350 anchors comprises
linkers specific for 10 different targets, then the array can be
used to detect as many as 3500 targets. In effect, such an
arrangement allows one to convert an array which can detect a low
density of targets to one which can detect a high density of
targets.
[0180] Multiple molecules (e.g., protection fragments) bound at a
single locus can be detected sequentially or simultaneously, e.g.,
using the detection methods described elsewhere in this
application. (For a discussion of "detection linkers" and "reporter
reagents," see, e.g., the section above concerning complex
sandwich-type detection methods.) In one embodiment, a first target
(e.g., a protection fragment) at a given locus is detected, e.g.,
with a first detection system (e.g., a detection linker/reporter
reagent, or a detection probe specific for it); then that first
detection linker/reporter reagent or probe is removed or
inactivated, using conventional procedures (e.g., changing the pH
to inactivate a reporter reagent comprising an enzyme that
generates a chemoluminescent signal), and a second detection
linker/reporter reagent or detection probe specific for a second
target at the same locus is used to detect that second target; and
so forth for as many cycles as desired. In another embodiment, the
first detection linker/reporter reagent or detection probe is added
to a combination as above, but it is not removed or inactivated
before the second detection linker/reporter reagent or detection
probe is added. In this embodiment, the amount of signal
corresponding to the second target can be determined by subtracting
out the amount of signal corresponding to the first target. In
another embodiment, the first and second detection linker/reporter
reagents or detection probes are added to the combinations as
above, substantially simultaneously, and are detected individually,
e.g., using differentially detectable labels as described elsewhere
herein. In any of the detection methods described herein, the
detection linkers can comprise moieties which are specific for the
same or for different reporter reagents. For example, if four
targets are associated with the linkers at a given locus, the
detection linkers specific for each of the four targets can each
comprise a moiety specific for a different reporter reagent.
Therefore, after the set of all four detection linkers is
hybridized to the targets, the targets can be detected sequentially
or simultaneously, as described above, using the four different
reporter reagents. Other detection methods, as well as combinations
of the above methods, will be evident to one of skill in the
art.
[0181] Of course, "mixed linkers" are also advantageous for use
with surfaces which contain a single (non-repeated) region.
[0182] In another embodiment of the invention, "anchors" which are
specific for a target(s) of interest are not associated with
linkers, but rather are associated directly with the target(s); the
target(s), in turn, can interact optionally with detection
linker(s) or with detection probe(s).
[0183] Targets, whether labeled or unlabeled, can be detected by
any of a variety of procedures, which are routine and conventional
in the art (see, e.g., Fodor et al (1996). U.S. Pat. No. 5,510,270;
Pirrung et al (1992). U.S. Pat. No. 5,143,854; Koster (1997). U.S.
Pat. No. 5,605,798; Hollis et al (1997) U.S. Pat. No. 5,653,939;
Heller (1996). U.S. Pat. No. 5,565,322; Eggers et al (1997). U.S.
Pat. No. 5,670,322; Lipshutz et al (1995). BioTechniques 19,
442-447; Southern (1996). Trends in Genetics 12, 110-115).
Detection methods include enzyme-based detection, calorimetric
methods, SPA, autoradiography, mass spectrometry, electrical
methods, detection of absorbance or luminescence (including
chemiluminescence or electroluminescence), and detection of light
scatter from, e.g., microscopic particles used as tags. Also,
fluorescent labels can be detected, e.g., by imaging with a
charge-coupled device (CCD) or fluorescence microscopy (e.g.,
scanning or confocal fluorescence microscopy), or by coupling a
scanning system with a CCD array or photomultiplier tube, or by
using array-based technology for detection (e.g., surface potential
of each 10-micron part of a test region can be detected or surface
plasmon resonance can be used if resolution can be made high
enough.) Alternatively, an array can contain a label (e.g., one of
a pair of energy transfer probes, such as fluorescein and
rhodamine) which can be detected by energy transfer to (or
modulation by) the label on a linker, target or reporter. Among the
host of fluorescence-based detection systems are fluorescence
intensity, fluorescence polarization (FP), time-resolved
fluorescence, fluorescence resonance energy transfer and
homogeneous time-released fluorescence (HTRF). Analysis of
repeating bar-code-like patterns can be accomplished by pattern
recognition (finding the appropriate spot or line for each specific
labeled target by its position relative to the other spots or
lines) followed by quantification of the intensity of the labels.
Bar-code recognition devices and computer software for the analysis
of one or two dimensional arrays are routinely generated and/or
commercially available (e.g., see Rava et al (1996). U.S. Pat. No.
5,545,531).
[0184] Another method which can be used for detection is 2-photon
fluorescence, including applications where the fluorescence of
endogenous or conjugated fluorochromes of components bound to the
array surface is enhanced by being bound close to the surface of
the array, for instance by close apposition to the substrate on
which the array is formed, or by close apposition to other agents
included in the anchor or linker or otherwise incorporated in the
bound complex. Other fluorescence methods or utility include
lifetime fluorescence, polarization, energy transfer, etc. For
instance, such methods permit the simultaneous detection and
descrimination of multiple targets within the same locus, and in
some instances can discriminate between bound label and unbound
label, eliminating the need to wash unbound lable away from the
array, and thus facilitating the measurment of rapidly reversible
or weak interactions by the array.
[0185] Methods of making and using the arrays of this invention,
including preparing surfaces or regions such as those described
herein, synthesizing or purifying and attaching or assembling
substances such as those of the anchors, linkers, probes and
detector probes described herein, and detecting and analyzing
labeled or tagged substances as described herein, are well known
and conventional technology. In addition to methods disclosed in
the references cited above, see, e.g., patents assigned to Affymax,
Affymetrix, Nanogen, Protogene, Spectragen, Millipore and Beckman
(from whom products useful for the invention are available);
standard textbooks of molecular biology and protein science,
including those cited above; and Cozette et al (1991). U.S. Pat.
No. 5,063,081; Southern (1996), Current Opinion in Biotechnology 7,
85-88; Chee et al (1996). Science 274, 610-614; and Fodor et al
(1993). Nature 364, 555-556.
BRIEF DESCRIPTION OF THE DRAWINGS
[0186] FIG. 1 illustrates a design scheme for oligonucleotides, in
which a linker 1 contains a portion that is specific for anchor 1
and another portion (a probe) that is specific for target mRNA 1,
and in which a labeled detection probe 1 is specific for a sequence
of target mRNA 1 which is different from the sequence of the
target-specific portion of the linker.
[0187] FIG. 2 illustrates a surface which comprises 15 test
regions, each of which comprises an array of six anchor
oligonucleotides.
[0188] FIG. 3 illustrates the design of a linker for a receptor
binding assay, in which the anchor-specific portion of the linker
is associated with the probe portion (the receptor protein) via
biotin and streptavidin molecules, and in which a ligand specific
for the receptor is labeled with a fluorescent labeling molecule.
B: Biotin. SA: Streptavidin. Rec: Receptor protein. Ligand: a
natural or synthetic ligand for the receptor. *: a fluorescent
labeling molecule attached to the Ligand.
[0189] FIG. 4 illustrates a surface which comprises 21 test
regions, each of which is further subdivided into 16 subregions
(indentations, dimples).
[0190] FIGS. 5a, 5b and 5c illustrate three pieces from which a
surface such as that shown in FIG. 4 can be assembled. FIG. 5a
represents a well separator; FIG. 5b represents a subdivider; and
FIG. 5c represents a base.
[0191] FIG. 6 represents two test regions, each of which comprises
a linear array of probes (or anchors) which are in a
"bar-code"-like formation.
[0192] FIG. 7 schematically represents a test region comprising 3
anchors (A, B and C), each of which is present in multiple copies
(a "group"). The location of each group of anchors is termed a
"locus."
[0193] FIG. 8 illustrates an assay in which cDNA(s) generated by
specific reverse transcriptase are assayed on MAPS plates.
[0194] FIG. 9 illustrates an assay which uses a nuclease protection
procedure (NPA-MAPS assay). Sample RNA is prepared from cells or
from tissue and is represented as thin wavy lines. To the RNA
sample is added a group of polynucleotide protection fragments,
portrayed as thick, dark and light lines. The dark sections of the
protection fragments represent segments that are complementary to
specific RNA targets and hybridize to those targets. The light
sections represent overhanging portions: sequences contiguous with
the complementary sequence but not complementary to target. The
protection fragments are added in excess. Following hybridization
of all available target to the protection fragments, the samples
are treated with an appropriate cocktail of nucleases and with
chemical treatments that destroy unwanted non-hybridized RNA and
non-hybridized polynucleotide. For example, S1 nuclease can destroy
any single stranded DNA present. Hence, excess protection fragment
is hydrolyzed as is the overhanging non-hybridized portion of bound
protection fragment. RNA can be hydrolyzed by addition of
ribonucleases including ribonuclease H and or by heating samples in
base. Remaining is a collection of cleaved protection fragments
that reflect how much of each target RNA had been present in the
sample. The remaining protection fragments are measured by a MAPS
hybridization assay.
[0195] FIG. 10 illustrates hybridization specificity in a MAPS
assay.
[0196] FIG. 11 illustrates binding kinetics of an anchor to a
linker.
[0197] FIG. 12 illustrates a MAPS assay of two oligonucleotide
targets.
[0198] FIG. 13 illustrates the quantification of a sensitivity
shift.
[0199] FIG. 14 illustrates melting temperature determinations for
four oligonucleotide linker/anchor combinations.
[0200] FIG. 15 illustrates an mRNA assay by NPA-MAPS.
[0201] FIG. 16 illustrates a dilution curve with NPA-MAPS.
[0202] FIG. 17 illustrates an assay to detect peptides containing
phosphotyrosine residues.
[0203] FIG. 18 illustrates the first step in an assay to map ESTs:
assembling linkers corresponding to each of the ESTs to be mapped
on arrays of generic anchors on a MAPS plate. To the surface of
each of 16 wells of a microplate are attached linkers comprising 16
different oligonucleotide probes, arranged in a 4.times.4 matrix.
The first locus has oligo 1, which is complementary to a portion of
the first EST sequence, and so on for the 16 ESTs to be tested.
[0204] cDNAs or mRNAs generated from the genes from which the ESTs
were obtained are added to all 16 wells and allowed to hybridize
under appropriate conditions. Hence, any cDNA or mRNA that contains
one of the 16 EST sequences will be assembled at the locus where
its complementary probe was placed.
[0205] FIG. 19 illustrates a subsequent step in an assay to map
ESTs: adding detector oligonucleotides to the MAPS plate. Each well
of the plate receives a detector oligonucleotide which corresponds
to one of the ESTs to be mapped. Each detector oligonucleotide is
an oligonucleotide coupled to a molecule used for detection, e.g.,
fluorescein if fluorescence imaging is to be the method of
detection. Each detector oligonucleotide is complementary to one of
the ESTs, but different from the EST-specific probe, so that a
probe and a detector oligonucleotide which are complementary to a
single EST can both bind at the same time.
[0206] After washing, a single detector oligonucleotide is added to
each well, as numbered in the figure. That is, the detector
oligonucleotide with sequences complementary to the first EST is
added to the first well, and so on.
[0207] FIG. 20a and b illustrate the results of the assay to map
ESTs shown in FIGS. 18 and 19. After hybridization of detector
oligonucleotides and washing with appropriate conditions of
stringency, the 16 wells of the microplate are imaged with a
CCD-based fluorescence imager, for example. FIG. 20a shows stylized
results. It is expected that each EST-specific detector
oligonucleotide should label the mRNA or cDNA held down by the
corresponding EST-specific probe. For example, probe 5 assembles
the cDNA or mRNA containing the fifth EST sequence at that locus,
so the fifth detector oligonucleotide should also hybridize to the
cDNA or mRNA at the same locus. This is the case for these stylized
data, with each detection oligonucleotide labeling the matching
probe. In addition, the first three detector oligonucleotides each
label cDNA or mRNA held down by the first three probes, showing
that these sequences lie along the same gene. Similarly, the last
five ESTs appear to be linked. The linkage assigned from these data
are presented graphically in FIG. 20b.
[0208] FIG. 21 illustrates the relationships of the probes,
detector oligonucleotides and ESTs #1, 2 and 6 shown in FIGS.
18-20.
[0209] FIG. 22 illustrates a high throughput assay.
[0210] FIG. 23 illustrates a method to prepare an amplified
target.
[0211] FIG. 24 illustrates an assay with detection linkers and
reporter agents.
[0212] FIG. 25 illustrates a use of multiple flours.
[0213] FIG. 26 illustrates a high throughput assay.
[0214] FIG. 27 illustrates the spatial arrangement of genes for the
THP-1 cells, along with two sample cells of data (selected from
FIG. 26).
[0215] FIG. 28 illustrates an assay with signal attenuation.
[0216] FIG. 29 illustrates an assay in which genomic DNA and
expressed RNA are measured from the same sample in the same well,
e.g., in which genomic DNA serves as a normalization control. The
left panel depicts the measurement of DNA alone; the right panel
depicts the measurement of both the DNA and GAPDH RNA (measured in
each corner of the array).
[0217] FIGS. 30 and 31 illustrate the detection of expressed
SNPs.
[0218] FIGS. 32-35 illustrate the sensitivity and reproducibility
of an assay.
[0219] FIG. 36 illustrates some types of assay configurations
encompassed by the invention.
[0220] FIG. 37 illustrates nuclease protection fragment
amplification by PCR.
[0221] FIG. 38 illustrates nuclease protection fragment
amplification by Ligase.
[0222] FIG. 39 illustrates nuclease protection fragment
amplification by Nuclease Protection.
[0223] FIGS. 40 and 41 illustrate assays in which, e.g., protein
and mRNA are assayed together from the same sample.
[0224] FIG. 42 illustrates nuclease protection fragment
amplification by polymerase. An application for the detection of
SNPs is illustrated.
EXAMPLES
Example 1
Hybridization Specificity (see FIG. 10)
[0225] A generic MAPS plate was produced by using an inkjet
dispenser, the Pixus system (Cartesian Technologies, Inc., Irvine,
Calif.) to form an identical grid of DNA within each well of a
microtiter plate. All oligonucleotides were purchased from
Biosource International (Camarillo, Calif.). For this plate, seven
different oligonucleotide anchors were dispensed within each well
in the pattern shown as the Key (left side of the figure). Each
oligonucleotide was dispensed as a 10 nanoliter droplet to two
spots, from a 2 uM solution containing 500 mM sodium phosphate pH
8.5 and 1 mM EDTA to the wells of a DNA Bind plate (Coming Costar),
and allowed to dry. After attachment, wells were blocked with 50 mM
Tris pH 8, and then oligonucleotide that had not covalently
attached to the surface was washed away with 0.1% SDS in
5.times.SSP buffer.
[0226] To the washed plate fluorescently labeled linker
oligonucleotides were added and allowed to hybridize in
6.times.SSPE with 0.1% Triton X-100 at room temperature for thirty
minutes. This is a preferred protocol for attachment of linkers.
The linker oligonucleotides were cy5-derivatized during synthesis,
and were complementary in 25 base-pair segments to specific
anchoring oligonucleotides. The sequences of the seven anchors and
linkers were as follows (all shown 5' to 3'):
1 #1 Anchor*: TCCACGTGAGGACCGGACGGCGTCC SEQ ID:1 Linker**
GTCGTTTCCATCTTTGCAGTCATAGGATACTGAGTGGACGC SEQ ID:2
CGTCCGGTCCTCACGTGGA RNA mimic(mouse C-jun):
CTATGACTGCAAAGATGGAAACGACGATACTGAGTTGGACC SEQ ID:3
TAACATTCGATCTCATTCA Detector Oligonucleotide***
TGAATGAGATCGAATGTTAGGTCCA SEQ ID:4 #2 Anchor*:
CACTACGGCTGAGCACGTGCGCTGC SEQ ID:5 Linker**
CTAGGCTGAAGTGTGGCTGGAGTCTGCAGCGCACGTGCTCA SEQ ID:6 GCCGTAGTG RNA
mimic (mouse MIP-2): AGACTCCAGCCACACTTCAGCCTAGGATACT- GAGTCTGAAC
SEQ ID:7 AAAGGCAAGGCTAACTGAC Detector Oligonucloeotide***
GTCAGTTAGCCTTGCCTTTGTTCAG SEQ ID:8 #3 Anchor*:
GTCAGTTAGCCTTGCCTTTGTTCAG SEQ ID:9 Linker**
ACCATGTAGTTGAGGTCAATGAAGGGCGCTCCCACAACGCT SEQ ID:10 CGACCGGCG RNA
mimic (mouse GAPDH): CCTTCATTGACCTCAACTACATGGTGATACTGAGTGGAGAA SEQ
ID:11 ACCTGCCAAGTATGATGAC Detector Oligonucloeotide***
GTCATCATACTTGGCAGGTTTCTCC SEQ ID:12 #4 Anchor*:
GAACCGCTCGCGTGTTCTACAGCCA SEQ ID:13 Linker**
CTACCGAGCAAACTGGAAATGAAATTGGCTGTAGAACACGC SEQ ID:14 GAGCGGTTC RNA
mimic (mouse L32 protein): ATTTCATTTCCAGTTTGCTCGGTA-
GGATACTGAGTGAGTCA SEQ ID:15 CCAATCCCAACGCCAGGCT Detector
Oligonuc1oeotide*** AGCCTGGCGTTGGGATTGGTGACTC SEQ ID:16 #5 Anchor*:
CTCGTTCCGCGTCCGTGGCTGCCAG SEQ ID:17 Linker**
CTGGCAGCCACGGACGCGGAACGAG SEQ ID:18 #6 Anchor*:
CGGTCGGCATGGTACCACAGTCCGC SEQ ID:19 Linker**
GCGGACTGTGGTACCATGCCGACCG SEQ ID:20 #7 Anchor*:
GCGCGCCGCGTTATGCATCTCTTCG SEQ ID:21 Linker**
CGAAGAGATGCATAACGCGGCGCCG SEQ ID:22 *Anchors were synthesized with
C12 spacer with amide at the 5' end **Linkers were synthesized with
Cy5 attached at the 5' end ***Detector Oligonucleotides were
synthesized with biotin attached at the 5' end
[0227] To each well either one linker or a mixture of linkers (as
indicated in the figure) was added in bulk. (To the well marked
"all" was added a mixture of all seven linkers.) Following
incubation and washing in 5.times.SSP 3 times, the fluorescence
picture shown on the right portion of the figure was taken with a
Tundra imager (IRI, St. Catherines, Ontario). As can be seen, the
linkers self-assembled to the surface, by specifically associating
with their complementary anchors.
[0228] This process is repeated except that eight different anchors
are dispersed in each well and linkers subsequently preferentially
associated therewith. The entire process is repeated with 36, 64
etc. different anchors in each well of a 24, 96, 384, 864 or 1536
well plate.
Example 2
Binding Kinetics (see FIG. 11)
[0229] The rate of hybridization of Cy5-derivatized linker number 1
to its complementary attached anchor is shown, for different
concentrations of linker. The generic MAPS plate was prepared as
for FIG. 1, except anchor 1 was attached at four spots per well.
Incubations were done at room temperature in 5.times.SSP with 0.1%
tween-20, wells were washed 3 times with 5.times.SSP, and bound
fluorescence was measured. A fluorescence picture of the plate was
taken with the Tundra, and background was subtracted and the
integrated intensity of each spot within each well was calculated
with Tundra software. Plotted is the average and standard deviation
for the integrated intensity for the four spots within each of two
duplicate wells.
Example 3
Fluorescent Linker
[0230] A generic MAPS plate is produced with one anchoring
oligonucleotide spotted to either 1 spot per well (top two rows), 4
spots per well (next four rows) or 16 spots per well (lower two
rows), according to the methods discussed above. To each well
complementary, fluorescently labeled, linker is attached by the
preferred protocol described in Example 1. Following washing the
fluorescence picture of the plate is taken with the Tundra. The
amount of fluorescence at each spot reports how much functional
linker is available to hybridize to target. The amount of signal
detected at repeated spots is highly reproducible.
Example 4
Binding Curves
[0231] To the plate prepared as described in Example 3, is added
different concentrations of a target oligonucleotide. The linker
that has been associated contains a 25-mer sequence complementary
to a portion of the target. The target is added in 5.times.SSC with
0.05% SDS in a total volume of either 30 or 100 microliters, and
the plate is covered and incubated at 50.degree. C. overnight.
Following hybridization of the target to the attached linker, the
target is visualized by a preferred protocol using
chemiluminescence. A biotinylated detector oligonucleotide,
containing a 25-mer sequence complementary to a separate portion of
the target (not to the same portion complementary to linker) is
added at 30 nM. Biotinylated detector can be added for 30 minutes
after washing away excess unattached target, or it can be added
along with target for the length of the overnight hybridization.
Following attachment of detector, the surface is washed twice with
5.times.SSC, once with 1.times.SSP containing 0.1% Tween-20 and 1%
PEG (SSPTP), and a 1:50,000 dilution of 250 ug/ml Horse Radish
Peroxidase conjugated to Streptavidin (HRP:SA, from Pierce,
Rockford, Ill.) is added for 5 hours in SSPTP at room temperature.
Wells are washed four times with SSPTP, and washed once and then
incubated with Super Signal Ultra reagent (Pierce). After a few
minutes, pictures of luminescence are collected with the Tundra
imager, e.g., the picture can accumulate within the CCD array for
five minutes. Low levels of target can be visualized in some wells
at a target concentration of as little as .about.5.times.10.sup.-13
M; the amount of signal generally becomes saturated at a target
concentration of .about.10.sup.-10 M. The amount of signal detected
at repeated spots is highly reproducible.
Example 5
Assay of Two Oligonucleotides (see FIG. 12)
[0232] A binding curve demonstrating a MAPS hybridization assay
using the preferred protocol discussed above for two different
target oligonucleotides is shown. A generic MAPS plate was prepared
with four different anchoring oligonucleotides each spotted four
times within each well. For the second and fourth anchor,
complementary linker oligonucleotides were self-assembled onto the
surface as described. Two targets were added at the concentrations
shown in 40 microliters to each well as described, and incubated at
50.degree. C. overnight. The amount of each target attached was
visualized by attaching biotinylated detection oligonucleotide
specific for each target followed by HRP:SA and chemiluminescence
imaging as described. In the lower panel the intensity of the image
is quantified. Software that is part of the Tundra Imager package
was used to scan the intensity of the images along lines between
the arrows shown in the upper panel. At the lowest concentration of
target, 1.1 pM, the scanned images show well-defined gaussian peaks
at each spot, while there are no discernable background peaks seen
in the left-most sample, at 0 concentration of target.
Example 6
Sensitivity Shifting (see FIG. 13)
[0233] A MAPS hybridization assay can be used for measuring the
concentration of a set of oligonucleotides, by binding them to a
surface and labeling them. This works well for those
oligonucleotides which are at modest or low concentration. Two
samples can be distinguished in such a case because if one sample
contains more oligonucleotide, more will bind. On the other hand,
if the concentration of targeted oligonucleotide is saturating for
the surface (i.e. if it is high enough to occupy all binding
sites), then if the concentration goes up no more can bind, so the
amount cannot be measured. However, the binding curve of a target
can be shifted by adding unlabeled competing ligand.
[0234] Binding data are obtained for four different oligonucleotide
targets, all of which saturate the surface (i.e. reach maximal
binding) at roughly 3 nM. By adding unlabeled competitive targets
to all wells, the binding of labeled oligonucleotide is shifted, so
that less binds at the lower concentration, and the level at which
saturation occurs is moved up. One can add competitive
oligonucleotides for, say, targets 1 and 3 but not 2 and 4. This
shifts the sensitivity of the assay only for targets 1 and 3. In
this way oligonucleotide targets of widely different concentrations
can be measured within one assay well, if the relative amount of
oligonucleotide expected is known.
[0235] The data can be quantified as explained above for the
binding of one of the oligonucleotide targets. FIG. 13 shows
quantitatively that including competitive oligonucleotide in the
assay shifts the binding curve used to assay for this target to
higher concentrations.
Example 7
Melting Temperature of Four Probes (see FIG. 14)
[0236] The amount of four different fluorescent labeled linker
oligonucleotides specifically hybridized to anchor oligonucleotides
by the MAPS assay is plotted as the temperature is raised. The four
oligonucleotides were first allowed to hybridize at 50.degree. C.
for 1 hour at 300 nM. Then the wells were washed with SSC without
probes, and the amount bound was measured as above by fluorescence
(50.degree. C. point). Then the surface was incubated at 55.degree.
C. for 30 minutes and the fluorescence bound measured, and so on
for all temperatures presented.
Example 8
Detection Methods
[0237] Two detection methods can be compared directly. To a MAPS
plate with four oligonucleotide anchors attached, each at four
spots per well, are added two oligonucleotides to each well, with
both including a covalently attached cy5 moiety or both containing
a biotin group. The epi-fluorescence measurement is performed as
described for viewing and measurement of the fluorescent linker.
The chemiluminescence measurements are performed as described for
the MAPS assay using subsequent addition of HRP:SA and a
chemiluminescence substrate. The signals generated are roughly of
the same magnitude. However, for the geometry of the microplates,
which contain walls separating each well, and occasional bubbles of
liquid or a miniscus of fluid, reflections in the epi-fluorescence
images can cause interference in data interpretation.
Example 9
Chemiluminescence Products
[0238] Two products available as chemiluminescence substrates for
horse radish peroxidase can be compared as detection procedures for
the MAPS assay. A MAPS plate is prepared as for Example 8, and
incubated with biotinylated linker oligonucleotides. Then either
alkaline phosphatase coupled to streptavidin (AlkPhos:SA) or HRP:SA
is added, followed by washing and addition of either CDP-Star
(Tropix) to the wells with AlkPhos:SA or ECL-Plus to the wells with
HRP:SA. Labeling with SA derivatized enzymes and substrates is as
suggested by the manufacturers for use in labeling of western
blots. These two (as well as other available substrates) can both
be used to assess oligonucleotide hybridization to MAPS plates.
Example 10
Resolution at 0.6 mm
[0239] The resolution of the current system for MAPS assay is
tested by preparing a MAPS plate with four different
oligonucleotide anchors per well each spotted four times per well,
with a pitch (center-to-center spacing) of 0.6 mm. Then either
cy5-derivatized linkers or biotinylated linkers are hybridized and
detected and scanned as above. For the epi-fluorescence measurement
the resolution is higher (and pitch could likely be reduced). For
the chemiluminescence detection procedure neighboring spots are not
completely separated, yet at this spacing individual peaks may be
resolved unambiguously by computer deconvolution.
Example 11
Test Nuclease Protection Protocol
[0240] In an assay to test for the optimal conditions for
hybridization and nuclease treatment for the nuclease protection
protocol, the Nuclease Protection Assay kit from Ambion (Austin,
Tex.) is used to provide conditions, buffers and enzymes. Eight
samples are prepared in one of three buffers. Hyb Buff 1 is 100%
Hybridization Buffer (Ambion); Hyb Buff 2 is 75% Hybridization
Buffer and 25% Hybridization Dilution Buffer (Ambion); and Hyb Buff
3 is 50% of each. A 70-mer oligonucleotide that contains 60
residues complementary to a test mRNA is synthesized (Biosource
International, Camarillo, Calif.) and labeled with
Psoralen-fluorescein (Schleicher and Schuell, Keene, N H) following
the protocol as suggested for labeling of Psoralen-biotin by
Ambion. Briefly, protection fragment is diluted to 50 ug/ml in 20
.mu.ls of TE buffer(10 mM Tris, 1 mM EDTA, pH 8) boiled for 10
minutes, and rapidly cooled in ice water. Four .mu.ls of 130 ug/ml
Psoralen-fluorescein in DMF is added, and the sample is illuminated
for 45 minutes at 40.degree. C. with a hand-held long wavelength UV
source. Free Psoralen-fluorescein is removed by extraction with
saturated butanol. The mRNA used is GAPDH anti-sense mRNA, prepared
from antisense plasmid (pTRI-GAPDH-Mouse antisense Control Template
from Ambion) using T7 promoter and the MaxiScript kit (Ambion). The
short protection fragment is the 60-mer complementary portion
synthesized separately and similarly labeled. The sequences of the
protection fragments are as follows:
2 Full length protection fragment: CGAGAAATATGACAACTCACTCAA-
GATTGTCAGCAATGCAT SEQ ID:23 CCTGCACCACCAACTGCTTGCTTGTCTAA Short
protection fragment: CGAGAAATATGACAACTCACTCAAGATTGTCA- GCAATGCAT
SEQ ID:24 CCTGCACCACCAACTGCTT
[0241] Hybridizations are done by mixing protection fragments at 20
nM and GAPDH mRNA at 60 nM in 10 .mu.ls final volume for two hours
at 22.degree. C. or 37.degree. C. Following hybridization, 200
.mu.ls of a mixture of nucleases is added according to instructions
from the manufacturer (Ambion Nuclease Protection Kit, 1:200
dilution of nuclease mixture) and incubated again at the same
temperatures for 30 minutes. Hydrolysis is stopped with
Hybridization Inhibition Buffer (Ambion), and oligonucleotides are
pelleted and washed with Ethanol. 10 .mu.ls of 1.times.Gel Loading
Buffer (Ambion) is added and oligonucleotides are separated on a
15% TBE-urea gel. The gel is swirled in running buffer for 30
minutes, put on a plastic plate and imaged with the Tundra using
fluorescein filters for selecting excitation and emission
wavelengths. The image is accumulated on the CCD array for 2
minutes. Best conditions are those for samples incubated in Hyb
Buff 2 at 37.degree. C. or in Hyb Buff 3 at 22.degree. C. In these
samples no detectable full-length protection fragment remains, and
significant amounts of a portion of the full-length protection
fragment at a size apparently the same as the short protection
fragment are seen.
Example 12
mRNA Assay by NPA-MAPS. (see FIG. 15)
[0242] The full NPA-MAPS protocol was used, with conditions for
hybridization and nuclease treatment similar to those described in
Example 11. Ten samples were run for the assay. All contained the
same amount of the 70-mer oligonucleotide protection fragment and
different amounts of GAPDH mRNA. Hybridization samples in 10 .mu.ls
in 50% Hybridization Buffer and 50% Dilution Buffer containing 0.08
mg/ml Yeast RNA (Ambion) were heated to 90.degree. C. for 6
minutes, briefly centrifuged, heated to 70.degree. C. for 5
minutes, and allowed to cool to 19.degree. C. and incubated for 19
hours. 200 .mu.ls of nuclease mixture was then added to each sample
for 30 minutes at 19.degree. C. 60 .mu.ls was aliquoted from each
sample for the MAPS assay. 2 .mu.l of 10 N NaOH and 2 .mu.l of 0.5
M EDTA was added, and the sample heated to 90.degree. C. for 15
minutes, 37.degree. C. for 15 minutes, and allowed to sit at room
temperature for 20 minutes. Then samples were neutralized with 2
.mu.l of 10 M HCl, and 12 .mu.ls of 20.times.SSC containing 2 M
HEPES pH 7.5 and 200 nM biotinylated detector oligonucleotide
specific for the protection fragment was added along with 1 .mu.l
of 10% SDS. Samples were mixed, heated to 80.degree. C. for 5
minutes, and two 35 .mu.l aliquots of each sample were pipetted to
two wells of a MAPS plate (each sample was split in two and run in
duplicate on the MAPS plate). The plate had been prepared as for
standard MAPS protocol, with self-assembled CY5-derivatized linker
specific for the protection fragment already attached. The MAPS
plate was covered and incubated at 50.degree. C. overnight, and
detection and luminescence performed as described. In the last
sample, no nucleases were added during the assay as a control to
visualize how the protection fragment alone would be detected by
MAPS. In the lower portion of the figure, the intensity scan (as
analyzed by the imager) for the top row of wells is presented. The
amount of GAPDH mRNA present in the sample (that is, the amount in
each duplicate well after aliquoting to the MAPS plate) is listed
in the figure.
[0243] The oligonucleotides used for the MAPS plates were as
follows:
3 Anchor*: CGCCGGTCGAGCGTTGTGGGAGCGC SEQ ID:25 Linker**
CTTGAGTGAGTTGTCATATTTCTCGGATACTGAGTGCGCTC SEQ ID:26
CCACAACGCTCGACCGGCG Protection fragment (complementary to mouse
antisense mRNA for GAPDH) CGAGAAATATGACAACTCACTCAAGATTGTCAGCAATGCAT
SEQ ID:27 CCTGCACCACCAACTGCTTGCTTGTCTAA Detector
Oligonucloeotide***- labeled at 5' end with biotin
AAGCAGTTGGTGGTGCAGGATGCAT SEQ ID:28 *Anchors were synthesized with
C12 spacer with amide at the 5' end **Linkers were synthesized with
Cy5 attached at the 5' end ***Detector Oligonucleotides were
synthesized with biotin attached at the 5' end
Example 13
Dilution Curve, NPA-MAPS (see FIG. 16)
[0244] The data discussed in Example 12 and shown in FIG. 15 were
quantified and plotted as a dilution curve. The average and
standard deviations for all eight spots of the two duplicate wells
are plotted for each concentration of mRNA. A binding curve is
superimposed, of the form:
Fraction Bound=Max Bound*1/(1+IC.sub.50/L)
[0245] where Max Bound is the maximum bound at saturation, Fraction
Bound is the amount bound at ligand concentration, L, and the
IC.sub.50 is the concentration of ligand at which the Fraction
Bound is half of Max Bound. The curve is shown as red dots on the
figure, drawn with a best fit value of IC.sub.50=4.2 femtomoles as
labeled in the figure.
Example 14
NPA-MAPS Assay of GAPDH mRNA in a Total Mouse Liver RNA Extract
[0246] A total mouse RNA extract is assayed for GAPDH mRNA with an
NPA-MAPS assay and a dilution curve is made. Total RNA from mouse
liver is prepared using a Qiagen kit. RNA is precipitated in 70%
EtOH with 0.5 M Mg-Acetate, and resuspended in 10 .mu.ls of
5.times.SSC with 0.05% SDS with 1.8 nM protection fragment. The
protection fragment added is an oligonucleotide 70 bases long, 60
bases of which are complementary to mouse GAPDH. Either a fragment
complementary to mouse GAPDH mRNA is used ("protection fragment"),
or the complement of the sequence is used as a negative control
[0247] ("antisense fragment").
[0248] RNA samples with protection fragments are heated to
90.degree. C. for 5 minutes, and hybridizations are done by
bringing samples to 70.degree. C. and allowing them to cool slowly
to room temperature over night. S1 nuclease (Promega) at 1:10
dilution is added in 30 .mu.ls of 1.times.S1 Nuclease Buffer
(Promega) for 30 minutes at 19.degree. C., and stopped by 1.6
.mu.ls of 10 N NaOH and 2.7 .mu.ls of 0.5 M EDTA. Samples are
heated to 90.degree. C. for 15 minutes and then 37.degree. C. for
15 minutes to denature and destroy RNA, neutralized with 1.6 .mu.ls
of 10 M HCl, and incubated on MAPS plates overnight in 5.times.SSC
with 0.05% SDS supplemented with 200 mM HEPES pH 7.5 to which 30 nM
biotinylated detection oligonucleotide is added. Washing and
visualization with SA-HRP is done as described. The amount of
signal decreases in parallel with decreasing amounts of mouse RNA
(samples include 500, 170, 50, 5, or 0.5 .mu.g of total mouse RNA.
Two control samples are included to which no S1 nuclease is added.
Signal is seen only for the complementary protection fragment.
[0249] Oligonucleotides used:
4 For Antisense Control (same oligonucleotides as for example 12):
Anchor*: CGCCGGTCGAGCGTTGTGGGAGCGC SEQ ID:25 Linker**
CTTGAGTGAGTTGTCATATTTCTCGGATACTGAGT- GCGCTC SEQ ID:26
CCACAACGCTCGACCGGCG Protection fragment (complementary to mouse
antisense mRNA for GAPDH) CGAGAAATATGACAACTCACTCAAGATTGTCAGCAATGCAT
SEQ ID:27 CCTGCACCACCAACTGCTTGCTTGTCTAA Detector
Oligonucloeotide*** AAGCAGTTGGTGGTGCAGGATGCAT SEQ ID:28 For Sense
GAPDH mRNA samples: Anchor*: CGCCGGTCGAGCGTTGTGGGAGCGC SEQ ID:25
Linker** ATGCATCCTGCACCACCAACTGCTTGATACTGAGTGCGCTC SEQ ID:29
CCACAACGCTCGACCGGCG Protection fragment (complementary to mouse
mRINA for GAPDH): AAGCAGTTGGTGGTGCAGGATGCA- TTGCTGACAATCTTGAG SEQ
ID:30 TGAGTTGTCATATTTCTCGGCTTGTCTAA Detector Oligonucleotide***
CGAGAAATATGACAACTCACTCAAG SEQ ID:31 *Anchors were synthesized with
C12 spacer with amide at the 5' end **Linkers were synthesized with
Cy5 attached at the 5' end ***Probes were synthesized with biotin
attached at the 5' end
Example 15
A Nuclease Protection MAPS Assay with Controls
[0250] mRNA is extracted from mouse liver and nuclease protection
is performed essentially as described in Example 14, except that
the GADPH specific protection fragment comprises 60 nucleotides
which are complementary to mouse GAPDH, followed by 15
"overhanging" nucleotides at the 3' end of the fragment which are
not complementary to the target. After hybridization and nuclease
digestion the remaining protection fragment is hybridized to a MAPS
plate as indicated in Example 14, except that two different
oligonucleotide detection fragments are used to detect the
immobilized protection fragment. One detection fragment is
complementary to the GAPDH-specific portion of the protection
fragment, and the other, a control, is complementary to the 15 base
overhang portion of the protection fragment. Each detection
fragment is used on different replicate samples (i.e., in different
wells), so that both detection fragments can be labeled with the
same detection molecule. In the present example both fragments are
labeled with HRP. Without the addition of nuclease, signals from
both of the detection fragments are seen; whereas, when nuclease
digestion is performed only the signal corresponding to the GAPDH
sequences can be detected. The amount of GAPDH-specific signal is
reduced relative to that observed in the absence of nuclease
digestion, because the protection fragment is added at excess
relative to the amount of GAPDH mRNA present. This allows the
amount of GAPDH mRNA to be limiting to the protective
hybridization, so that the amount of double-stranded hybrid formed
(and therefore the amount of protection fragment that is protected
from the nuclease) reflects the amount of mRNA. When no mRNA is
included in the reaction mixture, neither signal can be detected
when nucleases are added. The above findings demonstrate that the
hybridization and digestion steps of the assay occurred as
desired.
[0251] When protection fragments corresponding to a variety of
targets are included in a given assay, each of the protection
fragments can comprise the same 15 base overhang portion. This
allows for one detection fragment to be used to test for remaining
overhang for all samples.
Example 16
A Transcription Assay Screening for Compounds that May Alter the
Expression of Genes that are Correlative with a Disease State
[0252] A cell line derived from a human tumor is used. It is found
to express 30 genes at higher levels than do normal cells. (That
is, these 30 genes are being used more than in normal cells, to
make mRNA and then to make the protein for which the genes are the
instructions. A transcription assay measures how much the genes are
being used by measuring how much mRNA for each gene is present.)
Using a nuclease protection assay on MAPS plates (NPA-MAPS), 8800
chemical compounds are tested to see if growing the cells in the
presence of the compounds can reduce the expression of some of the
30 correlative genes without affecting the expression of six normal
(constitutive, "housekeeping") genes. Any compounds having that
effect might be useful in the future development of drugs for
treating this kind of tumor.
[0253] About 10,000 to 100,000 cells are added to each well of 100
96-well polystyrene plates and the cells are grown for 2 days until
they cover the surface of each well. For 8 wells of each plate, the
cells are left to grow without additions. To the remaining 88 wells
of each plate, a different chemical compound is added so that the
effect of it alone can be tested. For the 100 plates used at one
time, 8800 compounds can be tested or screened. The cells are grown
for 24 hours in the presence of the compounds, and then the cells
are harvested for assay. The cells in each plate are treated
according to the instructions for preparing RNA in samples from
96-well plates (for example according to the Qiagen RNeasy 96 kit).
After the RNA is prepared, the amount of each of 36 different mRNA
species is quantified by the NPA-MAPS approach, including the 30
correlative genes and 6 normal "housekeeping" genes. 36 DNA
oligonucleotide protection fragments, each corresponding to one of
the genes of interest, are added to each well and allowed to
hybridize under selected stringent conditions to their target mRNA
sequences. Then S1 nuclease is added to destroy excess unhybridized
DNA, and the samples are treated chemically to destroy the RNA as
well. Left is the oligonucleotide protection fragment for each of
the 36 genes in proportion to how much mRNA had been present in the
treated cells for each sample.
[0254] One hundred 96-well plates, each of which comprises an array
of a plurality of 36 different anchor oligonucleotides in each
well, are prepared by adding to each well 36 different linker
oligonucleotides. The linkers self-assemble on the surface of each
well, converting the generic plates to MAPS plates comprising
specific probes for each of the 36 oligonucleotide protection
fragments. Each linker has a portion specific for one of the 36
anchors and a portion specific for a segment of one of the 36
protection oligonucleotides. The oligonucleotide sample from each
well of the 100 sample plates is added to a corresponding well of
the 100 MAPS plates. After hybridization under selected stringent
conditions, a detection oligonucleotide for each target with a
chemiluminescent enzyme attached is added, so that each specific
spot of each well lights up in proportion to how much mRNA had been
present in the sample. Any wells that show reduced amounts of
correlative genes with no effect on the 6 house keeping genes are
interesting. The compounds added to the cells for those samples are
possible starting points to develop anti-tumor agents.
Example 17
Induced and Constitutive Gene Expression
[0255] RNA was prepared essentially as described in Example 14,
from the livers of mice either not infected ("Control") or one hour
after infection ("Infected") by adenovirus. 60 .mu.gs of liver RNA
was used for each sample, and samples were prepared in duplicate.
Each assay well contained three sets of duplicate loci,
corresponding to the three genes described above. Each locus
contained an anchor, bound to a linker comprising a probe which was
complementary to a protection fragment corresponding to one of the
three genes. A nuclease protection MAPS assay was performed
essentially as described in FIG. 12, and the images were collected
and scanned as described. Shown are the raw image data collected
and the intensity scans for duplicate wells for each of the three
mRNA targets. The numbers over the scan lines are the integrated
intensity values and standard deviations for each condition (n=4).
The house-keeping gene, GAPDH, not expected to change, showed a
modest increase of 1.3-fold in the infected sample that was not
statistically significant. The transcription of MIP-2 and c-jun was
increased 4 and 6-fold, respectively. These findings demonstrate
that two genes, MIP-2 and c-jun, exhibit enhanced expression in
response to adenovirus infection, compared to a control,
constitutively expressed gene--GAPDH.
Example 18
An Enzyme Assay Screening for Compounds that Selectively Inhibit
Tyrosine or Serine Kinases (see FIG. 17).
[0256] Kinases are enzymes that attach a phosphate to proteins.
Many have been shown to stimulate normal and neoplastic cell
growth. Hence, compounds that inhibit specific kinases (but not all
kinases) can be used to test whether the kinases are involved in
pathology and, if so, to serve as starting points for
pharmaceutical development. For example, five tyrosine kinases that
are involved in stimulating cell growth or in regulating the
inflammatory response are src, Ick, fyn, Zap70, and yes. Each
kinase has substrates that are partially identified, as short
peptides that contain a tyrosine. Some of the kinase specificities
overlap so that different kinases may phosphorylate some peptides
equally but others preferentially. For the five kinases, 36 peptide
substrates are selected that show a spectrum of specific and
overlapping specificities.
[0257] One hundred 96-well plates are used; each well comprises 36
generic oligonucleotide anchors. 36 linkers are prepared to convert
the generic oligonucleotide array (with anchors only) to arrays
comprising peptide substrates. The 36 peptide substrates are
synthesized and each is attached covalently through an amide bond,
for example, to an oligonucleotide containing a 5' amino group. The
oligonucleotides contain sequences that hybridize specifically to
the anchors. The peptide/oligo linkers are self assembled on the
surface by adding them to all wells of the MAPS plates.
[0258] For screening, the five kinases at appropriate
concentrations (so that the rates of phosphorylation of the
substrates are balanced as much as possible) are added to each well
along with one of 8800 different compounds to be tested. The
compounds are tested for their ability to directly inhibit the
isolated enzymes. The amount of phosphorylation of each arrayed
peptide is detected by adding labeled antibodies that bind only to
peptides that are phosphorylated on tyrosine. Any wells that show a
reduction in some of the phospho-tyrosine spots but not all of the
spots are interesting. Compounds that had been added to those wells
can be tested further as possible selective inhibitors of some of
the kinases tested.
[0259] The scheme of the assay is shown in the top panel of FIG.
17. A chimeric linker molecule is prepared in which a 25 base pair
oligonucleotide complementary to one of the anchors is crosslinked
to a peptide substrate of a tyrosine phosphokinase enzyme. The
chimeric oligo-peptide substrate self-assembles onto an array of
oligonucleotide anchors, the kinase enzyme is used to phosphorylate
the peptide portion of the chimera, and after the enzyme reaction
is allowed to proceed, the amount of phosphorylation of the peptide
is determined by anti-phoshotyrosine or anti-phosphoserine
antibodies with an attached detection fluorophore or enzyme.
[0260] The results of the assay are shown in the lower panel. The
homobifunctional crosslinker, DSS (Pierce), was used to attach the
5' amino group of an oligonucleotide linker to the N terminus of a
peptide synthesized with a phosphorylated tyrosine. The sequence of
the peptide in single-letter code was: TSEPQpYQPGENL (SEQ ID: 32),
where pY represents phosphotyrosine. The chimera was either used
directly or first 10 brought to pH 14 for 60 minutes in order to
partially hydrolyze the phosphate group from the tyrosine. The
phosphorylated or partially dephosphorylated chimeric molecules
were self-assembled onto complementary anchor molecules within a
MAPS plate at the concentrations shown for one hour. After washing
and blocking the wells with 0.3% BSA in SSPTP antiphosphotyrosine
antibody crosslinked to HRP (antibody 4G10 from Upstate
Biotechnology, Lake Placid, N.Y.) was added at a 1:3000 dilution in
SSPTP for one hour, and the amount of antibody attached detected
with chemiluminescence substrate, Super Signal Blaze. The image
shown was accumulated on the CCD array for 1 minute. As expected a
difference was seen in the amount of phosphate attached to the
oligo-peptide. This difference is the basis for an assay measuring
how active a series of kinases is when treated with different
possible inhibitors.
Example 19
A Binding Assay for the Detection of Selective Inhibitors of the
Interaction Between SH2 Domains and Phosphorylated Peptides
[0261] SH2 domains serve as docking subunits of some growth
regulatory proteins. The domains bind to phosphotyrosine containing
proteins or peptides with imperfect specificity. That is, some
phosphotyrosine peptides bind specifically to one or to few SH2
proteins while others bind widely to many SH2 proteins.
[0262] For this assay, the linkers are phosphorylated peptides
covalently attached to oligonucleotides. The peptide moieties are
selected for their ability to bind to a group of selected SH2
proteins. The linkers convert generic MAPS plates to plates with
ligands specific for the group of SH2 proteins. 100 96-well MAPS
plates bearing the ligands are generated. The proteins are isolated
and labeled with, for example, a cy5 fluorescent molecule.
[0263] In order to screen for inhibitors of the SH2
domain/phosphopeptide interaction, the group of labeled SH2
proteins is added to each well of the 100 96-well MAPS plates, and
in each well a different test compound is added. Hence the effect
of each compound individually on the interaction of the SH2
proteins with their phosphopeptide ligands is tested. The assay is
to measure the fluorescence of bound SH2 protein associated with
each surface-bound peptide linker. For any well showing reduced
fluorescence at some spots but not all spots, the compound added
can be further tested as a putative selective inhibitor of SH2
docking.
Example 20
High Throughput Screening (see FIG. 22)
[0264] Shown is a high throughput MAPS plate demonstrating the
detection of signal from 96 wells in a single experiment.
Hybridization to the same oligonucleotide was measured with 16
replicates in 80 wells. As shown, the reproducibility of the 1280
hybridization assays was very high. The left-most and right-most
columns served as controls to standardize the signal for different
concentrations of the oligonucleotide.
[0265] In a similar fashion, 16 different oligonucleotides can be
tested in each well, and the test repeated in the 80 different
wells of the plate. Of course, an even greater number of different
oligonucleotides or other probes, (e.g., 100 nucleotide probes) can
be assayed in each well, and many plates can be tested
simultaneously (e.g., 100 plates, such as 96-well microtiter
plates). The large number of assays which can be performed on each
sample (e.g., in the latter case, about 100 different assays) and
the large number of samples which can be assayed simultaneously
(e.g., in the latter case, about 96.times.100, or 9600 different
samples) provides for very high throughput.
Example 21
Preparation of Amplified Target (see FIG. 23)
[0266] A PCR primer (Primer One) is attached to a solid support
(e.g., a bead or a reaction vessel) via a chemical modification
that has been introduced at the 5' terminus of the primer
oligonucleotide. The primer comprises, 5' to 3', the chemical
modification, a restriction enzyme site, and a sequence that is
complementary to a target of interest (e.g., a cDNA copy of an mRNA
of interest). The target is amplified by PCR, using as PCR primers
the attached Primer One plus a Primer Two, which comprises, 5' to
3', a sequence that is specific for a detector oligonucleotide and
a sequence that is complementary to a different portion of the
target than that of Primer One. Following PCR amplification, the
amplified target DNA is washed to remove excess reaction material
and is released from the solid support by cleavage with a
restriction enzyme specific for the restriction site on Primer One.
The amplified primer is thus released into the liquid phase.
Thermal and/or chemical procedures can be used to deactivate the
restriction enzyme and to denature the double stranded DNA product.
The released, single stranded DNA target molecules can then be
contacted with a surface comprising anchors and/or linkers, and the
target can be detected using detector oligonucleotides
complementary to the detector-specific sequences of Primer Two.
Example 22
Preparation of Amplified Target
[0267] A PCR primer (Primer One) is attached to a solid support
(e.g., a bead or a reaction vessel) via a chemical modification
that has been introduced into the 5' terminus of the primer
oligonucleotide. The primer comprises, 5' to 3', the chemical
modification, a peptide sequence which can be cleaved by a
protease, and a sequence which is complementary to a target of
interest (e.g., a cDNA copy of an mRNA of interest). Instead of a
peptide, any other element which can be cleaved specifically can
also be used. Following PCR amplification as described, e.g., in
Example 21, the PCR product, still attached to the solid support,
is denatured and (optionally) washed, leaving behind a single
stranded molecule attached to the support. The washed, attached,
molecule can then be cleaved and released (e.g., by treatment with
an appropriate protease), and contacted with a surface comprising
anchors and/or linkers. Alternatively, the strand of the amplified
target which is released following denaturation can be contacted
with the surface comprising anchors and/or linkers. In either case,
only one strand of the amplified target is contacted (e.g.,
hybridized) with a linker, so competition for hybridization from
the opposite strand of the amplified target is eliminated and
background is reduced. Linkers can be designed to be specific for
either, or both, of the amplified target strands.
Example 23
Assay with Detection Linkers and Reporter Agents (See FIG. 24)
[0268] A sample comprising an mRNA of interest is subjected to a
nuclease protection procedure, using as a protection fragment an
oligonucleotide which comprises a target specific moiety and a
control overhang moiety, which is not complementary to the mRNA.
Following nuclease digestion, the control overhang moiety can be
cleaved off, as desired, as is illustrated in the left portion of
the figure; or the overhang can fail to be digested, as is
illustrated in the right portion of the figure. The resulting
nuclease protection fragments are hybridized to a detection linker,
which comprises a target-specific moiety and a control
overhang-specific moiety. In the assay shown in the left part of
the figure, the control overhang moiety of the detection linker
remains unhybridized; by contrast, in the assay shown in the right
part of the figure, the control overhang moiety of the detection
linker hybridizes to the residual control overhang sequence of the
protection fragment. In a subsequent step of the assay, a reporter
reagent, which comprises a moiety that can interact with control
overhang-specific moiety of the detection linker, is allowed to
interact with the complexes. In the assay shown in the left part of
the figure, the reporter reagent hybridizes to the control
overhang-specific moiety of the detection linker, which remains
available for hybridization, and the complex can be detected by
virtue of the signaling entity on the reporter reagent. By
contrast, in the assay shown in the right part of the figure, the
reporter reagent is unable to bind to the complex because the
complementary sequences are not available for hybridization, so no
signal is associated with the complex.
[0269] In many of the assays of this invention, a reporter reagent
can interact with any sequence present in a detection linker, not
limited to a sequence specific for a control overhang.
Example 24
Multiple Fluors (See FIG. 25)
[0270] A region comprising five loci, A-E, is shown in FIG. 25.
Each locus comprises a different group of substantially identical
anchors, anchors A-E. To the anchors at locus A are hybridized four
different types of linkers, each of which comprises a moiety
specific for anchor A. However, each of the anchors comprises a
different target-specific moiety: for targets 1, 2, 3 or 4.
Therefore, after hybridization of targets to the anchor/linker
complexes, targets 1, 2, 3, and 4 can all become localized at locus
A. Similarly, four different types of linkers can hybridize to
locus B. Each linker comprises a moiety specific for anchor B, but
the target-specific moieties are specific for targets 5, 6, 7 or 8.
In a similar fashion, targets 9-12 can become associated with locus
C, targets 13-16 at locus D, and targets 17-20 at locus E. If each
of these targets is labeled, either directly or indirectly, with a
different, independently detectable fluor, such as, e.g., an
upconvertable phosphore, one can independently detect all 20
targets at the five indicated loci.
Example 25
An Assay in High Throughput Format
[0271] In this example, a transcription assay of the invention is
used to detect and quantify changes in a gene expression pattern,
in a format ready for high throughput screening. All steps in the
assay are performed robotically. Routine washing steps are not
explicitly described. All reactions are carried out by conventional
procedures, which are known in the art and/or described herein.
[0272] THP-1 human monocytes are grown in 96-well V-bottom
microtiter plates, with 50,000 or 150,000 cells/well. The cells are
either untreated or are differentiated with phorbol 12-myristate
13-acetate (PMA) for 48 hours, followed by activation with
lipopolysaccharide (LPS) for four hours. Following treatment, the
cells are lysed in guanidinium isothyocyanate and frozen until
needed. mRNA is obtained using streptavidin-paramagnetic particles
to which is bound biotin-poly dT. Alternatively, total RNA is
obtained by extraction with tri-reagent (Sigma Chemical Co., St.
Louis, Mo.). Samples comprising either mRNA or total RNA are
subjected to a nuclease protection procedure, using as DNA
protection fragments a mixture of thirteen 60-mer single strand
oligonucleotides, each of which comprises, 5' to 3', a 25-mer
specific for one of the thirteen targets of interest (GAPDH, IL-1,
TNF-.alpha., cathepsin G, cox-2, cyclin-2, vimentin, LD78-.beta.,
HMG-17, osteopontin, .beta.-thromboglobin, angiotensin or actin); a
10-mer spacer; a 25-mer specific for a common oligonucleotide
detector probe; and a 15-mer common control overhang sequence. mRNA
is thereby converted into a stochiometric amount of "corresponding
DNA protection fragment," which is detected in the assay. Control
experiments in which these corresponding DNA protection fragments
are incubated with a probe specific for the control overhang
sequence show that substantially only sequences specific for the
mRNA targets of interest are present in the corresponding
protection fragments, as expected if nuclease digestion has
occurred as desired.
[0273] Surfaces are prepared according to the methods of the
invention. In each well of a 96-well DNA Bind Plate is placed an
array of sixteen different 25-mer oligonucleotide anchors. Fourteen
different anchor species are used. One anchor species is used at
three of the four corners of the array, and 13 different anchor
species are used, one each at the remaining locations in the array.
The anchors are then hybridized, in a defined orthogonal pattern,
to 60-mer oligonucleotide linkers, each of which comprises, 5' to
3', a 25-mer corresponding to one of the thirteen targets of
interest, a 10-mer spacer, and a 25-mer specific for one of the
anchors. Thus, in each of the multiply repeated 16-spot arrays,
each of the thirteen target-specific linkers is localized at a
defined position (locus) in the array. See FIG. 18 for an
illustration of such an orthogonal array. Linkers corresponding to
GAPDH, a constitutively expressed housekeeping gene which serves as
an internal normalization control, are represented at three loci
within each array. Control experiments indicate that the linkers,
as well as the protection fragments and detector oligonucleotides
used in the experiment, exhibit the desired specificity.
[0274] Samples comprising the mixtures of corresponding protection
fragments prepared as described above are hybridized to the
anchor/linker arrays. Samples derived from either untreated or
induced cultures are used. The presence and amount of hybridized
protection fragments at each locus is then detected by
hybridization to labeled detector oligonucleotides. In order to
normalize the amount of signal at each locus, the detector
oligonucleotides are diluted with appropriate amounts of blocked
oligomers, as described herein. The amount of signal at each locus
is processed and normalized to the control GAPDH signals. The data
obtained are reproducible in eight replicate samples, as well as in
samples prepared from three independent experiments, performed on
different days. A summary of the relative abundance of the thirteen
transcripts in one experiment is shown in the Table below.
5 Relative Intensity (10.sup.5 Cells/Well) Control Induced Gene
Average CV (n = 16) Average CV (n = 16) Ratio GAPDH 10110 7% 9833
9% 0.97 IL-1 527 36% 8124 38% 15.40 TNF 229 35% 2249 36% 9.80 GAPDH
9591 11% 10031 17% 1.05 Cathepsin G 10394 31% 19648 46% 1.89 COX-2
415 39% 3557 25% 8.58 Cyclin-2 1728 23% 2960 25% 1.71 Vimentin
25641 25% 71074 20% 2.77 LD78 1298 39% 13437 20% 10.35 HMG-17 8286
19% 2405 20% 0.29 Osteopontin 5604 42% 19053 46% 3.40
Thromboglobulin -53 -- 31761 23% >100 GAPDH 10299 13% 10136 12%
0.98 Angiotensin 3575 28% 6561 31% 1.84 Actin 12741 27% 21802 23%
1.71 (blank) 108 -- 234 --
Example 26
Computer Algorithm for Quantification of Multiple Array Plate
Data
[0275] A preferred algorithm finds the position of all spots for a
MAPS plate and automatically calculates a best-fit estimate of the
amplitude of the signal for each data point.
[0276] Preferably, the algorithm is implemented by a computer
program.
[0277] 1--Select a small part of the image data, a 40.times.40 box,
containing the intensity value of each pixel (picture element) of
the image that includes the first well to be examined.
[0278] 2--Define a function that calculates the intensity expected
at each pixel position, using 16 unknowns. The unknowns are:
[0279] The amplitudes of each of 13 different microarray spots
(that is, how bright are the real signals at each position of the
DNA array). There are 13 of these for the 4.times.4 (=16) spots
within each well because some of the 16 spots are duplicates of the
same target.
[0280] The x offset and the y offset defining the exact position of
the 4.times.4 array of spots within this particular well
[0281] The background intensity of the picture within the well.
[0282] The function for each pixel position calculates the distance
between the pixel and each spot, and adds up the contribution that
each spot makes to the intensity observed at that pixel, by
multiplying the spot amplitude by the impulse response function for
the given distance. For the images used the impulse response
function is defined by the sum of a Gaussian and a Lorentzian of
appropriate (constant) radii.
[0283] 3--Start the fitting for the current well by guessing the
values of the parameters quickly. To do this, calculate the average
image intensity for 16 regions of the picture where the spots are
expected to be. Subtract an offset from these 16 averages, and
scale the difference by a constant factor. The offset and scaling
constant are defined empirically. Rearrange the results to match up
the 16 spots with the 13 amplitudes. For the background and offets
use any small numbers.
[0284] 4--Optimize the fitted values (for the 16 unknowns) by curve
fitting. In particular use a non-linear least squares algorithm
with Marquadt procedure for linearizing the fitting function,
fitting 16 unknowns to 40.times.40=1600 equations (although of
course not all equations are linearly independent).
[0285] 5--Use the x,y offset as fitted for the current well to
estimate with improved precision where the grid will be for the
next well of the microplate. It is expected to be 9 millimeters
offset relative to the next neighbor well (converted to distance in
the number of pixels by the magnification factor of the imaging
system). Since the distance between wells is small relative to the
size of the plate, using local estimates of position is most
accurate.
[0286] 6--With the improved estimate of position, define a smaller
box of image for the next well, moving to a 30.times.30 box of
pixels. This makes the fitting proceed more quickly.
[0287] Go back to step 2 and repeat for each well.
Example 27
High Throughput Screening (See FIGS. 26 and 27)
[0288] FIG. 26 illustrates raw image data for an assay using
detection linkers and a single reporter reagent. The assay tests
the expression of 13 native mRNA species from 96 different cell
samples. Each well of a 96-well plate contains 10.sup.5 THP-1 cells
untreated (left half of the figure), or induced to monocytes with
PMA and LPS (right half).
[0289] The pattern of expression changes consistently. IL-1, TNF,
COX-2, Vimentin, LD78, Osteopontin, and beta-Thromboglobulin are
induced. Cathepsin-G, Cyclin-b, HMG-17 and Angiotensin are turned
off. GAPDH and Actin are unchanged. FIG. 27 presents the spatial
arrangement of genes for the THP-1 cells, along with two sample
wells of data (selected from FIG. 26).
[0290] The oligos used in this experiments are listed below. For
some targets, the intensity of signal is reduced by diluting the
detection linker with an incomplete detection linker
oligonucleotide, containing the 25 bases complementary to the
protection fragment but not containing the sequence complementary
to the reporter reagent. These incomplete oligos are referred to as
"attenuation factors."
[0291] Table 1 presents quantification of the raw data presented
above. This screening assay is done in high throughput fashion.
Cells are grown and treated in 96-well plates at an average of
10.sup.5 cells/well, the number of cells that can be conveniently
handled in microplates. An expression pattern for 13 genes is
measured in high throughput format, from small cell samples. The
results obtained using assay corroborate and extend the literature,
as summarized in Table 1. The assay can detect less than one copy
per cell. The literature references reflect observations
accumulated from a variety of related cell types, such as U-937
cells. The large differences seen between the Control and Induced
20 conditions result from the very low background signals for our
measurements. The use of detection linkers, allowing for only one
species of reporter reagent helps to reduce the background for the
assay. This is because the total concentration of HRP--containing
reporter reagent is much reduced.
6TABLE 1 Relative Abundance (RNA Molecules per cell.sup.+) MAPS
96-16 Format, 10.sup.5 Cells/Well Gene Control Induced Literature
GAPDH 30 .+-. *7% 30 .+-. 14% No Change IL1-beta **nd 684 .+-. 14%
Increase TNF 3.0 .+-. 40% 214 .+-. 23% Increase Cathepsin-G 53 .+-.
8% nd Decrease COX-2 nd 8.3 .+-. 23% Increase Cyclin-2 2.8 .+-. 11%
0.5 .+-. 46% No Change Vimentin nd 37 .+-. 33% Increase LD78-b nd
3360 .+-. 28% Increase HMG-17 336 .+-. 5% 33 .+-. 23% Decrease
Osteopontin nd 18 .+-. 23% Not Reported Thromboglobulin nd 66 .+-.
15% Increase Angiotensin 0.5 .+-. 18% 0.1 .+-. 66% Not Reported
Actin 79 .+-. 7% 43 .+-. 21% No Change .sup.+Estimated values,
assuming GAPDH was at 30/cell *% CV (Std Dev/Mean as a %) (n = 48)
**nd = not detectable
[0292] The oligos used in Example 27 with detection linkers and a
single probe are:
7 Fixed Probe: CACCTCCAAACAGTGAAGGAGAGCA (SEQ ID:33) (conjugated to
HRP) Target #1; ID:MI7851GAPDH (572-513) Anchor: -length = 25
CGCCGGTCGAGCGTTGTGGGAGCGC (SEQ ID:34) Target: -length = 60
TGAGAAGTATGACAACAGCCTCAAGATCATCAGCAAT (SEQ ID:35)
GCCTCCTGCACCACCAACTGCTT Linker: -length = 60
ATGCCTCCTGCACCACCAACTGCTTGATACTGAGTGC (SEQ ID:36)
GCTCCCACAACGCTCGACCGGCG Protection Fragment: -length = 75
AAGCAGTTGGTGGTGCAGGAGGCATTGCTGATGATCT (SEQ ID:37)
TGAGGCTGTTGTCATACTTCTCAGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- TG (SEQ ID:38)
AGAAGTATGACAACAGCCTCAAG Attenuation Factor: -length = 25
TGAGAAGTATGACAACAGCCTCAAG (SEQ ID:39) Target #2; ID:M 15840
ILI-beta (4392-4333) Anchor: -length = 25 TCCACGTGAGGACCGGACGGCGTCC
(SEQ ID:40) Target: -length = 60
CGACACATGGGATAACGAGGCTTATGTGCACGATGCA (SEQ ID:41)
CCTGTACGATCACTGAACTGCAC Linker: -length = 60
CACCTGTACGATCACTGAACTGCACGATACTGAGTGG (SEQ ID:42)
ACGCCGTCCGGTCCTCACGTGGA Protection Fragment: -length = 75
GTGCAGTTCAGTGATCGTACAGGTGCATCGTGCACAT (SEQ ID:43)
AAGCCTCGTTATCCCATGTGTCGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CG (SEQ ID:44)
ACACATGGGATAACGAGGCTTAT Attenuation Factor: -length = 25
CGACACATGGGATAACGAGGCTTAT (SEQ ID:45) Target #3; ID:M1O988TNF
(780-721) Anchor: -length = 25 CACTACGGCTGAGCACGTGCGCTGC (SEQ
ID:46) Target: -length = 60 CGGAACCCAAGCTTAGAACTTTAAGCAACAAGACCAC
(SEQ ID:47) CACTTCGAAACCTGGGATTCAGG Linker: -length = 60
ACCACTTCGAAACCTGGGATTCAGGGATACTGAGTGC (SEQ ID:48)
AGCGCACGTGCTCAGCCGTAGTG Protection Fragment: -length = 75
CCTGAATCCCAGGTTTCGAAGTGGTGGTCTTGTTGCT (SEQ ID:49)
TAAAGTTCTAAGCTTGGGTTCCGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CG (SEQ ID:50)
GAACCCAAGCTTAGAACTTTAAG Attenuation Factor: -length = 25
CGGAACCCAAGCTTAGAACTTTAAG (SEQ ID:51) Target #4; ID:M17851GAPDH
(572-513) (same as for Target #1) Target #5; ID:M16117Cathepsin-G
(373-314) Anchor: -length = 25 GAACCGCTCGCGTGTTCTACAGCCA (SEQ
ID:52) Target: -length = 60 GCGGACCATCCAGAATGACATCATGTTATTGCAGCT- G
(SEQ ID:53) AGCAGAAGAGTCAGACGGAATCG Linker: -length = 60
TGAGCAGAAGAGTCAGACGGAATCGGATACTGAGTTG (SEQ ID:54)
GCTGTAGAACACGCGAGCGGTTC Protection Fragment: -length = 75
CGATTCCGTCTGACTCTTCTGCTCAGCTGCAATAACA (SEQ ID:55)
TGATGTCATTCTGGATGGTCCGCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GC (SEQ ID:56)
GGACCATCCAGAATGACATCATG Attenuation Factor length = 25
GCGGACCATCCAGAATGACATCATG (SEQ ID:57) Target #6; ID:M90100COX-2
(240-181) Anchor: -length = 25 CTCGTTCCGCGTCCGTGGCTGCCAG (SEQ
ID:58) Target: -length = 60 CCGAGGTGTATGTATGAGTGTGGGATTTGACCAGTAT
(SEQ ID:59) AAGTGCGATTGTACCCGGACAGG Linker: -length = 60
ATAAGTGCGATTGTACCCGGACAGGGATACTGAGTCT (SEQ ID:60)
GGCAGCCACGGACGCGGAACGAG Protection Fragment: -length = 75
CCTGTCCGGGTACAATCGCACTTATACTGGTCAAATC (SEQ ID:61)
CCACACTCATACATACACCTCGGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CC (SEQ ID:62)
GAGGTGTATGTATGAGTGTGGGA Attenuation Factor: -length = 25
CCGAGGTGTATGTATGAGTGTGGGA (SEQ ID:63) Target #7; ID:M74091 cyclin
(932-873) Anchor: -length = 25 CGGTCGGCATGGTACCACAGTCCGC (SEQ
ID:64) Target: -length = 60 CACCTCCAAACAGTGAAGGAGAGCAGGGTCCAAATGG
(SEQ ID:65) AAGTCAGAACTCTAGCTACAGCC Linker: -length = 60
GGAAGTCAGAACTCTAGCTACAGCCGATACTGAGTGC (SEQ ID:66)
GGACTGTGGTACCATGCCGACCG Protection Fragment: -length 75
GGCTGTAGCTAGAGTTCTGACTTCCATTTGGACCCTG (SEQ ID:67)
CTCTCCTTCACTGTTTGGAGGTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:68)
CCTCCAAACAGTGAAGGAGAGCA Attenuation Factor: -length = 25
CACCTCCAAACAGTGAAGGAGAGCA (SEQ ID:69) Target #8; ID:M14144vimentin
(1338-1279) Anchor: -length = 25 GCGCGCCGCGTTATGCATCTCTTCG (SEQ
ID:70) Target: -length = 60 GTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAAC
(SEQ ID:71) GCCAGATGCGTGAAATGGAAGAG Linker: -length = 60
ACGCCAGATGCGTGAAATGGAAGAGGATACTGAGTCG (SEQ ID:72)
AAGAGATGCATAACGCGGCGCGC Protection Fragment: -length = 75
CTCTTCCATTTCACGCATCTGGCGTTCCAGGGACTCA (SEQ ID:73)
TTGGTTCCTTTAAGGGCATCCACGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GT (SEQ ID:74)
GGATGCCCTTAAAGGAACCAATG Attenuation Factor: -length = 25
GTGGATGCCCTTAAAGGAACCAATG (SEQ ID:75) Target #9; ID:D90145 LD78-b
(2049-1990) Anchor: -length = 25 GTTAGCATACGTGTCACCACACCGG (SEQ
ID:76) Target: -length = 60 CACCTCCCGACAGATTCCACAGAATTTCATAGCTGAC
(SEQ ID:77) TACTTTGAGACGAGCAGCCAGTG Linker: -length = 60
ACTACTTTGAGACGAGCAGCCAGTGGATACTGAGTCC (SEQ ID:78)
GGTGTGGTGACACGTATGCTAAC Protection Fragment: -length = 75
CACTGGCTGCTCGTCTCAAAGTAGTCAGCTATGAAAT (SEQ ID:79)
TCTGTGGAATCTGTCGGGAGGTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:80)
CCTCCCGACAGATTCCACAGAAT Attenuation Factor: -length = 25
CACCTCCCGACAGATTCCACAGAAT (SEQ ID:81) Target #10; ID:X13546 HMG-17
M12623-mRNA (191-132) Anchor: -length = 25
CGTCAGTCCGTCGGCCAGCTCTTCC (SEQ ID:82) Target: -length = 60
CAAAGGTGAAGGACGAACCACAGAGAAGATCCGCGAG (SEQ ID:83)
GTTGTCTGCTAAACCTGCTCCTC Linker: -length = 60
AGGTTGTCTGCTAAACCTGCTCCTCGATACTGAGTGG (SEQ ID:84)
AAGAGCTGGCCGACGGACTGACG Protection Fragment: -length = 75
GAGGAGCAGGTTTAGCAGACAACCTCGCGGATCTTCT (SEQ ID:85)
CTGTGGTTCGTCCTTCACCTTTGGCTTGTCTAAGTCT G Detection-Linker: -length
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGTCA (SEQ ID:86)
AAGGTGAAGGACGAACCACAGAG Attenuation Factor: -length = 25
CAAAGGTGAAGGACGAACCACAGAG (SEQ ID:87) Target #11; ID:X13694
Osteopontin (783-724) Anchor: -length = 25
ATCCAGTTAACCACATGCTAGTACC (SEQ ID:88) Target: -length = 60
CCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGAT (SEQ ID:89)
GACCAGAGTGCTGAAACCCACAG Linker: -length = 60
ATGACCAGAGTGCTGAAACCCACAGGATACTGAGTGG (SEQ ID:90)
TACTAGCATGTGGTTAACTGGAT Protection Fragment: -length = 75
CTGTGGGTTTCAGCACTCTGGTCATCCAGCTGACTCG (SEQ ID:91)
TTTCATAACTGTCCTTCCCACGGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CC (SEQ ID:92)
GTGGGAAGGACAGTTATGAAACG Attenuation Factor: -length = 25
CCGTGGGAAGGACAGTTATGAAACG (SEQ ID:93) Target #12;
ID:M17017b-thromboglobulin (142-83) Anchor: -length = 25
TTAGCGTTGGCCGAGGTTCATAGCC (SEQ ID:94) Target. -length = 60
GTGTAAACATGACTTCCAAGCTGGCCGTGGCTCTCTT (SEQ ID:95)
GGCAGCCTTCCTGATTTCTGCAG Linker: -length = 60
TTGGCAGCCTTCCTGATTTCTGCAGGATACTGAGTGG (SEQ ID:96)
CTATGAACCTCGGCCAACGCTAA Protection Fragment: -length = 75
CTGCAGAAATCAGGAAGGCTGCCAAGAGAGCCACGGC (SEQ ID:97)
CAGCTTGGAAGTCATGTTTACACGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GT (SEQ ID:98)
GTAAACATGACTTCCAAGCTGGC Attenuation Factor: -length = 25
GTGTAAACATGACTTCCAAGCTGGC (SEQ ID:99) Target #13; ID:M17851GAPDH
(572-513) (same as for Target #1) Target #14; ID:K02215 angiotensin
(805-746) Anchor: -length = 25 CATTACGAGTGCATTCGCATCAAGG (SEQ
ID:100) Target: -length = 60 CACGCTCTCTGGACTTCACAGAACTGGATGTTGCT-
GC (SEQ ID:101) TGAGAAGATTGACAGGTTCATGC Linker: -length = 60
GCTGAGAAGATTGACAGGTTCATGCGATACTGAGTCC (SEQ ID:102)
TTGATGCGAATGCACTCGTAATG Protection Fragment: -length = 75
GCATGAACCTGTCAATCTTCTCAGCAGCAACATCCAG (SEQ ID:103)
TTCTGTGAAGTCCAGAGAGCGTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:104)
CGCTCTCTGGACTTCACAGAACT Attenuation Factor: -length = 25
CACGCTCTCTGGACTTCACAGAACT (SEQ ID:105) Target #15; ID:MI0277Actin
(2627-2568) Anchor: -length = 25 ATCATGTAAGTCTTCGGTCGGTGGC (SEQ
ID:106) Target: -length = 60 GAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCA
(SEQ ID:107) TCATGAAGTGTGACGTGGACATC. Linker: -length = 60
CATCATGAAGTGTGACGTGGACATCGATACTGAGTGC (SEQ ID:108)
CACCGACCGAAGACTTACATGAT Protection Fragment: -length = 75
GATGTCCACGTCACACTTCATGATGGAOTTGAAGGTA (SEQ ID:109)
GTTTCGTGGATGCCACAGGACTCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GA (SEQ ID:110)
GTCCTGTGGCATCCACGAAACTA Attenuation Factor: -length = 25
GAGTCCTGTGGCATCCACGAAACTA (SEQ ID:111) Target #16; (this spot is
not used)
Example 28
Simultaneous Detection of DNA and RNA (See FIG. 29)
[0293] THP-1 human monocytes are grown in 96-well V-bottom
microtiter plates, with 30,000 to 150,000 cells/well. Control cells
which have not been differentiated with PMA 30 or activated with
LPS are used, because the RNAs for certain genes (e.g., IL-2,
Cox-2, LD78, Osteopontin and Thromboglobulin) are not present in
those cells and therefore only DNA is measured in the assay;
whereas both DNA and RNA for GAPDH are present and measured. The
cells are heated to 105.degree. C. in an aqueous medium (lysis
buffer), and nuclease protection fragments specific for the targets
of interest are added to the lysates. Lysis at elevated temperature
releases DNA in a measurable form, as well as RNA. For the
measurement of DNA, the nuclease protection fragments added are
those for IL-1, Cox-2, LD78, Osteopontin and Thromboglobulin. For
the measurement of both DNA and RNA, the preceding nuclease
protection fragments, as well as one specific for GAPDH, are added.
Nuclease protection reactions are performed in the wells as
described elsewhere herein.
[0294] The arrays are formed and the hybridization of protection
fragments is performed essentially as described in Example 27.
Detection of DNA vs DNA+RNA is done by serial hybridization of
detection linkers. Serial hybridization is performed here in order
to balance the signals from RNA and DNA targets (as discussed
below); serial hybridization is, of course, not a requirement for
assays in which DNA and RNA targets are detected together. In the
first round, detection linkers for IL-2, Cox-2, LD78, Osteopontin
and Thromboglobulin are added. In the second round, the detection
linker for GAPDH is added. Serial hybridization is performed in
order to image the DNA signal, which is relatively much weaker than
the RNA signal due to much lower copy number per sample, for a
longer period of time in order to accumulate a higher signal
intensity.
[0295] The results are presented in FIG. 29. The left panel
illustrates that when genomic DNA alone is examined, the genomic
sequences tested--IL-1, Cox-2, LD78, Osteopontin and
Thromboglobulin--can all be detected at the appropriate loci, and
are present in approximately the same amounts. That genomic DNA is
being measured is indicated by Table 1, which shows that in such
control cells, RNA for these genes is not detectable. The right
panel, in which both the DNA and RNA are measured, but a much
shorter image exposure time is collected such that the DNA signal
is much weaker than in the left panel, shows that when DNA and RNA
are examined together, the control genomic sequences can be
detected as before, as internal normalization standards, and the
expressed gene--GAPDH--is present at a much higher level than the
controls. By quantitating the relative amounts of signal in the
controls and the expressed GAPDH mRNA, one can calculate the amount
of mRNA expressed per cell.
Example 29
Detection of Expressed SNPs (See FIGS. 30 and 31)
[0296] FIG. 30 schematically illustrates one type of assay for
expressed SNPs. Here, a nuclease protection fragment is designed to
hybridize to the region of an RNA containing a SNP, in such a
manner that when an appropriate enzyme (e.g., RNAse H) is added, if
the nuclease protection fragment has hybridized to RNA for which
there is a mis-matched base (here, the SNP), the enzyme will cleave
the nuclease protection fragment. In this example, the resulting
cleaved fragment cannot hybridize to the array (e.g., due to the
hybridization conditions such as temperature used). In other
embodiments, hybridization to the array can occur, but a detection
linker cannot bind to the cleaved protection fragment (e.g., due to
the hybridization conditions such as temperature used); or the
cleavage occurs in such a way that the cleaved protection fragment
cannot hybridize simultaneously to the array and to a detection
linker.
[0297] FIG. 31 illustrates the results of such an assay, performed
by conventional methods as described herein. Wild type actin is
used as an internal control, and a protection fragment
corresponding to GAPDH containing an engineered SNP is
differentiated from a protection fragment corresponding to wild
type GAPDH. FIG. 31 depicts the measurement of multiple samples
containing either wild type GAPDH and wild type actin (left column
and left panel of blow-up) or containing SNP GAPDH and wild type
actin (right column and right panel of blow-up). The center panel
of the blow-up depicts the array layout.
Example 30
High Throughput Screening (See FIGS. 32-35)
[0298] Transcription assays are performed essentially as described
in Example 28, except, e.g., the anchors are placed on irradiated
plates rather than DNA Bind plates. The same anchors described in
Example 27 are used, but certain targets in the array are changed,
namely, only one anchor is used to measure GAPDH, and Tubulin,
actin, and LDH are added. The other targets measured are IL-1,
TNF-a, Cathepsin G, Cox-2, G-CSF, GM-CSF, GST-Pi1, HMG-17,
Cyclophilin, b-Thromboglobulin, TIMP-1, MMP-9. The array is
depicted in FIG. 32 and the linker and nuclease protection fragment
sequences are given below. Approximately 30,000 cells are used per
well (not adjusted for continued proliferation of control cells
during the course of PMA and LDH treatment of the treated
cells).
[0299] Sequences:
8 Target #1 GAPDH (same as Target #1 example 27) Target #2 IL-lb
(same as Target #2 Example 27) Target #3 TNF-a (same as Target #3
Example 27) Target #4 Tubulin (AF141347) Anchor: -length = 25
TAAGCGTCTCTAGGAAGGGACGTGG (SEQ ID:112) Target: -length = 60
GACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCA (SEQ ID:113)
CCATCAAGACCAAGCGTACCATC Linker: -length = 60
CACCATCAAGACCAAGCGTACCATCGATACTGAGTCC (SEQ ID:114)
ACGTCCCTTCCTAGAGACGCTTA Protection Fragment: -length = 75
GATGGTACGCTTGGTCTTGATGGTGGCAATGGCAGCA (SEQ ID:115)
TTGACATCTTTGGGAACCACGTCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGTGA (SEQ ID:116)
CGTGGTTCCCAAAGATGTCAATG Attenuation Factor: -length = 25
GACGTGGTTCCCAAAGATGTCAATG (SEQ ID:117) Target #5 Cathepsin-G (same
as Target #5 Example 27) Target #6 Cox-2 (same as Target #6 Example
27) Target #7 G-CSF (E01219) Anchor: -length = 25
CGGTCGGCATGGTACCACAGTCCGC (SEQ ID:118) Target: -length = 60
GAGGGAGCAGACAGGAGGAATCATGTCAGGCCTGTGT (SEQ ID:119)
GTGAAAGGAAGCTCCACTGTCAC Linker: -length = 60
GTGTGAAAGGAAGCTCCACTGTCACGATACTGAGTGC (SEQ ID:120)
GGACTGTGGTACCATGCCGACCG Protection Fragment: -length = 75
GTGACAGTGGAGCTTCCTTTCACACACAGGCCTGACA (SEQ ID:121)
TGATTCCTCCTGTCTGCTCCCTCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GA (SEQ ID:122)
GGGAGCAGACAGGAGGAATCATG Attenuation Factor: -length = 25
GAGGGAGCAGACAGGAGGAATCATG (SEQ ID:123) Target #8 GM-CSF (E02975)
Anchor: -length = 25 GCGCGCCGCGTTATGCATCTCTTCG (SEQ ID:124) Target:
-length = 60 CACTACAAGCAGCACTGCCCTCCAACCCCGGAAACTT (SEQ ID:125)
CCTGTGCAACCCAGATTATCACC Linker: -length = 60
TTCCTGTGCAACCCAGATTATCACCGATACTGAGTCG (SEQ ID:126)
AAGAGATGCATAACGCGGCGCGC Protection Fragment: -length = 75
GGTGATAATCTGGGTTGCACAGGAAGTTTCCGGGGTT (SEQ ID:127)
GGAGGGCAGTGCTGCTTGTAGTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:128)
CTACAAGCAGCACTGCCCTCCAA Attenuation Factor: -length = 25
CACTACAAGCAGCACTGCCCTCCAA (SEQ ID:129) Target #9 GST-PI1 X06547
Anchor: -length = 25 GTTAGCATACGTGTCACCACACCGG (SEQ ID:130) Target:
-length = 60 CAGGGAGGCAAGACCTTCATTGTGGGAGACCAGATCT (SEQ ID:131)
CCTTCGCTGACTACAACCTGCTG Linker: -length = 60
CTCCTTCGCTGACTACAACCTGCTGGATACTGAGTCC (SEQ ID:132)
GGTGTGGTGACACGTATGCTAAC Protection Fragment: -length = 75
CAGCAGGTTGTAGTCAGCGAAGGAGATCTGGTCTCCC (SEQ ID:133)
ACAATGAAGGTCTTGCCTCCCTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:134)
GGGAGGCAAGACCTTCATTGTGG Attenuation Factor: -length = 25
CAGGGAGGCAAGACCTTCATTGTGG (SEQ ID:135) Target #10 HMG-17 (same as
Target #10 Example 27) Target #11 Cyclophilin X52851 Anchor:
-length 25 ATCCAGTTAACCACATGCTAGTACC (SEQ ID:136) Target: -length
60 GGGTTTATGTGTCAGGGTGGTGACTTCACACGCCATA (SEQ ID:137)
ATGGCACTGGTGGCAAGTCCATC Linker: -length 60
TAATGGCACTGGTGGCAAGTCCATCGATACTGAGTGG (SEQ ID:138)
TACTAGCATGTGGTTAACTGGAT Protection Fragment: -length = 75
GATGGACTTGCCACCAGTGCCATTATGGCGTGTGAAG (SEQ ID:139)
TCACCACCCTGACACATAAACCCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GG (SEQ ID:140)
GTTTATGTGTCAGGGTGGTGACT Attenuation Factor: -length = 25
GGGTTTATGTGTCAGGGTGGTGACT (SEQ ID:141) Target #12 b-Thromboglobulin
(same as Target #12 Example 27) Target #13 LDH X02152 Anchor:
-length = 25 TCTCGGTCTGGAACGCCCGGCAACT (SEQ ID:142) Target: -length
= 60 GGTGGTTGAGAGTGCTTATGAGGTGATCAAACTCAAA (SEQ ID:143)
GGCTACACATCCTGGGCTATTGG Linker: -length = 60
AAGGCTACACATCCTGGGCTATTGGGATACTGAGTAG (SEQ ID:144)
TTGCCGGGCGTTCCAGACCGAGA Protection Fragment: -length = 75
CCAATAGCCCAGGATGTGTAGCCTTTGAGTTTGATCA (SEQ ID:145)
CCTCATAAGCACTCTCAACCACCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GG (SEQ ID:146)
TGGTTGAGAGTGCTTATGAGGTG Attenuation Factor: -length = 25
GGTGGTTGAGAGTGCTTATGAGGTG (SEQ ID:147) Target #14 TIMP-1 X03124
Anchor: -length = 25 CATTACGAGTGCATTCGCATCAAGG (SEQ ID:148) Target:
-length = 60 CACCAAGACCTACACTGTTGGCTGTGAGGAATGCACA (SEQ ID:149)
GTGTTTCCCTGTTTATCCATCCC Linker: -length = 60
CAGTGTTTCCCTGTTTATCCATCCCGATACTGAGTCC (SEQ ID:150)
TTGATGCGAATGCACTCGTAATG Protection Fragment: -length = 75
GGGATGGATAAACAGGGAAACACTGTGCATTCCTCAC (SEQ ID:151)
AGCCAACAGTGTAGGTCTTGGTGGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- CA (SEQ ID:152)
CCAAGACCTACACTGTTGGCTGT Attenuation Factor: -length = 25
CACCAAGACCTACACTGTTGGCTGT (SEQ ID:153) Target #15 MMP-9 J05070
Anchor: -length = 25 ATCATGTAAGTCTTCGGTCGGTGGC (SEQ ID:154) Target:
-length 60 GCAACGTGAACATCTTCGACGCCATCGCGGAGATTGG (SEQ ID:155)
GAACCAGCTGTATTTGTTCAAGG Linker: -length = 60
GGGAACCAGCTGTATTTGTTCAAGGGATACTGAGTGC (SEQ ID:156)
CACCGACCGAAGACTTACATGAT Protection Fragment: -length = 75
CCTTGAACAAATACAGCTGGTTCCCAATCTCCGCGAT (SEQ ID:157)
GGCGTCGAAGATGTTCACGTTGCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GC (SEQ ID:158)
AACGTGAACATCTTCGACGCCAT Attenuation Factor:-length = 25
GCAACGTGAACATCTTCGACGCCAT (SEQ ID:159) Target #16 Actin M10277
Anchor: -length = 25 CTGAGTCCTCCGGTGCCTACGTGGC (SEQ ID:160) Target:
-length = 60 GAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCA (SEQ ID:161)
TCATGAAGTGTGACGTGGACATC Linker: -length = 60
CATCATGAAGTGTGACGTGGACATCGATACTGAGTGC (SEQ ID:162)
CACGTAGGCACCGGAGGACTCAG Protection Fragment: -length = 75
GATGTCCACGTCACACTTCATGATGGAGTTGAAGGTA (SEQ ID:163)
GTTTCGTGGATGCCACAGGACTCGCTTGTCTAAGTCT G Detection-Linker: -length =
60 TGCTCTCCTTCACTGTTTGGAGGTGGATACTGAGT- GA (SEQ ID:164)
GTCCTGTGGCATCCACGAAACTA Attenuation Factor: -length = 25
GAGTCCTGTGGCATCCACGAAACTA (SEQ ID:165)
[0300] FIG. 33 shows that the reproducibility of the assay is high,
providing a %CV range of about 3% to 13% when 30,000 cells are
analyzed.
[0301] FIG. 34 shows that the sensitivity of the assay is high,
e.g., the target mRNAs for GAPDH can be detected when RNA from a
sample of as few as, or fewer than, 1,000 cells is assayed.
[0302] FIG. 35, performed using essentially the protocol of Example
25 and the array and targets of Example 27, shows that many of the
target mRNAs tested can be detected even when RNA from a sample of
as few as, or fewer than, 1000 cells is assayed, and all of the
targets, even those expressed at low abundance, can be detected
when the RNA is from as few as, or fewer than, 10,000 cells.
Example 31
Oligonucleotide Reagent Options (See FIG. 36)
[0303] FIG. 36 schematically shows several types of oligonucleotide
reagents which can be used in the methods of the invention. The
figure depicts assay schemes in which oligonucleotide anchors are
attached to a surface via either their 5' or their 3' ("Inverted")
termini, and in which oligonucleotides have two recognition
moieties that are either adjacent to each other ("Shortened") or
are separated by nucleic acid spacers. Each box represents 5
nucleotides.
[0304] Example 32
Nuclease Protection Fragment Amplification Methods (See FIGS. 37-39
and 42)
[0305] FIG. 37 illustrates nuclease protection fragment
amplification by PCR.
[0306] FIG. 38 illustrates nuclease protection fragment
amplification by ligase. By selecting a' as a 12 base sequence, out
of the 25 bases which in ligated a' a binds to the array,
hybridization conditions can be selected which only allow the
ligated, 25 base sequence of the a'a molecules to bind.
Discrimination can be improved by using a modified nucleotide(s) in
each portion of the linker binding region of a' and a. If the
cycles of heat dissociation destroy the ligase, it can be re-added
for each cycle.
[0307] FIG. 39 illustrates nuclease protection fragment
amplification by nuclease protection. (DNA a) strand complementary
to the (Nuclease Protection Fragment b) can contain modified bases
which hybridize at lower temperature than the (RNA a), or the (RNA
a) can be destroyed before (DNA a) is added. Likewise, the (Linker
a) for (DNA a) can contain modified nucleotides which allow
hybridization at lower temperature than (Nuclease Protection
Fragment b), even if the (Linker a)/(DNA a) hybrid is 25 bases and
the (DNA a)/(Nuclease Protection Fragment b) is a 50 base
hybridization, especially when taken into account experimentally is
that the DNA strands in solution are dilute, and passing thorough a
highly concentrated, essentially infinitely high concentration of
(Linker A). The flow through apparatus can be replaced with a plate
comprising an array for capture. The linear array can be replaced
with a 2-D or 3-D array.
[0308] FIG. 42 illustrates nuclease protection fragment
amplification by polymerase. After the nuclease protection reaction
is complete and the nuclease protection fragment is dissociated
from the RNA, a primer (a') is added which contains a double
stranded promoter for an RNA polymerase (e.g., T7 polymerase) and a
primer for extension along the nuclease protection fragment
template (e.g., extension by reverse transcriptase (RT) for the
replication of the RNA or DNA, or Taq polymerase for the
replication of DNA), such that after binding to the nuclease
protection fragment (e.g., RT or Taq polymerase) will use this as a
template to form a double stranded DNA complex, with the double
stranded promoter region apposed to the end of the nuclease
protection fragment sequence. Addition of ligase will ligate the
second strand of the promoter to the nuclease protection fragment
strand, unless the first base was a mismatched SNP, and therefore
during the nuclease protection reaction S1 clipped off the
unprotected base. Ligase will not ligate the promoter to the
nuclease protection fragment because of the skipped base. In the
case of ligation, the b strand is converted to an extended b"
strand incorporating the polymerase promoter and amplification can
proceed using polymerase, and continue as after the addition of RT
primer b'. The promoter/extended end of the nuclease protection
fragment is used to bind to the array or to a detection linker or
detection probe. For detection of SNP, this hybridization is
arranged so that the SNP site is approximately in the middle of the
sequence used for hybridization to the array (detection linker, or
detection probe, etc.). The array (detection linker, or detection
probe) hybridization region of the extended nuclease protection
probe does not have to include all the bases at the end (some of
the bases at the end of the extended nuclease protection probe can
overhang without having a complementary hybridization sequence in
the linker, etc.). In variations not depicted, it is not necessary
to ligate before use of (e.g., T7) polymerase, and therefore the
SNP detection is performed by selecting a sequence positioning the
SNP in the middle of the sequence hybridizing to a', and using an
SNP detection protocol as described elsewhere herein. It is not
necessary to extend the a' strand, but instead RNA polymerase can
use the promoter hybridized to the single stranded nuclease
protection fragment (omitting the indicated RT extension, or
alternative Taq polymerase extension step depicted) to produce
RNA.
[0309] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention,
and without departing from the spirit and scope thereof, can make
changes and modifications of the invention to adapt it to various
usage and conditions.
[0310] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, utilize the
present invention to its fullest extent. The preceding preferred
specific embodiments are, therefore, to be construed as merely
illustrative, and not limitative of the remainder of the disclosure
in any way whatsoever.
[0311] The entire disclosure of all applications, patents and
publications, cited above and in the figures are hereby
incorporated by reference.
* * * * *