U.S. patent application number 10/154251 was filed with the patent office on 2003-05-15 for essential bacterial genes and their use.
This patent application is currently assigned to Millennium Pharmaceuticals, Inc., a Delaware corporation. Invention is credited to Fritz, Christian, Guzman, Luz-Maria, Murphy, Christopher, Youngman, Philip.
Application Number | 20030092024 10/154251 |
Document ID | / |
Family ID | 22093213 |
Filed Date | 2003-05-15 |
United States Patent
Application |
20030092024 |
Kind Code |
A1 |
Youngman, Philip ; et
al. |
May 15, 2003 |
Essential bacterial genes and their use
Abstract
Disclosed are 23 genes, termed "GEP" genes, found in
Streptococcus pneumonia, which are located within operons that are
essential for survival. Also disclosed is a related essential gene
found in Bacillus subtilis. These genes and the polypeptides that
they encode, as well as homologs thereof, can be used to identify
antibacterial agents for treating bacterial infections such as
streptococcal pneumonia.
Inventors: |
Youngman, Philip; (Boston,
MA) ; Fritz, Christian; (Natick, MA) ; Murphy,
Christopher; (Upton, MA) ; Guzman, Luz-Maria;
(Boston, MA) |
Correspondence
Address: |
J. PETER FASSE
Fish & Richardson P.C.
225 Franklin Street
Boston
MA
02110-2804
US
|
Assignee: |
Millennium Pharmaceuticals, Inc., a
Delaware corporation
|
Family ID: |
22093213 |
Appl. No.: |
10/154251 |
Filed: |
May 22, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10154251 |
May 22, 2002 |
|
|
|
09222938 |
Dec 30, 1998 |
|
|
|
6437108 |
|
|
|
|
60070116 |
Dec 31, 1997 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/252.3; 435/32; 435/320.1 |
Current CPC
Class: |
C07K 14/3156 20130101;
C07K 14/32 20130101 |
Class at
Publication: |
435/6 ;
435/320.1; 435/32; 435/252.3 |
International
Class: |
C12Q 001/68; C12N
001/21; C12N 015/74; C12Q 001/18 |
Claims
What is claimed is:
1. An isolated operon comprising a nucleotide sequence, or an
allelic variant or homolog of the nucleotide sequence, encoding: a
gep103 polypeptide comprising the amino acid sequence of SEQ ID NO:
1, as depicted in FIG. 1; a gep1119 polypeptide comprising the
amino acid sequence of SEQ ID NO: 4, as depicted in FIG. 2; a
gep1122 polypeptide comprising the amino acid sequence of SEQ ID
NO: 7, as depicted in FIG. 3; a gep1315 polypeptide comprising the
amino acid sequence of SEQ ID NO: 10, as depicted in FIG. 4; a
gep1493 polypeptide comprising the amino acid sequence of SEQ ID
NO: 13, as depicted in FIG. 5; a gep1507 polypeptide comprising the
amino acid sequence of SEQ ID NO: 16, as depicted in FIG. 6; a
gep1511 polypeptide comprising the amino acid sequence of SEQ ID
NO: 19, as depicted in FIG. 7; a gep1518 polypeptide comprising the
amino acid sequence of SEQ ID NO: 22, as depicted in FIG. 8; a
gep1546 polypeptide comprising the amino acid sequence of SEQ ID
NO: 25, as depicted in FIG. 9; a gep1551 polypeptide comprising the
amino acid sequence of SEQ ID NO: 28, as depicted in FIG. 10; a
gep1561 polypeptide comprising the amino acid sequence of SEQ ID
NO: 31, as depicted in FIG. 11; a gep1580 polypeptide comprising
the amino acid sequence of SEQ ID NO: 34, as depicted in FIG. 12; a
gep1713 polypeptide comprising the amino acid sequence of SEQ ID
NO: 37 as depicted in FIG. 13; a gep222 polypeptide comprising the
amino acid sequence of SEQ ID NO: 40, as depicted in FIG. 14; a
gep2283 polypeptide comprising the amino acid sequence of SEQ ID
NO: 43, as depicted in FIG. 15; a gep273 polypeptide comprising the
amino acid sequence of SEQ ID NO: 46, as depicted in FIG. 16; a
gep286 polypeptide comprising the amino acid sequence of SEQ ID NO:
49, as depicted in FIG. 17; a gep311 polypeptide comprising the
amino acid sequence of SEQ ID NO: 52, as depicted in FIG. 18; a
gep3262 polypeptide comprising the amino acid sequence of SEQ ID
NO: 55, as depicted in FIG. 19; a gep3387 polypeptide comprising
the amino acid sequence of SEQ ID NO: 58, as depicted in FIG. 20; a
gep47 polypeptide comprising the amino acid sequence of SEQ ID NO:
61, as depicted in FIG. 21; a gep61 polypeptide comprising the
amino acid sequence of SEQ ID NO: 64, as depicted in FIG. 22; or a
gep76 polypeptide comprising the amino acid sequence of SEQ ID NO:
67, as depicted in FIG. 23.
2. An isolated nucleic acid molecule comprising a nucleic acid
sequence selected from the group consisting of: (1) an operon
comprising the sequence of SEQ ID NO: 2, as depicted in FIG. 1, or
degenerate variants thereof; (2) an operon comprising the sequence
of SEQ ID NO: 2, or degenerate variants thereof, wherein T is
replaced by U; (3) nucleic acids complementary to (1) and (2); (4)
fragments of (1), (2), and (3) that are at least 15 base pairs in
length and which hybridize under stringent conditions to genomic
DNA encoding the polypeptide of SEQ ID NO: 1; (5) an operon
comprising the sequence of SEQ ID NO: 5, as depicted in FIG. 2, or
degenerate variants thereof; (6) an operon comprising the sequence
of SEQ ID NO: 5, or degenerate variants thereof, wherein T is
replaced by U; (7) nucleic acids complementary to (5) and (6); (8)
fragments of (5), (6), and (7) that are at least 15 base pairs in
length and which hybridize under stringent conditions to genomic
DNA encoding the polypeptide of SEQ ID NO: 4; (9) an operon
comprising the sequence of SEQ ID NO: 8, as depicted in FIG. 3, or
degenerate variants thereof; (10) an operon comprising the sequence
of SEQ ID NO: 8, or degenerate variants thereof, wherein T is
replaced by U; (11) nucleic acids complementary to (9) and (10);
(12) fragments of (9), (10), and (11) that are at least 15 base
pairs in length and which hybridize under stringent conditions to
genomic DNA encoding the polypeptide of SEQ ID NO: 7; (13) an
operon comprising the sequence of SEQ ID NO: 11, as depicted in
FIG. 4, or degenerate variants thereof; (14) an operon comprising
the sequence of SEQ ID NO: 11, or degenerate variants thereof,
wherein T is replaced by U; (15) nucleic acids complementary to
(13) and (14); and (16) fragments of (13), (14), and (15) that are
at least 15 base pairs in length and which hybridize under
stringent conditions to genomic DNA encoding the polypeptide of SEQ
ID NO: 10; (17) an operon comprising the sequence of SEQ ID NO: 14,
as depicted in FIG. 5, or degenerate variants thereof; (18) an
operon comprising the sequence of SEQ ID NO: 14, or degenerate
variants thereof, wherein T is replaced by U; (19) nucleic acids
complementary to (17) and (18); (20) fragments of (17), (18), and
(19) that are at least 15 base pairs in length and which hybridize
under stringent conditions to genomic DNA encoding the polypeptide
of SEQ ID NO: 13; (21) an operon comprising the sequence of SEQ ID
NO: 17, as depicted in FIG. 6, or degenerate variants thereof; (22)
an operon comprising the sequence of SEQ ID NO: 17, or degenerate
variants thereof, wherein T is replaced by U; (23) nucleic acids
complementary to (21) and (22); (24) fragments of (21), (22), and
(23) that are at least 15 base pairs in length and which hybridize
under stringent conditions to genomic DNA encoding the polypeptide
of SEQ ID NO: 16; (25) an operon comprising the sequence of SEQ ID
NO: 20, as depicted in FIG. 7, or degenerate variants thereof; (26)
an operon comprising the sequence of SEQ ID NO: 20, or degenerate
variants thereof, wherein T is replaced by U; (27) nucleic acids
complementary to (25) and (26); (28) fragments of (25), (26), and
(27) that are at least 15 base pairs in length and which hybridize
under stringent conditions to genomic DNA encoding the polypeptide
of SEQ ID NO: 19; (29) an operon comprising the sequence of SEQ ID
NO: 23, as depicted in FIG. 8, or degenerate variants thereof; (30)
an operon comprising the sequence of SEQ ID NO: 23, or degenerate
variants thereof, wherein T is replaced by U; (31) nucleic acids
complementary to (29) and (30); and (32) fragments of (39), (30),
and (31) that are at least 15 base pairs in length and which
hybridize under stringent conditions to genomic DNA encoding the
polypeptide of SEQ ID NO: 22; (33) an operon comprising the
sequence of SEQ ID NO: 26, as depicted in FIG. 9, or degenerate
variants thereof; (34) an operon comprising the sequence of SEQ ID
NO: 26, or degenerate variants thereof, wherein T is replaced by U;
(35) nucleic acids complementary to (33) and (34); (36) fragments
of (33), (34), and (35) that are at least 15 base pairs in length
and which hybridize under stringent conditions to genomic DNA
encoding the polypeptide of SEQ ID NO: 25; (37) an operon
comprising the sequence of SEQ ID NO;29, as depicted in FIG. 10, or
degenerate variants thereof; (38) an operon comprising the sequence
of SEQ ID NO: 29, or degenerate variants thereof, wherein T is
replaced by U; (39) nucleic acids complementary to (37) and (38);
(40) fragments of (37), (38), and (39) that are at least 15 base
pairs in length and which hybridize under stringent conditions to
genomic DNA encoding the polypeptide of SEQ ID NO: 28; (41) an
operon comprising the sequence of SEQ ID NO: 32, as depicted in
FIG. 11, or degenerate variants thereof; (42) an operon comprising
the sequence of SEQ ID NO: 32, or degenerate variants thereof,
wherein T is replaced by U; (43) nucleic acids complementary to
(41) and (42); (44) fragments of (41), (42) , and (43) that are at
least 15 base pairs in length and which hybridize under stringent
conditions to genomic DNA encoding the polypeptide of SEQ ID NO:
31; (45) an operon comprising the sequence of SEQ ID NO: 35, as
depicted in FIG. 12, or degenerate variants thereof; (46) an operon
comprising the sequence of SEQ ID NO: 35, or degenerate variants
thereof, wherein T is replaced by U; (47) nucleic acids
complementary to (45) and (46); and (48) fragments of (45), (46),
and (47) that are at least 15 base pairs in length and which
hybridize under stringent conditions to genomic DNA encoding the
polypeptide of SEQ ID NO: 34; (49) an operon comprising the
sequence of SEQ ID NO: 38, as depicted in FIG. 13, or degenerate
variants thereof; (50) an operon comprising the sequence of SEQ ID
NO: 38, or degenerate variants thereof, wherein T is replaced by U;
(51) nucleic acids complementary to (49) and (50); (52) fragments
of (49), (50), and (51) that are at least 15 base pairs in length
and which hybridize under stringent conditions to genomic DNA
encoding the polypeptide of SEQ ID NO: 37; (53) an operon
comprising the sequence of SEQ ID NO: 41, as depicted in FIG. 14,
or degenerate variants thereof; (54) an operon comprising the
sequence of SEQ ID NO: 41, or degenerate variants thereof, wherein
T is replaced by U; (55) nucleic acids complementary to (53) and
(54); (56) fragments of (53), (54), and (55) that are at least 15
base pairs in length and which hybridize under stringent conditions
to genomic DNA encoding the polypeptide of SEQ ID NO: 40; (57) an
operon comprising the sequence of SEQ ID NO: 44, as depicted in
FIG. 15, or degenerate variants thereof; (58) an operon comprising
the sequence of SEQ ID NO: 44, or degenerate variants thereof,
wherein T is replaced by U; (59) nucleic acids complementary to
(57) and (58); (60) fragments of (57), (58), and (59) that are at
least 15 base pairs in length and which hybridize under stringent
conditions to genomic DNA encoding the polypeptide of SEQ ID NO:
39; (61) an operon comprising the sequence of SEQ ID NO: 47, as
depicted in FIG. 16, or degenerate variants thereof; (62) an operon
comprising the sequence of SEQ ID NO: 47, or degenerate variants
thereof, wherein T is replaced by U; (63) nucleic acids
complementary to (61) and (62); and (64) fragments of (61), (62),
and (63) that are at least 15 base pairs in length and which
hybridize under stringent conditions to genomic DNA encoding the
polypeptide of SEQ ID NO: 46; (65) an operon comprising the
sequence of SEQ ID NO: 50, as depicted in FIG. 17, or degenerate
variants thereof; (66) an operon comprising the sequence of SEQ ID
NO: 50, or degenerate variants thereof, wherein T is replaced by U;
(67) nucleic acids complementary to (65) and (66); (68) fragments
of (65), (66), and (67) that are at least 15 base pairs in length
and which hybridize under stringent conditions to genomic DNA
encoding the polypeptide of SEQ ID NO: 49; (69) an operon
comprising the sequence of SEQ ID NO: 53, as depicted in FIG. 18,
or degenerate variants thereof; (70) an operon comprising the
sequence of SEQ ID NO: 53, or degenerate variants thereof, wherein
T is replaced by U; (71) nucleic acids complementary to (69) and
(70); (72) fragments of (69), (70), and (71) that are at least 15
base pairs in length and which hybridize under stringent conditions
to genomic DNA encoding the polypeptide of SEQ ID NO: 52; (73) an
operon comprising the sequence of SEQ ID NO: 56, as depicted in
FIG. 19, or degenerate variants thereof; (74) an operon comprising
the sequence of SEQ ID NO: 56, or degenerate variants thereof,
wherein T is replaced by U; (75) nucleic acids complementary to
(73) and (74); (76) fragments of (73), (74), and (75) that are at
least 15 base pairs in length and which hybridize under stringent
conditions to genomic DNA encoding the polypeptide of SEQ ID NO:
55; (77) an operon comprising the sequence of SEQ ID NO: 59, as
depicted in FIG. 20, or degenerate variants thereof; (78) an operon
comprising the sequence of SEQ ID NO: 59, or degenerate variants
thereof, wherein T is replaced by U; (79) nucleic acids
complementary to (77) and (78); and (80) fragments of (77), (78),
and (79) that are at least 15 base pairs in length and which
hybridize under stringent conditions to genomic DNA encoding the
polypeptide of SEQ ID NO: 58; (81) an operon comprising the
sequence of SEQ ID NO: 62, as depicted in FIG. 21, or degenerate
variants thereof; (82) an operon comprising the sequence of SEQ ID
NO: 62, or degenerate variants thereof, wherein T is replaced by U;
(83) nucleic acids complementary to (81) and (82); (84) fragments
of (81), (82), and (83) that are at least 15 base pairs in length
and which hybridize under stringent conditions to genomic DNA
encoding the polypeptide of SEQ ID NO: 61; (85) an operon
comprising the sequence of SEQ ID NO: 65; as depicted in FIG. 22,
or degenerate variants thereof; (86) an operon comprising the
sequence of SEQ ID NO: 65, or degenerate variants thereof, wherein
T is replaced by U; (87) nucleic acids complementary to (85) and
(86); (88) fragments of (85), (86), and (87) that are at least 15
base pairs in length and which hybridize under stringent conditions
to genomic DNA encoding the polypeptide of SEQ ID NO: 66; (89) an
operon comprising the sequence of SEQ ID NO: 68, as depicted in
FIG. 23, or degenerate variants thereof; (90) an operon comprising
the sequence of SEQ ID NO: 68, or degenerate variants thereof,
wherein T is replaced by U; (91) nucleic acids complementary to
(89) and (90); and (92) fragments of (89), (90), and (91) that are
at least 15 base pairs in length and which hybridize under
stringent conditions to genomic DNA encoding the polypeptide of SEQ
ID NO: 67.
3. An isolated operon from Streptococcus comprising a nucleotide
sequence that is at least 85% identical to a nucleotide sequence
selected from the group consisting of SEQ ID NO: 2; SEQ ID NO: 5;
SEQ ID NO: 8; SEQ ID NO: 11; SEQ ID NO: 14; SEQ ID NO: 17; SEQ ID
NO: 20; SEQ ID NO: 23; SEQ ID NO: 26; SEQ ID NO: 29; SEQ ID NO: 32;
SEQ ID NO: 35; SEQ ID NO: 38; SEQ ID NO: 41; SEQ ID NO: 44; SEQ ID
NO: 47; SEQ ID NO: 50; SEQ ID NO: 53; SEQ ID NO: 56; SEQ ID NO: 59;
SEQ ID NO: 62; SEQ ID NO: 65; and SEQ ID NO: 68.
4. An isolated nucleic acid molecule that is at least 15 base pairs
in length and hybridizes under stringent conditions to a nucleotide
sequence selected from the group consisting of SEQ ID NO: 2; SEQ ID
NO: 5; SEQ ID NO: 8; SEQ ID NO: 11; SEQ ID NO: 14; SEQ ID NO: 17;
SEQ ID NO: 20; SEQ ID NO: 23; SEQ ID NO: 26; SEQ ID NO: 29; SEQ ID
NO: 32; SEQ ID NO: 35; SEQ ID NO: 38; SEQ ID NO: 41; SEQ ID NO: 44;
SEQ ID NO: 47; SEQ ID NO: 50; SEQ ID NO: 53; SEQ ID NO: 56; SEQ ID
NO: 59; SEQ ID NO: 62; SEQ ID NO: 65; and SEQ ID NO: 68.
5. A vector comprising an operon of claim 1.
6. A vector comprising a nucleic acid molecule of claim 2.
7. An expression vector comprising an operon of claim 1 operably
linked to a nucleotide sequence regulatory element that controls
expression of said operon.
8. An expression vector comprising a nucleic acid molecule of claim
2, wherein said nucleic acid molecule is operably linked to a
nucleotide sequence regulatory element that controls expression of
said nucleic acid.
9. A host cell comprising an exogenously introduced operon of claim
1.
10. A host cell comprising an exogenously introduced nucleic acid
molecule of claim 2.
11. A host cell of claim 9, wherein the cell is a yeast or
bacterium.
12. A host cell of claim 10, wherein the cell is a yeast or
bacterium.
13. A genetically engineered host cell comprising an operon of
claim 1 operably linked to a heterologous nucleotide sequence
regulatory element that controls expression of the operon in the
host cell.
14. A host cell of claim 13, wherein the cell is a yeast or
bacterium.
15. A genetically engineered host cell comprising a nucleic acid
molecule of claim 2 operably linked to a nucleotide sequence
regulatory element that controls expression of the nucleic acid in
the host cell.
16. A host cell of claim 15, wherein the cell is a yeast or
bacterium.
17. An isolated operon comprising a nucleotide sequence encoding a
polypeptide comprising an amino acid sequence selected from the
group consisting of: the amino acid sequence of SEQ ID NO: 1, as
depicted in FIG. 1; the amino acid sequence of SEQ ID NO: 4, as
depicted in FIG. 2; the amino acid sequence of SEQ ID NO: 7, as
depicted in FIG. 3; the amino acid sequence of SEQ ID NO: 10, as
depicted in FIG. 4; the amino acid sequence of SEQ ID NO: 13, as
depicted in FIG. 5; the amino acid sequence of SEQ ID NO: 16, as
depicted in FIG. 6; the amino acid sequence of SEQ ID NO: 19, as
depicted in FIG. 7; the amino acid sequence of SEQ ID NO: 22, as
depicted in FIG. 8; the amino acid sequence of SEQ ID NO: 25, as
depicted in FIG. 9; the amino acid sequence of SEQ ID NO: 28, as
depicted in FIG. 10; the amino acid sequence of SEQ ID NO: 31, as
depicted in FIG. 11; the amino acid sequence of SEQ ID NO: 34, as
depicted in FIG. 12; the amino acid sequence of SEQ ID NO: 37, as
depicted in FIG. 13; the amino acid sequence of SEQ ID NO: 40, as
depicted in FIG. 14; the amino acid sequence of SEQ ID NO: 43, as
depicted in FIG. 15; the amino acid sequence of SEQ ID NO: 46, as
depicted in FIG. 16; the amino acid sequence of SEQ ID NO: 49, as
depicted in FIG. 17; the amino acid sequence of SEQ ID NO: 52, as
depicted in FIG. 18; the amino acid sequence of SEQ ID NO: 55, as
depicted in FIG. 19; the amino acid sequence of SEQ ID NO: 58, as
depicted in FIG. 20; the amino acid sequence of SEQ ID NO: 61, as
depicted in FIG. 21; the amino acid sequence of SEQ ID NO: 64, as
depicted in FIG. 22; and the amino acid sequence of SEQ ID NO: 67,
as depicted in FIG. 23.
18. An isolated polypeptide encoded by a nucleic acid located
within an operon comprising a nucleic acid sequence selected from
the group consisting of SEQ ID NO: 2, 5, 8, 11, 14, 17, 20, 23, 26,
29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, and 68.
19. An isolated polypeptide, said polypeptide being encoded by an
operon of claim 1.
20. An isolated polypeptide, said polypeptide being encoded by a
nucleic acid molecule of claim 2.
21. An isolated polypeptide, said polypeptide being encoded by an
operon of claim 3.
22. A method for identifying an antibacterial agent, the method
comprising: (a) contacting a test compound with a polypeptide, or a
homolog of a polypeptide, encoded by a nucleic acid sequence
located within an operon comprising a GEP gene selected from the
group consisting of gep103, gep1119, gep1122, gep1315, gep1493,
gep1507, gep1511, gep1518, gep1546, gep1551, gep1561, gep1580,
gep1713, gep222, gep2283, gep273, gep286, gep311, gep3262, gep3387,
gep47, gep6l, and gep76; and (b) detecting binding of the test
compound to the polypeptide, wherein binding indicates that the
test compound is an antibacterial agent.
23. The method of claim 22, further comprising: (c) determining
whether a test compound that binds to the polypeptide inhibits
growth of bacteria, relative to growth of bacteria cultured in the
absence of a test compound that binds to the polypeptide, wherein
inhibition of growth indicates that the test compound is an
antibacterial agent.
24. The method of claim 22, wherein the polypeptide is selected
from the group consisting of gep103, gep1119, gep1122, gep1315,
gep1493, gep1507, gep1511, gep1518, gep1546, gep1551, gep1561,
gep1580, gep1713, gep222, gep2283, gep273, gep286, gep311, gep3262,
gep3387, gep47, gep6l, and gep76.
25. The method of claim 22, wherein the test compound is
immobilized on a substrate, and binding of the test compound to the
polypeptide is detected as immobilization of the polypeptide on the
immobilized test compound.
26. The method of claim 25, wherein immobilization of the
polypeptide on the test compound is detected in an immunoassay with
an antibody that specifically binds to the polypeptide.
27. The method of claim 22, wherein the test compound is selected
from the group consisting of polypeptides and small molecules.
28. The method of claim 22, wherein: (a) the polypeptide is
provided as a fusion protein comprising the polypeptide fused to
(i) a transcription activation domain of a transcription factor or
(ii) a DNA-binding domain of a transcription factor; and (b) the
test compound is a polypeptide that is provided as a fusion protein
comprising the test polypeptide fused to (i) a transcription
activation domain of a transcription factor or (ii) a DNA-binding
domain of a transcription factor, to interact with the fusion
protein; and (c) binding of the test compound to the polypeptide is
detected as reconstitution of a transcription factor.
29. An antibody that specifically binds to a GEP polypeptide of
claim 19.
30. An antibody of claim 29, wherein the antibody is a monoclonal
antibody.
31. A method for identifying an antibacterial agent, the method
comprising: (a) contacting a polypeptide encoded by a nucleic acid
located within an operon comprising a GEP gene with a test
compound; (b) detecting a decrease in function of the polypeptide
contacted with the test compound; and (c) determining whether a
test compound that decreases function of a contacted polypeptide
inhibits growth of bacteria, relative to growth of bacteria
cultured in the absence of a test compound that decreases function
of a contacted polypeptide, wherein inhibition of growth indicates
that the test compound is an antibacterial agent.
32. The method of claim 31, wherein the polypeptide is selected
from the group consisting of gep103, gep1119, gep1122, gep1315,
gep1493, gep1507, gep1511, gep1518, gep1546, gep1551, gep1561,
gep1580, gep1713, gep222, gep2283, gep273, gep286, gep311, gep3262,
gep3387, gep47, gep6l, and gep76.
33. The method of claim 31, wherein the test compound is selected
from the group consisting of polypeptides and small molecules.
34. A method for identifying an antibacterial agent, the method
comprising: (a) contacting a nucleic acid comprising an operon
containing a gene encoding a GEP polypeptide with a test compound,
wherein the GEP polypeptide is selected from the group consisting
of gep103, gep1119, gep1122, gep1315, gep1493, gep1507, gep1511,
gep1518, gep1546, gep1551, gep1561, gep1580, gep1713, gep222,
gep2283, gep273, gep286, gep311, gep3262, gep3387, gep47, gep6l,
and gep76; and (b) detecting binding of the test compound to the
nucleic acid, wherein binding indicates that the test compound is
an antibacterial agent.
35. The method of claim 34, further comprising: (c) determining
whether a test compound that binds to the nucleic acid inhibits
growth of bacteria, relative to growth of bacteria cultured in the
absence of the test compound that binds to the nucleic acid,
wherein inhibition of growth indicates that the test compound is an
antibacterial agent.
36. The method of claim 34, wherein the test compound is selected
from the group consisting of polypeptides and small molecules.
37. An isolated nucleic acid or an allelic variant thereof
encoding: a gep1493 polypeptide comprising the amino acid sequence
of SEQ ID NO: 13, as depicted in FIG. 5; a gep1507 polypeptide
comprising the amino acid sequence of SEQ ID NO: 16, as depicted in
FIG. 6; a gep1546 polypeptide comprising the amino acid sequence of
SEQ ID NO: 25, as depicted in FIG. 9; a gep273 polypeptide
comprising the amino acid sequence of SEQ ID NO: 46, as depicted in
FIG. 16; a gep286 polypeptide comprising the amino acid sequence of
SEQ ID NO: 49, as depicted in FIG. 17; or a gep76 polypeptide
comprising the amino acid sequence of SEQ ID NO: 67, as depicted in
FIG. 23.
38. An isolated nucleic acid comprising a sequence selected from
the group consisting of: (1) SEQ ID NO: 14, as depicted in FIG. 5,
or degenerate variants thereof; (2) SEQ ID NO: 14, or degenerate
variants thereof, wherein T is replaced by U; (3) nucleic acids
complementary to (1) and (2); (4) fragments of (1), (2), and (3)
that are at least 15 base pairs in length and which hybridize under
stringent conditions to genomic DNA encoding the polypeptide of SEQ
ID NO: 13; (5) SEQ ID NO: 17, as depicted in FIG. 6, or degenerate
variants thereof; (6) SEQ ID NO: 17, or degenerate variants
thereof, wherein T is replaced by U; (7) nucleic acids
complementary to (5) and (6); (8) fragments of (5), (6), and (7)
that are at least 15 base pairs in length and which hybridize under
stringent conditions to genomic DNA encoding the polypeptide of SEQ
ID NO: 16; (9) SEQ ID NO: 26, as depicted in FIG. 9, or degenerate
variants thereof; (10) SEQ ID NO: 26, or degenerate variants
thereof, wherein T is replaced by U; (11) nucleic acids
complementary to (9) and (10); (12) fragments of (9), (10), and
(11) that are at least 15 base pairs in length and which hybridize
under stringent conditions to genomic DNA encoding the polypeptide
of SEQ ID NO: 25; (13) SEQ ID NO: 47, as depicted in FIG. 16, or
degenerate variants thereof; (14) SEQ ID NO: 47, or degenerate
variants thereof, wherein T is replaced by U; (15) nucleic acids
complementary to (13) and (14); (16) fragments of (13), (14), and
(15) that are at least 15 base pairs in length and which hybridize
under stringent conditions to genomic DNA encoding the polypeptide
of SEQ ID NO: 46; (17) SEQ ID NO: 50, as depicted in FIG. 17, or
degenerate variants thereof; (18) SEQ ID NO: 50, or degenerate
variants thereof, wherein T is replaced by U; (19) nucleic acids
complementary to (i) and (j); (20) fragments of (i), (j), and (k)
that are at least 15 base pairs in length and which hybridize under
stringent conditions to genomic DNA encoding the polypeptide of SEQ
ID NO: 49; (21) SEQ ID NO: 68, as depicted in FIG. 23, or
degenerate variants thereof; (22) SEQ ID NO: 68, or degenerate
variants thereof, wherein T is replaced by U; (23) nucleic acids
complementary to (21) and (22); and (24) fragments of (21), (22),
and (23) that are at least 15 base pairs in length and which
hybridize under stringent conditions to genomic DNA encoding the
polypeptide of SEQ ID NO: 67.
39. A method for identifying an antibacterial agent, the method
comprising: (a) contacting a test compound with a polypeptide, or a
homolog of a polypeptide, encoded by a nucleic acid sequence
located within an operon comprising a B-yneS gene; and (b)
detecting binding of the test compound to the polypeptide, wherein
binding indicates that the test compound is an antibacterial
agent.
40. The method of claim 39, further comprising: (c) determining
whether a test compound that binds to the polypeptide inhibits
growth of bacteria, relative to growth of bacteria cultured in the
absence of a test compound that binds to the polypeptide, wherein
inhibition of growth indicates that the test compound is an
antibacterial agent.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority under 35 U.S.C. .sctn.119
from provisional application U.S. Serial No. 60/070,116, filed Dec.
31, 1997, which is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] The invention relates to essential bacterial genes and their
use in identifying antibacterial agents.
[0003] Bacterial infections may be cutaneous, subcutaneous, or
systemic. Opportunistic bacterial infections proliferate,
especially in patients afflicted with AIDS or other diseases that
compromise the immune system. The bacterium Streptococcus pneumonia
typically infects the respiratory tract and can cause lobar
pneumonia, as well as meningitis, sinusitis, and other
infections.
SUMMARY OF THE INVENTION
[0004] The invention is based on the discovery of 23 genes in the
bacterium Streptococcus pneumoniae, and a related gene in the
bacterium Bacillus subtilis, that are located within operons that
are essential for survival. These 23 Streptococcus genes are
referred to herein as "GEP genes" (which stands for general
essential protein); for convenience, the polypeptides encoded by
these genes are referred to herein as "GEP polypeptides." Each GEP
gene is located within an operon that contains a gene that is
essential for survival of Streptococcus pneumoniae; the essential
gene can be the GEP gene or another gene located within the same
operon. Bacterial operons contain several genes that are related,
e.g., with respect to function or biochemical pathway.
Transcription of an operon leads to the production of a single
transcript in which multiple coding regions are linked. Thus, an
operon containing one or more essential genes can be considered an
"essential operon," since disruption of expression of one gene
located within the operon will interfere with expression of the
other genes in the operon. Each coding region of the transcript is
separately translated into an individual polypeptide by ribosomes
that initiate translation at multiple points along the transcript.
Having identified one gene in the operon, one can readily identify
and sequence the other genes located within the operon.
[0005] The genes encoding the GEP polypeptides are useful molecular
tools for identifying similar genes in pathogenic microorganisms,
such as pathogenic strains of Bacillus. In addition, the operons
containing genes encoding GEP polypeptides, and the polypeptides
encoded by such operons, are useful targets for identifying
compounds that are inhibitors of the pathogens in which the GEP
polypeptides are expressed. Such inhibitors inhibit bacterial
growth by being bacteriostatic (e.g., inhibiting reproduction or
cell division) or by being bacteriocidal (i.e., by causing cell
death).
[0006] The invention, therefore, features an isolated polypeptide
encoded by a nucleic acid located within an operon encoding a GEP
polypeptide, termed gep103, having the amino acid sequence set
forth in SEQ ID NO: 1, or conservative variations thereof. An
isolated operon comprising a nucleic acid encoding gep103 also is
included within the invention. In addition, the invention includes
an isolated nucleic acid of (a) an operon comprising the sequence
of SEQ ID NO: 2, as depicted in FIG. 1, or degenerate variants
thereof; (b) an operon comprising the sequence of SEQ ID NO: 2, or
degenerate variants thereof, wherein T is replaced by U; (c)
nucleic acids complementary to (a) and (b); and (d) fragments of
(a), (b), and (c) that are at least 15 base pairs in length and
that hybridize under stringent conditions to genomic DNA encoding
the polypeptide of SEQ ID NO: 1. As described above for gep103,
other nucleic acids and polypeptides encoded by nucleic acids
located within operons encoding GEP polypeptides are included
within the invention, including: (a) operons comprising the nucleic
acids represented by the SEQ ID NOs. listed below, as depicted in
the Figures listed below, or degenerate variants thereof; (b)
operons comprising the nucleic acids represented by the SEQ ID NOs.
listed below, wherein T is replaced by U; (c) nucleic acids
complementary to (a) and (b); and (d) fragments of (a), (b), and
(c) that are at least 15 base pairs in length and that hybridize
under stringent conditions to genomic DNA encoding the polypeptides
represented by the SEQ ID NOs. listed below.
1TABLE 1 GEP nucleic acids and polypeptides SEQ ID ID NO. NO. OF
SEQ OF THE GEP SEQ ID THE CODING NON-CODING NUCLEIC NO. OF STRAND
OF STRAND OF ACID OR AMINO THE NUCLEIC THE NUCLEIC POLY- FIG. ACID
ACID ACID PEPTIDE NO. SEQUENCE SEQUENCE SEQUENCE gep1033 1 1 2 3
gep1119 2 4 5 6 gep1122 3 7 8 9 gep1315 4 10 11 12 gep1493 5 13 14
15 gep1507 6 16 17 18 gep1511 7 19 20 21 gep1518 8 22 23 24 gep1546
9 25 26 27 gep1551 10 28 29 30 gep1561 11 31 32 33 gep1580 12 34 35
36 gep1713 13 37 38 39 gep222 14 40 41 42 gep2283 15 43 44 45
gep273 16 46 47 48 gep286 17 49 50 51 gep311 18 52 53 54 gep3262 19
55 56 57 gep3387 20 58 59 60 gep47 21 61 62 63 gep61 22 64 65 66
gep76 23 67 68 69
[0007] The invention also includes allelic variants (i.e., genes
encoding isozymes) of the genes located within operons encoding the
GEP polypeptides listed above. For example, the invention includes
a gene that encodes a GEP polypeptide but which gene includes one
or more point mutations, deletions, promotor variants, or splice
site variants, provided that the resulting GEP polypeptide
functions as a GEP polypeptide (e.g., as determined in a
conventional complementation assay). Also included within the
invention are isolated operons comprising a nucleic acid molecule
containing the DNA sequence contained within the ATCC accession
number ______, ______, ______, ______, ______, ______, ______,
______, ______, ______, ______, ______, ______, ______, ______,
______, ______, ______, ______, ______, ______, ______, or ______,
as well as polypeptides encoded by these nucleic acid
molecules.
[0008] Identification of these GEP genes and the determination that
they are located within operons containing an essential gene allows
homologs of the GEP genes to be found in other organisms strains of
Streptococcus. Also, orthologs of these genes can be identified in
other species (e.g., Bacillus sp.). While "homologs" are
structurally similar genes contained within a species, "orthologs"
are functionally equivalent genes from other species (within or
outside of a given genus, e.g., from Bacillus subtilis or E. coli).
Such homologs and orthologs are expected to be located within
operons that are essential for survival. Such homologous and
orthologous genes and polypeptides can be used to identify
compounds that inhibit the growth of the host organism (e.g.,
compounds that are bacteriocidal or bacteriostatic against
pathogenic strains of the organism). Homologous and orthologous
genes and polypeptides that are essential for survival can serve as
targets for identifying a broad spectrum of antibacterial
agents.
[0009] An ortholog of gep1493, termed B-yneS, has been identified
in B. subtilis and is essential for survival of B. subtilis. The
amino acid sequence (SEQ ID NO: 70), coding sequence (SEQ ID NO:
71), and non-coding sequence (SEQ ID NO: 72) of B-yneS is set forth
in FIG. 24. As with the other polypeptides and genes disclosed
herein, the B-yneS polypeptide and gene can be used in the methods
described herein to identify antibacterial agents.
[0010] The term gep103 polypeptide or gene as used herein is
intended to include the polypeptide and gene set forth in FIG. 1
herein, as well as homologs of the sequences set forth in FIG. 1.
Also encompassed by the term gep103 gene are degenerate variants of
the nucleic acid sequence set forth in FIG. 1 (SEQ ID NO: 2).
Degenerate variants of a nucleic acid sequence exist because of the
degeneracy of the amino acid code; thus, those sequences that vary
from the sequence represented by SEQ ID NO: 2, but which
nonetheless encode a gep103 polypeptide are included within the
invention. Likewise, because of the similarity in the structures of
amino acids, conservative variations (as described herein) can be
made in the amino acid sequence of the gep103 polypeptide while
retaining the function of the polypeptide (e.g., as determined in a
conventional complementation assay). Other gep103 polypeptides and
genes identified in additional Streptococcus strains may be such
conservative variations or degenerate variants of the particular
gep103 polypeptide and nucleic acid set forth in FIG. 1 (SEQ ID
NOs: 1 and 2, respectively). The gep103 polypeptide and gene share
at least 80%, e.g., 90%, sequence identity with SEQ ID NOs: 1 and
2, respectively. Regardless of the percent sequence identity
between the gep103 sequence and the sequence represented by SEQ ID
NOs: 1 and 2, the gep103 genes and polypeptides encompassed by the
invention are able to complement for the lack of gep103 function
(e.g., in a temperature-sensitive mutant) in a standard
complementation assay. Additional gep103 genes that are identified
and cloned from additional Streptococcus strains, and pathogenic
strains in particular, can be used to produce gep103 polypeptides
for use in the various methods described herein, e.g., for
identifying antibacterial agents. Likewise, the terms gep1119,
gep1122, gep1315, gep1493, gep1507, gep1511, gep1518, gep1546,
gep1551, gep1561, gep1580, gep1713, gep222, gep2283, gep273,
gep286, gep311, gep3262, gep3387, gep47, gep61, and gep76 encompass
homologs, conservative variations, and degenerate variants of the
sequences depicted in FIGS. 2-23, respectively. Such homologs,
conservative variations, and degenerate variants also are included
within the invention.
[0011] Since the various GEP genes described herein have been
identified and shown to be located within operons that are
essential for survival, the GEP genes and polypeptides encoded by
nucleic acid sequences located within operons containing GEP genes
and their homologs and orthologs can be used to identify
antibacterial agents. More specifically, the polypeptides encoded
by nucleic acid sequences located within operons containing GEP
genes can be used, separately or together, in assays to identify
test compounds that bind to these polypeptides. Such test compounds
are expected to be antibacterial agents, in contrast to compounds
that do not bind to these GEP polypeptides. As described herein,
any of a variety of art-known methods can be used to assay for
binding of test compounds to the polypeptides. The invention
includes, for example, a method for identifying an antibacterial
agent where the method entails: (a) contacting a polypeptide
encoded by a nucleic acid sequence located within an operon
containing a GEP gene, or homolog or ortholog thereof, with a test
compound; (b) detecting binding of the test compound to the
polypeptide or homolog or ortholog; and (c) determining whether a
test compound that binds to the polypeptide or homolog or ortholog
inhibits growth of bacteria, relative to growth of bacteria
cultured in the absence of the test compound that binds to the
polypeptide or homolog or ortholog, as an indication that the test
compound is an antibacterial agent.
[0012] In various embodiments, the GEP polypeptide is derived from
a non-pathogenic or pathogenic Streptococcus strain, such as
Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus endocarditis, Streptococcus faecium,
Streptococcus sangus, Streptococcus viridans, and Streptococcus
hemolyticus. Suitable orthologs of the Streptococcus GEP genes can
be derived from the bacterium Bacillus subtilis. The test compound
can be immobilized on a substrate, and binding of the test compound
to the polypeptide or homolog or ortholog can be detected as
immobilization of the polypeptide or homolog or ortholog on the
immobilized test compound, e.g., in an immunoassay with an antibody
that specifically binds to the polypeptide.
[0013] If desired, the test compound can be a test polypeptide
(e.g., a polypeptide having a random or predetermined amino acid
sequence; or a naturally-occurring or synthetic polypeptide).
Alternatively, the test compound can be a nucleic acid, such as a
DNA or RNA molecule. In addition, small organic molecules can be
tested. The test compound can be a naturally-occurring compound or
it can be synthetically produced, if desired. Synthetic libraries,
chemical libraries, and the like can be screened to identify
compounds that bind to the polypeptides. More generally, binding of
test compounds to the polypeptide or homolog or ortholog can be
detected either in vitro or in vivo. Regardless of the source of
the test compound, the polypeptides described herein can be used to
identify compounds that are bactericidal or bacteriostatic to a
variety of pathogenic or non-pathogenic strains.
[0014] In an exemplary method, binding of a test compound to a
polypeptide encoded by a nucleic acid located within an operon
containing a GEP gene can be detected in a conventional two-hybrid
system for detecting protein/protein interactions (e.g., in yeast
or mammalian cells). Generally, in such a method, (a) the
polypeptide encoded by a nucleic acid located within an operon
containing a GEP gene is provided as a fusion protein that includes
the polypeptide fused to (i) a transcription activation domain of a
transcription factor or (ii) a DNA-binding domain of a
transcription factor; (b) the test polypeptide is provided as a
fusion protein that includes the test polypeptide fused to (i) a
transcription activation domain of a transcription factor or (ii) a
DNA-binding domain of a transcription factor; and (c) binding of
the test polypeptide to the polypeptide is detected as
reconstitution of a transcription factor. Homologs and orthologs of
the GEP polypeptides can be used in similar methods. Reconstitution
of the transcription factor can be detected, for example, by
detecting transcription of a gene that is operably linked to a DNA
sequence bound by the DNA-binding domain of the reconstituted
transcription factor (See, for example, White, 1996, Proc. Natl.
Acad. Sci. 93:10001-10003 and references cited therein and Vidal et
al., 1996, Proc. Natl. Acad. Sci. 93:10315-10320).
[0015] In an alternative method, an isolated operon containing a
nucleic acid molecule encoding a GEP polypeptide is used to
identify a compound that decreases the expression of a GEP
polypeptide in vivo. Such compounds can be used as antibacterial
agents. To discover such compounds, cells that express a GEP
polypeptide are cultured, exposed to a test compound (or a mixture
of test compounds), and the level of expression or activity is
compared with the level of GEP polypeptide expression or activity
in cells that are otherwise identical but that have not been
exposed to the test compound(s). Many standard quantitative assays
of gene expression can be utilized in this aspect of the
invention.
[0016] To identify compounds that modulate expression of a GEP
polypeptide (or homologous or orthologous sequence), the test
compound(s) can be added at varying concentrations to the culture
medium of cells that express a GEP polypeptide (or homolog or
ortholog), as described herein. Such test compounds can include
small molecules (typically, non-protein, non-polysaccharide
chemical entities), polypeptides, and nucleic acids. The expression
of the GEP polypeptide is then measured, for example, by Northern
blot PCR analysis or RNAse protection analyses using a nucleic acid
molecule of the invention as a probe. The level of expression in
the presence of the test molecule, compared with the level of
expression in its absence, will indicate whether or not the test
molecule alters the expression of the GEP polypeptide. Because the
GEP polypeptides are expressed from operons that are essential for
survival, test compounds that inhibit the expression and/or
function of the GEP polypeptide will inhibit growth of the cells or
kill the cells.
[0017] Compounds that modulate the expression of the polypeptides
of the invention can be identified by carrying out the assays
described herein and then measuring the levels of the GEP
polypeptides expressed in the cells, e.g., by performing a Western
blot analysis using antibodies that bind to a GEP polypeptide.
[0018] The invention further features methods of identifying from a
large group of mutants those strains that have conditional lethal
mutations. In general, the gene and corresponding gene product are
subsequently identified, although the strains themselves can be
used in screening or diagnostic assays. The mechanism(s) of action
for the identified genes and gene products provide a rational basis
for the design of antibacterial therapeutic agents. These
antibacterial agents reduce the action of the gene product in a
wild type strain, and therefore are useful in treating a subject
with that type, or a similarly susceptible type of infection by
administering the agent to the subject in a pharmaceutically
effective amount. Reduction in the action of the gene product
includes competitive inhibition of the gene product for the active
site of an enzyme or receptor; non-competitive inhibition;
disrupting an intracellular cascade path which requires the gene
product; binding to the gene product itself, before or after
post-translational processing; and acting as a gene product
mimetic, thereby down-regulating the activity. Therapeutic agents
include monoclonal antibodies raised against the gene product.
[0019] Furthermore, the presence of the gene sequence in certain
cells (e.g., a pathogenic bacterium of the same genus or similar
species), and the absence or divergence of the sequence in host
cells can be determined, if desired. Therapeutic agents directed
toward genes or gene products that are not present in the host have
several advantages, including fewer side effects, and lower overall
dosage.
[0020] The invention includes pharmaceutical formulations that
include a pharmaceutically acceptable excipient and an
antibacterial agent identified using the methods described herein.
In particular, the invention includes pharmaceutical formulations
that contain antibacterial agents that inhibit the growth of, or
kill, pathogenic Streptococcus strains. Such pharmaceutical
formulations can be used for treating a Streptococcus infection in
an organism. Such a method entails administering to the organism a
therapeutically effective amount of the pharmaceutical formulation.
In particular, such pharmaceutical formulations can be used to
treat streptococcal pneumonia in mammals such as humans and
domesticated mammals (e.g., cows, pigs, dogs, and cats), and in
plants. The efficacy of such antibacterial agents in humans can be
estimated in an animal model system well known to those of skill in
the art (e.g., mouse and rabbit model systems).
[0021] Also included within the invention are polyclonal and
monoclonal antibodies that specifically bind to the various GEP
polypeptides described herein (e.g., gep103). Such antibodies can
facilitate detection of GEP polypeptides in various Streptococcus
strains. These antibodies also are useful for detecting binding of
a test compound to GEP polypeptides (e.g., using the assays
described herein). In addition, monoclonal antibodies that bind to
GEP polypeptides are themselves adequate antibacterial agents when
administered to a mammal, as such monoclonal antibodies are
expected to impede one or more functions of GEP polypeptides.
[0022] As used herein, "nucleic acids" encompass both RNA and DNA,
including genomic DNA and synthetic (e.g., chemically synthesized)
DNA. The nucleic acid can be double-stranded or single-stranded.
Where single-stranded, the nucleic acid may be a sense strand or an
antisense strand. The nucleic acid may be synthesized using
oligonucleotide analogs or derivatives (e.g., inosine or
phosphorothioate nucleotides). Such oligonucleotides can be used,
for example, to prepare nucleic acids that have altered
base-pairing abilities or increased resistance to nucleases.
[0023] An "isolated nucleic acid" is a DNA or RNA that is not
immediately contiguous with both of the coding sequences with which
it is immediately contiguous (one on the 5' end and one on the 3'
end) in the naturally occurring genome of the organism from which
it is derived. Thus, in one embodiment, an isolated nucleic acid
includes some or all of the 5' non-coding (e.g., promoter)
sequences that are immediately contiguous to the coding sequence.
The term therefore includes, for example, a recombinant DNA that is
incorporated into a vector, into an autonomously replicating
plasmid or virus, or into the genomic DNA of a prokaryote or
eukaryote, or which exists as a separate molecule (e.g., a genomic
DNA fragment produced by PCR or restriction endonuclease treatment)
independent of other sequences. It also includes a recombinant DNA
that is part of a hybrid gene encoding an additional polypeptide
sequence. The term "isolated" can refer to a nucleic acid or
polypeptide that is substantially free of cellular material, viral
material, or culture medium (when produced by recombinant DNA
techniques), or chemical precursors or other chemicals (when
chemically synthesized). Moreover, an "isolated nucleic acid
fragment" is a nucleic acid fragment that is not naturally
occurring as a fragment and would not be found in the natural
state. As used herein, the term "isolated nucleic acid molecule"
includes an operon containing a contiguous cluster of linked
sequences. "Isolated operons" are those operons that are not
naturally occurring and which are not associated with the sequences
by which they are normally surrounded in a bacterial genome.
[0024] A nucleic acid sequence that is "substantially identical" to
a GEP nucleotide sequence is at least 80% (e.g., 85%) identical to
the nucleotide sequence of the nucleic acid sequences represented
by the SEQ ID NOs listed in Table 1, as depicted in FIGS. 1-23. For
purposes of comparison of nucleic acids, the length of the
reference nucleic acid sequence will generally be at least 40
nucleotides, e.g., at least 60 nucleotides or more nucleotides.
Sequence identity can be measured using sequence analysis software
(e.g., Sequence Analysis Software Package of the Genetics Computer
Group, University of Wisconsin Biotechnology Center, 1710
University Avenue, Madison, Wis. 53705).
[0025] The GEP polypeptides useful in practicing the invention
include, but are not limited to, recombinant polypeptides and
natural polypeptides. Also useful in the invention are nucleic acid
sequences that encode forms of GEP polypeptides in which naturally
occurring amino acid sequences are altered or deleted. Preferred
nucleic acids encode polypeptides that are soluble under normal
physiological conditions. Also within the invention are nucleic
acids encoding fusion proteins in which a portion of a GEP
polypeptide is fused to an unrelated polypeptide (e.g., a marker
polypeptide or a fusion partner) to create a fusion protein. For
example, the polypeptide can be fused to a hexa-histidine tag to
facilitate purification of bacterially expressed polypeptides, or
to a hemagglutinin tag to facilitate purification of polypeptides
expressed in eukaryotic cells. The invention also includes, for
example, isolated polypeptides (and the nucleic acids that encode
these polypeptides) that include a first portion and a second
portion; the first portion includes, e.g., a GEP polypeptide, and
the second portion includes an immunoglobulin constant (Fc) region
or a detectable marker.
[0026] The fusion partner can be, for example, a polypeptide which
facilitates secretion, e.g., a secretory sequence. Such a fused
polypeptide is typically referred to as a preprotein. The secretory
sequence can be cleaved by the host cell to form the mature
protein. Also within the invention are nucleic acids that encode a
GEP polypeptide fused to a polypeptide sequence to produce an
inactive preprotein. Preproteins can be converted into the active
form of the protein by removal of the inactivating sequence.
[0027] The invention also includes nucleic acids that hybridize,
e.g., under stringent hybridization conditions (as defined herein)
to all or a portion of the nucleotide sequences represented by the
SEQ ID NOs. listed in Table 1, or their complements. The
hybridizing portion of the hybridizing nucleic acids is typically
at least 15 (e.g., 20, 30, or 50) nucleotides in length. The
hybridizing portion of the hybridizing nucleic acid is at least
80%, e.g., at least 95%, or at least 98%, identical to the sequence
of a portion or all of a nucleic acid encoding a GEP polypeptide or
its complement. Hybridizing nucleic acids of the type described
herein can be used as a cloning probe, a primer (e.g., a PCR
primer), or a diagnostic probe. Nucleic acids that hybridize to the
nucleotide sequences represented by the SEQ ID NOs. listed in Table
1 are considered "antisense oligonucleotides." Also included within
the invention are ribozymes that inhibit the function of operons
containing the GEP genes of the invention, as determined, for
example, in a complementation assay.
[0028] Also useful in the invention are various cells, e.g.,
transformed host cells, that contain a GEP nucleic acid described
herein. A "transformed cell" is a cell into which (or into an
ancestor of which) has been introduced, by means of recombinant DNA
techniques, a nucleic acid encoding a GEP polypeptide. Both
prokaryotic and eukaryotic cells are included, e.g., bacteria,
Streptococcus, Bacillus, and the like.
[0029] Also useful in the invention are genetic constructs (e.g.,
vectors and plasmids) that include a nucleic acid of the invention
which is operably linked to a transcription and/or translation
sequence to enable expression, e.g., expression vectors. By
"operably linked" is meant that a selected nucleic acid, e.g., a
DNA molecule encoding a GEP polypeptide, is positioned adjacent to
one or more sequence elements, e.g., a promoter, which directs
transcription and/or translation of the sequence such that the
sequence elements can control transcription and/or translation of
the selected nucleic acid.
[0030] The invention also features purified or isolated
polypeptides encoded by nucleic acids located within operons
containing GEP genes, as listed in Table 1. As used herein, both
"protein" and "polypeptide" mean any chain of amino acids,
regardless of length or post-translational modification (e.g.,
glycosylation or phosphorylation). Thus, the terms gep103
polypeptide, gep1119 polypeptide, gep1122 polypeptide, gep1315
polypeptide, gep1493 polypeptide, gep1507 polypeptide, gep1511
polypeptide, gep1518 polypeptide, gep1546 polypeptide, gep1551
polypeptide, gep1561 polypeptide, gep1580 polypeptide, gep1713
polypeptide, gep222 polypeptide, gep2283 polypeptide, gep273
polypeptide, gep286 polypeptide, gep311 polypeptide, gep3262
polypeptide, gep3387 polypeptide, gep47 polypeptide, gep61
polypeptide, and gep76 polypeptide include full-length, naturally
occurring gep103, gep1119, gep1122, gep1315, gep1493, gep1507,
gep1511, gep1518, gep1546, gep1551, gep1561, gep1580, gep1713,
gep222, gep2283, gep273, gep286, gep311, gep3262, gep3387, gep47,
gep61, and gep76 proteins, respectively, as well as recombinantly
or synthetically produced polypeptides that correspond to the
full-length, naturally occurring proteins, or to a portion of the
naturally occurring or synthetic polypeptide.
[0031] A "purified" or "isolated" compound is a composition that is
at least 60% by weight the compound of interest, e.g., a GEP
polypeptide or antibody. Preferably the preparation is at least 75%
(e.g., at least 90% or 99%) by weight the compound of interest.
Purity can be measured by any appropriate standard method, e.g.,
column chromatography, polyacrylamide gel electrophoresis, or HPLC
analysis.
[0032] Preferred GEP polypeptides include a sequence substantially
identical to all or a portion of a naturally occurring GEP
polypeptide, e.g., including all or a portion of the sequences
shown in FIGS. 1-23. Polypeptides "substantially identical" to the
GEP polypeptide sequences described herein have an amino acid
sequence that is at least 80% (e.g., 85%, 90%, 95%, or 99%)
identical to the amino acid sequence of the GEP polypeptides
represented by the SEQ ID NOs. listed in Table 1. For purposes of
comparison, the length of the reference GEP polypeptide sequence
will generally be at least 16 amino acids, e.g., at least 20 or 25
amino acids.
[0033] In the case of polypeptide sequences that are less than 100%
identical to a reference sequence, the non-identical positions are
preferably, but not necessarily, conservative substitutions for the
reference sequence. Conservative substitutions typically include
substitutions within the following groups: glycine and alanine;
valine, isoleucine, and leucine; aspartic acid and glutamic acid;
asparagine and glutamine; serine and threonine; lysine and
arginine; and phenylalanine and tyrosine.
[0034] Where a particular polypeptide is said to have a specific
percent identity to a reference polypeptide of a defined length,
the percent identity is relative to the reference polypeptide.
Thus, a polypeptide that is 50% identical to a reference
polypeptide that is 100 amino acids long can be a 50 amino acid
polypeptide that is completely identical to a 50 amino acid long
portion of the reference polypeptide. It also might be a 100 amino
acid long polypeptide which is 50% identical to the reference
polypeptide over its entire length. Of course, other polypeptides
also will meet the same criteria.
[0035] The invention also features purified or isolated antibodies
that specifically bind to a GEP polypeptide. By "specifically
binds" is meant that an antibody recognizes and binds to a
particular antigen, e.g., a GEP polypeptide, but does not
substantially recognize and bind to other molecules in a sample,
e.g., a biological sample that naturally includes a GEP
polypeptide.
[0036] In another aspect, the invention features a method for
detecting a GEP polypeptide in a sample. This method includes:
obtaining a sample suspected of containing a GEP polypeptide;
contacting the sample with an antibody that specifically binds to a
GEP polypeptide under conditions that allow the formation of
complexes of an antibody and the GEP polypeptide; and detecting the
complexes, if any, as an indication of the presence of a GEP
polypeptide in the sample.
[0037] Also encompassed by the invention is a method of obtaining a
gene related to (i.e., a functional homolog or ortholog of) a GEP
gene. Such a method entails obtaining a labeled probe that includes
an isolated nucleic acid which encodes all or a portion of a GEP
nucleic acid, or a homolog or ortholog thereof; screening a nucleic
acid fragment library with the labeled probe under conditions that
allow hybridization of the probe to nucleic acid fragments in the
library, thereby forming nucleic acid duplexes; isolating labeled
duplexes, if any; and preparing a full-length gene sequence from
the nucleic acid fragments in any labeled duplex to obtain a gene
related to the GEP gene.
[0038] The invention offers several advantages. For example, the
methods for identifying antibacterial agents can be configured for
high throughput screening of numerous candidate antibacterial
agents.
[0039] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described herein. All
publications, patent applications, patents, and other references
mentioned herein are incorporated herein by reference in their
entirety. In the case of a conflict, the present specification,
including definitions, will control. In addition, the materials,
methods, and examples are illustrative and are not intended to
limit the scope of the invention, which is defined by the
claims.
[0040] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] FIG. 1 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep103
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 1, 2, and 3 respectively).
[0042] FIG. 2 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1119
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 4, 5 and 6, respectively).
[0043] FIG. 3 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1122
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 7, 8, and 9, respectively).
[0044] FIG. 4 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1315
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 10, 11, and 12, respectively).
[0045] FIG. 5 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1493
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 13, 14, and 15, respectively).
[0046] FIG. 6 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1507
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
16, 17, and 18, respectively).
[0047] FIG. 7 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1511
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
19, 20, and 21, respectively).
[0048] FIG. 8 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1518
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
22, 23, and 24, respectively).
[0049] FIG. 9 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1546
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 25, 26, and 27, respectively).
[0050] FIG. 10 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1551
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 28, 29, and 30, respectively).
[0051] FIG. 11 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1561
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 31, 32, and 33, respectively).
[0052] FIG. 12 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1580
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 34, 35, and 36, respectively).
[0053] FIG. 13 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep1713
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
37, 38, and 39, respectively)
[0054] FIG. 14 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep222
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
40, 41, and 42, respectively).
[0055] FIG. 15 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep2283
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
43, 44, and 45, respectively).
[0056] FIG. 16 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep273
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 46, 47, and 48, respectively).
[0057] FIG. 17 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep286
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 49, 50, and 51, respectively).
[0058] FIG. 18 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep311
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
52, 53, and 54, respectively).
[0059] FIG. 19 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep3262
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
55, 56, and 57, respectively).
[0060] FIG. 20 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep3387
polypeptide and gene from a Streptococcus pneumonia (SEQ ID NOs:
58, 59, and 60, respectively).
[0061] FIG. 21 are a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep47
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 61, 62, and 63, respectively).
[0062] FIG. 22 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep61
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 64, 65, and 66, respectively).
[0063] FIG. 23 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the gep76
polypeptide and gene from a Streptococcus pneumonia strain (SEQ ID
NOs: 67, 68, and 69, respectively).
[0064] FIG. 24 is a representation of the amino acid and coding
strand and non-coding strand nucleic acid sequences of the B-yneS
polypeptide and gene from a Bacillus subtilis strain (SEQ ID NOs:
70, 71, and 72, respectively).
[0065] FIG. 25 is a schematic representation of the PCR strategy
used to produce DNA molecules used for targeted deletions of
essential genes in Streptococcus pneumoniae.
[0066] FIG. 26 is a schematic representation of the strategy used
to produce targeted deletions of essential genes in Streptococcus
pneumoniae.
DETAILED DESCRIPTION OF THE INVENTION
[0067] Identifying Streptococcus Genes in Essential Operons
[0068] As shown by the experiments described below, each of the GEP
genes is located within an operon that is essential for survival of
Streptococcus pneumonia. Streptococcus pneumonia is available from
the ATCC. To identify genes located within essential operons,
mutants of Streptococcus pneumonia were produced. In general,
mutagenesis of Streptococcus pneumonia can be accomplished using
any of various art-known methods.
[0069] In general, and for the examples set forth below, genes
located within essential Streptococcus pneumonia operons can be
identified using genes from a Streptococcus pneumonia RX1 genomic
library, which was produced using standard methods (see Kim et al.,
Nucl. Acids. Res. 20: 1083-1085 (1992) and Ausubel et al. (eds.),
1995, Current Protocols in Molecular Biology, (John Wiley &
Sons, NY)). Genes in this Streptococcus library were disrupted
using a shuttle mutagenesis approach with the transposon TnPho-A.
Each disrupted gene then was tested to determine whether it was
located within an operon that is essential for survival of
Streptococcus pneumonia. In this method, 2 ml of LB broth
supplemented with chloramphenicol (10 .mu.g/ml), MgSO.sub.4 (10 mM)
and maltose (0.2%) were inoculated with 50 .mu.l of the
Streptococcus pneumonia RX-1 plasmid library. The culture was grown
at 37.degree. C. while shaking until the OD.sub.650 of the culture
reached 0.8 (approximately 2 hours). A 1 ml aliquot of
TnPho-A-containing phage (10.sup.9 pfu/ml) was added to 1 ml of the
Streptococcus culture, producing a ratio of approximately 10 phage
to 1 cell. The phage and cells were incubated at 37.degree. C. for
30 minutes. A 4 ml aliquot of LB broth, warmed to 37.degree. C.,
then was added to the phage/cell mixture, and the mixture was
incubated at 37.degree. C., while shaking, for 1 hour. The cells
then were pelleted by centrifuging them at 3500 rpm in a Beckman
tabletop centrifuge for 5 minutes.
[0070] The pelleted cells then were resuspended in 800 .mu.l of LB
broth, and a 200 .mu.l aliquot of cells was plated onto each of
four petri plates containing LB agar supplemented with
chloramphenicol (10 .mu.g/ml), kanamycin (50 .mu.g/ml), and
erythromycin (300 .mu.g/ml). The plates then were incubated
overnight at 37.degree. C., and the number of colonies appearing on
the plates was counted. Approximately 18,000 colonies then were
pooled and used to inoculate 50 ml of LB broth, which was incubated
overnight at 37.degree. C. Plasmid DNA from the culture then was
extracted using a Qiagen MIDI Prep Kit; other art-known extraction
methods can be substituted.
[0071] The concentration of the extracted DNA was measured, and 100
ng of the DNA was transformed, by electroporation, into E. coli
DH10B cells (Gibco BRL). A 1 ml aliquot of SOC broth then was added
the transformed cells, and the cells were incubated at 37.degree.
C. for 1 hour before being pelleted by centrifugation at 3500 RPM
for 5 minutes. The cells then were resuspended in 200 .mu.l of LB
broth, and aliquots of 2, 20, and 50 .mu.l were plated onto petri
plates containing LB agar and antibiotics as described above. After
incubating the plates overnight at 37.degree. C., 93 colonies were
picked and used, individually, to inoculate 1.25 ml of Terrific
broth supplemented with chloramphenicol (10 .mu.g/ml), kanamycin
(50 .mu.g/ml), and erythromycin (300 .mu.g/ml). The cultures were
incubated at 37.degree. G for approximately 20 hours, while
shaking. The DNA from each culture then was extracted, using a
conventional alkaline lysis miniprep method.
[0072] The extracted DNA samples then were used, individually, to
transform Streptococcus pneumonia cells in a 96-well microtitre
format. The transposon promotes insertion of the mutagenized gene
into the bacterial chromosome. Non-transforming clones indicate
that the mutation was within an operon containing an essential
gene.
[0073] The non-transforming clones then were grown in 50 ml of
Terrific broth supplemented with chloramphenicol (10 .mu.g/ml),
kanamycin (50 .mu.g/ml), and erythromycin (300 .mu.g/ml). DNA from
these clones was extracted and retransformed into Streptococcus
pneumonia and plated on petri dishes to confirm that they were
non-transforming. The genes located within essential operons then
were sequenced, using primers that hybridize to sequences of the
transposon. The sequences of the primers were:
[0074] 5'GCAGCCCGGTTTTCCAGAACAGG3' (SEQ ID NO: 73) and
[0075] 5'GATTTAGCCCAGTCGGCCGCACG3' (SEQ ID NO: 74).
[0076] In an alternative method, which also was used, the
transposon Tn 10 was used to disrupt genes in a Streptococcus
pneumonia fosmid library, which was produced using standard
methods. A 50 ml aliquot of TBMM broth supplemented with
chloramphenicol (10 .mu.g/ml), MgSO.sub.4 (10 mM), and maltose
(0.2%) were inoculated with a single fosmid colony from the fosmid
library, and the cultures were grown overnight at 37.degree. C. The
cells then were pelleted and resuspended in 5 ml of LB broth
supplemented with chloramphenicol (10 .mu.g/ml), MgSO.sub.4 (10
mM), and maltose (0.2%). A 100 .mu.l aliquot of the cells then was
mixed with 100 .mu.l of Tn10 phage lysate (10.sup.10 pfu/ml), and
the mixture was incubated at room temperature for 15 minutes and
then incubated at 37.degree. C. for 15 minutes.
[0077] A 5 ml aliquot of LB broth supplemented with IPTG (1 mM) and
sodium citrate (50 mM) and warmed to 37.degree. C. then was added
to the cell/phage mixture. After incubating the cell/phage mixture
at 37.degree. C., while shaking, the cells were pelleted and
resuspended in 800 .mu.l of LB broth. The cells then were plated
onto 4 plates of LB agar supplemented with chloramphenicol (10
.mu.g/ml) and erythromycin (300 .mu.g/ml). After incubating the
cells overnight at 37.degree. C., at least 10,000 of the resulting
colonies were used to inoculate 50 ml of LB broth. DNA then was
extracted and quantified using standard methods, and 100 ng of DNA
were used to transform E. coli DH10B cells (Gibco BRL) via
electroporation. After adding 1 ml of SOC broth to the cells, the
cells were incubated at 37.degree. C. for 1 hour. The cells then
were pelleted and suspended in 200 .mu.l LB broth, and aliquots of
2, 20, and 50 .mu.l were plated onto LB agar supplemented with
chloramphenicol (10 .mu.g/ml), kanamycin (50 .mu.g/ml), and
erythromycin (300 .mu.g/ml). The plates then were incubated
overnight at 37.degree. C., and 93 colonies were picked and used to
inoculate 1.25 ml of Terrific broth supplemented with
chloramphenicol (10 .mu.g/ml), kanamycin (50 .mu.g/ml) and
erythromycin (300 .mu.g/ml). These cultures were incubated for
approximately 20 hours, while shaking, and the DNA was isolated
using a standard miniprep method. The extracted DNA then was used
to transform Streptococcus pneumonia, and the genes located within
essential operons were sequenced as described above. The sequences
of the primers used for sequencing were:
[0078] 5'CCGCCATTCTTTGCTGTTTCG3' (SEQ ID NO: 75) and
[0079] 5'TTACACGTTACTAAAGGGAATG3' (SEQ ID NO: 76).
[0080] Identification of the gep1493, gep1507, gep1546, gep273,
gep286, and gep76 Genes as Essential Genes
[0081] As shown by the experiments described below, the gep1493,
gep1507, gep1546, gep273, gep286, and gep76 genes each have been
shown to be essential for survival of Streptococcus pneumoniae.
Each of the gep1493, gep1507, gep1546, gep273, gep286, and gep76
genes has been identified as essential by creating a targeted
deletion of each gene, separately, in Streptococcus pneumoniae.
[0082] Each of the gep1493, gep1507, gep1546, gep273, gep286, and
gep76 genes was, separately, replaced with a nucleic acid sequence
conferring resistance to the antibiotic erythromycin (an "erm"
gene). Other genetic markers can be used in lieu of this particular
antibiotic resistance marker. Polymerase chain reaction (PCR)
amplification was used to make a targeted deletion in the
Streptococcus genomic DNA, as shown in FIG. 25. Several PCR
reactions were used to produce the DNA molecules needed to carry
out target deletion of the genes of interest. First, using primers
5 and 6, an erm gene was amplified from pIL252 from B. subtilis
(available from the Bacillus Genetic Stock Center, Columbus, Ohio).
Primer 5 consists of 21 nucleotides that are identical to the
promoter region of the erm gene and complementary to Sequence A.
Primer 5 has the sequence 5'GTG TTC GTG CTG ACT TGC ACC3' (SEQ ID
NO: 77). Primer 6 consists of 21 nucleotides that are complementary
to the 3' end of the erm gene. Primer 6 has the sequence 5'GAA TTA
TTT CCT CCC GTT AAA3' (SEQ ID NO: 78). PCR amplification of the erm
gene was carried out under the following conditions: 30 cycles of
94.degree. C. for 1 minute, 55.degree. C. for 1 minute, and
72.degree. C. for 1.5 minutes, followed by one cycle of 72.degree.
C. for 10 minutes.
[0083] In the second and third PCR reactions, sequences flanking
the gene of interest were amplified and produced as hybrid DNA
molecules that also contained a portion of the erm gene. The second
reaction produced a double-stranded DNA molecule (termed "Left
Flanking Molecule") that includes sequences upstream of the 5' end
of the gene of interest and the first 21 nucleotides of the erm
gene. As shown in FIG. 25, this reaction utilized primer 1, which
is 21 nucleotides in length and identical to a sequence that is
located approximately 500 bp upstream of the translation start site
of the gene of interest. Primers 1 and 2 are gene-specific and
include the sequences 5'CTC CGT GAA GTC CAC CTG AT3' (SEQ ID NO:
79) and 5'GGT GCA AGT CAG CAC GAA CAC GCG ACA TAG GTT CCA GTT AGG3'
(SEQ ID NO: 80), respectively, for gep1493. Primer 2 is 42
nucleotides in length, with 21 of the nucleotides at the 3' end of
the primer being complementary to the 5' end of the sense strand of
the gene of interest. The 21 nucleotides at the 5' end of the
primer were identical to Sequence A and are therefore complementary
to the 5' end of the erm gene. Thus, PCR amplification using
primers 1 and 2 produced the left flanking DNA molecule, which is a
hybrid DNA molecule containing a sequence located upstream of the
gene of interest and 21 base pairs of the erm gene, as shown in
FIG. 25.
[0084] The third PCR reaction was similar to the second reaction,
but produced the right flanking DNA molecule, shown in FIG. 25. The
right flanking DNA molecule contains 21 base pairs of the 3' end of
the erm gene, a 21 base pair portion of the 3' end of the gene of
interest, and sequences downstream of the gene of interest. This
right flanking DNA molecule was produced with gene-specific primers
3 and 4. For gep 1493, primers 3 and 4 included the sequences 5'TTT
AAC GGG AGG AAA TAA TTC CCA TAT CGT GGC TCC TGA AT 3' (SEQ ID NO:
81) and 5'TAA AGC CCT CAT GTC GAA CC3' (SEQ ID NO: 82),
respectively. Primer 3 is 42 nucleotides; the 21 nucleotides at the
5' end of Primer 3 are identical to Sequence B and therefore are
identical to the 3' end of the erm gene. The 21 nucleotides at the
3' end of Primer 3 are identical to the 3' end of the gene of
interest. Primer 4 is 21 nucleotides in length and is complementary
to a sequence located approximately 500 bp downstream of the gene
of interest. As discussed above, primers 1-4 are gene-specific, and
the sequences disclosed above were used for gep1493. Gene-specific
primers were used to identify the other essential genes described
herein, as shown in Table 2.
2TABLE 2 Primers Used in Identifying Essential Genes Gene Primer 1
Primer 2 Primer 3 Primer 4 gep1493 5'CTCCGTGAAGTCC 5'GGTGCAAGTCAGCA
5'TTTAACGGGAGG 5'TTGGCAAGAAGG ACCTGAT3' CGAACACTGCTCGCGT
AAATAATTCGGGGA CAGAGAAT3' (SEQ ID NO:79) AGATTGATTTG3'
TTGAACCTAACCCA (SEQ ID NO:82) (SEQ ID NO:80) T3' (SEQ ID NO:81)
gep1507 5'GCATGAGAAACCC 5'GGTGCAAGTCAGCA 5'TTTAACGGGAGG
5'TAAAGCCCTCAT AGTCTCC3' CGAACACGCGACATAG AAATAATTCCCATA GTCGAACC3'
(SEQ ID NO:83) GTTCCAGTTAGG3' TCGTGGCTCCTGAA (SEQ ID NO:86) (SEQ ID
NO:84) T3' (SEQ ID NO:85) gep1546 5'CAGTGACGATACA 5'GGTGCAAGTCAGCA
5'TTTAACGGGAGG 5'CCAGCAAAGGAA GATGAAGAA3' CGAACACGATGCTGGC
AAATAATTCGTCGC AACCGATA3' (SEQ ID NO:87) TTCGTTGAGTG3'
GACTCCTAGCCATA (SEQ ID NO:90) (SEQ ID NO:88) C3' (SEQ ID NO:89)
gep273 5'GGTCAGTGACAGC 5'GGTGCAAGTCAGCA 5'TTTAACGGGAGG
5'CCCATAACCGTA AGCAGAT3' CGAACACGGCCTTGGA AAATAATTCCCGCT TCACCTGG3'
(SEQ ID NO:91) AAAAAGACCAT3' TAAATTCTGCCAAT (SEQ ID NO:94) (SEQ ID
NO:92) C3' (SEQ ID NO:93) gep286 5'CGGAACGGCTATG 5'GGTGCAAGTCAGCA
5'TTTAACGGGAGG 5'TCGCCCTACTTT AAAAAAA3' CGAACACACGACGAAA
AAATAATTCTGGTA TCGTATGC3' (SEQ ID NO:95) GGCAACCATAC3'
TGGGGGTTGATGAA (SEQ ID NO:98) (SEQ ID NO:96) G3' (SEQ ID NO:97)
gep76 5'AGCGATATTAGTG 5'GGTGCAAGTCAGCA 5'TTTAACGGGAGG
5'GGGATTGTCACG CGGGAGA3' CGAACACCAGCAATTT AAATAATTCCTGGG GTAAAACC3'
(SEQ ID NO:99) TGTCATCAGTCG3' GTAATGGAGCACAG (SEQ ID NO:102) (SEQ
ID NO:100) T3' (SEQ ID NO:101)
[0085] PCR amplification of the left and right flanking DNA
molecules was carried out, separately, in 50 .mu.l reaction
mixtures containing: 1 .mu.l Streptococcus pneumoniae (RX1) DNA
(0.25 .mu.g), 2.5 .mu.l Primer 1 or Primer 4 (10 pmol/.mu.l), 2.5
.mu.l Primer 2 or Primer 3 (20 pmol/.mu.l), 1.2 .mu.l a mixture
dNTPS (10 mM each), 37 .mu.l H.sub.2O, 0.7 .mu.l Taq polymerase (5
U/.mu.l), and 5 .mu.l 10.times.Taq polymerase buffer (10 mM Tris,
50 mM KCl, 2.5 mM MgCl.sub.2). The left and right flanking DNA
molecules were amplified using the following PCR cycling program:
95.degree. C. for 2 minutes; 72.degree. C. for 1 minute; 94.degree.
C. for 30 seconds; 49.degree. C. for 30 seconds; 72.degree. C. for
1 minute; repeating the 94.degree. C., 49.degree. C., and
72.degree. C. incubations 30 times; 72.degree. C. for 10 minutes
and then stopping the reactions. A 15 .mu.l aliquot of each
reaction mixture then was electrophoresed through a 1.2% low
melting point agarose gel in TAE buffer and then stained with
ethidium bromide. Fragments containing the amplified left and right
flanking DNA molecules were excised from the gel and purified using
the QIAQUICK.TM. gel extraction kit (Qiagen, Inc.) Other art-known
methods for amplifying and isolating DNA can be substituted. The
flanking left and right DNA fragments were eluted into 30 .mu.l TE
buffer at pH 8.0.
[0086] The amplified erm gene and left and right flanking DNA
molecules were then fused together to produce the fusion product,
as shown in FIG. 25. The fusion PCR reaction was carried out in a
volume of 50 .mu.l containing: 2 .mu.l of each of the left and
right flanking DNA molecules and the erm gene PCR product; 5 .mu.l
of 10.times. buffer; 2.5 .mu.l of Primer 1 (10 pmol/.mu.l); 2.5
.mu.l of Primer 4 (10 pmol/.mu.l), 1.2 .mu.l dNTP mix (10 mM each)
32 .mu.l H.sub.2O, and 0.7 .mu.l Taq polymerase. The PCR reaction
was carried out using the following cycling program: 95.degree. C.
for 2 minutes; 72.degree. C. for 1 minute; 94.degree. C. for 30
seconds, 48.degree. C. for 30 seconds; 72.degree. C. for 3 minutes;
repeat the 94.degree. C., 48.degree. C. and 72.degree. C.
incubations 25 times; 72.degree. C. for 10 minutes. After the
reaction was stopped, a 12 .mu.l aliquot of the reaction mixture
was electrophoresed through an agarose gel to confirm the presence
of a final product of approximately 2 kb.
[0087] A 5 .mu.l aliquot of the fusion product was used to
transform S. pneumoniae grown on a medium containing erythromycin
in accordance with standard techniques. As shown in FIG. 26, the
fusion product and the S. pneumoniae genome undergo a homologous
recombination event so that the erm gene replaces the chromosomal
copy of the gene of interest, thereby creating a gene knockout.
Disruption of an essential gene results in no growth on a medium
containing erythromycin. Using this gene knockout method, the
gep1493, gep1507, gep1546, gep273, gep286, and gep76 genes were
each identified as being essential for survival.
[0088] Identification of Homologs and Orthologs of GEP
Polypeptides
[0089] Having shown that the various GEP genes are essential or
located within operons that are essential for survival of
Streptococcus, it can be expected that homologs and orthologs of
the polypeptides encoded by these genes, when present in other
organisms, for example B. subtilis, are essential or located within
operons that are essential for survival of that organism as well,
and therefore are useful targets for identifying antibacterial
agents. Using the sequences of the GEP polypeptides identified in
Streptococcus, homologs and orthologs of these polypeptides can be
identified in other organisms. For example, the coding sequences of
the GEP nucleic acids can be used to search the GenBank database of
nucleotide sequences to identify homologs or orthologs that are
expressed from essential operons in other organisms. Sequence
comparisons can be performed using the Basic Local Alignment Search
Tool (BLAST) (Altschul et al., J. Mol. Biol., 215:403-410 1990).
The percent sequence identity shared by the GEP polypeptides and
their homologs or orthologs can be determined using the GAP program
from the Genetics Computer Group (GCG) Wisconsin Sequence Analysis
Package (Wisconsin Package Version 9.0, GCG; Madison, Wis.). The
following parameters are suitable: gap creation penalty, 12
(protein) 50 (DNA); gap extension penalty, 4 (protein) 3 (DNA).
Typically, the GEP polypeptides and their homologs share at least
25% (e.g., at least 40%) sequence identity. Typically, the DNA
sequences encoding GEP polypeptides and their homologs share at
least 35% (e.g., at least 45%) sequence identity. To confirm that
the homologs or orthologs of the GEP polypeptides are expressed
from operons that are essential for survival of bacteria, the
operon encoding each of the homologs or orthologs can be,
separately, deleted from the genome of the host organism.
[0090] Identification of Essential Operons in Additional
Streptococcus Strains
[0091] Now that the various GEP genes have been identified as being
located within operons that are essential for survival, these
genes, or fragments thereof, can be used to detect homologous or
orthologous genes in other organisms. In particular, these genes
can be used to analyze various pathogenic and non-pathogenic
strains of bacteria. Fragments of a nucleic acid (DNA or RNA)
encoding a GEP polypeptide or homolog or ortholog (or sequences
complementary thereto) can be used as probes in conventional
nucleic acid hybridization assays of pathogenic bacteria. For
example, nucleic acid probes (which typically are 8-30, or usually
15-20, nucleotides in length) can be used to detect GEP genes or
homologs or orthologs thereof in art-known molecular biology
methods, such as Southern blotting, Northern blotting, dot or slot
blotting, PCR amplification methods, colony hybridization methods,
and the like. Typically, an oligonucleotide probe based on the
nucleic acid sequences described herein, or fragments thereof, is
labeled and used to screen a genomic library constructed from mRNA
obtained from a Streptococcus or bacterial strain of interest. A
suitable method of labeling involves using polynucleotide kinase to
add .sup.32P-labeled ATP to the oligonucleotide used as the probe.
This method is well known in the art, as are several other suitable
methods (e.g., biotinylation and enzyme labeling).
[0092] Hybridization of the oligonucleotide probe to the library,
or other nucleic acid sample, typically is performed under
stringent to highly stringent conditions. Nucleic acid duplex or
hybrid stability is expressed as the melting temperature or
T.sub.m, which is the temperature at which a probe dissociates from
a target DNA. This melting temperature is used to define the
required stringency conditions. If sequences are to be identified
that are related and substantially identical to the probe, rather
than identical, then it is useful to first establish the lowest
temperature at which only homologous hybridization occurs with a
particular concentration of salt (e.g., SSC or SSPE). Then,
assuming that 1% mismatching results in a 1.degree. C. decrease in
the T.sub.m, the temperature of the final wash in the hybridization
reaction is reduced accordingly (for example, if sequences having
.gtoreq.95% identity with the probe are sought, the final wash
temperature is decreased by 5.degree. C.). In practice, the change
in T.sub.m can be between 0.5.degree. and 1.5.degree. C. per 1%
mismatch.
[0093] As used herein, highly stringent conditions refer to
hybridization at 68.degree. C. in 5.times.SSC/5.times.Denhardt's
solution/1.0% SDS, and washing in 0.2.times.SSC/0.1% SDS at
42.degree. C. Stringent conditions refer to washing in 3.times.SSC
at 42.degree. C. The parameters of salt concentration and
temperature can be varied to achieve the optimal level of identity
between the probe and the target nucleic acid. Additional guidance
regarding such conditions is readily available in the art, for
example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory
Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.),
1995, Current Protocols in Molecular Biology, (John Wiley &
Sons, N.Y.) at Unit 2.10.
[0094] In one approach, libraries constructed from pathogenic or
non-pathogenic Streptococcus or bacterial strains can be screened.
For example, such strains can be screened for expression of GEP
genes by Northern blot analysis. Upon detection of transcripts of
the GEP genes or homologs or orthologs thereof, libraries can be
constructed from RNA isolated from the appropriate strain,
utilizing standard techniques well known to those of skill in the
art. Alternatively, a total genomic DNA library can be screened
using an GEP gene probe (or a probe directed to a homolog or
ortholog thereof).
[0095] New gene sequences can be isolated, for example, by
performing PCR using two degenerate oligonucleotide primer pools
designed on the basis of nucleotide sequences within the GEP genes,
or their homologs or orthologs, as depicted herein. The template
for the reaction can be DNA obtained from strains known or
suspected to express a GEP allele or an allele of a homolog or
ortholog thereof. The PCR product can be subcloned and sequenced to
ensure that the amplified sequences represent the sequences of a
new GEP nucleic acid sequence, or a sequence of a homolog or
ortholog thereof.
[0096] Synthesis of the various GEP polypeptides or their homologs
or orthologs (or an antigenic fragment thereof) for use as
antigens, or for other purposes, can readily be accomplished using
any of the various art-known techniques. For example, a polypeptide
or homolog or ortholog thereof, or an antigenic fragment(s), can be
synthesized chemically in vitro, or enzymatically (e.g., by in
vitro transcription and translation). Alternatively, the gene can
be expressed in, and the polypeptide purified from, a cell (e.g., a
cultured cell) by using any of the numerous, available gene
expression systems. For example, the polypeptide antigen can be
produced in a prokaryotic host (e.g., E. coli or B. subtilis) or in
eukaryotic cells, such as yeast cells or insect cells (e.g., by
using a baculovirus-based expression vector).
[0097] Proteins and polypeptides can also be produced in plant
cells, if desired. For plant cells viral expression vectors (e.g.,
cauliflower mosaic virus and tobacco mosaic virus) and plasmid
expression vectors (e.g., Ti plasmid) are suitable. Such cells are
available from a wide range of sources (e.g., the American Type
Culture Collection, Rockland, Md.; also, see, e.g., Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, New
York, 1994). The optimal methods of transformation or transfection
and the choice of expression vehicle will depend on the host system
selected. Transformation and transfection methods are described,
e.g., in Ausubel et al., supra; expression vehicles may be chosen
from those provided, e.g., in Cloning Vectors: A Laboratory Manual
(P.H. Pouwels et al., 1985, Supp. 1987). The host cells harboring
the expression vehicle can be cultured in conventional nutrient
media, adapted as needed for activation of a chosen gene,
repression of a chosen gene, selection of transformants, or
amplification of a chosen gene.
[0098] If desired, GEP polypeptides or their homologs or orthologs
can be produced as fusion proteins. For example, the expression
vector pUR278 (Ruther et al., EMBO J., 2:1791, 1983) can be used to
create lacZ fusion proteins. The art-known pGEX vectors can be used
to express foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can be easily purified from lysed cells by adsorption to
glutathione-agarose beads followed by elution in the presence of
free glutathione. The pGEX vectors are designed to include thrombin
or factor Xa protease cleavage sites so that the cloned target gene
product can be released from the GST moiety.
[0099] In an exemplary insect cell expression system, a baculovirus
such as Autographa californica nuclear polyhedrosis virus (AcNPV),
which grows in Spodoptera frugiperda cells, can be used as a vector
to express foreign genes. A coding sequence encoding a GEP
polypeptide or homolog or ortholog can be cloned into a
non-essential region (for example the polyhedrin gene) of the viral
genome and placed under control of a promoter, e.g., the polyhedrin
promoter or an exogenous promoter. Successful insertion of a gene
encoding a GEP polypeptide or homolog or ortholog can result in
inactivation of the polyhedrin gene and production of non-occluded
recombinant virus (i.e., virus lacking the proteinaceous coat
encoded by the polyhedrin gene). These recombinant viruses are then
used to infect insect cells (e.g., Spodoptera frugiperda cells) in
which the inserted gene is expressed (see, e.g., Smith et al., J.
Virol., 46:584, 1983; Smith, U.S. Pat. No. 4,215,051).
[0100] In mammalian host cells, a number of viral-based expression
systems can be utilized. When an adenovirus is used as an
expression vector, the nucleic acid sequence encoding the GEP
polypeptide or homolog or ortholog can be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter
and tripartite leader sequence. This chimeric gene can then be
inserted into the adenovirus genome by in vitro or in vivo
recombination. Insertion into a non-essential region of the viral
genome (e.g., region E1 or E3) will result in a recombinant virus
that is viable and capable of expressing a essential gene product
in infected hosts (see, e.g., Logan, Proc. Natl. Acad. Sci. USA,
81:3655, 1984).
[0101] Specific initiation signals may be required for efficient
translation of inserted nucleic acid sequences. These signals
include the ATG initiation codon and adjacent sequences. In
general, exogenous translational control signals, including,
perhaps, the ATG initiation codon, should be provided. Furthermore,
the initiation codon must be in phase with the reading frame of the
desired coding sequence to ensure translation of the entire
sequence. These exogenous translational control signals and
initiation codons can be of a variety of origins, both natural and
synthetic. The efficiency of expression may be enhanced by the
inclusion of appropriate transcription enhancer elements, or
transcription terminators (Bittner et al., Methods in Enzymol.,
153:516, 1987).
[0102] The GEP polypeptides and homologs and orthologs can be
expressed individually or as fusions with a heterologous
polypeptide, such as a signal sequence or other polypeptide having
a specific cleavage site at the N-and/or C-terminus of the protein
or polypeptide. The heterologous signal sequence selected should be
one that is recognized and processed, i.e., cleaved by a signal
peptidase, by the host cell in which the fusion protein is
expressed.
[0103] A host cell can be chosen that modulates the expression of
the inserted sequences, or modifies and processes the gene product
in a specific, desired fashion. Such modifications and processing
(e.g., cleavage) of protein products may facilitate optimal
functioning of the protein. Various host cells have characteristic
and specific mechanisms for post-translational processing and
modification of proteins and gene products. Appropriate cell lines
or host systems familiar to those of skill in the art of molecular
biology can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells that possess the cellular machinery for
proper processing of the primary transcript, and phosphorylation of
the gene product can be used. Such mammalian host cells include,
but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3,
WI38, and choroid plexus cell lines.
[0104] If desired, the GEP polypeptide or homolog or ortholog
thereof can be produced by a stably-transfected mammalian cell
line. A number of vectors suitable for stable transection of
mammalian cells are available to the public, see, e.g., Pouwels et
al. (supra); methods for constructing such cell lines are also
publicly known, e.g., in Ausubel et al. (supra). In one example,
DNA encoding the protein is cloned into an expression vector that
includes the dihydrofolate reductase (DHFR) gene. Integration of
the plasmid and, therefore, the GEP polypeptide-encoding gene into
the host cell chromosome is selected for by including 0.01-300
.mu.M methotrexate in the cell culture medium (as described in
Ausubel et al., supra). This dominant selection can be accomplished
in most cell types.
[0105] Recombinant protein expression can be increased by
DHFR-mediated amplification of the transfected gene. Methods for
selecting cell lines bearing gene amplifications are described in
Ausubel et al. (supra); such methods generally involve extended
culture in medium containing gradually increasing levels of
methotrexate. DHFR-containing expression vectors commonly used for
this purpose include pCVSEII-DHFR and pAdD26SV(A) (described in
Ausubel et al., supra).
[0106] A number of other selection systems can be used, including
but not limited to, herpes simplex virus thymidine kinase genes,
hypoxanthine-guanine phosphoribosyl-transferase genes, and adenine
phosphoribosyltransferase genes, which can be employed in tk,
hgprt, or aprt cells, respectively. In addition, gpt, which confers
resistance to mycophenolic acid (Mulligan et al., Proc. Natl. Acad.
Sci. USA, 78:2072, 1981); neo, which confers resistance to the
aminoglycoside G-418 (Colberre-Garapin et al., J. Mol. Biol.,
150:1, 1981); and hygro, which confers resistance to hygromycin
(Santerre et al., Gene, 30:147, 1981), can be used.
[0107] Alternatively, any fusion protein can be readily purified by
utilizing an antibody or other molecule that specifically binds to
the fusion protein being expressed. For example, a system described
in Janknecht et al., Proc. Natl. Acad. Sci. USA, 88:8972 (1981),
allows for the ready purification of non-denatured fusion proteins
expressed in human cell lines. In this system, the gene of interest
is subcloned into a vaccinia recombination plasmid such that the
gene's open reading frame is translationally fused to an
amino-terminal tag consisting of six histidine residues. Extracts
from cells infected with recombinant vaccinia virus are loaded onto
Ni.sup.2+ nitriloacetic acid-agarose columns, and histidine-tagged
proteins are selectively eluted with imidazole-containing
buffers.
[0108] Alternatively, a GEP polypeptide or homolog or ortholog, or
a portion thereof, can be fused to an immunoglobulin Fc domain.
Such a fusion protein can be readily purified using a protein A
column, for example. Moreover, such fusion proteins permit the
production of a chimeric form of a GEP polypeptide or homolog or
ortholog having increased stability in vivo.
[0109] Once the recombinant GEP polypeptide (or homolog or
ortholog) is expressed, it can be isolated (i.e., purified).
Secreted forms of the polypeptides can be isolated from cell
culture media, while non-secreted forms must be isolated from the
host cells. Polypeptides can be isolated by affinity
chromatography. For example, an anti-gep103 antibody (e.g.,
produced as described herein) can be attached to a column and used
to isolate the protein. Lysis and fractionation of cells harboring
the protein prior to affinity chromatography can be performed by
standard methods (see, e.g., Ausubel et al., supra). Alternatively,
a fusion protein can be constructed and used to isolate a GEP
polypeptide (e.g., a gep103-maltose binding fusion protein, a
gep-103-.beta.-galactosidase fusion protein, or a gep103-trpE
fusion protein; see, e.g., Ausubel et al., supra; New England
Biolabs Catalog, Beverly, Mass.). The recombinant protein can, if
desired, be further purified, e.g., by high performance liquid
chromatography using standard techniques (see, e.g., Fisher,
Laboratory Techniques In Biochemistry And Molecular Biology, eds.,
Work and Burdon, Elsevier, 1980).
[0110] Given the amino acid sequences described herein,
polypeptides useful in practicing the invention, particularly
fragments of GEP polypeptides can be produced by standard chemical
synthesis (e.g., by the methods described in Solid Phase Peptide
Synthesis, 2nd ed., The Pierce Chemical Co., Rockford, Ill., 1984)
and used as antigens, for example.
[0111] Antibodies
[0112] The GEP polypeptides (or antigenic fragments or analogs of
such polypeptides) can be used to raise antibodies useful in the
invention, and such polypeptides can be produced by recombinant or
peptide synthetic techniques (see, e.g., Solid Phase Peptide
Synthesis, supra; Ausubel et al., supra). Likewise, antibodies can
be raised against the GEP homologs and orthologs. In general, the
polypeptides can be coupled to a carrier protein, such as KLH, as
described in Ausubel et al., supra, mixed with an adjuvant, and
injected into a host mammal. Antibodies can be purified, for
example, by affinity chromatography methods in which the
polypeptide antigen is immobilized on a resin.
[0113] In particular, various host animals can be immunized by
injection of a polypeptide of interest. Examples of suitable host
animals include rabbits, mice, guinea pigs, and rats. Various
adjuvants can be used to increase the immunological response,
depending on the host species, including but not limited to
Freund's (complete and incomplete adjuvant), adjuvant mineral gels
such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, dinitrophenol, BCG (bacille
Calmette-Guerin) and Corynebacterium parvum. Polyclonal antibodies
are heterogeneous populations of antibody molecules derived from
the sera of the immunized animals.
[0114] Antibodies useful in the invention include monoclonal
antibodies, polyclonal antibodies, humanized or chimeric
antibodies, single chain antibodies, Fab fragments, F(ab').sub.2
fragments, and molecules produced using a Fab expression
library.
[0115] Monoclonal antibodies (mAbs), which are homogeneous
populations of antibodies to a particular antigen, can be prepared
using the GEP polypeptides or homologs or orthologs thereof and
standard hybridoma technology (see, e.g., Kohler et al., Nature,
256:495, 1975; Kohler et al., Eur. J. Immunol., 6:511, 1976; Kohler
et al., Eur. J. Immunol., 6:292, 1976; Hammerling et al., In
Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981;
Ausubel et al., supra) .
[0116] In particular, monoclonal antibodies can be obtained by any
technique that provides for the production of antibody molecules by
continuous cell lines in culture, such as those described in Kohler
et al., Nature, 256:495, 1975, and U.S. Pat. No. 4,376,110; the
human B-cell hybridoma technique (Kosbor et al., Immunology Today,
4:72, 1983; Cole et al., Proc. Natl. Acad. Sci. USA, 80:2026,
1983); and the EBV-hybridoma technique (Cole et al., Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96,
1983). Such antibodies can be of any immunoglobulin class including
IgG, IgM, IgE, IgA, IgD, and any subclass thereof. The hybridomas
producing the mAbs of this invention can be cultivated in vitro or
in vivo.
[0117] Once produced, polyclonal or monoclonal antibodies are
tested for specific recognition of a GEP polypeptide or homolog or
ortholog thereof in an immunoassay, such as a Western blot or
immunoprecipitation analysis using standard techniques, e.g., as
described in Ausubel et al., supra. Antibodies that specifically
bind to the GEP polypeptides, or conservative variants and homologs
or orthologs thereof, are useful in the invention. For example,
such antibodies can be used in an immunoassay to detect a GEP
polypeptide in pathogenic or non-pathogenic strains of
bacteria.
[0118] Preferably, antibodies of the invention are produced using
fragments of the GEP polypeptides that appear likely to be
antigenic, by criteria such as high frequency of charged residues.
In one specific example, such fragments are generated by standard
techniques of PCR, and are then cloned into the pGEX expression
vector (Ausubel et al., supra). Fusion proteins are expressed in E.
coli and purified using a glutathione agarose affinity matrix as
described in Ausubel, et al., supra.
[0119] If desired, several (e.g., two or three) fusions can be
generated for each protein, and each fusion can be injected into at
least two rabbits. Antisera can be raised by injections in a
series, typically including at least three booster injections.
Typically, the antisera is checked for its ability to
immunoprecipitate a recombinant GEP polypeptide or homolog or
ortholog, or unrelated control proteins, such as glucocorticoid
receptor, chloramphenicol acetyltransferase, or luciferase.
[0120] Techniques developed for the production of "chimeric
antibodies" (Morrison et al., Proc. Natl. Acad. Sci., 81:6851,
1984; Neuberger et al., Nature, 312:604, 1984; Takeda et al.,
Nature, 314:452, 1984) can be used to splice the genes from a mouse
antibody molecule of appropriate antigen specificity together with
genes from a human antibody molecule of appropriate biological
activity. A chimeric antibody is a molecule in which different
portions are derived from different animal species, such as those
having a variable region derived from a murine mAb and a human
immunoglobulin constant region.
[0121] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; and U.S. Pat.
Nos. 4,946,778 and 4,704,692) can be adapted to produce single
chain antibodies against a GEP polypeptide or homolog or ortholog.
Single chain antibodies are formed by linking the heavy and light
chain fragments of the Fv region via an amino acid bridge,
resulting in a single chain polypeptide.
[0122] Antibody fragments that recognize and bind to specific
epitopes can be generated by known techniques. For example, such
fragments can include but are not limited to F(ab').sub.2
fragments, which can be produced by pepsin digestion of the
antibody molecule, and Fab fragments, which can be generated by
reducing the disulfide bridges of F(ab').sub.2 fragments.
Alternatively, Fab expression libraries can be constructed (Huse et
al., Science, 246:1275, 1989) to allow rapid and easy
identification of monoclonal Fab fragments with the desired
specificity.
[0123] Polyclonal and monoclonal antibodies that specifically bind
to GEP polypeptides or homologs or orthologs can be used, for
example, to detect expression of a GEP gene or homolog or ortholog
in another strain of bacteria. For example, a GEP polypeptide can
be readily detected in conventional immunoassays of bacteria cells
or extracts. Examples of suitable assays include, without
limitation, Western blotting, ELISAs, radioimmune assays, and the
like.
[0124] Assay for Antibacterial Agents
[0125] The invention provides a method for identifying an
antibacterial agent(s). Although the inventors are not bound by any
particular theory as to the biological mechanism involved, the new
antibacterial agents are thought to inhibit specifically (1) the
function of a polypeptide(s) encoded by a nucleic acid located
within an operon containing a GEP gene, or (2) expression of the a
gene located within an operon containing a GEP gene, or homologs or
orthologs thereof. Screening for antibacterial agents can be
rapidly accomplished by identifying those compounds (e.g.,
polypeptides or small molecules) that specifically bind to a
polypeptide encoded by a nucleic acid located within an operon
containing a GEP gene. A homolog or ortholog of a GEP polypeptide
can be substituted for the GEP polypeptide in the methods
summarized herein. Specific binding of a test compound to a
polypeptide can be detected, for example, in vitro by reversibly or
irreversibly immobilizing the test compound(s) on a substrate,
e.g., the surface of a well of a 96-well polystyrene microtitre
plate. Methods for immobilizing polypeptides and other small
molecules are well known in the art. For example, the microtitre
plates can be coated with a polypeptide encoded by a nucleic acid
located within an operon containing a GEP gene (e.g., a GEP
polypeptide or a combination of GEP polypeptides and/or homologs
and/or orthologs) by adding the polypeptide(s) in a solution
(typically, at a concentration of 0.05 to 1 mg/ml in a volume of
1-100 .mu.l) to each well, and incubating the plates at room
temperature to 37.degree. C. for 0.1 to 36 hours. Polypeptides that
are not bound to the plate can be removed by shaking the excess
solution from the plate, and then washing the plate (once or
repeatedly) with water or a buffer. Typically, the polypeptide,
homolog, or ortholog is contained in water or a buffer. The plate
is then washed with a buffer that lacks the bound polypeptide. To
block the free protein-binding sites on the plates, the plates are
blocked with a protein that is unrelated to the bound polypeptide.
For example, 300 .mu.l of bovine serum albumin (BSA) at a
concentration of 2 mg/ml in Tris-HCl is suitable. Suitable
substrates include those substrates that contain a defined
cross-linking chemistry (e.g., plastic substrates, such as
polystyrene, styrene, or polypropylene substrates from Corning
Costar Corp. (Cambridge, Mass.), for example). If desired, a beaded
particle, e.g., beaded agarose or beaded sepharose, can be used as
the substrate.
[0126] Binding of the test compound to the new polypeptides (or
homologs or orthologs thereof) can be detected by any of a variety
of art-known methods. For example, an antibody that specifically
binds to a GEP polypeptide can be used in an immunoassay. If
desired, the antibody can be labeled (e.g., fluorescently or with a
radioisotope) and detected directly (see, e.g., West and McMahon,
J. Cell Biol. 74:264, 1977). Alternatively, a second antibody can
be used for detection (e.g., a labeled antibody that binds to the
Fc portion of an anti-GEP103 antibody). In an alternative detection
method, the GEP polypeptide is labeled, and the label is detected
(e.g., by labeling a GEP polypeptide with a radioisotope,
fluorophore, chromophore, or the like). In still another method,
the GEP polypeptide is produced as a fusion protein with a protein
that can be detected optically, e.g., green fluorescent protein
(which can be detected under UV light). In an alternative method,
the polypeptide (e.g., gep103) can be produced as a fusion protein
with an enzyme having a detectable enzymatic activity, such as
horse radish peroxidase, alkaline phosphatase,
.beta.-galactosidase, or glucose oxidase. Genes encoding all of
these enzymes have been cloned and are readily available for use by
those of skill in the art. If desired, the fusion protein can
include an antigen, and such an antigen can be detected and
measured with a polyclonal or monoclonal antibody using
conventional methods. Suitable antigens include enzymes (e.g.,
horse radish peroxidase, alkaline phosphatase, and
.beta.-galactosidase) and non-enzymatic polypeptides (e.g., serum
proteins, such as BSA and globulins, and milk proteins, such as
caseins).
[0127] In various in vivo methods for identifying polypeptides that
bind to GEP polypeptides, the conventional two-hybrid assays of
protein/protein interactions can be used (see e.g., Chien et al.,
Proc. Natl. Acad. Sci. USA, 88:9578, 1991; Fields et al., U.S. Pat.
No. 5,283,173; Fields and Song, Nature, 340:245, 1989; Le Douarin
et al., Nucleic Acids Research, 23:876, 1995; Vidal et al., Proc.
Natl. Acad. Sci. USA, 93:10315-10320, 1996; and White, Proc. Natl.
Acad. Sci. USA, 93:10001-10003, 1996). Kits for practicing various
two-hybrid methods are commercially available (e.g., from Clontech;
Palo Alto, Calif.).
[0128] Generally, the two-hybrid methods involve in vivo
reconstitution of two separable domains of a transcription factor.
The DNA binding domain (DB) of the transcription factor is required
for recognition of a chosen promoter. The activation domain (AD) is
required for contacting other components of the host cell's
transcriptional machinery. The transcription factor is
reconstituted through the use of hybrid proteins. One hybrid is
composed of the AD and a first protein of interest. The second
hybrid is composed of the DB and a second protein of interest.
[0129] Useful reporter genes are those that are operably linked to
a promoter which is specifically recognized by the DB. Typically,
the two-hybrid system employs the yeast Saccharomyces cerevisiae
and reporter genes, the expression of which can be selected under
appropriate conditions. Other eukaryotic cells, including mammalian
and insect cells, can be used, if desired. The two-hybrid system
provides a convenient method for cloning a gene encoding a
polypeptide (i.e., a candidate antibacterial agent) that binds to a
second, preselected polypeptide (e.g., gep103). Typically, though
not necessarily, a DNA library is constructed such that randomly
generated sequences are fused to the AD, and the protein of
interest (e.g., gep103) is fused to the DB.
[0130] In such two-hybrid methods, two fusion proteins are
produced. One fusion protein contains the GEP polypeptide (or
homolog or ortholog thereof) fused to either a transactivator
domain or DNA binding domain of a transcription factor (e.g., of
Gal4). The other fusion protein contains a test polypeptide fused
to either the DNA binding domain or a transactivator domain of a
transcription factor. Once brought together in a single cell (e.g.,
a yeast cell or mammalian cell), one of the fusion proteins
contains the transactivator domain and the other fusion protein
contains the DNA binding domain. Therefore, binding of the GEP
polypeptide to the test polypeptide (i.e., candidate antibacterial
agent) reconstitutes the transcription factor. Reconstitution of
the transcription factor can be detected by detecting expression of
a gene (i.e., a reporter gene) that is operably linked to a DNA
sequence that is bound by the DNA binding domain of the
transcription factor.
[0131] The methods described above can be used for high throughput
screening of numerous test compounds to identify candidate
antibacterial (or anti-bacterial) agents. Having identified a test
compound as a candidate antibacterial agent, the candidate
antibacterial agent can be further tested for inhibition of
bacterial growth in vitro or in vivo (e.g., using an animal, e.g.,
rodent, model system) if desired. Using other, art-known variations
of such methods, one can test the ability of a nucleic acid (e.g.,
DNA or RNA) used as the test compound to bind to a polypeptide
encoded by a nucleic acid sequence located within an operon
containing a GEP gene or homolog or ortholog thereof.
[0132] In vitro, further testing can be accomplished by means known
to those in the art such as an enzyme inhibition assay or a
whole-cell bacterial growth inhibition assay. For example, an agar
dilution assay identifies a substance that inhibits bacterial
growth. Microtiter plates are prepared with serial dilutions of the
test compound; adding to the preparation a given amount of growth
substrate; and providing a preparation of Streptococcus cells.
Inhibition of growth is determined, for example, by observing
changes in optical densities of the bacterial cultures.
[0133] Inhibition of bacterial growth is demonstrated, for example,
by comparing (in the presence and absence of a test compound) the
rate of growth or the absolute growth of bacterial cells.
Inhibition includes a reduction of one of the above measurements by
at least 20% (e.g., at least 25%, 30%, 40%, 50%, 75%, 80%, or
90%).
[0134] Rodent (e.g., murine) and rabbit animal models of
streptococcal infections are known to those of skill in the art,
and such animal model systems are accepted for screening
antibacterial agents as an indication of their therapeutic efficacy
in human patients. In a typical in vivo assay, an animal is
infected with a pathogenic Streptococcus strain, e.g., by
inhalation of Streptococcus pneumoniae, and conventional methods
and criteria are used to diagnose the mammal as being afflicted
with streptococcal pneumonia. The candidate antibacterial agent
then is administered to the mammal at a dosage of 1-100 mg/kg of
body weight, and the mammal is monitored for signs of amelioration
of disease. Alternatively, the test compound can be administered to
the mammal prior to infecting the mammal with Streptococcus, and
the ability of the treated mammal to resist infection is measured.
of course, the results obtained in the presence of the test
compound should be compared with results in control animals, which
are not treated with the test compound. Administration of candidate
antibacterial agent to the mammal can be carried out as described
below, for example.
[0135] Pharmaceutical Formulations
[0136] Treatment includes administering a pharmaceutically
effective amount of a composition containing an antibacterial agent
to a subject in need of such treatment, thereby inhibiting
bacterial growth in the subject. Such a composition typically
contains from about 0.1 to 90% by weight (such as 1 to 20% or 1 to
10%) of an antibacterial 10 agent of the invention in a
pharmaceutically acceptable carrier.
[0137] Solid formulations of the compositions for oral
administration may contain suitable carriers or excipients, such as
corn starch, gelatin, lactose, acacia, sucrose, microcrystalline
cellulose, kaolin, mannitol, dicalcium phosphate, calcium
carbonate, sodium chloride, or alginic acid. Disintegrators that
can be used include, without limitation, micro-crystalline
cellulose, corn starch, sodium starch glycolate and alginic acid.
Tablet binders that may be used include acacia, methylcellulose,
sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone),
hydroxypropyl methylcellulose, sucrose, starch, and ethylcellulose.
Lubricants that may be used include magnesium stearates, stearic
acid, silicone fluid, talc, waxes, oils, and colloidal silica.
[0138] Liquid formulations of the compositions for oral
administration prepared in water or other aqueous vehicles may
contain various suspending agents such as methylcellulose,
alginates, tragacanth, pectin, kelgin, carrageenan, acacia,
polyvinylpyrrolidone, and polyvinyl alcohol. The liquid
formulations may also include solutions, emulsions, syrups and
elixirs containing, together with the active compound(s), wetting
agents, sweeteners, and coloring and flavoring agents. Various
liquid and powder formulations can be prepared by conventional
methods for inhalation into the lungs of the mammal to be
treated.
[0139] Injectable formulations of the compositions may contain
various carriers such as vegetable oils, dimethylacetamide,
dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl
myristate, ethanol, polyols (glycerol, propylene glycol, liquid
polyethylene glycol, and the like). For intravenous injections,
water soluble versions of the compounds may be administered by the
drip method, whereby a pharmaceutical formulation containing the
antibacterial agent and a physiologically acceptable excipient is
infused. Physiologically acceptable excipients may include, for
example, 5% dextrose, 0.9% saline, Ringer's solution or other
suitable excipients. Intramuscular preparations, a sterile
formulation of a suitable soluble salt form of the compounds can be
dissolved and administered in a pharmaceutical excipient such as
Water-for-Injection, 0.9% saline, or 5% glucose solution. A
suitable insoluble form of the compound may be prepared and
administered as a suspension in an aqueous base or a
pharmaceutically acceptable oil base, such as an ester of a long
chain fatty acid, (e.g., ethyl oleate).
[0140] A topical semi-solid ointment formulation typically contains
a concentration of the active ingredient from about 1 to 20%, e.g.,
5 to 10% in a carrier such as a pharmaceutical cream base. Various
formulations for topical use include drops, tinctures, lotions,
creams, solutions, and ointments containing the active ingredient
and various supports and vehicles.
[0141] The optimal percentage of the antibacterial agent in each
pharmaceutical formulation varies according to the formulation
itself and the therapeutic effect desired in the specific
pathologies and correlated therapeutic regimens. Appropriate
dosages of the antibacterial agents can readily be determined by
those of ordinary skill in the art of medicine by monitoring the
mammal for signs of disease amelioration or inhibition, and
increasing or decreasing the dosage and/or frequency of treatment
as desired. The optimal amount of the antibacterial compound used
for treatment of conditions caused by or contributed to by
bacterial infection may depend upon the manner of administration,
the age and the body weight of the subject and the condition of the
subject to be treated. Generally, the antibacterial compound is
administered at a dosage of 1 to 100 mg/kg of body weight, and
typically at a dosage of 1 to 10 mg/kg of body weight.
EXAMPLE
[0142] Using the transposon-based mutagenesis methods described
above, the Streptococcus pneumonia genome was mutagenized, and 23
genes were identified as being located within operons that are
essential for survival of Streptococcus pneumonia. These genes are
listed in Table 1, above, and their nucleic acid and amino acid
sequences are represented by SEQ ID NOs: 1-69, as shown in FIGS.
1-23.
[0143] Now that each of these genes is known to be located within
an operon that is essential for survival of Streptococcus, the
polypeptides encoded by nucleic acids located within those operons
can be used to identify antibacterial agents by using the assays
described herein. Other art-known assays to detect interactions of
test compounds with proteins, or to detect inhibition of bacterial
growth also can be used with the nucleic acids located within
operons containing the GEP genes, and gene products and homologs or
orthologs thereof.
Other Embodiments
[0144] The invention also features fragments, variants, analogs,
and derivatives of the GEP polypeptides described above that retain
one or more of the biological activities of the GEP polypeptides,
e.g., as determined in a complementation assay. Also included
within the invention are naturally-occurring and
non-naturally-occurring allelic variants. Compared with the
naturally-occurring GEP gene, sequences depicted in FIGS. 1-23, the
nucleic acid sequence encoding allelic variants may have a
substitution, deletion, or addition of one or more nucleotides. The
preferred allelic variants are functionally equivalent to a GEP
polypeptide, e.g., as determined in a complementation assay.
[0145] It is to be understood that, while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
* * * * *