U.S. patent application number 09/974870 was filed with the patent office on 2003-05-08 for methods and primers for detecting target nucleic acid sequences.
This patent application is currently assigned to Zeneca Limited. Invention is credited to Gibson, Neil James, Little, Stephen, Theaker, Jane, Whitcombe, David Mark.
Application Number | 20030087240 09/974870 |
Document ID | / |
Family ID | 10833706 |
Filed Date | 2003-05-08 |
United States Patent
Application |
20030087240 |
Kind Code |
A1 |
Whitcombe, David Mark ; et
al. |
May 8, 2003 |
Methods and primers for detecting target nucleic acid sequences
Abstract
A method for the detection of a target nucleic acid, which
method comprises contacting template nucleic acid from a sample
with (i) a signalling system and (ii) a tailed nucleic acid primer
having a template binding region and the tail comprising a linker
and a target binding region, in the presence of appropriate
nucleoside triphosphates and an agent for polymerization thereof,
under conditions such that the template binding region of the
primer will hybridize to a complementary sequence in the template
nucleic acid and be extended to form a primer extension product,
separating any such product from the template whereupon the target
binding region in the tail of the primer will hybridize to a
sequence in the primer extension product corresponding to the
target nucleic acid, and wherein any such target specific
hybridization causes a detectable change in the signalling system,
such that the presence or absence of the target nucleic acid in the
sample is detected by reference to the presence or absence of a
detectable change in the signalling system.
Inventors: |
Whitcombe, David Mark;
(Manchester, GB) ; Theaker, Jane; (Macclesfield,
GB) ; Gibson, Neil James; (Macclesfield, GB) ;
Little, Stephen; (Manchester, GB) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Assignee: |
Zeneca Limited
|
Family ID: |
10833706 |
Appl. No.: |
09/974870 |
Filed: |
October 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09974870 |
Oct 12, 2001 |
|
|
|
09200232 |
Nov 25, 1998 |
|
|
|
6326145 |
|
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/91.2; 536/24.3 |
Current CPC
Class: |
C12Q 1/6823 20130101;
C12Q 2525/161 20130101; C12Q 2561/119 20130101; C12Q 2565/1025
20130101; C12Q 2525/301 20130101; C12Q 2525/161 20130101; C12Q
2531/113 20130101; C12Q 2525/301 20130101; C12Q 2525/186 20130101;
C12Q 2525/186 20130101; C12Q 2525/186 20130101; C12Q 2525/161
20130101; C12Q 2531/113 20130101; C12Q 2525/186 20130101; C12Q
2525/161 20130101; C12Q 2531/113 20130101; C12Q 2525/186 20130101;
C12Q 1/6818 20130101; C12Q 2525/161 20130101; C12Q 1/6853 20130101;
C12Q 1/6823 20130101; C12Q 1/6853 20130101; C12Q 1/6818 20130101;
C12Q 1/6818 20130101; C12Q 1/6853 20130101; C12Q 1/6818
20130101 |
Class at
Publication: |
435/6 ; 435/91.2;
536/24.3 |
International
Class: |
C12Q 001/68; C07H
021/04; C12P 019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 13, 1998 |
GB |
9812768.1 |
Claims
1. A method for the detection of a target nucleic acid, which
method comprises contacting template nucleic acid from a sample
with (i) a signalling system and (ii) a tailed nucleic acid primer
having a template binding region and the tail comprising a linker
and a target binding region, in the presence of appropriate
nucleoside triphosphates and an agent for polymerisation thereof,
under conditions such that the template binding region of the
primer will hybridise to a complementary sequence in the template
nucleic acid and be extended to form a primer extension product,
separating any such product from the template whereupon the target
binding region in the tail of the primer will hybridise to a
sequence in the primer extension product corresponding to the
target nucleic acid, and wherein any such target specific
hybridisation causes a detectable change in the signalling system,
such that the presence or absence of the target nucleic acid in the
sample is detected by reference to the presence or absence of a
detectable change in the signalling system.
2. A method as claimed in claim 1 wherein the tailed nucleic acid
primer is used as an amplification primer in an amplification
system.
3. A method as claimed in claim 2 wherein the amplification system
is the polymerase chain reaction (PCR).
4. A method as claimed in claim 2 or claim 3 wherein the tail of
the nucleic acid primer remains uncopied during amplification.
5. A method as claimed in claim 4 wherein the linker in the tail
comprises a blocking moiety to prevent copying of the tail.
6. A method as claimed in claim 4 wherein the tail of the nucleic
acid primer comprises a non-copiable species.
7. A method as claimed in any one of the previous claims wherein
hybridisation of the tailed primer to template nucleic acid is
performed at a stringency so as to allow primer extension on
related template sequences.
8. A method as claimed in claim 7 wherein the related template
sequences are human leukocyte antigen (HLA) sequences.
9. A method as claimed in any one of the previous claims wherein
hybridisation of the template binding region and/or target binding
region of the primer to a complementary sequence is allele
specific.
10. A diagnostic primer for use in a method according to any one of
claims 1-9 and comprising (i) a template binding region and (ii) a
tail comprising a target binding region and wherein the target
binding region hybridises to a complementary sequence in an
extension product of the primer corresponding to the target nucleic
acid and the complementary sequence is less than 200 base pairs
from the template binding region.
11. A diagnostic primer for use in a method according to any one of
claims 1-9 and comprising (i) a template binding region and (ii) a
tail comprising a linker and a target binding region and wherein
the target binding region hybridises to a complementary sequence in
an extension product of the primer corresponding to the target
nucleic acid.
12. A primer as claimed in claim 10 or claim 11 wherein the
template binding region and the tail region are arranged such that
the tail region remains uncopied during amplification.
13. A primer as claimed in any one of claims 10-12 wherein the
linker comprises a blocking moiety which prevents polymerase
mediated copying of the primer tail.
14. A primer as claimed in any one of claims 10-13 and further
comprising at least one component of an integral signalling system
to indicate hybridisation of the target binding region to a
complementary sequence in an primer extension product of the
primer.
15. A primer as claimed in claim 14 wherein the primer tail carries
an intercalating dye.
16. A primer as claimed in claim 14 wherein the primer tail
comprises a fluorophore for the detection of target binding by
fluorescence polarisation.
17. A diagnostic primer as claimed in claim 14 and further having a
separate species comprising at least one component of an integral
signalling system releasably attached to the primer tail.
18. A primer as claimed in claim 17 wherein the signalling system
comprises energy transfer between fluorophore and quencher
species.
19. A primer as claimed in claim 14 wherein the primer tail acts as
a quencher species.
20. A primer as claimed in claim 13 wherein the primer tail
includes one or more regions of internal hybridisation to stabilise
one or more component(s) of the signalling system in a given
position.
21. A primer as claimed in claim 20 wherein the primer tail
comprises a self-complementary stem duplex having a fluorophore
quenched by a quencher species, and wherein the fluorophore becomes
unquenched when the stem duplex is disrupted.
22. A primer as claimed in any one of claims 10-21 which further
comprises a capture region which hybridises to complementary
sequence on a solid phase.
23. A method as claimed in any one of claims 1-9 and using more
than one nucleic acid primer for the detection of more than one
target nucleic acid sequence.
24. A kit which comprises at least one primer as claimed in any one
of claims 10-22 together with packaging and instructions for use.
Description
[0001] The present invention relates to a novel detection system
comprising novel primers and an integrated signalling system. The
system is used in the detection of target nucleic acid
sequences.
[0002] Available methods for the amplification and detection of
target nucleic acid sequences include use of the polymerase chain
reaction (PCR), for example as described in U.S. Pat. Nos.
4,683,195 and 4,683,202.
[0003] A significant improvement on the above amplification and
detection methods is the Amplification Refractory Mutation System
(ARMS) as claimed in our European Patent no. 0 332 435 (Zeneca
Limited) and corresponding U.S. Pat. No. 5,595,890.
[0004] Convenient probe based detection systems include Taqman (as
disclosed in U.S. Pat. Nos. 5,210,015 and 5,487,972) and Molecular
Beacons (as disclosed in WO-95/13399). In Taqman a probe molecule
comprising fluorophore/quencher species hybridises to PCR
amplification products and is digested by the 5'-3' exonuclease
activity of a polymerase. This leads to release of unquenched
fluorophore and a corresponding detectable signal. In Molecular
Beacons a probe molecule having a stem-loop structure keeping
fluorophore and quencher species in close proximity opens out upon
binding to its complementary target whereupon the fluorophore
becomes unquenched leading to a detectable signal.
[0005] Nazarenko et al (NAR 1997, 25, 2516-2521) disclose so called
"Sunrise" primers. These are primers which form hairpin loops at
their 5' ends to bring a fluorophore and quencher pair together,
thus ensuring low fluorescence. When these primers have been
incorporated into a PCR product, the tails become double stranded
and the hairpin is unravelled causing the fluorescence to increase.
However signal generation is not amplicon dependent, any double
stranded amplicon (including primer dimers) can incorporate the
Sunrise primer and thus generate a spurious signal.
[0006] U.S. Pat. No. 5,573,906 (Bannwarth et al) describe a process
using a 5' labelled primer containing a self-complementary sequence
in an amplification or extension process together with a subsequent
detection step using a 3' labelled probe for the amplified or
extended region. The labels may be close together in space after
hybridising the probe close to the short piece of double-stranded
DNA resulting from backfolding of the self-complementary region of
the primer incorporated into the amplified or extended product.
[0007] However, the levels of sequence specificity and detection
sensitivity, as well as speed of signal appearance, achievable
using the above amplification and detection methods are limited.
Therefore the need still exists for further improved diagnostic
methods.
[0008] We have now devised a novel detection system using a tailed
primer and an integrated signalling system. The primer has a
template binding region and a tail comprising a linker and a target
binding region. In use the target binding region in the tail
hybridises to complementary sequence in an extension product of the
primer. This target specific hybridisation event is coupled to a
signalling system wherein hybridisation leads to a detectable
change.
[0009] Therefore in a first aspect of the present invention we
provide a method for the detection of a target nucleic acid, which
method comprises contacting template nucleic acid from a sample
with (i) a signalling system and (ii) a tailed nucleic acid primer
having a template binding region and the tail comprising a linker
and a target binding region, in the presence of appropriate
nucleoside triphosphates and an agent for polymerisation thereof,
under conditions such that the template binding region of the
primer will hybridise to a complementary sequence in the template
nucleic acid and be extended to form a primer extension product,
separating any such product from the template whereupon the target
binding region in the tail of the primer will hybridise to a
sequence in the primer extension product corresponding to the
target nucleic acid, and wherein any such target specific
hybridisation causes a detectable change in the signalling system,
such that the presence or absence of the target nucleic acid in the
sample is detected by reference to the presence or absence of a
detectable change in the signalling system.
[0010] The detection method of the invention has a number of
significant advantages. These include the following. Only a single
primer/detector species is required. This means simplicity and
provides enhanced specificity based on the ready availability of
the target binding region for hybridisation with the primer
extension product. The newly synthesised primer extension product
is the target species so the output signal obtainable is directly
related to amount of extended primer. It is not dependent on
additional hybridisation events or enzymatic steps (such as TaqMan
cleavage). Intra- and inter-strand competition for the probe site
is limited so probe design becomes simplified. We have found that
probes which fail to bind under standard assay conditions in
separate probe format work well in our invention. The invention
also allows homogeneous assay formats to be readily devised. A
still further advantage is that, as the interaction is
unimolecular, the signalling reaction is very rapid, permitting
increased cycling rates. This is a significant feature for assay
designs.
[0011] Wilton et al (Human Mutation, 1998, 11, 252-258) disclose an
analytical method termed Snapback Single Strand Conformation
Polymorphism (SSCP). This involves the use of a tailed primer to
introduce a secondary structure in a single strand of an amplicon.
The primers consist of standard 3' ends with short tails on the 5'
end. These tails are complementary to an internal region of the
amplicon at some distance from the primer and can be used to probe
the conformation of the single strands formed after heating and
cooling. The conformational changes introduced by a mutation at the
probe complementary site are detected by migration rate changeson a
polyacylamide gel stained with silver. However there is no
anticipation of the features or advantages of the present
invention.
[0012] In the detection method of the invention, primer extension
may be repeated one or more times such as up to 5, up to 10, up to
15, up to 20, up to 30,up to 40, up to 50 or more times.
Conveniently, the novel primer of the invention is used as an
amplification primer in an amplification system such as the
polymerase chain reaction (PCR). In which case the target binding
region and the tail region are advantageously arranged such that
the tail region remains single stranded, ie. uncopied. Thus the
tail region is non-amplifiable in the PCR amplification products.
This facet of primer design is claimed in our European Patent No. 0
416 817 (Zeneca Limited) and corresponding U.S. Pat. No. 5,525,494.
Conveniently the linker comprises a blocking moiety which prevents
polymerase mediated chain extension on the primer template. A
preferred blocking moiety is a hexethylene glycol (HEG) monomer.
Alternatively the primer tail comprises material such as 2-O-alkyl
RNA which will not permit polymerase mediated replication of a
complementary strand. Alternatively the tail comprises nucleic acid
placed 5'-3' at the 5' terminus of the primer ie. 4 ie two
sequences are placed "back to back", it will be appreciated that in
this embodiment the 5'-3' nucleic acid of the tail serves both as
the linker and the target binding region. A separate and distinct
linker moiety is not essential.
[0013] The template binding region of the primer hybridises to
template nucleic acid from a sample. The region is of any
convenient design available to the person of ordinary skill and is
limited only by practical considerations. It may be DNA, RNA or
other provided that it provides a substrate for polymerase mediated
primer extension. Template binding can be effected at any desired
stringency, that is to say under appropriate hybridisation
stringency conditions the template binding region of the primer may
hybridise to the template region (if present in the template) to
the exclusion of other regions. Alternatively template binding may
be effected at reduced stringency to extend the primer on any
convenient number of related template sequences, such as for
example human leukocyte antigen (HLA) genes, or other conserved
genes, particularly bacterial or ribosomal RNA genes. Primers may
be provided wherein the template binding regions are members of a
set of random hexamer sequences. Thus the expression "a
complementary sequence" is intended to include all sequences
outlined above provided that the template binding region and
hybridisation conditions allow the desired degree of sequence
discrimination. By way of example the template binding region may
be 100%, up to 95%, up to 90%, up to 85%, up to 80%, up to 75%, or
up to 70% complementary to the corresponding template sequence. The
template binding region is conveniently of 6-50 nucleotides such as
10-40 nucleotides, 15-30 nucleotides, particularly 20-30, 17-22,
16-23 or 15-24 nucleotides. Each of the above ranges is a separate
and independent embodiment of the invention. All of the above
applies in an analogous manner to the target binding region of the
primer with the proviso that the target binding region is in
general shorter that the template binding region, examples of
convenient and preferred ranges are set out hereinafter. It will be
appreciated that the overall selectivity of the method of the
invention may be applied in an allele-specific or multiple allele
manner for the template binding or target binding regions
independently. Each permutation is a particular aspect of the
invention.
[0014] As outlined above, the target binding region may if desired
comprise a non-copiable species such as 2'-O-methyl RNA, peptide
nucleic acid (PNA) and variants of these. In this case a separately
identifiable linker is not required and the target binding region
is considered to comprise a linker separating the template binding
and target binding regions. The target binding region may be
shorter than those traditionally designed for hybridisation to
amplicons (amplification products) since the amplicon-target
interactions of this invention are unimolecular and hence
kinetically (and thermodynamically) more favoured than bi-molecular
interactions. By way of non-limiting example, the target binding
region may comprise no more than 6, such as no more than 7, no more
than, 8 no more than 9 or no more than 10 nucleotides.
[0015] It will be understood that the tail of the primer may
include additional nucleotides complementary to part of the
template binding region in the primer. These may be used to "fine
tune" the affinity of the primer tail for complementary
sequences.
[0016] The linker separates the template binding and target binding
regions. Optimum characteristics for the linker may be determined
by routine experimentation. Whilst we do not wish to be bound by
theoretical considerations, the linker may comprise no more than
200 nucleotides or less such as 100 or 50 nucleotides. In general
these regions are kept close together, we believe this may favour
hybridisation of target binding region to the target region. In a
preferred aspect the linker comprises a non-amplifiable moiety such
as HEG, alone or combined with further nucleotides, more preferably
alone. Where the template binding region and the tail region of the
primer are arranged to prevent polymerase-mediated copying of the
primer tail the linker may be a direct bond.
[0017] In a further aspect of the invention we provide a nucleic
acid primer comprising (i) a template binding region and (ii) a
tail comprising a linker and a target binding region such that in
use the target binding region hybridises to a complementary
sequence in an extension product of the primer corresponding to the
target nucleic acid. The template binding region and the tail
region are preferably arranged such that the tail region remains
single stranded in the PCR amplification products. More preferably
a blocking moiety is sited between the template binding region of
the primer and the tail region, which moiety prevents polymerase
mediated chain copying of the tail region of the primer template. A
particular blocking moiety is a hexethylene glycol (HEG) monomer.
The target binding region is preferably selected to hybridise to a
complementary target sequence in the primer extension product less
than 200 such as less than 100 base pairs, such as less than 50
base pairs, such as less than 40 base pairs, less than 30 base
pairs less than 25 or less than 20 base pairs such as less than 15,
10 or even 5 from a sequence complementary to the template binding
region in the primer.
[0018] Hybridisation of the target binding region in the tail of
the primer to a complementary sequence in the primer extension
product corresponding to the target nucleic acid causes a
detectable change in the signalling system. Any convenient
signalling system may be used, by way of non-limiting example we
refer to the measurement of the change in fluorescence polarisation
of a fluorescently labelled species (European Patent No. 0 382
433--Zeneca Limited), DNA binding proteins, creation of restriction
sites in duplex species for endpoint detection, the bringing
together of elements to give a target site, the incorporation of
detectably (modified) dNTPs into primer extension products and
further probe species. In addition any convenient sequence specific
species may be used, examples include intercalators such as
wavelength specific intercalators, also species used to form
triplex structures. Convenient intercalators will be apparent to
the scientist skilled in the art (cf. Higuchi et al, BioTechnology,
1992, 10, 413-417).
[0019] Further systems include two-component systems where a signal
is created or abolished when the two components are brought into
close proximity with one another. Alternatively a signal is created
or abolished when the two components are separated following
binding of the target binding region.
[0020] Both elements of the two component system may be provided on
the same or different molecules. By way of example the elements are
placed on different molecules, target specific binding displaces
one of the molecules into solution leading to a detectable signal.
Convenient two-component systems may based on the use of energy
transfer, for example between a fluorophore and a quencher. In a
particular aspect of the invention the detection system comprises a
fluorophore/quencher pair. Convenient and preferred attachment
points for energy transfer partners may be determined by routine
experimentation. A number of convenient fluorophore/quencher pairs
are detailed in the literature (for example Glazer et al, Current
Opinion in Biotechnology, 1997, 8, 94-102) and in catalogues such
as those from Molecular Probes, Glen and Applied Biosystems (ABI).
Any fluorescent molecule is suitable for signalling provided it may
be detected on the instrumentation available. Most preferred are
those compatible with the 488 nm laser of the ABI PRISM 7700
(Fluorescein and Rhodamine derivatives). The quencher must be able
to quench the dye in question and this may be via a Fluorescence
Resonance Energy Transfer (FRET) mechanism involving a second,
receptor fluorophore, or more preferably via a collisional
mechanism involving a non-fluorogenic quencher such as DABCYL,
which is a "Universal" quencher of fluorescence Furthermore it is
preferred that the selected fluorophores and quenchers are easily
incorporated into the oligonucleotide, most conveniently via
phosphoramidite chemistry. Convenient donors include FAM, HEX and
TET.
[0021] We surprisingly found that, without the inclusion of a
specific quencher, the tail alone can provide sufficient quenching
of fluorescence. When the target binding region hybridises to a
complementary sequence in the primer extension product a clear
fluorescence signal is observed. The optimum point of attachment of
the fluorophore may determined by routine experimentation. In a
further aspect of the invention the signalling system comprises a
fluorophore attached to the tail region of the primer, conveniently
at or adjacent the termini 5' terminus of the primer. Whilst we do
not wish to be limited by theoretical considerations, any G-rich
sequence of at least 5 base pairs, such as at least 10 or at least
15, such as at least 20 base pairs may be used as a quencher
species.
[0022] In a further specific embodiment, the primer tail includes
an intercalating dye, hybridisation of the target binding region
causes the dye to become incorporated between the bases of the
double stranded DNA and thus to fluoresce. The dye should
preferably have a low fluorescence when not intercalated, and a
strong fluorescent enhancement upon intercalation. Again the
preferred molecules should be easy to attach to the oligonucleotide
by solid phase chemistry or by simple post-synthesis addition.
[0023] It will be appreciated that the overall length of the primer
tail will be determined principally by the intended functions of
its individual components. In general, the primer tail will be of
at least 10 base pairs, such as at least 20, 30, 40 or 50 base
pairs, for example 10-30 or 15-25 base pairs.
[0024] It is desirable that all dyes, quenchers, linkers/blockers
should tolerate repeated rounds of PCR which include multiple
exposures to high temperatures.
[0025] In a preferred aspect of the invention at least one
component of the signalling system and the nucleic acid primer is
an integral species.
[0026] The template nucleic acid is any convenient nucleic acid for
analysis. Most commonly this will be DNA from an amplification
reaction such as the PCR. This DNA target may have been derived
from a reverse transcription (RT) reaction. Indeed, the primer of
the invention may be used in the RT reaction itself and be used
directly, without further amplification. Other in vitro
amplification techniques such as ligase chain reaction (LCR), OLA,
NASBA and Strand Displacement Amplification (SDA) may also be
suitable. It is important however that there is a single stranded
intermediate which allows the target binding region to hybridise to
a complementary sequence in the primer extension product. In
general the method of our invention is used as the last (detection)
step in the above methods. It will be appreciated that some
optimisation/reconfiguration may be required but the relevant steps
will be apparent to the artisan of ordinary skill.
[0027] Sources of sample nucleic acid include human cells such
circulating blood, buccal epithelial cells, cultured cells and
tumour cells. Also other mammalian tissue, blood and cultured cells
are suitable sources of template nucleic acids. In addition,
viruses, bacteriophage, bacteria, fungi and other micro-organisms
can be the source of nucleic acid for analysis. The DNA may be
genomic or it may be cloned in plasmids, bacteriophage, bacterial
artificial chromosomes (BACs), yeast artificial chromosomes (YACs)
or other vectors. RNA may be isolated directly from the relevant
cells or it may be produced by in vitro priming from a suitable RNA
promoter or by in vitro transcription.
[0028] The present invention may be used for the detection of
variation in genomic DNA whether human, animal or other. It finds
particular use in the analysis of inherited or acquired diseases or
disorders. A particular use is in the detection of inherited
disease. It will be appreciated that the target nucleic acid is
directly or indirectly linked to the sequence or region of interest
for analysis. In one preferred aspect the primer of the invention
is used as the common primer in a PCR in combination with an ARMS
primer (as disclosed in for example EP-B1-0 332 435). This is an
example of indirect linkage to the sequence or region of interest.
Alternatively the sequence or region of interest is identified when
it interacts with the template specific region in an allele
specific manner, preferably as an ARMS primer (see above).
Alternatively, the sequence or region of interest may be identified
by allele specific interaction with the target binding region in
the primer tail. Still further, the sequence or region of interest
may be a combination of the target region and template binding
seqence in the primer provided that hybridisation of the target
binding region in the primer tail is dependent on formation of a
primer extension product.
[0029] In addition to the gene based diagnostics of human heritable
disease, the invention will be useful in the detection of amplicons
from other sources. A particular use is in the detection of
infectious agents (bacteria, viruses etc), such as HIV, where the
combination of allele specific priming and allelic discrimination
via the target binding region offers opportunities to monitor the
emergence of particular variants of HIV within a virus population
in a patient. Other infectious agents for which quantitative data
(measured by Real time PCR) would be helpful include Hepatitis C
virus and others.
[0030] In other medical microbiology applications it is important
to be able to detect and quantify particular species of
micro-organism. The use of fluorescent Scorpions primers greatly
facilitates this.
[0031] The presence of bacteria in food or other products can also
be usefully monitored using real time PCR with Scorpions
fluorescence methods. The specificity of probe detection can be
modified to permit or exclude the detection of related targets.
[0032] A particular advantage is that the novel primers of the
invention need not be used at 100% primer concentration, that is to
say the detection method works well even where only a small
proportion of novel to conventional primer is used. Whilst we do
not wish to be bound by theoretical considerations we believe that
as little as a few percent, say up to 10%, up to 20%, such as up to
30%, up to 40% or up to 50% or 60% novel primer is used.
Alternatively at least 50%, 60%, 70%, 80%, 90% or 100% novel primer
is used.
[0033] The primer(s) can be added at any convenient stage in an
amplification reaction, for example in the final amplification
cycle, all that is required is one or more primer extension
reactions. For homogeneous detection systems it is preferable to
add the primer(s) at the start of any amplification procedure.
[0034] The primer tail may be configured in a number of different
ways, the sole requirement is that the target binding region in the
tail is available after primer extension to hybridise with a
complementary sequence (if present) in the primer extension
product. In its simplest form the primer tail is randomly coiled,
if fluorescent detection means are used the primer is self-quenched
prior to hybridisation of the target binding region.
[0035] The primer may include one or more regions of internal
hybridisation which help stabilise the signalling system in a given
position i.e. a particular configuration. Such region(s) are
conveniently located within the primer tail and may each be of 2 or
more base pairs. The configurations adopted are limited only by
practical considerations and may include the use of one or more
structures selected from hairpins, arms, elbows, stems, bubbles and
loops. Once convenient structures have been devised these may be
used as common features in the tailed primers of the invention.
[0036] The target binding region may have any convenient number of
additional bases at its 5' end. All or some of these additional
bases may form part of any region(s) of internal hybridisation.
[0037] In a further aspect of the invention the primer may comprise
a capture region. This may be placed at any convenient location,
preferably on the primer tail. The capture region may be a
contiguous or branched structure (cf. FIG. 8c)The capture region
hybridises to complementary sequence on, for example a solid
phase.
[0038] Any convenient template dependent polymerase may be used,
this is preferably a thermostable polymerase enzyme such as taq,
more preferably taq Gold.
[0039] Similarly any convenient nucleoside triphosphates for
conventional base pairing may be used. If required these may be
modified for fluorescence. As these may affect polymerisation rates
up to only about 1 in 20 dNTPs used is modified for best
results.
[0040] Further details of convenient polymerases, nucleoside
triphosphates, other PCR reagents, primer design, instruments and
consumables are given in "PCR" by C. R. Newton and A. Graham (The
Introduction to Biotechniques series, Second Edition 1997, ISBN 1
85996 011 1, Bios Scientific Publishers Limited, Oxford). Further
guidance may be found in "Laboratory protocols for mutation
detection" edited by Ulf Landegren, published by the Oxford
University Press, Oxford, 1996, ISBN 0 19 857795 8.
[0041] The invention will now be further illustrated by the
following non-limiting specific description wherein the tailed
primers of the invention are referred to as Scorpions primers:
[0042] The design of Scorpions primers may follow well known
guidelines for PCR amplimers; the 3' end of the Scorpions primer
and/or the target binding region may taken directly from, for
example an existing PCR or ARMS assay.
[0043] Target binding regions are typically about 17 bases (DNA)
although (depending upon the temperature at which measurements are
to be taken) shorter (as little as 6 to 10 bases) target binding
regions be used. In this context we envisage that non-natural
nucleic acids such as PNA or 2'-O-alkyl-RNA (particularly
2'-O-methyl RNA) will be useful since they have higher T.sub.ms
when bound to their targets. The spacing on a DNA strand between
the amplicon binding region and its complementary sequence within
the amplicon may be as little as 30 bases (that is directly
abutting the primer region) or may be as much as about 200-300
bases. The efficiency of the unimolecular interaction is expected
to decline as this distance increases.
[0044] Where stem regions are used, they may range from 2 bases
(especially useful for 2'-O-methyl RNA or PNA) to about 6, 8, 10 or
more bases. The balance between stem length and amplicon binding
length is important: the probe-target complex should have a
stronger (more negative) .DELTA.G (free energy) than the stem
duplex at the assay temperature. Any polymerisation blocking group
such as those described in our EP-B1-0 416817 (Zeneca Limited) is
suitable. However, we prefer that it should be easily incorporated
by solid phase oligonucleotide chemistry and should also form a
substrate for further extension in the same chemistry. Convenient
examples include hexethylene glycol (HEG) and tetraethylene glycol
(TEG) phosphorarnidites.
[0045] The range of assays which can be performed using the
Scorpions primers is extensive. Detection may, for example, be
effected after PCR amplification and at room temperatures since the
unimolecular hybridisation events happen quickly and are stable for
extended periods (at least overnight). Furthermore, positive
fluorescence signals are so high and backgrounds so low, that
fluorescence can be observed by eye under appropriate illumination
and at ambient temperature. These are significant advantages.
[0046] Where allelic discrimination is employed as an endpoint,
this may require the use of temperature control to selectively
destabilise mismatched target.
[0047] The Scorpions primers of this invention are particularly
suited to real time assays since signal generation is rapid and
requires only a unimolecular interaction. Additionally, backgrounds
are low and signals are high allowing a good deal of flexibility in
assay design. Continuous monitoring of fluorescence through the PCR
is possible with the appropriate hardware.
[0048] Scorpions primers also have substantial benefits for in situ
techniques such as in situ PCR (ISPCR) and primed in situ synthesis
(PRINS). Only priming events which generate the desired product
produce signal and this provides substantial benefits over other
techniques for detecting products within a cell.
[0049] It is generally desirable to include the Scorpions primer at
the beginning of the reaction and to measure fluorescence in the
closed tube (homogeneous) either continuously or post-PCR.
Alternatively the Scorpions primer may be added at a later stage of
the amplification; the only requirement is that the Scorpions
primer must undergo a single round of extension and produce the
unimolecular tail/target duplex.
[0050] Using appropriate signalling systems (for example different
fluorophores) it is possible to combine (multiplex) the output of
several Scorpions primers in a single reaction. The number of
primers that may be used is limited only by experimental
considerations.
[0051] We now disclose the following non-limiting embodiments:
[0052] Fluorphore/Quencher Embodiment
[0053] See FIG. 1. Quenching is achieved by the random folding of
the tail bringing the fluorophore/quencher (F/Q) pair into
proximity by chance (FIG. 2). In order to maximise this quenching,
it is preferred but not essential to have the fluorophore in the
middle of the molecule with the quencher at the 5' end. Signal
"switch-on" is by the same loss of quenching caused by
hybridisation of the probe (FIG. 3). In this embodiment, it is not
critical that the F and the Q are at opposite ends of the probing
entity, and it may be beneficial to place them closer together
within the probe portion. It is important, though, not to disrupt
the target binding function of the tail by introducing bulky, non
base-pairing elements, but both fluorophore and quencher could be
introduced on uracil monomers, replacing thymidines in the probe.
We believe that this embodiment may work best as an amplicon
detector.
[0054] Intercalation Embodiment
[0055] In this embodiment, the design of the Scorpions primer is
further simplified, having no quencher involved. Instead, the tail
carries an intercalating dye which is capable of being incorporated
between the bases of a double stranded nucleic acid molecule, upon
which it becomes highly fluorescent. In this way, sequence specific
intercalation is achieved (FIGS. 4a,b). In contrast to the
"no-stem" method described in the previous embodiment, the
intercalating fluorophore is better placed at the 5'-terminus of
the Scorpions molecule or as an internal part of the loop. Internal
folding within the primer is best minimised to ensure the absence
of double stranded DNA which may then be intercalated, leading to
high background noise. If the dye is placed within the loop portion
of the molecule, it may be possible to have a hairpin structure
(which would enhance the allele specificity of the the
hybridisation). The dye used is preferably not a standard
fluorophores but rather an intercalator having low fluorescence in
the absence of double stranded target and a high enhancement when
intercalated. Suitable fluorophores include the cyanine dyes
developed by Molecular Probes, ethidium bromide, acridine and
others. The dyes may need to be modified to ensure their easy
attachment to the Scorpions primer or incorporation via
phosphoramidite (solid phase) chemistry.
[0056] FRET Embodiment
[0057] In this modification of the basic system, the dyes involved
form an energy transfer pair. One of the dyes is positioned close
to the 3' end of the target binding region, while the other is
placed close to the 3' terminus of the amplicon binding region (see
FIGS. 5a,b). The probe must hybridise very close to the primer thus
bringing together the FRET pair and producing an enhanced
fluorescence signal
[0058] No-Quencher Embodiment
[0059] A fluorophore is attached to the tail of the Scorpions
primer (see FIGS. 6(a),(b) & (c)). Random folding of the
Scorpions primer around the fluorophore provides sufficient
quenching of the fluorophore. We believe this may be due
principally to the nucleotide, guanylic acid. In order to maximise
quenching it is preferred, but not essential, to have the
fluorophore at or around the middle of the primer, with sufficient
additional DNA to quench efficiently. Quenching efficiency is
dependent on the sequence of the surrounding DNA. Binding of the
target binding region of the tail to the target region alters the
conformation of the DNA sufficiently to remove this quenching. We
prefer this embodiment as an amplicon detector.
[0060] Bimolecular Embodiment
[0061] The fluorophore and quencher may be introduced on two
separate but complementary molecules (FIG. 7a). The fluorophore and
quencher may be on either end of the probe or complementary
strands, provided that hybridisation of the two strands brings the
fluorophore/quencher pair into close proximity. After a round of
denaturation, annealing and extension, the fluorophore remains
quenched, as the bimolecular moiety re-forms (FIG. 7b). The non
Scorpion, free strand is in excess to ensure that this bimolecular
interaction occurs and for this reason it is preferred that this
molecule carries the quencher, to minimise backgrounds. However,
after a further round of denaturation and annealing, the
self-probing strand forms (FIG. 7c) and the free quencher (oligo)
is unable to compete with this event kinetically or
thermodynamically thus leading to an increase in fluorescence.
[0062] If required one of the molecules may comprise a secondary
structure such as a hairpin structure so as to allow the attachment
of for example more quencher species for more efficient quenching
of a fluorophore on the other molecule.
[0063] Capture Probe Embodiment
[0064] In addition to the embodiments discussed above, amplicons
may be specifically captured and probed using the same
non-amplifiable tail (see FIGS. 8a & 8b). In a further specific
embodiment the capture and tail sequences are provided as
non-contiguous features ie. together with the template binding
region they form a branched primer structure (cf, FIG. 8c). After
amplification the amplicon may be captured onto a solid surface,
whilst the signal generation remains amplicon specific.
Alternatively the capture sequences and signalling system may be on
opposite ends of the amplicons. In this way, generic "chips" with
the same capture sequences may be used to analyse many different
targets--the capture regions remain unchanged while the amplifier
and probe elements vary.
[0065] Stem Embodiment
[0066] In this embodiment the primer tail comprises self
complementary stems (also DNA, RNA, 2'-O-methyl RNA, PNA and their
variants) which flank the amplicon binding region and which carry a
fluorophore quencher pair, such that hairpin formation by the two
stems brings the F/Q pair together causing the fluorescence to be
substantially quenched ("off"). The fluorophore and quencher can be
placed on either arm, depending upon preference or synthetic
simplicity; we prefer to have the quencher on the 3' arm (ie
adjacent to the blocker in the middle of the molecule)].
[0067] At high temperatures, the stem duplex is disrupted and the
fluorophore is unquenched (ie "on"--FIG. 9a); at lower
temperatures, however, the stem duplex forms and the fluorescence
is substantially off (FIG. 9b).
[0068] In an Amplification Cycle
[0069] After initial denaturation, annealing and extension, the
Scorpions amplicon comprises a region complementary to the loop
region at its 5'-end (FIG. 10a). Upon a second round of
denaturation (FIG. 10b) and annealing, the tail hybridises to the
newly synthesised region with great efficiency (a unimolecular
interaction) and fluorescence remains unquenched (FIG. 10c).
Unextended primers, however, will continue to form their quenched
conformation. Meanwhile, the "reverse" primer will have hybridised
to this same strand and synthesis goes on. We believe that the tail
is (at least partially) displaced by the Taq polymerase and the
remainder melts off easily since the probes are short. At this
stage, the Taq polymerase completes the synthesis of this strand
until it encounters the amplification blocker. Because signals are
strong and the priming function is identical to the non-Scorpions
variant, not all the primer needs to be in the Scorpions form.
Indeed, we have obtained strong signals when 10% or less of the
primer was in the Scorpions form. This allows cheaper reactions and
also permits the balancing of signal strengths where two different
fluorophores are used.
[0070] The Scorpions primers of the invention may be used in place
of conventional amplification primers, such as PCR primers and are
not expected to interfere with their amplification function. In a
two-tube ARMS test (normal and mutant) the Scorpions primer may
conveniently be the common primer (FIG. 11a), with the production
of signal dependent upon ARMS amplification. However, it is equally
viable to place the signalling entity on the ARMS primers. Each
ARMS primer may be labelled with different fluorochromes (F1, F2),
thus permitting single tube genotyping (STG)--that is both
reactions are run in the same tube and the amplicons are
distinguished by their characteristic "colour" (FIG. 11b).
Alternatively, the signalling entity may carry the allelic
specificity (see Example 2): the primers are standard (non-ARMS)
primers and two different probe sequences to match the two allelic
variants are introduced on two variants of one of the primers
(FIGS. 12a, b). It has been found that probes which can form
hairpins in the absence of target are better discriminators of
single base mismatches than the untailed versions of the same
probes. In another manifestation, probes for each variant may be
introduced one each on the two amplimers (FIGS. 12c, d) thereby
probing different strands of the reaction. Finally, combinations of
these ideas are possible: one subset of Scorpions primers may be
used for allele discrimination, while other primers in the same mix
may act as control probes to detect the amplicon itself (FIG. 12e).
Discrimination between these events is achieved either by
fluorescence wavelength or alternatively by the use of probe
elements having the same fluorophore but different T.sub.ms which
may then be discerned by measuring the fluorescence over a
temperature range.
[0071] The invention will now be illustrated but not limited by
reference to the following Figures and Examples wherein:
[0072] FIG. 1 shows the basic features of a convenient primer
design, the template binding region is indicated by the shaded
arrow, the tail region comprises a blocking group indicated by H,
also shown are a quencher and fluorophore, the target binding
region is in the region indicated by the solid line between the
quencher and fluorophore.
[0073] FIG. 2 shows quenching achieved by random coiling of the
tail bringing the fluorophore and quencher pair into close
proximity.
[0074] FIG. 3 shows hybridisation of the target binding region to a
complementary sequence in the primer extension product
corresponding to the target region.
[0075] FIG. 4(a) shows the inclusion of an intercalating
fluorophore (IF) in the tail of the primer and primer extension on
a sample template, (b) shows intercalation after hybridisation of
the target binding region to a complementary sequence in the primer
extension product corresponding to the target region.
[0076] FIG. 5(a) shows the use of dyes (R & F) incorporated
into the primer and which form an energy tranfer pair, (b) shows
their relative position upon hybridisation.
[0077] FIG. 6(a) shows the use of a primer having a single
fluorophore (F) attached at the 5' terminus, a blocking group (H)
is shown, the target binding region is indicated by the arrow to
the right, (b) shows the random coiling and quenching of the
fluorophore in solution and (c) shows hybridisation of the target
binding region after primer extension.
[0078] FIG. 7(a) shows the bimolecular embodiment of the invention,
the fluorophore and quencher are provided on separate species, in
(b) the primer is extended on a sample template, and in (c)
separation of the fluorophore and quencher upon hybridisation of
the target binding region are shown.
[0079] FIG. 8(a) shows the capture probe embodiment of the
invention, in (b) amplicons are captured on a solid phase and
probed using the same non-amplifiable tail, in (c) the primer
comprises a branched structure of the tail and capture
sequences.
[0080] FIG. 9 shows the stem embodiment of the invention, (a) at
high temperatures, the stem duplex is disrupted and the fluorophore
is unquenched, ie. "on"; (b) at lower temperatures, however, the
stem duplex forms and the fluorescence is substantially off.
[0081] FIG. 10 shows the primer as used in an amplification cycle.
(a) after initial denaturation, annealing and extension, the
Scorpions amplicon comprises a region complementary to the loop
region at its 5'-end; (b) upon a second round of denaturation and
annealing, the tail hybridises (c) to the newly synthesised region
with great efficiency (a unimolecular interaction) and fluorescence
remains unquenched (FIG. 10c). Unextended primers, however, will
continue to form their quenched conformation.
[0082] FIG. 11 shows use of the primer as (a) a common primer in a
two tube ARMS test and (b) as allele specific primers "a" and "b"
in a single tube ARMS test.
[0083] FIG. 12 shows the use of the primer where hybridisation of
the target binding region occurs in an allele specific manner, in
(a) primer extension gives a product corresponding to allele "a" or
"b", in (b) hybridisation is allele specific or mismatched in (c)
and (d) probes for each variant are provided on each of the two
amplimers, thereby probing different strands of the reaction, and
in (e) different primers may be used in the same mix for allele
discrimination and as control primers for amplicon detection.
[0084] FIG. 13 shows real time detection of amplification,
fluorescent signal is generated upon hybridisation of a matched
target binding region in contrast to a mismatched target.
[0085] FIG. 14 shows allele discrimination, fluorescent signal is
generated upon hybridisation of a matched target binding region in
contrast to a no-template control and a mismatched target.
[0086] FIG. 15 shows primer titration, fluorescent signal is
generated upon hybridisation of a matched target binding region in
contrast to a mismatched target. The following proportions of
Scorpion primer were used: (a) 100%, (b) 80%, (c) 50%, (d) 20% and
(e) 10%.
[0087] FIG. 16 shows heteroplasmy analysis, varying admixtures of C
homozygote and A homozygote were used as shown and readings taken
after 40 cycles of PCR.
[0088] FIG. 17 shows a comparison between this invention and a
bimolecular equivalent. In (a) mismatched targets show no
appreciable amplification, in (b) and (c) a substantial allele
specific signal is produced only by the matched Scorpions primers.
In FIG. 17 results obtained using Scorpions primers are shown as
triangles and crosses.
[0089] FIG. 18 shows use of the no quencher embodiment of the
invention, fluorescent signal is generated upon hybridisation of a
matched target binding region in contrast to a no-template
control.
[0090] FIG. 19 shows that random coiling of a primer of the
invention is sufficient to bring the fluorophore and quencher
together.
[0091] FIG. 20 shows the bimolecular embodiment of the invention,
different amounts of quencher oligonucleotide were added, (a) none,
(b) 0.5 .mu.M, (c) 2 .mu.M and (d) 20 .mu.M.
[0092] FIG. 21 shows (a) the proportion of free floating quencher
to the Scorpions primer ie. 40X, 4X, 1X and 0X respectively, and
(b) the effect of no quencher.
EXAMPLES
[0093] Materials
[0094] Primers/Scorpions Primers:
[0095] B2098-BRCA Scorpions:
FAM-CGCACGATGTAGCACATCAGAAGCGTGCG-MR-HEG-TTGG-
AGATTTTGTCACTTCCACTCTCAAA
[0096] Underlined regions are the hairpin forming parts, FAM is the
fluorescein dye, MR is a non-fluorogenic fluorophore attached to a
uracil, HEG is the replication blocking hexethylene glycol monomer.
The probe matches the "C-variant" of the BRCA2 polymorphism and
mismatches the "A-variant".
[0097] R186-98: untailed equivalent of B2098:
TTGGAGATTTTGTCACTTCCACTCTCAA- A
[0098] R187-98: opposing primer to the R186-98 and the equivalent
Scorpions.
[0099] Z3702: the probe segment of the Scorpions B2098:
FAM-CGCACGATGTAGCACATCAGAAGCGTGCG-MR
[0100] Template DNA: previously genotyped DNA prepared by
proteinase K and phenol/chloroform extraction was used at 50 ng per
50 .mu.l reaction. Genotypes were typically one homozygous A/A, one
homozygous C/C and one heterozygote (A/C).
[0101] Buffer (1.times.): 10 mM Tris-HCl (pH 8.3), 1.2 mM or 3.5 mM
MgCl.sub.2, 50 mM KCl, dNTPs (each at 100 .mu.M), gelatin at 0.01%
(w/v).
[0102] Enzyme: AmpliTaq Gold (Perkin-Elmer/ABI) was included in the
reaction mix at 2 units/50 .mu.l reaction.
Example 1
[0103] Amplification Detected in Real Time
[0104] In order to monitor the performance of a Scorpions primer in
an homogeneous amplification reaction, a PCR was performed using
primers which flank a polymorphism in the BRCA2 gene. The target
sequence selected had previously been used for allelic
discrimination of the two variants but was too short for real time
detection (the probe failed to hybridise at 60.degree. C.--the
lowest temperature in the thermocycling run). The (upper strand)
probe entity was synthesised as part of a lower strand primer with
a blocking HEG between the two functionalities. Target DNA could be
selected to produce amplicon which would match or mismatch the
probe.
[0105] Reaction conditions: After addition of template DNA, tubes
were sealed and reactions were cycled under the following
conditions: 20 min at 94.degree. C. to activate the Amplitaq Gold;
and 40 cycles of {94.degree. C. for 45s, 60.degree. C. for 45s}.
Reactions were performed in an ABI PRISM 7700 fluorescence PCR
machine.
[0106] Results: See FIG. 13. It is very clear that as amplicon
accumulates, fluorescent signal is generated. There are several
fluorescence readings at each timepoint and the sharp, stepwise
nature of the signal increase reflects the rapid production of
probe-target duplex in the early part of the thermocycle hold. This
is due to the unimolecular mode of action of a Scorpion primer,
which permits instantaneous recognition of an appropriate
amplicon.
Example 2
[0107] Allelic Discrimination
[0108] Materials and methods as above.
[0109] Results: See FIG. 14. In this experiment, the probe matched
or mismatched the amplicons at the polymorphic base. Both
amplifications were equally efficient (as viewed by agarose gels
[results not shown]), but the matched product was detected much
more readily than the mismatched. This illustrates the strong
specificity of the system even down to a single base change in the
amplicon.
Example 3
[0110] Primer Titration
[0111] Materials and method, see above. Titration of the primer
B2098 with its untailed equivalent (R186-98) was from 100%
Scorpions to 10% Scorpions; total primer was constant at 500
nM.
[0112] Results: See FIG. 15. At all ratios of Scorpions:untailed
primer, reactions were clearly detectable on the ABI7700. Indeed,
the Ct (the point at which signal crosses a threshold above
"background") was identical regardless of the ratio of Scorpions to
untailed primer indicating the same levels of priming effieciency
throughout the series. The only variable was absolute fluorescence
signal (as would be expected). The efficiency of this system is in
marked contrast to available methods where higher concentrations of
probe are required to drive kinetically the bimolecular probing
event.
Example 4
[0113] Endpoint Readings
[0114] Materials and methods: Reactions were set up as above but
were carried out at two different magnesium concentrations (1.2 and
3.5 mM). DNAs of all three genotypes and a no template control
(NTC) were used and the fluorescence was measured before and after
amplification. Fluorescence numbers are the means of at least 6
separate readings from duplicate samples.
[0115] Results
1 Sample CC AC AA NTC Mg 1.2 3.5 1.2 3.5 1.2 3.5 1.2 3.5 Before
6396 3706 5700 2958 6157 3299 6257 3685 After 12144 10316 8614 6140
6818 4641 6616 4453 Change 5748 6610 2914 3182 661 1342 359 768
[0116] Fluorescence readings increased through the PCR in a target
dependent manner. In fact the signals generated for heterozygotes
are approximately half those for the CC homozygotes and this may be
useful for genotyping in a simple way or for analysis of
heteroplasmy where the allele ratios vary more widely than 100:0,
50:50 or 0:100. In addition, the signals generated for mismatch
targets were similar to background levels showing that although
amplification had occurred, the probe was not efficiently
hybridising unless there was a perfect match. Increasing the
magnesium concentration decreased this discrimination but also
ensured that the backgrounds were lower, presumably by promoting
hybridisation in general.
[0117] In addition to observing these signal changes by
fluorimeter, increased fluorescence could be detected by visual
inspection of the tubes backlit by UV transilluminator. This is a
remarkable observation since the FAM dye has an excitation optimum
at 490 nm whereas the UV box illuminates at 330-360 nm. This means
that the fluorescent yield was far from optimal and may be
substantially improved by the use of more appropriate
wavelengths.
Example 5
[0118] Analysis of Heteroplasmy by Scorpions
[0119] Reactions were set up as in Example 4, but template DNA was
a standard quantity with varying admixtures of C homozygote to A
homozygote: 100%:0%, 90:10, 50:50, 10:90, 0:100 and NTC. After 40
cycles of PCR, the FAM fluorescence readings were taken and the NTC
subtracted from each. The data are shown in FIG. 16.
Example 6
[0120] Comparative Performance of Scorpions
[0121] In order to examine the relative performance of Scorpions
versus a bimolecular equivalent, the same amplicon and probe
sequences were used in each format. The bimolecular format
constituted 500 nM each of primers R186-98 and R187-98, plus 500 nM
Molecular Beacon Z3702, while the unimolecular version contained
B2098 and R187-98 each at 500 nM. Other reaction constituents were
identical to previous experiments (with 1.2 mM Mg) and cycling was
for 40 cycles as above. The results of these amplifications in real
time with targets which are homozygous C, homozygous A, or
heterozygous A/C are shown in FIG. 17. Clearly, there was no
substantial amplification above background for the reactions with a
bi-molecular probing mode of action, whereas substantial allele
specific signals were produced in the Scorpions reactions. It is
worth noting that the final level of signal for the heterozygote
was half that generated by the homozygous C amplification. This
experiment illustrates the substantial kinetic advantages of the
unimolecular hybridisation approach of this invention.
Examples 7 and 8
[0122] Random Coil Embodiment and Bimolecular Embodiment
2 Scorpion B2731: fam-AGGTAGTGCAGAGAGTG-mr-h-GAGCCTCAACATCCT-
GCTCCCCT CCTACTAC Scorpion B4249 (no quencher on same molecule)
fam-AGGTAGTGCAGAGAGTG-h-GAGCCTCAACATCCTGCTCCCCTCCT ACTAC Quencher
oligonucleotide (complement of the tail of B4249):
CACTCTCTGCACTACCT-mr ARMS primer R284-97:
TTCGGGGCTCCACACGGCGACTCTCAAC ARMS primer R283-97:
TTCGGGGCTCCACACGGCGACTCTCAAG
[0123] Target is the H63D polymorphism of the human heriditary
haemochromatosis gene (HH), B2731 and B4249 are "common" primers to
oppose the ARMS primers R283-97, R283-97. Cycling conditions and
reaction composition as above. Primers (including Scorpion primers)
were used at 500 nM concentration.
[0124] For the two molecule example, the quencher oligonucleotide
was incorporated at 0, 0.5 2 and 20 mM, that is: 0, 1, 4, 40 fold
relative to the Scorpion primer.
[0125] The random coil embodiment (FIG. 19) confirms that random
coiling alone can be sufficient to bring the probe and quencher
together and that an increase in signal is readily obtained in
continuous monitoring of PCR. (Furthermore, it should be noted that
this particular amplicon had previously proven refractory to
probing in a TaqMan or Molecular Beacons assay).
[0126] The bimolecular embodiment also gave good results (see FIGS.
20 and 21). The more quencher was added, the lower the backgrounds
in the absence of amplicon. The optimal overall performance (taking
account of absolute signal strength and signal/noise) was with
equimolar and 4.times. excess quencher.
Example 9
[0127] No Quencher Embodiment
3 Scorpion B4249 (no quencher) fam-AGGTAGTGCAGAGAGTG-h
GAGCCTCAACATCCTGCTCCCCTCCT ACTAC ARMS primer R284-97
TTCGGGGCTCCACACGGCGACTCTCAAC
[0128] Reactions were set up as described in the previous examples.
Primers were included at 500 nM. The target was the H63D mutation
of the human hereditary haemochromatosis gene (HH). 25 ng of DNA
was added per reaction. B4249 was the common primer in combination
with the ARMS mutant primer R284-97. Cycling was as described in
the previous examples. The results are shown in FIG. 18.
[0129] In this example, mutation specific signal was generated in
the absence of a quencher. Random folding of the Scorpion primer
around the fluorophore provides sufficient quenching of the
fluorophore. An increase in signal is readily obtained during
continuous monitoring of PCR.
Sequence CWU 1
1
9 1 30 DNA Artificial Sequence misc_feature ()..() B2098-BRCA
Scorpion Primer 1 cgcacgatgt agcacatcag aagcgtgcgn 30 2 29 DNA
Artificial Sequence misc_feature ()..() R186-98, untailed
equivalent of B2098 primer 2 ttggagattt tgtcacttcc actctcaaa 29 3
30 DNA Artificial Sequence misc_feature ()..() Z3702, probe segment
of B2098 primer 3 cgcacgatgt agcacatcag aagcgtgcgn 30 4 18 DNA
Artificial Sequence misc_feature ()..() B2731 Scorpion primer 4
aggtagtgca gagagtgn 18 5 31 DNA Artificial Sequence misc_feature
()..() B2731 Scorpion primer 5 gagcctcaac atcctgctcc cctcctacta c
31 6 17 DNA Artificial Sequence misc_feature ()..() B4249 Scorpion
primer 6 aggtagtgca gagagtg 17 7 19 DNA Artificial Sequence
misc_feature ()..() Quencher oligonucleotide 7 cactctcctg cactacctn
19 8 28 DNA Artificial Sequence misc_feature ()..() ARMS primer
R284-97 8 ttcggggctc cacacggcga ctctcaac 28 9 28 DNA Artificial
Sequence misc_feature ()..() ARMS primer R283-97 9 ttcggggctc
cacacggcga ctctcaag 28
* * * * *