U.S. patent application number 10/196515 was filed with the patent office on 2003-05-15 for cd4-independent hiv envelope proteins as vaccines and therapeutics.
This patent application is currently assigned to University of Pennsylvania. Invention is credited to Doms, Robert W., Hoffman, Trevor L., Hoxie, James A., LaBranche, Celia C..
Application Number | 20030091594 10/196515 |
Document ID | / |
Family ID | 26981020 |
Filed Date | 2003-05-15 |
United States Patent
Application |
20030091594 |
Kind Code |
A1 |
Hoxie, James A. ; et
al. |
May 15, 2003 |
CD4-independent HIV envelope proteins as vaccines and
therapeutics
Abstract
The invention relates to novel CD4-independent HIV Envelope
proteins and uses therefor.
Inventors: |
Hoxie, James A.; (Berwyn,
PA) ; LaBranche, Celia C.; (Chapel Hill, NC) ;
Doms, Robert W.; (Berwyn, PA) ; Hoffman, Trevor
L.; (Lansdowne, PA) |
Correspondence
Address: |
MORGAN, LEWIS & BOCKIUS LLP
1701 MARKET STREET
PHILADELPHIA
PA
19103-2921
US
|
Assignee: |
University of Pennsylvania
|
Family ID: |
26981020 |
Appl. No.: |
10/196515 |
Filed: |
July 16, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10196515 |
Jul 16, 2002 |
|
|
|
09337387 |
Jun 22, 1999 |
|
|
|
6420545 |
|
|
|
|
09337387 |
Jun 22, 1999 |
|
|
|
09317556 |
May 24, 1999 |
|
|
|
Current U.S.
Class: |
424/208.1 ;
435/235.1; 435/320.1; 435/325 |
Current CPC
Class: |
C07K 14/005 20130101;
C12N 2740/16021 20130101; C12N 7/00 20130101; A61P 31/18 20180101;
C12N 2740/16122 20130101; C12N 2740/15022 20130101 |
Class at
Publication: |
424/208.1 ;
435/235.1; 435/320.1; 435/325 |
International
Class: |
A61K 039/21; C12N
007/00; C12N 007/01; C12N 015/00; C12N 015/09; C12N 015/63; C12N
015/70; C12N 015/74; C12N 005/00; C12N 005/02 |
Goverment Interests
[0002] This invention was supported in part by funds from the U.S.
Government (National Institutes of Health Grant No. AI44308 and
Grant No. AI40880) and the U.S. Government may therefore have
certain rights in the invention.
Claims
What is claimed is:
1. An isolated nucleic acid encoding a CD4-independent human
immunodeficiency virus-1 (HIV-1) env, or a mutant, derivative, or
fragment thereof.
2. The isolated nucleic acid of claim 1, wherein said nucleic acid
shares at least about 98% homology with the nucleic acid having the
nucleotide sequence of SEQ ID NO:4.
3. The isolated nucleic acid of claim 2, wherein said nucleic acid
is selected from the group consisting of an HIV-1/IIIBx env, and an
HIV-1/IIIBx 8x (8x) env.
4. The isolated nucleic acid of claim 3, wherein said nucleic acid
is an HIV-1/IIIBx 8x env.
5. An isolated nucleic acid encoding a CD4-independent HIV env
having the nucleotide sequence of SEQ ID NO:4.
6. An isolated nucleic acid comprising a portion of a HIV-1 env
gene which confers CD4 independence on at least one HIV-1 env
clone.
7. A chimeric nucleic acid comprising a first portion and a second
portion, said first portion encoding at least a portion of an
HIV-1/IIIBx 8x env coding sequence and said second portion encoding
at least a portion of an HIV-1 env coding sequence which is not an
8x env.
8. The chimeric nucleic acid of claim 7, wherein said second
portion is an env coding sequence selected from the group
consisting of an S10 env, an HXB2 env, a BaL env, and an IIIB
env.
9. The chimeric nucleic acid of claim 7, wherein said second
portion comprises a chemokine receptor binding site selected from
the group consisting of a CXCR4 chemokine receptor binding site,
and a CCR5 chemokine receptor binding site.
10. The chimeric nucleic acid of claim 9, wherein said second
portion comprises a V3-loop coding sequence selected from the group
consisting of a V3-loop for a CXCR4 chemokine receptor binding
site, and a V3-loop for a CCR5 chemokine receptor binding site.
11. An isolated HIV-1 gp120 polypeptide comprising a stably exposed
chemokine coreceptor binding site.
12. An isolated polypeptide comprising an HIV-1/IIIBx 8x Env.
13. The isolated polypeptide of claim 12, wherein said polypeptide
shares at least about 98% homology with SEQ ID NO:3.
14. The isolated polypeptide of claim 13 comprising the amino acid
sequence of SEQ ID NO:3.
15. A chimeric HIV-1 Env polypeptide comprising a gp120 polypeptide
wherein said chimeric polypeptide comprises a first portion
comprising an HIV-1/IIIBx 8x gp120, said chimeric polypeptide
further comprising a second portion comprising a gp120 from an
HIV-1 other than HIV-1/IIIBx 8x.
16. A chimeric HIV-1 Env polypeptide wherein said polypeptide is
CD4-independent, and further wherein said polypeptide comprises a
chemokine receptor binding site selected from the group consisting
of a CXCR4 chemokine receptor binding site, and a CCR5 chemokine
receptor binding site.
17. The chimeric polypeptide of claim 16, wherein said second
portion comprises a V3-loop selected from the group consisting of a
HXB V3-loop, an 8x V3-loop, a BaL V3-loop, a YU-2 V3-loop, and an
89.6 V3-loop.
18. A composition comprising a CD4-independent HIV-1 Env comprising
a gp120 polypeptide comprising a stably exposed chemokine receptor
binding site wherein said HIV-1 is more sensitive to antibody
neutralization than an otherwise identical HIV-1 which does not
comprise a stably exposed chemokine receptor binding site.
19. A pharmaceutical composition comprising a CD4-independent HIV-1
Env protein, wherein said HIV-1 Env comprises at least one mutation
causing the chemokine coreceptor binding site to be stably
exposed.
20. The composition of claim 21, wherein said HIV-1 Env is
HIV-1/IIIBx 8x.
21. A vaccine comprising an immunogenic dose of a CD4-independent
HIV-1 Env.
22. The vaccine of claim 21, wherein said HIV-1 Env is selected
from the group consisting of a HIV-1 Env polypeptide, a nucleic
acid encoding HIV-1 Env, and a cell expressing HIV-1 Env.
23. A vector comprising the isolated nucleic acid of claim 1.
24. A vector comprising the isolated nucleic acid of claim 6.
25. A vector comprising the isolated nucleic acid of claim 7.
26. A cell comprising the isolated nucleic acid of claim 1.
27. A cell comprising the isolated nucleic acid of claim 6.
28. A cell comprising the isolated nucleic acid of claim 7.
29. A cell comprising the isolated polypeptide of claim 11.
30. A cell comprising the isolated polypeptide of claim 12.
31. A cell comprising the isolated polypeptide of claim 15.
32. A cell comprising the isolated polypeptide of claim 16.
33. A cell comprising the isolated polypeptide of claim 17.
34. A cell comprising the composition of claim 18.
35. A method of identifying an amino acid residue of an HIV-1 Env
protein which is involved in CD4 independence, said method
comprising obtaining a full-length env coding sequence from an Env
clone which is CD4-independent and replacing at least a portion of
the said env coding sequence with a coding sequence from an Env
clone which is CD4-dependent to form a chimera, wherein when said
chimera is CD4-dependent it is an indication that said portion of
said env coding sequence is involved in CD4-independence, thereby
identifying an amino acid residue involved in CD4-independence.
36. A method of eliciting an immune response to a HIV-1 chemokine
receptor binding site in a mammal, said method comprising
administering an immunogenic dose of a CD4-independent HIV-1 Env
protein to a mammal, wherein said protein comprises a stably
exposed chemokine receptor binding site, thereby eliciting an
immune response to a HIV-1 chemokine receptor binding site in said
mammal.
37. A method of identifying a compound which affects exposure of an
HIV-1 gp120 chemokine receptor binding site, said method comprising
contacting a cell with said compound prior to or contemporaneous
with contacting said cell with a labeled gp120 with or without
pre-incubation of said gp120 with soluble CD4, measuring the amount
of label bound to said cell, and comparing the amount of label
bound to said cell contacted with said compound to the amount of
label bound to an otherwise identical cell not contacted with said
compound, wherein a higher or lower amount of label bound to said
cell contacted with said compound compared with the amount of label
bound to said otherwise identical cell not contacted with said
compound, is an indication that said compound affects exposure of
an HIV-1 gp120 chemokine receptor binding site.
38. A method of identifying a small-molecule which inhibits binding
of an HIV-1 gp120, using its chemokine receptor binding site, to a
chemokine receptor, said method comprising contacting a cell with
said molecule prior to or contemporaneous with contacting said cell
with labeled gp120 with or without pre-incubation of said gp120
with soluble CD4, measuring the amount of label bound to said cell,
and comparing the amount of label bound to said cell contacted with
said molecule with the amount of label bound to an otherwise
identical cell not contacted with said molecule, wherein a lower
amount of label bound to said cell contacted with said molecule
compared with the amount of label bound to said otherwise identical
cell not contacted with said molecule, is an indication that said
molecule inhibits binding of an HIV-1 gp120 using its chemokine
receptor binding site to a chemokine receptor.
39. A method of producing a CD4-independent chimeric HIV-1 Env
clone comprising a variable chemokine receptor binding site, said
method comprising replacing the hypervariable V3-loop of the
CD4-independent Env clone with the V3 loop of another HIV-1,
wherein said V3-loop of another HIV-1 comprises a different
chemokine receptor binding site than that of said CD4-independent
Env clone.
40. The method of claim 39, wherein said CD4-independent clone is
selected from the group consisting of HIV-1/IIIBx, and HIV-1/IIIBx
8x.
41. The method of claim 40, wherein said V3-loop from another HIV-1
is selected from the group consisting of a V3-loop from HIV-1/BaL,
a V3-loop from HIV-1/YU-2, a V3-loop from HIV-1/ADA, and a V3-loop
from HIV-1/89.6.
42. A method of inhibiting HIV-1 gp120 binding, using its chemokine
receptor binding site, to a chemokine receptor, said method
comprising contacting said gp120 with a small-molecule identified
using the method of claim 37, thereby inhibiting HIV-1 gp120
binding, using its chemokine receptor binding site, to a chemokine
receptor.
43. A method of inhibiting HIV-1 infection of a cell, said method
comprising contacting said cell with a small-molecule which
inhibits binding of an HIV-1 gp120 using its chemokine receptor
binding site to a chemokine receptor, wherein said small-molecule
is identified using the method of claim 38, thereby inhibiting
HIV-1 infection of a cell.
44. A composition comprising a CD4-independent HIV-1 Env and at
least one compound used to treat HIV infection in a
pharmaceutically suitable carrier.
45. The composition of claim 44, wherein said HIV-1 Env is selected
from the group consisting of a HIV-1 Env polypeptide, a nucleic
acid encoding HIV-1 Env, and a cell expressing HIV-1 env.
46. The composition of claim 44, wherein said compound used to
treat HIV infection is selected from the group consisting of a
protease inhibitor, a reverse transcriptase nucleoside analog
inhibitor, a reverse transcriptase non-nucleoside analog inhibitor,
an interferon, AZT, interleukin-2, and a cytokine.
47. A method of treating HIV-1 infection in a human, said method
comprising administering an immunogenic dose of a CD4-independent
HIV-1 Env to an HIV-1 infected human, thereby treating HIV-1
infection in said human.
48. The method of claim 47, wherein said HIV-1 Env is selected from
the group consisting of a HIV-1 Env polypeptide, a nucleic acid
encoding HIV-1 Env, and a cell expressing HIV-1 env.
49. The method of claim 48, said method further comprising
administering a compound used to treat HIV infection.
50. The method of claim 49, wherein said compound used to treat HIV
infection is selected from the group consisting of a protease
inhibitor, a reverse transcriptase nucleoside analog inhibitor, a
reverse transcriptase non-nucleoside analog inhibitor, an
interferon, AZT, interleukin-2, and a cytokine.
51. The method of claim 50, wherein said compound is administered
to said human before, during or after administration of said
CD4-independent HIV-1 Env.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 09/317,556 filed May 24, 1999.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to CD4-independent variants of
HIV, their proteins, and uses therefor.
[0004] HIV entry is known to require an interaction of the viral
envelope glycoprotein (Env) with CD4 and cellular chemokine
receptors. HIV Env protein is produced as a precursor (gp160) that
is subsequently cleaved into two parts, gp120 which binds CD4 and
chemokine receptors, and gp41 which is anchored in the viral
membrane and mediates membrane fusion. Differential use of
chemokine receptors by HIV and SIV has largely explained
differences in tropism among different isolates (Berger, 1997, AIDS
11:S3-S16; Hoffman and Doms, 1998, AIDS 12:S17-S26). While a number
of chemokine receptors can be utilized by HIV or SIV (Deng et al.,
1997, Nature 388:296-300; Choe et al., 1996, Cell 85, 1135-1148;
Rucker et al., 1997, J. Virol. 71:8999-9007; Edinger et al., 1997,
Proc. Natl. Acad. Sci. USA 94:14742-14747; Liao et al., 1997, J.
Exp. Med. 185:2015-2023; Farzan et al., 1997, J. Exp. Med.
186:405-411), CCR5 and CXCR4 appear to be the principal coreceptors
for HIV-1 (Zhang et al., 1998, J Virol. 72:9337-9344; Zhang et al.,
1998, J. Virol. 72:9337-9344.). Isolates of HIV that first
establish infection target blood lymphocytes and macrophages using
CCR5 (Alkhatib et al., 1996, Science 272:1955-1958; Deng et al.,
1996, Nature 381:661-666; Dragic et al., 1996, Nature 381:667-673;
Doranz et al., 1996, Cell 85:1149-1158), while viruses that are
generally associated with progression to AIDS and can infect T cell
lines in vitro use CXCR4 (Choe et al., 1996, Cell 85:1135-1148;
Feng et al., 1996, Science 272:872-876; Connor et al., 1997, J.
Exp. Med. 185:621-628).
[0005] Binding of Env to CD4 initiates poorly understood
conformational changes enabling gp120 to bind to a chemokine
receptor and leading to fusion of the viral and cellular membranes
(Jones et al., 1998, J. Biol Chem. 273:404-409; Moore et al., 1994,
J. Virol. 68:469-484; Wyatt, 1992, J. Virol. 66:6997-7004; Wu et
al., 1996, Nature 384:179-183). Immunologic and mutagenesis
approaches have indicated that these changes involve movement of
V1/V2 and V3 hypervariable loops on gp120 (Moore, et al., 1994, J.
Virol. 68:469-484; Wyatt et al., 1992, J. Virol. 66:6997-7004; Wu
et al.,1996, Nature 384:179-183), which play a critical role in the
specificity of chemokine receptor utilization (Choe et al., 1996,
Cell 85:1135-1148; Cocchi et al., 1996, Nature Med 2:1244-1247; Cho
et al., 1998, J. Virol. 72:2509-2515; Speck et al., 1997, J. Virol.
71:7136-7139; Ross et al., 1998, Proc. Natl. Acad. Sci. U.S.A.
95:7682-7686; Hoffman et al., 1998, Proc. Natl. Acad. Sci. U.S.A.
95:11360-11365). The recent crystallographic resolution of a gp120
core structure bound to CD4 has revealed an intervening .beta.
sheet (the "bridging sheet") between the inner and outer domains of
gp120 that may serve as an additional contact site for the
chemokine receptor (Wyatt and Sodroski, 1998, Science
280:1884-1888; Rizzuto et al., 1998, Science 280:1949-1953).
[0006] Although CD4 is generally required for gp120 to associate
with a chemokine receptor, the identification of CD4-independent
isolates of HIV-1, HIV-2, and SIV has demonstrated that functional
interactions with chemokine receptors can occur in the absence of
CD4 interaction (Edinger et al., 1997, Proc. Natl. Acad. Sci. USA
94:14742-14747; Reeves and Schulz, 1996, J. Virol. 71:1453-1465;
Endres et al., 1996, Cell 87:745-756; Dumonceaux et al., 1998, J.
Virol. 72:512-519). The determinants for the CD4-independent
phenotype have been mapped to the viral env gene, but the
underlying mechanisms of this phenotype are unknown. It has been
proposed that mutations in env may increase the exposure and/or the
affinity of the chemokine receptor binding site on gp120, thus
circumventing the need for CD4 (Endres et al., 1996, Cell
87:745-756).
[0007] Biochemical assays have also shown that mutated or
deglycosylated recombinant gp120 can bind directly to chemokine
receptors, suggesting that domains normally activated by CD4 can be
artificially exposed (Hesselgesser et al., 1997, Curr. Biol. 7:
112-121; Martin et al., 1997, Science 278:1470-1473; Bandres et
al., 1998, J. Virol. 72:2500-2504; Misse et al., 1998, J. Virol.
72:7280-7288). A greater understanding of the determinants
responsible for CD4-independence should provide insights into the
Env domains that mediate and modulate interactions of Env with
chemokine receptors and that ultimately govern viral entry.
[0008] To date, the ability of HIV-1 to escape the immune system
has hindered development of efficacious vaccines to this important
human pathogen. Thus, there is a long-felt and unfilled need for
the development of effective vaccines and therapeutic modalities
for HIV-1 infection in humans. The present invention meets those
needs.
BRIEF SUMMARY OF THE INVENTION
[0009] The invention includes an isolated nucleic acid encoding a
CD4-independent human immunodeficiency virus-1 (HIV-1) env, or a
mutant, derivative, or fragment thereof. In one aspect, the
isolated nucleic acid shares at least about 98% homology with the
nucleic acid having the nucleotide sequence of SEQ ID NO:4.
[0010] In another aspect, the nucleic acid is selected from the
group consisting of an HIV-1/IIIBx env, and an HIV-1/IIIBx 8x (8x)
env.
[0011] In yet another aspect, the nucleic acid is an HIV-1/IIIBx 8x
env.
[0012] The invention also includes an isolated nucleic acid
encoding a CD4-independent HIV env having the nucleotide sequence
of SEQ ID NO:4.
[0013] The invention includes an isolated nucleic acid comprising a
portion of a HIV-1 env gene which confers CD4 independence on at
least one HIV-1 env clone.
[0014] The invention further includes a chimeric nucleic acid
comprising a first portion and a second portion, the first portion
encoding at least a portion of an HIV-1/IIIBx 8x env coding
sequence and the second portion encoding at least a portion of an
HIV-1 env coding sequence which is not an 8x env.
[0015] In one aspect, the second portion is an env coding sequence
selected from the group consisting of an S10 env, an HXB2 env, a
BaL env, and an IIIB env.
[0016] In another aspect, the second portion comprises a chemokine
receptor binding site selected from the group consisting of a CXCR4
chemokine receptor binding site, and a CCR5 chemokine receptor
binding site.
[0017] In yet another aspect, the second portion comprises a
V3-loop coding sequence selected from the group consisting of a
V3-loop for a CXCR4 chemokine receptor binding site, and a V3-loop
for a CCR5 chemokine receptor binding site.
[0018] The invention includes an isolated HIV-1 gp120 polypeptide
comprising a stably exposed chemokine coreceptor binding site.
[0019] The invention also includes an isolated polypeptide
comprising an HIV-1/IIIBx 8x Env. In one aspect, the polypeptide
shares at least about 98% homology with SEQ ID NO:3.
[0020] In another aspect, the isolated polypeptide comprises the
amino acid sequence of SEQ ID NO:3.
[0021] The invention includes a chimeric HIV-1 Env polypeptide
comprising a gp120 polypeptide wherein the chimeric polypeptide
comprises a first portion comprising an HIV-1/IIIBx 8x gp120, the
chimeric polypeptide further comprising a second portion comprising
a gp120 from an HIV-1 other than HIV-1/IIIBx 8x.
[0022] The invention further includes a chimeric HIV-1 Env
polypeptide wherein the polypeptide is CD4-independent, and further
wherein the polypeptide comprises a chemokine receptor binding site
selected from the group consisting of a CXCR4 chemokine receptor
binding site, and a CCR5 chemokine receptor binding site.
[0023] In one aspect, the second portion comprises a V3-loop
selected from the group consisting of a HXB V3-loop, an 8x V3-loop,
a BaL V3-loop, a YU-2 V3-loop, and an 89.6 V3-loop.
[0024] The invention includes a composition comprising a
CD4-independent HIV-1 comprising a gp120 polypeptide comprising a
stably exposed chemokine receptor binding site wherein the HIV-1 is
more sensitive to antibody neutralization than an otherwise
identical HIV-1 which does not comprise a stably exposed chemokine
receptor binding site.
[0025] The invention also includes a pharmaceutical composition
comprising a CD4-independent HIV-1 Env protein, wherein the HIV-1
Env comprises at least one mutation causing the chemokine
coreceptor binding site to be stably exposed.
[0026] In one aspect, the HIV-1 Env is HIV-1/IIIBx 8x.
[0027] The invention includes a vaccine comprising an immunogenic
dose of a CD4-independent HIV-1 Env.
[0028] In one aspect, the HIV- 1 Env is selected from the group
consisting of a HIV-1 Env polypeptide, a nucleic acid encoding
HIV-1 Env, and a cell expressing HIV-1 Env.
[0029] The invention includes a vector comprising an isolated
nucleic acid encoding a CD4-independent human HIV-1 env, or a
mutant, derivative, or fragment thereof.
[0030] The invention also includes a vector comprising an isolated
nucleic acid comprising a portion of a HIV-1 env gene which confers
CD4 independence on at least one HIV-1 env clone.
[0031] The invention includes a vector comprising a chimeric
nucleic acid comprising a first portion and a second portion, the
first portion encoding at least a portion of an HIV-1/IIIBx 8x env
coding sequence and the second portion encoding at least a portion
of an HIV-1 env coding sequence which is not an 8x env.
[0032] The invention includes a cell comprising an isolated nucleic
acid encoding a CD4-independent human HIV-1 env, or a mutant,
derivative, or fragment thereof.
[0033] The invention also includes a cell comprising an isolated
nucleic acid comprising a portion of a HIV-1 env gene which confers
CD4 independence on at least one HIV-1 env clone.
[0034] The invention further includes a cell comprising a chimeric
nucleic acid comprising a first portion and a second portion, the
first portion encoding at least a portion of an HIV-1/IIIBx 8x env
coding sequence and the second portion encoding at least a portion
of an HIV-1 env coding sequence which is not an 8x env.
[0035] The invention includes a cell comprising an isolated HIV-1
gp120 polypeptide comprising a stably exposed chemokine receptor
binding site.
[0036] The invention also includes a cell comprising an isolated
polypeptide comprising an HIV-1/IIIBx 8x Env.
[0037] The invention includes a cell comprising a chimeric HIV-1
Env polypeptide comprising a gp120 polypeptide wherein the chimeric
polypeptide comprises a first portion comprising an HIV-1/IIIBx 8x
gp120, the chimeric polypeptide further comprising a second portion
comprising a gp120 from an HIV-1 other than HIV-1/IIIBx 8x.
[0038] The invention also includes a cell comprising chimeric HIV-1
Env polypeptide wherein the polypeptide is CD4-independent, and
further wherein the polypeptide comprises a chemokine receptor
binding site selected from the group consisting of a CXCR4
chemokine receptor binding site, and a CCR5 chemokine receptor
binding site.
[0039] In one aspect, the second portion comprises a V3-loop
selected from the group consisting of a HXB V3-loop, an 8x V3-loop,
a BaL V3-loop, a YU-2 V3-loop, and an 89.6 V3-loop.
[0040] The invention includes a cell comprising a composition
comprising a CD4-independent HIV-1 Env comprising a gp120
polypeptide comprising a stably exposed chemokine receptor binding
site wherein the HIV-1 is more sensitive to antibody neutralization
than an otherwise identical HIV-1 which does not comprise a stably
exposed chemokine receptor binding site.
[0041] The invention includes a method of identifying an amino acid
residue of an HIV-1 Env protein which is involved in CD4
independence. The method comprises obtaining a full-length env
coding sequence from an Env clone which is CD4-independent and
replacing at least a portion of the said env coding sequence with a
coding sequence from an Env clone which is CD4-dependent to form a
chimera, wherein when the chimera is CD4-dependent it is an
indication that the portion of the env coding sequence is involved
in CD4-independence, thereby identifying an amino acid residue
involved in CD4-independence.
[0042] The invention also includes a method of eliciting an immune
response to a HIV-1 chemokine receptor binding site in a mammal.
The method comprises administering an immunogenic dose of a
CD4-independent HIV-1 Env protein to a mammal, wherein the protein
comprises a stably exposed chemokine receptor binding site, thereby
eliciting an immune response to a HIV-1 chemokine receptor binding
site in a mammal.
[0043] The invention also includes a method of identifying a
compound which affects exposure of an HIV-1 gp120 chemokine
receptor binding site. The method comprises contacting a cell with
the compound prior to or contemporaneous with contacting the cell
with a labeled gp120 with or without pre-incubation of the gp120
with soluble CD4, measuring the amount of label bound to the cell,
and comparing the amount of label bound to the cells contacted with
the compound to the amount of label bound to otherwise identical
cells not contacted with the compound, wherein a higher or lower
amount of label bound to the cells contacted with the compound
compared with the amount of label bound to the otherwise identical
cells not contacted with the compound, is an indication that the
compound affects exposure of an HIV-1 gp120 chemokine receptor
binding site.
[0044] The invention includes a method of identifying a
small-molecule which inhibits binding of an HIV-1 gp120, using its
chemokine receptor binding site, to a chemokine receptor. The
method comprises contacting a cell with the molecule prior to or
contemporaneous with contacting the cell with labeled gp120 with or
without pre-incubation of said gp120 with soluble CD4, measuring
the amount of label bound to the cell, and comparing the amount of
label bound to the cell contacted with the molecule with the amount
of label bound to an otherwise identical cell not contacted with
the molecule, wherein a lower amount of label bound to the cell
contacted with the molecule compared with the amount of label bound
to the otherwise identical cell not contacted with the molecule, is
an indication that the molecule inhibits binding of an HIV-1 gp120
using its chemokine receptor binding site to a chemokine
receptor.
[0045] The invention includes a method of producing a
CD4-independent chimeric HIV-1 Env clone comprising a variable
chemokine receptor binding site. The method comprises replacing the
hypervariable V3-loop of the CD4-independent Env clone with the V3
loop of another HIV-1, wherein the V3-loop of another HIV-1
comprises a different chemokine receptor binding site than that of
the CD4-independent Env clone.
[0046] In one aspect, the CD4-independent clone is selected from
the group consisting of HIV-1/IIIBx, and HIV-1/IIIBx 8x.
[0047] In another aspect, the V3-loop from another HIV-1 is
selected from the group consisting of a V3-loop from HIV-1/BaL, a
V3-loop from HIV-1/YU-2, a V3-loop from HIV-1/ADA, and a V3-loop
from HIV-1/89.6.
[0048] The invention also includes a method of inhibiting HIV-1
gp120 binding, using its chemokine receptor binding site, to a
chemokine receptor. The method comprises contacting said gp120 with
a small-molecule identified by a method of identifying a compound
which affects exposure of an HIV-1 gp120 chemokine receptor binding
site, the method comprising contacting a cell with the compound
prior to or contemporaneous with contacting the cell with a labeled
gp120 with or without pre-incubation of the gp120 with soluble CD4,
measuring the amount of label bound to the cell, and comparing the
amount of label bound to the cells contacted with the compound to
the amount of label bound to otherwise identical cells not
contacted with the compound, wherein a higher or lower amount of
label bound to the cells contacted with the compound compared with
the amount of label bound to the otherwise identical cells not
contacted with the compound, is an indication that the compound
affects exposure of an HIV-1 gp120 chemokine receptor binding site,
thereby inhibiting HIV-1 gp120 binding, using its chemokine
receptor binding site, to a chemokine receptor.
[0049] The invention includes a method of inhibiting HIV-1
infection of a cell. The method comprises contacting the cell with
a small-molecule which inhibits binding of an HIV-1 gp120 using its
chemokine receptor binding site to a chemokine receptor, wherein
the small-molecule is identified using a method of identifying a
small-molecule which inhibits binding of an HIV-1 gp120, using its
chemokine receptor binding site, to a chemokine receptor, the
method comprising contacting a cell with the molecule prior to or
contemporaneous with contacting the cell with labeled gp120 with or
without pre-incubation of said gp120 with soluble CD4, measuring
the amount of label bound to the cell, and comparing the amount of
label bound to the cell contacted with the molecule with the amount
of label bound to an otherwise identical cell not contacted with
the molecule, wherein a lower amount of label bound to the cell
contacted with the molecule compared with the amount of label bound
to the otherwise identical cell not contacted with the molecule, is
an indication that the molecule inhibits binding of an HIV-1 gp120
using its chemokine receptor binding site to a chemokine receptor,
thereby inhibiting HIV-1 infection of a cell.
[0050] The invention includes a composition comprising a
CD4-independent HIV-1 Env and at least one compound used to treat
HIV infection in a pharmaceutically suitable carrier.
[0051] In one aspect, the HIV-1 Env is selected from the group
consisting of a HIV-1 Env polypeptide, a nucleic acid encoding
HIV-1 Env, and a cell expressing HIV-1 env.
[0052] In another aspect, the compound used to treat HIV infection
is selected from the group consisting of a protease inhibitor, a
reverse transcriptase nucleoside analog inhibitor, a reverse
transcriptase non-nucleoside analog inhibitor, an interferon, AZT,
interleukin-2, and a cytokine.
[0053] The invention includes a method of treating HIV-1 infection
in a human. The method comprises administering an immunogenic dose
of a CD4-independent HIV-1 Env to an HIV-1 infected human, thereby
treating HIV-1 infection in the human.
[0054] In one aspect, the HIV-1 Env is selected from the group
consisting of a HIV-1 Env polypeptide, a nucleic acid encoding
HIV-1 Env, and a cell expressing HIV-1 env.
[0055] In another aspect, the method further comprises
administering a compound used to treat HIV infection.
[0056] In yet another aspect, the compound used to treat HIV
infection is selected from the group consisting of a protease
inhibitor, a reverse transcriptase nucleoside analog inhibitor, a
reverse transcriptase non-nucleoside analog inhibitor, an
interferon, AZT, interleukin-2, and a cytokine.
[0057] In a further aspect, the compound is administered to said
human before, during or after administration of said
CD4-independent HIV-1 Env.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0058] FIG. 1A is a graph, comprising two panels, depicting viral
replication in CD4-positive and CD4-negative T cells by HIV-1/IIIB
or HIV-1/IIIBx. CD4-negative BC7 cells (top panel) and SupT1
CD4-positive cells (bottom panel) were inoculated with equal
amounts of HIV-1/IIIB (open diamonds) or HIV-1/IIIBx (solid
circles) and viral replication was determined by reverse
transcriptase (RT) activity in culture supernatants.
[0059] FIG. 1B is a graph depicting the inhibition of HIV-1/IIIBx
replication by anti-CXCR4 antibody (12G5). CD4-negative BC7 cells
were inoculated with HIV-1/IIIBx in the absence (open bars) or
presence (5 .mu.g/ml, hatched bars, or 20 .mu.g/ml, solid bars) of
anti-CXCR4 antibody 12G5 and reverse transcriptase (RT) activity
was determined at the time points indicated.
[0060] FIG. 1C is an image, comprising two panels, depicting cell
fusion induced by HIV-1/IIIBx on murine cells expressing CXCR4.
HIV-1/IIIBx-infected BC7 cells were co-cultured with murine 3T3
cells which do not express CXCR4 (3T3, left panel) or with 3T3
cells that express human CXCR4 (3T3/CXCR4, right panel) for 24
hours and then the cells were stained for syncytial formation as
described in Endres et al. (1996, Cell 87:745-756).
[0061] FIG. 2 is a graph depicting the fusion activity, expressed
in relative light units (RLUs), of IIIBx env genes. The env genes
indicated were cloned into pSP73, transfected into QT6 cells, and
the genes were evaluated in fusion assays on QT6 cells expressing
CD4 plus CXCR4, CXCR4 alone, or CD4 alone as described in Rucker et
al. (1997, Methods Enzymol. 288:118-133) and as described elsewhere
herein. The results are expressed as the mean +SEM in RLU
normalized to the activity of 8x on CXCR4+/CD4+ cells. Also shown
are the fusion activities for 8x and HXBc2 Envs containing a D368R
mutation that ablates the CD4-binding site as described in
Olshevsky et al. (1990, J. Virol. 64:5701-5705).
[0062] FIG. 3A is a graph demonstrating the fusion activity of the
HIV-1/IIIBx env gene. The 8x env was inserted into pNL4-3 and a
viral stock was generated after transfection of BC7 cells. Equal
amounts of the resulting virus (designated NL43/8x) and HIV-1/IIIB
were inoculated onto SupT1 and BC7 cells and RT levels were
monitored over time.
[0063] FIG. 3B is an image of a Western blot depicting the
evaluation of the size of TM polypeptide of various viruses. Viral
lysates from HIV-1/IIIB infected SupT1 cells (lane 1), IIIBx
infected BC7 cells (lane 2), and NL43/8x-infected BC7 cells were
evaluated by Western blot using anti-TM mouse monoclonal antibody
D12. Consistent with the sequence analyses (FIG. 4), both IIIBx and
NL43/8x exhibited a truncated TM protein.
[0064] FIG. 4 is a diagram depicting the amino acid sequence
analysis of IIIBx env clones. Sequence analysis for IIIBx env
clones 8x (SEQ ID NO:3) and S10 (SEQ ID NO:12) are compared with
that of HXBc2 (SEQ ID NO:11). The shaded regions indicate mutations
that are also found in other clones from HIV-1/IIIB. The predicted
N-linked glycosylation sites are indicated by the shaded gray
circle symbol directly over the amino acid position (where amino
acids are designated using a one-letter code). The positions of the
variable loops, the gp120/gp41 cleavage site and the TM membrane
spanning domain (msd) are also indicated above the amino acid
sequence of HXBc2. The 8x sequence contains a frame shift mutation
at amino acid position 706 which results in a prematurely truncated
cytoplasmic tail compared with HxBc2. S10 contains a deletion of 50
nucleotides which also leads to a frameshift and a prematurely
truncated cytoplasmic tail. In FIG. 4, dashes indicate amino acid
residues that are identical to the corresponding amino acid residue
of HXBc2.
[0065] FIG. 5 is a diagram depicting the evaluation of chimeric Env
proteins in fusion assays. The diagram depicts the env genes from
8x, S10, HXBc2, and chimeras constructed using the indicated
restriction sites shown at the top of the diagram. The mutations
present in 8x are indicated above the top schematic. The chimeras
were cloned into pSP73 and evaluated in cell fusion assays as
described in FIG. 6, infra.
[0066] FIG. 6 is a graph depicting the evaluation of chimeric Env
proteins in fusion assays. The chimeric Env proteins constructed
between HXBc2 and 8x which are shown in FIG. 5, supra, were
evaluated in fusion assays on QT6 target cells expressing CXCR4
alone, CXCR4 and CD4, or CD4 alone. The results are expressed as
luciferase activity relative to that of HXBc2 on CXCR4+g/CD4+ cells
(i.e., relative luciferase units, RLU). The bars indicate the mean
RLU for 3 experiments+SEM.
[0067] FIG. 7 is a graph depicting the mapping of determinants for
a CD4-dependent clone of IIIBx. The fusion activity is shown for
the CD4-dependent S10 clone of IIIBx and for S10/8x chimeras as
indicated in FIG. 5, supra. In addition, the activity is shown for
an S10 Env in which the G431E mutation in the C4 domain was
corrected (S10-E431G ) and for an 8x Env that contained this
mutation (8x-G431E). The results are expressed as the percentage of
8x luciferase activity on target cells that coexpressed CXCR4 and
CD4.
[0068] FIG. 8 is graph depicting the CCR5 tropism of Env proteins
containing V3 loop from the CCR5-tropic Env, HIV-1/BaL. HXB2 (a
molecular clone derived from the IIIB swarm) Env, which is
CD4-dependent, and 8x Env proteins containing the V3 loop from
HIV-1/BaL were constructed and their fusion activity was compared
to the parental HBXc2 or 8x Envs on target cells that expressed
CCR5 or CXCR4.+-.CD4. Fusion activity is expressed as the
percentage of luciferase activity of HxBc2 on target cells that
expressed both CXCR4 and CD4. The bars indicate the mean+SEM.
[0069] FIG. 9A is an image of a space-filling model depicting the
HIV-1/HXB2 gp120 core crystal structure and demonstrating the
location of HIV-1/IIIBx mutations on the gp120 crystal structure.
The core crystal structure is depicted in white in conjunction with
a ribbon diagram of CD4 (Kwong et al., 1998, Nature 393:648-659)
which is shown in the bottom right quadrant of the image. The amino
acid sites at which mutations produced a 50% decrease or increase
in gp120 binding to CCR5 (Rizzuto et al., 1998, Science
280:1949-1953) are shown in red. Without wishing to be bound by
theory, of the 6 mutations in 8x that could be mapped onto the
gp120 core, 3 (shown in light blue) are located immediately
adjacent to this putative chemokine receptor binding site.
[0070] FIG. 9B is an image of a ribbon diagram of the gp120/CD4
complex depicted in a slightly different orientation from that
shown in FIG. 9A, supra, in order to indicate the position of the
G431E mutation, which was sufficient to abrogate CD4-independence
but not CD4-dependent fusion of the 8x clone.
[0071] FIG. 10A is a graph depicting CD4-independent cell-cell
fusion by HXB or 8x Env clones. QT6 effector cells expressing HXB
or 8x Env, as indicated, as well as T7 polymerase were mixed with
QT6 target cells expressing chemokine receptor CXCR4 (cross-hatched
bars), CD4 (open bars), or CXCR4/CD4 (closed bars) and the
luciferase gene under control of the T7 promoter. HIV-1/IIIB is an
uncloned virus from which several molecular clones, such as HXBc2
("HXB") and IIIBx ("8x"), have been derived. The data disclosed
herein compare these two Env molecular clones. Luciferase is
produced in this assay only if Env mediates fusion between effector
and target cells. The results for each Env are expressed in RLUs
and are normalized to the amount of fusion obtained with IIIB Env
effector and CXCR4/CD4 target cells. The results of a typical
experiment are shown.
[0072] FIG. 10B is a graph depicting CD4-independent cell-cell
fusion by HXB-V3BaL or 8x-V3BaL Env clones. Luciferase reporter
viruses bearing HXB-V3BaL or 8x-V3BaL Env proteins, as indicated,
were used to infect 293T cells expressing CCR5 (cross-hatched
bars), CD4 (open bars), or CCR5/CD4 (gray bars) and the luciferase
gene under control of the T7 promoter. The amount of luciferase
activity was determined 3 days after infection. The results for
each Env are expressed in RLU and are normalized to the results
obtained with virions bearing the IIIB-BaL Env and CCR5/CD4 target
cells. The results of a typical experiment are shown.
[0073] FIG. 11 is a graph depicting cell-surface binding of various
gp120s in cells expressing CD4, CXCR4 or CCR5. Radioiodinated
gp120s were incubated with 293T cells transiently transfected with
coreceptor or CD4 plasmids. Soluble CD4 (sCD4) was added to the
binding reaction as indicated. The amount of specific radioactivity
bound to the cells is presented and is normalized for each gp120
indicated such that binding to CD4 represents 100%. Each value
represents the average of .gtoreq.3 independent experiments and the
error bars represent SEMs. The following combinations are shown:
cells expressing empty vector pCDNA3 (open bars), cells expressing
CD4 (solid bars), cells expressing CXCR4 (dark gray bars), cells
expressing CXCR4 with sCD4 added (dark cross-hatch bars), cells
expressing CCR5 (light gray bars), cells expressing CCR5 with sCD4
added (light cross-hatch bars).
[0074] FIG. 12 is an image of a space-filling model of gp120 bound
to CD4 depicting the overlap between the CCR5 coreceptor binding
site and the MAb 17b epitope. The amino acid residues shown by
Rizzuto et al. (1998, Science 280:1949-1953), to decrease CCR5
binding by greater than 50% when mutated while reducing CD4 binding
by less than 50% are shown in red. The contact residues for MAb 17b
are shown in light blue, and the residues involved in both CCR5 and
17b binding are shown in lavender. Three residues that differ
between 8x and IIIB in the vicinity of the coreceptor binding site
as disclosed previously in Example 1 and which may impact
CD4-independence, are shown in green. One of these residues, 423,
is also a contact site for MAb 17b. The stems of the hypervariable
V1/V2 and V3 loops are shown in orange.
[0075] FIG. 13 is a graph depicting the sensorgrams for gp120
binding to the CD4i MAb 17b. MAb 17b was attached to the sensor
surface after which the indicated gp120 molecule (at equal
concentrations), with or without prior incubation with saturating
levels of sCD4 as indicated, were applied to the flow cell. A 300
second association was followed by a wash with running buffer for
an additional 300 seconds during which dissociation was measured.
The kinetic constants derived from linear transformations of the
data are presented in Table 1 elsewhere herein.
[0076] FIG. 14, comprising FIGS. 14A and 14B, lists the nucleotide
sequence of env obtained from clone 8x.
DETAILED DESCRIPTION OF THE INVENTION
[0077] The invention is based on the discovery of a CD4-independent
variant of HIV-1/IIIB, designated HIV-1/IIIBx (IIIBx), and a
functional full-length env clone therefrom termed HIV-1/IIIBx.8
(8x), which allow the study of the mechanism for virus infection of
host cells involving cell receptor proteins. Further, the present
invention relates to the construction of chimeras comprising
portions of a nucleic acid encoding 8x env covalently linked to a
least one nucleic acid encoding a portion of an env from another
HIV-1 virus. Thus, the chimeras are produced by combining portions
of the 8x env coding sequence with portions of the env coding
sequences of other virions leading to the further discovery of
which portion(s) of the 8x HIV-1 env sequence is involved in
CD4-independence.
[0078] CD4-independence is important in that it is an indicator
that the chemokine binding site of gp120 is stably exposed on the
virus envelope and is capable of binding to the cellular chemokine
receptor binding protein without prior binding of the gp120 to CD4.
Typically, the chemokine binding site is hidden until such binding
to CD4 causes a conformational change exposing the site and
resulting in a "triggered" conformation capable of binding to the
chemokine receptor protein on the host cell. Therefore, the
CD4-independent gp120 represents a stable intermediate
configuration which may be used to, inter alia, identify the
protein determinants involved in gp120 binding to a chemokine
receptor protein, produce neutralizing antibodies capable of
recognizing the gp120 chemokine receptor binding site, and to
identify small-molecule inhibitors which can block gp120/chemokine
receptor binding.
[0079] Accordingly, understanding which portions of the Env are
involved in virus binding to cell proteins and thereby mapping the
protein determinants involved in HIV-1 virus binding to host cell
receptors is important in the development of effective antiviral
vaccines to viral protein domains crucial for virus infection. Such
domains are believed to be highly conserved but somehow
"camouflaged" from the immune system such that a protective immune
response is not mounted to such protein domains. Therefore,
identification of these protein domains and the ability to present
them to the immune system such that an immune response is generated
to HIV-1 is an important goal of vaccine development to this
important human pathogen.
[0080] Moreover, production of chimeras has led to the discovery
that the CD4 dependence trait and the choice of chemokine receptor
are functionally dissociable traits. One skilled in the art would
appreciate, based upon the disclosure provided herein, that such
chimeras are useful for mapping the various structural and
functional elements of the nucleic acid encoding env and the Env
protein encoded thereby. Thus, by combining various portions of
different viruses having different properties, e.g., CD4-dependence
or independence and/or different affinities for various chemokine
receptors, the various functional elements of the Env protein may
be examined and identified.
[0081] In one embodiment, replacing the V3-loop portion of 8x
gp120, which binds the CXCR4 chemokine receptor in the absence of
CD4, with the V3-loop of HIV-1/BaL, which is a virus strain that is
CD4-dependent and binds the CCR5 chemokine coreceptor, converts the
chimeric gp120 8x/V3-BaL to a CCR5 binding protein which retains
CD4-independence. This further demonstrates that CD4-independence
exposes the chemokine receptor binding domain such that the
preceding step of CD4-binding by gp120 is no longer required
regardless of the choice of chemokine receptor. These data also
suggest that a chemokine receptor binding site exists on the gp120
that is able to interact with genetically divergent chemokine
receptors (i.e., CXCR4 and CCR5) and this site is functional and
likely exposed on CD4-independent viruses.
[0082] In addition, the present invention teaches that the
CD4-independent gp120 protein exists in a stable partially
"triggered" state, wherein the chemokine coreceptor binding site is
more exposed in the CD4-independent gp120 protein than in the
CD4-dependent conformation of the HIV-1 gp120 molecule. This has
the effect of rendering the CD4-independent virus more susceptible
to neutralization by anti-HIV-1 antibodies from mouse, human and
rabbit. Therefore, the present invention has important implications
for the development of HIV-1 therapeutics since the availability of
a stably exposed, highly conserved chemokine receptor binding site,
which may be otherwise camouflaged to escape immune detection,
should facilitate the development of a humoral and/or cellular
immune response and of small-molecule inhibitors to block this
virus-host protein interaction, thereby preventing HIV-1
infection.
[0083] The present invention includes an isolated nucleic acid
encoding a CD4-independent HIV env coding sequence which is
comprised of two components, a portion encoding gp120 and a portion
encoding gp41. In one embodiment, the full-length env clone of
CD4-independent HIV-1/IIIBx, i.e., 8x, has been isolated (SEQ ID
NO:3 and SEQ ID NO:4; see FIGS. 3 and 14A and 14B, respectively).
Further, the mutations in the 8x clone were identified relative to
the known env coding sequence of HXBc2 (GenBank Accession No.
AF038399) (SEQ ID NO:11) and are disclosed in FIG. 4. However, the
present invention should not be construed to be limited to a
full-length env clone of the CD4-independent HIV-1/IIIBx variant.
Rather, the present invention should be construed to encompass
partial env clones. Indeed, the data disclosed herein demonstrate
that the entire env coding sequence of 8x is not required for
CD4-independence. Thus, at least one mutation present in the 8x env
coding sequence confers CD4-independence to 8x, but not all
mutations in the clone are required for purposes of the present
invention. Further, completely separate mutations of gp120 can also
confer CD4-independence.
[0084] The experiments disclosed in the Examples below disclose the
isolation of a CD4-independent strain of the invention,
HIV-1/IIIBx, which was able to infect both CD4.sup.+ SupT1 cells
and CD4.sup.- BC7 cells, a SupT1 variant, as demonstrated by a
reverse transcriptase activity assay (FIG. 1A). However, the
present invention is not limited solely to infection of BC7 or
SupT1 cells by HIV-1. Rather, the "CD4-independence" of the present
invention encompasses infection by HIV-1 of any cell type which
does not express CD4. Further, as discussed previously herein, a
CD4-independent HIV-1 strain may also infect cells that are
CD4.sup.+ although CD4/gp120 interaction is not required for
infection of these cells by the CD4-independent HIV-1. Moreover, a
CD4-independent HIV-1 strain need not infect every CD4.sup.- cell
type. Rather, the HIV-1 strain need only be able to infect at least
one CD4.sup.- cell type while its otherwise identical parental
strain from which the clone was obtained cannot infect that cell
type.
[0085] Additionally, for purposes of the invention, an HIV-1 strain
variant is considered CD4-independent when it is able to infect at
least about 5% of the susceptible cells in culture or the level of
infection is about two to three-fold compared to background
levels.
[0086] It will be appreciated by one skilled in the art, based upon
the disclosure provided herein, that a CD4-independent isolate of
an HIV-1 strain may be obtained by passaging a CD4-dependent HIV-1
swarm initially grown in CD4.sub.+ cells onto cells which are
CD4.sup.-. As disclosed in the experiments described in Example 1
herein, HIV-1/IIIBx was obtained by passaging virus in CD4.sup.+
SupT1 cells followed by passaging virus on the otherwise identical
but CD4.sup.- BC7 cells. However, the invention should not be
construed to be limited to these particular cell types. Instead,
the invention encompasses a variety of CD4.sup.+ and CD4.sup.-
cells including, but not limited to, 293, Cf2TH, CCC.sup.+L.sup.-,
and QT6 cells as well as stably transfected cells (U87, HeLa, HOS)
that express a recombinant chemokine receptor in the presence or
absence of CD4.
[0087] In other related aspects, the invention includes vectors
which contain such an isolated nucleic acid comprising at least a
portion of the HIV-1 env and which isolated nucleic acid is
preferably capable of directing expression of the protein encoded
by the nucleic acid; and virions, proviruses, and/or cells
containing such vectors.
[0088] As the present experimental examples demonstrate, the
nucleic acid encoding the Env protein may be cloned into various
plasmid vectors. However, the present invention should not be
construed to be limited to these plasmids or to any particular
vector. Instead, the present invention should be construed as
encompassing a wide plethora of vectors which are readily available
and/or well-known in the art. Therefore, although in one
embodiment, the full-length env coding regions were amplified by
PCR and cloned into the plasmid pCDNA3, and the inserts were then
sub-cloned into the 3' hemigenome of pNL4-3, the present invention
should not be construed to be limited to these, or to any other,
specific vectors.
[0089] The isolated nucleic acid of the invention should be
construed to include an RNA or a DNA sequence encoding an Env
protein of the invention, and any modified forms thereof, including
chemical modifications of the DNA or RNA which render the
nucleotide sequence more stable when it is cell free or when it is
associated with a cell. Chemical modifications of nucleotides may
also be used to enhance the efficiency with which a nucleotide
sequence is taken up by a cell or the efficiency with which it is
expressed in a cell. Any and all combinations of modifications of
the nucleotide sequences are contemplated in the present
invention.
[0090] The present invention also includes an isolated polypeptide
comprising the amino acid sequence of HIV-1/IIIBx 8x.
[0091] The present invention also provides for analogs of proteins
or peptides which comprise a gp120 protein as disclosed herein.
Analogs may differ from naturally occurring proteins or peptides by
conservative amino acid sequence differences or by modifications
which do not affect sequence, or by both. For example, conservative
amino acid changes may be made, which although they alter the
primary sequence of the protein or peptide, do not normally alter
its function. Conservative amino acid substitutions typically
include substitutions within the following groups:
[0092] glycine, alanine;
[0093] valine, isoleucine, leucine;
[0094] aspartic acid, glutamic acid;
[0095] asparagine, glutamine;
[0096] serine, threonine;
[0097] lysine, arginine;
[0098] phenylalanine, tyrosine.
[0099] Modifications (which do not normally alter primary sequence)
include in vivo, or in vitro, chemical derivatization of
polypeptides, e.g., acetylation, carboxylation, or biotinylation.
Also included are modifications of glycosylation, e.g., those made
by modifying the glycosylation patterns of a polypeptide during its
synthesis and processing or in further processing steps; e.g., by
exposing the polypeptide to enzymes which affect glycosylation,
e.g., mammalian glycosylating or deglycosylating enzymes. Also
embraced are sequences which have phosphorylated amino acid
residues, e.g., phosphotyrosine, phosphoserine, or
phosphothreonine.
[0100] Also included are polypeptides which have been modified
using ordinary molecular biological techniques so as to improve
their resistance to proteolytic degradation or to optimize
solubility properties or to render them more suitable as a
therapeutic agent. Analogs of such polypeptides include those
containing residues other than naturally occurring L-amino acids,
e.g., D-amino acids or non-naturally occurring synthetic amino
acids. The peptides of the invention are not limited to products of
any of the specific exemplary processes listed herein.
[0101] Further, the invention should be construed to include
naturally occurring variants or recombinantly derived mutants of
HIV-1/IIIBx 8x env sequences, which variants or mutants render the
protein encoded thereby either more, less, or just as biologically
active as the full-length 8x env clone of the invention.
[0102] In addition, the present invention includes mutants or
variants of 8x gp120 comprising an altered chemokine receptor
binding site. As discussed previously elsewhere herein, the gp120
protein comprises a chemokine receptor binding domain which
mediates gp120 binding to various cellular chemokine receptor
proteins, which binding typically occurs after gp120 binding to
CD4. As disclosed in the experimental results which follow this
section, 8x gp120 binds to CXCR4 chemokine receptor and does not
require binding to CD4 before doing so. Further, the data disclosed
elsewhere herein demonstrate that introduction of a portion of a
nucleic acid encoding a portion of an HIV-1/BaL gp120 into the
coding sequence of 8x gp120 gives rise to a chimeric protein that
no longer binds to CXCR4. Instead, the chimeric gp120 now binds
CCR5. Such mutants are useful in the methods of the invention for
the study of the role of gp120-chemokine receptor protein
interaction in HIV-1 virus infection. The present invention should
not be construed to be limited solely to a chimeric gp120 wherein a
portion of the nucleic acid encoding 8x gp120 has been replaced a
portion of a nucleic acid encoding BaL gp120. Instead, the present
invention should be construed to include other chimeras wherein any
portion or portions of the nucleic acid encoding 8x gp120 may be
replaced by at least one portion of a nucleic acid encoding a gp120
from any other HIV-1 strain, preferably, those strains of HIV (or
SIV) that use CCR5 as a coreceptor. Further, such portions should
not be construed as being limited to any particular domain of
gp120, but rather, the portion of gp120 substituted may be from any
portion of the sequence encoding the protein. Therefore, the
resulting chimeric nucleic acid and the protein expressed therefrom
may be a chimera comprised of various gp120s from several HIV-1
strains, in any combination possible.
[0103] As more specifically set forth elsewhere herein, a mutant
gp120 gene which encodes a gp120 protein comprising an insertion,
deletion, or substitution, whereby amino acids residues at or near
the putative chemokine receptor binding site are altered, or
whereby a truncated cytoplasmic tail of Env is produced, is useful
in studying the association of gp120 with a host cell chemokine
receptor protein. Indeed, as disclosed in the experiments described
below, several such mutants have been discovered herein (see Table
1 and FIG. 3). However, the invention should not be construed as
being limited to only these mutants; rather, the invention
encompasses other mutants, comprising deletion, substitution, and
point mutations, which demonstrate altered binding to chemokine
receptor protein compared with the wild type gp120 and which
mutants demonstrate CD4-independence.
[0104] The invention should also be construed to include DNA
encoding variants of HIV-1 Env which may or may not retain
biological activity. Such variants, i.e., analogs of proteins or
polypeptides of gp120, gp41 (also referred to as TM), include
proteins or polypeptides which have been or may be modified using
recombinant DNA technology such that the protein or polypeptide
possesses additional properties which enhance its suitability for
use in the methods described herein, for example, but not limited
to, variants conferring enhanced stability of the exposed chemokine
receptor binding site, enhanced specific binding to CD4, CXCR4,
CCR5, and the like.
[0105] The present invention includes analogs of the 8x Env
protein. Analogs can differ from naturally occurring proteins or
peptides by conservative amino acid sequence differences or by
modifications which do not affect sequence, or by both. For
example, conservative amino acid changes may be made, which
although they alter the primary sequence of the protein or peptide,
do not normally alter its function.
[0106] Preferably, the amino acid sequence of an 8x Env analog is
about 70% homologous, more preferably about 80% homologous, even
more preferably about 90% homologous, more preferably, about 95%
homologous, and most preferably, at least about 99% homologous to
the amino acid sequence of 8x env (SEQ ID NO:3) disclosed herein at
FIG. 4.
[0107] The invention should not be construed as being limited
solely to the DNA and amino acid sequences disclosed herein. Once
armed with the present invention, it is readily apparent to one
skilled in the art that other CD4-independent env clones of HIV-1
may be obtained by following the procedures described herein in the
experimental details section for the isolation of the 8x env
nucleic acid (SEQ ID NO:4) encoding CD4-independent Env disclosed
herein.
[0108] The invention should therefore be construed to include any
and all nucleic acid sequences encoding HIV-1/IIIBx 8x Env and
amino acid sequences having substantial homology to the nucleic
acid encoding 8x env disclosed herein (SEQ ID NO:4) and the amino
acid sequence (SEQ ID NO:3) shown in FIG. 4. Preferably, DNA which
is substantially homologous is about 50% homologous, more
preferably about 70% homologous, even more preferably about 80%
homologous and most preferably about 90% homologous to the 8x env
sequence (SEQ ID NO:4) disclosed herein. Preferably, an amino acid
sequence which is substantially homologous is about 50% homologous,
more preferably about 70% homologous, even more preferably about
80% homologous and most preferably about 90% homologous to the 8x
Env amino acid sequences (SEQ ID NO:3) shown in FIG. 4.
[0109] Any number of procedures may be used for the generation of
mutant or variant forms of 8x env. For example, generation of
mutant forms of 8x which are not CD4 independent was accomplished
herein by introducing portions of a nucleic acid encoding env from
a virus which was CD4-dependent using recombinant DNA methodology
well known in the art such as, for example, as described in
Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, New York) and Ausubel et al. (1997,
Current Protocols in Molecular Biology, Green & Wiley, New
York). Mutant Env so generated is expressed and the resulting
protein is assessed for its ability to bind CD4 in a real time
biosensor assay such as that described herein. Mutant proteins
which bind chemokine receptor protein in a CD4-independent manner
were then examined by RT, fusion activity, real time
binding/dissociation kinetics, and other such assays.
[0110] Procedures for the introduction of amino acid changes in a
protein or polypeptide by altering the DNA sequence encoding the
polypeptide are well known in the art and are also described in
Sambrook et al. (1989, supra); Ausubel et al. (1997, supra).
[0111] The invention also includes an isolated nucleic acid having
nucleic acid sequence which is complementary to a portion or all of
the nucleic acid encoding HIV-1 Env (SEQ ID NO:4).
[0112] As used herein, the term "fragment" as applied to a nucleic
acid, may ordinarily be at least about 100 nucleotides in length,
typically, at least about 200 nucleotides, more typically, from
about 300 to about 600 nucleotides, typically at least about 700 to
about 1000 nucleotides, preferably at least about 1000 to about
1400 nucleotides, even more preferably at least about 1600
nucleotides to about 2000 nucleotides, and most preferably, the
nucleic acid fragment will be greater than about 2400 nucleotides
in length.
[0113] The invention further includes a cell comprising the nucleic
acids of interest. The nucleic acids need not be integrated into
the cell genome nor do they need to be expressed in the cell.
Moreover, the cell may be a prokaryotic or a eukaryotic cell and
the invention should not be construed to be limited to any
particular cell line or type.
[0114] The invention also includes antibodies specific for the
chemokine receptor binding site of gp120, or a portion thereof,
which antibodies comprise a monoclonal antibody.
[0115] In one embodiment, the antibody is a murine monoclonal
antibody to gp120 (17b) the epitope of which overlaps with the
chemokine receptor binding site, as well as a murine monoclonal
antibody to gp120 termed 48d (Thali et al., 1993, J. Virol.
67:3978-3988). However, the invention should not be construed as
being limited solely to these antibodies but rather, should be
construed to include other antibodies, as that term is defmed
herein, to Env, or portions thereof, which antibodies perform in a
manner substantially similar to those described herein in that,
inter alia, the antibodies bind to gp120 chemokine receptor binding
site, and they are able to inhibit HIV-1 infection as measured by
RT activity and cell fusion activity.
[0116] The invention also comprises an isolated polypeptide
comprising the amino acid sequence of 8x Env protein, and mutants,
variants and fragments thereof.
[0117] The peptides of the invention may be substantially pure. A
substantially pure peptide is purified by following known
procedures for protein purification, wherein an immunological,
enzymatic or other assay is used to monitor purification at each
stage in the procedure. Protein purification methods are well known
in the art, and are described, for example in Deutscher et al.
(1990, In: Guide to Protein Purification, Harcourt Brace
Jovanovich, San Diego).
[0118] The invention should thus be construed to include nucleic
acid encoding desired proteins and fragments of nucleic acid
encoding desired polypeptides.
[0119] The present invention includes an isolated nucleic acid
encoding a chimeric protein comprising a first portion and a second
portion. In one embodiment, the chimeric nucleic acid comprises a
first portion encoding 8x env and a second portion encoding an env
from S10, IIIB, or HXB2. Although these chimeras were useful in
mapping which regions of 8x are required for CD4-independence, the
present invention should not be construed to be limited to these
chimeras. Rather, the invention should be construed to encompass
any chimeras in the env coding region which may be constructed
comprising any portion of 8x and any HIV-1 virus strain or variant
thereof.
[0120] Further, in another embodiment, the chimeras comprised a
portion of the 8x env coding region and a portion of the env coding
region of a CCR5-tropic HIV-1 strain, BaL. More'specifically, the
embodiment comprises the 8x env clone with the nucleic acid portion
encoding the V3-loop of BaL. However, the present invention should
not be construed to be limited to this particular portion of the
env coding region or to this particular strain of HIV-1. Rather, as
previously discussed elsewhere herein, the present invention
includes the substitution of any portion of the 8x env coding
sequence with a portion of the env coding sequence of at least one
other HIV-1 strain or variant, and any possible permutation
thereof. Therefore, the chimeras, both nucleic acid and amino acid
expressed therefrom, include combinations from two or more HIV-1
env coding regions of interest. Thus, armed with the disclosure
provided herein, the production of an almost infinite combination
of chimeras with the predicted effects disclosed herein would be
clear to one skilled in the art.
[0121] The invention also includes a method of identifying an amino
acid residue of an HIV-1 Env protein which is involved in
CD4-independence. The method comprises producing chimeric proteins
comprising at least a portion from a CD4-independent Env clone and
at least a second portion from a CD4-dependent Env clone. The
resulting chimera is then examined to determine the ability of the
chimeric protein to mediate CD4-independent infection by various
assays as disclosed elsewhere herein. As discussed previously
herein, a preferred embodiment is disclosed wherein portions of the
8x env coding sequence were combined with various portions of the
env coding sequences of several CD4-dependent HIV-1 strains, e.g.,
S10 and HxBc2. Also as noted previously herein, the present
invention is not limited to these particular combinations or to
these particular strains. Rather, one skilled in the art would
appreciate, based on the disclosure provided herein, that any
combination of CD4-dependent and -independent env coding sequences
may be examined to map the CD4-independent determinants. Further,
the CD4-independence may be examined using a variety of assays on
various mammalian cell lines also as described previously elsewhere
herein.
[0122] The present invention also includes an isolated gp120
protein comprising a stably exposed chemokine receptor binding
site. In one embodiment, the increased exposure of the chemokine
receptor binding site was determined by measuring the real time
binding kinetics of the various proteins in biosensor experiments
and the enhanced neutralization of the virus by anti-HIV antibodies
and by crystallographic analyses. However, the present invention
should not be construed to be limited to these particular assays.
Rather, other assays well-known in the art or to be developed for
the study of protein-protein interactions may be used to measure
the exposure of the chemokine receptor binding site of a gp120 or
Env protein of interest.
[0123] The invention includes a method of eliciting an immune
response to a HIV-1 chemokine receptor binding site. The method
comprises administering an immunogenic dose of a CD4-independent
HIV-1 Env protein to a mammal wherein the protein comprises a
stably exposed chemokine receptor binding site.
[0124] In addition, the use of purified nucleic acid to generate an
immune response, where the nucleic acid is in a vector (e.g., a
plasmid or a virus), or where the nucleic acid comprises naked
nucleic acid not associated with any other nucleic acid, is
well-known in the art. For example, methods for construction of
nucleic acid vaccines are described in Burger et al. (1991, J. Gen.
Virol. 72:359-367), and are well-known in the art. See also
Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, New York; Ausubel et al., 1997,
Current Protocols in Molecular Biology, Green & Wiley, New
York.
[0125] Further, cells expressing the HIV-1 Env protein of choice
may also be used to generate an immune response to an HIV-1
chemokine receptor binding site.
[0126] The immune response to the Env immunogen is measured by
standard immunological techniques such as ELISA or Western blotting
and other such techniques well-known in the art or to be developed
in the future. A variety of immunoassay formats may be used to
select antibodies specifically immunoreactive with a particular
protein. See, e.g., Harlow and Lane (1988, Antibodies, A Laboratory
Manual, Cold Spring Harbor Publications, New York) for a
description of immunoassay formats and conditions that can be used
to determine specific immunoreactivity.
[0127] The CD4-independent HIV-1 Env protein of the invention may
be formulated in a pharmaceutical composition which is suitable for
administration of the protein to a human or veterinary patient. It
will be appreciated that the precise formulation and dosage amounts
will vary depending upon any number of factors, including, but not
limited to, the type and severity of the disease to be treated, the
route of administration, the age and overall health of the
individual, the nature of the Env protein, etc. However, the
preparation of a pharmaceutically acceptable composition having an
appropriate pH, isotonicity, stability and other characteristics is
within the skill of the art. Pharmaceutical compositions are
described in the art, for example, in Remington's Pharmaceutical
Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, Pa.).
[0128] The amount of the CD4-independent Env administered, whether
it is administered as protein or as nucleic acid or as a cell
expressing HIV env, is sufficient to elicit an immune response to
an HIV-1 chemokine receptor binding site. The pharmaceutical
compositions useful for practicing the invention may be
administered to deliver a dose of between about 1 ng/kg and about
100 mg/kg of patient body weight. Suitable amounts of the
CD4-independent Env protein for administration include doses which
are high enough to have the desired effect without concomitant
adverse effects. When the CD4-independent Env is a protein or
peptide, a preferred dosage range is from about 10 to about 1000
.mu.g of protein or peptide per kg of patient body weight. When the
CD4-independent Env is administered in the form of DNA encoding the
same contained within a recombinant virus vector, a dosage of
between about 10.sup.2 and about 10.sup.11 plaque forming units of
virus per kg of patient body weight may be used. When naked DNA
encoding the CD4-independent Env is to be administered as the
pharmaceutical composition, a dosage of between about 10 .mu.g to
about several mg of DNA per kg of patient body weight may be
used.
[0129] In the practice of the methods of the invention, a
composition containing a CD4-independent Env protein is
administered to a patient in a sufficient amount to treat, prevent,
or alleviate a HIV-1 infection in the individual.
[0130] One skilled in the art would appreciate, based on the
disclosure provided herein, that the Env protein/nucleic acid
encoding Env may be administered to a patient to prevent HIV
infection by interfering with virus binding to the appropriate
chemokine receptor using the virus' chemokine receptor binding site
and, thereby preventing infection. Further, the Env protein/nucleic
acid encoding env may also treat or alleviate the condition in a
previously infected individual by augmenting the immune response in
the person that could, in turn, be beneficial as an adjunct to
antiretroviral pharmacologic therapy. That is, the immunogen may
boost the immune response to the virus chemokine receptor binding
site thereby generating antibodies which block the requisite
interactions between the virus chemokine receptor binding site and
the target cell chemokine receptor.
[0131] The frequency of administration of a CD4-independent Env
protein to a patient will also vary depending on several factors
including, but not limited to, the type and severity of the viral
infection to be treated, the route of administration, the age and
overall health of the individual, the nature of the Env protein,
etc. It is contemplated that the frequency of administration of the
Env protein to the patient may vary from about once every few
months to about once a month, to about once a week, to about once
per day, to about several times daily.
[0132] Pharmaceutical compositions that are useful in the methods
of the invention may be administered systemically in parenteral,
oral solid and liquid formulations, ophthalmic, suppository,
aerosol, topical or other similar formulations. In addition to the
appropriate Env protein, or nucleic acid encoding same, these
pharmaceutical compositions may contain pharmaceutically-acceptable
carriers and other ingredients known to enhance and facilitate drug
administration. Thus such compositions may optionally contain other
components, such as adjuvants, e.g., aqueous suspensions of
aluminum and magnesium hydroxides, and/or other pharmaceutically
acceptable carriers, such as saline. Other possible formulations,
such as nanoparticles, liposomes, resealed erythrocytes, and
immunologically based systems may also be used to administer the
appropriate Env protein or nucleic acid encoding it to a patient
according to the methods of the invention.
[0133] Preferably, the composition of the invention is administered
to the human by a parenteral or intravenous route.
[0134] An Env protein and/or a nucleic acid encoding Env, may be
administered in conjunction with other compounds which are used to
treat HIV infection. Such compounds include, but are not limited
to, protease inhibitors, reverse transcriptases inhibitors
(nucleoside and non-nucleoside analogs), AZT, interferons,
interleukin-2, other cytokines, and the like. The choice of which
additional compound to administer will vary depending upon any
number of the same types of factors that govern the selection of
dosage and administration frequency of the Env protein or nucleic
acid encoding same. Selection of these types of compounds for use
in conjunction with an Env protein for practice of the method of
the invention is well within the skill of those in the art.
[0135] The invention also includes a vaccine comprising an
immunogenic dose of a CD4-independent HIV-1 Env protein. As
discussed previously elsewhere herein, generation of an immune
response to the virus chemokine receptor binding site should block
interaction of this virus site to the host chemokine receptor
ligand thereby interfering with and/or inhibiting the requisite
virus/host cell interaction needed for HIV infection.
[0136] In addition, the invention includes a method of identifying
a compound which affects exposure of a gp120 protein chemokine
receptor binding site. The method comprises contacting a cell with
the compound and comparing the amount of labeled gp120 specifically
bound to the cell with the amount of labeled chemokine bound to an
otherwise identical cell not contacted with the compound. In one
embodiment, the gp120 of interest was .sup.125I-labeled and bound
to cells expressing various chemokine receptors in the presence or
absence of soluble CD4. However, the present invention should not
be construed to be limited to radioiodination or to any particular
gp120 or to expression of only these chemokine receptors. Rather,
the invention should be construed to encompass a variety of protein
labels such that binding of the gp120 of interest may be
quantitated. Such methods are well-known in the art and include,
but are not limited to, biotinylation, and .sup.35S-cys and
.sup.35S-met.
[0137] The invention also includes a method of identifying a
small-molecule which inhibits binding of a chemokine receptor by an
HIV-1 gp120 using its chemokine receptor binding site. The method
comprises contacting a cell with a small-molecule prior to or
contemporaneous with contacting the cell with labeled gp120 with or
without preincubation of the gp120 with soluble CD4. Then, the
amount of label bound to the cell is measured thereby detecting the
amount of labeled gp120 bound to the cell. The amount of bound
gp120 bound to a cell contacted with the small-molecule is compared
to the amount of gp120 bound to a cell not contacted with the
small-molecule. If a lower amount of gp120 is bound to the cell
contacted with the small molecule compared to the amount of gp120
bound to the cell which was not contacted with the small-molecule,
this is an indication that contacting the cell with the
small-molecule inhibits binding of HIV-1 gp120 to a chemokine
receptor using its chemokine receptor binding site.
[0138] One skilled in the art would appreciate, based on the
disclosure provided herein, that such small-molecules are useful
therapeutics inhibiting HIV-1 infection of cells in that such
small-molecules would inhibit the requisite HIV-1 gp120/chemokine
receptor interactions necessary for virus infection of the target
cell. Further, the prior art teaches that antibodies and chemokines
which specifically bind to chemokine receptors and which block
gp120 binding to the chemokine receptor often also block HIV
infection (Lee et al., 1999, J. Biol. Chem., in press; Olson et
al., 1999, J. Virol., in press; Wu et al., 1997, J. Exp. Med.).
Thus, the small-molecule inhibitors of gp120 binding to the
chemokine receptor identified using the methods of the invention
are useful inhibitors of HIV infection.
[0139] Further, one skilled in the art, based upon the disclosure
provided herein, would appreciate that a small-molecule inhibitor
of gp120 binding using its chemokine receptor binding site to a
chemokine receptor identified using the methods of the invention is
a useful inhibitor of a chemokine binding to and activation of its
receptor. That is, the small-molecule inhibitor may be useful for
inhibiting the natural function of chemokine receptors unrelated to
the role of the chemokine receptors in HIV infection. Thus, a
small-molecule inhibitor identified herein is a useful therapeutic
having potential uses for, among other things, immune system
treatments, inflammation, and development in any non-HIV infected
human.
[0140] The invention includes a method of inhibiting HIV-1 gp120
binding, using its chemokine receptor binding site, to a chemokine
receptor. The method comprises contacting a the gp120 with a
small-molecule which inhibits binding of gp120 to a chemokine
receptor where such binding is mediated by the chemokine receptor
binding site of the virus gp120 protein. The small-molecule is
identified as disclosed previously elsewhere herein. Contacting the
gp120 with the small-molecule binding inhibitor inhibits binding of
the gp120 with the cell chemokine receptor.
[0141] The invention also includes a method of inhibiting HIV-1
infection of a cell. The method comprises contacting a cell with a
small-molecule identified as described previously elsewhere herein.
The small-molecule so identified inhibits the binding an HIV-1
gp120 to a cell chemokine receptor mediated by the virus gp120's
chemokine receptor binding site. The small-molecule, by interfering
with the requisite gp120/chemokine receptor interaction(s), thereby
inhibits HIV-1 infection of the cell. Indeed, it has been
demonstrated previously (Lee et al., 1999, J. Biol. Chem., in
press; Olson et al., 1999, J. Virol., in press; Wu et al., 1997, J.
Exp. Med.) antibodies and chemokines that block gp120 binding to
the chemokine receptor often also block HIV infection. Thus, the
invention includes a method of inhibiting HIV-1 infection by
interfering with the receptor/ligand interactions required for
HIV-1 infection of a target cell using a small-molecule inhibitor
of gp120 binding to the cell chemokine receptor using the gp120
chemokine receptor binding site.
[0142] The invention also includes a composition comprising a
CD4-independent HIV-1 Env and at least one compound used to treat
HIV infection in a pharmaceutically suitable carrier. As described
elsewhere herein, the HIV-1 Env may be a HIV-1 Env polypeptide, a
nucleic acid encoding HIV-1 Env, and/or a cell expressing HIV-1
env. Further, as disclosed previously elsewhere herein, the
invention should be construed to encompass compounds used to treat
HIV infection such as, for example but not limited to, protease
inhibitors, reverse transcriptase inhibitor, reverse transcriptase
inhibitors (including both nucleoside and non-nucleoside analogs),
interferons, AZT, interleukin-2, and cytokines.
[0143] The invention includes a method of treating HIV-1 infection
in a human. The method comprises administering an immunogenic dose
of a CD4-independent HIV-1 Env to an HIV-1 infected human.
Administration of such CD4-independent HIV-1 Env induces the
production of antibodies to the stably exposed chemokine receptor
binding site of gp120. Thus, administration of the CD4-independent
HIV-1 Env causes the production of potentially neutralizing
antibodies which block the gp120/chemokine receptor interaction(s)
required for HIV-1 infection of the host cell. This is suggested by
the fact, disclosed elsewhere herein, that the CD4-independent
gp120 is more sensitive to neutralizing antibodies than otherwise
identical CD4-dependent gp120 which does not comprise a stably
exposed chemokine receptor binding site. Further, antibodies that
block Env-chemokine receptor interactions can neutralize HIV-1 (Wu
et al., 1996, Nature 384:179-183; Trkola et al., 1996, Nature
384:184-187). Thus, increased exposure of the chemokine receptor
binding site will enhance the production of antibodies to this
conserved region which antibodies inhibit the requisite
gp120-chemokine receptor interactions. Therefore, immunizing a
human with CD4-independent Env causes the production of antibodies
to the stably exposed chemokine receptor binding site which
antibodies block requisite Env-chemokine receptor interactions
needed for infection, thereby treating HIV-1 infection in the
human.
[0144] One skilled in the art would appreciate, based upon the
disclosure provided herein, that the immunogenic dose of a
CD4-independent HIV-1 Env may be a useful therapeutic to treat
and/or alleviate the HIV-1 infection in a human both before and
after exposure to the HIV-1 virus. That is, the immunogenic dose
may be administered prior to, during, or after infection of a human
by HIV-1. Irrespective of when it is administered, the immunogen
elicits a response in the human to, inter alia, the stably exposed
chemokine receptor binding site of gp120 thereby inducing a
response which inhibits the binding of the virus gp120 to the
chemokine receptor. This inhibition is generated in both previously
infected individuals as well as uninfected persons. In the
individual already infected with HIV-1, the immunogen generates an
immune response in addition to any immune response already present
in the individual and thus mediates a reduction in the virus load
in that individual. Thus, the CD4-independent HIV-1 Env is useful
as a therapeutic vaccine in a human already infected by HIV-1
virus.
[0145] As disclosed previously elsewhere herein, one skilled in the
art would appreciate, based on the disclosure provided herein, that
the immunogenic dose of a CD4-independent HIV-1 Env may be
administered as a protein, a nucleic acid (comprising a vector or
as naked DNA), and/or a cell expressing a nucleic acid encoding a
CD4-independent env.
[0146] In another aspect, the method of treating HIV-1 infection in
a human comprises further administering a compound used to treat
HIV infection. As disclosed previously elsewhere herein, such
compounds include, but are not limited to, a protease inhibitors, a
reverse transcriptase inhibitor, a reverse transcriptase inhibitor
(including both nucleoside and non-nucleoside analogs), an
interferon, AZT, interleukin-2, and a cytokine. The compound may be
administered before, during, or after the administration of the
immunogenic dose of a CD4-independent HIV-1 Env.
[0147] One skilled in the art would appreciate, based upon the
disclosure provided herein, that the timing of the compound
relative to the immunogenic dose of a CD4-independent HIV-1 Env
would depend upon the immunization regimen regarding the HIV-1 Env
and the particular compound(s) administered with the Env immunogen,
as well as the health and age of the patient and the severity and
stage of the disease process.
[0148] The HIV-1 Env immunogen(s) and/or compounds which are
identified using any of the methods described herein may be
formulated and administered to a mammal for treatment and/or
prevention of HIV infection as now described.
[0149] The invention encompasses the preparation and use of
pharmaceutical compositions comprising a compound useful for
treatment of HIV infection as an active ingredient. Such a
pharmaceutical composition may consist of the active ingredient
alone, as a combination of at least one active ingredient (e.g., an
immunogenic dose of a CD4-independent HIV-1 Env and a compound used
to treat HIV infection such as interleukin-2) in a form suitable
for administration to a subject, or the pharmaceutical composition
may comprise the active ingredient and one or more pharmaceutically
acceptable carriers, one or more additional ingredients, or some
combination of these. The active ingredient may be present in the
pharmaceutical composition in the form of a physiologically
acceptable ester or salt, such as in combination with a
physiologically acceptable cation or anion, as is well known in the
art.
[0150] As used herein, the term "pharmaceutically acceptable
carrier" means a chemical composition with which the active
ingredient may be combined and which, following the combination,
can be used to administer the active ingredient to a subject.
[0151] As used herein, the term "physiologically acceptable" ester
or salt means an ester or salt form of the active ingredient which
is compatible with any other ingredients of the pharmaceutical
composition, which is not deleterious to the subject to which the
composition is to be administered.
[0152] The formulations of the pharmaceutical compositions
described herein may be prepared by any method known or hereafter
developed in the art of pharmacology. In general, such preparatory
methods include the step of bringing the active ingredient into
association with a carrier or one or more other accessory
ingredients, and then, if necessary or desirable, shaping or
packaging the product into a desired single- or multi-dose
unit.
[0153] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for ethical administration to
humans, it will be understood by the skilled artisan that such
compositions are generally suitable for administration to animals
of all sorts. Modification of pharmaceutical compositions suitable
for administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design and
perform such modification with merely ordinary, if any,
experimentation. Subjects to which administration of the
pharmaceutical compositions of the invention is contemplated
include, but are not limited to, humans and other primates, mammals
including commercially relevant mammals such as non-human primates,
cattle, pigs, horses, sheep, cats, and dogs, birds including
commercially relevant birds such as chickens, ducks, geese, and
turkeys, fish including farm-raised fish and aquarium fish, and
crustaceans such as farm-raised shellfish.
[0154] Pharmaceutical compositions that are useful in the methods
of the invention may be prepared, packaged, or sold in formulations
suitable for oral, rectal, vaginal, parenteral, topical, pulmonary,
intranasal, buccal, ophthalmic, or another route of administration.
Other contemplated formulations include projected nanoparticles,
liposomal preparations, resealed erythrocytes containing the active
ingredient, and immunologically-based formulations.
[0155] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in bulk, as a single unit dose, or as a
plurality of single unit doses. As used herein, a "unit dose" is
discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the
active ingredient is generally equal to the dosage of the active
ingredient which would be administered to a subject or a convenient
fraction of such a dosage such as, for example, one-half or
one-third of such a dosage.
[0156] The relative amounts of the active ingredient, the
pharmaceutically acceptable carrier, and any additional ingredients
in a pharmaceutical composition of the invention will vary,
depending upon the identity, size, and condition of the subject
treated and further depending upon the route by which the
composition is to be administered. By way of example, the
composition may comprise between 0.1% and 100% (w/w) active
ingredient.
[0157] In addition to the active ingredient, a pharmaceutical
composition of the invention may further comprise one or more
additional pharmaceutically active agents. Particularly
contemplated additional agents include anti-emetics and scavengers
such as cyanide and cyanate scavengers and AZT, protease
inhibitors, reverse transcriptase inhibitors, interleukin-2,
interferons, cytokines, and the like.
[0158] Controlled- or sustained-release formulations of a
pharmaceutical composition of the invention may be made using
conventional technology.
[0159] A formulation of a pharmaceutical composition of the
invention suitable for oral administration may be prepared,
packaged, or sold in the form of a discrete solid dose unit
including, but not limited to, a tablet, a hard or soft capsule, a
cachet, a troche, or a lozenge, each containing a predetermined
amount of the active ingredient. Other formulations suitable for
oral administration include, but are not limited to, a powdered or
granular formulation, an aqueous or oily suspension, an aqueous or
oily solution, or an emulsion.
[0160] As used herein, an "oily" liquid is one which comprises a
carbon-containing liquid molecule and which exhibits a less polar
character than water.
[0161] A tablet comprising the active ingredient may, for example,
be made by compressing or molding the active ingredient, optionally
with one or more additional ingredients. Compressed tablets may be
prepared by compressing, in a suitable device, the active
ingredient in a free-flowing form such as a powder or granular
preparation, optionally mixed with one or more of a binder, a
lubricant, an excipient, a surface active agent, and a dispersing
agent. Molded tablets may be made by molding, in a suitable device,
a mixture of the active ingredient, a pharmaceutically acceptable
carrier, and at least sufficient liquid to moisten the mixture.
Pharmaceutically acceptable excipients used in the manufacture of
tablets include, but are not limited to, inert diluents,
granulating and disintegrating agents, binding agents, and
lubricating agents. Known dispersing agents include, but are not
limited to, potato starch and sodium starch glycolate. Known
surface active agents include, but are not limited to, sodium
lauryl sulphate. Known diluents include, but are not limited to,
calcium carbonate, sodium carbonate, lactose, microcrystalline
cellulose, calcium phosphate, calcium hydrogen phosphate, and
sodium phosphate. Known granulating and disintegrating agents
include, but are not limited to, corn starch and alginic acid.
Known binding agents include, but are not limited to, gelatin,
acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and
hydroxypropyl methylcellulose. Known lubricating agents include,
but are not limited to, magnesium stearate, stearic acid, silica,
and talc.
[0162] Tablets may be non-coated or they may be coated using known
methods to achieve delayed disintegration in the gastrointestinal
tract of a subject, thereby providing sustained release and
absorption of the active ingredient. By way of example, a material
such as glyceryl monostearate or glyceryl distearate may be used to
coat tablets. Further by way of example, tablets may be coated
using methods described in U.S. Pat. Nos. 4,256,108; 4,160,452; and
4,265,874 to form osmotically-controlled release tablets. Tablets
may further comprise a sweetening agent, a flavoring agent, a
coloring agent, a preservative, or some combination of these in
order to provide pharmaceutically elegant and palatable
preparation.
[0163] Hard capsules comprising the active ingredient may be made
using a physiologically degradable composition, such as gelatin.
Such hard capsules comprise the active ingredient, and may further
comprise additional ingredients including, for example, an inert
solid diluent such as calcium carbonate, calcium phosphate, or
kaolin.
[0164] Soft gelatin capsules comprising the active ingredient may
be made using a physiologically degradable composition, such as
gelatin. Such soft capsules comprise the active ingredient, which
may be mixed with water or an oil medium such as peanut oil, liquid
paraffin, or olive oil.
[0165] Liquid formulations of a pharmaceutical composition of the
invention which are suitable for oral administration may be
prepared, packaged, and sold either in liquid form or in the form
of a dry product intended for reconstitution with water or another
suitable vehicle prior to use.
[0166] Liquid suspensions may be prepared using conventional
methods to achieve suspension of the active ingredient in an
aqueous or oily vehicle. Aqueous vehicles include, for example,
water and isotonic saline. Oily vehicles include, for example,
almond oil, oily esters, ethyl alcohol, vegetable oils such as
arachis, olive, sesame, or coconut oil, fractionated vegetable
oils, and mineral oils such as liquid paraffin. Liquid suspensions
may further comprise one or more additional ingredients including,
but not limited to, suspending agents, dispersing or wetting
agents, emulsifying agents, demulcents, preservatives, buffers,
salts, flavorings, coloring agents, and sweetening agents. Oily
suspensions may further comprise a thickening agent. Known
suspending agents include, but are not limited to, sorbitol syrup,
hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone,
gum tragacanth, gum acacia, and cellulose derivatives such as
sodium carboxymethylcellulose, methylcellulose, hydroxypropyl
methylcellulose. Known dispersing or wetting agents include, but
are not limited to, naturally-occurring phosphatides such as
lecithin, condensation products of an alkylene oxide with a fatty
acid, with a long chain aliphatic alcohol, with a partial ester
derived from a fatty acid and a hexitol, or with a partial ester
derived from a fatty acid and a hexitol anhydride (e.g.
polyoxyethylene stearate, heptadecaethyleneoxycetanol,
polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan
monooleate, respectively). Known emulsifying agents include, but
are not limited to, lecithin and acacia. Known preservatives
include, but are not limited to, methyl, ethyl, or
n-propyl-para-hydroxybenzoates, ascorbic acid, and sorbic acid.
Known sweetening agents include, for example, glycerol, propylene
glycol, sorbitol, sucrose, and saccharin. Known thickening agents
for oily suspensions include, for example, beeswax, hard paraffin,
and cetyl alcohol.
[0167] Liquid solutions of the active ingredient in aqueous or oily
solvents may be prepared in substantially the same manner as liquid
suspensions, the primary difference being that the active
ingredient is dissolved, rather than suspended in the solvent.
Liquid solutions of the pharmaceutical composition of the invention
may comprise each of the components described with regard to liquid
suspensions, it being understood that suspending agents will not
necessarily aid dissolution of the active ingredient in the
solvent. Aqueous solvents include, for example, water and isotonic
saline. Oily solvents include, for example, almond oil, oily
esters, ethyl alcohol, vegetable oils such as arachis, olive,
sesame, or coconut oil, fractionated vegetable oils, and mineral
oils such as liquid paraffin.
[0168] Powdered and granular formulations of a pharmaceutical
preparation of the invention may be prepared using known methods.
Such formulations may be administered directly to a subject, used,
for example, to form tablets, to fill capsules, or to prepare an
aqueous or oily suspension or solution by addition of an aqueous or
oily vehicle thereto. Each of these formulations may further
comprise one or more of dispersing or wetting agent, a suspending
agent, and a preservative. Additional excipients, such as fillers
and sweetening, flavoring, or coloring agents, may also be included
in these formulations.
[0169] A pharmaceutical composition of the invention may also be
prepared, packaged, or sold in the form of oil-in-water emulsion or
a water-in-oil emulsion. The oily phase may be a vegetable oil such
as olive or arachis oil, a mineral oil such as liquid paraffin, or
a combination of these. Such compositions may further comprise one
or more emulsifying agents such as naturally occurring gums such as
gum acacia or gum tragacanth, naturally-occurring phosphatides such
as soybean or lecithin phosphatide, esters or partial esters
derived from combinations of fatty acids and hexitol anhydrides
such as sorbitan monooleate, and condensation products of such
partial esters with ethylene oxide such as polyoxyethylene sorbitan
monooleate. These emulsions may also contain additional ingredients
including, for example, sweetening or flavoring agents.
[0170] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for rectal
administration. Such a composition may be in the form of, for
example, a suppository, a retention enema preparation, and a
solution for rectal or colonic irrigation.
[0171] Suppository formulations may be made by combining the active
ingredient with a non-irritating pharmaceutically acceptable
excipient which is solid at ordinary room temperature (i.e., about
20.degree. C.) and which is liquid at the rectal temperature of the
subject (i.e., about 37.degree. C. in a healthy human). Suitable
pharmaceutically acceptable excipients include, but are not limited
to, cocoa butter, polyethylene glycols, and various glycerides.
Suppository formulations may further comprise various additional
ingredients including, but not limited to, antioxidants and
preservatives.
[0172] Retention enema preparations or solutions for rectal or
colonic irrigation may be made by combining the active ingredient
with a pharmaceutically acceptable liquid carrier. As is well known
in the art, enema preparations may be administered using, and may
be packaged within, a delivery device adapted to the rectal anatomy
of the subject. Enema preparations may further comprise various
additional ingredients including, but not limited to, antioxidants
and preservatives.
[0173] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for vaginal
administration. Such a composition may be in the form of, for
example, a suppository, an impregnated or coated
vaginally-insertable material such as a tampon, a douche
preparation, or gel or cream or a solution for vaginal
irrigation.
[0174] Methods for impregnating or coating a material with a
chemical composition are known in the art, and include, but are not
limited to methods of depositing or binding a chemical composition
onto a surface, methods of incorporating a chemical composition
into the structure of a material during the synthesis of the
material (i.e. such as with a physiologically degradable material),
and methods of absorbing an aqueous or oily solution or suspension
into an absorbent material, with or without subsequent drying.
[0175] Douche preparations or solutions for vaginal irrigation may
be made by combining the active ingredient with a pharmaceutically
acceptable liquid carrier. As is well known in the art, douche
preparations may be administered using, and may be packaged within,
a delivery device adapted to the vaginal anatomy of the subject.
Douche preparations may further comprise various additional
ingredients including, but not limited to, antioxidants,
antibiotics, antifungal agents, and preservatives.
[0176] As used herein, "parenteral administration" of a
pharmaceutical composition includes any route of administration
characterized by physical breaching of a tissue of a subject and
administration of the pharmaceutical composition through the breach
in the tissue. Parenteral administration thus includes, but is not
limited to, administration of a pharmaceutical composition by
injection of the composition, by application of the composition
through a surgical incision, by application of the composition
through a tissue-penetrating non-surgical wound, and the like. In
particular, parenteral administration is contemplated to include,
but is not limited to, subcutaneous, intraperitoneal,
intramuscular, intrasternal injection, and kidney dialytic infusion
techniques.
[0177] Formulations of a pharmaceutical composition suitable for
parenteral administration comprise the active ingredient combined
with a pharmaceutically acceptable carrier, such as sterile water
or sterile isotonic saline. Such formulations may be prepared,
packaged, or sold in a form suitable for bolus administration or
for continuous administration. Injectable formulations may be
prepared, packaged, or sold in unit dosage form, such as in ampules
or in multi-dose containers containing a preservative. Formulations
for parenteral administration include, but are not limited to,
suspensions, solutions, emulsions in oily or aqueous vehicles,
pastes, and implantable sustained-release or biodegradable
formulations. Such formulations may further comprise one or more
additional ingredients including, but not limited to, suspending,
stabilizing, or dispersing agents. In one embodiment of a
formulation for parenteral administration, the active ingredient is
provided in dry (i.e. powder or granular) form for reconstitution
with a suitable vehicle (e.g. sterile pyrogen-free water) prior to
parenteral administration of the reconstituted composition.
[0178] The pharmaceutical compositions may be prepared, packaged,
or sold in the form of a sterile injectable aqueous or oily
suspension or solution. This suspension or solution may be
formulated according to the known art, and may comprise, in
addition to the active ingredient, additional ingredients such as
the dispersing agents, wetting agents, or suspending agents
described herein. Such sterile injectable formulations may be
prepared using a non-toxic parenterally-acceptable diluent or
solvent, such as water or 1,3-butane diol, for example. Other
acceptable diluents and solvents include, but are not limited to,
Ringer's solution, isotonic sodium chloride solution, and fixed
oils such as synthetic mono- or di-glycerides. Other
parentally-administrable formulations which are useful include
those which comprise the active ingredient in microcrystalline
form, in a liposomal preparation, or as a component of a
biodegradable polymer systems. Compositions for sustained release
or implantation may comprise pharmaceutically acceptable polymeric
or hydrophobic materials such as an emulsion, an ion exchange
resin, a sparingly soluble polymer, or a sparingly soluble
salt.
[0179] Formulations suitable for topical administration include,
but are not limited to, liquid or semi-liquid preparations such as
liniments, lotions, oil-in-water or water-in-oil emulsions such as
creams, ointments or pastes, and solutions or suspensions.
Topically-administrable formulations may, for example, comprise
from about 1% to about 10% (w/w) active ingredient, although the
concentration of the active ingredient may be as high as the
solubility limit of the active ingredient in the solvent.
Formulations for topical administration may further comprise one or
more of the additional ingredients described herein.
[0180] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for pulmonary
administration via the buccal cavity. Such a formulation may
comprise dry particles which comprise the active ingredient and
which have a diameter in the range from about 0.5 to about 7
nanometers, and preferably from about 1 to about 6 nanometers. Such
compositions are conveniently in the form of dry powders for
administration using a device comprising a dry powder reservoir to
which a stream of propellant may be directed to disperse the powder
or using a self-propelling solvent/powder-dispensing container such
as a device comprising the active ingredient dissolved or suspended
in a low-boiling propellant in a sealed container. Preferably, such
powders comprise particles wherein at least 98% of the particles by
weight have a diameter greater than 0.5 nanometers and at least 95%
of the particles by number have a diameter less than 7 nanometers.
More preferably, at least 95% of the particles by weight have a
diameter greater than 1 nanometer and at least 90% of the particles
by number have a diameter less than 6 nanometers. Dry powder
compositions preferably include a solid fine powder diluent such as
sugar and are conveniently provided in a unit dose form.
[0181] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50 to 99.9% (w/w)
of the composition, and the active ingredient may constitute 0.1 to
20% (w/w) of the composition. The propellant may further comprise
additional ingredients such as a liquid non-ionic or solid anionic
surfactant or a solid diluent (preferably having a particle size of
the same order as particles comprising the active ingredient).
[0182] Pharmaceutical compositions of the invention formulated for
pulmonary delivery may also provide the active ingredient in the
form of droplets of a solution or suspension. Such formulations may
be prepared, packaged, or sold as aqueous or dilute alcoholic
solutions or suspensions, optionally sterile, comprising the active
ingredient, and may conveniently be administered using any
nebulization or atomization device. Such formulations may further
comprise one or more additional ingredients including, but not
limited to, a flavoring agent such as saccharin sodium, a volatile
oil, a buffering agent, a surface active agent, or a preservative
such as methylhydroxybenzoate. The droplets provided by this route
of administration preferably have an average diameter in the range
from about 0.1 to about 200 nanometers.
[0183] The formulations described herein as being useful for
pulmonary delivery are also useful for intranasal delivery of a
pharmaceutical composition of the invention.
[0184] Another formulation suitable for intranasal administration
is a coarse powder comprising the active ingredient and having an
average particle from about 0.2 to 500 micrometers. Such a
formulation is administered in the manner in which snuff is taken
i.e. by rapid inhalation through the nasal passage from a container
of the powder held close to the nares.
[0185] Formulations suitable for nasal administration may, for
example, comprise from about as little as 0.1% (w/w) and as much as
100% (w/w) of the active ingredient, and may further comprise one
or more of the additional ingredients described herein.
[0186] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for buccal
administration. Such formulations may, for example, be in the form
of tablets or lozenges made using conventional methods, and may,
for example, 0.1 to 20% (w/w) active ingredient, the balance
comprising an orally dissolvable or degradable composition and,
optionally, one or more of the additional ingredients described
herein. Alternately, formulations suitable for buccal
administration may comprise a powder or an aerosolized or atomized
solution or suspension comprising the active ingredient. Such
powdered, aerosolized, or aerosolized formulations, when dispersed,
preferably have an average particle or droplet size in the range
from about 0.1 to about 200 nanometers, and may further comprise
one or more of the additional ingredients described herein.
[0187] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for
ophthalmic administration. Such formulations may, for example, be
in the form of eye drops including, for example, a 0.1-1.0% (w/w)
solution or suspension of the active ingredient in an aqueous or
oily liquid carrier. Such drops may further comprise buffering
agents, salts, or one or more other of the additional ingredients
described herein. Other ophthalmalmically-administ- rable
formulations which are useful include those which comprise the
active ingredient in microcrystalline form or in a liposomal
preparation.
[0188] As used herein, "additional ingredients" include, but are
not limited to, one or more of the following: excipients; surface
active agents; dispersing agents; inert diluents; granulating and
disintegrating agents; binding agents; lubricating agents;
sweetening agents; flavoring agents; coloring agents;
preservatives; physiologically degradable compositions such as
gelatin; aqueous vehicles and solvents; oily vehicles and solvents;
suspending agents; dispersing or wetting agents; emulsifying
agents, demulcents; buffers; salts; thickening agents; fillers;
emulsifying agents; antioxidants; antibiotics; antifungal agents;
stabilizing agents; and pharmaceutically acceptable polymeric or
hydrophobic materials. Other "additional ingredients" which may be
included in the pharmaceutical compositions of the invention are
known in the art and described, for example in Remington's
Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co.,
Easton, Pa.), which is incorporated herein by reference.
[0189] Typically dosages of the compound of the invention which may
be administered to an animal, preferably a human, range in amount
from 1 .mu.g to about 100 g per kilogram of body weight of the
animal. While the precise dosage administered will vary depending
upon any number of factors, including but not limited to, the type
of animal and type of disease state being treated, the age of the
animal and the route of administration. Preferably, the dosage of
the compound will vary from about 1 mg to about 10 g per kilogram
of body weight of the animal. More preferably, the dosage will vary
from about 10 mg to about 1 g per kilogram of body weight of the
animal.
[0190] The compound may be administered to an animal as frequently
as several times daily, or it may be administered less frequently,
such as once a day, once a week, once every two weeks, once a
month, or even less frequently, such as once every several months
or even once a year or less. The frequency of the dose will be
readily apparent to the skilled artisan and will depend upon any
number of factors, such as, but not limited to, the type and
severity of the disease being treated, the type and age of the
animal, etc.
[0191] The compound used to treat HIV infection may be
co-administered with the immunogenic dose of CD4-independent HIV-1
Env. Alternatively, the compound(s) may be administered an hour, a
day, a week, a month, or even more, in advance of the immunogenic
dose(s) of HIV-1 Env, or any permutation thereof. Further, the
compound(s) may be administered an hour, a day, a week, or even
more, after the immunogenic dose(s) of HIV-1 Env, or any
permutation thereof. The frequency and administration regimen will
be readily apparent to the skilled artisan and will depend upon any
number of factors such as, but not limited to, the type and
severity of the disease being treated, the age and health status of
the animal, the identity of the compound or compounds being
administered, the route of administration of the various compounds
and HIV-1 Env, and the like.
[0192] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0193] Definitions
[0194] As used herein, each of the following terms has the meaning
associated with it in this section.
[0195] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0196] As used herein, to "alleviate" a HIV-1 infection means
reducing the severity of the symptoms of the disease or
disorder.
[0197] The term "antibody," as used herein, refers to an
immunoglobulin molecule which is able to specifically bind to a
specific epitope on an antigen. Antibodies can be intact
immunoglobulins derived from natural sources or from recombinant
sources and can be immunoreactive portions of intact
immunoglobulins. Antibodies are typically tetramers of
immunoglobulin molecules. The antibodies in the present invention
may exist in a variety of forms including, for example, polyclonal
antibodies, monoclonal antibodies, Fv, Fab and F(ab).sub.2, as well
as single chain antibodies and humanized antibodies (Harlow et al.,
1988, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New
York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0198] By the term "synthetic antibody" as used herein, is meant an
antibody which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage as
described herein. The term should also be construed to mean an
antibody which has been generated by the synthesis of a DNA
molecule encoding the antibody and which DNA molecule expresses an
antibody protein, or an amino acid sequence specifying the
antibody, wherein the DNA or amino acid sequence has been obtained
using synthetic DNA or amino acid sequence technology which is
available and well known in the art.
[0199] By "biological activity," as the term is used herein, is
meant that the protein has the ability to interact with its
associated protein(s) and effectuate its normal function(s) within
the cell and/or with respect to HIV-1 infection. In one embodiment,
the 8x gp120 retains its biological activity in that the protein
does not require interaction with CD4 in order to bind to CXCR4
chemokine receptor protein, and to mediate fusion of the virus
envelope with the host cell membrane. Further, biological activity
as it refers to any form or fragment of Env, means that the
polypeptide has the ability to bind to a chemokine receptor protein
without the requirement that it also bind to CD4.
[0200] By "chemokine receptor binding site," as the term is used
herein, is meant the portion of the viral gp120 which specifically
binds the human chemokine receptor protein such as, but not limited
to, CXCR4 or CCR5. Thus, a CXCR4 chemokine receptor binding site
means a portion of the HIV-1 gp120 molecule which specifically
binds to CXCR4 chemokine receptor but which does not substantially
bind to another chemokine receptor such as CCR5. Similarly, a CCR5
chemokine receptor binding site means a portion of the HIV-1 gp120
molecule which specifically binds to CCR5 but which does not
significantly bind to any other molecule including another
chemokine receptor such as CXCR4 and the like.
[0201] By the term "CD4-independence," as the term is used herein,
is meant that the HIV-1 strain is capable of infecting cells which
do not express the CD4 protein and/or its gp120 can bind to a
coreceptor in the absence of CD4-induced conformational change(s).
However, the CD4-independent HIV-1 may also infect cells which
express CD4 and an appropriate chemokine receptor, although this is
not required.
[0202] By the term "chimera," as used herein, is meant a nucleic
acid encoding env comprising a portion of the 8x nucleic acid
encoding at least a portion of env covalently linked to at least
one nucleic acid encoding a portion of an env from a different
HIV-1 strain.
[0203] By the term "Env clone," as that term is used herein, is
meant an env nucleic acid encoding an Env protein, gp160,
comprising gp120 and gp41. A full-length Env clone encodes a
complete Env protein, gp160, while a partial clone includes
fragment(s) of a full-length clone that may be used to construct
smaller portions of the 8x Env that may comprise mutations that are
specific for 8x.
[0204] "Complementary" as used herein refers to the broad concept
of subunit sequence complementarity between two nucleic acids,
e.g., two DNA molecules. When a nucleotide position in both of the
molecules is occupied by nucleotides normally capable of base
pairing with each other, then the nucleic acids are considered to
be complementary to each other at this position. Thus, two nucleic
acids are complementary to each other when a substantial number (at
least 50%) of corresponding positions in each of the molecules are
occupied by nucleotides which normally base pair with each other
(e.g., A:T and G:C nucleotide pairs). As defined herein, an
antisense sequence is complementary to the sequence of a double
stranded DNA molecule encoding a protein. It is not necessary that
the antisense sequence be complementary solely to the coding
portion of the coding strand of the DNA molecule. The antisense
sequence may be complementary to regulatory sequences specified on
the coding strand of a DNA molecule encoding a protein, which
regulatory sequences control expression of the coding
sequences.
[0205] The use of the terms "nucleic acid encoding" or "nucleic
acid coding" should be construed to include the RNA or DNA sequence
which encodes the desired protein and any necessary 5' or 3'
untranslated regions accompanying the actual coding sequence.
[0206] By the terms "encoding" and "coding," as these terms are
used herein, is meant that the nucleotide sequence of a nucleic
acid is capable of specifying a particular polypeptide of interest.
That is, the nucleic acid may be transcribed and/or translated to
produce the polypeptide. Thus, for example, a nucleic acid encoding
HIV-1 Env is capable of being transcribed and/or translated to
produce an HIV-1 envelope protein.
[0207] As used herein, the term "fragment" as applied to a
polypeptide, may ordinarily be at least about seven contiguous
amino acids, typically, at least about fifteen contiguous amino
acids, more typically, at least about thirty contiguous amino
acids, typically at least about forty contiguous amino acids,
preferably at least about fifty amino acids, even more preferably
at least about sixty amino acids and most preferably, the peptide
fragment will be greater than about sixty contiguous amino acids in
length.
[0208] "Homologous" as used herein, refers to the subunit sequence
similarity between two polymeric molecules, e.g., between two
nucleic acid molecules, e.g., two DNA molecules or two RNA
molecules, or between two polypeptide molecules. When a subunit
position in both of the two molecules is occupied by the same
monomeric subunit, e.g., if a position in each of two DNA molecules
is occupied by adenine, then they are homologous at that position.
The homology between two sequences is a direct function of the
number of matching or homologous positions, e.g., if half (e.g.,
five positions in a polymer ten subunits in length) of the
positions in two compound sequences are homologous then the two
sequences are 50% homologous, if 90% of the positions, e.g., 9 of
10, are matched or homologous, the two sequences share 90%
homology. By way of example, the DNA sequences 3' ATTGCC 5' and 3'
TATGCG 5' share 50% homology.
[0209] Further, algorithms may be used to calculate the percent
homology between two nucleic acids or two proteins of interest and
these are well-known in the art.
[0210] By the term "immunogenic dose," as the term is used herein,
is meant an amount of protein, whether it is administered as
protein or as nucleic acid, which generates a detectable humoral
and/or cellular immune response to the protein compared to the
immune response of an otherwise identical mammal to which the
protein is not administered. In one aspect, the dose is
administered as Env protein or a fragment thereof. In another
aspect, the dose is administered as a nucleic acid.
[0211] By the term "isolated nucleic acid," as used herein, is
meant a nucleic acid sequence, or a fragment thereof, which has
been separated from the sequences which flank it in a naturally
occurring state, e.g., a DNA fragment which has been removed from
the sequences which are normally adjacent to the fragment, e.g.,
the sequences adjacent to the fragment in a genome in which it
naturally occurs. The term also applies to nucleic acids which have
been substantially purified from other components which naturally
accompany the nucleic acid, e.g., RNA or DNA or proteins, which
naturally accompany it in the cell. The term therefore includes,
for example, a recombinant DNA which is incorporated into a vector;
into an autonomously replicating plasmid or virus; or into the
genomic DNA of a prokaryote or eukaryote; or which exists as a
separate molecule (e.g., as a cDNA or a genomic or cDNA fragment
produced by PCR or restriction enzyme digestion) independent of
other sequences. It also includes a recombinant DNA which is part
of a hybrid gene encoding additional polypeptide sequences.
[0212] By the terms "isolated peptide," "isolated polypeptide," or
"isolated protein," as used herein, is meant a peptide or protein
which has been substantially separated from the components, e.g.,
DNA, RNA, other proteins and peptides, carbohydrates and lipids,
which naturally accompany the protein or peptide in the cell. The
terms isolated peptide and protein may be construed to include a
peptide or protein which is expressed and/or secreted from a cell
comprising an isolated nucleic acid.
[0213] "Mutants," "derivatives," and "variants" of the peptides of
the invention (or of the DNA encoding the same) are peptides which
may be altered in one or more amino acids (or in one or more base
pairs) such that the peptide (or DNA) is not identical to the
sequences recited herein, but has the same property as the peptides
disclosed herein, in that the peptide has the property of binding
to a chemokine receptor protein in a CD4-independent manner.
[0214] As used herein, the term "pharmaceutically-acceptable
carrier" means a chemical composition with which an appropriate Env
protein, may be combined and which, following the combination, can
be used to administer the protein to a patient.
[0215] By the term "specifically binds," as used herein, is meant a
chemokine receptor binding site which recognizes and binds, for
example, CXCR4 polypeptide, but does not substantially recognize or
bind other molecules in a sample. Similarly, a chemokine receptor
binding site "specifically binds CXCR4" if the binding site
recognizes and binds CXCR4 in a sample but does not substantially
recognize or bind to other molecules, e.g., CCR5, in a sample.
Similarly, a chemokine receptor binding site may specifically bind
CCR5 and, thus, would not bind other molecules such as CXCR4.
[0216] A swarm refers to an uncloned stock of HIV from infected
cells. Such stocks are known to contain many genetically distinct
variants of a founder or a parental virus, hence the term
"swarm."
[0217] The term "stably exposed chemokine receptor binding site,"
as used herein, means that the gp120 chemokine receptor binding
site is available to bind to the chemokine receptor protein without
the need for gp120 interaction with CD4 which typically, is a
prerequisite to gp120 binding of the chemokine receptor protein. As
demonstrated by the data disclosed herein, the chemokine receptor
binding site of gp120 can exist in a stable, exposed configuration
which is more sensitive to antibody neutralization than the
otherwise identical CD4-dependent gp120 prior to binding of CD4.
The stably exposed form of the chemokine binding site can exist in
solution for a period of at least about three months and/or
indefinitely.
[0218] As used herein, the term "substantially pure" describes a
compound, e.g., a nucleic acid, protein or polypeptide, which has
been separated from components which naturally accompany it.
Typically, a compound is substantially pure when at least about
10%, preferably at least about 20%, more preferably at least about
50%, still more preferably at least about 75%, even more preferably
at least about 90%, and most preferably at least about 99% of the
total material (by volume, by wet or dry weight, or by mole percent
or mole fraction) in a sample is the compound of interest. Purity
can be measured by any appropriate method, e.g., by column
chromatography, gel electrophoresis or HPLC analysis.
[0219] A compound, e.g., a nucleic acid, a protein or polypeptide
is also "substantially purified" when it is essentially free of
naturally associated components or when it is separated from the
native contaminants which accompany it in its natural state. Thus,
a "substantially pure" preparation of a nucleic acid, as used
herein, refers to a nucleic acid sequence which has been purified
from the sequences which flank it in a naturally occurring state,
e.g., a DNA fragment which has been removed from the sequences
which are normally adjacent to the fragment in a genome in which it
naturally occurs.
[0220] Similarly, a "substantially pure" preparation of a protein
or a polypeptide, as used herein, refers to a protein or
polypeptide which has been purified from components with which it
is normally associated in its naturally occurring state.
[0221] As used herein, to "treat" means reducing the frequency with
which symptoms of the HIV-1 infection are experienced by a
patient.
[0222] By "triggered," as the term is used herein, it is meant that
the HIV-1 Env protein does not require binding to CD4 before gp120
can bind to a chemokine receptor protein such as CXCR4 or CCR5.
Preferably, a triggered Env comprises a gp120 that is in a
conformation that can bind chemokine receptors in the absence of
binding to CD4.
[0223] By the term "vector" as used herein, is meant any plasmid or
virus encoding an exogenous nucleic acid. The term should also be
construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into virions or cells, such as,
for example, polylysine compounds and the like. The vector may be a
viral vector which is suitable as a delivery vehicle for delivery
of the HIV-1 Env protein or nucleic acid encoding the HIV-1 env, to
the patient, or the vector may be a non-viral vector which is
suitable for the same purpose. Examples of viral and non-viral
vectors for delivery of DNA to cells and tissues are well known in
the art and are described, for example, in Ma et al. (1997, Proc.
Natl. Acad. Sci. U.S.A. 94:12744-12746). Examples of viral vectors
include, but are not limited to, a recombinant vaccinia virus, a
recombinant adenovirus, a recombinant retrovirus, a recombinant
adeno-associated virus, a recombinant avian pox virus, and the like
(Cranage et al., 1986, EMBO J. 5:3057-3063; International Patent
Application No. WO94/17810, published Aug. 18, 1994; International
Patent Application No. WO94/23744, published Oct. 27, 1994).
Examples of non-viral vectors include, but are not limited to,
liposomes, polyamine derivatives of DNA, and the like.
[0224] By the term "vaccine," as the term is used herein, is meant
a compound which when administered to a human or veterinary
patient, induces a detectable immune response, humoral and/or
cellular, to HIV-1 or a component(s) thereof.
EXAMPLE 1
Determinants of CD4-independence for an HIV-1 Map Outside Regions
Required for Coreceptor Specificity
[0225] The experiments presented in this example may be summarized
as follows.
[0226] Although infection by HIV typically requires an interaction
between the viral envelope glycoprotein (Env), CD4, and a chemokine
receptor, CD4-independent isolates of HIV and SIV have been
discovered herein. The present invention discloses the derivation
of a variant of HIV-1/IIIB, termed HIV-1/IIIBx, which exhibits the
ability to utilize CXCR4 in the absence of CD4. This virus infected
CD4-negative T and B cells and fused with murine 3T3 cells
expressing human CXCR4 alone.
[0227] A functional HIV-1/IIIBx env clone exhibited several
mutations, including the striking loss of 5 glycosylation sites.
The data disclosed herein demonstrate the construction of chimeras
with CD4-dependent envs. The data disclose that the determinants
for CD4-independence map outside the V1/V2 and V3 hypervariable
loops, which determine chemokine receptor specificity, and, at
least in part, within an area on the gp120 core that has been
implicated in forming a conserved chemokine receptor binding site.
Further, the data disclosed herein demonstrate that when the V3
loop of a CCR5-tropic Env was substituted into the HIV-1/IIIBx Env,
the resulting chimera utilized CCR5 but remained CD4-independent.
Thus, the data disclosed demonstrate, for the first time, that Env
determinants for chemokine receptor specificity are distinct from
those that mediate use of that receptor for cell fusion. These
findings provide evidence that mutations in HIV-1/IIIBx expose a
conserved chemokine receptor binding site that can interact with
either CXCR4 or CCR5 in the absence of CD4 and may have important
implications for designing Envs with exposed chemokine receptor
binding sites for vaccine development.
[0228] The data presented herein disclose the derivation and
molecular characterization of a variant of HIV-1/IIIB, termed
HIV-1/IIIBx, which acquired the ability to utilize CXCR4 in the
absence of CD4. A functional HIV-1/IIIBx env clone (8x) was used to
construct chimeras with a closely related but CD4-dependent env,
and the determinants for CD4 independence were shown to map in
part, to the conserved chemokine receptor binding site and outside
the variable loops. Remarkably, when 8x contained the V3 loop of a
CCR5-tropic Env, it utilized CCR5 but maintained CD4 independence.
These findings provide evidence that CD4 binding likely exposes a
domain on the gp120 core that can interact with genetically
divergent chemokine receptors. This work may have important
implications in designing HIV-1 Env proteins with exposed chemokine
receptor contact sites that could exhibit novel biochemical and
immunogenic properties.
[0229] The Materials and Methods used in the experiments presented
in this example are now described.
[0230] Cells, Viruses and Infectivity Assays
[0231] Hut-78 and SupT1 are immortalized CD4+ T cell lines. BC7 is
a CD4-negative line derived from SupT1 (Endres et al., 1996, Cell
87:745-756 ). Uncloned HIV-1/IIIB was obtained in chronically
infected Hut-78 cells as described in Popovic et al. (1984, Science
224:497-500). Supernatant virus from this infected Hut-78 cell
culture was serially passaged onto SupT1 cells from which
HIV-1/IIIBx was isolated by subsequent passage onto BC7. The
IIIB/Sup virus was derived from early passage HIV-1/IIIB in SupT1.
NIH-3T3 cells, untransfected and stably transfected with human
CXCR4, were described in (Deng et al.,1996, Nature 381:661-666).
Reverse transcriptase (RT) assays were performed on culture
supernatants as described in Endres et al. (1997, Science
278:1462-1464). For neutralization assays, BC7 cells were
preincubated with varying concentrations of anti-CXCR4 MAb, or 12G5
(Endres et al., 1997, supra), for 30 minutes at 37.degree. C., the
cells were then inoculated with HIV-1/IIIBx (10 TCID.sub.50) and
the cells were monitored for RT activity.
[0232] PCR, Cloning. Virus Production and Chimera Construction
[0233] Full-length env coding regions were amplified by PCR from
genomic DNA of chronically infected cells using the sense primer
5'-CGCAACCTATACCAATAGTAGCAA-3' [SEQ ID NO:1] and the antisense
primer 5'-CAGTAAGCCATCCAATCACACTAC-3' [SEQ ID NO:2] in a BioCycler
(Ericomp, San Diego, Calif.). The PCR product was TA-cloned into
pCDNA3.1 (Invitrogen, San Diego, Calif.) and tested in a reporter
gene fusion assay. Functional clones of HIV-1/IIIBx (8x) and
IIIB/Sup (S10) were sequenced using an automated sequencer. Clones
were also subcloned into pSP73 (Promega Corp., Madison, Wis.) that
contained the HXBc2 env using Asp718 and BamH1 (Hoffman et al.,
1998, Proc. Natl. Acad. Sci. U.S.A. 95:11360-11365).
[0234] Functional env clones were sub-cloned into the 3' hemigenome
of pNL4-3 (from the EcoRI site) using unique NdeI and BamHI
restriction sites in env, which encompass the mutations in
HIV-1/IIIBx and IIIB/Sup. Virus was generated by digesting 20 .mu.g
each of the 5' pNL4-3 .DELTA.vpr hemigenome (to the EcoRI site)
(Gibbs et al., 1994, AIDS Res. Hum. Retroviruses. 10:343-350) and
the various 3' hemigenome constructs with EcoRI, phenol extracting,
and coprecipitating before transfection into BC7 and SupT1 by
electroporation. Cells were monitored for syncytia formation and
supernatant virus harvested to generate virus stocks. HIV-1/IIIB
virus stocks were frozen at -70.degree. C. in 1 ml aliquots.
HIV-1/IIIBx and 8x virus stocks were frozen at -140.degree. C. in
5% sucrose to preserve infectivity. Chimeras between 8x and S10 or
HXBc2 (Hoffman et al., 1998, Proc. Natl. Acad. Sci. U.S.A.
95:11360-11365) were constructed using a BsaBI site (nt 7673) to
isolate changes in SU (i.e., the gp120 portion of Env which is the
surface portion of Env) from TM (i.e., the gp41 portion of Env
which is the transmembrane portion of Env) and DraIII (nt 6714),
StuI (nt 6948), and Bsu36I (nt 7430) to isolate V1-V2, V3, and
V4/C4 regions, respectively. Clones containing the V3 loop of an R5
virus were constructed by subcloning the Asp718-BamHI fragment from
a proviral clone of HXB with the V3 loop of BaL (Hwang et al.,
1991, Science 253:71-74) into pSP73-HXBc2 (Hoffman et al., 1998,
Proc. Natl. Acad. Sci. U.S.A. 95:11360-11365). A version of 8x
containing the V3-loop of BaL was made in a similar fashion, by
inserting the StuII-Bsu36I fragment of this provirus into
pSP73-8x.
[0235] Cell-cell Fusion Assay
[0236] The ability of env genes to mediate cell-cell fusion was
evaluated using a luciferase-based gene reporter assay (Rucker et
al., 1997, Methods Enzymol. 288:118-133). Briefly, quail QT6 cells
were co-transfected with plasmids containing HIV envs by CaPO.sub.4
and infected with a vaccinia virus expressing T7 RNA polymerase
(Alexander et al., 1992, 1992, J. Virol. 66:2934-2942). These cells
were mixed with quail QT6 cells transiently expressing human CXCR4
or CCR5 with or without human CD4 and the luciferase gene under the
control of the T7 promoter. Fusion was quantified by lysing the
cells 7-8 hours after combining the cells and measuring luciferase
expression with a luminometer.
[0237] Reverse Transcriptase Assays
[0238] The productive infection of cells was documented by
detection of the reverse transcriptase (RT) activity in the culture
supernatant as previously described (Hoxie et al., 1985, Science
229:1400-1402). Briefly, virus from 1 ml of clarified culture
supernatant was pelleted at 100,000.times.g for 30 minutes at
4.degree. C. and the virus was solubilized in 100 .mu.l
solubilizing buffer (0.15 M Tris pH 8, 0.4 M NaCl, 0.25% Triton
X-100, 10% glycerol, 0.5 mM D.T.). Duplicate 20 .mu.l aliquots were
mixed with 85 .mu.l RT cocktail (67.5 mM Tris pH 7.5, 1.3 mM D.T.,
1 mM ATP, 13.5 mM MgCl.sub.2 containing 0.05 units poly r(A) and
12.5 .mu.Ci .sup.3H-dTTP) and incubated for 1 hour at 37.degree. C.
The tubes were placed on ice, 225 .mu.g tRNA was added to each
tube, and RNA was precipitated with cold 10% TCA. Precipitated RNA
was captured on a glass fiber filter, and the RNA was washed with
TCA and EtOH. The filters were dried and the radioactivity present
on each filter (in counts per minute, cpm) was determined in a
scintillation counter (LKB/Wallac, Turku, Finland).
[0239] Mutagenesis
[0240] Point mutations were engineered into Env constructs in pSP73
using the Quickchange.TM. Site Directed Mutagenesis Kit
(Stratagene, La Jolla, Calif.) according to the manufacturer's
specifications. The following primer pairs produced the D368R
mutation that ablated CD4 binding: D368R-forward,
5'CCTCAGGAGGGGACCCAGAAATTGTAACGC-3' (SEQ ID NO:5); D368R-reverse,
5'GCGTTACAATTTCTGGGTCCCCTCCTGAGG-3' (SEQ ID NO:6). Reciprocal
exchange of residues at position 431 in 8x and S10 was accomplished
using two sets of oligonucleotides:
1 (SEQ ID NO:7) 8x-G431E-forward 5'-GGCAGGAAGTAGAAAAAGCAATG- TATGCC
CC-3' and (SEQ ID NO:8) 8X-G431E-reverse
5'GGGGCATACATTGCTTTTTCTACTTCCTGC C-3' and (SEQ ID NO:9)
S10-E431G-forward 5'-GGCAGGAAGTAGGAAAAGCAA- TGTATGCC CC-3' and (SEQ
ID NO:10) S10-E431G-reverse 5'-GGGGCATACATTGCTTTTCAATGTATGCC
CC-3'.
[0241] Western Blot
[0242] Virus isolated from the supernatant of an infected cell
culture was pelleted at 100,000.times.g for 90 minutes at 4.degree.
C., and the virus pellet resuspended in lysis buffer (20 mM Tris pH
8.0, 120 mM NaCl, 0.2% sodium deoxycholate, 0.5% NP-40, 0.2 mM
EGTA, 0.2 mM NaF, 1 .mu.M pepstatin, 5 .mu.g/in leupeptin, 5
.mu.g/ml aprotinin) on ice. Equal volumes of lysate and 2.times.
sample buffer (50 mM Tris, pH 6.8, 2% SDS, 30% glycerol, 10%
.beta.-mercaptoethanol, 0.2% pyronine Y) were boiled for 7 minutes,
chilled on ice for 7 minutes, and the samples were then run on a
12% SDS-PAGE gel.
[0243] The proteins were transferred from the gel to nitrocellulose
(BioRad Laboratories, Richmond, Calif.) using a Multiphor II
semi-dry electrotransfer apparatus (Pharmacia-LKB Biotechnology
Inc., Piscataway, N.J.). The presence of HIV-1 transmembrane
proteins was detected on the blot using the D12 mouse monoclonal
antibody as described in Earl et al. (1997, J. Virol.
71:2674-2684), followed by biotinylated sheep anti-mouse IG (heavy
and light chains) (Jackson ImmunoResearch Laboratories, West Grove,
Pa.), streptavidin-conjugated to horse radish peroxidase
(streptavidin-HRP, Amersham, Arlington Heights, Ill.) and
chemiluminescence substrate (Pierce Chemical Co., Rockford,
Ill.).
[0244] The Results of the experiments presented in this example are
now described.
[0245] Derivation of a CD4-independent Variant of HIV-1/IIIB
[0246] A CD4-independent variant of HIV-1/IIIB was derived by
serial passage of an uncloned stock of HIV-1/IIIB in SupT1 and then
inoculating BC7, a CD4-negative line of SupT1 (Endres et al., 1996,
Cell 87:745-756). In one experiment, approximately 5% of BC7 cells
were positive for viral p24.sup.gag by immunofluorescence assay
(IFA). Virus from this culture was passaged twice onto uninfected
BC7 cells and a chronically infected line was established. Virus
from this line, termed HIV-1/IIIBx, was compared to an earlier
passage of HIV-1/IIIB in SupT1 cells, designated IIIB/SupT1. As
shown in FIG. 1A, only HIV-1/IIIBx could infect BC7 while both
viruses were able to infect SupT1. HIV-1/IIIBx was also able to
infect Raji cells, a CD4-negative B lymphoblastoid cell line.
Infection of BC7 could be completely inhibited by the anti-CXCR4
MAb, 12G5 (FIG. 1B), indicating that this infection was likely
mediated by CXCR4. Moreover, HIV-1/IIIBx-infected BC7 cells induced
syncytia when cocultured with murine 3T3 fibroblasts that stably
expressed human CXCR4 while no fusion was induced on untransfected
3T3 cells (FIG. 1C). In addition, no fusion was observed when
HIV-1/IIIB-infected HUT-78 cells were cocultured with the
CXCR4-expressing 3T3 cells. Together, these data indicate that the
HIV-1/IIIBx variant can utilize CXCR4 as a primary receptor in the
absence of CD4 on T and B lymphoid cell lines and murine
fibroblasts.
[0247] Cloning and Characterization of a Functional HIV-1/IIIBx
env
[0248] A full length env clone of HIV-1/IIIBx (designated 8x) (SEQ
ID NO:4) was amplified by PCR from infected BC7 cells, cloned into
pSP73, and compared to a prototypic CD4-dependent IIIB clone
(HXBc2) in a cell fusion assay. Both 8x and HXBc2 were able to
mediate fusion on quail QT6 cells expressing both CD4 and CXCR4,
but only 8x could fuse with cells that expressed CXCR4 alone (FIG.
2). Of note, 8x fusion was enhanced when CD4 and CXCR4 were
co-expressed, indicating that the 8x Env was likely still able to
interact with CD4. Additionally, the 8x env cloned into the pNL4-3
provirus generated a replication competent virus that infected
SupT1 as well as BC7 cells (FIG. 3A), providing further proof that
the 8x Env was able to utilize CXCR4 in the absence of CD4, and
that the 8x clone was representative of the uncloned parental IIIBx
virus.
[0249] The CD4-independence of the 8x was further evaluated by
introducing an Asp to Arg substitution at gp120 amino acid position
368. This Asp is highly conserved among all HIV-1 isolates and is a
critical determinant for CD4 binding by forming a salt bridge with
Arg-59 in the CDR2 loop of CD4 (Kwong et al., 1998, Nature
393:648-659). Mutations at this position have been shown to ablate
CD4-binding (Olshevsky et al., 1990, J. Virol. 64:5701-5705). As
shown in FIG. 2, although a D368R (i.e., Asp to Arg at amino acid
368) mutation abrogated fusion by HXBc2 on cells that coexpressed
CD4 and CXCR4, this mutation did not affect 8x-mediated fusion on
target cells expressing only CXCR4. Unlike the 8x clone, fusion of
8x-D368R was not enhanced when CD4 was co-expressed with CXCR4,
confirming that the 8x-D368R Env was unable to interact with CD4.
Thus, the 8x Env was not only able utilize CXCR4 in the absence of
CD4, but could tolerate a mutation that destroyed the CD4 binding
site on gp120.
[0250] Sequence Analysis of env Clones
[0251] Sequences of 8x (SEQ ID NO:3) and S10 (SEQ ID NO:12) were
compared to the published sequence of HXBc2 (SEQ ID NO:11) (FIG.
4). While the number of mutations in 8x is large (16 in gp120 and 7
in TM), 6 of the mutations in gp120 and 2 in TM have been observed
in other env clones derived from HIV-1/IIIB and, thus, are likely
not involved in the CD4-independent phenotype. In gp120, 8 of the
11 unique mutations were in the hypervariable loops, V1/V2 (S143G,
I165K, G167S, Q170K, and T188P), V3 (R298K, Q310H, and I320V), and
V4 (N386K). Three mutations were in the gp120 core (D62E, N339S,
I423V). Interestingly, 5 mutations in the gp120 resulted in the
loss of potential N-linked glycosylation sites, and 4 of these
(S143G, T188P, N339S, and N386K) were unique to 8x. The 4
8x-specific mutations in the external domain of TM were located
within the two regions that form coiled coils (T536A, L544S, N651I
and K655M). Remarkably, 8x also contained a single nucleotide
deletion in the TM membrane-spanning domain that introduced a
frame-shift at position 706 generating a divergent cytoplasmic tail
of only 30 amino acids. This feature is surprising since HIV-1
viruses with truncated cytoplasmic tails typically have been
attenuated or non-infectious (Shimizu et al., 1992, Virology
189:534-546; Dubay et al., 1992, J. Virol. 66:6616-6625; Chen et
al., 1996, Virology 226:260-268). Nonetheless, as noted above, the
8x Env was able to generate a replication competent virus that
could infect SupT1 as well as BC7 cells (FIG. 3A). Moreover,
western blots of viral lysates from uncloned HIV-1/IIIBx as well as
from NL4-3 containing the 8x env demonstrated a TM of approximately
35 kD compared to 41 kD for parental HIV-1/IIIB (FIG. 3B).
[0252] Mapping CD4-independence Using Chimeric Env Proteins
[0253] To identify determinants of CD4-independence, a set of
reciprocal chimeras was generated between 8x and HXBc2. Unique
restriction sites were chosen to isolate mutations in gp120 from
those in TM and to define the effects of mutations in the V1/V2,
V3, and the V4/C4 subdomains (FIG. 5). Chimeras were cloned into
pSP73 and were analyzed in fusion assays as described herein on
target cells expressing CXCR4 alone or with CD4. The results for
each chimera are expressed as the percentage of fusion activity of
the HXBc2 Env fusion activity on target cells that expressed both
CXCR4 and CD4. All chimeras were functional when CXCR4 and CD4 were
coexpressed on the target cells, although considerable quantitative
differences were detected with fusion activities ranging from about
50% to about 500% that of HXBc2 (FIG. 6). Reciprocal chimeras that
exchanged the entire gp120 and TM were CD4-dependent, although an
assessment of the 8x gp120 with an HXBc2 TM [8x (gp120)] was
somewhat limited due to the poor overall fusion activity of this
Env. Of note, chimeras that contained the 8x TM were more fusogenic
than HXBc2 or chimeras that contained an HXBc2 TM, suggesting that
determinants in the 8x ectodomain or the prematurely truncated
cytoplasmic tail were contributing to the increased fusogenicity of
these clones. Nonetheless, these finding suggested that
determinants for CD4-independence were not entirely restricted to
gp120 or TM.
[0254] Among chimeras that introduced gp120 subdomains of HXBc2
into an 8x background, replacement of V1/V2 and V3 loops either
individually or in combination failed to eliminate CD4-independence
(FIG. 6; see chimeras HX(V1/V2), HX(V3), HX(V1-V3)). This finding
was of interest given the importance of these loops as determinants
of chemokine receptor specificity (Cho et al., 1998, J. Virol.
72:2509-2515; Choe et al., 1996, Cell 85:1135-1148; Cocchi et al.,
1996, Nature Med. 2:1244-1247; Hoffman et al., 1998,.Proc. Natl.
Acad. Sci. USA 95:11360-11365; Ross and Cullen, 1998, Proc. Natl.
Acad. Sci. USA 95:7682-7686; Speck et al., 1997, J. Virol.
71:7136-7139). For these chimeras, fusion activity relative to 8x
was reduced (80%) on both CD4-negative and -positive cells,
although CD4-dependent fusion was still greater than that seen with
HXBc2. In contrast, fusion activity of HX(v4/C4), which contained
the HXBc2 V4/C4, was reduced on CD4 negative cells but was
unchanged on CD4+ cells. Interestingly, when both the V3 and V4/C4
domains of 8x were replaced with those of HXBc2 [HX(V3-C4)],
CD4-independent fusion was completely abrogated, while fusion in
the presence of CD4 was unaffected.
[0255] For chimeras in which domains of 8x were placed on an HXBc2
background, no single region of gp120 was able to confer
CD4-independence to HXBc2, consistent with evidence noted above
that determinants in both gp120 and TM are required (FIG. 6).
However, an HXBc2 chimera that contained both the V4/C4 and TM
domains from 8x [8x(V4-TM)] was highly competent for both
CD4-dependent and independent fusion. Collectively these findings
with 8x- and HXBc2-based chimeras indicate that determinants in the
8x gp120 V3 and, particularly, the V4/C4 domain contribute to the
CD4-independent phenotype of 8x, but only when associated with the
8x TM.
[0256] Evaluation of a CD4-dependent Clone from IIIBx-infected
Cells
[0257] A CD4-dependent Env was also derived from IIIBx-infected
SupT1 cells. This clone, termed S10, was able to mediate fusion on
QT6 cells that coexpressed CXCR4 and CD4, but was unable to fuse in
the absence of CD4 (FIG. 7). Sequence analysis demonstrated that
S10 shared several mutations with 8x relative to HXBc2 (8 in gp120
and 3 in gp41) (FIG. 4). In addition, S10 contained several unique
mutations: in gp120, G431E in C4 and S461N in V5, and in TM, six
additional amino acid changes in the ecto- and membrane spanning
domains, including the loss of predicted N-lined glycosylation
sites at positions 611 and 674 (FIG. 4). S10 also contained a 55 nt
deletion in the TM cytoplasmic tail that, similar to 8x, produces a
frameshift mutation and a prematurely truncated cytoplasmic tail.
This deletion also disrupts the rev open reading frame by
eliminating the nuclear localization signal at the N terminus and
introducing a frame-shift mutation that truncates the protein
before the RRE-binding site (Pollard and Malim, 1998, Annu. Rev.
Microbiol. 52:491-532). Finally, S10 lacked several changes that
were present in the 8x gp120 (S143G, G167S, Q310H, and I423V) and
TM (N651I). Even though S10 was functional in fusion assays on
CD4+/CXCR4+ target cells, this env was unable to generate
infectious virus when cloned into NL4-3, likely as a result of its
non-functional Rev Protein.
[0258] Because the S10 Env shared several mutations with 8x but was
completely CD4-dependent, a set of chimeras between 8x and S10 were
made to identify the determinants for this change. As shown in FIG.
7, chimeras that contained the 8x V3 and V4/C4 [8x(V3-C4)] or V4/C4
alone [8x (V4/C4] on an S10 background exhibited some
CD4-independence while the reciprocal chimeras on an 8x background,
[S10(V3-C4)] and [S10(V4/C4)], were completely CD4-dependent.
Because the S10 V4/C4 domain contained a unique G431E mutation, the
possibility that this change could have a negative effect on
CD4-independence was considered. Indeed, when a Gly was restored at
this position in S10 (S10-E431G), this clone exhibited a limited
degree of CD4-independence on CXCR4-expressing target cells.
Moreover, when the G431E mutation was introduced into 8x
(8x-G431E), this clone remained fusion competent but became
completely CD4-dependent (FIG. 7). Thus, a charge change within the
C4 domain was sufficient to abrogate CD4-independence of 8x, and
these data further support the mapping data obtained using the
8x/HXBc2 chimeras described above that implicated this region as
being critical to the CD4-independent phenotype.
[0259] CCR5-tropic V3 Loop Alters Chemokine Receptor Specificity
but not CD4-independence
[0260] Given the importance of the V3 loop in determining chemokine
receptor specificity and the evidence that determinants for CD4
independence were located outside this domain, the extent to which
tropism and CD4-independence of 8x could be dissociated was
examined. An HXB2 gp120 that contained the V3 loop from the
macrophage/CCR5-tropic isolate HIV-1/BaL (HXB2-V3BaL) (Hwang et
al., 1991, Science 253:71-74) was used to introduce the BaL V3 loop
into 8x. The resulting chimera (8x-V3BaL) was compared to 8x, HXBc2
and HXB2-V3BaL in fusion assays on target cells that expressed
CXCR4 or CCR5, in the presence or absence of CD4 (FIG. 8). As the
data disclosed herein demonstrate, HXBc2 and HXB2-V3BaL exhibited
fusion on CXCR4- or CCR5-expressing cells, respectively, and their
activity was strictly CD4-dependent. In contrast, the 8x-V3BaL
chimera was both CCR5-tropic and CD4-independent. Thus,
determinants for CD4-independence of 8x are functionally distinct
from those that mediate chemokine receptor tropism.
[0261] The data disclosed herein demonstrate the derivation and
characterization of a CD4-independent variant of HIV-1/IIIB, termed
HIV-1/IIIBx, that could utilize CXCR4 in the absence of CD4. The 8x
env clone of IIIBx was able to generate a replication competent,
CD4-independent virus when cloned into an HV-1 provirus and could
mediate fusion on CXCR4-expressing quail cells in the absence of
CD4. This clone was also fully functional when Arg was substituted
for Asp at gp120 position 368, a residue previously shown to be
critical to the formation of the DE4 binding site (Kwong et al.,
1998, Nature 393:648-659; Olshevsky et al., 1990, J. Virol.
64:5701-5705). Sequence analysis of 8x revealed 17 mutations that
have not been described in other HIV-11/IIIB proviral clones and a
remarkable net loss of 5 glycosylation sites on gp120. Reciprocal
chimeras between 8x and a related CD4-dependent clone, HXBc2,
indicated that the determinants for CD4 independence mapped outside
the hypervariable V1/V2 and V3 loops. An HXBc2 chimera that
contained both the V4/C4 and TM domains of 8x was CD4-independent
while chimeras that contained either domain alone were
CD4-dependent. In addition, a CD4-dependent clone from the IIIBx
swarm, S10, that contained a unique G431E mutation in the gp120 C4
domain became CD4-independent when this mutation was corrected.
Introduction of the G431 E mutation into 8x rendered this Env
completely CD4-dependent, indicating that a charge change at this
position was sufficient to disrupt CD4-independent but not
CD4-dependent utilization of CXCR4. Collectively, these findings
indicate that a chemokine receptor binding site exists on the gp120
core, and that mutations in this region can, in association with
alterations in TM, render an HIV-1 Env fully functional in the
absence of CD4.
[0262] The HIV-1 V3 loop has been shown to be a principal
determinant for chemokine receptor specificity for CCR5 or CXCR4
following CD4 binding (Cho et al., J. Virol. 72:2509-2515; Choe et
al., 1996, Cell 85:1135-1148; Cocchi et al., 1996, Nature Med.
2:1244-1247; Speck et al., 1997, J. Virol. 71:7136-7139; Trkola et
al., 1998, J. Virol. 72:1876-1885; Wu et al., 1996, Nature
384:179-183). More recently, the V1/V2 region has also been shown,
in the context of an appropriate V3, to mediate use of additional
chemokine receptors including CCR3, CCR2b, STRL33, and APJ (Hoffman
et al., 1998, Proc. Natl. Acad. Sci. USA 95:11360-11365; Ross and
Cullen, 1998, Proc. Natl. Acad. Sci. USA 95:7682-7686) suggesting
that cooperative interactions between V1/V2 and V3 are involved in
chemokine receptor recognition. These loops are known to undergo
conformational changes following CD4 binding (Jones et al., 1998,
J. Biol. Chem. 273:404-409; Moore et al., 1994, J. Virol.
68:469-484; Wu et al., 1996, Nature 384:179-183; Wyatt et al.,
1992, J. Virol. 66:6997-7004) that may facilitate an interaction
with a particular chemokine receptor (Jones et al., 1998, J. Biol.
Chem. 273:404-409; Wu et al., 1996, Nature 384:179-183; Wyatt et
al., 1992, J. Virol. 66:6997-7004). However, while these findings
have suggested that V3 itself may contain a chemokine receptor
binding site, the marked genetic diversity of V3 loops among CCR5-
or CXCR4-tropic viruses indicates either that these loops contain a
common structural element or that other regions on Env also
contribute to chemokine receptor utilization. Recently, mutagenesis
of a CCR5-tropic HIV-1 gp120 has identified a probable CCR5 binding
site on Env that is formed by a bridging sheet that connects the
inner and outer domains of the gp120 core. This region is located
between the bases of the V1/V2 and V3 loops and is predicted to be
oriented towards the cell membrane following CD4 binding (Rizzuto
et al., 1998, Science 280:1949-1953). The remarkable conservation
of amino acids in this region among CCR5- and CXCR4-tropic Envs has
suggested that this site could represent a generic chemokine
receptor binding domain capable of interacting with multiple
chemokine receptors. These findings are consistent with a model in
which CD4-induces movement of the V1/V2 and V3 loops, which
facilitates an initial interaction with a specific chemokine
receptor and exposes this conserved binding site that is then
required for fusion to occur (Rizzuto et al., 1998, Science
280:1949-1953; Wyatt and Sodroski, 1998, Science
280:1884-1888).
[0263] Because determinants for CD4-independence of the 8x clone
mapped outside regions required for chemokine receptor specificity,
the possibility that a different V3 might change the chemokine
receptor tropism of 8x without affecting its CD4-independence was
investigated. Remarkably, the data disclosed herein demonstrate
that when the V3 loop from a CCR5-tropic Env (HIV-1BaL) was
inserted into 8x, the resulting chimera was able to mediate
CD4-independent fusion on CCR5-expressing cells. No fusion on
CXCR4-expressing cells with or without CD4 was observed for this
chimera. In contrast, a chimera containing the HIV-1/BaL V3 loop on
an HxBc2 background utilized CCR5 but was completely CD4-dependent.
These data clearly indicate that chemokine receptor specificity and
the utilization of that receptor for fusion are mediated by
distinct regions of gp120. Moreover, the data disclosed herein also
provide direct evidence that, although specificity determinants on
V3 are still required, a region on the gp120 core that is rendered
functional on CD4-independent viruses is able to mediate fusion
using genetically divergent chemokine receptors.
[0264] The bridging sheet on gp120 noted above is made up largely
of amino acids from the C4 domain and the V1IV2 stem (Rizzuto et
al., 1998, Science 280:1949-1953). This region has also been shown
to contribute to the formation of gp120 epitopes that are induced
by CD4 binding (Kwong et al., 1998, Nature 393:648-659; Thali et
al., 1993, J. Virol. 67:3978-3988). Interestingly, the two
mutations in the 8x V4/C4 domain (N386K and 1423V) and a third
mutation near the base of the V3 loop (R298K) map to positions that
immediately flank this area (FIG. 9A). As the data disclosed herein
demonstrate, an 8x chimera that included the corresponding V3 and
V4/C4 domains from HXBc2 and that lacked these mutations was highly
competent for fusion but was completely CD4-dependent (FIG. 6).
Without wishing to be bound by theory, the remarkable proximity of
R298K, N386K, and I423V to the putative chemokine receptor binding
domain strongly suggests that these mutations expose this site
and/or help to present it to the chemokine receptor during viral
attachment. Further, data disclosed elsewhere herein (Example 2,
infra) demonstrate that recombinant 8x gp120 is able to bind to
CXCR4-expressing cells independently of CD4 and that CD4-induced
epitopes that are partially contained within the gp120 chemokine
receptor domain are stably exposed in the absence of CD4 binding.
In addition, the G431E mutation in C4, which was sufficient to
abrogate CD4-independence on S10 and 8x, is shown by the crystal
structure of the gp120 core to be juxtaposed to residues at the
base of the V1/V2 stem that contribute to the chemokine receptor
binding site (FIG. 9B). Without wishing to be bound by theory, the
acquisition of a negative charge at this residue could alter the
orientation of the V1/V2 loops and/or affect the conformation of
the chemokine receptor binding site on gp120. Regardless of the
mechanism, it is apparent that mutations in or around this
chemokine receptor binding site can impact positively or negatively
on the ability of the 8x Env to function without CD4 and is
consistent with the view that CD4 binding improves the overall
efficiency and/or avidity of chemokine receptor utilization.
[0265] While the V4/C4 domain is clearly involved with
CD4-independence of IIBx, it is apparent that other regions of the
Env also contribute to this phenotype. A chimera that contained the
8x V4/C4 on an HXBc2 background was only CD4-independent when it
also contained the 8x TM. A previous study by Reeves et al. (1996,
J. Virol. 71:1453-1465) of the CD4-independent HIV-2/ROD-B
demonstrated that mutations in both gp120 and in TM were the
minimal requirements for this phenotype (i.e., a Leu to Phe
mutation just proximal to the analogous V4 loop of HIV-1, and two
mutations in the first heptad repeat of the TM ectodomain).
Although the underlying mechanism for this effect is unclear,
regions of the HIV-1 TM have been implicated in a number of
cooperative interactions with the gp120 that could affect its
binding to CD4 and/o to chemokine receptors (Cao et al., 1993, J.
Virol. 67:2747-2755; Chan et al., 1997, Cell 89:263-273; Matthews
et al., 1994, Immunol. Rev. 140:93-104). Of note, the gp120
chemokine receptor binding site described above is located near the
predicted trimer axis of the assembled Env oligomer where
interactions with TM are likely to occur (Haigwood et al., 1992, J.
Med. Primatol. 21:82-90). The data obtained in recent experiments
demonstrate that and HXBc2 chimera containing only the 8x V4/C4 and
the 8x frameshift mutation in TM was able to mediate
CD4-independent fusion to a level approximately 10% that of 8x.
Whether this small but reproducible effect is due to an increase in
the surface expression of Env on transfected cells (LaBranche et
al., 1995, J. Virol. 69:5217-5227; Mulligan et al., 1992, J. Virol.
66:3971-3975) or whether the effect is due to structural
alterations in the TM ectodomain (Ritter et al., 1993, Virology
197:255-264; Spies et al., 1994, J. Virol. 68:585-591), and/or
gp120 (Cao et al., 1993, J. Virol. 67:2747-2755; Chan et al., 1997,
Cell 89:263-273; Matthews et al., 1994, Immunol. Rev. 140:93-104)
remains to be determined.
[0266] Further, 8x contains mutations that are predicted to
eliminate 5 glycosylation sites in gp120, including N386K as noted
previously elsewhere herein, which mutation lies adjacent to the
putative chemokine receptor binding site. Carbohydrates have
recently been implicated in modifying the immunogenicity of SIV
gp120 and in masking neutralization epitopes (Reitter et al., 1998,
Nature Med. 4:679-684). Without wishing to be bound by theory, it
is possible that the loss of one or more glycosylation sites could
also be involved in exposing the chemokine receptor binding
site.
[0267] Although the data disclosed herein have implicated mutations
in the IIIBx V4/C4 and TM as determinants for CD4-independence, it
should be noted that mutations in different regions of gp120 have
been associated with CD4-independence for other HIV-1 isolates. A
CD4-independent variant of HIV-1 /NDK has been described that could
infect HeLa cells using CXCR4 by virtue of a combination of
mutations in the C2, C3, and V3 domains (Dumonceaux et al., 1998,
J. Virol. 72:512-519). Recent findings by Sodroski et al., have
demonstrated that determinants for a CD4-independent, CCR5 tropic
variant of HIV-1/ADA mapped to point mutations in the distal region
of the V1/V2 stem. Despite these genetic differences,
CD4-independent viruses could have a similar structural basis for
this phenotype. In this regard, at least some of the changes in
CD4-independent HIV-1/NDK and HIV-1/ADA are similar to IIIBx, being
located near the gp120 bridging sheet where they could affect the
presentation of this region to a chemokine receptor.
[0268] HIV has evolved strategies that enable viral replication to
continue in spite of a vigorous host immune response (Wei et al.,
1995, Nature 373:117-122; Perelson et al., 1996, Science
271:1582-1586). Neutralizing antibodies typically arise late in the
course of infection, if at all, and are frequently directed at
type-specific rather than group-specific determinants on gp120
(Wyatt and Sodroski, 1998, Science 280:1884-1888; Moore and Ho,
1995, AIDS 9:S117-S136). The deduced crystal structure of the gp120
core has suggested that the CD4 binding domain and the chemokine
receptor binding site are poorly accessible and/or are concealed
within the Env oligomer (Wyatt and Sodroski, 1998, Science
280:1884-1888; Rizzuto et al., 1998, Science 280:1949-1953). In
contrast, the exposed surfaces of gp120 contain hypervariable
domains and carbohydrates that may serve as immunologic decoys for
the humoral immune response (Stamatatos and Cheng-Mayer, 1998, J.
Virol. 72:7840-7845; Reitter et al., 1998, Nature Med. 4:679-684;
Cao et al., 1997, J. Virol. 71:9808-9812). Approaches to expose
these conserved and functionally critical domains may enable
qualitatively different and perhaps more efficacious immune
responses to be generated. Recent studies by LaCasse et al. (1999,
Science 283:357-362), have demonstrated that a fusion-activated
form of Env in which conserved neutralization epitopes on gp120 and
gp41 were apparently stabilized was able to generate a potent and
broadly cross-neutralizing antibody response in mice. In this
regard, CD4-independent Envs that are derived or designed may
provide a means to present these domains in a biologically relevant
context. Data disclosed elsewhere herein demonstrate that the 8x
gp120 exhibits a number of novel immunological and biochemical
properties including the increased exposure of CD4-induced epitopes
(see Example 2) and the ability to bind to CXCR4 in the absence of
CD4. Future studies of HIV-1/IIIBx and additional CD4-independent
isolates should provide powerful tools to probe the structure and
function of the viral envelope glycoprotein and lead to the
rational design of gp120 molecules with altered immunogenic
properties as therapeutic modalities.
EXAMPLE 2
Stable Exposure of the Coreceptor Binding Site in a CD4-independent
HIV-1 Envelope Protein
[0269] The experiments presented in this example may be summarized
as follows.
[0270] The data presented previously in Example 1, disclose a
CD4-independent HIV-1 virus, HIV-1/IIIBx, that interacts directly
with the chemokine receptor CXCR4 to infect cells in the absence of
CD4. The data presented herein disclose the underlying mechanism of
the CD4-independence by using a novel cloned Env from the
HIV-1/IIIBx swarm named 8x previously disclosed in Example 1. The
8x Env clone was used to produce soluble gp120. The data disclosed
herein demonstrate that 8x gp120 bound directly to cells expressing
only CXCR4 while binding of IIIB gp120 also required soluble CD4.
Further, using an optical biosensor, the data disclosed herein
demonstrate that CD4-induced (CD4i) epitopes recognized by
monoclonal antibodies (MAbs) 17b and 48d were more exposed on 8x
than on IIIB gp120. The ability of 8x gp120 to bind directly to
CXCR4 and to react with MAbs 17b and 48d in the absence of CD4
indicates that 8x gp120 exists in a partially triggered but stable
state in which the conserved coreceptor binding site in gp120,
which overlaps with the 17b epitope, is exposed.
[0271] Substitution of the CXCR4-specific V3-loop of 8x with the
V3-loop from the CCR5 tropic HIV-1/BaL strain resulted in an Env
clone that mediated CD4-independent, CCR5-dependent virus
infection. Therefore, the substitution of the V3-loop produced a
gp120 chimera (8x-BaL) that bound to CCR5 in the absence of CD4.
Thus, the data disclosed herein demonstrate that in a partially
triggered Env protein, the V3-loop can alter the specificity of
coreceptor use, but does not alter CD4 independence. Moreover, the
data disclosed herein indicate that CD4 independence and chemokine
coreceptor binding are dissociable. Further, HIV-1/IIIBx was far
more sensitive to neutralization by HIV-positive human sera, a
variety of anti-IIIB gp120 rabbit antisera, and CD4i MAbs than was
the CD4-dependent IIIB strain. The increased sensitivity of
HIV-1/IIIBx virus to neutralization by antibodies and the stable
exposure of a highly conserved region of gp120 suggest novel
strategies for the development of antibodies and small molecule
inhibitors to this functionally important domain.
[0272] The Materials and Methods used in the experiments presented
in this Example are now described.
[0273] Plasmids
[0274] Human CCR5, CXCR4, and CD4 were expressed using the pCDNA3
vector (Invitrogen, San Diego, Calif.). The luciferase gene was
expressed under control of the T7 promoter in the pGEM2 vector
(Promega Corp., Madison, Wis.). The Envs from the HXBc2 clone of
IIIB and 8x were both expressed in the pSP73 vector (Promega Corp.,
Madison, Wis.). To generate Env constructs containing the V3 loop
of the R5 HIV-1 strain BaL, the KpnI-BamHI fragment in env from the
full-length proviral clone pIIIB-V3BaL was cloned into pSP73-IIIB.
To produce a version of 8x containing the V3 loop of BaL, the
StuI-Bsu361 env fragment of pIIIB-V3BaL was cloned into pSP73-8x.
Stop codons were inserted into each env plasmid at the gp120/gp41
junction using the Quickchange.TM. Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, Calif.) to make constructs for gp120
production. The identity of all mutants and clones was confirmed by
DNA sequencing.
[0275] Cell-Cell Fusion Assay
[0276] This assay has been described in more detail elsewhere.
Briefly, effector QT6 cells in T25 flasks were infected with
recombinant vaccinia virus expressing T7 polymerase (vTF1.1) and
transfected with 30 .mu.g of env constructs wherein expression was
driven by the T7 promoter. Target QT6 cells were plated in 24-well
plates and each well of cells was transfected with 0.5 .mu.g CD4
and 1.0 .mu.g coreceptor plasmids under the control of the CMV
promoter, and 1.5 .mu.g of the luciferase reporter plasmid under
the control of the T7 promoter. Following overnight expression, the
effector cells were added to target cells and luciferase activity
was quantified in cell lysates 7.5 hours after mixing.
[0277] Protein Production and Purification
[0278] 293T cells were infected in T225 flasks with vTF1.1 and the
cells were then transfected with 200 .mu.g of gp120 plasmid. Four
hours post-transfection, the cells were washed with phosphate
buffered saline (PBS) and placed in serum-free media for 24 hours.
Media was collected, clarified by centrifugation and 0.2 .mu.M
filtration prior to addition of 0.1% TX-100. Protein in the
supernatant was bound to a Galanthis Navalis column (Vector
Laboratories, Burlingame, Calif.), washed with
methyl-.alpha.-D-mannopyranoside (MES) buffer (20 mM MES, pH 7.0,
0.13 M NaCl, 10 mM CaCl.sub.2) and eluted in MES buffer containing
0.5M .alpha.-methyl mannoside. The eluate was subjected to
additional purification, washing, and concentration using an Amicon
ultrafiltration system with a 50 kD protein molecular weight
cutoff. HPLC analysis determined that Env prepared in this fashion
was highly pure, and accurate protein concentrations were
determined by amino acid analysis and BCA assay.
[0279] Cell-Surface Binding Assay
[0280] Binding of gp120 to coreceptors was determined as described
by Doranz et al. (1999, J. Virol., 73:2752-2761). Briefly,
approximately 5 .mu.g of each gp120 was iodinated using Iodogen
(Pierce) to specific activities of 12.3 .mu.Ci/.mu.g, 7.15
.mu.Ci/.mu.g, 47.3 .mu.Ci/.mu.g, and 22.0 .mu.Ci/.mu.g for IIIB,
8x, IIIB-V3BaL, and 8x-V3BaL, respectively. One-hundred thousand
counts per minute (CPM) was added to about 0.5 to about
1.0.times.10.sup.6293T cells which had been transfected the
previous day with 14 .mu.g DNA in a total volume of 100 .mu.l
binding buffer (50 mM Hepes pH 7.4, 5 mM MgCl.sub.2, 1 mM
CaCl.sub.2, 5% BSA). Soluble CD4 (sCD4) was added at 100 nM when
indicated. The cells were incubated for 1 hour at 25.degree. C.
[0281] Unbound radioactivity was removed by filtering the cells
through Whatman GF/C filters presoaked in 0.3% polyethylenimine,
and washing twice with 4 ml wash buffer (50 mM Hepes pH 7.4, 5 mM
MgCl.sub.2, 1 mM CaCl.sub.2, 500 mM NaCl). The amount of
radioactivity which bound nonspecifically to the filters in the
absence of cells was subtracted from all data points.
[0282] Biosensor Experiments
[0283] All experiments were performed using a BIACORE 2000 (Upsala,
Sweden) optical biosensor at 25.degree. C. Approximately 200 RU of
sCD4 and the full length human MAbs 17b and 48d were attached by
amine coupling to a research grade CM5 chip. A naked sensor surface
without antibody or sCD4 served as a negative control for each
binding interaction. Env which had been serially diluted was run
across each sensor surface at 6 different concentrations in a
running buffer of PBS+0.005% Tween-20 (11 nM to 585 nM for gp120, 5
nM to 91 nM for gp120+sCD4). Soluble CD4 was added at an 8-fold
molar excess to Env at least 30 minutes prior to measuring binding,
and completely eliminated binding of Env to CD4 attached to the
sensor surface. Binding and dissociation were measured for 300
seconds each at a flow rate of 30 .mu.l/minute which gave a
flow-independent binding on-rate. The sensor surface was
regenerated between each binding reaction by using 2 washes of 10
mM HCI for 15 seconds at 100 .mu.l/minute, which was found to
return the signal completely to baseline without decreasing the
binding capacity of the immobilized surface. Each binding curve was
corrected for nonspecific binding by subtraction of the signal
obtained from the negative control flow cell. Kinetic constants for
association and dissociation were derived from linear
transformations of the exported binding data of at least 5
concentrations of analyte. The kinetic parameters obtained were
compared to those estimated by fitting the data to the simple 1:1
Langmuir interaction model using the BIA Evaluation 3.1
software.
[0284] Neutralization Assays
[0285] Neutralization of virus by antisera or MAbs was performed
using a modification of the previously described MAGI assay
(Chakerian et al., 1997, J. Virol. 71:3932-3939) or luciferase
reporter virus system described by Connor et al. (1995, Virology
206:935-944). Briefly, 1.25.times.10.sup.5 MAGI cells were plated
in a 48-well plate, and the cells were allowed to adhere. The cells
were infected with virus that had been pre-incubated with serial
dilutions of antibody for 1 hour at 37.degree. C. The amount of
virus used was the amount previously determined with the MAGI assay
to contain 400-800 infectious units. Twenty-four hours after
infection, the DP178 inhibitory peptide was added at a final
concentration of 5 .mu.g/ml to prevent the formation of syncytia.
The cell cultures were incubated another 48 hours, fixed and the
cells were stained with X-gal. Blue nuclei were quantified using an
AlphaImager 2000 (AlphaInnotech Corporation, San Leandro, Calif.).
For luciferase reporter virus infections, equal amounts of virus,
as judged by relative light units (RLU), were also incubated with
serial dilutions of antibody for 1 hour at 37.degree. C. Virus was
added to GHOST-CCR5 cells in 96-well plates and cell lysates were
measured for luciferase activity 2 days post-infection.
[0286] The Results of the experiments presented in this example are
now described.
[0287] Direct Binding of 8x gp120 to CXCR4
[0288] Binding of CD4 to HIV-1 Env induces conformational changes
required for subsequent Env-coreceptor interactions. These changes
are likely to include increased exposure of an exceptionally
well-conserved domain in gp120 that has been implicated in
coreceptor binding (FIG. 12). Many SIV and HIV-2 strains can
short-circuit this normal entry process by utilizing coreceptors
for virus entry in a CD4-independent manner, although their
efficiency is typically enhanced when CD4 is present. The data
presented previously in Example 1 disclose production of a
CD4-independent HIV-1 strain through repeated passaging of HIV-1
IIIB on CD4-negative, CXCR4-positive cells (Example 1, supra). The
resulting virus strain (HIV-1/IIIBx) can utilize CXCR4 in the
absence of CD4 to infect a wide variety of cell types (Example 1,
supra). An Env clone derived from cells chronically infected with
HIV-1/IIIBx, termed 8x, maintains this phenotype. Thus, cells
expressing 8x Env mediated fusion with CD4-negative, CXCR4-positive
cells. In the presence of CD4, fusion efficiency was enhanced
approximately 3-fold (FIGS. 10A and 10B). Fusion mediated by 8x is
strictly dependent upon CXCR4, and is not observed when other
coreceptors are expressed (FIGS. 10A and 10B). Since CD4 is known
to induce conformational changes in Env that enable it to interact
with coreceptors and since the 8x Env can mediate CXCR4-dependent
fusion in the absence of CD4, experiments were performed to
determine whether the 8x Env protein exists in a partially
triggered state, thereby enabling it to bind CXCR4 in a
CD4-independent manner.
[0289] To evaluate conformational differences in the 8x gp120, the
ability of purified 8x gp120 to bind directly to CXCR4 was
examined. In this regard, a cell surface binding assay as described
by Doranz et al. (1999, J. Virol., 73:2752-2761), and set forth
herein, was used in which radioiodinated gp120, with or without
prior incubation with soluble CD4 (sCD4), was added to cells
expressing the desired coreceptor. The cells were washed and the
amount of bound radiolabeled gp120 was measured. The data disclosed
herein demonstrate that IIIB gp120 complexed with sCD4 bound to
cells expressing CXCR4 but not to cells expressing other
coreceptors (FIG. 11). In contrast, the 8x gp120 bound to
CXCR4-expressing cells equally well in the presence or absence of
sCD4 (FIG. 11). Binding to cells expressing vector alone or CCR5
was not observed. These results demonstrate that unlike the
parental IIIB Env, the 8x gp120 exists in a stable conformation
that enables it to interact directly with CXCR4 in the absence of
CD4.
[0290] Exposure of the Coreceptor Binding Site
[0291] Without wishing to be bound by theory, the ability of 8x
gp120 to bind to CXCR4 may be the result of increased exposure of
sites on gp120 that interact with CXCR4. To determine whether there
was increased exposure of these sites, the abilities of IIIB and 8x
gp120 to interact with the CD4i MAbs 17b and 48d were examined. A
Fab fragment of 17b was co-crystallized with gp120 and sCD4 (Kwong
et al., 1998, Nature 393:648-659), and the data disclosed
demonstrate that many of the contact residues involved in 17b-gp120
interactions are also important for coreceptor binding (FIG. 12).
Thus, 17b can be used as an immunological surrogate to measure
exposure of the conserved, coreceptor binding site defined by
Rizzuto et al. (1998, Science 280:1949-1953).
[0292] Binding of IIIB and 8x gp120, with or without prior
incubation with sCD4, to the CD4i MAbs 17b and 48d was measured
using an optical biosensor assay method as described elsewhere
herein (see materials and methods, Example 2). This approach makes
it possible to measure protein-protein interactions in real time,
and can be used to derive on- and off-rates as well as affinity
constants. The desired MAb was covalently coupled to the sensor
surface after which gp120 or gp120-sCD4 complexes were applied. A
typical sensorgram is shown in FIG. 13. As expected, the rate at
which HIV-1/IIIB gp120 bound to MAb 17b was markedly increased by
prior incubation of Env with sCD4. Once bound to 17b, both IIIB
gp120 and gp120-sCD4 complexes exhibited negligible off-rates. In
contrast to IIIB gp120, 8x gp120 bound efficiently to 17b without
sCD4, exhibiting an on-rate that was an order of magnitude greater
than that of IIIB gp120. Addition of sCD4 enhanced this on-rate
2-fold. When complexed with sCD4, both the 8x and IIIB gp120s
exhibited identical on-rates (Table 1). Interestingly, once bound
to 17b, the 8x gp120 exhibited a greater off-rate than did IIIB
gp120. This effect may be due to the Ile to Val mutation in the 8x
gp120 at amino acid position 423 (FIG. 12), a residue previously
shown to be a contact site for 17b (Kwong et al., supra).
2 TABLE 1 ka (1/Ms) kd (1/s) Kd (nM) Binding to 17b 8x 1 .times.
10.sup.5 2 .times. 10.sup.-3 15 8x/CD4 2 .times. 10.sup.5 9 .times.
10.sup.-4 4.5 HXB 8 .times. 10.sup.3 2 .times. 10.sup.-5 2.5
HXB/CD4 3 .times. 10.sup.5 5 .times. 10.sup.-5 0.2 Binding to 48d
8x 2 .times. 10.sup.5 1 .times. 10.sup.-3 6.0 8x/CD4 3 .times.
10.sup.5 6 .times. 10.sup.-4 2.0 HXB 1 .times. 10.sup.4 5 .times.
10.sup.-5 5.0 HIXB/CD4 5 .times. 10.sup.5 3 .times. 10.sup.-5
0.1
[0293] The data disclosed in Table 1 demonstrate the apparent
kinetic and equilibrium constants derived from binding of gp120 to
CD4i antibodies in biosensor experiments performed as described
previously elsewhere herein. Briefly, the CD4i antibodies 17b and
48d were attached to the biosensor surface, and both binding and
dissociation of serial dilutions of 8x and HXB gp120 were measured.
Binding of serial dilutions of both Envs which had been premixed
with a saturating amount of sCD4 was also determined. All bindings
were performed at 25.degree. C., and a sample sensorgram is shown
in FIG. 13. The best fitted values for the slopes of the linearized
plots of the data (r.sup.2.gtoreq.0.98) are reported. The
parameters estimated by fitting the simple 1:1 Langmuir interaction
model globally were within 15% of the reported values. Values in
italics represent dissociation rates that were so slow that they
were at the limits of detection of the biosensor, making the
affinity constants derived from these values less accurate.
[0294] Analysis of a different CD4i MAb, 48d, yielded results that
were similar to 17b (Table 1). Finally, IIIB and 8x gp120 molecules
interacted with CD4 attached to the sensor surface in an identical
fashion. Thus, the mutations in 8x that render it CD4-independent
did not affect CD4 binding to an appreciable degree, but did result
in greater exposure of the 17b epitope, which overlaps with the
conserved coreceptor binding site.
[0295] Dissociation of Coreceptor Choice and CD4-independence
[0296] Both the conserved coreceptor binding site as well as the
V1/V2 and V3 loops of gp120 play important roles in Env-coreceptor
interactions. Available evidence indicates that the V3 loop and, to
a lesser extent, the V1/V2 region govern the number and types of
coreceptors used by a given Env (Hoffman et al., 1998, Proc. Natl.
Acad. Sci. U.S.A. 95:11360-11365; Ross and Cullen, 1998, Proc.
Natl. Acad. Sci. U.S.A. 95:7682-7686; Speck et al., 1997, J. Virol.
71:7136-7139; Cocchi et al., 1996, Nature Med. 2:1244-1247; Cho et
al., 1998, J. Virol. 72:2509-2515; Choe et al., 1996, Cell
85:1135-1148). In contrast, mutations in the conserved coreceptor
binding site can affect Env-coreceptor binding (Rizzuto et al.,
1998, Science 280:1949-1953), but it is not clear if this region
also plays a role in coreceptor specificity. The ability of 8x
gp120 to interact directly with CXCR4 provided an opportunity to
determine if coreceptor choice and changes in Env that expose the
coreceptor binding site are dissociable. Previous studies
demonstrated that the introduction of an R5 V3-loop (from HIV-1
BaL) into an HIV-1 IIIB background resulted in an Env protein
(IIIB-BaL) that used CCR5, but not CXCR4, for virus infection (Ross
and Cullen, 1998, Proc. Natl. Acad. Sci. U.S.A. 95:7682-7686; Ross
et al., 1997, J. Virol. 72:1918-1924). The data disclosed
previously herein in Example 1 demonstrate, using a cell-cell
fusion assay, that substituting the V3 loop of the 8x Env with that
from an R5 Env (BaL) produced a protein (8x-BaL) that was able to
mediate fusion with CCR5-positive, CD4-negative cells. To determine
if 8x-BaL could also mediate CD4-independent virus infection,
luciferase reporter viruses as described in Connor et al. (1995,
Virology 206:935-944) were generated bearing either IIIB-V3BaL or
8x-V3BaL Env proteins. Virions bearing 8x-V3BaL Env mediated
CD4-independent, CCR5 -dependent virus infection (FIG. 10B). As was
observed with 8x Env in fusion assays, the presence of CD4
increased the efficiency of virus entry. Neither IIIB-BaL or 8x-BaL
used CXCR4 in the presence or absence of CD4. Also, IIIB-BAL and
8x-BaL gp120 molecules were produced, and data disclosed herein
demonstrate that IIIB-BaL gp120 bound to CCR5 in a CD4-dependent
manner, while 8x-BaL bound to CCR5 independently of CD4. Neither
protein bound to CXCR4 under any conditions examined. Thus, changes
in the V3-loop affected which coreceptor was used, but did not
impact CD4-independence.
Neutralization of HIV-1/IIIBx
[0297] Antibodies that block Env-coreceptor interactions can
neutralize HIV-1 (Wu et al., 1996, Nature 384:179-183; Trkola et
al., 1996, Nature 384:184-187). The exposed nature of the
coreceptor binding site in HIV-1/IIIBx gp120 might therefore be
expected to make this virus more sensitive to antibody mediated
neutralization. Several SIV and HIV-1 strains with modifications in
the V1/V2 region have been shown to be neutralization sensitive,
presumably because of increased exposure of conserved determinants
(Stamatatos and Cheng-Mayer, 1998, J. Virol. 72:7840-7845; Reitter
et al., 1998, Nature Med. 4:679-684). Therefore, the relative
sensitivities of H-1/IIIB and HIV-1/IIIBx to neutralization by
HIV-positive human sera, and to sera from rabbits immunized with
either IIIB or 8x gp120, were compared and the results are set
forth in Table 2.
3 TABLE 2 HIV-1 IIIB HIV-I IIIBx Rabbit Immunogen 50% 90% 50% 90%
1169 IIIB 1,934 132 3,081 287 1170 IIIB 1,896 109 93,756 5,616 1171
8x >10,240 1,005 >163,840 13,748 1172 8x 1,552 94 64,295
4,426 Human sera ZT02575 1,616 46 20,894 4,195 Human sera JT2140
155 11 892 187 IIIB- BaL 8x- BaL MAb 14 ng/ml 90 ng/ml 2 ng/ml 15
ng/ml 17b MAb >5,000 ng/ml >5,000 ng/ml 3 ng/ml >200
ng/ml* 48d MAb 95 ng/ml 375 ng/ml 45 ng/ml 610 ng/ml 50.1
[0298] The data disclosed in Table 2 were obtained by infecting
sMAGI cells with equivalent amounts of HIV-1/IIIB and HIV-1/IIIBx.
Infection was determined 72 hours after infection as previously
described by Chackerian et al. (1997, J. Virol. 71:3932-3939). For
MAbs 17b and 48d, equivalent amounts of luciferase reporter viruses
bearing the IIIB-BaL or 8x-BaL Envs were used to infect GHOST-CCR5
cells which were lysed 48 hours post-infection. For all infections,
virus and serial dilutions of MAbs, human sera, and rabbit sera
were mixed for 1 hour prior to addition to the target cells. The
concentration of sera or antibody required to neutralize 50% and
90% of input virus is indicated. MAb 48d did not neutralize
IIIB-BaL under any condition tested, and only 88% neutralization of
8x-BaL was achieved by this MAb at a concentration of 200 ng/ml (as
indicated by an *). MAb 50.1 is directed against BaL V3-loop as
described by White-Scharf et al. (1993, Virology 192:197-206).
[0299] The data disclosed herein demonstrate that HIV-1/IIIBx was
uniformly more sensitive to neutralization than the parental
HIV-1/IIIB, in many cases by one-log or more (Table 2). HIV-1
-positive human sera, rabbit sera generated against IIIB gp120, and
rabbit sera generated against 8x gp120 all neutralized HIV-1/IIIBx
far more efficiently than HIV-1/IIIB. In addition, the data
disclosed herein demonstrate that virions containing 8x-BaL Env
were much more sensitive to neutralization by the CD4i MAbs 17b and
48d than those containing IIIB-BaL Env, but 8x-BaL Env virions did
not demonstrate increased sensitivity to neutralization by an
antibody recognizing the V3 loop of these viruses (Table 2). Thus,
without wishing to be bound by theory, the data disclosed herein
demonstrate that increased exposure of the coreceptor binding site,
as well as increased exposure of CD4i epitopes, is likely to
account for the increased sensitivity of HIV-1/IIIBx to
antibody-induced neutralization.
[0300] The prior art teaches that receptor binding triggers
conformational changes in Env that activate its membrane fusion
potential. Binding to CD4 enables Env to interact with an
appropriate coreceptor (Wu et al., 1996, Nature 384:179-183; Trkola
et al., 1996, Nature 384:184-187; Lapham et al., 1996, Science
274:602-605; Hill et al., 1997, J. Virol. 71:6296-6304), generally
CCR5 or CXCR4, which is thought to result in additional
conformational changes in Env that ultimately lead to membrane
fusion and virus entry. Fusion is a critical step in virus
infection, and understanding the structural intermediates in Env
that lead to this process may suggest the development of novel
anti-viral strategies. Indeed, early clinical trials with a peptide
inhibitor of the membrane fusion reaction have shown significant
reductions in viral load (Kilby et al., 1998, Nature Med.
4:1302-1307).
[0301] The discovery of the viral coreceptors and the recently
solved crystal structure of a gp120 core fragment have provided
greater understanding of the viral entry process and have
identified new potential targets for pharmacologic or immunologic
intervention (Kwong et al., 1998, Nature 393:648-659; Rizzuto et
al., 1998, Science 280:1949-1953; Wyatt et al., 1998, Nature
393:705-710). In the case of Env, an exceptionally well conserved
region in gp120 has been implicated in CCR5 binding (Rizzuto et
al., 1998, Science 280:1949-1953). This region, located in the
bridging sheet between the inner and outer domains of gp120, lies
between the base of the V3 loop and the V1/V2 region (FIG. 12).
Binding to CD4, which is known to reposition these variable regions
(Wyatt et al., 1995, J. Virol. 69:5723-5733), may lead to exposure
and/or formation of this highly conserved site. Neutralizing
antibodies such as 17b bind to epitopes that overlap with this
region (Rizzuto et al., 1998, Science 280:1949-1953; Wyatt et al.,
1998, Nature 393:705-710), thus serving as immunological surrogates
for exposure of this domain and suggesting that, if properly
presented, this region may elicit broadly cross-reactive
neutralizing antibodies. However, prior to the present invention,
there was no way to present this region to the immune system in
such a way to generate an immune response to the coreceptor binding
region of gp120.
[0302] A number of HIV-1, HIV-2, and SIV virus strains have been
described that bypass the normal viral entry process by interacting
directly with CCR5 or CXCR4 to infect cells (Example 1; Edinger et
al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94:14742-14747; Endres et
al., 1996, Cell 87:745-756). While CD4-independent viruses may
impact viral tropism and pathogenesis, they also serve as useful
tools for dissecting the virus entry pathway. The data disclosed
herein demonstrate two lines of evidence indicating that the
CD4-independent HIV-1 Env disclosed herein exists in a stable,
partially triggered state in which the conserved coreceptor binding
site is well exposed. First, 8x gp120 bound directly to CXCR4 while
the parental IIIB gp120 bound CXCR4 in a CD4-dependent manner.
Second, 8x gp120 bound much more rapidly to two CD4i MAbs than did
the parental CD4-dependent protein. However, as a consequence of a
faster off-rate, the overall affinity of 8x gp120 for CD4i MAbs was
similar to that of HIV-1 IIIB gp120, providing a striking example
of how important differences in protein-protein interactions can be
revealed by the real time analysis afforded by the use of an
optical biosensor. The faster off-rate exhibited by 8x relative to
IIIB could be due to a number of amino acid changes in the 8x
protein in the vicinity of the coreceptor binding site, including
I423V, a residue which serves as a contact site for 17b (Kwong et
al., 1998, Nature 393:648-659).
[0303] HIV-1 tropism is governed in large part by coreceptor
choice. The ability of a virus to utilize CCRS, CXCR4, or both,
largely dictates the type of CD4-positive cells it can enter. The
V3 loop in gp120 plays a critical role in coreceptor choice, with
the V1/2 region playing a more subsidiary role (Hoffman et al.,
1998, Proc. Natl. Acad. Sci. U.S.A. 95:11360-11365; Ross and
Cullen, 1998, Proc. Natl. Acad. Sci. U.S.A. 95:7682-7686; Speck et
al., 1997, J. Virol. 71:7136-7139; Cocchi et al., 1996, Nature Med.
2:1244-1247; Cho et al., 1998, J. Virol. 72:2509-2515; Choe et al.,
1996, Cell 85:1135-1148). The data disclosed herein demonstrate
that the determinants underlying coreceptor choice and
CD4-independence in 8x Env are dissociable. Thus, 8x Env containing
a V3-loop from an R5 Env maintains its CD4-independent phenotype
but now uses CCR5 rather than CXCR4 for cell-cell fusion and virus
infection. Further, the data disclosed herein demonstrate that
8x-BaL gp120 is able to bind to CCR5-expressing cells in the
absence of CD4. These data clearly demonstrate, for the first time,
that coreceptor choice and CD4-independent use of a chemokine
receptor are dissociable. These data suggest, without wishing to be
bound by theory, that the coreceptor binding region can interact
with both CXCR4 and CCR5, depending on the nature of the associated
V3-loop (Rizzuto et al., 1998, Science 280:1949-1953). Thus, in the
context of the HIV-1 variant disclosed herein, the V3-loop can
affect coreceptor choice in a partially triggered Env as well. The
disclosure of the present invention will facilitate the
clarification of the respective roles the variable regions and the
conserved binding site play in coreceptor interactions and the
identification of the domains in CCR5 and CXCR4 with which each
interacts.
[0304] A particularly striking feature of the HIV-1/IIIBx swarm and
the 8x molecular clone was their sensitivity to neutralization by
antibodies. HIV-1/IIIBx was approximately 10-fold more sensitive to
neutralization by HIV-positive human sera as well as to rabbit sera
generated against either IIIB gp120 or 8x gp120. Without wishing to
be bound by theory, the increased sensitivity of HIV-1/IIIBx to
antibody mediated neutralization suggests that one or more
neutralization determinants in this partially triggered Env is more
generally accessible to antibodies than in the parental,
CD4-dependent Env. The conserved coreceptor binding site is a
likely target that may account for this phenotype, as indicated by
the ability of CD4i MAbs to bind directly to 8x Env and to
efficiently neutralize 8x-BaL Env-pseudotyped virions. In addition,
as demonstrated by the data disclosed in Example 1 herein, the 8x
Env also exhibits a remarkable loss of 5 glycosylation sites
relative to parental IIIB raising the possibility that the loss of
carbohydrates could play a role in exposing this region. Despite
the increased neutralization of 8x-BaL by CD4i MAbs, increased
exposure of the coreceptor binding site did not lead to increased
sensitivity of 8x-BaL to a MAb directed against the V3-loop (Table
2). Several other neutralization sensitive viruses have been
described recently, including a SIVmac239 lacking glycosylation
sites in the V1/V2 region, as well as a HIV-1 SF162 strain
containing a deletion in V1 (Stamatatos and Cheng-Mayer, 1998, J.
Virol. 72:7840-7845). The present invention will facilitate studies
to determine whether the coreceptor binding site which adjoins the
V1/V2 stem is exposed in these viruses as well.
[0305] Numerous studies have shown that immunization with
recombinant gp120 typically fails to generate broadly
cross-reactive neutralizing antibodies, yet it is clear that such
antibodies are generated in some individuals as a consequence of
virus infection (Burton and Motefiori, 1997, AIDS 11 (Supp.
A):S87-S98). Without wishing to be bound by theory, it may be that
only strain-specific neutralization has been observed following
immunization by gp120 because conserved regions of Env are
sequestered in CD4-dependent gp120s prior to CD4 binding. The data
disclosed herein suggest that if CD4-independence results from the
partially triggered form of gp120 which no longer requires the
initial binding to CD4 before the protein will bind to the
chemokine receptor protein, then exposure of the highly conserved
chemokine receptor binding site renders the virus more sensitive to
neutralization. More importantly, the data disclosed herein suggest
indicate that immunization with Envs that are partially triggered
thus stably exposing the otherwise hidden chemokine receptor
binding site may result in more efficient generation of broadly
cross-reactive neutralizing antibodies directed against this
region. For this to occur, antibodies must be generated that can
access the coreceptor binding site in native, CD4-dependent Env
proteins, perhaps after CD4-binding induces a triggered
conformation in which access to this region is enhanced.
Identifying determinants that render Envs CD4-independent and that
influence exposure of this region will make it possible to
systematically address the potential of this site to elicit
neutralizing antibodies. It is important to note that while
exposure of the coreceptor binding site may be an important
component of CD4-independent Envs, other changes in Env are also
likely to influence the ability to infect cells in a
CD4-independent manner (Example 1).
[0306] In addition, the ability to examine and map, at the
molecular level, the chemokine receptor binding site determinant(s)
will facilitate the development of small-molecule inhibitors of
gp120/chemokine receptor binding.
[0307] A "small-molecule," as the term is used herein, means a
compound, whether synthetic or naturally occurring, including
nucleic acids and polypeptides, such as, but not limited to,
peptidomimetics and ALX40-4C (Doranz et al., 1997, J. Exp. med.
186:1395-1400), which are capable of inhibiting gp120 binding to a
chemokine receptor protein, and which are less than about 1 kDa in
size.
[0308] Therefore, the data disclosed herein have important
implications in the development of effective antiviral therapeutics
including, but not limited to, antibody-based modalities. Thus, the
present invention should be construed to encompass the development
of a wide class of compounds as inhibitors of gp120/chemokine
receptor protein interactions.
[0309] Further, that the coreceptor binding site can be stably
exposed may have implications for viral entry. Without wishing to
be bound by theory, it is conceivable that exposure and/or
formation of the coreceptor binding site subsequent to CD4 binding
could result in a conformation of Env that is relatively unstable,
requiring interactions with a coreceptor within a short period of
time. For example, triggering the conformational change in the
Semliki Forest virus spike glycoprotein by acid pH leads to rapid
inactivation of the protein's membrane fusion potential unless it
can interact with its lipid coreceptors within several minutes
(Kielian, 1995, Advances in Virus Res. 45:113-151). However, the 8x
Env protein, which exists in a partially triggered but stable
state, suggests that exposure of the coreceptor binding site is
compatible with a long-lived triggered Env conformation. Thus,
coreceptor binding could occur long after the conformational
changes induced by CD4 that make this event possible, perhaps
accounting for the ability of HIV-1 to infect cells that express
very low levels of coreceptor when adequate levels of CD4 are
present (Platt et al., 1998, J. Virol. 72:2855-2864; Kozak et al.,
1997, J. Virol. 71:873-882). This discovery further emphasizes the
potential of the present invention in the development of antiviral
therapeutics based on the inhibition of HIV-1/chemokine receptor
interactions since the triggered conformation may potentially be
present long enough for compounds blocking the necessary
determinants to effect the inhibition of virus binding to the host
cell receptors.
[0310] In conclusion, the data disclosed herein demonstrate that
the CD4-independent phenotype of the 8x Env protein is associated
with stable exposure of the coreceptor binding site. Thus, this
protein likely represents a structural intermediate of the normal
fusion process, and can be used to investigate the structural
parameters that influence the conformational changes that lead to
membrane fusion. Importantly, the highly conserved nature of this
stably exposed domain and the fact the neutralizing antibodies can
be directed against it raise the possibility that this domain, if
properly presented, can be used to elicit broadly cross-reactive
neutralizing antibodies against HIV-1.
[0311] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety.
[0312] While the invention has been disclosed with reference to
specific embodiments, it is apparent that other embodiments and
variations of this invention may be devised by others skilled in
the art without departing from the true spirit and scope of the
invention. The appended claims are intended to be construed to
include all such embodiments and equivalent variations.
Sequence CWU 1
1
12 1 24 DNA Artificial Sequence Description of Artificial Sequence
PCR primer 1 cgcaacctat accaatagta gcaa 24 2 24 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 2 cagtaagcca
tccaatcaca ctac 24 3 726 PRT Human immunodeficiency virus type 1 3
Met Arg Val Lys Glu Lys Tyr Gln His Leu Trp Arg Trp Gly Trp Arg 1 5
10 15 Trp Gly Thr Met Leu Leu Gly Met Leu Met Ile Cys Asn Ala Thr
Glu 20 25 30 Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp
Lys Glu Ala 35 40 45 Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys
Ala Tyr Glu Thr Glu 50 55 60 Val His Asn Val Trp Ala Thr His Ala
Cys Val Pro Thr Asp Pro Asn 65 70 75 80 Pro Gln Glu Val Val Leu Val
Asn Val Thr Glu Asn Phe Asn Met Trp 85 90 95 Lys Asn Asp Met Val
Glu Gln Met His Glu Asp Ile Ile Ser Leu Trp 100 105 110 Asp Gln Ser
Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Ser 115 120 125 Leu
Lys Cys Thr Asp Leu Lys Asn Asp Thr Asn Thr Asn Ser Gly Ser 130 135
140 Gly Arg Met Ile Met Glu Lys Gly Glu Ile Lys Asn Cys Ser Phe Asn
145 150 155 160 Ile Ser Thr Ser Lys Arg Ser Lys Val Lys Lys Glu Tyr
Ala Phe Phe 165 170 175 Tyr Lys Leu Asp Ile Ile Pro Ile Asp Asn Asp
Pro Thr Ser Tyr Thr 180 185 190 Leu Thr Ser Cys Asn Thr Ser Val Ile
Thr Gln Ala Cys Pro Lys Val 195 200 205 Ser Phe Glu Pro Ile Pro Ile
His Tyr Cys Ala Pro Ala Gly Phe Ala 210 215 220 Ile Leu Lys Cys Asn
Asn Lys Thr Phe Asn Gly Thr Gly Pro Cys Thr 225 230 235 240 Asn Val
Ser Thr Val Gln Cys Thr His Gly Ile Arg Pro Val Val Ser 245 250 255
Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Val Val Ile 260
265 270 Arg Ser Val Asn Phe Thr Asp Asn Ala Lys Thr Ile Ile Val Gln
Leu 275 280 285 Asn Thr Ser Val Glu Ile Asn Cys Thr Lys Pro Asn Asn
Asn Thr Arg 290 295 300 Lys Arg Ile Arg Ile His Arg Gly Pro Gly Arg
Ala Phe Val Thr Val 305 310 315 320 Gly Lys Ile Gly Asn Met Arg Gln
Ala His Cys Asn Ile Ser Arg Ala 325 330 335 Lys Trp Ser Asn Thr Leu
Lys Gln Ile Ala Ser Lys Leu Arg Glu Gln 340 345 350 Phe Gly Asn Asn
Lys Thr Ile Ile Phe Lys Gln Ser Ser Gly Gly Asp 355 360 365 Pro Glu
Ile Val Thr His Ser Phe Asn Cys Gly Gly Glu Phe Phe Tyr 370 375 380
Cys Lys Ser Thr Gln Leu Phe Asn Ser Thr Trp Ser Thr Lys Gly Ser 385
390 395 400 Asn Asn Thr Glu Gly Ser Asp Thr Ile Thr Leu Pro Cys Arg
Ile Lys 405 410 415 Gln Val Ile Asn Met Trp Gln Glu Val Gly Lys Ala
Met Tyr Ala Pro 420 425 430 Pro Ile Ser Gly Gln Ile Arg Cys Ser Ser
Asn Ile Thr Gly Leu Leu 435 440 445 Leu Thr Arg Asp Gly Gly Asn Ser
Asn Asn Glu Ser Glu Ile Phe Arg 450 455 460 Pro Gly Gly Gly Asp Met
Arg Asp Asn Trp Arg Ser Glu Leu Tyr Lys 465 470 475 480 Tyr Lys Val
Val Lys Ile Glu Pro Leu Gly Val Ala Pro Thr Lys Ala 485 490 495 Lys
Arg Arg Val Val Gln Arg Glu Lys Arg Ala Val Gly Ile Gly Ala 500 505
510 Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala
515 520 525 Ser Met Ala Leu Thr Val Gln Ala Arg Gln Ser Leu Ser Gly
Ile Val 530 535 540 Gln Gln Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala
Gln Gln His Leu 545 550 555 560 Leu Gln Leu Thr Val Trp Gly Ile Lys
Gln Leu Gln Ala Arg Ile Leu 565 570 575 Ala Val Glu Arg Tyr Leu Lys
Asp Gln Gln Leu Leu Gly Ile Trp Gly 580 585 590 Cys Ser Gly Lys Leu
Ile Cys Thr Thr Ala Val Pro Trp Asn Ala Ser 595 600 605 Trp Ser Asn
Lys Ser Leu Glu Gln Ile Trp Asn Asn Met Thr Trp Met 610 615 620 Glu
Trp Asp Arg Glu Ile Asn Asn Tyr Thr Ser Leu Ile His Ser Leu 625 630
635 640 Ile Glu Glu Ser Gln Ile Gln Gln Glu Met Asn Glu Gln Glu Leu
Leu 645 650 655 Glu Leu Asp Lys Trp Ala Ser Leu Trp Asn Trp Phe Asn
Ile Thr Asn 660 665 670 Trp Leu Trp Tyr Ile Lys Leu Phe Ile Met Ile
Val Gly Gly Leu Val 675 680 685 Gly Leu Arg Ile Val Phe Ala Val Leu
Ser Val Val Lys Lys Leu Gly 690 695 700 Arg Asp Ile His His Tyr Arg
Phe Arg Pro Thr Ser Gln His Arg Gly 705 710 715 720 Asp Thr Gly Pro
Lys Glu 725 4 2184 DNA Human immunodeficiency virus type 1 4
atgagagtga aggagaaata tcagcacttg tggagatggg ggtggagatg gggcaccatg
60 ctccttggga tgttgatgat ctgtaatgct acagaaaaat tgtgggtcac
agtctattat 120 ggggtacctg tgtggaagga agcaaccacc actctatttt
gtgcatcaga tgctaaagca 180 tatgaaacag aggtacataa tgtttgggcc
acacatgcct gtgtacccac agaccccaac 240 ccacaagaag tagtattggt
aaatgtgaca gaaaatttta acatgtggaa aaatgacatg 300 gtagaacaga
tgcatgagga tataatcagt ttatgggatc aaagcctaaa gccatgtgta 360
aaattaaccc cactctgtgt tagtttaaag tgcactgatt tgaagaatga tactaatacc
420 aatagtggta gcgggagaat gataatggag aaaggagaga taaaaaactg
ctctttcaat 480 atcagcacaa gcaaaagaag taaggtgaag aaagaatatg
cattttttta taaacttgat 540 ataataccaa tagataatga tcctaccagc
tatacgttga caagttgtaa cacctcagtc 600 attacacagg cctgtccaaa
ggtatccttt gagccaattc ccatacatta ttgtgccccg 660 gctggttttg
cgattctaaa atgtaataat aagacgttca atggaacagg accatgtaca 720
aatgtcagca cagtacaatg tacacatgga attaggccag tagtatcaac tcaactgctg
780 ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt
cacggacaat 840 gctaaaacca taatagtaca gctgaacaca tctgtagaaa
ttaattgtac aaaacccaac 900 aacaatacaa gaaaaagaat ccgtatccat
agaggaccag ggagagcatt tgttacagta 960 ggaaaaatag gaaatatgag
acaagcacat tgtaacatta gtagagcaaa atggagtaac 1020 actttaaaac
agatagctag caaattaaga gaacaatttg gaaataataa aacaataatc 1080
tttaagcagt cctcaggagg ggacccagaa attgtaacgc acagttttaa ttgtggaggg
1140 gaatttttct actgtaagtc aacacaactg tttaatagta cttggagtac
taaagggtca 1200 aataacactg aaggaagtga cacaatcacc ctcccatgca
gaataaaaca agttataaac 1260 atgtggcagg aagtaggaaa agcaatgtat
gcccctccca tcagtggaca aattagatgt 1320 tcatcaaata ttacagggct
gctattaaca agagatggtg gtaatagcaa caatgagtcc 1380 gagatcttca
gacctggagg aggagatatg agggacaatt ggagaagtga attatataaa 1440
tataaagtag taaaaattga accattagga gtagcaccca ccaaggcaaa gagaagagtg
1500 gtgcagagag aaaaaagagc agtgggaata ggagctttgt tccttgggtt
cttgggagca 1560 gcaggaagca ctatgggcgc agcgtcaatg gcgctgacgg
tacaggccag acaatcattg 1620 tctggtatag tgcagcagca gaacaatctg
ctgagggcta ttgaggcgca acagcatctg 1680 ttgcaactca cagtctgggg
catcaagcag ctccaggcaa gaatcctggc tgtggaaaga 1740 tacctaaagg
atcaacagct cctggggatt tggggttgct ctggaaaact catttgcacc 1800
actgctgtgc cttggaatgc tagttggagt aataaatctc tggaacagat ttggaataac
1860 atgacctgga tggagtggga cagagaaatt aacaattaca caagcttaat
acactcctta 1920 attgaagaat cgcaaatcca gcaagaaatg aatgaacaag
aattattgga attagataaa 1980 tgggcaagtt tgtggaattg gtttaacata
acaaattggc tgtggtatat aaaattattc 2040 ataatgatag taggaggctt
ggtaggttta agaatagttt ttgctgtact ttctgtagtg 2100 aaaaagttag
gcagggatat tcaccattat cgtttcagac ccacctccca acaccgaggg 2160
gacccgacag gcccgaagga atag 2184 5 30 DNA Artificial Sequence
Description of Artificial SequencePCR primer 5 cctcaggagg
ggacccagaa attgtaacgc 30 6 30 DNA Artificial Sequence Description
of Artificial SequencePCR primer 6 gcgttacaat ttctgggtcc cctcctgagg
30 7 31 DNA Artificial Sequence Description of Artificial
SequencePCR primer 7 ggcaggaagt agaaaaagca atgtatgccc c 31 8 31 DNA
Artificial Sequence Description of Artificial SequencePCR primer 8
ggggcataca ttgctttttc tacttcctgc c 31 9 31 DNA Artificial Sequence
Description of Artificial SequencePCR primer 9 ggcaggaagt
aggaaaagca atgtatgccc c 31 10 31 DNA Artificial Sequence
Description of Artificial SequencePCR primer 10 ggggcataca
ttgcttttcc tacttcctgc c 31 11 856 PRT Human immunodeficiency virus
type 1 11 Met Arg Val Lys Glu Lys Tyr Gln His Leu Trp Arg Trp Gly
Trp Arg 1 5 10 15 Trp Gly Thr Met Leu Leu Gly Met Leu Met Ile Cys
Asn Ala Thr Glu 20 25 30 Lys Leu Trp Val Thr Val Tyr Tyr Gly Val
Pro Val Trp Lys Glu Ala 35 40 45 Thr Thr Thr Leu Phe Cys Ala Ser
Asp Ala Lys Ala Tyr Asp Thr Glu 50 55 60 Val His Asn Val Trp Ala
Thr His Ala Cys Val Pro Thr Asp Pro Asn 65 70 75 80 Pro Gln Glu Val
Val Leu Val Asn Val Thr Glu Asn Phe Asp Met Trp 85 90 95 Lys Asn
Asp Met Val Glu Gln Met His Glu Asp Ile Ile Ser Leu Trp 100 105 110
Asp Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Ser 115
120 125 Leu Lys Cys Thr Asp Leu Lys Asn Asp Thr Asn Thr Asn Ser Ser
Ser 130 135 140 Gly Arg Met Ile Met Glu Lys Gly Glu Ile Lys Asn Cys
Ser Phe Asn 145 150 155 160 Ile Ser Thr Ser Ile Arg Gly Lys Val Gln
Lys Glu Tyr Ala Phe Phe 165 170 175 Tyr Lys Leu Asp Ile Ile Pro Ile
Asp Asn Asp Thr Thr Ser Tyr Ser 180 185 190 Leu Thr Ser Cys Asn Thr
Ser Val Ile Thr Gln Ala Cys Pro Lys Val 195 200 205 Ser Phe Glu Pro
Ile Pro Ile His Tyr Cys Ala Pro Ala Gly Phe Ala 210 215 220 Ile Leu
Lys Cys Asn Asn Lys Thr Phe Asn Gly Thr Gly Pro Cys Thr 225 230 235
240 Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Arg Pro Val Val Ser
245 250 255 Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Val
Val Ile 260 265 270 Arg Ser Val Asn Phe Thr Asp Asn Ala Lys Thr Ile
Ile Val Gln Leu 275 280 285 Asn Thr Ser Val Glu Ile Asn Cys Thr Arg
Pro Asn Asn Asn Thr Arg 290 295 300 Lys Arg Ile Arg Ile Gln Arg Gly
Pro Gly Arg Ala Phe Val Thr Ile 305 310 315 320 Gly Lys Ile Gly Asn
Met Arg Gln Ala His Cys Asn Ile Ser Arg Ala 325 330 335 Lys Trp Asn
Asn Thr Leu Lys Gln Ile Asp Ser Lys Leu Arg Glu Gln 340 345 350 Phe
Gly Asn Asn Lys Thr Ile Ile Phe Lys Gln Ser Ser Gly Gly Asp 355 360
365 Pro Glu Ile Val Thr His Ser Phe Asn Cys Gly Gly Glu Phe Phe Tyr
370 375 380 Cys Asn Ser Thr Gln Leu Phe Asn Ser Thr Trp Phe Asn Ser
Thr Trp 385 390 395 400 Ser Thr Glu Gly Ser Asn Asn Thr Glu Gly Ser
Asp Thr Ile Thr Leu 405 410 415 Pro Cys Arg Ile Lys Gln Ile Ile Asn
Met Trp Gln Lys Val Gly Lys 420 425 430 Ala Met Tyr Ala Pro Pro Ile
Ser Gly Gln Ile Arg Cys Ser Ser Asn 435 440 445 Ile Thr Gly Leu Leu
Leu Thr Arg Asp Gly Gly Asn Ser Asn Asn Glu 450 455 460 Ser Glu Ile
Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg 465 470 475 480
Ser Glu Leu Tyr Lys Tyr Lys Val Val Lys Ile Glu Pro Leu Gly Val 485
490 495 Ala Pro Thr Lys Ala Lys Arg Arg Val Val Gln Arg Glu Lys Arg
Ala 500 505 510 Val Gly Ile Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala
Ala Gly Ser 515 520 525 Thr Met Gly Ala Ala Ser Met Thr Leu Thr Val
Gln Ala Arg Gln Leu 530 535 540 Leu Ser Gly Ile Val Gln Gln Gln Asn
Asn Leu Leu Arg Ala Ile Glu 545 550 555 560 Ala Gln Gln His Leu Leu
Gln Leu Thr Val Trp Gly Ile Lys Gln Leu 565 570 575 Gln Ala Arg Ile
Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln Gln Leu 580 585 590 Leu Gly
Ile Trp Gly Cys Ser Gly Lys Leu Ile Cys Thr Thr Ala Val 595 600 605
Pro Trp Asn Ala Ser Trp Ser Asn Lys Ser Leu Glu Gln Ile Trp Asn 610
615 620 His Thr Thr Trp Met Glu Trp Asp Arg Glu Ile Asn Asn Tyr Thr
Ser 625 630 635 640 Leu Ile His Ser Leu Ile Glu Glu Ser Gln Asn Gln
Gln Glu Lys Asn 645 650 655 Glu Gln Glu Leu Leu Glu Leu Asp Lys Trp
Ala Ser Leu Trp Asn Trp 660 665 670 Phe Asn Ile Thr Asn Trp Leu Trp
Tyr Ile Lys Leu Phe Ile Met Ile 675 680 685 Val Gly Gly Leu Val Gly
Leu Arg Ile Val Phe Ala Val Leu Ser Ile 690 695 700 Val Asn Arg Val
Arg Gln Gly Tyr Ser Pro Leu Ser Phe Gln Thr His 705 710 715 720 Leu
Pro Thr Pro Arg Gly Pro Asp Arg Pro Glu Gly Ile Glu Glu Glu 725 730
735 Gly Gly Glu Arg Asp Arg Asp Arg Ser Ile Arg Leu Val Asn Gly Ser
740 745 750 Leu Ala Leu Ile Trp Asp Asp Leu Arg Ser Leu Cys Leu Phe
Ser Tyr 755 760 765 His Arg Leu Arg Asp Leu Leu Leu Ile Val Thr Arg
Ile Val Glu Leu 770 775 780 Leu Gly Arg Arg Gly Trp Glu Ala Leu Lys
Tyr Trp Trp Asn Leu Leu 785 790 795 800 Gln Tyr Trp Ser Gln Glu Leu
Lys Asn Ser Ala Val Ser Leu Leu Asn 805 810 815 Ala Thr Ala Ile Ala
Val Ala Glu Gly Thr Asp Arg Val Ile Glu Val 820 825 830 Val Gln Gly
Ala Cys Arg Ala Ile Arg His Ile Pro Arg Arg Ile Arg 835 840 845 Gln
Gly Leu Glu Arg Ile Leu Leu 850 855 12 759 PRT Human
immunodeficiency virus type 1 12 Met Arg Val Lys Glu Lys Tyr Gln
His Leu Trp Arg Trp Gly Trp Arg 1 5 10 15 Trp Gly Thr Met Leu Leu
Gly Met Leu Met Ile Cys Asn Ala Thr Glu 20 25 30 Lys Leu Trp Val
Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala 35 40 45 Thr Thr
Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Glu Thr Glu 50 55 60
Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn 65
70 75 80 Pro Gln Glu Val Val Leu Val Asn Val Thr Glu Asn Phe Asn
Met Trp 85 90 95 Lys Asn Asp Met Val Glu Gln Met His Glu Asp Ile
Ile Ser Leu Trp 100 105 110 Asp Gln Ser Leu Lys Pro Cys Val Lys Leu
Thr Pro Leu Cys Val Ser 115 120 125 Leu Lys Cys Thr Asp Leu Lys Asn
Asp Thr Asn Thr Asn Ser Ser Ser 130 135 140 Gly Arg Met Ile Met Glu
Lys Gly Glu Ile Lys Asn Cys Ser Phe Asn 145 150 155 160 Ile Ser Thr
Ser Lys Arg Gly Lys Val Lys Lys Glu Tyr Ala Phe Phe 165 170 175 Tyr
Lys Leu Asp Ile Ile Pro Ile Asp Asn Asp Pro Thr Ser Tyr Thr 180 185
190 Leu Thr Ser Cys Asn Thr Ser Val Ile Thr Gln Ala Cys Pro Lys Val
195 200 205 Ser Phe Glu Pro Ile Pro Ile His Tyr Cys Ala Pro Ala Gly
Phe Ala 210 215 220 Ile Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Thr
Gly Pro Cys Thr 225 230 235 240 Asn Val Ser Thr Val Gln Cys Thr His
Gly Ile Arg Pro Val Val Ser 245 250 255 Thr Gln Leu Leu Leu Asn Gly
Ser Leu Ala Glu Glu Glu Val Val Ile 260 265 270 Arg Ser Val Asn Phe
Thr Asp Asn Ala Lys Thr Ile Ile Val Gln Leu 275 280 285 Asn Thr Ser
Val Glu Ile Asn Cys Thr Lys Pro Asn Asn Asn Thr Arg 290 295 300 Lys
Arg Ile Arg Ile Gln Arg Gly Pro Gly Arg Ala Phe Val Thr Val 305
310
315 320 Gly Lys Ile Gly Asn Met Arg Gln Ala His Cys Asn Ile Ser Arg
Ala 325 330 335 Lys Trp Ser Asn Thr Leu Lys Gln Ile Ala Ser Lys Leu
Arg Glu Gln 340 345 350 Phe Gly Asn Asn Lys Thr Ile Ile Phe Lys Gln
Ser Ser Gly Gly Asp 355 360 365 Pro Glu Ile Val Thr His Ser Phe Asn
Cys Gly Gly Glu Phe Phe Tyr 370 375 380 Cys Lys Ser Thr Gln Leu Phe
Asn Ser Thr Trp Ser Thr Lys Gly Ser 385 390 395 400 Asn Asn Thr Glu
Gly Ser Asp Thr Ile Thr Leu Pro Cys Arg Ile Lys 405 410 415 Gln Ile
Ile Asn Met Trp Gln Lys Val Glu Lys Ala Met Tyr Ala Pro 420 425 430
Pro Ile Ser Gly Gln Ile Arg Cys Ser Ser Asn Ile Thr Gly Leu Leu 435
440 445 Leu Thr Arg Asp Gly Gly Asn Asn Asn Asn Glu Ser Glu Ile Phe
Arg 450 455 460 Pro Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser Glu
Leu Tyr Lys 465 470 475 480 Tyr Lys Val Val Lys Ile Glu Pro Leu Gly
Val Ala Pro Thr Lys Ala 485 490 495 Lys Arg Arg Val Val Gln Arg Glu
Lys Arg Ala Val Gly Ile Gly Ala 500 505 510 Leu Phe Leu Gly Phe Leu
Gly Ala Ala Gly Ser Thr Met Gly Ala Ala 515 520 525 Ser Met Ala Leu
Thr Val Gln Ala Arg Gln Ser Leu Ser Gly Ile Val 530 535 540 Gln Gln
Gln Asn Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Leu 545 550 555
560 Leu Gln Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Ala Arg Ile Leu
565 570 575 Ala Val Glu Arg Tyr Leu Lys Asp Gln Gln Leu Leu Gly Ile
Trp Gly 580 585 590 Cys Ser Gly Lys Leu Ile Cys Thr Thr Ala Val Pro
Trp Ser Ala Ser 595 600 605 Trp Ser Asn Lys Ser Leu Glu Gln Ile Trp
Asn Asn Met Thr Trp Met 610 615 620 Glu Trp Asp Arg Glu Ile Asn Asn
Tyr Thr Ser Leu Ile His Ser Leu 625 630 635 640 Ile Glu Glu Ser Gln
Asn Gln Gln Glu Met Asn Glu Gln Glu Leu Leu 645 650 655 Glu Leu Asp
Lys Trp Ala Ser Leu Trp Asn Trp Phe Ile Ile Ser Ser 660 665 670 Trp
Leu Trp Tyr Ile Lys Ile Phe Ile Met Ile Val Gly Gly Leu Val 675 680
685 Gly Leu Arg Ile Val Phe Ala Val Phe Ser Ile Val Asn Arg Val Arg
690 695 700 Gln Gly Tyr Ser Pro Leu Ser Phe Gln Thr His Leu Pro Ile
Pro Lys 705 710 715 720 Gly Pro Asp Arg Pro Lys Arg Ile Leu Asn Thr
Tyr Leu Gly Arg Ser 725 730 735 Ala Glu Pro Val Pro Leu Gln Leu Pro
Pro Leu Glu Arg Leu Ser Gly 740 745 750 Thr Leu Asp Cys Asn Lys Asp
755
* * * * *