U.S. patent application number 10/184508 was filed with the patent office on 2003-05-22 for use of a native epitope for selecting evolved binding members from a library of mutants of a protein capable of binding to said epitope.
Invention is credited to Logtenberg, Ton.
Application Number | 20030096225 10/184508 |
Document ID | / |
Family ID | 8241110 |
Filed Date | 2003-05-22 |
United States Patent
Application |
20030096225 |
Kind Code |
A1 |
Logtenberg, Ton |
May 22, 2003 |
Use of a native epitope for selecting evolved binding members from
a library of mutants of a protein capable of binding to said
epitope
Abstract
The invention provides a method for selecting at least one
member from a library of proteinaceous molecules comprising
providing at least one cell and/or a functional equivalent
thererof, with at least part of said library under conditions that
allow binding of any such member to an epitope in and/or on said
cells and/or said functional equivalent thereof, removing unbound
proteinaceous molecules and selecting said at least one member,
wherein said library comprises at least one mutant of a
proteinaceous molecule capable of binding to said epitope.
Inventors: |
Logtenberg, Ton; (Werkhoven,
NL) |
Correspondence
Address: |
TRASK BRITT
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Family ID: |
8241110 |
Appl. No.: |
10/184508 |
Filed: |
June 27, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10184508 |
Jun 27, 2002 |
|
|
|
PCT/NL00/00941 |
Dec 21, 2000 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/7.1;
530/350; 530/388.1 |
Current CPC
Class: |
G01N 33/6857 20130101;
C07K 2317/56 20130101; C07K 2317/734 20130101; C07K 16/30 20130101;
C07K 2317/21 20130101; C07K 2317/732 20130101; C07K 2317/622
20130101; C07K 16/00 20130101; C07K 2317/565 20130101; G01N 33/6854
20130101; A61K 2039/505 20130101; A61P 35/00 20180101 |
Class at
Publication: |
435/5 ; 435/7.1;
530/350; 530/388.1 |
International
Class: |
C12Q 001/70; G01N
033/53; C07K 016/40; C07K 014/47 |
Claims
1. A method for selecting at least one member from a library of
proteinaceous molecules comprising providing at least one cell
and/or a functional equivalent thereof, with at least part of said
library under conditions that allow binding of any such member to
an epitope in and/or on said cells and/or said functional
equivalent thereof, removing unbound proteinaceous molecules and
selecting said at least one member, wherein said library comprises
at least one mutant of a proteinaceous molecule capable of binding
to said epitope.
2. A method according to claim 1, wherein at least one of said
proteinaceous molecules comprises a single chain antibody and/or a
FAB fragment, or a functional equivalent thereof.
3. A method according to claim 1 or claim 2, wherein said at least
one mutant of a proteinaceous molecule is associated with nucleic
acid encoding said at least one mutant proteinaceous molecule.
4. A method according to claim 3, wherein said association is
achieved through a vehicle that is physically linked to said at
least one mutant proteinaceous molecule.
5. A method according to claim 4, wherein said vehicle comprises a
virus-like particle such as a phage capsid or a functional
equivalent thereof.
6. A method according to anyone of claims 1-5, wherein said epitope
comprises a tumour-associated epitope.
7. A proteinaceous molecule obtainable by a method according to
anyone of claims 1-6.
8. A molecule capable of binding to an epitope, comprising at least
part of a member obtained with a method according to anyone of
claims 1-6.
9. A molecule according to claim 7 or claim 8, wherein said
molecule comprises an antibody or a functional part thereof.
10. A molecule according to claim 9, wherein said antibody is
human, humanised and/or human-like, or a functional equivalent
thereof.
11. Use of a cell and/or a functional equivalent thereof displaying
an epitope, for obtaining an evolved epitope binding molecule with
an enhanced property as compared to the epitope binding molecule
said evolved epitope binding molecule is at least in part derived
from.
12. A use according to claim 11, wherein said epitope binding
molecule comprises a part of a complementarity determining region
of an antibody or a functional equivalent thereof.
13. A use according to claim 11 or claim 12, wherein said property
comprises an enhanced epitope binding property.
14. A use according to anyone of claims 11-13, wherein said
property comprises an enhanced tissue penetration property.
15. A use according to anyone of claims 11-14, wherein said
property comprises an enhanced complement activation property.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of International
Application Number PCT/NL00/00941 filed on Dec. 21, 2000,
designating the United States of America, International Publication
No. WO 01/48485 (Jul. 5, 2001), the contents of the entirety of
which is incorporated by this reference.
BACKGROUND OF THE INVENTION
[0002] The invention relates to the field of biotechnology. More in
particular the invention relates to the field of antibodies and
uses thereof. One of such use relates to medical uses of
antibodies.
[0003] The exposure to a highly diverse and continuously changing
environment requires a dynamic immune system that is able to
rapidly adapt in order to adequately respond to potentially harmful
micro-organisms. Higher organisms have evolved specialized
molecular mechanisms to ensure the implementation of
clonally-distributed, highly diverse repertoires of
antigen-receptor molecules expressed by cells of the immune system:
immunoglobulin (Ig) molecules on B lymphocytes and T cell receptors
on T lymphocytes. For B lymphocytes, a primary repertoire of
(generally low affinity) Ig receptors is established during B cell
differentiation in the bone marrow as a result of rearrangement of
germline-encoded gene segments. Further refinement of Ig receptor
specificity and affinity takes place in peripheral lymphoid organs
where antigen-stimulated B lymphocytes activate a somatic
hypermutation machinery that specifically targets the
immunoglobulin variable (V) regions. During this process, B cell
clones with mutant Ig receptors of higher affinity for the inciting
antigen are stimulated into clonal proliferation and maturation
into antibody-secreting plasma cells (reviewed in 1)
[0004] In recent years, recombinant DNA technology has been used to
mimic many aspects of the processes that govern the generation and
selection of natural human antibody repertoires (reviewed in 2,3).
The construction of large repertoires of antibody fragments
expressed on the surface of filamentous phage particles and the
selection of phages by panning on antigens has been developed as a
versatile and rapid method to obtain antibodies of desired
specificities (reviewed in 4,5). Further optimization of the
affinity of individual phage antibodies has been achieved by
creating mutant antibody repertoires that are expressed on
bacteriophage particles and sampled for higher affinity mutants by
selection for binding to antigen under stringent conditions
(reviewed in 6). Various approaches have been used to create
mutated antibody repertoires, including chain shuffling (7,8),
error prone PCR (9), use of E. coli mutator strains (10) or
approaches more specifically directed to the complementarity
determining regions (CDRs) of the antibody molecule, like CDR
walking and parsimonious mutagenesis (11-13).
[0005] To select higher affinity mutants from a library of
phage-displayed, mutagenized antibody fragments, selections have
been performed on purified immobilized antigen or biotinylated
antigen in solution, followed by capture of phage bound on
streptavidin magnetic beads (14 16). It has been demonstrated that
the selection of a higher affinity single chain Fv antibody
fragments (scFv) specific for the antigen c-erb-2 from phage
libraries of mutants of that scFv was dependent on the availability
of purified antigen in solution. Antigen captured on a solid phase
resulted in the isolation of false positives with higher avidity
rather than affinity due to the dimerization and oligomerization of
the scFv on the phage. In addition, it was shown to be crucial for
the isolation of higher affinity scFv to perform subsequent rounds
of phage selections with carefully controlled and increasingly
lower antigen concentrations in solution (14). Although very high
affinity scFv have been isolated with these approaches, they are
not readily applicable when the target antigen is difficult to
express as a recombinant molecule or tedious to purify in
sufficient quantities without loosing its native configuration.
Examples of these types of molecules are seven-transmembrane
spanning proteins, insoluble lipid-modified membrane molecules and
post-translationally-modified proteinaceous molcules that are
specific for particular cell types or disease states. Thus a
selection procedure for higher affinity mutant antibody fragments,
without the need for purified antigen would represent an important
extension of affinity maturation strategies for phage displayed
antibodies.
[0006] The invention now in one aspect provides a method for
selecting a member from a library of proteinaceous molecules
comprising providing cells and/or a functional equivalent thereof,
with at least part of said library under conditions that allow
binding of any member to an epitope in and/or on said cells and/or
said functional equivalent thereof, removing unbound proteinaceous
molecules and selecting said member, wherein said library comprises
at least one mutant of a proteinaceous molecule capable of binding
to said epitope. Preferably a mutant comprises one or more
mutations that affect the capability of binding of the mutant to
said epitope in a positive or negative way, compared with the
unmutated proteinaceous molecule. The capability may be affected by
an altered binding affinity or altered dissociation constant, or
both.
[0007] A member of the library is a proteinaceous molecule present
in said library and/or a proteinaceous molecule selected from said
library. A selected member typically comprises the capacity to bind
to said epitope. Once selected and characterised a member may also
be generated in another way for instance artificially, through
molecular biological techniques such as but not limited to peptide
synthesis or the expression of a nucleic acid encoding said
proteinaceous molecule. A proteinaceous molecule may be a peptide,
a polypeptide or a protein. Peptides are strings of amino acids
linked together by a peptide bond. Although not precisely defined,
peptides typically comprise between 2 and 50 amino acids.
Polypeptides are longer peptides that may contain up to thousands
of peptide bond-linked amino acids. The words polypeptide and
protein are often interchangeably used to describe single, long
polypeptide chains. In addition, proteins may consist of multiple
polypeptide chains that collectively form the basis of a complex
three-dimensional structure. A peptide, a polypeptide and/or a
protein may comprise modifications such as those generated by a
cellular protein modification machinery. A mutant of a
proteinaceous molecule is a proteinaceous molecule comprising one
or more changes compared to the unmutated proteinaceous molecule. A
change can comprise for instance an exchange, a deletion, an
insertion or an addition of one or more amino-acids or a
combination of these changes. Preferably but not necessarily said
mutation is generated through a change in a nucleic acid encoding
said proteinaceous molecule.
[0008] A library comprises at least one mutant of a proteinaceous
molecule capable of binding to an epitope. Typically, a library
will comprise more than 100 different mutants of said proteinaceous
molecule. Such a library may be used on its own or it may be
combined with one or more other libraries comprising at least one
mutant of another proteinaceous molecule capable of binding to at
least a part of said epitope. An advantages of such a combination
is that it increases the complexity of mutants thereby increasing
the odds for finding a particularly favourable mutant. A library
may of course also be combined with other libraries or
proteinaceous molecules. One such combination may be occasioned by
the desire to provide a library comprising an array of mutants of
different proteinaceous molecules capable of binding to different
epitopes present on a certain target molecule.
[0009] An epitope according to the invention is typically present
in and/or on a protein produced by a cell. An epitope is a binding
site capable of binding said proteinaceous molecule. An epitope may
be (part of) any kind of molecule. Typically, an epitope comprises
a peptide, a polypeptide, a protein and/or a modification such as
produced by a cellular protein modification machinery.
[0010] The cells to which at least part of the library is provided
can be living cells and/or dead cells. Typically cells are obtained
from a culture. Cells may be processed prior to providing at least
part of the library. For instance, for fixation purposes and/or
permeabilisation purposes. A functional equivalent of cells is a
crude cellular extract. In such an extract the structure of the
cells is usually distorted in such a way that individual cells can
essentially not be recognised through microscopic means. A crude
extract may have undergone several steps to remove one or more
undesired components. However, extracts comprising essentially only
a proteinaceous molecule comprising said epitope are not considered
crude extracts. The division line between what can be considered to
be a crude extract and what must be considered to be a purified
extract is difficult to give. However, extracts comprising more or
less intact organelles are functionally equivalent to cells. A
functional equivalent of a cell must comprise most of the epitope
in a form essentially similar to a form the epitope has when it is
present in and/or on an intact cell comprising said epitope.
[0011] Removal of the part of the library that is not bound to the
cells and/or the functional equivalent thereof, can be achieved
through washing the cells and/or functional equivalent thereof with
a suitable solution such as a buffered isotonic solution. Cells can
be washed easily by pelleting the cells and suspending the cells in
a suitable solution. For removal of that part of the library that
is not bound to a functional equivalent of cells, such as an
extract of cells, it is advantageous to attach the functional
equivalent thereof to a carrier thus enabling easy manipulation of
the functional equivalent. Cells may of course also be attached to
a carrier. A preferred method of removing unbound proteinaceous
molecules is by means of one or more washing steps. It is
advantageous to provide for one or more stringent washing steps to
remove proteinaceous molecules that are bound with an eventually
undesired low affinity. For cells or parts thereof such as
organelles and/or membranous particles attachment to a carrier is
not required, though may still be advantageous. A method of the
invention usually comprises more than 10,000 cells or functional
equivalent thereof. However, lower amounts of cells or equivalent
thereof may also be used. The invention can even be performed using
only one cell.
[0012] A proteinaceous molecule may be any proteinaceous molecule
capable of binding to an epitope. Non-limiting examples of such a
proteinaceous molecule are an antibody (artificial or natural), a
FAB-fragment(artificial or natural), a single chain Fv fragment, a
T-cell receptor, a ligand, a receptor, a peptide selected
preferably from a library for specific epitope binding capacity or
a matrix attachment protein. Of course, functional equivalents of
said proteinaceous molecules may also be used. Such a functional
equivalent comprises the same epitope binding activity in kind not
necessarily in amount. A functional equivalent may be a part, a
derivative and/or an analogue of said proteinaceous molecule. A
derivative is typically obtained through amino-acid substitution. A
proteinaceous molecule is said to be able to bind to an epitope
when cells comprising said epitope, upon exposure to said
proteinaceous molecule followed by one or more washing steps, are
found to retain said proteinaceous molecule to a significantly
higher extend than other cells, essentially not comprising said
epitope.
[0013] In a preferred embodiment of the invention said
proteinaceous molecule comprises a single chain Fv fragment (scFv)
and/or a FAB fragment, or a functional equivalent thereof. A
functional equivalent of said scFv and/or said FAB fragment is a
part, derivative and/or analogue of said scFv and/or said FAB
comprising essentially the same binding activity as said scFv
and/or FAB fragment in kind not necessarily in amount.
[0014] In a preferred embodiment said each of said mutants of a
proteinaceous molecule is physically linked to a vehicle comprising
nucleic acid encoding said mutant proteinaceous molecule. This has
the advantage that when said member is recovered from said cells
and/or functional equivalent thereof, one simultaneously recovers
nucleic acid encoding said proteinaceous molecule. Said nucleic
acid is then available for multiplication, analysis, subcloning
and/or expression in a cell.
[0015] Preferably, said vehicle comprises a virus-like particle
such as a phage capsid or a functional equivalent thereof. A
virus-like particle is preferred since it is able to condense
nucleic acid into a manageable form. A virus-like particle is also
preferred for the reason that it may be used to efficiently
introduce the nucleic acid of the selected member into a cell. This
is particularly advantageous when the nucleic acid, once introduced
in the cell, is capable of multiplication, thus allowing for
instance the easy isolation of relatively large amounts of said
nucleic acid.
[0016] In another preferred aspect of the invention said epitope
comprises a tumour-associated epitope. A tumour-associated epitope
is an epitope essentially characteristic for tumour cells in a
body. Said epitope can be present in other cells as long as it is
not present in said other cells in the same way as in tumour cells.
For instance, an epitope is a tumour-associated epitope when it is
present on the surface of a tumour cell and essentially not present
on the surface of non-tumour cells due to, for instance but not
limited to, a substantially lower expression of said epitome in
non-tumour cells. Said epitope may also he present on other cells
as long as said cells do not normally co-exist with tumour cells in
the same body. A typical example is a tumour-associated epitope
present on foetal cells but essentially not present on normal adult
cells. A tumour-associated epitope may be individually determined,
i.e. a tumour-associated epitope for one individual may not be a
tumour-associated epitope in another individual of the same
species. A tumour-associated epitope may also be a part of a
protein that is present on normal cells but wherein the
glycosylation of the protein in normal cells is different from the
glycosylation of the protein on tumour cells.
[0017] In another aspect the invention provides a molecule capable
of binding to said epitope, comprising at least part of a member
obtained with a method according to the invention. In one
embodiment said part comprises a part of the epitope binding site
of said member, or a functional equivalent thereof. In another
embodiment said part is a part not directly involved in epitope
binding. One example of such a part not directly involved in
epitope binding is a part involved in the association with
complement factors. Another example is a part associated with
tissue penetration of said proteinaceous molecule. This may be due
to altered epitope binding properties or due to other mutations. A
part can of course comprise more than one property. For instance a
part may comprise the epitope binding site and a part involved in
association with complement factors. Preferably said molecule
comprises an antibody or a functional part thereof. Said antibody
is preferably synthesised artificially. Preferably, in a cell
cultured in vitro. In one embodiment said antibody is human,
humanised and/or human-like, or a functional equivalent
thereof.
[0018] In another aspect the invention provides the use of a cell
and/or a functional equivalent thereof displaying an epitope for
obtaining an evolved epitope binding molecule with an enhanced
property as compared to the epitope binding molecule said evolved
epitope binding molecule is at least in part derived from. In one
embodiment said epitope binding molecule comprises a part of a
complementarity determining region of an antibody or a functional
equivalent thereof. In another embodiment said property comprises
an enhanced epitope binding property. In yet another embodiment
said property comprises an enhanced tissue penetration property
and/or an enhanced complement activation property.
[0019] In one embodiment of the invention higher affinity huMabs
that bind to the tumor-associated antigen Ep-CAM were obtained by
constructing small phage display libraries of mutant scFv antibody
fragments derived from the parental anti-Ep-Cam scFv UBS-54. These
libraries were subsequently panned on intact Ep-Cam-positive tumor
cells. Stringent washing steps during phage selections resulted in
the isolation of scFv C52, which was converted into an intact IgGl
huMab with a 15-fold affinity improvement and a KD=4*10.sup.-10 M.
The affinity improvement resulted mainly from a lower k.sub.off (or
dissociation constant). Light chain shuffling and DNA shuffling
were employed to introduce mutations in the antibody V regions. The
approximately four fold increase in affinity achieved with each of
these mutagenesis approaches were comparable to results achieved by
antibody affinity maturation using other mutagenesis and phage
display selection techniques (11,14,33). In the present invention
it is demonstrated that affinity selection can be performed on
intact fixed cells, precluding the need to purify or express the
target antigen as a recombinant molecule. Previous selection
procedures for isolation of higher affinity antibody variants from
phage display libraries have used purified soluble antigen or
antigen immobilized on a solid phase as targets for phage
selections. It has been noted that selection on solid-phase-bound
antigen results in the preferential selection of dimeric over
monomeric scFv, due to avidity, thus interfering with the selection
of truly higher affinity scFv (14). Selection in solution reduces
the avidity effect but requires the careful and step-wise reduction
of target antigen concentration in subsequent selection rounds
(14). As has been noted for other scFv, in solution scFv UBS-54 is
a mixture of dimers (30%) and monomers (70%). This ratio was
maintained in mutants A37, B43, and C52, showing that the selection
on intact cells did not result in a biased selection for dimers
(data not shown). Screening for higher affinity binders out of a
selected phage pool has been carried out by ranking of mutant scFv
according to a lower k.sub.off as determined by surface plasmon
resonance (6). Although we attempted to rank our selected scFv
according to this method, we found the experimental data with crude
periplasmic scFv preparations difficult to evaluate due to
complexity of the affinity plots (RU versus time), resulting from
the mixtures of monomer, dimers and aggregates. We therefore
decided to pursue clones that were dominating the phage pools after
three rounds of selection. Of note, dominance of phage clones in
selections is not entirely determined by affinity but also
influenced by scFv expression level, folding efficiency and level
of toxicity to E. Coli. Although in our analysis, the presence of
dominant clones correlated with higher affinity scFv, we can not
exclude that other, higher affinity yet less dominant clones were
present in the selected phage pools.
[0020] Light chain shuffling resulted in the replacement of the
original Vk2 light chain by a Vk3 light chain in mutant A37.
Structural analysis revealed that the canonical structure of the
Vk3 light chain in A37 consisted of a much shorter loop, creating a
broader interaction surface. Thermodynamically, it is attractive
for antigen-antibody interactions to have a large and close
interaction surface because more water molecules are excluded (gain
in solvent entropy) and, more importantly, many simultaneous
interactions (hydrogen bonds, van der Waals and dipole-dipole
interactions) can occur between epitope and paratope (contributing
to binding enthalpy) (23). Structurally, this results in a broad
face binding site of the antibody that is complementary to an
equally broad epitope on a large interacting protein. In contrast,
binding sites consisting of deep clefts that snugly surround
antigen are generally associated with small ligands such as
peptides and low molecular weight organic molecules (23).
[0021] DNA shuffling of the VL region but not the VH region
resulted in the isolation of higher affinity antibodies. The
modeled structure of high affinity huMab C52 indicated that only
one of the seven mutations within the VL region,
Asn.sup.L30A.fwdarw.Ser, most likely directly affects the
interaction with Ep-CAM. The other mutations can result in more
subtle optimization of the antibody binding site through additional
hydrogen bonds and improved packing interactions, as previously
reported (21), rather than a specific improved interaction between
one of the mutated antibody residues and the antigen Ep-Cam.
Indeed, mutation Ser.sup.L31 results in an additional hydrogen bond
with Val.sup.L29 that stabilizes the LCDR1 loop. The major gain in
affinity appears to be caused by mutations located at the periphery
of the antigen combining site in CDR1, resembling the distribution
of mutations found in in vivo somatically mutated V regions
(34).
[0022] Antibody-mediated killing of solid tumors in vivo is a
complex process involving Fc receptor-bearing effector cells of the
immune system, complement factors and signaling events resulting
from the interaction between the antibody and its target. The
relative importance and contribution to this process by
antibody-related characteristics such as affinity and isotype are
becoming the focus of antibody research, spurred by the recent
successes of engineered antibodies in the clinic. We exploited the
engineered high and lower affinity anti-Ep-CAM huMabs to study two
aspects of antibody affinity-dependent processes: killing of tumor
cells and penetration of antibodies into clusters of tumor cells
mimicking micrometastasis.
[0023] We found that the lower affinity UBS-54 penetrated faster
into the center of the multicell spheroid, resulting in a
homogeneous distribution of the huMab. This observation supports
other studies showing that very high affinities of antibodies
(>10.sup.9M.sup.-1) leads to trapping of antibody at the tumor
edge and slows their penetration into the tumor interior
(31,32,35,36).
[0024] To our surprise, the lower affinity huMab UBS-54 mediated a
persistently higher specific tumor cell lysis with PBMC as effector
source compared to the higher affinity mutant C52. The same results
were obtained with target cells transfected with an Ep-CAM cDNA
construct lacking a cytoplasmic tail, suggesting that signaling via
Ep-CAM did not play a role in tumor cell killing. Although many
Fc.gamma.R are able to trigger ADCC, the high affinity Fc.gamma.RI
appears to be the most effective trigger molecule (37,38). We
propose that quantitative differences in activation of effector
cells mediated via binding of antibodies to high affinity
Fc.gamma.RI may affect their killing capacity in ADCC Although the
mechanism has not been elucidated for Fc.gamma.RI, recent
experiments with the Fc.epsilon.R, another high affinity member the
multichain immune recognition receptor family, have shown that
aggregation of this receptor by an excess of low-affinity ligand
leads to the sequestration of the receptor associated kinase Lyn
(39). As a consequence, a smaller number of aggregates
simultaneously induced by a higher affinity ligand become deprived
of Lyn and are thus unable to initiate the signaling cascade (38).
In this model, scarcity of a receptor associated kinase prevents
low affinity interactions to activate the complete signaling
cascade (40,41). Based on our in vitro tumor cell killing data we
hypothesize that extensive Fc.gamma.RI receptor triggering by very
high affinity antibodies may also result in sequestration of
receptor associated kinases and consequently result in a
less-efficient Fc.gamma.RI-mediated induction of the cascade of
events leading to activation of effector cells.
[0025] The CDCC experiments showed a significantly higher specific
tumor cell lysis with huMab C52 compared to huMab UBS-54,
indicating an advantage of higher affinity antibodies in activating
the complement system. Although the improved capacity of the higher
affinity mutant in activating the complement system is evident in
vitro, several studies indicate that CDCC may play a marginal role
in in vivo tumor cell killing. Most tumor cells express
complement-inhibiting regulators which protect the cells against
lysis by autologous complement (42-46). Furthermore, tumor
cell-specific monoclonal antibodies have been found to be equally
effective in eradicating tumors in mice deficient in complement
factor C5 as in control mice (47). Thus, ADCC may be the dominant
immunological mechanism to kill tumor cells, suggesting that the
lower affinity UBS-54 with its higher killing capacity in ADCC may
be favorable for passive immunotherapy.
EXAMPLES
Materials and Methods
[0026] Mutagenesis an Affinity Maturation:
[0027] The scFv UBS-54, isolated from a semisynthetic phage
antibody display library, is encoded by members of the VH1 and Vk2
heavy and light chain variable region gene families (17, 48). For
light chain shuffling, total RNA was isolated from peripheral B
blood cells of a pool of 15 donors, converted to cDNA by oligo(dT)
priming and amplified by PCR using Vk2 gene family specific primers
with Nco-I and Xho-I restriction sites: Vk2-NCO-I
(5'-'GCCTCCACCTCCATGGGATATTGTGATGACTCACTCT-3') and Vk2-XHO-I
(5'-GCCTCCACCTCTCGAGCTGCTGACAGTAATAAGTTGCAAAATC-3'). Amplified
products were purified, digested with appropriate restriction
enzymes, cloned into vector pPV containing the original UBS-54
heavy chain, transformed into XL-1blue bacteria and plated on
ampicillin containing 2TY plates as described (48). The resulting
shuffled library contained 2*10.sup.7 individual clones.
[0028] For phage selections, LS174T colon carcinoma cells were
washed in PBS and fixed in 1% paraformaldehyde for 15 min at
4.degree. C. For selection of higher affinity mutants, 10.sup.6
fixed cells and the shuffled library were incubated for 2 hours at
4.degree. C. and the cells were washed 3 times in 50 ml ice cold
medium. The stringent washing procedure consisted of incubation of
fixed cells in 1%BSA/PBS containing 0.5% tween 80 at 37.degree. C.
Every 15 minutes cells were washed and transferred to a new
eppendorf tube, this procedure was repeated 16 times. Finally,
cells were washed twice in PBS, and phages were eluted by
resuspending the final cell pellet in 500 .mu.l 100 mM HCL for 5
minutes, followed by neutralization with 250 .mu.l 1 M Tris/HCl
pH7.4. Phages were propagated and 2 additional rounds of selection
were performed using the same procedure except that the number of
washing cycles increased with 3 in every subsequent round. Afer the
last round of selection, 70 colonies were randomly picked and used
for nucleotide sequence analysis.
[0029] DNA shuffling of the VH gene was performed, according to a
procedure described in detail elsewhere (18,19). In brief, cDNA
from peripheral blood B cells was amplified using primers specific
for the VH1 gene family :NCO-I-VH1:
5'GCCTCCACCTCCATGGCCCAGGTGCAGCTGGTGCAGTCTGG3' and pan VH
XHO-I:5'GCCTCCACCTCTCGAGTCTCGCACAGTAATACACGGCCG3'. After
purification, 2 .mu.g of PCR product was treated with DNA'se I
(Sigma, St. Louis, Mo.) to generate DNA fragments ranging in size
between 50 and 100 base pairs. These fragments were reassembled in
a volume of 100 .mu.l with 800 .mu.M dNTP's, 0.2 units of Taq
polymerase (Supertaq, HT biotechnology Ltd. Cambridge, UK) in the
manufacturer's recommended buffer in the absence of primers.
Reassembly PCR consisted of 40 cycles of 30 s at 94.degree. C., 30
s at 50.degree. C. and two min at 72.degree. C. The reassembled PCR
product was used in a 1/30 dilution in a subsequent PCR (20 cycles)
with the primer NCO-VH1 and a spiked primer
XHO-HCDR3-UBS-54:5'GCCTCCACCTCTCGAGACGGTGACCAGGG TACCTTGGCCCCA [ATA
(CAT/AGG/ACC)] [GTG (AAA/CTT/GGC)] [AAG (CTA/AGT/ACC)]
[AAA(CTT/AGG/ACC)] [CGG(AAA/CTT/CCC)] [GTA(AAT/CGG/GCC)] T
CTTGCACAGTAATACACGCCCGTGTC3'. The nucleotides between circular
brackets comprise 10% of the mixture. Spiked oligo primer of HCDR3
introduced an average replacement of 2 of the 6 amino acids in the
original HCDR3 of UBS-54. PCR product was digested with Ncol and
Xhol and cloned in pPV vector containing the A37 light chain. This
resulted in a library of 4*10.sup.7 clones. The library was
incubated with fixed LS174T cells at room temperature for 2 hours
and subjected to the stringent washing procedure. After 3 rounds of
selection the nucleotide sequence of 64 clones was analyzed. For
DNA shuffling of the light chain, the following primers were used:
NCO Vk2 and Vk2-XHO. After DNA'se I treatment and reassembly PCR
the reassembled product was amplified using the same primers,
digested with Sacl and Not 1 and cloned in the pPV vector
containing the VH gene of clone B43. Except increased number of
washing cycles, phage selections with this library of 1*10.sup.7
clones were identical to those descibed above. After 3 rounds of
selection, 70 clones were picked for nucleotide sequence analysis,
resulting in the identification of a single dominant clone (31/70
clones) named clone C52.
[0030] Construction and Evaluation of Intact huMabs
[0031] The VH and VL regions encoding scFv A37, B43 and C52 were
excised and recloned into expression vectors for the synthesis of
complete human IgGl/K molecules as described in detail elsewhere
(17,49). In a two step cloning procedure, the VH and VL regions
encoding the scFv's were first inserted into the vector pLEADER to
append the T-cell receptor .alpha.-chain HAVT leader peptide
sequence and a splice donor site In the second cloning step, the VH
or VL regions, which contain leader and splice donor sites, were
subcloned in the pNUT-C.gamma.1 or pNUT-Ck expression vectors using
appropriate restriction sites. Subsequently the constructs were
stably transfected in BHK cells. In brief, cells were maintained at
37.degree. C. in a 5% CO.sub.2 humidified incubator in Iscove's
modified Dulbecco's medium containing 10% FCS, 2 mM glutamine and
10 .mu.g/ml gentamicine (complete medium). Cells were transfected
at a density of 70-80% confluency using calcium phosphate-plasmid
DNA precipitation for 4 h at 37.degree. C., followed by a 15%
glycerol shock for 1 min. Selection was initiated by adding 80
.mu.M methotrexate (Sigma, St. Louis, Mo.). After 2 weeks, colonies
of resistant cells were picked and cultured in
methotrexate-containing medium. Production of huMabs was determined
in the supernatant by quantitative ELISA. Integrity of protein-A
purified recombinant huMabs was determined by SDS/PAGE and by
Coomassie brilliant blue staining of gels. Concentration of
purified huMab was determined by spectrophotometry at 1 280 nm. For
immunofluorescence staining, 10 .mu.l of purified huMab IgGl at a
concentration of 10 .mu.l/ml was used. HuMabs were detected by FITC
conjugated goat anti-human IgG (Southern Biotechnology Associates,
Birmingham, Ala.) The L929 fibroblast cell line and L929 cells
transfected with human Ep-CAM cDNA (LME-6) were a kind gift of Dr.
S. Litvinov (University of Leiden, The Netherlands) (50).
[0032] Affinity Measurements
[0033] In separate BIAcore flow cells, approximately 160, 1565 and
4154 reasonance units of purified recombinant Ep-CAM produced in
insect cells (kindly provided by Dr. D. Herlyn, Wistar institute,
Philadelphia, Pa.) (25 .mu.g/ml) in 10 mM acetate buffer (pH 4.0)
were coupled to a CM5 sensor chip using NHS/EDC coupling chemistry.
Association and dissociation were measured under continuous flow of
30 ml/min using a concentration range from 100 to 1 nM.
[0034] Structural Analysis
[0035] After initial sequential and structural alignment using the
automatic classification described by Martin and Thornton (51),
structure 1GCl (52), deposited with the Protein Data Bank (53), was
chosen as scaffold for the heavy chain of all models. To create a
scaffold for the non-canonical CDR H3, a loopsearch was performed
with the program SYBYL v.6.5 (Tripos Inc., St. Louis, Missouri,
USA) between residues Gly.sup.94 and Phe.sup.100y of 1GCl. These
positions, deviating relatively little in torsion angles (26),
precede a more variable part of the CDR H3. In addition, regions
92-94 and 100y-104 show high sequential similarity with 1GCl.
Structure 1NQB (54) with the CDR L3 loop of 1JRH (55) was used as
scaffold for the light chain of antibody UBS-54. Structure 1FIG
(56) was used as scaffold for the light chains of models A37 and
C52. Actual modeling was performed with the BLDPIR module of WHAT
IF v.19970813-1517 (57). The quality was checked with PROCHECK
v.3.3 (58) and the WHATCHECK module of WHAT IF. The atomic
coordinates of the models can be found at
http://wwwcmc.pharm.uu.nl/moret/pub/. A knowledge base was created
by analysis of the following antigen-antibody complexes, selected
from the Protein Data Bank: 1BAF, 1CBV, 2GCR, 1CLZ, 1DBB, 1EAP,
1FIG, 1FLR, 1GAF, 1HYX, 1IBG, 1IGJ, 1IND, 1KEL, 1KNO, 2MCP, 1MFA,
1MRD, 1MPA (hapten class), 1ACY, 1TET, 1FPT, 1FRG, 1GGI, 2IGF
(peptide class), 1AFV, 1DVF, 1FBI, 1VFB, 3HFL, 3HFM, 1LAI, 1IKF,
1JEL, 1JHL, 1MLC, 1NCD, 1NMB, 1OSP (protein class). The programs
used for analysis are: HBPLUS (59) "AS INTEGRATED IN LIGPLOT" v.3.0
(60), NACCESS v.2.1.1 (Hubbard, S. J., and Thornton, J. M. 1993.
"NACCES", Computer Program, Department of Biochemistry and
Molecular Biology, University College London), DISCOVER v.97.0
(Molecular Simulations Inc., San Diego, Calif., USA) and SYBYL.
Protein sequence analysis was carried out with the program BLAST
v.2.0 (61).
[0036] Antibody and Complement-Dependent Cellular Cytotoxicity
[0037] The cytolytic activity of human peripheral blood
polymorphonuclear cells (PMN) and mononuclear cells (PBMC) was
evaluated in a standard .sup.51Cr release assay (62). Briefly,
target tumor cells were labeled with 150 .mu.Ci of .sup.52Cr
(Amersham, Buckinghamshire, UK) for 2 h at 37.degree. C. After
extensive washing, target cells were plated in U-bottom microtiter
plates at a concentration of 5 *10.sup.3 cells/well. Isolated human
PMN and PBMC were added to each well at an effector:target ratio of
80:1. Cells were incubated at 37.degree. C. in the presence of
various concentrations of purified antibodies in a final volume of
200 .mu.l. For whole blood ADCC assays, 50 .mu.l/well of
heparinized peripheral blood was added as a source of effector
cells. Complement-mediated lysis was performed with 50 .mu.l of
serum. After 4h, .sup.51Cr release was determined in triplicate.
The percentage of cellular cytotoxicity was calculated according to
the formula: % specific lysis=([experimental cpm-basal
cpm]/[maximal cpm-basal cpm])*100%, with maximal .sup.51Cr release
determined after lysing target cells with 10% Zapoglobin (Coulter,
Pittsburgh, Pa.), and basal release measured after incubating
target cells with medium alone. Heparinized peripheral blood was
collected from healthy volunteers. PMN and PBMC were isolated by
Ficoll-Histopaque discontinuous gradient centrifugation, as
previously described (63). Contaminating erythrocytes were removed
by hypotonic shock with 0.2% NaCl. Effector cells were more than
95% pure, as determined by cytospin preparations and more than 95%
viable as assessed by trypan blue exclusion. For ADCC and CDCC
experiments, LS174T tumor cells and HCA cells transfected with
human Ep-CAM (HCE) or with cytoplasmic tail-deleted human Ep-CAM
(HCM), both under transcriptional control of a metallothionine
promoter, were used as target cells (64). HCE and HCM cells were
kindly provided by Dr. S. Litvinov (Dept. of Pathology, University
of Leiden, The Netherlands).
[0038] Antibody Penetration in Multicell Spheroids
[0039] Purified antibodies UBS-54 and mutant C52 were labelled with
FITC according to standard procedures. Naturally-occurring
multicell spheroids of the Ep-CAM+GLC-8 carcinoma cell line were
incubated for various times with FITC labelled huMabs and analyzed
using a Bio-Rad MRC-1000 CLSM (BioRad, Hercules, Calif.). The
confocal images were recorded after 10-15 minutes of incubation at
the center of the multicell spheroid as described (65).
Results
[0040] Generation and Selection of Mutant Libraries
[0041] Recently, we have described the isolation of a scFv directed
against the tumor-associated Ep-CAM molecule and its conversion
into an intact, functional human IgGl antibody with an affinity of
5 nM (19). The germline Vk2 light chain of this antibody was
replaced by Vk light chains obtained by PCR amplification of cDNA
extracted from pooled blood lymphocytes of 15 healthy individuals.
A phage display library of 2.times.10.sup.7 clones was generated
and subsequently panned on paraformaldehyde fixed Ep-Cam+ LS174T
colon carcinoma cells. Of note, 24 randomly picked clones from the
unselected library all bound to the Ep-CAM transfected LME-6 cell
line but not the parental L929 cell line in flow cytometric
analysis, showing the dominant role of the VH gene in determining
the Ep-CAM specificity. The cells with bound phages were incubated
at 37.degree. C. and washed every 15 minutes with PBS/tween (0.5%)
for 16 cycles. In preliminary experiments, it was determined that
phages expressing the UBS-54 scFv could not be detected in
flowcytometry on LS174 colon carcinoma cells after these stringent
washing procedures. Approximately 10.sup.7 phages could be
recovered after the first, second and third round of selection,
while the number of washing cycles increased with 3 for each
subsequent round. Nucleotide sequence analysis of randomly picked
clones from the third round of selection revealed an identical Vk
sequence in approximately 50% of the clones. This clone was named
A37.
[0042] Crystallographic and CDR grafting studies have convincingly
shown that both mutations in the CDR and framework regions of V
regions may contribute to affinity improvement of antibodies
(20,21). We therefore selected DNA shuffling as a second
mutagenesis strategy because it results in the introduction of
mutations in both CDR and framework regions. DNA shuffling
introduces point mutations and exchange of stretches of DNA between
homologous genes, thereby mimicking natural protein evolution
(18,19). In addition, this mutation strategy potentially introduces
CDR blocks that already have been selected for favorable amino
acids like Tyr, Trp, Ser, and Asp. The amino acids Tyr, Trp, Ser,
and Asp are favorable for antigen binding because they have a low
conformational degree of freedom (less entropy to loose) and they
participate in a variety of molecular interactions such as hydrogen
bonds, van der Waals interactions, dipole-dipole interactions, and
aromatic p-stacking (Tyr and Trp) (22,23). The VH1 gene encoding
scFv UBS-54 was mixed with amplified VH1 gene segments from the
pool of healthy donors. Fragments of 50-100 base pairs obtained
after DNA'se I digestion were used in a reassembly PCR, and
subsequently amplified with a VH1-specific 5' primer and a `spiked`
CDR3 primer. The spiked oligonucleotide primer was designed to
introduce a low rate of mutations in the CDR3 region of the VH1
gene segments. A small library of 4*10.sup.7 VH1 mutagenized clones
was constructed by ligating PCR-amplified material in the construct
containing the A37 light chain. This library was subsequently
selected on intact fixed cells. Sequence analysis of 24 clones
randomly picked from the unselected DNA shuffled library
demonstrated an average of approximately 18 mutations in the entire
VH gene with an average of 2.6 mutations in the CDR3 region. This
number of mutations dropped to approximately 4 mutations in each VH
gene after three rounds of selection. Of note, all clones analyzed
after three rounds of selection contained the original UBS-54 CDR3
region. Because no single dominant clone could be detected after
three rounds of selection for binding to LST174 carcinoma cells,
clone B43 was randomly chosen for further analysis. This choice was
based on the observation that it contained a number of mutations
frequently observed in other clones in this collection.
Subsequently DNA shuffling with the light chain was performed using
the collection of Vk gene segments used for the construction of the
light chain shuffled library. The resulting library comprised
1*10.sup.7 clones and was selected for binding to the intact cells
under stringent conditions. After three rounds of selection,
sequence analysis was performed and revealed a single dominant
clone (31 out of 70 sequences), named clone C52.
[0043] Reconstruction of Intact huMabs
[0044] The V regions of mutant scFv A37, B43 and C52 were recloned
in eukaryotic expression vectors for the production of IgGl huMabs
in BHK cells (17). Immunoglobulin was purified from the supernatant
of stably-transfected cell lines using protein A affinity
chromatography as described (17). Although intact and functional
huMabs could be isolated from the supernatant of clone B43 (data
not shown), it did not reveal significant improvement of affinity
for recombinant Ep-CAM in BiaCore analysis (see next paragraph).
Therefore we focused on the original UBS-54 and the A37 and C52
mutants. The integrity of the IgGl/K huMabs A37 and C52 was
confirmed by Coomassie staining of SDS/PAGE gels run under
denaturing and non-denaturing conditions (FIG. 1). Purified huMabs
A37 and C52 retained their specificity as determined by binding to
the the Ep-CAM transfected LME-6 cell line but not the
non-transfected L929 parental cell line (FIG. 1).
[0045] Biacore Analysis
[0046] The kinetic association and dissociation rates of the
original huMab UBS-54 and the mutant huMabs A37 and C52 were
determined by surface plasmon resonance (Table 1). The original
huMab UBS-54 and the murine anti-Ep-CAM antibody 323/A3 were used
as controls, revealing an average KD of 6 nM and 0.5 nM
respectively. HuMab A37 with the shuffled Vk light chain
demonstrated an affinity of 1.6nM (.sup.-4 fold increase). The
binding affinity of the huMab C52 containing the DNA-shuffled Vk
light chain was improved 15 fold compared to the original UBS-54
huMab, yielding a huMab with a KD=4 *10.sup.-10 nM. The improvement
was mainly the result of a lower dissociation constant.
[0047] Structural Analysis
[0048] Sequence analysis shows that the light chain selected in
mutant A37 displays only 54% sequence homology with the original
light chain in UBS-54 and possesses a shorter CDR1 sequence (FIG.
2). The A37 light chain is a member of the Vk3 gene family with the
highest degree of homology to DPK22/A27 germline gene segment (24).
Although the Vk primer preferentially anneals to Vk2 genes, we
noted that Vk3 genes are also present in our shuffled library. The
shorter CDR1 loop in C52 appears to protrude to a lesser extend in
the antigen binding site, creating a flat contact interface that is
energetically favorable in anti-protein antibodies (23; FIG.
3).
[0049] The affinity matured mutant C52 differs from A37 by three
amino acid changes in the heavy chain (the mutations of VH B43,
introduced by DNA shuffling of VH) and by eight additional
mutations in the light chain (the mutations of VL C52, introduced
by DNA shuffling of VL) (FIG. 2 and FIG. 3). Mutations
Ser.sup.H16.fwdarw.Ala, Arg.sup.H19.fwdarw.Lys,
Arg.sup.L40.fwdarw.Pro, Ser.sup.L65.fwdarw.Thr and
Glu.sup.L105.fwdarw.Asp are located within the framework, far away
from the combining site and are likely not involved in
stabilization of the conformation of the CDR loops. Mutation
Ile.sup.H52.fwdarw.Val in CDR H2 can result in removal of a
repulsive steric interaction of the Cd atom of Ile.sup.H52.
However, because mutant B43 with the same mutations shows no
significant increase in antigen binding affinity (data not shown),
the overall effect of this mutation appears to be small. Residue
L50 (mutation Ala.sup.L50.fwdarw.Gly) is frequently involved in
antigen contact according to the knowledge base. A change in the
backbone conformation of CDR L2, due to the higher conformational
freedom of Gly is not likely, as CDR L2 has a conserved canonical
structure (25). Presumably because of the relatively large distance
between the top of CDR L2 and the surface of the antibody, which
includes the antigen binding site, the high energy interactions
appear to be reserved for amino acids with large side chains.
[0050] Four mutations are located in the CDR L1,
Thr.sup.L28.fwdarw.Ser, Ile.sup.L29.fwdarw.Val,
Asn.sup.L30A.fwdarw.Ser and Asn.sup.L31.fwdarw.Ser (FIG. 2 and FIG.
3). The knowledge base reveals that antibody positions L28, L29 and
L31 very rarely interact in protein-antibody complexes, in contrast
to position L30A. In case of position L28 (mutation
Thr.sup.L28.fwdarw.Ser), this is probably due to its peripheral
location. The side chain of A37 Ile.sup.L29 is buried within the
CDR L1, stabilizing the loop through packing interactions, which
are mimicked by C52 Val.sup.L29. The side chain of A37 Asn.sup.L31
appears to be turned away from the binding site. Mutation C52
Ser.sup.L31 allows an additional hydrogen bond between its hydroxyl
group and the main chain carbonyl group of Val.sup.L29, further
stabilizing the CDR L1 loop. Hotspot mutation
Asn.sup.L30A.fwdarw.Ser is most likely to affect the interaction
with Ep-CAM directly.
[0051] Functional Analysis
[0052] The availability of two anti-tumor huMabs with the same
epitope specificity but different affinities allowed us to
precisely assess the influence of affinity on in-vitro tumor cell
killing capacity in antibody and complement dependent cellular
cytotoxicity assays (ADCC and CDCC respectively). ADCC with LS174T
tumor target cells and PBMC as a source of effector cells
consistently resulted in .sup.-10% lower tumor cell lysis with the
high affinity huMab C52 compared to the original huMab UBS54 (FIG.
4). The persistently lower tumor cell lysis mediated via huMab C52
occurs with saturating antibody concentrations, indicated by the
plateau shape in the curve (FIG. 4). Based on animal studies and
the improved performance of chimeric human/mouse monoclonal
antibodies in patients, ADCC is considered to be an important
immunological mechanism in tumor cell killing (26,28). A direct
inhibitory effect of therapeutic antibodies on tumor cell growth or
induction of tumor cell apoptosis, mediated via binding of
antibodies to their target receptor may also contribute to clinical
efficiency (29,30). To assess whether the less efficient tumor cell
lysis mediated via C52 is independent of signal transduction via
Ep-Cam, ADCC was performed with HMA cell lines transfected with
full-length Ep-CAM cDNA or with a mutant Ep-CAM cDNA lacking the
cytoplasmic tail. With both transfectants, we reproducibly observed
the same less efficient tumor cell killing of the high affinity
mutant huMab C52, suggesting that the observed difference in
killing capacity between UBS54 and C52 is not influenced by
variations in signal transduction via Ep-CAM (data not shown).
[0053] The same experiments performed with whole blood instead of
purified PBMC as a source of effector cells demonstrated a
significantly more efficient tumor cell lysis with the high
affinity mutant huMab C52 (FIG. 4). We hypothesized that the
improved performance of the high affinity huMab C52 was caused by a
more efficient CDCC. Indeed, humab C52 more efficiently mediated
tumor cell killing in the absence of effector cells and with serum
as a source of complement (FIG. 4). Apparently, the lower
dissociation rate of mutant huMab C52 results in a more efficient
crosslinking of complement fragment Clq.
[0054] Influence of Antibody Affinity on Penetration in Multicell
Speroids of Tumor Cells
[0055] Deep percolation and uniform distribution through the tumor
of monoclonal antibodies applied in immunotherapy of solid tumors
is considered to be important for optimal therapeutic effect. In
vitro and in vivo studies have suggested that transport of
antibodies through the tumor interstitium is retarded by its
specific binding to the tumor antigen. This so-called binding site
barrier is a function of binding affinity, antigen concentration,
and the antibody transport coefficients (31,32). To determine the
relative binding site barrier effect of the high and lower affinity
anti-tumor huMabs, we employed an in vitro multicell spheroid model
system. The small cell lung carcinoma cell line Glc-8, that
expresses high levels of Ep-CAM and grows in multicell spheroids of
about 100 cells, was incubated with 10 mg of FITC-conjugated UBS54
or C52. Confocal laser scanning microscopy of the spheroids after
10-15 minutes of incubation unveiled a binding site barrier with
the higher affinity huMab. At this timepoint, uniform binding of
huMab UBS-54 to cells in the spheroids was observed, whereas
binding of the higher affinity mutant C52 was almost restricted to
the outer cell layer (FIG. 5). After one hour of incubation,
uniform binding to all cells in the spheroids was observed for both
antibodies (data not shown).
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] FIG. 1: SDS/PAGE analysis of purified huMabs under reducing
(A) and non-reducing (B) conditions (UBS-54, lane 1 and 4; A37,
lane 2 and 5; C52, lane 3 and 6). MW: molecular weight markers in
kilodaltons. Panel C: staining of the Ep-CAM-negative parental L929
cell line (thin line) and stably transfected Ep-CAM-positive cells
(bold line) with huMab UBS-54, huMab A37, and huMab C52.
[0057] FIG. 2: Sequence comparison of the original UBS-54 and the
higher affinity mutants A37 and C52. Note the shorter CDR1 sequence
in the shuffled Vk3 light chain. Numbering is according to Chothia
(25).
[0058] FIG. 3: Modelling of the original UBS-54(A) and the
mutagenized antibody V regions of C52 (B) shows the shorter
canonical structure of LCDR1 (arrow). The magnification (C) shows
the positions of the mutated residues in LCDR1
(Thr.sup.L28.fwdarw.Ser, Ile.sup.L29.fwdarw.Val,
Asn.sup.L30A.fwdarw.Ser and Asn.sup.L31.fwdarw.Ser). Position
Ser.sup.L30 most likely directly affects the interaction with
Ep-CAM. A hydrogen bond beween Ser.sup.L31 and Val.sup.L29 results
in stabilisation of the LCDR1 loop.
[0059] FIG. 4: Antibody-dependent cellular cytotoxicity (ADCC) and
complement-dependent cellular cytotoxicity (CDCC) using huMab
UBS-54 (.box-solid.) and huMab C52 (). The shown experiments are
representative for at least 6 experiments performed with effector
cells of different donors.
[0060] FIG. 5: Confocal scanning laser microscope images recorded
within the center of Glc-8 multicell spheroids with FITC labelled
huMab UBS54 (A) and FITC labelled huMab C52 (B).
1TABLE 1 Affinities and bindinq kinetics of huMabs UBS-54, A37, and
C52. Standard error of the mean is indicated between brackets. IgGl
Ka (l/Ms)*10.sup.5 Kd(l/s)*10.sup.-4 KD (nM) UBS-54 1.0 (0.3) 6.0
(0.7) 6.0 A37 2.5 (0.3) 4.1 (0.4) 1.6 C52 2.7 (0.6) 1.1 (0.8)
0.4
REFERENCES
[0061] 1 Berek, C., & Milstein, C. 1987 Mutation drift and
repertoire shift in the maturation of the immune response. Immunol.
Rev. 96:23.
[0062] 2 Winter, G. & Milstein, C. 1991. Man-made antibodies.
Nature. 349:293.
[0063] 3 Vaughan, T. J., Osbourn, J. K., & Tempest, P. R. 1998.
Human antibodies by design. Nat. Biotechnol. 16,535.
[0064] 4 Winter, C., Griffiths, A. D., Hawkins, R. E., &
Hoogenboom, H. R. 1994. Making antibodies by phage display
technology. Annu. Rev. Immunol. 12:433.
[0065] 5 Burton, D. R., & Barbas, C. F. 1994. Human antibodies
from combinatorial libraries. Adv. Immunol. 57:191.
[0066] 6 Hoogenboom, H. R. 1994. Designing and optimizing library
selection strategies for generating high-affinity antibodies.
Trends in Biotechnol. 15:62.
[0067] 7 Marks, J. D., Griffiths, A. D., Malmqvist, M., Clackson,
T., Bye, J. M., & Winter, G. 1992. Bypassing immunisation: high
affinity human antibodies by chain shuffling. Bio/Technology.
10:779.
[0068] 8 Clackson, T., Hoogenboom, H. R., Griffiths, A. D., &
Winter, G. 1991. Making antibody fragments using phage display
libraries. Nature. 352:624.
[0069] 9 Hawkins, R. E., Russel, S. J., & Winter. G. 1992.
Selection of phage antibodies by binding affinity: mimicking
affinity maturation. J. Mol. Biol. 226:889.
[0070] 10 Low, N. M., Holliger, P. H., & Winter, C. 1996.
Mimicking somatic hypermutation: affinity maturation of antibodies
displayed on bacteriophage using a bacterial mutator strain. J.
Mol. Biol. 260,359.
[0071] 11 Barbas, C. F., Hu, D., Dunlop, N., Sawyer, L., Cababa,
D., Hendry, R. M., Nara, P. L., & Burton, D. R. 1994. In vitro
evolution of a neutralizing human antibody to human
immunodeficiency virus type 1 to enhance affinity and broaden
strain cross-reactivity. Proc. Natl. Acad. Sci. USA. 91:3809.
[0072] 12 Yang, W. -P., Green, K., Pinz-Sweeney, S., Briones, A.
T., Burton, D. R., & Barbas, C. F. 1995. CDR walking
mutagenesis for the affinity maturation of a potent human ant-HIV-1
antibody into the picomolar range. J. Mol. Biol. 254:392.
[0073] 13 Balint, R. F., & Larrick, J. W. 1993. Antibody
engineering by parsimonious mutagenesis. Gene. 137:109.
[0074] 14 Schier, R., Bye, J., Apell, G., McCall, A., Adams, G. P.,
Malmqvist, M., Weiner, L. M., & Marks, J. D. 1996. Isolation of
high-affinity monomeric human anti c-erbB-2 single chain Fv using
affinity-driven selection. J. Mol. Biol. 255:28..
[0075] 15 Chowdhury P S, Pastan I. 1999. Improving antibody
affinity by mimicking somatic hypermutation in vitro. Nat
Biotechnol 17:568.
[0076] 16 Neri D, Carnemolla B, Nissim A, Leprini A, Querze G,
Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G. 1997.
Targeting by affinity-matured recombinant antibody fragments of an
angiogenesis associated fibronectin isoform. Nat Biotechnol
12:1271.
[0077] 17 Huls, G. A., et al. 1999. A recombinant, fully human
monoclonal antibody with antitumor activity constructed from
phage-displayed antibody fragments. Nature Biotechnology.
17:276.
[0078] 18 Stemmer, W. P. C. 1994. DNA shuffling by random
fragmentation and reassembly: In vitro recombination for molecular
evolution. Proc. Natl. Acad. Sci. USA. 91:10747.
[0079] 19 Stemmer, W. P. C. 1994. Rapid evolution of a protein in
vitro by DNA shuffling. Nature. 370:389.
[0080] 20 Foote, J., & Winter, G. 1992. Antibody framework
residues affecting the conformation of the hypervariable loops. J.
Mol. Biol. 224:487.
[0081] 21 Wedemayer, G. J., Patten, P. A., Wang, L. H., Schultz, P.
G., & Stevens, R. C. 1997. Structural insights into the
evolution of an antibody combining site. Science 276:1665.
[0082] 22 Mian, I. S., Bradwell, A. R., & Olson, A. J. 1991.
Structure, function and properties of antibody binding sites. J.
Mol. Biol. 217:133.
[0083] 23 Davies, D. R., Padlan, E. A., & Sheriff, S. 1990.
Antigen-antibody interactions. Annu. Rev. Biochem. 59:439.
[0084] 24 www.mrc-cpe.ac.uk/imt-doc/public/INTRO.html Tomlinson, I.
M., Williams, S. C., Corbett, S. J., Cox, J. P. L., & Winter,
G. V 1997. Base: the database of human antibody genes. MRC Centre
for Protein Engineering, Cambridge, UK.
[0085] 25 Al-Lazikani, B., Lesk, A. M., & Chothia, C. 1997.
Standard conformations for the canonical structures of
immunoglobulins. J. Mol. Biol. 273:927.
[0086] 26 Surfus, J. E., Hank, J. A., Oosterwijk, E., Welt, S.,
Lindstrom, M. J., Albertini, M. R., Schiller, H. J. H., &
Sondel, P. M. 1996. Anti-renal-cell carcinoma chimeric antibody
G250 facilitates antibody-dependent cellular cytotoxicity with in
vitro and in vivo interleukin-2-activated effectors. J. Immunother.
3:184.
[0087] 27 Denkers, E. Y., Badger, C. C., Ledbetter, J. A., &
Bernstein, I. D. 1985. Influence of antibody isotype on passive
serotherapy of lymphoma. J. Immunol. 135:2183.
[0088] 28 Kaminski, M. S., Kitamura, K., Maloney, D. G., Campbell,
M. J., & Levy, R. 1986. Importance of antibody isotype in
monoclonal anti-idiotype therapy of a murine B cell lymphoma: a
study of hybridoma class switch variants. J. Immunol. 136:1123.
[0089] 29 Ghetie, M. A., Podar, E. M., Ilgen, A., Gordon, B. E.,
Uhr, J. W., & Vitetta, E. S. 1997. Homodimerization of
tumor-reactive monoclonal antibodies markedly increases their
ability to induce growth arrest or apoptosis of tumor cells. Proc.
Natl. Acad. Sci. USA. 94:7509.
[0090] 30 Tutt, A. L., et al. 1998. Monoclonal antibody therapy of
B cell lymphoma: signalling activity on tumor cells apears more
important that recruitment of effectors. J. Immunol. 161:3176.
[0091] 31 Osdol, W., Fujimori, K., & Weinstein, J. N. 1991. An
analysis of monoclonal antibody distribution in microscopic tumour
nodules: Consequences of a "Binding Site Barrier". Cancer Res.
51:4778.
[0092] 32 Langmuir, V. K., Mendonca, H. L., & Woo, D. V. 1992.
Comparisons between two monoclonal antibodies that bind to the same
antigen but have differing affinities: uptake kinetics and
125I-antibody therapy efficacy in multicell spheroids. Cancer Res.
52:4728.
[0093] 33 Hawkins, R. E., Russel, S. J., Baier, M., & Winter,
G. 1993. The contribution of contact and non-contact residues of
antibody in the affinity of binding to antigen. J. Mol. Biol.
234:958.
[0094] 34 Tomlinson, I. M. T., Walter, G., Jones, P. T., Dear, P.
H., Sonhammer, E. L-L., & Winter, G. 1996. The imprint of
somatic hypermutation on the repertoire of human germline V genes.
J. Mol. Biol. 256:813.
[0095] 35 Fujimori, K., Covell, D. C., Fletcher, J. E., &
Weinstein, J. N. 1989. Modeling analysis of the global and
microscopic distribution of IgG, F(ab').sub.2 and Fab in tumors.
Cancer Res. 49:5656.
[0096] 36 Sung, C., Shockley, T. R., Morrison, P. F., Dvorak, H.
F., Yarmush, M. L., & Dedrick, R. L. 1992. Predicted and
observed effects of antibody affinity and antigen density on
monoclonal antibody uptake in solid tumors. Cancer Res. 52:377.
[0097] 37 Van de Winkel, J. G. J., & Capel, P. J. A. 1993.
Human IgG Fc receptor heterogeneity: molecular aspects and clinical
implications. Immunol. Today. 14:215.
[0098] 38 Van de Winkel, J. G. J., Boonen, G. J. J. C., Janssen, P.
L. W., Vlug, A., Hogg, N., & Tax, W. J. M. 1989. Activity of
two types of Fc receptors, Fc.gamma.RI and Fc.gamma.RII, in human
monocyte cytotoxicity to sensitized erythrocytes. Scand. J.
Immunol. 29:23.
[0099] 39 Torigoe, C., Inman, J., & Metzger, H. 1998. An
unusual mechanism for ligand antagonism. Science. 281:568.
[0100] 40 McKeithan, T. W. 1995. Kinetic proofreading in T-cell
receptor signal transduction. Proc. Natl. Acad. Sci. USA
92:5042.
[0101] 41 Torigoe, C., Goldstein, B., Wofsy, C., & Metzger, H.
1997. Shuttling of initiating kinase between discrete aggregates of
the high affinity receptor for IgE regulates the cellular response.
Proc. Natl. Acad. Sci. USA. 94:1372.
[0102] 42 Seya, T., Hara, T., Matsumoto, M., & Akedo, H. 1990.
Quantitative analysis of membrane cofactor protein (MCP) of
complement. J. Immunol. 145:238.
[0103] 43 Panneerselvam, M., Welt, S., Old, L. J., & Vogel,
C-W. 1986. A molecular mechanism of complement resistance of human
melanoma cells. J. Immunol. 136:2534.
[0104] 44 Cheung, N-K, V., Walter, E. I., Smith-Mensah, W. H.,
Ratnoff, W. D., Tykocinski, M. L., & Medof, M. E. 1988.
Decay-accelerating factor protects human tumor cells from
complement-mediated cytotoxicity in vitro. J. Clin. Invest.
81:1122.
[0105] 45 Kumar, S., Vinci, J. M., Pytel, B. A., & Baglioni, C.
1993. Expression of messenger RNAs for complement inhibitors in
human tissues and tumors. Cancer Res. 53:348.
[0106] 46 Gorter, A., Block, V. T., Haasnoot, W. H. B., Ensink, N.
G., Daha, M. R., & Fleuren, G. J. 1996. Expression of CD46,
CD55, and CD59 on renal tumor cell lines and their role in
preventing complement-mediated tumor cell lysis. Lab. Invest.
74:1039.
[0107] 47 Berends, D., van der Kwast, T. H., de Both, N. J., &
Mulder, P. G. 1989. Factors influencing antibody-mediated
cytotoxicity during the immunotherapy of Rauscher-virus-induced
myeloid leukemic cells. Cancer Immunol. Immunother. 28:123.
[0108] 48 De Kruif, J., Boel, E., & Logtenberg, T. 1995.
Selection and application of human single chain Fv antibody
fragments from a semi-synthetic phage antibody display library with
designed CDR3 regions. J. Mol. Biol. 248:97.
[0109] 49 Boel, E. PhD. Thesis. 1998. University of Utrecht, The
Netherlands.
[0110] 50 Balzar, M., Bakker, H. A., Briaire-de-Bruijn, I. H.,
Fleuren, G. J., Warnaar, S. O., & Litvinov, S. V. 1998.
Cytoplasmic tail regulates the intercellular adhesion function of
the epithelial cell adhesion molecule. Mol. Cell. Biol.
18:4833.
[0111] 51 Martin, A. C. R. & Thornton, J. M. 1996. Structural
families in loops of homologous proteins: automatic classification,
modelling and application of antibodies. J. Mol. Biol. 263:800.
[0112] 52 Kwong, P. D., Wyatt, R., Robinson, J., Sweet, R. W.,
Sodroski, J., & Hendrickson, W. A. 1998. Structure of an HIV
Gp120 envelope glycoprotein in complex with the CD4 receptor and a
neutralizing human antibody. Nature. 393:648.
[0113] 53 Sussman, J. L., et al. 1998. Database of
Three-Dimensional Structure Information of Biological
Macromolecules. Acta Cryst. D54:1078.
[0114] 54 Pei, X. Y., Holliger, P., Murzin, A. G., & Williams,
R. L. 1997. The 2.0-A resolution crystal structure of a trimeric
antibody fragment with noncognate VH-VL domain pairs shows a
rearrangement of VH CDR3. Proc. Natl. Acad. Sci. USA. 94: 9637.
[0115] 55 Willliams, G., et al. 1995. Dissection of the
extracellular human interferon gamma receptor alpha-chain into two
immunoglobulin-like domains. Production in an Escherichia coli
thioredoxin gen fusion expression system and recognition by
neutralizing antibodies. Biochemistry 34:1787.
[0116] 56 Haynes, M. R., Stura, E. A., Hilvert, D., & Wilson,
I. A. 1994. Routes to catalysis: structure of a catalytic antibody
and comparison with its natural counterpart. Science. 263:646.
[0117] 57 Vriend, G. 1990. WHAT IF: A molecular modeling and drug
design program. J. Mol. Graph. 8:52.
[0118] 58 Laskowski, R. A., MacArthur, M. W., Moss, D. S., &
Thornton, J. M. 1993. PROCHECK: A program to check the
stereochemical quality of protein structures. J. Appl. Cryst.
265:283.
[0119] 59 McDonald, I. K., & Thornton, J. M. 1994. Satisfying
hydrogen bonding potential in proteins. J. Mol. Biol. 238:577.
[0120] 60 Wallace, A. C., Laskowski, R. A. & Thornton, J. M.
1995. LIGPLOT: A program to generate schematic diagrams of
protein-ligand interactions. Protein Eng. 8:127.
[0121] 61 Altschul, S. F., et al. 1997. Gapped BLAST and PSI-BLAST:
a new generation of protein database search programs. Nucleic Acids
Res. 25:3389.
[0122] 62 Valerius, T., et al. 1993. Involvement of the high
affinity receptor for IgG (Fc.gamma.RI:CD64) in enhanced tumor cell
cytotoxicity of neutrophils during G-CSF therapy. Blood.
82:931.
[0123] 63 Van Strijp, J. A. G., van Kessel, K. P. M., van der Tol,
M. E., & Verhoef, J. 1989. Complement-mediated phagocytosis of
herpes simplex virus by human granulocytes: binding or ingestion.
J. Clin. Invest. 84:107.
[0124] 64 Velders, M. P., van Rhijn, C. M., Oskam, E., Fleuren, G.
J., Warnaar, S. O., & Litvinov, S. V. 1998. The impact of
antigen density and antibody affinity on antibody-dependent
cellular cytotoxicity: relevance for immunotherapy of carcinomas.
Br. J. Cancer. 74:478.
[0125] 65 Hjelstuen, M. H., Rasch-Halvorsen, K., Bruland, O., &
De L Davies, C. 1998. Uptake, penetration, and binding of
monoclonal antibodies with increasing affinity in human
osteosarcoma multicell spheroids. Anticancer Res. 18:3153.
* * * * *
References