U.S. patent application number 10/252408 was filed with the patent office on 2003-05-01 for fusion proteins comprising tumor necrosis factor receptor.
This patent application is currently assigned to IMMUNEX CORPORATION. Invention is credited to Smith, Craig A..
Application Number | 20030082736 10/252408 |
Document ID | / |
Family ID | 29554581 |
Filed Date | 2003-05-01 |
United States Patent
Application |
20030082736 |
Kind Code |
A1 |
Smith, Craig A. |
May 1, 2003 |
Fusion proteins comprising tumor necrosis factor receptor
Abstract
Fusion proteins comprise a tumor necrosis factor receptor
(TNF-R) polypeptide and at least one additional polypeptide
selected from an interleukin-1 receptor (IL-1R) and a second TNF-R
polypeptide. One such fusion protein comprises one IL-1R and two
TNF-R polypeptides. The fusion proteins have therapeutic use and
may be produced via recombinant DNA technology.
Inventors: |
Smith, Craig A.; (Seattle,
WA) |
Correspondence
Address: |
SUGHRUE MION, PLLC
2100 Pennsylvania Avenue, NW
Washington
DC
20037-3213
US
|
Assignee: |
IMMUNEX CORPORATION
|
Family ID: |
29554581 |
Appl. No.: |
10/252408 |
Filed: |
September 24, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10252408 |
Sep 24, 2002 |
|
|
|
08406824 |
Mar 20, 1995 |
|
|
|
08406824 |
Mar 20, 1995 |
|
|
|
08255849 |
Jun 8, 1994 |
|
|
|
08255849 |
Jun 8, 1994 |
|
|
|
07860710 |
Mar 30, 1992 |
|
|
|
07860710 |
Mar 30, 1992 |
|
|
|
07523635 |
May 10, 1990 |
|
|
|
5395760 |
|
|
|
|
07523635 |
May 10, 1990 |
|
|
|
07421417 |
Oct 13, 1989 |
|
|
|
07421417 |
Oct 13, 1989 |
|
|
|
07405370 |
Sep 11, 1989 |
|
|
|
07405370 |
Sep 11, 1989 |
|
|
|
07403241 |
Sep 5, 1989 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/350; 536/23.5 |
Current CPC
Class: |
Y02A 50/30 20180101;
C07K 14/7151 20130101; C07K 14/71 20130101; A61K 38/00 20130101;
Y02A 50/411 20180101; C07K 2319/00 20130101 |
Class at
Publication: |
435/69.1 ;
435/320.1; 435/325; 530/350; 536/23.5 |
International
Class: |
C07K 014/715; C07H
021/04; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. A fusion protein comprising a human tumor necrosis factor
receptor (TNF-R) and a human interleukin-1 receptor (IL-1R).
2. A fusion protein according to claim 1, comprising two TNF-Rs and
one IL-1R, wherein said fusion protein is of a formula selected
from: TNF-R-linker-TNF-R-linker-IL-1R and
IL-1R-linker-TNF-R-linker-TNF-R wherein each linker is a peptide
linker.
3. A fusion protein according to claim 2 wherein each of the
peptide linkers comprises from 5 to 100 amino acids selected from
the group consisting of glycine, asparagine, serine, threonine, and
alanine.
4. A fusion protein according to claim 2 wherein each TNF-R
represents a soluble TNF-R and IL-1R represents a soluble
IL-1R.
5. A fusion protein according to claim 4 wherein each soluble TNF-R
comprises an amino acid sequence selected from the group consisting
of amino acids 1-x and -22-x of SEQ ID NO: 1, wherein x represents
an integer from 163 to 235.
6. A fusion protein according to claim 4 wherein the soluble IL-1R
comprises an amino acid sequence selected from the group consisting
of amino acids 1-x and -20-x of SEQ ID NO: 5, wherein x is
312-316.
7. A fusion protein according to claim 4 wherein the soluble IL-1R
comprises an amino acid sequence selected from the group consisting
of amino acids 1-x and -13-x of SEQ ID NO: 7, wherein x is
330-333.
8. A fusion protein of the formula: TNF-R-linker-TNF-R wherein the
linker is a peptide linker.
9. A fusion protein according to claim 8 wherein said peptide
linker comprises from 5 to 100 amino acids selected from the group
consisting of glycine, asparagine, serine, threonine, and
alanine.
10. A fusion protein according to claim 8 wherein each TNF-R
represents a soluble TNF-R polypeptide.
11. A fusion protein according to claim 10, wherein each soluble
TNF-R comprises an amino acid sequence selected from the group
consisting of amino acids 1-x and -22-x of SEQ ID NO: 1, wherein x
represents an integer from 163 to 235.
12. An isolated DNA sequence that encodes a fusion protein
according to claim 1.
13. An expression vector comprising a DNA sequence according to
claim 12.
14. A host cell containing an expression vector according to claim
13.
15. An isolated DNA sequence that encodes a fusion protein
according to claim 2.
16. An expression vector comprising a DNA sequence according to
claim 15.
17. A host cell containing an expression vector according to claim
16.
18. An isolated DNA sequence that encodes a fusion protein
according to claim 8.
19. An expression vector comprising a DNA sequence according to
claim 18.
20. A host cell containing an expression vector according to claim
19.
21. A process for producing a fusion protein of the formula:
TNF-R-linker-TNF-R-linker-IL-1R or IL-1R-linker-TNF-R-linker-TNF-R
comprising culturing a host cell according to claim 17 under
conditions that promote expression of said fusion protein, and
recovering said fusion protein.
22. A process for producing a fusion protein of the formula
TNF-R-polypeptide linker-TNF-R comprising culturing a host cell
according to claim 20 under conditions that promote expression of
said fusion protein, and recovering said fusion protein.
23. A pharmaceutical composition comprising a fusion protein
according to claim 2 and a suitable diluent, excipient, or
carrier.
24. A pharmaceutical composition comprising a fusion protein
according to claim 8 and a suitable diluent, excipient, or
carrier.
25. A method for treating a condition mediated by tumor necrosis
factor and by interleukin-1, comprising administering a
therapeutically effective amount of a pharmaceutical composition
according to claim 23 to a patient afflicted with said
condition.
26. A method for treating a condition mediated by tumor necrosis
factor, comprising administering a therapeutically effective amount
of a pharmaceutical composition according to claim 24 to a patient
afflicted with said condition.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 523,635, filed May 10, 1990, now pending,
which is a continuation-in-part of U.S. application Ser. No.
421,417, filed Oct. 13, 1989, now abandoned, which is a
continuation-in-part of U.S. application Ser. No. 405,370, filed
Sep. 11, 1989, now abandoned, which is a continuation-in-part of
U.S. application Ser. No. 403,241, filed Sep. 5, 1989, now
abandoned, which prior applications are all incorporated by
reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] A number of cytokines are known to bind to specific receptor
proteins on the surface of target cells. Among the specific
receptor proteins that have been identified are tumor necrosis
factor receptors and interleukin-1 receptors. Much effort is being
directed toward isolation and characterization of a number of
receptors in order to study their physiological roles and to
explore possible therapeutic uses. The binding of a particular
target molecule by a soluble receptor administered to a patient may
alleviate disorders mediated by the target molecule.
[0003] Tumor necrosis factor-.alpha. (TNF.alpha., also known as
cachectin) and tumor necrosis factor-.beta. (TNF.beta., also known
as lymphotoxin) are homologous mammalian endogenous secretory
proteins capable of inducing a wide variety of effects on a large
number of cell types. The great similarities in the structural and
functional characteristics of these two cytokines have resulted in
their collective description as "TNF." Complementary cDNA clones
encoding TNF.alpha. (Pennica et al., Nature 312:724, 1984) and
TNF.beta. (Gray et al., Nature 312:721, 1984) have been isolated,
permitting further structural and biological characterization of
TNF.
[0004] TNF proteins initiate their biological effect on cells by
binding to specific TNF receptor (TNF-R) proteins expressed on the
plasma membrane of a TNF-responsive cell. TNF.alpha. and TNF.beta.
were first shown to bind to a common receptor on the human cervical
carcinoma cell line ME-180 (Aggarwal et al., Nature 318:665, 1985).
Hohmann et al. (J. Biol. Chem. 264:14927, 1989) reported that at
least two different cell surface receptors for TNF exist on
different cell types, although the relationship between these
TNF-Rs is unclear. These receptors have an apparent molecular mass
of about 75-80 kDa and about 55-60 kDa, respectively. In addition
to cell surface receptors for TNF, soluble proteins from human
urine capable of binding TNF have also been identified (Peetre et
al., Eur. J. Haematol. 41:414, 1988; Seckinger et al., J. Exp. Med.
167:1511, 1988; Seckinger et al., J. Biol. Chem. 264:11966, 1989;
UK Patent Application, Publ. No. 2 218 101 A to Seckinger et al.;
Engelmann et al., J. Biol. Chem. 264:11974, 1989).
[0005] Interleukin-1.alpha. (IL-1.alpha.) and interleukin-1.beta.
(IL-1.beta.) are distantly related polypeptide hormones that play a
central role in the regulation of immune and inflammatory
responses. These two proteins act on a variety of cell types and
have multiple biological activities. The biological activities
ascribed to IL-1.alpha. and IL-1.beta. are mediated via at least
two classes of plasma membrane bound receptors which bind both
IL-1.alpha. and IL-1.beta.. The IL-1 receptors expressed on B cells
(referred to herein as type II IL-1 receptors) are different from
IL-1 receptors detected on T cells and other cell types (referred
to herein as type I IL-1 receptors).
SUMMARY OF THE INVENTION
[0006] The present invention is directed to receptors comprising a
first tumor necrosis factor receptor (TNF-R) polypeptide covalently
linked to a second TNF-R polypeptide. Alternatively, the receptor
comprises one or two TNF-R polypeptides covalently linked to one or
two interleukin-1 receptor (IL-1R) polypeptides.
[0007] The receptors preferably are produced as fusion proteins via
recombinant DNA technology. The present invention provides fusion
proteins comprising, as one of at least two biologically active
polypeptide components, a TNF-R polypeptide. One fusion protein of
the present invention comprises two TNF-R polypeptides, preferably
joined via a peptide linker.
[0008] In another embodiment of the invention, the fusion protein
comprises TNF-R and IL-1R. The fusion protein preferably comprises
two TNF-R polypeptides and either one or two IL-1R
polypeptides.
[0009] The present invention also provides isolated DNA sequences
encoding the fusion proteins, recombinant expression vectors
comprising such DNA sequences, host cells containing the expression
vectors, and processes for producing the recombinant fusion
proteins by culturing the host cells. Pharmaceutical compositions
comprising a purified fusion protein as described above and a
suitable diluent, carrier, or excipient are also provided by the
present invention. Such compositions are useful in therapy,
diagnosis, and assays for conditions mediated by tumor necrosis
factor or interleukin-1.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1 presents a restriction map for a type I human IL-1R
cDNA clone. The sites at which certain restriction enzymes cleave
the cDNA are shown.
[0011] FIGS. 2A-2B depict the partial cDNA sequence and derived
amino acid sequence of a human TNF-R clone. Nucleotides are
numbered from the beginning of the 5' untranslated region. Amino
acids are numbered from the beginning of the signal peptide
sequence. The apparent signal peptide sequence is represented by
the amino acids -22 to -1. The N-terminal leucine of the mature
TNF-R protein is underlined at position 1. The apparent
transmembrane region from amino acids 236 to 265 is also
underlined. The C-termini of various soluble TNF-Rs are marked with
an arrow (). Cleavage sites for certain restriction endonucleases
employed in constructing expression vectors are indicated.
[0012] FIG. 3 depicts a plasmid vector comprising a DNA fragment
encoding a fusion protein of the formula TNF-R-linker-TNF-R,
constructed as described in example 11.
[0013] FIG. 4 depicts a plasmid vector comprising a DNA fragment
encoding a fusion protein of the formula
IL-1R-linker-TNF-R-linker-TNF-R, constructed as described in
example 12.
[0014] FIG. 5 depicts three plasmid vectors that are intermediates
in the construction of certain vectors of the present invention, as
described in example 12.
DETAILED DESCRIPTION OF THE INVENTION
[0015] The present invention is directed to receptors comprising a
first TNF-R polypeptide covalently linked to a second TNF-R
polypeptide. Alternatively, the receptor comprises one or two TNF-R
polypeptides covalently linked to one or two IL-1R polypeptides.
The TNF-R and (when present) IL-1R polypeptide components may be
attached to one another using any suitable technique for attaching
one polypeptide to another. Cross-linking reagents and peptide
linkers are among the linkage methods that may be employed. The
TNF-R and IL-1R polypeptides are derived from mammalian species,
preferably human.
[0016] The receptors preferably are produced as fusion proteins via
recombinant DNA technology. The present invention provides fusion
proteins comprising, as one component, a mammalian tumor necrosis
factor receptor (TNF-R). One fusion protein of the present
invention comprises two TNF-R polypeptides and may be represented
by the following formula:
TNF-R-linker-TNF-R
[0017] wherein the linker is a peptide linker.
[0018] In another embodiment of the invention, the fusion protein
comprises TNF-R and a mammalian interleukin-1 receptor (IL-1R). In
this embodiment of the invention, the fusion protein may comprise
one TNF-R polypeptide and one IL-1R polypeptide. Preferably, two
TNF-R polypeptides and one IL-1R polypeptide are joined to form the
fusion protein. The two TNF-R polypeptides preferably are adjacent
to one another (as opposed to IL-1R being positioned between the
two TNF-Rs) to enhance binding of TNF. Examples of such fusion
proteins are represented by the following formulas:
TNF-R-linker-IL-1R
IL-1R-linker-TNF-R
TNF-R-linker-TNF-R-linker-IL-1R and
IL-1R-linker-TNF-R-linker-TNF-R
[0019] wherein each linker is a peptide linker. The N-terminus of
each fusion protein is on the left side of each formula.
[0020] Each TNF-R polypeptide component of the fusion proteins is
independently capable of binding tumor necrosis factor (TNF).
Likewise, each IL-1R polypeptide employed in the fusion proteins is
independently capable of binding interleukin-1 (IL-1). Including
two adjacent TNF-R polypeptides in the fusion protein is
advantageous in that the TNF binding affinity is increased compared
to the binding of TNF by a single TNF-R polypeptide.
[0021] Peptide linkers that may be employed in the present
invention separate TNF-R polypeptides (and IL-1R polypeptides, when
present) from one another by a distance sufficient to ensure that
each polypeptide properly folds into the secondary and tertiary
structures necessary for the desired biological activity. The
linker also should allow the extracellular domains of the TNF-R and
IL-1R polypeptides to assume the proper spatial orientation to form
a binding site for TNF or IL-1. The peptide linkers function as
spacers, as opposed to the pharmaceutically active TNF-R and IL-1R
polypeptide components of the fusion proteins. Suitable polypeptide
linkers preferably (1) will adopt a flexible extended conformation,
(2) will not exhibit a propensity for developing an ordered
secondary structure which could interact with the functional
protein domains, and (3) will have minimal hydrophobic or charged
character which could promote interaction with the functional
protein domains. Typical surface amino acids in flexible protein
regions include glycine (Gly), asparagine (Asn) and serine (Ser).
Virtually any permutation of amino acid sequences containing Gly,
Asn and Ser would be expected to satisfy the above criteria for a
peptide linker sequence. Other near neutral amino acids, such as
threonine (Thr) and alanine (Ala), may also be used in the linker
sequence. Suitable peptide linkers generally comprise a chain of
amino acids, preferably from 5 to 100 amino acids in length and
most preferably from 10 to 20 amino acids in length. Examples of
such linkers include, but are not limited to, (Gly.sub.4Ser).sub.n,
wherein n is 1-12, Gly.sub.4SerGly.sub.5Ser, and
(Gly.sub.4SerGly.sub.5Ser).sub.2.
[0022] TNF-R and IL-1R Polypeptides
[0023] As used herein, the terms "interleukin-1 receptor" and
"IL-1R" refer to proteins which are capable of binding
interleukin-1 (IL-1) molecules and, in their native configuration
as human plasma membrane proteins, play a role in transducing the
signal provided by IL-1 to a cell. As used herein, the terms "TNF
receptor" and "TNF-R" refer to proteins that are biologically
active in that they are capable of binding tumor necrosis factor
(TNF). Native membrane bound forms of the proteins also transduce a
biological signal initiated by a TNF molecule binding to a cell.
For fusion proteins comprising more than one TNF-R polypeptide, the
TNF-R polypeptides may be identical or different. Likewise for
IL-1R polypeptides.
[0024] Intact receptors generally include an extracellular domain
which binds to a ligand, a hydrophobic transmembrane domain which
remains embedded within the plasma membrane lipid bilayer, and a
cytoplasmic or intracellular domain which is believed to deliver a
biological signal to effector cells via a cascade of chemical
reactions within the cytoplasm of the cell. The hydrophobic
transmembrane domain and a highly charged region of the cytoplasmic
domain immediately downstream of the transmembrane domain
cooperatively function to halt transport of the IL-1 and TNF
receptors across the plasma membrane. The extracellular domain of
the TNF-R and IL-1R proteins disclosed herein is the N-terminal
portion of the protein, from amino acid 1 to the amino acid
immediately preceding the transmembrane region. The cytoplasmic
domain is that portion of the protein that is located downstream of
the transmembrane region.
[0025] Among the TNF-R polypeptides that may be employed as
components of the inventive fusion proteins is a polypeptide
comprising amino acids 1 to 439 of the sequence presented in FIGS.
2A-2B, which is a full length native TNF-R sequence. This TNF-R DNA
and amino acid sequence is also presented in SEQ ID NOS: 1 and 2.
When the signal sequence is desired, the TNF-R polypeptide may
comprise amino acids -22 to 439 of the FIGS. 2A-2B sequence. The
desirability of including the signal sequence depends on such
factors as the position of the TNF-R polypeptide in the fusion
protein and whether the intended host cells will process a
mammalian signal sequence, as discussed below. The mature
full-length native glycosylated form of this human TNF-R is a
glycoprotein having a molecular weight of about 80 kilodaltons
(kDa). As used throughout the specification, the term "mature"
means a protein lacking a leader or signal sequence as may be
present in full-length transcripts of a native gene. A protein may
comprise a signal sequence when initially expressed. Cleavage of
the signal sequence upon secretion of the protein from the cell
yields the mature form of the protein.
[0026] Other suitable TNF-R polypeptides are described in European
patent application publication number 422,339 (EP 422,339
hereinafter), which is hereby incorporated by reference in its
entirety. Two suitable TNF-R polypeptides comprise arginine (Arg)
as residue 174 but are otherwise identical to the above-described
polypeptides comprising amino acids 1 to 439 or -22 to 439,
respectively, of FIGS. 2A-2B of the present application. A TNF-R
amino acid sequence identical to that of FIGS. 2A-2B (of the
present application) except for substitution of arginine (Arg) for
methionine (Met) at position 174 of the mature sequence is
disclosed in EP 422,339 (see FIG. 39 therein).
[0027] The cDNA and encoded amino acid sequences of another useful
TNF-R polypeptide are disclosed in FIG. 21 of EP 422,339. The
coding region of the EP 422,339 FIG. 21 cDNA sequence, and the
amino acid sequence encoded thereby, are presented as SEQ ID NOS: 3
and 4 of the present application. Although referred to as a 30
kilodalton protein in EP 422,339, other molecular weights have been
reported for this protein. A molecular weight of about 55
kilodaltons was reported by Loetscher et al. (Cell 61:351, 1990)
and in EP 417,563, for example. Useful TNF-R polypeptides include
those comprising amino acids 1 to 415 of the SEQ ID NO: 4 sequence,
or, when the signal sequence is desired, amino acids -40 to 415 of
the SEQ ID NO: 4 sequence. Methods for producing this TNF-R
protein, either by purification from urine or from the medium of a
culture of U937 cells, or by recombinant DNA technology, are
described in EP 422,339. This TNF-R is characterized by an
N-terminal sequence (for the mature form of the protein) of
Asp-Ser-Val-Cys-Pro-Gln-, whereas the N-terminal sequence of the
mature form of the TNF-R protein of FIGS. 2A-2C is
Leu-Pro-Ala-Gln-Val-Ala-.
[0028] In certain embodiments of the present invention, the TNF-R
polypeptide is a soluble TNF-R polypeptide. Soluble TNF-R
polypeptides lack at least part (preferably all) of the
transmembrane region that promotes retention of the protein on the
cell surface. The soluble polypeptides generally also lack the
charged region of the cytoplasmic domain (located immediately
downstream of the transmembrane region) that contributes to
retention on the cell surface. Preferably, the entire transmembrane
region and cytoplasmic domain are deleted from the protein or
substituted with hydrophilic amino acids to form soluble TNF-R.
Soluble TNF-R is secreted from the cell and retains the desired
biological activity.
[0029] Examples of soluble TNF-R polypeptides are those comprising
amino acids 1-x of the FIG. 2A sequence, wherein x is the
C-terminal amino acid and is selected from the group consisting of
any one of amino acids 163-235 of FIG. 2A. Specific examples
include polypeptides comprising the acids 1-163, 1-185, or 1-235 of
FIG. 2A. The soluble TNF-R polypeptide may additionally comprise a
signal sequence, e.g., amino acids -22 to -1 of FIG. 2A.
[0030] Additional examples of soluble TNF-R polypeptides are those
comprising amino acids 1-184 or 1-182, -22-184, or -22-182 of the
FIGS. 2A-2B sequence. Such proteins may contain either methionine
or arginine at position 174. Procedures for preparing examples of
such TNF-R polypeptides include those described in examples 17 and
22 of EP 422,339.
[0031] The TNF-R protein shown in SEQ ID NO:4 comprises a signal
peptide (designated amino acids -40 to -1) and a transmembrane
region beginning with the valine residue at position 172. Preferred
soluble forms of this TNF-R protein include those comprising amino
acids -40-w or 1-w of SEQ ID NO:4, wherein w is an integer from
161-171 (i.e., any of amino acids 161 to 171 of SEQ ID NO:4 is the
C-terminus). The use of oligonucleotide-directed in vitro
mutagenesis to construct an expression vector encoding a
biologically active TNF-R protein having amino acid 161
(asparagine) as the C-terminal amino acid is illustrated in example
7 of EP 422,339. Further, procedures for purifying naturally
occurring soluble forms of both of the above-described TNF-R
proteins (i.e., soluble forms of the SEQ ID NO:2 and the SEQ ID
NO:4 proteins) from human urine have been described by Engelmann et
al. (J. Biol. Chem. 265:1531, 1990).
[0032] Interleukin-1 receptors that may be employed as components
of the inventive fusion proteins include polypeptides designated
herein as type I IL-1R and type II IL-1R. Type I IL-1 receptors
have been detected on T-cells and certain other cell types, while
expression of type II IL-1 receptors on B cells has been reported.
In the absence of any specific designation, the term "IL-1
receptor" as used herein refers collectively to type I and type II
IL-1 receptors.
[0033] Among the IL-1R polypeptides that may be employed in the
present invention are the type I IL-1R polypeptides described in
U.S. patent application Ser. No. 07/821,716, filed Jan. 14, 1992;
and Ser. No. 455,488, filed Dec. 21, 1989; and in European patent
application publication no. 318,296; the disclosures of which are
incorporated herein by reference, in their entireties. The DNA
sequence of a cloned cDNA encoding a human type I IL-1R protein and
the amino acid sequence encoded thereby are presented herein in SEQ
ID NOS: 5 and 6. The protein contains 569 amino acids, of which 20
are an N-terminal signal peptide. The aspartic acid (Asp) residue
at position 1 is the first amino acid of the mature protein. The
transmembrane region includes amino acids 317 (His) through 336
(Tyr). The sequence of human IL-1R is also disclosed in Sims et
al., Proc Nat'l. Acad. Sci. USA 86:8946 (1989).
[0034] As with the TNF-R polypeptides, soluble IL-1R polypeptides
may be employed in the fusion proteins of the present invention.
Soluble IL-1R polypeptides generally lack the transmembrane region
and preferably lack the cytoplasmic domain as well. Soluble IL-1R
proteins may also include part of the transmembrane region or the
cytoplasmic domain, provided that the soluble IL-1R protein is
capable of being secreted from the cell.
[0035] Examples of soluble type I IL-1R polypeptides include, but
are not limited to, those comprising the amino acid sequence
depicted as amino acids y-x of SEQ ID NO: 6, wherein x is 312-316
and y is -3 to 3. In other words, the N-terminal amino acid is
selected from the Leu, Glu, Ala, Asp, Lys, and Cys residues at
positions -3, -2, -1, 1, 2, and 3, respectively. The C-terminal
amino acid of the soluble protein is selected from the Thr, Asn,
Phe, Gln, and Lys residues at positions 312, 313, 314, 315, and
316, respectively. Preferred soluble IL-1R polypeptides include
those comprising amino acids 1-x of SEQ ID NO: 6, wherein x is
312-316.
[0036] Any of the above-described soluble type I IL-1R polypeptides
may additionally comprise a signal sequence, e.g., the signal
sequence shown as amino acids -20 to -1 in SEQ ID NO: 6.
Alternatively, a different signal sequence functional in an
intended host cell (e.g., a yeast signal sequence) may be employed,
as discussed below.
[0037] Among the type II IL-1R polypeptides that may be employed in
the present invention are those described in U.S. patent
application Ser. No. 701,415, filed Jun. 16, 1991; and in European
patent application publication no. 460,846; the disclosures of
which are incorporated herein by reference, in their entireties.
Native glycosylated human type II IL-1R proteins recovered from
cell lysates generally have an apparent molecular weight of about
60-68 kilodaltons by SDS-PAGE. The DNA sequence of a cloned cDNA
encoding a human type II IL-1R protein and the amino acid sequence
encoded thereby are presented herein in SEQ ID NOS: 7 and 8. The
protein comprises a 13-amino acid signal peptide. The transmembrane
region includes amino acids 331 (Ala) through 356 (Met).
[0038] Soluble type II IL-1R proteins are derived by deleting a
C-terminal portion of the protein that is not necessary for IL-1
binding, so that the protein is secreted from the cell. The
cysteine residue at position 313 is believed to be necessary to
maintain the tertiary structure of the type II IL-1R molecule and
permit binding of IL-1. Examples of soluble type II IL-1R
polypeptides thus include those in which the C-terminal amino acid
is selected from any of amino acids 314-333. In other words, the
soluble IL-1R may contain the amino acid sequence shown as amino
acids 1-x of SEQ ID NO: 8 wherein x is an integer from 314-333.
Preferred examples of suitable soluble type II IL-1R polypeptides
include, but are not limited to, those comprising amino acids 1-x
of SEQ ID NO: 8, wherein x is 330-333. In other words, the
C-terminal amino acid of the soluble protein is selected from the
Glu, Ala, Ser, and Ser residues at positions 330, 331, 332, and
333, respectively. The soluble type II IL-1R polypeptides may
additionally comprise a signal sequence, e.g., the signal sequence
shown as amino acids -13 to -1 in SEQ ID NO: 8. Alternatively, a
different signal sequence functional in an intended host cell
(e.g., a yeast signal sequence) may be employed, as discussed
below.
[0039] Assay procedures described herein may be employed to confirm
biological activity for additional soluble TNF-R and IL-1R
polypeptides, beyond the particular examples set forth above.
Soluble TNF-R and soluble IL-1R may be identified (and
distinguished from their non-soluble membrane-bound counterparts)
by separating intact cells which express the desired protein from
the culture medium, e.g., by centrifugation, and assaying the
medium (supernatant) for the presence of the desired protein. The
culture medium may be assayed using procedures which are similar or
identical to those described in the examples below. The presence of
TNF-R and IL-1R in the medium indicates that the protein was
secreted from the cells and thus is a soluble form of the desired
protein.
[0040] The N- or C-terminus of the TNF-R or IL-1R polypeptides may
vary according to such factors as the type of host cells employed
when producing the fusion protein via recombinant DNA technology
and the particular cells from which the protein is purified when
non-recombinant TNF-R or IL-1R is employed. Such variations may be
attributable to differential post-translational processing of the
protein in various types of cells, for example. Variations in the
N- or C-terminal sequence also may result from the oligonucleotides
chosen to reconstruct either terminus of the TNF-R or IL-1R
encoding DNA sequence when constructing expression vectors.
[0041] Differential processing may result in mature TNF-R or IL-1R
proteins having an N-terminal amino acid other than those shown at
position 1 of SEQ ID NOS: 2, 4, 6 and 8. For example, in certain
host cells, post-translational processing will remove the
methionine residue encoded by an initiation codon, whereas the
methionine residue will remain at the N-terminus of proteins
produced in other host cells. Further, the N- and C-termini have
been known to vary for the same protein, depending on the source of
the protein. In some cases, the deletion of amino acids at either
terminus of the protein may be due to proteolysis, occurring either
intracellularly or during purification. Varying N-termini may also
result from cleavage of the signal peptide in certain host cells at
a point other than between amino acids -1 and 1 of the disclosed
sequences.
[0042] As described in examples 10 and 11 and FIG. 31 of EP
422,339, a non-recombinant mature TNF-R protein purified from human
urine lacked two N-terminal amino acids found in a non-recombinant
TNF-R protein purified from the human monocyte-like cell line U937.
The N-terminal amino acid of the urine-derived TNF-R was the
alanine residue at position 3 of SEQ ID NO:1. Engelmann et al. (J.
Biol. Chem. 265:1531, 1990) disclose a protein that binds TNF and
was purified from human urine in forms truncated to varying degrees
at the N-terminus (see the abstract and page 1533). The N-terminal
amino acid sequence of one protein species was
Val-Ala-Phe-Thr-Pro-, which corresponds to amino acids 5-9 of SEQ
ID NO: 1. Other forms of the protein had either phenylalanine
(amino acid 7 of SEQ ID NO:1) or threonine (amino acid 8 of SEQ ID
NO:1) as the N-terminal amino acid.
[0043] The N- and C-termini of the TNF-R and IL-1R proteins may
vary for reasons that include those discussed above. The N-terminal
amino acid may, for example, be any of the amino acids at positions
1 to 5 of SEQ ID NOS: 2 or 4 for TNF-R or of SEQ ID NOS: 6 or 8 for
IL-1R. The C-terminus may be truncated deliberately during
expression vector construction (e.g., in constructing vectors
encoding soluble proteins as described above) or as a result of
differential processing which may remove up to about five
C-terminal amino acids, for example.
[0044] Additional TNF-R and IL-1R polypeptides that may be employed
retain the desired biological activity but vary from the native
sequences in that amino acid(s) are added to, deleted from, or
substituted in the native sequence. The biological activity of such
proteins can be confirmed using the assays described herein.
[0045] Derivatives of TNF-R and IL-1R that are within the scope of
the invention also include various structural forms of the primary
protein which retain biological activity. Due to the presence of
ionizable amino and carboxyl groups, for example, a TNF-R or IL-1R
protein may be in the form of acidic or basic salts, or may be in
neutral form. Individual amino acid residues may also be modified
by oxidation or reduction.
[0046] The primary amino acid structure may be modified by forming
covalent or aggregative conjugates with other chemical moieties,
such as glycosyl groups, lipids, phosphate, acetyl groups and the
like. Covalent derivatives are prepared by linking particular
functional groups to amino acid side chains or at the N- or
C-termini. Naturally occurring variants may result from alternative
RNA splicing events.
[0047] Other proteins that may be employed in the inventive fusion
proteins include conjugates of TNF-R or IL-1R with other
polypeptides, which may be produced by synthesis in recombinant
culture as N-terminal or C-terminal fusions. For example, the
conjugated peptide may be a a signal (or leader) peptide sequence
at the N-terminal region of the protein which co-translationally or
post-translationally directs transfer of the protein from its site
of synthesis to its site of function inside or outside of the cell
membrane or wall (e.g., the yeast .alpha.-factor leader). The
fusion proteins can comprise peptides added to facilitate
purification or identification of the fusion protein. Such peptides
include, for example, poly-His or the antigenic identification
peptides described in U.S. Pat. No. 5,011,912 and in Hopp et al.,
Bio/Technology 6:1204, 1988. One such peptide is the FLAG.RTM.
peptide, Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK), which is
highly antigenic and provides an epitope reversibly bound by a
specific monoclonal antibody enabling rapid assay and facile
purification of expressed recombinant protein. This sequence is
also specifically cleaved by bovine mucosal enterokinase at the
residue immediately following the Asp-Lys pairing. Fusion proteins
capped with this peptide may also be resistant to intracellular
degradation in E. coli. A murine hybridoma designated 4E11 produces
a monoclonal antibody that binds the peptide DYKDDDDK in the
presence of certain divalent metal cations (as described in U.S.
Pat. No. 5,011,912) and has been deposited with the American Type
Culture Collection under accession no HB 9259.
[0048] The inventive fusion proteins comprise TNF-R or IL-1R with
or without associated native-pattern glycosylation. TNF-R and IL-1R
expressed in yeast or mammalian expression systems, e.g., COS-7
cells, may be similar or slightly different in molecular weight and
glycosylation pattern than the native molecules, depending upon the
expression system. Expression of recombinant proteins in bacteria
such as E. coli provides non-glycosylated proteins. Proteins having
inactivated N-glycosylation sites can be produced by
oligonucleotide synthesis and ligation or by site-specific
mutagenesis techniques. These mutant proteins can be produced in a
homogeneous, reduced-carbohydrate form in good yield using yeast
expression systems. N-glycosylation sites in eukaryotic proteins
are characterized by the amino acid triplet Asn-A.sub.1-Z, where
A.sub.1 is any amino acid except Pro, and Z is Ser or Thr. In this
sequence, asparagine provides a side chain amino group for covalent
attachment of carbohydrate. Such a site can be eliminated by
substituting another amino acid for Asn or for residue Z, deleting
Asn or Z, or inserting a non-Z amino acid between A.sub.1 and Z, or
an amino acid other than Asn between Asn and A.sub.1. Known
procedures for inactivating N-glycosylation sites in proteins
include those described in U.S. Pat. No. 5,071,972 and EP 276,846.
Examples of N-glycosylation sites in human type II IL-1R are amino
acids 53-55, 59-61, 99-101, 206-208, and 264-266 in SEQ ID NO: 8.
Potential N-glycosylation sites are found in the type I IL-1R
protein (SEQ ID NO: 6) at amino acids 80-82, 173-175, 213-215,
229-231, 243-245, and 277-279. N-glycosylation sites are found at
amino acid 171-173 and 358-360 of TNF-R in FIGS. 2A-2B.
[0049] Cysteine residues that are not essential for biological
activity can be deleted or replaced with other amino acids to
prevent formation of unnecessary or incorrect intramolecular
disulfide bridges upon renaturation. The cysteine residue at
position 178 in the FIGS. 2A-2B TNF-R sequence can be deleted, for
example. U.S. Pat. No. 4,518,584 describes the use of site directed
mutagenesis to delete or replace cysteine residues within a
protein. Other approaches to mutagenesis involve modification of
adjacent dibasic amino acid residues to enhance expression in yeast
systems in which KEX2 protease activity is present. EP 212,914
discloses the use of site-specific mutagenesis to inactivate KEX2
protease processing sites in a protein.
[0050] In order to preserve the biological activity of TNF-R and
IL-1R, substitutions will preferably result in homologous or
conservatively substituted sequences, meaning that a given amino
acid residue is replaced by a residue having similar physiochemical
characteristics. Examples of conservative substitutions include
substitution of one aliphatic residue for another, such as Ile,
Val, Leu, or Ala for one another, or substitutions of one polar
residue for another, such as between Lys and Arg; Glu and Asp; or
Gln and Asn. Other such conservative substitutions, for example,
substitutions of entire regions having similar hydrophobicity
characteristics, are well known. Moreover, particular amino acid
differences between human, murine and other mammalian TNF-Rs is
suggestive of additional conservative substitutions that may be
made without altering the essential biological characteristics of
TNF-R or IL-1R.
[0051] Alterations of the native amino acid sequence may be
accomplished by any of a number of known techniques. Mutations can
be introduced at particular loci by synthesizing oligonucleotides
containing a mutant sequence, flanked by restriction sites enabling
ligation to fragments of the native sequence. Following ligation,
the resulting reconstructed sequence encodes an analog having the
desired amino acid insertion, substitution, or deletion.
[0052] Alternatively, oligonucleotide-directed site-specific
mutagenesis procedures can be employed to provide an altered gene
having particular codons altered according to the substitution,
deletion, or insertion required. Exemplary methods of making the
alterations set forth above are disclosed by Walder et al. (Gene
42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik
(BioTechniques, Jan. 12-19, 1985); Smith et al. (Genetic
Engineering: Principles and Methods, Plenum Press, 1981); and U.S.
Pat. Nos. 4,518,584 and 4,737,462 disclose suitable techniques, and
are incorporated by reference herein.
[0053] The variant amino acid sequence preferably is at least 80%
identical, most preferably at least 90% identical, to the native
sequence. Percent similarity may be determined, for example, by
comparing sequence information using the GAP computer program,
version 6.0, available from the University of Wisconsin Genetics
Computer Group (UWGCG). The GAP program utilizes the alignment
method of Needleman and Wunsch (J. Mol. Biol. 48:443, 1970), as
revised by Smith and Waterman (Adv. Appl. Math. 2:482, 1981).
Briefly, the GAP program defines similarity as the number of
aligned symbols (i.e., nucleotides or amino acids) which are
similar, divided by the total number of symbols in the shorter of
the two sequences. The preferred default parameters for the GAP
program include: (1) a unary comparison matrix (containing a value
of 1 for identities and 0 for non-identities) for nucleotides, and
the weighted comparison matrix of Gribskov and Burgess, Nucl. Acids
Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds.,
Atlas of Protein Sequence and Structure, National Biomedical
Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for
each gap and an additional 0.10 penalty for each symbol in each
gap; and (3) no penalty for end gaps.
[0054] Other proteins capable of blocking the binding of IL-1 to
cellular receptors in vivo may be substituted for the IL-1R
polypeptides described above in the fusion proteins of the present
invention. Such proteins, generally referred to as IL-1 receptor
antagonists, include those described by Eisenberg et al. (Nature
343:341, 1990), Hannum et al. (Nature 343:336, 1990), and Carter et
al. (Nature 344:633, 1990), which are hereby incorporated by
reference in their entireties. These antagonist proteins bind to
IL-1 receptors, but have no IL-1-like activity (e.g., do not
transduce a signal or otherwise produce the biological effects that
result from binding of IL-1 to a cellular IL-1 receptor). The
antagonist proteins compete with IL-1 for binding to endogenous
IL-1 receptors, thus inhibiting biological effects mediated by IL-1
in vivo.
[0055] DNA Sequences Encoding Recombinant Fusion Proteins
[0056] Isolated DNA sequences encoding the above-described fusion
proteins are also provided by the present invention. A DNA sequence
encoding a fusion protein of the present invention is constructed
using recombinant DNA techniques to insert DNA fragments encoding
the IL-1R or TNF-R polypeptides into an appropriate expression
vector. The 3' end of a DNA fragment encoding TNF-R is ligated (via
a peptide linker) to the 5' end of the DNA fragment encoding IL-1R
with the reading frames of the sequences in phase to permit
translation of the mRNA into a single biologically active fusion
protein. Alternatively, the 3' end of a DNA fragment encoding IL-1R
may be ligated (via a peptide linker) to the 5' end of the DNA
fragment encoding TNF-R, with the reading frames of the sequences
in phase to permit translation of the mRNA into a single
biologically active fusion protein. An additional sequence encoding
TNF-R may be ligated in the same reading frame to produce a
sequence encoding a fusion protein comprising two TNF-R
polypeptides and one IL-1R polypeptide. The IL-1R-encoding sequence
is preferably positioned upstream of the TNF-R-encoding
sequence(s). While the fusion protein may comprise two IL-1R
polypeptides along with the TNF-R polypeptide(s), one IL-1R is
preferred. A single IL-1R provides the desired high affinity IL-1
binding activity without the possible disadvantages of increasing
the size of the fusion protein by adding a second IL-1R. Such
disadvantages may include increased complexity of vector
construction procedures and possible reduction in the level of
expression of the desired protein. In another embodiment of the
present invention, a DNA sequence encoding TNF-R is ligated to a
linker sequence which in turn is ligated to a second TNF-R encoding
sequence.
[0057] A DNA sequence encoding an N-terminal signal sequence may be
retained on the DNA sequence encoding the N-terminal polypeptide,
while stop codons, which would prevent read-through to the
downstream DNA sequence(s), are eliminated. Conversely, a stop
codon required to end translation is generally retained on the DNA
sequence encoding the C-terminal polypeptide. DNA encoding a signal
sequence is preferably removed from DNA sequences other than those
encoding the N-terminal polypeptide.
[0058] A DNA sequence encoding a desired peptide linker may be
inserted between, and in the same reading frame as, the DNA
sequences encoding TNF-R or IL-1R using any suitable conventional
technique. For example, a chemically synthesized oligonucleotide
encoding the linker and containing appropriate restriction
endonuclease cleavage sites may be ligated between the sequences
encoding TNF-R or IL-1R. Alternatively, a chemically synthesized
DNA sequence may contain a sequence complementary to the 3'
terminus (without the stop codon) of either TNF-R or IL-1R followed
by a linker-encoding sequence which is followed by a sequence
complementary to the 5' terminus of the other of TNF-R and IL-1R.
Oligonucleotide directed mutagenesis is then employed to insert the
linker-encoding sequence into a vector containing a direct fusion
of TNF-R and IL-1R. Another technique employs polymerase chain
reactions using primers comprising, in part, single strand segments
encoding a peptide linker. PCR-generated DNA fragments encoding two
different proteins can be joined through annealing of the
complementary single stranded linker-encoding segments present at a
terminus of each fragment. Preferred procedures for inserting a
linker-encoding DNA segment between TNF-R and IL-1R DNA sequences
(or between two TNF-R DNA sequences) are described in examples 11
and 12 below.
[0059] DNA sequences encoding TNF-R and IL-1R may be isolated by
any suitable conventional procedure, for use in constructing the
fusion protein-encoding DNA sequences of the present invention. DNA
sequences encoding fusion proteins to be expressed in a
microorganism will preferably contain no introns that could
prematurely terminate transcription of DNA into mRNA; however,
premature termination of transcription may be desirable, for
example, where it would result in mutants having advantageous
C-terminal truncations, for example, deletion of a transmembrane
region to yield a soluble receptor not bound to the cell membrane.
Among the suitable procedures for cloning type I and type II IL-1R
cDNA are those presented in examples 8 and 9, respectively. TNF-R
cDNA may be isolated by procedures that include those described in
example 3.
[0060] The coding sequence of TNF-R may be obtained by isolating a
sequence encoding TNF-R from a recombinant cDNA or genomic DNA
library. A cDNA library is preferably constructed by obtaining
polyadenylated mRNA from a particular cell line which expresses a
mammalian TNF-R, for example, the human fibroblast cell line WI-26
VA4 (ATCC CCL 95.1) and using the mRNA as a template for
synthesizing double stranded cDNA. The double stranded cDNA is then
packaged into a recombinant vector, which is introduced into a host
cell (e.g., an appropriate E. coli strain) and propagated. TNF-R
sequences contained in the cDNA library can be identified by
screening the library with an appropriate nucleic acid probe which
is capable of hybridizing with human TNF-R cDNA. Another cloning
technique that may be employed is the direct expression procedure
described in example 3 below. Alternatively, DNAs encoding TNF-R
proteins can be assembled by ligation of synthetic oligonucleotide
subunits corresponding to all or part of the sequence of FIGS.
2A-2B to provide a complete coding sequence.
[0061] Additional cDNA clones can be isolated from cDNA libraries
of other mammalian species by cross-species hybridization. For use
in hybridization, DNA encoding TNF-R or IL-1R may be covalently
labeled with a detectable substance such as a fluorescent group, a
radioactive atom or a chemiluminescent group by methods well known
to those skilled in the pertinent art.
[0062] Like most mammalian genes, mammalian TNF receptors and IL-1
receptors are presumably encoded by multi-exon genes. Alternative
mRNA constructs which can be attributed to different mRNA splicing
events following transcription, and which share large regions of
identity or similarity with the cDNAs disclosed herein such that
biologically active TNF-R or IL-1R is encoded thereby, are
considered to be useful in preparing the fusion proteins of the
present invention.
[0063] DNA encoding soluble TNF-R and IL-1R polypeptides may be
prepared by any of a number of conventional techniques. A DNA
fragment encoding a desired soluble polypeptide may be subcloned
into an expression vector. DNA fragments may be produced by
restriction endonuclease digestion of a full length cloned DNA
sequence, and isolated by electrophoresis on agarose gels.
Alternatively, a desired DNA sequence may be chemically synthesized
using known techniques. Linkers containing restriction endonuclease
cleavage site(s) may be employed to insert the desired DNA fragment
into an expression vector, or the fragment may be digested at
cleavage sites naturally present therein.
[0064] The well known polymerase chain reaction (PCR) procedures
also may be employed to isolate a DNA sequence encoding a desired
soluble protein fragment. This technique is illustrated in the
examples below.
[0065] In another approach, enzymatic treatment (using Bal 31
exonuclease) may be employed to delete terminal nucleotides from a
DNA fragment to obtain a fragment having a particular desired
terminus. Among the commercially available linkers are those that
an be ligated to the blunt ends produced by Bal 31 digestion, and
which contain restriction endonuclease cleavage site(s).
Alternatively, oligonucleotides that reconstruct the N- or
C-terminus of a DNA fragment to a desired point may be synthesized.
The oligonucleotide may contain a restriction endonuclease cleavage
site upstream of the desired coding sequence and position an
initiation codon (ATG) at the N-terminus of the coding
sequence.
[0066] The TNF-R and IL-1R DNA sequences may vary from those
presented in SEQ ID NOS: 1, 3, 5 and 7. Due to the known degeneracy
of the genetic code, there can be considerable variation in
nucleotide sequences encoding the same amino acid sequence, for
example. DNA sequences capable of hybridizing to the DNA sequences
of SEQ ID NOS: 1, 3, 5 and 7 under moderately stringent conditions
(55.degree. C., 5.times. SSC), and which encode a biologically
active TNF-R or IL-1R polypeptide, are also considered to be
TNF-R-encoding or IL-1R-encoding DNA sequences, respectively, in
the context of the present invention.
[0067] Mutations may be deliberately made to the native DNA
sequences, e.g. to produce the amino acid substitutions, deletions
and insertions described above. Certain of the mutations will not
be expressed in the final protein product. For example, nucleotide
substitutions may be made to enhance expression, primarily to avoid
secondary structure loops in the transcribed mRNA (see EP 75,444,
incorporated herein by reference). Other alterations of the
nucleotide sequence may be made to provide codons that are more
readily translated by the selected host, e.g., the well-known E.
coli preference codons for E. coli expression. Silent mutations
(changes in the DNA sequence that do not alter the encoded amino
acid sequence) also may occur during polymerase chain reactions. In
one embodiment of the present invention, nucleotide number 437 of
SEQ ID NO: 5 (type I IL-1 R) is changed from a T to a C. This
silent mutation occurred during a polymerase chain reaction.
[0068] Mutations in nucleotide sequences should, of course,
preserve the reading frame phase of the coding sequences. The
mutations preferably will not create complementary regions that
could hybridize to produce secondary mRNA structures such as loops
or hairpins which would adversely affect translation of the fusion
protein mRNA.
[0069] The present invention thus provides inventive DNA sequences
encoding the above-described fusion proteins, wherein each TNF-R
DNA sequence in the fusion protein DNA sequence is selected from:
(a) DNA sequences derived from the coding region of a native
mammalian TNF-R gene (e.g., cDNA derived from the coding region of
SEQ ID NOS: 1 or 3); (b) DNA sequences capable of hybridization to
a DNA sequence of (a) under moderately stringent conditions
(50.degree. C., 2.times. SSC) and which encode biologically active
TNF-R and (c) DNA sequences which are degenerate as a result of the
genetic code to the DNA sequences defined in (a) or (b) and which
encode biologically active TNF-R. The fusion protein DNA sequence
likewise may comprise IL-1R encoding DNA sequence(s) selected from:
(a) DNA sequences derived from the coding region of a native
mammalian IL-1R gene (e.g., cDNA derived from the coding region of
SEQ ID NOS: 5 or 7); (b) DNA sequences capable of hybridization to
a DNA sequence of (a) under moderately stringent conditions
(55.degree. C., 5.times. SSC) and which encode biologically active
IL-1R; and (c) DNA sequences which are degenerate as a result of
the genetic code to the DNA sequences defined in (a) or (b) and
which encode biologically active IL-1R.
[0070] Expression of Recombinant Fusion Proteins
[0071] The present invention provides recombinant expression
vectors to express DNA encoding the fusion proteins of the present
invention. The inventive recombinant expression vectors are
replicable DNA constructs which contain a synthetic or cDNA-derived
DNA sequence encoding one of the above-described fusion proteins,
operably linked to suitable transcriptional or translational
regulatory elements. Examples of genetic elements having a
regulatory role in gene expression include transcriptional
promoters, operators or enhancers, a sequence encoding suitable
mRNA ribosomal binding sites, and appropriate transcription and
translation initiation and termination sequences. The ability to
replicate in a host, usually conferred by an origin of replication,
and a selection gene to facilitate recognition of transformants may
additionally be incorporated. The regulatory elements employed in
the expression vectors are generally derived from mammalian,
microbial, viral, or insect genes. Expression vectors derived from
retroviruses also may be employed.
[0072] DNA regions are operably linked when they are functionally
related to each other. A DNA sequence encoding a fusion protein is
said to be operably linked to one or more of the above-described
regulatory elements when the fusion protein DNA sequence is
transcribed, or the resulting mRNA is translated, under the control
of the regulatory element(s).
[0073] Transformed host cells are cells which have been transformed
or transfected with foreign DNA using recombinant DNA techniques.
In the context of the present invention, the foreign DNA includes a
sequence encoding the inventive fusion protein. Host cells may be
transformed for purposes of cloning or amplifying the foreign DNA,
or may be transformed with an expression vector for production of
the fusion protein under the control of appropriate promoters.
Suitable host cells include prokaryotes, yeast, or higher
eukaryotic cells. Appropriate cloning and expression vectors for
use with bacterial, fungal, yeast, and mammalian cellular hosts are
described by Pouwels et al. (Cloning Vectors: A Laboratory Manual,
Elsevier, N.Y., 1985), the relevant disclosures of which is hereby
incorporated by reference. Cell-free translation systems could also
be employed to produce fusion protein using RNAs derived from the
DNA constructs of the present invention.
[0074] Prokaryotes include gram negative or gram positive
organisms. Prokaryotic expression vectors generally comprise one or
more phenotypic selectable markers, for example a gene encoding
proteins conferring antibiotic resistance or supplying an
autotrophic requirement, and an origin of replication recognized by
the host to ensure amplification within the host. Examples of
suitable prokaryotic hosts for transformation include E. coli,
bacilli such as Bacillus subtilis, Salmonella typhimurium, and
various species within the genera Pseudomonas, Streptomyces, and
Staphylococcus, although others may also be employed as a matter of
choice.
[0075] Useful expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well-known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed. E. coli is
typically transformed using derivatives of pBR322, a plasmid
derived from an E. coli species (Bolivar et al., Gene 2:95, 1977).
pBR322 contains genes for ampicillin and tetracycline resistance,
providing simple means for identifying transformed cells.
[0076] Promoters commonly used in recombinant microbial expression
vectors include the b-lactamase (penicillinase) and lactose
promoter system (Chang et al., Nature 275:615, 1978; and Goeddel et
al., Nature 281:544, 1979), the tryptophan (trp) promoter system
(Goeddel et al., Nucl. Acids Res. 8:4057, 1980; and EPA 36,776) and
tac promoter (Maniatis, Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory, p. 412, 1982). A particularly useful
bacterial expression system employs the phage .lambda. P.sub.L
promoter and cI857ts thermoinducible repressor. Plasmid vectors
available from the American Type Culture Collection which
incorporate derivatives of the .lambda. P.sub.L promoter include
plasmid pHUB2, resident in E. coli strain JMB9 (ATCC 37092) and
pPLc28, resident in E. coli RR1 (ATCC 53082).
[0077] The recombinant fusion protein may also be expressed in
yeast hosts, preferably from Saccharomyces species, such as S.
cerevisiae. Yeast of other genera such as Pichia or Kluyveromyces
may also be employed. Yeast vectors will generally contain an
origin of replication from the 2 .mu.m yeast plasmid or an
autonomously replicating sequence (ARS), a promoter, DNA encoding
the fusion protein, sequences for polyadenylation and transcription
termination and a selection gene. Preferably, yeast vectors will
include an origin of replication and selectable markers permitting
transformation of both yeast and E. coli, e.g., the ampicillin
resistance gene of E. coli and the S. cerevisiae trp1 gene, which
provides a selection marker for a mutant strain of yeast lacking
the ability to grow in tryptophan, and a promoter derived from a
highly expressed yeast gene to induce transcription of a structural
sequence downstream. The presence of the trp1 lesion in the yeast
host cell genome then provides an effective environment for
detecting transformation by growth in the absence of
tryptophan.
[0078] Suitable promoter sequences in yeast vectors include the
promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman
et al., J. Biol. Chem. 255:2073, 1980) or other glycolytic enzymes
(Hess et al., J. Adv. Enzyme Reg. 7:149, 1968; and Holland et al.,
Biochem. 17:4900, 1978), such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase and glucokinase. Suitable
vectors and promoters for use in yeast expression are further
described in R. Hitzeman et al., EPA 73,657.
[0079] Preferred yeast vectors can be assembled using DNA sequences
from pBR322 for selection and replication in E. coli (Amp.sup.r
gene and origin of replication) and yeast DNA sequences including a
glucose-repressible ADH2 promoter and .alpha.-factor secretion
leader. The ADH2 promoter has been described by Russell et al. (J.
Biol. Chem. 258:2674, 1982) and Beier et al., (Nature 300:724,
1982). Advantageously, a DNA segment encoding a leader sequence
functional in yeast is operably linked to the 5' end of the DNA
encoding the fusion protein. The encoded leader peptide promotes
secretion of the fusion protein from the host cell and is generally
cleaved from the fusion protein upon secretion. As one example, the
yeast .alpha.-factor leader, which directs secretion of
heterologous proteins, can be inserted between the promoter and the
structural gene to be expressed. See, e.g., Kurjan et al., Cell
30:922, 1982; and Bitter et al., Proc. Natl. Acad. Sci. USA
81:5330, 1984. The leader sequence may be modified to contain, near
its 3' end, one or more useful restriction sites to facilitate
fusion of the leader sequence to foreign genes.
[0080] Suitable yeast transformation protocols are known to those
of skill in the art. An exemplary technique is described by Hinnen
et al., Proc. Natl. Acad. Sci. USA 75:1929, (1978), selecting for
Trp.sup.+ transformants in a selective medium consisting of 0.67%
yeast nitrogen base, 0.5% casamino acids, 2% glucose, 10 .mu.g/ml
adenine and 20 .mu.g/ml uracil. Host strains transformed by vectors
comprising the above-described ADH2 promoter may be grown for
expression in a rich medium consisting of 1% yeast extract, 2%
peptone, and 1% glucose supplemented with 80 .mu.g/ml adenine and
80 .mu.g/ml uracil. Derepression of the ADH2 promoter occurs upon
exhaustion of medium glucose. Crude yeast supernatants are
harvested by filtration and held at 4.degree. C. prior to further
purification.
[0081] Various mammalian or insect cell culture systems can be
employed to express recombinant protein. Baculovirus systems for
production of heterologous proteins in insect cells are reviewed by
Luckow and Summers, Bio/Technology 6:47 (1988). Established cell
lines of mammalian origin may be employed. Examples of suitable
mammalian host cell lines include the COS-7 lines of monkey kidney
cells, described by Gluzman (Cell 23:175, 1981), L cells, C127,
3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines.
Mammalian expression vectors may comprise non-transcribed elements
such as an origin of replication, a suitable promoter and enhancer
linked to the gene to be expressed, and other 5' or 3' flanking
nontranscribed sequences, and 5' or 3' nontranslated sequences,
such as necessary ribosome binding sites, a poly-adenylation site,
splice donor and acceptor sites, and transcriptional termination
sequences.
[0082] The transcriptional and translational control sequences in
expression vectors to be used in transforming vertebrate cells may
be provided by viral sources. For example, commonly used promoters
and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus
40 (SV40), and human cytomegalovirus. DNA sequences derived from
the SV40 viral genome, for example, SV40 origin, early and late
promoter, enhancer, splice, and polyadenylation sites may be used
to provide the other genetic elements required for expression of a
heterologous DNA sequence. The early and late promoters are
particularly useful because both are obtained easily from the virus
as a fragment which also contains the SV40 viral origin or
replication (Fiers et al., Nature 273:113, 1978). Smaller or larger
SV40 fragments may also be used, provided the approximately 250 bp
sequence extending from the Hind III site toward the BglI site
located in the viral origin of replication is included. Exemplary
vectors can be constructed as disclosed by Okayama and Berg (Mol.
Cell. Biol. 3:280, 1983). A useful system for stable high level
expression of mammalian receptor cDNAs in C127 murine mammary
epithelial cells can be constructed substantially as described by
Cosman et al. (Mol. Immunol. 23:935, 1986).
[0083] Producing and Purifying the Fusion Protein
[0084] The present invention provides a process for producing the
recombinant fusion protein of the present invention, comprising
culturing a host cell transformed with an expression vector
comprising a DNA sequence that encodes said fusion protein under
conditions that promote expression of the fusion protein, which is
then purified from culture media or cell extracts. Any suitable
purification process may be employed, with the procedure of choice
varying according to such factors as the type of host cells and
whether or not the desired protein is secreted from the host cells.
The fusion protein will be secreted into the culture medium when it
is initially fused to a signal sequence or leader peptide operative
in the host cells, or when the protein comprises soluble forms of
the TNF-R and IL-1R polypeptides.
[0085] For example, supernatants from expression systems which
secrete recombinant protein into the culture medium can be first
concentrated using a commercially available protein concentration
filter, for example, an Amicon or Millipore Pellicon
ultrafiltration unit. Following the concentration step, the
concentrate can be applied to a suitable purification matrix. For
example, a suitable affinity matrix can comprise TNF or IL-1. An
affinity matrix may be prepared by coupling recombinant human TNF
or IL-1 to cyanogen bromide-activated Sepharose (Pharmacia) or
Hydrazide Affigel (Biorad), according to manufacturer's
recommendations. A preferred purification procedure involves
sequential immunopurification using antibodies bound to a suitable
support. Proteins binding to an antibody specific for TNF-R are
recovered and contacted with antibody specific for IL-1R on an
insoluble support. Proteins immunoreactive with both antibodies may
thus be identified and isolated. A monoclonal antibody specific for
human type I IL-1R was deposited with the American Type Culture
Collection under accession number HB10556 on Sep. 13, 1990.
Alternatively, an anion exchange resin can be employed, for
example, a matrix or substrate having pendant diethylaminoethyl
(DEAE) groups. The matrices can be acrylamide, agarose, dextran,
cellulose or other types commonly employed in protein purification.
Alternatively, a cation exchange step can be employed. Suitable
cation exchangers include various insoluble matrices comprising
sulfopropyl or carboxymethyl groups. Sulfopropyl groups are
preferred. One or more reversed-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
e.g., silica gel having pendant methyl or other aliphatic groups,
can be employed to further purify a fusion protein composition.
[0086] Recombinant protein produced in bacterial culture is usually
isolated by initial extraction from cell pellets, followed by one
or more concentration, salting-out, aqueous ion exchange or size
exclusion chromatography steps. Finally, high performance liquid
chromatography (HPLC) can be employed for final purification steps.
Microbial cells employed in expression of recombinant fusion
proteins can disrupted by any convenient method, including
freeze-thaw cycling, sonication, mechanical disruption, or use of
cell lysing agents.
[0087] Fermentation of yeast which express fusion proteins as a
secreted protein greatly simplifies purification. Secreted
recombinant protein resulting from a large-scale fermentation can
be purified by methods analogous to those disclosed by Urdal et al.
(J. Chromatog. 296:171, 1984), involving two sequential,
reversed-phase HPLC steps for purification of a recombinant protein
on a preparative HPLC column.
[0088] Some or all of the foregoing purification steps, in various
combinations, can be employed to provide an essentially homogeneous
recombinant protein. Recombinant cell culture enables the
production of the fusion protein free of those contaminating
proteins which may be normally associated with TNF-R or IL-1R as
they are found in nature in their respective species of origin,
e.g., in cells, cell exudates or body fluids. The foregoing
purification procedures are among those that may be employed to
purify non-recombinant receptors of the present invention as
well.
[0089] As an alternative to production of the inventive receptors
as fusion proteins, the TNF-R and IL-1R proteins may be separately
produced and purified, and subsequently linked together. Numerous
reagents useful for crosslinking one protein molecule to another
are known. Heterobifunctional and homobifunctional linkers are
available for this purpose from Pierce Chemical Company, Rockford,
Ill., for example. Such linkers contain two functional groups
(e.g., esters and/or maleimides) that will react with certain
functional groups on amino acid side chains (e.g., amines on lysine
residues and sulfhydryls generated on cysteine residues by
reduction), thus linking one polypeptide to another. Examples of
such crosslinking reagents are N-maleimidobenzoyl succinimidyl
ester and N-hydroxysuccinimide. The reagent and reaction conditions
should be chosen such that the cross-linking does not interfere
with binding of TNR or IL-1 to the receptor. The TNF-R and IL-1R
polypeptides are preferably linked via one of the above-described
peptide linkers that functions as a spacer. A peptide linker may be
attached to TNF-R or to IL-1R by any of the conventional procedures
used to attach one polypeptide to another. The cross-linking
reagents available from Pierce Chemical Company as described above
are among those that may be employed. Amino acids having side
chains reactive with such reagents may be included in the peptide
linker, e.g., at the termini thereof.
[0090] Pharmaceutical Compositions
[0091] The present invention provides pharmaceutical compositions
comprising any of the above-described fusion proteins and a
physiologically acceptable carrier, diluent, or excipient. Such
carriers, excipients and diluents will be nontoxic to recipients at
the dosages and concentrations employed. Such compositions may
comprise buffers, antioxidants such as ascorbic acid, low molecular
weight (less than about 10 residues) polypeptides, proteins, amino
acids, carbohydrates including glucose, sucrose or dextrins,
chelating agents such as EDTA, glutathione and other stabilizers
and excipients. Neutral buffered saline or saline mixed with
conspecific serum albumin are exemplary appropriate diluents.
Preferably, the composition is formulated as a lyophilizate using
appropriate excipient solutions (e.g., sucrose) as diluents.
Appropriate dosages can be determined in clinical trials. The
amount and frequency of administration will depend, of course, on
such factors as the nature and severity of the indication being
treated, the desired response, the condition of the patient, and so
forth.
[0092] Conditions mediated by either TNF or IL-1 may be treated by
administering a therapeutically effective amount of a fusion
protein of the present invention in the form of a pharmaceutical
composition, to a patient afflicted with such a disorder. A
disorder is said to be mediated by TNF or IL-1 when TNF or IL-1
causes (directly or indirectly) or exacerbates the disorder.
Soluble receptor proteins can be used to competitively bind to TNF
or IL-1, thereby inhibiting binding of TNF and IL-1 to cell surface
receptors.
[0093] For therapeutic use, purified fusion proteins of the present
invention are administered to a patient, preferably a human, for
treatment in a manner appropriate to the indication. Thus, for
example, the pharmaceutical compositions can be administered by
bolus injection, continuous infusion, sustained release from
implants, or other suitable technique.
[0094] The fusion protein employed in the pharmaceutical
compositions should be purified, in that the fusion protein is
substantially free of other proteins of natural or endogenous
origin and contains less than about 1% by mass of protein
contaminants residual of production processes. Such compositions,
however, can contain other proteins added as stabilizers, carriers,
excipients or co-therapeutics. The fusion protein is purified to
substantial homogeneity if it is detectable as a single protein
band in a polyacrylamide gel by silver staining.
[0095] The fusion proteins of the present invention may be
administered to treat conditions believed to be mediated, at least
in part, by TNF, such as cachexia, rheumatoid arthritis, diabetes,
multiple sclerosis, pulmonary fibrosis and silicosis, cerebral
malaria, and allograft and xenograft rejection in graft versus host
disease. TNF has also been implicated in sepsis and septic shock.
Bacterial endotoxin can cause sepsis in mammals infected with
certain types of bacteria, and is believed to stimulate macrophages
to produce factors that include TNF. Folks et al. (PNAS USA
86:2365, 1989) suggests that TNF-.alpha. plays an important role in
the pathogenesis of HIV infection. TNF-.alpha. induced expression
of HIV in a cell line employed as a model of HIV latency to study
conversion from a latent to a productive infection.
[0096] Certain cytokines (IL-1, IL-2 and other colony stimulating
factors) can induce significant host production of TNF. Fusion
proteins of the formula TNF-R-linker-TNF-R thus may be used to
treat side effects associated with cytokine therapy. Because of the
primary role IL-1 plays in the production of TNF, fusion proteins
comprising both IL-1 receptor(s) and TNF receptor(s) may be
preferred in the treatment of TNF-associated clinical
indications.
[0097] TNF has been reported to induce secretion of IL-1 in vivo.
Thus, fusion proteins that bind both TNF and IL-1 may be employed
in treating conditions mediated by IL-1. The inventive fusion
proteins can be administered, for example, for the purpose of
suppressing immune responses in a human. A variety of diseases or
conditions are caused by an immune response to alloantigen. In
alloantigen-induced immune responses, IL-1R suppresses
lymphoproliferation and inflammation which result upon activation
of T cells. IL-1R thus may be used to suppress alloantigen-induced
immune responses in the clinical treatment of, for example,
rejection of allografts (such as skin, kidney, and heart
transplants), and graft-versus-host reactions in patients who have
received bone marrow transplants. IL-1 is believed to play a
causative role in allergies and autoimmune dysfunctions (such as
rheumatoid arthritis, diabetes, and multiple sclerosis, which are
dependent upon the activation of T cells against antigens not
recognized as being indigenous to the host.
[0098] TNF and IL-1 have been implicated in a number of the same
diseases, as can be seen by comparing the lists of TNF-mediated and
IL-1-mediated conditions presented above. In addition, TNF and IL-1
are two of the major mediators of inflammation, often acting in
concert. The fusion proteins of the present invention that comprise
receptors for both TNF and IL-1 thus offer advantages in the
treatment of a number of conditions in which both TNF and IL-1 are
believed to play a causative role.
[0099] The use of soluble forms of IL-1R and TNF-R in the inventive
fusion proteins is advantageous for certain applications.
Purification of the proteins from recombinant host cells is
facilitated, since the soluble proteins are secreted from the
cells. Further, soluble proteins are generally more suitable for
intravenous administration and may exert their therapeutic effect
(binding IL-1 and/or TNF) in the bloodstream. By binding IL-1
and/or TNF, the soluble fusion proteins will inhibit signal
transduction via endogenous cell surface receptors for IL-1 or
TNF.
[0100] The inventive fusion proteins may also be used as reagents
in receptor-based immunoassays, reagents in assays for TNF or IL-1,
or as binding agents for affinity purification or TNF or IL-1.
[0101] The following examples are offered by way of illustration,
and not by way of limitation.
EXAMPLES
Example 1
TNF Binding Assays
[0102] A. Radiolabeling of TNF.alpha. and TNF.beta.. Recombinant
human TNF.alpha., in the form of a fusion protein containing a
hydrophilic octapeptide at the N-terminus, was expressed in yeast
as a secreted protein and purified by affinity chromatography (Hopp
et al., Bio/Technology 6:1204, 1988). Purified recombinant human
TNF.beta. was purchased from R&D Systems (Minneapolis, Minn.).
Both proteins were radiolabeled using the commercially available
solid phase agent, IODO-GEN (Pierce). In this procedure, 5 .mu.g of
IODO-GEN were plated at the bottom of a 10.times.75 mm glass tube
and incubated for 20 minutes at 4.degree. C. with 75 .mu.l of 0.1 M
sodium phosphate, pH 7.4 and 20 .mu.l (2 mCi) Na .sup.125I. This
solution was then transferred to a second glass tube containing 5
.mu.g TNF.alpha. (or TNF.beta.) in 45 .mu.l PBS for 20 minutes at
4.degree. C. The reaction mixture was fractionated by gel
filtration on a 2 ml bed volume of Sephadex G-25 (Sigma)
equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium
containing 2.5% (w/v) bovine serum albumin (BSA), 0.2% (w/v) sodium
azide and 20 mM Hepes pH 7.4 (binding medium). The final pool of
.sup.125I-TNF was diluted to a working stock solution of
1.times.10.sup.-7 M in binding medium and stored for up to one
month at 4.degree. C. without detectable loss of receptor binding
activity. The specific activity is routinely 1.times.10.sup.6
cpm/mmole TNF.
[0103] B. Binding to Intact Cells. Binding assays with intact cells
were performed by two methods. In the first method, cells were
first grown either in suspension (e.g., U 937) or by adherence on
tissue culture plates (e.g., WI26-VA4, COS cells expressing the
recombinant TNF receptor). Adherent cells were subsequently removed
by treatment with 5 mM EDTA treatment for ten minutes at 37 degrees
centigrade. Binding assays were then performed by a pthalate oil
separation method (Dower et al., J. Immunol. 132:751, 1984)
essentially as described by Park et al. (J. Biol. Chem. 261:4177,
1986). Non-specific binding of .sup.125I-TNF was measured in the
presence of a 200-fold or greater molar excess of unlabeled TNF.
Sodium azide (0.2%) was included in a binding assay to inhibit
internalization of .sup.125I-TNF by cells. In the second method,
COS cells transfected with the TNF-R-containing plasmid, and
expressing TNF receptors on the surface, were tested for the
ability to bind .sup.125I-TNF by the plate binding assay described
by Sims et al. (Science 241:585, 1988).
[0104] C. Solid Phase Binding Assays. The ability of TNF-R to be
stably adsorbed to nitrocellulose from detergent extracts of human
cells yet retain TNF-binding activity provided a means of detecting
TNF-R. Cell extracts were prepared by mixing a cell pellet with a
2.times. volume of PBS containing 1% Triton X-100 and a cocktail of
protease inhibitors (2 mM phenylmethyl sulfonyl fluoride, 10 .mu.M
pepstatin, 10 .mu.M leupeptin, 2 mM o-phenanthroline and 2 mM EGTA)
by vigorous vortexing. The mixture was incubated on ice for 30
minutes after which it was centrifuged at 12,000.times. g for 15
minutes at 8.degree. C. to remove nuclei and other debris. Two
microliter aliquots of cell extracts were placed on dry BA85/21
nitrocellulose membranes (Schleicher and Schuell, Keene, N.H.) and
allowed to dry. The membranes were incubated in tissue culture
dishes for 30 minutes in Tris (0.05 M) buffered saline (0.15 M) pH
7.5 containing 3% w/v BSA to block nonspecific binding sites. The
membrane was then covered with 5.times.10.sup.-11 M .sup.125I-TNF
in PBS.+-.3% BSA and incubated for 2 hr at 4.degree. C. with
shaking. At the end of this time, the membranes were washed 3 times
in PBS, dried and placed on Kodak X-Omat AR film for 18 hr at
-70.degree. C.
[0105] D. Signal Transduction Assays. Inhibition of TNF signal
transduction activity can be determined by transfecting cells with
recombinant TNF-R DNAs encoding membrane-bound TNF-R to obtain
recombinant receptor expression on the cell surface. The cells are
then contacted with TNF and the resulting metabolic effects
examined. If an effect results which is attributable to the action
of the ligand, and is not attributable to endogenous TNF receptors
on the cells, then the recombinant receptor has signal transduction
activity. Exemplary procedures for determining whether a
polypeptide has signal transduction activity are disclosed by
Idzerda et al., J. Exp. Med. 171:861 (1990); Curtis et al., Proc.
Natl. Acad. Sci. USA 86:3045 (1989); Prywes et al., EMBO J. 5:2179
(1986) and Chou et al., J. Biol. Chem. 262:1842 (1987). The ability
of a soluble TNF-R polypeptide to competitively inhibit signal
transduction can be determined using similar procedures. Primary
cells or cell lines which express an endogenous TNF receptor and
have a detectable biological response to TNF could be utilized as
an alternative to the cells expressing recombinant membrane-bound
TNF-R. Decreased signal transduction when a soluble TNF-R
polypeptide is added to the assay indicates binding of TNF by the
soluble TNF-R, so that less TNF binds to the cell surface TNF
receptors to initiate signal transduction.
Example 2
IL-1 Binding Assays
[0106] A. Radiolabeling of rIL-1.beta.. Recombinant human
IL-1.beta. was prepared by expression in E. coli and purification
to homogeneity as described by Kronheim et al. (Bio/Technology
4:1078, 1986). The IL-1.beta. was labeled with di-iodo (.sup.125I)
Bolton-Hunter reagent (New England Nuclear, Glenolden, Pa.). Ten
micrograms (0.57 nmol) of protein in 10 uL of phosphate (0.015
mol/L)-buffered saline (PBS; 0.15 mol/L), pH 7.2, was mixed with 10
uL of sodium borate (0.1 mol/L)-buffered saline (0.15 mol/L), pH
8.5, and reacted with 1 mCi (0.23 nmol) of Bolton-Hunter reagent
according to the manufacturer's instructions for 12 hours at
8.degree. C. Subsequently, 30 uL of 2% gelatin and 5 uL of 1 mol/L
glycine ethyl ester were added, and the protein was separated from
unreacted Bolton-Hunter reagent on a 1 mL bed volume Biogel.TM. P6
column (BioRad Laboratories, Richmond, Calif.). Routinely, 50% to
60% incorporation of label was observed. Radioiodination yielded
specific activities in the range of 1.times.10.sup.15 to
5.times.10.sup.15 cpm/mmol-1 (0.4 to 2 atoms I per molecule
protein), and sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS/PAGE) revealed a single labeled polypeptide of
17.5 kD, consistant with previously reported values for IL-1. The
labeled protein was greater than 98% TCA precipitable, indicating
that the .sup.125I was covalently bound to protein.
[0107] B. Inhibition Binding Assay for Membrane-Bound IL-1R. "IL-1"
refers collectively to IL-1.alpha. and IL-1.beta.. The binding
inhibition constant of an IL-1R protein may be determined by
inhibition binding assays in which varying concentrations of a
competitor (IL-1.beta. or IL-1.alpha.) are incubated with a
constant amount of radiolabeled IL-1.beta. or IL-1.alpha. and cells
expressing the IL-1R. The non-radiolabeled competitor binds to the
receptor and prevents the radiolabeled ligand from binding to the
receptor. Binding assays were performed by a phthalate oil
separation method essentially as described by Dower et al., J.
Immunol. 132:751, 1984 and Park et al., J. Biol. Chem. 261:4177,
1986. Briefly, host cells expressing a membrane-bound recombinant
IL-1R were incubated in six-well plates (Costar, Cambridge, Mass.)
at 4.degree. C. for 2 hours with .sup.125I-IL-1.beta. in 1 ml
binding medium (Roswell Park Memorial Institute (RPMI) 1640 medium
combining 2% BSA, 20 mM hepes buffer, and 0.1% sodium azide, pH
7.2). Sodium azide was included to inhibit internalization and
degradation of .sup.125I-IL-1 by cells at 37.degree. C. The plates
were incubated on a gyratory shaker for 1 hour at 37.degree. C.
Replicate aliquots of the incubation mixture were then transferred
to polyethylene centrifuge tubes containing a phthalate oil mixture
comprising 1.5 parts dibutylphthalate, to 1 part
bis(s-ethylhexyl)phthalate. Control tubes containing a 100.times.
molar excess of unlabeled IL-1.beta. were also included to
determine non-specific binding. The cells with bound .sup.125I-IL-1
were separated from unbound .sup.125I-IL-1 by centrifugation for 5
minutes at 15,000.times. g in an Eppendorf Microfuge. The
radioactivity associated with the cells was then determined on a
gamma counter.
[0108] C. Inhibition Binding Assay for Soluble IL-1R. The binding
inhibition constant of a soluble human IL-1R may be determined by
an inhibition binding assay in which varying concentrations of an
IL-1.beta. competitor is incubated with a constant amounts of
radiolabeled I-IL-1.beta. and CB23 cells (an Epstein Barr virus
transformed cord blood B lymphocyte cell line) expressing the type
II IL-1R. A cell line expressing endogenous type I IL-1 receptors
may be substituted for the CB23 cells in assays involving soluble
type I IL-1R. Binding assays were performed by a phthalate oil
separation method essentially as described by Dower et al., J.
Immunol. 132:751, 1984 and Park et al., J. Biol. Chem. 261:4177,
1986. Briefly, CVI-EBNA (mammalian) cells were transfected with the
expression vector pDC406 containing a cDNA encoding a soluble human
type II IL-1R as described in example 10. Supernatants from the
cells were harvested 3 days after transfection and serially diluted
in binding medium (Roswell Park Memorial Institute (RPMI) 1640
medium containing 2% BSA, 20 mM Hepes buffer, and 0.2% sodium
azide, pH 7.2) in 6 well plates to a volume of 50 .mu.l/well. The
supernatants were incubated with 50 .mu.l of 9.times.10.sup.-10 M
.sup.125I-IL-1.beta. plus 2.5.times.10.sup.6 CVI-EBNA cells at
8.degree. C. for 2 hours with agitation. Duplicate 60 .mu.l
aliquots of the incubation mixture were then transferred to
polyethylene centrifuge types containing a phthalate oil mixture
comprising 1.5 parts dibutylphthalate, to 1 part
bis(s-ethylhexyl)phthalate. A negative control tube containing
3.times.10.sup.-6 M unlabeled IL-1.beta. was also included to
determine non-specific binding (100% inhibition) and a positive
control tube containing 50 ml binding medium with only radiolabeled
IL-1.beta. was included to determine maximum binding. The cells
with bound .sup.125I-IL-1.beta. were separated from unbound
.sup.125I-IL-1.beta. by centrifugation for 5 minutes at
15,000.times. g in an Eppendorf Microfuge. Supernatants containing
unbound .sup.125I-IL-1.beta. were discarded and the cells were
carefully rinsed with ice-cold binding medium. The cells were
incubated in 1 ml of trypsin-EDTA at 37.degree. C. for 15 minutes
and then harvested. The radioactivity associated with the cells was
then determined on a gamma counter. The ability of soluble IL-1R to
inhibit binding of IL-1.alpha. to endogenous cellular receptors may
be determined by the same procedure. Analogous techniques may be
employed in assays involving soluble TNF-R.
Example 3
Isolation of Human TNF-R cDNA by Direct Expression of Active
Protein in COS-7 Cells
[0109] Various human cell lines were screened for expression of
TNF-R based on their ability to bind .sup.125I-labeled TNF. The
human fibroblast cell line WI-26 VA4 (ATCC CCL 95.1) was found to
express a reasonable number of receptors per cell. Equilibrium
binding studies showed that the cell line exhibited biphasic
binding of .sup.125I-TNF with approximately 4,000 high affinity
sites (K.sub.a=1.times.10.sup.10 M.sup.-1) and 15,000 low affinity
sites (K.sub.a=1.times.10.sup.8 M.sup.-1) per cell.
[0110] An unsized cDNA library was constructed by reverse
transcription of polyadenylated mRNA isolated from total RNA
extracted from human fibroblast WI-26 VA4 cells grown in the
presence of pokeweed mitogen using standard techniques (Gubler, et
al., Gene 25:263, 1983; Ausubel et al., eds., Current Protocols in
Molecular Biology, Vol. 1, 1987). The cells were harvested by
lysing the cells in a guanidine hydrochloride solution and total
RNA isolated as previously described (March et al., Nature 315:641,
1985).
[0111] Poly A.sup.+ RNA was isolated by oligo dT cellulose
chromatography and double-stranded cDNA was prepared by a method
similar to that of Gubler and Hoffman (Gene 25:263, 1983). Briefly,
the poly A.sup.+ RNA was converted to an RNA-cDNA hybrid by reverse
transcriptase using oligo dT as a primer. The RNA-cDNA hybrid was
then converted into double-stranded cDNA using RNAase H in
combination with DNA polymerase I. The resulting double stranded
cDNA was blunt-ended with T4 DNA polymerase. To the blunt-ended
cDNA is added EcoRI linker-adapters (having internal Not1 sites)
which were phosphorylated on only one end (Invitrogen). The
linker-adaptered cDNA was treated with T4 polynucleotide kinase to
phosphorylate the 5' overhanging region of the linker-adapter and
unligated linkers were removed by running the cDNA over a Sepharose
CL4B column. The linker-adaptered cDNA was ligated to an equimolar
concentration of EcoR1 cut and dephosphorylated arms of
bacteriophage .lambda.gt10 (Huynh et al, DNA Cloning: A Practical
Approach, Glover, ed., IRL Press, pp. 49-78). The ligated DNA was
packaged into phage particles using a commercially available kit to
generate a library of recombinants (Stratagene Cloning Systems, San
Diego, Calif., USA). Recombinants were further amplified by plating
phage on a bacterial lawn of E. coli strain c600(hf1.sup.-).
[0112] Phage DNA was purified from the resulting .lambda.gt10 cDNA
library and the cDNA inserts excised by digestion with the
restriction enzyme Not1. Following electrophoresis of the digest
through an agarose gel, cDNAs greater than 2,000 bp were
isolated.
[0113] The resulting cDNAs were ligated into the eukaryotic
expression vector pCAV/NOT, which was designed to express cDNA
sequences inserted at its multiple cloning site when transfected
into mammalian cells. pCAV/NOT was assembled from pDC201 (a
derivative of pMLSV, previously described by Cosman et al., Nature
312: 768, 1984), SV40 and cytomegalovirus DNA and comprises, in
sequence with the direction of transcription from the origin of
replication: (1) SV40 sequences from coordinates 5171-270 including
the origin of replication, enhancer sequences and early and late
promoters; (2) cytomegalovirus sequences including the promoter and
enhancer regions (nucleotides 671 to +63 from the sequence
published by Boechart et al. (Cell 41:521, 1985); (3) adenovirus-2
sequences containing the first exon and part of the intron between
the first and second exons of the tripartite leader, the second
exon and part of the third exon of the tripartite leader and a
multiple cloning site (MCS) containing sites for Xho1, Kpn1, Sma1,
Not1 and Bgl1; (4) SV40 sequences from coordinates 4127-4100 and
2770-2533 that include the polyadenylation and termination signals
for early transcription; (5) sequences derived from pBR322 and
virus-associated sequences VAI and VAII of pDC201, with adenovirus
sequences 10532-11156 containing the VAI and VAII genes, followed
by pBR322 sequences from 4363-2486 and 1094-375 containing the
ampicillin resistance gene and origin of replication. pCAV/NOT has
been deposited with the American Type Culture Collection under
accession no. ATCC 68014.
[0114] The resulting WI-26 VA4 cDNA library in pCAV/NOT was used to
transform E. coli strain DH5.alpha., and recombinants were plated
to provide approximately 800 colonies per plate and sufficient
plates to provide approximately 50,000 total colonies per screen.
Colonies were scraped from each plate, pooled, and plasmid DNA
prepared from each pool. The pooled DNA was then used to transfect
a sub-confluent layer of monkey COS-7 cells using DEAE-dextran
followed by chloroquine treatment, as described by Luthman et al.
(Nucl. Acids Res. 11:1295, 1983) and McCutchan et al. (J. Natl.
Cancer Inst. 41:351, 1986). The cells were then grown in culture
for three days to permit transient expression of the inserted
sequences. After three days, cell culture supernatants were
discarded and the cell monolayers in each plate assayed for TNF
binding as follows. Three ml of binding medium containing
1.2.times.10.sup.-11 M .sup.125I-labeled FLAG.RTM.-TNF was added to
each plate and the plates incubated at 4.degree. C. for 120
minutes. This medium was then discarded, and each plate was washed
once with cold binding medium (containing no labeled TNF) and twice
with cold PBS. The edges of each plate were then broken off,
leaving a flat disk which was contacted with X-ray film for 72
hours at -70.degree. C. using an intensifying screen as described
by Sims et al., Science 241:585 (1988). TNF binding activity was
visualized on the exposed films as a dark focus against a
relatively uniform background.
[0115] After approximately 240,000 recombinants from the library
had been screened in this manner, one transfectant pool was
observed to provide TNF binding foci which were clearly apparent
against the background exposure. A frozen stock of bacteria from
the positive pool was then used to obtain plates of approximately
150 colonies. Replicas of these plates were made on nitrocellulose
filters, and the plates were then scraped and plasmid DNA prepared
and transfected as described above to identify a positive plate.
Bacteria from individual colonies from the nitrocellulose replica
of this plate were grown in 0.2 ml cultures, which were used to
obtain plasmid DNA, which was transfected into COS-7 cells as
described above. In this manner, a single clone was isolated which
was capable of inducing expression of human TNF-R in COS cells. The
expression vector pCAV/NOT containing this TNF-R cDNA has been
deposited with the American Type Culture Collection, 12301 Parklawn
Drive, Rockville, Md. 20852, USA (Accession No. 68088) under the
name pCAV/NOT-TNF-R.
Example 4
Construction of cDNAs Encoding Soluble huTNF-R.DELTA.235
[0116] A cDNA encoding a soluble huTNF-R.DELTA.235 was constructed.
The encoded protein comprises the sequence of amino acids -22 to
235 of FIG. 2A. Processing of the signal sequence yields a protein
having the sequence of amino acids 1 to 235 of FIG. 2A. An 840 bp
fragment was excised from pCAV/NOT-TNF-R with the restriction
enzymes Not1 and Pvu2. Not1 cuts at the multiple cloning site of
pCAV/NOT-TNF-R and Pvu2 cuts within the TNF-R coding region 20
nucleotides 5' of the transmembrane region. In order to reconstruct
the 3' end of the TNF-R sequences, two oligonucleotides were
synthesized and annealed to create the following oligonucleotide
linker:
1 Pvu2 BamHl Bgl2 SEQ ID NO:9 CTGAAGGGAGCACTGGCGACTAAGGATCCA
GACTTCCCTCGTGACCGCTGATTCC- TAGGTCTAG AlaGluGlySerThrGlyAspEnd
[0117] This oligonucleotide linker has terminal Pvu2 and Bgl2
restriction sites, regenerates 20 nucleotides of the TNF-R,
followed by a termination codon (underlined) and a BamH1
restriction site (for convenience in isolating the entire soluble
TNF-R by Not1/BamH1 digestion). This oligonucleotide was then
ligated with the 840 bp Not1/Pvu2 TNF-R insert into Bgl2/Not1 cut
pCAV/NOT to yield psolhuTNF-R.DELTA.235/CAVNOT, which was
transfected into COS-7 cells as described above. This expression
vector induced expression of soluble human TNF-R which was capable
of binding TNF.
Example 5
Construction of cDNAs Encoding Soluble huTNF-R.DELTA.185
[0118] A cDNA encoding a soluble huTNF-R.DELTA.185 having the
sequence of amino acids -22-185 of FIG. 2A (or amino acids 1-185
upon processing of the signal sequence in an appropriate host cell)
was constructed by excising a 640 bp fragment from pCAV/NOT-TNF-R
with the restriction enzymes Not1 and Bgl2. Not1 cuts at the
multiple cloning site of pCAV/NOT-TNF-R and Bgl2 cuts within the
TNF-R coding region at nucleotide 637, which is 237 nucleotides 5'
of the transmembrane region. The following oligonucleotide linkers
were synthesized:
2 Bgl 2 5'-GATCTGTAACGTGGTGGCCATCCCTGGGAATGCA SEQ ID NO:10
ACATTGCACCACCGGTAGGGACCCTTACGT IleCysAsnValValAlaIleProGlyAsnAla
AGCATGGATGC-3' TCG SerMetAspAla 5'- AGTCTGCACGTCCACGTCCCCCACCCGGTG
SEQ ID NO:11 TACCTACGTCAGACGTGCAGGTGCAGGGGGTGGGCCAC
ValCysThrSerThrSerProThrArgEn Not1 AGC -3' TCGCCGG d
[0119] The above oligonucleotide linkers reconstruct the 3' end of
the receptor molecule up to nucleotide 708, followed by a
termination codon (underlined). These oligonucleotides were then
ligated with the 640 bp Not1 TNF-R insert into Not1 cut pCAV/NOT to
yield the expression vector psolTNFR.DELTA.185/CAVNOT, which was
transfected into COS-7 cells as described above. This expression
vector induced expression of soluble human TNF-R which was capable
of binding TNF.
Example 6
Construction of cDNAs Encoding Soluble huTNF-R.DELTA.163
[0120] A cDNA encoding a soluble huTNF-R.DELTA.163 having the
sequence of amino acids -22-163 of FIG. 2A (1-163 upon processing
of the signal sequence) was constructed by excising a 640 bp
fragment from from pCAV/NOT-TNF-R with the restriction enzymes Not1
and Bgl2 as described in Example 4. The following oligonucleotide
linkers were synthesized:
3 Bg12 Notl SEQ ID NO:12 5'-GATCTGTTGAGC -3' ACAACTCGCCGG
IleCysEnd
[0121] This above oligonucleotide linker reconstructs the 3' end of
the receptor molecule up to nucleotide 642 (amino acid 163),
followed by a termination codon (underlined). This oligonucleotide
was then ligated with the 640 bp Not1 TNF-R insert into Not1 cut
pCAV/NOT to yield the expression vector psolTNFR.DELTA.163/CAVNOT,
which was transfected into COS-7 cells as described above. This
expression vector induced expression of soluble human TNF-R which
was capable of binding TNF in the binding assay described in
Example 1.
Example 7
Construction of cDNAs Encoding Soluble huTNF-R.DELTA.142
[0122] A cDNA encoding a soluble huTNF-R.DELTA.142 (having the
sequence of amino acids -22-142 of FIG. 2A (1-142 upon processing
of the signal sequence) was constructed by excising a 550 bp
fragment from from pCAV/NOT-TNF-R with the restriction enzymes Not1
and A1wN1. A1wN1 cuts within the TNF-R coding region at nucleotide
549. The following oligonucleotide linker was synthesized:
4 SEQ ID NO:13 Bg12 Notl 5'-CTGAAACATCAGACGTGGTGTGCAAGCCCTGTTAAA-3'
CTTGACTTTGTAGTCTGCACCACACGTTCGGGACAATTTCTAGA End
[0123] This above oligonucleotide linker reconstructs the 3' end of
the receptor molecule up to nucleotide 579 (amino acid 142),
followed by a termination codon (underlined). This oligonucleotide
was then ligated with the 550 bp Not1/A1wN1 TNF-R insert into
Not1/Bgl2 cut pCAV/NOT to yield the expression vector
psolTNFR.DELTA.142/CAVNOT, which was transfected into COS-7 cells
as described above. This expression vector did not induce
expression of soluble human TNF-R which was capable of binding TNF.
It is believed that this particular construct failed to express
biologically active TNF-R because one or more essential cysteine
residues (e.g., Cys.sup.157 or Cys.sup.163) required for
intramolecular bonding (for formation of the proper tertiary
structure of the TNF-R molecule) was eliminated.
Example 8
Isolation of Human Type I IL-1R cDNA Clones
[0124] cDNA encoding a human type I IL-1R protein was isolated by
hybridization to a probe derived from murine type I IL-1R cDNA.
Cloning of this murine IL-1R cDNA is described in example 4 of EP
318,296. A vector containing the murine cDNA was deposited with the
American Type Culture Collection under the name GEMBL78 on Nov. 19,
1987 and given the accession number ATCC 67563.
[0125] A 2356 base pair (bp) fragment of this deposited murine
clone 78 was isolated as described by Sims et al. (Science 241:585,
1988) and radiolabeled by nick-translation using DNA polymerase I
for use as a probe. The method employed was substantially similar
to that disclosed by Maniatis et al. (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, 1982, p.
109).
[0126] The probe was used to screen human cDNA libraries for human
IL-1R, as described by Sims et al., Proc. Natl. Acad. Sci. (USA)
86:8946, 1989. A cDNA library was constructed by reverse
transcription of polyadenylated mRNA isolated from total RNA
extracted from the cultured cells of a human T-cell line designated
clone 22, described by Acres et al. (J. Immunol. 138:2132, 1987).
These cells were cultured in RPMI 1640 medium plus 10% fetal bovine
serum as described by Acres et al. (supra), in the presence of 10
ng/ml OKT3 antibody and 10 ng/ml human IL-2. The cDNA was rendered
double-stranded using DNA polymerase I, blunt-ended with T4 DNA
polymerase, methylated with EcoRI methylase to protect EcoRI
cleavage sites within the cDNA, and ligated to EcoRI linkers. The
resulting constructs were digested with EcoRI to remove all but one
copy of the linkers at each end of the cDNA, and ligated to
EcoRI-cut and dephosphorylated arms of bacteriophage .lambda.gt10
(Huynh et al., DNA Cloning: A Practical Approach, Glover, ed., IRL
Press, pp. 49-78). The ligated DNA was packaged into phage
particles using a commercially available kit (Stratagene Cloning
Systems, San Diego, Calif., USA 92121) to generate a library of
recombinants. Recombinants were plated on E. coli strain C600(hf1-)
and screened by standard plaque hybridization techniques under
conditions of moderate stringency (50.degree. C., 6.times.
SSC).
[0127] Following several rounds of screening, nine clones were
isolated from the library which hybridized to the cDNA probe. The
clones were plaque purified and used to prepare bacteriophage DNA
which was digested with EcoRI. The digests were electrophoresed on
an agarose gel, blotted onto nylon filters, and retested for
hybridization. The clones were digested with EcoRI followed by
preparative agarose gel electrophoresis, then subcloned into an
EcoRI-cut derivative (pGEMBL) of the standard cloning vector pBR322
containing a polylinker having a unique EcoRI site, a BamH1 site
and numerous other unique restriction sites. An exemplary vector of
this type is described by Dente et al. (Nucl. Acids Res. 11:1645,
1983).
[0128] Restriction mapping and sequencing of a 4.8 kb human IL-1R
clone indicated that the clone included a sequence encoding 518
amino acids which exhibited 80% amino acid sequence identity to the
corresponding murine sequence in the extracellular, or N-terminal
region distal to the transmembrane region, 63% identity in the
transmembrane region, and 87% identity in the cytoplasmic, or
C-terminal region. A 440 bp EcoRI-NsiI fragment derived from the 5'
portion of the human IL-1R clone was .sup.32P-labeled by
nick-translation as described above and used to screen a cDNA
library produced by randomly-priming human T cell line clone 22
mRNA prepared as described above. 23 clones which hybridized to the
probe were isolated and analyzed by restriction mapping. Sequencing
of one of these clones provided the sequence information
corresponding to the remaining N-terminal 34 amino acids of the
human protein. The DNA and deduced amino acid sequence of the
complete coding region of the type I human IL-1R are shown in SEQ
ID NOS: 5 and 6. This human IL-1R protein comprises 569 amino acids
(including a 20 amino acid signal peptide), and includes 16
cysteine residues, 13 of which are conserved between the murine and
human genes. In addition, the human sequence includes six potential
N-glycosylation sites, of which five are conserved between murine
and human.
Example 9
Isolation of cDNAs Encoding Type II IL-1R
[0129] A DNA sequence encoding human type II IL-1R was isolated
from a cDNA library prepared using standard methods, by reverse
transcription of polyadenylated RNA isolated from the human B cell
lymphoblastoid line CB23, described by Benjamin & Dower, Blood
75:2017, 1990. Briefly, the CB23 cell line is an EBV-transformed
cord blood (CB) lymphocyte cell line, which was derived using the
methods described by Benjamin et al., Proc. Natl. Acad. Sci. USA
81:3547, 1984.
[0130] The CB23 library was screened by modified direct expression
of pooled cDNA fragments in the monkey kidney cell line CV-1/EBNA-1
using a mammalian expression vector (pDC406) that contains origins
of replication derived from SV40, Epstein-Barr virus and pBR322.
pDC406 is a derivative of HAV-EO described by Dower et al., J.
Immunol. 142:4314 (1989). pDC406 differs from HAV-EO by the
deletion of the intron present in the adenovirus 2 tripartite
leader sequence in HAV-EO. The CV-1/EBNA-1 cell line was derived by
transfection of the CV-1 cell line with the gene encoding
Epstein-Barr virus nuclear antigen-1 (EBNA-1) and with a vector
containing CMV regulatory sequences, so that EBNA-1 is expressed
under the control of the human CMV immediate-early
enhancer/promoter. The EBNA-1 gene allows the episomal replication
of expression vectors such as pDC406 that contain the EBV origin of
replication.
[0131] Transfectants expressing biologically active type II IL-1R
were initially identified using a modified slide autoradiographic
technique, substantially as described by Gearing et al., EMBO J.
8:3667, 1989. Briefly, CV-1/EBNA-1 cells were transfected with
miniprep DNA in pDC406 from pools of cDNA clones directly on glass
slides and cultured for 2-3 days to permit transient expression of
type II IL-1R. The slides containing the transfected cells were
then incubated with medium containing .sup.125I-IL-1.beta., washed
to remove unbound labeled IL-1.beta., fixed with gluteraldehyde,
and dipped in liquid photographic emulsion and exposed in the dark.
After developing the slides, they were individually examined with a
microscope and positive cells expressing type II IL-1R were
identified by the presence of autoradiographic silver grains
against a light background.
[0132] Using this approach, approximately 250,000 cDNAs were
screened in pools of approximately 3,000 cDNAs using the slide
autoradiographic method until assay of one transfectant pool showed
multiple cells clearly positive for IL-1.beta. binding. This pool
was then partitioned into pools of 500 and again screened by slide
autoradiography. A positive pool was identified. This pool was
further partitioned into pools of 75 and screened by plate binding
assays analyzed by quantitation of bound .sup.125I-IL-1.beta.. The
cells were scraped off and counted to determine which pool of 75
was positive. Individual colonies from this pool of 75 were
screened until a single clone was identified which directed
synthesis of a surface protein with detectable IL-1.beta. binding
activity. This clone was isolated, and its insert was sequenced to
determine the sequence of the human type II IL-1R cDNA that is
presented along with the amino acid sequence encoded thereby in SEQ
ID NOS: 7 and 8. The pDC406 cloning vector containing the human
type II IL-1R cDNA, designated pHu IL-1R-II 75, was deposited in
E.coli host cells with the American Type Culture Collection,
Rockville, Md. USA (ATCC) on Jun. 5, 1990 under accession number
ATCC 68337. The deposit was made under the conditions of the
Budapest Treaty.
[0133] Like most mammalian genes, mammalian type II IL-1R is
presumably encoded by multi-exon genes. Alternative mRNA constructs
which can be attributed to different mRNA splicing events following
transcription, and which share large regions of identity or
similarity with the cDNAs claimed herein, are considered to be
within the scope of the present invention.
Example 10
Construction and Expression of cDNAs Encoding Human Soluble Type II
IL-1R
[0134] A cDNA encoding a soluble human type II IL-1R (having the
sequence of amino acids -13-333 of SEQ ID NO: 8) was constructed by
polymerase chain reaction (PCR) amplification using the full length
type II IL-1R cDNA clone 75 (ATCC 68337) in vector pDC406
(described in example 9) as a template. The following 5'
oligonucleotide primer (SEQ ID NO: 14) and 3' oligonucleotide
primer (SEQ ID NO: 15) were first constructed:
5 5'-GCGTCGACCTAGTGACGCTCATACAAATC-3' SEQ ID NO:14 <SalI>
5'-GCGCGGCCGCTCAGGAGGAGGCTTCCTTGACTG SEQ ID NO:15 -3'
.rarw.NotI.fwdarw.End\1191 \1 172
[0135] The 5' primer corresponds to nucleotides 31-51 from the
untranslated region of human type II IL-1R clone 75 (SEQ ID NO:7)
with a 5' add-on of a SalI restriction site; this nucleotide
sequence is capable of annealing to the (-) strand complementary to
nucleotides 31-51 of human clone 75. The 3' primer is complementary
to nucleotides 1191-1172 (which includes anti-sense nucleotides
encoding 3 amino acids of human type II IL-1R clone 75 and has a 5'
add-on of a NotI restriction site and a stop codon.
[0136] The following PCR reagents were added to a 1.5 ml Eppendorf
microfuge tube: 10 .mu.l of 10.times. PCR buffer (500 mM KCl, 100
mM Tris-HCl, pH 8.3 at 25.degree. C., 15 MM MgCl.sub.2, and 1 mg/ml
gelatin) (Perkins-Elmer Cetus, Norwalk, Conn.), 10 .mu.l of a 2 mM
solution containing each dNTP (2 mM dATP, 2 mM dCTP, 2 mM dGTP and
2 mM dTTP), 2.5 units (0.5 .mu.l of standard 5000 units/ml
solution) of Taq DNA polymerase (Perkins-Elmer Cetus), 50 ng of
template DNA and 5 .mu.l of a 20 .mu.M solution of each of the
above oligonucleotide primers and 74.5 .mu.l water to a final
volume of 100 .mu.l. The final mixture was then overlaid with 100
.mu.l parafin oil. PCR was carried out using a DNA thermal cycler
(Ericomp, San Diego, Calif.) by initially denaturing the template
at 94.degree. for 90 seconds, reannealing at 55.degree. for 75
seconds and extending the cDNA at 72.degree. for 150 seconds. PCR
was carried out for an additional 20 cycles of amplification using
a step program (denaturation at 94.degree., 25 sec; annealing at
55.degree., 45 sec; extension at 72.degree., 150 sec.), followed by
a 5 minute extension at 72.degree..
[0137] The sample was removed from the parafin oil and DNA
extracted by phenolchloroform extraction and spun column
chromatography over G-50 (Boehringer Mannheim). A 10 .mu.l aliquot
of the extracted DNA was separated by electrophoresis on 1% SeaKem
agarose (FMC BioProducts, Rockland, Me.) and stained with ethidium
bromide to confirm that the DNA fragment size was consistent with
the predicted product.
[0138] 20 .mu.l of the PCR-amplified cDNA products were then
digested with SalI and NotI restriction enzymes using standard
procedures. The SalI/NotI restriction fragment was then separated
on a 1.2% Seaplaque.TM. low gelling temperature (LGT) agarose, and
the band representing the fragment was isolated. The fragment was
ligated into the pDC406 vector by a standard "in gel" ligation
method. The resulting vector was transfected into CV1-EBNA cells
and the soluble IL-1R protein was expressed.
Example 11
Construction of Vector Encoding Di-TNF-R
[0139] A vector encoding a fusion protein of the formula
TNF-R-peptide linker-TNF-R and depicted in FIG. 3 was constructed
as follows. Pertinent restriction enzyme cleavage sites in the
TNF-R sequence are also shown in FIGS. 2A-2B.
[0140] The expression vector constructed in example 4 and
designated psol huTNF-R.DELTA.235/CAVNOT was digested with the
restriction enzyme Not I, which cuts at the multiple cloning site
of the pCAV/NOT vector (i.e., upstream of the TNF-R sequence
inserted therein). The overhang generated by Not I digestion was
filled in using the Klenow fragment of DNA polymerase I to produce
a blunt end. The vector was then digested with Bam HI which cleaves
downstream of the stop codon that follows the codon for amino acid
235, as shown in example 4.
[0141] The blunted NotI/Bam HI fragment containing the TNF-R
sequence was isolated by conventional procedures and inserted into
a plasmid vector designated pCAV/DHFR which had been digested with
Sma I and Bgl II. The pCAV/DHFR vector is an expression vector
containing SV40 promoter sequences upstream of a multiple cloning
site and other features as described for pCAV/NOT in example 3, and
also contains a dihydrofolate reductase (DHFR) gene as a selectable
marker. The DHFR gene confers a selective advantage on otherwise
DHFR.sup.- mammalian cells that have taken up the vector, when
grown in the presence of methotrexate (MTX). Sma I digestion
produces blunt ends, to which the blunted Not I ends of the
TNF-R-containing fragment are ligated. The Bgl II-generated
overhangs are ligated to the Bam HI-digested ends of the
TNF-R-containing fragment. The ligation destroys the Bam HI and Bgl
II sites. E. coli cells are transformed with the ligation mixture
by conventional procedures. Plasmid DNA is recovered from the host
cells and the desired construct is confirmed by restriction
analysis. The resulting vector containing the TNF-R insert is
designated pCAV/DHFR/TNF-R.
[0142] The following DNA fragments were isolated for use in
preparing a vector encoding two TNF-R polypeptides separated by a
peptide linker:
[0143] (A) Asp718 (a restriction enzyme) to Esp I fragment of the
pCAV/DHFR/TNF-R vector. Asp 718 cleaves the vector upstream of the
inserted TNF-R sequence; EspI (available from U.S. Biochemicals)
cleaves the TNF-R sequence at the position shown in FIG. 2A. The
desired fragment is about 6.7 kilobase-pairs (kbp) in length and
includes vector sequences and the 3' end of a TNF-R sequence.
[0144] (B) Asp718 to PvuII fragment of the expression vector
constructed in example 4 and designated psol hu TNF-R
.DELTA.235/CAVNOT. Asp718 cleaves the vector upstream of the
inserted TNF-R sequence. The desired 865 bp fragment includes a
TNF-R sequence extending from the 5' signal sequence through the
Pvu II site shown in example 4.
[0145] (C) a double-stranded oligonucleotide having the sequence
(SEQ ID NOS: 16 and 17):
6 5' CTGAAGGGAGCACTGGCGACGGTGGCGGTGGATCCGGCGGTGGCGGC
GGCTCATTGCCCGCCCAGG 3' 3' GACTTCCCTCGTGACCGCTGCCACCGCCACC-
TAGGCCGCCACCGCCG CCGAGTAACGGGCGGG 5'
GluGlySerThrGlyAspGlyGlyGlyGlySerGlyGlyGlyGly
GlySerLeuProAlaGlnVal
[0146] (D) Bgl I to Esp I fragment of the expression vector
constructed in example 4 and designated psol hu TNF-R
.DELTA.235/CAVNOT. The desired fragment is about 304 bp in length.
Bgl I cleaves within the codon for amino acid 5 (Val) of TNF-R; Esp
I cleaves the TNF-R sequence at the position shown in FIG. 2A; the
remainder (3' end) of this soluble TNF-R-encoding sequence is
provided by fragment (A).
[0147] The oligonucleotide (C) is prepared by conventional
procedures for chemical synthesis of oligonucleotides. The
oligonucleotide reconstructs the 3' end of the first TNF-R sequence
from the Pvu II site through the last amino acid of the
extracellular domain (Asp at position 235). The oligonucleotide
also contains an in-frame sequence encoding the peptide linker
Gly.sub.4SerGly.sub.5Ser. The sequence of this portion of the
oligonucleotide may be varied if desired to encode other peptide
linkers. Oligonucleotide C also reconstructs the 5' end of the
second TNF-R sequence from a codon for leucine, the first amino
acid of the mature protein, through a partial codon for valine
(amino acid 5) within the protruding 3' overhang, which will
regenerate the Val codon when ligated to the complementary overhang
on the Bgl I-digested end of fragment D.
[0148] The DNA fragments designated A-D were ligated together in
the positions shown in FIG. 3 to form a vector designated pCAV DHFR
Di-TNF-R which encodes a fusion protein of the present invention.
E. coli cells are transformed with the ligation mixture by
conventional procedures. Plasmid DNA is recovered from the host
cells and the desired construct is confirmed by restriction
analysis. The upstream TNF-R polypeptide encoded by this expression
vector contains amino acids -22 to 235 of SEQ ID NO:2 (i.e., a
soluble TNF-R including the N-terminal signal sequence and the
entire extracellular domain without a stop codon). The downstream
TNF-R polypeptide lacks the signal sequence and contains amino
acids 1-235 of SEQ ID NO:2, with a stop codon positioned
immediately after amino acid 235. The peptide linker of this
particular construct is Gly.sub.4SerGly.sub.5Ser.
[0149] Mammalian cells are transfected with the expression vector
by conventional procedures and cultured to produce the desired
fusion protein. One suitable mammalian cell line is a DHFR.sup.-
Chinese hamster ovary cell line designated CHO-K1 and available
from the American Type Culture Collection, Rockville, Md., under
accession number CCL61. The cells may be transfected with the
expression vector by standard calcium phosphate precipitation,
essentially as described by Graham and van der Eb, Virology 52:456
(1983). The transfected cells are cultured under suitable
conventional conditions, and the presence of the desired fusion
protein in the culture medium is confirmed by assays such as those
described in examples 1 and 2.
Example 12
Fusion Protein Comprising One IL-1R Polypeptide and Two TNF-R
Polypeptides
[0150] A plasmid vector containing DNA encoding a fusion protein of
the formula IL-1R-peptide linker-TNF-R-peptide linker-TNF-R is
constructed as follows.
[0151] cDNA encoding a soluble type I IL-1R polypeptide was
isolated and amplified using the well known polymerase chain
reaction (PCR) procedure. The following oligonucleotides were
synthesized for use as primers in the PCR reaction:
7 5' ACCGAGGGACCTGAGCG 3' SEQ ID NO:18 3'
TCAATTATATAGGTCAGTGACCACCGCCACCTAG SEQ ID NO:19 GCCGCCACCGCCGCCGAGT
5'
[0152] These oligonucleotides as well as those discussed below are
synthesized by conventional procedures, e.g., by using an automated
DNA synthesis machine such as those available from Biosearch, Inc.,
San Rafael, Calif. or Applied Biosystems. The template employed in
the PCR reaction is a plasmid vector prepared by inserting type I
human IL-1R cDNA into a vector designated SF CAV. The SF CAV vector
is a mammalian expression vector shown in FIG. 5 (which depicts the
use of SF CAV in an additional vector construction described
below.) SF CAV in E. coli cells was deposited with the American
Type Culture Collection on Feb. 27, 1992, under the terms of the
Budapest Treaty, and was given accession number 68922.
[0153] The SV40, CMV, pA, and VA sequences and ampicillin
resistance gene in SF CAV are as described for pCAV/NOT in example
3 above and also in example 8 and FIG. 3 of PCT application WO
90/05183. A multiple cloning site positioned between the
adenovirus-2 tripartite leader (TPL) and pA sequences contains
recognition sites for the restriction endonucleases Xhol, KpnI,
SmaI, NotI, and BglI. The TPL sequence differs from that of
pCAV/NOT in that a region believed to be detrimental to
construction of IL-1R-encoding vectors has been deleted from the SF
CAV TPL sequence. The adverse impact on IL-1R vectors may possibly
be attributable to a cryptic promoter in the undesirable sequence,
from which undesired protein is expressed in E. coli. Low level
expression of human IL-1R off the cryptic promoter may be toxic to
the bacteria.
[0154] SF CAV is digested with SmaI, which recognizes a unique
restriction site within the multiple cloning site and produces
blunt ends. A DNA fragment containing type I IL-1R cDNA is produced
by StyI/BglII digestion followed by filling in the overhangs using
the Klenow fragment of DNA polymerase I to generate blunt ends.
StyI cleaves at nucleotide 49 and BglII cleaves at nucleotide 1997
of SEQ ID NO: 5. The IL-1R cDNA fragment is ligated into the
SmaI-digested SF CAV vector, and E. coli cells are transformed with
the ligation mixture by standard procedures. The resulting vector
is recovered from the E. coli cells and used as the template in the
PCR reaction.
[0155] The 5' primer (SEQ ID NO: 18) corresponds to a 17-nucleotide
sequence found in the vector upstream of the inserted IL-1R cDNA.
The 3' primer (SEQ ID NO: 19) includes a segment complementary to
nucleotides 1060-1079 of SEQ ID NO: 5, which encode amino acids 306
(partial codon) through 312, near the C-terminus of the IL-1R
extracellular domain. This 3' primer also contains a sequence
encoding the peptide linker Gly.sub.4SerGly.sub.5Ser.
[0156] A PCR reaction is conducted using any suitable procedure,
such as those described in Sarki et al., Science 239:487 (1988); in
Recombinant DNA Methodology, Wu et al., eds., Academic Press Inc.,
San Diego (1989), pp. 189-196; and in PCR Protocols: A Guide to
Methods and Applications, Innis et al., eds., Academic Press, Inc.
(1990). An example of a suitable PCR procedure is as follows. All
temperatures are in degrees centigrade. The following PCR reagents
are added to a 0.5 ml Eppendorf microfuge tube: 10 .mu.l of
10.times. PCR buffer (500 mM KCl, 100 mM Tris-HCl, pH 8.3 at
25.degree. C., 25 mM MgCl.sub.2, and 1 mg/ml gelatin) (Perkin-Elmer
Cetus, Norwalk, Conn.), 8 .mu.l of a 2.5 mM solution containing
each dNTP (2 mM dATP, 2 mM dCTP, 2 mM dGTP and 2 mM dTTP), 2.5
units (0.5 .mu.l of standard 5000 units/ml solution) of Taq DNA
polymerase (Perkins-Elmer Cetus), 1 ng of template DNA, 100
picomoles of each of the oligonucleotide primers, and water to a
final volume of 100 .mu.l. The final mixture is then overlaid with
100 .mu.l parafin oil. PCR is carried out using a DNA thermal
cycler (Ericomp, San Diego, Calif.). The template is denatured at
94.degree. for 5 minutes and PCR is carried out for 25 cycles of
amplification using a step program (denaturation at 94.degree., 1.5
minutes; annealing at 60.degree., 1 minute; extension at
72.degree., 1 minute).
[0157] Electrophoresis of an aliquot of the reaction mixture on 1%
SeaKem low melting temperature (LMT) agarose (FMC BioProducts,
Rockland, Me.) and staining with ethidium bromide visualizes a
single DNA fragment of the expected size as the PCR reaction
product. The PCR-amplified DNA fragment comprises a short vector
sequence that includes an Asp718 restriction site, upstream of a
sequence encoding IL-1R amino acids 1(Asp) to 312 (Thr), followed
by a single stranded segment encoding the peptide linker.
[0158] A second PCR reaction is conducted to isolate and amplify a
cDNA fragment encoding a soluble TNF-R polypeptide. The template
was the vector designated psolhuTNF-R .DELTA.235/CAVNOT in example
4, which contains a cDNA insert encoding TNF-R amino acids -22 to
235 of SEQ ID NO: 1. The primers employed in the reaction are:
8 5' GGTGGCGGTGGATCCGGCGGTGGCGGCGGCTCAT SEQ ID NO:20
TGCCCGCCCAGGTGGCA 3' 3' TGACGCGCGACTCGTTCG 5' SEQ ID NO:21
[0159] The 5' primer (SEQ ID NO: 20) comprises a peptide linker
encoding segment complementary to the peptide linker encoding
portion of the SEQ ID NO: 19 primer. The linker-encoding segment is
followed by codons for the first six amino acids of mature TNF-R
(Leu through Ala).
[0160] The 3' primer (SEQ ID NO: 21) comprises nucleotides
complementary to nucleotides 461-478 of TNF-R SEQ ID NO: 1, which
encode amino acids 103 (Tyr, partial codon) through 109 (Gln,
partial codon). This primer also encompasses an EspI restriction
site that is naturally present in this portion of the TNF-R
protein.
[0161] The PCR reaction procedure is as described above. The DNA
fragment amplified by this second PCR reaction comprises the
above-described linker-encoding segment followed by a sequence
encoding amino acids 1 (Leu) through 109 (Gln, partial codon) of
TNF-R. This DNA fragment is visualized by electrophoresis followed
by ethidium bromide staining of the gel, as described above. A
third PCR reaction is conducted to isolate an amplified double
stranded DNA fragment comprising IL-1R and TNF-R sequences
separated by the linker sequence. The following reagents were
combined in a 0.5 ml. tube:
[0162] 3 .mu.l (about 5-10 ng) of the IL-1R-peptide linker DNA
fragment amplified in the first PCR reaction above--a 3 .mu.l
aliquot is taken directly from the LMT agarose by micropipette,
using UV light to visualize the desired band on the ethidium
bromide stained gel
[0163] 3 .mu.l (about 5-10 ng) of the peptide linker-TNF-R DNA
fragment amplified in the second PCR reaction above--a 3 .mu.l
aliquot is micropipetted directly from the region of the LMT
agarose gel that contains the desired band
[0164] 10 .mu.l of 10.times. PCR buffer (described above)
[0165] 100 pmole of the SEQ ID NO: 18 oligonucleotide as the 5'
primer
[0166] 100 pmole of the SEQ ID NO: 21 oligonucleotide as the 3'
primer
[0167] 4 .mu.l of a 2.5 mM solution containing each of the four
dNTPs
[0168] 0.5 .mu.l of Taq DNA polymerase (5 units/.mu.l)
[0169] water to a final volume of 100 .mu.l
[0170] The PCR reaction cycles are conducted at the temperatures
and for the time periods specified above. After the initial
denaturing step, the complementary peptide linker-encoding segments
of the two DNA fragments anneal. The end product of the reaction is
a blunt-ended double-stranded amplified DNA fragment about 1370 bp
in length, comprising an IL-1R DNA sequence upstream of a sequence
encoding a peptide linker, followed by a TNF-R DNA sequence.
[0171] A 25 .mu.l aliquot of this third PCR reaction mixture is,
without purification, reacted with the restriction enzymes Asp718
and EspI. Asp 718 cleaves upstream of the IL-1R sequence, as
discussed above. EspI cleaves within the TNF-R sequence, as shown
in FIG. 2A and discussed above. The restriction endonuclease Cell
II is an isoschizomer of EspI and may be substituted for EspI. The
desired fragment, referred to as fragment E hereinafter, is
purified by conventional procedures such as separation by gel
electrophoresis, e.g., on a 1.0% Seaplaque low melting temperature
agarose gel, and isolation of the band representing the desired
fragment.
[0172] Two additional DNA fragments designated F and G are isolated
and joined with fragment E to construct an expression vector having
a second TNF-R sequence fused (via a peptide linker sequence)
downstream of the IL-1R-linker-TNF-R DNA fragment prepared above.
The resulting vector and the positions of fragments E, F, and G
contained therein are depicted in FIG. 4.
[0173] The DNA fragment designated F is prepared by digesting the
vector depicted in FIG. 3 and constructed in example 11 with EspI.
A fragment containing a 3' portion of TNF-R (extending from the
EspI site shown in FIG. 2A through a codon for amino acid 235)
followed by a sequence encoding a Gly.sub.4SerGly.sub.5Ser peptide
linker that is followed by a second TNF-R sequence extending from
the codon for amino acid 1 (Leu) to the EspI site in the second
(downstream) TNF-R sequence of the FIG. 3 vector, is isolated. This
fragment, about 739 base pairs in length, is designated fragment F
hereinafter.
[0174] Fragment G, containing vector sequences (including DHFR) and
a 3' portion of a TNF-R sequence is isolated from a "splice free"
vector as follows. The pCAV/DHFR/TNF-R vector prepared in example
11 contains a sequence which is believed to be disadvantageous for
construction of IL-1R-encoding vectors, possibly because of a
cryptic promoter within this sequence from which undesired protein
is expressed in E. coli. A derivative of pCAV/DHFR/TNF-R was
prepared by replacing an NdeI/Asp 718 vector fragment that contains
the undesirable sequence with an NdeI/Asp 718 fragment from splice
free vector SF CAV (ATCC 68922, described above). The construction
is depicted in FIG. 5.
[0175] SF CAV is digested with NdeI and Asp 718 (unique sites in
this plasmid) and the fragment of about 500 bp labeled H in FIG. 5
is isolated. Fragment H lacks the undesired sequence found in the
corresponding fragment of pCAV/DHFR/TNF-R.
[0176] The pCAV/DHFR/TNF-R vector prepared in example 11 and shown
in FIG. 5 is digested with Asp 718, EspI, and NdeI. An Asp 718/EspI
fragment of about 495 bp is isolated (fragment I). An NdeI/EspI
fragment of about 4647 bp is also isolated (fragment J).
[0177] DNA fragments H, I, and J prepared above are ligated
together to form the splice free vector SF CAV/DHFR/TNF-R shown in
FIG. 5. E. coli cells are transformed with the ligation mixture by
conventional procedures. Plasmid DNA is recovered from the host
cells and the desired construct is confirmed by restriction
analysis. SF pCAV/DHFR/TNF-R is then digested with Asp718 and EspI.
The fragment designated G in FIG. 5 contains vector sequences
(including DHFR) and the 3' end of a TNF-R sequence (from the
internal EspI site through the codon for amino acid 235 followed by
a stop codon) and is isolated by conventional procedures.
[0178] DNA fragments E, F, and G prepared above are ligated
together to form the vector depicted in FIG. 4 (and designated SF
CAV DHFR tri-R). E. coli cells are transformed with the ligation
mixture and the desired plasmid is recovered as described above.
The fusion protein encoded by this vector comprises (from N- to
C-terminus) amino acids -20 to 312 of type I IL-1R; a
Gly.sub.4SerGly.sub.4Ser peptide linker; amino acids 1 to 235 of
TNF-R; a Gly.sub.4SerGly.sub.5Ser peptide linker; and a second
TNF-R polypeptide comprising amino acids 1 to 235.
[0179] Mammalian cells are transfected with the expression vector
by conventional procedures and cultured to produce the desired
fusion protein. One suitable mammalian cell line is a DHFR.sup.-
Chinese hamster ovary cell line designated CHO-K1 and available
from the American Type Culture Collection, Rockville, Md., under
accession number CCL61. The cells may be transfected with the
expression vector by standard calcium phosphate precipitation,
essentially as described by Graham and van der Eb, Virology 52:456
(1983). The transfected cells are cultured under suitable
conventional conditions, and the presence of the desired fusion
protein in the culture medium is confirmed by assays such as those
described in examples 1 and 2.
Example 13
Fusion Protein Comprising One IL-1R Polypeptide and One TNF-R
Polypeptide
[0180] Fragments E and G prepared in example 12 may be ligated
together to form a vector containing a DNA sequence that encodes a
fusion protein of the formula IL-1R-peptide linker-TNF-R, wherein
the peptide linker is Gly.sub.4SerGly.sub.5Ser. IL-1R and TNF-R are
soluble polypeptides as described in example 12. The fusion protein
of example 12 is preferred due to the enhanced TNF binding achieved
when two, rather than one, TNF-R polypeptides are employed.
[0181] The skilled artisan will appreciate that the techniques
disclosed herein may be employed to produce additional fusion
proteins of the present invention, beyond those illustrative
embodiments presented in the foregoing examples. The peptide linker
may be varied by synthesizing an oligonucleotide encoding a
different peptide linker sequence, for example. Further,
alternative fragments of the IL-1R or TNF-R proteins may be
isolated by employing PCR primers that anneal to a different
desired portion of the disclosed DNA sequences thus defining the
termini of the desired fragment. Oligonucleotides used to
regenerate a terminus of a DNA fragment (e.g., the oligonucleotide
employed in example 4) may be varied to position a stop codon after
any desired amino acid. Further, the choice of expression vector
will depend upon the intended host cells.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0182] SEQ ID NO: 1 and SEQ ID NO: 2 show the nucleotide sequence
and encoded amino acid sequence of a human TNF-R cDNA. The mature
protein is defined by amino acids 1-439. The signal peptide is
defined by amino acids -22 through -1. The transmembrane region is
defined by amino acids 236-265.
[0183] SEQ ID NO: 3 and SEQ ID NO: 4 show the nucleotide sequence
and encoded amino acid sequence of the coding region of a human
TNF-R cDNA. This TNF-R is a different protein from the TNF-R of SEQ
ID NOS: 1 and 2. The mature protein is defined by amino acids
1-415. The signal peptide is defined by amino acids -40 through -1.
The transmembrane region is defined by amino acids 172-192.
[0184] SEQ ID NO: 5 and SEQ ID NO: 6 show the nucleotide sequence
and encoded amino acid sequence of a human type I IL-1R cDNA. The
mature protein is defined by amino acids 1-549. The predicted
signal peptide is defined by amino acids -20 through -1. The
transmembrane region is defined by amino acids 317-336.
[0185] SEQ ID NO: 7 and SEQ ID NO: 8 show the nucleotide sequence
and encoded amino acid sequence of a human type II IL-1R cDNA. The
mature protein is defined by amino acids 1-385. The predicted
signal peptide is defined by amino acids -13 through -1. The
transmembrane region is defined by amino acids 331-356.
[0186] SEQ ID NOS: 9-15 and 18-21 depict oligonucleotides employed
in constructing various recombinant plasmids, as described in the
examples section.
[0187] SEQ ID NOS: 16 and 17 depict an oligonucleotide and the
amino acid sequence encoded thereby, which includes a
Gly.sub.4SerGly.sub.5Ser peptide linker sequence. This
oligonucleotide is employed in the vector construction described in
example 11.
Sequence CWU 1
1
29 1 1641 DNA Homo sapiens mat_peptide (154)..() 1 gcgaggcagg
cagcctggag agaaggcgct gggctgcgag ggcgcgaggg cgcgagggca 60
gggggcaacc ggaccccgcc cgcatcc atg gcg ccc gtc gcc gtc tgg gcc gcg
114 Met Ala Pro Val Ala Val Trp Ala Ala -20 -15 ctg gcc gtc gga ctg
gag ctc tgg gct gcg gcg cac gcc ttg ccc gcc 162 Leu Ala Val Gly Leu
Glu Leu Trp Ala Ala Ala His Ala Leu Pro Ala -10 -5 -1 1 cag gtg gca
ttt aca ccc tac gcc ccg gag ccc ggg agc aca tgc cgg 210 Gln Val Ala
Phe Thr Pro Tyr Ala Pro Glu Pro Gly Ser Thr Cys Arg 5 10 15 ctc aga
gaa tac tat gac cag aca gct cag atg tgc tgc agc aaa tgc 258 Leu Arg
Glu Tyr Tyr Asp Gln Thr Ala Gln Met Cys Cys Ser Lys Cys 20 25 30 35
tcg ccg ggc caa cat gca aaa gtc ttc tgt acc aag acc tcg gac acc 306
Ser Pro Gly Gln His Ala Lys Val Phe Cys Thr Lys Thr Ser Asp Thr 40
45 50 gtg tgt gac tcc tgt gag gac agc aca tac acc cag ctc tgg aac
tgg 354 Val Cys Asp Ser Cys Glu Asp Ser Thr Tyr Thr Gln Leu Trp Asn
Trp 55 60 65 gtt ccc gag tgc ttg agc tgt ggc tcc cgc tgt agc tct
gac cag gtg 402 Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser
Asp Gln Val 70 75 80 gaa act caa gcc tgc act cgg gaa cag aac cgc
atc tgc acc tgc agg 450 Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg
Ile Cys Thr Cys Arg 85 90 95 ccc ggc tgg tac tgc gcg ctg agc aag
cag gag ggg tgc cgg ctg tgc 498 Pro Gly Trp Tyr Cys Ala Leu Ser Lys
Gln Glu Gly Cys Arg Leu Cys 100 105 110 115 gcg ccg ctg cgc aag tgc
cgc ccg ggc ttc ggc gtg gcc aga cca gga 546 Ala Pro Leu Arg Lys Cys
Arg Pro Gly Phe Gly Val Ala Arg Pro Gly 120 125 130 act gaa aca tca
gac gtg gtg tgc aag ccc tgt gcc ccg ggg acg ttc 594 Thr Glu Thr Ser
Asp Val Val Cys Lys Pro Cys Ala Pro Gly Thr Phe 135 140 145 tcc aac
acg act tca tcc acg gat att tgc agg ccc cac cag atc tgt 642 Ser Asn
Thr Thr Ser Ser Thr Asp Ile Cys Arg Pro His Gln Ile Cys 150 155 160
aac gtg gtg gcc atc cct ggg aat gca agc atg gat gca gtc tgc acg 690
Asn Val Val Ala Ile Pro Gly Asn Ala Ser Met Asp Ala Val Cys Thr 165
170 175 tcc acg tcc ccc acc cgg agt atg gcc cca ggg gca gta cac tta
ccc 738 Ser Thr Ser Pro Thr Arg Ser Met Ala Pro Gly Ala Val His Leu
Pro 180 185 190 195 cag cca gtg tcc aca cga tcc caa cac acg cag cca
act cca gaa ccc 786 Gln Pro Val Ser Thr Arg Ser Gln His Thr Gln Pro
Thr Pro Glu Pro 200 205 210 agc act gct cca agc acc tcc ttc ctg ctc
cca atg ggc ccc agc ccc 834 Ser Thr Ala Pro Ser Thr Ser Phe Leu Leu
Pro Met Gly Pro Ser Pro 215 220 225 cca gct gaa ggg agc act ggc gac
ttc gct ctt cca gtt gga ctg att 882 Pro Ala Glu Gly Ser Thr Gly Asp
Phe Ala Leu Pro Val Gly Leu Ile 230 235 240 gtg ggt gtg aca gcc ttg
ggt cta cta ata ata gga gtg gtg aac tgt 930 Val Gly Val Thr Ala Leu
Gly Leu Leu Ile Ile Gly Val Val Asn Cys 245 250 255 gtc atc atg acc
cag gtg aaa aag aag ccc ttg tgc ctg cag aga gaa 978 Val Ile Met Thr
Gln Val Lys Lys Lys Pro Leu Cys Leu Gln Arg Glu 260 265 270 275 gcc
aag gtg cct cac ttg cct gcc gat aag gcc cgg ggt aca cag ggc 1026
Ala Lys Val Pro His Leu Pro Ala Asp Lys Ala Arg Gly Thr Gln Gly 280
285 290 ccc gag cag cag cac ctg ctg atc aca gcg ccg agc tcc agc agc
agc 1074 Pro Glu Gln Gln His Leu Leu Ile Thr Ala Pro Ser Ser Ser
Ser Ser 295 300 305 tcc ctg gag agc tcg gcc agt gcg ttg gac aga agg
gcg ccc act cgg 1122 Ser Leu Glu Ser Ser Ala Ser Ala Leu Asp Arg
Arg Ala Pro Thr Arg 310 315 320 aac cag cca cag gca cca ggc gtg gag
gcc agt ggg gcc ggg gag gcc 1170 Asn Gln Pro Gln Ala Pro Gly Val
Glu Ala Ser Gly Ala Gly Glu Ala 325 330 335 cgg gcc agc acc ggg agc
tca gat tct tcc cct ggt ggc cat ggg acc 1218 Arg Ala Ser Thr Gly
Ser Ser Asp Ser Ser Pro Gly Gly His Gly Thr 340 345 350 355 cag gtc
aat gtc acc tgc atc gtg aac gtc tgt agc agc tct gac cac 1266 Gln
Val Asn Val Thr Cys Ile Val Asn Val Cys Ser Ser Ser Asp His 360 365
370 agc tca cag tgc tcc tcc caa gcc agc tcc aca atg gga gac aca gat
1314 Ser Ser Gln Cys Ser Ser Gln Ala Ser Ser Thr Met Gly Asp Thr
Asp 375 380 385 tcc agc ccc tcg gag tcc ccg aag gac gag cag gtc ccc
ttc tcc aag 1362 Ser Ser Pro Ser Glu Ser Pro Lys Asp Glu Gln Val
Pro Phe Ser Lys 390 395 400 gag gaa tgt gcc ttt cgg tca cag ctg gag
acg cca gag acc ctg ctg 1410 Glu Glu Cys Ala Phe Arg Ser Gln Leu
Glu Thr Pro Glu Thr Leu Leu 405 410 415 ggg agc acc gaa gag aag ccc
ctg ccc ctt gga gtg cct gat gct ggg 1458 Gly Ser Thr Glu Glu Lys
Pro Leu Pro Leu Gly Val Pro Asp Ala Gly 420 425 430 435 atg aag ccc
agt taaccaggcc ggtgtgggct gtgtcgtagc caaggtgggc 1510 Met Lys Pro
Ser tgagccctgg caggatgacc ctgcgaaggg gccctggtcc ttccaggccc
ccaccactag 1570 gactctgagg ctctttctgg gccaagttcc tctagtgccc
tccacagccg cagcctccct 1630 ctgacctgca g 1641 2 461 PRT Homo sapiens
2 Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu
-20 -15 -10 Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr
Pro Tyr -5 -1 1 5 10 Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg
Glu Tyr Tyr Asp Gln 15 20 25 Thr Ala Gln Met Cys Cys Ser Lys Cys
Ser Pro Gly Gln His Ala Lys 30 35 40 Val Phe Cys Thr Lys Thr Ser
Asp Thr Val Cys Asp Ser Cys Glu Asp 45 50 55 Ser Thr Tyr Thr Gln
Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys 60 65 70 Gly Ser Arg
Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 75 80 85 90 Glu
Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 95 100
105 Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg
110 115 120 Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp
Val Val 125 130 135 Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr
Thr Ser Ser Thr 140 145 150 Asp Ile Cys Arg Pro His Gln Ile Cys Asn
Val Val Ala Ile Pro Gly 155 160 165 170 Asn Ala Ser Met Asp Ala Val
Cys Thr Ser Thr Ser Pro Thr Arg Ser 175 180 185 Met Ala Pro Gly Ala
Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 190 195 200 Gln His Thr
Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser 205 210 215 Phe
Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 220 225
230 Asp Phe Ala Leu Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly
235 240 245 250 Leu Leu Ile Ile Gly Val Val Asn Cys Val Ile Met Thr
Gln Val Lys 255 260 265 Lys Lys Pro Leu Cys Leu Gln Arg Glu Ala Lys
Val Pro His Leu Pro 270 275 280 Ala Asp Lys Ala Arg Gly Thr Gln Gly
Pro Glu Gln Gln His Leu Leu 285 290 295 Ile Thr Ala Pro Ser Ser Ser
Ser Ser Ser Leu Glu Ser Ser Ala Ser 300 305 310 Ala Leu Asp Arg Arg
Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly 315 320 325 330 Val Glu
Ala Ser Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser 335 340 345
Asp Ser Ser Pro Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile 350
355 360 Val Asn Val Cys Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser
Gln 365 370 375 Ala Ser Ser Thr Met Gly Asp Thr Asp Ser Ser Pro Ser
Glu Ser Pro 380 385 390 Lys Asp Glu Gln Val Pro Phe Ser Lys Glu Glu
Cys Ala Phe Arg Ser 395 400 405 410 Gln Leu Glu Thr Pro Glu Thr Leu
Leu Gly Ser Thr Glu Glu Lys Pro 415 420 425 Leu Pro Leu Gly Val Pro
Asp Ala Gly Met Lys Pro Ser 430 435 3 1368 DNA Homo sapiens CDS
(1)..(1365) 3 atg ggc ctc tcc acc gtg cct gac ctg ctg ctg ccg ctg
gtg ctc ctg 48 Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu
Val Leu Leu -40 -35 -30 -25 gag ctg ttg gtg gga ata tac ccc tca ggg
gtt att gga ctg gtc cct 96 Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly
Val Ile Gly Leu Val Pro -20 -15 -10 cac cta ggg gac agg gag aag aga
gat agt gtg tgt ccc caa gga aaa 144 His Leu Gly Asp Arg Glu Lys Arg
Asp Ser Val Cys Pro Gln Gly Lys -5 -1 1 5 tat atc cac cct caa aat
aat tcg att tgc tgt acc aag tgc cac aaa 192 Tyr Ile His Pro Gln Asn
Asn Ser Ile Cys Cys Thr Lys Cys His Lys 10 15 20 gga acc tac ttg
tac aat gac tgt cca ggc ccg ggg cag gat acg gac 240 Gly Thr Tyr Leu
Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp 25 30 35 40 tgc agg
gag tgt gag agc ggc tcc ttc acc gct tca gaa aac cac ctc 288 Cys Arg
Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu 45 50 55
aga cac tgc ctc agc tgc tcc aaa tgc cga aag gaa atg ggt cag gtg 336
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val 60
65 70 gag atc tct tct tgc aca gtg gac cgg gac acc gtg tgt ggc tgc
agg 384 Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys
Arg 75 80 85 aag aac cag tac cgg cat tat tgg agt gaa aac ctt ttc
cag tgc ttc 432 Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe
Gln Cys Phe 90 95 100 aat tgc agc ctc tgc ctc aat ggg acc gtg cac
ctc tcc tgc cag gag 480 Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His
Leu Ser Cys Gln Glu 105 110 115 120 aaa cag aac acc gtg tgc acc tgc
cat gca ggt ttc ttt cta aga gaa 528 Lys Gln Asn Thr Val Cys Thr Cys
His Ala Gly Phe Phe Leu Arg Glu 125 130 135 aac gag tgt gtc tcc tgt
agt aac tgt aag aaa agc ctg gag tgc acg 576 Asn Glu Cys Val Ser Cys
Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr 140 145 150 aag ttg tgc cta
ccc cag att gag aat gtt aag ggc act gag gac tca 624 Lys Leu Cys Leu
Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser 155 160 165 ggc acc
aca gtg ctg ttg ccc ctg gtc att ttc ttt ggt ctt tgc ctt 672 Gly Thr
Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu 170 175 180
tta tcc ctc ctc ttc att ggt tta agt tat cgc tac caa cgg tgg aag 720
Leu Ser Leu Leu Phe Ile Gly Leu Ser Tyr Arg Tyr Gln Arg Trp Lys 185
190 195 200 tcc aag ctc tac tcc att gtt tgt ggg aaa tcg aca cct gaa
aaa gag 768 Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu
Lys Glu 205 210 215 ggg gag ctt gaa gga act act act aag ccc ctg gcc
cca aac cca agc 816 Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala
Pro Asn Pro Ser 220 225 230 ttc agt ccc act cca ggc ttc acc ccc acc
ctg ggc ttc agt ccc gtg 864 Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr
Leu Gly Phe Ser Pro Val 235 240 245 ccc agt tcc acc ttc acc tcc agc
tcc acc tat acc ccc ggt gac tgt 912 Pro Ser Ser Thr Phe Thr Ser Ser
Ser Thr Tyr Thr Pro Gly Asp Cys 250 255 260 ccc aac ttt gcg gct ccc
cgc aga gag gtg gca cca ccc tat cag ggg 960 Pro Asn Phe Ala Ala Pro
Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly 265 270 275 280 gct gac ccc
atc ctt gcg aca gcc ctc gcc tcc gac ccc atc ccc aac 1008 Ala Asp
Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn 285 290 295
ccc ctt cag aag tgg gag gac agc gcc cac aag cca cag agc cta gac
1056 Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu
Asp 300 305 310 act gat gac ccc gcg acg ctg tac gcc gtg gtg gag aac
gtg ccc ccg 1104 Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu
Asn Val Pro Pro 315 320 325 ttg cgc tgg aag gaa ttc gtg cgg cgc cta
ggg ctg agc gac cac gag 1152 Leu Arg Trp Lys Glu Phe Val Arg Arg
Leu Gly Leu Ser Asp His Glu 330 335 340 atc gat cgg ctg gag ctg cag
aac ggg cgc tgc ctg cgc gag gcg caa 1200 Ile Asp Arg Leu Glu Leu
Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln 345 350 355 360 tac agc atg
ctg gcg acc tgg agg cgg cgc acg ccg cgg cgc gag gcc 1248 Tyr Ser
Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala 365 370 375
acg ctg gag ctg ctg gga cgc gtg ctc cgc gac atg gac ctg ctg ggc
1296 Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu
Gly 380 385 390 tgc ctg gag gac atc gag gag gcg ctt tgc ggc ccc gcc
gcc ctc ccg 1344 Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro
Ala Ala Leu Pro 395 400 405 ccc gcg ccc agt ctt ctc aga tga 1368
Pro Ala Pro Ser Leu Leu Arg 410 415 4 455 PRT Homo sapiens 4 Met
Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu -40 -35
-30 -25 Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val
Pro -20 -15 -10 His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro
Gln Gly Lys -5 -1 1 5 Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys
Thr Lys Cys His Lys 10 15 20 Gly Thr Tyr Leu Tyr Asn Asp Cys Pro
Gly Pro Gly Gln Asp Thr Asp 25 30 35 40 Cys Arg Glu Cys Glu Ser Gly
Ser Phe Thr Ala Ser Glu Asn His Leu 45 50 55 Arg His Cys Leu Ser
Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val 60 65 70 Glu Ile Ser
Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg 75 80 85 Lys
Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe 90 95
100 Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu
105 110 115 120 Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe
Leu Arg Glu 125 130 135 Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys
Ser Leu Glu Cys Thr 140 145 150 Lys Leu Cys Leu Pro Gln Ile Glu Asn
Val Lys Gly Thr Glu Asp Ser 155 160 165 Gly Thr Thr Val Leu Leu Pro
Leu Val Ile Phe Phe Gly Leu Cys Leu 170 175 180 Leu Ser Leu Leu Phe
Ile Gly Leu Ser Tyr Arg Tyr Gln Arg Trp Lys 185 190 195 200 Ser Lys
Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu 205 210 215
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser 220
225 230 Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro
Val 235 240 245 Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro
Gly Asp Cys 250 255 260 Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala
Pro Pro Tyr Gln Gly 265 270 275 280 Ala Asp Pro Ile Leu Ala Thr Ala
Leu Ala Ser Asp Pro Ile Pro Asn 285 290 295 Pro Leu Gln Lys Trp Glu
Asp Ser Ala His Lys Pro Gln Ser Leu Asp 300 305 310 Thr Asp Asp Pro
Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro 315 320 325 Leu Arg
Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu 330 335 340
Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln 345
350 355 360 Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg
Glu Ala 365 370 375 Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met
Asp Leu Leu Gly 380 385 390
Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro 395
400 405 Pro Ala Pro Ser Leu Leu Arg 410 415 5 3011 DNA Homo sapiens
CDS (84)..(1790) 5 agacgcaccc tctgaagatg gtggactccc tcctgagaag
ctgggacccc ttggtaaaag 60 acaaggcctt ctccaagaag aat atg aaa gtg tta
ctc aga ctt att tgt ttc 113 Met Lys Val Leu Leu Arg Leu Ile Cys Phe
-20 -15 ata gct cta ctg att tct tct ctg gag gct gat aaa tgc aag gaa
cgt 161 Ile Ala Leu Leu Ile Ser Ser Leu Glu Ala Asp Lys Cys Lys Glu
Arg -10 -5 -1 1 5 gaa gaa aaa ata att tta gtg tca tct gca aat gaa
att gat gtt cgt 209 Glu Glu Lys Ile Ile Leu Val Ser Ser Ala Asn Glu
Ile Asp Val Arg 10 15 20 ccc tgt cct ctt aac cca aat gaa cac aaa
ggc act ata act tgg tat 257 Pro Cys Pro Leu Asn Pro Asn Glu His Lys
Gly Thr Ile Thr Trp Tyr 25 30 35 aaa gat gac agc aag aca cct gta
tct aca gaa caa gcc tcc agg att 305 Lys Asp Asp Ser Lys Thr Pro Val
Ser Thr Glu Gln Ala Ser Arg Ile 40 45 50 cat caa cac aaa gag aaa
ctt tgg ttt gtt cct gct aag gtg gag gat 353 His Gln His Lys Glu Lys
Leu Trp Phe Val Pro Ala Lys Val Glu Asp 55 60 65 70 tca gga cat tac
tat tgc gtg gta aga aat tca tct tac tgc ctc aga 401 Ser Gly His Tyr
Tyr Cys Val Val Arg Asn Ser Ser Tyr Cys Leu Arg 75 80 85 att aaa
ata agt gca aaa ttt gtg gag aat gag cct aac tta tgt tat 449 Ile Lys
Ile Ser Ala Lys Phe Val Glu Asn Glu Pro Asn Leu Cys Tyr 90 95 100
aat gca caa gcc ata ttt aag cag aaa cta ccc gtt gca gga gac gga 497
Asn Ala Gln Ala Ile Phe Lys Gln Lys Leu Pro Val Ala Gly Asp Gly 105
110 115 gga ctt gtg tgc cct tat atg gag ttt ttt aaa aat gaa aat aat
gag 545 Gly Leu Val Cys Pro Tyr Met Glu Phe Phe Lys Asn Glu Asn Asn
Glu 120 125 130 tta cct aaa tta cag tgg tat aag gat tgc aaa cct cta
ctt ctt gac 593 Leu Pro Lys Leu Gln Trp Tyr Lys Asp Cys Lys Pro Leu
Leu Leu Asp 135 140 145 150 aat ata cac ttt agt gga gtc aaa gat agg
ctc atc gtg atg aat gtg 641 Asn Ile His Phe Ser Gly Val Lys Asp Arg
Leu Ile Val Met Asn Val 155 160 165 gct gaa aag cat aga ggg aac tat
act tgt cat gca tcc tac aca tac 689 Ala Glu Lys His Arg Gly Asn Tyr
Thr Cys His Ala Ser Tyr Thr Tyr 170 175 180 ttg ggc aag caa tat cct
att acc cgg gta ata gaa ttt att act cta 737 Leu Gly Lys Gln Tyr Pro
Ile Thr Arg Val Ile Glu Phe Ile Thr Leu 185 190 195 gag gaa aac aaa
ccc aca agg cct gtg att gtg agc cca gct aat gag 785 Glu Glu Asn Lys
Pro Thr Arg Pro Val Ile Val Ser Pro Ala Asn Glu 200 205 210 aca atg
gaa gta gac ttg gga tcc cag ata caa ttg atc tgt aat gtc 833 Thr Met
Glu Val Asp Leu Gly Ser Gln Ile Gln Leu Ile Cys Asn Val 215 220 225
230 acc ggc cag ttg agt gac att gct tac tgg aag tgg aat ggg tca gta
881 Thr Gly Gln Leu Ser Asp Ile Ala Tyr Trp Lys Trp Asn Gly Ser Val
235 240 245 att gat gaa gat gac cca gtg cta ggg gaa gac tat tac agt
gtg gaa 929 Ile Asp Glu Asp Asp Pro Val Leu Gly Glu Asp Tyr Tyr Ser
Val Glu 250 255 260 aat cct gca aac aaa aga agg agt acc ctc atc aca
gtg ctt aat ata 977 Asn Pro Ala Asn Lys Arg Arg Ser Thr Leu Ile Thr
Val Leu Asn Ile 265 270 275 tcg gaa att gaa agt aga ttt tat aaa cat
cca ttt acc tgt ttt gcc 1025 Ser Glu Ile Glu Ser Arg Phe Tyr Lys
His Pro Phe Thr Cys Phe Ala 280 285 290 aag aat aca cat ggt ata gat
gca gca tat atc cag tta ata tat cca 1073 Lys Asn Thr His Gly Ile
Asp Ala Ala Tyr Ile Gln Leu Ile Tyr Pro 295 300 305 310 gtc act aat
ttc cag aag cac atg att ggt ata tgt gtc acg ttg aca 1121 Val Thr
Asn Phe Gln Lys His Met Ile Gly Ile Cys Val Thr Leu Thr 315 320 325
gtc ata att gtg tgt tct gtt ttc atc tat aaa atc ttc aag att gac
1169 Val Ile Ile Val Cys Ser Val Phe Ile Tyr Lys Ile Phe Lys Ile
Asp 330 335 340 att gtg ctt tgg tac agg gat tcc tgc tat gat ttt ctc
cca ata aaa 1217 Ile Val Leu Trp Tyr Arg Asp Ser Cys Tyr Asp Phe
Leu Pro Ile Lys 345 350 355 gct tca gat gga aag acc tat gac gca tat
ata ctg tat cca aag act 1265 Ala Ser Asp Gly Lys Thr Tyr Asp Ala
Tyr Ile Leu Tyr Pro Lys Thr 360 365 370 gtt ggg gaa ggg tct acc tct
gac tgt gat att ttt gtg ttt aaa gtc 1313 Val Gly Glu Gly Ser Thr
Ser Asp Cys Asp Ile Phe Val Phe Lys Val 375 380 385 390 ttg cct gag
gtc ttg gaa aaa cag tgt gga tat aag ctg ttc att tat 1361 Leu Pro
Glu Val Leu Glu Lys Gln Cys Gly Tyr Lys Leu Phe Ile Tyr 395 400 405
gga agg gat gac tac gtt ggg gaa gac att gtt gag gtc att aat gaa
1409 Gly Arg Asp Asp Tyr Val Gly Glu Asp Ile Val Glu Val Ile Asn
Glu 410 415 420 aac gta aag aaa agc aga aga ctg att atc att tta gtc
aga gaa aca 1457 Asn Val Lys Lys Ser Arg Arg Leu Ile Ile Ile Leu
Val Arg Glu Thr 425 430 435 tca ggc ttc agc tgg ctg ggt ggt tca tct
gaa gag caa ata gcc atg 1505 Ser Gly Phe Ser Trp Leu Gly Gly Ser
Ser Glu Glu Gln Ile Ala Met 440 445 450 tat aat gct ctt gtt cag gat
gga att aaa gtt gtc ctg ctt gag ctg 1553 Tyr Asn Ala Leu Val Gln
Asp Gly Ile Lys Val Val Leu Leu Glu Leu 455 460 465 470 gag aaa atc
caa gac tat gag aaa atg cca gaa tcg att aaa ttc att 1601 Glu Lys
Ile Gln Asp Tyr Glu Lys Met Pro Glu Ser Ile Lys Phe Ile 475 480 485
aag cag aaa cat ggg gct atc cgc tgg tca ggg gac ttt aca cag gga
1649 Lys Gln Lys His Gly Ala Ile Arg Trp Ser Gly Asp Phe Thr Gln
Gly 490 495 500 cca cag tct gca aag aca agg ttc tgg aag aat gtc agg
tac cac atg 1697 Pro Gln Ser Ala Lys Thr Arg Phe Trp Lys Asn Val
Arg Tyr His Met 505 510 515 cca gtc cag cga cgg tca cct tca tct aaa
cac cag tta ctg tca cca 1745 Pro Val Gln Arg Arg Ser Pro Ser Ser
Lys His Gln Leu Leu Ser Pro 520 525 530 gcc act aag gag aaa ctg caa
aga gag gct cac gtg cct ctc ggg 1790 Ala Thr Lys Glu Lys Leu Gln
Arg Glu Ala His Val Pro Leu Gly 535 540 545 tagcatggag aagttgccaa
gagttcttta ggtgcctcct gtcttatggc gttgcaggcc 1850 aggttatgcc
tcatgctgac ttgcagagtt catggaatgt aactatatca tcctttatcc 1910
ctgaggtcac ctggaatcag attattaagg gaataagcca tgacgtcaat agcagcccag
1970 ggcacttcag agtagagggc ttgggaagat cttttaaaaa ggcagtaggc
ccggtgtggt 2030 ggctcacgcc tataatccca gcactttggg aggctgaagt
gggtggatca ccagaggtca 2090 ggagttcgag accagcccag ccaacatggc
aaaaccccat ctctactaaa aatacaaaaa 2150 tgagctaggc atggtggcac
acgcctgtaa tcccagctac acctgaggct gaggcaggag 2210 aattgcttga
accggggaga cggaggttgc agtgagccga gtttgggcca ctgcactcta 2270
gcctggcaac agagcaagac tccgtctcaa aaaaagggca ataaatgccc tctctgaatg
2330 tttgaactgc caagaaaagg catggagaca gcgaactaga agaaagggca
agaaggaaat 2390 agccaccgtc tacagatggc ttagttaagt catccacagc
ccaagggcgg cggctatgcc 2450 ttgtctgggg accctgtaga gtcactgacc
ctggagcggc tctcctgaga ggtgctgcag 2510 gcaaagtgag actgacacct
cactgaggaa gggagacata ttcttggaga actttccatc 2570 tgcttgtatt
ttccatacac atccccagcc agaagttagt gtccgaagaa gagcttgaaa 2630
actcacttca atgaacaaag ggattctcca ggattccaaa gttttgaagt catcttagct
2690 ttccacagga gggagagaac ttaaaaaagc aacagtagca gggaattgat
ccacttctta 2750 atgctttcct ccctggcatg accatcctgt cctttgttat
tatcctgcat tttacgtctt 2810 tggaggaaca gctccctagt ggcttcctcc
gtctgcaatg tcccttgcac agcccacaca 2870 tgaaccatcc ttcccatgat
gccgctcttc tgtcatcccg ctcctgctga aacacctccc 2930 aggggctcca
cctgttcagg agctgaagcc catgctttcc caccagcatg tcactcccag 2990
accacctccc tgccctgtcc t 3011 6 569 PRT Homo sapiens 6 Met Lys Val
Leu Leu Arg Leu Ile Cys Phe Ile Ala Leu Leu Ile Ser -20 -15 -10 -5
Ser Leu Glu Ala Asp Lys Cys Lys Glu Arg Glu Glu Lys Ile Ile Leu -1
1 5 10 Val Ser Ser Ala Asn Glu Ile Asp Val Arg Pro Cys Pro Leu Asn
Pro 15 20 25 Asn Glu His Lys Gly Thr Ile Thr Trp Tyr Lys Asp Asp
Ser Lys Thr 30 35 40 Pro Val Ser Thr Glu Gln Ala Ser Arg Ile His
Gln His Lys Glu Lys 45 50 55 60 Leu Trp Phe Val Pro Ala Lys Val Glu
Asp Ser Gly His Tyr Tyr Cys 65 70 75 Val Val Arg Asn Ser Ser Tyr
Cys Leu Arg Ile Lys Ile Ser Ala Lys 80 85 90 Phe Val Glu Asn Glu
Pro Asn Leu Cys Tyr Asn Ala Gln Ala Ile Phe 95 100 105 Lys Gln Lys
Leu Pro Val Ala Gly Asp Gly Gly Leu Val Cys Pro Tyr 110 115 120 Met
Glu Phe Phe Lys Asn Glu Asn Asn Glu Leu Pro Lys Leu Gln Trp 125 130
135 140 Tyr Lys Asp Cys Lys Pro Leu Leu Leu Asp Asn Ile His Phe Ser
Gly 145 150 155 Val Lys Asp Arg Leu Ile Val Met Asn Val Ala Glu Lys
His Arg Gly 160 165 170 Asn Tyr Thr Cys His Ala Ser Tyr Thr Tyr Leu
Gly Lys Gln Tyr Pro 175 180 185 Ile Thr Arg Val Ile Glu Phe Ile Thr
Leu Glu Glu Asn Lys Pro Thr 190 195 200 Arg Pro Val Ile Val Ser Pro
Ala Asn Glu Thr Met Glu Val Asp Leu 205 210 215 220 Gly Ser Gln Ile
Gln Leu Ile Cys Asn Val Thr Gly Gln Leu Ser Asp 225 230 235 Ile Ala
Tyr Trp Lys Trp Asn Gly Ser Val Ile Asp Glu Asp Asp Pro 240 245 250
Val Leu Gly Glu Asp Tyr Tyr Ser Val Glu Asn Pro Ala Asn Lys Arg 255
260 265 Arg Ser Thr Leu Ile Thr Val Leu Asn Ile Ser Glu Ile Glu Ser
Arg 270 275 280 Phe Tyr Lys His Pro Phe Thr Cys Phe Ala Lys Asn Thr
His Gly Ile 285 290 295 300 Asp Ala Ala Tyr Ile Gln Leu Ile Tyr Pro
Val Thr Asn Phe Gln Lys 305 310 315 His Met Ile Gly Ile Cys Val Thr
Leu Thr Val Ile Ile Val Cys Ser 320 325 330 Val Phe Ile Tyr Lys Ile
Phe Lys Ile Asp Ile Val Leu Trp Tyr Arg 335 340 345 Asp Ser Cys Tyr
Asp Phe Leu Pro Ile Lys Ala Ser Asp Gly Lys Thr 350 355 360 Tyr Asp
Ala Tyr Ile Leu Tyr Pro Lys Thr Val Gly Glu Gly Ser Thr 365 370 375
380 Ser Asp Cys Asp Ile Phe Val Phe Lys Val Leu Pro Glu Val Leu Glu
385 390 395 Lys Gln Cys Gly Tyr Lys Leu Phe Ile Tyr Gly Arg Asp Asp
Tyr Val 400 405 410 Gly Glu Asp Ile Val Glu Val Ile Asn Glu Asn Val
Lys Lys Ser Arg 415 420 425 Arg Leu Ile Ile Ile Leu Val Arg Glu Thr
Ser Gly Phe Ser Trp Leu 430 435 440 Gly Gly Ser Ser Glu Glu Gln Ile
Ala Met Tyr Asn Ala Leu Val Gln 445 450 455 460 Asp Gly Ile Lys Val
Val Leu Leu Glu Leu Glu Lys Ile Gln Asp Tyr 465 470 475 Glu Lys Met
Pro Glu Ser Ile Lys Phe Ile Lys Gln Lys His Gly Ala 480 485 490 Ile
Arg Trp Ser Gly Asp Phe Thr Gln Gly Pro Gln Ser Ala Lys Thr 495 500
505 Arg Phe Trp Lys Asn Val Arg Tyr His Met Pro Val Gln Arg Arg Ser
510 515 520 Pro Ser Ser Lys His Gln Leu Leu Ser Pro Ala Thr Lys Glu
Lys Leu 525 530 535 540 Gln Arg Glu Ala His Val Pro Leu Gly 545 7
1357 DNA Homo sapiens CDS (154)..(1347) 7 ctggaaaata cattctgcta
ctcttaaaaa ctagtgacgc tcatacaaat caacagaaag 60 agcttctgaa
ggaagacttt aaagctgctt ctgccacgtg ctgctgggtc tcagtcctcc 120
acttcccgtg tcctctggaa gttgtcagga gca atg ttg cgc ttg tac gtg ttg
174 Met Leu Arg Leu Tyr Val Leu -10 gta atg gga gtt tct gcc ttc acc
ctt cag cct gcg gca cac aca ggg 222 Val Met Gly Val Ser Ala Phe Thr
Leu Gln Pro Ala Ala His Thr Gly -5 -1 1 5 10 gct gcc aga agc tgc
cgg ttt cgt ggg agg cat tac aag cgg gag ttc 270 Ala Ala Arg Ser Cys
Arg Phe Arg Gly Arg His Tyr Lys Arg Glu Phe 15 20 25 agg ctg gaa
ggg gag cct gta gcc ctg agg tgc ccc cag gtg ccc tac 318 Arg Leu Glu
Gly Glu Pro Val Ala Leu Arg Cys Pro Gln Val Pro Tyr 30 35 40 tgg
ttg tgg gcc tct gtc agc ccc cgc atc aac ctg aca tgg cat aaa 366 Trp
Leu Trp Ala Ser Val Ser Pro Arg Ile Asn Leu Thr Trp His Lys 45 50
55 aat gac tct gct agg acg gtc cca gga gaa gaa gag aca ggg atg tgg
414 Asn Asp Ser Ala Arg Thr Val Pro Gly Glu Glu Glu Thr Gly Met Trp
60 65 70 gcc cag gac ggt gct ctg tgg ctt ctg cca gcc ttg cag gag
gac tct 462 Ala Gln Asp Gly Ala Leu Trp Leu Leu Pro Ala Leu Gln Glu
Asp Ser 75 80 85 90 ggc acc tac gtc tgc act act aga aat gct tct tac
tgt gac aaa atg 510 Gly Thr Tyr Val Cys Thr Thr Arg Asn Ala Ser Tyr
Cys Asp Lys Met 95 100 105 tcc att gag ctc aga gtt ttt gag aat aca
gat gct ttc ctg ccg ttc 558 Ser Ile Glu Leu Arg Val Phe Glu Asn Thr
Asp Ala Phe Leu Pro Phe 110 115 120 atc tca tac ccg caa att tta acc
ttg tca acc tct ggg gta tta gta 606 Ile Ser Tyr Pro Gln Ile Leu Thr
Leu Ser Thr Ser Gly Val Leu Val 125 130 135 tgc cct gac ctg agt gaa
ttc acc cgt gac aaa act gac gtg aag att 654 Cys Pro Asp Leu Ser Glu
Phe Thr Arg Asp Lys Thr Asp Val Lys Ile 140 145 150 caa tgg tac aag
gat tct ctt ctt ttg gat aaa gac aat gag aaa ttt 702 Gln Trp Tyr Lys
Asp Ser Leu Leu Leu Asp Lys Asp Asn Glu Lys Phe 155 160 165 170 cta
agt gtg agg ggg acc act cac tta ctc gta cac gat gtg gcc ctg 750 Leu
Ser Val Arg Gly Thr Thr His Leu Leu Val His Asp Val Ala Leu 175 180
185 gaa gat gct ggc tat tac cgc tgt gtc ctg aca ttt gcc cat gaa ggc
798 Glu Asp Ala Gly Tyr Tyr Arg Cys Val Leu Thr Phe Ala His Glu Gly
190 195 200 cag caa tac aac atc act agg agt att gag cta cgc atc aag
aaa aaa 846 Gln Gln Tyr Asn Ile Thr Arg Ser Ile Glu Leu Arg Ile Lys
Lys Lys 205 210 215 aaa gaa gag acc att cct gtg atc att tcc ccc ctc
aag acc ata tca 894 Lys Glu Glu Thr Ile Pro Val Ile Ile Ser Pro Leu
Lys Thr Ile Ser 220 225 230 gct tct ctg ggg tca aga ctg aca atc ccg
tgt aag gtg ttt ctg gga 942 Ala Ser Leu Gly Ser Arg Leu Thr Ile Pro
Cys Lys Val Phe Leu Gly 235 240 245 250 acc ggc aca ccc tta acc acc
atg ctg tgg tgg acg gcc aat gac acc 990 Thr Gly Thr Pro Leu Thr Thr
Met Leu Trp Trp Thr Ala Asn Asp Thr 255 260 265 cac ata gag agc gcc
tac ccg gga ggc cgc gtg acc gag ggg cca cgc 1038 His Ile Glu Ser
Ala Tyr Pro Gly Gly Arg Val Thr Glu Gly Pro Arg 270 275 280 cag gaa
tat tca gaa aat aat gag aac tac att gaa gtg cca ttg att 1086 Gln
Glu Tyr Ser Glu Asn Asn Glu Asn Tyr Ile Glu Val Pro Leu Ile 285 290
295 ttt gat cct gtc aca aga gag gat ttg cac atg gat ttt aaa tgt gtt
1134 Phe Asp Pro Val Thr Arg Glu Asp Leu His Met Asp Phe Lys Cys
Val 300 305 310 gtc cat aat acc ctg agt ttt cag aca cta cgc acc aca
gtc aag gaa 1182 Val His Asn Thr Leu Ser Phe Gln Thr Leu Arg Thr
Thr Val Lys Glu 315 320 325 330 gcc tcc tcc acg ttc tcc tgg ggc att
gtg ctg gcc cca ctt tca ctg 1230 Ala Ser Ser Thr Phe Ser Trp Gly
Ile Val Leu Ala Pro Leu Ser Leu 335 340 345 gcc ttc ttg gtt ttg ggg
gga ata tgg atg cac aga cgg tgc aaa cac 1278 Ala Phe Leu Val Leu
Gly Gly Ile Trp Met His Arg Arg Cys Lys His 350 355 360 aga act gga
aaa gca gat ggt ctg act gtg cta tgg cct cat cat caa 1326 Arg Thr
Gly Lys Ala Asp Gly Leu Thr Val Leu Trp Pro His His Gln 365 370 375
gac ttt caa tcc tat ccc aag tgaaataaat 1357 Asp Phe Gln Ser Tyr Pro
Lys 380 385 8 398 PRT Homo sapiens 8 Met Leu Arg Leu Tyr Val Leu
Val Met Gly Val Ser Ala Phe Thr Leu -10 -5 -1 1 Gln Pro Ala Ala His
Thr Gly Ala Ala Arg Ser Cys Arg Phe Arg Gly
5 10 15 Arg His Tyr Lys Arg Glu Phe Arg Leu Glu Gly Glu Pro Val Ala
Leu 20 25 30 35 Arg Cys Pro Gln Val Pro Tyr Trp Leu Trp Ala Ser Val
Ser Pro Arg 40 45 50 Ile Asn Leu Thr Trp His Lys Asn Asp Ser Ala
Arg Thr Val Pro Gly 55 60 65 Glu Glu Glu Thr Gly Met Trp Ala Gln
Asp Gly Ala Leu Trp Leu Leu 70 75 80 Pro Ala Leu Gln Glu Asp Ser
Gly Thr Tyr Val Cys Thr Thr Arg Asn 85 90 95 Ala Ser Tyr Cys Asp
Lys Met Ser Ile Glu Leu Arg Val Phe Glu Asn 100 105 110 115 Thr Asp
Ala Phe Leu Pro Phe Ile Ser Tyr Pro Gln Ile Leu Thr Leu 120 125 130
Ser Thr Ser Gly Val Leu Val Cys Pro Asp Leu Ser Glu Phe Thr Arg 135
140 145 Asp Lys Thr Asp Val Lys Ile Gln Trp Tyr Lys Asp Ser Leu Leu
Leu 150 155 160 Asp Lys Asp Asn Glu Lys Phe Leu Ser Val Arg Gly Thr
Thr His Leu 165 170 175 Leu Val His Asp Val Ala Leu Glu Asp Ala Gly
Tyr Tyr Arg Cys Val 180 185 190 195 Leu Thr Phe Ala His Glu Gly Gln
Gln Tyr Asn Ile Thr Arg Ser Ile 200 205 210 Glu Leu Arg Ile Lys Lys
Lys Lys Glu Glu Thr Ile Pro Val Ile Ile 215 220 225 Ser Pro Leu Lys
Thr Ile Ser Ala Ser Leu Gly Ser Arg Leu Thr Ile 230 235 240 Pro Cys
Lys Val Phe Leu Gly Thr Gly Thr Pro Leu Thr Thr Met Leu 245 250 255
Trp Trp Thr Ala Asn Asp Thr His Ile Glu Ser Ala Tyr Pro Gly Gly 260
265 270 275 Arg Val Thr Glu Gly Pro Arg Gln Glu Tyr Ser Glu Asn Asn
Glu Asn 280 285 290 Tyr Ile Glu Val Pro Leu Ile Phe Asp Pro Val Thr
Arg Glu Asp Leu 295 300 305 His Met Asp Phe Lys Cys Val Val His Asn
Thr Leu Ser Phe Gln Thr 310 315 320 Leu Arg Thr Thr Val Lys Glu Ala
Ser Ser Thr Phe Ser Trp Gly Ile 325 330 335 Val Leu Ala Pro Leu Ser
Leu Ala Phe Leu Val Leu Gly Gly Ile Trp 340 345 350 355 Met His Arg
Arg Cys Lys His Arg Thr Gly Lys Ala Asp Gly Leu Thr 360 365 370 Val
Leu Trp Pro His His Gln Asp Phe Gln Ser Tyr Pro Lys 375 380 385 9
30 DNA Artificial Sequence Miscellaneous Structure 9 ctgaagggag
cactggcgac taaggatcca 30 10 45 DNA Artificial Sequence
Miscellaneous Structure 10 gatctgtaac gtggtggcca tccctgggaa
tgcaagcatg gatgc 45 11 33 DNA Artificial Sequence Miscellaneous
Structure 11 agtctgcacg tccacgtccc ccacccggtg agc 33 12 12 DNA
Artificial Sequence Miscellaneous Structure 12 gatctgttga gc 12 13
36 DNA Artificial Sequence Miscellaneous Structure 13 ctgaaacatc
agacgtggtg tgcaagccct gttaaa 36 14 29 DNA Artificial Sequence
Miscellaneous Structure 14 gcgtcgacct agtgacgctc atacaaatc 29 15 33
DNA Artificial Sequence Miscellaneous Structure 15 gcgcggccgc
tcaggaggag gcttccttga ctg 33 16 66 DNA Artificial Sequence
Miscellaneous Structure 16 ct gaa ggg agc act ggc gac ggt ggc ggt
gga tcc ggc ggt ggc ggc 47 Glu Gly Ser Thr Gly Asp Gly Gly Gly Gly
Ser Gly Gly Gly Gly 1 5 10 15 ggc tca ttg ccc gcc cag g 66 Gly Ser
Leu Pro Ala Gln 20 17 21 PRT Artificial Sequence Miscellaneous
Structure 17 Glu Gly Ser Thr Gly Asp Gly Gly Gly Gly Ser Gly Gly
Gly Gly Gly 1 5 10 15 Ser Leu Pro Ala Gln 20 18 17 DNA Artificial
Sequence Miscellaneous Structure 18 accgagggac ctgagcg 17 19 53 DNA
Artificial Sequence Miscellaneous Structure 19 tgagccgccg
ccaccgccgg atccaccgcc accagtgact ggatatatta act 53 20 51 DNA
Artificial Sequence Miscellaneous Structure 20 ggtggcggtg
gatccggcgg tggcggcggc tcattgcccg cccaggtggc a 51 21 18 DNA
Artificial Sequence Miscellaneous Structure 21 gcttgctcag cgcgcagt
18 22 5 PRT Artificial Sequence Miscellaneous Structure 22 Gly Gly
Gly Gly Ser 1 5 23 11 PRT Artificial Sequence Miscellaneous
Structure 23 Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Ser 1 5 10 24
22 PRT Artificial Sequence Miscellaneous Structure 24 Gly Gly Gly
Gly Ser Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 Gly
Gly Gly Gly Gly Ser 20 25 6 PRT Artificial Sequence Miscellaneous
Structure 25 Asp Ser Val Cys Pro Gln 1 5 26 6 PRT Artificial
Sequence Miscellaneous Structure 26 Leu Pro Ala Gln Val Ala 1 5 27
5 PRT Artificial Sequence Miscellaneous Structure 27 Val Ala Phe
Thr Pro 1 5 28 8 PRT Artificial Sequence Miscellaneous Structure 28
Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 29 10 PRT Artificial Sequence
Miscellaneous Structure 29 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10
* * * * *