U.S. patent application number 10/166899 was filed with the patent office on 2003-05-15 for 4,4-disubstituted-3,4-dihydro-2(1h)-quinazolines useful as hiv reverse transcriptase inhibitors.
Invention is credited to Corbett, Jeffrey W., Ko, Soo S..
Application Number | 20030092722 10/166899 |
Document ID | / |
Family ID | 27366273 |
Filed Date | 2003-05-15 |
United States Patent
Application |
20030092722 |
Kind Code |
A1 |
Corbett, Jeffrey W. ; et
al. |
May 15, 2003 |
4,4-disubstituted-3,4-dihydro-2(1H)-quinazolines useful as HIV
reverse transcriptase inhibitors
Abstract
The present invention relates to
4,4-disubstituted-3,4-dihydro-2(1H)-quina- zolinones of formula I:
1 or stereoisomeric forms, stereoisomeric mixtures, or
pharmaceutically acceptable salt forms thereof, which are useful as
inhibitors of HIV reverse transcriptase, and to pharmaceutical
compositions and diagnostic kits comprising the same, and methods
of using the same for treating viral infection or as an assay
standard or reagent.
Inventors: |
Corbett, Jeffrey W.;
(Portage, MI) ; Ko, Soo S.; (Hockessin,
DE) |
Correspondence
Address: |
BRISTOL-MYERS SQUIBB PHARMA COMPANY
PATENT DEPARTMENT
P.O. BOX 4000
PRINCETON
NJ
08543-4000
US
|
Family ID: |
27366273 |
Appl. No.: |
10/166899 |
Filed: |
June 11, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10166899 |
Jun 11, 2002 |
|
|
|
09630824 |
Aug 2, 2000 |
|
|
|
6423718 |
|
|
|
|
10166899 |
Jun 11, 2002 |
|
|
|
09056820 |
Apr 8, 1998 |
|
|
|
6124302 |
|
|
|
|
60043115 |
Apr 9, 1997 |
|
|
|
60071322 |
Jan 14, 1998 |
|
|
|
Current U.S.
Class: |
514/266.3 ;
514/228.2; 514/234.5; 514/266.2; 544/116; 544/231; 544/284;
544/286; 544/60 |
Current CPC
Class: |
C07D 401/06 20130101;
C07D 239/80 20130101 |
Class at
Publication: |
514/266.3 ;
544/231; 544/284; 544/286; 544/60; 544/116; 514/266.2; 514/228.2;
514/234.5 |
International
Class: |
A61K 031/541; A61K
031/5377; A61K 031/517; A61K 031/519; C07D 417/02; C07D 413/02;
C07D 239/72 |
Claims
What is claimed as new and desired to be secured by Letter Patent
of United States is:
1. A compound of formula (I): 29or a stereoisomer or
pharmaceutically acceptable salt thereof, wherein: R.sup.1 is
C.sub.1-3 alkyl substituted with 1-7 halogen; R.sup.2 is selected
from C.sub.1-5 alkyl substituted with 1-2 R.sup.4, C.sub.2-5
alkenyl substituted with 1-2 R.sup.4, and C.sub.2-5 alkynyl
substituted with 1 R.sup.4; R.sup.3, at each occurrence, is
independently selected from C.sub.1-4 alkyl, OH, C.sub.1-4 alkoxy,
F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6,
NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a; alternatively, if two
R.sup.3,s are present and are attached to adjacent carbons, then
they may combine to form --OCH.sub.2O--; R.sup.4 is selected from
C.sub.3-5 cycloalkyl substituted with 0-2 R.sup.3, phenyl
substituted with 0-5 R.sup.3, and a 5-6 membered heterocyclic
system containing 1-3 heteroatoms selected from O, N, and S,
substituted with 0-2 R.sup.3; R.sup.5 and R.sup.5a are
independently selected from H and C.sub.1-3 alkyl; R.sup.6 is
selected from H, OH, C.sub.1-4 alkyl, C.sub.1-4 alkoxy, and
NR.sup.5R.sup.5a; R.sup.7 is selected from C.sub.1-3 alkyl and
C.sub.1-3 alkoxy; R.sup.8 is selected from H, C.sub.3-5 cycloalkyl,
and C.sub.1-3 alkyl; and, n is selected from 0, 1, 2, 3, and 4.
2. A compound according to claim 1, wherein: R.sup.1 is C.sub.1-3
alkyl substituted with 1-7 halogen; R.sup.2 is selected from
C.sub.1-5 alkyl substituted with 1 R.sup.4, C.sub.2-5 alkenyl
substituted with 1 R.sup.4, and C.sub.2-5 alkynyl substituted with
1 R.sup.4; R.sup.3, at each occurrence, is independently selected
from C.sub.1-4 alkyl, OH, C.sub.1-4 alkoxy, F, Cl, Br, I,
NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6, NHC(O)R.sup.7, and
NHC(O)NR.sup.5R.sup.5a; alternatively, if two R.sup.3's are present
and are attached to adjacent carbons, then they may combine to form
--OCH.sub.2O--; R.sup.4 is selected from C.sub.3-5 cycloalkyl
substituted with 0-2 R.sup.3, phenyl substituted with 0-2 R.sup.3,
and a 5-6 membered heterocyclic system containing 1-3 heteroatoms
selected from O, N, and S, substituted with 0-1 R.sup.3; R.sup.5
and R.sup.5a are independently selected from H, CH.sub.3 and
C.sub.2H.sub.5; R.sup.6 is selected from H, OH, CH.sub.3,
C.sub.2H.sub.5, OCH.sub.3, OC.sub.2H.sub.5, and NR5R.sup.5a;
R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5, OCH.sub.3, and
OC.sub.2H.sub.5; R.sup.8 is selected from H, cyclopropyl, CH.sub.3
and C.sub.2H.sub.5; and, n is selected from 0, 1, 2, and 3.
3. A compound according to claim 2, wherein: R.sup.1 is selected
from CF.sub.3, and C.sub.2F.sub.5; R.sup.2 is selected from
C.sub.1-3 alkyl substituted with 1 R.sup.4, C.sub.2-3 alkenyl
substituted with 1 R.sup.4, and C.sub.2-3 alkynyl substituted with
1 R.sup.4; R.sup.3, at each occurrence, is independently selected
from C.sub.1-3 alkyl, OH, C.sub.1-3 alkoxy, F, Cl, Br, I,
NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6, NHC(O)R.sup.7, and
NHC(O)NR.sup.5R.sup.5a; alternatively, if two R.sup.3's are present
and are attached to adjacent carbons, then they may combine to form
--OCH.sub.2O--; R.sup.4 is selected from C.sub.3-5 cycloalkyl
substituted with 0-2 R.sup.3, phenyl substituted with 0-2 R.sup.3,
and a 5-6 membered heterocyclic system containing 1-3 heteroatoms
selected from O, N, and S, substituted with 0-1 R.sup.3; R.sup.5
and R.sup.5a are independently selected from H, CH.sub.3 and
C.sub.2H.sub.5; R.sup.6 is selected from H, OH, CH.sub.3,
C.sub.2H.sub.5, OCH.sub.3, OC.sub.2H.sub.5, and NR.sup.5R.sup.5a;
R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5, OCH.sub.3, and
OC.sub.2H.sub.5; R.sup.8 is selected from H, CH.sub.3 and
C.sub.2H.sub.5; and, n is selected from 0, 1, and 2.
4. A compound according to claim 3, wherein: R.sup.1 is CF.sub.3;
R.sup.2 is selected from C.sub.1-3 alkyl substituted with 1
R.sup.4, C.sub.2-3 alkenyl substituted with 1 R.sup.4, and
C.sub.2-3 alkynyl substituted with 1 R.sup.4; R.sup.3, at each
occurrence, is independently selected from C.sub.1-3 alkyl, OH,
C.sub.1-3 alkoxy, F, C.sup.1, NR.sup.5R.sup.5a, NO.sub.2, CN,
C(O)R.sup.6, NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a;
alternatively, if two R.sup.3's are present and are attached to
adjacent carbons, then they may combine to form --OCH.sub.2O--;
R.sup.4 is selected from cyclopropyl substituted with 0-1 R.sup.3,
phenyl substituted with 0-2 R.sup.3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected from O, N,
and S, substituted with 0-1 R.sup.3, wherein the heterocyclic
system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl,
3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl,
4-isoxazolyl, and 2-imidazolyl; R.sup.5 and R.sup.5a are
independently selected from H, CH.sub.3 and C.sub.2H.sub.5; R.sup.6
is selected from H, OH, CH.sub.3, C.sub.2H.sub.5, OCH.sub.3,
OC.sub.2H.sub.5, and NR.sup.5R.sup.5a; R.sup.7 is selected from
CH.sub.3, C.sub.2H.sub.5, OCH.sub.3, and OC.sub.2H5; R.sup.8 is
selected from H, CH.sub.3 and C.sub.2H.sub.5; and, n is selected
from 1 and 2.
5. A compound according to claim 4, wherein the compound is of
formula Ia: 30
6. A compound according to claim 4, wherein the compound is of
formula Ia: 31
7. A compound according to claim 1, wherein the compound 1s
selected from:
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-q-
uinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethy-
l-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4--
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyri-
dyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quina-
zolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone; (+/-)
-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trif-
luoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylet-
hynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-q-
uinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethy-
l-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4--
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylet-
hyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-qui-
nazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluorome-
thyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluor-
o-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-E-4-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone; and,
(-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluorometh-
yl-3,4-dihydro-2(1H)-quinazolinone; or a pharmaceutically
acceptable salt thereof.
8. A compound according of formula II: 32or a stereoisomer or
pharmaceutically acceptable salt thereof, wherein: R.sup.2 is
C.ident.CR.sup.4a; R.sup.3 is selected from C.sub.1-4 alkyl, OH,
C.sub.1-4 alkoxy, F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN,
C(O)R.sup.6, NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a; R.sup.4a is
selected from methyl, ethyl, n-propyl, i-propyl, i-butyl, t-butyl,
and i-pentyl; R.sup.5 and R.sup.5a are independently selected from
H and C.sub.1-3 alkyl; R.sup.6 is selected from H, OH, C.sub.1-4
alkyl, C.sub.1-4 alkoxy, and NR.sup.5R.sup.5a; R.sup.7 is selected
from C.sub.1-3 alkyl and C.sub.1-3 alkoxy; R.sup.8 is selected from
H, C.sub.3-5 cycloalkyl, and C.sub.1-3 alkyl; and, n is selected
from 0, 1, 2, 3, and 4.
9. A compound according to claim 8, wherein: R.sup.2 is
C.ident.C--R.sup.4a; R.sup.3 is selected from C.sub.1-4 alkyl, OH,
C.sub.1-4 alkoxy, F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN,
C(O)R.sup.6, and NHC(O)R.sup.7; R.sup.4a is selected from methyl,
ethyl, n-propyl, i-propyl, i-butyl, t-butyl, and i-pentyl; R.sup.5
and R.sup.5a are independently selected from H, CH.sub.3 and
C.sub.2H.sub.5; R.sup.6 is selected from H, OH, CH.sub.3,
C.sub.2H.sub.5, OCH.sub.3, OC.sub.2HS, and NR.sup.5R.sup.5a;
R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5, OCH.sub.3, and
OC.sub.2H.sub.5; R.sup.8 is selected from H, cyclopropyl, CH.sub.3
and C.sub.2H.sub.5; and, n is selected from 0, 1, and 2.
10. A compound according to claim 9, wherein the compound is of
formula IIa: 33
11. A compound according to claim 9, wherein the compound is of
formula IIb: 34
12. A compound according to claim 8, wherein the compound 1s
selected from:
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihy-
dro-2(1H)-quinazolinone;
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromet-
hyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopropylethynyl-
-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-qui-
nazolinone; (+/-)
-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro--
2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3-
,4-dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluorom-
ethyl-3,4-dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-
-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-q-
uinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone; and,
(+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromet-
hyl-3,4-dihydro-2(1H)-quinazolinone; or a pharmaceutically
acceptable salt thereof.
13. A pharmaceutical composition, comprising: a pharmaceutically
acceptable carrier and a therapeutically effective amount of a
compound of claim 1 or a pharmaceutically acceptable salt
thereof.
14. A method for treating HIV infection, comprising: administering
to a host in need of such treatment a therapeutically effective
amount of a compound of claim 1, or a pharmaceutically acceptable
salt form thereof.
15. A method of treating HIV infection which comprises
administering, in combination, to a host in need thereof a
therapeutically effective amount of: (a) a compound of claim 1 or
stereoisomeric forms, mixtures of stereoisomeric forms, or
pharmaceutically acceptable salts thereof; and, (b) at least one
compound selected from the group consisting of HIV reverse
transcriptase inhibitors and HIV protease inhibitors.
16. A method according to claim 15, wherein the reverse
transcriptase inhibitor is selected from AZT, 3TC, ddl, ddC, d4T,
delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY
73497, Ro 18,893, loviride, trovirdine, MKC-442, and HBY 097, and
the protease inhibitor is selected from saquinavir, ritonavir,
indinavir, vx-478, nelfinavir, KNI-272, CGP-61755, U-140690, and
ABT-378.
17. A method according to claim 16, wherein the reverse
transcriptase inhibitor is selected from AZT and 3TC and the
protease inhibitor is selected from saquinavir, nelfinavir,
ritonavir, and indinavir.
18. A pharmaceutical kit useful for the treatment of HIV infection,
which comprises a therapeutically effective amount of: (a) a
compound of claim 1 or stereoisomeric forms, mixtures of
stereoisomeric forms, or pharmaceutically acceptable salts thereof;
and, (b) at least one compound selected from the group consisting
of HIV reverse transcriptase inhibitors and HIV protease
inhibitors, in one or more sterile containers.
19. A method of inhibiting HIV present in a body fluid sample which
comprises treating the body fluid sample with an effective amount
of a compound according to claim 1 or a salt form thereof.
Description
FIELD OF THE INVENTION
[0001] This invention relates generally to
4,4-disubstituted-3,4-dihydro-2 (1H)-quinazolinones which are
useful as inhibitors of HIV reverse transcriptase, pharmaceutical
compositions and diagnostic kits comprising the same, methods of
using the same for treating viral infection or as assay standards
or reagents, and intermediates and processes for making the
same.
BACKGROUND OF THE INVENTION
[0002] Two distinct retroviruses, human immunodeficiency virus
(HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically
linked to the immunosuppressive disease, acquired immunodeficiency
syndrome (AIDS). HIV seropositive individuals are initially
asymptomatic but typically develop AIDS related complex (ARC)
followed by AIDS. Affected individuals exhibit severe
immunosuppression which predisposes them to debilitating and
ultimately fatal opportunistic infections.
[0003] The disease AIDS is the end result of an HIV-1 or HIV-2
virus following its own complex life cycle. The virion life cycle
begins with the virion attaching itself to the host human T-4
lymphocyte immune cell through the bonding of a glycoprotein on the
surface of the virion's protective coat with the CD4 glycoprotein
on the lymphocyte cell. Once attached, the virion sheds its
glycoprotein coat, penetrates into the membrane of the host cell,
and uncoats its RNA. The virion enzyme, reverse transcriptase,
directs the process of transcribing the RNA into single-stranded
DNA. The viral RNA is degraded and a second DNA strand is created.
The now double-stranded DNA is integrated into the human cell's
genes and those genes are used for virus reproduction.
[0004] At this point, RNA polymerase transcribes the integrated DNA
into viral RNA. The viral RNA is translated into the precursor
gag-pol fusion polyprotein. The polyprotein is then cleaved by the
HIV protease enzyme to yield the mature viral proteins. Thus, HIV
protease is responsible for regulating a cascade of cleavage events
that lead to the virus particle's maturing into a virus that is
capable of full infectivity.
[0005] The typical human immune system response, killing the
invading virion, is taxed because the virus infects and kills the
immune system's T cells. In addition, viral reverse transcriptase,
the enzyme used in making a new virion particle, is not very
specific, and causes transcription mistakes that result in
continually changed glycoproteins on the surface of the viral
protective coat. This lack of specificity decreases the immune
system's effectiveness because antibodies specifically produced
against one glycoprotein may be useless against another, hence
reducing the number of antibodies available to fight the virus. The
virus continues to reproduce while the immune response system
continues to weaken. Eventually, the HIV largely holds free reign
over the body's immune system, allowing opportunistic infections to
set in and without the administration of antiviral agents,
immunomodulators, or both, death may result.
[0006] There are at least three critical points in the virus's life
cycle which have been identified as possible targets for antiviral
drugs: (1) the initial attachment of the virion to the T-4
lymphocyte or macrophage site, (2) the transcription of viral RNA
to viral DNA (reverse transcriptase, RT), and (3) the processing of
gag-pol protein by HIV protease.
[0007] Inhibition of the virus at the second critical point, the
viral RNA to viral DNA transcription process, has provided a number
of the current therapies used in treading AIDS. This transcription
must occur for the virion to reproduce because the virion's genes
are encoded in RNA and the host cell reads only DNA. By introducing
drugs that block the reverse transcriptase from completing the
formation of viral DNA, HIV-1 replication can be stopped.
[0008] A number of compounds that interfere with viral replication
have been developed to treat AIDS. For example, nucleoside analogs,
such as 3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxycytidine
(ddC), 2',3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddI),
and 2',3'-dideoxy-3'-thiacytidine (3TC) have been shown to be
relatively effective in halting HIV replication at the reverse
transcriptase (RT) stage.
[0009] An active area of research is in the discovery of
non-nucleoside HIV reverse transcriptase inhibitors. As an example,
it has been found that certain benzoxazinones and quinazolinones
are active in the inhibition of HIV reverse transcriptase, the
prevention or treatment of infection by HIV and the treatment of
AIDS.
[0010] U.S. Pat. No. 5,519,021 describe reverse transcriptase
inhibitors which are benzoxazinones of the formula: 2
[0011] wherein X is a halogen, Z may be O.
[0012] EP 0,530,994 and WO 93/04047 describe HIV reverse
transcriptase inhibitors which are quinazolinones of the formula A:
3
[0013] wherein G is a variety of groups, R.sup.3 and R.sup.4 may be
H, Z may be O, R.sup.2 may be unsubstituted alkyl, unsubstituted
alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl,
unsubstituted heterocycle, and optionally substituted aryl, and
R.sup.1 may be a variety of groups including substituted alkyl.
[0014] WO 95/12583 also describes HIV reverse transcriptase
inhibitors of formula A. In this publication, G is a variety of
groups, R.sup.3 and R.sup.4 may be H, Z may be 0, R.sup.2 is
substituted alkenyl or substituted alkynyl, and R.sup.1 is
cycloalkyl, alkynyl, alkenyl, or cyano. WO 95/13273 illustrates the
asymmetric synthesis of one of the compounds of WO 95/12583,
(S)-(-)-6-chloro-4-cyclopropyl-3,4-dihydro-4((2- -pyridy)ethynyl)-2
(1H)-quinazolinone.
[0015] Synthetic procedures for making quinazolinones like those
described above are detailed in the following references: Houpis et
al, Tetr. Lett. 1994, 35(37), 6811-6814; Tucker et al, J. Med.
Chem. 1994, 37, 2437-2444; and, Huffman et al, J. Org. Chem. 1995,
60, 1590-1594.
[0016] DE 4,320,347 illustrates quinazolinones of the formula:
4
[0017] wherein R is a phenyl, carbocyclic ring, or a heterocyclic
ring. Compounds of this sort are not considered to be part of the
present invention.
[0018] Even with the current success of reverse transcriptase
inhibitors, it has been found that HIV patients can become
resistant to a single inhibitor. Thus, it is desirable to develop
additional inhibitors to further combat HIV infection.
SUMMARY OF THE INVENTION
[0019] Accordingly, one object of the present invention is to
provide novel reverse transcriptase inhibitors.
[0020] It is another object of the present invention to provide a
novel method for treating HIV infection which comprises
administering to a host in need of such treatment a therapeutically
effective amount of at least one of the compounds of the present
invention or a pharmaceutically acceptable salt form thereof.
[0021] It is another object of the present invention to provide a
novel method for treating HIV infection which comprises
administering to a host in need thereof a therapeutically effective
combination of (a) one of the compounds of the present invention
and (b) one or more compounds selected form the group consisting of
HIV reverse transcriptase inhibitors and HIV protease
inhibitors.
[0022] It is another object of the present invention to provide
pharmaceutical compositions with reverse transcriptase inhibiting
activity comprising a pharmaceutically acceptable carrier and a
therapeutically effective amount of at least one of the compounds
of the present invention or a pharmaceutically acceptable salt form
thereof.
[0023] It is another object of the present invention to provide a
method of inhibiting HIV present in a body fluid sample which
comprises treating the body fluid sample with an effective amount
of a compound of the present invention.
[0024] It is another object of the present invention to provide a
kit or container containing at least one of the compounds of the
present invention in an amount effective for use as a standard or
reagent in a test or assay for determining the ability of a
potential pharmaceutical to inhibit HIV reverse transcriptase, HIV
growth, or both.
[0025] These and other objects, which will become apparent during
the following detailed description, have been achieved by the
inventors' discovery that compounds of formula (I): 5
[0026] wherein R.sup.1, R.sup.2, R.sup.3, and R.sup.8 are defined
below, stereoisomeric forms, mixtures of stereoisomeric forms, or
pharmaceutically acceptable salt forms thereof, are effective
reverse transcriptase inhibitors.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0027] [1] Thus, in a first embodiment, the present invention
provides a novel compound of formula I: 6
[0028] or a stereoisomer or pharmaceutically acceptable salt
thereof, wherein:
[0029] R.sup.1 is C.sub.1-3 alkyl substituted with 1-7 halogen;
[0030] R.sup.2 is selected from C.sub.1-5 alkyl substituted with
1-2 R.sup.4, C.sub.2-5 alkenyl substituted with 1-2 R.sup.4, and
C2-S alkynyl substituted with 1 R.sup.4;
[0031] R.sup.3, at each occurrence, is independently selected from
C.sub.1-4 alkyl, OH, C.sub.1-4 alkoxy, F, Cl, Br, I,
NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6, NHC(O)R.sup.7, and
NHC(O)NR.sup.5R.sup.5a;
[0032] alternatively, if two R.sup.3's are present and are attached
to adjacent carbons, then they may combine to form
--OCH.sub.2O--;
[0033] R.sup.4 is selected from C.sub.3-5 cycloalkyl substituted
with 0-2 R.sup.3, phenyl substituted with 0-5 R.sup.3, and a 5-6
membered heterocyclic system containing 1-3 heteroatoms selected
from O, N, and S, substituted with 0-2 R.sup.3;
[0034] R.sup.5 and R.sup.5a are independently selected from H and
C.sub.1-3 alkyl;
[0035] R.sup.6 is selected from H, OH, C.sub.1-4 alkyl, C.sub.1-4
alkoxy, and NR.sup.5R.sup.5a;
[0036] R.sup.7 is selected from C.sub.1-3 alkyl and C.sub.1-3
alkoxy;
[0037] R.sup.8 is selected from H, C.sub.3-5 cycloalkyl, and
C.sub.1-3 alkyl; and,
[0038] n is selected from 0, 1, 2, 3, and 4.
[0039] [2] In a preferred embodiment, the present invention
provides a novel compound of formula I, wherein:
[0040] R.sup.1 is C.sub.1-3 alkyl substituted with 1-7 halogen;
[0041] R.sup.2 is selected from C.sub.1-5 alkyl substituted with 1
R.sup.4, C.sub.2-5 alkenyl substituted with 1 R.sup.4, and
C.sub.2-5 alkynyl substituted with 1 R.sup.4;
[0042] R.sup.3, at each occurrence, is independently selected from
C.sub.1-4 alkyl, OH, C.sub.1-4 alkoxy, F, Cl, Br, I,
NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6, NHC(O)R.sup.7, and
NHC(O)NR.sup.5R.sup.5a;
[0043] alternatively, if two R.sup.3's are present and are attached
to adjacent carbons, then they may combine to form --OCH.sub.2O--;
R.sup.4 is selected from C.sub.3-5 cycloalkyl substituted with 0-2
R.sup.3, phenyl substituted with 0-2 R.sup.3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected from O, N,
and S, substituted with 0-1 R.sup.3;
[0044] R.sup.5 and R.sup.5a are independently selected from H,
CH.sub.3 and C.sub.2H.sub.5;
[0045] R.sup.6 is selected from H, OH, CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, OC2Hs, and NR.sup.5R.sup.5a; R.sup.7 is selected from
CH.sub.3, C.sub.2H.sub.5, OCH.sub.3, and OC.sub.2H.sub.5;
[0046] R.sup.8 is selected from H, cyclopropyl, CH.sub.3 and
C.sub.2H.sub.5; and, n is selected from 0, 1, 2, and 3.
[0047] [3] In a more preferred embodiment, the present invention
provides a novel compound of formula I, wherein:
[0048] R.sup.1 is selected from CF.sub.3, and C.sub.2F.sub.5;
[0049] R.sup.2 is selected from C.sub.1-3 alkyl substituted with 1
R.sup.4, C.sub.2-3 alkenyl substituted with 1 R.sup.4, and
C.sub.2-3 alkynyl substituted with 1 R.sup.4; R.sup.3, at each
occurrence, is independently selected from C.sub.1-3 alkyl, OH,
C.sub.1-3 alkoxy, F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN,
C(O)R.sup.6, NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a;
[0050] alternatively, if two R.sup.3's are present and are attached
to adjacent carbons, then they may combine to form
--OCH.sub.2O--;
[0051] R.sup.4 is selected from C.sub.3-5 cycloalkyl substituted
with 0-2 R.sup.3, phenyl substituted with 0-2 R.sup.3, and a 5-6
membered heterocyclic system containing 1-3 heteroatoms selected
from O, N, and S, substituted with 0-1 R.sup.3;
[0052] R.sup.5 and R.sup.5a are independently selected from H,
CH.sub.3 and C.sub.2H.sub.5;
[0053] R.sup.6 is selected from H, OH, CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, OC.sub.2H.sub.5, and NR.sup.5R.sup.5a;
[0054] R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, and OC.sub.2H.sub.5;
[0055] R.sup.8 is selected from H, CH.sub.3 and C.sub.2H.sub.5;
and, n is selected from 0, 1, and 2.
[0056] [4] In an even more preferred embodiment, the present
invention provides a novel compound of formula I, wherein:
[0057] R.sup.1 is CF.sub.3;
[0058] R.sup.2 is selected from C.sub.1-3 alkyl substituted with 1
R.sup.4, C.sub.2-3 alkenyl substituted with 1 R.sup.4, and
C.sub.2-3 alkynyl substituted with 1 R.sup.4;
[0059] R.sup.3, at each occurrence, is independently selected from
C.sub.1-3 alkyl, OH, C.sub.1-3 alkoxy, F, C.sup.1,
NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6,
[0060] NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a;
[0061] alternatively, if two R.sup.3's are present and are attached
to adjacent carbons, then they may combine to form
--OCH.sub.2O--;
[0062] R.sup.4 is selected from cyclopropyl substituted with 0-1
R.sup.3, phenyl substituted with 0-2 R.sup.3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected from O, N,
and S, substituted with 0-1 R.sup.3, wherein the heterocyclic
system is selected from 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl,
3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl,
4-isoxazolyl, and 2-imidazolyl;
[0063] R.sup.5 and R.sup.5a are independently selected from H,
CH.sub.3 and C.sub.2H.sub.5;
[0064] R.sup.6 is selected from H, OH, CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, OC.sub.2H.sub.5, and NR5R.sup.5a;
[0065] R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, and OC2H.sub.5;
[0066] R.sup.8 is selected from H, CH.sub.3 and C.sub.2H.sub.5;
and, n is selected from 1 and 2.
[0067] [5] In a further preferred embodiment, wherein the compound
is of formula Ia 7
[0068] [5] In a further preferred embodiment, wherein the compound
is of formula Ib: 8
[0069] [7] In a further preferred embodiment, the compound of
formula I is selected from:
[0070]
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0071]
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0072]
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)--
quinazolinone;
[0073]
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro--
2(1H)-quinazolinone;
[0074]
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro--
2(1H)-quinazolinone;
[0075]
(+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-
-quinazolinone;
[0076]
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihyd-
ro-2(1H)-quinazolinone;
[0077] (+/-) -5,6-Difluoro-4- (2-pyridyl)
ethynyl-4-trifluoromethyl-3,4-di- hydro-2(1H)-quinazolinone;
[0078]
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(-
1H)-quinazolinone;
[0079]
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0080]
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0081]
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)--
quinazolinone;
[0082]
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-dihydro--
2(1H)-quinazolinone;
[0083]
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-2(1H)-qu-
inazolinone;
[0084]
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
[0085]
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
[0086]
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-
-2(1H)-quinazolinone;
[0087]
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-
-2(1H)-quinazolinone;
[0088]
(+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3,4-dihyd-
ro-2(1H)-quinazolinone; and,
[0089]
(-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0090] or a pharmaceutically acceptable salt thereof.
[0091] [8] In a second embodiment, the present invention provides a
novel compound of formula II: 9
[0092] or a stereoisomer or pharmaceutically acceptable salt
thereof, wherein:
[0093] R.sup.2 is C.ident.C--R.sup.4a;
[0094] R.sup.3 is selected from C.sub.1-4 alkyl, OH, C.sub.1-4
alkoxy, F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6,
NHC(O)R.sup.7, and NHC(O)NR.sup.5R.sup.5a;
[0095] R.sup.4a is selected from methyl, ethyl, n-propyl, i-propyl,
i-butyl, t-butyl, and i-pentyl;
[0096] R.sup.5 and R.sup.5a are independently selected from H and
C.sub.1-3 alkyl; R.sup.6 is selected from H, OH, C.sub.1-4 alkyl,
C.sub.1-4 alkoxy, and NR.sup.5R.sup.5a;
[0097] R.sup.7 is selected from C.sub.1-3 alkyl and C.sub.1-3
alkoxy;
[0098] R.sup.8 is selected from H, C.sub.3-5 cycloalkyl, and
C.sub.1-3 alkyl; and,
[0099] n is selected from 0, 1, 2, 3, and 4.
[0100] [9] In another preferred embodiment, the present invention
provides a novel compound of formula II, wherein:
[0101] R.sup.2 is C.ident.C--R.sup.4a;
[0102] R.sup.3 is selected from C.sub.1-4 alkyl, OH, C.sub.1-4
alkoxy, F, Cl, Br, I, NR.sup.5R.sup.5a, NO.sub.2, CN, C(O)R.sup.6,
and NHC(O)R.sup.7;
[0103] R.sup.4a is selected from methyl, ethyl, n-propyl, i-propyl,
i-butyl, t-butyl, and i-pentyl;
[0104] R.sup.5 and R.sup.5a are independently selected from H,
CH.sub.3 and C.sub.2H.sub.5;
[0105] R.sup.6 is selected from H, OH, CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, OC.sub.2H.sub.5, and NR.sup.5R.sup.5a;
[0106] R.sup.7 is selected from CH.sub.3, C.sub.2H.sub.5,
OCH.sub.3, and OC.sub.2H.sub.5;
[0107] R.sup.8 is selected from H, cyclopropyl, CH.sub.3 and
C.sub.2H.sub.5; and,
[0108] n is selected from 0, 1, and 2.
[0109] [10] In a further preferred embodiment, wherein the compound
is of formula IIa 10
[0110] [11] In a further preferred embodiment, wherein the compound
is of formula IIb: 11
[0111] [12] In another more preferred embodiment, the compound of
formula II is selected from:
[0112]
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
[0113]
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-q-
uinazolinone;
[0114]
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-dihydro-2(-
1H)-quinazolinone;
[0115] (+/-)
-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone;
[0116]
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
[0117] (+/-)
-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(1H)-
-quinazolinone;
[0118]
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2(1-
H)-quinazolinone;
[0119]
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-q-
uinazolinone;
[0120]
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0121]
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dihydro-2-
(1H)-quinazolinone;
[0122]
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-
-quinazolinone; and,
[0123]
(+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-
-quinazolinone;
[0124] or a pharmaceutically acceptable salt thereof.
[0125] In a third embodiment, the present invention provides a
novel pharmaceutical composition comprising a pharmaceutically
acceptable carrier and a therapeutically effective amount of a
compound of formula I or II or pharmaceutically acceptable salt
form thereof.
[0126] In a fourth embodiment, the present invention provides a
novel method for treating HIV infection which comprises
administering to a host in need of such treatment a therapeutically
effective amount of a compound of formula I or II or
pharmaceutically acceptable salt form thereof.
[0127] In a fifth embodiment, the present invention provides a
novel method of treating HIV infection which comprises
administering, in combination, to a host in need thereof a
therapeutically effective amount of:
[0128] (a) a compound of formula I or II; and,
[0129] (b) at least one compound selected from the group consisting
of HIV reverse transcriptase inhibitors and HIV protease
inhibitors.
[0130] In another preferred embodiment, the reverse transcriptase
inhibitor is selected from AZT, 3TC, ddI, ddC, d4T, delavirdine,
TIBO derivatives, BI-RG-587, nevirapine, L-697,661, LY 73497, Ro
18,893, loviride, trovirdine, MKC-442, and HBY 097, and the
protease inhibitor is selected from saquinavir, ritonavir,
indinavir, VX-478, nelfinavir, KNI-272, CGP-61755, U-140690, and
ABT-378.
[0131] In an even more preferred embodiment, the reverse
transcriptase inhibitor is selected from AZT and 3TC and the
protease inhibitor is selected from saquinavir, ritonavir,
nelfinavir, and indinavir.
[0132] In a still further preferred ebodiment, the reverse
transcriptase inhibitor is AZT.
[0133] In another still further preferred embodiment, the protease
inhibitor is indinavir.
[0134] In a sixth embodiment, the present invention provides a
pharmaceutical kit useful for the treatment of HIV infection, which
comprises a therapeutically effective amount of:
[0135] (a) a compound of formula I or II; and,
[0136] (b) at least one compound selected from the group consisting
of HIV reverse transcriptase inhibitors and HIV protease
inhibitors, in one or more sterile containers.
[0137] In a seventh embodiment, the present invention provides a
novel method of inhibiting HIV present in a body fluid sample which
comprises treating the body fluid sample with an effective amount
of a compound of formula I or II.
[0138] In a eighth embodiment, the present invention to provides a
novel a kit or container comprising a compound of formula I or II
in an amount effective for use as a standard or reagent in a test
or assay for determining the ability of a potential pharmaceutical
to inhibit HIV reverse transcriptase, HIV growth, or both.
DEFINITIONS
[0139] As used herein, the following terms and expressions have the
indicated meanings. It will be appreciated that the compounds of
the present invention contain an asymmetrically substituted carbon
atom, and may be isolated in optically active or racemic forms. It
is well known in the art how to prepare optically active forms,
such as by resolution of racemic forms or by synthesis, from
optically active starting materials. All chiral, diastereomeric,
racemic forms and all geometric isomeric forms of a structure are
intended, unless the specific stereochemistry or isomer form is
specifically indicated.
[0140] The processes of the present invention are contemplated to
be practiced on at least a multigram scale, kilogram scale,
multikilogram scale, or industrial scale. Multigram scale, as used
herein, is preferably the scale wherein at least one starting
material is present in 10 grams or more, more preferably at least
50 grams or more, even more preferably at least 100 grams or more.
Multikilogram scale, as used herein, is intended to mean the scale
wherein more than one kilogram of at least one starting material is
used. Industrial scale as used herein is intended to mean a scale
which is other than a laboratory scale and which is sufficient to
supply product sufficient for either clinical tests or distribution
to consumers.
[0141] As used herein, "alkyl" is intended to include both branched
and straight-chain saturated aliphatic hydrocarbon groups having
the specified number of carbon atoms. Examples of alkyl include,
but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl,
s-butyl; t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended
to include both branched and straight-chain saturated aliphatic
hydrocarbon groups having the specified number of carbon atoms,
substituted with 1 or more halogen (for example --C.sub.vF.sub.w
where v=1 to 3 and w=1 to (2v+1)). Examples of haloalkyl include,
but are not limited to, trifluoromethyl, trichloromethyl,
pentafluoroethyl, and pentachloroethyl. "Alkoxy" represents an
alkyl group as defined above with the indicated number of carbon
atoms attached through an oxygen bridge. Examples of alkoxy
include, but are not limited to, methoxy, ethoxy, n-propoxy,
i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy.
"Cycloalkyl" is intended to include saturated ring groups, such as
cyclopropyl, cyclobutyl, or cyclopentyl. Alkenyl" is intended to
include hydrocarbon chains of either a straight or branched
configuration and one or more unsaturated carbon-carbon bonds which
may occur in any stable point along the chain, such as ethenyl,
propenyl and the like. "Alkynyl" is intended to include hydrocarbon
chains of either a straight or branched configuration and one or
more triple carbon-carbon bonds which may occur in any stable point
along the chain, such as ethynyl, propynyl and the like.
[0142] "Halo" or "halogen" as used herein refers to fluoro, chloro,
bromo and iodo. "Counterion" is used to represent a small,
negatively charged species such as chloride, bromide, hydroxide,
acetate, sulfate and the like.
[0143] As used herein, "aryl" or "aromatic residue" is intended to
mean an aromatic moiety containing the specified number of carbon
atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or
"carbocyclic residue" is intended to mean any stable 3- to 5-
membered monocyclic ring, which may be saturated or partially
unsaturated. Examples of such carbocyles include, but are not
limited to, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, biphenyl,
naphthyl, indanyl, adamantyl, or tetrahydronaphthyl (tetralin).
[0144] As used herein, the term "heterocycle" or "heterocyclic
system" is intended to mean a stable 5- to 6- membered monocyclic
heterocyclic ring which is saturated partially unsaturated or
unsaturated (aromatic), and which consists of carbon atoms and from
1 to 3 heteroatoms independently selected from the group consisting
of N, O and S. The nitrogen and sulfur heteroatoms may optionally
be oxidized. The heterocyclic ring may be attached to its pendant
group at any heteroatom or carbon atom which results in a stable
structure. The heterocyclic rings described herein may be
substituted on carbon or on a nitrogen atom if the resulting
compound is stable. If specifically noted, a nitrogen in the
heterocycle may optionally be quaternized. It is preferred that
when the total number of S and O atoms in the heterocycle exceeds
1, then these heteroatoms are not adjacent to one another. It is
preferred that the total number of S and O atoms in the heterocycle
is not more than 1. As used herein, the term "aromatic heterocyclic
system" is intended to mean a stable 5- to 6- membered monocyclic
heterocyclic aromatic ring which consists of carbon atoms and from
1 to 3 heterotams independently selected from the group consisting
of N, O and S. It is preferred that the total number of S and O
atoms in the aromatic heterocycle is not more than 1.
[0145] Examples of heterocycles include, but are not limited to,
2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-thiadiazinyl,
2H,6H-1,5,2-dithiazinyl, furanyl, furazanyl, imidazolidinyl,
imidazolinyl, imidazolyl, isoxazolyl, morpholinyl, oxadiazolyl,
1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl,
1,3,4-oxadiazolyl, oxazolidinyl., oxazolyl, piperazinyl,
piperidinyl, pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl,
purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl,
pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl,
pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6H-1,2,5-thiadiazinyl,
1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl,
1,3,4-thiadiazolyl, thiazolyl, thienyl, thienothiazolyl,
thienooxazolyl, thienoimidazolyl, thiophenyl, triazinyl,
1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, and
1,3,4-triazolyl. Preferred heterocycles include, but are not
limited to, pyridinyl, furanyl, thienyl, pyrrolyl, pyrazolyl,
imidazolyl, and oxazolidinyl. Also included are fused ring and
spiro compounds containing, for example, the above
heterocycles.
[0146] As used herein, "HIV reverse transcriptase inhibitor" is
intended to refer to both nucleoside and non-nucleoside inhibitors
of HIV reverse transcriptase (RT). Examples of nucleoside RT
inhibitors include, but are not limited to, AZT, ddC, ddI, d4T, and
3TC. Examples of non-nucleoside RT inhibitors include, but are no
limited to, delavirdine (Pharmacia and Upjohn U90152S), TIBO
derivatives, BI-RG-587, nevirapine (Boehringer Ingelheim),
L-697,661, LY 73497, Ro 18,893 (Roche), loviride (Janssen),
trovirdine (Lilly), MKC-442(Triangle), and HBY 097 (Hoechst).
[0147] As used herein, "HIV protease inhibitor" is intended to
refer to compounds which inhibit HIV protease. Examples include,
but are not limited, saquinavir (Roche, Ro3l-8959), ritonavir
(Abbott, ABT-538), indinavir (Merck, MK-639), VX-478 (Vertex/Glaxo
Wellcome), nelfinavir (Agouron, AG-1343), KNI-272(Japan Energy),
CGP-61755 (Ciba-Geigy), U-140690 (Pharmacia and Upjohn), and
ABT-378. Additional examples include the cyclic protease inhibitors
disclosed in WO93/07128, WO 94/19329, WO 94/22840, and PCT
Application Number US96/03426.
[0148] As used herein, "pharmaceutically acceptable salts" refer to
derivatives of the disclosed compounds wherein the parent compound
1s modified by making acid or base salts thereof. Examples of
pharmaceutically acceptable salts include, but are not limited to,
mineral or organic acid salts of basic residues such as amines;
alkali or organic salts of acidic residues such as carboxylic
acids; and the like. The pharmaceutically acceptable salts include
the conventional non-toxic salts or the quaternary ammonium salts
of the parent compound formed, for example, from non-toxic
inorganic or organic acids. For example, such conventional
non-toxic salts include those derived from inorganic acids such as
hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric
and the like; and the salts prepared from organic acids such as
acetic, propionic, succinic, glycolic, stearic, lactic, malic,
tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic,
phenylacetic, glutamic, benzoic, salicylic, sulfanilic,
2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane
disulfonic, oxalic, isethionic, and the like.
[0149] The pharmaceutically acceptable salts of the present
invention can be synthesized from the parent compound which
contains a basic or acidic moiety by conventional chemical methods.
Generally, such salts can be prepared by reacting the free acid or
base forms of these compounds with a stoichiometric amount of the
appropriate base or acid in water or in an organic solvent, or in a
mixture of the two; generally, nonaqueous media like ether, ethyl
acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists
of suitable salts are found in Remington's Pharmaceutical Sciences,
17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, the
disclosure of which is hereby incorporated by reference.
[0150] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication commensurate with a reasonable
benefit/risk ratio.
[0151] "Prodrugs" are intended to include any covalently bonded
carriers which release the active parent drug according to formula
(I) or other formulas or compounds of the present invention in vivo
when such prodrug is administered to a mammalian subject. Prodrugs
of a compound of the present invention, for example formula (I),
are prepared by modifying functional groups present in the compound
in such a way that the modifications are cleaved, either in routine
manipulation or in vivo, to the parent compound. Prodrugs include
compounds of the present invention wherein the hydroxy or amino
group is bonded to any group that, when the prodrug is administered
to a mammalian subject, cleaves to form a free hydroxyl or free
amino, respectively. Examples of prodrugs include, but are not
limited to, acetate, formate and benzoate derivatives of alcohol
and amine functional groups in the compounds of the present
invention, and the like.
[0152] "Stable compound" and "stable structure" are meant to
indicate a compound that is sufficiently robust to survive
isolation to a useful degree of purity from a reaction mixture, and
formulation into an efficacious therapeutic agent. Only stable
compounds are contempleted by the present invention.
[0153] "Substituted" is intended to indicate that one or more
hydrogens on the atom indicated in the expression using
"substituted" is replaced with a selection from the indicated
group(s), provided that the indicated atom's normal valency is not
exceeded, and that the substitution results in a stable compound.
When a substituent is keto (i.e., .dbd.O) group, then 2 hydrogens
on the atom are replaced.
[0154] "Therapeutically effective amount" is intended to include an
amount of a compound of the present invention or an amount of the
combination of compounds claimed effective to inhibit HIV infection
or treat the symptoms of HIV infection in a host. The combination
of compounds 1s preferably a synergistic combination. Synergy, as
described for example by Chou and Talalay, Adv. Enzyme Regul.
22:27-55 (1984), occurs when the effect (in this case, inhibition
of HIV replication) of the compounds when administered in
combination is greater than the additive effect of the compounds
when administered alone as a single agent. In general, a
synergistic effect is most clearly demonstrated at suboptimal
concentrations of the compounds. Synergy can be in terms of lower
cytotoxicity, increased antiviral effect, or some other beneficial
effect of the combination compared with the individual
components.
SYNTHESIS
[0155] The compounds of the present invention can be prepared in a
number of ways well known to one skilled in the art of organic
synthesis. The compounds of the present invention can be
synthesized using the methods described below, together with
synthetic methods known in the art of synthetic organic chemistry,
or variations thereon as appreciated by those skilled in the art.
Preferred methods include but are not limited to those methods
described below. Each of the references cited below are hereby
incorporated herein by reference. 12
[0156] Scheme 1 illustrates a method of preparing keto-anilines
from an appropriately substituted 2-aminobenzoic acid. The acid is
converted to its N-methoxy-N-methyl amide derivative which can then
be displaced to obtain the R.sup.1-substituted ketone. The
keto-anilines are useful intermediates for the presently claimed
compounds. 13
[0157] Scheme 2 describes another method of preparing
keto-anilines, this time from an appropriately substituted aniline.
After iodination and amine protection, a group such as
trifluoromethyl can be introduced using a strong base and ethyl
trifluoroacetate. Deprotection provides the keto-aniline.
Additional means of preparing keto-anilines are known to one of
skill in the art, e.g, Houpis et al, Tetr. Lett. 1994, 35(37),
6811-6814, the contents of which are hereby incorporated herein by
reference. 14
[0158] Another method of making 2-trifluoroacetylanilines is shown
in Scheme 3. After forming the protected aniline, the amide is then
reduced and the trifluoromethyl group added. Oxidation with an
oxidant, such as MnO.sub.2, provides the useful intermediate.
15
[0159] Using the general method detailed in Scheme 4, one can
prepare compounds of the present invention. Keto-aniline 1, which
may be prepared by the methods desribed in Schemes 1 and 2, is
treated with trimethylsilyl isocyanate in dry tetrahydofuran in the
presence of dimethylaminopyridine followed by tetrabutylammonium
fluoride to give the hydroxy-urea 2. The hydroxy-urea 2 is then
dehydrated with a dehydrating agent such as 4 .ANG. molecular
sieves in refluxing toluene or xylenes to give the ketimine 3. A
substituted acetylenic R.sup.2 group is added by treating the
ketimine 3 with a lithium acetylide, which is prepared in a
separate vessel by reacting the corresponding substituted acetylene
with n-butyllithium in dry tetrahydrofuran, to give the
4,4-disubstituted 3,4-dihydro-2(1H)-quinazolinone 4, a compound of
formula I. The acetylenic bond of the compound 4 may be reduced,
e.g., by catalytic hydrogenation, to give the corresponding alkenyl
group (not shown) or the saturated compound 5.
[0160] Other R.sup.2 groups may also be introduced by directly
reacting the imine 3 with a lithiate R.sup.2Li or a Grignard
reagent R.sup.2MgX in the presence or absence of Lewis acid
catalyst, such as BF.sub.3 etherate. See also Huffman et al, J.
Org. Chem. 1995, 60, 1590-1594, the contents of which are hereby
incorporated herein by reference.
[0161] In certain instances, one enantiomer of a compound of
Formula I or II may display superior activity compared with the
other. When required, separation of the racemic material can be
achieved by HPLC using a chiral column as exemplified in Examples
27-34 (Scheme 4) or by a resolution using a resolving agent such as
camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem.
1994, 37, 2437-2444. A chiral compound of Formula I may also be
directly synthesized using a chiral catalyst or a chiral ligand,
e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594.
[0162] Other features of the invention will become apparent in the
course of the following descriptions of exemplary embodiments which
are given for illustration of the invention and are not intended to
be limiting thereof.
EXAMPLES
[0163] Abbreviations used in the Examples are defined as follows:
".degree. C." for degrees Celsius, "d" for doublet, "dd" for
doublet of doublets, "eq" for equivalent or equivalents, "g" for
gram or grams, "mg" for milligram or milligrams, "mL" for
milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for
hour or hours, "Im" for multiplet, "M" for molar, "min" for minute
or minutes, "MHz" for megahertz, "MS" for mass spectroscopy, "nmr"
or "NMR" for nuclear magnetic resonance spectroscopy, "t" for
triplet, "TLC" for thin layer chromatography, "EDAC" for
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride,
"DIPEA" for diisopropylethylamine, "TBAF" for tetrabutylammonium
fluoride, "LAH" for lithium aluminium hydride, and "TEA" for
triethylamine.
Example 1
Prepration of
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone (R4 Cyclopropyl)
[0164] 16
[0165] Step 1. Synthesis of II-a from I-a.
[0166] To a solution of compound I-a (4.55 g, 20.2 mmol) in
anhydrous THF (40 mL) was added dimethylaminopyridine (0.25 g, 2.02
mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL, 52.5 mmol).
The mixture was stirred at room temperature for approximately 16
hours, then tetrabutylammonium fluoride (21 mL of 1 M solution in
THF) was added. The thick slurry was diluted with additional THF
(20 mL) and stirred at room temperature for 0.5 hours. The THF was
removed under reduced pressure, the residue was taken up in EtOAc
(100 mL) and washed sequentially with 1 N HCl (70 mL), saturated
aqueous NaHCO.sub.3 (70 mL) and saturated aqueous NaCl (50 mL). The
organic phase was dried over MgSO4, filtered and concentrated under
reduced pressure to afford a light yellow solid. The yellow color
was removed upon trituration with hexanes to afford IIa (5.09 g,
94%) as a white solid: .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 9.06 (br s, 1H), 7.48 (s, 1H), 7.40 (br s, 1H), 7.34 (dd,
J=8.8, 2.6 Hz, 1H), 6.97 (d, J=8.8 Hz, 1H); .sup.19F NMR (282 MHz,
acetone-d.sub.6) .delta. -86.33, -86.35; IR (KBr Pellet) 1724,
1678, 1398, 1198, 1174 cm.sup.-1; MS (CI) m/e 266 (MH.sup.+,
100).
[0167] Step 2. Synthesis of III-a from II-a.
[0168] A suspension of II-a (5.09 g, 19.1 mmol) in toluene (150 mL)
containing 4 .ANG. molecular sieves (approximately 100 mg) was
heated at reflux for 16 hours. The resulting clear yellow solution
was cooled to room temperature, the precipitated solids were
dissolved in acetone and the molecular sieves were removed by
vacuum filtration. The filtrate was concentrated under reduced
pressure, and triturated with hexanes to afford III-a (4.25 g, 89%)
as a yellow solid: .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta.
7.86-7.82(m, 2H), 7.61 (d, J=8.8 Hz, 1H); .sup.19F NMR (282 MHz,
acetone-d.sub.6) .delta. -67.88.
[0169] Step 3. Synthesis of IV-a from IIIa.
[0170] A solution of cyclopropylacetylene (13.0 mL of 30 wt %
solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF (118
mL) was cooled to -78.degree. C., treated with n-BuLi (32.8 mL of
1.6 M solution in hexanes, 52.4 mmol), warmed to 0.degree. C. in an
ice bath, and aged for 0.5 h. To a solution of III-a (3.12 g, 12.6
mmol) in anhydrous THF (66 mL) at -78.degree. C. was added the
lithium acetylide over approximately 10 minutes. To this was added
boron trifluoride etherate (0.89 g, 0.80 mL, 6.28 mmol), followed
by removal of the cooling bath. The reaction was allowed to reach
room temperature and stirred at room temperature for 4 hours before
quenching with 1 M citric acid (100 mL). The mixture was
concentrated under reduced pressure to 1/2 original volume, diluted
with EtOAc (200 mL), the aqueous phase was removed and the organic
phase was sequentially washed with saturated aqueous NaHCO.sub.3
(100 ML), and saturated aqueous NaCl (100 mL). The organic phase
was dried over MgSO.sub.4, filtered and concentrated under reduced
pressure. The crude material was purified by flash chromatography
(3% MeOH/CH.sub.2Cl.sub.2) to afford a thick yellow oil from which
was obtained crystalline IV-a (R.sup.4=cyclopropyl) (3.85 g, 97%)
as a white solid: mp 86.6-88.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 8.95 (br s, 1H), 7.51 (br s, 1H), 7.43 (br
s, 1H), 7.40 (dd, J=8.8, 2.4 Hz, 1H), 7.02(d, J=8.8 Hz, 1H),
1.49-1.41 (m, 1H), 0.93-0.82(m, 1H), 0.77-0.74 (m, 1H); .sup.19F
NMR (282 MHz, acetone-d.sub.6) .delta. -82.96; IR (KBr Pellet)
1696, 1172 cm.sup.-1; MS (CI) m/e calc'd for
C.sub.14H.sub.10ClF.sub.3N.sub.2O: 315.051201, found 315.051626;
315 (MH.sup.+, 51), 332 (M+NH.sub.4.sup.+, 100); Analysis calc'd
for C.sub.14H.sub.10N.sub.2ClF.sub.3O.0.25H.sub.2O: C, 52.68; H,
3.32; N, 8.78; found: C, 52.61; H, 3.35; N, 8.28.
Example 2
Preparation of
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-dih-
ydro-2(1H)-quinazolinone (R.sup.4 Isopropyl)
[0171] A solution of III-a (50 mg, 0.201 mmol) was treated with the
lithium acetylide derived from 3-methyl-1-butyne (62 mg, 93 mL,
0.905 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by flash chromatography (35%
EtOAc/hexanes) to afford 26 mg (41%) of the desired product:
.sup.1H NMR (300 MHz, ) .delta. 9.08 (br s, 1H), 7.59 (br s, 1H),
7.53 (br s, 1H), 7.40 (dd, J=8.4, 2.2 Hz, 1H), 7.02(d, J=8.8 Hz,
1H), 2.81-2.68 (m, 1H), 1.20 (dd, J=6.6 Hz, 6H); .sup.19F NMR (282
MHz, acetone-d.sub.6) .delta. 83.05; MS (CI) m/e calc'd for
C.sub.14H.sub.12ClF.sub.3N.sub.2O: 317.066851, found 317.069433;
317 (MH.sup.+, 43), 334 (M+NH.sub.4.sup.+, 100).
Example 3
Preparation of
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-d-
ihydro-2(1H)-quinazolinone (R.sup.4=2-Pyridyl)
[0172] A solution of III-a (100 mg, 0.402 mmol) was treated with
the the lithium acetylide derived from 2-ethynylpyridine (0.19 g,
1.81 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 85 mg (60%) of the desired
product: mp 105.degree. C. dec.; .sup.1H NMR (300 MHz, acetone-d6)
.delta. 9.14 (br s, 1H), 8.64-8.61 (m, 1H), 7.89-7.84 (m, 2H),
7.70-7.66 (m, 2H), 7.48-7.43 (m, 2H), 7.09 (d, J=8.8 Hz, 1H);
.sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -82.48; IR (KBr
Pellet) 1704, 1430, 1186 cm.sup.-1; MS (CI) m/e calc'd for
C.sub.16H.sub.10ClF.sub.3N.sub.3O: 352.046450, found 352.046956;
352(MH.sup.+, 100); Analysis calc'd for
C.sub.16H.sub.9ClF.sub.3N.sub.3O.- 0.125H.sub.2O: C, 54.3; H, 2.56;
N, 11.9; found: C, 54.71; H, 3.03; N, 11.3.
Example 4
Preparation of
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-
-2(1H)-quinazolinone (R.sup.4=Ethyl)
[0173] A solution of III-a (100 mg, 0.402 mmol) was treated with
the the lithium acetylide derived from 1-butyne (109 mg, 2.01 mmol)
according to the procedure of Step 3 of Example 1. The resulting
crude material was purified by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) to
afford 79 mg (65%) of the desired product: .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 9.05 (br s, 1H), 7.54 (br s, 2H),
7.41-7.39 (m, 1H), 7.02(d, J=8.4 Hz, 1H), 2.36-2.32 (m, 2H),
2.18-1.13 (m, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-82.99; MS (CI) m/e calc'd for C.sub.13H.sub.10ClF.sub.3N.sub.2O:
303.051201, found 303.051882; 303 (MH.sup.+, 55), 320 (M+NH4+,
100).
Example 5
Preparation of
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone (R.sup.4=Phenyl)
[0174] A solution of III-a (100 mg, 0.402 mmol) was treated with
the the lithium acetylide derived from phenylacetylene (185 mg,
1.81 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 54 mg (38%) of the desired
product: .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 9.07 (br s,
1H), 7.74 (br s, 1H), 7.67 (br s, 1H), 7.62-7.58 (m, 2H), 7.48-7.40
(m, 4H), 7.08 (d, J=8.4 Hz, 1H); .sup.19F NMR (282 MHz,
acetone-d.sub.6) .delta. -82.67; IR (KBr Pellet) 1696, 1186
cm.sup.-1; MS (CI) m/e calc'd for
C.sub.17H.sub.11ClF.sub.3N.sub.2O: 351.051201, found 351.051704;
351 (MH.sup.+, 51), 368 (M+NH.sub.4.sup.+, 100); Analysis calc'd
for C.sub.17H.sub.10ClF.sub.3N.sub.2O.0.25H.sub.2O: C, 57.48; H,
2.98; N, 7.89; found: C, 57.00; H, 3.03; N, 7.48.
Example 6
Preparation of
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4--
dihydro-2(1H)-quinazolinone (R.sup.4Cyclopropyl)
[0175] 17
[0176] Step 1. Synthesis of VI-a from V-a.
[0177] A solution of V-a (0.50 g, 2.28 mmol) was treated with
dimethylaminopyridine and trimethylsilyl isocyanate as described in
Step 1 of Example 1 to afford 0.58 g (97%) of the desired product:
.sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 8.81 (br s, 1H),
7.17 (br s, 1H), 7.11 (br s, 1H), 7.00-6.92(m, 2H), 6.83 (s, 1H),
3.76 (s, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) 67
-85.99.
[0178] Step 2. Synthesis of VII-a from VI-a.
[0179] A solution of VI-a (0.58 g, 2.21 mmol) was heated in toluene
at reflux as described in Step 2 of Example 1 to afford 0.50 g
(93%) of the desired product: .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 7.52(br s, 2H), 7.27 (s, 1H), 3.90 (s,
3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -68.08.
[0180] Step 3. Synthesis of VIII-a from VII-a.
[0181] A solution of VII-a (100 mg, 0.410 mmol) was treated with
the the lithium acetylide derived from cyclopropylacetylene (0.41
mL of 30 wt % solution in toluene/THF/hexanes, 1.85 mmol) according
to the procedure of Step 3 of Example 1. The resulting crude
material was purified by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) to
afford 103 mg (81%) of the desired product: .sup.1H NMR (300 MHz,
acetone-d6) .delta. 8.77 (br s, 1H), 7.29 (br s, 1H), 7.06 (br s,
1H), 6.99-6.90 (m, 2H), 3.77 (s, 3H), 1.46-1.38 (m, 1H), 0.91-0.85
(m, 2H), 0.79-0.72(m, 2H); .sup.19F NMR (282 MHz, acetone-d.sub.6)
.delta. -82.61; MS (CI) m/e calcld for
C.sub.15H.sub.14F.sub.3N.sub.2O.sub.2: 311.100738, found
311.099970; 311 (MH.sup.+, 100).
Example 7
Preparation of
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone (R.sup.4=Isopropyl)
[0182] A solution of VII-a (100 mg, 0.410 mmol) was treated with
the the lithium acetylide derived from 3-methyl-1-butyne (126 mg,
0.19 mL, 1.85 mmol) according to the procedure of Step 3 of Example
1. The resulting crude material was purified by flash
chromatography (2.5% MeOH/CH.sub.2Cl.sub.2) to afford 30 mg (24%)
of the desired product: mp 228-229.degree. C.; .sup.1H NMR (300
MHz, acetone-d.sub.6) .delta. 8.72(br s, 1H), 7.27 (br s, 1H), 7.10
(br s, 1H), 7.00-6.91 (m, 2H), 3.77 (s, 3H), 2.73-2.67 (m, 1H),
1.20 (dd, J=7.0, 1.5 Hz, 6H); .sup.19F NMR (282 MHz,
acetone-d.sub.6) .delta. -82.71; IR (KBr Pellet) 1696, 1428, 1190,
1176 cm.sup.-1; MS (CI) m/e calcld for
C.sub.15H.sub.16F.sub.3N.sub- .2O.sub.2: 313.116388, found
313.115871; 313 (MH.sup.+, 100), 330 (M+NH.sub.4.sup.+, 15);
Analysis calc'd for C.sub.15H.sub.15F.sub.3N.sub.- 2O.sub.2: C,
57.69; H, 4.84; N, 8.97; found: C, 57.74; H, 5.01; N, 8.57.
Example 8
Preparation of
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4--
dihydro-2(1H)-quinazolinone (R.sup.4=2-Pyridyl)
[0183] A solution of VII-a (100 mg, 0.410 mmol) was treated with
the the lithium acetylide derived from 2-ethynylpyridine (0.19 g,
1.85 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by flash chromatography (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 56 mg (39%) of the desired
product: .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 8.81 (br s,
1H), 8.61 (d, J=4.8 Hz, 1H), 7.88-7.82(m, 1H), 7.66 (d, J=7.7 Hz,
1H), 7.61 (br s, 1H), 7.46-7.42(m, 1H), 7.23 (br s, 1H), 7.06-6.97
(m, 2H), 3.79 (s, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6)
.delta. -82.13; IR (KBr Pellet) 1698, 1518, 1464, 1430, 1244, 1208,
1184 cm.sup.-1; MS (CI) m/e calc'd for
C.sub.17H.sub.13F.sub.3N.sub.3O.sub.2: 348.095987, found
348.095629; 348 (MH.sup.+, 100); Analysis calc'd for
C.sub.17H.sub.12F.sub.3N.sub.3O.- sub.2.0.25 C.sub.3H.sub.6O: C,
58.92; H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35.
Example 9
Preparation of
(+/-)-6-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-dihyd-
ro-2(1H)-quinazolinone (R.sup.4=Phenyl)
[0184] A solution of VII-a (100 mg, 0.410 mmol) was treated with
the the lithium acetylide derived from phenylacetylene (0.19 g,
1.85 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by flash chromatography (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 34 mg (24%) of the desired
product: mp 206.2-207.7.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 8.85 (br s, 1H), 7.60-7.57 (m, 3H),
7.49-7.39 (m, 3H), 7.21 (br s, 1H), 7.05-6.96 (m, 2H), 3.79 (s,
3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -82.32; IR
(KBr Pellet) 1696, 1516, 1430, 1236, 1204, 1184, 1128 cm.sup.-1; MS
(CI) m/e calcld for C.sub.18H.sub.14F.sub.3N.sub.2O.sub.2:
347.100738, found 347.101482; 347 (MH.sup.+, 100), 364
(M+NH.sub.4.sup.+, 48); Analysis calc'd for
C.sub.18H.sub.13F.sub.3N.sub.2O.sub.2: C, 62.43; H, 3.78; N, 8.10;
found: C, 62.35; H, 3.58; N, 7.83.
Example 10
Preparation of
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3-
,4-dihydro-2(1H)-quinazolinone (R.sup.4=Cyclopropyl)
[0185] 18
[0186] Step 1. Synthesis of X-a from IX-a.
[0187] A solution of IX-a (6.46 g, 28.7 mmol) was treated with
dimethylaminopyridine and trimethylsilyl isocyanate as described in
Step 1 of Example 1 to afford 6.74 g (88%) of the desired product:
.sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 9.13 (br s, 1H),
7.45-7.32(m, 2H), 7.18 (br s, 1H), 6.85-6.80 (m, 1H); .sup.19F NMR
(282 MHz, acetone-d.sub.6) .delta. -86.6 (d, 17.2, 3),
-137.52-137.68 (m, 1), -148.47-148.59 (m, 1).
[0188] Step 2. Synthesis of XI-a from X-a.
[0189] A solution of X-a (6.74 g, 25.1 mmol) was heated in xylenes
at reflux as described in Step 2 of Example 1, substituting xylenes
for toluene, to afford 6.3 g (100%) of the desired product: .sup.1H
NMR (300 MHz, acetone-d6) .delta. -7.92-7.83 (m, 1H), 7.46-7.44 (m,
1H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -70.7 (d,
38.7, 3), -136.72(s, 1), -146.47-146.57 (m, 1).
[0190] Step 3. Synthesis of XII-a from XI-a.
[0191] A solution of XI-a (6.28 g, 25.1 mmol) was treated with the
the lithium acetylide derived from cyclopropylacetylene (24.9 mL of
30 wt % solution in toluene/THF/hexanes, 0.113 mol) according to
the procedure of Step 3 of Example 1. The resulting crude yellow
oil was dissolved in acetone and concentrated under reduced
pressure to deliver a yellow solid. Crystallization from acetone
afforded 5.98 g (75%) of the desired material: mp 86.5-88.5.degree.
C.; .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 9.01 (br s, 1H),
7.46 (br s, 1H), 7.44-7.35 (m, 1H), 6.86-6.81 (m, 1H), 1.41-1.37
(m, 1H), 0.90-0.83 (m, 1H), 0.74-0.69 (m, 1H); .sup.19F NMR (282
MHz, acetone-d.sub.6) .delta. -83.3 (d, J=12.9, 1), -136.04-136.23
(m, 1), -148.14-148.26 (m, 1); IR (KBr Pellet) 1706, 1516, 1442,
1246, 1214, 1196 cm.sup.-1; MS (CI) m/e calc'd for
C.sub.14H.sub.10F.sub.5N.sub.2O: 317.071329, found 317.070836; 317
(MH.sup.+, 100), 334 (M+NH.sub.4+, 62); Analysis calc'd for
C.sub.14H.sub.9F.sub.5N.sub.2O: C, 53.17; H, 2.88; N, 8.87; found:
C, 53.30; H, 3.16; N, 8.53.
Example 11
Preparation of (+/-)-5,6-Difluoro-4-isopropylethynyl
-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(R.sup.4=Isopropyl)
[0192] A solution of XI-a (7.24 g, 28.9 mmol) was treated with the
the lithium acetylide derived from 3-methyl-1-butyne (8.87 g, 13.3
mL, 0.130 mol) according to the procedure of Step 3 of Example 1.
The resulting crude material was purified by flash chromatography
(2.5% MeOH/CH.sub.2Cl.sub.2) to afford a yellow oil.
Crystallization from acetone afforded 6.77 g (74%) of the desired
product: mp 79-80.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 9.02(br s, 1H), 7.50 (br s, 1H), 7.44-7.35
(m, 1H), 6.87-6.82(m, 1H), 2.69-2.65 (m, 1H), 1.17 (d, J=7.0 Hz,
6H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -83.4 (d,
J=12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS (CI)
m/e calc'd for C.sub.14H.sub.12F.sub.5N.sub.2O: 319.086979, found
319.087376; 319 (MH.sup.+, 100), 336 (M+NH.sub.4+, 76).
Example 12
Preparation of
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3-
,4-dihydro-2(1H)-quinazolinone (R.sup.4=2-Pyridyl)
[0193] A solution of XI-a (100 mg, 0.400 mmol) was treated with the
the lithium acetylide derived from 2-ethynylpyridine (0.19 g, 1.80
mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by flash chromatography (4%
MeOH/CH.sub.2Cl.sub.2) to afford 83 mg (59%) of the desired
product: mp 219-220.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 9.15 (br s, 1H), 8.61 (d, J=4.4 Hz, 1H),
7.88-7.82(m, 2H), 7.63 (dd, J=7.0, 1.1 Hz, 1H), 7.47-7.42(m, 2H),
6.94-6.88 (m, 1H); .sup.19F NMR (282 MHz, acetone-d6) 6-82.8 (d,
J=12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1); IR (KBr
Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238, 1226, 1198, 1186
cm.sup.-1; MS (CI) m/e calc'd for C.sub.16H.sub.9F.sub.5N.sub.3O:
354.066578, found 354.067821; 354 (MH.sup.+, 100).
Example 13
Preparation of
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dih-
ydro-2(1H)-quinazolinone (R.sup.4=2-Ethyl)
[0194] A solution of XI-a (100 mg, 0.400 mmol) was treated with the
the lithium acetylide derived from 1-butyne (97 mg, 1.80 mmol)
according to the procedure of Step 3 of Example 1. The resulting
crude material was purified by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) to
afford 69 mg (57%) of the desired product: mp 191-194.degree. C.;
.sup.1H NMR (300 MHz, acetone-d6) .delta. 9.03 (br s, 1H), 7.50 (br
s, 1H), 7.45-7.35 (m, 1H), 6.87-6.82(m, 1H), 2.34-2.27 (m, 2H),
1.20-1.15 (m, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6)
.delta.0-83.3 (d, J=12.9, 3), -135.79-135.98 (m, 1), -148.16-148.29
(m, 1); IR (KBr Pellet) 1704, 1686, 1518, 1444, 1244, 1210, 1192,
1172 cm.sup.-1; MS (CI) m/e calc'd for
C.sub.13H.sub.10F.sub.5N.sub.2O: 305.071329, found 305.071146; 305
(MH.sup.+, 100); Analysis calc'd for
C.sub.13H.sub.9F.sub.5N.sub.2O: C, 51.33; H, 2.98; N, 9.22; found:
C, 51.00; H, 2.79; N, 8.99.
Example 14
Preparation of
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-di-
hydro-2(1H)-quinazolinone (R.sup.4=Phenyl)
[0195] A solution of XI-a (100 mg, 0.400 mmol) was treated with the
the lithium acetylide derived from phenylacetylene (0.18 g, 0.20
mL, 1.80 mmol) according to the procedure of Step 3 of Example 1.
The resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 92 mg (65%) of the desired
product: .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 9.14 (br s,
1H), 7.80 (br s, 1H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H),
6.92-6.87 (m, 1H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-83.0 (d, J=12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1);
MS (CI) m/e calc'd for C.sub.17H.sub.10F.sub.5N.su- b.2O:
353.071329, found 353.071716; 353 (MH.sup.+, 42), 370
(M+NH.sub.4.sup.+, 100).
Example 15
Preparation of
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone (R.sup.4=Isopropyl) Synthesis of XIII-a from
XII-a.
[0196] A solution of XIII-a (R.sup.4=isopropyl) (26 mg, 82 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
(35 mg) under H.sub.2(1 atm) for 16 hours. The catalyst was removed
by vacuum filtration through Celite and the filter cake was washed
with EtOAc. The combined filtrates were concentrated under reduced
pressure to afford 26 mg (100%) of the desired material. No further
purification was necessary: .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 8.88 (br s, 1H), 7.41-7.31 (m, 1H), 6.89-6.81 (m, 2H),
2.55-2.50 (m, 1H), 1.64-1.45 (m, 2H), 1.06-1.02(m, 1H), 0.89 (dd,
J=6.6, 2.2 Hz, 6H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-83.22(d, J=12.1, 3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1);
IR (KBr Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm.sup.-1;
MS (CI) m/e calc'd for C.sub.14H.sub.16F.sub.5N.sub- .2O:
323.118280, found 323.116703; 323 (MH.sup.+, 100), 340
(M+NH.sub.4.sup.+, 57).
Example 16
Preparation of
(+/-)-4-Butyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(-
1H)-quinazolinone (R.sup.4=Ethyl)
[0197] A solution of XIII-a (R.sup.4=ethyl) (20 mg, 66 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
under H.sub.2 according to the procedure of Example 15.
Purification by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) afforded 12 mg
(56%) of the desired product: .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 8.89 (br s, 1H), 7.41-7.32(m, 1H),
6.86-6.81 (m, 2H), 2.57-2.47 (m, 1H), 1.56-1.15 (m, 5H), 0.88 (t,
J=7.3 Hz, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-83.19-83.24 (m, 1), -139.14 (s, 1), -148.49-148.62(m, 1); MS (CI)
m/e calc'd for C.sub.13H.sub.14F.sub.5N.sub.2O: 309.102629, found
309.103555; 309 (MH.sup.+, 100), 326 (M+NH.sub.4.sup.+, 62).
Example 17
Preparation of
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-d-
ihydro-2(1H)-quinazolinone (R.sup.4=Cyclopropyl)
[0198] 19
[0199] Step 1. Synthesis of XV-a from XIV-a.
[0200] A solution of XIII-a (3.07 g, 14.8 mmol) was treated with
dimethylaminopyridine and trimethylsilyl isocyanate as described in
Step 1 of Example 1 to afford 2.81 g (76%) of the desired
product.
[0201] Step 2. Synthesis of XVI-a from XV-a.
[0202] A solution of XV-a (6.74 g, 25.1 mmol) was heated in toluene
at reflux as described in Step 2 of Example 1 to afford 0.73 g
(94%) of the desired product.
[0203] Step 3. Synthesis of XVII-a from XVI-a.
[0204] A solution of XVI-a (100 mg, 0.431 mmol) was treated with
the the lithium acetylide derived from cyclopropylacetylene (1.43
mL of 30 wt % solution in toluene/THF/hexanes, 1.94 mmol) according
to the procedure of Step 3 of Example 1. The resulting crude
material was purified by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) to
afford 44 mg (34%) of the desired product: mp 155.degree. C.;
.sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 8.86 (br s, 1H),
7.36 (br s, 1H), 7.30-7.27 (m, 1H), 7.22-7.15 (m, 1H), 7.04-6.99
(m, 1H), 1.47-1.42(m, 1H), 0.90-0.87 (m, 2H), 0.76-0.75 (m, 2H);
.sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -82.86,
-123.36-123.44; MS (CI) m/e calc'd for C.sub.14H.sub.11F.sub.4N.s-
ub.2O: 299.080751, found 299.079976; 299 (MH.sup.+, 100).
Example 18
Preparation of
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-dih-
ydro-2(1H)-quinazolinone (R4 Isopropyl)
[0205] A solution of XVI-a (100 mg, 0.431 mmol) was treated with
the the lithium acetylide derived from 3-methyl-1-butyne (0.13 g,
0.20 mL, 1.94 mmol) according to the procedure of Step 3 of Example
1. The resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 24 mg (18%) of the desired
product: mp 158.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 9.07 (br s, 1H), 7.60 (br s, 1H), 7.32-7.30 (m, 1H),
7.24-7.16 (m, 1H), 7.05-6.99 (m, 1H), 2.77-2.67 (m, 1H), 1.20 (dd,
J=7.0, 2.6 Hz, 6H); .sup.19F NMR (282 MHz, acetone-d.sub.6)
8-82.95, -123.41-123.49; MS (301) m/e calc'd for
C.sub.14H.sub.13F.sub.4N.sub.2O: 301.096401, found 301.096235; 301
(MH.sup.+, 100).
Example 19
Preparation of
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-d-
ihydro-2(1H)-quinazolinone (R4 2-Pyridyl)
[0206] A solution of XVI-a (100 mg, 0.431 mmol) was treated with
the the lithium acetylide derived from 2-ethynylpyridine (0.20 g,
1.94 mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 65 mg (45%) of the desired
product: mp 155.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 9.02(br s, 1H), 8.60 (d, J=4.0 Hz, 1H), 7.87-7.78 (m, 2H),
7.66 (d, J=7.7 Hz, 1H), 7.45-7.41 (m, 2H), 7.26-7.20 (m, 1H),
7.09-7.05 (m, 1H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-82.36, -122.94-123.02; MS (CI) m/e calc'd for
C.sub.16H.sub.10F.sub.4N.sub.3O: 336.076000, found 336.074156; 336
(MH.sup.+, 25).
Example 20
Preparation of
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-
-2(1H)-quinazolinone (R.sup.4=Ethyl)
[0207] A solution of XVI-a (100 mg, 0.431 mmol) was treated with
the the lithium acetylide derived from 1-butyne (0.10 g, 1.94 mmol)
according to the procedure of Step 3 of Example 1. The resulting
crude material was purified by HPLC (2.5% MeOH/CH.sub.2Cl.sub.2) to
afford 40 mg (33%) of the desired product: mp 190.degree. C.;
.sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 8.86 (br s, 1H),
7.38 (br s, 1H), 7.34-7.31 (m, 1H), 7.22-7.16 (m, 1H), 7.05-7.00
(m, 1H), 2.04-2.01 (m, 2H), 1.19-1.14 (m, 3H); .sup.19F NMR (282
MHz, acetone-d.sub.6) .delta. -75.392, -123.42-123.50; MS (CI) m/e
calc'd for C.sub.13H.sub.11F.sub.4N.sub.2O: 287.080751, found
287.080740; 287 (MH.sup.+, 100).
Example 21
Preparation of
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydr-
o-2(1H)-quinazolinone (R.sup.4=Phenyl)
[0208] A solution of XVI-a (100 mg, 0.431 mmol) was treated with
the the lithium acetylide derived from phenylacetylene (0.20 g,
0.21 mL, 1.94 mmol) according to the procedure of Step 3 of Example
1. The resulting crude material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 41 mg (28%) of the desired
product: mp 107.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 9.00 (br s, 1H), 7.69 (br s, 1H), 7.63-7.59 (m, 2H),
7.50-7.40 (m, 4H), 7.27-7.20 (m, 1H), 7.10-7.05 (m, 1H); .sup.19F
NMR (282 MHz, acetone-d.sub.6) .delta. -82.56, -122.99-123.07; MS
(CI) m/e calc'd for C.sub.17H.sub.11F.sub.4N.sub.2O: 335.080751,
found 335.082057; 335 (MH.sup.+, 74), 352(M+NH.sub.4+, 100).
Example 22
Preparation of
(+/-)-6-Fluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-2(-
1H)-quinazolinone (R.sup.4=Isopropyl) Synthesis of XVIII-a from
XVII-a.
[0209] A solution of XVII-a (R.sup.4=isopropyl) (26 mg, 87 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
under H.sub.2 according to the procedure of Example 15 to afford 15
mg (58%) of the desired product. No further purification was
necessary: mp 179.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 7.02-6.97 (m, 2H), 6.80-6.76 (m, 1H),
2.18-2.09 (m, 2H), 1.92-1.82(m, 2H), 1.52-1.45 (m, 1H), 0.88-0.79
(m, 6H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -82.60,
-123.72-123.84; MS (CI) m/e calc'd for
C.sub.14H.sub.17F.sub.4N.sub.2O: 305.127707, found 305.126790; 305
(MH.sup.+, 100).
Example 23
Preparation of
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4--
dihydro-2(1H)-quinazolinone (R.sup.4=2-Pyridyl)
[0210] A solution of XVII-a (R.sup.4=2-pyridyl) (33 mg, 99 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
under H.sub.2 according to the procedure of Example 15 to afford 10
mg (30%) of the desired product. No further purification was
necessary: mp 88.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 8.35 (d, J=4.4 Hz, 1H), 7.63 (dt, J=7.7, 1.5 Hz, 1H),
7.20-7.13 (m, 3H), 7.04-6.98 (m, 1H), 6.83-6.79 (m, 1H), 2.84-2.78
(m, 1H), 2.68-2.48 (m, 2H), 2.27-2.06 (m, 1H); .sup.19F NMR (282
MHz, acetone-d.sub.6) .delta. -82.58, -123.26-123.34; MS (CI) m/e
calc'd for C.sub.16H.sub.14F.sub.4N.sub.3O: 340.107300, found
340.107719; 340 (MH.sup.+, 100).
Example 24
Preparation of
(+/-)-4-Butyl-6-fluoro-4-trifluoromethyl-3,4-dihydro-2(1H)
-quinazolinone (R.sup.4=Ethyl)
[0211] A solution of XVII-a (R.sup.4=ethyl) (24 mg, 84 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
under H.sub.2 according to the procedure of Example 15 to afford 24
mg (100%) of the desired product. No further purification was
necessary: mp 198.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 7.03-6.97 (m, 2H), 6.80-6.76 (m, 1H),
2.18-2.11 (m, 1H), 1.90-1.81 (m, 1H), 1.30-1.19 (m, 3H), 0.97-0.80
(m, 4H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta. -82.692,
-123.78-123.86; MS (CI) m/e calc'd for C.sub.13H.sub.15F.sub.4N.-
sub.2O: 291.112051, found 291.112227; 291 (MH.sup.+, 100).
Example 25
Preparation of
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro--
2(1H)-quinazolinone (R.sup.4=Phenyl)
[0212] A solution of XVII-a (R.sup.4=phenyl) (30 mg, 90 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10% Pd on carbon
under H.sub.2 according to the procedure of Example 15 to afford 20
mg (67%) of the-desired product. No further purification was
necessary: mp 98.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1H), 2.68-2.60 (m, 1H),
2.48-2.12(m, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-82.67, -123.24-123.32; MS (CI) m/e calc'd for
C.sub.17H.sub.15F.sub.4N.sub.2O: 339.112051, found 339.110781; 339
(MH.sup.+, 100).
Example 26
Preparation of
(+/-)-6-Fluoro-4-methylpropargyl-4-trifluoromethyl-3,4-dihy-
dro-2(1H)-quinazolinone (R.sup.4=Methyl)
[0213] Synthesis of XIX-a from XVI-a.
[0214] A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous THF
(3.5 mL) was cooled to 0.degree. C., treated with n-BuLi (0.97 mL
of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h. To a
solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF (1.9 mL) at
-78.degree. C. was added the lithium anion over 5 minutes, followed
by boron trifluoride etherate (25 mL, 0.194 mmol). The cooling bath
was removed and the mixture was allowed to warm to room
temperature. After 16 h at room temperature, quench by addition of
1 M citric acid (10 mL), dilute with EtOAc (50 mL), separate phases
and wash the organic phase sequentially with saturated aqueous
NaHCO.sub.3 (20 mL) and saturated aqueous NaCl (20 mL). The
resulting material was purified by HPLC (2.5%
MeOH/CH.sub.2Cl.sub.2) to afford 10 mg (9%) of the desired product:
mp 181.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta.
8.91 (br s, 1H), 7.27 (d, 8.4H), 7.18-7.08 (m, 1H), 7.02-6.97 (m,
2H), 3.29 (dd, J=16.8, 2.6 Hz, 1H), 3.00 (dd, J=16.8, 2.2 Hz, 1H),
1.61-1.59 (m, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-81.86, -123.69-123.70; MS (CI) m/e calc'd for
C.sub.13H.sub.11F.sub.4N.sub.2O: 287.080751, found 287.080340; 287
(MH.sup.+, 75), 304 (M+NH.sub.4.sup.+, 100).
1 SCHEME 4: Chiral Resolution 20 21 22 R.sup.3 Compound R.sup.3
Compound R.sup.3 Compound 6-Cl IV-a 6-Cl IV-b 6-Cl IV-c 6-MeO
VIII-a 6-MeO VIII-b 6-MeO VIII-c 5,6-diF XII-a 5,6-diF XII-b
5,6-diF XII-c 6-F XVII-a 6-F XVII-b 6-F XVII-c
Examples 27 and 28
Preparation of
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-dih-
ydro-2(1H)-quinazolinone (Example 27) and
(+)-6-Chloro-4-cyclopropylethyny-
l-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example
28)
[0215] Resolution of IV-b,c from IV-a (R.sup.4=Cyclopropyl).
[0216] Chiral HPLC utilizing a Chiralcel OD column, 3% isopropanol,
5% CH.sub.2Cl.sub.2 and 92% hexanes at ambient temperature with a
1.0 mL/min flow rate and detection at 250 n=afforded seperation of
IV-b from IV-c with enantiomeric excesses of 99% and 99.4%,
respectively. IV-b: mp 106-109.degree. C.; [.alpha.].sub.D.sup.25
-60.34.degree. (c=0.274, MeOH). IV-c: mp105-107.degree. C.;
[.alpha.].sub.D.sup.25+58.330 (c=0.288, MeOH).
Examples 29 and 30
Preparation of (+)-4-Cyclopropylethynyl-5,6-difluoro
-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 29) and
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)-
-quinazolinone (Example 30)
[0217] Resolution of XII-b,c from XII-a (R.sup.4=Cyclopropyl).
[0218] Chiral HPLC utilizing a Chiralpak AD column, 5% water and
95% methanol at ambient temperature with a 0.8 mL/min flow rate and
detection at 250 nm afforded seperation of XII-b from XII-c with
enantiomeric excesses of 100% and 99%, respectively. XII-b: mp
187.degree. C.; [.alpha.].sub.D.sup.25+1.46.degree. (c=0.274,
MeOH). XII-c: mp 187.5-188.8.degree. C.;
[.alpha.].sub.D.sup.25-1.45.degree. (c=0.278, MeOH).
Examples 31 and 32
Preparation of
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-d-
ihydro-2(1H)-quinazolinone (Example 31) and
(+)-5,6-Difluoro-4-isopropylet-
hynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example
32)
[0219] Resolution of XII-b,c from XII-a (R.sup.4=Isopropyl).
[0220] Chiral HPLC utilizing a Chiralpak AD column, 5% water and
95% methanol at ambient temperature with a 0.5 mL/min flow rate and
detection at 250 nm afforded seperation of XII-b from XII-c with
enantiomeric excesses of 100% and 99%, respectively. XII-b: mp
155.degree. C.; [.alpha.].sub.D.sup.25 -2.14.degree. (c=0.280,
MeOH). XII-c: 98.degree. C.; [.alpha.].sub.D.sup.25+4.45.degree.
(c=0.292, MeOH).
Examples 33 and 34
Preparation of
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihyd-
ro-2(1H)-quinazolinone (Example 33) and
(+)-5,6-Difluoro-4-ethylethynyl-4--
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Example 34)
[0221] Resolution of XII-b,c from XII-a (R.sup.4=Ethyl).
[0222] Chiral HPLC utilizing a AS column, 20% ethanol and 80%
hexanes at ambient temperature with a 1.0 mL/min flow rate and
detection at 250 nm afforded seperation of XII-b from XII-c with
enantiomeric excesses of 100% and 99%, respectively. XII-b: mp
165-167.degree. C. XII-c: mp 157-159.degree. C.
Examples 35 and 36
Preparation of
5,6-Difluoro-4-(2-hydroxyethyl)ethynyl-4-trifluoromethyl-3,-
4-dihydro-2(1H)-quinazolinone (Example 35) and
5,6-Difluoro-4-(1-hydroxyet-
hyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 36)
[0223]
2 23 24 Compound R Ex. 35 CH.sub.2CH.sub.2OTBS Ex. 36
CH(OTBS)CH.sub.3 25 Compound R Ex. 35 CH.sub.2CH.sub.2OH Ex. 36
CH(OH)CH.sub.3
[0224] To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd.
[0225] THF (11 mL) at -78.degree. C. was sequentially added a
precooled (0.degree. C.) solution of the silyl protected lithium
acetylide (5.40 mmol) and BF3.0Et2(0.60 mmol). The resulting
mixture was stirred at rt overnight. The reaction was quenched by
the addition of 1 M citric acid and diluted with EtOAc. The phases
were separated, the organic phase was washed with water, sat. aq.
NaHCO3 and sat. aq. NaCl. The organic extracts were dried over
MgSO4, filtered and concentrated. The material was purified by
regular phase HPLC chromatography (41.4 mm Rainin Dynamax.RTM.
column using 60 .ANG. silica @ 25 mL/min): 2.5%
MeOH/CH.sub.2Cl.sub.2 for 24 min, increase to 30% MeOH/CH2Cl2 over
4 min, 30% MeOH/CH.sub.2Cl.sub.2 for 10 min, and ramp back to 2.5%
MeOH/CH.sub.2Cl.sub.2 over 2 min. The yield of the protected
intermediates was 47% and 32%, respectively.
Example 35-Intermediate
[0226] Mp 62.9-64.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) .delta. 8.98 (br s, 1H), 7.41-7.32(m, 2H),
6.83-6.78 (m, 1H), 3.74 (t, J=6.6 Hz, 2H), 2.47 (t, J=6.6 Hz, 2H),
0.81 (s, 9H), 0.00 (s, 6H); .sup.19F NMR (282 MHz, acetone-d.sub.6)
.delta. -83.17, -135.16-135.31, -148.09-148.22; MS (CI) calc'd for
C19H24F5N2O2Si: m/z 435.152723, found 435.151149; 435 (MH.sup.+,
94), 452(M+NH.sub.4.sup.+, 100); Analysis calc'd for
C.sub.19H.sub.23FSN.sub.2O.sub.2Si: C, 52.52; H, 5.35; N, 6.46;
found: C, 52.65; H, 5.29; N, 6.31.
Example 36-Intermediate
[0227] .sup.1H NMR (300 MHz, acetone-d.sub.6) .delta. 8.96 (br s,
1H), 7.50 (br s, 1H), 7.37-7.28 (m, 1H), 6.79-6.74 (m, 1H), 4.61
(q, J=13.2, 6.6 Hz, 1H), 1.30 (d, J=6.6 Hz, 3H), 0.78 (s, 9H), 0.01
(s, 6H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-82.88--82.95, -135.20--135.42, -148.06-148.23; MS (CI) calc'd for
C19H24F5N2O2Si: m/z 435.152723, found 435.152927; 435 (MH.sup.+,
51), 452(M+NH4+, 100); Analysis calc'd for
C.sub.19H.sub.23F.sub.5N.sub.2O.sub.2Si: C, 52.52; H, 5.35; N,
6.46; found: C, 52.54; H, 5.34; N, 6.69.
[0228] To a solution of the protected intermediate for Example 35
(0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0 M
solution in THF). The resulting mixture was stirred at rt for 1 h,
diluted with EtOAc, washed with 1 N HCl, sat. aq. NaHCO.sub.3, and
sat. aq. NaCl. The organic extract was dried over MgSO.sub.4,
filtered and concentrated. The material was purified by regular
phase HPLC chromatography (41.4 mm Rainin Dynamax.RTM. column using
60 .ANG. silica @ 25 mL/min): 2.5% MeOH/CH.sub.2Cl.sub.2 for 24
min, increase to 30% MeOH/CH.sub.2Cl.sub.2 over 4 min, 30%
MeOH/CH.sub.2Cl.sub.2 for 10 min, and ramp back to 2.5%
MeOH/CH.sub.2Cl.sub.2 over 2 min. Example 35 was isolated in 82%
yield.
Example 35
Mp 190-192.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6)
.delta. 9.05 (br s, 1H), 7.53 (br s, 1H), 7.45-7.36 (m, 1H),
6.88-6.83 (m, 1H), 4.01-3.98 (m, 1H), 3.68-3.64 (m, 2H), 2.50 (t,
J=6.6 Hz, 2H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-83.3, -135.68-135.88, -148.10-148.22; MS (CI) calc'd for
C.sub.13H.sub.10F.sub.5N.sub.2O.sub.2: m/z 321.066244, found
321.066479; 321 (MH.sup.+, 100); Analysis calc'd for
C.sub.13H.sub.9F.sub.5N.sub.2O.sub.2: C, 48.76; H, 2.83; N, 8.76;
found: C, 49.05; H, 3.23; N, 8.38.
[0229] Example 36 was synthesized in an analogous manner to deliver
the title compound in 88% yield. Mp 190-191.degree. C.; .sup.1H NMR
(300 MHz, acetone-d.sub.6) .delta. 9.06 (br s, 1H), 7.56 (br s,
1H), 7.46-7.37 (m, 1H), 6.88-6.83 (m, 1H), 4.58-4.57 (m, 2H), 1.39
(d, J=5.5 Hz, 3H); .sup.19F NMR (282 MHz, acetone-d.sub.6) .delta.
-83.15, -135.40, -135.60, -148.08-148.20; MS (CI) calc'd for
C.sub.13H.sub.10F.sub.5N.sub.2O.sub.2: m/z 321.066244, found
321.065983; 321 (MH.sup.+, 58), 338 (M+NH4+, 100); Analysis calc'd
for C.sub.13H.sub.9F.sub.5N.sub.2O.sub.2: C, 48.76; H, 2.83; N,
8.76; found: C, 48.84; H, 2.76; N, 8.63.
Example 37
Preparation of
(+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-3-
,4-dihydro-2(1H)-quinazolinone
[0230] To a solution of XII-b (200 mg, 0.632 mmol) in anhyd. THF
(1.3 mL) at rt was added a solution of lithium aluminium hydride
(1.3 mL of 1.0 M solution in THF). The resulting mixture was
stirred at rt overnight. The reaction was quenched by addition of
10% NaOH (3 mL) and water (3 mL). The mixture was diluted with
EtOAc (30 mL) and the phases were separated. The organic phase was
washed with sat. aq. NaCl, dried over MgSO.sub.4, filtered and
concentrated. The title compound was purified by regular phase HPLC
(41.4 mm Rainin Dynamax.RTM. column using 60 .ANG. silica): 2.5%
MeOH/CH.sub.2Cl.sub.2 for 24 min, increase to 30%
MeOH/CH.sub.2Cl.sub.2 over 4 min, 30% MeOH/CH.sub.2Cl.sub.2 for 10
min, and ramp back to 2.5% MeOH/CH.sub.2Cl.sub.2 over 2 min. Mp
80-83.degree. C.; .sup.1H NMR (300 MHz, acetone-d.sub.6) d 9.07 (br
s, 1H), 7.33 (q, J=8.8 Hz, 1H), 6.94 (br s, 1H), 6.84-6.79 (m, 1H),
6.27 (dd, J=15.6, 7.5 Hz, 1H), 5.67 (dd, J=15.2, 9.4 Hz, 1H),
1.65-1.56 (m, 1H), 0.80-0.71 (m, 2H), 0.50-0.42(m, 2H); .sup.19F
NMR (282 MHz, acetone-d.sub.6) d -82.68, -135.05, -148.49; MS (CI)
calc'd for C.sub.14H.sub.12F.sub.5N.sub.2O: m/z 319.086979, found
319.087755; 319 (MH.sup.+, 100);
[.alpha.].sub.D.sup.20+72.77.degree. (c=0.382, MeOH); Analysis
calc'd for C.sub.14H.sub.11F.sub.5N.sub.2O: C, 52.84; H, 3.48; N,
8.80; found: C, 53.02; H, 3.48; N, 8.61.
Example 38
Preparation of
(-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluoromethyl-3,4-d-
ihydro-2(1H)-quinazolinone
[0231] The title compound was prepared as described for Example 37
(starting from IV-b), except that it was purified using a Chiralcel
OD column at 1.5 mL/min in 0.5% EtOH/20% CH.sub.2Cl.sub.2/79.5%
hexanes. Mp 87-89.degree. C.; .sup.1H NMR (300 MHz,
acetone-d.sub.6) d 9.08 (br s, 1H), 7.40-7.25 (m, 2H), 7.04-6.90
(m, 2H), 6.28-6.18 (m, 1H), 5.64-5.52(m, 1H), 1.68-1.55 (m, 1H),
0.83-0.71 (m, 2H), 0.53-0.41 (m, 2H); .sup.19F NMR (282 MHz,
acetone-d.sub.6) d -81.67; MS (CI) calc'd for
C.sub.14H.sub.13ClF.sub.3N.sub.2O: m/z 317.066851, found
317.065857; 317 (MH.sup.+, 100);
[.alpha.].sub.D.sup.20-6.81.degree. (c=0.382, MeOH); Analysis
calc'd for C.sub.14H.sub.12ClF.sub.3N.sub.2O. 0.27 C.sub.3H.sub.6O:
C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H, 4.07; N, 8.80.
3TABLE 1* 26 Ex. m.p. Mass # R.sup.3 R.sup.1 R.sup.2 R.sup.8
(.degree. C.) Spec 1 6-Cl CF.sub.3 C.ident.C-cycPr H 86.6- 332 (M +
88 NH.sub.4.sup.+) 2 6-Cl CF.sub.3 C.ident.C-iPr H 180 334 (M +
NH.sub.4.sup.+) 3 6-Cl CF.sub.3 C.ident.C-2-Pyridyl H 105 352
(MH.sup.+) 4 6-Cl CF.sub.3 C.ident.C--Et H 217- 303 219 (MH.sup.+)
5 6-Cl CF.sub.3 C.ident.C--Ph H 104- 368 (M + 107 NH.sub.4.sup.+) 6
6-MeO CF.sub.3 C.ident.C-cycPr H 208 311 (MH.sup.+) 7 6-MeO
CF.sub.3 C.ident.C-iPr H 228- 313 229 (MH.sup.+) 8 6-MeO CF.sub.3
C.ident.C-2-Pyridyl H 97- 348 98 (MH.sup.+) 9 6-MeO CF.sub.3
C.ident.C--Ph H 206.2- 347 207.7 (MH.sup.+) 10 5,6-diF CF.sub.3
C.ident.C-cycPr H 101 317 dec. (MH.sup.+) 11 5,6-diF CF.sub.3
C.ident.C-iPr H 79- 319 80 (MH.sup.+) 12 5,6-diF CF.sub.3
C.ident.C-2-Pyridyl H 219- 354 220 (MH.sup.+) 13 5,6-diF CF.sub.3
C.ident.C--Et H 191- 305 194 (MH.sup.+) 14 5,6-diF CF.sub.3
C.ident.C--Ph H 215- 370 (M + 217 NH.sub.4.sup.+) 15 5,6-diF
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 192- 323 193
(MH.sup.+) 16 5,6-diF CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H
309 (MH.sup.+) 17 6-F CF.sub.3 C.ident.C-cycPr H 155 299 (MH.sup.+)
18 6-F CF.sub.3 C.ident.C-iPr H 158 301 (MH.sup.+) 19 6-F CF.sub.3
C.ident.C-2-Pyridyl H 155 336 (MH.sup.+) 20 6-F CF.sub.3
C.ident.C--Et H 190 287 (MH.sup.+) 21 6-F CF.sub.3 C.ident.C--Ph H
107 352 (M + NH.sub.4.sup.+) 22 6-F CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).s- ub.2 H 179 305 (MH.sup.+) 23 6-F
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl H 88 340 (MH.sup.+) 24 6-F
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 198 291 (MH.sup.+) 25
6-F CF.sub.3 CH.sub.2CH.sub.2Ph H 98 339 (MH.sup.+) 26 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 H 181 304 (M + NH.sub.4.sup.+) 27 (-)
6-Cl CF.sub.3 C.ident.C-cycPr H 106- 313 109 (M.sup.-) 28 (+) 6-Cl
CF.sub.3 C.ident.C-cycPr H 105- 313 107 (M.sup.-) 29 (+) 5,6-diF
CF.sub.3 C.ident.C-cycPr H 187 315 (M.sup.-) 30 (-) 5,6-diF
CF.sub.3 C.ident.C-cycPr H 188- 315 189 (M.sup.-) 31 (-) 5,6-diF
CF.sub.3 C.ident.C-iPr H 155 317 (M.sup.-) 32 (+) 5,6-diF CF.sub.3
C.ident.C-iPr H 98 317 (M.sup.-) 33 (-) 5,6-diF CF.sub.3
C.ident.C--Et H 165- 303 167 (M.sup.-) 34 (+) 5,6-diF CF.sub.3
C.ident.C--Et H 157- 303 159 (M.sup.-) 35 5,6-diF CF.sub.3
C.ident.CCH.sub.2CH.sub.2OH H 190- 321 192 (MH.sup.+) 36 5,6-diF
CF.sub.3 C.ident.C--CH(OH)Me H 190- 338 (M + 191 NH.sub.4.sup.+) 37
(+) 5,6-diF CF.sub.3 C.ident.C-cycPr (E) H 80- 319 83 (MH.sup.+) 38
(-) 6-Cl CF.sub.3 C.ident.C-cycPr (E) H 87- 317 89 (MH.sup.+)
*Unless otherwise indicated, stereochemisty is (+/-).
[0232]
4TABLE 2* 27 Ex. # R.sup.3 R.sup.1 R.sup.2 R.sup.8 1 6-Cl CF.sub.3
C.ident.CCH.sub.2CH.sub.2OH H 2 6-Cl CF.sub.3 C.ident.C--CH(OH)Me H
3 6-Cl CF.sub.3 C.ident.C-(2-Cl)Ph H 4 6-Cl CF.sub.3
C.ident.C-(3-Cl)Ph H 5 6-Cl CF.sub.3 C.ident.C-(4-Cl)Ph H 6 6-Cl
CF.sub.3 C.ident.C-(2-F)Ph H 7 6-Cl CF.sub.3 C.ident.C-(3-F)Ph H 8
6-Cl CF.sub.3 C.ident.C-(4-F)Ph H 9 6-Cl CF.sub.3
C.ident.C-(2-OH)Ph H 10 6-Cl CF.sub.3 C.ident.C-(3-OH)Ph H 11 6-Cl
CF.sub.3 C.ident.C-(4-OH)Ph H 12 6-Cl CF.sub.3 C.ident.C-(2-OMe)Ph
H 13 6-Cl CF.sub.3 C.ident.C-(3-OMe)Ph H 14 6-Cl CF.sub.3
C.ident.C-(4-OMe)Ph H 15 6-Cl CF.sub.3 C.ident.C-(2-CN)Ph H 16 6-Cl
CF.sub.3 C.ident.C-(3-CN)Ph H 17 6-Cl CF.sub.3 C.ident.C-(4-CN)Ph H
18 6-Cl CF.sub.3 C.ident.C-(2-NO.sub.2)Ph H 19 6-Cl CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 20 6-Cl CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 21 6-Cl CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 22 6-Cl CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 23 6-Cl CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 24 6-Cl CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 25 6-Cl CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 26 6-Cl CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 27 6-Cl CF.sub.3 C.ident.C-3-Pyridyl H
28 6-Cl CF.sub.3 C.ident.C-4-Pyridyl H 29 6-Cl CF.sub.3
C.ident.C-2-furanyl H 30 6-Cl CF.sub.3 C.ident.C-3-furanyl H 31
6-Cl CF.sub.3 C.ident.C-2-thienyl H 32 6-Cl CF.sub.3
C.ident.C-3-thienyl H 33 6-Cl CF.sub.3 C.ident.C-2-oxazolyl H 34
6-Cl CF.sub.3 C.ident.C-2-thiazolyl H 35 6-Cl CF.sub.3
C.ident.C-4-isoxazolyl H 36 6C1 CF.sub.3 C.ident.C-2-imidazolyl H
37 6-Cl CF.sub.3 C.dbd.CCH.sub.2CH.sub.2OH H 38 6C1 CF.sub.3
C.dbd.C--CH(OH)Me H 39 6-Cl CF.sub.3 C.dbd.C-(2-Cl)Ph H 40 6-Cl
CF.sub.3 C.dbd.C-(3-Cl)Ph H 41 6-Cl CF.sub.3 C.dbd.C-(4-Cl)Ph H 42
6-Cl CF.sub.3 C.dbd.C-(2-F)Ph H 43 6-Cl CF.sub.3 C.dbd.C-(3-F)Ph H
44 6-Cl CF.sub.3 C.dbd.C-(4-F)Ph H 45 6-Cl CF.sub.3
C.dbd.C-(2-OH)Ph H 46 6-Cl CF.sub.3 C.dbd.C-(3-OH)Ph H 47 6-Cl
CF.sub.3 C.dbd.C-(4-OH)Ph H 48 6-Cl CF.sub.3 C.dbd.C-(2-OMe)Ph H 49
6-Cl CF.sub.3 C.dbd.C-(3-OMe)Ph H 50 6-Cl CF.sub.3
C.dbd.C-(4-OMe)Ph H 51 6-Cl CF.sub.3 C.dbd.C-(2-CN)Ph H 52 6-Cl
CF.sub.3 C.dbd.C-(3-CN)Ph H 53 6-Cl CF.sub.3 C.dbd.C-(4-CN)Ph H 54
6-Cl CF.sub.3 C.dbd.C-(2-NO.sub.2)Ph H 55 6-Cl CF.sub.3
C.dbd.C-(3-NO.sub.2)Ph H 56 6-Cl CF.sub.3 C.dbd.C-(4-NO.sub.2)Ph H
57 6-Cl CF.sub.3 C.dbd.C-(2-NH.sub.2)Ph H 58 6-Cl CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 59 6-Cl CF.sub.3 C.dbd.C-(4-NH.sub.2)Ph H
60 6-Cl CF.sub.3 C.dbd.C-(2-NMe.sub.2)Ph H 61 6-Cl CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 62 6-Cl CF.sub.3 C.dbd.C-(4-NMe.sub.2)Ph
H 63 6-cl CF.sub.3 C.dbd.C-3-Pyridyl H 64 6-Cl CF.sub.3
C.dbd.C-4-Pyridyl H 65 6-cl CF.sub.3 C.dbd.C-2-furanyl H 66 6-Cl
CF.sub.3 C.dbd.C-3-furanyl H 67 6-Cl CF.sub.3 C.dbd.C-2-thienyl H
68 6-Cl CF.sub.3 C.dbd.C-3-thienyl H 69 6-Cl CF.sub.3
C.dbd.C-2-oxazolyl H 70 6-Cl CF.sub.3 C.dbd.C-2-thiazolyl H 71 6-Cl
CF.sub.3 C.dbd.C-4-isoxazolyl H 72 6-Cl CF.sub.3
C.dbd.C-2-imidazolyl H 73 6-Cl CF.sub.3 CH.sub.2CH.sub.2-cycPr H 74
6-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 75 6-Cl CF.sub.3
CH.sub.2CH.sub.2--CH(OH)Me H 76 6-Cl CF.sub.3 CH.sub.2CH.sub.2--Ph
H 77 6-Cl CF.sub.3 CH.sub.2CH.sub.2-(2-Cl)Ph H 78 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-Cl)Ph H 79 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 80 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 81 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 82 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 83 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 84 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 85 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 86 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 87 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 88 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 89 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 90 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 91 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 92 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 93 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 94 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 95 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 96 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 97 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 98 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 99 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 100 6-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 101 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 102 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 103 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 104 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 105 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 106 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-furanyl H 107 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 108 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 109 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 110 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 111 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-imidazoyl H 112 6-Cl CF.sub.3 C.ident.C-cycPr
CH.sub.3 113 6-Cl CF.sub.3 C.ident.C--Ph CH.sub.3 114 6-Cl CF.sub.3
C.ident.C-2-Pyridyl CH.sub.3 115 6-Cl CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.3 116 6-Cl CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 117 6-Cl
CF.sub.3 C.ident.C-2-furanyl CH.sub.3 118 6-Cl CF.sub.3
C.ident.C-3-furanyl CH.sub.3 119 6-Cl CF.sub.3 C.ident.C-2-thienyl
CH.sub.3 120 6-Cl CF.sub.3 C.ident.C-3-thienyl CH.sub.3 121 6-Cl
CF.sub.3 C.dbd.C-cycPr CH.sub.3 122 6-Cl CF.sub.3 C.dbd.C--Ph
CH.sub.3 123 6-Cl CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 124 6-Cl
CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 125 6-Cl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 126 6-Cl CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 127 6-Cl CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 128 6-Cl
CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 129 6-Cl CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 130 6-Cl CF.sub.3 CH.sub.2CH.sub.2-cycPr
CH.sub.3 131 6-Cl CF.sub.3 CH.sub.2CH.sub.2--Ph CH.sub.3 132 6-Cl
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 133 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 134 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 135 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 136 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 137 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 138 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 139 6-Cl CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 140 6-Cl CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 141 6-Cl CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 142 6-Cl CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 143 6-Cl CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 144 6-Cl CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 145 6-Cl CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 146 6-Cl CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 147 6-Cl CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 148 6-Cl CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3
149 6-Cl CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 150 6-Cl CF.sub.3
C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 151 6-Cl CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 152 6-Cl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 153 6-Cl CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 154 6-Cl CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 155 6-Cl CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 156 6-Cl CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 157 6-Cl CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 158 6-Cl CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 159 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 160 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 161 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 162 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 163 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 164 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 165 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 166 6-MeO CF.sub.3
C.ident.CCH.sub.2CH.sub.2OH H 167 6-MeO CF.sub.3
C.ident.C--CH(OH)Me H 168 6-MeO CF.sub.3 C.ident.C-(2-Cl)Ph H 169
6-MeO CF.sub.3 C.ident.C-(3-Cl)Ph H 170 6-MeO CF.sub.3
C.ident.C-(4-Cl)Ph H 171 6-MeO CF.sub.3 C.ident.C-(2-F)Ph H 172
6-MeO CF.sub.3 C.ident.C-(3-F)Ph H 173 6-MeO CF.sub.3
C.ident.C-(4-F)Ph H 174 6-MeO CF.sub.3 C.ident.C-(2-OH)Ph H 175
6-MeO CF.sub.3 C.ident.C-(3-OH)Ph H 176 6-MeO CF.sub.3
C.ident.C-(4-OH)Ph H 177 6-MeO CF.sub.3 C.ident.C-(2-OMe)Ph H 178
6-MeO CF.sub.3 C.ident.C-(3-OMe)Ph H 179 6-MeO CF.sub.3
C.ident.C-(4-OMe)Ph H 180 6-MeO CF.sub.3 C.ident.C-(2-CN)Ph H 181
6-MeO CF.sub.3 C.ident.C-(3-CN)Ph H 182 6-MeO CF.sub.3
C.ident.C-(4-CN)Ph H 183 6-MeO CF.sub.3 C.ident.C-(2-NO.sub.2)Ph H
184 6-MeO CF.sub.3 C.ident.C-(3-NO.sub.2)Ph H 185 6-MeO CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 186 6-MeO CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 187 6-MeO CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 188 6-MeO CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 189 6-MeO CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 190 6-MeO CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 191 6-MeO CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 192 6-MeO CF.sub.3 C.ident.C-3-Pyridyl
H 193 6-MeO CF.sub.3 C.ident.C-4-Pyridyl H 194 6-MeO CF.sub.3
C.ident.C-2-furanyl H 195 6-MeO CF.sub.3 C.ident.C-3-furanyl H 196
6-MeO CF.sub.3 C.ident.C-2-thienyl H 197 6-MeO CF.sub.3
C.ident.C-3-thienyl H 198 6-MeO CF.sub.3 C.ident.C-2-oxazolyl H 199
6-MeO CF.sub.3 C.dbd.C-2-thiazolyl H 200 6-MeO CF.sub.3
C.dbd.C-4-isoxazolyl H 201 6-MeO CF.sub.3 C.dbd.C-2-imidazolyl H
202 6-MeO CF.sub.3 C.dbd.CCH.sub.2CH.sub.2O- H H 203 6-MeO CF.sub.3
C.dbd.C--CH(OH)Me H 204 6-MeO CF.sub.3 C.dbd.C-(2-Cl)Ph H 205 6-MeO
CF.sub.3 C.dbd.C-(3-Cl)Ph H 206 6-MeO CF.sub.3 C.dbd.C-(4-Cl)Ph H
207 6-MeO CF.sub.3 C.dbd.C-(2-F)Ph H 208 6-MeO CF.sub.3
C.dbd.C-(3-F)Ph H 209 6-MeO CF.sub.3 C.dbd.C-(4-F)Ph H 210 6-MeO
CF.sub.3 C.dbd.C-(2-OH)Ph H 211 6-MeO CF.sub.3 C.dbd.C-(3-OH)Ph H
212 6-MeO CF.sub.3 C.dbd.C-(4-OH)Ph H 213 6-MeO CF.sub.3
C.dbd.C-(2-OMe)Ph H 214 6-MeO CF.sub.3 C.dbd.C-(3-OMe)Ph H 215
6-MeO CF.sub.3 C.dbd.C-(4-OMe)Ph H 216 6-MeO CF.sub.3
C.dbd.C-(2-CN)Ph H 217 6-MeO CF.sub.3 C.dbd.C-(3-CN)Ph H 218 6-MeO
CF.sub.3 C.dbd.C-(4-CN)Ph H 219 6-MeO CF.sub.3
C.dbd.C-(2-NO.sub.2)Ph H 220 6-MeO CF.sub.3 C.dbd.C-(3-NO.sub.2)Ph
H 221 6-MeO CF.sub.3 C.dbd.C-(4-NO.sub.2)Ph H 222 6-MeO CF.sub.3
C.dbd.C-(2-NH.sub.2)Ph H 223 6-MeO CF.sub.3 C.dbd.C-(3-NH.sub.2)Ph
H 224 6-MeO CF.sub.3 C.dbd.C-(4-NH.sub.2)Ph H 225 6-MeO CF.sub.3
C.dbd.C-(2-NMe.sub.2)Ph H 226 6-MeO CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 227 6-MeO CF.sub.3
C.dbd.C-(4-NMe.sub.2)Ph H 228 6-MeO CF.sub.3 C.dbd.C-3-Pyridyl H
229 6-MeO CF.sub.3 C.dbd.C-4-Pyridyl H 230 6-MeO CF.sub.3
C.dbd.C-2-furanyl H 231 6-MeO CF.sub.3 C.dbd.C-3-furanyl H 232
6-MeO CF.sub.3 C.dbd.C-2-thienyl H 233 6-MeO CF.sub.3
C.dbd.C-3-thienyl H 234 6-MeO CF.sub.3 C.dbd.C-2-oxazolyl H 235
6-MeO CF.sub.3 C.dbd.C-2-thiazolyl H 236 6-MeO CF.sub.3
C.dbd.C-4-isoxazolyl H 237 6-MeO CF.sub.3 C.dbd.C-2-imidazolyl H
238 6-MeO CF.sub.3 CH.sub.2CH.sub.2-cycPr H 239 6-MeO CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 240 6-MeO CF.sub.3
CH.sub.2CH.sub.2--CH(OH)Me H 241 6-MeO CF.sub.3
CH.sub.2CH.sub.2--Ph H 242 6-MeO CF.sub.3 CH.sub.2CH.sub.2-(2-Cl)P-
h H 243 6-MeO CF.sub.3 CH.sub.2CH.sub.2-(3-Cl)Ph H 244 6-MeO
CF.sub.3 CH.sub.2CH.sub.2-(4-Cl)Ph H 245 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 246 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 247 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 248 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 249 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 250 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 251 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 252 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 253 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 254 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 255 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 256 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 257 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 258 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 259 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 260 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 261 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 262 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 263 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 264 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 265 6-MeO CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 266 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 267 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 268 6-MeO CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 269 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 270 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 271 6-MeO CF.sub.3
CH.sub.2CH.sub.2-4-furanyl H 272 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 273 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 274 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 275 6-MeO CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 276 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 277 6-MeO CF.sub.3 C.ident.C-cycPr
CH.sub.3 278 6-MeO CF.sub.3 C.ident.C--Ph CH.sub.3 279 6-MeO
CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 280 6-MeO CF.sub.3
C.ident.C-3-Pyridyl CH.sub.3 281 6-MeO CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.3 282 6-MeO CF.sub.3 C.ident.C-2-furanyl CH.sub.3 283 6-MeO
CF.sub.3 C.ident.C-3-furanyl CH.sub.3 284 6-MeO CF.sub.3
C.ident.C-2-thienyl CH.sub.3 285 6-MeO CF.sub.3 C.ident.C-3-thienyl
CH.sub.3 286 6-MeO CF.sub.3 C.dbd.C-cycPr CH.sub.3 287 6-MeO
CF.sub.3 C.dbd.C--Ph CH.sub.3 288 6-MeO CF.sub.3 C.dbd.C-2-Pyridyl
CH.sub.3 289 6-MeO CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 290 6-MeO
CF.sub.3 C.dbd.C-4-Pyridyl CH.sub.3 291 6-MeO CF.sub.3
C.dbd.C-2-furanyl CH.sub.3 292 6-MeO CF.sub.3 C.dbd.C-3-furanyl
CH.sub.3 293 6-MeO CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 294 6-MeO
CF.sub.3 C.dbd.C-3-thienyl CH.sub.3 295 6-MeO CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 296 6-MeO CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 297 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 298 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 299 6-MeO CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 300 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 301 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 302 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 303 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 304 6-MeO CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 305 6-MeO CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 306 6-MeO CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 307 6-MeO CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 308 6-MeO CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 309 6-MeO CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 310 6-MeO CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 311 6-MeO CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 312 6-MeO CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 313 6-MeO CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3
314 6-MeO CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 315 6-MeO CF.sub.3
C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 316 6-MeO CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 317 6-MeO CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 318 6-MeO CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 319 6-MeO CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 320 6-MeO CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 321 6-MeO CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 322 6-MeO CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 323 6-MeO CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 324 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 325 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 326 6-MeO CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 327 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 328 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 329 6-MeO CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 330 6-MeO CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 331 5,6-diF CF.sub.3
C.ident.C-(2-Cl)Ph H 332 5,6-diF CF.sub.3 C.ident.C-(3-Cl)Ph H 333
5,6-diF CF.sub.3 C.ident.C-(4-Cl)Ph H 334 5,6-diF CF.sub.3
C.ident.C-(2-F)Ph H 335 5,6-diF CF.sub.3 C.ident.C-(3-F)Ph H 336
5,6-diF CF.sub.3 C.ident.C-(4-F)Ph H 337 5,6-diF CF.sub.3
C.ident.C-(2-OH)Ph H 338 5,6-diF CF.sub.3 C.ident.C-(3-OH)Ph H 339
5,6-diF CF.sub.3 C.ident.C-(4-OH)Ph H 340 5,6-diF CF.sub.3
C.ident.C-(2-OMe)Ph H 341 5,6-diF CF.sub.3 C.ident.C-(3-OMe)Ph H
342 5,6-diF CF.sub.3 C.ident.C-(4-OMe)Ph H 343 5,6-diF CF.sub.3
C.ident.C-(2-CN)Ph H 344 5,6-diF CF.sub.3 C.ident.C-(3-CN)Ph H 345
5,6-diF CF.sub.3 C.ident.C-(4-CN)Ph H 346 5,6-diF CF.sub.3
C.ident.C-(2-NO.sub.2)Ph H 347 5,6-diF CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 348 5,6-diF CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 349 5,6-diF CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 350 5,6-diF CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 351 5,6-diF CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 352 5,6-diF CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 353 5,6-diF CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 354 5,6-diF CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 355 5,6-diF CF.sub.3
C.ident.C-3-Pyridyl H 356 5,6-diF CF.sub.3 C.ident.C-4-Pyridyl H
357 5,6-diF CF.sub.3 C.ident.C-2-furanyl H 358 5,6-diF CF.sub.3
C.ident.C-3-furanyl H 359 5,6-diF CF.sub.3 C.ident.C-2-thienyl H
360 5,6-diF CF.sub.3 C.ident.C-3-thienyl H 361 5,6-diF CF.sub.3
C.ident.C-2-oxazolyl H 362 5,6-diF CF.sub.3 C.ident.C-2-thiazolyl H
363 5,6-diF CF.sub.3 C.ident.C-4-isoxazolyl H 364 5,6-diF CF.sub.3
C.ident.C-2-imidazolyl H 365 5,6-diF CF.sub.3 C.dbd.C-(2-Cl)Ph H
366 5,6-diF CF.sub.3 C.dbd.C-(3-Cl)Ph H 367 5,6-diF CF.sub.3
C.dbd.C-(4-Cl)Ph H 368 5,6-diF CF.sub.3 C.dbd.C-(2-F)Ph H 369
5,6-diF CF.sub.3 C.dbd.C-(3-F)Ph H 370 5,6-diF CF.sub.3
C.dbd.C-(4-F)Ph H 371 5,6-diF CF.sub.3 C.dbd.C-(2-OH)Ph H 372
5,6-diF CF.sub.3 C.dbd.C-(3-OH)Ph H 373 5,6-diP CF.sub.3
C.dbd.C-(4-OH)Ph H 374 5,6-diF CF.sub.3 C.dbd.C-(2-OMe)Ph H 375
5,6-diF CF.sub.3 C.dbd.C-(3-OMe)Ph H 376 5,6-diF CF.sub.3
C.dbd.C-(4-OMe)Ph H 377 5,6-diF CF.sub.3 C.dbd.C-(2-CN)Ph H 378
5,6-diF CF.sub.3 C.dbd.C-(3-CN)Ph H 379 5,6-diF CF.sub.3
C.dbd.C-(4-CN)Ph H 380 5,6-diF CF.sub.3 C.dbd.C-(2-NO.sub.2)Ph H
381 5,6-diF CF.sub.3 C.dbd.C-(3-NO.sub.2)Ph H 382 5,6-diF CF.sub.3
C.dbd.C-(4-NO.sub.2)Ph H 383 5,6-diF CF.sub.3
C.dbd.C-(2-NH.sub.2)Ph H 384 5,6-diF CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 385 5,6-diF CF.sub.3
C.dbd.C-(4-NH.sub.2)Ph H 386 5,6-diF CF.sub.3
C.dbd.C-(2-NMe.sub.2)Ph H 387 5,6-diF CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 388 5,6-diF CF.sub.3
C.dbd.C-(4-NMe.sub.2)Ph H 389 5,6-diF CF.sub.3 C.dbd.C-3-Pyridyl H
390 5,6-diF CF.sub.3 C.dbd.C-4-Pyridyl H 391 5,6-diF CF.sub.3
C.dbd.C-2-furanyl H 392 5,6-diF CF.sub.3 C.dbd.C-3-furanyl H 393
5,6-diF CF.sub.3 C.dbd.C-2-thienyl H 394 5,6-diF CF.sub.3
C.dbd.C-3-thienyl H 395 5,6-diF CF.sub.3 C.dbd.C-2-oxazolyl H 396
5,6-diF CF.sub.3 C.dbd.C-2-thiazolyl H 397 5,6-diF CF.sub.3
C.dbd.C-4-isoxazolyl H 398 5,6-diF CF.sub.3 C.dbd.C-2-imidazolyl H
399 5,6-diF CF.sub.3 CH.sub.2CH.sub.2-cycPr H 400 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 401 5,6-diF CF.sub.3
CH.sub.2CH.sub.2--CH(OH)Me H 402 5,6-diF CF.sub.3
CH.sub.2CH.sub.2--Ph H 403 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-Cl)Ph H 404 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-Cl)Ph H 405 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 406 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 407 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 408 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 409 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 410 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 411 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 412 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 413 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 414 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 415 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 416 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 417 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 418 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 419 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 420 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 421 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 422 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 423 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 424 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 425 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 426 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 427 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 428 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 429 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 430 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 431 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 432 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 433 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 434 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 435 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 436 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 437 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 438 5,6-diF CF.sub.3
C.ident.C-cycPr CH.sub.3 439 5,6-diF CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.3 440 5,6-diF CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 441
5,6-diF CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 442 5,6-diF CF.sub.3
C.ident.C-2-furanyl CH.sub.3 443 5,6-diF CF.sub.3
C.ident.C-3-furanyl CH.sub.3 444 5,6-diF CF.sub.3
C.ident.C-2-thienyl CH.sub.3 445 5,6-diF CF.sub.3
C.ident.C-3-thienyl CH.sub.3 446 5,6-diF CF.sub.3 C.dbd.C-cycPr
CH.sub.3 447 5,6-diF CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 448
5,6-diF CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 449 5,6-diF CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 450 5,6-diF CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 451 5,6-diF CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 452
5,6-diF CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 453 5,6-diF CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 454 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 455 5,6-diF CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 456 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 457 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 458 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 459 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 460 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 461 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 462 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 463 5,6-diF CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 464 5,6-diF CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 465 5,6-diF CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 466 5,6-diF CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 467 5,6-diF CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 468 5,6-diF CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 469 5,6-diF CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 470 5,6-diF CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 471 5,6-diF CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 472 5,6-diF CF.sub.3 C.dbd.C-cycPr
CH.sub.2CH.sub.3 473 5,6-diF CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3
474 5,6-diF CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 475 5,6-diF
CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 476 5,6-diF CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 477 5,6-diF CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 478 5,6-diF CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 479 5,6-diF CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 480 5,6-diF CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 481 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 482 5,6-diF CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 483 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 484 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 485 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 486 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 487 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 488 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 489 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 490 5,6-diCl CF.sub.3
C.ident.C-(2-Cl)Ph H 491 5,6-diCl CF.sub.3 C.ident.C-(3-Cl)Ph H 492
5,6-diCl CF.sub.3 C.ident.C-(4-Cl)Ph H 493 5,6-diCl CF.sub.3
C.ident.C-(2-F)Ph H 494 5,6-diCl CF.sub.3 C.ident.C-(3-F)Ph H 495
5,6-diCl CF.sub.3 C.ident.C-(4-F)Ph H 496 5,6-diCl CF.sub.3
C.ident.C-(2-OH)Ph H 497 5,6-diCl CF.sub.3 C.ident.C-(3-OH)Ph H 498
5,6-diCl CF.sub.3 C.ident.C-(4-OH)Ph H 499 5,6-diCl CF.sub.3
C.ident.C-(2-OMe)Ph H 500 5,6-diCl CF.sub.3 C.ident.C-(3-OMe)Ph H
501 5,6-diCl CF.sub.3 C.ident.C-(4-OMe)Ph H 502 5,6-diCl CF.sub.3
C.ident.C-(2-CN)Ph H 503 5,6-diCl CF.sub.3 C.ident.C-(3-CN)Ph H 504
5,6-diCl CF.sub.3 C.ident.C-(4-CN)Ph H 505 5,6-diCl CF.sub.3
C.ident.C-(2-NO.sub.2)Ph H 506 5,6-diCl CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 507 5,6-diCl CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 508 5,6-diCl CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 509 5,6-diCl CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 510 5,6-diCl CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 511 5,6-diCl CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 512 5,6-diCl CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 513 5,6-diCl CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 514 5,6-diCl CF.sub.3
C.ident.C-3-Pyridyl H 515 5,6-diCl CF.sub.3 C.ident.C-4-Pyridyl H
516 5,6-diCl CF.sub.3 C.ident.C-2-furanyl H 517 5,6-diCl CF.sub.3
C.ident.C-3-furanyl H 518 5,6-diCl CF.sub.3 C.ident.C-2-thienyl H
519 5,6-diCl CF.sub.3 C.ident.C-3-thienyl H 520 5,6-diCl CF.sub.3
C.ident.C-2-oxazolyl H 521 5,6-diCl CF.sub.3 C.ident.C-2-thiazolyl
H 522 5,6-diCl CF.sub.3 C.ident.C-4-isoxazolyl H 523 5,6-diCl
CF.sub.3 C.ident.C-2-imidazolyl H 524 5,6-diCl CF.sub.3
C.dbd.C-(2-Cl)Ph H 525 5,6-diCl CF.sub.3 C.dbd.C-(3-Cl)Ph H 526
5,6-diCl CF.sub.3 C.dbd.C-(4-Cl)Ph H 527 5,6-diCl CF.sub.3
C.dbd.C-(2-F)Ph H 528 5,6-diCl CF.sub.3 C.dbd.C-(3-F)Ph H 529
5,6-diCl CF.sub.3 C.dbd.C-(4-F)Ph H 530 5,6-diCl CF.sub.3
C.dbd.C-(2-OH)Ph H 531 5,6-diCl CF.sub.3 C.dbd.C-(3-OH)Ph H 532
5,6-diCl CF.sub.3 C.dbd.C-(4-OH)Ph H 533 5,6-diCl CF.sub.3
C.dbd.C-(2-OMe)Ph H 534 5,6-diCl CF.sub.3 C.dbd.C-(3-OMe)Ph H 535
5,6-diCl CF.sub.3 C.dbd.C-(4-OMe)Ph H 536 5,6-diCl CF.sub.3
C.dbd.C-(2-CN)Ph H 537 5,6-diCl CF.sub.3 C.dbd.C-(3-CN)Ph H 538
5,6-diCl CF.sub.3 C.dbd.C-(4-CN)Ph H 539 5,6-diCl CF.sub.3
C.dbd.C-(2-NO.sub.2)Ph H 540 5,6-diCl CF.sub.3
C.dbd.C-(3-NO.sub.2)Ph H 541 5,6-diCl CF.sub.3
C.dbd.C-(4-NO.sub.2)Ph H 542 5,6-diCl CF.sub.3
C.dbd.C-(2-NH.sub.2)Ph H 543 5,6-diCl CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 544 5,6-diCl CF.sub.3
C.dbd.C-(4-NH.sub.2)Ph H 545 5,6-diCl CF.sub.3
C.dbd.C-(2-NMe.sub.2)Ph H 546 5,6-diCl CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 547 5,6-diCl CF.sub.3
C.dbd.C-(4-NMe.sub.2)Ph H 548 5,6-diCl CF.sub.3 C.dbd.C-3-Pyridyl H
549 5,6-diCl CF.sub.3 C.dbd.C-4-Pyridyl H 550 5,6-diCl CF.sub.3
C.dbd.C-2-furanyl H 551 5,6-diCl CF.sub.3 C.dbd.C-3-furanyl H 552
5,6-diCl CF.sub.3 C.dbd.C-2-thienyl H 553 5,6-diCl CF.sub.3
C.dbd.C-3-thienyl H 554 5,6-diCl CF.sub.3 C.dbd.C-2-oxazolyl H 555
5,6-diCl CF.sub.3 C.dbd.C-2-thiazolyl H 556 5,6-diCl CF.sub.3
C.dbd.C-4-isoxazolyl H 557 5,6-diCl CF.sub.3 C.dbd.C-2-imidazolyl H
558 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-cycPr H 559 5,6-diCl
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 560 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2--CH(OH)Me H 561 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2--Ph H 562 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-Cl)Ph H 563 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-Cl)Ph H 564 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 565 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 566 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 567 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 568 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 569 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 570 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 571 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 572 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 573 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 574 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 575 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 576 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 577 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 578 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 579 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 580 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 581 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 582 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 583 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 584 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 585 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 586 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 587 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 588 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 589 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 590 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 591 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 592 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 593 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 594 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 595 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 596 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 597 5,6-diCl CF.sub.3
C.ident.C-cycPr CH.sub.3 598 5,6-diCl CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.3 599 5,6-diCl CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 600
5,6-diCl CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 601 5,6-diCl
CF.sub.3 C.ident.C-2-furanyl CH.sub.3 602 5,6-diCl CF.sub.3
C.ident.C-3-furanyl CH.sub.3 603 5,6-diCl CF.sub.3
C.ident.C-2-thienyl CH.sub.3 604 5,6-diCl CF.sub.3
C.ident.C-3-thienyl CH.sub.3 605 5,6-diCl CF.sub.3 C.dbd.C-cycPr
CH.sub.3 606 5,6-diCl CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 607
5,6-diCl CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 608 5,6-diCl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 609 5,6-diCl CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 610 5,6-diCl CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 611
5,6-diCl CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 612 5,6-diCl CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 613 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 614 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 615 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 616 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 617 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 618 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 619 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 620 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 621 5,6-diCl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 622 5,6-diCl CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 623 5,6-diCl CF.sub.3
C.ident.C--Ph CH.sub.2CH.sub.3 624 5,6-diCl CF.sub.3
C.ident.C-2-Pyridyl CH.sub.2CH.sub.3 625 5,6-diCl CF.sub.3
C.ident.C-3-Pyridyl CH.sub.2CH.sub.3 626 5,6-diCl CF.sub.3
C.ident.C-4-Pyridyl CH.sub.2CH.sub.3 627 5,6-diCl CF.sub.3
C.ident.C-2-furanyl CH.sub.2CH.sub.3 628 5,6-diCl CF.sub.3
C.ident.C-3-furanyl CH.sub.2CH.sub.3 629 5,6-diCl CF.sub.3
C.ident.C-2-thienyl CH.sub.2CH.sub.3 630 5,6-diCl CF.sub.3
C.ident.C-3-thienyl CH.sub.2CH.sub.3 631 5,6-diCl CF.sub.3
C.dbd.C-cycPr CH.sub.2CH.sub.3 632 5,6-diCl CF.sub.3 C.dbd.C--Ph
CH.sub.2CH.sub.3 633 5,6-diCl CF.sub.3 C.dbd.C-2-Pyridyl
CH.sub.2CH.sub.3 634 5,6-diCl CF.sub.3 C.dbd.C-3-Pyridyl
CH.sub.2CH.sub.3 635 5,6-diCl CF.sub.3 C.dbd.C-4-Pyridyl
CH.sub.2CH.sub.3 636 5,6-diCl CF.sub.3 C.dbd.C-2-furanyl
CH.sub.2CH.sub.3 637 5,6-diCl CF.sub.3 C.dbd.C-3-furanyl
CH.sub.2CH.sub.3 638 5,6-diCl CF.sub.3 C.dbd.C-2-thienyl
CH.sub.2CH.sub.3 639 5,6-diCl CF.sub.3 C.dbd.C-3-thienyl
CH.sub.2CH.sub.3 640 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-cycPr
CH.sub.2CH.sub.3 641 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2--Ph
CH.sub.2CH.sub.3 642 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl
CH.sub.2CH.sub.3 643 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-3-Pyridyl
CH.sub.2CH.sub.3 644 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-4-Pyridyl
CH.sub.2CH.sub.3 645 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-2-furanyl
CH.sub.2CH.sub.3 646 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-3-furanyl
CH.sub.2CH.sub.3 647 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-2-thienyl
CH.sub.2CH.sub.3 648 5,6-diCl CF.sub.3 CH.sub.2CH.sub.2-3-thienyl
CH.sub.2CH.sub.3 649 6-F CF.sub.3 C.ident.CCH.sub.2CH.sub.2OH H 650
6-F CF.sub.3 C.ident.C--CH(OH)Me H 651 6-F CF.sub.3
C.ident.C-(2-Cl)Ph H 652 6-F CF.sub.3 C.ident.C-(3-Cl)Ph H 653 6-F
CF.sub.3 C.ident.C-(4-Cl)Ph H 654 6-F CF.sub.3 C.ident.C-(2-F)Ph H
655 6-F CF.sub.3 C.ident.C-(3-F)Ph H 656 6-F CF.sub.3
C.ident.C-(4-F)Ph H 657 6-F CF.sub.3 C.ident.C-(2-OH)Ph H 658 6-F
CF.sub.3 C.ident.C-(3-OH)Ph H 659 6-F CF.sub.3 C.ident.C-(4-OH)Ph H
660 6-F CF.sub.3 C.ident.C-(2-OMe)Ph H 661 6-F CF.sub.3
C.ident.C-(3-OMe)Ph H 662 6-F CF.sub.3 C.ident.C-(4-OMe)Ph H 663
6-F CF.sub.3 C.ident.C-(2-CN)Ph H 664 6-F CF.sub.3
C.ident.C-(3-CN)Ph H 665 6-F CF.sub.3 C.ident.C-(4-CN)Ph H 666 6-F
CF.sub.3 C.ident.C-(2-NO.sub.2)Ph H 667 6-F CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 668 6-F CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 669 6-F CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 670 6-F CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 671 6-F CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 672 6-F CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 673 6-F CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 674 6-F CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 675 6-F CF.sub.3 C.ident.C-3-Pyridyl H
676 6-F CF.sub.3 C.ident.C-4-Pyridyl H 677 6-F CF.sub.3
C.ident.C-2-furanyl H 678 6-F CF.sub.3 C.ident.C-3-furanyl H 679
6-F CF.sub.3 C.ident.C-2-thienyl H 680 6-F CF.sub.3
C.ident.C-3-thienyl H 681 6-F CF.sub.3 C.ident.C-2-oxazolyl H 682
6-F CF.sub.3 C.ident.C-2-thiazolyl H 683 6-F CF.sub.3
C.ident.C-4-isoxazolyl H 684 6-F CF.sub.3 C.ident.C-2-imidazolyl H
685 6-F CF.sub.3 C.dbd.CCH.sub.2CH.sub.2OH H 686 6-F CF.sub.3
C.dbd.C--CH(OH)Me H 687 6-F CF.sub.3 C.dbd.C-(2-Cl)Ph H 688 6-F
CF.sub.3 C.dbd.C-(3-Cl)Ph H 689 6-F CF.sub.3 C.dbd.C-(4-Cl)Ph H 690
6-F CF.sub.3 C.dbd.C-(2-F)Ph H 691 6-F CF.sub.3 C.dbd.C-(3-F)Ph H
692 6-F CF.sub.3 C.dbd.C-(4-F)Ph H 693 6-F CF.sub.3
C.dbd.C-(2-OH)Ph H 694 6-F CF.sub.3 C.dbd.C-(3-OH)Ph H 695 6-F
CF.sub.3 C.dbd.C-(4-OH)Ph H 696 6-F CF.sub.3 C.dbd.C-(2-OMe)Ph H
697 6-F CF.sub.3 C.dbd.C-(3-OMe)Ph H 698 6-F CF.sub.3
C.dbd.C-(4-OMe)Ph H 699 6-F CF.sub.3 C.dbd.C-(2-CN)Ph H 700 6-F
CF.sub.3 C.dbd.C-(3-CN)Ph H 701 6-F CF.sub.3 C.dbd.C-(4-CN)Ph H 702
6-F CF.sub.3 C.dbd.C-(2-NO.sub.2)Ph H 703 6-F CF.sub.3
C.dbd.C-(3-NO.sub.2)Ph H 704 6-F CF.sub.3 C.dbd.C-(4-NO.sub.2)Ph H
705 6-F CF.sub.3 C.dbd.C-(2-NH.sub.2)Ph H 706 6-F CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 707 6-F CF.sub.3 C.dbd.C-(4-NH.sub.2)Ph H
708 6-F CF.sub.3 C.dbd.C-(2-NMe.sub.2)Ph H 709 6-F CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 710 6-F CF.sub.3 C.dbd.C-(4-NMe.sub.2)Ph
H 711 6-F CF.sub.3 C.dbd.C-3-Pyridyl H 712 6-F CF.sub.3
C.dbd.C-4-Pyridyl H 713 6-F CF.sub.3 C.dbd.C-2-furanyl H 714 6-F
CF.sub.3 C.dbd.C-3-furanyl H 715 6-F CF.sub.3 C.dbd.C-2-thienyl H
716 6-F CF.sub.3 C.dbd.C-3-thienyl H 717 6-F CF.sub.3
C.dbd.C-2-oxazolyl H 718 6-F CF.sub.3 C.dbd.C-2-thiazolyl H 719 6-F
CF.sub.3 C.dbd.C-4-isoxazolyl H 720 6-F CF.sub.3
C.dbd.C-2-imidazolyl H 721 6-F CF.sub.3 CH.sub.2CH.sub.2-cycPr H
722 6-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2- CH.sub.2OH H 723 6-F
CF.sub.3 CH.sub.2CH.sub.2--CH(OH)Me H 724 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-Cl)Ph H 725 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-Cl)Ph H 726 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 727 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 728 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 729 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 730 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 731 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 732 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 733 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 734 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 735 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 736 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 737 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 738 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 739 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 740 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 741 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 742 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 743 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 744 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 745 6-F CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 746 6-F CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 747 6-F CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 748 6-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 749 6-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 750 6-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 751 6-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 752 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 753 6-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 754 6-F CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 755 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 756 6-F CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 757 6-F CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 758 6-F CF.sub.3 C.ident.C-cycPr
CH.sub.3 759 6-F CF.sub.3 C.ident.C-iPr CH.sub.3 760 6-F CF.sub.3
C.ident.C--Pr CH.sub.3 761 6-F CF.sub.3 C.ident.C--Bu CH.sub.3 762
6-F CF.sub.3 C.ident.C-iBu CH.sub.3 763 6-F CF.sub.3 C.ident.C-tBu
CH.sub.3 764 6-F CF.sub.3 C.ident.C--Et CH.sub.3 765 6-F CF.sub.3
C.ident.C--Me CH.sub.3 766 6-F CF.sub.3 C.ident.C--Ph CH.sub.3 767
6-F CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 768 6-F CF.sub.3
C.ident.C-3-Pyridyl CH.sub.3 769 6-F CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.3 770 6-F CF.sub.3 C.ident.C-2-furanyl CH.sub.3 771 6-F
CF.sub.3 C.ident.C-3-furanyl CH.sub.3 772 6-F CF.sub.3
C.ident.C-2-thienyl CH.sub.3 773 6-F CF.sub.3 C.ident.C-3-thienyl
CH.sub.3 774 6-F CF.sub.3 C.dbd.C-cycPr CH.sub.3 775 6-F CF.sub.3
C.dbd.C-iPr CH.sub.3 776 6-F CF.sub.3 C.dbd.C--Pr CH.sub.3 777 6-F
CF.sub.3 C.dbd.C--Bu CH.sub.3 778 6-F CF.sub.3 C.dbd.C-iBu CH.sub.3
779 6-F CF.sub.3 C.dbd.C-tBu CH.sub.3 780 6-F CF.sub.3 C.dbd.C--Et
CH.sub.3 781 6-F CF.sub.3 C.dbd.C--Me CH.sub.3 782 6-F CF.sub.3
C.dbd.C--Ph CH.sub.3 783 6-F CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3
784 6-F CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 785 6-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 786 6-F CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 787 6-F CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 788 6-F
CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 789 6-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 790 6-F CF.sub.3 CH.sub.2CH.sub.2-cycPr
CH.sub.3 791 6-F CF.sub.3 CH.sub.2CH.sub.2--Ph CH.sub.3 792 6-F
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 793 6-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 794 6-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 795 6-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 796 6-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 797 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 798 6-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 799 6-F CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 800 6-F CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 801 6-F CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 802 6-F CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 803 6-F CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 804 6-F CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 805 6-F CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 806 6-F CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 807 6-F CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 808 6-F CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3
809 6-F CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 810 6-F CF.sub.3
C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 811 6-F CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 812 6-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 813 6-F CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 814 6-F CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 815 6-F CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 816 6-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 817 6-F CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 818 6-F CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 819 6-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 820 6-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 821 6-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 822 6-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 823 6-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 824 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 825 6-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 826 5-Cl CF.sub.3
C.ident.C-cycPr H 827 5-Cl CF.sub.3 C.ident.CCH.sub.2CH.sub.2OH H
828 5-Cl CF.sub.3 C.ident.C--CH(OH)Me H 829 5-Cl CF.sub.3
C.ident.C--Ph H 830 5-Cl CF.sub.3 C.ident.C-(2-Cl)Ph H 831 5-Cl
CF.sub.3 C.ident.C-(3-Cl)Ph H 832 5-Cl CF.sub.3 C.ident.C-(4-Cl)Ph
H 833 5-Cl CF.sub.3 C.ident.C-(2-F)Ph H 834 5-Cl CF.sub.3
C.ident.C-(3-F)Ph H 835 5-Cl CF.sub.3 C.ident.C-(4-F)Ph H 836 5-Cl
CF.sub.3 C.ident.C-(2-OH)Ph H 837 5-Cl CF.sub.3 C.ident.C-(3-OH)Ph
H 838 5-Cl CF.sub.3 C.ident.C-(4-OH)Ph H 839 5-Cl CF.sub.3
C.ident.C-(2-OMe)Ph H 840 5-Cl CF.sub.3 C.ident.C-(3-OMe)Ph H 841
5-Cl CF.sub.3 C.ident.C-(4-OMe)Ph H 842 5-Cl CF.sub.3
C.ident.C-(2-CN)Ph H 843 5-Cl CF.sub.3 C.ident.C-(3-CN)Ph H 844
5-Cl CF.sub.3 C.ident.C-(4-CN)Ph H 845 5-Cl CF.sub.3
C.ident.C-(2-NO.sub.2)Ph H 846 5-Cl CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 847 5-Cl CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 848 5-Cl CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 849 5-Cl CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 850 5-Cl CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 851 5-Cl CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 852 5-Cl CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 853 5-Cl CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 854 5-Cl CF.sub.3 C.ident.C-2-Pyridyl H
855 5-Cl CF.sub.3 C.ident.C-2-Pyridyl H 856 5-Cl CF.sub.3
C.ident.C-3-Pyridyl H 857 5-Cl CF.sub.3 C.ident.C-4-Pyridyl H 858
5-Cl CF.sub.3 C.ident.C-2-furanyl H 859 5-Cl CF.sub.3
C.ident.C-3-furanyl H 860 5-Cl CF.sub.3 C.ident.C-2-thienyl H 861
5-Cl CF.sub.3 C.ident.C-3-thienyl H 862 5-Cl CF.sub.3
C.ident.C-2-oxazolyl H 863 5-Cl CF.sub.3 C.ident.C-2-thiazolyl H
864 5-Cl CF.sub.3 C.ident.C-4-isoxazolyl H 865 5-Cl CF.sub.3
C.ident.C-2-imidazolyl H 866 5-Cl CF.sub.3 C.dbd.C-cycPr H 867 5-Cl
CF.sub.3 C.dbd.CCH.sub.2CH.sub.2OH H 868 5-Cl CF.sub.3
C.dbd.C--CH(OH)Me H 869 5-Cl CF.sub.3 C.dbd.C--Ph H 870 5-Cl
CF.sub.3 C.dbd.C-(2-Cl)Ph H 871 5-Cl CF.sub.3 C.dbd.C-(3-Cl)Ph H
872 5-Cl CF.sub.3 C.dbd.C-(4-Cl)Ph H 873 5-Cl CF.sub.3
C.dbd.C-(2-F)Ph H 874 5-Cl CF.sub.3 C.dbd.C-(3-F)Ph H 875 5-Cl
CF.sub.3 C.dbd.C-(4-F)Ph H 876 5-Cl CF.sub.3 C.dbd.C-(2-OH)Ph H 877
5-Cl CF.sub.3 C.dbd.C-(3-OH)Ph H 878 5-Cl CF.sub.3 C.dbd.C-(4-OH)Ph
H 879 5-Cl CF.sub.3 C.dbd.C-(2-OMe)Ph H 880 5-Cl CF.sub.3
C.dbd.C-(3-OMe)Ph H 881 5-Cl CF.sub.3 C.dbd.C-(4-OMe)Ph H 882 5-Cl
CF.sub.3 C.dbd.C-(2-CN)Ph H 883 5-Cl CF.sub.3 C.dbd.C-(3-CN)Ph H
884 5-Cl CF.sub.3 C.dbd.C-(4-CN)Ph H 885 5-Cl CF.sub.3
C.dbd.C-(2-NO.sub.2)Ph H 886 5-Cl CF.sub.3 C.dbd.C-(3-NO.sub.2)Ph H
887 5-Cl CF.sub.3 C.dbd.C-(4-NO.sub.2)Ph H 888 5-Cl CF.sub.3
C.dbd.C-(2-NH.sub.2)Ph H 889 5-Cl CF.sub.3 C.dbd.C-(3-NH.sub.2)Ph H
890 5-Cl CF.sub.3 C.dbd.C-(4-NH.sub.2)Ph H 891 5-Cl CF.sub.3
C.dbd.C-(2-NMe.sub.2)Ph H 892 5-Cl CF.sub.3 C.dbd.C-(3-NMe.sub.2)Ph
H 893 5-Cl CF.sub.3 C.dbd.C-(4-NMe.sub.2)Ph H 894 5-Cl CF.sub.3
C.dbd.C-2-Pyridyl H 895 5-Cl CF.sub.3 C.dbd.C-2-Pyridyl H 896 5-Cl
CF.sub.3 C.dbd.C-3-Pyridyl H 897 5-Cl CF.sub.3 C.dbd.C-4-Pyridyl H
898 5-Cl CF.sub.3 C.dbd.C-2-furanyl H 899 5-Cl CF.sub.3
C.dbd.C-3-furanyl H 900 5-Cl CF.sub.3 C.dbd.C-2-thienyl H 901 5-Cl
CF.sub.3 C.dbd.C-3-thienyl H 902 5-Cl CF.sub.3 C.dbd.C-2-oxazolyl H
903 5-Cl CF.sub.3 C.dbd.C-2-thiazolyl H
904 5-Cl CF.sub.3 C.dbd.C-4-isoxazolyl H 905 5-Cl CF.sub.3
C.dbd.C-2-imidazolyl H 906 5-Cl CF.sub.3 CH.sub.2CH.sub.2-cycPr H
907 5-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 908 5-Cl
CF.sub.3 CH.sub.2CH.sub.2--CH(OH)Me H 909 5-Cl CF.sub.3
CH.sub.2CH.sub.2Ph H 910 5-Cl CF.sub.3 CH.sub.2CH.sub.2-(2-Cl)Ph H
911 5-Cl CF.sub.3 CH.sub.2CH.sub.2-(3-Cl)Ph H 912 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 913 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 914 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 915 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 916 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 917 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 918 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 919 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 920 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 921 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 922 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 923 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 924 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 925 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 926 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 927 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 928 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 929 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 930 S-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 931 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 932 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 933 5-Cl CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 934 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 935 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 936 5-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 937 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 938 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 939 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 940 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 941 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 942 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 943 5-Cl CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 944 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 945 5-Cl CF.sub.3 C.ident.C-cycPr
CH.sub.3 946 5-Cl CF.sub.3 C.ident.C--Ph CH.sub.3 947 5-Cl CF.sub.3
C.ident.C-2-Pyridyl CH.sub.3 948 5-Cl CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.3 949 5-Cl CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 950 5-Cl
CF.sub.3 C.ident.C-2-furanyl CH.sub.3 951 5-Cl CF.sub.3
C.ident.C-3-furanyl CH.sub.3 952 5-Cl CF.sub.3 C.ident.C-2-thienyl
CH.sub.3 953 5-Cl CF.sub.3 C.ident.C-3-thienyl CH.sub.3 954 5-Cl
CF.sub.3 C.dbd.C-cycPr CH.sub.3 955 5-Cl CF.sub.3 C.dbd.C--Ph
CH.sub.3 956 5-Cl CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 957 5-Cl
CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 958 5-Cl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 959 5-Cl CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 960 5-Cl CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 961 5-Cl
CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 962 5-Cl CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 963 5-Cl CF.sub.3 CH.sub.2CH.sub.2-cycPr
CH.sub.3 964 5-Cl CF.sub.3 CH.sub.2CH.sub.2--Ph CH.sub.3 965 5-Cl
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 966 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 967 5-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 968 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 969 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 970 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 971 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 972 5-Cl CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 973 5-Cl CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 974 5-Cl CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 975 5-Cl CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 976 5-Cl CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 977 5-Cl CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 978 5-Cl CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 979 5-Cl CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 980 5-Cl CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 981 5-Cl CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3
982 5-Cl CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 983 5-Cl CF.sub.3
C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 984 5-Cl CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 985 5-Cl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 986 5-Cl CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 987 5-Cl CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 988 5-Cl CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 989 5-Cl CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 990 5-Cl CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 991 5-Cl CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 992 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 993 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 994 5-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 995 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 996 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 997 5-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 998 5-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 999 5-F CF.sub.3
C.ident.C-cycPr H 1000 5-F CF.sub.3 C.ident.CCH.sub.2CH.sub.2OH H
1001 5-F CF.sub.3 C.ident.C--CH(OH)Me H 1002 5-F CF.sub.3
C.ident.C--Ph H 1003 5-F CF.sub.3 C.ident.C-(2-Cl)Ph H 1004 5-F
CF.sub.3 C.ident.C-(3-Cl)Ph H 1005 5-F CF.sub.3 C.ident.C-(4-Cl)Ph
H 1006 5-F CF.sub.3 C.ident.C-(2-F)Ph H 1007 5-F CF.sub.3
C.ident.C-(3-F)Ph H 1008 5-F CF.sub.3 C.ident.C-(4-F)Ph H 1009 5-F
CF.sub.3 C.ident.C-(2-OH)Ph H 1010 5-F CF.sub.3 C.ident.C-(3-OH)Ph
H 1011 5-F CF.sub.3 C.ident.C-(4-OH)Ph H 1012 5-F CF.sub.3
C.ident.C-(2-OMe)Ph H 1013 5-F CF.sub.3 C.ident.C-(3-OMe)Ph H 1014
5-F CF.sub.3 C.ident.C-(4-OMe)Ph H 1015 5-F CF.sub.3
C.ident.C-(2-CN)Ph H 1016 5-F CF.sub.3 C.ident.C-(3-CN)Ph H 1017
5-F CF.sub.3 C.ident.C-(4-CN)Ph H 1018 5-F CF.sub.3
C.ident.C-(2-NO.sub.2)Ph H 1019 5-F CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 1020 5-F CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 1021 5-F CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 1022 5-F CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 1023 5-F CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 1024 5-F CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 1025 5-F CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 1026 5-F CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 1027 5-F CF.sub.3 C.ident.C-2-Pyridyl H
1028 5-F CF.sub.3 C.ident.C-2-Pyridyl H 1029 5-F CF.sub.3
C.ident.C-3-Pyridyl H 1030 5-F CF.sub.3 C.ident.C-4-Pyridyl H 1031
5-F CF.sub.3 C.ident.C-2-furanyl H 1032 5-F CF.sub.3
C.ident.C-3-furanyl H 1033 5-F CF.sub.3 C.ident.C-2-thienyl H 1034
5-F CF.sub.3 C.ident.C-3-thienyl H 1035 5-F CF.sub.3
C.ident.C-2-oxazolyl H 1036 5-F CF.sub.3 C.ident.C-2-thiazolyl H
1037 5-F CF.sub.3 C.ident.C-4-isoxazolyl H 1038 5-F CF.sub.3
C.ident.C-2-imidazolyl H 1039 5-F CF.sub.3 C.dbd.C-cycPr H 1040 5-F
CF.sub.3 C.dbd.CCH.sub.2CH.sub.2OH H 1041 5-F CF.sub.3
C.dbd.C--CH(OH)Me H 1042 5-F CF.sub.3 C.dbd.C--Ph H 1043 5-F
CF.sub.3 C.dbd.C-(2-Cl)Ph H 1044 5-F CF.sub.3 C.dbd.C-(3-Cl)Ph H
1045 5-F CF.sub.3 C.dbd.C-(4-Cl)Ph H 1046 5-F CF.sub.3
C.dbd.C-(2-F)Ph H 1047 5-F CF.sub.3 C.dbd.C-(3-F)Ph H 1048 5-F
CF.sub.3 C.dbd.C-(4-F)Ph H 1049 5-F CF.sub.3 C.dbd.C-(2-OH)Ph H
1050 5-F CF.sub.3 C.dbd.C-(3-OH)Ph H 1051 5-F CF.sub.3
C.dbd.C-(4-OH)Ph H 1052 5-F CF.sub.3 C.dbd.C-(2-OMe)Ph H 1053 5-F
CF.sub.3 C.dbd.C-(3-OMe)Ph H 1054 5-F CF.sub.3 C.dbd.C-(4-OMe)Ph H
1055 5-F CF.sub.3 C.dbd.C-(2-CN)Ph H 1056 5-F CF.sub.3
C.dbd.C-(3-CN)Ph H 1057 5-F CF.sub.3 C.dbd.C-(4-CN)Ph H 1058 5-F
CF.sub.3 C.dbd.C-(2-NO.sub.2)Ph H 1059 5-F CF.sub.3
C.dbd.C-(3-NO.sub.2)Ph H 1060 5-F CF.sub.3 C.dbd.C-(4-NO.sub.2)Ph H
1061 5-F CF.sub.3 C.dbd.C-(2-NH.sub.2)Ph H 1062 5-F CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 1063 5-F CF.sub.3 C.dbd.C-(4-NH.sub.2)Ph H
1064 5-F CF.sub.3 C.dbd.C-(2-NMe.sub.2)Ph H 1065 5-F CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 1066 5-F CF.sub.3 C.dbd.C-(4-NMe.sub.2)Ph
H 1067 5-F CF.sub.3 C.dbd.C-2-Pyridyl H 1068 5-F CF.sub.3
C.dbd.C-2-Pyridyl H 1069 5-F CF.sub.3 C.dbd.C-3-Pyridyl H 1070 5-F
CF.sub.3 C.dbd.C-4-Pyridyl H 1071 5-F CF.sub.3 C.dbd.C-2-furanyl H
1072 5-F CF.sub.3 C.dbd.C-3-furanyl H 1073 5-F CF.sub.3
C.dbd.C-2-thienyl H 1074 5-F CF.sub.3 C.dbd.C-3-thienyl H 1075 5-F
CF.sub.3 C.dbd.C-2-oxazolyl H 1076 5-F CF.sub.3 C.dbd.C-2-thiazolyl
H 1077 5-F CF.sub.3 C.dbd.C-4-isoxazolyl H 1078 5-F CF.sub.3
C.dbd.C-2-imidazolyl H 1079 5-F CF.sub.3 CH.sub.2CH.sub.2-cycPr H
1080 5-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 1081 5-F
CF.sub.3 CH.sub.2CH.sub.2--CH(OH)Me H 1082 5-F CF.sub.3
CH.sub.2CH.sub.2Ph H 1083 5-F CF.sub.3 CH.sub.2CH.sub.2-(2-Cl)Ph H
1084 5-F CF.sub.3 CH.sub.2CH.sub.2-(3-Cl)Ph H 1085 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 1086 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 1087 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 1088 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 1089 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 1090 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 1091 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 1092 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 1093 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 1094 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 1095 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 1096 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 1097 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 1098 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 1099 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 1100 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 1101 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 1102 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 1103 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 1104 5-F CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 1105 5-F CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 1106 5-F CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 1107 5-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 1108 5-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1109 5-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1110 5-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1111 5-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1112 5-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1113 5-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1114 5-F CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 1115 5-F CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 1116 5-F CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 1117 5-F CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 1118 5-F CF.sub.3 C.ident.C-cycPr
CH.sub.3 1119 5-F CF.sub.3 C.ident.C--Ph CH.sub.3 1120 5-F CF.sub.3
C.ident.C-2-Pyridyl CH.sub.3 1121 5-F CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.3 1122 5-F CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 1123 5-F
CF.sub.3 C.ident.C-2-furanyl CH.sub.3 1124 5-F CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1125 5-F CF.sub.3 C.ident.C-2-thienyl
CH.sub.3 1126 5-F CF.sub.3 C.ident.C-3-thienyl CH.sub.3 1127 5-F
CF.sub.3 C.dbd.C-cycPr CH.sub.3 1128 5-F CF.sub.3 C.dbd.C--Ph
CH.sub.3 1129 5-F CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 1130 5-F
CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 1131 5-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 1132 5-F CF.sub.3 C.dbd.C-2-furanyl
CH.sub.3 1133 5-F CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 1134 5-F
CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 1135 5-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 1136 5-F CF.sub.3 CH.sub.2CH.sub.2-cycPr
CH.sub.3 1137 5-F CF.sub.3 CH.sub.2CH.sub.2--Ph CH.sub.3 1138 5-F
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1139 5-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1140 5-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1141 5-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1142 5-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1143 5-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1144 5-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 1145 5-F CF.sub.3
C.ident.C-cycPr CH.sub.2CH.sub.3 1146 5-F CF.sub.3 C.ident.C--Ph
CH.sub.2CH.sub.3 1147 5-F CF.sub.3 C.ident.C-2-Pyridyl
CH.sub.2CH.sub.3 1148 5-F CF.sub.3 C.ident.C-3-Pyridyl
CH.sub.2CH.sub.3 1149 5-F CF.sub.3 C.ident.C-4-Pyridyl
CH.sub.2CH.sub.3 1150 5-F CF.sub.3 C.ident.C-2-furanyl
CH.sub.2CH.sub.3 1151 5-F CF.sub.3 C.ident.C-3-furanyl
CH.sub.2CH.sub.3 1152 5-F CF.sub.3 C.ident.C-2-thienyl
CH.sub.2CH.sub.3 1153 5-F CF.sub.3 C.ident.C-3-thienyl
CH.sub.2CH.sub.3 1154 5-F CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3
1155 5-F CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 1156 5-F CF.sub.3
C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 1157 5-F CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 1158 5-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 1159 5-F CF.sub.3
C.dbd.C-2-furanyl CH.sub.2CH.sub.3 1160 5-F CF.sub.3
C.dbd.C-3-furanyl CH.sub.2CH.sub.3 1161 5-F CF.sub.3
C.dbd.C-2-thienyl CH.sub.2CH.sub.3 1162 5-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.2CH.sub.3 1163 5-F CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3 1164 5-F CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.2CH.sub.3 1165 5-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 1166 5-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 1167 5-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.2CH.sub.3 1168 5-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 1169 5-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 1170 5-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.2CH.sub.3 1171 5-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 1172 5-Cl, 6-F CF.sub.3
C.ident.C-cycPr H 1173 5-Cl, 6-F CF.sub.3 C.ident.C--Ph H 1174
5-Cl, 6-F CF.sub.3 C.ident.C-2-Pyridyl H 1175 5-Cl, 6-F CF.sub.3
C.ident.C-3-Pyridyl H 1176 5-Cl, 6-F CF.sub.3 C.ident.C-4-Pyridyl H
1177 5-Cl, 6-F CF.sub.3 C.ident.C-2-furanyl H 1178 5-Cl, 6-F
CF.sub.3 C.ident.C-3-furanyl H 1179 5-Cl, 6-F CF.sub.3
C.ident.C-2-thienyl H 1180 5-Cl, 6-F CF.sub.3 C.ident.C-3-thienyl H
1181 5-Cl, 6-F CF.sub.3 C.dbd.C-cycPr H 1182 5-Cl, 6-F CF.sub.3
C.dbd.C--Ph H 1183 5-Cl, 6-F CF.sub.3 C.dbd.C-2-Pyridyl H 1184
5-Cl, 6-F CF.sub.3 C.dbd.C-3-Pyridyl H 1185 5-Cl, 6-F CF.sub.3
C.dbd.C-4-Pyridyl H 1186 5-Cl, 6-F CF.sub.3 C.dbd.C-2-furanyl H
1187 5-Cl, 6-F CF.sub.3 C.dbd.C-3-furanyl H 1188 5-Cl, 6-F CF.sub.3
C.dbd.C-2-thienyl H 1189 5-Cl, 6-F CF.sub.3 C.dbd.C-3-thienyl H
1190 5-Cl, 6-F CF.sub.3 CH.sub.2CH.sub.2-cycPr H 1191 5-Cl, 6-F
CF.sub.3 CH.sub.2CH.sub.2--Ph H 1192 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 1193 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1194 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1195 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1196 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1197 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1198 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1199 5-Cl, 6-F CF.sub.3
C.ident.C-cycPr CH.sub.3 1200 5-Cl, 6-F CF.sub.3 C.ident.C--Ph
CH.sub.3 1201 5-Cl, 6-F CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 1202
5-Cl, 6-F CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 1203 5-Cl, 6-F
CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 1204 5-Cl, 6-F CF.sub.3
C.ident.C-2-furanyl CH.sub.3 1205 5-Cl, 6-F CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1206 5-Cl, 6-F CF.sub.3
C.ident.C-2-thienyl CH.sub.3 1207 5-Cl, 6-F CF.sub.3
C.ident.C-3-thienyl CH.sub.3 1208 5-Cl, 6-F CF.sub.3 C.dbd.C-cycPr
CH.sub.3 1209 5-Cl, 6-F CF.sub.3 C.dbd.C--Ph CH.sub.3 1210 5-Cl,
6-F CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 1211 5-Cl, 6-F CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.3 1212 5-Cl, 6-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 1213 5-Cl, 6-F CF.sub.3
C.dbd.C-2-furanyl CH.sub.3 1214 5-Cl, 6-F CF.sub.3
C.dbd.C-3-furanyl CH.sub.3 1215 5-Cl, 6-F CF.sub.3
C.dbd.C-2-thienyl CH.sub.3 1216 5-Cl, 6-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 1217 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 1218 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 1219 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1220 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1221 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1222 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1223 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1224 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1225 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 1226 5-F, 6-Cl CF.sub.3
C.ident.C-cycPr H 1227 5-F, 6-Cl CF.sub.3 C.ident.C--Ph H 1228 5-F,
6-Cl CF.sub.3 C.ident.C-2-Pyridyl H 1229 5-F, 6-Cl CF.sub.3
C.ident.C-3-Pyridyl H 1230 5-F, 6-Cl CF.sub.3 C.ident.C-4-Pyridyl H
1231 5-F, 6-Cl CF.sub.3 C.ident.C-2-furanyl H 1232 5-F, 6-Cl
CF.sub.3 C.ident.C-3-furanyl H 1233 5-F, 6-Cl CF.sub.3
C.ident.C-2-thienyl H 1234 5-F, 6-Cl CF.sub.3 C.ident.C-3-thienyl H
1235 5-F, 6-Cl CF.sub.3 C.dbd.C-cycPr H 1236 5-F, 6-Cl CF.sub.3
C.dbd.C--Ph H 1237 5-F, 6-Cl CF.sub.3 C.dbd.C-2-Pyridyl H 1238 5-F,
6-Cl CF.sub.3 C.dbd.C-3-Pyridyl H 1239 5-F, 6-Cl CF.sub.3
C.dbd.C-4-Pyridyl H 1240 5-F, 6-Cl CF.sub.3 C.dbd.C-2-furanyl H
1241 5-F, 6-Cl CF.sub.3 C.dbd.C-3-furanyl H 1242 5-F, 6-Cl CF.sub.3
C.dbd.C-2-thienyl H 1243 5-F, 6-Cl CF.sub.3 C.dbd.C-3-thienyl H
1244 5-F, 6-Cl CF.sub.3 CH.sub.2CH.sub.2-cycPr H 1245 5-F, 6-Cl
CF.sub.3 CH.sub.2CH.sub.2--Ph H 1246 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 1247 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1248 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1249 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1250 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1251 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1252 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1253 5-F, 6-Cl CF.sub.3
C.ident.C-cycPr CH.sub.3 1254 5-F, 6-Cl CF.sub.3 C.ident.C--Ph
CH.sub.3 1255 5-F, 6-Cl CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 1256
5-F, 6-Cl CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 1257 5-F, 6-Cl
CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 1258 5-F, 6-Cl CF.sub.3
C.ident.C-2-furanyl CH.sub.3 1259 5-F, 6-Cl CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1260 5-F, 6-Cl CF.sub.3
C.ident.C-2-thienyl CH.sub.3 1261 5-F, 6-Cl CF.sub.3
C.ident.C-3-thienyl CH.sub.3 1262 5-F, 6-Cl CF.sub.3 C.dbd.C-cycPr
CH.sub.3 1263 5-F, 6-Cl CF.sub.3 C.dbd.C--Ph CH.sub.3 1264 5-F,
6-Cl CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 1265 5-F, 6-Cl CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.3 1266 5-F, 6-Cl CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 1267 5-F, 6-Cl CF.sub.3
C.dbd.C-2-furanyl CH.sub.3 1268 5-F, 6-Cl CF.sub.3
C.dbd.C-3-furanyl CH.sub.3 1269 5-F, 6-Cl CF.sub.3
C.dbd.C-2-thienyl CH.sub.3 1270 5-F, 6-Cl CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 1271 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 1272 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 1273 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1274 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1275 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1276 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1277 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1278 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1279 5-F, 6-Cl CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 1280 6-Cl, 8-F CF.sub.3
C.ident.C-cycPr H 1281 6-Cl, 8-F CF.sub.3 C.ident.C--Ph H 1282
6-Cl, 8-F CF.sub.3 C.ident.C-2-Pyridyl H 1283 6-Cl, 8-F CF.sub.3
C.ident.C-3-Pyridyl H 1284 6-Cl, 8-F CF.sub.3 C.ident.C-4-Pyridyl H
1285 6-Cl, 8-F CF.sub.3 C.ident.C-2-furanyl H 1286 6-Cl, 8-F
CF.sub.3 C.ident.C-3-furanyl H 1287 6-Cl, 8-F CF.sub.3
C.ident.C-2-thienyl H 1288 6-Cl, 8-F CF.sub.3 C.ident.C-3-thienyl H
1289 6-Cl, 8-F CF.sub.3 C.dbd.C-cycPr H 1290 6-Cl, 8-F CF.sub.3
C.dbd.C--Ph H 1291 6-Cl, 8-F CF.sub.3 C.dbd.C-2-Pyridyl H 1292
6-Cl, 8-F CF.sub.3 C.dbd.C-3-Pyridyl H 1293 6-Cl, 8-F CF.sub.3
C.dbd.C-4-Pyridyl H 1294 6-Cl, 8-F CF.sub.3 C.dbd.C-2-furanyl H
1295 6-Cl, 8-F CF.sub.3 C.dbd.C-3-furanyl H 1296 6-Cl, 8-F CF.sub.3
C.dbd.C-2-thienyl H 1297 6-Cl, 8-F CF.sub.3 C.dbd.C-3-thienyl H
1298 6-Cl, 8-F CF.sub.3 CH.sub.2CH.sub.2-cycPr H 1299 6-Cl, 8-F
CF.sub.3 CH.sub.2CH.sub.2--Ph H 1300 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 1301 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1302 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1303 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1304 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1305 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1306 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1307 6-Cl, 8-F CF.sub.3
C.ident.C-cycPr CH.sub.3 1308 6-Cl, 8-F CF.sub.3 C.ident.C--Ph
CH.sub.3 1309 6-Cl, 8-F CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 1310
6-Cl, 8-F CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 1311 6-Cl, 8-F
CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 1312 6-Cl, 8-F CF.sub.3
C.ident.C-2-furanyl CH.sub.3 1313 6-Cl, 8-F CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1314 6-Cl, 8-F CF.sub.3
C.ident.C-2-thienyl CH.sub.3 1315 6-Cl, 8-F CF.sub.3
C.ident.C-3-thienyl CH.sub.3 1316 6-Cl, 8-F CF.sub.3 C.dbd.C-cycPr
CH.sub.3 1317 6-Cl, 8-F CF.sub.3 C.dbd.C--Ph CH.sub.3 1318 6-Cl,
8-F CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 1319 6-Cl, 8-F CF.sub.3
C.dbd.C-3-Pyridyl CH.sub.3 1320 6-Cl, 8-F CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 1321 6-Cl, 8-F CF.sub.3
C.dbd.C-2-furanyl CH.sub.3 1322 6-Cl, 8-F CF.sub.3
C.dbd.C-3-furanyl CH.sub.3 1323 6-Cl, 8-F CF.sub.3
C.dbd.C-2-thienyl CH.sub.3 1324 6-Cl, 8-F CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 1325 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 1326 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 1327 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1328 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1329 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1330 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1331 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1332 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1333 6-Cl, 8-F CF.sub.3
CH.sub.2Ch.sub.2-3-thienyl CH.sub.3 1334 6-CH.sub.3 CF.sub.3
C.ident.C-cycPr H 1335 6-CH.sub.3 CF.sub.3 C.ident.C--Ph H 1336
6-CH.sub.3 CF.sub.3 C.ident.C-2-Pyridyl H 1337 6-CH.sub.3 CF.sub.3
C.ident.C-3-Pyridyl H 1338 6-CH.sub.3 CF.sub.3 C.ident.C-4-Pyridyl
H 1339 6-CH.sub.3 CF.sub.3 C.ident.C-2-furanyl H 1340 6-CH.sub.3
CF.sub.3 C.ident.C-3-furanyl H 1341 6-CH.sub.3 CF.sub.3
C.ident.C-2-thienyl H 1342 6-CH.sub.3 CF.sub.3 C.ident.C-3-thienyl
H 1343 6-CH.sub.3 CF.sub.3 C.dbd.C-cycPr H 1344 6-CH.sub.3 CF.sub.3
C.dbd.C--Ph H 1345 6-CH.sub.3 CF.sub.3 C.dbd.C-2-Pyridyl H 1346
6-CH.sub.3 CF.sub.3 C.dbd.C-3-Pyridyl H 1347 6-CH.sub.3 CF.sub.3
C.dbd.C-4-Pyridyl H 1348 6-CH.sub.3 CF.sub.3 C.dbd.C-2-furanyl H
1349 6-CH.sub.3 CF.sub.3 C.dbd.C-3-furanyl H 1350 6-CH.sub.3
CF.sub.3 C.dbd.C-2-thienyl H 1351 6-CH.sub.3 CF.sub.3
C.dbd.C-3-thienyl H 1352 6-CH.sub.3 CF.sub.3 CH.sub.2CH.sub.2-cycPr
H 1353 6-CH.sub.3 CF.sub.3 CH.sub.2CH.sub.2--Ph H 1354 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl H 1355 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1356 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1357 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1358 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1359 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1360 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1361 6-CH.sub.3 CF.sub.3
C.ident.C-cycPr CH.sub.3 1362 6-CH.sub.3 CF.sub.3 C.ident.C--Ph
CH.sub.3 1363 6-CH.sub.3 CF.sub.3 C.ident.C-2-Pyridyl CH.sub.3 1364
6-CH.sub.3 CF.sub.3 C.ident.C-3-Pyridyl CH.sub.3 1365 6-CH.sub.3
CF.sub.3 C.ident.C-4-Pyridyl CH.sub.3 1366 6-CH.sub.3 CF.sub.3
C.ident.C-2-furanyl CH.sub.3 1367 6-CH.sub.3 CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1368 6-CH.sub.3 CF.sub.3
C.ident.C-2-thienyl CH.sub.3 1369 6-CH.sub.3 CF.sub.3
C.ident.C-3-thienyl CH.sub.3 1370 6-CH.sub.3 CF.sub.3 C.dbd.C-cycPr
CH.sub.3 1371 6-CH.sub.3 CF.sub.3 C.dbd.C--Ph CH.sub.3 1372
6-CH.sub.3 CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3 1373 6-CH.sub.3
CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 1374 6-CH.sub.3 CF.sub.3
C.dbd.C-4-Pyridyl CH.sub.3 1375 6-CH.sub.3 CF.sub.3
C.dbd.C-2-furanyl CH.sub.3 1376 6-CH.sub.3 CF.sub.3
C.dbd.C-3-furanyl CH.sub.3 1377 6-CH.sub.3 CF.sub.3
C.dbd.C-2-thienyl CH.sub.3 1378 6-CH.sub.3 CF.sub.3
C.dbd.C-3-thienyl CH.sub.3 1379 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-cycPr CH.sub.3 1380 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2--Ph CH.sub.3 1381 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1382 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1383 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1384 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1385 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1386 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1387 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.3 1388 6-COCH.sub.3 CF.sub.3
C.ident.C-cycPr H 1389 6-COCH.sub.3 CF.sub.3 C.ident.C--Ph H 1390
6-COCH.sub.3 CF.sub.3 C.ident.C-2-Pyridyl H 1391 6-COCH.sub.3
CF.sub.3 C.ident.C-3-Pyridyl H 1392 6-COCH.sub.3 CF.sub.3
C.ident.C-4-Pyridyl H 1393 6-COCH.sub.3 CF.sub.3
C.ident.C-2-furanyl H 1394 6-COCH.sub.3 CF.sub.3
C.ident.C-3-furanyl H 1395 6-COCH.sub.3 CF.sub.3
C.ident.C-2-thienyl H 1396 6-COCH.sub.3 CF.sub.3
C.ident.C-3-thienyl H 1397 6-NH.sub.2 CF.sub.3 C.ident.C-cycPr H
1398 6-NH.sub.2 CF.sub.3 C.ident.C--Ph H 1399 6NH.sub.2 CF.sub.3
C.ident.C-2-Pyridyl H 1400 6-NH.sub.2 CF.sub.3 C.ident.C-3-Pyridyl
H 1401 6-NH.sub.2 CF.sub.3 C.ident.C-4-Pyridyl H 1402 6-NH.sub.2
CF.sub.3 C.ident.C-2-furanyl H 1403 6-NH.sub.2 CF.sub.3
C.ident.C-3-furanyl H 1404 6-NH.sub.2 CF.sub.3 C.ident.C-2-thienyl
H 1405 6-NH.sub.2 CF.sub.3 C.ident.C-3-thienyl H 1406 6-NMe.sub.2
CF.sub.3 C.ident.C-cycPr H 1407 6-NMe.sub.2 CF.sub.3 C.ident.C--Ph
H 1408 6-NMe.sub.2 CF.sub.3 C.ident.C-2-Pyridyl H 1409 6-NMe.sub.2
CF.sub.3 C.ident.C-3-Pyridyl H 1410 6-NMe.sub.2 CF.sub.3
C.ident.C-4-Pyridyl H 1411 6-NMe.sub.2 CF.sub.3 C.ident.C-2-furanyl
H 1412 6-NMe.sub.2 CF.sub.3 C.ident.C-3-furanyl H 1413 6-NMe.sub.2
CF.sub.3 C.ident.C-2-thienyl H 1414 6-NMe.sub.2 CF.sub.3
C.ident.C-3-thienyl H 1415 7-Cl CF.sub.3 C.ident.C-cycPr H 1416
7-Cl CF.sub.3 C.ident.C--Ph H 1417 7-Cl CF.sub.3
C.ident.C-2-Pyridyl H 1418 7-Cl CF.sub.3 C.ident.C-3-Pyridyl H 1419
7-Cl CF.sub.3 C.ident.C-4-Pyridyl H 1420 7-Cl CF.sub.3
C.ident.C-2-furanyl H 1421 7-Cl CF.sub.3 C.ident.C-3-furanyl H 1422
7-Cl CF.sub.3 C.ident.C-2-thienyl H 1423 7-Cl CF.sub.3
C.ident.C-3-thienyl H 1424 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-cycPr H 1425 5,6-OCH.sub.2O-- CF.sub.3
C.ident.CCH.sub.2CH.sub.2OH H 1426 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C--CH(OH)Me H 1427 5,6-OCH.sub.2O-- CF.sub.3 C.ident.C--Ph
H 1428 5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-(2-Cl)Ph H 1429
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-(3-Cl)Ph H 1430
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-(4-Cl)Ph H 1431
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-(2-F)Ph H 1432 5,6-OCH.sub.2O--
CF.sub.3 C.ident.C-(3-F)Ph H 1433 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-F)Ph H 1434 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-OH)Ph H 1435 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-OH)Ph H 1436 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-OH)Ph H 1437 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-OMe)Ph H 1438 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-OMe)Ph H 1439 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-OMe)Ph H 1440 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-CN)Ph H 1441 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-CN)Ph H 1442 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-CN)Ph H 1443 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-NO.sub.2)Ph H 1444 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-NO.sub.2)Ph H 1445 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-NO.sub.2)Ph H 1446 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-NH.sub.2)Ph H 1447 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-NH.sub.2)Ph H 1448 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-NH.sub.2)Ph H 1449 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(2-NMe.sub.2)Ph H 1450 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(3-NMe.sub.2)Ph H 1451 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-(4-NMe.sub.2)Ph H 1452 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-Pyridyl H 1453 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-Pyridyl H 1454 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-Pyridyl H 1455 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-4-Pyridyl H 1456 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-furanyl H 1457 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-furanyl H 1458 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-thienyl H 1459 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-thienyl H 1460 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-oxazolyl H 1461 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-thiazolyl H 1462 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-4-isoxazolyl H 1463 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-imidazolyl H 1464 6-COCH.sub.3 CF.sub.3 C.dbd.C-cycPr H
1465 6-COCH.sub.3 CF.sub.3 C.dbd.C--Ph H 1466 6-COCH.sub.3 CF.sub.3
C.dbd.C-2-Pyridyl H 1467 6-COCH.sub.3 CF.sub.3 C.dbd.C-3-Pyridyl H
1468 6-COCH.sub.3 CF.sub.3 C.dbd.C-4-Pyridyl H 1469 6-COCH.sub.3
CF.sub.3 C.dbd.C-2-furanyl H 1470 6-COCH.sub.3 CF.sub.3
C.dbd.C-3-furanyl H 1471 6-COCH.sub.3 CF.sub.3 C.dbd.C-2-thienyl H
1472 6-COCH.sub.3 CF.sub.3 C.dbd.C-3-thienyl H 1473 6-NH.sub.2
CF.sub.3 C.dbd.C-cycPr H 1474 6-NH.sub.2 CF.sub.3 C.dbd.C--Ph H
1475 6-NH.sub.2 CF.sub.3 C.dbd.C-2-Pyridyl H 1476 6-NH.sub.2
CF.sub.3 C.dbd.C-3-Pyridyl H 1477 6-NH.sub.2 CF.sub.3
C.dbd.C-4-Pyridyl H 1478 6-NH.sub.2 CF.sub.3 C.dbd.C-2-furanyl H
1479 6-NH.sub.2 CF.sub.3 C.dbd.C-3-furanyl H 1480 6-NH.sub.2
CF.sub.3 C.dbd.C-2-thienyl H 1481 6-NH.sub.2 CF.sub.3
C.dbd.C-3-thienyl H 1482 6-NMe.sub.2 CF.sub.3 C.dbd.C-cycPr H 1483
6-NMe.sub.2 CF.sub.3 C.dbd.C--Ph H 1484 6-NMe.sub.2 CF.sub.3
C.dbd.C-2-Pyridyl H 1485 6-NMe.sub.2 CF.sub.3 C.dbd.C-3-Pyridyl H
1486 6-NMe.sub.2 CF.sub.3 C.dbd.C-4-Pyridyl H 1487 6-NMe.sub.2
CF.sub.3 C.dbd.C-2-furanyl H 1488 6-NMe.sub.2 CF.sub.3
C.dbd.C-3-furanyl H
1489 6-NMe.sub.2 CF.sub.3 C.dbd.C-2-thienyl H 1490 6-NMe.sub.2
CF.sub.3 C.dbd.C-3-thienyl H 1491 7-Cl CF.sub.3 C.dbd.C-cycPr H
1492 7-Cl CF.sub.3 C.dbd.C--Ph H 1493 7-Cl CF.sub.3
C.dbd.C-2-Pyridyl H 1494 7-Cl CF.sub.3 C.dbd.C-3-Pyridyl H 1495
7-Cl CF.sub.3 C.dbd.C-4-Pyridyl H 1496 7-Cl CF.sub.3
C.dbd.C-2-furanyl H 1497 7-Cl CF.sub.3 C.dbd.C-3-furanyl H 1498
7-Cl CF.sub.3 C.dbd.C-2-thienyl H 1499 7-Cl CF.sub.3
C.dbd.C-3-thienyl H 1500 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-cycPr H
1501 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.CCH.sub.2CH.sub.2OH H 1502
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C--CH(OH)Me H 1503 5,6-OCH.sub.2O--
CF.sub.3 C.dbd.C--Ph H 1504 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(2-Cl)Ph H 1505 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(3-Cl)Ph
H 1506 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(4-Cl)Ph H 1507
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(2-F)Ph H 1508 5,6-OCH.sub.2O--
CF.sub.3 C.dbd.C-(3-F)Ph H 1509 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(4-F)Ph H 1510 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(2-OH)Ph H
1511 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(3-OH)Ph H 1512
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(4-OH)Ph H 1513 5,6-OCH.sub.2O--
CF.sub.3 C.dbd.C-(2-OMe)Ph H 1514 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(3-OMe)Ph H 1515 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(4-OMe)Ph H 1516 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(2-CN)Ph
H 1517 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(3-CN)Ph H 1518
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-(4-CN)Ph H 1519 5,6-OCH.sub.2O--
CF.sub.3 C.dbd.C-(2-NO.sub.2)Ph H 1520 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(3-NO.sub.2)Ph H 1521 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(4-NO.sub.2)Ph H 1522 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(2-NH.sub.2)Ph H 1523 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(3-NH.sub.2)Ph H 1524 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(4-NH.sub.2)Ph H 1525 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(2-NMe.sub.2)Ph H 1526 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(3-NMe.sub.2)Ph H 1527 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-(4-NMe.sub.2)Ph H 1528 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-Pyridyl H 1529 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-Pyridyl H 1530 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-3-Pyridyl H 1531 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-4-Pyridyl H 1532 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-furanyl H 1533 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-3-furanyl H 1534 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-thienyl H 1535 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-3-thienyl H 1536 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-oxazolyl H 1537 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-thiazolyl H 1538 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-4-isoxazolyl H 1539 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-2-imidazolyl H 1540 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-cycPr H 1541 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2OH H 1542 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2--CH(OH)Me H 1543 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2Ph H 1544 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-Cl)Ph H 1545 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-Cl)Ph H 1546 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-Cl)Ph H 1547 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-F)Ph H 1548 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-F)Ph H 1549 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-F)Ph H 1550 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-OH)Ph H 1551 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-OH)Ph H 1552 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-OH)Ph H 1553 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-OMe)Ph H 1554 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-OMe)Ph H 1555 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-OMe)Ph H 1556 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-CN)Ph H 1557 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-CN)Ph H 1558 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-CN)Ph H 1559 5,6-OCl120-- CF.sub.3
CH.sub.2CH.sub.2-(2-NO.sub.2)Ph H 1560 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-NO.sub.2)Ph H 1561 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-NO.sub.2)Ph H 1562 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-NH.sub.2)Ph H 1563 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-NH.sub.2)Ph H 1564 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-NH.sub.2)Ph H 1565 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(2-NMe.sub.2)Ph H 1566 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(3-NMe.sub.2)Ph H 1567 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-(4-NMe.sub.2)Ph H 1568 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl H 1569 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-3-Pyridyl H 1570 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-4-Pyridyl H 1571 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-furanyl H 1572 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-3-furanyl H 1573 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-thienyl H 1574 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-3-thienyl H 1575 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-oxazolyl H 1576 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-thiazolyl H 1577 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-4-isoxazolyl H 1578 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-imidazolyl H 1579 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-cycPr CH.sub.3 1580 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C--Ph CH.sub.3 1581 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-Pyridyl CH.sub.3 1582 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-Pyridyl CH.sub.3 1583 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-4-Pyridyl CH.sub.3 1584 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-furanyl CH.sub.3 1585 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-furanyl CH.sub.3 1586 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-2-thienyl CH.sub.3 1587 5,6-OCH.sub.2O-- CF.sub.3
C.ident.C-3-thienyl CH.sub.3 1588 5,6-OCH.sub.2O-- CF.sub.3
C.dbd.C-cycPr CH.sub.3 1589 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C--Ph
CH.sub.3 1590 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.3
1591 5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.3 1592
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-4-Pyridyl CH.sub.3 1593
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-furanyl CH.sub.3 1594
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-furanyl CH.sub.3 1595
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-thienyl CH.sub.3 1596
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-thienyl CH.sub.3 1597
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-cycPr CH.sub.3 1598
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2--Ph CH.sub.3 1599
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-2-Pyridyl CH.sub.3 1600
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-3-Pyridyl CH.sub.3 1601
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-4-Pyridyl CH.sub.3 1602
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-2-furanyl CH.sub.3 1603
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-3-furanyl CH.sub.3 1604
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-2-thienyl CH.sub.3 1605
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-3-thienyl CH.sub.3 1606
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-cycPr CH.sub.2CH.sub.3 1607
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C--Ph CH.sub.2CH.sub.3 1608
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-2-Pyridyl CH.sub.2CH.sub.3 1609
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-3-Pyridyl CH.sub.2CH.sub.3 1610
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-4-Pyridyl CH.sub.2CH.sub.3 1611
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-2-furanyl CH.sub.2CH.sub.3 1612
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-3-furanyl CH.sub.2CH.sub.3 1613
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-2-thienyl CH.sub.2CH.sub.3 1614
5,6-OCH.sub.2O-- CF.sub.3 C.ident.C-3-thienyl CH.sub.2CH.sub.3 1615
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-cycPr CH.sub.2CH.sub.3 1616
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C--Ph CH.sub.2CH.sub.3 1617
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-Pyridyl CH.sub.2CH.sub.3 1618
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-Pyridyl CH.sub.2CH.sub.3 1619
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-4-Pyridyl CH.sub.2CH.sub.3 1620
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-furanyl CH.sub.2CH.sub.3 1621
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-furanyl CH.sub.2CH.sub.3 1622
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-2-thienyl CH.sub.2CH.sub.3 1623
5,6-OCH.sub.2O-- CF.sub.3 C.dbd.C-3-thienyl CH.sub.2CH.sub.3 1624
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-cycPr CH.sub.2CH.sub.3
1625 5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2--Ph
CH.sub.2CH.sub.3 1626 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-Pyridyl CH.sub.2CH.sub.3 1627 5,6-OCH.sub.2O--
CF.sub.3 CH.sub.2CH.sub.2-3-Pyridyl CH.sub.2CH.sub.3 1628
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-4-Pyridyl
CH.sub.2CH.sub.3 1629 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-2-furanyl CH.sub.2CH.sub.3 1630 5,6-OCH.sub.2O--
CF.sub.3 CH.sub.2CH.sub.2-3-furanyl CH.sub.2CH.sub.3 1631
5,6-OCH.sub.2O-- CF.sub.3 CH.sub.2CH.sub.2-2-thienyl
CH.sub.2CH.sub.3 1632 5,6-OCH.sub.2O-- CF.sub.3
CH.sub.2CH.sub.2-3-thienyl CH.sub.2CH.sub.3 *Unless otherwise
indicated, stereochemisty is (+/-). TABLE 3* 28 Ex. # R.sup.3
R.sup.1 R.sup.2 R.sup.8 1 6-Cl CF.sub.3 C.ident.C--Pr H 2 6-Cl
CF.sub.3 C.ident.C-Bu H 3 6-Cl CF.sub.3 C.ident.C-iBu H 4 6-Cl
CF.sub.3 C.ident.C-tBu H 5 6-Cl CF.sub.3 C.ident.C-Me H 6 6-Cl
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 7 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 8 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 9 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 10 6-Cl CF.sub.3 CH.sub.2CH.sub.2-tBu H
11 6-Cl CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 H 12 6-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 13 6-Cl CF.sub.3
C.ident.C-iPr CH.sub.3 14 6-Cl CF.sub.3 C.ident.C--Pr CH.sub.3 15
6-Cl CF.sub.3 C.ident.C-Bu CH.sub.3 16 6-Cl CF.sub.3 C.ident.C-iBu
CH.sub.3 17 6-Cl CF.sub.3 C.ident.C-tBu CH.sub.3 18 6-Cl CF.sub.3
C.ident.C-Et CH.sub.3 19 6-Cl CF.sub.3 C.ident.C-Me CH.sub.3 20
6-Cl CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 21 6-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 22 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 23 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 24 6-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 25 6-Cl CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 26 6-Cl CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 27 6-Cl CF.sub.3 C.ident.C--Pr CH.sub.2CH.sub.3 28
6-Cl CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3 29 6-Cl CF.sub.3
C.ident.C-iBu CH.sub.2CH.sub.3 30 6-Cl CF.sub.3 C.ident.C-tBu
CH.sub.2CH.sub.3 31 6-Cl CF.sub.3 C.ident.C-Et CH.sub.2CH.sub.3 32
6-Cl CF.sub.3 C.ident.C-Me CH.sub.2CH.sub.3 33 6-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.2CH.sub.3 34 6-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.su- b.3 CH.sub.2CH.sub.3 35 6-Cl
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).- sub.2 CH.sub.2CH.sub.3 36
6-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.- sub.3 CH.sub.2CH.sub.3
37 6-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 38 6-Cl
CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 39 6-MeO CF.sub.3
C.ident.C--Pr H 40 6-MeO CF.sub.3 C.ident.C-Bu H 41 6-MeO CF.sub.3
C.ident.C-iBu H 42 6-MeO CF.sub.3 C.ident.C-tBu H 43 6-MeO CF.sub.3
C.ident.C-Et H 44 6-MeO CF.sub.3 C.ident.C-Me H 45 6-MeO CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 H 46 6-MeO CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 47 6-MeO CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 48 6-MeO CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 49 6-NeO CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 50 6-MeO CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 51 6-MeO CF.sub.3 CH.sub.2CH.sub.2-tBu H
52 6-MeO CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 H 53 6-NeO CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 54 6-MeO CF.sub.3
C.ident.C-iPr CH.sub.3 55 6-MeO CF.sub.3 C.ident.C--Pr CH.sub.3 56
6-MeO CF.sub.3 C.ident.C-Bu CH.sub.3 57 6-MeO CF.sub.3
C.ident.C-iBu CH.sub.3 58 6-MeO CF.sub.3 C.ident.C-tBu CH.sub.3 59
6-MeO CF.sub.3 C.ident.C-Et CH.sub.3 60 6-MeO CF.sub.3 C.ident.C-Me
CH.sub.3 61 6-MeO CF.sub.3 CH.sub.2C.ident.C--CH.sub.- 3 CH.sub.3
62 6-MeO CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 63
6-MeO CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 64 6-MeO
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 65 6-MeO
CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 66 6-MeO CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 67 6-MeO CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 68 6-MeO CF.sub.3 C.ident.C--Pr CH.sub.2CH.sub.3
69 6-MeO CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3 70 6-MeO CF.sub.3
C.ident.C-iBu CH.sub.2CH.sub.3 71 6-MeO CF.sub.3 C.ident.C-tBu
CH.sub.2CH.sub.3 72 6-MeO CF.sub.3 C.ident.C-Et CH.sub.2CH.sub.3 73
6-MeO CF.sub.3 C.ident.C-Me CH.sub.2CH.sub.3 74 6-MeO CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.2CH.sub.3 75 6-MeO CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.s- ub.3 CH.sub.2CH.sub.3 76 6-MeO
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3- ).sub.2 CH.sub.2CH.sub.3 77
6-MeO CF.sub.3 CH.sub.2CH.sub.2CH.sub.2- CH.sub.3 CH.sub.2CH.sub.3
78 6-MeO CF.sub.3 CH.sub.2CH.sub.2CH.sub.- 3 CH.sub.2CH.sub.3 79
6-MeO CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 80 5,6-diF
CF.sub.3 C.ident.C--Pr H 81 5,6-diF CF.sub.3 C.ident.C-Bu H 82
5,6-diF CF.sub.3 C.ident.C-iBu H 83 5,6-diF CF.sub.3 C.ident.C-tBu
H 84 5,6-diF CF.sub.3 C.ident.C-Me H 85 5,6-diF CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 H 86 5,6-diF CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 87 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 88 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 89 5,6-diF CF.sub.3 CH.sub.2CH.sub.2-tBu
H 90 5,6-diF CF.sub.3 C.ident.C-iPr CH.sub.3 91 5,6-diF CF.sub.3
C.ident.C--Pr CH.sub.3 92 5,6-diF CF.sub.3 C.ident.C-Bu CH.sub.3 93
5,6-diF CF.sub.3 C.ident.C-iBu CH.sub.3 94 5,6-diF CF.sub.3
C.ident.C-tBu CH.sub.3 95 5,6-diF CF.sub.3 C.ident.C-Et CH.sub.3 96
5,6-diF CF.sub.3 C.ident.C-Me CH.sub.3 97 5,6-diF CF.sub.3
C.ident.C-Ph CH.sub.3 98 5,6-diF CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 99 5,6-diF CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 100 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 101 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 102 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 103 5,6-diF CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 104 5,6-diF CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 105 5,6-diF CF.sub.3 C.ident.C--Pr
CH.sub.2CH.sub.3 106 5,6-diF CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3
107 5,6-diF CF.sub.3 C.ident.C-iBu CH.sub.2CH.sub.3 108 5,6-diF
CF.sub.3 C.ident.C-tBu CH.sub.2CH.sub.3 109 5,6-diF CF.sub.3
C.ident.C-Et CH.sub.2CH.sub.3 110 5,6-diF CF.sub.3 C.ident.C-Me
CH.sub.2CH.sub.3 111 5,6-diF CF.sub.3 CH.sub.2C.ident.C--CH.sub.3
CH.sub.2CH.sub.3 112 5,6-diF CF.sub.3 CH.sub.2C.ident.C--CH.sub.2C-
H.sub.3 CH.sub.2CH.sub.3 113 5,6-diF CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.2CH.sub.3 114 5,6-diF
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 115
5,6-diF CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 116
5,6-diF CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 117 6-F
CF.sub.3 C.ident.C--Pr H 118 6-F CF.sub.3 C.ident.C-Bu H 119 6-F
CF.sub.3 C.ident.C-iBu H 120 6-F CF.sub.3 C.ident.C-tBu H 121 6-F
CF.sub.3 C.ident.C-Me H 122 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 123 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 124 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 125 6-F CF.sub.3 CH.sub.2CH.sub.2-tBu H
126 6-F CF.sub.3 C.ident.C-iPr CH.sub.3 127 6-F CF.sub.3
C.ident.C--Pr CH.sub.3 128 6-F CF.sub.3 C.ident.C-Bu CH.sub.3 129
6-F CF.sub.3 C.ident.C-iBu CH.sub.3 130 6-F CF.sub.3 C.ident.C-tBu
CH.sub.3 131 6-F CF.sub.3 C.ident.C-Et CH.sub.3 132 6-F CF.sub.3
C.ident.C-Me CH.sub.3 133 6-F CF.sub.3 CH.sub.2C.ident.C--CH.sub.3
CH.sub.3 134 6-F CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3
CH.sub.3 135 6-F CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2
CH.sub.3 136 6-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3
137 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 138 6-F CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 139 6-F CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 140 6-F CF.sub.3 C.ident.C--Pr CH.sub.2CH.sub.3
141 6-F CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3 142 6-F CF.sub.3
C.ident.C-iBu CH.sub.2CH.sub.3 143 6-F CF.sub.3 C.ident.C-tBu
CH.sub.2CH.sub.3 144 6-F CF.sub.3 C.ident.C-Et CH.sub.2CH.sub.3 145
6-F CF.sub.3 C.ident.C-Me CH.sub.2CH.sub.3 146 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.2CH.sub.3 147 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 148 6-F
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.2CH.sub.3 149
6-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 150
6-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 151 6-F
CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 152 5-Cl CF.sub.3
C.ident.C-iPr H 153 5-Cl CF.sub.3 C.ident.C--Pr H 154 5-Cl CF.sub.3
C.ident.C-Bu H 155 5-Cl CF.sub.3 C.ident.C-iBu H 156 5-Cl CF.sub.3
C.ident.C-tBu H 157 5-Cl CF.sub.3 C.ident.C-Et H 158 5-Cl CF.sub.3
C.ident.C-Me H 159 5-Cl CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 H 160
5-Cl CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 161 5-Cl
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 162 5-Cl
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 163 5-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 164 5-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 165 5-Cl CF.sub.3 CH.sub.2CH.sub.2-tBu H
166 5-Cl CF.sub.3 C.ident.C-iPr CH.sub.3 167 5-Cl CF.sub.3
C.ident.C--Pr CH.sub.3 168 5-Cl CF.sub.3 C.ident.C-Bu CH.sub.3 169
5-Cl CF.sub.3 C.ident.C-iBu CH.sub.3 170 5-Cl CF.sub.3
C.ident.C-tBu CH.sub.3 171 5-Cl CF.sub.3 C.ident.C-Et CH.sub.3 172
5-Cl CF.sub.3 C.ident.C-Me CH.sub.3 173 5-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 174 5-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 175 5-Cl CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 176 5-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 177 5-Cl CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 178 5-Cl CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 179 5-Cl CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 180 5-Cl CF.sub.3 C.ident.C--Pr CH.sub.2CH.sub.3
181 5-Cl CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3 182 5-Cl CF.sub.3
C.ident.C-iBu CH.sub.2CH.sub.3 183 5-Cl CF.sub.3 C.ident.C-tBu
CH.sub.2CH.sub.3 184 5-Cl CF.sub.3 C.ident.C-Et CH.sub.2CH.sub.3
185 5-Cl CF.sub.3 C.ident.C-Me CH.sub.2CH.sub.3 186 5-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.2CH.sub.3 187 5-Cl CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 188 5-Cl
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.2CH.sub.3 189
5-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.- 3 CH.sub.2CH.sub.3
190 5-Cl CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 191
5-Cl CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 192 5-F
CF.sub.3 C.ident.C-iPr H 193 5-F CF.sub.3 C.ident.C--Pr H 194 5-F
CF.sub.3 C.ident.C-Bu H 195 5-F CF.sub.3 C.ident.C-iBu H 196 5-F
CF.sub.3 C.ident.C-tBu H 197 5-F CF.sub.3 C.ident.C-Et H 198 5-F
CF.sub.3 C.ident.C-Me H 199 5-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 H 200 5-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 201 5-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 202 5-F CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 203 5-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 204 5-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 205 5-F CF.sub.3 CH.sub.2CH.sub.2-tBu H
206 5-F CF.sub.3 C.ident.C-iPr CH.sub.3 207 5-F CF.sub.3
C.ident.C--Pr CH.sub.3 208 5-F CF.sub.3 C.ident.C-Bu CH.sub.3 209
5-F CF.sub.3 C.ident.C-iBu CH.sub.3 210 5-F CF.sub.3 C.ident.C-tBu
CH.sub.3 211 5-F CF.sub.3 C.ident.C-Et CH.sub.3 212 5-F CF.sub.3
C.ident.C-Me CH.sub.3 213 5-F CF.sub.3 CH.sub.2C.ident.C--CH.sub.3
CH.sub.3 214 5-F CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3
CH.sub.3 215 5-F CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2
CH.sub.3 216 5-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3
217 5-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 218 5-F CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 219 5-F CF.sub.3 C.ident.C-iPr
CH.sub.2CH.sub.3 220 5-F CF.sub.3 C.ident.C--Pr CH.sub.2CH.sub.3
221 5-F CF.sub.3 C.ident.C-Bu CH.sub.2CH.sub.3 222 5-F CF.sub.3
C.ident.C-iBu CH.sub.2CH.sub.3 223 5-F CF.sub.3 C.ident.C-tBu
CH.sub.2CH.sub.3 224 5-F CF.sub.3 C.ident.C-Et CH.sub.2CH.sub.3 225
5-F CF.sub.3 C.ident.C-Me CH.sub.2CH.sub.3 226 5-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.2CH.sub.3 227 5-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 228 5-F
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.2CH.sub.3 229
5-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 230
5-F CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.2CH.sub.3 231 5-F
CF.sub.3 CH.sub.2CH.sub.2-tBu CH.sub.2CH.sub.3 232 5-Cl, 6-F
CF.sub.3 C.ident.C-iPr H 233 5-Cl, 6-F CF.sub.3 C.ident.C--Pr H 234
5-Cl, 6-F CF.sub.3 C.ident.C-Bu H 235 5-Cl, 6-F CF.sub.3
C.ident.C-iBu H 236 5-Cl, 6-F CF.sub.3 C.ident.C-tBu H 237 5-Cl,
6-F CF.sub.3 C.ident.C-Et H 238 5-Cl, 6-F CF.sub.3 C.ident.C-Me H
239 5-Cl, 6-F CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 H 240 5-Cl, 6-F
CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 241 5-Cl, 6-F
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 242 5-Cl, 6-F
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 243 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 244 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-tBu H 245 5-Cl, 6-F CF.sub.3 C.ident.C-iPr
CH.sub.3 246 5-Cl, 6-F CF.sub.3 C.ident.C--Pr CH.sub.3 247 5-Cl,
6-F CF.sub.3 C.ident.C-Bu CH.sub.3 248 5-Cl, 6-F CF.sub.3
C.ident.C-iBu CH.sub.3 249 5-Cl, 6-F CF.sub.3 C.ident.C-tBu
CH.sub.3 250 5-Cl, 6-F CF.sub.3 C.ident.C-Et CH.sub.3 251 5-Cl, 6-F
CF.sub.3 C.ident.C-Me CH.sub.3 252 5-Cl, 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 253 5-Cl, 6-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 254 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 255 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 256 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 257 5-Cl, 6-F CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 258 6-Cl, 8-F CF.sub.3 C.ident.C-iPr
H 259 6-Cl, 8-F CF.sub.3 C.ident.C--Pr H 260 6-Cl, 8-F CF.sub.3
C.ident.C-Bu H 261 6-Cl, 8-F CF.sub.3 C.ident.C-iBu H 262 6-Cl, 8-F
CF.sub.3 C.ident.C-tBu H 263 6-Cl, 8-F CF.sub.3 C.ident.C-Et H 264
6-Cl, 8-F CF.sub.3 C.ident.C-Me H 265 6-Cl, 8-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 H 266 6-Cl, 8-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 267 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 268 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 269 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 270 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-tBu H 271 6-Cl, 8-F CF.sub.3 C.ident.C-iPr
CH.sub.3 272 6-Cl, 8-F CF.sub.3 C.ident.C--Pr CH.sub.3 273 6-Cl,
8-F CF.sub.3 C.ident.C-Bu CH.sub.3 274 6-Cl, 8-F CF.sub.3
C.ident.C-iBu CH.sub.3 275 6-Cl, 8-F CF.sub.3 C.ident.C-tBu
CH.sub.3 276 6-Cl, 8-F CF.sub.3 C.ident.C-Et CH.sub.3 277 6-Cl, 8-F
CF.sub.3 C.ident.C-Me CH.sub.3 278 6-Cl, 8-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 279 6-Cl, 8-F CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 280 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 281 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 282 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 283 6-Cl, 8-F CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 284 6-CH.sub.3 CF.sub.3 C.ident.C-iPr
H 285 6-CH.sub.3 CF.sub.3 C.ident.C--Pr H 286 6-CH.sub.3 CF.sub.3
C.ident.C-Bu H 287 6-CH.sub.3 CF.sub.3 C.ident.C-iBu H 288
6-CH.sub.3 CF.sub.3 C.ident.C-tBu H 289 6-CH.sub.3 CF.sub.3
C.ident.C-Et H 290 6-CH.sub.3 CF.sub.3 C.ident.C-Me H 291
6-CH.sub.3 CF.sub.3 CH.sub.2C.ident.C--CH.sub.3 H 292 6-CH.sub.3
CF.sub.3 CH.sub.2C.ident.C--CH.sub.2CH.sub.3 H 293 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 H 294 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 H 295 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2CH.sub.3 H 296 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-tBu H 297 6-CH.sub.3 CF.sub.3 C.ident.C-iPr
CH.sub.3 298 6-CH.sub.3 CF.sub.3 C.ident.C--Pr CH.sub.3 299
6-CH.sub.3 CF.sub.3 C.ident.C-Bu CH.sub.3 300 6-CH.sub.3 CF.sub.3
C.ident.C-iBu CH.sub.3 301 6-CH.sub.3 CF.sub.3 C.ident.C-tBu
CH.sub.3 302 6-CH.sub.3 CF.sub.3 C.ident.C-Et CH.sub.3 303
6-CH.sub.3 CF.sub.3 C.ident.C-Me CH.sub.3 304 6-CH.sub.3 CF.sub.3
CH.sub.2C.ident.C--CH.sub.3 CH.sub.3 305 6-CH.sub.3 CF.sub.3
CH.sub.2C.ident.C--CH.sub.2CH.sub.3 CH.sub.3 306 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2CH(CH.sub.3).sub.2 CH.sub.3 307 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 308 6-CH.sub.3
CF.sub.3 CH.sub.2CH.sub.2CH.sub.3 CH.sub.3 309 6-CH.sub.3 CF.sub.3
CH.sub.2CH.sub.2-tBu CH.sub.3 310 6-COCH.sub.3 CF.sub.3
C.ident.C-iPr H 311 6-COCH.sub.3 CF.sub.3 C.ident.C--Pr H 312
6-COCH.sub.3 CF.sub.3 C.ident.C-Bu H 313 6-COCH.sub.3 CF.sub.3
C.ident.C-iBu H 314 6-COCH.sub.3 CF.sub.3 C.ident.C-tBu H 315
6-COCH.sub.3 CF.sub.3 C.ident.C-Et H 316 6-COCH.sub.3 CF.sub.3
C.ident.C-Me H 317 6-NH.sub.2 CF.sub.3 C.ident.C-iPr H 318
6-NH.sub.2 CF.sub.3 C.ident.C--Pr H 319 6-NH.sub.2 CF.sub.3
C.ident.C-Bu H 320 6-NH.sub.2 CF.sub.3 C.ident.C-iBu H 321
6-NH.sub.2 CF.sub.3 C.ident.C-tBu H 322 6-NH.sub.2 CF.sub.3
C.ident.C-Et H 323 6-NH.sub.2 CF.sub.3 C.ident.C-Me H 324
6-NMe.sub.2 CF.sub.3 C.ident.C-iPr H 325 6-NMe.sub.2 CF.sub.3
C.ident.C--Pr H 326 6-NMe.sub.2 CF.sub.3 C.ident.C-Bu H 327
6-NMe.sub.2 CF.sub.3 C.ident.C-iBu H 328 6-NMe.sub.2 CF.sub.3
C.ident.C-tBu H 329 6-NMe.sub.2 CF.sub.3 C.ident.C-Et H 330
6-NMe.sub.2 CF.sub.3 C.ident.C-Me H 331 7-Cl CF.sub.3 C.ident.C-iPr
H 332 7-Cl CF.sub.3 C.ident.C--Pr H 333 7-Cl CF.sub.3 C.ident.C-Bu
H 334 7-Cl CF.sub.3 C.ident.C-iBu H 335 7-Cl CF.sub.3 C.ident.C-tBu
H 336 7-Cl CF.sub.3 C.ident.C-Et H 337 7-Cl CF.sub.3 C.ident.C-Me H
*Unless otherwise indicated, stereochemisty is (+/-).
Utility
[0233] The compounds of this invention possess reverse
transcriptase inhibitory activity, in particular, HIV inhibitory
efficacy. The compounds of formula (I) possess HIV reverse
transcriptase inhibitory activity and are therefore useful as
antiviral agents for the treatment of HIV infection and associated
diseases. The compounds of formula (I) possess HIV reverse
transcriptase inhibitory activity and are effective as inhibitors
of HIV growth. The ability of the compounds of the present
invention to inhibit viral growth or infectivity is demonstrated in
standard assay of viral growth or infectivity, for example, using
the assay described below.
[0234] The compounds of formula (I) of the present invention are
also useful for the inhibition of HIV in an ex vivo sample
containing HIV or expected to be exposed to HIV. Thus, the
compounds of the present invention may be used to inhibit HIV
present in a body fluid sample (for example, a serum or semen
sample) which contains or is suspected to contain or be exposed to
HIV.
[0235] The compounds provided by this invention are also useful as
standard or reference compounds for use in tests or assays for
determining the ability of an agent to inhibit viral clone
replication and/or HIV reverse transcriptase, for example in a
pharmaceutical research program. Thus, the compounds of the present
invention may be used as a control or reference compound in such
assays and as a quality control standard. The compounds of the
present invention may be provided in a commercial kit or container
for use as such standard or reference compound.
[0236] Since the compounds of the present invention exhibit
specificity for HIV reverse transcriptase, the compounds of the
present invention may also be useful as diagnostic reagents in
diagnostic assays for the detection of HIV reverse transcriptase.
Thus, inhibition of the reverse transcriptase activity in an assay
(such as the assays described herein) by a compound of the present
invention would be indicative of the presence of HIV reverse
transcriptase and HIV virus.
[0237] As used herein ".mu.g" denotes microgram, "mg" denotes
milligram, "g" denotes gram, ".mu.L" denotes microliter, "mL"
denotes milliliter, "L" denotes liter, "nM" denotes nanomolar,
".mu.M" denotes micromolar, "mM" denotes millimolar, "M" denotes
molar and "nm" denotes nanometer. "Sigma" stands for the
Sigma-Aldrich Corp. of St. Louis, Mo.
HIV RNA Assay
[0238] DNA Plasmids and In Vitro RNA Transcripts:
[0239] Plasmid pDAB 72 containing both gag and pol sequences of
BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to
Erickson-Viitanen et al. AIDS Research and Human Retroviruses 1989,
5, 577. The plasmid was linearized with Bam HI prior to the
generation of in vitro RNA transcripts using the Riboprobe Gemini
system II kit (Promega) with T7 RNA polymerase. Synthesized RNA was
purified by treatment with RNase free DNAse (Promega),
phenol-chloroform extraction, and ethanol precipitation. RNA
transcripts were dissolved in water, and stored at -70.degree. C.
The concentration of RNA was determined from the A.sub.260.
[0240] Probes:
[0241] Biotinylated capture probes were purified by HPLC after
synthesis on an Applied Biosystems (Foster City, Calif.) DNA
synthesizer by addition of biotin to the 5' terminal end of the
oligonucleotide, using the biotin-phosphoramidite reagent of
Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated capture
probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to
nucleotides 889-912 of HXB2 and the pol biotinylated capture probe
(5'-biotin --CCCTATCATTTTTGGTTTCCAT 3') was complementary to
nucleotides 2374-2395 of HXB2. Alkaline phosphatase conjugated
oligonucleotides used as reporter probes were prepared by Syngene
(San Diego, Calif.). The pol reporter probe
(5'CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides
2403-2425 of HXB2. The gag reporter probe
(5'CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides
950-973 of HXB2. All nucleotide positions are those of the GenBank
Genetic Sequence Data Bank as accessed through the Genetics
Computer Group Sequence Analysis Software Package (Devereau Nucleic
Acids Research 1984, 12, 387). The reporter probes were prepared as
0.5 .mu.M stocks in 2.times. SSC (0.3 M NaCl, 0.03 M sodium
citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture
probes were prepared as 100 .mu.M stocks in water.
[0242] Streptavidin Coated Plates:
[0243] Streptavidin coated plates were obtained from Du Pont
Biotechnology Systems (Boston, Mass.).
[0244] Cells and Virus Stocks:
[0245] MT-2 and MT-4 cells were maintained in RPMI 1640
supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10%
FCS for MT-4 cells, 2 mM L-glutamine and 50 .mu.g/mL gentamycin,
all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same
medium. Virus stocks were prepared approximately 10 days after
acute infection of MT-4 cells and stored as aliquots at -70.degree.
C. Infectious titers of HIV-1(RF) stocks were 1-3.times.10.sup.7
PFU (plaque forming units)/mL as measured by plaque assay on MT-2
cells (see below). Each aliquot of virus stock used for infection
was thawed only once.
[0246] For evaluation of antiviral efficacy, cells to be infected
were subcultured one day prior to infection. On the day of
infection, cells were resuspended at 5.times.10.sup.5 cells/mL in
RPMI 1640, 5% FCS for bulk infections or at 2.times.10.sup.6/mL in
Dulbecco's modified Eagles medium with 5% FCS for infection in
microtiter plates. Virus was added and culture continued for 3 days
at 37.degree. C.
[0247] HIV RNA Assay:
[0248] Cell lysates or purified RNA in 3 M or 5 M GED were mixed
with 5 M GED and capture probe to a final guanidinium
isothiocyanate concentration of 3 M and a final biotin
oligonucleotide concentration of 30 nM. Hybridization was carried
out in sealed U bottom 96 well tissue culture plates (Nunc or
Costar) for 16-20 hours at 37.degree. C. RNA hybridization
reactions were diluted three-fold with deionized water to a final
guanidinium isothiocyanate concentration of 1 M and aliquots (150
.mu.L) were transferred to streptavidin coated microtiter plates
wells. Binding of capture probe and capture probe-RNA hybrid to the
immobilized streptavidin was allowed to proceed for 2 hours at room
temperature, after which the plates were washed 6 times with DuPont
ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05%
Tween 20.) A second hybridization of reporter probe to the
immobilized complex of capture probe and hybridized target RNA was
carried out in the washed streptavidin coated well by addition of
120 .mu.l of a hybridization cocktail containing 4.times. SSC,
0.66% Triton X 100, 6.66% deionized formamide, 1 mg/mL BSA and 5 nM
reporter probe. After hybridization for one hour at 37.degree. C.,
the plate was again washed 6 times. Immobilized alkaline
phosphatase activity was detected by addition of 100 .mu.L of 0.2
mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer
.delta. (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM
MgCl.sub.2, 5 mM zinc acetate dihydrate and 5 mM
N-hydroxyethyl-ethylene-- diamine-triacetic acid). The plates were
incubated at 37.degree. C. Fluorescence at 450 nM was measured
using a microplate fluorometer (Dynateck) exciting at 365 nM.
[0249] Microplate Based Compound Evaluation in HIV-1 Infected MT-2
Cells:
[0250] Compounds to be evaluated were dissolved in DMSO and diluted
in culture medium to twice the highest concentration to be tested
and a maximum DMSO concentration of 2%. Further three-fold serial
dilutions of the compound in culture medium were performed directly
in U bottom microtiter plates (Nunc). After compound dilution, MT-2
cells (50 .mu.L) were added to a final concentration of
5.times.10.sup.5 per mL (1.times.10.sup.5 per well). Cells were
incubated with compounds for 30 minutes at 37.degree. C. in a
CO.sub.2 incubator. For evaluation of antiviral potency, an
appropriate dilution of HIV-1 (RF) virus stock (50 .mu.L) was added
to culture wells containing cells and dilutions of the test
compounds. The final volume in each well was 200 .mu.L. Eight wells
per plate were left uninfected with 50 .mu.L of medium added in
place of virus, while eight wells were infected in the absence of
any antiviral compound. For evaluation of compound toxicity,
parallel plates were cultured without virus infection.
[0251] After 3 days of culture at 37.degree. C. in a humidified
chamber inside a CO.sub.2 incubator, all but 25 .mu.L of
medium/well was removed from the HIV infected plates. Thirty seven
.mu.L of 5 M GED containing biotinylated capture probe was added to
the settled cells and remaining medium in each well to a final
concentration of 3 M GED and 30 nM capture probe. Hybridization of
the capture probe to HIV RNA in the cell lysate was carried out in
the same microplate well used for virus culture by sealing the
plate with a plate sealer (Costar), and incubating for 16-20 hrs in
a 37.degree. C. incubator. Distilled water was then added to each
well to dilute the hybridization reaction three-fold and 150 .mu.L
of this diluted mixture was transferred to a streptavidin coated
microtiter plate. HIV RNA was quantitated as described above. A
standard curve, prepared by adding known amounts of PDAB 72 in
vitro RNA transcript to wells containing lysed uninfected cells,
was run on each microtiter plate in order to determine the amount
of viral RNA made during the infection.
[0252] In order to standardize the virus inoculum used in the
evaluation of compounds for antiviral activity, dilutions of virus
were selected which resulted in an IC90 value (concentration of
compound required to reduce the HIV RNA level by 90%) for
dideoxycytidine (ddC) of 0.2 .mu.g/mL. IC.sub.90 values of other
antiviral compounds, both more and less potent than ddC, were
reproducible using several stocks of HIV-1 (RF) when this procedure
was followed. This concentration of virus corresponded to
-3.times.10.sup.5 PFU (measured by plaque assay on MT-2 cells) per
assay well and typically produced approximately 75% of the maximum
viral RNA level achievable at any virus inoculum. For the HIV RNA
assay, IC.sub.90 values were determined from the percent reduction
of net signal (signal from infected cell samples minus signal from
uninfected cell samples) in the RNA assay relative to the net
signal from infected, untreated cells on the same culture plate
(average of eight wells). Valid performance of individual infection
and RNA assay tests was judged according to three criteria. It was
required that the virus infection should result in an RNA assay
signal equal to or greater than the signal generated from 2 ng of
pDAB 72 in vitro RNA transcript. The IC.sub.90 for ddC, determined
in each assay run, should be between 0.1 and 0.3 .mu.g/mL. Finally,
the plateau level of viral RNA produced by an effective reverse
transcriptase inhibitor should be less than 10% of the level
achieved in an uninhibited infection. A compound was considered
active if its IC.sub.90 was found to be less than 20.mu.M.
[0253] For antiviral potency tests, all manipulations in microtiter
plates, following the initial addition of 2.times. concentrated
compound solution to a single row of wells, were performed using a
Perkin Elmer/Cetus ProPette.
Protein Binding and Mutant Resistance
[0254] In order to characterize NNRTI analogs for their clinical
efficacy potential the effect of plasma proteins on antiviral
potency and measurements of antiviral potency against wild type and
mutant variants of HIV which carry amino acid changes in the known
binding site for NNRTIs were examined. The rationale for this
testing strategy is two fold:
[0255] 1. Many drugs are extensively bound to plasma proteins.
Although the binding affinity for most drugs for the major
components of human plasma, namely, human serum albumin (HSA) or
alpha-1-acid glycoprotein (AAG), is low, these major components are
present in high concentration in the blood. Only free or unbound
drug is available to cross the infected cell membrane for
interaction with the target site (i.e., HIV-1 reverse
transcriptase, HIV-1 RT). Therefore, the effect of added HSA+AAG on
the antiviral potency in tissue culture more closely reflects the
potency of a given compound in the clinical setting. The
concentration of compound required for 90% inhibition of virus
replication as measured in a sensitive viral RNA-based detection
method is designated the IC90. The fold increase in apparent IC90
for test compounds in the presence or added levels of HSA and AAG
that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was
then calculated. The lower the fold increase, the more compound
will be available to interact with the target site.
[0256] 2. The combination of the high rate of virus replication in
the infected individual and the poor fidelity of the viral RT
results in the production of a quasi-species or mixtures of HIV
species in the infected individual. These species will include a
majority wild type species, but also mutant variants of HIV and the
proportion of a given mutant will reflect its relative fitness and
replication rate. Because mutant variants including mutants with
changes in the amino acid sequence of the viral RT likely pre-exist
in the infected individual's quasi-species, the overall potency
observed in the clinical setting will reflect the ability of a drug
to inhibit not only wild type HIV-1, but mutant variants as well.
We thus have constructed, in a known genetic background, mutant
variants of HIV-1 which carry amino acid substitutions at positions
thought to be involved in NNRTI binding, and measured the ability
of test compounds to inhibit replication of these mutant viruses.
The concentration of compound required for 90% inhibition of virus
replication as measured in a sensitive viral RNA-based detection
method is designated the IC90. It is desirable to have a compound
which has high activity against a variety of mutants.
[0257] Dosage and Formulation
[0258] The antiviral compounds of this invention can be
administered as treatment for viral infections by any means that
produces contact of the active agent with the agent's site of
action, i.e., the viral reverse transcriptase, in the body of a
mammal. They can be administered by any conventional means
available for use in conjunction with harmaceuticals, either as
individual therapeutic agents or in a combination of therapeutic
agents. They can be administered alone, but preferably are
administered with a pharmaceutical carrier selected on the basis of
the chosen route of administration and standard pharmaceutical
practice.
[0259] The dosage administered will, of course, vary depending upon
known factors, such as the pharmacodynamic characteristics of the
particular agent and its mode and route of administration; the age,
health and weight of the recipient; the nature and extent of the
symptoms; the kind of concurrent treatment; the frequency of
treatment; and the effect desired. A daily dosage of active
ingredient can be expected to be about 0.001 to about 1000
milligrams per kilogram of body weight, with the preferred dose
being about 0.1 to about 30 mg/kg.
[0260] Dosage forms of compositions suitable for administration
contain from about 1 mg to about 100 mg of active ingredient per
unit. In these pharmaceutical compositions the active ingredient
will ordinarily be present in an amount of about 0.5-95% by weight
based on the total weight of the composition. The active ingredient
can be administered orally in solid dosage forms, such as capsules,
tablets and powders, or in liquid dosage forms, such as elixirs,
syrups and suspensions. It can also be administered parenterally,
in sterile liquid dosage forms.
[0261] Gelatin capsules contain the active ingredient and powdered
carriers, such as lactose, starch, cellulose derivatives, magnesium
stearate, stearic acid, and the like. Similar diluents can be used
to make compressed tablets. Both tablets and capsules can be
manufactured as sustained release products to provide for
continuous release of medication over a period of hours. Compressed
tablets can be sugar coated or film coated to mask any unpleasant
taste and protect the tablet from the atmosphere, or enteric coated
for selective disintegration in the gastrointestinal tract.
[0262] Liquid dosage forms for oral administration can contain
coloring and flavoring to increase patient acceptance.
[0263] In general, water, a suitable oil, saline, aqueous dextrose
(glucose), and related sugar solutions and glycols such as
propylene glycol or polyethylene glycols are suitable carriers for
parenteral solutions. Solutions for parenteral administration
preferably contain a water soluble salt of the active ingredient,
suitable stabilizing agents, and if necessary, buffer substances.
Antioxidizing agents such as sodium bisulfite, sodium sulfite, or
ascorbic acid, either alone or combined, are suitable stabilizing
agents. Also used are citric acid and its salts, and sodium EDTA.
In addition, parenteral solutions can contain preservatives, such
as benzalkonium chloride, methyl- or propyl-paraben and
chlorobutanol. Suitable pharmaceutical carriers are described in
Remington's Pharmaceutical Sciences, supra, a standard reference
text in this field.
[0264] Useful pharmaceutical dosage-forms for administration of the
compounds of this invention can be illustrated as follows:
[0265] Capsules
[0266] A large number of unit capsules can be prepared by filling
standard two-piece hard gelatin capsules each with 100 mg of
powdered active ingredient, 150 mg of lactose, 50 mg of cellulose,
and 6 mg magnesium stearic
[0267] Soft Gelatin Capsules
[0268] A mixture of active ingredient in a digestible oil such as
soybean oil, cottonseed oil or olive oil can be prepared and
injected by means of a positive displacement pump into gelatin to
form soft gelatin capsules containing 100 mg of the active
ingredient. The capsules should then be washed and dried.
[0269] Tablets
[0270] A large number of tablets can be prepared by conventional
procedures so that the dosage unit is 100 mg of active ingredient,
0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium
stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and
98.8 mg of lactose. Appropriate coatings may be applied to increase
palatability or delay absorption.
[0271] Suspension
[0272] An aqueous suspension can be prepared for oral
administration so that each 5 mL contain 25 mg of finely divided
active ingredient, 200 mg of sodium carboxymethyl cellulose, 5 mg
of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025
mg of vanillin.
[0273] Injectable
[0274] A parenteral composition suitable for administration by
injection can be prepared by stirring 1.5% by weight of active
ingredient in 10% by volume propylene glycol and water. The
solution is sterilized by commonly used techniques.
[0275] Combination of Components (a) and (b)
[0276] Each therapeutic agent component of this invention can
independently be in any dosage form, such as those described above,
and can also be administered in various ways, as described above.
In the following description component (b) is to be understood to
represent one or more agents as described previously. Thus, if
components (a) and (b) are to be treated the same or independently,
each agent of component (b) may also be treated the same or
independently.
[0277] Components (a) and (b) of the present invention may be
formulated together, in a single dosage unit (that is, combined
together in one capsule, tablet, powder, or liquid, etc.) as a
combination product. When component (a) and (b) are not formulated
together in a single dosage unit, the component (a) may be
administered at the same time as component (b) or in any order; for
example component (a) of this invention may be administered first,
followed by administration of component (b), or they may be
administered in the revserse order. If component (b) contains more
that one agent, e.g., one RT inhibitor and one protease inhibitor,
these agents may be administered together or in any order. When not
administered at the same time, preferably the administration of
component (a) and (b) occurs less than about one hour apart.
Preferably, the route of administration of component (a) and (b) is
oral. The terms oral agent, oral inhibitor, oral compound, or the
like, as used herein, denote compounds which may be orally
administered. Although it is preferable that component (a) and
component (b) both be administered by the same route (that is, for
example, both orally) or dosage form, if desired, they may each be
administered by different routes (that is, for example, one
component of the combination product may be administered orally,
and another component may be administered intravenously) or dosage
forms.
[0278] As is appreciated by a medical practitioner skilled in the
art, the dosage of the combination therapy of the invention may
vary depending upon various factors such as the pharmacodynamic
characteristics of the particular agent and its mode and route of
administration, the age, health and weight of the recipient, the
nature and extent of the symptoms, the kind of concurrent
treatment, the frequency of treatment, and the effect desired, as
described above.
[0279] The proper dosage of components (a) and (b) of the present
invention will be readily ascertainable by a medical practitioner
skilled in the art, based upon the present disclosure. By way of
general guidance, typically a daily dosage may be about 100
milligrams to about 1.5 grams of each component. If component (b)
represents more than one compound, then typically a daily dosage
may be about 100 milligrams to about 1.5 grams of each agent of
component (b). By way of general guidance, when the compounds of
component (a) and component (b) are administered in combination,
the dosage amount of each component may be reduced by about 70-80%
relative to the usual dosage of the component when it is
administered alone as a single agent for the treatment of HIV
infection, in view of the synergistic effect of the
combination.
[0280] The combination products of this invention may be formulated
such that, although the active ingredients are combined in a single
dosage unit, the physical contact between the active ingredients is
minimized. In order to minimize contact, for example, where the
product is orally administered, one active ingredient may be
enteric coated. By enteric coating one of the active ingredients,
it is possible not only to minimize the contact between the
combined active ingredients, but also, it is possible to control
the release of one of these components in the gastrointestinal
tract such that one of these components is not released in the
stomach but rather is released in the intestines. Another
embodiment of this invention where oral administration is desired
provides for a combination product wherein one of the active
ingredients is coated with a sustained-release material which
effects a sustained-release throughout the gastrointestinal tract
and also serves to minimize physical contact between the combined
active ingredients. Furthermore, the sustained-released component
can be additionally enteric coated such that the release of this
component occurs only in the intestine. Still another approach
would involve the formulation of a combination product in which the
one component is coated with a sustained and/or enteric release
polymer, and the other component is also coated with a polymer such
as a low viscosity grade of hydroxypropyl methylcellulose or other
appropriate materials as known in the art, in order to further
separate the active components. The polymer coating serves to form
an additional barrier to interaction with the other component. In
each formulation wherein contact is prevented between components
(a) and (b) via a coating or some other material, contact may also
be prevented between the individual agents of component (b).
[0281] Dosage forms of the combination products of the present
invention wherein one active ingredient is enteric coated can be in
the form of tablets such that the enteric coated component and the
other active ingredient are blended together and then compressed
into a tablet or such that the enteric coated component is
compressed into one tablet layer and the other active ingredient is
compressed into an additional layer. Optionally, in order to
further separate the two layers, one or more placebo layers may be
present such that the placebo layer is between the layers of active
ingredients. In addition, dosage forms of the present invention can
be in the form of capsules wherein one active ingredient is
compressed into a tablet or in the form of a plurality of
microtablets, particles, granules or non-perils, which are then
enteric coated. These enteric coated microtablets, particles,
granules or non-perils are then placed into a capsule or compressed
into a capsule along with a granulation of the other active
ingredient.
[0282] These as well as other ways of minimizing contact between
the components of combination products of the present invention,
whether administered in a single dosage form or administered in
separate forms but at the same time or concurrently by the same
manner, will be readily apparent to those skilled in the art, based
on the present disclosure.
[0283] Pharmaceutical kits useful for the treatment of HIV
infection, which comprise a therapeutically effective amount of a
pharmaceutical composition comprising a compound of component (a)
and one or more compounds of component (b), in one or more sterile
containers, are also within the ambit of the present invention.
Sterilization of the container may be carried out using
conventional sterilization methodology well known to those skilled
in the art. Component (a) and component (b) may be in the same
sterile container or in separate sterile containers. The sterile
containers of materials may comprise separate containers, or one or
more multi-part containers, as desired. Component (a) and component
(b), may be separate, or physically combined into a single dosage
form or unit as described above. Such kits may further include, if
desired, one or more of various conventional pharmaceutical kit
components, such as for example, one or more pharmaceutically
acceptable carriers, additional vials for mixing the components,
etc., as will be readily apparent to those skilled in the art.
Instructions, either as inserts or as labels, indicating quantities
of the components to be administered, guidelines for
administration, and/or guidelines for mixing the components, may
also be included in the kit.
[0284] Obviously, numerous modifications and variations of the
present invention are possible in light of the above teachings. It
is therefore to be understood that within the scope of the appended
claims, the invention may be practiced otherwise than as
specifically described herein.
* * * * *