U.S. patent application number 09/751654 was filed with the patent office on 2003-05-22 for column device for isolation and labeling of nucleic acids.
Invention is credited to Akowski, James P., Bavykin, Sergei G., Mirzabekov, Andrei, Zakhariev, Vladimir M..
Application Number | 20030096229 09/751654 |
Document ID | / |
Family ID | 25022921 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096229 |
Kind Code |
A1 |
Bavykin, Sergei G. ; et
al. |
May 22, 2003 |
Column device for isolation and labeling of nucleic acids
Abstract
A method for manipulating genetic material, the method
comprising disrupting cells so as to liberate genetic material
contained in the cells; contacting the genetic material to a silica
column in a manner to cause the genetic material to become
immobilized to the column; labeling the immobilized genetic
material; and eluting the labeled material from the column. Also
provided is a two-buffer process for manipulating genetic material,
the process comprising: contacting cells containing the genetic
material to a silica column; creating a first fraction of cell
detritus and a second fraction containing the genetic material;
confining the genetic material to the column; removing the cell
detritus; contacting the genetic material with radicals so as to
produce reactive aldehyde groups on the genetic material, and
attaching chromophore to the genetic material.
Inventors: |
Bavykin, Sergei G.; (Darien,
IL) ; Akowski, James P.; (Alexandria, VA) ;
Zakhariev, Vladimir M.; (Moscow, RU) ; Mirzabekov,
Andrei; (Darien, IL) |
Correspondence
Address: |
CHERSKOV & FLAYNIK
The Civic Opera Building
Suite 1447
20 North Wacker Drive
Chicago
IL
60606
US
|
Family ID: |
25022921 |
Appl. No.: |
09/751654 |
Filed: |
December 29, 2000 |
Current U.S.
Class: |
435/6.12 ;
435/270; 536/25.4 |
Current CPC
Class: |
C07H 21/00 20130101;
C12N 15/101 20130101; C12Q 1/6806 20130101; C12Q 1/6816 20130101;
B01J 20/283 20130101; C12Q 1/6806 20130101; C12Q 2563/107 20130101;
C12Q 2563/113 20130101 |
Class at
Publication: |
435/6 ; 435/270;
536/25.4 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Goverment Interests
[0001] The United States Government has rights in this invention
pursuant to Contract Number W-31-109-ENG-38 between the United
States Government and Argonne National Laboratory.
Claims
The embodiment of the invention in which an exclusive property or
privilege is claimed is defined as follows:
1. A method for manipulating genetic material, the method
comprising: a) disrupting cells so as to liberate genetic material
contained in the cells; b) contacting the genetic material to a
column in a manner to cause the genetic material to become
immobilized to the column; c) labeling the immobilized genetic
material; and d) eluting the labeled material from the column.
2. The method as recited in 1 wherein the step of labeling the
genetic material further comprises maintaining the column at a
temperature of between 45.degree. C. and 100.degree. C.
3. The method as recited in claim 1 wherein the column comprises a
means for subjecting the silica to pressure.
4. The method as recited in claim 3 wherein the pressure means is a
syringe.
5. The method as recited in claim 1 wherein the step of labeling
the genetic material comprises: a) contacting double-stranded
nucleic acid molecules of the genetic material with
radical-generating complexes for a time and at concentrations
sufficient to produce free-aldehyde moieties; b) reacting the
aldehyde moieties with amine to produce a condensation product; and
c) contacting the condensation product with a chromophore.
6. The method as recited in claim 5 wherein the step of contacting
the condensation product with a chromophore further comprises
reducing the condensation product and cross-linking the reduced
condensation product with the chromophore in one reaction step.
7. The method as recited in claim 1 wherein the column is a solid
substrate selected from the group consisting of silica, ground
glass filter, pulped glass filter, HNO3-washed glass filter pulp,
HNO3-washed gel, HNO3-washed diatoms, silicic acid 400 mesh silica
gel, SPE-SIL and combinations thereof.
8. A two-buffer process for manipulating genetic material, the
process comprising: a) contacting cells containing the genetic
material to a silica column; b) creating a first fraction of cell
detritus and a second fraction containing the genetic material; c)
confining the genetic material to the column; d) removing the cell
detritus; e) subjecting the genetic material to radicals so as to
produce reactive aldehyde groups on the genetic material; and f)
attaching chromophore to the genetic material.
9. The process as recited in claim 8 wherein the genetic material
is contacted with radical in aerobic conditions.
10. The process as recited in claim 8 wherein the genetic material
is contacted with radical in anaerobic conditions.
11. The process as recited in claim 8 wherein the step of creating
a fraction of cell detritus and the genetic material comprises
contacting the cells with a lysis buffer.
12. The process as recited in claim 8 wherein steps a) through f)
occur in approximately 20 minutes.
13. The process as recited in claim 8 wherein the two buffers
comprise a first buffer to lyse the cells and a second buffer to
attach the genetic material to the column.
14. The process as recited in claim 13 wherein the first buffer and
second buffer contain guanidine thyocianate and EDTA.
15. The process as recited in claim 13 wherein the first buffer and
the second buffer contact the cells simultaneously.
16. The process as recited in claim 8 wherein the genetic material
is bound to chromophore in aerobic conditions.
17. The process as recited in claim 8 wherein the genetic material
is bound to chromophore in anaerobic conditions.
18. The process as recited in claim 13 wherein the first buffer and
the second buffer are present in a relative weight ratio of
9:4.
19. The process as recited in claim 8 wherein the temperature is
maintained at 95.degree. C.
Description
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to a device for manipulating genetic
material, and more specifically, this invention relates to a column
device for isolation, fractionating, fragmentation, labeling and
purification of total nucleic acid material, DNA and RNA in a
minimal number of steps.
[0004] 2. Background of the Invention
[0005] Traditional methods of bacterial identification are usually
based on morphological and/or physiological features of a
microorganism or on analysis of 16S rRNA gene sequences. These
methods require considerable amounts of time.
[0006] PCR and other amplification techniques are utilized for
bacteria identification. Immunological methods and
mass-spectrometry also have been adapted for this purpose, but are
expensive and cumbersome.
[0007] DNA microchip technology is a rapid, high throughput
platform for nucleic acid hybridization reactions. However, nucleic
acid fragmentation and labeling are two of the limiting steps in
the development of rapid protocols for DNA/RNA microchip
technology.
[0008] Several enzymatic and chemical protocols are available for
fluorescent labeling of nucleic acids. All of these methods are
expensive and time consuming. Lastly, most of these protocols
demand careful prerequisite nucleic acid isolation, fractionation
(generally requiring one or more hours), labeling, separate sample
fragmentation procedures and a final purification step.
[0009] Typical nucleic acid labeling methods adopt a myriad of
approaches. For example, M. D. Schena et al., Science 270, 467-470
(1995); J. L. DeRisi et al., Science 278, 680-686 (1997); G. P.
Yang et al., Nucl. Acid Res. 27, 1517-1523 (1999); K. Wang et al.,
Gene 229, 101-108 (1999), and M. Wilson et al. Proc. Natl. Acad.
Sci USA 96, 12833-12838 all rely on effecting labeling using
reverse transcriptase. Typically, this process requires from one to
two hours to complete.
[0010] D. Guiliano et al. Bio Techniques 27 146-152 (1999) and G.
T. Hermanson, Bioconjugate Techniques (Academic Press, Inc. San
Diego, Calif., 1996) utilize random priming. However, these
protocols require from 3 to 10 hours to complete.
[0011] Terminal transferase protocols are featured in K. L.
Gunderson et al. Genome Res. 8, 1142-1153 (1998) and L. Wodicka et
al. Nat. Biotechnol. 15, 1359-1367. However, these processes also
require between 1 and 2 hours to run.
[0012] Polymerase Chain Reaction (PCR) protocols for labeling are
widespread. Typical references for PCR processes include R. J.
Sapolsky et al. Genomics 33, 445-456 (1996); M. T. Cronin et al.
Hum. Mutat. 7, 244-255 (1996); S. Tyagi et al. Nat. Biotechnol 16,
49-53 (1998); and P. N. Gilles et al. Nat. Biotechnol 17, 365-370
(1999). However, PCR protocols require between 1 and 2 hours to
complete.
[0013] A need exists in the art for a high throughput fractionation
and labeling protocol for nucleic acid materials. The protocol
should require mild conditions of reaction, and decrease the number
of solutions and reaction steps compared to typical protocols. The
method should yield high amounts of cross-linked complexes in short
incubation times. And the method should be applicable to both DNA
and RNA sequences.
SUMMARY OF THE INVENTION
[0014] It is an object of the present invention to provide a method
for labeling nucleotide molecules that overcomes many of the
disadvantages of the prior art.
[0015] Another object of the present invention is an economical
method for labeling DNA and RNA molecules. A feature of the
invention is that a column, which very easily may be automated, is
utilized to immobilize and subject genetic material to reaction
sequences. Another feature is that fluid transport through the
column can be facilitated using low speed centrifugation in the
laboratory or via syringe-imparted pressure in the field. An
advantage of the method is that the process is portable and can be
easily juxtaposed to any arrays for subsequent analysis of
hybridizations.
[0016] Yet another object of the present invention is to provide a
method for modifying nucleic acid. A feature of the invention is
that the modification occurs on a column in the presence of
hydrogen peroxide and ultimately lead to the formation of an
aldehyde group for subsequent labeling. An advantage of the present
method is that the reaction is simple, requires mild conditions,
and produces high yields of cross-linked complexes which are
utilized in hybridization experiments.
[0017] As a result, a universal method of preparation of labeled
nucleic acids samples from studied bacterial or eucaryotic cells is
provided for use with any type of hybridization experiments,
including microarray assays. The method allows all chemical
manipulations to be provided in a minimal number of steps
(typically three steps) on a single column, in a span of
approximately 30 minutes.
[0018] Briefly, the invention provides a method for manipulating
genetic material, the method comprising: disrupting cells so as to
liberate genetic material contained in the cells; fractionating, if
necessary, the genetic material so as to separate DNA from RNA,
contacting the genetic material to a silica column in a manner to
cause the genetic material to become immobilized to the column;
separating cell detritus from the immobilized genetic material;
fragmenting and labeling the immobilized genetic material;
separating the labeled genetic material from excess label, and
eluting the labeled material from the column.
[0019] Also provided is a two-buffer process for manipulating
genetic material, the process comprising contacting cells
containing the genetic material to a silica column; creating a
first fraction of cell detritus and a second fraction containing
the genetic material; confining the genetic material to the column;
removing the cell detritus; subjecting the genetic material to
radicals so as to produce reactive aldehyde groups on the genetic
material; and attaching chromophore to the genetic material.
BRIEF DESCRIPTION OF THE DRAWING
[0020] The present invention together with the above and other
objects and advantages may best be understood from the following
detailed description of the embodiment of the invention illustrated
in the drawing, wherein:
[0021] FIG. 1 is a schematic diagram of a column-based protocol for
manipulating genetic material, in accordance with features of the
present invention;
[0022] FIG. 2 is a reaction sequence of DNA labeling, in accordance
with features of the present invention;
[0023] FIG. 3 is a reaction sequence of RNA labeling, in accordance
with features of the present invention; and
[0024] FIG. 4 is a depiction of the hybridizations resulting from
operation of the invented column process.
DETAILED DESCRIPTION OF THE INVENTION
[0025] A column-based protocol for manipulating genetic material is
provided herein. The column can be used alone or in combination
with any microarray system. A salient feature of such a system
include the invented column employed for successive DNA/RNA
isolation, fractionation, fragmentation, fluorescent labeling, and
removal of excess free label and short oligonucleotides. To
demonstrate the efficiency of the column protocol the inventors
used microarrays of immobilized oligonucleotide probes whereby the
microarrays are juxtaposed at a depending end of the column; and a
portable battery-powered device for imaging the hybridization of
fluorescently labeled RNA fragments with the arrays.
[0026] The inventors have utilized the invented column in the
above-identified configuration for 16S ribosomal RNA
identification.
[0027] The inventors have exploited a phenomenon that nucleic acids
bind to silica in the presence of high concentration of salt. To
eliminate all centrifugation steps, heretofore required in typical
protocols, a syringe column configuration can be utilized. As a
result of this syringe configuration (depicted in FIG. 1C), the
invented column-based protocol requires only two buffers. The
isolation of total nucleic acids or the fractionation of DNA/RNA is
effected in 3 to 5 minutes, as opposed to the typical 60-120 minute
procedures employing four or more buffers, as discussed, supra. The
buffers utilized are those effecting lysis and binding of the
target genetic material.
[0028] The entire mini-column procedure, from cell lysis to removal
of excess fluorescent label, is executed within 20-30 minutes.
[0029] The mini-column combines a method of nucleic acid isolation
utilizing guanidine thiocynanate, with a newly developed hydroxyl
radical-based technique for DNA/RNA labeling and fragmentation. The
chemistry of nucleic acid isolation and DNA/RNA fractionation is
effected via the application of the two buffer system, outlined
infra. Chemical components of the two buffer system effect
differential binding of double- and single-stranded forms of
nucleic acids to the silica column, thus allowing the DNA and RNA
to be fractionated.
[0030] The procedure involves sequential washing of the column with
different solutions. When a syringe is utilized as a means to
facilitate fluid transfer through the column, no vacuum filtration
steps, phenol extraction, or centrifugation are required. Any
targeted eluent of the column is then hybridized with immobilized
moieties on a micro-array. The overall fluorescence pattern
displayed by the micro-array is captured as a digital image
stationary microscope, a laser-based scanner, etc., or as a
Polaroid photo.
[0031] The above-referenced three-component system was used by the
inventors to discriminate Escherichia coli, Bacillus subtilis,
Bacillus thuringiensis, and human HL60 cells.
[0032] The column device expedites processes for fractionating and
labeling genetic molecules; for example, beginning with whole
cells, it takes approximately 25 minutes to obtain labeled DNA/RNA
samples and an additional 25 minutes to hybridize and acquire the
microarray image using a stationary image analysis system or the
portable imager.
[0033] Generally, the device comprises a single syringe-operated
silica minicolumn. A schematic diagram of the column process is
designated as numeral 10 in FIGS. 1A-1C. The column configuration
centralizes three main steps in the fragmentation and isolation
process.
[0034] In a first step, whole cells or pre-treated cell feed-stocks
12 are mixed with a lysis/binding buffer 14 to create a mixture 16.
This mixture 16 is added to a column 18 comprising silica 20. The
lysed cells 16 are allowed to contact the silica 20 for a time and
at a temperature sufficient to cause genetic macromolecules from
the lysed cells to adsorb to the silica 20. A myriad of times and
temperatures are suitable, with typical parameters for silica
binding disclosed in Boom et al. J. Clin, Microbiol. 28, 495-503
(1990). Detritus is passed through the column and discarded as
eluent. Targeted genetic material is attached to the silica at this
step and therefore is detained in the column.
[0035] The column containing the genetic material is then washed
with lysis buffer and ethanol, with washing protocols 22 or 22a
(elaborated below) dependent on the type of genetic material
isolated. After washing, a depending end 19 of the column 18 is
capped.
[0036] In a second step, the column is then heated to a selected
temperature ranging from between approximately 45.degree. C. and
100.degree. C., mostly to evaporate any washing alcohols utilized
in the previous steps. Also, it is preferred that the alcohols be
removed so as to prevent their inhibition of labeling reagent.
Labeling cocktail, sans hydrogen peroxide and reductant, is also
subject to a short preheating step.
[0037] The column is then infused with a labeling cocktail 26 and a
top 23 of the column is sealed. After the label remains in contact
with the column-bound genetic material for a time sufficient to
provide thorough labeling of the genetic material, a reaction
terminator is applied to the column. Then, nucleic acid
precipitators 28 are added to the column to facilitate adsorption
of the genetic material to the silica particles in the column. In
this step, nucleic acids are not bound to the silica, but rather
are agglomerated. A filter means 21 at the bottom 19 of the column
is provided so as to retain precipitated genetic material The
filter 21 also is resistant to ethanol or other washing fluid, as
discussed elsewhere in this specification. Filter paper having an
average pore side of approximately 0.22 microns provides good
results. Whatman PSU 0.2 centrifuge filter units are suitable
candidates for filter means.
[0038] In the third step, the column is then unsealed and subjected
to a washing and drying protocol 30 to remove excess label. Labeled
product 32 is then eluted from the column, mixed with hybridization
buffer 34, and added to a gel array 36.
[0039] FIG. 1B depicts a protocol for solely RNA/DNA isolation.
Briefly, the cell sample 12 is first contacted with lysis buffer to
form a lysate. The lysate is passed over a column 25 at a rate to
allow DNA in the lysate to bind to the column 25. At this juncture,
column eluent is unbound material such as RNA, proteins and
macromolecules.
[0040] Eluent 38 from the column 25 (containing RNA) is then mixed
with a binding buffer 40 to create an RNA/binder mixture 42. That
mixture 42 is contacted with a second column 44. The second column
44 is subjected to a washing protocol 22 to isolate the RNA on the
column. The RNA-only containing column is then treated to either
elute the RNA or else label the RNA in protocols outlined
infra.
[0041] Buffer Detail
[0042] The buffer system utilized is a two component system: one
for lysis, the other for binding of the target genetic material.
Buffer detail is disclosed in M. Beld et al., Nucleic Acid Res. 24
2618-2619 (1996), and incorporated herein by reference.
[0043] Generally, both buffers utilize a powerful lysing agent such
as guanidine thyocianate. Guanidine thyocianate destabilizes
nucleic acid duplexes and increases hybridization rates. EDTA also
is present in the buffers as an inhibitor of nucleases, which are
enzymes that destroy nucleic acids. The binding buffer further
contains nonionic detergents, which are necessary in stances where
single stranded nucleic acids are to be bound to silica. Exemplary
detergents include Trtion X-100 and MgCl.sub.2. When utilized
simultaneously, the lysis buffer and binding buffer is present in a
ratio of approximately 9:4 volume ratio.
[0044] Exemplary concentrations of components of the buffers are
disclosed infra, when specific protocols are discussed.
[0045] Column Preparation and Usage Detail
[0046] A myriad of packing materials are suitable column
constituents, including, but not limited to silica, ground glass
filter, pulped glass filter, HNO3-washed glass filter pulp,
HNO3-washed gel, HNO3-washed diatoms, silicic acid 400 mesh silica
gel, SPE-SIL and combinations thereof.
[0047] The results of various column packing substrates are
depicted infra in Table 1, wherein "batch" signifies the
substrate's binding ability when confined to a centrifuge test-tube
and "column" signifies the substrate's binding ability in a
flow-through column. Percentage yield signifies that amount of
total nucleic acid isolated on the substrate.
1TABLE 1 Retention Substrates for nucleic acid retention Percent
Retention Substrate Configuration Of Nucleic Acid Silica Particles
batch 102 Ground Glass Filter batch 60 Pulped Glass Filter batch 26
Crushed Glass Vial batch 6 HN03-washed column 56 glass filter pulp
HNO3-washed gel batch 53 HNO3-washed gel column 32 HNO3-washed
column 46 diatoms Silicic acid column 50 Silica particles column 84
with class filter Glass filter in filtration unit 22 Swinnex Fumed
silica column 5 400 Mesh batch 42 Silica Gel SPE-SIL batch 54
Crushed Quartz batch 12
[0048] When silica is utilized, a size-fractionated, silica
suspension prepared as described in R. Boom, et al. J. Clin.
Microbiol 28: 495-503, and incorporated herein by reference, is
suitable.
[0049] While a variety of column shapes, diameters and lengths are
applicable, the following protocol is offered for illustrative
purposes only, to enable the construction of a bench-top column
device. Briefly, silica stored at approximately 4 C is resuspended
to a 50 micro liter (.mu.l) suspension (containing approximately 40
.mu.l silica). This suspension is loaded into a 25-mm-long sterile
centrifuge device containing a polysulfone filter with a diameter
of 6.5 mm and a pore size of 0.2 .mu.m (Whatman, Fairfield, N.J.).
The column is washed with approximately 500 ul of DEPC water and
approximately 60-120 ml of air is forced through the column to
dry.
[0050] When a syringe is utilized, the column is sealed against the
end of a 10-ml syringe (element 24 in FIG. 1C) without any glue
using the O-ring from a 1.5-ml screw-cap microcentrifuge tube
introduced between the syringe and the top of the column, and
washed once with 500 .mu.l of diethyl pyrocarbonate (DEPC)-treated
water.
[0051] When the protocol is conducted in stationary environs, for
example in a laboratory, the syringe operations can be replaced
with centrifugation. In such instances, typical sedimentation
forces and times are employed to effect separation of target from
non-target moieties. Typically 10,000 g for 30 seconds provides
good results.
[0052] To this silica mini-column is added either whole cells, DNA
or RNA. The protocols for the isolation and fractionation of these
various feedstocks are discussed infra.
[0053] Total Nucleic Acid Isolation Detail
[0054] A variety of cells can be lysed and manipulated via the
invented column protocol, including, but not limited to
gram-positive cells, gram-negative cells, eucaryotes, and human
cells. For the sake of simplicity, specific bacterial strains are
discussed herein. Bacterial strains B. subtilis B-459, B.
thuringiensis 4Q281, and E. coli BL21, as well as human HL60 cells,
were used as starting material.
[0055] Gram-positive cells were pretreated by incubation with 25
.mu.l of a lysozyme solution (100 mg/ml) at 37.degree. C. for 5 min
before lysis. A cell pellet obtained from 1 ml of log-phase
bacterial (2.times.10.sup.8 to 5.times.10.sup.8 cells/ml) which
were grown in standard LB medium, or human HL60 cells cultures
(6.times.10.sup.6 cells/ml) that were grown as described supra, was
lysed by adding 550 .mu.l of mixture (9:4) of lysis (L) and binding
(B) buffers. Buffer L was composed of 4.5 M guanidine thyocianate
(GuSCN) and 100 mM EDTA (pH 8); buffer B contained 4 M GuSCN, 135
mM Tris--HCl (pH 6.4), 3.5% (wt/vol) Triton X-100, 17.5 mM EDTA,
and 215 mM MgCl.sub.2. The lysate was applied to a silica
mini-column, which was washed by using centrifugation (10,000 g, 30
sec.) or via the syringe 24 (twice with 0.5 ml of the L/B mixture
(9:4), twice with 0.5 ml of 70% (vol/vol) ethanol, and once with
0.5 ml of 100% ethanol). The column was dried by forcing 5 ml of
air through the column with the syringe 24. The bound nucleic acids
were either eluted from the column by passing through same
2.times.60 ul of 1 mM HEPES (pH 7.5) or directly subjected to
labeling/fragmentation.
[0056] RNA/DNA Isolation and Fractionation Detail
[0057] A cell pellet obtained from 1 ml of log-phase culture was
lysed by the addition of 450 .mu.l of buffer L (Gram-positive cells
were pretreated with lysozyme as described above). DNA was isolated
by passing the lysate over the syringe-column, allowing DNA to bind
to the silica. Buffer B (200 .mu.l) was added to the flow-through
RNA fraction, which was then applied to the analogous fresh column.
The first column containing bound DNA was washed five times with
0.5 ml of buffer L, twice with 0.5 ml of 70% (vol/vol) ethanol, and
once with 0.5 ml of 100% (vol/vol) ethanol. The second column
containing bound RNA was washed twice with 0.5 ml of the L/B
mixture (9:4), and ethanol as described for isolation of total
nucleic acids (see previous section). Fractionated DNA or RNA was
either eluted as described above, or directly subjected to
labeling/fragmentation on the column.
[0058] Column-Labeling, -Fragmentation and -Hybridization
Detail
[0059] The following protocol pertains to a specific sized column,
as outlined supra. As such, while the fluid volumes are specific, a
technician skilled in the art of laboratory science can scale the
volumes up to industrial-scale operations.
[0060] The silica column containing bound RNA, DNA, or both was
sealed at the bottom with a cap from a microcentrifuge tube and
pre-heated in a sand bath at 95.degree. C. for 2 min. Freshly
prepared (heated for approximately 95 C for 30 seconds) labeling
cocktail (132 .mu.l) containing 5 ul of 150 mM 1,10-phenanthroline,
5 ul of 15 mM CuSO.sub.4, 1 ul 100 mg/ml Lissamine rhodamine B
ethylenediamine (Molecular Probes, Inc., Eugene, Oreg.), and 121 ul
of 25 mM sodium phosphate (pH 7.0), was mixed with 3 ul 200 mM
H.sub.2O.sub.2 and 15 ul 200 mM NaCNBH.sub.3 and immediately
applied to the minicolumn. The column was then sealed to prevent
evaporation. After incubation for 10 min at 95.degree. C., the
reaction was stopped by adding 2.7 .mu.l of 500 mM EDTA (pH 8.0).
Nucleic acids were precipitated on the column by adding 17.3 .mu.l
of 3 M sodium acetate and 540 .mu.l of cold (approximately 4 C)
100% (vol/vol) ethanol, followed by a 5-min incubation at room
temperature.
[0061] Excess fluorescent label was removed by washing the column
twice with 1.5 ml of 100% (vol/vol) ethanol. The column was then
dried with forced air. The labeled product was eluted twice with
45-60 .mu.l of 1 mM HEPES (pH 7.5). The eluant was adjusted to
contain 5 mM EDTA, 1 M GuSCN, and 50 mM HEPES (pH 7.5) and filtered
through a 0.45-.mu.m Millex-HV syringe filter (Millipore, Bedford,
Mass.).
[0062] The resulting solution (30 .mu.l) containing 5 to 15 .mu.g
of nucleic acids, including 1 to 3.5 .mu.g of 16S rRNA, was applied
to the oligonucleotide microarray covered with a 0.5-mm-deep,
13-mm-diameter CoverWell gasketed incubation chamber (Grace
Bio-Labs, Inc., Bend, Oreg.) and incubated for 20 min at room
temperature.
[0063] Chemical Fragmentation and Labeling Detail
[0064] The column device is used in conjunction with the inventors'
method for using redox-reactive coordination complexes to fragment
and label RNA and DNA. The developed protocol can be used for both
DNA and RNA-non-specific fragmentation and labeling.
[0065] Specifically, the inventors have utilized oxidants, which
have free radical characteristics, to facilitate the labeling of
nucleic acids. The advantages of the radical-mediated labeling
methods are simplicity and high speed. In addition, the reactions
are run at any temperature selected below the boiling point of
water, and preferably from between 30.degree. C. and 100.degree.
C.
[0066] The inventors have determined that redox-active coordination
complexes such as OP--Cu and Fe-EDTA can be effectively used for
sequence-independent nucleic acid fragmentation and labeling with
fluorescent dyes as part of a DNA microchip protocol. Radicals
generated with OP--Cu and Fe-EDTA effectively attack both DNA and
RNA.
[0067] A myriad of coordination complexes are utilized in the
invented method, including, but not limited to,
1,10-phenanthroline-Cu(II) (hereinafter referred to as OP--Cu),
bleomycin-Fe(III) (hereinafter referred to as BLM-Fe), EDTA-Fe,
ascorbic acid-Cu, methylene-blue-Cu, metallogporphyrins, and other
chemical nucleases. These radical producing complexes facilitate
amine-hydrazide-nucleic acid crosslinking. For example, in the
presence of hydrogen peroxide, the BLM-Fe complex catalyzes the
formation of free nucleic acid bases and the aldehyde form of
deoxyribose at the abasic site of the DNA backbone. The backbone
typically undergoes scission in the presence of alkali or
amines.
[0068] Generally, the invention embodies a two step method for
labeling DNA and RNA molecules with compounds containing primary
amines. First, DNA or RNA is modified with radicals produced via a
reaction between hydrogen peroxide and a coordination complex.
These radicals attack the nucleic acids, resulting in the formation
of the aldehyde forms of ribose or deoxyribose (See Equation 1).
1
[0069] wherein NA designates nucleic acid, R. is the product of a
chemical radical production, of the type discussed supra,
NH.sub.2--F is a fluorescent dye F conjugated with primer
containing primary amine, NaCNBH.sub.3 is a reducing agent,
.SIGMA.Na.sub.i, --CH.dbd.O depicts an intermediate nucleic-acid
form containing the aldehyde or ketone moiety, typically on the 5'
carbon or on the sugar (ribose) itself. The reactive aldehyde- or
ketone-group on the DNA and RNA thus serves in the second step of
the method as the substrate for subsequent labeling reactions.
[0070] In the second step of the method, a primary amine is
combined with the aldehyde- or ketone-group in a condensation
reaction to produce a Schiff base or amides. The Schiff base is
reduced and the product of this reduction step is labeled with a
desirable tag. Alternatively, and as depicted above in Equation 1,
the reduction and labeling step can be combined. The reduction
and/or labeling processes can be done in aerobic or anaerobic
conditions.
[0071] The invented method produces high yields of crosslinked
complexes. It is only slightly dependent on the nucleic acid
sequence or reaction temperature. The same invented protocol can be
utilized to label both DNA and RNA. The resulting labeled products
are effective probes in hybridization experiments.
[0072] FIGS. 2 and 3 depict the mechanisms for dye cross linking to
modified DNA and RNA, respectively. Hemiacetal, lactone, and
5'-aldehyde are the common intermediates in the oxidative strand
scission of nucleic acids by radical-generating agents. These
intermediates appear after base elimination has occurred and they
may serve as cross-linking sites for primary amines in the invented
radical-mediated nucleic acid labeling procedure.
[0073] As depicted in FIG. 2A, five carbon atoms of the DNA sugar
residue have a total of seven hydrogen atoms available for
abstraction by an oxidizing agent. The main pathway of DNA cleavage
by OP--Cu is H-1 abstraction. OP--Cu also cleaves DNA with H-4
abstraction. OP--Cu degradation is associated with some slight
sequence specificity.
[0074] The Fe-EDTA complex is negatively charged and so does not
interact directly with the DNA molecule. Instead, the Fe-EDTA
complex, in the presence of hydrogen peroxide, produces hydroxyl
radicals which have no charge and are therefore able to diffuse
into the molecule. Abstraction of the H-4 and H-5 are the
predominant pathways. Preference for individual hydrogen atoms was
H-5>H-4>H-2=H-3>H-1.
[0075] H-4 abstraction under anaerobic conditions results in
nucleobase release with the production of a hemiacetal intermediate
(FIG. 2A,1) that is in equilibrium with the aldehyde form of
deoxyribose (FIG. 2A,2). Anaerobic conditions were utilized to
optimize amine cross-linking. Generally, oxygen was reduced in
reactants and reactant solutions by bubbling with argon. The
inventors found that, at least for OP--Cu oxidation protocols, a 15
percent increase in hybridization signal was realized when
anaerobic conditions were utilized.
[0076] The aldehyde group generated by the initial oxidation step
is attacked by a nucleophilic moiety (such as a primary amine or a
hydrazide), creating a reversible covalent bond (Schiff base). The
resultant imine undergoes spontaneous conversion with the
3'phosphodiester bond cleaved by the mechanism of
.beta.-elimination. This facilitates the simultaneous cross-linking
of amine or hydrazine derivatives of the fluorescent dyes to the
modified DNA at the same time as fragmentation occurs.
[0077] After fragmentation and cross-linking, reduction of the
Schiff base with sodium cyanoborohydride is desirable for
production of the final labeled product, (FIG. 2A,3). This prevents
removal of the cross-linked dye by .delta.-elimination.
[0078] Another DNA intermediate used for labeling with
amino-derivatives of fluorescent dyes is meta-stable lactone in
FIG. 2B. Reaction of this lactone with a primary amine leads to two
stable labeled products, (FIGS. 2B,5, 6).
[0079] The H-5' abstraction pathway under both aerobic and
anaerobic conditions results in the production of an
oligonucleotide 5'-aldehyde, as depicted in FIG. 2, C. In one
scenario, the aldehyde reacts with amines through the formation of
a Schiff base in the same manner as described for the anaerobic
pathway depicted in FIG. 2A. In this labeling reaction, the
presence of sodium cyanoboro-hydride in the reaction buffer or
immediate sodium cyanoborohydride treatment following Fe-EDTA
treatment is desirable for fast Schiff base reduction and
subsequent production of a stable covalent complex 8.
[0080] FIG. 3 depicts differences in labeling protocol between DNA
and RNA. Specifically, the presence of the hydroxyl group in the
2'-position of ribose results in the production of
.alpha.-oxa-.gamma.-lactone, (FIG. 3A,9) instead of lactone 4 (of
FIG. 2B,4) produced in the DNA manipulation. This lactone is able
to react with primary amines to form an amide (FIG. 3A,10), or a
Schiff base with an aldehyde group. The Schiff base then can be
reduced to produce a stable complex (FIG. 3A,11). Alternatively, a
putative intermediate (FIG. 3B,12) serves as a substrate for
cross-linking with primary amines to form stable labeled products
(FIGS. 3A,14 and 17).
[0081] The inventors have found that linking the dye to the end of
the nucleic acid fragment is more useful than having the dye
randomly localized along the fragment. Having the dye at the end of
the fragment causes minimal steric interference during subsequent
hybridization. The invented method of using radical mediated
labeling is an effective method for placing the majority of the dye
on the ends of the nucleic acid fragments.
[0082] In summary, radical mediated labeling results in the
cross-linking of the flourescent dye to the 5'- or 3'-end of the
nucleic acid strand, as depicted in FIGS. 2 and 3.
[0083] Oligonucleotide Synthesis and Array Fabrication Detail
[0084] Oligonucleotide microarrays were constructed with 10
oligonucleotide probes, each approximately 20 bases in length, with
the following sequences (5'.fwdarw.3'): EU1, ACCGCTTGTGCGGGCCC;
EU2, TGCCTCCCGTAGGAGTCT; U1, GA/TATTACCGCGGCT/GGCTG; U2,
ACGGGCGGTGTGTA/GCAA; BSG1, ATTCCAGCTTCACGCAGTC; BSG2,
ACAGATTTGTGGGATTGGCT; BS1, AAGCCACCTTTTATGTTTGA; BS2,
CGGTTCAAACAACCATCCGG; BCG1, CGGTCTTGCAGCTCTTTGTA; BCG2,
CAACTAGCACTTGTTCTTCC. Each potential probe was tested against all
available 16S rRNA sequences (GenBank and RDP) by a function that
estimates the relative duplex stability according to the number and
position of mismatches.
[0085] If the 16S rRNA of any microorganism that did not belong to
the genus of interest formed stable duplexes with any
oligonucleotide considered as a potential probe for the microchip,
this oligonucleotide was excluded from the list of probes.
Oligonucleotides were synthesized with a 394 DNA/RNA Synthesizer
(Perkin Elmer/Applied BioSystems, Foster City, Calif.) using
standard phosphoramidite chemistry. 5.cent.-Amino-Modifier C6 (Glen
Research, Sterling, Va.) was linked to the 50-end of
oligonucleotides. The microarray matrix containing 100'100'20-mm
polyacrylamide gel pads fixed on a glass slide and spaced by 200 mm
from each other was manufactured using photopolymerization D.
Gushin, Anal. Biochem. 250, 203-211, and incorporated herein by
reference, and activated as described in D. Proudnikov et al. Anal.
Biochem. 259, 34-41, which is also incorporated herein by
reference.
[0086] Predetermined aliquots of individual 1 mM
amino-oligonucleotide solutions were applied to each gel pad,
containing aldehyde groups. Schiff bases coupling the
oligonucleotides with aldehyde groups within the gel pads were
stabilized by reduction with NaCNBH.sub.3 as described herein, and
also in Timofeev et al. Nucl. Acids Res. 24, 3142-3148 (1996),
incorporated herein by reference.
EXAMPLE 1
[0087] Hybridization of Total NA Labeled With OPCu Using Oligo
Microarray
[0088] Up to 70 percent of total bacterial nucleic acid is rRNA.
Therefore rRNA analysis is a common, sensitive and relatively
simple method of bacterial identification.
[0089] FIG. 4 depicts the results when total nucleic acids are
labeled with OP--Cu using the invented column device. FIG. 4A
depicts the arrangement of the probes (having the sequences
disclosed above) on the micro array. U1 and U2 represents "all
life" (i.e., these probes screen for all procaryotic and eucaryotic
cells except for some archibacteria). EU1 and EU2 represents all
eubacteria. BSG1 and BSG2 represents B. subtilis group bacteria.
BS1 and Bs2 represents B. subtilis sp. BCG1 and BCG2 represents
cereus group bacteria.
[0090] FIG. 4B depicts the analysis of E. coli hybridization with a
stationary microscope.
[0091] FIG. 4C depicts the same analysis using a portable
imager.
[0092] Normalized fluorescent signal intensities for labeled HL60
cells are depicted in FIG. 4D. Normalized intensities for E. coli
are depicted in FIG. 4E. Signal intensities for B. thuringiensis
and B. subtilis are depicted in FIGS. 4F and G, respectively.
Fluorescent intensities were quantified using "Image", a custom
LabView.TM. program available through National Instruments, Austin,
Tex.
EXAMPLE 2
[0093] Hybridization of Total NA Labeled With Fe-EDTA With
Microarray
[0094] Example 2 provides data wherein a FeEDTA labeling method is
used with the invented column protocol and device. Unlike the
OP--Cu protocol, the FeEDTA method does not depend on the presence
of reducing agents in the labeling cocktail.
[0095] Freshly prepared cocktail (135 .mu.l) containing 30 ul of 5
mM EDTA/2.5 mM ammonium iron (II) sulfate, 1 ul 100 mg/ml Lissamine
rhodamine B ethylenediamine, 30 ul sodium phosphate (ph 7.0) and 74
ul DEPC-treated H.sub.2O was preheated 95.degree. C. for 30 sec. 15
ul of 100 mM H.sub.2O.sub.2 was added and immediately applied on
the column containing total nucleic acids isolated from B.
thuringiensis str. 4Q281. All other procedures were identical as in
the OP--Cu protocol. Results of this hybridization is depicted in
FIG. 5.
[0096] The microarray depicted in FIG. 5 is identical to the
immobilized gel sequence arrangement depicted in FIG. 4. As can be
noted, the entire first column of the array, from top to bottom
(i.e., EU1, EU2, U1, and U2), is illuminated. Also, the first two
cells in the second column from top to bottom (i.e., BSG1 and BSG2)
are illuminated.
[0097] In summary, a procedure has been developed for nucleic acid
isolation, labeling, and fragmentation within a single
syringe-operated silica minicolumn. The process requires no vacuum
filtration step, phenol-chloroform extraction, CsCl fractionation
or centrifugation. This syringe-operated format is useful for field
conditions. Alternatively, the syringe-based protocols can be
replaced with centrifugation separations when the column protocol
is utilized in laboratory settings. There are three main steps to
the column protocol: 1) cell lysis and nucleic acid isolation; 2)
fluorescent labeling and fragmentation of nuclei acids (whereby DNA
or RNA can be labeled using the same protocol); and 3) the removal
of short oligonucleotides and unbound dye from the column.
[0098] While the invention has been described with reference to
details of the illustrated embodiment, these details are not
intended to limit the scope of the invention as defined in the
appended claims.
Sequence CWU 1
1
* * * * *