U.S. patent application number 10/176380 was filed with the patent office on 2003-05-15 for methods for the production of multimeric immunoglobulins, and related compositions.
Invention is credited to Moloney, Maurice, Szarka, Steven, Van Rooijen, Gijs.
Application Number | 20030093832 10/176380 |
Document ID | / |
Family ID | 46280774 |
Filed Date | 2003-05-15 |
United States Patent
Application |
20030093832 |
Kind Code |
A1 |
Szarka, Steven ; et
al. |
May 15, 2003 |
Methods for the production of multimeric immunoglobulins, and
related compositions
Abstract
Improved methods for the production of
multimeric-protein-complexes, such as redox proteins and
immunoglobulins, in association with oil bodies are described. The
redox protein is enzymatically active when prepared in association
with the oil bodies. Also provided are related nucleic acids,
proteins, cells, plants, and compositions.
Inventors: |
Szarka, Steven; (Calgary,
CA) ; Van Rooijen, Gijs; (Calgary, CA) ;
Moloney, Maurice; (Calgary, CA) |
Correspondence
Address: |
BERESKIN AND PARR
SCOTIA PLAZA
40 KING STREET WEST-SUITE 4000 BOX 401
TORONTO
ON
M5H 3Y2
CA
|
Family ID: |
46280774 |
Appl. No.: |
10/176380 |
Filed: |
June 21, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10176380 |
Jun 21, 2002 |
|
|
|
10032201 |
Dec 19, 2001 |
|
|
|
10032201 |
Dec 19, 2001 |
|
|
|
10006038 |
Dec 4, 2001 |
|
|
|
60302885 |
Jul 5, 2001 |
|
|
|
Current U.S.
Class: |
800/281 ;
435/419; 530/388.26; 800/288 |
Current CPC
Class: |
C12N 15/8257 20130101;
C12N 15/8258 20130101 |
Class at
Publication: |
800/281 ;
800/288; 530/388.26; 435/419 |
International
Class: |
A01H 005/00; C07K
016/40; C12N 005/04 |
Claims
What is claimed is:
1. A method of producing an oil body associated with a recombinant
multimeric-immunoglobulin, said method comprising: (a) producing in
a cell comprising oil bodies, a first
immunoglobulin-polypeptide-chain and a second
immunoglobulin-polypeptide-chain wherein said first
immunoglobulin-polypeptide-chain is capable of associating with
said second immunoglobulin-polypeptide-chain to form said
multimeric-immunoglobulin; and (b) associating said
multimeric-immunoglobulin with an oil body through an
oil-body-targeting-protein capable of associating with said oil
body and said first immunoglobulin-polypeptide-chain.
2. The method of claim 1 further comprising (c) isolating said oil
bodies associated with said multimeric-immunoglobulin.
3. The method of claim 1 wherein said multimeric-immunoglobulin
associates with oil bodies obtained from said cell comprising oil
bodies.
4. The method of claim 1 wherein said multimeric-immunoglobulin
associates intracellularly with said oil bodies.
5. The method of claim 1 wherein said second
immunoglobulin-polypeptide-ch- ain is associated with a second
oil-body-targeting-protein capable of associating with an oil body
and said second immunoglobulin-polypeptide-c- hain.
6. The method of claim 5 wherein each of said
oil-body-targeting-proteins is an oil-body-protein or an
immunoglobulin.
7. The method of claim 6 wherein said oil-body-targeting-protein is
an oleosin or caleosin.
8. The method of claim 1 wherein said oil-body-targeting-protein is
an oleosin or caleosin and said first
immunoglobulin-polypeptide-chain is fused to said oleosin or
caleosin.
9. The method of claim 8 wherein said second
immunoglobulin-polypeptide-ch- ain is fused to a second oleosin or
second caleosin capable of associating with an oil body.
10. The method of claim 1 wherein said first and second
immunoglobulin-polypeptide-chains are produced as a
multimeric-fusion-protein comprising said first and second
immunoglobulin-polypeptide-chains.
11. The method of claim 1, wherein said first
immunoglobulin-polypeptide-c- hain is capable of associating with
said second immunoglobulin-polypeptide- -chain in the cell.
12. The method of claim 1 wherein said cell is a plant cell.
13. The method of claim 1 wherein said cell is a safflower
cell.
14. The method of claim 1 wherein said first
immunoglobulin-polypeptide-ch- ain is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
15. The method of claim 14 wherein said second
immunoglobulin-polypeptide chain is an immunoglobulin heavy chain,
or an immunologically active portion thereof.
16. The method of claim 1 wherein said oil-body targeting-protein
comprises protein A, protein L or protein G.
17. A method of expressing a recombinant multimeric-immunoglobulin
comprising a first and second immunoglobulin-polypeptide-chain in a
cell, said method comprising: (a) introducing into a cell a first
chimeric nucleic acid sequence comprising: (i) a first nucleic acid
sequence capable of regulating transcription in said cell
operatively linked to; (ii) a second nucleic acid sequence encoding
a first immunoglobulin-polypeptide-chain; (b) introducing into said
cell a second chimeric nucleic acid sequence comprising: (i) a
third nucleic acid sequence capable of regulating transcription in
said cell operatively linked to, (ii) a fourth nucleic acid
sequence encoding a second immunoglobulin-polypeptide-chain; (c)
growing said cell under conditions to permit expression of said
first and second immunoglobulin-polypeptide-- chain in a progeny
cell comprising oil bodies wherein said first recombinant
immunoglobulin polypeptide-chain and said second
immunoglublin-polypeptide-chain are capable of forming a
multimeric-immunoglobulin; and (d) associating said first
immunoglobulin-polypeptide-chain with an oil body through an
oil-body-targeting-protein capable of associating With said oil
body and said first immunoglobulin-polypeptide-chain.
18. The method of claim 17 further comprising (e) isolating from
said progeny cell, oil bodies comprising said
multimeric-immunoglobulin.
19. The method of claim 17 wherein said multimeric-immunoglobulin
associates with said oil bodies obtained from said progeny cell
comprising oil bodies.
20. The method of claim 17 wherein said oil bodies associate
intracellularly with said multimeric-immunoglobulin.
21. The method of claim 17 wherein said second
immunoglobulin-polypeptide-- chain is associated with a second
oil-body-targeting-protein capable of associating with an oil body
and said second immunoglobulin-polypeptide-c- hain.
22. The method of claim 21 wherein each of said
oil-body-targeting-protein- s is selected from an oil-body-protein
or an immunoglobulin.
23. The method of claim 22 wherein said oil-body-protein is an
oleosin or caleosin.
24. The method of claim 23 wherein said first
immunoglobulin-polypeptide-c- hain is fused to said oleosin or
caleosin.
25. The method of claim 24 wherein said second
immunoglobulin-polypeptide chain is fused to a second oleosin or
second caleosin capable of associating with an oil body.
26. The method of claim 17 wherein said first and second
immunoglobulin-polypeptide-chain are produced as a
multimeric-fusion-protein comprising said first and second
immunoglobulin-polypeptide-chain.
27. The method of claim 17 wherein said first
immunoglobulin-polypeptide-c- hain and said second
recombinant-polypeptide-chain are capable of forming a
multimeric-immunoglobulin in said progeny cell.
28. The method of claim 17 wherein said first
immunoglobulin-polypeptide-c- hain is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
29. The method of claim 28 wherein said second
immunoglobulin-polypeptide is an immunoglobulin heavy chain, or an
immunologically active portion thereof.
30. The method of claim 28 wherein said oil-body targeting-protein
comprises protein A, protein L or protein G.
31. The method of claim 17 wherein said cell is a plant cell.
32. The method of claim 31 wherein said plant cell is a safflower
cell.
33. A method of producing in a plant a recombinant
multimeric-immunoglobul- in, said method comprising: (a) preparing
a first plant comprising cells, said cells comprising oil bodies
and a first immunoglobulin-polypeptide-c- hain wherein said first
immunoglobulin-polypeptide-chain is capable of associating with
said oil bodies through an oil-body-targeting-protein; (b)
preparing a second plant comprising cells, said cells comprising
oil bodies and a second immunoglobulin-polypeptide-chain; and (c)
sexually crossing said first plant with said second plant to
produce a progeny plant comprising cells, said cells comprising oil
bodies, wherein said oil bodies are capable of associating with
said first immunoglobulin-polypeptide-chain and said first
recombinant immunoglobulin polypeptide is capable of associating
with said second immunoglobulin-polypeptide-chain to form said
recombinant multimeric-immunoglobulin.
34. The method of claim 33 wherein said second
immunoglobulin-polypeptide-- chain is capable of associating with
oil bodies through an oil-body-targeting-protein in said second
plant.
35. The method of claim 33 further comprising (d) isolating from
said progeny plant oil bodies comprising said
multimeric-immunoglobulin.
36. The method of claim 33 wherein said oil-body-targeting-protein
is selected from an oil-body-protein or an immunoglobulin.
37. The method of claim 36 wherein said oil-body-protein is an
oleosin or caleosin.
38. The method of claim 37 wherein said first
immunoglobulin-polypeptide-c- hain is fused to said oleosin or
caleosin.
39. The method of claim 38 wherein said second
immunoglobulin-polypeptide-- chain is fused to a second oleosin or
second caleosin capable of associating with an oil body.
40. The method of claim 33 wherein said first
immunoglobulin-polypeptide-c- hain is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
41. The method of claim 40 wherein said second
immunoglobulin-polypeptide-- chain is an immunoglobulin heavy
chain, or an immunologically active portion thereof.
42. The method of claim 40 wherein said oil-body targeting-protein
comprises protein A, protein L or protein G.
43. The method of claim 33 wherein said plant is safflower.
44. A method of producing in a plant a recombinant
multimeric-immunoglobul- in comprising: (a) preparing a first plant
comprising cells, said cells comprising oil bodies and a first and
second immunoglobulin-polypeptide-c- hain wherein said first
immunoglobulin-polypeptide-chain is capable of associating with
said oil bodies through an oil-body-targeting-protein; (b)
preparing a second plant comprising cells, said cells comprising
oil bodies and an oil-body-targeting-protein capable of associating
with said first immunoglobulin-polypeptide-chain through said
oil-body-targeting-protein; and (c) sexually crossing said first
plant with said second plant to produce a progeny plant comprising
cells, said cells comprising oil bodies, wherein said oil bodies
are capable of associating with said first
immunoglobulin-polypeptide-chain through an
oil-body-targeting-protein, and said first
immunoglobulin-polypeptide-cha- in is capable of associating with
said second immunoglobulin-polypeptide-c- hain to form said
recombinant multimeric-immunoglobulin.
45. A method for preparing a multimeric-immunoglobulin associated
with oil bodies comprising: a) introducing into a cell a chimeric
nucleic acid sequence comprising: 1) a first nucleic acid sequence
capable of regulating transcription in said cell operatively linked
to; 2) a second nucleic acid sequence encoding a recombinant fusion
polypeptide comprising (i) a nucleic acid sequence encoding a
sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked to (ii) a
nucleic acid sequence encoding encoding a immunoglobulin comprising
a first immunoglobulin-polypeptide-chain linked to a second
immunoglobulin-polypeptide-chain, operatively linked to; 3) a third
nucleic acid sequence capable of terminating transcription in said
cell; b) growing said cell under conditions to permit expression of
said multimeric-immunoglobulin in a progeny cell comprising oil
bodies; and c) isolating from said progeny cell said oil bodies
comprising said multimeric-immunoglobulin.
46. A chimeric nucleic acid sequence comprising: 1) a first nucleic
acid sequence capable of regulating transcription in a host cell
operatively linked to; 2) a second nucleic acid sequence encoding a
recombinant fusion polypeptide comprising (i) a nucleic acid
sequence encoding a sufficient portion of an oil-body-protein to
provide targeting of said recombinant fusion polypeptide to an oil
body linked to (ii) a nucleic acid sequence encoding an
immunoglobulin comprising a first immunoglobulin-polypeptide-chain
linked to a second immunoglobulin-polypeptide-chain operatively
linked to; 3) a third nucleic acid sequence capable of terminating
transcription in said cell.
47. A chimeric nucleic acid sequence encoding a
multimeric-immunoglobulin-- fusion-protein, said nucleic acid
sequence comprising: (a) a first nucleic acid sequence encoding an
oil-body-targeting-protein operatively linked in reading frame to;
(b) a second nucleic acid sequence encoding a first
immunoglobulin-polypeptide-chain; linked in reading frame to; (c) a
third nucleic acid sequence encoding a second
immunoglobulin-polypeptide-chain, wherein said first and second
immunoglobulin-polypeptide-chain are capable of forming a
multimeric-immunoglobulin.
48. The nucleic acid of claim 47, wherein said
oil-body-targeting-protein is selected from an oil-body-protein or
an immunoglobulin.
49. The nucleic acid of claim 48, wherein said oil-body-protein is
an oleosin or caleosin.
50. The nucleic acid of claim 47, wherein said
multimeric-immunoglobulin is a heteromultimeric-immunoglobulin.
51. The chimeric nucleic acid of claim 47 wherein said first
immunoglobulin-polypeptide-chain is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
52. The chimeric nucleic acid of claim 51 wherein said second
immunoglobulin-polypeptide-chain is an immunoglobulin heavy chain,
or an immunologically active portion thereof.
53. The chimeric nucleic add of claim 51 wherein said oil-body
targeting-protein comprises protein A, protein L or protein G.
54. Isolated oil bodies comprising: (a) a first fusion protein
comprising a first oil-body-targeting-protein fused to a first
immunoglobulin-polypeptide-chain; and (b) a second fusion protein
comprising a second oil-body-targeting-protein fused to a
second-immunoglobulin-polypeptide-chain, wherein said first and
second immunoglobulin-polypeptide-chain are capable of forming a
multimeric-immunoglobulin.
55. Isolated oil bodies of claim 54 wherein said first
oil-body-targeting-protein is an oil-body-protein or an
immunoglobulin.
56. Isolated oil bodies according claim 54 wherein said first
oil-body-protein is an oleosin or a caleosin.
57. The isolated oil bodies of claim 54, wherein said
multimeric-immunoglobulin is a heteromultimeric-immunoglobulin.
58. The oil bodies of claim 54 wherein said first
immunoglobulin-polypepti- de-chain is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
59. The oil bodies of claim 58 wherein said second
immunoglobulin-polypept- ide-chain is an immunoglobulin heavy
chain, or an immunologically active portion thereof.
60. The oil bodies of claim 59 wherein said oil-body
targeting-protein comprises protein A, protein L or protein G.
61. A cell comprising oil bodies and (i) an
oil-body-targeting-protein, (ii) a first
immunoglobulin-polypeptide-chain and (iii) a second
immunoglobulin-polypeptide-chain wherein (1) said first
immunoglobulin-polypeptide-chain is capable of associating with
said oil-body-targeting-protein, and (2) said first
immunoglobulin-polypeptide- -chain capable of associating with said
second immunoglobulin-polypeptide-- chain to form a
multimeric-immunoglobulin.
62. The cell of claim 61 wherein said oil-body-targeting-protein is
an oil-body-protein or an immunoglobulin.
63. The cell of claim 62 wherein said oil-body-protein is an
oleosin or caleosin.
64. The cell of claim 61 wherein said first
immunoglobulin-polypeptide-cha- in is fused to said second
immunoglobulin-polypeptide-chain so as to form a multimeric
immunoglobulin-fusion-protein.
65. The cell of claim 64 wherein said
multimeric-immunoglobulin-fusion-pro- tein is a heteromultimeric
immunoglobulin-fusion-protein.
66. The cell of claim 61 wherein said first
immunoglobulin-polypeptide-cha- in is fused to said
oil-body-targeting-protein.
67. The cell of claim 61 wherein said first
immunoglobulin-polypeptide-cha- in is fused to said first
oil-body-targeting-protein and said second
immunoglobulin-polypeptide-chain is fused to a second
oil-body-targeting-protein.
68. The cell of claim 59 wherein said second
immunoglobulin-polypeptide-ch- ain is capable of associating with a
second oil-body-targeting-protein.
69. The cell of claim 61 wherein said first and second
immunoglobulin-polypeptide-chain form a
heteromultimeric-immunoglobulin.
70. The cell of claim 61 wherein said first
immunoglobulin-polypeptide-cha- in is an
immunoglobulin-polypeptide-light chain or an immunologically active
portion thereof.
71. The cell of claim 70 wherein said second
immunoglobulin-polypeptide-ch- ain is an immunoglobulin heavy
chain, or an immunologically active portion thereof.
72. The cell of claim 61 wherein said cell is obtained from a
plant.
73. The cell of claim 61 wherein said cell is obtainable from a
safflower plant.
74. A plant comprising cells of claim 61.
75. Plant seed comprising cells of claim 61.
76. A safflower plant comprising cells of claim 61.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. utility
application Ser. No. 10/032,201, filed on Dec. 19, 2001, which is a
continuation-in-part of U.S. utility application Ser. No.
10/006,038, filed Dec. 4, 2001 to van Rooijen, et al., entitled
"METHODS FOR THE PRODUCTION OF REDOX PROTEINS"; which is a
continuation-in-part of U.S. utility application Ser. No.
09/742,900, filed Dec. 19, 2000 to Heifetz, et al., entitled
"METHOD OF PRODUCTION AND DELIVERY OF THIOREDOXIN". The Ser.
10/032,201 application is also a continuation-in-part of U.S.
utility application Ser. No. 09/742,900 and claims benefit of
priority under 35 U.S.C. .sctn.119(e) to U.S. provisional
application Serial No. 60/302,885, filed Jul. 5, 2001, to van
Rooijen, et al., entitled "METHODS FOR THE PRODUCTION OF REDOX
PROTEINS". The subject matter of each of the provisional and
utility applications is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to
multimeric-protein-complexes, redox proteins, immunoglobulins and
recombinant polypeptides; and improved methods for their
production.
BACKGROUND OF THE INVENTION
[0003] Multimeric proteins (i.e. proteins comprising multiple
polypeptide chains) are a biologically and commercially important
class of proteins. Antibodies for example are multimeric proteins
which are used to treat a wide range of disease conditions. However
in view of their complexity, multimeric proteins frequently
represent significant manufacturing challenges.
[0004] Redox proteins are also a commercially important class of
proteins with applications in a variety of different industries
including the pharmaceutical, personal care and food industry. For
example, the redox protein thioredoxin may be used in the
manufacture of personal care products (Japanese Patent Applications
JP9012471A2, JP103743A2, JP1129785A2), pharmaceutical
compositions/products (Aota et al. (1996) J. Cardiov. Pharmacol.
(1996) 27: 727-732) as well as to reduce protein allergens present
in food products such as milk (del Val et al. (1999) J. Allerg.
Vlin. Immunol. 103: 690-697) and wheat (Buchanan et al. (1997)
Proc. Natl. Acad. Sci. USA 94: 5372-5377).
[0005] However, there is a need in the art to further improve the
methods for the recombinant expression of multimeric proteins,
including redox proteins and immunoglobulins. The present invention
satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
[0006] The present invention relates to novel and improved methods
of producing a first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulin-polypeptide-chains, immunoglobulins,
redox-fusion-polypeptides, and/or thioredoxin-related proteins; in
association with oil bodies.
[0007] Accordingly, provided herein are methods of producing a
recombinant multimeric-protein-complex, said method comprising: (a)
producing in a cell comprising oil bodies, a first recombinant
polypeptide and a second recombinant polypeptide wherein said first
recombinant polypeptide is capable of associating with said second
recombinant polypeptide to form said multimeric-protein-complex;
and (b) associating said multimeric-protein-complex with an oil
body through an oil-body-targeting-protein capable of associating
with said oil bodies and said first recombinant polypeptide.
[0008] The method further contemplates isolating the oil bodies
associated with said recombinant multimeric-protein-complex. The
second recombinant polypeptide can be associated with a second
oil-body-targeting-protein capable of associating with an oil body
and said second recombinant polypeptide. Each of said
oil-body-targeting-proteins can be an oil-body-protein or an
immunoglobulin. The oil-body-targeting-protein can be an oleosin or
caleosin. When the oil-body-targeting-protein can be an oleosin or
caleosin, the first recombinant polypeptide can be fused to said
oleosin or caleosin. Likewise, the second recombinant polypeptide
can be fused to a second oleosin or second caleosin capable of
associating with an oil body. The oil-body-targeting protein can
also comprise an immunoglobulin-binding-protein, such as protein A.
The first and second recombinant polypeptides can be produced as a
multimeric-fusion-protein comprising said first and second
polypetide, and can form a multimeric-protein-complex. The
multimeric-protein-complex can be a
heteromultimeric-protein-complex, and the
heteromultimeric-protein-complex can be an enzymatically active
redox complex or an immunoglobulin. In one embodiment, the first
recombinant polypeptide is capable of associating with said second
recombinant polypeptide in the cell. In another embodiment, the
first recombinant polypeptide can be a thioredoxin and the second
recombinant polypeptide can be a thioredoxin-reductase. In another
embodiment, the first and second recombinant polypeptides can be an
immunoglobulin-polypeptide-chai- n. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin. The cell can be a plant cell, such as a safflower cell,
and the like.
[0009] Also provided herein is a method of expressing a recombinant
multimeric-protein-complex comprising a first and second
recombinant polypeptide in a cell, said method comprising:
[0010] (a) introducing into a cell a first chimeric nucleic acid
sequence comprising:
[0011] (i) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0012] (ii) a second nucleic acid sequence encoding a first
recombinant polypeptide;
[0013] (b) introducing into said cell a second chimeric nucleic
acid sequence comprising:
[0014] (i) a third nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0015] (ii) a fourth nucleic acid sequence encoding a second
recombinant polypeptide;
[0016] (c) growing said cell under conditions to permit expression
of said first and second recombinant polypeptide in a progeny cell
comprising oil bodies wherein said first recombinant polypeptide
and said second recombinant polypeptide are capable of forming a
multimeric-protein-compl- ex; and
[0017] (d) associating said first recombinant polypeptide with an
oil body through an oil-body-targeting-protein capable of
associating with said oil bodies and said first recombinant
polypeptide. This method further contemplates isolating from the
progeny cell, oil bodies comprising the multimeric-protein-complex.
The method also contemplates separating the
multimeric-protein-complex from the oil bodies. The second
recombinant polypeptide can be associated with a second
oil-body-targeting-protein capable of associating with an oil body
and second recombinant polypeptide. Each of said
oil-body-targeting-proteins can be an oil-body-protein or an
immunoglobulin. The oil-body-targeting-protein can be an oleosin or
caleosin. When the oil-body-targeting-protein is an oleosin or
caleosin, the first recombinant polypeptide can be fused to said
oleosin or caleosin. Likewise, the second recombinant polypeptide
can be fused to a second oleosin or second caleosin capable of
associating with an oil body. The first and second recombinant
polypeptides can be produced as a multimeric-fusion-protein
comprising said first and second polypetide, and can form a
multimeric-protein-compl- ex. The multimeric-protein-complex can be
a heteromultimeric-protein-compl- ex, and the
heteromultimeric-protein-complex can be an enzymatically active
redox complex or an immunoglobulin. In one embodiment, the first
recombinant polypeptide and said second recombinant polypeptide are
capable of forming a multimeric-protein-complex in said progeny
cell. In another embodiment, the first recombinant polypeptide can
be a thioredoxin and the second recombinant polypeptide can be a
thioredoxin-reductase. In another embodiment, the first and second
recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin. The cell can be a plant cell, such as a safflower cell,
and the like.
[0018] Also provided herein are methods of producing in a plant a
recombinant multimeric-protein-complex, said method comprising:
[0019] (a) preparing a first plant comprising cells, said cells
comprising oil bodies and a first recombinant polypeptide wherein
said first recombinant polypeptide is capable of associating with
said oil bodies through an oil-body-targeting-protein;
[0020] (b) preparing a second plant comprising cells, said cells
comprising oil bodies and a second recombinant polypeptide; and
[0021] (c) sexually crossing said first plant with said second
plant to produce a progeny plant comprising cells, said cells
comprising oil bodies, wherein said oil bodies are capable of
associating with said first recombinant polypeptide, and said first
recombinant recombinant polypeptide is capable of associating with
said second recombinant polypeptide to form said recombinant
multimeric-protein-complex. The second recombinant polypeptide can
be associated with oil bodies through a second
oil-body-targeting-protein in the second plant. The oil bodies can
be isolated from the progeny plant comprising said
multimeric-protein-complex. The oil-body-targeting-protein can be
selected from an oil-body-protein or an immunoglobulin, wherein the
oil-body-protein can be an oleosin or caleosin. The first
recombinant polypeptide can be fused to the oleosin or caleosin;
and the second recombinant polypeptide can be fused to a second
oleosin or second caleosin capable of associating with an oil body.
The first and second recombinant polypeptide can form a
multimeric-protein-complex, such as a
heteromultimeric-protein-complex, wherein the
heteromultimeric-protein-co- mplex can be an enzymatically active
redox complex or an immunoglobulin. In another embodiment, the
first and second recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protei- n can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin. The plant can be a safflower plant.
[0022] Also provided herein are methods of producing in a plant a
recombinant multimeric-protein-complex, said method comprising:
[0023] (a) preparing a first plant comprising cells, said cells
comprising oil bodies and a first and second recombinant
polypeptide wherein said first recombinant polypeptide is capable
of associating with said oil bodies through an
oil-body-targeting-protein;
[0024] (b) preparing a second plant comprising cells, said cells
comprising oil bodies and an oil-body-targeting-protein that is
capable of associating with said first recombinant polypeptide;
and
[0025] (c) sexually crossing said first plant with said second
plant to produce a progeny plant comprising cells, said cells
comprising oil bodies, wherein said oil bodies are capable of
associating with said first recombinant polypeptide through said
oil-body-targeting-protein, and said first recombinant recombinant
polypeptide is capable of associating with said second recombinant
polypeptide to form said recombinant multimeric-protein-complex.
The oil bodies can be isolated from the progeny plant comprising
said multimeric-protein-complex. The multimeric-protein-complex can
be separated from the oil bodies. The oil-body-targeting-protein
can be selected from an oil-body-protein or an immunoglobulin,
wherein the oil-body-protein can be an oleosin or caleosin. The
first and second recombinant polypeptide can form a
multimeric-protein-complex, such as a
heteromultimeric-protein-complex, wherein the
heteromultimeric-protein-complex can be an enzymatically active
redox complex or an immunoglobulin. In a particular embodiment, the
first recombinant polypeptide is a thioredoxin and the second
recombinant polypeptide is a thioredoxin-reductase. In another
embodiment, the first and second recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin. The plant can be a safflower plant.
[0026] Also provided herein are chimeric nucleic acids encoding a
multimeric-fusion-protein as described herein, said nucleic acid
comprising:
[0027] (a) a first nucleic acid sequence encoding an
oil-body-targeting-protein operatively linked in reading frame
to;
[0028] (b) a second nucleic acid sequence encoding a first
recombinant polypeptide; linked in reading frame to;
[0029] (c) a third nucleic acid sequence encoding a second
recombinant polypeptide, wherein said first and second recombinant
polypeptide are capable of forming a multimeric-protein-complex.
The oil-body-targeting-protein can be selected from an
oil-body-protein or an immunoglobulin. The oil-body-protein can be
an oleosin or caleosin. The multimeric-protein-complex can be a
heteromultimeric-protein-complex, and the first and second
recombinant polypeptide can form an enzymatically active
heteromultimeric redox complex or an immunoglobulin. In a
particular embodiment, the first recombinant polypeptide is a
thioredoxin and the second recombinant polypeptide is a
thioredoxin-reductase. In another embodiment, the first and second
recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In yet another embodiment,
positioned between the nucleic acid sequence encoding an
oil-body-targeting-protein and the nucleic acid sequence encoding a
first recombinant polypeptide can be a linker nucleic acid sequence
encoding an oil-body-surface-avoiding linker amino acid sequence.
The oil-body-surface-avoiding linker amino acid sequence can be
substantially negatively charged, or have a molecular weight of at
least 35 kd. Optionally, the gene fusion further comprises a linker
nucleic acid sequence encoding an amino acid sequence that is
specifically cleavable by an enzyme or a chemical, wherein the
linker sequence is positioned between the oil-body-surface-avoiding
linker amino acid sequence that is also a non-proteolytic linker
and said sequence encoding the first recombinant polypeptide.
[0030] Also provided herein are recombinant
multimeric-fusion-proteins comprising (i) an
oil-body-targeting-protein, or fragment thereof, (ii) a first
recombinant polypeptide and a (iii) second recombinant polypeptide,
wherein said first and second recombinant polypeptides are capable
of forming a multimeric-protein-complex. The
oil-body-targeting-protein can be selected from an oil-body-protein
or an immunoglobulin, and the oil-body-protein can be an oleosin or
a caleosin. The multimeric-fusion-protein can be a
heteromultimeric-fusion-protein, wherein said first and second
recombinant polypeptide form an enzymatically active
heteromultimeric redox complex or an immunoglobulin. In a
particular embodiment, the first recombinant polypeptide is a
thioredoxin and the second recombinant polypeptide is a
thioredoxin-reductase. In another embodiment, the first and second
recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin. In yet another embodiment, positioned between the nucleic
acid sequence encoding an oil-body-targeting-protein and the
nucleic acid sequence encoding a first recombinant polypeptide can
be a linker nucleic acid sequence encoding a
oil-body-surface-avoiding linker amino acid sequence. The
oil-body-surface-avoiding linker amino acid sequence can be
substantially negatively charged, or have a molecular weight of at
least 35 kd. Optionally, the gene fusion further comprises a linker
nucleic acid sequence encoding an amino acid sequence that is
specifically cleavable by an enzyme or a chemical, wherein the
linker sequence is positioned between the oil-body-surface-avoiding
linker amino acid sequence and said sequence encoding the first
recombinant polypeptide.
[0031] Also provided herein are isolated oil bodies comprising a
multimeric-protein-complex comprising (i) an
oil-body-targeting-protein and (ii) a first recombinant
polypeptide, said oil bodies further comprising a second
recombinant polypeptide, wherein said first and second recombinant
polypeptide are capable of forming a multimeric-protein-complex.
The oil-body-targeting-protein can be selected from an
oil-body-protein or an immunoglobulin, and the oil-body-protein can
be an oleosin or a caleosin. The multimeric-fusion-protein can be a
heteromultimeric-fusion-protein, wherein said first and second
recombinant polypeptide form an enzymatically active
heteromultimeric redox complex or an immunoglobulin. In a
particular embodiment, the first recombinant polypeptide is a
thioredoxin and the second recombinant polypeptide is a
thioredoxin-reductase. In another embodiment, the first and second
recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G, preferably fused to an oil body protein such as an
oleosin.
[0032] Also provided herein are isolated oil bodies comprising:
[0033] (a) a first fusion protein comprising a first
oil-body-targeting-protein fused to a first recombinant
polypeptide; and
[0034] (b) a second fusion protein comprising a second
oil-body-targeting-protein fused to a second recombinant
polypeptide,
[0035] wherein said first and second recombinant polypeptide are
capable of forming a multimeric-protein-complex. The
oil-body-targeting-protein can be selected from an oil-body-protein
or an immunoglobulin, and the oil-body-protein can be an oleosin or
a caleosin. The multimeric-fusion-protein can be a
heteromultimeric-fusion-protein, wherein said first and second
recombinant polypeptide form an enzymatically active
heteromultimeric redox complex or an immunoglobulin. In a
particular embodiment, the first recombinant polypeptide is a
thioredoxin and the second recombinant polypeptide is a
thioredoxin-reductase. In another embodiment, the first and second
recombinant polypeptides can be an
immunoglobulin-polypeptide-chain. For example, the first
recombinant polypeptide can be an immunoglobulin light chain, or an
immunologically active portion thereof, and the second recombinant
polypeptide can be an immunoglobulin heavy chain, or an
immunologically active portion thereof. In this embodiment, the
oil-body-targeting-protein can comprise protein A, protein L or
protein G.
[0036] Also provided are cells and transgenic plants comprising oil
bodies, multimeric-protein-complexes, multimeric-fusion-proteins,
set forth herein. In one embodiment, the first recombinant
polypeptide can be an immunoglobulin-polypeptide-chain. For
example, the first recombinant polypeptide can be an immunoglobulin
light chain, or an immunologically active portion thereof, and the
second recombinant polypeptide can be an immunoglobulin heavy
chain, or an immunologically active portion thereof. In this
embodiment, the oil-body-targeting-protein can comprise protein A,
protein L or protein G. In embodiments, wherein said first
recombinant polypeptide is a thioredoxin and said second
recombinant polypeptide is a thioredoxin-reductase, the methods
described herein can be used to formulate the oil bodies for use in
the preparation of a food product, personal care product or
pharmaceutical composition. These formulations can further comprise
the addition of NADP or NADPH. The food product can be a milk or
wheat based food product. The personal care product can reduce the
oxidative stress to the surface area of the human body or can be
used to lighten the skin. The pharmaceutical composition can be
used to treat chronic obstructive pulmonary disease (COPD),
cataracts, diabetes, envenomation, bronchiopulmonary disease,
malignancies, psoriasis, reperfusion injury, wound healing, sepsis,
GI bleeding, intestinal bowel disease (IBD), ulcers, GERD (gastro
esophageal reflux disease).
[0037] Also provided herein are compositions comprising isolated
oil bodies and a first recombinant polypeptide that can be an
immunoglobulin-polypeptide-chain and a second recombinant
polypeptide that can also be an immunoglobulin-polypeptide-chain.
For example, the first recombinant polypeptide can be an
immunoglobulin light chain, or an immunologically active portion
thereof, and the second recombinant polypeptide can be an
immunoglobulin heavy chain, or an immunologically active portion
thereof. In this embodiment, the oil-body-targeting-protei- n can
comprise protein A, protein L or protein G.
[0038] Also provided are multimeric-fusion-proteins, wherein the
fusion-protein contains two or more polypeptide chains selected
from the group of proteins set forth in FIG. 1. Methods are also
provided of reducing allergenicity of a food comprising the steps
of providing the isolated oil bodies set forth herein; and adding
the isolated oil bodies to the food, whereby allergenicity of the
food is reduced. The food can be selected from the group consisting
of wheat flour, wheat dough, milk, cheese, yogurt and ice cream.
The various methods of treating food can further comprise providing
NADH as a co-factor in the substantial absence of NADPH.
[0039] Also provided herein are methods of treating or protecting a
target against oxidative stress, comprising the steps of providing
the recombinant redox fusion polypeptide comprising thioredoxin and
thioredoxin-reductase; and contacting the recombinant fusion
polypeptide with a target, wherein the target is susceptible to
oxidative stress, thereby treating or protecting against the
stress. The target can be selected from the group consisting of a
molecule, a molecular complex, a cell, a tissue, and an organ.
[0040] Also provided herein are methods for preparing an
enzymatically active redox protein associated with oil bodies
comprising:
[0041] a) producing in a cell a redox fusion polypeptide comprising
a first redox protein linked to a second redox protein;
[0042] b) associating said redox fusion polypeptide with oil bodies
through an oil-body-targeting-protein capable of associating with
said redox fusion polypeptide and said oil bodies; and
[0043] c) isolating said oil bodies associated with said redox
fusion polypeptide.
[0044] The first redox protein can be a thioredoxin and the second
redox protein can be a thioredoxin-reductase.
[0045] Also, provided herein are methods of producing an
immunoglobulin, said method comprising: (a) producing in a cell
comprising oil bodies, a first immunoglobulin-polypeptide-chain and
a second immunoglobulin-polypeptide-chain wherein said first
immunoglobulin-polypeptide-chain is capable of associating with
said second immunoglobulin-polypeptide-chain to form said
immunoglobulin; and (b) associating said immunoglobulin with an oil
body through an oil-body-targeting-protein capable of associating
with said oil bodies and said first
immunoglobulin-polypeptide-chain. For example, the first
immunoglobulin-polypeptide-chain can be an immunoglobulin light
chain, or an immunologically active portion thereof, and the second
immunoglobulin-polypeptide-chain can be an immunoglobulin heavy
chain, or an immunologically active portion thereof. In this
embodiment, the oil-body-targeting-protein can comprise protein A,
protein L or protein G, preferably fused to an oil body protein
such as an oleosin.
[0046] Also provided herein are methods for preparing a redox
protein or an immunoglobulin associated with oil bodies
comprising:
[0047] a) introducing into a cell a chimeric nucleic acid sequence
comprising:
[0048] 1) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0049] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a nucleic acid sequence encoding
a sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked to (ii) a
nucleic acid sequence encoding a redox fusion polypeptide
comprising a first redox protein linked to a second redox protein,
or a nucleic acid sequence encoding a immunoglobulin comprising a
first immunoglobulin-polypeptide-chain linked to a second
immunoglobulin-polypeptide-chain, operatively linked to;
[0050] 3) a third nucleic acid sequence capable of terminating
transcription in said cell;
[0051] b) growing said cell under conditions to permit expression
of said redox fusion polypeptide or immunoglobulin in a progeny
cell comprising oil bodies; and
[0052] c) isolating from said progeny cell said oil bodies
comprising said redox fusion polypeptide or immunoglobulin.
[0053] In certain embodiments, positioned between said nucleic acid
sequence encoding a sufficient portion of an oil-body-protein and
said nucleic acid sequence encoding a redox fusion polypeptide or
immunoglobulin can be a linker nucleic acid sequence encoding a
oil-body-surface-avoiding linker amino acid sequence. The
oil-body-surface-avoiding linker amino acid sequence can be
substantially negatively charged or have a molecular weight of at
least 35 kd. Optionally, the gene fusion further comprises a linker
nucleic acid sequence encoding an amino acid sequence that is
specifically cleavable by an enzyme or a chemical, wherein the
linker sequence is positioned between the oil-body-surface-avoiding
linker amino acid sequence and said nucleic acid sequence encoding
a redox fusion polypeptide. In this optional embodiment, also
contemplated is the introduction of an enzyme or chemical that
cleaves said redox fusion polypeptide from said oil body, thereby
obtaining isolated redox fusion polypeptide. The first redox
protein can be a thioredoxin and said second redox protein can be a
thioredoxin-reductase. In one embodiment, the thioredoxin and
thioredoxin-reductase can be obtained from Arabidopsis. In another
embodiment, the first redox protein is at least 5 times more active
when produced as a redox fusion polypeptide as compared to the
production of the first redox protein without the second redox
protein.
[0054] Also provided herein, for use with the various methods set
forth herein is the formulation of an emulsion of the oil bodies
associated with the redox fusion polypeptide for use in the
preparation of a product capable of treating oxidative stress in a
target, a product capable of chemically reducing a target,
pharmaceutical composition, a personal care product or a food
product. Accordingly, an emulsion formulation composition is
provided.
[0055] Also provided herein is a chimeric nucleic acid
comprising:
[0056] 1) a first nucleic acid sequence capable of regulating
transcription in a host cell operatively linked to;
[0057] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a nucleic acid sequence encoding
a sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked to (ii) a
nucleic acid sequence encoding a redox fusion polypeptide
comprising a first redox protein linked to a second redox protein
operatively linked to;
[0058] 3) a third nucleic acid sequence capable of terminating
transcription in said cell.
[0059] The oil-body-protein can be an oleosin or a caleosin. The
first redox protein can be a thioredoxin and said second redox
protein can be a thioredoxin-reductase. In certain embodiments,
positioned between said nucleic acid sequence encoding a sufficient
portion of an oil-body-protein and said nucleic acid sequence
encoding a redox fusion polypeptide is a linker nucleic acid
sequence encoding a oil-body-surface-avoiding linker amino acid
sequence. The oil-body-surface-avoiding linker amino acid sequence
can be substantially negatively charged, or have a molecular weight
of at least 35 kd. In one embodiment, the gene fusion optionally
further comprises a linker nucleic acid sequence encoding an amino
acid sequence that is specifically cleavable by an enzyme or a
chemical, wherein the linker sequence is positioned between the
oil-body-surface-avoiding linker amino acid sequence and said
nucleic acid sequence encoding a redox fusion polypeptide.
[0060] Also provided herein are transgenic plants, e.g., safflower
plants, comprising any of the chimeric nucleic acid sequences and
constructs described herein. The chimeric nucleic acids can be
contained within a plastid. Accordingly, isolated plastids are
provided having chimeric nucleic acids therein. Also provided are
plant seeds comprising the chimeric nucleic acids provided
herein.
[0061] Also provided are oil body preparations obtained using any
of the methods provided herein, and food products, pharmaceutical
compositions, and personal care products containing the oil body
preparations. The products and/or compositions provided herein are
capable of treating oxidative stress in a target, capable of
chemically reducing a target. Also provided is a detergent
composition comprising an oil body preparation capable of
chemically reducing a target, and related methods of cleansing an
item, comprising administering such product to the item under
conditions that promote cleansing.
[0062] Also provided herein are nucleic acid constructs comprising
a gene fusion, wherein the gene fusion comprises a first region
encoding an oil-body-protein or an active fragment thereof,
operably linked to a second region encoding at least one
thioredoxin-related protein or an active fragment thereof. In one
embodiment, the at least one thioredoxin-related protein can be
thioredoxin. The thioredoxin can be obtained from Arabidopsis or
wheat.
[0063] In another embodiment, the at least one thioredoxin-related
protein can be thioredoxin-reductase. The thioredoxin-reductase can
be derived from Arabidopsis or wheat. The thioredoxin-reductase can
be an NADPH-dependent thioredoxin-reductase. The second region can
encode a thioredoxin and thioredoxin-reductase. In one embodiment,
the thioredoxin and thioredoxin-reductase is obtained from
Mycobacterium leprae. In another embodiment, the at least one
thioredoxin-related protein can be an engineered fusion protein.
The first region can precede, in a 5' to 3' direction, the second
region. Alternatively, the first region follows, in a 5' to 3'
direction, the second region. The gene fusion can optionally
further comprise a third region encoding a second
thioredoxin-related protein or an active fragment thereof, operably
linked to the first region, or to the second region, or to both. A
seed-specific promoter, such as a phaseolin promoter or linin
promoter, can be operably linked to the gene fusion. In one
embodiment, at least one thioredoxin-related protein is derived
from a plant species selected from the group consisting of
Arabidopsis and wheat. In another embodiment, at least one
thioredoxin-related protein can be derived from E. coli.
[0064] In one embodiment, the gene fusion further comprises a
nucleic acid sequence encoding a oil-body-surface-avoiding linker
amino acid sequence, wherein the linker amino acid sequence is
positioned between the first region and the second region. The
oil-body-surface-avoiding linker amino acid sequence can be
substantially negatively charged, or have a molecular weight of at
least 35 kd. In addition, the gene fusion can further comprise a
linker nucleic acid sequence encoding an amino acid sequence that
is specifically cleavable by an enzyme or a chemical, wherein the
linker sequence is positioned between the oil-body-surface-avoiding
linker amino acid sequence and the second region.
[0065] Also provided herein are transgenic plants containing a
nucleic acid construct comprising a gene fusion, wherein the gene
fusion comprises a region encoding an oil-body-protein or an active
fragment thereof, operably linked to a region encoding a first
thioredoxin-related protein or an active fragment thereof. The
thioredoxin-related protein can be thioredoxin. The nucleic acid
construct can be contained within a plastid. In one embodiment,
when the first thioredoxin-related protein is thioredoxin and the
construct can further comprise a region encoding a
thioredoxin-reductase. The gene fusion can optionally further
comprise a third region encoding a second thioredoxin-related
protein or an active fragment thereof, operably linked to the first
region, or to the second region, or to both. The gene fusion can
further optionally further comprise a nucleic acid sequence
encoding a oil-body-surface-avoiding linker amino acid sequence,
wherein the nucleic acid encoding the linker amino acid sequence is
positioned between the region encoding an oil-body-protein and the
region encoding a first thioredoxin-related protein. The
oil-body-surface-avoiding linker amino acid sequence can be
substantially negatively charged, or have a molecular weight of at
least 35 kd. The gene fusion can optionally further comprise a
linker nucleic acid sequence encoding an amino acid sequence that
is specifically cleavable by an enzyme or a chemical, wherein the
linker sequence is positioned between the oil-body-surface-avoiding
linker amino acid sequence and the region encoding a first
thioredoxin-related protein.
[0066] Also provided is a transgenic plant comprising a nucleic
acid construct, a seed-specific promoter operably linked to a gene
fusion, wherein the gene fusion comprises a region encoding an
oil-body-protein or an active fragment thereof, operably linked to
a region encoding a first thioredoxin-related protein or an active
fragment thereof, wherein a fusion protein comprising activities of
oleosin and the thioredoxin-related protein is produced in a seed
of the plant. In another embodiment, a thioredoxin-related protein
having concentration of at least about 0.5% of total cellular seed
protein is provided. Also provided herein is an extract comprising
an activity of a thioredoxin-related protein. Also provided are oil
bodies and/or oil obtained from various seeds.
[0067] Also provided herein are methods of making a fusion protein
comprising a thioredoxin-related activity, the method comprising
the steps of:
[0068] a) providing a transgenic plant comprising a nucleic acid
construct comprising a seed-specific promoter operably linked to a
gene fusion, wherein the gene fusion comprises a region encoding an
oil-body-protein or an active fragment thereof, operably linked to
a region encoding a first thioredoxin-related protein or an active
fragment thereof, the gene fusion encoding a fusion protein
comprising a thioredoxin-related activity;
[0069] b) obtaining seeds from the plant; and
[0070] c) recovering the fusion protein by isolating oil bodies
from the seeds. In one embodiment, the oil bodies are fractionated
to achieve partial purification of the fusion protein. The oil
bodies can be in association with a fusion protein. The
oil-body-protein can be cleaved from the thioredoxin-related
protein after fractionation of the oil bodies. The cleaving step
can make use of a protease or chemical proteolysis.
[0071] Also provided herein are methods of reducing allergenicity
of a food comprising the steps of:
[0072] a) providing a preparation comprising oil bodies associated
with a fusion protein, the fusion protein comprising an
oil-body-protein or an active fragment thereof and a
thioredoxin-related protein or an active fragment thereof; and
[0073] b) adding the preparation to the food, whereby allergenicity
of the food is reduced due to activity of the thioredoxin-related
protein or fragment. The food can be wheat flour, wheat dough,
milk, cheese, yogurt and ice cream. In one embodiment, NADH is used
as a co-factor in the substantial absence of NADPH.
[0074] Also provided herein are pharmaceutical compositions
comprising a fusion protein, the fusion protein comprising an
oil-body-protein or an active fragment thereof and a
thioredoxin-related protein or an active fragment thereof, in a
pharmaceutically acceptable carrier. The oil bodies can be
associated with the fusion protein. Also provided is a cosmetic
formulation comprising oil bodies associated with a fusion protein,
the fusion protein comprising an oil-body-protein or an active
fragment thereof and a thioredoxin-related protein or an active
fragment thereof, in a pharmaceutically acceptable carrier. Also
provided are methods of treating or protecting a target against
oxidative stress, comprising the steps of:
[0075] a) providing a preparation comprising a fusion protein, the
fusion protein comprising an oil-body-protein or an active fragment
thereof and a thioredoxin-related protein or an active fragment
thereof; and
[0076] b) contacting the preparation with a target, wherein the
target is susceptible to oxidative stress, thereby treating or
protecting against the stress. The target can be selected from the
group consisting of a molecule, a molecular complex, a cell, a
tissue, and an organ.
[0077] Also provided is a nucleic acid construct comprising a gene
fusion, wherein the gene fusion comprises a first region encoding
an oil-body-protein or an active fragment thereof, operably linked
to a second region encoding at least one polypeptide or an active
fragment thereof, and an oil-body-surface-avoiding linker in frame
between the first and second region polypeptides. Also provided are
methods of expressing this construct into the encoded amino acid
sequence; and oil bodies, formulations, emulsions, cells, and
plants comprising the construct and encoded amino acid sequence.
These particular constructs, oil bodies, formulations, emulsions,
cells, and plants can be produced according to the methods
described herein. The second region can encode any polypeptide, for
example, a therapeutically, nutritionally, industrially or
cosmetically useful peptide as set forth herein. For example, the
second region can encode a redox protein, an immunoglobulin, a
thioredoxin-related protein or any one or more recombinant
polypeptides of a multimeric-protein-complex.
[0078] Other features and advantages of the present invention will
become readily apparent from the following detailed description. it
should be understood however that the detailed description and the
specific examples while indicating particular embodiments of the
invention are given by way of illustration only.
BRIEF DESCRIPTION OF THE DRAWINGS
[0079] FIG. 1 provides a listing of exemplary proteins for use in
the heteromultimeric-fusion-proteins and
heteromultimeric-protein-complexes provided herein.
[0080] FIG. 2 Coomassie stained protein gel showing the
partitioning of assembled antibody complexes with the oil body (OB)
or the soluble undematant (U) fraction from wild type (wt)
Arabidopsis C24 or transgenic SBS4803 seeds. The arrow indicates
the high molecular weight antibody complexes in non-reduced samples
separated by SDS-PAGE as evident by the mouse IgG1 and purified D9
MAb control lanes.
[0081] FIG. 3. A) Coomassie stained gel of Arabidopsis total
protein extracts showing reduced or non-reduced samples from wild
type (wt) seeds and transgenic SBS4809 seeds expressing chimeric
heavy and light antibody chains (Lines #6 and #13). Mouse (Mm) and
human (Hu) samples of IgG1 antibody are included as controls. B)
Western blots showing human heavy chain IgG Fc-specifc detection
and human kappa chain-specific detection. Reduced samples were
separated on SDS-PAGE to identify individual antibody chains, while
non-reduced samples were separated to identify antibody assemblies
of heavy and light chains covalently bound by disulfide bonds. Both
heavy and light chains are detected in the assembled antibody
complex (non-reduced samples; arrow). The migration of this complex
is comparable to the mouse and human IgG1 control protein.
[0082] FIG. 4 (and SEQ ID NO:38) shows the amino acid sequence of
the five immunoglobulin-binding domains in the Protein A sequence
of Staphylococcus aureus.
[0083] FIG. 5 (and SEQ ID NO:39) shows the DNA and encoding amino
acid sequence of the Protein A insert in pSBS2904.
[0084] FIG. 6. Individual wild type (wt) or transgenic safflower
seeds were extracted and oil body (OB) and soluble undernatant (U)
fractions were analyzed by Western blot. Detection was performed
using a goat anti-human IgG Fc-specific secondary antibody (ICN
Biomedicals Inc.). Seeds analyzed were from individual transgenic
lines (Protein A-oleosin SBS4901, chimeric heavy and light chain
SBS4810) or seeds resulting from the cross of the SBS4901 and
SBS4810 transgenic lines. The double transgenic seed
(SBS4810+SBS4901) and single transgenic seed (SBS4810 +-) resulting
from the cross are compared to the single transgenic lines.
DETAILED DESCRIPTION OF THE INVENTION
[0085] As hereinbefore mentioned, the present invention relates to
novel and improved methods for the production of multimeric
proteins, including a first and second recombinant polypeptide,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulin-polypeptide-chains, immunoglobulins,
redox-fusion-polypeptides, and a first and second
thioredoxin-related protein; and related products. These methods
permit the production of active multimeric-protein-complexes in
association with oil bodies. The oil bodies in association with the
multimeric-protein-complex may be used to prepare various useful
emulsions.
[0086] Accordingly, provided herein are methods of producing a
recombinant multimeric-protein-complex associated with an oil body,
said method comprising:
[0087] (a) producing in a cell comprising oil bodies, a first
recombinant polypeptide and a second recombinant polypeptide
wherein said first recombinant polypeptide is capable of
associating with said second recombinant polypeptide in the cell to
form said multimeric-protein-compl- ex; and
[0088] (b) associating said multimeric-protein-complex with an oil
body through an oil-body-targeting-protein capable of associating
with said oil body and said first recombinant polypeptide.
[0089] Definitions and Terms
[0090] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which this invention belongs. Where
permitted, all patents, applications, published applications and
other publications and sequences from GenBank, SwissPro and other
data bases referred to throughout in the disclosure herein are
incorporated by reference in their entirety.
[0091] As used herein, the phrase "multimeric-protein-complex",
refers to two or more polypeptide chains that permanently or
repeatedly interact or permanently or repeatedly coordinate to form
a biologically active assembly comprising said two or more
polypeptide chains. It should be noted that the polypeptides may be
independently biologically active without interaction or
coordination to form the complex. The multimeric-protein-complex
may provide a biological structure, or it may be capable of
facilitating a chemical or biological reaction. For example, one of
the protein regions within the multimeric-protein-complex can
repeatedly activate or repeatedly inactivate the biological or
metabolic activity of one or more of the other proteins contained
within the multimeric-protein-complex. In one embodiment, the first
and second recombinant polypeptide contained in a
multimeric-protein-complex may either associate or interact as
independent non-contiguous polypeptide chains or the
multimeric-protein-complex may be prepared as a fusion polypeptide
(multimeric-fusion-protein) between the first and second
recombinant polypeptide.
[0092] One example of a repeated (e.g., reoccurring) interaction or
association between the two or more polypeptides of a
multimeric-protein-complex provided herein is the interaction
between two or more non-identical redox proteins to form a
heteromultimeric-protein-c- omplex. Exemplary redox proteins for
use in this regard are thioredoxin and the thioredoxin-reductase. A
further example is the interaction between two or more
immunoglobulin-polypeptide-chains to form an immunoglobulin. As
used herein, the phrase "heteromultimeric-protein-comp- lex",
refers to two or more non-identical polypeptide chains that
permanently or repeatedly interact or permanently or repeatedly
coordinate to form a biologically active assembly comprising said
two or more polypeptide chains. Other examples of
multimeric-protein-complexes provided herein include a first and
second recombinant polypeptide, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, first and second
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, and a
first and second thioredoxin-related protein.
[0093] The recombinant polypeptide or multimeric-protein-complex is
associated with an oil body. As used herein, the phrase "oil body"
or "oil bodies" refers to any oil or fat storage organelle in any
cell type. Accordingly, the oil bodies may be obtained from any
cell comprising oil bodies, including plant cells (described in for
example: Huang (1992) Ann. Rev. Plant Mol. Biol. 43: 177-200),
animal cells (described in for example: Murphy (1990) Prog Lipid
Res 29(4): 299-324), including adipocytes, hepatocytes,
steroigogenic cells, mammary epithelial cells, macrophages, algae
cells (described in for example: Rossler (1988) J. Physiol. London,
24: 394-400) fungal cells, including yeast cells (described in for
example Leber et al. (1994) Yeast 10: 1421-1428) and bacterial
cells (described in for example: Pieper-Furst et al. (1994) J.
Bacteriol. 176: 4328-4337). Preferably the oil bodies used herein
are oil bodies obtainable from plant cells and more preferably the
oil bodies obtainable from plant seed cells.
[0094] As used herein, the phrase "is capable of associating with",
"associate" or grammatical variations thereof, refers to any
interaction between two or more polypeptides, including any
covalent interactions (e.g. multimeric-fusion-proteins) as well as
non-covalent interactions. Exemplary non-covalent interactions can
be between the oil-body-targeting-protein and a redox protein or
immunoglobulin-polypept- ide-chain, as well as between two or more
different proteins contained within two or more separate
oil-body-protein fusion proteins (e.g., the redox proteins in
oleosin-thioredoxin and oleosin-thioredoxin-reductase).
[0095] As used herein, the term "recombinant" (also referred to as
heterologous) in the context of recombinant proteins and amino
acids, means "of different natural origin" or represents a
non-natural state. For example, if a host cell is transformed with
a nucleotide sequence derived from another organism, particularly
from another species, that nucleotide sequence and amino acid
sequence encoded thereby, is recombinant (heterologous) with
respect to that host cell and also with respect to descendants of
the host cell which carry that gene. Similarly, recombinant (or
heterologous) refers to a nucleotide sequence derived from and
inserted into the same natural, original cell type, but which is
present in a non-natural state, e.g., a different copy number, or
under the control of different regulatory elements. A transforming
nucleotide sequence may include a recombinant coding sequence, or
recombinant regulatory elements. Alternatively, the transforming
nucleotide sequence may be completely heterologous or may include
any possible combination of heterologous and endogenous nucleic
acid sequences.
[0096] In various embodiments of the present invention, the first
and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or thioredoxin-related proteins, are
produced in a cell comprising oil bodies. As used herein the phrase
"in a cell", "in the cell", or grammatical variations thereof, mean
that the first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or thioredoxin-related proteins, may
be produced in any cellular compartment of that cell, so long as
that cell comprises oil bodies therein. In embodiments of the
invention in which plant cells are used, the phrase is intended to
include the plant apoplast.
[0097] In various embodiments provided herein, the first and/or
second recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, and
thioredoxin-related proteins, associate with an oil body through an
oil-body-targeting-protein. As used herein, the phrase
"oil-body-targeting-protein" refers to any protein, protein
fragment or peptide capable of associating with an oil body.
Exemplary oil-body-targeting-proteins for use herein include
oil-body-proteins, such as oleosin and caleosin; immunoglobulins,
such as bi-specific antibodies; and the like.
[0098] In embodiments described herein in which an oil-body-protein
is used, the first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and thioredoxin-related proteins, are
preferably fused to the oil-body-protein. The term
"oil-body-protein" refers to any protein naturally present in cells
and having the capability of association with oil bodies, including
any oleosin or caleosin.
[0099] Accordingly, provided herein a method of expressing a
recombinant multimeric-protein-complex comprising a first and
second recombinant polypeptide in a cell, said method
comprising:
[0100] (a) introducing into a cell a first chimeric nucleic acid
sequence comprising:
[0101] (i) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0102] (ii) a second nucleic acid sequence encoding a first
recombinant polypeptide, such as a redox protein, an
immunoglobulin-polypeptide-chain or an thioredoxin-related protein,
fused to an oil-body-protein;
[0103] (b) introducing into said cell a second chimeric nucleic
acid sequence comprising:
[0104] (i) a third nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0105] (ii) a fourth nucleic acid sequence encoding a second
recombinant polypeptide, such as a second redox protein, a second
immunoglobulin-polypeptide-chain or a second thioredoxin-related
protein;
[0106] (c) growing said cell under conditions to permit expression
of said first and second recombinant polypeptide in a progeny cell
comprising oil bodies wherein said first recombinant polypeptide
and said second recombinant polypeptide are capable of forming a
multimeric-protein-compl- ex, preferably in said progeny cell;
and
[0107] (d) associating said first recombinant polypeptide with an
oil body through said oil-body-protein.
[0108] The term "nucleic acid" as used herein refers to a sequence
of nucleotide or nucleoside monomers consisting of naturally
occurring bases, sugars and intersugar (backbone) linkages. The
term also includes modified or substituted sequences comprising
non-naturally occurring monomers or portions thereof, which
function similarly. The nucleic acid sequences may be ribonucleic
acids (RNA) or deoxyribonucleic acids (DNA) and may contain
naturally occurring bases including adenine, guanine, cytosine,
thymidine and uracil. The sequences also may contain modified bases
such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl
and other alkyl adenines, 5-halo-uracil, 5-halo cytosine, 6-aza
uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil,
4-thiouracil, 8-halo adenine, 8-amino adenine, 8-thiol-adenine,
8-thio-alkyl adenines, 8-hydroxyl adenine and other 8-substituted
adenines, 8-halo guanines, 8 amino guanine, 8 thiol guanine,
8-thioalkyl guanines, 8 hydroxyl guanine and other 8-substituted
guanines, other aza and deaza uracils, thymidines, cytosines,
adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro
cytosine.
[0109] Multimeric-protein-complexes
[0110] In accordance with the methods and compositions provided
herein, any two recombinant polypeptides capable of forming a
multimeric-protein-complex may be used. The nucleic acid sequences
encoding the two recombinant polypeptides may be obtained from any
biological source or may be prepared synthetically. In general
nucleic acid sequence encoding multimeric proteins are known to the
art and readily available. Known nucleic acid sequences encoding
multimeric-protein-complexes may be used to design and construct
nucleic acid sequence based probes in order to uncover and identify
previously undiscovered nucleic acid sequences encoding
multimeric-protein-complexes- , for example, by screening cDNA or
genomic libraries or using 2- or multi-hybrid systems. Thus,
additional nucleic acid sequences encoding
multimeric-protein-complexes may be discovered and used as
described herein.
[0111] The first and/or second recombinant polypeptides that are
comprised within a multimeric-protein-complex provided herein, can
themselves be in the form of heteromultimeric-protein-complexes,
multimeric-fusion-protein- s, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or a first and/or second
thioredoxin-related protein.
[0112] The nucleic acid sequence encoding the first and second
recombinant polypeptide, heteromultimeric-protein-complexes,
multimeric-fusion-protei- ns, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or a first and/or second
thioredoxin-related protein may be obtained from separate sources
or may be obtained from the same source. In general however, such
nucleic acid sequence is obtained from the same or a similar
biological source. In certain embodiments wherein the nucleic acid
sequence encoding the first and second recombinant polypeptide
protein are obtained from the same source, the nucleic acid
sequence encoding the first recombinant polypeptide and second
recombinant polypeptide may be naturally fused. In accordance with
a particular embodiment, the nucleic acid sequences encoding the
first and second recombinant polypeptide are obtained from a plant
source.
[0113] Oil-Body-Surface-Avoiding Linkers
[0114] Polypeptide spacers or linkers of variable length and/or
negative charge can be used herein to separate the first and/or
second recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-comp- lexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, and
the first and/or second thioredoxin-related proteins from the
in-frame oil-body-targeting-protein- , to improve activity of
and/or the accessibility of the polypeptide or complex. For
example, in one embodiment set forth herein, positioned between a
nucleic acid sequence encoding a sufficient portion of an
oil-body-protein and a nucleic acid sequence encoding either the
first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and the first and/or second
thioredoxin-related proteins; is a linker nucleic acid sequence
encoding an oil-body-surface-avoiding linker amino acid
sequence.
[0115] Oil-body-surface-avoiding linkers are positioned between the
oil-body targeting sequence and an in-frame recombinant polypeptide
of interest, e.g., the multimeric-protein-complexes provided
herein, serve to increase the distance and or decrease the
interaction between the negatively charged oil body surface and the
recombinant polypeptide of interest. A negatively charged linker is
repelled by the negatively charged oil body surface, in turn
increasing the distance or decreasing the interaction of its
attached recombinant polypeptide with the oil body surface. As a
consequence of the increased distance from the oil body surface,
the recombinant polypeptide will be more accessible, e.g. to its
target(s) substrate, protein substrate, protein partner, and less
affected by the charged oil body surface. Exemplary linker
sequences for use herein can be either a negatively charged linker,
or a linker having a molecular weight of at least about 35 kd or
more.
[0116] As used herein, a "negatively charged linker" sequence,
refers to any amino acid segment, or nucleic acid encoding such,
that has a pi less than or equal to the pI of an oil body. In
certain embodiments, the pI of the negatively charged linker is
about 90%, 80%, 70%, 60%, 50%, 40%, 30%, down to about 25% or more,
below that of the pI of an oil body in the particular plant or cell
system being used. Exemplary negatively charged linkers can be
prepared comprising any combination of the negatively charged amino
acid residues. For example, in one embodiment, a negatively charged
linker comprises either a poly-glutamate or poly-aspartate
sequence, or any combination of both amino acid residues. The
negatively charged linker is typically at least 5, 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more
amino acids in length. The negatively charged linkers are
preferably non-proteolytic (e.g., non-proteolytic linkers), having
no site for efficient proteolysis. When linker size rather than
charge is used to minimize interaction of the recombinant
polypeptide of interest with the oil body surface, then the linker
is non-proteolytic and ranges in molecular weight from about 35 kd
up to about 100 kd. The upper size limit is chosen such that the
expression of, the activity of, the conformation of, and/or the
access to target of, the recombinant polypeptide of interest is not
significantly affected by the linker.
[0117] In certain embodiments, described herein where a
non-proteolytic linker amino acid sequence is employed, the gene
fusion or protein fusion (multimeric-fusion-protein) can optionally
further comprise a linker nucleic or amino acid sequence encoding a
sequence that is specifically cleavable by an enzyme or a chemical,
wherein the linker sequence is positioned between the
non-proteolytic linker sequence and sequence encoding the desired
recombinant protein region, e.g., the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins set forth
herein. When a cleavable linker sequence is used herein, in a
particular embodiment, it is further downstream than the
non-proteolytic linker sequence from the oil-body-targeting-protein
region of the fusion protein. By virtue of cleavable linker, the
recombinant fusion polypeptides provided herein, such as the
multimeric-fusion-proteins and redox fusion polypeptides, can be
isolated and purified by introducing an enzyme or chemical that
cleaves said multimeric-fusion-protein and/or redox fusion
polypeptide from said oil body, thereby obtaining and/or isolating
the desired protein. it is contemplated herein that the use of
cleavable linker sequence downstream of the non-proteolytic
linker/spacer sequence will improve the yield of protein recovery
when isolating or purifying proteins using the methods provided
herein.
[0118] The nucleic acid sequences encoding the first or second
recombinant polypeptide may be altered to improve expression levels
for example, by optimizing the nucleic acids sequence in accordance
with the preferred codon usage for the particular cell type which
is selected for expression of the first and second recombinant
polypeptide, or by altering of motifs known to destabilize mRNAs
(see for example: PCT Patent Application 97/02352). Comparison of
the codon usage of the first and second recombinant polypeptide
with codon usage of the host will enable the identification of
codons that may be changed. For example, typically plant evolution
has tended towards a preference for CG rich nucleotide sequences
while bacterial evolution has resulted in bias towards AT rich
nucleotide sequences. By modifying the nucleic acid sequences to
incorporate nucleic acid sequences preferred by the host cell,
expression may be optimized. Construction of synthetic genes by
altering codon usage is described in for example PCT patent
Application 93/07278. The first and second recombinant polypeptide
can be altered using for example targeted mutagenesis, random
mutagenesis (Shiraishi et al. (1998) Arch. Biochem. Biophys. 358:
104-115; Galkin et al. (1997) Protein Eng. 10: 687-690; Carugo et
al. (1997) Proteins 28: 10-28; Hurley et al. (1996) Biochemistry
35: 5670-5678), gene shuffling, and/or by the addition of organic
solvent (Holmberg et al. (1999) Protein Eng. 12: 851-856). Any
polypeptide spacers that are used in accordance with the methods
and products provided herein may be altered in similar ways.
[0119] In particular embodiments provided herein, the recombinant
polypeptides or thioredoxin-related proteins capable of forming a
multimeric-protein-complex are capable of forming a
heteromultimeric-protein-complex. Examples of
heteromultimeric-protein-co- mplexes that contain polypeptide
chains that repeatedly interact, either to activate, inactivate,
oxidize, reduce, stabilize, etc., with one another, that can be
produced in association with oil bodies using the methods provided
herein include those set forth in FIG. 1. Accordingly, exemplary
proteins for use in the heteromultimeric-protein-complexes and
nucleic acid constructs encoding such, provided herein include,
among others described herein, those set forth in FIG. 1.
[0120] Other polypeptide regions that can be used in the first
and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins, provided herein include, among other,
those immunoglobulin regions set forth in Table 1.
1TABLE 1 IMMUNOGLOBULIN HETERODIMERS Class or molecule Subunits Fab
Variable region and first constant region of heavy chain and
complete light chain Fv Variable regions of heavy and light
antibody chains IgA heavy chains, light chains and J (joining)
chain IgG, IgD, IgE heavy and light chains IgM heavy chains, light
chains and J (joining) chain Antibody chain(s) and a toxin Antibody
chain(s) and a toxin Autoantigens, allergens and Autoantigens,
allergens and transplant transplant antigens with an antigens with
an adjuvant or tolerogen adjuvant or tolerogen Chimeras using
antibody Fc Receptor subunits fused to the constant domain region
of antibody heavy chains
[0121] As set forth above, in one embodiment, exemplary
heteromultimeric-protein-complexes and exemplary
heteromultimeric-fusion-- proteins provided herein comprise redox
proteins, such as the thioredoxins and thioredoxin-reductases and
immunoglobulins.
[0122] Oil-body-targeting-proteins
[0123] The nucleic acid sequence encoding the
oil-body-targeting-protein that may be used in the methods and
compositions provided herein may be any nucleic acid sequence
encoding an oil-body-targeting-protein, protein fragment or peptide
capable of association with first recombinant polypeptide,
heteromultimeric-protein-complexes, multimeric-fusion-protei- ns,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides,
and/or a first and/or second thioredoxin-related protein and the
oil bodies. The nucleic acid sequence encoding the oil body
targeting peptide may be synthesized or obtained from any
biological source.
[0124] For example, in one embodiment the
oil-body-targeting-protein is an immunoglobulin or an
immunoglobulin derived molecule, for example, a bispecific single
chain antibody. The immunoglobulin will preferably bind an oil body
protein that is associated with an oil body. The generation of
single chain antibodies and bi-specific single chain antibodies is
known to the art (see, e.g., US Patents U.S. Pat. No. 5,763,733,
U.S. Pat. No. 5,767,260 and U.S. Pat. No. 5,260,203). Nucleic acid
sequences encoding single chain antibodies functioning as
oil-body-targeting-protei- ns may be prepared from hybridoma cell
lines expressing monoclonal antibodies raised against an oil body
protein. In one embodiment the antibody binds an oleosin as
described by Alting-Mees et al (2000) IBC's Annual International
Conference on Antibody Engineering, Poster #1. In order to attain
specificity for the first recombinant polypeptide a nucleic acid
sequence encoding a second single chain antibody prepared from a
monoclonal raised against the first recombinant polypeptide may be
prepared and linked to the anti-oleosin single chain antibody. In
this embodiment the oil body associates with the first recombinant
polypeptide through non-covalent interactions of the
oil-body-targeting-protein with the first recombinant polypeptide
and the oil body. Alternatively the first recombinant polypeptide
may be prepared as a fusion protein with an
oil-body-targeting-protein. For example, a nucleic acid sequence
encoding a single chain antibody raised against an oleosin may be
fused to a nucleic acid sequence encoding the first recombinant
polypeptide
[0125] Non-immunoglobulin-based oil-body-targeting-proteins capable
of association with the first recombinant polypeptide may be
discovered and prepared using for example phage display techniques
(Pharmacia Biotech Catalogue Number 27-9401-011 Recombinant Phage
Antibody System Expression Kit).
[0126] Oil-body-targeting-proteins may also be chemically modified.
For example, oleosins may be modified by changing chemical
modification of the lysine residues using chemical agents such as
biotinyl-N-hyrdoxysucci- nimide ester resulting in a process
referred to as biotinylation. Conveniently this is accomplished by
in vitro biotinylation of the oil bodies. In vivo biotinylation may
be accomplished using the biotinylation domain peptide from the
biotin carboxy carrier protein of E. coli acetyl-CoA carboxylase
(Smith et al. (1998) Nucl. Acids. Res. 26: 1414-1420). Avidin or
streptavidin may subsequently be used to accomplish association of
the redox protein with the oil body.
[0127] In a particular embodiment the oil-body-targeting-protein is
an oil-body-protein such as for example an oleosin or a caleosin or
a sufficient portion derived thereof capable of targeting to an oil
body. Nucleic acid sequences encoding oleosins are known to the
art. These include for example the Arabidopsis oleosin (van Rooijen
et al (1991) Plant Mol. Bio. 18:1177-1179); the maize oleosin (Qu
and Huang (1990) J. Biol. Chem. Vol. 265 4:2238-2243); rapeseed
oleosin (Lee and Huang (1991) Plant Physiol. 96:1395-1397); and the
carrot oleosin (Hatzopoulos et al (1990) Plant Cell Vol. 2,
457-467.). Caleosin nucleic acid sequences are also known to the
art (Naested et al (2000) Plant Mol Biol. 44(4):463-476; Chen et al
(1999) Plant Cell Physiol. 40(10):1079-1086). Animal cell derived
oil body proteins that may be used herein include adopihilin
(Brasaemle et al, (1997) J. Lipid Res., 38: 2249-2263; Heid et al.
(1998) Cell Tissue Research 294: 309-321), perilipin
(Blanchette-Mackie et al. (1995), J. Lipid Res. 36: 1211-1226;
Servetnick et al. (1995) J. Biol. Chem. 270: 16970-16973),
apolipoproteins such as apo A-I, A-II, A-IV, C-I, C-II, CIII
(Segrest et al. (1990), Proteins 8:103-117) and apoB (Chatterton et
al. (1995) J. Lipid Res. 36: 2027-2037; Davis, R A in: Vance D E,
Vance J. editors. Lipoprotein structure and secretion. The
Netherlands, Elsevier, 191: 403-426.
[0128] In one embodiment, the first recombinant polypeptide is
fused to an oil-body-protein. The methodology is further described
in U.S. Pat. No. 5,650,554, which is incorporated herein by
reference in its entirety. The first recombinant polypeptide may be
fused to the N-terminus as well as to the C-terminus of the
oil-body-protein (as described in: Moloney and van Rooijen (1996)
INFORM 7:107-113) and fragments of the oil-body-protein such as for
example the central domain of an oleosin molecule, or modified
versions of the oil-body-protein may be used. In this embodiment,
the second recombinant polypeptide is expressed intracellularly and
then intracellularly associates with the first recombinant
polypeptide to form the multimeric-protein-complex in the cell. Oil
bodies comprising the multimeric-protein-complex are then
conveniently isolated from the cells.
[0129] In a further embodiment both the first and second
recombinant polypeptide are separately fused to an
oil-body-protein. In this embodiment nucleic acid sequences
encoding the first and second polypeptides may be prepared
separately and introduced in separate cell lines or they may be
introduced in the same cell lines. Where the nucleic acid sequences
are introduced in the same cell line, these nucleic acid sequence
may be prepared using two separate expression vectors, or they may
be prepared using a single vector comprising nucleic acid sequences
encoding both the first polypeptide fused to an body protein and
the second polypeptide fused to an oil-body-protein. Where separate
cell lines are used subsequent mating of the offspring (e.g. mating
of plants) is used to prepare a generation of cells comprising oil
bodies which comprise both the first and second recombinant
polypeptide fused to an oil-body-protein.
[0130] In further alternate embodiment, the first and second
recombinant polypeptide are fused to form a
multimeric-fusion-protein comprising the
multimeric-protein-complex. In such an embodiment, the first and
second polypeptide is associated with the oil body through an
oil-body-targeting-protein capable of associating with both the
fusion protein and with the oil body. In a particular embodiment,
the fusion protein comprising the multimeric-protein-complex is
fused to an oil-body-protein, for example, an oleosin or
caleosin.
[0131] In embodiments provided herein in which the
multimeric-protein-comp- lex is an immunoglobulin (e.g., a
multimeric-immunoglobulin-complex), a particularly preferred oil
body targeting protein is an oleosin or caleosin associated with an
immunoglobulin binding protein, such as for example protein A (U.S.
Pat. No. 5,151,350), protein L (U.S. Pat. No. 5,965,390) and
protein G (U.S. Pat. No. 4,954,618), or active fragments of such
immunoglobulin binding proteins. In a preferred embodiment, the
immunoglobulin binding protein will be prepared as a fusion protein
with an oil body protein.
[0132] New oil-body-proteins may be discovered for example by
preparing oil bodies (described in further detail below) and
identifying proteins in these preparations using for example SDS
gel electrophoresis. Polyclonal antibodies may be raised against
these proteins and used to screen cDNA libraries in order to
identify nucleic acid sequences encoding oil-body-proteins. The
methodologies are familiar to the skilled artisan (Huynh et al.
(1985) in DNA Cloning Vol. 1. a Practical Approach ed. CM Glover,
IRL Press, pp 49-78). New oil-body-proteins may further be
discovered using known nucleic acid sequences encoding
oil-body-proteins (e.g. the Arabidopsis, rapeseed, carrot and corn
nucleic acid sequences) to probe for example cDNA and genomic
libraries for the presence of nucleic acid sequences encoding
oil-body-proteins.
[0133] Redox Proteins
[0134] In one embodiment, the first and second polypeptide are a
first and second redox protein. Accordingly, one embodiment
provided herein relates to novel and improved methods for the
production of redox proteins. It has unexpectedly been found that a
redox protein when prepared as a fusion protein with a second redox
protein is fully enzymatically active when produced in association
with an oil body. In contrast, when the redox protein is prepared
without the second redox protein it has reduced enzymatic activity.
In one embodiment, the first redox protein is at least 5 times more
active when produced as a redox fusion polypeptide relative to
production as a non-fusion polypeptide.
[0135] Accordingly, provided herein are methods for producing an
oil body associated with a heteromultimeric redox protein complex,
said method comprising:
[0136] (a) producing in a cell comprising oil bodies, a first redox
protein and a second redox protein wherein said first redox protein
is capable of interacting with said second redox protein,
preferably in the cell, to form said heteromultimeric redox protein
complex; and
[0137] (b) associating said heteromultimeric redox protein complex
with an oil body through an oil-body-targeting-protein capable of
associating with said oil bodies and said heteromultimeric redox
protein complex.
[0138] In a particular embodiment the first and second redox
protein are prepared as a fusion protein to form a redox fusion
polypeptide. Accordingly, provided herein are methods for preparing
an enzymatically active redox protein associated with oil bodies
comprising:
[0139] a) producing in a cell a redox fusion polypeptide comprising
a first redox protein linked to a second redox protein;
[0140] b) associating said redox fusion polypeptide with oil bodies
through an oil-body-targeting-protein capable of associating with
said redox fusion polypeptide and said oil bodies; and
[0141] c) isolating said oil bodies associated with said redox
fusion polypeptide. The oil bodies in association with the redox
protein may be used to prepare a variety of useful emulsions.
[0142] As used herein the phrase "redox proteins" or grammatical
variations thereof, refers to any protein or active protein
fragment capable of participating in electron transport. For
example, redox proteins are capable of catalyzing the transfer of
an electron donor (also frequently referred to as the reducing
agent) to an electron acceptor (also frequently referred to as the
oxidizing agent). In the process of electron transfer, the reducing
agent (electron donor) is oxidized and the oxidizing agent
(electron acceptor) is reduced. Exemplary redox proteins for use
herein include iron-sulfur proteins, cytochromes, redox active
thiol proteins and redox-active flavoproteins. To carry out their
function as conduits for electron donors, redox proteins, such as
thioredoxin and thioredoxin-reductase for example, are known to
function by interacting or associating with one another in
multimeric-protein-complexes (e.g.,
heteromultimeric-protein-complexes).
[0143] The term "redox fusion polypeptide" as used herein refers to
any fusion polypeptide comprising a first redox protein linked to a
second redox protein (e.g., an in-frame translational fusion). The
redox proteins that may be used with the methods and compositions
provided herein may be any redox protein. In one embodiment the
first and second redox proteins are a pair of redox proteins that
would normally occur together from the same source, in nature. In a
particular embodiment, the first redox protein is a thioredoxin and
the second redox protein is a thioredoxin-reductase.
[0144] The redox fusion polypeptide may be produced in any cell
comprising oil bodies, including any animal cell, plant cell, algae
cell, fungal cell or bacterial cell. In certain embodiments the
redox fusion polypeptide is produced in a plant cell and in
particular embodiments the redox fusion polypeptide is produced in
the seed cells of a seed plant.
[0145] In particular embodiments the oil-body-targeting-protein
that is used is an oil-body-protein. In embodiments of the present
invention in which an oil-body-protein is used, the first and
second redox protein are preferably covalently fused to the
oil-body-protein. Accordingly, provided herein are methods for the
preparation of a redox protein in association with an oil body
comprising:
[0146] a) introducing into a cell a chimeric nucleic acid sequence
comprising:
[0147] 1) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0148] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a first nucleic acid sequence
encoding a sufficient portion of an oil-body-protein to provide
targeting of said recombinant fusion polypeptide to an oil body
linked in reading frame to (ii) a second nucleic acid sequence
encoding a redox fusion polypeptide comprising a first redox
protein linked to a second redox protein operatively linked to;
[0149] 3) a third nucleic acid sequence capable of terminating
transcription in said cell;
[0150] b) growing said cell under conditions to permit expression
of said redox fusion polypeptide in a progeny cell comprising oil
bodies; and
[0151] c) isolating said oil bodies comprising said redox fusion
polypeptide from said progeny cell.
[0152] In particular embodiments, the redox proteins provided
herein are thioredoxin and its reductant thioredoxin-reductase
(which are jointly also referred to herein as "thioredoxin-related"
protein(s)). As used herein, the term "thioredoxin" refers to
relatively small proteins (typically approximately 12 kDa) that
belong to the family of thioltransferases which catalyze
oxido-reductions via the formation or hydrolysis of disulfide bonds
and are widely, if not universally, distributed throughout the
animal plant and bacterial kingdom. The reduced form of thioredoxin
is an excellent catalyst for the reduction of even the most
intractable disulfide bonds. In order to reduce the oxidized
thioredoxin, two cellular reductants provide the reduction
equivalents: reduced ferredoxin and NADPH. These reduction
equivalents are supplied to thioredoxin via interaction or
association with different thioredoxin-reductases including the
NADPH thioredoxin-reductase and ferredoxin thioredoxin-reductase.
The supply of these reduction equivalents requires the formation of
a heteromultimeric-protein-complex comprising thioredoxin and
thioredoxin-reductase. Ferredoxin thioredoxin-reductase is involved
in the reduction of plant thioredoxins designated as Trxf and Trxm,
both of which are involved in the regulation of photosynthetic
processes in the chloroplast. The NADPH/thioredoxin active in plant
seeds is designated Trxh (also referred to herein as thioredoxin
h-type) and is capable of the reduction of a wide range of proteins
thereby functioning as an important cellular redox buffer.
Generally, only one kind of thioredoxin, which analogous to the
plant Trxh type, is found in bacterial or animal cells. The h-type
thioredoxins are capable of being reduced by NADPH and
NADPH-thioredoxin reductase.
[0153] Exemplary thioredoxins are further characterized as a
protein having a core of 5 beta-sheets surrounded by 4 to 6 alpha
helixes. Exemplary thioredoxins are further characterized by having
an active site containing the consensus amino acid sequence:
XCYYCZ,
[0154] wherein Y is any amino acid, such as hydrophobic or
non-polar amino acids,
[0155] wherein X can be any of the 20 amino acids, preferably a
hydrophobic amino acid, such as a tryptophan, and
[0156] Z can be any amino acid, preferably polar amino acids.
[0157] In certain embodiments, the thioredoxins for use herein
comprise an active site having the amino acid sequence X C G P C
Z.
[0158] When the cysteines in the active site of thioredoxin or
thioredoxin-like proteins are, they form an intramolecular
disulfide bond. In the reduced state, the same active sites are
capable of participating in redox reactions through the reversible
oxidation of its active site dithiol, to a disulfide and catalyzes
dithioldisulfide exchange reactions.
[0159] Exemplary thioredoxins are well-known in the art and can be
obtained from several organisms including Arabidopsis thaliana
(Riveira Madrid et al. (1995) Proc. Natl. Acad. Sci. 92:
5620-5624), wheat (Gautier et al. (1998) Eur. J. Biochem. 252:
314-324); Escherichia coli (Hoeoeg et al (1984) Biosci. Rep. 4:
917-923) and thermophylic microorganisms such as Methanococcus
jannaschii and Archaeoglobus fulgidus (PCT Patent Application
00/36126). Thioredoxins have also been recombinantly expressed in
several host systems including bacteria (Gautier et al. (1998) Eur
J. Biochem. 252: 314-324) and plants (PCT Patent Application WO
00/58453) Commercial preparations of E. coli sourced Thioredoxins
are readily available from for example: Sigma Cat No. T 0910
Thioredoxin (E. coli, recombinant; expressed in E. coli).
[0160] Exemplary nucleic acid sequences encoding thioredoxin
polypeptides for use herein are readily available from a variety of
diverse biological sources including E. coli (Hoeoeg et al. (1984)
Biosci. Rep.: 4 917-923); Methanococcus jannaschii and
Archaeoglobus fulgidus (PCT Patent Application 00/36126);
Arabidopsis thaliana (Rivera-Madrid (1995) Proc. Natl. Acad. Sci.
92: 5620-5624); wheat (Gautier et al (1998) Eur. J. Biochem.
252(2): 314-324); tobacco (Marty et al. (1991) Plant Mol. Biol. 17:
143-148); barley (PCT Patent Application 00/58352); rice
(Ishiwatari et al. (1995) Planta 195: 456-463); soybean (Shi et al.
(1996) Plant Mol. Biol. 32: 653-662); rapeseed (Bower et al. Plant
Cell 8: 1641-1650) and calf (Terashima et al. (1999) DNA Seq.
10(3): 203-205); and the like.
[0161] As used herein, the term "thioredoxin-reductase" refers to a
protein that complexes with a flavin, such as FAD. The flavin
compound serves as an electron donor for the thioredoxin-reductase
protein active site. Thioredoxin reductases have a redox active,
disulfide bond site capable of reducing thioredoxin. The active
site of thioredoxin-reductase contains 2 cysteines. The type of
amino acids surrounding the 2 cysteine residues forming the active
site can vary as hydrophobic, non-polar or polar. An exemplary
thioredoxin-reductase is NADPH-thioredoxin-reductase (TR), which is
a cytosolic homodimeric enzyme comprising typically 300-500 amino
acids. Crystal structures of both E. coli and plant
thioredoxin-reductase have been obtained (Waksman et al. (1994) J.
Mol. Biol. 236: 800-816; Dai et al. (1996) J. Mol. Biol.
264:1044-1057). NADPH-thioredoxin-reductases have been expressed in
heterologous hosts, for example the Arabidopsis
NADPH-thioredoxin-reductase has been expressed in E. coli (Jacquot
et al. (1994) J. Mol. Biol. 235: 1357-1363) and wheat (PCT Patent
Application 00/58453).
[0162] Exemplary nucleic acid sequences encoding
thioredoxin-reductase proteins can readily be obtained from a
variety of sources, such as from the sequence set forth in Table 5
and the Sequence Listing provide herein, from Arabidopsis (Riveira
Madrid et al. (1995) Proc. Natl. Acad. Sci. USA 92: 5620-5624), E.
coli (Russel et al. (1988) J. Biol. Chem. 263: 9015-9019); barley
(PCT Patent Application 00/58352 and wheat (Gautier et al., (1998)
Eur. J. Biochem. 252: 314-324); and the like.
[0163] Also contemplated for use in the methods and compositions
provided herein are nucleic acid and amino acid homologs that are
"substantially homologous" to the thioredoxin and
thioredoxin-reductase nucleic and amino acids set forth herein,
which includes thioredoxin and thioredoxin-reductase polypeptides
encoded by a sequence of nucleotides that hybridizes under
conditions of low, moderate or high stringency to the sequence of
nucleotides encoding the thioredoxin and thioredoxin-reductase
nucleic and amino acids set forth herein (e.g., in the Examples,
Sequence Listing and/or Table 5). As used herein, a DNA or nucleic
acid homolog refers to a nucleic acid that includes a preselected
conserved nucleotide sequence, such as a sequence encoding a
therapeutic polypeptide. By the term "substantially homologous" is
meant having at least 80%, preferably at least 90%, most preferably
at least 95% homology therewith or a less percentage of homology or
identity and conserved biological activity or function.
[0164] The terms "homology" and "identity" are often used
interchangeably. In this regard, percent homology or identity may
be determined, for example, by comparing sequence information using
a GAP computer program. The GAP program utilizes the alignment
method of Needleman and Wunsch (J. Mol. Biol. 48:443 (1970), as
revised by Smith and Waterman (Adv. Appl. Math. 2:482 (1981).
Briefly, the GAP program defines similarity as the number of
aligned symbols (i.e., nucleotides or amino acids) which are
similar, divided by the total number of symbols in the shorter of
the two sequences. The preferred default parameters for the GAP
program may include: (1) a unary comparison matrix (containing a
value of 1 for identities and 0 for non-identities) and the
weighted comparison matrix of Gribskov and Burgess, Nucl. Acids
Res. 14:6745 (1986), as described by Schwartz and Dayhoff, eds.,
ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical
Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for
each gap and an additional 0.10 penalty for each symbol in each
gap; and (3) no penalty for end gaps.
[0165] By sequence identity, the number of conserved amino acids
are determined by standard alignment algorithms programs, and are
used with default gap penalties established by each supplier.
Substantially homologous nucleic acid molecules would hybridize
typically at moderate stringency or at high stringency all along
the length of the nucleic acid of interest. Preferably the two
molecules will hybridize under conditions of high stringency. Also
contemplated are nucleic acid molecules that contain degenerate
codons in place of codons in the hybridizing nucleic acid
molecule.
[0166] Whether any two nucleic acid molecules have nucleotide
sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or
99% "identical" can be determined using known computer algorithms
such as the "FAST A" program, using for example, the default
parameters as in Pearson and Lipman, Proc. Natl. Acad. Sci. USA
85:2444 (1988). Alternatively the BLAST function of the National
Center for Biotechnology Information database may be used to
determine relative sequence identity.
[0167] In general, sequences are aligned so that the highest order
match is obtained. "Identity" per se has an art-recognized meaning
and can be calculated using published techniques. (See, e.g.:
Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part I, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M Stockton Press, New York, 1991). While there exist a number
of methods to measure identity between two polynucleotide or
polypeptide sequences, the term "identity" is well known to skilled
artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073
(1988)). Methods commonly employed to determine identity or
similarity between two sequences include, but are not limited to,
those disclosed in Guide to Huge Computers, Martin J. Bishop, ed.,
Academic Press, San Diego, 1994, and Carillo, H. & Lipton, D.,
SIAM J Applied Math 48:1073 (1988). Methods to determine identity
and similarity are codified in computer programs. Preferred
computer program methods to determine identity and similarity
between two sequences include, but are not limited to, GCG program
package (Devereux, J., et al., Nucleic Acids Research 12(l):387
(1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al, J Molec Biol
215:403 (1990)).
[0168] Therefore, as used herein, the term "identity" represents a
comparison between a test and a reference polypeptide or
polynucleotide. For example, a test polypeptide may be defined as
any polypeptide that is 90% or more identical to a reference
polypeptide.
[0169] As used herein, the term at least "90% identical to" refers
to percent identities from 90 to 99.99 relative to the reference
polypeptides. Identity at a level of 90% or more is indicative of
the fact that, assuming for exemplification purposes a test and
reference polynucleotide length of 100 amino acids are compared. No
more than 10% (i.e., 10 out of 100) amino acids in the test
polypeptide differs from that of the reference polypeptides.
Similar comparisons may be made between a test and reference
polynucleotides. Such differences may be represented as point
mutations randomly distributed over the entire length of an amino
acid sequence or they may be clustered in one or more locations of
varying length up to the maximum allowable, e.g. 10/100 amino acid
difference (approximately 90% identity). Differences are defined as
nucleic acid or amino acid substitutions, or deletions.
[0170] As used herein: stringency of hybridization in determining
percentage mismatch is as follows:
[0171] 1) high stringency: 0.1.times.SSPE, 0.1% SDS, 65.degree.
C.
[0172] 2) medium stringency: 0.2.times.SSPE, 0.1% SDS, 50.degree.
C.
[0173] 3) low stringency: 1.0.times.SSPE, 0.1% SDS, 50.degree.
C.
[0174] Those of skill in this art know that the washing step
selects for stable hybrids and also know the ingredients of SSPE
(see, e.g., Sambrook, E. F. Fritsch, T. Maniatis, in: Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press
(1989), vol. 3, p. B.13, see, also, numerous catalogs that describe
commonly used laboratory solutions). SSPE is pH 7.4
phosphate-buffered 0.18 NaCl. Further, those of skill in the art
recognize that the stability of hybrids is determined by T.sub.m,
which is a function of the sodium ion concentration and temperature
(T.sub.m=81.5.degree. C. -16.6(log.sub.10[Na.sup.+])+0.41(%G+-
C)-600/I)), so that the only parameters in the wash conditions
critical to hybrid stability are sodium ion concentration in the
SSPE (or SSC) and temperature.
[0175] It is understood that equivalent stringencies may be
achieved using alternative buffers, salts and temperatures. By way
of example and not limitation, procedures using conditions of low
stringency are as follows (see also Shilo and Weinberg, Proc. Natl.
Acad. Sci. USA, 78:6789-6792 (1981)): Filters containing DNA are
pretreated for 6 hours at 40.degree. C. in a solution containing
35% formamide, 5.times.SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA,
0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 .mu.g/ml denatured salmon
sperm DNA (10.times.SSC is 1.5 M sodium chloride, and 0.15 M sodium
citrate, adjusted to a pH of 7).
[0176] In a particular embodiment, a
heteromultimeric-protein-complex is produced as a fusion
polypeptide between the first and second redox protein, wherein the
first redox protein is thioredoxin and the second redox protein is
a thioredoxin-reductase. In one embodiment, the second recombinant
polypeptide, e.g., the thioredoxin-reducase is positioned
N-terminal relative to the first recombinant polypeptide, e.g., the
thioredoxin. Accordingly, any protein which is classified as
thioredoxin, such as the thioredoxin component of the NADPH
thioredoxin system and the thioredoxin present in the
ferredoxin-thioredoxin system also known as TRx and TRm may be used
in combination with any thioredoxin-reductase such as the NADPH
thioredoxin-reductase and the ferredoxin-thioredoxin-re- ductase
and any other proteins having the capability of reducing
thioredoxin. In particular embodiments the thioredoxin and
thioredoxin-reductase are plant derived.
[0177] In an alternate embodiment, the naturally occurring nucleic
acid sequence encoding the thioredoxin/thioredoxin-reductase
protein fusion obtainable from Mycobacterium leprae (Wieles et al.
(1995) J. Biol. Chem. 27:25604-25606) is used, as set forth in the
Examples herein.
[0178] Immunoglobulins
[0179] In another embodiment of the present invention, the
multimeric-protein-complexes are immunoglobulins. As used herein
"immunoglobulin-polypeptide-chain" refers to a polypeptide
comprising an immunoglobulin fold. "Immunoglobulin fold" as used
herein refers to a barrel shaped protein structure comprising 2
.beta.-sheets comprising several (e.g. seven in the case of a light
chain C-domain of an IgG) anti-parallel .beta.-strands held
together by a disulfide bond. This includes any immunoglobulin or
immunoglobulin-like proteins including portions of fragments
thereof. The types of immunoglobulins and
immunoglobulin-polypeptide-chains contemplated for use herein
include the immunologically active (i.e. antigen binding) portions
of a light or heavy chain of an antibody, as well as other
polypeptides comprising an immunoglobulin fold, for example the
immunoglobulin C-like domain and V-like domain of a T-cell
receptor, and the antigen-binding domains of the MHC class of
molecules, such as the .alpha. and .beta. antigen binding domains
of CD8. In a specific embodiment, the immunoglobulin-polypeptide
chain is an immunoglobulin heavy chain or an immunoglobulin light
chain or portions thereof. In preferred embodiments, the first
immunoglobulin polypeptide is an immunoglobulin-light-chain, or an
immunologically active fragment thereof, of an antibody, such as
the VL fragment, and the second immunoglobulin polypeptide is an
immunoglobulin-heavy-chain or an immunologically active fragment
thereof of an antibody, such as the VH domain. The
immunoglobulin-light-chain can be a k- or .gamma.-light chain or an
immunologically active fragment thereof. The immunoglobulin heavy
chain can be a .gamma.-, .mu.-, .alpha.-, .epsilon.- or
.delta.-heavy chain or an immunologically active fragment thereof.
Exemplary immunoglobulins for use herein include substantially
intact immunoglobulins, including any IgG, IgA, IgD, IgE and IgM,
as well as any portion of an immunoglobulin, including those
portions well-known as Fab fragments, Fab' fragments, F(ab').sub.2.
fragments and Fv fragments.
[0180] In this embodiment, the first recombinant polypeptide may be
any immunoglobulin heavy chain, including any IgG, IgA, IgD, IgE or
IgM heavy chain, and the second recombinant polypeptide may be a
kappa or lambda immunoglobulin light chain. The immunoglobulin that
may be used in accordance with the present invention may be capable
of binding any antigenic determinant, including such determinants
that are associated with any disease or condition. Accordingly,
provided herein are methods of producing an immunoglobulin, said
method comprising: (a) producing in a cell comprising oil bodies, a
first immunoglobulin-polypeptide-chain and a second
immunoglobulin-polypeptide-chain wherein said first
immunoglobulin-polypeptide-chain is capable of associating with
said second immunoglobulin-polypeptide-chain to form said
immunoglobulin; and (b) associating said immunoglobulin with an oil
body through an oil-body-targeting-protein capable of assodating
with said oil bodies and said first
immunoglobulin-polypeptide-chain.
[0181] Also provided herein are methods for preparing a multimeric
immunoglobulin associated with oil bodies comprising:
[0182] a) introducing into a cell a chimeric nucleic acid sequence
comprising:
[0183] 1) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0184] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a nucleic acid sequence encoding
a sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked to (ii) a
nucleic acid sequence encoding a immunoglobulin comprising a first
immunoglobulin-polypeptide-c- hain linked to a second
immunoglobulin-polypeptide-chain, operatively linked to;
[0185] 3) a third nucleic acid sequence capable of terminating
transcription in said cell;
[0186] b) growing said cell under conditions to permit expression
of said multimeric-immunoglobulin in a progeny cell comprising oil
bodies; and
[0187] c) isolating from said progeny cell said oil bodies
comprising said multimeric immunoglobulin.
[0188] The present invention also provides a chimeric nucleic acid
comprising:
[0189] 1) a first nucleic acid sequence capable of regulating
transcription in a host cell operatively linked to;
[0190] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a nucleic acid sequence encoding
a sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked to (ii) a
nucleic acid sequence encoding an immunoglobulin comprising a first
immunoglobulin polypeptide chain linked to a second immunoglobulin
polypeptide chain operatively linked to;
[0191] 3) a third nucleic acid sequence capable of terminating
transcription in said cell.
[0192] The term "sufficient portion of an oil body protein" means
that a nucleic acid sequence would be used that encodes enough of
an oil body protein to allow for targeting of the recombinant
fusion polypeptide to the oil bodies in the host cell. In general,
the N-terminus and the hydrophobic core of an oil body protein
(such as an oleosin) are sufficient to provide targeting of a
recombinant fusion protein to the oil bodies in a cell.
[0193] Preparation of Immunoglobulin cDNAs
[0194] For expression of multimeric-protein-complexes containing
multimeric-immunoglobulin-complexes, the cDNA sequences encoding
individual light immunoglobulin and heavy immunoglobulin chains can
be prepared from any appropriate source, including for example cell
lines expressing a particular antibody, such as a hybridoma cell
line, or clonal B cell lines, or may be prepared as recombinant
antibody, assembled by combining select light and heavy chain
variable domains and available light and heavy chain constant
domain sequences, respectively. Variable domains with specific
binding properties may be isolated from screening populations of
such sequences, usually in the form of a single-chain Fv phage
display library.
[0195] Methodologies to create hybridomas are well known to the an
and vary depending on the cell type that is selected (see e.g.,
Harlow, E and Lane D, in: Antibodies, A Laboratory Manual, Cold
Spring Harbor Laboratory Press (1988) p 139-243.) The production of
monoclonal antibodies using hybridomas is usually accomplished by
fusing mouse myelomas and mice antibody-secreting cells but rat or
human cells, or other appropriate cells may also be used.
Interspecies fusions (e.g.. the immunization of rats and the fusion
of rat B-cells with mouce myeloma cells) may also be performed. For
the purpose of the present application, the production of mouse
hybridomas is described: the production of mouse monoclonal
antibodies can be divided into three stages: (1) immunization of
the mice, (2) development of the screening procedure and (3) the
production of the hybridomas. Mouse immunization involves injection
of a mouse with the antigen and preferably the addition of an
adjuvant (i.e. Freund's complete which contains killed
Mycobacterium tuberculosis bacterium (initial injection) and
Freund's incomplete antigen without the bacterium (subsequent
injections)). Injection can include one or more of the following
sites including intraperitoneal, subcutaneous, intravenous,
intramuscular, intradermal and lymph node. Multiple injections or
boosters are performed to ensure that a high antibody titre
results. Antibody titre may be tested by collecting a tail bleed
and preparing blood serum. A tail bleed is performed by swabbing a
portion of the mouse tail about 1.5-2 inches from the body with
alcohol and nicking the underside of the tail across one of the
lower veins using a sterile scalpel. Several drops of blood are
collected and the blood is incubated at 37.degree. C. for 1 hour
and subsequently flicking the side of the tube to dislodge the
blood clot. The tube is transferred to 4.degree. C. for a minimum
of 2 hours or overnight. The tube is spun at 10,000 g for 10
minutes at 4.degree. C., the serum collected. The serum is respun a
second time for 10 minutes and the supernatant is carefully
collected and 0.02% sodium azide is added. 1 in 5 dilutions of the
serum samples in PBS (phosphate buffered saline) are compared with
similar dilutions of normal mouse serum using for example in a dot
blot. A dot blot is used when the antigen is a protein that is
available in large amounts. The antigen is bound directly to a
nitrocellulose sheet. An alternative to a dot blot may be the use
of polyvinylchloride multi-well plates. To perform a dot blot, a
protein solution of at least 1 .mu.g/ml is placed on a
nitrocellulose sheet at 0.1 ml/cm.sup.2 and allowed to bind for a
period of 1 hour. The nitrocellulose sheet is subsequently washed
three times in PBS and placed in a solution of 3% BSA (bovine serum
albumin) with 0.02% sodium azide for a period of 2 hours or
overnight. The nitrocellulose sheet is cut into squares so that
each sample may be tested. 1 .mu.l of a diluted test bleed is
blotted on the sheet and allowed to incubate in a humid atmosphere
for 30 minutes. The presence of the antibody can be detected using
multiple methods including .sup.125I-labeled rabbit anti-mouse
immunoglobulin or a horse radish peroxidase associated anti-mouse
immunoglobulin. The mouse is then typically boosted to further
increase the levels of antibodies. Positives may be evaluated
further for antibody titre, affinity for the antigen, and
appearance of spurious antibody activities against unrelated
antigens. The decision to boost the mouse or proceed to fusion
involves three factors: (1) whether the antibody recognizes the
antigen of interest, (2) the different titres of the antibodies and
different affinities of the antibody for the antigen and (3) the
appearance of spurious antibody activities against unrelated
antigens. To test whether the antibody recognizes the antigen of
interest the dot blot performed above is likely sufficient but it
is suggested that the antibody should be checked in assays that
resemble the tests for which the antibody is being prepared for,
i.e. immunoprecipitation, immunoblot analysis, immunohistochemical
staining. To test whether the concentration of specific antibodies
is appropriate, the test bleeds should be titred in appropriate
assays, i.e. ELISA assay. As the immune response matures, increased
levels of the antibody will be found. It should be noted that
increased amounts of the antibody does not necessarily indicate
that the antibody has a higher affinity to the antigen. Assays that
are sensitive to affinity include immunoprecepitation. The final
factor is the appearance of antibody activities against other,
extraneous antigens (i.e. contaminating antigens in the sample, or
antigens in response to antigens in the mouse's environment,
including pathogenic organisms).
[0196] The next stage in creating hybridomas is the development of
the screening procedure. A good screening procedure must reduce the
number of cultures to be maintained to a reasonable level (50
cultures maximum is preferable), identify the potential positives
within 48 hours, more preferably within 24 hours and be easy to
perform as multiple samples will need to be tested. It is suggested
that all screening procedures be tested and validated before the
hybridoma fusions begin. In general, there are three different
classes of screening strategies, antibody capture assays, antigen
capture assays and functional screenings.
[0197] In general antibody capture assays the often the easiest and
most convenient of the methods. The procedure for an antibody
capture assay involves binding the antigen to a solid substrate,
binding of the antibody from either the test bleed or subsequently
the hybridoma tissue culture to the antigen, removing unbound
antibody with washing and detecting the bound antibody with a
secondary reagent that will specifically recognize the antibody.
Most of these methods rely on an indirect method of detecting the
antibody, most commonly done using a secondary antibody, for
example a rabbit anti-mouse immunoglobulin antibody. Examples of
secondary antibody labels or tags include iodine which is detected
using X-ray film, an enzyme like horse radish peroxidase detected
using chromogenic substrates, biotin which is detected using
avidin/spreptavidin coupled to various labels and fluorochromes
detected using a fluorescence microscope or fluorimeter.
Alternatively, positives can be located using other reagents that
bind specifically to antibodies like Protein A or Protein G labeled
with an appropriate tag. The dot blot described above is indicative
of an antibody capture assay. Other procedures including antibody
capture in polyvinylchloride wells using 125I detection, antibody
capture in polyvinylchloride wells using enzyme linked detection,
antibody capture on whole cells using cell surface binding and
antibody capture of permeabilized cells using cell staining are
described in Harlow, E and Lane D, in: Antibodies, A Laboratory
Manual, Cold Spring Harbor Laboratory Press (1988) p 180-187.
[0198] The second screening strategy is the antigen capture assay.
This method identifies the presence of the antigen by labeling the
antigen directly and requires the antibody to have a high affinity
since the labeled antigen is added in very low concentrations. In
general the procedure for an antigen capture assay includes binding
the antibody-antigen complex to a solid support, removing any
unbound antigen by washing and identifying positives by detecting
the antigen. Two variations exist for the antigen capture assay. In
the first variation the antibody is bound to a solid phase first
and the antigen is allowed to react with the antibody. In the
second variation, the antibody-antigen complex is allowed to form
prior to binding the antibody to the solid phase. Detection of the
antigen can be done by pre-labeling the antigen with a radiolabel,
fluorescent label or by coupling an enzyme to the antigen.
Alternatively if the antigen itself is an enzyme, positives may be
identified by the presence of enzymatic activity. An example of an
antigen capture assay is the reverse dot blot. To perform a reverse
dot blot nitrocellulose paper is cut to the size of the dot blot
apparatus and 10 ml/100 cm.sup.2 of rabbit anti-mouse
immunoglobulin solution (approximately 200 .mu.g of purified
antibody/ml in PBS). Rabbit anti-mouse immunoglobulin can be
purified using protein A beads or alternatively purchased from a
commercial source. The solution is incubated with the
nitrocellulose paper for 60 minutes at room temperature. After
incubation the paper is washed three times with PBS for a period of
5 minutes for each wash. The paper is subsequently incubated in 3%
BSA/PBS with 0.02% sodium azide for 1 hour at room temperature and
loaded into a 96-well dot blot apparatus. 50 .mu.l of either
hybridoma tissue culture supernatant or serum from a test bleed are
added to each well and incubated for a period of 1 hour at room
temperature to allow for the mouse antibody to bind to the rabbit
anti-mouse immunoglobulin. The supernatant is drawn through the
nitrocellulose paper using a vacuum and the paper is subsequently
washed three times with 3% BSA/PBS. The paper is removed from the
apparatus and incubated with labeled antigen at room temperature
for 1 hour with shaking. If for example .sup.125I-labeled antigen
is used 10 ml/96-well sheet, 50,000 cpm/well in 3% BSA/PBS is used.
The paper is then washed with PBS until the counts in the wash
butter approach background levels. The paper is then covered in
plastic wrap and exposed to X-ray film at -70.degree. C. with a
screen. Other examples of antigen capture assays including antigen
capture in polyvinylchloride wells and antigen capture in solution
using immunoprecipitation are described in Harlow, E and Lane D,
in: Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory
Press (1988) p 192-194.
[0199] The final screening assay is a functional assay. In a
functional assay the antibodies in the hybridoma tissue culture
supernatant or test bleed serum is used to either block a reaction
or as a molecular handle to deplete an essential component of a
reaction mixture. It should be noted that these assays are
difficult to perform and interpret and a seldom used.
[0200] Once a good immune response has been achieved in the animal
and a good screening procedure is developed, the final step is the
creation of hybridomas. In general the procedure for producing
hybridomas includes isolating antibody-secreting cells from the
appropriate lymphoid tissue, mixing the cells with myeloma cells,
centrifuging the two cell types to generate good cell-to-cell
contact the fusing the cells with PEG (polyethylene glycol). The
fused cells are subsequently diluted into selective media and
plated in multi-well tissue culture dishes. Approximately 1 week
later the supernatants are removed and tested for the presence of
the desired antibody. The cells from the positive wells are grown,
single-cloned and frozen.
[0201] It should be noted that approximately 3 to 5 days before the
fusion, the mice should be given one final boost. The final boost
should be administered at least 3 weeks after the previous
injection to allow for the circulating antibodies to be cleared
from the blood serum by the mouse. Waiting the 3-week time period
will prevent high level of circulating antibodies from binding to
the injected antigen and lowering the effectiveness of the final
boost. This is due to the fact that serum antibody titres decrease
approximately 14 days following injection of an antigen. The
purpose of the final boost is to induce a good, strong response and
to synchronize the maturation of the response (i.e. a substantial
number of antigen-specific lymphocytes will be present 3-4 days
after the final boost.).
[0202] The myeloma cells are prepared by thawing the cells from
liquid nitrogen stocks at least 6 days prior to the fusion
procedure. The myelomas should be growing rapidly and healthy
before the fusion. One day before the fusion, the myelomas cells
should be split into fresh medium supplemented with 10% fetal
bovine serum (available commercially) so that the cells are at a
concentration of 5.times.10.sup.5 cells/ml. 10 ml of the overnight
culture is subsequently diluted with an equal volume of medium
supplemented with 20% fetal bovine serum and 2.times.OPI. (100 mls
of 100.times.OPI is prepared by dissolving 1.5 grams of
oxaloacetate, 500 mg of sodium pyruvate in 100 mls of water that is
suitable for tissue culture work. 2000 IU of bovine insulin is
added to the solution and the solution is filtered sterilized.)
[0203] The splenocytes are isolated from the spleen of a sacrificed
mouse. The spleen is aseptically removed from an immunized mouse
and placed in a 100-mm tissue culture dish containing 10 ml of
medium without serum which has been prewarmed to 37.degree. C.
Contaminating tissue from the spleen is trimmed off and discarded.
The spleen is teased apart using a 19-gauge needle on a 1.0 ml
syringe until the majority of the cells have been released and the
spleen is torn into small particles. Cell clumps can be disrupted
by pipetting. The cells and medium are transferred into a sterile
centrifuge tube leaving any larger pieces of spleen tissue behind.
The tissue culture plate and tissue clumps are washed with 10 ml of
medium without serum which has been prewarmed to 37.degree. C. and
the solution is combined with the first 10 mls. The cell suspension
is allowed to settle for approximately 2 minutes and the
supernatant is carefully removed and transferred to a fresh
centrifuge tube.
[0204] Fusion of the splenocytes and the melanocytes can be
performed by stirring in the presence of 50% PEG (polyethylene
glycol). PEG is prepared by melting PEG 1500 in a 50.degree. C.
water bath. 0.5 grams of PEG is placed in a small glass vial. The
vial is capped and autoclaved to sterilize the PEG mixture. It
should be noted that PEG 1500 is usually used for fusions but the
range of PEG 1000 to PEG 6000 can also be used. The first step is
the fusion of splenocytes and melanocytes is the washing of the
splenocytes twice by centrifugation in 400 ml of medium without
serum (prewarmed to 37.degree. C.). During the second wash, the
melanocytes can also be washed in a second centrifuge tube
containing 20 ml of medium without serum. During these washes, the
vial with 0.5 grams of PEG is melted in a 50.degree. C. water bath.
Once the PEG has melted, 0.5 ml of medium without serum is added
and the vial is transferred to a 37.degree. C. water bath. After
the splenocytes and melanocytes have been washed the two cell
pellets are resuspended in medium without serum (prewarmed to
37.degree. C.) and combined. The cells are centrifuged together at
800 g for 5 minutes and after centrifugation the medium is
carefully removed. The 50% PEG solution is removed from its vial
with a Pasteur pipette and slowly added to the cell pellet while
resuspending the cells by stirring with the end of the pipette.
This procedure should take approximately 1 minute with stirring for
an additional minute. A 10-ml pipette is filled with 10 ml of
medium without serum (prewarmed to 37.degree. C.). 1.0 ml of the
medium is added to the cell suspension over the next minute with
continued stirring with the end of the pipette. The remaining 9.0
mls is added over the next 2 minutes with continuous stirring. The
final mixture is centrifuged at 400 g for 5 minutes. The
supernatant is removed and the cells are resuspended in 10 ml of
medium supplemented with 20% fetal bovine serum (prewarmed to
37.degree. C.), 1.times.OPI and 1.times.AH. (100 ml of 100.times.AH
is prepared ahead of time by adding 0.136 grams of hypoxanthine in
water suitable for tissue culture, heated to 70.degree. C. to
dissolve with a subsequent addition of 10 mg of azaserine. The
solution is filter sterilized and dispensed into sterile tubes in
2.0 ml aliquots. 100.times.AH can be stored at -20.degree. C. for a
period of 1 year.) The cells are transferred to 200 ml of medium
with 20% pre-screened fetal bovine serum (prewarmed to 37.degree.
C.), 1.times.OPI and 1.times.AH. 100 .mu.l of cells are dispensed
into the wells of 20 96-well microtite plates and placed at
37.degree. C. in a CO.sub.2 incubator.
[0205] Screening of hybridomas can be done approximately 7 to 14
days after the fusion. For most screening procedures, clones that
are just visible by the eye are acceptable for screening. Due to
the large number of hybridomas to screen on the first day it may be
advisable to pool the supernatants to reduce the total number of
tests to be performed. The most widely used method is a simple
combination of several tissue culture supernatants. A possible
disadvantage of this method is that the positive well in the pool
will need to be identified by immediately rescreening. The use of a
2 dimensional matrix (i.e. pooling each vertical column and each
horizontal row) can be used to identify positives. The positive
clone can be identified by the location of intersecting positives.
It should be noted that the matrix should only be used if the
positive supernatants are likely to be rare. The screening method
used to screen the hybridomas will have been determined in the
development of the screening procedure discussed above. When the
clones are ready to be screened 50 .mu.l of supernatant is
aseptically removed without disturbing the hybridoma and
transferred to a suitable container. After the removal of the
supernatant, fresh medium should be added to the hybridomas.
[0206] After the positives clones have been identified, the cells
are transferred from the 96-well plate to 0.5 ml of medium
supplemented with 20% fetal bovine serum, 1.times.OPI and
1.times.AH in a 24-well plate. Once the cultures become dense, the
cells are transferred into 5.0 ml in a 60-mm dish and then to 10 ml
in a 100-mm dish. At the 100-mm dish stage the cells should be
frozen. The next step is to clone the antibody-producing cell so
that only one clone of the hybridoma cells is present. The
single-cell cloning ensures that monoclonal antibodies are being
produced and that the secretion of the antibody can be maintained.
The easiest single cell cloning technique is limiting dilution.
Note that limiting dilution should be done at least twice to ensure
that colonies do not arise from two cells that were stuck together.
Limiting dilution is performed by adding 50 .mu.l of medium with
20% FBS and 2.times.OPI to each well of a 96-well place already
containing 50 .mu.l of feeder cells giving 100 .mu.l total volume.
(Splenocyte feeder cells are prepared as described above for the
splenocytes except that the source of the spleen is a female mouse
of the same genetic background as the hybridoma). 100 .mu.l of the
hybridoma cell suspension is removed using a pipetteman and
transferred to the top left-hand well. 1 in 2 doubling dilutions
are done down the left-hand row of the plate and the tip discarded.
1 in 2 doubling dilutions are subsequently performed across the
plate using an 8-well multipipetter. Clones should be visible
within a few days using microscopy and should be ready to screen
after 7 to 10 days.
[0207] Once the hybridoma has been cloned messenger RNA coding for
the heavy and light chain can be isolated employing standard
techniques of RNA isolation and using oligo-dT cellulose
chromatography to segregate the poly-A mRNA. A cDNA library is
prepared from the mixture of RNA using a suitable primer. The
primer is preferably a nucleic acid sequence which is
characteristic of the desired cDNA. It the sequence of the antibody
is known then the primer may be hypothesized based on the known
amino acid sequence. In the present invention, cDNA must be used so
that the DNA to be subsequently introduced into the selected host
system is free from introns.
[0208] For expression of multimeric-protein-complexes containing
multimeric-immunoglobulin-complexes, the cDNA sequences encoding
individual light and heavy chains may be a recombinant antibody,
assembled by combining select light and heavy chain variable
domains and available light and heavy chain constant domain
sequences, respectively. For example a chimeric antibody is
constructed using mouse variable domains and human constant domains
for both the heavy and light chains. Variable domains with specific
binding properties may be isolated from screening populations of
such sequences, usually in the form of a single-chain Fv phage
display library. Or alternatively if the sequence of the mouse
variable domain is known for either the heavy or light chain, PCR
primers can be readily designed to amplify the variable region
which can subsequently be fused to the a human constant region for
the appropriate heavy or light chain. If the sequence is not known,
degenerate primers to mouse immunoglobulin gene variable regions
have been designed (see for example Wang et al. (2000) J.
Immunological Methods 233: 167-177) for Reverse Transcription
Polymerase Chain Reaction.
[0209] The nucleic acid sequences encoding the heavy and light
antibody chains may be altered to improve expression levels for
example by optimizing the nucleic acids sequence in accordance with
the preferred codon usage for the particular cell type which is
selected for expression of the heavy and light antibody chains, or
by altering of motifs known to destabilize mRNAs (see for example:
PCT Patent Application 97/02352). Comparison of the codon usage of
the heavy and light antibody chains with codon usage of the host
will enable the identification of codons that may be changed. For
example, typically plant evolution has tended towards a preference
for CG rich nucleotide sequences while bacterial evolution has
resulted in bias towards AT rich nucleotide sequences. By modifying
the nucleic acid sequences to incorporate nucleic acid sequences
preferred by the host cell, expression may be optimized.
Construction of synthetic genes by altering codon usage is
described in for example PCT patent Application 93/07278. The heavy
and light antibody chain genes may be altered using for example,
targeted mutagenesis, random mutagenesis (Shiraishi et al. (1998)
Arch. Biochem. Biophys. 358: 104-115; Galkin et al. (1997) Protein
Eng. 10: 687-690; Carugo et al. (1997) Proteins 28: 10-28; Hurley
et al. (1996) Biochemistry 35: 5670-5678) (and/or by the addition
of organic solvent (Holmberg et al. (1999) Protein Eng. 12:
851-856).
[0210] As set forth herein, the multimeric immunoglobulin is
associated with an oil body through an oil-body-targeting-protein.
In particular embodiments, the oil-body-targeting-protein may be a
fusion polypeptide comprising an oil-body-protein and an
immunoglobulin binding protein, such as for example protein A,
protein L, and protein G. In this embodiment the the first
recombinant polypeptide may be an immunglobulin heavy chain,
including any IgG, IgA, IgD, IgE or IgM heavy chain and the second
recombinant polypeptide may be a kappa or lambda immunoglobulin
light chain.
[0211] In yet another embodiment involving immunoglobulins, the
first and second recombinant polypeptides (immunoglobulins) are
separately fused to an oil body protein, for example an oleosin or
caleosin. For example,
[0212] a) the first recombinant polypeptide may be an
immunoglobulin heavy chain, including any IgG, IgA, IgD, IgE or IgM
heavy chain, and the second recombinant polypeptide may be a kappa
or lambda immunoglobulin light chain; or
[0213] b) the first recombinant polypeptide may be the variable and
first constant domain from an immunoglobulin heavy chain and the
second recombinant polypeptide may be a kappa or lambda
immunoglobulin light chain; or
[0214] c) the first recombinant polypeptide may be the variable
domain from an immunoglobulin heavy chain and the second
recombinant polypeptide may be the variable domain from a kappa or
lambda immunoglobulin light chain.
[0215] In certain embodiments, the fusion polypeptides are designed
or selected to allow the heteromultimeric-protein-complex formation
between immunoglobulin light and heavy chain sequences on the oil
bodies within the cell comprising oil bodies.
[0216] Preparation of Expression Vectors Comprising
oil-body-targeting-proteins and the First and/or Second Recombinant
Polypeptides, Multimeric-protein-complexes,
Heteromultimeric-protein-comp- lexes, Multimeric-fusion-proteins,
Heteromultimeric-fusion-proteins, Immunoglobulins,
Immunoglobulin-polypeptide-chains, Redox-fusion-polypeptides, or
the First and/or Second Thioredoxin-related Proteins
[0217] In accordance with the present invention, the first and/or
second recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins; and the
oil-body-targeting-protein are conveniently produced in a cell. In
order to produce the recombinant polypeptides or
multimeric-protein-complexes, a nucleic acid sequence encoding
either the first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins; and/or the oil-body-targeting-protein
are incorporated in a recombinant expression vector. Accordingly,
provided herein are recombinant expression vectors comprising the
chimeric nucleic acids provided herein suitable for expression of
the oil-body-targeting-protein and the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins, suitable for
the selected cell. The term "suitable for expression in the
selected cell" means that the recombinant expression vector
contains all nucleic acid sequences required to ensure expression
in the selected cell.
[0218] Accordingly, the recombinant expression vectors further
contain regulatory nucleic acid sequences selected on the basis of
the cell which is used for expression and ensuring initiation and
termination of transcription operatively linked to the nucleic acid
sequence encoding the recombinant polypeptide or
multimeric-protein-complex and/or the oil-body-targeting-protein.
Regulatory nucleic acid sequences include promoters, enhancers,
silencing elements, ribosome binding sites, Shine-Dalgarno
sequences, introns and other expression elements. "Operatively
linked" is intended to mean that the nucleic acid sequences
comprising the regulatory regions linked to the nucleic acid
sequences encoding the recombinant polypeptide or
multimeric-protein-complex and/or the oil-body-targeting-protein
allow expression in the cell. A typical nucleic acid construct
comprises in the 5' to 3' direction a promoter region capable of
directing expression, a coding region comprising the first and/or
second recombinant polypeptides, multimeric-protein-complexe- s,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins; and/or an
oil-body-targeting-protein and a termination region functional in
the selected cell.
[0219] The selection of regulatory sequences will depend on the
organism and the cell type in which the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-comp- lexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins; and/or the
oil-body-targeting-protein is expressed, and may influence the
expression levels of the polypeptide. Regulatory sequences are
art-recognized and selected to direct expression of the
oil-body-targeting-protein and the recombinant polypeptides or
multimeric-protein-complexes in the cell.
[0220] Promoters that may be used in bacterial cells include the
lac promoter (Blackman et al. (1978) Cell: 13: 65-71), the trp
promoter (Masuda et al. (1996) Protein Eng: 9: 101-106) and the T7
promoters (Studier et al. (1986) J. Mol. Biol. 189: 113-130).
Promoters functional in plant cells that may be used herein include
constitutive promoters such as the 35S CaMV promoter (Rothstein et
al. (1987) Gene: 53: 153-161) the actin promoter (McElroy et al.
(1990) Plant Cell 2: 163-171) and the ubiquitin promoter (European
Patent Application 0 342 926). Other promoters are specific to
certain tissues or organs (for example, roots, leaves, flowers or
seeds) or cell types (for example, leaf epidermal cells, mesophyll
cells or root cortex cells) and or to certain stages of plant
development. Timing of expression may be controlled by selecting an
inducible promoter, for example the PR-a promoter described in U.S.
Pat. No. 5,614,395. Selection of the promoter therefore depends on
the desired location and timing of the accumulation of the desired
polypeptide. In a particular embodiment, the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins; and the
oil-body-targeting-protein are expressed in a seed cell and seed
specific promoters are utilized. Seed specific promoters that may
be used herein include for example the phaseolin promoter
(Sengupta-Gopalan et al. (1985) Proc. Natl. Acad. Sci. USA: 82:
3320-3324), and the Arabidopsis 18 kDa oleosin promoter (van
Rooijen et al. (1992) Plant. Mol. Biol. 18: 1177-1179). New
promoters useful in various plant cell types are constantly
discovered. Numerous examples of plant promoters may be found in
Ohamuro et al. (Biochem of PI. (1989) 15: 1-82).
[0221] Genetic elements capable of enhancing expression of the
polypeptide may be included in the expression vectors. In plant
cells these include for example, the untranslated leader sequences
from viruses such as the AMV leader sequence (Jobling and Gehrke
(1987) Nature: 325: 622-625) and the intron associated with the
maize ubiquitin promoter (See: U.S. Pat. No. 5,504,200).
[0222] Transcriptional terminators are generally art recognized and
besides serving as a signal for transcription termination serve as
a protective element serving to extend the mRNA half-life
(Guarneros et al. (1982) Proc. Natl. Acad. Sci. USA: 79: 238-242).
In nucleic acid sequences for the expression in plant cells, the
transcriptional terminator typically is from about 200 nucleotide
to about 1000 nucleotides in length. Terminator sequences that may
be used herein include for example, the nopaline synthase
termination region (Bevan et al. (1983) Nucl. Acid. Res.: 11:
369-385), the phaseolin terminator (van der Geest et al. (1994)
Plant J.: 6: 413-423), the terminator for the octopine synthase
gene of Agrobacterium tumefaciens or other similarly functioning
elements. Transcriptional terminators can be obtained as described
by An (1987) Methods in Enzym. 153: 292). The selection of the
transcriptional terminator may have an effect on the rate of
transcription.
[0223] Accordingly, provided herein are chimeric nucleic acid
sequences encoding a first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or thioredoxin-related proteins. In
one embodiment, said nucleic acid comprises:
[0224] (a) a first nucleic acid sequence encoding an
oil-body-targeting-protein operatively linked in reading frame
to;
[0225] (b) a second nucleic acid sequence encoding a first
recombinant polypeptide, immunoglobulin-polypeptide-chain, or redox
protein; linked in reading frame to;
[0226] (c) a third nucleic acid sequence encoding a second
recombinant polypeptide, immunoglobulin-polypeptide-chain or redox
protein, wherein said first and second recombinant polypeptides,
immunoglobulin-polypeptid- e-chains or redox proteins are capable
of forming a multimeric-protein-complex.
[0227] In another embodiment, provided herein is an expression
vector comprising:
[0228] 1) a first nucleic acid sequence capable of regulating
transcription in said cell operatively linked to;
[0229] 2) a second nucleic acid sequence encoding a recombinant
fusion polypeptide comprising (i) a nucleic acid sequence encoding
a sufficient portion of an oil-body-protein to provide targeting of
said recombinant fusion polypeptide to an oil body linked in
reading frame to (ii) a nucleic acid sequence encoding a
multimeric-fusion-protein, such as a redox fusion polypeptide or
immunoglobulin, comprising a first recombinant polypeptide, such as
a redox protein or immunoglobulin-polypeptide-chain, linked to a
second recombinant polypeptide, such as a second redox protein or a
second immunoglobulin-polypeptide-chain, operatively linked to;
[0230] 3) a third nucleic acid sequence capable of terminating
transcription in said cell.
[0231] The recombinant expression vector further may contain a
marker gene. Marker genes that may be used in accordance with the
present invention include all genes that allow the distinction of
transformed cells from non-transformed cells including all
selectable and screenable marker genes. A marker may be a
resistance marker such as an antibiotic resistance marker against
for example kanamycin, ampicillin, G418, bleomycin hygromycin,
chloramphenicol which allows selection of a trait by chemical means
or a tolerance marker against for example a chemical agent such as
the normally phytotoxic sugar mannose (Negrotto et al. (2000) Plant
Cell Rep. 19: 798-803). In plant recombinant expression vectors
herbicide resistance markers may conveniently be used for example
markers conferring resistance against glyphosate (U.S. Pat. Nos.
4,940,935 and 5,188,642) or phosphinothricin (White et al. (1990)
Nucl. Acids Res. 18: 1062; Spencer et al. (1990) Theor. Appl.
Genet. 79: 625-631). Resistance markers to a herbicide when linked
in close proximity to the redox protein or
oil-body-targeting-protein may be used to maintain selection
pressure on a population of plant cells or plants for those plants
that have not lost the protein of interest. Screenable markers that
may be employed to identify transformants through visual
observation include beta-glucuronidase (GUS) (see US Patents U.S.
Pat. No. 5,268,463 and U.S. Pat. No. 5,599,670) and green
fluorescent protein (GFP) (Niedz et al. (1995) Plant Cell Rep.:
14:403).
[0232] The recombinant expression vectors further may contain
nucleic acid sequences encoding targeting signals ensuring
targeting to a cell compartment or organelle. Suitable targeting
signals that may be used herein include those that are capable of
targeting polypeptides to the endomembrane system. Exemplary
targeting signals that may be used herein include targeting signals
capable of directing the protein to the periplasm, the cytoplasm,
the golgi apparatus, the apoplast (Sijmons et al., 1990,
Bio/Technology, 8:217-221) the chloroplast (Comai et al. (1988) J.
Biol. Chem. 263: 15104-15109), the mitochondrion, the peroxisome
(Unger et al. (1989) Plant Mol. Biol. 13: 411 418), the ER, the
vacuole (Shinshi et al. (1990) Plant Mol. Biol. 14: 357-368 and the
oil body. By the inclusion of the appropriate targeting sequences
it is possible to direct the oil-body-targeting-protein or the
first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, and/or thioredoxin-related proteins, to
the desired organelle or cell compartment.
[0233] The recombinant expression vectors of the present invention
may be prepared 5 in accordance with methodologies well known to
those of skill in the art of molecular biology (see for example:
Sambrook et al. (1990) Molecular Cloning, 2.sup.nded. Cold Spring
Harbor Press). The preparation of these constructs may involve
techniques such as restriction digestion, ligation, gel
electrophoresis, DNA sequencing and PCR. A wide variety of cloning
vectors is available to perform the necessary cloning steps
resulting in a recombinant expression vector ensuring expression of
the polypeptide. Especially suitable for this purpose are vectors
with a replication system that is functional in Escherichia coli
such as pBR322, the PUC series of vectors, the M13mp series of
vectors, pBluescript etc. Typically these vectors contain a marker
allowing the selection of transformed cells for example by
conferring antibiotic resistance. Nucleic acid sequences may be
introduced in these vectors and the vectors may be introduced in E.
coli grown in an appropriate medium. Vectors may be recovered from
cells upon harvesting and lysing the cells.
[0234] Recombinant expression vectors suitable for the introduction
of nucleic acid sequences in plant cells include Agrobacterium and
Rhizobium based vectors such as the Ti and Ri plasmids.
Agrobacterium based vectors typically carry at least one T-DNA
border sequence and include vectors such pBIN 19 (Bevan (1984) Nucl
Acids Res. Vol. 12, 22:8711-8721) and other binary vector systems
(for example: U.S. Pat. No. 4,940,838).
[0235] Production of Cells Comprising a First and/or Second
Recombinant Polypeptides, Multimeric-protein-complexes,
Heteromultimeric-protein-comp- lexes, Multimeric-fusion-proteins,
Heteromultimeric-fusion-proteins, Immunoglobulins,
Immunoglobulin-polypeptide-chains, Redox-fusion-polypeptides,
and/or a First and/or Second Thioredoxin-related Protein and
Oil-body-targeting-proteins
[0236] In accordance with the present invention, the recombinant
expression vectors are introduced into the cell that is selected
and the selected cells are grown to produce the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-comp- lexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, a
first and/or second thioredoxin-related protein; and the
oil-body-targeting-protein either directly or in a progeny
cell.
[0237] Methodologies to introduce recombinant expression vectors
into a cell also referred to herein as "transformation" are well
known to the art and vary depending on the cell type that is
selected. General techniques to transfer the recombinant expression
vectors into the cell include electroporation; chemically mediated
techniques, for example CaCl2 mediated nucleic acid uptake;
particle bombardment (biolistics); the use of naturally infective
nucleic acid sequences for example virally derived nucleic acid
sequences or when plant cells are used Agrobacterium or Rhizobium
derived nucleic acid sequences; PEG mediated nucleic acid uptake,
microinjection, and the use of silicone carbide whiskers (Kaeppler
et al. (1990) Plant Cell Rep. 9:415418) all of which may be used
herein.
[0238] Introduction of the recombinant expression vector into the
cell may result in integration of its whole or partial uptake into
host cell genome including the chromosomal DNA or the plastid
genome. Alternatively the recombinant expression vector may not be
integrated into the genome and replicate independently of the host
cell's genomic DNA. Genomic integration of the nucleic acid
sequence is typically used as it will allow for stable inheritance
of the introduced nucleic acid sequences by subsequent generations
of cells and the creation of cell, plant or animal lines.
[0239] Particular embodiments involve the use of plant cells.
Particular plant cells used herein include cells obtainable from
Brazil nut (Betholletia excelsa); castor (Riccinus communis);
coconut (Cocus nucifera); coriander (Coriandrum sativum); cotton
(Gossypium spp.); groundnut (Arachis hypogaea); jojoba (Simmondsia
chinensis); linseed/flax (Linum usitatissimum); maize (Zea mays);
mustard (Brassica spp. and Sinapis alba); oil palm (Elaeis
guineeis); olive (Olea europaea); rapeseed (Brassica spp.);
safflower (Carthamus tinctorius); soybean (Glycine max); squash
(Cucurbita maxima); barley (Hordeum vulgare); wheat (Traeticum
aestivum) and sunflower (Helianthus annuus).
[0240] Transformation methodologies for dicotelydenous plant
species are well known. Generally Agrobacterium mediated
transformation is utilized because of its high efficiency as well
as the general susceptibility by many, if not all dicotelydenous
plant species. Agrobacterium transformation generally involves the
transfer of a binary vector (e.g. pBIN19) comprising the DNA of
interest to an appropriate Agrobacterium strain (e.g. CIB542) by
for example tri-parental mating with an E. coli strain carrying the
recombinant binary vector and an E. coli strain carrying a helper
plasmid capable of mobilization of the binary vector to the target
Agrobacterium strain, or by DNA transformation of the Agrobacterium
strain (Hofgen et al. Nucl. Acids. Res. (1988) 16: 9877. Other
transformation methodologies that may be used to transform
dicotelydenous plant species include biolistics (Sanford (1988)
Trends in Biotechn. 6: 299-302); electroporation (Fromm et al.
(1985) Proc. Natl. Acad. Sci. USA 82: 5824-5828); PEG mediated DNA
uptake (Potrykus et al. (1985) Mol. Gen. Genetics 199: 169-177);
microinjection (Reich et al. Bio/Techn. (1986) 4: 1001-1004) and
silicone carbide whiskers (Kaeppler et al. (1990) Plant Cell Rep.
9: 415-418). The exact transformation methodologies typically vary
somewhat depending on the plant species that is used.
[0241] In a particular embodiment the oil bodies are obtained from
safflower and the recombinant proteins are expressed in safflower.
Safflower transformation has been described by Baker and Dyer
(Plant Cell Rep. (1996) 16: 106-110).
[0242] Monocotelydenous plant species may now also be transformed
using a variety of methodologies including particle bombardment
(Christou et al. (1991) Biotechn. 9: 957-962; Weeks et al. Plant
Physiol. (1993) 102: 1077-1084; Gordon-Kamm et al. Plant Cell
(1990) 2: 603-618) PEG mediated DNA uptake (EP 0 292 435; 0 392
225) or Agrobacterium-mediated transformation (Goto-Fumiyuki et al
(1999) Nature-Biotech. 17 (3):282-286).
[0243] Plastid transformation is described in U.S. Pat. Nos.
5,451,513; 5,545,817 and 5,545,818; and PCT Patent Applications
95/16783; 98/11235 and 00/39313) Basic chloroplast transformation
involves the introduction of cloned plastid DNA flanking a
selectable marker together with the nucleic acid sequence of
interest into a suitable target tissue using for example biolistics
or protoplast transformation. Selectable markers that may be used
include for example the bacterial aadA gene (Svab et al. (1993)
Proc. Natl. Acad. Sci. USA 90: 913-917). Plastid promoters that may
be used include for example the tobacco clpP gene promoter (PCT
Patent Application 97/06250).
[0244] In another embodiment, the invention chimeric nucleic acid
constructs provided herein are directly transformed into the
plastid genome. Plastid transformation technology is described
extensively in U.S. Pat. Nos. 5,451,513, 5,545,817, 5,545,818 and
5,576,198; in PCT application nos. WO 95/16783 and WO 97/32977; and
in McBride et. al., Proc Natl Acad Sci USA 91: 7301-7305 (1994),
the entire disclosures of all of which are hereby incorporated by
reference. In one embodiment, plastid transformation is achieved
via biolistics, first carried out in the unicellular green alga
Chlamydomonas reinhardtii (Boynton et al. (1988) Science
240:1534-1537)) and then extended to Nicotiana tabacum (Svab et al.
(1990) Proc Natl Acad Sci USA 87:8526-8530), combined with
selection for cis-acting antibiotic resistance loci (spectinomycin
or streptomycin resistance) or complementation of
non-photosynthetic mutant phenotypes.
[0245] In another embodiment, tobacco plastid transformation is
carried out by particle bombardment of leaf or callus tissue, or
polyethylene glycol (PEG)-mediated uptake of plasmid DNA by
protoplasts, using cloned plastid DNA flanking a selectable
antibiotic resistance marker. For example, 1 to 1.5 kb flanking
regions, termed targeting sequences, facilitate homologous
recombination with the plastid genome and allow the replacement or
modification of specific regions of the 156 kb tobacco plastid
genome. In one embodiment, point mutations in the plastid 16S rDNA
and rps12 genes conferring resistance to spectinomycin and/or
streptomycin can be utilized as selectable markers for
transformation (Svab et al. (1990) Proc Natl Acad Sci USA
87:8526-8530; Staub et al. (1992) Plant Cell 4:39-45, the entire
disclosures of which are hereby incorporated by reference),
resulting in stable homoplasmic transformants at a frequency of
approximately one per 100 bombardments of target leaves. The
presence of cloning sites between these markers allows creation of
a plastid targeting vector for introduction of foreign genes (Staub
et al. (1993) EMBO J 12:601-606, the entire disclosure of which is
hereby incorporated by reference). In another embodiment,
substantial increases in transformation frequency can be obtained
by replacement of the recessive rRNA or r-protein antibiotic
resistance genes with a dominant selectable marker, the bacterial
aadA gene encoding the spectinomycin-detoxifying enzyme
aminoglycoside-3'-adenyltransferase (Svab et al. (1993) Proc Natl
Acad Sci USA 90: 913-917, the entire disclosure of which is hereby
incorporated by reference). This marker has also been used
successfully for high-frequency transformation of the plastid
genome of the green alga Chlamydomonas reinhardtii
(Goldschmidt-Clermont, M. (1991) Nucl Acids Res 19, 4083-4089, the
entire disclosure of which is hereby incorporated by reference). In
other embodiments, plastid transformation of protoplasts from
tobacco and the moss Physcomitrella can be attained using
PEG-mediated DNA uptake (O'Neill et al. (1993) Plant J 3:729-738;
Koop et al. (1996) Planta 199:193-201, the entire disclosures of
which are hereby incorporated by reference).
[0246] Both particle bombardment and protoplast transformation are
also contemplated for use herein. Plastid transformation of oilseed
plants has been successfully carried out in the genera Arabidopsis
and Brassica (Sikdar et al. (1998) Plant Cell Rep 18:20-24; PCT
Application WO 00/39313, the entire disclosures of which are hereby
incorporated by reference).
[0247] A chimeric nucleic sequence construct is inserted into a
plastid expression cassette including a promoter capable of
expressing the construct in plant plastids. A particular promoter
capable of expression in a plant plastid is, for example, a
promoter isolated from the 5' flanking region upstream of the
coding region of a plastid gene, which may come from the same or a
different species, and the native product of which is typically
found in a majority of plastid types including those present in
non-green tissues. Gene expression in plastids differs from nuclear
gene expression and is related to gene expression in prokaryotes
(Stern et al. (1997) Trends in Plant Sci 2:308-315, the entire
disclosure of which is hereby incorporated by reference).
[0248] Plastid promoters generally contain the -35 and -10 elements
typical of prokaryotic promoters, and some plastid promoters called
PEP (plastid-encoded RNA polymerase) promoters are recognized by an
E. coli-like RNA polymerase mostly encoded in the plastid genome,
while other plastid promoters called NEP promoters are recognized
by a nuclear-encoded RNA polymerase. Both types of plastid
promoters are suitable for use herein. Examples of plastid
promoters include promoters of clpP genes such as the tobacco clpP
gene promoter (WO 97/06250, the entire disclosure of which is
hereby incorporated by reference) and the Arabidopsis clpP gene
promoter (U.S. Application No. 09/038,878, the entire disclosure of
which is hereby incorporated by reference). Another promoter
capable of driving expression of a chimeric nucleic acid construct
in plant plastids comes from the regulatory region of the plastid
16S ribosomal RNA operon (Harris et al., (1994) Microbiol Rev
58:700-754; Shinozaki et al. (1986) EMBO J 5:2043-2049, the entire
disclosures of both of which are hereby incorporated by reference).
Other examples of promoters capable of driving expression of a
nucleic acid construct in plant plastids include a psbA promoter or
am rbcL promoter. A plastid expression cassette preferably further
includes a plastid gene 3' untranslated sequence (3' UTR)
operatively linked to a chimeric nucleic acid construct of the
present invention. The role of untranslated sequences is preferably
to direct the 3' processing of the transcribed RNA rather than
termination of transcription. An exemplary 3' UTR is a plastid
rps16 gene 3' untranslated sequence, or the Arabidopsis plastid
psbA gene 3' untranslated sequence. In a further embodiment, a
plastid expression cassette includes a poly-G tract instead of a 3'
untranslated sequence. A plastid expression cassette also
preferably further includes a 5' untranslated sequence (5' UTR)
functional in plant plastids, operatively linked to a chimeric
nucleic acid construct provided herein.
[0249] A plastid expression cassette is contained in a plastid
transformation vector, which preferably further includes flanking
regions for integration into the plastid genome by homologous
recombination. The plastid transformation vector may optionally
include at least one plastid origin of replication. The present
invention also encompasses a plant plastid transformed with such a
plastid transformation vector, wherein the chimeric nucleic acid
construct is expressible in the plant plastid. Also encompassed
herein is a plant or plant cell, including the progeny thereof,
including this plant plastid. In a particular embodiment, the plant
or plant cell, including the progeny thereof, is homoplasmic for
transgenic plastids.
[0250] Other promoters capable of driving expression of a chimeric
nucleic acid construct in plant plastids include
transactivator-regulated promoters, preferably heterologous with
respect to the plant or to the subcellular organelle or component
of the plant cell in which expression is effected. In these cases,
the DNA molecule encoding the transactivator is inserted into an
appropriate nuclear expression cassette which is transformed into
the plant nuclear DNA. The transactivator is targeted to plastids
using a plastid transit peptide. The transactivator and the
transactivator-driven DNA molecule are brought together either by
crossing a selected plastid-transformed line with and a transgenic
line containing a DNA molecule encoding the transactivator
supplemented with a plastid-targeting sequence and operably linked
to a nuclear promoter, or by directly transforming a plastid
transformation vector containing the desired DNA molecule into a
transgenic line containing a chimeric nucleic acid construct
encoding the transactivator supplemented with a plastid-targeting
sequence operably linked to a nuclear promoter. If the nuclear
promoter is an inducible promoter, in particular a chemically
inducible embodiment, expression of the chimeric nucleic acid
construct in the plastids of plants is activated by foliar
application of a chemical inducer. Such an inducible
transactivator-mediated plastid expression system is preferably
tightly regulatable, with no detectable expression prior to
induction and exceptionally high expression and accumulation of
protein following induction.
[0251] A particular transactivator is, for example, viral RNA
polymerase. Particular promoters of this type are promoters
recognized by a single sub-unit RNA polymerase, such as the T7 gene
10 promoter, which is recognized by the bacteriophage T7
DNA-dependent RNA polymerase. The gene encoding the T7 polymerase
is preferably transformed into the nuclear genome and the T7
polymerase is targeted to the plastids using a plastid transit
peptide. Promoters suitable for nuclear expression of a gene, for
example a gene encoding a viral RNA polymerase such as the T7
polymerase, are described above and elsewhere in this application.
Expression of chimeric nucleic acid constructs in plastids can be
constitutive or can be inducible, and such plastid expression can
be also organ- or tissue-specific. Examples of various expression
systems are extensively described in WO 98/11235, the entire
disclosure of which is hereby incorporated by reference. Thus, in
one aspect, the present invention utilizes coupled expression in
the nuclear genome of a chloroplast-targeted phage T7 RNA
polymerase under the control of the chemically inducible PR-1a
promoter, for example of the PR-1 promoter of tobacco, operably
linked with a chloroplast reporter transgene regulated by T7 gene
10 promoter/terminator sequences, for example as described in as in
U.S. Pat. No. 5,614,395 the entire disclosure of which is hereby
incorporated by reference. In another embodiment, when plastid
transformants homoplasmic for the maternally inherited TR or NTR
genes are pollinated by lines expressing the T7 polymerase in the
nucleus, F1 plants are obtained that carry both transgene
constructs but do not express them until synthesis of large amounts
of enzymatically active protein in the plastids is triggered by
foliar application of the PR-1a inducer compound
benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester
(BTH).
[0252] In a particular embodiment, two or more genes, for example
TR and NTR genes, are transcribed from the plastid genome from a
single promoter in an operon-like polycistronic gene. In one
embodiment, the operon-like polycistronic gene includes an
intervening DNA sequence between two genes in the operon-like
polycistronic gene. In a particular embodiment, the intervening DNA
sequence is not present in the plastid genome to avoid homologous
recombination with plastid sequences. In another embodiment, the
DNA sequence is derived from the 5' untranslated (UTR) region of a
non-eukaryotic gene, preferably from a viral 5'UTR, preferably from
a 5'UTR derived from a bacterial phage, such as a T7, T3 or SP6
phage. In one embodiment, a portion of the DNA sequence may be
modified to prevent the formation of RNA secondary structures in an
RNA transcript of the operon-like polycistronic gene, for example
between the DNA sequence and the RBS of the downstream gene. Such
secondary structures may inhibit or repress the expression of the
downstream gene, particularly the initiation of translation. Such
RNA secondary structures are predicted by determining their melting
temperatures using computer models and programs such a the "mfold"
program version 3 (available from Zuker and Turner, Washington
University School of Medicine, St-Louis, Mo.) and other methods
known to one skilled in the art.
[0253] The presence of the intervening DNA sequence in the
operon-like polycistronic gene increases the accessibility of the
RBS of the downstream gene, thus resulting in higher rates of
expression. Such strategy is applicable to any two or more genes to
be transcribed from the plastid genome from a single promoter in an
operon-like chimeric heteromultimeric gene.
[0254] Following transformation the cells are grown, typically in a
selective medium allowing the identification of transformants.
Cells may be harvested in accordance with methodologies known to
the art. In order to associate the oil bodies with the first and/or
second recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-comp- lexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, and a
first and/or second thioredoxin-related protein, the integrity of
cells may be disrupted using any physical, chemical or biological
methodology capable of disrupting the cells' integrity. These
methodologies are generally cell-type dependent and known to the
skilled artisan. Where plants are employed they may be regenerated
into mature plants using plant tissue culture techniques generally
known to the skilled artisan. Seeds may be harvested from mature
transformed plants and used to propagate the plant line. Plants may
also be crossed and in this manner, contemplated herein is the
breeding of cells lines and transgenic plants that vary in genetic
background. It is also possible to cross a plant line comprising
the first recombinant polypeptide with a plant line comprising the
second recombinant polypeptide. Accordingly, also provided herein
are methods of producing in a plant a recombinant
multimeric-protein-complex, said method comprising:
[0255] (a) preparing a first plant comprising cells, said cells
comprising oil bodies and a first recombinant polypeptide, such as
a redox protein (e.g., a thioredoxin-related protein, and the like)
or an immunoglobulin-polypeptide-chain, wherein said first
recombinant polypeptide is capable of associating with said oil
bodies through an oil-body-targeting-protein;
[0256] (b) preparing a second plant comprising cells, said cells
comprising oil bodies and a second recombinant polypeptide, such as
a second redox protein (e.g., a thioredoxin-related protein, and
the like) or a second immunoglobulin-polypeptide-chain; and
[0257] (c) sexually crossing said first plant with said second
plant to produce a progeny plant comprising cells, said cells
comprising oil bodies, wherein said oil bodies are capable of
associating with said first recombinant polypeptide, and said first
recombinant recombinant polypeptide is capable of associating with
said second recombinant polypeptide to form said recombinant
multimeric-protein-complex.
[0258] The second recombinant polypeptide may also associate with
the oil bodies. Accordingly, also provided herein are methods of
producing in a plant a recombinant multimeric-protein-complex, said
method comprising:
[0259] (a) preparing a first plant comprising cells, said cells
comprising oil bodies and a first recombinant polypeptide, such as
a redox (or thioredoxin-related) protein or
immunoglobulin-polypeptide-chain, wherein said first recombinant
polypeptide is capable of associating with said oil bodies through
an oil-body-targeting-protein;
[0260] (b) preparing a second plant comprising cells, said cells
comprising oil bodies and a second recombinant polypeptide, such as
a second redox (thioredoxin-related) protein or a second
immunoglobulin-polypeptide-chain, wherein said second recombinant
polypeptide is capable of associating with said oil bodies through
an oil body targeting protein; and
[0261] (c) sexually crossing said first plant with said second
plant to produce a progeny plant comprising cells, said cells
comprising oil bodies, wherein said oil bodies are capable of
associating with said first recombinant polypeptide, and said first
recombinant recombinant polypeptide is capable of associating with
said second recombinant polypeptide to form said recombinant
multimeric-protein-complex.
[0262] The first and second recombinant polypeptide may also be
prepared in a first plant line. A second plant line comprising the
oil body targeting protein capable of associating with the first
recombinant polypeptide may subsequently be crossed with the first
plant line. Oil bodies comprising the multimeric-protein-complex
may be isolated from progeny plants. Accordingly, also provided
herein are methods of producing in a plant a recombinant
multimeric-protein-complex, said method comprising:
[0263] (a) preparing a first plant comprising cells, said cells
comprising oil bodies and a first and second recombinant
polypeptide wherein said first recombinant polypeptide is capable
of associating with said oil bodies through an
oil-body-targeting-protein;
[0264] (b) preparing a second plant comprising cells, said cells
comprising oil bodies and an oil-body-targeting-protein that is
capable of associating with said first recombinant polypeptide;
and
[0265] (c) sexually crossing said first plant with said second
plant to produce a progeny plant comprising cells, said cells
comprising oil bodies, wherein said oil bodies are capable of
associating with said first recombinant polypeptide through said
oil-body-targeting-protein, and said first recombinant recombinant
polypeptide is capable of associating with said second recombinant
polypeptide to form said recombinant multimeric-protein-complex.
The oil bodies can be isolated from the progeny plant comprising
said multimeric-protein-complex. The oil-body-targeting-protein can
be selected from an oil-body-protein or an immunoglobulin, wherein
the oil-body-protein can be an oleosin or caleosin. The first and
second recombinant polypeptide can form a
multimeric-protein-complex, such as a
heteromultimeric-protein-complex, wherein the
heteromultimeric-protein-complex can be an enzymatically active
redox complex or an immunoglobulinln another embodiment, the first
recombinant polypeptide can be an immunoglobulin-polypeptide-chain.
For example, the first recombinant polypeptide can be an
immunoglobulin light chain, or an immunologically active portion
thereof, and the second recombinant polypeptide can be an
immunoglobulin heavy chain, or an immunologically active portion
thereof. In this embodiment, the oil-body-targeting-protein can
comprise protein A, protein L or protein G. The plant can be a
safflower plant.
[0266] Isolation of Oil Bodies
[0267] The oil bodies provided herein may be obtained from any cell
containing oil bodies, including any animal cell; plant cell;
fungal cell; for example a yeast cell, algae cell; or bacterial
cell. Any process suitable for the isolation oil bodies from cells
may be used herein. Processes for the isolation of oil bodies from
plant seed cells have been described in U.S. Pat. Nos. (6,146,645
and 6,183,762) and the isolation of oil bodies from yeast cells has
been described by Ting et al. (1997) J. Biol. Chem. 272:
3699-3706).
[0268] In certain embodiments, the oil bodies are obtained from a
plant cell such as for example a pollen cell; a fruit cell; a spore
cell; a nut cell; mesocarp cell; for example the mesocarp cells
obtainable from olive (Olea europaea) or avocado (Persea
americana); or a seed cell. In particular embodiments the oil
bodies are obtained from a plant seed cell. The seeds can be
obtained from a transgenic plant according to the present
invention. In particular embodiments, a seed of a transgenic plant
according to the present invention contains the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
first and/or second thioredoxin-related proteins in a concentration
of at least about 0.5% of total cellular seed protein. In further
embodiments, a seed of a transgenic plant provided herein contains
a recombinant polypeptide or multimeric-protein-complex in a
concentration of at least about 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%,
1.25%, 1.5%, 1.75%, 2.0%, 2.25%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%,
10% or more, of total cellular seed protein. The upper limits of
the recombinant polypeptide or multimeric-protein-complex
concentration can be up to about 8%, 9%, 10%, 11%, 12%, 13%, 14%,
15%. Thus, the ranges at least about 0.5% up to about 15%; at least
about 1.0% up to about 10%; and at least about 5% up to about 8%
are among the various ranges contemplated herein.
[0269] Among the plant seeds useful in this regard are plant seeds
obtainable from the group of plant species consisting of Brazil nut
(Betholletia excelsa); castor (Riccinus communes); coconut (Cocus
nucifera); coriander (Coriandrum sativum); cotton (Gossypium spp.);
groundnut (Arachis hypogaea); jojoba (Simmondsia chinensis);
linseed/flax (Linum usitatissimum); maize (Zea mays); mustard
(Brassica spp. and Sinapis alba); oil palm (Elaeis guineeis); olive
(Olea europaea); rapeseed (Brassica spp.); safflower (Carthamus
tinctorius); soybean (Glycine max); squash (Cucurbita maxima);
sunflower (Helianthus annuus); barley (Hordeum vulgare); wheat
(Traeticum aestivum) and mixtures thereof. In a particular
embodiment, oil bodies are obtainable from the seeds obtainable
from safflower (Carthamus tinctorius).
[0270] In order to prepare oil bodies from plant seeds, plants are
grown and allowed to set seed in accordance with common
agricultural practices. Thus, the present invention also provides
seeds comprising oil bodies, wherein said oil bodies further
comprise invention multimeric-protein-complexes described herein.
Upon harvesting the seed and, if necessary the removal of large
insoluble materials such as stones or seed hulls, by for example
sieving or rinsing, any process suitable for the isolation of oil
bodies from seeds may be used herein. A typical process involves
grinding of the seeds followed by an aqueous extraction
process.
[0271] Seed grinding may be accomplished by any comminuting process
resulting in a substantial disruption of the seed cell membrane and
cell walls without compromising the structural integrity of the oil
bodies present in the seed cell. Suitable grinding processes in
this regard include mechanical pressing and milling of the seed.
Wet milling processes such as described for cotton (Lawhon et al.
(1977) J. Am. Oil Chem. Soc. 63: 533-534) and soybean (U.S. Pat.
No. 3,971,856; Carter et al. (1974) J. Am. Oil Chem. Soc. 51:
137-141) are particularly useful in this regard. Suitable milling
equipment capable of industrial scale seed milling include colloid
mills, disc mills, pin mills, orbital mills, IKA mills and
industrial scale homogenizers. The selection of the milling
equipment will depend on the seed, which is selected, as well as
the throughput requirement.
[0272] Solid contaminants such as seed hulls, fibrous materials,
undissolved carbohydrates, proteins and other insoluble
contaminants are subsequently preferably removed from the ground
seed fraction using size exclusion based methodologies such as
filtering or gravitational based methods such as a centrifugation
based separation process. Centrifugation may be accomplished using
for example a decantation centrifuge such as a HASCO 200 2-phase
decantation centrifuge or an NX310B (Alpha Laval). Operating
conditions are selected such that a substantial portion of the
insoluble contaminants and sediments and may be separated from the
soluble fraction.
[0273] Following the removal of insolubles the oil body fraction
may be separated from the aqueous fraction. Gravitational based
methods as well as size exclusion based technologies may be used.
Gravitational based methods that may be used include centrifugation
using for example a tubular bowl centrifuge such as a Sharples
AS-16 or AS-46 (Alpha Laval), a disc stack centrifuge or a
hydrocyclone, or separation of the phases under natural
gravitation. Size exclusion methodologies that may be used include
membrane ultra filtration and crossflow microfiltration.
[0274] Separation of solids and separation of the oil body phase
from the aqueous phase may also be carried out concomitantly using
gravity based separation methods or size exclusion based
methods.
[0275] The oil body preparations obtained at this stage in the
process are generally relatively crude and depending on the
application of the oil bodies, it may be desirable to remove
additional contaminants. Any process capable of removing additional
seed contaminants may be used in this regard. Conveniently the
removal of these contaminants from the oil body preparation may be
accomplished by resuspending the oil body preparation in an aqueous
phase and re-centrifuging the resuspended fraction, a process
referred to herein as "washing the oil bodies". The washing
conditions selected may vary depending on the desired purity of the
oil body fractions. For example where oil bodies are used in
pharmaceutical compositions, generally a higher degree of purity
may be desirable than when the oil bodies are used in food
preparations. The oil bodies may be washed one or more times
depending on the desired purity and the ionic strength, pH and
temperature may all be varied. Analytical techniques may be used to
monitor the removal of contaminants. For example SDS gel
electrophoresis may be employed to monitor the removal of seed
proteins.
[0276] The entire oil body isolation process may be performed in a
batch wise fashion or continuous flow. In a particular embodiment,
industrial scale continuous flow processes are utilized.
[0277] Through the application of these and similar techniques the
skilled artisan is able to obtain oil bodies from any cell
comprising oil bodies. The skilled artisan will recognize that
generally the process will vary somewhat depending on the cell type
that is selected. However, such variations may be made without
departing from the scope and spirit of the present invention.
[0278] Association of the First and/or Second Recombinant
Polypeptides, Multimeric-protein-complexes,
Heteromultimeric-protein-complexes, Multimeric-fusion-proteins,
Heteromultimeric-fusion-proteins, Immunoglobulins,
Immunoglobulin-polypeptide-chains, Redox-fusion-polypeptides, the
First and/or Second Thioredoxin-related Proteins with Oil
Bodies
[0279] In accordance with the present invention, the oil bodies are
associated with either the first and/or second recombinant
polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, the
first and/or second thioredoxin-related proteins through
association with an oil-body-targeting-protein capable of
association with these multimeric-protein-complexes and the oil
bodies. As used herein the phrase "associating the oil bodies with
the multimeric-protein-complex" means that the oil bodies are
brought in proximity of the multimeric-protein-complexes in a
manner that allows the association of the oil bodies with either
the first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins. The association of the oil bodies
with the multimeric-protein-complexes is accomplished by
association of the oil-body-targeting-protein with both the oil
body and with the multimeric-protein-complex. In particular
embodiments, the cells expressing the multimeric-protein-complex
associate with the oil bodies that are obtainable from these same
cells, which permits the convenient production and isolation of the
multimeric-protein-complex, including the first and/or second
recombinant polypeptides, heteromultimeric-protein-co- mplexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins, in an oil body-comprising host cell
system. Accordingly, in one embodiment, the association of the oil
body with the multimeric-protein-complex is accomplished
intracellularly during the growth of the cell. For example, a redox
fusion polypeptide may be fused to an oil-body-protein and the
chimeric protein may be expressed in oil body-containing plant
seeds. Isolation of the oil bodies from the seeds in this case
results in isolation of oil bodies comprising either the first
and/or second recombinant polypeptides,
multimeric-protein-complexe- s, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins. In another embodiment, in which the
multimeric-protein-complex associates with oil bodies obtainable
from the same cells in which the complex is produced, the
association of the oil bodies with the multimeric-protein-complex
is accomplished upon disrupting the cell's integrity, for example
in embodiments of the present invention where plant seeds are used
upon grinding these plant seeds.
[0280] For example, the first and/or second recombinant
polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-complexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins may be
expressed in such a manner that it is targeted to the endomembrane
system of the seed cells. Oil bodies present in the same seed cells
comprising an oil-body-targeting-protein capable of association
with these multimeric-protein-complexes, for example an oleosin
linked to a single chain antibody capable of association with a
recombinant polypeptide or multimeric-protein-complex, may then
associate with the recombinant polypeptide or
multimeric-protein-complex upon grinding of the seed.
[0281] In accordance with this embodiment, plant seed cells
comprising a light and heavy chain of an immunoglobulin targeted to
the plant apoplast can be prepared. These particular seed cells are
prepared to further comprise oil bodies associated with an
oil-body-targeting-protein capable of association with the
immunoglobulin, such as for example, an oleosin-protein A fusion
protein, and the like. Upon grinding of the seed, the oil bodies
comprising protein A associate with the immunoglobulin through
binding.
[0282] In yet another embodiment, the oil bodies used to associate
with the multimeric-protein-complex are obtained from a cellular
source different from the cell comprising the first and/or second
recombinant polypeptides, multimeric-protein-complexes,
heteromultimeric-protein-comp- lexes, multimeric-fusion-proteins,
heteromultimeric-fusion-proteins, immunoglobulins,
immunoglobulin-polypeptide-chains, redox-fusion-polypeptides, or
the first and/or second thioredoxin-related proteins, such as from
a separate plant line. For example, oil bodies associated with
protein A may be prepared from one plant line. These oil bodies may
then be mixed with ground seeds comprising an apoplastically
expressed light and heavy chain constituting an immunoglobulin.
Alternatively, a plant line comprising oil bodies associated with
protein A may be crossed with a plant line comprising an
immunoglobulin.
[0283] The first recombinant polypeptide, second recombinant
polypeptide and oil-body-targeting-protein may also be prepared in
separate cellular compartments. Association of the first
polypeptide, second polypeptide, and oil body then may occur upon
disruption of the cell's integrity. For example, various mechanisms
for targeting gene products are known to exist in plants, and the
sequences controlling the functioning of these mechanisms have been
characterized in some detail. For example, the targeting of gene
products to the chloroplast is controlled by a transit sequence
found at the amino terminal end of various proteins which is
cleaved during chloroplast import to yield the mature protein
(Comai et al. (1988) J Biol Chem 263: 15104-15109). Other gene
products are localized to other organelles such as the
mitochondrion and the peroxisome (Unger et al. (1989) Plant Mol
Biol 13:411-418). The cDNAs encoding these products can be
manipulated to target heterologous gene products to these
organelles. In addition, sequences have been characterized which
cause the targeting of gene products to other cell compartments.
Amino terminal sequences are responsible for targeting to the ER,
the apoplast, and extracellular secretion from aleurone cells
(Koehler & Ho (1990) Plant Cell 2:769-783). Additionally, amino
terminal sequences in conjunction with carboxy terminal sequences
are responsible for vacuolar targeting of gene products (Shinshi et
al., (1990) Plant Mol Biol 14:357-368). By the fusion of the
appropriate targeting sequences described above to transgene
sequences of interest it is possible to direct the transgene
product to the desired organelle or cell compartment.
[0284] As hereinbefore mentioned, the redox protein obtained using
the methods provided herein is enzymatically active while
associated with the oil body. Preferably the redox protein is at
least 5 times more active when produced as a redox fusion
polypeptide with a second redox protein relative to its production
in association with an oil body as a non-fusion polypeptide (i.e.
without the second redox protein). More preferably the redox
protein is at least 10 times more active when produced as a redox
fusion polypeptide.
[0285] The activity of the redox fusion polypeptide may be
determined in accordance with methodologies generally known to the
art (see for example: Johnson et al (1984) J. of Bact. Vol. 158
3:1061-1069) and may be optimized by for example the addition of
detergents, including ionic and non-ionic detergents.
[0286] Formulation of Oil Bodies
[0287] In accordance with a particular embodiment, the oil bodies
comprising the first and/or second recombinant polypeptides,
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides, or the first and/or second
thioredoxin-related proteins, are preferably formulated into an
emulsion. The emulsion is preferably used in the preparation of a
pharmaceutical composition, personal care or a food product. In
emulsified form, the oil body offers certain desirable properties,
such as for example excellent compatibility with the human
skin.
[0288] It particular embodiments, the oil body formulation is
stabilized so that a final product may be obtained which may be
stored and preserved for longer periods of time. As used herein,
the term "stabilized oil body preparation" refers to an oil body
preparation that is prepared so that the formulation does not
undergo undesirable physical or chemical alterations when the oil
body preparation is stored. The stabilization requirements may vary
depending on the final product. For example personal care products
are preferably stable for at least one year at room temperature
while additionally being able to withstand short temperature
fluctuations. Pharmaceutical formulations may in some cases be less
stable as they may be stored at lower temperatures thereby
preventing the occurrence of undesirable reactions.
[0289] In general, stabilization techniques that may be used herein
include any and all methods for the preservation of biological
material including the addition of chemical agents, temperature
modulation based methodologies, radiation-based technologies and
combinations thereof. In particular embodiments small amounts of
stabilizing chemical agents are mixed with the oil body formulation
to achieve stabilization. These chemical agents include inter alia
preservatives, antioxidants, acids, salts, bases, viscosity
modifying agents, emulsifiers, gelling agents and mixtures thereof
and may all be used to stabilize the oil body preparation. In view
of the presence of the redox fusion polypeptide or immunoglobulin
the stabilizing agent is generally selected to be compatible with
and resulting in good enzymatic function of the redox fusion
polypeptide or immunoglobulin function.
[0290] Diagnostic parameters to assess the stability of the oil
body preparation may be as desired and include all parameters
indicative of undesirable qualitative or quantitative changes with
respect to chemical or physical stability. Typical parameters to
assess the oil body preparation over time include color, odor,
viscosity, texture, pH and microbial growth, and enzymatic
activity.
[0291] In particular embodiments, the oil body formulation is
stabilized prior to the addition of further ingredients that may be
used to prepare the final product. However, in other embodiments,
it is nevertheless possible to formulate the final formulation
using non-stabilized oil bodies and stabilize the final
formulation. The final preparations may be obtained using one or
more additional ingredients and any formulation process suitable
for the preparation of a formulation comprising oil bodies.
Ingredients and processes employed will generally vary depending on
the desired use of the final product, will be art recognized and
may be as desired. Ingredients and processes that may be used
herein include those described in US Patents (U.S. Pat. Nos.
6,146,645 and 6,183,762) which are incorporated by reference
herein.
[0292] In particular embodiments, the redox fusion polypeptide
comprises a thioredoxin and a thioredoxin-reductase. Accordingly,
provided herein are oil bodies comprising a
thioredoxin/thioredoxin-reductase fusion polypeptide. Also provided
herein is a formulation containing oil bodies comprising a
thioredoxin/thioredoxin-reductase fusion capable of treating or
protecting a target against oxidative stress. The stress of the
target is treated or prevented by contacting the target with the
formulation. The target may be any substance susceptible to
oxidative stress, including any molecule, molecular complex, cell,
tissue or organ.
[0293] In another embodiment, provided herein is a formulation
containing oil bodies comprising a
thioredoxin/thioredoxin-reductase fusion capable of chemically
reducing a target. Contacting the target with the formulation
reduces the target. The target may be any substance susceptible to
reduction, including any molecule or molecular complex.
Particularly susceptible targets in this regard are the disulfide
bonds present in proteins.
[0294] The oil bodies comprising thioredoxin/thioredoxin-reductase
may be used to prepare formulations used to reduce the
allergenicity of food or increase the digestibility of food.
Preferably, the method of reducing the food allergenicity is
practiced by mixing the thioredoxin/thioredoxin- -reductase
comprising oil bodies with food or food ingredients selected from a
variety of sources including for example wheat flour, wheat dough,
milk, cheese, soya, yogurt and ice cream. The
thioredoxin/thioredoxin-red- uctase comprising oil bodies may also
be used to increase the digestibility of milk as well as other
disulfide containing proteins (Jiao, J. et al. (1992) J. Agric.
Food Chem 40: 2333-2336). Further food applications include the use
of the oil thioredoxin/thioredoxin-reductase comprising oil bodies
as a food additive to enhance dough strength and bread quality
properties (Wong et al., (1993) J. Cereal Chem. 70: 113-114;
Kobrehel et al. (1994) Gluten Proteins: Association of Cereal
Research; Detmold, Germany).
[0295] Also provided herein are pharmaceutical compositions
comprising, in a pharmaceutically active carrier: oil bodies
comprising a thioredoxin/thioredoxin-reductase; oil bodies
comprising multimeric-protein-complexes, such as
heteromultimeric-protein-complexes; isolated
thioredoxin/thioredoxin-reductase fusion proteins; or isolated
multimeric-protein-complexes. These pharmaceutical compositions may
be used for the treatment of reperfusion injury (Aota et al. (1996)
J. Cardiov. Pharmacol. (1996) 27: 727-732), cataracts (U.S. Pat.
No. 4,771,036), chronic obstructive pulmonary disease (COPD)
(MacNee et al. (1999) Am. J. Respir. Crit. Care Med. 160:S58-S65),
diabetes (Hotta et al. J. Exp. Med. 188: 1445-1451), envenomation
(PCT Patent Application 99/20122; U.S. Pat. No. 5,792,506),
bronchiopulmonary disease (MacNee (2000) Chest 117:3035-3175);
malignancies (PCT Patent Application 91/04320) and the alleviation
of the allergenic potential of airborne, for example
pollen-derived, and contact allergens (PCT Patent Application
00/44781). Other diseases or conditions that may be treated with
the pharmaceutical compositions provided herein include: psoriasis,
wound healing, sepsis, GI bleeding, intestinal bowel disease (IBD),
ulcers, transplantation, GERD (gastro esophageal reflux
disease).
[0296] The pharmaceutical compositions provided herein are
preferably formulated for single dosage administration. The
concentrations of the compounds in the formulations are effective
for delivery of an amount, upon administration, that is effective
for the intended treatment. Typically, the compositions are
formulated for single dosage administration. To formulate a
composition, the weight fraction of a compound or mixture thereof
is dissolved, suspended, dispersed or otherwise mixed in a selected
vehicle at an effective concentration such that the treated
condition is relieved or ameliorated. Pharmaceutical carriers or
vehicles suitable for administration of the compounds provided
herein include any such carriers known to those skilled in the art
to be suitable for the particular mode of administration.
[0297] In addition, the compounds may be formulated as the sole
pharmaceutically active ingredient in the composition or may be
combined with other active ingredients. Liposomal suspensions,
including tissue-targeted liposomes, may also be suitable as
pharmaceutically acceptable carriers. These may be prepared
according to methods known to those skilled in the art. For
example, liposome formulations may be prepared as described in U.S.
Pat. No. 4,522,811.
[0298] The active compound is included in the pharmaceutically
acceptable carrier in an amount sufficient to exert a
therapeutically useful effect in the absence of undesirable side
effects on the patient treated. The therapeutically effective
concentration may be determined empirically by testing the
compounds in known in vitro and in vivo systems, such as the assays
provided herein.
[0299] The concentration of active compound in the drug composition
will depend on absorption, inactivation and excretion rates of the
active compound, the physicochemical characteristics of the
compound, the dosage schedule, and amount administered as well as
other factors known to those of skill in the art.
[0300] Typically a therapeutically effective dosage is
contemplated. The amounts administered may be on the order of 0.001
to 1 mg/ml, preferably about 0.005-0.05 mg/ml, more preferably
about 0.01 mg/ml, of blood volume. Pharmaceutical dosage unit forms
are prepared to provide from about 1 mg to about 1000 mg and
preferably from about 10 to about 500 mg, more preferably about
25-75 mg of the essential active ingredient or a combination of
essential ingredients per dosage unit form. The precise dosage can
be empirically determined.
[0301] The active ingredient may be administered at once, or may be
divided into a number of smaller doses to be administered at
intervals of time. It is understood that the precise dosage and
duration of treatment is a function of the disease being treated
and may be determined empirically using known testing protocols or
by extrapolation from in vivo or in vitro test data. It is to be
noted that concentrations and dosage values may also vary with the
severity of the condition to be alleviated. It is to be further
understood that for any particular subject, specific dosage
regimens should be adjusted over time according to the individual
need and the professional judgment of the person administering or
supervising the administration of the compositions, and that the
concentration ranges set forth herein are exemplary only and are
not intended to limit the scope or use of the claimed compositions
and combinations containing them.
[0302] Preferred pharmaceutically acceptable derivatives include
acids, salts, esters, hydrates, solvates and prodrug forms. The
derivative is typically selected such that its pharmacokinetic
properties are superior to the corresponding neutral compound.
[0303] Thus, effective concentrations or amounts of one or more of
the compounds provided herein or pharmaceutically acceptable
derivatives thereof are mixed with a suitable pharmaceutical
carrier or vehicle for systemic, topical or local administration to
form pharmaceutical compositions. Compounds are included in an
amount effective for ameliorating or treating the disorder for
which treatment is contemplated. The concentration of active
compound in the composition will depend on absorption,
inactivation, excretion rates of the active compound, the dosage
schedule, amount administered, particular formulation as well as
other factors known to those of skill in the art. Solutions or
suspensions used for parenteral, intradermal, subcutaneous, or
topical application can include any of the following components: a
sterile diluent, such as water for injection, saline solution,
fixed oil, polyethylene glycol, glycerine, propylene glycol or
other synthetic solvent; antimicrobial agents, such as benzyl
alcohol and methyl parabens; antioxidants, such as ascorbic acid
and sodium bisulfite; chelating agents, such as
ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates,
citrates and phosphates; and agents for the adjustment of tonicity
such as sodium chloride or dextrose. Parenteral preparations can be
enclosed in ampules, disposable syringes or single or multiple dose
vials made of glass, plastic or other suitable material. In
instances in which the compounds exhibit insufficient solubility,
methods for solubilizing compounds may be used. Such methods are
known to those of skill in this art, and include, but are not
limited to, using cosolvents, such as dimethylsulfoxide (DMSO),
using surfactants, such as Tween.RTM., or dissolution in aqueous
sodium bicarbonate. Derivatives of the compounds, such as prodrugs
of the compounds may also be used in formulating effective
pharmaceutical compositions. For ophthalmic indications, the
compositions are formulated in an ophthalmically acceptable
carrier. For the ophthalmic uses herein, local administration,
either by topical administration or by injection is preferred. Time
release formulations are also desirable. Typically, the
compositions are formulated for single dosage administration, so
that a single dose administers an effective amount.
[0304] Upon mixing or addition of the compound with the vehicle,
the resulting mixture may be a solution, suspension, emulsion or
other composition. The form of the resulting mixture depends upon a
number of factors, including the intended mode of administration
and the solubility of the compound in the selected carrier or
vehicle. If necessary, pharmaceutically acceptable salts or other
derivatives of the compounds are prepared.
[0305] The compound is included in the pharmaceutically acceptable
carrier in an amount sufficient to exert a therapeutically useful
effect in the absence of undesirable side effects on the patient
treated. It is understood that number and degree of side effects
depends upon the condition for which the compounds are
administered. For example, certain toxic and undesirable side
effects are tolerated when treating life-threatening illnesses that
would not be tolerated when treating disorders of lesser
consequence.
[0306] The compounds can also be mixed with other active materials,
that do not impair the desired action, or with materials that
supplement the desired action known to those of skill in the art.
The formulations of the compounds and agents for use herein include
those suitable for oral, rectal, topical, inhalational, buccal
(e.g., sublingual), parenteral (e.g., subcutaneous, intramuscular,
intradermal, or intravenous), transdermal administration or any
route. The most suitable route in any given case will depend on the
nature and severity of the condition being treated and on the
nature of the particular active compound which is being used. The
formulations are provided for administration to humans and animals
in unit dosage forms, such as tablets, capsules, pills, powders,
granules, sterile parenteral solutions or suspensions, and oral
solutions or suspensions, and oil-water emulsions containing
suitable quantities of the compounds or pharmaceutically acceptable
derivatives thereof. The pharmaceutically therapeutically active
compounds and derivatives thereof are typically formulated and
administered in unit-dosage forms or multiple-dosage forms.
Unit-dose forms as used herein refers to physically discrete units
suitable for human and animal subjects and packaged individually as
is known in the art. Each unit-dose contains a predetermined
quantity of the therapeutically active compound sufficient to
produce the desired therapeutic effect, in association with the
required pharmaceutically acceptable carrier, vehicle or diluent.
Examples of unit-dose forms include ampoules and syringes and
individually packaged tablets or capsules. Unit-dose forms may be
administered in fractions or multiples thereof. A multiple-dose
form is a plurality of identical unit-dosage forms packaged in a
single container to be administered in segregated unit-dose form.
Examples of multiple-dose forms include vials, bottles of tablets
or capsules or bottles of pints or gallons. Hence, multiple dose
form is a multiple of unit-doses which are not segregated in
packaging.
[0307] The composition can contain along with the active
ingredient: a diluent such as lactose, sucrose, dicalcium
phosphate, or carboxymethylcellulose; a lubricant, such as
magnesium stearate, calcium stearate and talc; and a binder such as
starch, natural gums, such as gum acaciagelatin, glucose, molasses,
polvinylpyrrolidine, celluloses and derivatives thereof, povidone,
crospovidones and other such binders known to those of skill in the
art. Liquid pharmaceutically administrable compositions can, for
example, be prepared by dissolving, dispersing, or otherwise mixing
an active compound as defined above and optional pharmaceutical
adjuvants in a carrier, such as, for example, water, saline,
aqueous dextrose, glycerol, glycols, ethanol, and the like, to
thereby form a solution or suspension. If desired, the
pharmaceutical composition to be administered may also contain
minor amounts of nontoxic auxiliary substances such as wetting
agents, emulsifying agents, or solubilizing agents, pH buffering
agents and the like, for example, acetate, sodium citrate,
cyclodextrine derivatives, sorbitan monolaurate, triethanolamine
sodium acetate, triethanolamine oleate, and other such agents.
Methods of preparing such dosage forms are known, or will be
apparent, to those skilled in this art (see, e.g., Remington's
Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.,
15th. Edition, 1975). The composition or formulation to be
administered will contain a quantity of the active compound in an
amount sufficient to alleviate the symptoms of the treated
subject.
[0308] Dosage forms or compositions containing active ingredient in
the range of 0.005% to 100% with the balance made up from non-toxic
carrier may be prepared. For oral administration, the
pharmaceutical compositions may take the form of, for example,
tablets or capsules prepared by conventional means with
pharmaceutically acceptable excipients such as binding agents
(e.g., pregelatinized maize starch, polyvinyl pyrrolidone or
hydroxypropyl methylcellulose); fillers (e.g., lactose,
microcrystalline cellulose or calcium hydrogen phosphate);
lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets may be
coated by methods well-known in the art.
[0309] The pharmaceutical preparation may also be in liquid form,
for example, solutions, syrups or suspensions, or may be presented
as a drug product for reconstitution with water or other suitable
vehicle before use. Such liquid preparations may be prepared by
conventional means with pharmaceutically acceptable additives such
as suspending agents (e.g., sorbitol syrup, cellulose derivatives
or hydrogenated edible fats); emulsifying agents (e.g., lecithin or
acacia); non-aqueous vehicles (e.g., almond oil, oily esters, or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid).
[0310] Formulations suitable for rectal administration are
preferably presented as unit dose suppositories. These may be
prepared by admixing the active compound with one or more
conventional solid carriers, for example, cocoa butter, and then
shaping the resulting mixture.
[0311] Formulations suitable for topical application to the skin or
to the eye preferably take the form of an ointment, cream, lotion,
paste, gel, spray, aerosol and oil. Carriers which may be used
include vaseline, lanoline, polyethylene glycols, alcohols, and
combinations of two or more thereof. The topical formulations may
further advantageously contain 0.05 to 15 percent by weight of
thickeners selected from among hydroxypropyl methyl cellulose,
methyl cellulose, polyvinylpyrrolidone, polyvinyl alcohol, poly
(alkylene glycols), poly/hydroxyalkyl, (meth)acrylates or
poly(meth)acrylamides. A topical formulation is often applied by
instillation or as an ointment into the conjunctival sac. It can
also be used for irrigation or lubrication of the eye, facial
sinuses, and external auditory meatus. It may also be injected into
the anterior eye chamber and other places. The topical formulations
in the liquid state may be also present in a hydrophilic
three-dimensional polymer matrix in the form of a strip, contact
lens, and the like from which the active components are
released.
[0312] For administration by inhalation, the compounds for use
herein can be delivered in the form of an aerosol spray
presentation from pressurized packs or a nebulizer, with the use of
a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide
or other suitable gas. In the case of a pressurized aerosol, the
dosage unit may be determined by providing a valve to deliver a
metered amount. Capsules and cartridges of, e.g., gelatin, for use
in an inhaler or insulator may be formulated containing a powder
mix of the compound and a suitable powder base such as lactose or
starch.
[0313] Formulations suitable for buccal (sublingual) administration
include, for example, lozenges containing the active compound in a
flavored base, usually sucrose and acacia or tragacanth; and
pastilles containing the compound in an inert base such as gelatin
and glycerin or sucrose and acacia.
[0314] The compounds may be formulated for parenteral
administration by injection, e.g., by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form, e.g., in ampules or in multi-dose containers, with an
added preservative. The compositions may be suspensions, solutions
or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents. Alternatively, the active ingredient may be in
powder form for reconstitution with a suitable vehicle, e.g.,
sterile pyrogen-free water or other solvents, before use.
[0315] Formulations suitable for transdermal administration may be
presented as discrete patches adapted to remain in intimate contact
with the epidermis of the recipient for a prolonged period of time.
Such patches suitably contain the active compound as an optionally
buffered aqueous solution of, for example, 0.1 to 0.2 M
concentration with respect to the active compound. Formulations
suitable for transdermal administration may also be delivered by
iontophoresis (see, e.g., Pharmaceutical Research 3 (6), 318
(1986)) and typically take the form of an optionally buffered
aqueous solution of the active compound.
[0316] The pharmaceutical compositions may also be administered by
controlled release means and/or delivery devices (see, e.g., in
U.S. Pat. Nos. 3,536,809; 3,598,123; 3,630,200; 3,845,770;
3,847,770; 3,916,899; 4,008,719; 4,687,610; 4,769,027; 5,059,595;
5,073,543; 5,120,548; 5,354,566; 5,591,767; 5,639,476; 5,674,533
and 5,733,566).
[0317] Desirable blood levels may be maintained by a continuous
infusion of the active agent as ascertained by plasma levels. It
should be noted that the attending physician would know how to and
when to terminate, interrupt or adjust therapy to lower dosage due
to toxicity, or bone marrow, liver or kidney dysfunctions.
Conversely, the attending physician would also know how to and when
to adjust treatment to higher levels if the clinical response is
not adequate (precluding toxic side effects).
[0318] The efficacy and/or toxicity of the pharmaceutical
compositions provided herein, alone or in combination with other
agents can also be assessed by the methods known in the art (See
generally, O'Reilly, Investigational New Drugs, 15:5-13
(1997)).
[0319] The active compounds or pharmaceutically acceptable
derivatives may be prepared with carriers that protect the compound
against rapid elimination from the body, such as time release
formulations or coatings.
[0320] Kits containing the compositions and/or the combinations
with instructions for administration thereof are provided. The kit
may further include a needle or syringe, preferably packaged in
sterile form, for injecting the complex, and/or a packaged alcohol
pad. Instructions are optionally included for administration of the
active agent by a clinician or by the patient. Finally, the
pharmaceutical compositions provided herein containing any of the
preceding agents may be packaged as articles of manufacture
containing packaging material, a compound or suitable derivative
thereof provided herein, which is effective for treatment of a
diseases or disorders contemplated herein, within the packaging
material, and a label that indicates that the compound or a
suitable derivative thereof is for treating the diseases or
disorders contemplated herein. The label can optionally include the
disorders for which the therapy is warranted. Also provided herein
are personal care formulations containing oil bodies comprising a
thioredoxin/thioredoxin-reductase fusion polypeptide or a
multimeric immunoglobulin. Personal care products comprising
thioredoxin and thioredoxin-reductase are disclosed in for example
Japanese Patent Applications JP9012471A2, JP103743A2, and
JP1129785A2. Personal care formulations that may be prepared in
accordance with the present invention include formulations capable
of improving the physical appearance of skin exposed to detrimental
environmental stimuli resulting in oxidative stress for example
oxidative stress caused by UV-generated free-radicals. The oil
bodies comprising thioredoxin/thioredoxin-reductase may also be
used to prepare hair care products as described in U.S. Pat. Nos.
4,935,231 and 4,973,475 (incorporated herein by reference in their
entirety). The personal care formulations comprising multimeric
immunoglobulins that may be prepared in accordance with the present
invention, include formulations to treat acne, liver spots, skin
aging and the like.
[0321] Oil Bodies as Vehicles to Isolate Multimeric Recombinant
Protein Complexes
[0322] Once the oil bodies comprising the
multimeric-protein-complexes, heteromultimeric-protein-complexes,
multimeric-fusion-proteins, heteromultimeric-fusion-proteins,
immunoglobulins, immunoglobulin-polypeptide-chains,
redox-fusion-polypeptides have been isolated, the
multimeric-protein-complexes may be separated from the oil bodies.
In embodiments of the invention in which the oil bodies are
associated with the multimeric-protein-complexes in a non-covalent
manner such a separation may be accomplished by eluting the
multimeric-protein-complexes from the oil bodies using an
appropriate elution buffer. The multimeric-protein-complexes may
then conveniently be separated from the oil bodies by density
centrifugation or any other methodology allowing separation of the
oil bodies from the multimeric protein complex. In this manner
immunoglobulins associated with oil bodies through for example
Protein A, may be separated from the oil bodies. In embodiments of
the invention in which the multimeric protein complex is covalently
associated with the oil body--either through covalent association
of the first recombinant polypeptide or the second recombinant
polypeptide, or both the first and second recombinant
polypeptide--the covalent linkage may be designed to be sensitive
to cleavage by a chemical or enzymatic cleavage agent. Application
of the cleavage agent results in breaking of the linkage between
the oil bodies and multimeric protein complexes. As above,
separation of the multimeric-protein-complex from the oil bodies
may be accomplished using for example density centrifugation. The
isolated multimeric-protein-compl- exes may be used in accordance
with applications for such complexes known to those skilled in the
art.
[0323] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
EXAMPLE 1
[0324] Production of Multimeric Immunoglobulin Protein in Plant
Seed Cells and Capture on Oil Bodies Using Protein A--oleosin
Fusion Proteins
[0325] 1+ Production of Multimeric Immunoglobulin Protein in Plant
Seed Cells
[0326] For expression of multimeric-protein-complexes containing
multimeric-immunoglobulin-complexes, the cDNA sequences encoding
individual light and heavy chains can be isolated from; 1) cell
lines expressing a particular antibody, such as clonal B cell
lines, or a hybridoma cell line, or 2) may be a recombinant
antibody, assembled by combining select light and heavy chain
variable domains and available light and heavy chain constant
domain sequences, respectively. Variable domains with specific
binding properties may be isolated from screening populations of
such sequences, usually in the form of a single-chain Fv phage
display library.
[0327] Starting from known nucleic acid sequences and a source of
light and heavy chains, the mature polypeptide coding sequences of
each chain is isolated with a secretion signal sequence. The signal
sequence can be the native antibody sequence or derived from a
known secreted plant sequence (e.g. a PR sequence from Arabidopsis
or tobacco). The addition of a plant secretion signal sequence to
both light and heavy chain mature coding sequences is carried out
by standard molecular biology techniques. PCR fusion is used
routinely to make such modifications. Secretion signal sequences
are included to target the light and heavy immunoglobulin
polypeptides for secretion from the cell and further assembly of
the two chains into a multimeric-immunoglobulin-complex. For
expression in transgenic plant seeds, an expression cassette is
assembled comprising: 1) a regulatory promoter sequence to provide
expression in plant seeds, 2) the secretion signal-light chain
sequence, and 3) a regulatory sequence to terminate transcription.
A second expression cassette is assembled comprising: 1) a
regulatory promoter sequence to provide expression in plant seeds,
2) the secretion signal -heavy chain sequence, and 3) a regulatory
sequence to terminate transcription. Each of the antibody chain
expression cassettes is cloned individually into an Agrobacterium
plant transformation vector or is combined into a single
transformation vector with both expression cassettes. In both
cases, the expression cassettes are cloned into plant
transformation vectors, between the left and right delineating
border sequences, and adjacent to a plant selectable marker
cassette. Each plant transformation vector is transformed into
Agrobacterium. The resulting Agrobacterium strains are used to
infect plant tissues. Transgenic plant material is regenerated and
viable transgenic plants are selected. When individual
transformation vectors are used, the transgenic plant lines that
are produced, expressing either light or heavy chain sequences, are
crossed to generate a single plant line expressing both chains in
the same plant cell. When a single transformation vector,
containing both light and heavy expression cassettes, is used, the
initial transgenic plant line produces both light and heavy chain
sequences in the same plant cell.
[0328] 2+ Production of Transgenic Oil Bodies Which Display Protein
A for the Capture of Immunoglobulins
[0329] To capture and display immunoglobulin protein on oil bodies,
oil bodies are engineered to display an immunoglobulin binding
protein. In this example, the well-known antibody-binding domains
from Protein A are used. Based on the known sequence for Protein A
from Staphylococcus aureus, PCR primers are designed to isolate the
five consecutive Ig-binding domains from the bacterial Protein A
sequence. Primers are designed to allow cloning of the Protein A
sequence as either an N-terminal or C-terminal fusion to an oleosin
sequence for targeting to oil bodies. The sequence that encodes an
in-frame translational fusion between Protein A and oleosin is
cloned into a plant expression cassette for seed-specific
expression. The final cassette consists of a regulatory promoter
sequence that provides expression in seeds, the Protein A--oleosin
fusion sequence, and a regulatory sequence to terminate
transcription. The Protein A--oleosin expression cassette is cloned
into a plant transformation vector compatible with
Agrobacterium--mediated plant transformation. The transformation
vector comprises left and right border sequences flanking the
Protein A--oleosin expression cassette and an adjacent plant
selectable marker cassette. The Agrobacterium strain containing
this vector is used to infect plant tissues and subsequent
regeneration and selection from transgenic plant material to create
transgenic plants.
[0330] 3+ Capture and Display of Multimeric-immunoglobulins on Oil
Bodies Displaying Protein A
[0331] Having produced light and heavy chain multimeric
immunoglobulin complexes in one transgenic plant line and the
display of Protein A on oil bodies through the oil body targeting
of a Protein A--oleosin fusion protein in a second plant line, at
least two embodiments can be used to capture the immunoglobulin
complex on the Protein A oil bodies. In the first embodiment,
transgenic seed from both the immunoglobulin and the Protein
A--oleosin expression lines is combined in an optimum ratio and
then ground together such that the disrupted material from both
seed lines would be combined in the same extract. The combined seed
extracts are mixed and/or incubated under conditions that allow
maximum recovery of the immunoglobulin by Protein A. The oil body
fraction is separated using standard phase separation techniques
(e.g. centrifugation). The recovered oil body fraction contains
both native oil bodies, from the immunoglobulin expression line,
and transgenic Protein A oil bodies from the Protein A--oleosin
expression line.
[0332] In a second embodiment, the plant lines expressing the
immunoglobulin complex and the Protein A--oleosin fusion are
crossed and individual plant lines expressing both components are
identified and propagated. In this approach, the immunoglobulin
complex and the Protein A--oleosin fusion are produced in different
cellular compartments of the same plant seed cell. Seed from the
double transgenic line is ground to disrupt the cellular material
and mix the contents of all cellular compartments, including
combining the immunoglobulin in the extracellular compartment and
the Protein A--oleosin on the oil body in the cytosolic
compartment. The material is mixed and/or incubated under
conditions to allow maximum recovery of the immunoglobulin by
Protein A, and the oil body fraction is separated by phase
separation techniques. The recovered oil body fraction contains the
displayed Protein A and the capture immunoglobulin complex.
EXAMPLE 2
[0333] Production of Assembled Multimeric-immunoglobulin-complexess
as Fusions with Oil Body Targeting Domains
[0334] Individual polypeptides are produced as a fusion protein
with oil body targeting sequences (e.g. oleosin) for display on oil
bodies. It has been found that the individual subunits of naturally
associating heterodimeric proteins can be co-produced as individual
oleosin fusions and still associate as an active heterodimer on the
surface of the oil body. In this example, the heterodimer is the
light and heavy chain subunits, or derived portions thereof, of an
immunoglobulin complex.
[0335] Production of an Immunoglobulin Fab Complex on Oil
Bodies
[0336] The mature light chain sequence, lacking the secretion
signal sequence, is attached as an in-frame N-terminal fusion to an
oleosin sequence. This fusion sequence is assembled into a
seed-specific expression cassette consisting of a seed-specific
promoter sequence, the light chain--oleosin fusion sequence, and a
transcriptional terminator sequence. The expression cassette is
inserted between the left and right border markers, adjacent to a
plant selectable marker cassette, of a transformation vector. The
transformation vector, in Agrobacterium, is used to infect plants
and generate transgenic plants.
[0337] An equivalent construct for the heavy chain subunit,
comprising the variable and constant heavy chain domains, is also
attached as an in-frame fusion to oleosin and assembled into an
expression cassette for seed-specific expression. The expression
cassette can be a part of a separate transformation vector for the
generation of a separate transgenic line, or the heavy chain
expression cassette can be combined together with the light chain
cassette into a single transformation vector. If light and heavy
chain expression cassettes are transformed into plants on separate
transformation vectors, the individual plant lines are crossed to
create a single line expressing both heterodimer subunit--oleosin
fusions in the same plant cell. Seed from the double transgenic
line, or a single transgenic line generated from the dual
expression vector, is extracted to isolate oil bodies. The seed
material is ground to release the cellular contents and oil bodies
are isolated by phase separation. The targeting of both light and
heavy chain sequence to oil bodies, as oleosin fusions, allows the
association of the immunoglobulin complex on the surface of the oil
body.
[0338] Similar configurations, using the entire heavy chain
sequence in combination with the entire light chain sequence, or
using the variable domains from both the light and heavy chain
sequences, are constructed to assemble different types of
heteromultimeric-immunoglobulin-complexes (e.g., heterodimers) on
the surface of oil bodies.
EXAMPLE 3
[0339] To assemble immunoglobulin complexes on the surface of oil
bodies requires 1) the use of an oil body-binding domain (e.g.
anti-oleosin MAb or scFv) as part of the immunoglobulin complex
(EXAMPLE 3), or 2) the use of an immunoglobulin binding domain
attached to the surface of oil bodies (EXAMPLE 4).
[0340] Isolation of an Anti-Oleosin Monoclonal Antibody-Producing
Hybridoma Cell Line
[0341] To produce monoclonal antibodies (MAb) which specifically
bind to the oleosin protein on the surface of oil bodies, an
Arabidopsis oleosin cDNA sequence (Arabidopsis Stock Center; GI:
16928) was cloned into an expression vector for recombinant protein
production in E. coli. The oleosin coding sequence was selectively
amplified by a polymerase chain reaction (PCR) using primers #0013
(SEQ ID NO:1) and #0605 (SEQ ID NO:2) to engineer an NcoI site at
the translation initiation codon (ATG) and a HindIII site following
the translation termination codon (TAA), respectively.
2 Primer # 0013: 5' CGCGGATCCATGGCGGATACAGCTAGA 3' (SEQ ID NO:1)
(NcoI site underlined) Primer # 0605: 5' AAGCTTAAGTAGTGTGCTGGCCACC
3' (SEQ ID NO:2) (HindIII site underlined)
[0342] The oleosin PCR fragment was cloned and confirmed by DNA
sequencing. The oleosin sequence was then digested with NcoI and
HindIII, and cloned into the NcoI and HindIII sites of pRSET B
(Invitrogen) to create an E. coli expression vector. The vector is
designed to produce a peptide containing six tandem histidine
residues and a T7 epitope fused to the 5' end of the inserted
oleosin sequence. The pRSET B vector containing the Arabidopsis
oleosin sequence was transformed into the E. coli strain BL21(DE3)
containing an inducible T7 RNA polymerase gene. A confirmed clone
was grown in liquid media and induced to produce the recombinant
oleosin protein (Schoepfer R. (1993) Gene 14: 83-85; Kroll D. J. et
al (1993) DNA Cell. Biol. 12: 441-453). The oleosin protein was
produced as an insoluble aggregate in E. coli. The cell pellet was
collected by centrifugation, and the inclusion body fraction was
solubilized in SDS loading buffer and separated by preparative
SDS-PAGE. The gel strip containing the recombinant oleosin protein
was excised and the protein was electroeluted from the gel in
SDS-PAGE running buffer. The eluted oleosin protein was dialyzed
against a minimal amount of SDS to maintain solubility of the
oleosin protein. Using this material as the antigen for MAb
production, standard procedures were used to immunize mice and
recover hybridoma cell lines producing anti-oleosin monoclonal
antibodies (Antibodies: A Laboratory Manual. (1988) Harlow E. &
Lane D. Cold Spring Harbour Press). Several clones showed
specificity for the Arabidopsis oleosin when used in Western blots
to detect Arabidopsis seed extracts. Based on signal intensity and
specificity, the D9 clone was selected for further manipulation.
The D9 MAb was confirmed to bind to the surface of intact oil
bodies isolated from Arabidopsis seeds, a functional requirement
for its use as an oil body associating-sequence.
[0343] Primer Design for Isolating the D9 Heavy and Light Chain
Sequences
[0344] To isolate a cDNA copy of the complete D9 heavy and light
chain coding sequences from the D9 hybridoma cell line, the
variable regions of each chain were isolated using the Recombinant
Phage Antibody System (RPAS; Amersham Biosciences). The RPAS
protocols for reverse transcription (RT)-PCR were followed to
amplify the heavy variable and light variable domains from D9
hybridoma-derived mRNA. The DNA sequence of the cloned D9 heavy and
light chain variable domains was determined. Using a commercially
available kit, the isotype class of the D9 MAb chains was also
determined and found to be IgG1 and kappa for the heavy and light
chains, respectively. The isotype and variable domain sequence
information was used to determine more precisely the gene or gene
subgroup from which the D9 MAb arose. The known sequences for other
members of the same subgroup were then used to design primers
outside the known regions of the D9 sequence. This allowed the
complete coding sequence of the D9 heavy and light chains to be
isolated.
[0345] The D9 heavy chain variable sequence was used as a query to
search the Genbank database using the BLAST algorithm
(www.ncbi.nlm.nih.gov). Four entries with the strongest sequence
match to the D9 heavy variable domain, and that also contain
sequence encompassing the secretion signal peptide upstream of the
mature coding sequence, were selected for alignment (Genbank IDs
GI: 2791981, 195311, 195307, 195305). The small number of sequence
differences between D9 and the other four antibody sequences
suggested that D9 also arose from the same germline sequence. The
secretion signal sequences for all four antibodies were identical.
Therefore a single specific forward primer was designed to this
region (#1020--SEQ ID NO:3). Since the D9 heavy chain was
identified as an IgG1 isotype, mouse sequences encoding the IgG1
C-terminal constant domain (GI: 1513181, 861030) were used to
design a single specific reverse primer downstream of the coding
sequence termination codon (#1021--SEQ ID NO:4).
3 Primer # 1020: 5' CTGTCAGTAACTGCAGGTGTC 3' (SEQ ID NO:3) Primer #
1021: 5' GTAGGTGTCAGAGTCCTGTAG 3' (SEQ ID NO:4)
[0346] A Genbank database search using the D9 light chain variable
sequence as a BLAST query identified four sequences with strong
identity and which also included sequence upstream encoding the
secretion signal peptide (GI: 2906115, 286098, 286086, 5327121).
Within the aligned variable regions a number of base differences
were apparent, therefore instead of a single specific primer, a
degenerate primer sequence was used with broader specificity for
the light chain subgroup I family of sequences (#1022 (SEQ ID
NO:5); Chards T. et al (1999) FEBS Letters 452: 386-394). Based on
the identification of the D9 light chain as a kappa isotype, the
mouse germline sequence encoding the kappa C-terminal constant
domain (GI: 51657) was used to design a specific reverse primer
downstream of the coding sequence termination codon (#1023 (SEQ ID
NO:6)).
4 Primer # 1022: 5' TCTGGGTATCTGGTRCSTGTG 3' (SEQ ID NO:5) Primer #
1023: 5' GCAACAGTGGTAGGTCGCTTG 3' (SEQ ID NO:6)
[0347] Isolation of Anti-Oleosin D9 Monoclonal Antibody Heavy and
Light Chain cDNA Sequences and Construction of a Dual Expression
Transformation Vector
[0348] The mouse hybridoma cell line expressing the D9 monoclonal
antibody was used as the source of RNA for the D9 heavy and light
chain sequences. Messenger RNA (mRNA) was isolated from the D9
hybridoma cell line using the QuickPrep Micro mRNA Purification kit
(Amersham Biosciences). RT-PCR (Titan One Tube RT-PCR System; Roche
Applied Science) was carried out on the D9 hybridoma mRNA using
primers #1020 (SEQ ID NO:3) and #1021 (SEQ ID NO:4) or #1022 (SEQ
ID NO:5) and #1023 (SEQ ID NO:6) to amply the D9 IgG1 heavy chain
and kappa light chain sequences respectively. The D9 heavy and
light chain PCR products were each cloned into the pCR2.1 vector
(Invitrogen). The DNA sequence was determined for the insert in
each of the resulting clones (pSBS2801 heavy chain and pSBS2800
light chain). As the primers were designed outside the D9 heavy and
light chain coding sequences (for the purpose of obtaining complete
native coding sequence) removal of these extra sequences was
required for expression in plants. In addition, the partial mouse
secretion signal sequences present in each sequence was replaced
with a complete plant-derived secretion signal sequence.
[0349] Primers were designed and synthesized to selectively amplify
the mature protein coding sequence for each chain. These primers
were designed as part of a larger set, which when assembled by PCR
fusion (Sandhu G. S. et al (1992) BioTechniques 12:14-16), attached
a complete secretion signal sequence to the 5' end of both heavy
and light chain sequences. The secretion signal DNA sequences were
designed de novo but encode the secretion peptide of the tobacco
pathogenesis-related thaumatin-like protein (GI: 131017, 19857). In
addition, restriction enzyme sites were included 5' of the
secretion signal sequence and 3' of the coding sequence of each
chain to facilitate subsequent cloning. PCR of the heavy chain
sequence used pSBS2801 as a template and primers #1207 (SEQ ID
NO:7), #1208 (SEQ ID NO:8), #1209 (SEQ ID NO:9), #1210 (SEQ ID
NO:10) and #1211 (SEQ ID NO:11). PCR of the light chain sequence
used pSBS2800 as a template and primers #1202 (SEQ ID NO:12), #1203
(SEQ ID NO:13), #1204 (SEQ ID NO:14), #1205 (SEQ D NO:15) and #1206
(SEQ ID NO:16).
5 Primer # 1202: 5' GCGCCTCGAGATCTACCATGAACTTCCTCAAGT (SEQ ID
NO:12) CTTTC 3' (Xhol site underlined) Primer # 1203: 5'
GACCAAAGCAGAGAAAAGCATAAAACGGGAAAG (SEQ ID NO:13) ACTTGAGGAAGTTCAT
3' Primer # 1204: 5' GCTTTTCTCTGCTTTGGTCAGTATTTCGTCGCT (SEQ ID
NO:14) GTTACCCATGCT 3' Primer # 1205: 5'
GACTGTGTCATCACAATGTCAGCATGG- GTAACA (SEQ ID NO:15) GCGACG 3' Primer
# 1206: 5' GCGCAGATCTCGAGCTAACACTCATTCCTGTTG (SEQ ID NO:16) AAGC 3'
(Xhol site underlined) Primer # 1207: 5'
GCGCAGATCTAACATGAACTTTCTCAAGTCC (SEQ ID NO:7) 3' (BgIII site
underlined) Primer # 1208: 5' GTCCGAAACAGAGGAAAGCGTAGAATGGAAAGG
(SEQ ID NO:8) ACTTGAGAAAGTTCAT 3' Primer # 1209: 5'
GCTTTCCTCTGTTTCGGACAATACTTT- GTTGCT (SEQ ID NO:9) GTCACTCACGCT 3'
Primer # 1210: 5' GACTGCTGCAGGTGAACCTGAGCGTGAGTGACA (SEQ ID NO:10)
GCAAC 3' Primer # 1211: 5' GCGCAGATCTTCATTTACCAGGAGAGTGG 3' (SEQ ID
NO:11) (BgIII site underlined)
[0350] The assembled signal sequence--D9 heavy chain PCR product
was cloned into pCR2.1 (Invitrogen) to generate pSBS2803. The
assembled signal sequence--D9 light chain PCR product was cloned
into pCR2.1 to generate pSBS2802. To create the plant
transformation vector containing dual D9 heavy and light expression
cassettes, the signal sequence--D9 heavy chain was cut from
pSBS2803 with BgIII and cloned into the compatible BamHI site of
pSBS4014, between the phaseolin promoter and phaseolin terminator
regulatory elements, creating pSBS4800. The phaseolin promoter and
terminator gene regulatory elements are derived from the common
bean Phaseolus vulgaris (Slightom et al (1983) Proc. Natl. Acad.
Sci. 80: 1897-1901; Sengupta-Gopalan et al (1985) Proc. Natl. Acad.
Sci. USA 82: 3320-3324) and are used to achieve seed-specific over
expression. pSBS4014 was constructed by inserting a (PstI
MluI)--phaseolin promoter--(BamHI)--phaseolin terminator--(KpnI)
cassette into the PstI and KpnI sites of pSBS4004 (described
below).
[0351] The signal sequence--D9 light chain was cut from pSBS2802
with XhoI and cloned into the XhoI site of pSBS2808, between the
flax linin storage protein promoter and terminator sequences (see
patent WO 01/16340)), to create pSBS2810. These storage protein
regulatory elements are also used to achieve seed-specific over
expression. The linin promoter--secretion signal D9 light
chain--linin terminator cassette (SEQ ID NO:17) was excised from
pSBS2810 with the MluI sites flanking the cassette and cloned into
the MluI site upstream of the phaseolin D9 heavy chain cassette
(SEQ ID NO:18) in pSBS4800. The two heavy and light cassettes in
the final transformation vector pSBS4803 were in a divergent
orientation relative to direction of transcription for each
cassette.
[0352] The pSBS4803 transformation vector was electroporated into
Agrobacterium strain EHA101 (Hood et al (1986) J. Bacteriol. 168:
1291-1301). A confirmed Agrobacterium clone was used to transform
Arabidopsis. Arabidopsis transformation was done essentially as
described in "Arabidopsis Protocols: Methods in Molecular Biology"
Vol 82. (Edited by Martinez-Zapater J M and Salinas J. ISBN
0-89603-391-0 pg 259-266 (1998)) with the modification of selecting
putative transgenic plants on agarose plates containing 80 .mu.M
L-phosphinothricine. Plants which survived selection were
transplanted to soil and allowed to set seed.
[0353] Extraction of D9 Antibody Complexes Associated with Oil
bodies
[0354] A representative SBS4803 transgenic Arabidopsis line was
tested for association of the assembled D9 heavy and light chain
antibody complex with the surface of extracted oil bodies. The
behavior of mouse IgG1 antibody protein with no affinity for oil
bodies and anti-oleosin D9 mAb, produced and purified from the
original D9 hybridoma cell line, were analyzed as negative and
positive controls respectively.
[0355] Forty milligrams of non-transgenic wild type Arabidopsis C24
seed was ground in 150 ul of 50 mM sodium phosphate buffer pH 8.0.
The extract was centrifuged for 10 minutes at 4.degree. C. and the
oil body and soluble undernatant fractions were removed to a new
tube. The pellet was re-extracted with 100 ul of sodium phosphate
buffer. The tube was centrifuged at 4.degree. C. for 10 minutes,
and the oil body and soluble undernatant fraction was pooled with
the first equivalent fraction. The pooled oil body and soluble
undernatant fractions were centrifuged for 10 minutes at 4.degree.
C. and the oil body fraction was recovered and resuspended in 200
ul of sodium phosphate buffer. To equal aliquots of the oil bodies
was added 15 ug of either mouse IgG1 antibody (Sigma) or D9 MAb
purified from the hybridoma cell culture medium. The samples were
centrifuged and the undernatants were removed to a fresh tube. The
undernatants were clarified twice more by centrifugation before
SDS-PAGE. The oil body fractions were washed three times by
repeated centrifugation and resuspension in 200 ul of sodium
phosphate buffer. The final washed oil bodies and clarified
undernatants were solubilized in SDS loading buffer before analysis
be SDS-PAGE. Similar to the control treatments above, 20 mg of
transgenic SBS4803 seed was ground in 50 mM sodium phosphate buffer
pH 8.0 and centrifuged for 10 minutes at 4.degree. C. The soluble
undernatant was removed and clarified by two further centrifugation
steps to remove trace oil bodies. The first SBS4803 oil body
fraction was washed three times by repeat centrifugation and
resuspension in 200 ul of sodium phosphate buffer. The oil body and
undernatant samples were solubilized in SDS loading buffer before
SDS-PAGE analysis. The mouse IgG1 control antibody protein, when
added to wild type Arabidopsis oil body extracts, does not interact
with oil bodies and partitions with the undernatant fraction (FIG.
2). The anti-oleosin D9 mAb, purified from the original mouse
hybridoma cell line, partitions with the oil body fraction.
Extraction of the SBS4803 transgenic Arabidopsis seed shows the D9
mAb, produced and assembled within the seed, also associates with
the oil body fraction.
EXAMPLE 4
[0356] As described above for the mouse D9 antibody, standard
hybridoma techniques may be used to isolate antibody sequences for
MAbs which bind a wide range of different antigens. To assemble
antibody complexes on oil bodies, particularly for those antibodies
that do not bind directly to oil body-associated antigens, requires
the assembly to be mediated by an immunoglobulin-binding domain
attached to the surface of the oil body. In this example, the
IgG-binding domains of Protein A from Staphylococcus aureus are
attached to the surface of the oil body, to mediate the association
of immunoglobulin complexes on oil bodies. To make the
immunoglobulin complex compatible with Protein A binding, mouse MAb
sequences are converted to mouse/human chimeric sequences. The Fc
region of human IgG1, IgG2 and IgG4 immunoglobulin isotypes bind
strongly to Protein A, in contrast to the equivalent Fc region of
mouse IgG proteins. By replacing the mouse Fc region on the heavy
chain and the constant domains on both heavy and light chains with
the equivalent human sequences, a chimeric antibody complex can
assemble which now binds to Protein A.
[0357] Construction of a Dual Expression Transformation Vector for
the Production of an Assembled Chimeric Antibody
[0358] Additional mouse monoclonal antibodies, with affinity for
non-oil body related antigens, can be cloned from mouse hybridoma
cell lines following a procedure similar to that used for the D9
MAb. Following well defined procedures, the mouse heavy and light
chain variable domains can be fused to the constant domains from
human heavy and light chain sequences to generate chimeric
antibodies (Sahagan B. G. et al (1983) J. Immunol. 137: 1066-1074;
Hutzell P. et al (1991) Cancer Res. 51: 181-189).
[0359] The heavy and light chain sequences of a chimeric antibody
were both modified by PCR fusion to attach a secretion signal
sequence and flanking restriction enzyme sites for cloning
(described above for D9 MAb). The signal peptide--chimeric heavy
chain sequence in pSBS2819 was excised with BgIII and cloned into
the compatible BamHI site of pSBS4014 (described above) between the
phaseolin promoter and terminator sequences to create pSBS4807. The
signal peptide--chimeric light chain sequence in pSBS2820 was
excised with XhoI and cloned into the Xhol site between the linin
promoter and terminator in pSBS4013 to create pSBS4808. pSBS4013 is
equivalent to pSBS4014 but contains the (MluI)--linin
promoter--(XhoI)--linin terminator--(MluI) cassette upstream of the
phaseolin promoter--terminator sequence. The MluI fragment from
pSBS4808, containing the linin promoter--chimeric light
chain--linin terminator cassette, was cloned upstream of the
phaseolin promoter--chimeric heavy chain--phaseolin terminator
cassette in pSBS4807 to generate tandem dual expression vectors.
The clone with the two expression cassettes in a divergent
orientation is pSBS4809, and the clone with the expression
cassettes in a series configuration is pSBS4810.
[0360] The chimeric antibody transformation vectors pSBS4809 and
pSBS4810 were electroporated into Agrobacterium strain EHA101 (Hood
et al (1986) J. Bacteriol. 168: 1291-1301). The pSBS4810
Agrobacterium strain was used to transform Arabidopsis. Arabidopsis
transformation was done essentially as described in "Arabidopsis
Protocols: Methods in Molecular Biology" Vol 82. (Edited by
Martinez-Zapater J M and Salinas J. ISBN 0-89603-391-0 pg 259-266
(1998)) with the modification of selecting putative transgenic
plants on agarose plates containing 80 .mu.M L-phosphinothricine.
Plants surviving selection were transplanted to soil and allowed to
set seed.
[0361] Transgenic Arabidopsis seed from representative SBS4809
lines (#6 & #13) were analyzed for the co-production of
chimeric heavy and light chains and their assembly into a
immunoglobulin complex. Twenty five to thirty seeds of each line
were ground in 50 ul of 50 mM Tris-HCl buffer pH 7.6. An equal
volume (50 ul) of 2.times.SDS loading buffer, either with or
without the reducing agent (dithiothreitol, DTT) component
included, was added to each sample. The samples were heated and
clarified before SDS-PAGE. Wild type Arabidopsis C24 seed was
included as a negative control. Human IgG1 (Sigma) and purified
mouse D9 MAb were included as comparative controls (FIG. 3A). Two
additional replicate gels were electroblotted for Western blot
analysis (FIG. 3B). Detection with an anti-human IgG Fc (heavy
chain-specific) antibody indicated the production of the chimeric
heavy chain (reduced sample) and its association into a higher
molecular weight complex (nonreduced sample) comparable to the
mouse and human antibody controls. Detection with an anti-human
kappa-specific antibody indicated the production of the chimeric
light chain (reduced sample) and its association into a higher
molecular weight complex (nonreduced sample) comparable to the
mouse and human antibody controls.
[0362] Synthesis of a Protein A Coding Sequence for Enhanced
Expression in Plants
[0363] For enhanced expression of Protein A in plants, a DNA
sequence encoding the five tandem immunoglobulin (IgG)-binding
domains from the Protein A sequence of Staphylococcus aureus (aa
37-331; Uhlen M. et al (1984) J. Biol. Chem. 259: 1695-1702) was
designed and synthesized de novo. The 295 amino acid sequence,
encoding the IgG-binding domain repeats, was backtranslated using a
codon frequency table for Arabidopsis thaliana. The DNA sequence
resulting from the backtranslation was further analyzed and
modified. Sequence motifs, representing different potential RNA
processing signals (AATAAA, AATGGAA, AATGGA, AATGAA, TATAAA,
AATAAT, ATTTA, GTAAAA, GTAAGT, GTACGT, GCAG), within the
backtranslated DNA coding sequence were identified. Where possible,
each motif was eliminated. This was done by changing the sequence
within a motif without modifying the Protein A coding potential of
the overall sequence. These "silent" DNA changes were made by
selecting alternate amino acid codons for any codon overlapping a
motif. Alternate codons were selected only if; 1) they encoded the
same amino acid, 2) they did not create a tandem duplication with
adjacent codons, and 3) they introduced a DNA base change which
reduced the identity with the original motif. The process of
searching for and eliminating motifs was repeated until remaining
motifs could not be eliminated without altering the encoded amino
acid sequence. The final DNA sequence was theoretically translated
and shown to encode a protein with 100% amino acid identity to the
five IgG-binding domains of Staphylococcus aureus Protein A (FIG.
4).
[0364] To synthesize the DNA sequence designed by the process
described above, sixteen overlapping primers (#1184 (SEQ ID NO:19),
#1185 (SEQ ID NO:20), #1186 (SEQ ID NO:21), #1187 (SEQ ID NO:22),
#1188 (SEQ ID NO:23), #1189 (SEQ D NO:24), #1190 (SEQ ID NO:25),
#1191 (SEQ ID NO:26), #1192 (SEQ ID NO:27), #1193 (SEQ ID NO:28),
#1194 (SEQ ID NO:29), #1195 (SEQ ID NO:30), #1196 (SEQ D NO:31),
#1197 (SEQ ID NO:32), #1198 (SEQ ID NO:33), #1199 (SEQ ID NO:34))
ranging in size from 51-81 bp, were chemically synthesized and
assembled using PCR-based primer extension and PCR fusion (Sandhu
G. S. et al (1992) BioTechniques 12:14-16). The primers were
designed as eight pairs of alternating forward and reverse
primers.
6 Primer # 1184 (forward): 5' GCACAGCATGATGAAGCACAGCAGAATGC- TTTC
(SEQ ID NO:19) TACCAGGTGCTCAACATG 3' Primer # 1185 (reverse): 5'
GTCGTCTTTAAGCGATTGGATGAAGCCGTTACG (SEQ ID NO:20)
TTGATCAGCATTGAGATTGGGCATGTTGAGCACCTG GTAG 3' Primer # 1186
(forward): 5' CCAATCGCTTAAAGACGACCCTTCCCAGAG- CGC (SEQ ID NO:21)
TAATGTCCTCGGCGAAGCTCAAAAGCTGAACGACAG CCAAGCTC 3' Primer # 1187
(reverse): 5' CTCGTAAAAGGCTGACTGTTGATCTTTGTTGAA (SEQ ID NO:22)
GTTGTTCTGTTGAGCATCCGCTTTTGGAGCTTGGCT GTCGTTCAG 3' Primer # 1188
(forward): 5' CAGTCAGCCTTTTACGAGATCCTTAATATGCCC (SEQ ID NO:23)
AACCTCAACGAGGCCCAGCGTAATGGTTTCATCCAA TCTCTTAAGGAC 3' Primer # 1189
(reverse): 5' CTCGTTTAGCTTCTTAGCTTCACCCAAAACGTT (SEQ ID NO:24)
GGTCGACTGCGATGGGTCGTCCTTAAGAGATTGGAT G 3' Primer # 1190 (forward):
5' GCTAAGAAGCTAAACGAGTCACAGGCTCCTAAA (SEQ ID NO:25)
GCTGATAACAACTTCAACAAGGAGCAGCAGAACGCC TTC 3' Primer # 1191
(reverse): 5' CTGGATGAACCCGTTTCGCTGTTCCTCGTTG- AG (SEQ ID NO:26)
ATTCGGCATGTTGAGGATTTCATAGAAGGCGTTCTG CTGCTC 3' Primer # 1192
(forward): 5' CGAAACGGGTTCATCCAGAGTCTTAAAGATGAC (SEQ ID NO:27)
CCATCCCAATCCGCTAACCTTCTGTCTGAAGCTAAG AAGCTAAAC 3' Primer # 1193
(reverse): 5' GAAGGCGTTCTGTTGCTCCTTGTTAAACTTGTT (SEQ ID NO:28)
GTCGGCTTTGGGCGCCTGGCTCTCGTTTAGCTTCTT AGCTTC 3' Primer # 1194
(forward): 5' GAGCAACAGAACGCCTTCTATGAAA- TTCTGCAT (SEQ ID NO:29)
CTCCCTAATCTCAACGAGGAACAACGTAACGGTTTC ATCCAATCG 3' Primer # 1195
(reverse): 5' GTTCAGTTTCTTGGCCTCCGCCAACAAGTTTGC (SEQ ID NO:30)
GGATTGACTCGGATCATCCTTAAGCGATTGGATGAA ACCGTTACG 3' Primer # 1196
(forward): 5' GAGGCCAAGAAACTGAACGACGCGCAAGCACCA (SEQ ID NO:31)
AAAGCTGATAACAAGTTCAACAAGGAACAACAGAAT GC 3' Primer # 1197 (reverse):
5' GAAGCCGTTTCTTTGTTCCTCAGTGAGAT- TTGG (SEQ ID NO:32)
CAAGTGAAGTATCTCGTAGAAAGCATTCTGTTGTTC CTTG 3' Primer # 1198
(forward): 5' GGAACAAAGAAACGGCTTCATCCAGAGTTTGAA (SEQ ID NO:33)
GGATGACCCGTCTGTCAGCAAGGAGATACTAGCTGA GGCGAAG 3' Primer # 1199
(reverse): 5' ATTGTCCTCCTCCTTCGGAGCTTGCGCATCGTT (SEQ ID NO:34)
CAACTTCTTCGCCTCAGCTAGTATC 3'
[0365] NcoI restriction enzyme sites were added onto both ends of
the DNA sequence to facilitate cloning. Each NcoI site (CCATGG) was
adjusted such that the ATG within the site (CCATGG) is in the
necessary reading frame to encode a methionine codon for 1)
translation initiation at the 5' end and 2) correct translational
fusion with the initiating methionine codon of oleosin at the 3'
end. Maintaining the correct reading frame required the inclusion
of an alanine codon as part of the NcoI/methionine addition to the
3' end. The final amplification of the assembled sequence and the
attachment of the NcoI sites was performed by an additional PCR
using the two primers #1024 (SEQ ID NO:35) and #1025 (SEQ ID
NO:36).
7 Primer # 1024: 5' GCGCCATGGCACAGCATGATGAAGCACAGC 3' (SEQ ID
NO:35) (NcoI site underlined) Primer # 1025: 5'
GCGCCCATGGCATTGTCCTCCTCCTTCGGAGC (SEQ ID NO:36) 3' (NcoI site
underlined)
[0366] The final PCR product was cloned into pCR2.1 (Invitrogen) to
yield pSBS2904 and the Protein A insert was confirmed by DNA
sequencing. The final DNA sequence and encoding protein sequence is
shown in FIG. 5.
[0367] Construction of a Protein A--Oleosin Expression Vector
[0368] An expression vector was constructed to allow for the
seed-specific over expression of Protein A as an oil
body-associated protein. Oil body targeting and display is achieved
by producing a fusion protein with an oleosin sequence (van Rooijen
G. J. H. & Moloney M. M. (1995) Bio/Technology 13: 72-77). The
Protein A sequence was subcloned, as an NcoI fragment from
pSBS2904, into the NcoI site of pSBS2091 to generate a Protein
A--oleosin translational fusion in construct pSBS2911. pSBS2091
contains the Arabidopsis oleosin gene (van Rooijen et al (1992
Plant Mol. Biol. 18: 1177-1179) with a unique NcoI restriction
enzyme site at the oleosin initiation methionine (ATG) codon.
Flanking the 5' and 3' end of the Protein A--oleosin sequence in
pSBS2911 is the phaseolin promoter and the phaseolin terminator
sequences respectively. The phaseolin promoter sequence in pSBS2091
has been modified to change the NcoI site (CCATGG) present in the
promoter to CCATGA, thus making the NcoI site at the beginning of
oleosin unique. The phaseolin promoter and terminator gene
regulatory elements are derived from the common bean Phaseolus
vulgaris (Slightom et al (1983) Proc. Natl. Acad. Sci. 80:
1897-1901; Sengupta-Gopalan et al (1985) Proc. Natl. Acad. Sci. USA
82: 3320-3324) and are used to achieve seed-specific over
expression. The complete promoter--gene fusion--terminator cassette
(SEQ ID NO:349) was excised from pSBS2911 as a PstI-Kpnl fragment
and cloned into pSBS4004 to generate pSBS4901. pSBS4004 is a
derivative of the Agrobacterium binary plasmid pPZP221
(Hajdukiewicz et al (1994) Plant Mol. Biol. 25: 989-994). In
pSBS4004, the region between the right and left border sequences of
pPZP221 has been removed and replaced with PstI, NcoI, Kpnl
restriction enzyme sites and a plant selectable marker cassette
containing the parsley ubiquitin promoter, the phosphinothricin
acetyl transferase gene, and parsley ubiquitin terminator
sequences. This selectable marker cassette allows selection of
transformed plant cells based on its conferred resistance to the
herbicide glufosinate ammonium.
[0369] The pSBS4901 and SBS4810 Agrobacterium strains were each
used to transform the S317 California variety of safflower to
generate individual transgenic lines. The transformation procedure
was similar to that outlined by Orlikowska T. K. et al. ( (1995)
Plant Cell, Tissue and Organ Culture 40: 85-91), but with
modifications and improvements both for transforming the S317
variety as well as for using phosphinothricin as the selectable
marker. Seeds, which were not damaged, cracked or diseased, were
decontaminated in 0.1% HgCl2 for 12 min followed by 4-5 rinses with
sterile distilled water. Sterile seeds were germinated in the dark
on MS medium (Murashige T. & Skoog F. (1962) Physiol. Plant.
15: 473-497) with 1% sucrose and 0.25% Gelrite. Agrobacterium
cultures were initiated from frozen glycerol stocks in 5 ml AB
minimal liquid media with antibiotic selection, and grown for 48
hours at 28.degree. C. For transformation, an aliquot of this
culture was grown overnight in 5 ml of Luria broth with selection.
Before use, 6-8 ml of bacterial cells were washed twice with AB
media, and made up to a final cell density of 0.4 -0.5 (OD600).
[0370] Two-day-old cotyledons were removed from germinated
seedlings, dipped in the prepared Agrobacterium cells, and plated
on MS medium with 3% sucrose, 4 uM N6-benzyladenine (BA) and 0.8 uM
naphthaleneacetic acid (NAA). Plates were incubated at 21.degree.
C. under dark conditions. After 3 days, these were transferred to
the same medium with 300 mg/L timentin. After an additional 4 days,
all cultures were moved to the light. After 3 days, explants were
placed on selection medium with phosphinothricin added at 0.5 mg/L.
For continued bud elongation, explants were transferred weekly onto
MS medium without phytohormones but with twice and basal amount of
KNO3. Shoots that had elongated to greater than 10 mm were excised
from the initial explant and individually grown on selection. For
rooting, green shoots, representing putative transgenic tissue,
were placed on MS medium with 2% sucrose, 10 uM indolebutyric acid
and 0.5 uM NAA. Rooted shoots were transferred to a well drained
soilless mix and grown under high humidity and 12 hours of
light.
[0371] Extraction of Assembled Antibody Complexes Associated with
Oil Bodies/Antibody and Protein A--Oleosin Components in a Single
Seed Line
[0372] To create a single safflower line expressing both chimeric
antibody (SBS4810) and Protein A--oleosin (SBS4901) transgene
constructs, single transgenic lines were selected as male and
female donor and manually crossed. Capitula or heads at the late
bud stage, just before the florets start emerging, were selected.
Two hours after the daily artificial light regime began, bracts
were removed from selected capitula for crossing, and any expanded
florets were removed and discarded. The anther tubes were removed
from all remaining florets. These heads were then bagged and
labelled. The next day, when the styles were elongated, the bags
were removed and the emasculated florets are fertilized with pollen
from selected plants. The fertilized head was covered again for
approximately one week or until seeds began to develop visually.
Seed was allowed to continue development on the plant and was
harvested at maturity.
[0373] Double transgenic seeds were analyzed for the presence of
both recombinant products; production and assembly of the SBS4810
heavy and light antibody chains, and production of the Protein
A-oleosin fusion on the surface of oil bodies. Seeds which
contained both chimeric antibody and Protein A-oleosin components
were used to test the assembly of the antibody complex on the oil
bodies, mediated by Protein A. Individual safflower seeds were
ground in 150 ul of 50 mM sodium phosphate buffer pH 8.0. The
extracts were centrifuged for 10 minutes at 4.degree. C. and the
oil body and soluble undernatant fractions were transferred to a
fresh tube. The pellet fraction was reextracted in 50 ul of sodium
phosphate buffer and the second oil body and soluble undernatant
fraction was pooled with the first equivalent fraction. The pooled
oil body and undernatant fractions were centrifuged for 10 minutes
at 4.degree. C. The soluble undernatant was removed and clarified
by two rounds of centrifugation. The oil body fraction was washed
three times in 200 ul of 50 mM sodium phosphate buffer pH 8.0. The
washed oil bodies and clarified undematant fractions were
solublized in SDS loading buffer and separated by SDS-PAGE before
electroblotting for Western analysis. Both SBS4810 chimeric
antibody and SBS4901 Protein A-oleosin fusion are detected using a
goat anti-human IgG Fc secondary antibody (ICN Biomedicals
Inc.).
[0374] The recombinant protein profiles of wild type safflower or
individual transgenic safflower lines for Protein A--oleosin
(SBS4901) or chimeric heavy and light antibody chains (SBS4810) are
shown in FIG. 2. No antibody or Protein A products are detected in
the oilbody or soluble undernatant fractions of the wild type
safflower seed. The Protein A--Arabidopsis oleosin fusion protein
is detected predominantly in the undernatant fraction from the
SBS4901 safflower seed (arrowhead, FIG. 6). Protein A is detected
through direct binding to the goat secondary antibody. A number of
antibody derived proteins and complexes are produced and detected
in the SBS4810 safflower seed, including the completely assembled
immunoglobulin (arrow, FIG. 6). The majority of these protein
products partition with the soluble undematant, with only a minor
portion is associating non-specifically with the oilbody fraction.
Since the transgenic lines used as donor parent lines for the
crosses, were segregating the Protein A or chimeric antibody
transgene respectively, not all seed resulting from the cross
inherited both transgenes. The "SBS4810+-" seed produced from the
cross did not inherit the SBS4901 Protein A--oleosin transgene and
has an antibody profile comparable to the original SBS4810
transgenic line. This demonstrates that the antibody partitioning
between oilbodies and soluble undernatant has not changed as a
result of the crossing manipulation itself. The seed producing both
transgenes (SBS4810 +SBS4901) however shows a marked increase in
the association of antibody products (including the full length
immunoglobulin complex) with the oilbodies.
[0375] The present invention should therefore not be seen as
limited to the particular embodiments described herein, but rather,
it should be understood that the present invention has wide
applicability with respect to protein expression generally. Since
modifications will be apparent to those of skill in this art, it is
intended that this invention be limited only by the scope of the
appended claims.
[0376] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety.
SUMMARY OF SEQUENCES
[0377] SEQ ID NOs:1 and 2 set forth primers which were designed to
amplify the oleosin coding sequence and to engineer an NcoI site at
the translation initation codon (ATG) and a HindIII site following
the translation termination codon (TAA), respectively.
[0378] SEQ ID NOs:3 and 4 set forth primers which were designed to
an antibody secretion signal sequence and the sequence downstream
of the IgG1 isotype termination codon respectively to amplify the
D9 heavy chain.
[0379] SEQ ID NOs:5 and 6 set forth primers which were designed to
represent a degenerate primer sequence was used with broader
specificity for the light chain subgroup I family of sequences and
the sequence downstream of the coding sequence termination codon to
amplify the D9 light chain variable sequence.
[0380] SEQ ID NOs:7 to 11 set forth primers which were designed to
add a secretion sequence to the D9 heavy chain through primer
extension.
[0381] SEQ ID NOs:12 to 16 set forth primers which were designed to
add a secretion sequence to the D9 light chain through primer
extension.
[0382] SEQ ID NO:17 sets forth the sequence of the linin
promoter--secretion signal D9 light chain--linin terminator
cassette excised from pSBS2810
[0383] SEQ ID NO:18 sets forth the sequence of the phaseolin
promoter--signal sequence--D9 heavy--phaseolin terminator cassette
from pSBS4800.
[0384] SEQ ID NOs:19-34 set forth primers designed to synthesize
the Protein A sequence found in FIG. 4.
[0385] SEQ ID NOs:35 and 36 set forth primers designed to attach
NcoI sites on the Protein A sequence found in FIG. 4.
[0386] SEQ ID NO:37 sets forth the sequence of the Phaseolin
promoter--Egineered Protein A--Arabidopsis Oleosin gene (with
intron)--Phaseolin terminator excised from pSBS2911 as a PstI--Kpnl
fragment and cloned into pSBS4004 to generate pSBS4901.
[0387] SEQ ID NO:38 sets forth the sequence shown in FIG. 4.
[0388] SEQ ID NO:39 sets forth the sequence shown in FIG. 5.
Sequence CWU 1
1
37 1 27 DNA Artificial Sequence Primer #0013 1 cgcggatcca
tggcggatac agctaga 27 2 25 DNA Artificial Sequence Primer #0605 2
aagcttaagt agtgtgctgg ccacc 25 3 21 DNA Artificial Sequence Primer
#1020 3 ctgtcagtaa ctgcaggtgt c 21 4 21 DNA Artificial Sequence
Primer #1021 4 gtaggtgtca gagtcctgta g 21 5 21 DNA Artificial
Sequence Primer #1022 5 tctgggtatc tggtrcstgt g 21 6 21 DNA
Artificial Sequence Primer #1023 6 gcaacagtgg taggtcgctt g 21 7 31
DNA Artificial Sequence Primer #1207 7 gcgcagatct aacatgaact
ttctcaagtc c 31 8 49 DNA Artificial Sequence Primer #1208 8
gtccgaaaca gaggaaagcg tagaatggaa aggacttgag aaagttcat 49 9 45 DNA
Artificial Sequence Primer #1209 9 gctttcctct gtttcggaca atactttgtt
gctgtcactc acgct 45 10 38 DNA Artificial Sequence Primer #1210 10
gactgctgca ggtgaacctg agcgtgagtg acagcaac 38 11 29 DNA Artificial
Sequence Primer #1211 11 gcgcagatct tcatttacca ggagagtgg 29 12 38
DNA Artificial Sequence Primer #1202 12 gcgcctcgag atctaccatg
aacttcctca agtctttc 38 13 49 DNA Artificial Sequence Primer #1203
13 gaccaaagca gagaaaagca taaaacggga aagacttgag gaagttcat 49 14 45
DNA Artificial Sequence Primer #1204 14 gcttttctct gctttggtca
gtatttcgtc gctgttaccc atgct 45 15 39 DNA Artificial Sequence Primer
#1205 15 gactgtgtca tcacaatgtc agcatgggta acagcgacg 39 16 37 DNA
Artificial Sequence Primer #1206 16 gcgcagatct cgagctaaca
ctcattcctg ttgaagc 37 17 3344 DNA Artificial Sequence The Linin
promoter-secretion signal D9 light chain - linin terminator
cassette 17 acgcgtctca agcatacgga caagggtaaa taacatagtc accagaacat
aataaacaaa 60 aagtgcagaa gcaagactaa aaaaattagc tatggacatt
caggttcata ttggaaacat 120 cattatccta gtcttgtgac catccttcct
cctgctctag ttgagaggcc ttgggactaa 180 cgagaggtca gttgggatag
cagatcctta tcctggacta gcctttctgg tgtttcagag 240 tcttcgtgcc
gccgtctaca tctatctcca ttaggtctga agatgactct tcacaccaac 300
gacgtttaag gtctctatcc tactcctagc ttgcaatacc tggcttgcaa tacctggagc
360 atcgtgcacg atgattggat actgtggagg aggagtgttt gctgatttag
agctcccggt 420 tgggtgattt gacttcgatt tcagtttagg cttgttgaaa
tttttcaggt tccattgtga 480 agcctttaga gcttgagctt ccttccatgt
taatgccttg atcgaattct cctagagaaa 540 agggaagtcg atctctgagt
attgaaatcg aagtgcacat tttttttcaa cgtgtccaat 600 caatccacaa
acaaagcaga agacaggtaa tctttcatac ttatactgac aagtaatagt 660
cttaccgtca tgcataataa cgtctcgttc cttcaagagg ggttttccga catccataac
720 gacccgaagc ctcatgaaag cattagggaa gaacttttgg ttcttcttgt
catggccttt 780 ataggtgtca gccgagctcg ccaattcccg tccgactggc
tccgcaaaat attcgaacgg 840 caagttatgg acttgcaacc ataactccac
ggtattgagc aggacctatt gtgaagactc 900 atctcatgga gcttcagaat
gtggttgtca gcaaaccaat gaccgaaatc catcacatga 960 cggacgtcca
gtgggtgagc gaaacgaaac aggaagcgcc tatctttcag agtcgtgagc 1020
tccacaccgg attccggcaa ctacgtgttg ggcaggcttc gccgtattag agatatgttg
1080 aggcagaccc atctgtgcca ctcgtacaat tacgagagtt gttttttttg
tgattttcct 1140 agtttctcgt tgatggtgag ctcatattct acatcgtatg
gtctctcaac gtcgtttcct 1200 gtcatctgat atcccgtcat ttgcatccac
gtgcgccgcc tcccgtgcca agtccctagg 1260 tgtcatgcac gccaaattgg
tggtggtgcg ggctgccctg tgcttcttac cgatgggtgg 1320 aggttgagtt
tgggggtctc cgcggcgatg gtagtgggtt gacggtttgg tgtgggttga 1380
cggcattgat caatttactt cttgcttcaa attctttggc agaaaacaat tcattagatt
1440 agaactggaa accagagtga tgagacggat taagtcagat tccaacagag
ttacatctct 1500 taagaaataa tgtaacccct ttagacttta tatatttgca
attaaaaaaa taatttaact 1560 tttagacttt atatatagtt ttaataacta
agtttaacca ctctattatt tatatcgaaa 1620 ctatttgtat gtctcccctc
taaataaact tggtattgtg tttacagaac ctataatcaa 1680 ataatcaata
ctcaactgaa gtttgtgcag ttaattgaag ggattaacgg ccaaaatgca 1740
ctagtattat caaccgaata gattcacact agatggccat ttccatcaat atcatcgccg
1800 ttcttcttct gtccacatat cccctctgaa acttgagaga cacctgcact
tcattgtcct 1860 tattacgtgt tacaaaatga aacccatgca tccatgcaaa
ctgaagaatg gcgcaagaac 1920 ccttcccctc catttcttat gtggcgacca
tccatttcac catctcccgc tataaaacac 1980 ccccatcact tcacctagaa
catcatcact acttgcttat ccatccaaaa gatacccacc 2040 ctcgagatct acc atg
aac ttc ctc aag tct ttc ccg ttt tat gct ttt 2089 Met Asn Phe Leu
Lys Ser Phe Pro Phe Tyr Ala Phe 1 5 10 ctc tgc ttt ggt cag tat ttc
gtc gct gtt acc cat gct gac att gtg 2137 Leu Cys Phe Gly Gln Tyr
Phe Val Ala Val Thr His Ala Asp Ile Val 15 20 25 atg aca cag tct
cca tcc tcc ctg gct atg tca gtg gga cag cgg gtc 2185 Met Thr Gln
Ser Pro Ser Ser Leu Ala Met Ser Val Gly Gln Arg Val 30 35 40 act
atg cgc tgc aag tcc agt cag agc ctt tta aaa agt acc aat caa 2233
Thr Met Arg Cys Lys Ser Ser Gln Ser Leu Leu Lys Ser Thr Asn Gln 45
50 55 60 aag aac tat ttg gcc tgg tac cag cag aaa cca gga cag tct
cct aaa 2281 Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
Ser Pro Lys 65 70 75 ctt ctg gta tac ttt gca tcc act agg gaa tct
ggg gtc cct gat cgc 2329 Leu Leu Val Tyr Phe Ala Ser Thr Arg Glu
Ser Gly Val Pro Asp Arg 80 85 90 ttc ata ggc agt gga tct ggg aca
gat ttc act ctt acc atc agc agt 2377 Phe Ile Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser 95 100 105 gtg cag gct gaa gac
ctg gca gat tac ttc tgt cag caa cat tat aac 2425 Val Gln Ala Glu
Asp Leu Ala Asp Tyr Phe Cys Gln Gln His Tyr Asn 110 115 120 act cct
ccc acg ttc ggt gct ggg acc aag ctg gag ctg aaa cgg gct 2473 Thr
Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ala 125 130
135 140 gat gct gca cca act gta tcc atc ttc cca cca tcc agt gag cag
tta 2521 Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu
Gln Leu 145 150 155 aca tct gga ggt gcc tca gtc gtg tgc ttc ttg aac
aac ttc tac ccc 2569 Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu
Asn Asn Phe Tyr Pro 160 165 170 aaa gac atc aat gtc aag tgg aag att
gat ggc agt gaa cga caa aat 2617 Lys Asp Ile Asn Val Lys Trp Lys
Ile Asp Gly Ser Glu Arg Gln Asn 175 180 185 ggc gtc ctg aac agt tgg
act gat cag gac agc aaa gac agc acc tac 2665 Gly Val Leu Asn Ser
Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr 190 195 200 agc atg agc
agc acc ctc acg ttg acc aag gac gag tat gaa cga cat 2713 Ser Met
Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His 205 210 215
220 aac agc tat acc tgt gag gcc act cac aag aca tca act tca ccc att
2761 Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro
Ile 225 230 235 gtc aag agc ttc aac agg aat gag tgt ta gctcgagcaa
gcttatgtga 2810 Val Lys Ser Phe Asn Arg Asn Glu Cys 240 245
cgtgaaataa taacggtaaa atatatgtaa taataataat aataaagcca caaagtgaga
2870 atgaggggaa ggggaaatgt gtaatgagcc agtagccggt ggtgctaatt
ttgtatcgta 2930 ttgtcaataa atcatgaatt ttgtggtttt tatgtgtttt
tttaaatcat gaattttaaa 2990 ttttataaaa taatctccaa tcggaagaac
aacattccat atccatgcat ggatgtttct 3050 ttacccaaat ctagttcttg
agaggatgaa gcatcaccga acagttctgc aactatccct 3110 caaaagcttt
aaaatgaaca acaaggaaca gagcaacgtt ccaaagatcc caaacgaaac 3170
atattatcta tactaatact atattattaa ttactactgc ccggaatcac aatccctgaa
3230 tgattcctat taactacaag ccttgttggc ggcggagaag tgatcggcgc
ggcgagaagc 3290 agcggactcg gagacgaggc cttggatgag cagagtcttt
acctgccaac gcgt 3344 18 4191 DNA Artificial Sequence Phaseolin D9
heavy chain cassette 18 ctgcagacgc gtattgtact cccagtatca ttatagtgaa
agttttggct ctctcgccgg 60 tggtttttta cctctattta aaggggtttt
ccacctaaaa attctggtat cattctcact 120 ttacttgtta ctttaatttc
tcataatctt tggttgaaat tatcacgctt ccgcacacga 180 tatccctaca
aatttattat ttgttaaaca ttttcaaacc gcataaaatt ttatgaagtc 240
ccgtctatct ttaatgtagt ctaacatttt catattgaaa tatataattt acttaatttt
300 agcgttggta gaaagcataa tgatttattc ttattcttct tcatataaat
gtttaatata 360 caatataaac aaattcttta ccttaagaag gatttcccat
tttatatttt aaaaatatat 420 ttatcaaata tttttcaacc acgtaaatct
cataataata agttgtttca aaagtaataa 480 aatttaactc cataattttt
ttattcgact gatcttaaag caacacccag tgacacaact 540 agccattttt
ttctttgaat aaaaaaatcc aattatcatt gtattttttt tatacaatga 600
aaatttcacc aaacaatgat ttgtggtatt tctgaagcaa gtcatgttat gcaaaattct
660 ataattccca tttgacacta cggaagtaac tgaagatctg cttttacatg
cgagacacat 720 cttctaaagt aattttaata atagttacta tattcaagat
ttcatatatc aaatactcaa 780 tattacttct aaaaaattaa ttagatataa
ttaaaatatt acttttttaa ttttaagttt 840 aattgttgaa tttgtgacta
ttgatttatt attctactat gtttaaattg ttttatagat 900 agtttaaagt
aaatataagt aatgtagtag agtgttagag tgttacccta aaccataaac 960
tataagattt atggtggact aattttcata tatttcttat tgcttttacc ttttcttggt
1020 atgtaagtcc gtaactggaa ttactgtggg ttgccatgac actctgtggt
cttttggttc 1080 atgcatggat gcttgcgcaa gaaaaagaca aagaacaaag
aaaaaagaca aaacagagag 1140 acaaaacgca atcacacaac caactcaaat
tagtcactgg ctgatcaaga tcgccgcgtc 1200 catgtatgtc taaatgccat
gcaaagcaac acgtgcttaa catgcacttt aaatggctca 1260 cccatctcaa
cccacacaca aacacattgc ctttttcttc atcatcacca caaccacctg 1320
tatatattca ttctcttccg ccacctcaat ttcttcactt caacacacgt caacctgcat
1380 atgcgtgtca tcccatgccc aaatctccat gcatgttcca accaccttct
ctcttatata 1440 atacctataa atacctctaa tatcactcac ttctttcatc
atccatccat ccagagtact 1500 actactctac tactataata ccccaaccca
actcatattc aatactactc taccggatct 1560 aac atg aac ttt ctc aag tcc
ttt cca ttc tac gct ttc ctc tgt ttc 1608 Met Asn Phe Leu Lys Ser
Phe Pro Phe Tyr Ala Phe Leu Cys Phe 1 5 10 15 gga caa tac ttt gtt
gct gtc act cac gct cag gtt cac ctg cag cag 1656 Gly Gln Tyr Phe
Val Ala Val Thr His Ala Gln Val His Leu Gln Gln 20 25 30 tct gga
gct gag ctg atg aag cct ggg gcc tca atg aag ata tcc tgc 1704 Ser
Gly Ala Glu Leu Met Lys Pro Gly Ala Ser Met Lys Ile Ser Cys 35 40
45 aag gct act ggc tac aca ttc agt agc tac tgg ata gag tgg gta aag
1752 Lys Ala Thr Gly Tyr Thr Phe Ser Ser Tyr Trp Ile Glu Trp Val
Lys 50 55 60 cag agg cct gga cat ggc ctt gag tgg att gga gag att
tta cct ggc 1800 Gln Arg Pro Gly His Gly Leu Glu Trp Ile Gly Glu
Ile Leu Pro Gly 65 70 75 agt ggt agt act acc tac aat gag aag ttc
aag ggc aag gcc aca ttc 1848 Ser Gly Ser Thr Thr Tyr Asn Glu Lys
Phe Lys Gly Lys Ala Thr Phe 80 85 90 95 act gca gat aca tcc tcc aac
aca gcc tac atg caa ctc agc agc ctg 1896 Thr Ala Asp Thr Ser Ser
Asn Thr Ala Tyr Met Gln Leu Ser Ser Leu 100 105 110 aca tct gag gac
tct gcc gtc tat tac tgt gca aga ttg gat gtt gac 1944 Thr Ser Glu
Asp Ser Ala Val Tyr Tyr Cys Ala Arg Leu Asp Val Asp 115 120 125 tcc
tgg ggc caa ggc acc act ctc aca gtc tcc tca gcc aaa acg aca 1992
Ser Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Ala Lys Thr Thr 130
135 140 ccc cca tct gtc tat cca ctg gcc cct gga tct gct gcc caa act
aac 2040 Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln
Thr Asn 145 150 155 tcc atg gtg acc ctg gga tgc ctg gtc aag ggc tat
ttc cct gag cca 2088 Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly
Tyr Phe Pro Glu Pro 160 165 170 175 gtg aca gtg acc tgg aac tct gga
tcc ctg tcc agc ggt gtg cac acc 2136 Val Thr Val Thr Trp Asn Ser
Gly Ser Leu Ser Ser Gly Val His Thr 180 185 190 ttc cca gct gtc ctg
cag tct gac ctc tac act ctg agc agc tca gtg 2184 Phe Pro Ala Val
Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val 195 200 205 act gtc
ccc tcc agc acc tgg ccc agc gag acc gtc acc tgc aac gtt 2232 Thr
Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys Asn Val 210 215
220 gcc cac ccg gcc agc agc acc aag gtg gac aag aaa att gtg ccc agg
2280 Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val Pro
Arg 225 230 235 gat tgt ggt tgt aag cct tgc ata tgt aca gtc cca gaa
gta tca tct 2328 Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro
Glu Val Ser Ser 240 245 250 255 gtc ttc atc ttc ccc cca aag ccc aag
gat gtg ctc acc att act ctg 2376 Val Phe Ile Phe Pro Pro Lys Pro
Lys Asp Val Leu Thr Ile Thr Leu 260 265 270 act cct aag gtc acg tgt
gtt gtg gta gac atc agc aag gat gat ccc 2424 Thr Pro Lys Val Thr
Cys Val Val Val Asp Ile Ser Lys Asp Asp Pro 275 280 285 gag gtc cag
ttc agc tgg ttt gta gat gat gtg gag gtg cac aca gct 2472 Glu Val
Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala 290 295 300
cag acg caa ccc cgg gag gag cag ttc aac agc act ttc cgc tca gtc
2520 Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Ser
Val 305 310 315 agt gaa ctt ccc atc atg cac cag gac tgg ctc aat ggc
aag gag ttc 2568 Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn
Gly Lys Glu Phe 320 325 330 335 aaa tgc agg gtc aac agt gca gct ttc
cct gcc ccc atc gag aaa acc 2616 Lys Cys Arg Val Asn Ser Ala Ala
Phe Pro Ala Pro Ile Glu Lys Thr 340 345 350 atc tcc aaa acc aaa ggc
aga ccg aag gct cca cag gtg tac acc att 2664 Ile Ser Lys Thr Lys
Gly Arg Pro Lys Ala Pro Gln Val Tyr Thr Ile 355 360 365 cca cct ccc
aag gag cag atg gcc aag gat aaa gtc agt ctg acc tgc 2712 Pro Pro
Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu Thr Cys 370 375 380
atg ata aca gac ttc ttc cct gaa gac att act gtg gag tgg cag tgg
2760 Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Gln
Trp 385 390 395 aat ggg cag cca gcg gag aac tac aag aac act cag ccc
atc atg gac 2808 Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln
Pro Ile Met Asp 400 405 410 415 aca gat ggc tct tac ttc gtc tac agc
aag ctc aat gtg cag aag agc 2856 Thr Asp Gly Ser Tyr Phe Val Tyr
Ser Lys Leu Asn Val Gln Lys Ser 420 425 430 aac tgg gag gca gga aat
act ttc acc tgc tct gtg tta cat gag ggc 2904 Asn Trp Glu Ala Gly
Asn Thr Phe Thr Cys Ser Val Leu His Glu Gly 435 440 445 ctg cac aac
cac cat act gag aag agc ctc tcc cac tct cct ggt aaa t 2953 Leu His
Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro Gly Lys 450 455 460
gaagatccaa gcttaaataa gtatgaacta aaatgcatgt aggtgtaaga gctcatggag
3013 agcatggaat attgtatccg accatgtaac agtataataa ctgagctcca
tctcacttct 3073 tctatgaata aacaaaggat gttatgatat attaacactc
tatctatgca ccttattgtt 3133 ctatgataaa tttcctctta ttattataaa
tcatctgaat cgtgacggct tatggaatgc 3193 ttcaaatagt acaaaaacaa
atgtgtacta taagactttc taaacaattc taactttagc 3253 attgtgaacg
agacataagt gttaagaaga cataacaatt ataatggaag aagtttgtct 3313
ccatttatat attatatatt acccacttat gtattatatt aggatgttaa ggagacataa
3373 caattataaa gagagaagtt tgtatccatt tatatattat atactaccca
tttatatatt 3433 atacttatcc acttatttaa tgtctttata aggtttgatc
catgatattt ctaatatttt 3493 agttgatatg tatatgaaaa ggtactattt
gaactctctt actctgtata aaggttggat 3553 catccttaaa gtgggtctat
ttaattttat tgcttcttac agataaaaaa aaattatgag 3613 ttggtttgat
aaaatattga aggatttaaa ataataataa ataataaata acatataata 3673
tatgtatata aatttattat aatataacat ttatctataa aaaagtaaat attgtcataa
3733 atctatacaa tcgtttagcc ttgctggaac gaatctcaat tatttaaacg
agagtaaaca 3793 tatttgactt tttggttatt taacaaatta ttatttaaca
ctatatgaaa tttttttttt 3853 ttatcagcaa agaataaaat taaattaaga
aggacaatgg tgtcccaatc cttatacaac 3913 caacttccac aagaaagtca
agtcagagac aacaaaaaaa caagcaaagg aaatttttta 3973 atttgagttg
tcttgtttgc tgcataattt atgcagtaaa acactacaca taaccctttt 4033
agcagtagag caatggttga ccgtgtgctt agcttctttt attttatttt tttatcagca
4093 aagaataaat aaaataaaat gagacacttc agggatgttt caacccttat
acaaaacccc 4153 aaaaacaagt ttcctagcac cctaccaact aaggtacc 4191 19
51 DNA Artificial Sequence Primer #1184 (forward) 19 gcacagcatg
atgaagcaca gcagaatgct ttctaccagg tgctcaacat g 51 20 73 DNA
Artificial Sequence Primer #1185 (reverse) 20 gtcgtcttta agcgattgga
tgaagccgtt acgttgatca gcattgagat tgggcatgtt 60 gagcacctgg tag 73 21
77 DNA Artificial Sequence Primer #1186 (forward) 21 ccaatcgctt
aaagacgacc cttcccagag cgctaatgtc ctcggcgaag ctcaaaagct 60
gaacgacagc caagctc 77 22 78 DNA Artificial Sequence Primer #1187
(reverse) 22 ctcgtaaaag gctgactgtt gatctttgtt gaagttgttc tgttgagcat
ccgcttttgg 60 agcttggctg tcgttcag 78 23 81 DNA Artificial Sequence
Primer #1188 (forward) 23 cagtcagcct tttacgagat ccttaatatg
cccaacctca acgaggccca gcgtaatggt 60 ttcatccaat ctcttaagga c 81 24
70 DNA
Artificial Sequence Primer #1189 (reverse) 24 ctcgtttagc ttcttagctt
cacccaaaac gttggtcgac tgcgatgggt cgtccttaag 60 agattggatg 70 25 72
DNA Artificial Sequence Primer #1190 (forward) 25 gctaagaagc
taaacgagtc acaggctcct aaagctgata acaacttcaa caaggagcag 60
cagaacgcct tc 72 26 75 DNA Artificial Sequence Primer #1191
(reverse) 26 ctggatgaac ccgtttcgct gttcctcgtt gagattcggc atgttgagga
tttcatagaa 60 ggcgttctgc tgctc 75 27 78 DNA Artificial Sequence
Primer #1192 (forward) 27 cgaaacgggt tcatccagag tcttaaagat
gacccatccc aatccgctaa ccttctgtct 60 gaagctaaga agctaaac 78 28 75
DNA Artificial Sequence Primer #1193 (reverse) 28 gaaggcgttc
tgttgctcct tgttaaactt gttgtcggct ttgggcgcct ggctctcgtt 60
tagcttctta gcttc 75 29 78 DNA Artificial Sequence Primer #1194
(forward) 29 gagcaacaga acgccttcta tgaaattctg catctcccta atctcaacga
ggaacaacgt 60 aacggtttca tccaatcg 78 30 78 DNA Artificial Sequence
Primer #1195 (reverse) 30 gttcagtttc ttggcctccg ccaacaagtt
tgcggattga ctcggatcat ccttaagcga 60 ttggatgaaa ccgttacg 78 31 71
DNA Artificial Sequence Primer #1196 (forward) 31 gaggccaaga
aactgaacga cgcgcaagca ccaaaagctg ataacaagtt caacaaggaa 60
caacagaatg c 71 32 73 DNA Artificial Sequence Primer #1197
(reverse) 32 gaagccgttt ctttgttcct cagtgagatt tggcaagtga agtatctcgt
agaaagcatt 60 ctgttgttcc ttg 73 33 76 DNA Artificial Sequence
Primer #1198 (forward) 33 ggaacaaaga aacggcttca tccagagttt
gaaggatgac ccgtctgtca gcaaggagat 60 actagctgag gcgaag 76 34 58 DNA
Artificial Sequence Primer #1199 (forward) 34 attgtcctcc tccttcggag
cttgcgcatc gttcaacttc ttcgcctcag ctagtatc 58 35 30 DNA Artificial
Sequence Primer #1024 35 gcgccatggc acagcatgat gaagcacagc 30 36 32
DNA Artificial Sequence Primer #1025 36 gcgcccatgg cattgtcctc
ctccttcgga gc 32 37 4473 DNA Artificial Sequence The complete
promoter-gene fusion-terminator cassette 37 ctgcaggaat tcattgtact
cccagtatca ttatagtgaa agttttggct ctctcgccgg 60 tggtttttta
cctctattta aaggggtttt ccacctaaaa attctggtat cattctcact 120
ttacttgtta ctttaatttc tcataatctt tggttgaaat tatcacgctt ccgcacacga
180 tatccctaca aatttattat ttgttaaaca ttttcaaacc gcataaaatt
ttatgaagtc 240 ccgtctatct ttaatgtagt ctaacatttt catattgaaa
tatataattt acttaatttt 300 agcgttggta gaaagcataa tgatttattc
ttattcttct tcatataaat gtttaatata 360 caatataaac aaattcttta
ccttaagaag gatttcccat tttatatttt aaaaatatat 420 ttatcaaata
tttttcaacc acgtaaatct cataataata agttgtttca aaagtaataa 480
aatttaactc cataattttt ttattcgact gatcttaaag caacacccag tgacacaact
540 agccattttt ttctttgaat aaaaaaatcc aattatcatt gtattttttt
tatacaatga 600 aaatttcacc aaacaatgat ttgtggtatt tctgaagcaa
gtcatgttat gcaaaattct 660 ataattccca tttgacacta cggaagtaac
tgaagatctg cttttacatg cgagacacat 720 cttctaaagt aattttaata
atagttacta tattcaagat ttcatatatc aaatactcaa 780 tattacttct
aaaaaattaa ttagatataa ttaaaatatt acttttttaa ttttaagttt 840
aattgttgaa tttgtgacta ttgatttatt attctactat gtttaaattg ttttatagat
900 agtttaaagt aaatataagt aatgtagtag agtgttagag tgttacccta
aaccataaac 960 tataagattt atggtggact aattttcata tatttcttat
tgcttttacc ttttcttggt 1020 atgtaagtcc gtaactggaa ttactgtggg
ttgccatgac actctgtggt cttttggttc 1080 atgcatggat gcttgcgcaa
gaaaaagaca aagaacaaag aaaaaagaca aaacagagag 1140 acaaaacgca
atcacacaac caactcaaat tagtcactgg ctgatcaaga tcgccgcgtc 1200
catgtatgtc taaatgccat gcaaagcaac acgtgcttaa catgcacttt aaatggctca
1260 cccatctcaa cccacacaca aacacattgc ctttttcttc atcatcacca
caaccacctg 1320 tatatattca ttctcttccg ccacctcaat ttcttcactt
caacacacgt caacctgcat 1380 atgcgtgtca tcccatgccc aaatctccat
gcatgttcca accaccttct ctcttatata 1440 atacctataa atacctctaa
tatcactcac ttctttcatc atccatccat ccagagtact 1500 actactctac
tactataata ccccaaccca actcatattc aatactactc tacc atg 1557 Met 1 gca
cag cat gat gaa gca cag cag aat gct ttc tac cag gtg ctc aac 1605
Ala Gln His Asp Glu Ala Gln Gln Asn Ala Phe Tyr Gln Val Leu Asn 5
10 15 atg ccc aat tta aat gct gat caa cgt aac ggc ttc atc caa tcg
ctt 1653 Met Pro Asn Leu Asn Ala Asp Gln Arg Asn Gly Phe Ile Gln
Ser Leu 20 25 30 aaa gac gac cct tcc cag agc gct aat gtc ctc ggc
gaa gct caa aag 1701 Lys Asp Asp Pro Ser Gln Ser Ala Asn Val Leu
Gly Glu Ala Gln Lys 35 40 45 ctg aac gac agc caa gct cca aaa gcg
gat gct caa cag aac aac ttc 1749 Leu Asn Asp Ser Gln Ala Pro Lys
Ala Asp Ala Gln Gln Asn Asn Phe 50 55 60 65 aac aaa gat caa cag tca
gcc ttt tac gag atc ctt aat atg ccc aac 1797 Asn Lys Asp Gln Gln
Ser Ala Phe Tyr Glu Ile Leu Asn Met Pro Asn 70 75 80 ctc aac gag
gcc cag cgt aat ggt ttc atc caa tct ctt aag gac gac 1845 Leu Asn
Glu Ala Gln Arg Asn Gly Phe Ile Gln Ser Leu Lys Asp Asp 85 90 95
cca tcg cag tcg acc aac gtt ttg ggt gaa gct aag aag cta aac gag
1893 Pro Ser Gln Ser Thr Asn Val Leu Gly Glu Ala Lys Lys Leu Asn
Glu 100 105 110 tca cag gct cct aaa gct gat aac aac ttc aac aag gag
cag cag aac 1941 Ser Gln Ala Pro Lys Ala Asp Asn Asn Phe Asn Lys
Glu Gln Gln Asn 115 120 125 gcc ttc tat gaa atc ctc aac atg ccg aat
ctc aac gag gaa cag cga 1989 Ala Phe Tyr Glu Ile Leu Asn Met Pro
Asn Leu Asn Glu Glu Gln Arg 130 135 140 145 aac ggg ttc atc cag agt
ctt aaa gat gac cca tcc caa tcc gct aac 2037 Asn Gly Phe Ile Gln
Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn 150 155 160 ctt ctg tct
gaa gct aag aag cta aac gag agc cag gcg ccc aaa gcc 2085 Leu Leu
Ser Glu Ala Lys Lys Leu Asn Glu Ser Gln Ala Pro Lys Ala 165 170 175
gac aac aag ttt aac aag gag caa cag aac gcc ttc tat gaa att ctg
2133 Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile
Leu 180 185 190 cat ctc cct aat ctc aac gag gaa caa cgt aac ggt ttc
atc caa tcg 2181 His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly
Phe Ile Gln Ser 195 200 205 ctt aag gat gat ccg agt caa tcc gca aac
ttg ttg gcg gag gcc aag 2229 Leu Lys Asp Asp Pro Ser Gln Ser Ala
Asn Leu Leu Ala Glu Ala Lys 210 215 220 225 aaa ctg aac gac gcg caa
gca cca aaa gct gat aac aag ttc aac aag 2277 Lys Leu Asn Asp Ala
Gln Ala Pro Lys Ala Asp Asn Lys Phe Asn Lys 230 235 240 gaa caa cag
aat gct ttc tac gag ata ctt cac ttg cca aat ctc act 2325 Glu Gln
Gln Asn Ala Phe Tyr Glu Ile Leu His Leu Pro Asn Leu Thr 245 250 255
gag gaa caa aga aac ggc ttc atc cag agt ttg aag gat gac ccg tct
2373 Glu Glu Gln Arg Asn Gly Phe Ile Gln Ser Leu Lys Asp Asp Pro
Ser 260 265 270 gtc agc aag gag ata cta gct gag gcg aag aag ttg aac
gat gcg caa 2421 Val Ser Lys Glu Ile Leu Ala Glu Ala Lys Lys Leu
Asn Asp Ala Gln 275 280 285 gct ccg aag gag gag gac aat gcc atg gcg
gat aca gct aga gga acc 2469 Ala Pro Lys Glu Glu Asp Asn Ala Met
Ala Asp Thr Ala Arg Gly Thr 290 295 300 305 cat cac gat atc atc ggc
aga gac cag tac ccg atg atg ggc cga gac 2517 His His Asp Ile Ile
Gly Arg Asp Gln Tyr Pro Met Met Gly Arg Asp 310 315 320 cga gac cag
tac cag atg tcc gga cga gga tct gac tac tcc aag tct 2565 Arg Asp
Gln Tyr Gln Met Ser Gly Arg Gly Ser Asp Tyr Ser Lys Ser 325 330 335
agg cag att gct aaa gct gca act gct gtc aca gct ggt ggt tcc ctc
2613 Arg Gln Ile Ala Lys Ala Ala Thr Ala Val Thr Ala Gly Gly Ser
Leu 340 345 350 ctt gtt ctc tcc agc ctt acc ctt gtt gga act gtc ata
gct ttg act 2661 Leu Val Leu Ser Ser Leu Thr Leu Val Gly Thr Val
Ile Ala Leu Thr 355 360 365 gtt gca aca cct ctg ctc gtt atc ttc agc
cca atc ctt gtc ccg gct 2709 Val Ala Thr Pro Leu Leu Val Ile Phe
Ser Pro Ile Leu Val Pro Ala 370 375 380 385 ctc atc aca gtt gca ctc
ctc atc acc ggt ttt ctt tcc tct gga ggg 2757 Leu Ile Thr Val Ala
Leu Leu Ile Thr Gly Phe Leu Ser Ser Gly Gly 390 395 400 ttt ggc att
gcc gct ata acc gtt ttc tct tgg att tac aag 2799 Phe Gly Ile Ala
Ala Ile Thr Val Phe Ser Trp Ile Tyr Lys 405 410 415 taagcacaca
tttatcatct tacttcataa ttttgtgcaa tatgtgcatg catgtgttga 2859
gccagtagct ttggatcaat ttttttggta gaataacaaa tgtaacaata agaaattgca
2919 aattctaggg aacatttggt taactaaata cgaaatttga cctagctagc
ttgaatgtgt 2979 ctgtgtatat catctatata ggtaaaatgc ttggtatgat
acctattgat tgtgaatagg 3039 tac gca acg gga gag cac cca cag gga tca
gac aag ttg gac agt gca 3087 Tyr Ala Thr Gly Glu His Pro Gln Gly
Ser Asp Lys Leu Asp Ser Ala 420 425 430 agg atg aag ttg gga agc aaa
gct cag gat ctg aaa gac aga gct cag 3135 Arg Met Lys Leu Gly Ser
Lys Ala Gln Asp Leu Lys Asp Arg Ala Gln 435 440 445 tac tac gga cag
caa cat act ggt ggg gaa cat gac cgt gac cgt act 3183 Tyr Tyr Gly
Gln Gln His Thr Gly Gly Glu His Asp Arg Asp Arg Thr 450 455 460 cgt
ggt ggc cag cac act act taagttaccc cactgatgtc atcgtctaga 3234 Arg
Gly Gly Gln His Thr Thr 465 470 tttaaatgca agcttaaata agtatgaact
aaaatgcatg taggtgtaag agctcatgga 3294 gagcatggaa tattgtatcc
gaccatgtaa cagtataata actgagctcc atctcacttc 3354 ttctatgaat
aaacaaagga tgttatgata tattaacact ctatctatgc accttattgt 3414
tctatgataa atttcctctt attattataa atcatctgaa tcgtgacggc ttatggaatg
3474 cttcaaatag tacaaaaaca aatgtgtact ataagacttt ctaaacaatt
ctaactttag 3534 cattgtgaac gagacataag tgttaagaag acataacaat
tataatggaa gaagtttgtc 3594 tccatttata tattatatat tacccactta
tgtattatat taggatgtta aggagacata 3654 acaattataa agagagaagt
ttgtatccat ttatatatta tatactaccc atttatatat 3714 tatacttatc
cacttattta atgtctttat aaggtttgat ccatgatatt tctaatattt 3774
tagttgatat gtatatgaaa aggtactatt tgaactctct tactctgtat aaaggttgga
3834 tcatccttaa agtgggtcta tttaatttta ttgcttctta cagataaaaa
aaaattatga 3894 gttggtttga taaaatattg aaggatttaa aataataata
aataataaat aacatataat 3954 atatgtatat aaatttatta taatataaca
tttatctata aaaaagtaaa tattgtcata 4014 aatctataca atcgtttagc
cttgctggaa cgaatctcaa ttatttaaac gagagtaaac 4074 atatttgact
ttttggttat ttaacaaatt attatttaac actatatgaa attttttttt 4134
tttatcagca aagaataaaa ttaaattaag aaggacaatg gtgtcccaat ccttatacaa
4194 ccaacttcca caagaaagtc aagtcagaga caacaaaaaa acaagcaaag
gaaatttttt 4254 aatttgagtt gtcttgtttg ctgcataatt tatgcagtaa
aacactacac ataacccttt 4314 tagcagtaga gcaatggttg accgtgtgct
tagcttcttt tattttattt ttttatcagc 4374 aaagaataaa taaaataaaa
tgagacactt cagggatgtt tcaaccctta tacaaaaccc 4434 caaaaacaag
tttcctagca ccctaccaac taaggtacc 4473
* * * * *