U.S. patent application number 10/189123 was filed with the patent office on 2003-05-01 for antibodies having diagnostic, preventive, therapeutic, and other uses.
This patent application is currently assigned to MILLENNIUM PHARMACEUTICALS, INC.. Invention is credited to Barnes, Thomas S., Fraser, Christopher C., Holtzman, Douglas A., Kirst, Susan J., Sharp, John D..
Application Number | 20030082586 10/189123 |
Document ID | / |
Family ID | 26992974 |
Filed Date | 2003-05-01 |
United States Patent
Application |
20030082586 |
Kind Code |
A1 |
Kirst, Susan J. ; et
al. |
May 1, 2003 |
Antibodies having diagnostic, preventive, therapeutic, and other
uses
Abstract
The invention provides isolated nucleic acids encoding a variety
of proteins and nucleic acids having diagnostic, preventive,
therapeutic, and other uses. These nucleic acids and proteins are
useful for diagnosis, prevention, and therapy of a number of human
and other animal disorders. The invention also provides antisense
nucleic acid molecules, expression vectors containing the nucleic
acid molecules of the invention, host cells into which the
expression vectors have been introduced, and non-human transgenic
animals in which a nucleic acid molecule of the invention has been
introduced or disrupted. The invention still further provides
isolated polypeptides, fusion polypeptides, antigenic peptides and
antibodies. Diagnostic, screening, and therapeutic methods
utilizing compositions of the invention are also provided. The
nucleic acids and polypeptides of the present invention are useful
as modulating agents in regulating a variety of cellular
processes.
Inventors: |
Kirst, Susan J.; (Brookline,
MA) ; Holtzman, Douglas A.; (Jamaica Plain, MA)
; Fraser, Christopher C.; (Lexington, MA) ; Sharp,
John D.; (Arlington, MA) ; Barnes, Thomas S.;
(Boston, MA) |
Correspondence
Address: |
AKIN, GUMP, STRAUSS, HAUER & FELD, L.L.P.
ONE COMMERCE SQUARE, SUITE 2200
2005 MARKET STREET
PHILADELPHIA
PA
19103
US
|
Assignee: |
MILLENNIUM PHARMACEUTICALS,
INC.
Cambridge
MA
|
Family ID: |
26992974 |
Appl. No.: |
10/189123 |
Filed: |
July 2, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10189123 |
Jul 2, 2002 |
|
|
|
09596194 |
Jun 16, 2000 |
|
|
|
09596194 |
Jun 16, 2000 |
|
|
|
09342364 |
Jun 29, 1999 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/183; 435/320.1; 435/325; 435/69.1; 435/7.1; 530/388.26;
536/23.2 |
Current CPC
Class: |
A01K 2217/05 20130101;
C07K 14/47 20130101; A61K 38/00 20130101; G01N 33/5058 20130101;
C07K 16/18 20130101; C07K 16/28 20130101 |
Class at
Publication: |
435/6 ; 435/7.1;
435/183; 435/320.1; 435/325; 435/69.1; 530/388.26; 536/23.2 |
International
Class: |
C12Q 001/68; G01N
033/53; C12N 009/00; C12P 021/02; C12N 005/06; C07K 016/40 |
Claims
What is claimed is:
1. An antibody substance which selectively binds with a polypeptide
selected from the group consisting of: a) a fragment of a
polypeptide having the amino acid sequence of any of SEQ ID NO: 61,
SEQ ID NO: 63, and the amino acid sequence encoded by the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151, wherein
the fragment comprises at least 200 contiguous amino acid residues
of any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino acid sequence
encoded by the cDNA clone; b) a naturally occurring variant of a
polypeptide having the amino acid sequence of any of SEQ ID NO: 61,
SEQ ID NO: 63, and the amino acid sequence encoded by the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151, wherein
the variant is encoded by a nucleic acid molecule which hybridizes
under stringent conditions with the complement of a nucleic acid
molecule having the nucleotide sequence of any of SEQ ID NO: 59,
SEQ ID NO: 60, and the nucleotide sequence of the cDNA clone; c) a
polypeptide having an amino acid sequence that is at least 95%
identical to any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino
acid sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151; and d) a polypeptide which is encoded by
a nucleic acid molecule having a nucleotide sequence which is at
least 90% identical to any of SEQ ID NO: 59, SEQ ID NO: 60, and the
nucleotide sequence of the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151.
2. The antibody substance of claim 1, which selectively binds with
a fragment of a polypeptide having the amino acid sequence of any
of SEQ ID NO: 61, SEQ ID NO: 63, and the amino acid sequence
encoded by the cDNA clone deposited with ATCC.RTM. as Accession
number PTA-151, wherein the fragment comprises at least 200
contiguous amino acid residues of any of SEQ ID NO: 61, SEQ ID NO:
63, and the amino acid sequence encoded by the cDNA clone.
3. The antibody substance of claim 1, which selectively binds with
a polypeptide having the amino acid sequence of any of SEQ ID NO:
61, SEQ ID NO: 63, and the amino acid sequence encoded by the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151.
4. The antibody substance of claim 1, which selectively binds with
a polypeptide having the amino acid sequence of SEQ ID NO: 61.
5. The antibody substance of claim 1, which selectively binds with
a polypeptide having the amino acid sequence of SEQ ID NO: 63.
6. The antibody substance of claim 1, which selectively binds with
a naturally occurring variant of a polypeptide having the amino
acid sequence of any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino
acid sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151, wherein the variant is encoded by a
nucleic acid molecule which hybridizes with the complement of a
nucleic acid molecule having the nucleotide sequence of any of SEQ
ID NO: 59, SEQ ID NO: 60, and the nucleotide sequence of the cDNA
clone, under stringent conditions.
7. The antibody substance of claim 6, wherein the stringent
conditions comprise hybridization in 6.times.sodium chloride/sodium
citrate (SSC) at about 45.degree. C., followed by one or more
washes in 0.2.times. SSC, 0.1% SDS at 65.degree. C.
8. The antibody substance of claim 1, which selectively binds with
a polypeptide having an amino acid sequence that is at least 95%
identical to any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino
acid sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151.
9. The antibody substance of claim 8, wherein the polypeptide has
an amino acid sequence that is at least 95% identical to any of SEQ
ID NO: 61, SEQ ID NO: 63, and the amino acid sequence encoded by
the cDNA clone.
10. The antibody substance of claim 1, which selectively binds with
a polypeptide which is encoded by a nucleic acid molecule having a
nucleotide sequence which is at least 90% identical to any of SEQ
ID NO: 59, SEQ ID NO: 60, and the nucleotide sequence of the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151.
11. The antibody substance of claim 10, wherein the nucleic acid
molecule has a nucleotide sequence which is at least 95% identical
to a nucleic acid consisting of the nucleotide sequence of any of
SEQ ID NO: 59, SEQ ID NO: 60, and the nucleotide sequence of the
cDNA clone.
12. The antibody substance of claim 10, wherein the nucleic acid
molecule has a nucleotide sequence which is at least 98% identical
to a nucleic acid consisting of the nucleotide sequence of any of
SEQ ID NO: 59, SEQ ID NO: 60, and the nucleotide sequence of the
cDNA clone.
13. The antibody substance of claim 10, wherein the nucleic acid
molecule has a nucleotide sequence which is identical to a nucleic
acid consisting of the nucleotide sequence of any of SEQ ID NO: 59,
SEQ ID NO: 60, and the nucleotide sequence of the cDNA clone.
14. The antibody substance of claim 1, wherein the antibody
substance is made by providing the polypeptide to an
immunocompetent vertebrate and thereafter harvesting blood or serum
comprising the antibody substance from the vertebrate.
15. The antibody substance of claim 14, isolated from the blood or
serum.
16. A kit comprising an antibody substance of claim 1 and
instructions for use.
17. A method for modulating the activity of TANGO 332 protein, the
method comprising contacting the protein or a cell expressing the
protein with an antibody substance of claim 1 at a sufficient
concentration to modulate a biological function of the protein.
18. The method of claim 17, wherein the biological function is
selected from the group consisting of: i) ability to bind with
hyaluronic acid; ii) ability to modulate human brain tissue
organization; iii) ability to modulate interaction of human brain
cells with brain extracellular matrix; iv) ability to modulate
movement of human brain cells through brain extracellular matrix;
v) ability to modulate growth of human brain cells; vi) ability to
modulate proliferation of human brain cells; vii) ability to
modulate differentiation of human brain cells; viii) ability to
modulate adhesion between human brain cells; and ix) ability to
modulate formation of neurological connections between human brain
cells.
19. The method of claim 18, wherein the biological function is
selected from the group consisting of iii) to ix) and wherein the
human brain cells are glial cells.
20. The method of claim 19, wherein the glial cells are cells of a
glioma.
21. The method of claim 20, wherein the glioma is selected from the
group consisting of an astrocytoma, an endophytic retinoblastoma,
an exophytic retinoblastoma, an ependymoma, a ganglioglioma, a
nasal glioma, an optic glioma, a Schwannoma, and a mixed
glioma.
22. A pharmaceutical composition for modulating human brain tissue
development, the composition comprising the antibody substance of
claim 1 and a pharmaceutically acceptable carrier.
23. A pharmaceutical composition for inhibiting a human brain
tumor, the composition comprising the antibody substance of claim 1
and a pharmaceutically acceptable carrier.
24. A pharmaceutical composition for inhibiting proliferation of
human glioma cells, the composition comprising the antibody
substance of claim 1 and a pharmaceutically acceptable carrier.
25. A pharmaceutical composition for inhibiting metastasis of human
glioma cells, the composition comprising the antibody substance of
claim 1 and a pharmaceutically acceptable carrier.
26. A pharmaceutical composition for modulating establishment of
human neural cell connections, the composition comprising the
antibody substance of claim 1 and a pharmaceutically acceptable
carrier.
27. A pharmaceutical composition for alleviating a brain disorder
selected from the group consisting of a brain tumor, impaired
cognitive function, dementia, senility, Alzheimer's disease, and
mental retardation, the composition comprising the antibody
substance of claim 1 and a pharmaceutically acceptable carrier.
28. A method of making an antibody capable of binding with TANGO
332 protein, the method comprising inoculating a vertebrate with a
polypeptide selected from the group consisting of: a) a fragment of
a polypeptide having the amino acid sequence of any of SEQ ID NO:
61, SEQ ID NO: 63, and the amino acid sequence encoded by the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151, wherein
the fragment comprises at least 200 contiguous amino acid residues
of any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino acid sequence
encoded by the cDNA clone; b) a naturally occurring variant of a
polypeptide having the amino acid sequence of any of SEQ ID NO: 61,
SEQ ID NO: 63, and the amino acid sequence encoded by the cDNA
clone deposited with ATCC.RTM. as Accession number PTA-151, wherein
the variant is encoded by a nucleic acid molecule which hybridizes
under stringent conditions with the complement of a nucleic acid
molecule having the nucleotide sequence of any of SEQ ID NO: 59,
SEQ ID NO: 60, and the nucleotide sequence of the cDNA clone; c) a
polypeptide having an amino acid sequence that is at least 95%
identical to any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino
acid sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151; and d) a polypeptide which is encoded by
a nucleic acid molecule having a nucleotide sequence which is at
least 90% identical to any of SEQ ID NO: 59, SEQ ID NO: 60, and the
nucleotide sequence of the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151; and thereafter harvesting from the
vertebrate blood or serum comprising the antibody.
29. The method of claim 28, further comprising thereafter isolating
the antibody from the blood or serum.
30. A method of making an antibody capable of modulating a
biological function of TANGO 332 protein, the method comprising
inoculating a vertebrate with a polypeptide selected from the group
consisting of: a) a fragment of a polypeptide having the amino acid
sequence of any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino acid
sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151, wherein the fragment comprises at least
200 contiguous amino acid residues of any of SEQ ID NO: 61, SEQ ID
NO: 63, and the amino acid sequence encoded by the cDNA clone; b) a
naturally occurring variant of a polypeptide having the amino acid
sequence of any of SEQ ID NO: 61, SEQ ID NO: 63, and the amino acid
sequence encoded by the cDNA clone deposited with ATCC.RTM. as
Accession number PTA-151, wherein the variant is encoded by a
nucleic acid molecule which hybridizes under stringent conditions
with the complement of a nucleic acid molecule having the
nucleotide sequence of any of SEQ ID NO: 59, SEQ ID NO: 60, and the
nucleotide sequence of the cDNA clone; c) a polypeptide having an
amino acid sequence that is at least 95% identical to any of SEQ ID
NO: 61, SEQ ID NO: 63, and the amino acid sequence encoded by the
cDNA clone deposited with ATCC.RTM.) as Accession number PTA-151;
and d) a polypeptide which is encoded by a nucleic acid molecule
having a nucleotide sequence which is at least 90% identical to any
of SEQ ID NO: 59, SEQ ID NO: 60, and the nucleotide sequence of the
cDNA clone deposited with ATCC.RTM. as Accession number PTA-151;
and thereafter harvesting from the vertebrate blood or serum
comprising the antibody.
31. The method of claim 30, wherein the biological function is
selected from the group consisting of: i) ability to bind with
hyaluronic acid; ii) ability to modulate human brain tissue
organization; iii) ability to modulate interaction of human brain
cells with brain extracellular matrix; iv) ability to modulate
movement of human brain cells through brain extracellular matrix;
v) ability to modulate growth of human brain cells; vi) ability to
modulate proliferation of human brain cells; vii) ability to
modulate differentiation of human brain cells; viii) ability to
modulate adhesion between human brain cells; and ix) ability to
modulate formation of neurological connections between human brain
cells.
32. The method of claim 30, further comprising thereafter isolating
the antibody from the blood or serum.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 09/596,194, filed Jun. 16, 2000, which is a
continuation-in-part of co-pending U.S. patent application Ser. No.
09/342,364, filed Jun. 29, 1999.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not applicable.
REFERENCE TO A MICROFICHE APPENDIX
[0003] Not applicable.
BACKGROUND OF THE INVENTION
[0004] The molecular bases underlying many human and animal
physiological states (e.g., diseased and homeostatic states of
various tissues) remain unknown. Nonetheless, it is well understood
that these states result from interactions among the proteins and
nucleic acids present in the cells of the relevant tissues. In the
past, the complexity of biological systems overwhelmed the ability
of practitioners to understand the molecular interactions giving
rise to normal and abnormal physiological states. More recently,
though, the techniques of molecular biology, transgenic and null
mutant animal production, computational biology, pharmacogenomics,
and the like have enabled practitioners to discern the role and
importance of individual genes and proteins in particular
physiological states.
[0005] Knowledge of the sequences and other properties of genes
(particularly including the portions of genes encoding proteins)
and the proteins encoded thereby enables the practitioner to design
and screen agents which will affect, prospectively or
retrospectively, the physiological state of an animal tissue in a
favorable way. Such knowledge also enables the practitioner, by
detecting the levels of gene expression and protein production, to
diagnose the current physiological state of a tissue or animal and
to predict such physiological states in the future. This knowledge
furthermore enables the practitioner to identify and design
molecules which bind with the polynucleotides and proteins, in
vitro, in vivo, or both.
[0006] The present invention provides sequence information for
polynucleotides derived from human genes and for proteins encoded
thereby, and thus enables the practitioner to assess, predict, and
affect the physiological state of various human tissues.
BRIEF SUMMARY OF THE INVENTION
[0007] The present invention is based, at least in part, on the
discovery of a variety of human cDNA molecules which encode
proteins which are herein designated INTERCEPT 217, INTERCEPT 297,
TANGO 276, TANGO 292, TANGO 325, TANGO 331, and TANGO 332. These
seven proteins, fragments thereof, derivatives thereof, and
variants thereof are collectively referred to herein as the
polypeptides of the invention or the proteins of the invention.
Nucleic acid molecules encoding polypeptides of the invention are
collectively referred to as nucleic acids of the invention.
[0008] The nucleic acids and polypeptides of the present invention
are useful as modulating agents in regulating a variety of cellular
processes. Accordingly, in one aspect, the present invention
provides isolated nucleic acid molecules encoding a polypeptide of
the invention or a biologically active portion thereof. The present
invention also provides nucleic acid molecules which are suitable
as primers or hybridization probes for the detection of nucleic
acids encoding a polypeptide of the invention.
[0009] The nucleic acids and polypeptides of the present invention
are useful as modulating agents in regulating a variety of cellular
processes. Accordingly, in one aspect, the present invention
provides isolated nucleic acid molecules encoding a polypeptide of
the invention or a biologically active portion thereof. The present
invention also provides nucleic acid molecules which are suitable
as primers or hybridization probes for the detection of nucleic
acids encoding a polypeptide of the invention.
[0010] The invention also features nucleic acid molecules which are
at least 40% (or 50%, 60%, 70%, 80%, 90%, 95%, or 98%) identical to
the nucleotide sequence of any of SEQ ID NOs: 1, 2, 9, 10, 33, 34,
38, 39, 46, 47, 54, 55, 59, 60, 81, 82, and 92, or the nucleotide
sequence of a cDNA clone deposited with ATCC.RTM. as one of
Accession numbers PTA-147, PTA-150, 207230, and PTA-151 ("a cDNA of
a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151"), or a complement thereof.
[0011] The invention features nucleic acid molecules which include
a fragment of at least 15 (25, 40, 60, 80, 100, 150, 200, 250, 300,
350, 400, 450, 550, 650, 700, 800, 900, 1000, 1200, 1400, 1600,
1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500, or
4928) consecutive nucleotide residues of any of SEQ ID NOs: 1, 2,
9, 10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, and 92, or a
cDNA of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, or a complement thereof.
[0012] The invention also features nucleic acid molecules which
include a nucleotide sequence encoding a protein having an amino
acid sequence that is at least 50% (or 60%, 70%, 80%, 90%, 95%, or
98%) identical to the amino acid sequence of any of SEQ ID NOs:
3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88, and 93-98, or
the amino acid sequence encoded by a cDNA of a clone deposited as
ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151, or a complement
thereof.
[0013] In preferred embodiments, the nucleic acid molecules have
the nucleotide sequence of any of SEQ ID NOs: 1, 2, 9, 10, 33, 34,
38, 39, 46, 47, 54, 55, 59, 60, 81, 82, and 92, or a cDNA of a
clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151.
[0014] Also within the invention are nucleic acid molecules which
encode a fragment of a polypeptide having the amino acid sequence
of any of SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98, or the amino acid sequence encoded by a
cDNA of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, the fragment including at least 8 (10, 15, 20, 25, 30, 40,
50, 75, 100, 125, 150, or 200) consecutive amino acids of any of
SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88,
and 93-98, or the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151.
[0015] The invention includes nucleic acid molecules which encode a
naturally occurring allelic variant of a polypeptide comprising the
amino acid sequence of any of SEQ ID NOs: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, and 93-98, or the amino acid sequence
encoded by a cDNA of a clone deposited as one of ATCC.RTM. PTA-147,
PTA-150, 207230, and PTA-151, wherein the nucleic acid molecule
hybridizes under stringent conditions to a nucleic acid molecule
having a nucleic acid sequence encoding any of SEQ ID NOs: 1, 2, 9,
10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, and 92, or a
cDNA of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, or a complement thereof.
[0016] Also within the invention are isolated polypeptides or
proteins having an amino acid sequence that is at least about 50%,
preferably 60%, 75%, 90%, 95%, or 98% identical to the amino acid
sequence of any of SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, and 93-98.
[0017] Also within the invention are isolated polypeptides or
proteins which are encoded by a nucleic acid molecule having a
nucleotide sequence that is at least about 40%, preferably 50%,
75%, 85%, or 95% identical the nucleic acid sequence encoding any
of SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63,
83-88, and 93-98, and isolated polypeptides or proteins which are
encoded by a nucleic acid molecule consisting of the nucleotide
sequence which hybridizes under stringent hybridization conditions
to a nucleic acid molecule having the nucleotide sequence of any of
SEQ ID NOs: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60,
81, 82, and 92.
[0018] Also within the invention are polypeptides which are
naturally occurring allelic variants of a polypeptide that includes
the amino acid sequence of any of SEQ ID NOs: 3-8, 11-32, 35-37,
40-45, 48-53, 56-58, 61-63, 83-88, and 93-98, or the amino acid
sequence encoded by a cDNA of a clone deposited as ATCC.RTM.
PTA-147, PTA-150, 207230, or PTA-151, wherein the polypeptide is
encoded by a nucleic acid molecule which hybridizes under stringent
conditions to a nucleic acid molecule having the nucleotide
sequence of any of SEQ ID NOs: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47,
54, 55, 59, 60, 81, 82, and 92, or a complement thereof.
[0019] The invention also features nucleic acid molecules that
hybridize under stringent conditions to a nucleic acid molecule
having the nucleotide sequence of any of SEQ ID NOs: 1, 2, 9, 10,
33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, and 92, or a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, or a complement thereof. In other embodiments, the nucleic
acid molecules are at least 15 (25, 40, 60, 80, 100, 150, 200, 250,
300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1200, 1400,
1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500,
or 4928) nucleotides in length and hybridize under stringent
conditions to a nucleic acid molecule having the nucleotide
sequence of any of SEQ ID NOs: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47,
54, 55, 59, 60, 81, 82, and 92, or a cDNA of a clone deposited as
ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151, or a complement
thereof. In some embodiments, the isolated nucleic acid molecules
encode a cytoplasmic, transmembrane, extracellular, or other domain
of a polypeptide of the invention. In other embodiments, the
invention provides an isolated nucleic acid molecule which is
antisense to the coding strand of a nucleic acid of the
invention.
[0020] Another aspect of the invention provides vectors, e.g.,
recombinant expression vectors, comprising a nucleic acid molecule
of the invention. In another embodiment, the invention provides
isolated host cells, e.g., mammalian and non-mammalian cells,
containing such a vector or a nucleic acid of the invention. The
invention also provides methods for producing a polypeptide of the
invention by culturing, in a suitable medium, a host cell of the
invention containing a recombinant expression vector encoding a
polypeptide of the invention such that the polypeptide of the
invention is produced.
[0021] Another aspect of this invention features isolated or
recombinant proteins and polypeptides of the invention. Preferred
proteins and polypeptides possess at least one biological activity
possessed by the corresponding naturally-occurring human
polypeptide. An activity, a biological activity, and a functional
activity of a polypeptide of the invention refers to an activity
exerted by a protein or polypeptide of the invention on a
responsive cell as determined in vivo, or in vitro, according to
standard techniques. Such activities can be a direct activity, such
as an association with or an enzymatic activity on a second protein
or an indirect activity, such as a cellular processes mediated by
interaction of the protein with a second protein.
[0022] By way of example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof exhibit the ability to affect growth,
proliferation, survival, differentiation, and activity of human
pancreas, skeletal muscle, heart, brain, placenta, lung, liver, and
kidney cells. INTERCEPT 217 modulates cellular binding to one or
more mediators, modulates activity and release of one or more
pancreatically secreted digestive enzymes, and protects tissue from
endogenous digestive enzymes. Thus, INTERCEPT 217 polypeptides,
nucleic acids, and modulators thereof can be used to prevent,
diagnose, or treat disorders relating to aberrant endogenous
digestive enzyme activity, inappropriate interaction (or
non-interaction) of cells with mediators, inappropriate cellular
development and proliferation, inappropriate inflammation, and
inappropriate immune responses. Exemplary disorders for which
INTERCEPT 217 polypeptides, nucleic acids, and modulators thereof
are useful include immune disorders (e.g., insufficient immune
responses and auto-immune disorders), infectious diseases,
auto-immune disorders, pancreatic disorders (e.g., pancreatitis and
pancreatic carcinoma), disorders related to mal-expression of
growth factors, cancers, inflammatory disorders, acute and chronic
traumas, and the like.
[0023] Further by way of example, INTERCEPT 297 polypeptides,
nucleic acids, and modulators thereof exhibit the ability to affect
growth, proliferation, survival, differentiation, and activity of
human fetal cells and spleen cells and of (e.g., bacterial or
fungal) cells and viruses which infect humans. Furthermore,
INTERCEPT 297 modulates organization, structure, and function of
biological membranes. Thus, INTERCEPT 297 polypeptides, nucleic
acids, and modulators thereof can be used to affect development and
persistence of atherogenesis and arteriosclerosis, for example, or
to modulate transmembrane transport processes such as ion transport
across neuronal and muscle cell membranes (e.g., ion transport
relating to nerve impulse conduction and muscle contraction).
INTERCEPT 297 polypeptides, nucleic acids, and modulators thereof
can be used to prevent, diagnose, or treat transmembrane transport
disorders such as cystic fibrosis, pain, seizure, epilepsy, mental
disorders, and the like. Other exemplary disorders for which
INTERCEPT 297 polypeptides, nucleic acids, and modulators thereof
are useful include disorders involving generation and persistence
of an immune response to bacterial, fungal, and viral
infections.
[0024] Still further by way of example, TANGO 276 polypeptides,
nucleic acids, and modulators thereof modulate growth,
proliferation, survival, differentiation, and activity of human
heart, placenta, brain, lung, liver, skin, kidney, pancreas,
spleen, and fetal tissues. TANGO 276 guides neuronal growth and
development and modulates growth, homeostasis, and regeneration of
other epithelial tissues. TANGO 276 is a secreted protein which
mediates cellular interaction with cells, molecules, and structures
(e.g., extracellular matrix) in the extracellular environment.
TANGO 276 is therefore involved in growth, organization, migration,
and adhesion of tissues and the cells which constitute those
tissues. Furthermore, TANGO 276 modulates growth, proliferation,
survival, differentiation, and activity of neuronal cells and
immune system cells. Thus, TANGO 276 polypeptides, nucleic acids,
and modulators thereof can be used, for example, to prevent,
diagnose, or treat disorders characterized by aberrant organization
or development of a tissue or organ, for modulating migration and
adhesion of cells (e.g., in disorders such as cancer metastasis,
autoimmune disorders, and graft-versus-host disease or in normal or
aberrant processes involving angiogenesis, such as tumor growth and
persistence), for guiding neural axon development and regeneration,
for modulating differentiation of cells of the immune system (e.g.,
to treat bacterial, fungal, or viral infection or to prevent,
diagnose, or treat autoimmune disorders), for modulating cytokine
production by cells of the immune system (e.g., to prevent, detect,
or treat inflammation and pain), for modulating reactivity of cells
of the immune system toward cytokines, for modulating initiation
and persistence of an inflammatory response, and for modulating
proliferation of epithelial cells.
[0025] Yet further by way of example, TANGO 292 polypeptides,
nucleic acids, and modulators thereof modulate growth,
proliferation, survival, differentiation, and activity of human
keratinocytes, including embryonic keratinocytes. TANGO 292, a
transmembrane protein, is also involved in binding and uptake of
calcium and other metal ions, and in responses of cells which
express it to the presence and uptake of such ions. TANGO 292
polypeptides, nucleic acids, and modulators thereof can therefore
be used to prevent, diagnose, and treat disorders involving one or
more physiological activities mediated by TANGO 292 protein. These
activities include, for example, bone uptake, maintenance, and
deposition, formation, maintenance, and repair of cartilage and
skin, formation and maintenance of extracellular matrices, movement
of cells through extracellular matrices, coagulation and
dissolution of blood components, and deposition of materials in and
on arterial walls. TANGO 292 is also related to a variety of
disorders which involve these activities. Such disorders include,
for example, various bone-related disorders such as osteoporosis,
skeletal development disorders, bone fragility, traumatic bone
injuries, rickets, osteomalacia, Paget's disease, and other bone
disorders, osteoarthritis, rheumatoid arthritis, ankylosing
spondylitis, and other disorders of the joints and cartilage, skin
disorders such as psoriasis, eczema, scleroderma, and skin tumors
(e.g., keratoses, squamous cell carcinomas, malignant melanomas,
and Kaposi's sarcomas), iron deficiency anemia, hemophilia,
inappropriate blood coagulation, stroke, arteriosclerosis,
atherosclerosis, aneurysm, and other disorders related to blood and
blood vessels, metastasis and other disorders related to
inappropriate movement of cells through extracellular matrices, and
the like. TANGO 292 polypeptides, nucleic acids, and modulators
thereof can thus be used to prevent, diagnose, and treat one or
more of these disorders. TANGO 292 is also involved in skin
disorders such as psoriasis, eczema, scleroderma, skin tumors
(e.g., keratoses, squamous cell carcinomas, malignant melanomas,
and Kaposi's sarcomas), in placental disorders such as placenta
previa and abruptio placentae, in liver disorders such as cirrhosis
of the liver, liver fibrosis, hepatitis, and hepatic cancers, in
kidney disorders such as urolithiasis, glomerulonephritis,
nephrosis, renal cell carcinomas, and renal failure (both acute and
chronic), in lung disorders such as cystic fibrosis, chronic
obstructive pulmonary diseases (e.g., emphysema, bronchitis, and
bronchiectasis), lung cancers, and asthma, in pancreatic disorders
such as diabetes, pancreatitis, pancreatic cancers, and pancreatic
insufficiency, in cardiac disorders such as coronary artery disease
(and other ischemic heart diseases), arrhythmia, congestive heart
failure, endocarditis, and pericarditis, and the like. Thus, TANGO
292 polypeptides, nucleic acids, and modulators thereof can thus be
used to prevent, diagnose, and treat one or more of these
disorders.
[0026] As an additional example, TANGO 325 polypeptides, nucleic
acids, and modulators thereof modulate growth, proliferation,
survival, differentiation, and activity of human tissues such as
vascular endothelium, including aortic endothelium, other heart
tissues, placenta, liver, kidney, and pancreas tissues. Thus, TANGO
325 polypeptides, nucleic acids, and modulators thereof can
therefore be used to prevent, diagnose, and treat disorders
involving one or more physiological activities mediated by TANGO
325 protein in tissues in which it is expressed. Such activities
include, for example, modulation of cardiac contractility and
vasomotor tone, modulation of leukocyte extravasation, sensing
physiological signals by the endocrine system, modulating growth,
development, maintenance, and regeneration of neurons, and the
like. Disorders related to these activities include, by way of
example and not limitation, cardiovascular disorders such as
arteriosclerosis, atherosclerosis, coronary artery disease (and
other ischemic heart diseases), angina, myocardial infarction,
restenotic disorders, hypertension, Buerger's disease, aneurysm,
stroke, arrythmia, congestive heart failure, endocarditis, and
pericarditis, placental disorders such as placenta previa and
abruptio placentae, liver disorders such as cirrhosis of the liver,
liver fibrosis, hepatitis, and hepatic cancers, kidney disorders
such as urolithiasis, glomerulonephritis, nephrosis, renal cell
carcinomas, and renal failure (both acute and chronic), pancreatic
disorders such as diabetes, pancreatitis, pancreatic cancers, and
pancreatic insufficiency, neurological system disorders, immune and
auto-immune disorders, hyperthyroidism, hypothyroidism, diabetes,
goiter, growth and developmental disorders, and the like.
[0027] Further by way of example, TANGO 331 polypeptides, nucleic
acids, and modulators thereof modulate growth, proliferation,
survival, differentiation, and activity of human fetal, lung,
spleen, and thymus cells and tissues. As described herein, TANGO
331 is involved in physiological activities such as maintenance of
epithelia, carcinogenesis, modulation and storage of protein
factors and metals, lactation, and infant nutrition. TANGO 331 also
modulates cellular binding and uptake of cytokines, growth factors,
and metal ions. Thus, TANGO 331 polypeptides, nucleic acids, and
modulators thereof can be used to prevent, diagnose, and treat
disorders such as breast cancer, insufficient lactation, infant
nutritional and growth disorders, malnutrition and mineral
deficiency disorders, hemochromatosis, inappropriate calcification
of body tissues, bone disorders such as osteoporosis, autoimmune
disorders, insufficient or inappropriate host responses to
infection, acquired immune deficiency syndrome, and the like.
[0028] As another example, TANGO 332 polypeptides, nucleic acids,
and modulators thereof modulate growth, proliferation, survival,
differentiation, and activity of human brain and other tissues. As
described herein, TANGO 332 is involved in modulating establishment
and maintenance of neural connections, cell-to-cell adhesion,
tissue and extracellular matrix invasivity, and the like. Thus,
TANGO 332 polypeptides, nucleic acids, and modulators thereof can
be used to prevent, diagnose, and treat disorders such as brain
cancers (e.g., gliomas, astrocytomas, medulloblastomas,
ependymomas, Schwannomas, pituitary adenomas, teratomas, and the
like), disorders of neural connection establishment or maintenance,
impaired cognitive function, dementia, senility, Alzheimer's
disease, mental retardation, inflammation, immune and autoimmune
responses, and the like.
[0029] In one embodiment, a polypeptide of the invention has an
amino acid sequence sufficiently identical to an identified domain
of a polypeptide of the invention. As used herein, the term
"sufficiently identical" refers to a first amino acid or nucleotide
sequence which contains a sufficient or minimum number of identical
or equivalent (e.g., with a similar side chain) amino acid residues
or nucleotides to a second amino acid or nucleotide sequence such
that the first and second amino acid or nucleotide sequences have a
common structural domain and/or common functional activity. For
example, amino acid or nucleotide sequences which contain a common
structural domain having about 65% identity, preferably 75%
identity, more preferably 85%, 95%, or 98% identity are defined
herein as sufficiently identical.
[0030] In one embodiment, the isolated polypeptide of the invention
lacks both a transmembrane and a cytoplasmic domain. In another
embodiment, the polypeptide lacks both a transmembrane domain and a
cytoplasmic domain and is soluble under physiological
conditions.
[0031] The polypeptides of the present invention, or biologically
active portions thereof, can be operably linked to a heterologous
amino acid sequence to form fusion proteins. The invention further
features antibody substances that specifically bind a polypeptide
of the invention such as monoclonal or polyclonal antibodies,
antibody fragments, single-chain antibodies, and the like. In
addition, the polypeptides of the invention or biologically active
portions thereof can be incorporated into pharmaceutical
compositions, which optionally include pharmaceutically acceptable
carriers. These antibody substances can be made, for example, by
providing the polypeptide of the invention to an immunocompetent
vertebrate and thereafter harvesting blood or serum from the
vertebrate.
[0032] In another aspect, the present invention provides methods
for detecting the presence of the activity or expression of a
polypeptide of the invention in a biological sample by contacting
the biological sample with an agent capable of detecting an
indicator of activity such that the presence of activity is
detected in the biological sample.
[0033] In another aspect, the invention provides methods for
modulating activity of a polypeptide of the invention comprising
contacting a cell with an agent that modulates (inhibits or
enhances) the activity or expression of a polypeptide of the
invention such that activity or expression in the cell is
modulated. In one embodiment, the agent is an antibody that
specifically binds to a polypeptide of the invention.
[0034] In another embodiment, the agent modulates expression of a
polypeptide of the invention by modulating transcription, splicing,
or translation of an mRNA encoding a polypeptide of the invention.
In yet another embodiment, the agent is a nucleic acid molecule
having a nucleotide sequence that is antisense with respect to the
coding strand of an mRNA encoding a polypeptide of the
invention.
[0035] The present invention also provides methods to treat a
subject having a disorder characterized by aberrant activity of a
polypeptide of the invention or aberrant expression of a nucleic
acid of the invention by administering an agent which is a
modulator of the activity of a polypeptide of the invention or a
modulator of the expression of a nucleic acid of the invention to
the subject. In one embodiment, the modulator is a protein of the
invention. In another embodiment, the modulator is a nucleic acid
of the invention. In other embodiments, the modulator is a peptide,
peptidomimetic, or other small molecule.
[0036] The present invention also provides diagnostic assays for
identifying the presence or absence of a genetic lesion or mutation
characterized by at least one of: (i) aberrant modification or
mutation of a gene encoding a polypeptide of the invention, (ii)
mis-regulation of a gene encoding a polypeptide of the invention,
and (iii) aberrant post-translational modification of a polypeptide
of the invention wherein a wild-type form of the gene encodes a
polypeptide having the activity of the polypeptide of the
invention.
[0037] In another aspect, the invention provides a method for
identifying a compound that binds to or modulates the activity of a
polypeptide of the invention. In general, such methods entail
measuring a biological activity of the polypeptide in the presence
and absence of a test compound and identifying those compounds
which alter the activity of the polypeptide.
[0038] The invention also features methods for identifying a
compound which modulates the expression of a polypeptide or nucleic
acid of the invention by measuring the expression of the
polypeptide or nucleic acid in the presence and absence of the
compound.
[0039] In yet a further aspect, the invention provides
substantially purified antibodies or fragments thereof, including
non-human antibodies or fragments thereof, which antibodies or
fragments specifically bind to a polypeptide having an amino acid
sequence comprising a sequence selected from the group consisting
of
[0040] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0041] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0042] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0043] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM120 weight residue table, a gap length penalty of 12, and
a gap penalty of 4; and
[0044] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C.
[0045] In various embodiments, the substantially purified
antibodies of the invention, or fragments thereof, can be human,
non-human, chimeric and/or humanized antibodies.
[0046] In another aspect, the invention provides non-human
antibodies or fragments thereof, which antibodies or fragments
specifically bind with a polypeptide having an amino acid sequence
comprising a sequence selected from the group consisting of
[0047] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0048] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0049] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0050] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM120 weight residue table, a gap length penalty of 12, and
a gap penalty of 4; and
[0051] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C.
[0052] Such non-human antibodies can be goat, mouse, sheep, horse,
chicken, rabbit, or rat antibodies. Alternatively, the non-human
antibodies of the invention can be chimeric and/or humanized
antibodies. In addition, the non-human antibodies of the invention
can be polyclonal antibodies or monoclonal antibodies.
[0053] In still a further aspect, the invention provides monoclonal
antibodies or fragments thereof, which antibodies or fragments
specifically bind to a polypeptide having an amino acid sequence
comprising a sequence selected from the group consisting of
[0054] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0055] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0056] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0057] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM120 weight residue table, a gap length penalty of 12, and
a gap penalty of 4; and
[0058] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C.
[0059] The monoclonal antibodies can be human, humanized, chimeric
and/or non-human antibodies.
[0060] In a particularly preferred embodiment, the antibody
substance of the invention specifically binds with an extracellular
domain of one of INTERCEPT 217, INTERCEPT 297, TANGO 276, TANGO
292, TANGO 325, TANGO 331, and TANGO 332. Preferably, the
extracellular domain with which the antibody substance binds has an
amino acid sequence selected from the group consisting of SEQ ID
NOs: 6, 14-18, 37, 43, 51, 58, 63, 83, or 93.
[0061] Any of the antibodies of the invention can be conjugated
with a therapeutic moiety or with a detectable substance.
Non-limiting examples of detectable substances that can be
conjugated with the antibodies of the invention include an enzyme,
a prosthetic group, a fluorescent material, a luminescent material,
a bioluminescent material, and a radioactive material.
[0062] The invention also provides a kit containing an antibody of
the invention conjugated to a detectable substance, and
instructions for use. Still another aspect of the invention is a
pharmaceutical composition comprising an antibody of the invention
and a pharmaceutically acceptable carrier. In preferred
embodiments, the pharmaceutical composition contains an antibody of
the invention, a therapeutic moiety, and a pharmaceutically
acceptable carrier.
[0063] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0064] FIG. 1 comprises FIGS. 1A through 1M. The nucleotide
sequence (SEQ ID NO: 1) of a cDNA encoding the human INTERCEPT 217
protein described herein is listed in FIGS. 1A through 1E. The open
reading frame (ORF; residues 215 to 1579; SEQ ID NO: 2) of the cDNA
is indicated by nucleotide triplets, above which the amino acid
sequence (SEQ ID NO: 3) of human INTERCEPT 217 is listed. FIG. 1F
is a hydrophilicity plot of human INTERCEPT 217 protein, in which
the locations of cysteine residues ("Cys") and potential
N-glycosylation sites ("Ngly") are indicated by vertical bars and
the predicted extracellular ("out"), intracellular ("ins"), or
transmembrane ("TM") locations of the protein backbone is indicated
by a horizontal bar. An alignment of the amino acid sequences of
human INTERCEPT 217 protein ("H"; SEQ ID NO: 3) and porcine
ribonuclease inhibitor protein ("P"; SwissProt Accession number
P10775; SEQ ID NO: 64) is shown in FIGS. 1G and 1H, wherein
identical amino acid residues are indicated by ":" and similar
amino acid residues are indicated by ".". These alignments were
made using the ALIGN software {Myers and Miller (1989) CABIOS, ver.
2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4). The nucleotide sequence (SEQ ID NO: 92) of an
ORF encoding the murine INTERCEPT 217 protein described herein is
listed in FIGS. 1I through 1K. The ORF is indicated by nucleotide
triplets, beneath which the amino acid sequence (SEQ ID NO: 93) of
murine INTERCEPT 217 is listed. FIG. 1L is a hydrophilicity plot of
murine INTERCEPT 217 protein, in which the locations of cysteine
residues ("Cys") and potential N-glycosylation sites ("Ngly") are
indicated by vertical bars and the predicted extracellular ("out"),
intracellular ("ins"), or transmembrane ("TM") locations of the
protein backbone is indicated by a horizontal bar. An alignment of
the amino acid sequences of human INTERCEPT 217 protein ("H"; SEQ
ID NO: 3) and murine INTERCEPT 217 protein ("M"; SEQ ID NO: 93) is
shown in FIG. 1M, wherein identical amino acid residues are
indicated by ".vertline." and similar amino acid residues are
indicated by ".". These alignments were made using the BESTFIT
software (BLOSUM62 scoring matrix, gap opening penalty=12,
frameshift gap penalty=5, gap extension penalty=4).
[0065] FIG. 2 comprises FIGS. 2A through 2D. The nucleotide
sequence (SEQ ID NO: 9) of a cDNA encoding the human INTERCEPT 297
protein described herein is listed in FIGS. 2A, 2B, and 2C. The
open reading frame (ORF; residues 40 to 1152; SEQ ID NO: 10) of the
cDNA is indicated by nucleotide triplets, above which the amino
acid sequence (SEQ ID NO: 11) of human INTERCEPT 297 is listed.
FIG. 2D is a hydrophilicity plot of human INTERCEPT 297
protein.
[0066] FIG. 3 comprises FIGS. 3A through 3R. The nucleotide
sequence (SEQ ID NO: 33) of a cDNA encoding the human TANGO 276
protein described herein is listed in FIGS. 3A to 3D. The ORF
(residues 58 to 786; SEQ ID NO: 34) of the cDNA is indicated by
nucleotide triplets, above which the amino acid sequence (SEQ ID
NO: 35) of human TANGO 276 is listed. FIG. 3E is a hydrophilicity
plot of TANGO 276 protein. An alignment of the amino acid sequences
of human TANGO 276 protein ("H"; SEQ ID NO: 35) and murine protein
M-Sema-F ("M"; SEQ ID NO: 65) is shown in FIGS. 3F to 3H. In FIGS.
3I through 3R, an alignment of the nucleotide sequences of the cDNA
encoding human TANGO 276 protein ("H"; SEQ ID NO: 33) and the
nucleotide sequences of the cDNA encoding murine protein M-Sema-F
("M"; SEQ ID NO: 66) is shown. These alignments were made using the
ALIGN software {Myers and Miller (1989) CABIOS, ver. 2.0};
pam120.mat scoring matrix; gap opening penalty=12, gap extension
penalty=4).
[0067] FIG. 4 comprises FIGS. 4A through 4M. The nucleotide
sequence (SEQ ID NO: 38) of a cDNA encoding the human TANGO 292
protein described herein is listed in FIGS. 4A to 4C. The ORF
(residues 205 to 882; SEQ ID NO: 39) of the cDNA is indicated by
nucleotide triplets, beneath which the amino acid sequence (SEQ ID
NO: 40) of human TANGO 292 is listed. FIG. 4D is a hydrophilicity
plot of human TANGO 292 protein. The nucleotide sequence (SEQ ID
NO: 81) of a cDNA encoding the gerbil TANGO 292 protein described
herein is listed in FIGS. 4E to 4H. The ORF (residues 89 to 763;
SEQ ID NO: 82) of the cDNA is indicated by nucleotide triplets,
below which the amino acid sequence (SEQ ID NO: 83) of gerbil TANGO
292 is listed. FIGS. 4I to 4K are an alignment of the nucleotide
sequences of the ORF encoding human TANGO 292 protein ("H"; SEQ ID
NO: 38) and the nucleotide sequence of the ORF encoding gerbil
TANGO 292 protein ("G"; SEQ ID NO: 81), made using the ALIGN
software {Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat
scoring matrix; gap opening penalty=12, gap extension penalty=4),
wherein identical nucleotide residues are indicated by
".vertline.". FIG. 4L is an alignment of the human (H) and gerbil
(G) TANGO 292 amino acid sequences, made using the same software
and parameters, wherein identical amino acid residues are indicated
by ".vertline." and similar amino acid residues are indicated by
".". FIG. 4M is a hydrophilicity plot of gerbil TANGO 292
protein.
[0068] FIG. 5 comprises FIGS. 5A through 5M-18. The nucleotide
sequence (SEQ ID NO: 46) of a cDNA encoding the human TANGO 325
protein described herein is listed in FIGS. 5A through 5E. The ORF
(residues 135 to 2000; SEQ ID NO: 47) of the cDNA is indicated by
nucleotide triplets, above which the amino acid sequence (SEQ ID
NO: 48) of human TANGO 325 is listed. FIG. 5F is a hydrophilicity
plot of TANGO 325 protein. An alignment of the amino acid sequences
of TANGO 325 ("325"; SEQ ID NO: 48) and Slit-1 protein ("Slit"; SEQ
ID NO: 67) protein is shown in FIGS. 5G to 5L. In FIGS. 5M-1 to
5M-18, an alignment of the nucleotide sequences of the cDNA
encoding human TANGO 325 protein ("325"; SEQ ID NO: 33) and the
nucleotide sequence of the cDNA encoding Slit-1 protein ("Slit";
SEQ ID NO: 68) is shown. This alignment was made using the ALIGN
software {Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat
scoring matrix; gap opening penalty=12, gap extension
penalty=4).
[0069] FIG. 6 comprises FIGS. 6A through 6J. The nucleotide
sequence (SEQ ID NO: 54) of a cDNA encoding the human TANGO 331
protein described herein is listed in FIGS. 6A, 6B, and 6C. The ORF
(residues 114 to 1172; SEQ ID NO: 55) of the cDNA is indicated by
nucleotide triplets, above which the amino acid sequence (SEQ ID
NO: 56) of human TANGO 331 is listed. FIG. 6D is a hydrophilicity
plot of TANGO 331 protein. An alignment of the amino acid sequences
of human TANGO 331 protein ("H"; SEQ ID NO: 56) and Chinese hamster
protein HT ("C"; SEQ ID NO: 69; GenBank Accession No. U48852) is
shown in FIG. 6E. In FIGS. 6F through 6J, an alignment of the
nucleotide sequences of the cDNA encoding human TANGO 331 protein
("H"; SEQ ID NO: 54) and the nucleotide sequence of the cDNA
encoding Chinese hamster protein HT ("C"; SEQ ID NO: 70) is shown.
These alignments were made using the ALIGN software {Myers and
Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap
opening penalty=12, gap extension penalty=4).
[0070] FIG. 7 comprises FIGS. 7A through 7U. The nucleotide
sequence (SEQ ID NO: 59) of a cDNA encoding the human TANGO 332
protein described herein is listed in FIGS. 7A through 7E. The ORF
(residues 173 to 2185; SEQ ID NO: 60) of the cDNA is indicated by
nucleotide triplets, above which the amino acid sequence (SEQ ID
NO: 61) of human TANGO 332 protein is listed. FIG. 7F is a
hydrophilicity plot of TANGO 332 protein. An alignment of the amino
acid sequences of TANGO 332 protein ("332"; SEQ ID NO: 61) and BEF
protein ("BEF"; SEQ ID NO: 71) is shown in FIGS. 7G and 7H. An
alignment of the amino acid sequences of human TANGO 332 protein
("H"; SEQ ID NO: 61) and murine brevidin protein ("M"; SEQ ID NO:
72) is shown in FIGS. 7I to 7K. In FIGS. 7L through 7U, an
alignment of the nucleotide sequences of the cDNA encoding human
TANGO 332 protein ("H"; SEQ ID NO: 60) and the nucleotide sequence
of the cDNA encoding murine brevidin protein ("M"; SEQ ID NO: 73)
is shown. These alignments were made using the ALIGN software
{Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring
matrix; gap opening penalty=12, gap extension penalty=4).
DETAILED DESCRIPTION OF THE INVENTION
[0071] The present invention is based, at least in part, on the
discovery of a variety of human cDNA molecules which encode
proteins which are herein designated INTERCEPT 217, INTERCEPT 297,
TANGO 276, TANGO 292, TANGO 325, TANGO 331, and TANGO 332. These
proteins exhibit a variety of physiological activities, and are
included in a single application for the sake of convenience. It is
understood that the allowability or non-allowability of claims
directed to one of these proteins has no bearing on the
allowability of claims directed to the others. The characteristics
of each of these proteins and the cDNAs encoding them are now
described separately.
[0072] INTERCEPT 217
[0073] A cDNA clone (designated jthqc035f08) encoding at least a
portion of human INTERCEPT 217 protein was isolated from a human
prostate cDNA library. The human INTERCEPT 217 protein is predicted
by structural analysis to be a transmembrane protein. In addition,
cDNA clones (including those designated jtmca047g07, jTmob373b05,
and jambd078d12) encoding at least a portion of murine INTERCEPT
217 protein were isolated from murine cDNA libraries.
[0074] The full length of the cDNA encoding human INTERCEPT 217
protein (FIG. 1; SEQ ID NO: 1) is 2895 nucleotide residues. The ORF
of this cDNA, nucleotide residues 215 to 1579 of SEQ ID NO: 1
(i.e., SEQ ID NO: 2), encodes a 455-amino acid transmembrane
protein (FIG. 1; SEQ ID NO: 3). The murine ORF (FIG. 1; SEQ ID NO:
92) comprises at least 962 nucleotide residues. The protein encoded
by the murine ORF comprises at least 320 amino acid residues (i.e.,
SEQ ID NO: 93), and is also a transmembrane protein.
[0075] The invention also includes purified human INTERCEPT 217
protein, both in the form of the immature 455 amino acid residue
protein (SEQ ID NO: 3) and in the form of the mature, approximately
435 amino acid residue protein (SEQ ID NO: 5). Mature human
INTERCEPT 217 protein can be synthesized without the signal
sequence polypeptide at the amino terminus thereof, or it can be
synthesized by generating immature INTERCEPT 217 protein and
cleaving the signal sequence therefrom.
[0076] The invention thus includes purified murine INTERCEPT 217
protein, both in the immature form comprising the 320 amino acid
residues of SEQ ID NO: 93 and in the mature form comprising the
approximately 305 carboxyl terminal amino acid residues of SEQ ID
NO: 93 (i.e., comprising SEQ ID NO: 95). Mature murine INTERCEPT
217 protein can be synthesized without the signal sequence
polypeptide at the amino terminus thereof, or it can be synthesized
by generating immature INTERCEPT 217 protein and cleaving the
signal sequence therefrom.
[0077] In addition to full length mature and immature human and
murine INTERCEPT 217 proteins, the invention includes fragments,
derivatives, and variants of these INTERCEPT 217 proteins, as
described herein. These proteins, fragments, derivatives, and
variants are collectively referred to herein as INTERCEPT 217
polypeptides of the invention or INTERCEPT 217 proteins of the
invention.
[0078] The invention also includes nucleic acid molecules which
encode an INTERCEPT 217 polypeptide of the invention. Such nucleic
acids include, for example, a DNA molecule having the nucleotide
sequence listed in SEQ ID NO: 1, in SEQ ID NO: 92 (i.e., the murine
ORF), or in some portion of either of these, such as the portion
which encodes mature human INTERCEPT 217 protein, immature human
INTERCEPT 217 protein, or a domain of human INTERCEPT 217 protein.
These nucleic acids are collectively referred to as INTERCEPT 217
nucleic acids of the invention.
[0079] INTERCEPT 217 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features. Each of these molecules is
included in the invention. As used herein, the term "family" is
intended to mean two or more proteins or nucleic acid molecules
having a common or similar domain structure and having sufficient
amino acid or nucleotide sequence identity as defined herein.
Family members can be from either the same or different species.
For example, a family can comprise two or more proteins of human
origin, or can comprise one or more proteins of human origin and
one or more of non-human origin (e.g., the human and murine
INTERCEPT 217 proteins described herein).
[0080] A common domain present in INTERCEPT 217 proteins is a
signal sequence. As used herein, a signal sequence includes a
peptide of at least about 10 amino acid residues in length which
occurs at the amino terminus of membrane-bound proteins and which
contains at least about 45% hydrophobic amino acid residues such as
alanine, leucine, isoleucine, phenylalanine, proline, tyrosine,
tryptophan, or valine. In a preferred embodiment, a signal sequence
contains at least about 10 to 35 amino acid residues, preferably
about 10 to 20 amino acid residues, and has at least about 35-60%,
more preferably 40-50%, and more preferably at least about 45%
hydrophobic residues. A signal sequence serves to direct a protein
containing such a sequence to a lipid bilayer. Thus, in one
embodiment, a INTERCEPT 217 protein contains a signal sequence
corresponding to about amino acid residues 1 to 20 of SEQ ID NO: 3
(SEQ ID NO: 4). The signal sequence is cleaved during processing of
the mature protein.
[0081] INTERCEPT 217 proteins can include an extracellular domain.
As used herein, an "extracellular domain" refers to a portion of a
protein which is localized to the non-cytoplasmic side of a lipid
bilayer of a cell when a nucleic acid encoding the protein is
expressed in the cell. The human INTERCEPT 217 protein
extracellular domain is located from about amino acid residue 21 to
about amino acid residue 383 of SEQ ID NO: 3 (SEQ ID NO: 6). The
murine INTERCEPT 217 protein extracellular domain is located from
about amino acid residue 17 to about amino acid residue 213 of SEQ
ID NO: 93 (SEQ ID NO: 96).
[0082] In addition, INTERCEPT 217 includes a transmembrane domain.
As used herein, a "transmembrane domain" refers to an amino acid
sequence which is at least about 20 to 25 amino acid residues in
length and which contains at least about 65-70% hydrophobic amino
acid residues such as alanine, leucine, phenylalanine, protein,
tyrosine, tryptophan, or valine. In a preferred embodiment, a
transmembrane domain contains at least about 15 to 30 amino acid
residues, preferably about 20-25 amino acid residues, and has at
least about 60-80%, more preferably 65-75%, and more preferably at
least about 70% hydrophobic residues. Thus, in one embodiment, an
INTERCEPT 217 protein of the invention contains a transmembrane
domain corresponding to about amino acid residues 384 to 403 of SEQ
ID NO: 3 (SEQ ID NO: 7) or to about amino acid residues 214 to 233
of SEQ ID NO: 93 (SEQ ID NO: 97).
[0083] The present invention includes INTERCEPT 217 proteins having
a cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. As used herein, a
"cytoplasmic domain" refers to a portion of a protein which is
localized to the cytoplasmic side of a lipid bilayer of a cell when
a nucleic acid encoding the protein is expressed in the cell. The
human INTERCEPT 217 cytoplasmic domain is located from about amino
acid residue 404 to amino acid residue 455 of SEQ ID NO: 3 (SEQ ID
NO: 8). The murine INTERCEPT 217 cytoplasmic domain is located from
about amino acid residue 234 to amino acid residue 320 of SEQ ID
NO: 93 (SEQ ID NO: 98).
[0084] In one embodiment, the amino acid residues of human
INTERCEPT 217 corresponding to SEQ ID NO: 8 are part of an
extracellular domain, and the amino acid residues corresponding to
SEQ ID NO: 6 are part of a cytoplasmic domain. In another
embodiment, the amino acid residues of murine INTERCEPT 217
corresponding to SEQ ID NO: 98 are part of an extracellular domain,
and the amino acid residues corresponding to SEQ ID NO: 96 are part
of a cytoplasmic domain.
[0085] INTERCEPT 217 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Tables IA
(for human INTERCEPT 217) and IB (for murine INTERCEPT 217), as
predicted by computerized sequence analysis of INTERCEPT 217
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of INTERCEPT 217 with the information in
the PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, or 10 or more of the
post-translational modification sites listed in Tables IA and
IB.
1TABLE IA Amino Acid Type of Potential Modification Site Residues
Amino Acid or Domain SEQ ID NO: 3 Sequence N-glycosylation site 107
to 110 NASG 272 to 275 NCSS 301 to 304 NTSV 362 to 365 NQTH 368 to
371 NVSV Protein kinase C phosphorylation site 120 to 122 TLR 192
to 194 SNR 295 to 297 SLR Casein kinase II phosphorylation site 199
to 202 SVPE 440 to 443 TPPD Tyrosine Kinase Phosphorylation Site
282 to 289 KRPEEHLY N-myristoylation site 8 to 13 GTLLCM 19 to 24
GTPDSE 103 to 108 GVFVNA 179 to 184 GLSATH 323 to 328 GSRDGS 348 to
353 GLFVCL 390 to 395 GCAVGL 449 to 454 GQASTS Leucine zipper
pattern 45 to 66 See FIG. 1 Leucine rich repeat amino terminal 33
to 61 See FIG. 1 domain (LLRNT) Leucine rich repeat (LRR) Domain 62
to 85 See FIG. 1 86 to 109 See FIG. 1 110 to 133 See FIG. 1 134 to
157 See FIG. 1 158 to 181 See FIG. 1 184 to 207 See FIG. 1 Leucine
rich repeat carboxyl terminal 219 to 274 See FIG. 1 (LLRCT)
domain
[0086]
2TABLE IB Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 93 Sequence N-glycosylation site
102 to 105 NCSV 131 to 134 NTSV 192 to 195 NQTL 198 to 201 NVSV
cAMP- and cGMP-dependent protein 280 to 283 RKAS kinase site
Protein kinase C phosphorylation site 125 to 127 SLR 143 to 145 SPK
279 to 281 SRK Casein kinase II phosphorylation site 29 to 32 SIPE
273 to 276 TPPD N-myristoylalion site 9 to 14 GLGLTR 178 to 183
GVFVCL 220 to 225 GCIVGL 239 to 244 GCCHCC Amidation Site 293 to
296 PGKK Immunoglobulin Domain 14 to 37 See FIG. 1 Leucine rich
repeat (LRR) Domain 49 to 104 See FIG. 1 Leucine rich repeat
carboxyl terminal 123 to 184 See FIG. 1 (LLRCT) domain
[0087] Among the domains that occur in INTERCEPT 217 proteins are
LRR domains, LRRNT domains, LRRCT domains, and immunoglobulin
domains. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to one of these domains. In other embodiments, the protein has at
least one of each of the LRR, LRRNT, and LRRCT domains described
herein in Tables IA and IB. In other embodiments, the protein has
at least one LRRNT domain, at least one LRRCT domain, and a
plurality of (e.g., 2, 3, 4, or more) LRR domains.
[0088] One or more LRR domains are present in a variety of proteins
involved in protein-protein interactions. Such proteins include,
for example, proteins involved in signal transduction, cell-to-cell
adhesion, cell-to-extracellular matrix adhesion, cell development,
DNA repair, RNA processing, and cellular molecular recognition
processes. Specialized LRR domains, designated LRR amino terminal
(LRRNT) domains and LRR carboxyl terminal (LRRCT) domains often
occur near the amino and carboxyl, respectively, ends of a series
of LRR domains. Human INTERCEPT 217 protein has eight clustered LRR
domains, including (from the amino terminus toward the carboxyl
terminus of INTERCEPT 217) an LRRNT domain, six LRR domains, and an
LRRCT domain.
[0089] The organization of LRR domains in human INTERCEPT 217
protein closely mirrors the organization of LRR domains in human
platelet glycoprotein IB alpha chain precursor (GP-IB-alpha), which
also has eight clustered LRR domains from about amino acid residue
19 to about amino acid residue 281 thereof. The eight LRR domains
of GP-IB-alpha include an LRRNT domain at the end of the cluster
nearest the amino terminus of GP-IB-alpha and an LRRCT domain at
the end of the cluster nearest the carboxyl terminus of
GP-IB-alpha. GP-IB-alpha is a membrane-bound protein of human
platelets that is involved in binding of von Willebrand's factor
and in aggregation of platelets during thrombus formation. Thus,
INTERCEPT 217 is involved in both normal and aberrant physiological
activities involving blood clotting and thrombus formation.
Examples of disorders involving such activities include, for
example, stroke, embolism (e.g., cerebral, renal, and pulmonary
emboli), hemophilia, restenotic injury, prosthesis-associated
thrombogenesis, atherosclerosis, and arteriosclerosis.
[0090] INTERCEPT 217 is involved in one or more physiological
processes in which these other LRR domain-containing proteins are
involved, namely binding of cells with extracellular proteins such
as soluble extracellular proteins and cell surface proteins of
other cells.
[0091] Human INTERCEPT 217 comprises a leucine zipper region at
about amino acid residue 45 to about amino acid residue 66 (i.e.,
45 LsctglgLqdvpaeLpaa tadL 66). Leucine zipper regions are known to
be involved in dimerization of proteins. Leucine zipper regions
interact with one another, leading to formation of homo- or
hetero-dimers between proteins, depending on their identity. The
presence in INTERCEPT 217 of a leucine zipper region is a further
indication that this protein is involved in protein-protein
interactions.
[0092] The amino acid sequence of human INTERCEPT 217 protein
includes multiple potential proline-rich Src homology 3 (SH3)
domain binding sites in the cytoplasmic portion of the protein. SH3
domains mediate specific assembly of protein complexes, presumably
by interacting with proline-rich protein domains (Morton and
Campbell (1994) Curr. Biol. 4:615-617). SH3 domains also mediate
interactions between proteins involved in transmembrane signal
transduction. Coupling of proteins mediated by SH3 domains has been
implicated in a variety of physiological systems, including those
involving regulation of cell growth and proliferation, endocytosis,
and activation of respiratory burst.
[0093] SH3 domains have been described in the art (e.g., Mayer et
al. (1988) Nature 332:272-275; Musacchio et al. (1992) FEBS Lett.
307:55-61; Pawson and Schlessinger (1993) Curr. Biol. 3:434-442;
Mayer and Baltimore (1993) Trends Cell Biol. 3:8-13; Pawson (1993)
Nature 373:573-580), and occur in a variety of cytoplasmic
proteins, including several (e.g., protein tyrosine kinases)
involved in transmembrane signal transduction. Among the proteins
in which one or more SH3 domains occur are protein tyrosine kinases
such as those of the Src, Abl, Bkt, Csk and ZAP70 families,
mammalian phosphatidylinositol-specific phospholipases C-gamma-1
and -2, mammalian phosphatidylinositol 3-kinase regulatory p85
subunit, mammalian Ras GTPase-activating protein (GAP), proteins
which mediate binding of guanine nucleotide exchange factors and
growth factor receptors (e.g., vertebrate GRB2, Caenorhabditis
elegans sem-5, and Drosophila DRK proteins), mammalian Vav
oncoprotein, guanidine nucleotide releasing factors of the CDC 25
family (e.g., yeast CDC25, yeast SCD25, and fission yeast ste6
proteins), MAGUK proteins (e.g., mammalian tight junction protein
ZO-1, vertebrate erythrocyte membrane protein p55, C. elegans
protein lin-2, rat protein CASK, and mammalian synaptic proteins
SAP90/PSD-95, CHAPSYN-110/PSD-93, SAP97/DLG1, and SAP102), proteins
which interact with vertebrate receptor protein tyrosine kinases
(e.g., mammalian cytoplasmic protein Nck and oncoprotein Crk),
chicken Src substrate p80/85 protein (cortactin), human hemopoietic
lineage cell specific protein Hs1, mammalian
dihydrouridine-sensitive L-type calcium channel beta subunit, human
myasthenic syndrome antigen B (MSYB), mammalian neutrophil
cytosolic activators of NADPH oxidase (e.g., p47 {NCF-1}, p67
{NCF-2}, and C. elegans protein B0303.7), myosin heavy chains
(MYO3) from amoebae, from slime molds, and from yeast, vertebrate
and Drosophila spectrin and fodrin alpha chain proteins, human
amphiphysin, yeast actin-binding proteins ABP1 and SLA3, yeast
protein BEM1, fission yeast protein scd2 (ral3), yeast BEM1-binding
proteins B012 (BEB1) and BOB1 (BOI1), yeast fusion protein FUS1,
yeast protein RSV167, yeast protein SSU81, yeast hypothetical
proteins YAR014c, YFR024c, YHL002w, YHR016c, YJL020C, and YHR114w,
hypothetical fission yeast protein SpAC12C2.05c, and C. elegans
hypothetical protein F42H10.3. Of these proteins, multiple SH3
domains occur in vertebrate GRB2 protein, C. elegans sem-5 protein,
Drosophila DRK protein, oncoprotein Crk, mammalian neutrophil
cytosolic activators of NADPH oxidase p47 and p67, yeast protein
BEM1, fission yeast protein scd2, yeast hypothetical protein
YHR114w, mammalian cytoplasmic protein Nck, C. elegans neutrophil
cytosolic activator of NADPH oxidase B0303.7, and yeast
actin-binding protein SLA1. Of these proteins, three or more SH3
domains occur in mammalian cytoplasmic protein Nck, C. elegans
neutrophil cytosolic activator of NADPH oxidase B0303.7, and yeast
actin-binding protein SLA1. The presence of SH3 domain binding
sites in INTERCEPT 217 indicates that INTERCEPT 217 interacts with
one or more of these and other SH3 domain-containing proteins and
is thus involved in physiological processes in which one or more of
these or other SH3 domain-containing proteins are involved.
[0094] Human INTERCEPT 217 exhibits amino acid sequence similarity
to porcine ribonuclease inhibitor, a protein which binds with high
affinity to pancreatic ribonucleases and inhibits their activity.
INTERCEPT 217 thus is involved with similar physiological processes
in humans. An alignment of the amino acid sequences of human
INTERCEPT 217 and porcine ribonuclease inhibitor protein (SwissProt
Accession number P10775) is shown in FIG. 1G. In this alignment
(made using the ALIGN software {Myers and Miller (1989) CABIOS,
ver. 2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4), the proteins are 20.5% identical. An
alignment of human (SEQ ID NO: 3) and murine INTERCEPT 217 amino
acid sequences (SEQ ID NO: 93; made using BESTFIT software,
BLOSUM62 scoring matrix, gap opening penalty=12, frameshift gap
penalty=5, gap extension penalty=4). In this alignment, the human
and murine amino acid sequences are 71.3% identical in the
overlapping region. Alignment of human and murine INTERCEPT 217
ORFs indicated 79.9% nucleotide sequence identity in the
overlapping region.
[0095] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 217 protein includes an approximately 20 (i.e., 18, 19,
20, 21, or 22) amino acid residue signal peptide (amino acid
residues 1 to 20 of SEQ ID NO: 3; SEQ ID NO: 4) preceding the
mature INTERCEPT 217 protein (i.e., approximately amino acid
residues 21 to 455 of SEQ ID NO: 3; SEQ ID NO: 5). In one
embodiment, human INTERCEPT 217 protein includes an extracellular
domain (amino acid residues 21 to 383 of SEQ ID NO: 3; SEQ ID NO:
6); a transmembrane domain (amino acid residues 384 to 403 of SEQ
ID NO: 3; SEQ ID NO: 7); and a cytoplasmic domain (amino acid
residues 404 to 455 of SEQ ID NO: 3; SEQ ID NO: 8). In an
alternative embodiment, human INTERCEPT 217 protein includes a
cytoplasmic domain (amino acid residues 21 to 383 of SEQ ID NO: 3;
SEQ ID NO: 6); a transmembrane domain (amino acid residues 384 to
403 of SEQ ID NO: 3; SEQ ID NO: 7); and an extracellular domain
(amino acid residues 404 to 455 of SEQ ID NO: 3; SEQ ID NO: 8).
[0096] The SIGNALP program predicted that murine INTERCEPT 217
protein includes an approximately 15 (i.e., 13, 14, 15, 16, or 17)
amino acid residue signal peptide (amino acid residues 1 to 16 of
SEQ ID NO: 93; SEQ ID NO: 94) preceding the mature INTERCEPT 217
protein (i.e., approximately amino acid residues 16 to 320 of SEQ
ID NO: 93; SEQ ID NO: 95). In one embodiment, murine INTERCEPT 217
protein includes an extracellular domain (amino acid residues 16 to
213 of SEQ ID NO: 93; SEQ ID NO: 96); a transmembrane domain (amino
acid residues 214 to 233 of SEQ ID NO: 93; SEQ ID NO: 97); and a
cytoplasmic domain (amino acid residues 234 to 320 of SEQ ID NO:
93; SEQ ID NO: 98). In an alternative embodiment, murine INTERCEPT
217 protein includes a cytoplasmic domain (amino acid residues 16
to 213 of SEQ ID NO: 93; SEQ ID NO: 96); a transmembrane domain
(amino acid residues 214 to 233 of SEQ ID NO: 93; SEQ ID NO: 97);
and an extracellular domain (amino acid residues 234 to 320 of SEQ
ID NO: 93; SEQ ID NO: 98).
[0097] FIG. 1F depicts a hydrophilicity plot of human INTERCEPT 217
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 20 of SEQ ID NO: 3 is the signal sequence
of human INTERCEPT 217 (SEQ ID NO: 4). The hydrophobic region which
corresponds to amino acid residues 384 to 403 of SEQ ID NO: 3 is
the transmembrane domain of human INTERCEPT 217 (SEQ ID NO: 7). As
described elsewhere herein, relatively hydrophilic regions are
generally located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human INTERCEPT 217
protein from about amino acid residue 355 to about amino acid
residue 380 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 190 to
about amino acid residue 210 appears not to be located at or near
the surface. FIG. 1L depicts a hydrophilicity plot of murine
INTERCEPT 217 protein.
[0098] The predicted molecular weight of human INTERCEPT 217
protein without modification and prior to cleavage of the signal
sequence is about 49.8 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 217 protein without modification and
after cleavage of the signal sequence is about 47.4
kilodaltons.
[0099] The predicted molecular weight of murine INTERCEPT 217
protein, without modification and prior to cleavage of the signal
sequence is about 35.5 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 217 protein without modification and
after cleavage of the signal sequence is about 33.8
kilodaltons.
[0100] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding INTERCEPT 217 is expressed in
two forms, one having an apparent approximate size of about 6
kilobases and another having an apparent approximate size of about
3 kilobases (i.e., corresponding to the size of the INTERCEPT 217
cDNA). These experiments indicated that INTERCEPT 217 is expressed
in the tissues listed in Table II, wherein "++" indicates strong
expression, "+" indicates lower expression, and "+/-" indicates
still lower expression.
3 TABLE II Animal Tissue Relative Level of Expression Human
pancreas ++ skeletal muscle + heart +/- brain +/- placenta +/- lung
+/- liver +/- kidney +/-
[0101] An assay to detect possible secretion of INTERCEPT 217
protein was negative. This assay was performed as follows. About
8.times.10.sup.5 293T cells were incubated at 37.degree. C. in
wells containing growth medium (Dulbecco's modified Eagle's medium
{DMEM} supplemented with 10% fetal bovine serum) under a 5% (v/v)
CO.sub.2, 95% air atmosphere to about 60-70% confluence. The cells
were then transfected using a standard transfection mixture
comprising 2 micrograms of DNA and 10 microliters of
LIPOFECTAMINE.TM. (GIBCO/BRL Catalog no. 18342-012) per well. The
transfection mixture was maintained for about 5 hours, and then
replaced with fresh growth medium and maintained in an air
atmosphere. Each well was gently rinsed twice with DMEM which did
not contain methionine or cysteine (DMEM-MC; ICN Catalog no.
16-424-54). About 1 milliliter of DMEM-MC and about 50 microcuries
of TRANS-35S.TM. reagent (ICN Catalog no.51006) were added to each
well. The wells were maintained under the 5% CO.sub.2 atmosphere
described above and incubated at 37.degree. C. for a selected
period. Following incubation, 150 microliters of conditioned medium
was removed, centrifuged to remove floating cells and debris, and
combined with 150 microliters of 2.times. SDS sample buffer. The
sample was boiled at 100.degree. C. for 5 minutes, and about 40
microliters of sample was loaded onto a NOVEX.TM. 4-20% (w/v)
SDS-containing polyacrylamide gel. Following electrophoresis, the
gel was stained for protein and dried according to the NOVEX.TM.
procedure. The dried gel was exposed to radiation-sensitive film in
order to detect the position of secreted proteins.
[0102] Biological function of INTERCEPT 217 proteins, nucleic acids
encoding them, and modulators of these molecules
[0103] INTERCEPT 217 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observation that INTERCEPT 217 is expressed in pancreas, skeletal
muscle, heart, brain, placenta, lung, liver, and kidney tissue,
INTERCEPT 217 protein is involved in one or more biological
processes which occur in these tissues. In particular, INTERCEPT
217 is involved in modulating binding of cells of one or more of
these tissues with proteins of other cells or with secreted
proteins which occur in the extracellular environment of one or
more of these tissues. INTERCEPT 217 is especially implicated in
disorders of skeletal muscle (e.g., protection of skeletal muscle
cells during ischemia and in bruised tissue), and more especially
those involving the pancreas (e.g., diabetes, pancreatitis, and the
like).
[0104] Structural similarity of human INTERCEPT 217 protein with
human GP-IB-alpha indicates that INTERCEPT 217 is involved in
binding extracellular proteins and other ligands. INTERCEPT 217
protein is involved in binding of proteins which induce release of
pancreatic digestive enzymes (e.g., amylases, lipases, proteases,
and nucleases) from pancreatic cells, and in disorders associated
with insufficient or inappropriate release of such enzymes.
INTERCEPT 217 protein is also involved in binding of secreted
pancreatic digestive enzymes in pancreatic tissue, thereby
protecting pancreatic tissue from autodigestion. Thus, INTERCEPT
217 protein is involved in disorders such as diabetes,
pancreatitis, and pancreatic carcinoma which involve acute and
chronic autodigestive damage to pancreatic tissues. Homology of
INTERCEPT 217 protein with -porcine ribonuclease inhibitor protein
is a further indication of this involvement.
[0105] The presence of LRR domains in human INTERCEPT 217 protein
and detection of its expression in a variety of tissues indicate
that the tissue protective functions of INTERCEPT 217 are not
limited to pancreatic tissues, but are involved in protection of
other tissues as well (e.g., skeletal muscle, heart, brain,
placenta, lung, liver, prostate, and kidney tissues). INTERCEPT 217
is therefore involved in protection of these (and likely other
tissues) from the effects of inflammation, autoimmunity, infection,
and acute and chronic traumas.
[0106] Presence in INTERCEPT 217 protein of multiple SH3 domain
binding sites indicates that INTERCEPT 217 protein interacts with
one or more SH3 domain-containing proteins. Thus, INTERCEPT 217
protein mediates binding of proteins (i.e., binding of proteins to
INTERCEPT 217 and to one another to form protein complexes) in
cells in which it is expressed. INTERCEPT 217 is also involved in
transduction of signals between the exterior environment of cells
(i.e., including from other cells) and the interior of cells in
which it is expressed. INTERCEPT 217 mediates regulation of cell
growth and proliferation, endocytosis, activation of respiratory
burst, and other physiological processes triggered by transmission
of a signal via a protein with which INTERCEPT 217 interacts.
[0107] INTERCEPT 217-related molecules can be used to modulate one
or more of the activities in which INTERCEPT 217 is involved and
can also be used to prevent, diagnose, or treat one or more of the
disorders in which INTERCEPT 217 is involved.
[0108] INTERCEPT 217 polypeptides, nucleic acids, and modulators
thereof, can, for example, be used to treat pancreatic disorders,
such as pancreatitis (e.g., acute hemorrhagic pancreatitis and
chronic pancreatitis), pancreatic cysts (e.g., congenital cysts,
pseudocysts, and benign or malignant neoplastic cysts), pancreatic
tumors (e.g., pancreatic carcinoma and adenoma), diabetes mellitus
(e.g., insulin- and non-insulin-dependent types,. impaired glucose
tolerance, and gestational diabetes), and islet cell tumors (e.g.,
insulinomas, adenomas, Zollinger-Ellison syndrome, glucagonomas,
and somatostatinoma). INTERCEPT 217 polypeptides, nucleic acids,
and modulators thereof can be used to prognosticate, diagnose,
inhibit, prevent, or alleviate one or more of these disorders.
[0109] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat disorders of
skeletal muscle, such as muscular dystrophy (e.g., Duchenne
muscular dystrophy, Becker muscular dystrophy, Emery-Dreifuss
muscular dystrophy, limb-girdle muscular dystrophy,
facioscapulohumeral muscular dystrophy, myotonic dystrophy,
oculopharyngeal muscular dystrophy, distal muscular dystrophy, and
congenital muscular dystrophy), motor neuron diseases (e.g.,
amyotrophic lateral sclerosis, infantile progressive spinal
muscular atrophy, intermediate spinal muscular atrophy, spinal
bulbar muscular atrophy, and adult spinal muscular atrophy),
myopathies (e.g., inflammatory myopathies {e.g., dermatomyositis
and polymyositis}, myotonia congenita, paramyotonia congenita,
central core disease, nemaline myopathy, myotubular myopathy, and
periodic paralysis), and metabolic diseases of muscle (e.g.,
phosphorylase deficiency, acid maltase deficiency,
phosphofructokinase deficiency, debrancher enzyme deficiency,
mitochondrial myopathy, carnitine deficiency, carnitine palmityl
transferase deficiency, phosphoglycerate kinase deficiency,
phosphoglycerate mutase deficiency, lactate dehydrogenase
deficiency, and myoadenylate deaminase deficiency). INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0110] Because INTERCEPT 217 exhibits expression in heart tissue,
INTERCEPT 217 nucleic acids, proteins, and modulators thereof can
be used to treat heart disorders (e.g., ischemic heart disease,
atherosclerosis, hypertension, angina pectoris, hypertrophic
cardiomyopathy, and congenital heart disease). INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0111] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat disorders of
the brain, such as cerebral edema, hydrocephalus, brain
herniations, iatrogenic disease (due to, e.g., infection, toxins,
or drugs), inflammations (e.g., bacterial and viral meningitis,
encephalitis, and cerebral toxoplasmosis), cerebrovascular diseases
(e.g., hypoxia, ischemia, and infarction, intracranial hemorrhage
and vascular malformations, and hypertensive encephalopathy), and
tumors (e.g., neuroglial tumors, neuronal tumors, tumors of pineal
cells, meningeal tumors, primary and secondary lymphomas,
intracranial tumors, and medulloblastoma), and to treat injury or
trauma to the brain. INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0112] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat placental
disorders, such as toxemia of pregnancy (e.g., preeclampsia and
eclampsia), placentitis, and spontaneous abortion. INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0113] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat pulmonary
(i.e., lung) disorders, such as atelectasis, cystic fibrosis,
rheumatoid lung disease, pulmonary congestion, pulmonary edema,
chronic obstructive airway disease (e.g., emphysema, chronic
bronchitis, bronchial asthma, and bronchiectasis), diffuse
interstitial diseases (e.g., sarcoidosis, pneumoconiosis,
hypersensitivity pneumonitis, Goodpasture's syndrome, idiopathic
pulmonary hemosiderosis, pulmonary alveolar proteinosis,
desquamative interstitial pneumonitis, chronic interstitial
pneumonia, fibrosing alveolitis, hamman-rich syndrome, pulmonary
eosinophilia, diffuse interstitial fibrosis, Wegener's
granulomatosis, lymphomatoid granulomatosis, and lipid pneumonia),
and tumors (e.g., bronchogenic carcinoma, bronchioloalveolar
carcinoma, bronchial carcinoid, hamartoma, and mesenchymal tumors).
INTERCEPT 217 polypeptides, nucleic acids, and modulators thereof
can be used to prognosticate, diagnose, inhibit, prevent, or
alleviate one or more of these disorders.
[0114] In another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat cardiovascular
disorders, such as ischemic heart disease (e.g., angina pectoris,
myocardial infarction, and chronic ischemic heart disease),
hypertensive heart disease, pulmonary heart disease, valvular heart
disease (e.g., rheumatic fever and rheumatic heart disease,
endocarditis, mitral valve prolapse, and aortic valve stenosis),
congenital heart disease (e.g., valvular and vascular obstructive
lesions, atrial or ventricular septal defect, and patent ductus
arteriosus), and myocardial disease (e.g., myocarditis, congestive
cardiomyopathy, and hypertrophic cariomyopathy). INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0115] In yet another example, INTERCEPT 217 polypeptides, nucleic
acids, and modulators thereof, can be used to treat hepatic (i.e.,
liver) disorders, such as jaundice, hepatic failure, hereditary
hyperbiliruinemias (e.g., Gilbert's syndrome, Crigler-Naijar
syndromes and Dubin-Johnson and Rotor's syndromes), hepatic
circulatory disorders (e.g., hepatic vein thrombosis and portal
vein obstruction and thrombosis), hepatitis (e.g., chronic active
hepatitis, acute viral hepatitis, and toxic and drug-induced
hepatitis), cirrhosis (e.g., alcoholic cirrhosis, biliary
cirrhosis, and hemochromatosis), and malignant tumors (e.g.,
primary carcinoma, hepatoblastoma, and angiosarcoma). INTERCEPT 217
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0116] In still another example, INTERCEPT 217 polypeptides,
nucleic acids, and modulators thereof, can be used to treat renal
(i.e., kidney) disorders, such as glomerular diseases (e.g., acute
and chronic glomerulonephritis, rapidly progressive
glomerulonephritis, nephrotic syndrome, focal proliferative
glomerulonephritis, glomerular lesions associated with systemic
disease, such as systemic lupus erythematosus, Goodpasture's
syndrome, multiple myeloma, diabetes, neoplasia, sickle cell
disease, and chronic inflammatory diseases), tubular diseases
(e.g., acute tubular necrosis and acute renal failure, polycystic
renal disease, medullary sponge kidney, medullary cystic disease,
nephrogenic diabetes, and renal tubular acidosis),
tubulointerstitial diseases (e.g., pyelonephritis, drug and toxin
induced tubulointerstitial nephritis, hypercalcemic nephropathy,
and hypokalemic nephropathy), acute and rapidly progressive renal
failure, chronic renal failure, nephrolithiasis, vascular diseases
(e.g., hypertension and nephrosclerosis, microangiopathic hemolytic
anemia, atheroembolic renal disease, diffuse cortical necrosis, and
renal infarcts), and tumors (e.g., renal cell carcinoma and
nephroblastoma). INTERCEPT 217 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0117] INTERCEPT 297
[0118] A cDNA clone (designated jthsa085g01) encoding at least a
portion of human INTERCEPT 297 protein was isolated from a human
fetal spleen cDNA library. The human INTERCEPT 297 protein is
predicted by structural analysis to be a transmembrane protein.
[0119] The full length of the cDNA encoding human INTERCEPT 297
protein (FIG. 2.; SEQ ID NO: 9) is 1518 nucleotide residues. The
ORF of this cDNA, nucleotide residues 40 to 1152 of SEQ ID NO: 9
(i.e., SEQ ID NO: 10), encodes a 371-amino acid transmembrane
protein (FIG. 2; SEQ ID NO: 11).
[0120] The invention thus includes purified human INTERCEPT 297
protein, both in the form of a 371 amino acid residue protein (SEQ
ID NO: 11) in which the `signal sequence` (i.e., the portion of
INTERCEPT 297 protein corresponding to amino acid residues 1 to 18)
described in this section is not cleaved and in the form of a 353
amino acid residue protein (SEQ ID NO: 13) in which the `signal
sequence` is cleaved. Human INTERCEPT 297 protein can exist with or
without the signal sequence polypeptide at the amino terminus
thereof. It is likely that the `signal sequence` is not cleaved,
but is instead a transmembrane domain of the protein.
[0121] In addition to full length human INTERCEPT 297 proteins, the
invention includes fragments, derivatives, and variants of these
INTERCEPT 297 proteins, as described herein. These proteins,
fragments, derivatives, and variants are collectively referred to
herein as INTERCEPT 297 polypeptides of the invention or INTERCEPT
297 proteins of the invention.
[0122] The invention also includes nucleic acid molecules which
encode an INTERCEPT 297 polypeptide of the invention. Such nucleic
acids include, for example, a DNA molecule having the nucleotide
sequence listed in SEQ ID NO: 9 or some portion thereof, such as
the portion which encodes mature INTERCEPT 297 protein, immature
INTERCEPT 297 protein, or a domain of INTERCEPT 297 protein. These
nucleic acids are collectively referred to as INTERCEPT 297 nucleic
acids of the invention.
[0123] INTERCEPT 297 proteins and nucleic acid molecules encoding
them comprise a family of molecules having certain conserved
structural and functional features.
[0124] A common domain present in INTERCEPT 297 proteins is a
signal sequence. As used herein, a signal sequence includes a
peptide of at least about 10 amino acid residues in length which
occurs at the amino terminus of membrane-bound proteins and which
contains at least about 45% hydrophobic amino acid residues such as
alanine, leucine, isoleucine, phenylalanine, proline, tyrosine,
tryptophan, or valine. In a preferred embodiment, a signal sequence
contains at least about 10 to 35 amino acid residues, preferably
about 10 to 20 amino acid residues, and has at least about 35-60%,
more preferably 40-50%, and more preferably at least about 45%
hydrophobic residues. A signal sequence serves to direct a protein
containing such a sequence to a lipid bilayer. Thus, in one
embodiment, a INTERCEPT 297 protein contains a signal sequence
corresponding to about amino acid residues 1 to 18 of SEQ ID NO: 11
(SEQ ID NO: 12). The signal sequence can be cleaved during
processing of the mature protein, but it is likely that amino acid
residues 1 to 18 of SEQ ID NO: 11 represent a (non-cleaved)
transmembrane region of the protein.
[0125] INTERCEPT 297 proteins can include one or more extracellular
domains. In one embodiment of the human INTERCEPT 297 protein,
extracellular domains are located from about amino acid residues 19
to 47, from about amino acid residues 110 to 118, from about amino
acid residues 162 to 175, from about amino acid residues 234 to
260, and from about amino acid residues 313 to 319 of SEQ ID NO: 11
(SEQ ID NOs: 14-18, respectively). In an alternative embodiment,
extracellular domains are located from about amino acid residue 69
to 88, from about amino acid residue 138 to 144, from about amino
acid residue 193 to 215, from about amino acid residue 284 to 292,
and from about amino acid residue 337 to 371 of SEQ ID NO: 11 (SEQ
ID NOs: 28-32, respectively).
[0126] In addition, INTERCEPT 297 includes one or more
transmembrane domains. In one embodiment, a INTERCEPT 297 protein
of the invention contains transmembrane domains corresponding to
about amino acid residues 48 to 68, about amino acid residues 89 to
109, about amino acid residues 119 to 137, about amino acid
residues 145 to 161, about amino acid residues 176 to 192, about
amino acid residues 216 to 233, about amino acid residues 261 to
283, about amino acid residues 293 to 312, and about amino acid
residues 320 to 336 of SEQ ID NO: 11 (SEQ ID NOs: 19-27,
respectively). As indicated above, it is likely that the `signal
sequence` of INTERCEPT 297 is an additional (and non-cleaved)
transmembrane region.
[0127] The present invention includes INTERCEPT 297 proteins having
one or more cytoplasmic domains. In one embodiment of the human
INTERCEPT 297 protein, cytoplasmic domains are located from about
amino acid residue 69 to 88, from about amino acid residue 138 to
144, from about amino acid residue 193 to 215, from about amino
acid residue 284 to 292, and from about amino acid residue 337 to
371 of SEQ ID NO: 11 (SEQ ID NOs: 28-32, respectively). In an
alternative embodiment, cytoplasmic domains are located from about
amino acid residues 19 to 47, from about amino acid residues 110 to
118, from about amino acid residues 162 to 175, from about amino
acid residues 234 to 260, and from about amino acid residues 313 to
319 of SEQ ID NO: 11 (SEQ ID NOs: 14-18, respectively).
[0128] INTERCEPT 297 proteins typically comprise a variety of
potential post-translational modification sites (often within an
extracellular domain), such as those described herein in Table III,
as predicted by computerized sequence analysis of INTERCEPT 297
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of INTERCEPT 297 with the information in
the PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table III.
4TABLE III Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 11 Sequence N-glycosylation site
110 to 113 NMTS 269 to 272 NISS Protein kinase C phosphorylation
site 24 to 26 SAK 290 to 292 TTR 297 to 299 SLR Casein kinase II
phosphorylation site 78 to 81 SSVD 165 to 168 SKHD 245 to 248 TLED
354 to 357 SEQE N-myristoylation site 18 to 23 GSINTL 35 to 40
GCGGSK 53 to 58 GMFLGE 74 to 79 GQSDSS 147 to 152 GILATI 236 to 241
GSFSGN 268 to 273 GNISSI 280 to 285 GISVTK Amidation site 136 to
139 LGRR DUF6 domain 44 to 171 See FIG. 2
[0129] Among the domains that occur in INTERCEPT 297 protein is a
DUF6 domain. In one embodiment, the protein of the invention has at
least one domain that is at least 55%, preferably at least about
65%, more preferably at least about 75%, yet more preferably at
least about 85%, and most preferably at least about 95% identical
to this DUF6 domain.
[0130] The DUF6 domain is a transmembrane domain that is highly
conserved among eukaryote, prokaryote, and archae kingdoms. This
high degree of domain sequence conservation indicates that proteins
of the class which includes INTERCEPT 297 are involved in
fundamental membrane physiology of living cells. INTERCEPT 297
protein is therefore involved in disorders which are associated
with aberrant membrane function including, for example, disorders
involving abnormal membrane fluidity, disorders involving aberrant
transmembrane transport, disorders involving abnormal membrane
organization, disorders involving abnormal membrane synthesis,
disorders involving aberrant cell division, and the like.
[0131] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human
INTERCEPT 297 protein includes an approximately 18 (i.e., 16, 17,
18, 19, or 20) amino acid residue signal peptide (amino acid
residues 1 to 18 of SEQ ID NO: 11; SEQ ID NO: 12) preceding the
mature INTERCEPT 297 protein (i.e., approximately amino acid
residues 19 to 371 of SEQ ID NO: 11; SEQ ID NO: 13). In one
embodiment, human INTERCEPT 297 protein includes about five
extracellular domains (amino acid residues 19 to 47, 110 to 118,
162 to 175, 234 to 260, and 313 to 319 of SEQ ID NO: 11); about
nine transmembrane domains (amino acid residues 48 to 68, 89 to
109, 119 to 137, 145 to 161, 176 to 192, 216 to 233, 261 to 283,
293 to 312, and 320 to 326 of SEQ ID NO: 11); and about five
cytoplasmic domains (amino acid residues 69 to 88, 138 to 144, 193
to 215, 284 to 292, and 337 to 371 of SEQ ID NO: 11). In an
alternative embodiment, human INTERCEPT 297 protein includes about
five cytoplasmic domains (amino acid residues 19 to 47, 110 to 118,
162 to 175, 234 to 260, and 313 to 319 of SEQ ID NO: 11); about
nine transmembrane domains (amino acid residues 48 to 68, 89 to
109, 119 to 137, 145 to 161, 176 to 192, 216 to 233, 261 to 283,
293 to 312, and 320 to 326 of SEQ ID NO: 11); and about five
extracellular domains (amino acid residues 69 to 88, 138 to 144,
193 to 215, 284 to 292, and 337 to 371 of SEQ ID NO: 11).
[0132] FIG. 2D depicts a hydrophilicity plot of human INTERCEPT 297
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. Hydrophobic region corresponding to the
signal sequence and the transmembrane domains are observed in this
figure. As described elsewhere herein, relatively hydrophilic
regions are generally located at or near the surface of a protein,
and are more frequently effective immunogenic epitopes than are
relatively hydrophobic regions. For example, the region of human
INTERCEPT 297 protein from about amino acid residue 165 to about
amino acid residue 175 appears to be located at or near the surface
of the protein.
[0133] The predicted molecular weight of human INTERCEPT 297
protein without modification and prior to cleavage of the signal
sequence is about 40.2 kilodaltons. The predicted molecular weight
of the mature human INTERCEPT 297 protein without modification and
after cleavage of the signal sequence is about 38.2
kilodaltons.
[0134] Biological function of INTERCEPT 297 proteins, nucleic acids
encoding them, and modulators of these molecules
[0135] INTERCEPT 297 proteins are involved in disorders which
affect both tissues in which they are normally expressed and
tissues in which they are normally not expressed. Based on the
observation that INTERCEPT 297 is expressed in human fetal spleen,
INTERCEPT 297 protein is involved in one or more biological
processes which occur in fetal and spleen tissues. In particular,
INTERCEPT 297 is involved in modulating growth, proliferation,
survival, differentiation, and activity of cells including, but not
limited to, spleen and fetal cells of the animal in which it is
normally expressed. Thus, INTERCEPT 297 has a role in disorders
which affect these cells and their growth, proliferation, survival,
differentiation, and activity (e.g., hematologic and immune
disorders). Expression of INTERCEPT 297 in an animal is also
involved in modulating growth, proliferation, survival,
differentiation, and activity of cells and viruses which are
foreign to the host (i.e., bacterial, fungal, and viral
infections).
[0136] INTERCEPT 297 bears amino acid sequence similarity to
Caenorhabditis elegans protein C2G12.12, and therefore exhibits one
or more activities analogous to that protein.
[0137] INTERCEPT 297 nucleic acids, proteins, and modulators
thereof can be used to modulate the proliferation, differentiation,
or function of cells of the spleen (e.g., cells of the splenic
connective tissue, splenic smooth muscle cells, and endothelial
cells of the splenic blood vessels). INTERCEPT 297 nucleic acids,
proteins, and modulators thereof can also be used to modulate the
proliferation, differentiation, and function of cells that are
processed within the spleen (e.g., regenerated or phagocytized
within the spleen, erythrocytes, B and T lymphocytes, and
macrophages). Thus, INTERCEPT 297 nucleic acids, proteins, and
modulators thereof can be used to treat disorders of the spleen
(including disorders of the fetal spleen). Examples of splenic
disorders include, splenic lymphoma, splenomegaly, and phagocytotic
disorders (e.g., those in which macrophage engulfment of bacteria
and viruses in the bloodstream is inhibited). INTERCEPT 297
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0138] Structural analysis of INTERCEPT 297 and the presence of a
DUF6 domain therein indicate that INTERCEPT 297 is involved in
disorders which affect membrane structure and function. INTERCEPT
297 can be used to affect development and persistence of disorders
involving inappropriate membrane structure and function, such as
atherogenesis, arteriosclerosis, and various transmembrane
transport disorders. Other exemplary disorders for which INTERCEPT
297 is useful include disorders involving generation and
persistence of an immune response to bacterial, fungal, and viral
infections. INTERCEPT 297 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0139] The structure of INTERCEPT 297 is analogous to the
structures of integral membrane proteins responsible for
transmembrane transport of molecules such as sugars, ions, and the
like. INTERCEPT 297 is thus involved in one or more transmembrane
transport-related disorders such as cystic fibrosis, nerve
conduction disorders (e.g., pain and loss or failure of sensation),
muscle contraction disorders (e.g., cardiac insufficiency), metal
ion uptake disorders (e.g., hemochromatosis), and the like.
INTERCEPT 297 polypeptides, nucleic acids, and modulators thereof
can be used to prognosticate, diagnose, inhibit, prevent, or
alleviate one or more of these disorders.
[0140] TANGO 276
[0141] A cDNA clone (designated jthsa006e01) encoding at least a
portion of human TANGO 276 protein was isolated from a human fetal
spleen cDNA library. The human TANGO 276 protein is predicted by
structural analysis to be a secreted protein.
[0142] The full length of the cDNA encoding human TANGO 276 protein
(FIG. 3; SEQ ID NO: 33) is 2811 nucleotide residues. The ORF of
this cDNA, nucleotide residues 58 to 786 of SEQ ID NO: 33 (i.e.,
SEQ ID NO: 34), encodes a 243-amino acid secreted protein (FIG. 3;
SEQ ID NO: 35).
[0143] The invention thus includes purified human TANGO 276
protein, both in the form of the immature 243 amino acid residue
protein (SEQ ID NO: 35) and in the form of the mature,
approximately 223 amino acid residue protein (SEQ ID NO: 37).
Mature human TANGO 276 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 276 protein and
cleaving the signal sequence therefrom.
[0144] In addition to full length mature and immature human TANGO
276 proteins, the invention includes fragments, derivatives, and
variants of these TANGO 276 proteins, as described herein. These
proteins, fragments, derivatives, and variants are collectively
referred to herein as TANGO 276 polypeptides of the invention or
TANGO 276 proteins of the invention.
[0145] The invention also includes nucleic acid molecules which
encode a TANGO 276 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 33 or some portion thereof, such as the
portion which encodes mature TANGO 276 protein, immature TANGO 276
protein, or a domain of TANGO 276 protein. These nucleic acids are
collectively referred to as TANGO 276 nucleic acids of the
invention.
[0146] TANGO 276 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 276 protein and the murine
protein designated M-Sema-F (see Inagaki et al. (1995) FEBS Lett.
370:269-272), as shown in FIGS. 3F to 3H.
[0147] A common domain present in TANGO 276 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound proteins and which contains at
least about 45% hydrophobic amino acid residues such as alanine,
leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan,
or valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 35 amino acid residues, preferably about 10 to 20
amino acid residues, and has at least about 35-60%, more preferably
40-50%, and more preferably at least about 45% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer. Thus, in one embodiment, a
TANGO 276 protein contains a signal sequence corresponding to about
amino acid residues 1 to 20 of SEQ ID NO: 35 (SEQ ID NO: 36). The
signal sequence is cleaved during processing of the mature
protein.
[0148] TANGO 276 proteins can exist in a secreted form, such as a
mature protein having the amino acid sequence of amino acid
residues 21 to 243 of SEQ ID NO: 35 (SEQ ID NO: 37).
[0149] TANGO 276 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table IV,
as predicted by computerized sequence analysis of TANGO 276
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 276 with the information in the
PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, or all 8 of the
post-translational modification sites listed in Table IV.
5TABLE IV Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 35 Sequence N-glycosylation site
106 to 109 NQTE 121 to 124 NASH cAMP- or cGMP-dependent protein 43
to 46 RRFS kinase phosphorylation site Protein kinase C
phosphorylation site 194 to 196 SLK Casein kinase II
phosphorylation site 34 to 37 SSGE 57 to 60 TLTE N-myristoylation
site 16 to 21 GLGIGA 68 to 73 GAREAL Sema domain 53 to 141 See FIG.
3
[0150] A Sema domain occurs in human TANGO 276 protein. In one
embodiment, the protein of the invention has at least one domain
that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to this Sema
domain.
[0151] Sema domains occur in semaphorin proteins. Semaphorins are a
large family of secreted and transmembrane proteins, some of which
function as repellent signals during neural axon guidance. The Sema
domain and a variety of semaphorin proteins in which it occurs are
described, for example, in Winberg et al. (1998 Cell 95:903-916).
Sema domains also occur in human hepatocyte growth factor receptor
(SwissProt Accession no. P08581) and the similar neuronal and
epithelial transmembrane receptor protein (SwissProt Accession no.
P51805). The presence of a Sema domain in human TANGO 276 protein
indicates that TANGO 276 is involved in one or more physiological
processes in which the semaphorins are involved, has biological
activity in common with one or more of the semaphorins, or
both.
[0152] Human TANGO 276 protein exhibits considerable sequence
similarity to murine M-Sema F protein (GenBank Accession no.
S79463), as indicated herein in FIGS. 3F to 3H. FIGS. 3F to 3H
depict an alignment of the amino acid sequences of human TANGO 276
protein (SEQ ID NO: 35) and murine M-Sema F protein (SEQ ID NO:
65). In this alignment (pam120.mat scoring matrix, gap opening
penalty=12, gap extension penalty=4), the amino acid sequences of
the proteins are 76.1% identical. FIGS. 3I through 3R depict an
alignment of the nucleotide sequences of cDNA encoding human TANGO
276 protein (SEQ ID NOs: 33) and murine cDNA encoding M-Sema F
protein (SEQ ID NO: 66). In this alignment (pam120.mat scoring
matrix, gap opening penalty=12, gap extension penalty=4), the
nucleic acid sequences of the cDNAs are 79.7% identical. Thus,
TANGO 276 is related to murine M-Sema F and shares functional
similarities to that protein.
[0153] It is known that semaphorins are bi-functional, capable of
functioning either as attractive axonal guidance proteins or as
repellent axonal guidance proteins (Wong et al. (1997) Development
124:3597-3607). Furthermore, semaphorins bind with neuronal cell
surface proteins designated plexins, which are expressed on both
neuronal cells and cells of the immune system (Comeau et al. (1998)
Immunity 8:473-482; Jin and Strittmatter (1997) J. Neurosci.
17:6256-6263).
[0154] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
276 protein includes an approximately 20 (i.e., 18, 19, 20, 21, or
22) amino acid signal peptide (amino acid residues 1 to 20 of SEQ
ID NO: 35; SEQ ID NO: 36) preceding the mature TANGO 276 protein
(i.e., approximately amino acid residues 21 to 243 of SEQ ID NO:
34; SEQ ID NO: 37). Human TANGO 276 protein is a secreted
protein.
[0155] FIG. 3E depicts a hydrophilicity plot of human TANGO 276
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
about amino acid residues 1 to 20 of SEQ ID NO: 35 is the signal
sequence of human TANGO 276. As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. For example, the
region of human TANGO 276 protein from about amino acid residue 90
to about amino acid residue 105 appears to be located at or near
the surface of the protein, while the region from about amino acid
residue 170 to about amino acid residue 180 appears not to be
located at or near the surface.
[0156] The predicted molecular weight of human TANGO 276 protein
without modification and prior to cleavage of the signal sequence
is about 27.1 kilodaltons. The predicted molecular weight of the
mature human TANGO 276 protein without modification and after
cleavage of the signal sequence is about 24.8 kilodaltons.
[0157] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding TANGO 276 is expressed in the
tissues listed in Table V, wherein "++" indicates a greater level
of expression and "+" indicates a lower level of expression.
6 TABLE V Animal Tissue Relative Level of Expression Human heart ++
placenta ++ brain + lung + liver + skin + kidney + pancreas +
[0158] Biological function of TANGO 276 proteins, nucleic acids
encoding them, and modulators of these molecules
[0159] TANGO 276 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 276 is expressed in human heart and placenta tissues, to
a lesser extent in brain, lung, liver, skin, kidney, and pancreas
tissues, and in fetal spleen tissue, TANGO 276 protein is involved
in one or more biological processes which occur in these tissues.
In particular, TANGO 276 is involved in modulating growth,
proliferation, survival, differentiation, and activity of cells
including, but not limited to, heart, placenta, spleen, brain,
lung, liver, skin, kidney, and pancreas cells of the animal in
which it is normally expressed. Thus, TANGO 276 has a role in
disorders which affect these cells and their growth, proliferation,
survival, differentiation, and activity.
[0160] Because TANGO 276 exhibits expression in the heart, TANGO
276 nucleic acids, proteins, and modulators thereof can be used to
treat heart disorders. Examples of heart disorders with which TANGO
276 can be involved include ischemic heart disease,
atherosclerosis, hypertension, angina pectoris, hypertrophic
cardiomyopathy, and congenital heart disease. TANGO 276
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0161] In another example, TANGO 276 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as toxemia of pregnancy (e.g., preeclampsia and eclampsia),
placentitis, and spontaneous abortion. TANGO 276 polypeptides,
nucleic acids, and modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0162] In another example, TANGO 276 polypeptides, nucleic acids,
or modulators thereof, can be used to treat disorders of the brain,
such as cerebral edema, hydrocephalus, brain herniations,
iatrogenic disease (due to, e.g., infection, toxins, or drugs),
inflammations (e.g., bacterial and viral meningitis, encephalitis,
and cerebral toxoplasmosis), cerebrovascular diseases (e.g.,
hypoxia, ischemia, and infarction, intracranial hemorrhage and
vascular malformations, and hypertensive encephalopathy), and
tumors (e.g., neuroglial tumors, neuronal tumors, tumors of pineal
cells, meningeal tumors, primary and secondary lymphomas,
intracranial tumors, and medulloblastoma), and to treat injury or
trauma to the brain. TANGO 276 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0163] TANGO 276 polypeptides, nucleic acids, and modulators
thereof can be associated with pulmonary (i.e., lung) disorders,
such as atelectasis, cystic fibrosis, rheumatoid lung disease,
pulmonary congestion, pulmonary edema, chronic obstructive airway
disease (e.g., emphysema, chronic bronchitis, bronchial asthma, and
bronchiectasis), diffuse interstitial diseases (e.g., sarcoidosis,
pneumoconiosis, hypersensitivity pneumonitis, Goodpasture's
syndrome, idiopathic pulmonary hemosiderosis, pulmonary alveolar
proteinosis, desquamative interstitial pneumonitis, chronic
interstitial pneumonia, fibrosing alveolitis, hamman-rich syndrome,
pulmonary eosinophilia, diffuse interstitial fibrosis, Wegener's
granulomatosis, lymphomatoid granulomatosis, and lipid pneumonia),
and tumors (e.g., bronchogenic carcinoma, bronchioloalveolar
carcinoma, bronchial carcinoid, hamartoma, and mesenchymal tumors).
TANGO 276 polypeptides, nucleic acids, or modulators thereof can be
used to prognosticate, diagnose, inhibit, prevent, or alleviate one
or more of these disorders.
[0164] In another example, TANGO 276 polypeptides, nucleic acids,
and modulators thereof, can be used to treat hepatic (i.e., liver)
disorders, such as jaundice, hepatic failure, hereditary
hyperbiliruinemias (e.g., Gilbert's syndrome, Crigler-Naijar
syndromes and Dubin-Johnson and Rotor's syndromes), hepatic
circulatory disorders (e.g., hepatic vein thrombosis and portal
vein obstruction and thrombosis) hepatitis (e.g., chronic active
hepatitis, acute viral hepatitis, and toxic and drug-induced
hepatitis) cirrhosis (e.g., alcoholic cirrhosis, biliary cirrhosis,
and hemochromatosis), and malignant tumors (e.g., primary
carcinoma, hepatoblastoma, and angiosarcoma). TANGO 276
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0165] Exemplary skin disorders with which TANGO 276 can be
associated include, by way of example, psoriasis, infections,
wounds (and healing of wounds), inflammation, dermatitis, acne,
benign and malignant dermatological tumors, and the like. TANGO 276
proteins, nucleic acids encoding them, and agents that modulate
activity or expression of either of these can be used to
prognosticate, diagnose, treat, and inhibit one or more of these
disorders.
[0166] In another example, TANGO 276 polypeptides, nucleic acids,
or modulators thereof, can be used to treat renal (i.e., kidney)
disorders, such as glomerular diseases (e.g., acute and chronic
glomerulonephritis, rapidly progressive glomerulonephritis,
nephrotic syndrome, focal proliferative glomerulonephritis,
glomerular lesions associated with systemic disease, such as
systemic lupus erythematosus, Goodpasture's syndrome, multiple
myeloma, diabetes, neoplasia, sickle cell disease, and chronic
inflammatory diseases), tubular diseases (e.g., acute tubular
necrosis and acute renal failure, polycystic renal disease,
medullary sponge kidney, medullary cystic disease, nephrogenic
diabetes, and renal tubular acidosis), tubulointerstitial diseases
(e.g., pyelonephritis, drug and toxin induced tubulointerstitial
nephritis, hypercalcemic nephropathy, and hypokalemic nephropathy)
acute and rapidly progressive renal failure, chronic renal failure,
nephrolithiasis, vascular diseases (e.g., hypertension and
nephrosclerosis, microangiopathic hemolytic anemia, atheroembolic
renal disease, diffuse cortical necrosis, and renal infarcts), and
tumors (e.g., renal cell carcinoma and nephroblastoma). TANGO 276
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0167] Pancreatic disorders in which TANGO 276 can be involved
include pancreatitis (e.g., acute hemorrhagic pancreatitis and
chronic pancreatitis), pancreatic cysts (e.g., congenital cysts,
pseudocysts, and benign or malignant neoplastic cysts), pancreatic
tumors (e.g., pancreatic carcinoma and adenoma), diabetes mellitus
(e.g., insulin- and non-insulin-dependent types, impaired glucose
tolerance, and gestational diabetes), and islet cell tumors (e.g.,
insulinomas, adenomas, Zollinger-Ellison syndrome, glucagonomas,
and somatostatinoma). TANGO 276 polypeptides, nucleic acids, or
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0168] The presence of the Sema domain in TANGO 276 indicates that
this protein is involved in development of neuronal and epithelial
tissues and also functions as a repellant protein which guides
axonal development. TANGO 276 modulates nerve growth and
regeneration and also modulates growth and regeneration of other
epithelial tissues. TANGO 276 is thus involved in a variety of
neuronal disorder including, but not limited to, one or more of
seizure, epilepsy, (regeneration of) neuronal damage, pain
(including, for example, migraine, headache, and other chronic
pain), infections of the central nervous system, multiple
sclerosis, sleep disorders, psychological disorders, nerve root
disorders, and the like. Presence of a Sema domain in TANGO 276
further indicates that TANGO 276 has one or more physiological
roles in common with other proteins (e.g., secreted and
transmembrane semaphorins, collapsins, neuropilins, plexins, and
the like) in which the Sema domain occurs. Thus, TANGO 276 is
implicated in development, maintenance, and regeneration of
neuronal connections and networks, in modulating differentiation of
cells of the immune system, in modulating cytokine production by
cells of the immune system, in modulating reactivity of cells of
the immune system toward cytokines, in modulating initiation and
persistence of an inflammatory response, and in modulating
proliferation of epithelial cells. Sema domain-containing proteins
have also been implicated in development and progression of small
cell lung cancer, in normal brain development, and immune system
regulation. This indicates that TANGO 276 is also involved in one
or more of these processes and in disorders relating to these
processes (e.g., small cell lung cancer, brain development
disorders, and immune and auto-immune disorders). TANGO 276
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0169] The observation that TANGO 276 shares identity with the
murine semaphorin protein designated M-Sema F suggests that TANGO
276 has activity identical or analogous to the activity of this
protein. These observations indicate that TANGO 276 modulates
growth, proliferation, survival, differentiation, and activity of
neuronal cells. Thus, TANGO 276 protein is useful, for example, for
modulating and guiding neural axon development and for modulating
establishment and maintenance of neuronal networks.
[0170] TANGO 292
[0171] A cDNA clone (designated jthkf040b11) encoding at least a
portion of human TANGO 292 protein was isolated from a human normal
embryonic keratinocyte cDNA library. A corresponding gerbil cDNA
clone (designated jtiba040e12) was also isolated, and encoded at
least a portion of gerbil TANGO 292 protein. The human and TANGO
292 proteins are predicted by structural analysis to be
transmembrane proteins.
[0172] The full length of the cDNA encoding human TANGO 292 protein
(FIG. 4; SEQ ID NO: 38) is 2498 nucleotide residues. The ORF of
this cDNA, nucleotide residues 205 to 882 of SEQ ID NO: 38 (i.e.,
SEQ ID NO: 39), encodes a 226-amino acid residue transmembrane
protein (FIG. 4; SEQ ID NO: 40). The full length of the cDNA
encoding gerbil TANGO 292 protein (FIG. 4; SEQ ID NO: 81) is 2002
nucleotide residues. The ORF of this cDNA, nucleotide residues 89
to 763 of SEQ ID NO: 81 (i.e., SEQ ID NO: 82), encodes a 225-amino
acid transmembrane protein (FIG. 4; SEQ ID NO: 83).
[0173] The invention thus includes purified human TANGO 292
protein, both in the form of the immature 226 amino acid residue
protein (SEQ ID NO: 40) and in the form of the mature,
approximately 209 amino acid residue protein (SEQ ID NO: 42). The
invention also includes purified gerbil TANGO 292 protein, both in
the form of the immature 225-amino acid residue (SEQ ID NO: 83)
protein and in the form of the mature, approximately 208-amino acid
residue protein (SEQ ID NO: 85). Mature human or gerbil TANGO 292
protein can be synthesized without the signal sequence polypeptide
at the amino terminus thereof, or it can be synthesized by
generating immature TANGO 292 protein and cleaving the signal
sequence therefrom.
[0174] In addition to full length mature and immature human and
gerbil TANGO 292 proteins, the invention includes fragments,
derivatives, and variants of these TANGO 292 proteins, as described
herein. These proteins, fragments, derivatives, and variants are
collectively referred to herein as TANGO 292 polypeptides of the
invention or TANGO 292 proteins of the invention.
[0175] The invention also includes nucleic acid molecules which
encode a TANGO 292 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 38 or 81 or some portion thereof, such as the
portion which encodes mature human or gerbil TANGO 292 protein,
immature human or gerbil TANGO 292 protein, or a domain of human or
gerbil TANGO 292 protein. These nucleic acids are collectively
referred to as TANGO 292 nucleic acids of the invention.
[0176] TANGO 292 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features. This family includes, for example, human
and gerbil TANGO 292 proteins and nucleic acid molecules described
herein.
[0177] A common domain present in TANGO 292 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound proteins and which contains at
least about 45% hydrophobic amino acid residues such as alanine,
leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan,
or valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 35 amino acid residues, preferably about 10 to 20
amino acid residues, and has at least about 35-60%, more preferably
40-50%, and more preferably at least about 45% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer. Thus, in one embodiment, a
TANGO 292 protein contains a signal sequence corresponding to about
amino acid residues 1 to 17 of SEQ ID NO: 40 (SEQ ID NO: 41) or to
about amino acid residues 1 to 17 of SEQ ID NO: 83 (SEQ ID NO: 84).
The signal sequence is cleaved during processing of the mature
protein.
[0178] TANGO 292 proteins can include an extracellular domain. The
human TANGO 292 protein extracellular domain is located from about
amino acid residue 18 to about amino acid residue 113 of SEQ ID NO:
40 (SEQ ID NO: 43). The gerbil TANGO 292 protein extracellular
domain includes at least about amino acid residues 18 to 112 of SEQ
ID NO: 83 (SEQ ID NO: 86).
[0179] In addition, TANGO 292 include a transmembrane domain. In
one embodiment, a human TANGO 292 protein contains a transmembrane
domain corresponding to about amino acid residues 114 to 138 of SEQ
ID NO: 40 (SEQ ID NO: 44). Gerbil TANGO 292 protein includes a
transmembrane domain corresponding to about amino acid residues 113
to 137 of SEQ ID NO: 83 (SEQ ID NO: 87).
[0180] The present invention includes TANGO 292 proteins having a
cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human TANGO 292
cytoplasmic domain is located from about amino acid residue 139 to
amino acid residue 226 of SEQ ID NO: 40 (SEQ ID NO: 45). The gerbil
TANGO 292 cytoplasmic domain is located from about amino acid
residue 138 to amino acid residue 225 of SEQ ID NO: 83 (SEQ ID NO:
88).
[0181] TANGO 292 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table VIa
as predicted by computerized sequence analysis of human TANGO 292
protein, or in Table VIb as predicted by computerized sequence
analysis of gerbil TANGO 292 protein, using amino acid sequence
comparison software (comparing the amino acid sequence of TANGO 292
with the information in the PROSITE database {rel. 12.2; Feb, 1995}
and the Hidden Markov Models database {Rel. PFAM 3.3}). In certain
embodiments, a protein of the invention has at least 1, 2, 4, 6, or
all of the post-translational modification sites listed in Table
VIa or in Table VIb.
7TABLE VIa Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 40 Sequence cAMP- or
cGMP-dependent protein 197 to 200 RKHS kinase phosphorylation site
Protein kinase C phosphorylation site 37 to 39 TSK 97 to 99 SAK 102
to 104 TTK 196 to 198 TRK Casein kinase II phosphorylation site 37
to 40 TSKE 103 to 106 TKSD 180 to 183 SVED N-myristoylation site
116 to 121 GLLTGL Vitamin K-dependent carboxylation 56 to 98 See
FIG. 4 domain
[0182]
8TABLE VIb Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 83 Sequence cAMP- or
cGMP-dependent protein 196 to 199 RKHS kinase phosphorylation site
Protein kinase C phosphorylation site 23 to 25 SLK 37 to 39 SKK 96
to 98 SVK 101 to 103 TTR 155 to 157 TRIR 195 to 197 TRIK Casein
kinase II phosphorylation site 74 to 77 SYEE 102 to 105 TRSD 155 to
157 THEE 195 to 197 SSSE N-myristoylation site 33 to 38 GVFASK 115
to 120 GLLTGL Vitamin K-dependent carboxylation 55 to 92 See FIG. 4
domain
[0183] Among the domains that occur in TANGO 292 protein is a
vitamin K-dependent carboxylation domain. In one embodiment, the
protein of the invention has at least one domain that is at least
55%, preferably at least about 65%, more preferably at least about
75%, yet more preferably at least about 85%, and most preferably at
least about 95% identical to this vitamin K-dependent carboxylation
domain.
[0184] The vitamin K-dependent carboxylation domain has the
following consensus sequence, wherein standard single-letter amino
acid codes are used and `X` refers to any amino acid residue.
[0185] -X.sub.12-E-X.sub.3-E-X-C-X.sub.6-(D or E or N)-X-(L or I or
V or M or F or Y)-Xg-(F or Y or W)-
[0186] Glutamic acid residues within this consensus region are
potential vitamin K-dependent carboxylation sites. Human TANGO 292
has 9 glutamic acid residues in the vitamin K-dependent
carboxylation domain located from about amino acid residue 56 to 98
of SEQ ID NO: 40, namely at amino acid residues 58, 66, 68, 71, 72,
77, 78, 81, and 86 of SEQ ID NO: 40, and gerbil TANGO 292 has 10
glutamic acid residues in the vitamin K-dependent carboxylation
domain located from about amino acid residue 55 to 92 of SEQ ID NO:
83, namely at amino acid residues 57, 65, 67, 70, 71, 76, 77, 80,
86, and 87 of SEQ ID NO: 83. In one embodiment, the protein of the
invention is carboxylated at one or more of these glutamic acid
residues. In some proteins in which a vitamin K-dependent
carboxylation domain occurs, many of the glutamic acid residues
which occur from the amino terminus of the protein through the
conserved aromatic residue at the carboxyl terminal end of the
domain are carboxylated. Human TANGO 292 has 13 glutamic acid
residues in the region from the amino terminus of (both the
immature and mature forms of) the protein and the tryptophan
residue at amino acid residue 93 of SEQ ID NO: 40, and also has
another glutamic acid residue at position 95 of SEQ ID NO: 40 which
can also be carboxylated. In addition, human TANGO 292 protein has
four sets of paired (i.e., adjacent) glutamic acid residues, at
residues 33-34, 40-41, 71-72, and 77-78 and a pair of glutamic acid
residues (66 and 68) which are separated by a single residue.
Similarly, gerbil TANGO 292 has 12 glutamic acid residues in the
region from the amino terminus of (both the immature and mature
forms of) the protein and the tryptophan residue at amino acid
residue 92 of SEQ ID NO: 83, and also has another glutamic acid
residue at position 94 of SEQ ID NO: 83 which can also be
carboxylated. In addition, gerbil TANGO 292 protein has three sets
of glutamic acid residues, at residues 70-71, 76-77, and 86-87, and
a pair of glutamic acid residues (65 and 67) which are separated by
a single residue. The protein of the invention includes proteins
which are carboxylated at one or more of the individual or paired
glutamic acid residues.
[0187] TANGO 292, like other vitamin K-dependent carboxylation
domain-containing proteins, is involved in binding, uptake, and
response to metal cations such as calcium, to proteins, and to
small molecules. Other proteins in which a vitamin K-dependent
carboxylation domain occurs include, for example, osteocalcin
(bone-Gla protein), matrix Gla protein, various plasma proteins
such as prothrombin, coagulation factors VII, IX, and X, proline
rich Gla domain-containing proteins PRGP1 and PRGP2, and proteins
C, S, and Z. Thus, TANGO 292 is involved in physiological processes
in which one or more of these other vitamin K-dependent
carboxylation domain-containing proteins is involved.
[0188] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
292 protein includes an approximately 17 (i.e., 15, 16, 17, 18, or
19) amino acid residue signal peptide (amino acid residues 1 to 17
of SEQ ID NO: 40; SEQ ID NO: 41) preceding the mature TANGO 292
protein (i.e., approximately amino acid residues 18 to 226 of SEQ
ID NO: 40; SEQ ID NO: 42). In one embodiment, human TANGO 292
protein includes an extracellular domain (amino acid residues 18 to
113 of SEQ ID NO: 40; SEQ ID NO: 43); a transmembrane domain (amino
acid residues 114 to 138 of SEQ ID NO: 40; SEQ ID NO: 44); and a
cytoplasmic domain (amino acid residues 139 to 225 of SEQ ID NO:
40; SEQ ID NO: 45). In an alternative embodiment, human TANGO 292
protein includes a cytoplasmic domain (amino acid residues 18 to
113 of SEQ ID NO: 40; SEQ ID NO: 43); a transmembrane domain (amino
acid residues 114 to 138 of SEQ ID NO: 40; SEQ ID NO: 44); and an
extracellular domain (amino acid residues 139 to 225 of SEQ ID NO:
40; SEQ ID NO: 45).
[0189] The SignalP program predicted that gerbil TANGO 292 protein
includes an approximately 17 (i.e., 15, 16, 17, 18, or 19) amino
acid residue amino acid signal peptide (amino acid residues 1 to 17
of SEQ ID NO: 83; SEQ ID NO: 84) preceding the mature TANGO 292
protein (i.e., approximately amino acid residues 18 to 225 of SEQ
ID NO: 83; SEQ ID NO: 85). In one embodiment, gerbil TANGO 292
protein includes an extracellular domain (amino acid residues 18 to
112 of SEQ ID NO: 83; SEQ ID NO: 86); a transmembrane domain (amino
acid residues 113 to 137 of SEQ ID NO: 83; SEQ ID NO: 87); and a
cytoplasmic domain (amino acid residues 138 to 225 of SEQ ID NO:
83; SEQ ID NO: 88). In an alternative embodiment, gerbil TANGO 292
protein includes a cytoplasmic domain (amino acid residues 18 to
112 of SEQ ID NO: 83; SEQ ID NO: 86); a transmembrane domain (amino
acid residues 113 to 137 of SEQ ID NO: 83; SEQ ID NO: 87); and an
extracellular domain (amino acid residues 138 to 225 of SEQ ID NO:
83; SEQ ID NO: 88).
[0190] FIG. 4E depicts a hydrophilicity plot of human TANGO 292
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 17 of SEQ ID NO: 40 is the signal sequence
of human TANGO 292. The hydrophobic region which corresponds to
amino acid residues 114 to 138 of SEQ ID NO: 40 is the
transmembrane domain of human TANGO 292. As described elsewhere
herein, relatively hydrophilic regions are generally located at or
near the surface of a protein, and are more frequently effective
immunogenic epitopes than are relatively hydrophobic regions. For
example, the region of human TANGO 292 protein from about amino
acid residue 90 to about amino acid residue 110 appears to be
located at or near the surface of the protein, while the region
from about amino acid residue 190 to about amino acid residue 195
appears not to be located at or near the surface.
[0191] FIG. 4M depicts a hydrophilicity plot of gerbil TANGO 292
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 17 of SEQ ID NO: 83 is the signal sequence
of gerbil TANGO 292. The hydrophobic region which corresponds to
amino acid residues 113 to 137 of SEQ ID NO: 40 is the
transmembrane domain of gerbil TANGO 292. As described elsewhere
herein, relatively hydrophilic regions are generally located at or
near the surface of a protein, and are more frequently effective
immunogenic epitopes than are relatively hydrophobic regions. For
example, the region of gerbil TANGO 292 protein from about amino
acid residue 90 to about amino acid residue 110 appears to be
located at or near the surface of the protein.
[0192] An alignment of the human (H) and gerbil (G) ORF sequences
encoding TANGO 292 protein is shown in FIGS. 41-4K. This alignment
was made using the ALIGN software {Myers and Miller (1989) CABIOS,
ver. 2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4), and indicates about 64.1% identity between
these two cDNA sequences. An alignment of the amino acid sequences
of gerbil (G) and human (H) TANGO 292 proteins is shown in FIG. 4L.
In this alignment (made using the ALIGN software {Myers and Miller
(1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap opening
penalty=12, gap extension penalty=4), the proteins are about 77.7%
identical and about 80% similar.
[0193] The predicted molecular weight of human TANGO 292 protein
without modification and prior to cleavage of the signal sequence
is about 25.4 kilodaltons. The predicted molecular weight of the
mature human TANGO 292 protein without modification and after
cleavage of the signal sequence is about 23.6 kilodaltons. The
predicted molecular weight of gerbil TANGO 292 protein without
modification and prior to cleavage of the signal sequence is about
25.4 kilodaltons. The predicted molecular weight of the mature
human TANGO 292 protein without modification and after cleavage of
the signal sequence is about 23.5 kilodaltons.
[0194] Northern analysis experiments indicated that human mRNA
corresponding to the cDNA encoding TANGO 292 is expressed in the
tissues listed in Table VIc, wherein "++" indicates strong
expression, "+" indicates lower expression, "+/-" indicates still
lower expression, and "-" indicates that expression could not be
detected in the corresponding tissue.
9 TABLE VIc Animal Tissue Relative Level of Expression Human
placenta ++ liver ++ kidney ++ lung + pancreas + heart +/- brain -
skeletal muscle -
[0195] Biological function of TANGO 292 proteins, nucleic acids
encoding them, and modulators of these molecules
[0196] TANGO 292 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 292 is expressed in human embryonic keratinocytes, and
in placenta, liver, kidney, lung, pancreas, and heart tissues,
TANGO 292 protein is involved in one or more biological processes
which occur in these tissues. In particular, TANGO 292 is involved
in modulating growth, proliferation, survival, differentiation, and
activity of cells including, but not limited to, keratinocytes and
cells with which keratinocytes interact in the animal in which
TANGO 292 is normally expressed. TANGO 292 is also involved in
modulating growth, proliferation, survival, differentiation, and
activity of placenta, liver, kidney, lung, pancreas, and heart
cells. Thus, TANGO 292 has a role in disorders which affect these
cells and their growth, proliferation, survival, differentiation,
and activity. TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0197] In another example, TANGO 292 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as toxemia of pregnancy (e.g., preeclampsia and eclampsia),
placentitis, and spontaneous abortion. TANGO 292 polypeptides,
nucleic acids, and modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0198] In another example, TANGO 292 polypeptides, nucleic acids,
and modulators thereof, can be used to treat hepatic (i.e., liver)
disorders, such as jaundice, hepatic failure, hereditary
hyperbiliruinemias (e.g., Gilbert's syndrome, Crigler-Naijar
syndromes and Dubin-Johnson and Rotor's syndromes), hepatic
circulatory disorders (e.g., hepatic vein thrombosis and portal
vein obstruction and thrombosis) hepatitis (e.g., chronic active
hepatitis, acute viral hepatitis, and toxic and drug-induced
hepatitis) cirrhosis (e.g., alcoholic cirrhosis, biliary cirrhosis,
and hemochromatosis), and malignant tumors (e.g., primary
carcinoma, hepatoblastoma, and angiosarcoma). TANGO 292
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0199] In another example, TANGO 292 polypeptides, nucleic acids,
or modulators thereof, can be used to treat renal (i.e., kidney)
disorders, such as glomerular diseases (e.g., acute and chronic
glomerulonephritis, rapidly progressive glomerulonephritis,
nephrotic syndrome, focal proliferative glomerulonephritis,
glomerular lesions associated with systemic disease, such as
systemic lupus erythematosus, Goodpasture's syndrome, multiple
myeloma, diabetes, neoplasia, sickle cell disease, and chronic
inflammatory diseases), tubular diseases (e.g., acute tubular
necrosis and acute renal failure, polycystic renal disease,
medullary sponge kidney, medullary cystic disease, nephrogenic
diabetes, and renal tubular acidosis), tubulointerstitial diseases
(e.g., pyelonephritis, drug and toxin induced tubulointerstitial
nephritis, hypercalcemic nephropathy, and hypokalemic nephropathy)
acute and rapidly progressive renal failure, chronic renal failure,
nephrolithiasis, vascular diseases (e.g., hypertension and
nephrosclerosis, microangiopathic hemolytic anemia, atheroembolic
renal disease, diffuse cortical necrosis, and renal infarcts), and
tumors (e.g., renal cell carcinoma and nephroblastoma). TANGO 292
polypeptides, nucleic acids, and modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0200] TANGO 292 polypeptides, nucleic acids, and modulators
thereof can be associated with pulmonary (i.e., lung) disorders,
such as atelectasis, cystic fibrosis, rheumatoid lung disease,
pulmonary congestion, pulmonary edema, chronic obstructive airway
disease (e.g., emphysema, chronic bronchitis, bronchial asthma, and
bronchiectasis), diffuse interstitial diseases (e.g., sarcoidosis,
pneumoconiosis, hypersensitivity pneumonitis, Goodpasture's
syndrome, idiopathic pulmonary hemosiderosis, pulmonary alveolar
proteinosis, desquamative interstitial pneumonitis, chronic
interstitial pneumonia, fibrosing alveolitis, hamman-rich syndrome,
pulmonary eosinophilia, diffuse interstitial fibrosis, Wegener's
granulomatosis, lymphomatoid granulomatosis, and lipid pneumonia),
and tumors (e.g., bronchogenic carcinoma, bronchioloalveolar
carcinoma, bronchial carcinoid, hamartoma, and mesenchymal tumors).
TANGO 292 polypeptides, nucleic acids, or modulators thereof can be
used to prognosticate, diagnose, inhibit, prevent, or alleviate one
or more of these disorders.
[0201] Pancreatic disorders in which TANGO 292 can be involved
include pancreatitis (e.g., acute hemorrhagic pancreatitis and
chronic pancreatitis), pancreatic cysts (e.g., congenital cysts,
pseudocysts, and benign or malignant neoplastic cysts), pancreatic
tumors (e.g., pancreatic carcinoma and adenoma), diabetes mellitus
(e.g., insulin- and non-insulin-dependent types, impaired glucose
tolerance, and gestational diabetes), and islet cell tumors (e.g.,
insulinomas, adenomas, Zollinger-Ellison syndrome, glucagonomas,
and somatostatinoma). TANGO 292 polypeptides, nucleic acids, or
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0202] Because TANGO 292 exhibits expression in the heart, TANGO
292 nucleic acids, proteins, and modulators thereof can be used to
treat heart disorders. Examples of heart disorders with which TANGO
292 can be involved include ischemic heart disease,
atherosclerosis, hypertension, angina pectoris, hypertrophic
cardiomyopathy, and congenital heart disease. TANGO 292
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0203] Presence in TANGO 292 of a vitamin K-dependent carboxylation
(Gla) domain indicates that TANGO 292 is involved in physiological
functions identical or analogous to the functions performed by
other proteins having such domains. For example, like other Gla
domain-containing proteins, TANGO 292 modulates binding and uptake
of calcium and other metal ions by cells which express it and the
response of those cells to the presence and uptake of such ions.
Human matrix Gla protein, for example, is involved in Keutel
syndrome, an autosomal recessive disorder characterized by abnormal
cartilage calcification, peripheral pulmonary stenosis, and
midfacial hypoplasia (Munroe et al. (1999) Nat. Genet. 21:142-144).
Other proteins containing a Gla domain include, for example, two
human proline-rich Gla proteins designated PRGP1 and PRGP2, human G
domain-containing protein Gas6, and several human blood coagulation
factors (Kulman et al. (1997) Proc. Natl. Acad. Sci. USA
94:9058-9062; Mark et al., (1996) J. Biol. Chem. 271:9785-9786;
Cancela et al. (1990) J. Biol. Chem. 265:15040-15048). These
proteins are involved in binding of mineral ions such as calcium,
phosphate, and hydroxyapatite, binding of proteins, binding of
vitamins and small molecules, and mediation of blood coagulation.
Thus, TANGO 292 is involved in numerous physiological processes
which are influenced by levels of calcium and other metal ions in
body fluids or by the presence of proteins, vitamins, or small
molecules. Such processes include, for example, bone uptake,
maintenance, and deposition, formation, maintenance, and repair of
cartilage, formation and maintenance of extracellular matrices,
movement of cells through extracellular matrices, coagulation and
dissolution of blood components (e.g., blood cells and proteins),
and deposition of materials (e.g., lipids, cells, calcium, and the
like) in arterial walls. TANGO 292 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0204] TANGO 292 is involved in disorders which affect the tissues
in which it is normally expressed and upon which it normally acts.
Thus, TANGO 292 is involved in disorders which involve aberrant
binding or aberrant failure to bind of keratinocytes or similar
cells with a tissue affected by the disorder. Such disorders
include, by way of example and not limitation, osteoporosis,
(repair of) traumatic bone injuries, rickets, osteomalacia, Paget's
disease, and other bone disorders, osteoarthritis, rheumatoid
arthritis, ankylosing spondylitis, Keutel syndrome, and other
disorders of the joints and cartilage, iron deficiency anemia,
hemophilia, inappropriate blood coagulation, stroke,
arteriosclerosis, atherosclerosis, aneurysm, and other disorders
related to blood and blood vessels, metastasis and other disorders
related to inappropriate movement of cells through extracellular
matrices, and the like. TANGO 292 polypeptides, nucleic acids, and
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0205] TANGO 325
[0206] A cDNA clone (designated jthdc071a12) encoding at least a
portion of human TANGO 325 protein was isolated from a human aortic
endothelial cell cDNA library. The human TANGO 325 protein is
predicted by structural analysis to be a transmembrane protein.
[0207] The full length of the cDNA encoding human TANGO 325 protein
(FIG. 5; SEQ ID NO: 46) is 2169 nucleotide residues. The ORF of
this cDNA, nucleotide residues 135 to 2000 of SEQ ID NO: 46 (i.e.,
SEQ ID NO: 47), encodes a 622-amino acid transmembrane protein
(FIG. 5; SEQ ID NO: 48).
[0208] The invention thus includes purified human TANGO 325
protein, both in the form of the immature 622 amino acid residue
protein (SEQ ID NO: 48) and in the form of the mature,
approximately 591 amino acid residue protein (SEQ ID NO: 50).
Mature human TANGO 325 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 325 protein and
cleaving the signal sequence therefrom.
[0209] In addition to full length mature and immature human TANGO
325 proteins, the invention includes fragments, derivatives, and
variants of these TANGO 325 proteins, as described herein. These
proteins, fragments, derivatives, and variants are collectively
referred to herein as TANGO 325 polypeptides of the invention or
TANGO 325 proteins of the invention.
[0210] The invention also includes nucleic acid molecules which
encode a TANGO 325 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 46 or some portion thereof, such as the
portion which encodes mature TANGO 325 protein, immature TANGO 325
protein, or a domain of TANGO 325 protein. These nucleic acids are
collectively referred to as TANGO 325 nucleic acids of the
invention.
[0211] TANGO 325 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features.
[0212] A common domain present in TANGO 325 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound proteins and which contains at
least about 45% hydrophobic amino acid residues such as alanine,
leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan,
or valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 35 amino acid residues, preferably about 10 to 20
amino acid residues, and has at least about 35-60%, more preferably
40-50%, and more preferably at least about 45% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer. Thus, in one embodiment, a
TANGO 325 protein contains a signal sequence corresponding to about
amino acid residues 1 to 31 of SEQ ID NO: 48 (SEQ ID NO: 49). The
signal sequence is cleaved during processing of the mature
protein.
[0213] TANGO 325 proteins can include an extracellular domain. The
human TANGO 325 protein extracellular domain is located from about
amino acid residue 32 to about amino acid residue 529 of SEQ ID NO:
48 (SEQ ID NO: 51).
[0214] In addition, TANGO 325 include a transmembrane domain. In
one embodiment, a TANGO 325 protein of the invention contains a
transmembrane domain corresponding to about amino acid residues 530
to 547 of SEQ ID NO: 48 (SEQ ID NO: 52).
[0215] The present invention includes TANGO 325 proteins having a
cytoplasmic domain, particularly including proteins having a
carboxyl-terminal cytoplasmic domain. The human TANGO 325
cytoplasmic domain is located from about amino acid residue 548 to
amino acid residue 622 of SEQ ID NO: 48 (SEQ ID NO: 53).
[0216] TANGO 325 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table VII,
as predicted by computerized sequence analysis of TANGO 325
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 325 with the information in the
PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table VII.
10TABLE VII Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 48 Sequence N-glycosylation site
71 to 74 NISY 76 to 79 NESE 215 to 218 NLTK 266 to 269 NVTR 317 to
320 NDTF 331 to 334 NLSF 336 to 339 NLTA 400 to 403 NITN 410 to 413
NVSR 451 to 454 NITF 579 to 582 NVTA cAMP- or cGMP-dependent
protein 231 to 234 RRLS kinase phosphorylation site Protein kinase
C phosphorylation site 40 to 42 TGR 229 to 231 SLR 326 to 328 SLK
390 to 392 SMR 510 to 512 SGK 575 to 577 SAR Casein kinase II
phosphorylation site 284 to 287 SHND 442 to 445 SPLE 447 to 450
TETE 453 to 456 TFWE N-myristoylation site 3 to 8 GLQFSL 69 to 74
GNNISY 126 to 131 GIFKGL 174 to 179 GTFVGM ATP/GTP-binding site
motif A 506 to 513 AASMSGKT (P-loop) Leucine rich repeat amino
terminal 32 to 60 See FIG. 5 domain (LLRNT) Leucine rich repeat
(LRR) domain 61 to 84 See FIG. 5 85 to 108 See FIG. 5 109 to 132
See FIG. 5 133 to 156 See FIG. 5 157 to 180 See FIG. 5 181 to 204
See FIG. 5 205 to 228 See FIG. 5 229 to 252 See FIG. 5 253 to 276
See FIG. 5 277 to 300 See FIG. 5 301 to 324 See FIG. 5 326 to 349
See FIG. 5 Leucine rich repeat carboxyl terminal 359 to 405 See
FIG. 5 domain (LRRCT)
[0217] Among the domains that occur in TANGO 325 protein are
leucine rich repeat (LRR) domains, including amino terminal and
carboxyl terminal LRR domains, and a P-loop domain. In one
embodiment, the protein of the invention has at least one domain
that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to one of
these domains. In another embodiment, the protein has at least on
amino terminal LRR domain, at least one carboxyl terminal LRR
domain, and a plurality of LRR domains interposed therebetween. In
yet another embodiment, the protein has at least one P-loop domain,
and a plurality (e.g., 2, 3, 4, or more) of the LRR domains
described herein in Table VII.
[0218] One or more LRR domains is present in a variety of proteins
involved in protein-protein interactions. Such proteins include,
for example, proteins involved in signal transduction, cell-to-cell
adhesion, cell-to-extracellular matrix adhesion, cell development,
DNA repair, RNA processing, and cellular molecular recognition
processes. Specialized LRR domains, designated LRR amino terminal
(LRRNT) domains and LRR carboxyl terminal (LRRCT) domains often
occur near the amino and carboxyl, respectively, ends of a series
of LRR domains. TANGO 325 protein has fourteen clustered LRR
domains, including (from the amino terminus toward the carboxyl
terminus of TANGO 325) an LRRNT domain, twelve LRR domains, and an
LRRCT domain. TANGO 325 is thus involved in one or more
physiological processes in which these other LRR domain-containing
proteins are involved, namely binding of cells with extracellular
proteins such as soluble extracellular proteins and cell surface
proteins of other cells.
[0219] The fact that TANGO 325 has an ATP/GTP-binding domain (i.e.,
a P-loop domain) within the extracellular domain of the protein
indicates that this protein is involved in transmembrane signaling
events. Considered in combination with the protein-binding LRR
domains present in the extracellular domain of the, the presence of
the ATP/GTP-binding domain indicates that TANGO 325 protein is
capable of sensing extracellular proteins, including ATP-binding
proteins and GTP-binding proteins, and extracellular nucleotides
(e.g., ATP, ADP, and AMP). Thus, TANGO 325 protein is involved in
translating information (e.g., environmental conditions or
signaling molecules provided to the environment by other cells)
from the extracellular environment of the cell in which it is
expressed to one or more intracellular biochemical systems.
[0220] TANGO 325 exhibits amino acid sequence and nucleic acid
sequence homology with human Slit-1 protein. An alignment of the
amino acid sequences of TANGO 325 and human Slit-1 protein is shown
in FIGS. 5G to 5L. In this alignment (made using the ALIGN software
{Myers and Miller (1989) CABIOS, ver. 2.0}; pam120.mat scoring
matrix; gap opening penalty=12, gap extension penalty=4), the
proteins are 35.4% identical (i.e., 35.4% of the residues of TANGO
325 correspond to identical residues in Slit-1). An alignment of
the nucleotide sequences of the ORFs encoding TANGO 325 and human
Slit-I protein is shown in FIGS. 5Mi through 5Mxviii. The two ORFs
are 65.7% identical, as assessed using the same software and
parameters.
[0221] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
325 protein includes an approximately 31 (i.e., 29, 30, 31, 32, or
33) amino acid residue signal peptide (amino acid residues 1 to 31
of SEQ ID NO: 48; SEQ ID NO: 49) preceding the mature TANGO 325
protein (i.e., approximately amino acid residues 42 to 622 of SEQ
ID NO: 48; SEQ ID NO: 50). In one embodiment, human TANGO 325
protein includes an extracellular domain (amino acid residues 32 to
529 of SEQ ID NO: 48; SEQ ID NO: 51); a transmembrane domain (amino
acid residues 530 to 547 of SEQ ID NO: 48; SEQ ID NO: 52); and a
cytoplasmic domain (amino acid residues 548 to 622 of SEQ ID NO:
48; SEQ ID NO: 53). In an alternative embodiment, human TANGO 325
protein includes a cytoplasmic domain (amino acid residues 32 to
529 of SEQ ID NO: 48; SEQ ID NO: 51); a transmembrane domain (amino
acid residues 530 to 547 of SEQ ID NO: 48; SEQ ID NO: 52); and an
extracellular domain (amino acid residues 548 to 622 of SEQ ID NO:
48; SEQ ID NO: 53).
[0222] FIG. 5F depicts a hydrophilicity plot of human TANGO 325
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 31 of SEQ ID NO: 48 is the signal sequence
of human TANGO 325 (SEQ ID NO: 49). The hydrophobic region which
corresponds to amino acid residues 530 to 547 of SEQ ID NO: 48 is
the transmembrane domain of human TANGO 325 (SEQ ID NO: 52). As
described elsewhere herein, relatively hydrophilic regions are
generally located at or near the surface of a protein, and are more
frequently effective immunogenic epitopes than are relatively
hydrophobic regions. For example, the region of human TANGO 325
protein from about amino acid residue 550 to about amino acid
residue 565 appears to be located at or near the surface of the
protein, while the region from about amino acid residue 168 to
about amino acid residue 185 appears not to be located at or near
the surface.
[0223] The predicted molecular weight of human TANGO 325 protein
without modification and prior to cleavage of the signal sequence
is about 70.3 kilodaltons. The predicted molecular weight of the
mature human TANGO 325 protein without modification and after
cleavage of the signal sequence is about 66.8 kilodaltons.
[0224] Northern analysis experiments indicated that mRNA
corresponding to the cDNA encoding TANGO 325 is expressed in the
tissues listed in Table VIIA, wherein "+" indicates expression and
"-" indicates that expression could not be detected in the
corresponding tissue.
11 TABLE VIIA Animal Tissue Relative Level of Expression Human
placenta + liver + kidney + pancreas + heart + brain - skeletal
muscle - lung -
[0225] Biological function of TANGO 325 proteins, nucleic acids
encoding them, and modulators of these molecules
[0226] TANGO 325 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 325 is expressed in human aortic endothelial tissue and
in placenta, liver, kidney, pancreas, and heart tissues, TANGO 325
protein is involved in one or more biological processes which occur
in these tissues. In particular, TANGO 325 is involved in
modulating growth, proliferation, survival, differentiation, and
activity of endothelial cells including, but not limited to,
vascular and cardiac (including valvular) endothelial cells of the
animal in which it is normally expressed. TANGO 325 also modulates
growth, proliferation, survival, differentiation, and activity of
placenta, liver, kidney, and pancreas cells. Thus, TANGO 325 has a
role in disorders which affect these cells and their growth,
proliferation, survival, differentiation, and activity. TANGO 325
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0227] In one example, TANGO 325 polypeptides, nucleic acids, and
modulators thereof can be used to treat placental disorders, such
as toxemia of pregnancy (e.g., preeclampsia and eclampsia),
placentitis, and spontaneous abortion. TANGO 325 polypeptides,
nucleic acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0228] In another example, TANGO 325 polypeptides, nucleic acids,
and modulators thereof, can be used to treat hepatic (i.e., liver)
disorders, such as jaundice, hepatic failure, hereditary
hyperbiliruinemias (e.g., Gilbert's syndrome, Crigler-Naijar
syndromes and Dubin-Johnson and Rotor's syndromes), hepatic
circulatory disorders (e.g., hepatic vein thrombosis and portal
vein obstruction and thrombosis) hepatitis (e.g., chronic active
hepatitis, acute viral hepatitis, and toxic and drug-induced
hepatitis) cirrhosis (e.g., alcoholic cirrhosis, biliary cirrhosis,
and hemochromatosis), and malignant tumors (e.g., primary
carcinoma, hepatoblastoma, and angiosarcoma). TANGO 325
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0229] In another example, TANGO 325 polypeptides, nucleic acids,
or modulators thereof, can be used to treat renal (i.e., kidney)
disorders, such as glomerular diseases (e.g., acute and chronic
glomerulonephritis, rapidly progressive glomerulonephritis,
nephrotic syndrome, focal proliferative glomerulonephritis,
glomerular lesions associated with systemic disease, such as
systemic lupus erythematosus, Goodpasture's syndrome, multiple
myeloma, diabetes, neoplasia, sickle cell disease, and chronic
inflammatory diseases), tubular diseases (e.g., acute tubular
necrosis and acute renal failure, polycystic renal disease,
medullary sponge kidney, medullary cystic disease, nephrogenic
diabetes, and renal tubular acidosis), tubulointerstitial diseases
(e.g., pyelonephritis, drug and toxin induced tubulointerstitial
nephritis, hypercalcemic nephropathy, and hypokalemic nephropathy)
acute and rapidly progressive renal failure, chronic renal failure,
nephrolithiasis, vascular diseases (e.g., hypertension and
nephrosclerosis, microangiopathic hemolytic anemia, atheroembolic
renal disease, diffuse cortical necrosis, and renal infarcts), and
tumors (e.g., renal cell carcinoma and nephroblastoma). TANGO 325
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0230] Pancreatic disorders in which TANGO 325 can be involved
include pancreatitis (e.g., acute hemorrhagic pancreatitis and
chronic pancreatitis), pancreatic cysts (e.g., congenital cysts,
pseudocysts, and benign or malignant neoplastic cysts), pancreatic
tumors (e.g., pancreatic carcinoma and adenoma), diabetes mellitus
(e.g., insulin- and non-insulin-dependent types, impaired glucose
tolerance, and gestational diabetes), and islet cell tumors (e.g.,
insulinomas, adenomas, Zollinger-Ellison syndrome, glucagonomas,
and somatostatinoma). TANGO 325 polypeptides, nucleic acids, or
modulators thereof can be used to prognosticate, diagnose, inhibit,
prevent, or alleviate one or more of these disorders.
[0231] Because TANGO 325 exhibits expression in the heart, TANGO
325 nucleic acids, proteins, and modulators thereof can be used to
treat heart disorders. Examples of heart disorders with which TANGO
325 can be involved include ischemic heart disease,
atherosclerosis, hypertension, angina pectoris, hypertrophic
cardiomyopathy, and congenital heart disease. TANGO 325
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0232] It is known that serum nucleotide levels (e.g., ATP) affect
cardiac contractility and vasomotor tone. Presence in TANGO 325 of
an ATP/GTP binding domain in the extracellular portion thereof
implicates this transmembrane protein in sensing of serum
nucleotide levels and transmission of the sensed level by
mechanisms not yet fully understood to myocytes underlying the
epithelium. Thus, TANGO 325 is involved in disorders such as
cardiovascular insufficiency, hypertension, hypotension, shock, and
the like.
[0233] Leukocytes are known to bind with vascular endothelial
surfaces in a reversible manner prior to penetrating the vascular
endothelium in route to an underlying tissue. Although a few
proteins have previously been implicated in the
leukocyte-endothelium binding process, the identities of all of the
proteins involved remain unknown. The presence of numerous LRR
domains on the exterior portion of TANGO 325 protein implicates
this protein in reversible binding of leukocytes to vascular
endothelium. Thus, TANGO 325 is involved in physiological processes
and disorders which involve leukocyte-endothelium binding. Such
processes and disorders include, by way of example, cellular
aspects of immune responses, autoimmune responses and disorders,
and migration of leukocytes to lymph nodes.
[0234] The aortic endothelium, as well as other vascular
endothelia, are known to be involved in detection of signals (e.g.,
metabolites, proteins, and the like) in the blood stream. Mammalian
Slit-1 protein is known to be involved in the human endocrine
system (Itoh et al. (1998) Brain Res. Mol. Brain Res. 62:175-186).
Amino acid and nucleic acid sequence similarity of TANGO 325 with
human Slit-1 protein, as described herein, indicates that TANGO 325
is involved in sensing physiological signals by the endocrine
system. Thus, TANGO 325 is involved in one or more human endocrine
disorders such as pituitary disorders (e.g., diabetes insipidus),
thyroid disorders (e.g., hyperthyroidism, hypothyroidism, diabetes,
goiter, and growth and developmental disorders), adrenal disorders
(e.g., Addison's disease, Cushing's syndrome, hyperaldosteronism,
and pheochromocytoma), and the like.
[0235] Human Slit-1 protein is also known to be involved in
guidance of neuronal growth. The sequence similarity of TANGO 325
with Slit-1, as described herein, implicates TANGO 325 in growth,
development, maintenance, and regeneration of neurons. TANGO 325
can thus be used to prevent, diagnose, and treat a variety of
neurological disorders.
[0236] TANGO 331
[0237] A cDNA clone (designated jthvb042g08) encoding at least a
portion of human TANGO 331 protein was isolated from a human
mammary epithelium cDNA library. A corresponding cDNA clone
(designated jchrc045a03) was isolated from a human heart library.
The human TANGO 331 protein is predicted by structural analysis to
be a secreted protein.
[0238] The full length of the cDNA encoding human TANGO 331 protein
(FIG. 6; SEQ ID NO: 54) is 1432 nucleotide residues. The ORF of
this cDNA, nucleotide residues 114 to 1172 of SEQ ID NO: 54 (i.e.,
SEQ ID NO: 55), encodes a 353-amino acid secreted protein (FIG. 6;
SEQ ID NO: 56).
[0239] The invention thus includes purified human TANGO 331
protein, both in the form of the immature 353 amino acid residue
protein (SEQ ID NO: 56) and in the form of the mature,
approximately 329 amino acid residue protein (SEQ ID NO: 58).
Mature human TANGO 331 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 331 protein and
cleaving the signal sequence therefrom.
[0240] In addition to full length mature and immature human TANGO
331 proteins, the invention includes fragments, derivatives, and
variants of these TANGO 331 proteins, as described herein. These
proteins, fragments, derivatives, and variants are collectively
referred to herein as TANGO 331 polypeptides of the invention or
TANGO 331 proteins of the invention.
[0241] The invention also includes nucleic acid molecules which
encode a TANGO 331 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 54 or some portion thereof, such as the
portion which encodes mature TANGO 331 protein, immature TANGO 331
protein, or a domain of TANGO 331 protein. These nucleic acids are
collectively referred to as TANGO 331 nucleic acids of the
invention.
[0242] TANGO 331 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 331 protein and the Chinese
hamster (Cricetulus griseus) protein designated HT and having
GenBank Accession number U48852, as shown in FIG. 6E, and the
conservation of nucleotide sequence between the ORFs encoding human
TANGO 331 protein and Chinese hamster protein HT, as shown in FIGS.
6F through 6J.
[0243] A common domain present in TANGO 331 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound proteins and which contains at
least about 45% hydrophobic amino acid residues such as alanine,
leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan,
or valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 35 amino acid residues, preferably about 10 to 20
amino acid residues, and has at least about 35-60%, more preferably
40-50%, and more preferably at least about 45% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer. Thus, in one embodiment, a
TANGO 331 protein contains a signal sequence corresponding to about
amino acid residues 1 to 24 of SEQ ID NO: 56 (SEQ ID NO: 57). The
signal sequence is cleaved during processing of the mature
protein.
[0244] TANGO 331 proteins can include an extracellular domain. The
human TANGO 331 protein is a secreted protein, and thus includes an
`extracellular domain` consisting of the entire mature protein
(i.e., approximately residues 25 to 353 of SEQ ID NO: 56; SEQ ID
NO: 58).
[0245] TANGO 331 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table
VIII, as predicted by computerized sequence analysis of TANGO 331
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 331 with the information in the
PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table VIII.
12TABLE VIII Amino Acid Type of Potential Modification Site
Residues of Amino Acid or Domain SEQ ID NO: 56 Sequence
N-glycosylation site 190 to 193 NETH 251 to 254 NGSY cAMP- or
cGMP-dependent protein 26 to 29 KKPT kinase phosphorylation site
Protein kinase C phosphorylation site 48 to 50 TAK 123 to 125 TLK
144 to 146 SQR 165 to 167 SCR 187 to 189 SLR 202 to 204 SCK 210 to
212 TNR Casein kinase II phosphorylation site 58 to 61 TAWE 66 to
69 SKYE 86 to 89 SDFE 197 to 200 TACD 210 to 213 TNRD 255 to 258
TCEE 295 to 298 SLAE 339 to 342 TEGE 349 to 352 SRED Tyrosine
kinase phosphorylation site 303 to 309 RKNENCY N-myristoylation
site 44 to 49 GMVDTA 54 to 59 GGGNTA 81 to 86 GLCESS 150 to 155
GNGHCS 158 to 163 GSRQGD 164 to 169 GSCRCH 252 to 257 GSYTCE 313 to
318 GSYVCV Aspartic acid and asparagine 308 to 319 See FIG. 6
hydroxylation site EGF-like domain cysteine pattern 166 to 177 See
FIG. 6 signature EGF domain 140 to 177 See FIG. 6 234 to 263 See
FIG. 6 301 to 330 See FIG. 6 Laminin-like EGF domain 153 to 199 See
FIG. 6 TNFR/NGFR cysteine-rich region 180 to 214 See FIG. 6 domain
Vertebrate metallothionein-like domain 229 to 298 See FIG. 6
Leucine Zipper domain 94 to 115 See FIG. 6
[0246] Among the domains that occur in TANGO 331 protein are EGF
domains, including a laminin-like EGF domain, a TNFR/NGFR
cysteine-rich domain, a metallothionein-like domain, and a leucine
zipper domain.
[0247] EGF-like domains are about 30 to 40 amino acid residues in
length and comprise several conserved cysteine residues in one of
several patterns. EGF-like domains occur in a large number of
proteins including, for example, human epidermal growth factor
(EGF), murine adipocyte differentiation inhibitor, human agrin,
human growth factor amphiregulin, human growth factor betacellulin,
sea urchin blastula tissue patterning proteins BP10 and Span,
cattle tick glycoprotein BM86, human bone morphogenic protein 1,
sea urchin suBMP, Drosophila tolloid protein, Caenorhabditis
elegans developmental proteins lin-12 and glp-1, C. elegans tissue
patterning protein APX-1, human calcium-dependent serine
proteinase, human cartilage matrix protein, human cartilage
oligomeric matrix protein, human cell surface antigen 114/A10, rat
cell surface glycoprotein complex transmembrane subunit ASGP-2,
human coagulation associated proteins C, Z, and S, human
coagulation factors VII, IX, X, and XII, human complement
components Clr, Cls, C6, C7, C8alpha, C8beta, and C9, human
complement-activating components of Ra-reactive factor, Drosophila
epithelial development protein Crumbs, sea urchin
exogastrula-inducing peptides A, C, D, and X, Drosophila
cadherin-related tumor suppressor protein Fat, human fetal antigen
1 (a neuroendocrine differentiation protein derived from the
delta-like protein), human fibrillins 1 and 2, sea urchin
fibropellins IA, IB, IC, II, and III, human extracellular matrix
proteins fibulin-1 and -2, Drosophila cell determination/axon
guidance protein Argos, various poxvirus growth factor-related
proteins, Drosophila developmental protein Gurken, human
heparin-binding EGF-like growth factor, human transforming growth
factor-alpha, human growth factors Lin-3 and Spitz, human
hepatocyte growth factor activator, human LDL and VLDL receptors,
human LDL receptor-related protein, human leukocyte antigen CD97,
human cell surface glycoprotein EMR1, human cell surface
glycoprotein F4/80, Japanese horseshoe crab limulus clotting factor
C, mammalian membrane-bound endopeptidase Meprin A alpha subunit,
murine milk fat globule-EGF factor 8, human glial growth factors
neuregulin GGF-I and GGF-II, mammalian neurexins, human neurogenic
proteins Notch, Xotch, Tan-1, and Delta, C. elegans differentiation
protein Lag-2, Drosophila differentiation proteins Serrate and
Slit, chordate basement membrane protein Nidogen, Plasmodium
ookinete 24, 25, and 28 kilodalton surface proteins, human
pancreatic secretory granule membrane glycoprotein GP2, human
non-specific cell lysis protein Perforin, human proteoglycans
aggrecan, versican, perlecan, brevican, and chondroitin sulfate,
human endoplasmic reticulum prostaglandin G/H synthases 1 and 2,
human extracellular protein S1-5, human autocrine growth factor
Schwannoma-derived growth factor, human E-, P-, and L-selectins,
Arabidopsis thaliana chlorophyll complex assembly protein
serine/threonine-protein kinase homolog, guinea pig sperm-egg
fusion proteins PH-30alpha and beta, murine stromal cell derived
protein-1, human teratocarcinoma-derived growth factor, mammalian
extracellular protein tenascin, chicken extracellular protein
TEN-A, human tenascin-X, Drosophila tenascin-like proteins TEN-A
and TEN-M, human protein C activator thrombomodulin, human adhesive
glycoproteins thrombospondins 1, 2, 3, and 4, human thyroid
peroxidases 1 and 2, human transforming growth factor beta-1
binding protein, human tyrosine-protein kinase receptors Tek and
Tie, human urokinase-type plasminogen activator, human tissue
plasminogen activator, human uromodulin, human vitamin K-dependent
anticoagulant proteins C and S (and the related human single-chain
plasma glycoprotein Z), the sea urchin 63 kilodalton sperm
flagellar membrane protein, chicken Nel protein, and the
hypothetical C. Elegans protein T20G5.3. Although these proteins
have a variety of activities and sites of expression, a common
characteristic of most of them is that they are involved in
protein-to-protein binding in the extracellular space--either to a
secreted protein, a component of the extracellular matrix, or to an
extracellular portion of an integral membrane protein. Based on
this shared characteristic, the presence of multiple EGF-like
domains in TANGO 331 indicates that TANGO 331 is involved in
binding to proteins extracellularly.
[0248] Post-translational hydroxylation of aspartic acid or
asparagine to form erythro-beta-hydroxyaspartic acid or
erythro-beta-hydroxyasparagine occurs in various proteins having
one or more EGF-like domains (e.g., blood coagulation protein
factors VII, IX, and X, blood coagulation proteins C, S, and Z, the
LDL receptor, thrombomodulin, and the like). TANGO 331 has a
signature sequence which is characteristic of hydroxylation of the
asparagine residue at amino acid residue 310. The invention thus
includes TANGO 331 proteins having a hydroxylated asparagine
residue at position 310 of SEQ ID NO: 56.
[0249] TNFR/NGFR (tumor necrosis factor receptor/nerve growth
factor receptor) cysteine-rich region domains are about 30 to 40
amino acid residues in length, and generally exhibit a conserved
pattern of six or more cysteine residues. These domains occur in
several soluble and transmembrane proteins which are known to be
receptors for growth factors or for cytokines. Examples of
TNFR/NGFR cysteine-rich region domain-containing proteins are human
tumor necrosis factor (TNF) cysteine-rich region domains type I and
type II receptors, Shope fibroma virus soluble TNF receptor, human
lymphotoxin-alpha-beta, human low-affinity nerve growth factor
receptor, human CD40L (cytokine) receptor CD40, human CD27L
(cytokine) receptor CD27, human CD30L (cytokine) receptor CD30,
human T-cell cytokine receptor 4-1BB, human apoptotic FASL protein
receptor FAS, human T-cell OX40L (cytokine) receptor OX40, human
apoptosis-related receptor Wsl-1, and Vaccinia protein A53.
Presence of a TNFR/NGFR cysteine-rich region domain in TANGO 331 is
an indication that TANGO 331 is involved in one or more
physiological processes involving extracellular binding with a
cytokine or growth factor. Such processes include, for example,
growth, homeostasis, regeneration, and proliferation of cells and
tissues, immune (including autoimmune) responses, host defenses
against infection, and the like.
[0250] Metallothioneins are cysteine-rich proteins which are
capable of binding heavy metals such as calcium, zinc, copper,
cadmium, cobalt, nickel, and the like. Proteins which have a domain
which resembles a metal-binding domain of a metallothionein are
also capable of binding such metals. TANGO 331 comprises a
metallothionein-like domain, and is capable of binding one or more
heavy metals. This is an indication that TANGO 331 is involved in
one or more physiological processes which involve metal binding.
Such processes include, by way of example and not limitation,
nutritional supply of metals to cells on a controlled basis,
removal of toxic metal species from body tissues, storage of
metals, and the like.
[0251] TANGO 331 comprises a leucine zipper region at about amino
acid residue 94 to about amino acid residue 115 (i.e., 94
LeaqeehLeawwlqLkseypdL 115). Leucine zipper regions are known to be
involved in dimerization of proteins. Leucine zipper regions
interact with one another, leading to formation of homo- or
hetero-dimers between proteins, depending on their identity. The
presence in TANGO 331 of a leucine zipper region is a further
indication that this protein is involved in protein-protein
interactions.
[0252] TANGO 331 shares amino acid and nucleic acid homology with a
Chinese hamster protein designated HT, and thus is involved in
corresponding physiological processes in humans. An alignment of
the amino acid sequences of (human) TANGO 331 and Chinese hamster
protein HT is shown in FIG. 6E. In this alignment (made using the
ALIGN software {Myers and Miller (1989) CABIOS, ver. 2.0};
pam120.mat scoring matrix; gap opening penalty=12, gap extension
penalty=4), the proteins are 71.9% identical. An alignment of the
nucleotide sequences of the ORFs encoding (human) TANGO 331 and
Chinese hamster protein HT is shown in FIGS. 6F through 6J. The two
ORFs are 74.5% identical, as assessed using the same software and
parameters.
[0253] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
331 protein includes an approximately 24 (i.e., 22, 23, 24, 25, or
26) amino acid residue signal peptide (amino acid residues 1 to 24
of SEQ ID NO: 56; SEQ ID NO: 57) preceding the mature TANGO 331
protein (i.e., approximately amino acid residues 25 to 353 of SEQ
ID NO: 56; SEQ ID NO: 58). Mature human TANGO 331 is a secreted
protein.
[0254] FIG. 6D depicts a hydrophilicity plot of human TANGO 331
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 24 of SEQ ID NO: 56 is the signal sequence
of human TANGO 331 (SEQ ID NO: 57). As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. For example, the
region of human TANGO 331 protein from about amino acid residue 140
to about amino acid residue 170 appears to be located at or near
the surface of the protein, while the region from about amino acid
residue 115 to about amino acid residue 130 appears not to be
located at or near the surface.
[0255] The predicted molecular weight of human TANGO 331 protein
without modification and prior to cleavage of the signal sequence
is about 38.2 kilodaltons. The predicted molecular weight of the
mature human TANGO 331 protein without modification and after
cleavage of the signal sequence is about 35.6 kilodaltons.
[0256] Tissue distribution of TANGO 331 mRNA was determined by
Northern blot. hybridization. Northern blot hybridizations with the
various RNA samples were performed using standard Northern blotting
conditions and washing under stringent conditions (i.e., 0.2.times.
SSC at 65.degree. C.). The DNA probe used in the Northern Blot
experiments was radioactively labeled with .sup.32P-dCTP using the
PRIME-IT.TM. kit (Stratagene, La Jolla, Calif.) according to the
instructions of the supplier. Filters having human mRNA disposed
thereon (MULTITISSUE.TM. Northern I and MULTITISSUE.TM. Northern II
obtained from Clontech, Palo Alto, Calif.) were probed in
EXPRESSHYB.TM. hybridization solution (Clontech) and washed at high
stringency according to the manufacturer's recommendations.
[0257] Two isoforms of human TANGO 331 were identified using this
Northern blot analysis, indicating that TANGO 331 can have a splice
variant. One isoform (corresponding to the larger message) can be a
transmembrane protein (frizzled-like) and the other (i.e., smaller)
isoform can be a secreted form. The two isoforms exhibit a clear
pattern of tissue specificity. On the multiple tissue blot from
Clontech, the large transcript is found in almost all tissues,
whereas the smaller message is expressed mainly in heart, skeletal
muscle, placenta, and pancreas tissues.
[0258] TANGO 331 can be expressed as a recombinant
glutathione-S-transfera- se (GST) fusion polypeptide in E. coli and
the fusion polypeptide is isolated and characterized. Specifically,
TANGO 331 can be fused with GST and this fusion polypeptide can
expressed in E. coli, e.g., in strain PEB199. Expression of the
GST-TANGO 331 fusion protein in PEB199 is induced with IPTG. The
recombinant fusion polypeptide can be purified from crude bacterial
lysates of the induced PEB199 strain by affinity chromatography,
e.g., using glutathione-substituted beads. Using polyacrylamide gel
electrophoretic analysis of the polypeptide purified from the
bacterial lysates, the molecular weight of the resultant fusion
polypeptide can be determined.
[0259] To express the TANGO 331 gene in COS cells, the pcDNA/Amp
vector by Invitrogen Corporation (San Diego, Calif.) can be used.
This vector contains an SV40 origin of replication, an ampicillin
resistance gene, an E. coli replication origin, a CMV promoter
followed by a polylinker region, and an SV40 intron and
polyadenylation site. A DNA fragment encoding the entire TANGO 331
protein and an HA tag (Wilson et al. (1984) Cell 37:767) or a FLAG
tag fused in-frame to its 3' end of the fragment can be cloned into
the polylinker region of the vector, thereby placing the expression
of the recombinant protein under the control of the CMV
promoter.
[0260] To construct the plasmid, the TANGO 331 DNA sequence is
amplified by PCR using two primers. The 5' primer contains the
restriction site of interest followed by approximately twenty
nucleotides of the TANGO 331 coding sequence starting from the
initiation codon; the 3' end sequence contains complementary
sequences to the other restriction site of interest, a translation
stop codon, the HA tag or FLAG tag and the last 20 nucleotides of
the TANGO 331 coding sequence. The PCR amplified fragment and the
pcDNA/Amp vector are digested with the appropriate restriction
enzymes and the vector is dephosphorylated using the CIAP enzyme
(New England Biolabs, Beverly, Mass.). Preferably the two
restriction sites chosen are different so that the TANGO 331 gene
is inserted in the correct orientation. The ligation mixture is
transformed into E. coli cells (e.g., one or more of strains HB101,
DH5a, SURE, available from Stratagene Cloning Systems, La Jolla,
Calif.), the transformed culture is plated on ampicillin media
plates, and resistant colonies are selected. Plasmid DNA is
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment.
[0261] COS cells are subsequently transfected using the TANGO
331-pcDNA/Amp plasmid DNA using the calcium phosphate or calcium
chloride co-precipitation methods, DEAE-dextran-mediated
transfection, lipofection, or electroporation. Other suitable
methods of transfecting host cells can be found in Sambrook, J.,
Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory
Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989. The expression of
the TANGO 331 polypeptide can be detected by radiolabeling
(.sup.35S-methionine or .sup.35S-cysteine available from NEN,
Boston, Mass., can be used) and immunoprecipitation (Harlow, E. and
Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1988) using an HA
specific monoclonal antibody. Briefly, the cells are labeled for 8
hours with .sup.35S-methionine (or .sup.35S-cysteine). The culture
media are then collected and the cells are lysed using detergents
(RIPA buffer, 150 millimolar NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50
millimolar Tris, pH 7.5). Both the cell lysate and the culture
media are precipitated with an HA specific monoclonal antibody.
Precipitated polypeptides are then analyzed by SDS-PAGE.
[0262] Alternatively, DNA containing the TANGO 331 coding sequence
can be cloned directly into the polylinker of the pcDNA/Amp vector
using the appropriate restriction sites. The resulting plasmid is
transfected into COS cells in the manner described above, and the
expression of the TANGO 331 polypeptide can be detected by
radiolabeling and immunoprecipitation using an TANGO 331 specific
monoclonal antibody.
[0263] The human TANGO 331 gene was mapped using the Genebridge 4
Human Radiation hybrid mapping panel with ATTATTCAGAAGGATGTCCCGTGG
(SEQ ID NO: 99) as the forward primer and CCTCCTGATTACCTACAATGGTC
(SEQ ID NO: 100) as the reverse primer. The human TANGO 331 gene
maps to human 22q 11-q 13. Flanking markers for this region are
WI-4572 and WI-8917. The schizophrenia 4 (sczd4) locus also maps to
this region of the human chromosome. Also mapping to this region of
the human chromosome are the following genes: transcription factor
20 (tcf20), Benzodiazepine receptor, peripheral type (bzrp),
Arylsulfatase A (arsa), diaphorase (NADH); cytochrome b-5 reductase
(dia1), and Solute carrier family 5 (sodium/glucose transporter),
member 1 (slca1). This region is syntenic to mouse chromosome 15.
The stargazer (stg), gray tremor (gt), brachyury modifier 2 (Brm2),
bronchial hyper-responsiveness 2 (Bhr2), loss of righting induced
by ethanol 5 (Lore5), fluctuating asymmetry QTL 8 (Faq8), jerky
(Jrk), belted (bt), and koala (Koa) loci also map to this region of
the mouse chromosome, several of which are neuromuscular
related.
[0264] Biological function of TANGO 331 proteins, nucleic acids
encoding them, and modulators of these molecules
[0265] TANGO 331 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 331 is expressed in human mammary epithelial tissue and
human heart tissue, TANGO 331 protein is involved in one or more
biological processes which occur in mammary epithelial tissue, in
other epithelial tissues, and in heart tissue. In particular, TANGO
331 is involved in modulating growth, proliferation, survival,
differentiation, and activity of cells including, but not limited
to, epithelial cells (e.g., mammary epithelial cells) of the animal
in which it is normally expressed. Thus, TANGO 331 has a role in
disorders which affect these cells and their growth, proliferation,
survival, differentiation, and activity. TANGO 331 is therefore
involved in physiological processes such as maintenance of
epithelia, carcinogenesis, modulation and storage of protein
factors and metals, and lactation. Furthermore, because TANGO 331
is expressed in human mammary epithelial cells, it also has a role
in nutrition of human infants (e.g., providing nutrients such as
minerals to infants and providing protein factors not synthesized
by infants) and in disorders which affect them. Thus, TANGO 331 is
involved in a number of disorders such as breast cancer,
insufficient lactation, infant nutritional and growth disorders,
and the like. TANGO 331 polypeptides, nucleic acids, or modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0266] Because TANGO 331 exhibits expression in the heart, TANGO
331 nucleic acids, proteins, and modulators thereof can be used to
treat heart disorders. Examples of heart disorders with which TANGO
331 can be involved include ischemic heart disease,
atherosclerosis, hypertension, angina pectoris, hypertrophic
cardiomyopathy, and congenital heart disease. TANGO 331
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0267] In another example, TANGO 331 polypeptides, nucleic acids,
and modulators thereof, can be involved in normal and aberrant
functioning of skeletal muscle tissue, and can thus be involved in
disorders of such tissue. Examples of skeletal muscle disorders
include muscular dystrophy (e.g., Duchenne muscular dystrophy,
Becker muscular dystrophy, Emery-Dreifuss muscular dystrophy,
limb-girdle muscular dystrophy, facioscapulohumeral muscular
dystrophy, myotonic dystrophy, oculopharyngeal muscular dystrophy,
distal muscular dystrophy, and congenital muscular dystrophy),
motor neuron diseases (e.g., amyotrophic lateral sclerosis,
infantile progressive spinal muscular atrophy, intermediate spinal
muscular atrophy, spinal bulbar muscular atrophy, and adult spinal
muscular atrophy), myopathies (e.g., inflammatory myopathies (e.g.,
dermatomyositis and polymyositis), myotonia congenita, paramyotonia
congenita, central core disease, nemaline myopathy, myotubular
myopathy, and periodic paralysis), and metabolic diseases of muscle
(e.g., phosphorylase deficiency, acid maltase deficiency,
phosphofructokinase deficiency, debrancher enzyme deficiency,
mitochondrial myopathy, carnitine deficiency, carnitine palmityl
transferase deficiency, phosphoglycerate kinase deficiency,
phosphoglycerate mutase deficiency, lactate dehydrogenase
deficiency, and myoadenylate deaminase deficiency). TANGO 331
polypeptides, nucleic acids, or modulators thereof can be used to
prognosticate, diagnose, inhibit, prevent, or alleviate one or more
of these disorders.
[0268] In another example, TANGO 331 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as toxemia of pregnancy (e.g., preeclampsia and eclampsia),
placentitis, and spontaneous abortion. TANGO 331 polypeptides,
nucleic acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0269] In another example, TANGO 331 polypeptides, nucleic acids,
and modulators thereof can be used to treat placental disorders,
such as toxemia of pregnancy (e.g., preeclampsia and eclampsia),
placentitis, and spontaneous abortion.
[0270] Presence in TANGO 331 of numerous EGF-like domains,
including the laminin-like EGF-like domain indicates that TANGO 331
is involved in extracellular binding of proteins, including both
other secreted proteins (e.g., growth factors and cytokines) and
cell-surface proteins. Binding of TANGO 331 to other secreted
proteins modulates their activity, their rate of uptake by cells,
and their rate of degradation. Binding of TANGO 331 to cell surface
proteins modulates their activity, including, for example, their
ability to bind with other secreted proteins, and transmits a
signal to the cell expressing the cell-surface protein. Presence in
TANGO 331 of a TNFR/NGFR cysteine-rich region domain is further
indicative of the ability of TANGO 331 to bind with growth factors
and cytokines. Thus, TANGO 331 is involved in a number of
proliferative and immune disorders including, but not limited to,
cancers (e.g., breast cancer), autoimmune disorders, insufficient
or inappropriate host responses to infection, acquired immune
deficiency syndrome, and the like. TANGO 331 polypeptides, nucleic
acids, or modulators thereof can be used to prognosticate,
diagnose, inhibit, prevent, or alleviate one or more of these
disorders.
[0271] The fact that TANGO 331 has a metallothionein-like region is
indicative of the ability of TANGO 331 to bind with metal ions,
including nutritionally required metal ions (e.g., calcium,
magnesium, zinc, manganese, cobalt, iron, and the like). Thus,
TANGO 331 is involved in binding with essential minerals and in
delivering them to their proper body locations. TANGO 331 is also
involved in binding excess or toxic metal ions so that they can be
excreted. TANGO 331 is thus involved in disorders involving
insufficient or inappropriate localization of metal ions. Such
disorders include, but are not limited to, malnutrition and mineral
deficiency disorders, hemochromatosis, inappropriate calcification
of body tissues, bone disorders such as osteoporosis, and the like.
TANGO 331 polypeptides, nucleic acids, or modulators thereof can be
used to prognosticate, diagnose, inhibit, prevent, or alleviate one
or more of these disorders.
[0272] Mapping of the human TANGO 331 gene to chromosomal region
22q11-q13 is an indication of disorders with which its expression
(or non- or aberrant-expression) can be associated. For example,
arylsulfatase A is associated with Metachromatic leukodystrophy.
Diaphorase (NADH:cytochrome b-5 reductase) is associated with
methemoglobinemia, types I and II. Solute carrier family 5
(sodium/glucose transporter), member 1 is associated with
glucose/galactose malabsorption. The gene designated schizophrenia
4 is associated with schizophrenia and velocardiofacial syndrome,
as described in Online Mendelian Inheritance in Man, Johns Hopkins
University, Baltimore, Md. MIM Number: 600850:12/7/98. (World Wide
Web URL: http://www.ncbi.nlm.nih.gov/omim/). These mapping data
indicate that TANGO 331 polypeptides, nucleic acids, and modulators
thereof can be used to prognosticate, diagnose, inhibit, prevent,
or alleviate one or more of these disorders.
[0273] TANGO 332
[0274] A cDNA clone (designated jlhbab463g12) encoding at least a
portion of human TANGO 332 protein was isolated from a human adult
brain cDNA library. The human TANGO 332 protein is predicted by
structural analysis to be a secreted protein.
[0275] The full length of the cDNA encoding human TANGO 332 protein
(FIG. 7; SEQ ID NO: 59) is 2730 nucleotide residues. The ORF of
this cDNA, nucleotide residues 173 to 2185 of SEQ ID NO: 59 (i.e.,
SEQ ID NO: 60), encodes a 671-amino acid transmembrane protein
(FIG. 7; SEQ ID NO: 61).
[0276] The invention thus includes purified human TANGO 332
protein, both in the form of the immature 671 amino acid residue
protein (SEQ ID NO: 61) and in the form of the mature,
approximately 649 amino acid residue protein (SEQ ID NO: 63).
Mature human TANGO 332 protein can be synthesized without the
signal sequence polypeptide at the amino terminus thereof, or it
can be synthesized by generating immature TANGO 332 protein and
cleaving the signal sequence therefrom.
[0277] In addition to full length mature and immature human TANGO
332 proteins, the invention includes fragments, derivatives, and
variants of these TANGO 332 proteins, as described herein. These
proteins, fragments, derivatives, and variants are collectively
referred to herein as TANGO 332 polypeptides of the invention or
TANGO 332 proteins of the invention.
[0278] The invention also includes nucleic acid molecules which
encode a TANGO 332 polypeptide of the invention. Such nucleic acids
include, for example, a DNA molecule having the nucleotide sequence
listed in SEQ ID NO: 59 or some portion thereof, such as the
portion which encodes mature TANGO 332 protein, immature TANGO 332
protein, or a domain of TANGO 332 protein. These nucleic acids are
collectively referred to as TANGO 332 nucleic acids of the
invention.
[0279] TANGO 332 proteins and nucleic acid molecules encoding them
comprise a family of molecules having certain conserved structural
and functional features, as indicated by the conservation of amino
acid sequence between human TANGO 332 protein, human brain-enriched
hyaluronan-binding factor (BEF), as shown in FIGS. 7G and 7H, and
murine brevican protein, as shown in FIGS. 7I to 7K. This
conservation is further indicated by conservation of nucleotide
sequence between the ORFs encoding human TANGO 332 protein and
murine brevican protein, as shown in FIGS. 7L through 7U.
[0280] A common domain present in TANGO 332 proteins is a signal
sequence. As used herein, a signal sequence includes a peptide of
at least about 10 amino acid residues in length which occurs at the
amino terminus of membrane-bound proteins and which contains at
least about 45% hydrophobic amino acid residues such as alanine,
leucine, isoleucine, phenylalanine, proline, tyrosine, tryptophan,
or valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 35 amino acid residues, preferably about 10 to 20
amino acid residues, and has at least about 35-60%, more preferably
40-50%, and more preferably at least about 45% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer. Thus, in one embodiment, a
TANGO 332 protein contains a signal sequence corresponding to about
amino acid residues 1 to 22 of SEQ ID NO: 61 (SEQ ID NO: 62). The
signal sequence is cleaved during processing of the mature
protein.
[0281] TANGO 332 proteins are secreted proteins. The mature form of
human TANGO 332 protein has the amino acid sequence of
approximately amino acid residues 23 to 671 of SEQ ID NO: 61.
[0282] TANGO 332 proteins typically comprise a variety of potential
post-translational modification sites (often within an
extracellular domain), such as those described herein in Table IX,
as predicted by computerized sequence analysis of TANGO 332
proteins using amino acid sequence comparison software (comparing
the amino acid sequence of TANGO 332 with the information in the
PROSITE database {rel. 12.2; Feb, 1995} and the Hidden Markov
Models database {Rel. PFAM 3.3}). In certain embodiments, a protein
of the invention has at least 1, 2, 4, 6, 10, 15, or 20 or more of
the post-translational modification sites listed in Table IX.
13TABLE IX Amino Acid Type of Potential Modification Site Residues
of Amino Acid or Domain SEQ ID NO: 61 Sequence N-glycosylation site
130 to 133 NDSG 337 to 340 NQTG Protein kinase C phosphorylation
site 67 to 69 SRR 74 to 76 SPR 165 to 167 SAR 212 to 214 TVR 219 to
221 TPR 310 to 312 SVR 319 to 321 SQR 545 to 547 TPR 615 to 617 SGR
Casein kinase II phosphorylation site 29 to 32 SSED 116 to 119 SLTD
219 to 222 TPRE 269 to 272 TLEE 382 to 385 TVTE 386 to 389 TLEE 397
to 400 TESE 419 to 422 STPE 430 to 433 TLLE 446 to 449 SEEE 545 to
548 TPRE 558 to 561 TLVE Tyrosine kinase phosphorylation site 128
to 135 RPNDSGIY 451 to 459 KALEEEEKY N-myristoylation site 47 to 52
GVLGGA 133 to 138 GIYRCE 142 to 147 GIDDSS 174 to 179 GAQEAC 183 to
188 GAHIAT 281 to 286 GAEIAT 288 to 293 GQLYAA 297 to 302 GLDHCS
324 to 329 GGLPGV 403 to 408 GAIYSI 414 to 419 GGGGSS 576 to 581
GVPRGE 586 to 591 GSSEGA Immunoglobulin-/major 50 to 141 See FIG. 7
histocompatibility protein-like (Ig-/MHC-like) domain Extracellular
link domain 156 to 251 See FIG. 7 257 to 353 See FIG. 7
[0283] Among the domains that occur in TANGO 332 protein are an
Ig-/MHC-like domain and a pair of extracellular link domains. In
one embodiment, the protein of the invention has at least one
domain that is at least 55%, preferably at least about 65%, more
preferably at least about 75%, yet more preferably at least about
85%, and most preferably at least about 95% identical to one of
these domains. In other embodiments, the protein has at least one
Ig-/MHC-like domain and one extracellular link domain described
herein in Table IX. In other embodiments, the protein has at least
one Ig-/MHC-like domain and at least two extracellular link
domains.
[0284] Ig-/MHC-like domains are conserved among immunoglobulin (Ig)
constant (CL) regions and one of the three extracellular domains of
major histocompatibility proteins (MHC). The presence in TANGO 332
of an Ig-/MHC-like domain indicates that the corresponding region
of TANGO 332 is structurally similar to this conserved
extracellular region.
[0285] Extracellular link domains occur in hyaluronan-(HA-)binding
proteins. Proteins having this domain include cartilage link
protein, proteoglycans such as aggrecan, brevican, neurocan, and
versican, CD44 antigen (the primary cell surface receptor for HA),
and tumor necrosis factor-inducible protein TSG-6. Presence of a
pair of extracellular link domains in TANGO 332 indicates that this
protein is also involved in HA-binding, and therefore is involved
in physiological processes such as cartilage (and other tissue)
organization, extracellular matrix organization, neural growth and
branching, and cell-to-cell and cell-to-matrix interactions.
Involvement of TANGO 332 in these processes implicates this protein
in disorders such as tumor growth and metastasis, movement of cells
(e.g., leukocytes) through extracellular matrix, inappropriate
inflammation, and the like.
[0286] Brevican is a murine nervous system-specific chondroitin
sulfate proteoglycan which binds in a calcium-dependent manner with
two classes of sulfated glycolipids, namely sulfatides and
HNK-1-reactive sulfoglucuronylglycolipids (Miura et al. (1999) J.
Biol. Chem. 274:11431-11438). A human orthologue, designated BEF
(`Brain-Enriched hyaluronan-binding Factor`), of murine brevican is
expressed by human glioma cells, but not by brain tumors of
non-glial origin (P.C.T. application publication number WO98/31800;
Zhang et al. (1998) J. Neurosci. 18:2370-2376). Those authors
suggested that cleavage of that human orthologue mediates glioma
cell invasion in vivo.
[0287] An alignment of the amino acid sequences of TANGO 332 and
BEF protein is shown in FIGS. 7G and 7H. In this alignment (made
using the ALIGN software {Myers and Miller (1989) CABIOS, ver.
2.0}; pam120.mat scoring matrix; gap opening penalty=12, gap
extension penalty=4), the proteins are 75.7% identical, although it
is seen that TANGO 332 includes two domains (one from about amino
acid residue 152 to about residue 208, and the other near the
carboxyl terminus of TANGO 332) which do not occur in BEF protein.
It is likely that these two regions account for the differences
between the physiological roles of TANGO 332 and BEF.
[0288] An alignment of the amino acid sequences of (human) TANGO
332 and murine brevican protein is shown in FIGS. 7I through 7K. In
this alignment (made using the ALIGN software {Myers and Miller
(1989) CABIOS, ver. 2.0}; pam120.mat scoring matrix; gap opening
penalty=12, gap extension penalty=4), the proteins are 75.5%
identical, although it is seen that murine brevican protein
includes a domain which does not occur in TANGO 332 protein, this
domain is present from about amino acid residue 626 to the carboxyl
terminus of murine brevican protein. An alignment of the nucleotide
sequences of the ORFs encoding (human) TANGO 332 and murine
brevican protein is shown in FIGS. 7L through 7U. The two ORFs are
62.6% identical, as assessed using the same software and
parameters.
[0289] TANGO 332 exhibits many of the same properties as BEF. TANGO
332 is also related to murine brevican protein, and thus is
involved with corresponding physiological processes (i.e., such as
those described above) in humans. For example, TANGO 332 modulates
intracellular binding and migration of cells in a tissue or
extracellular matrix. However, the absence from BEF of one of the
two extracellular link domains present in TANGO 332 indicates that
one or more of the subunit structure, the tissue specificity, and
the binding specificity of TANGO 332 and BEF proteins differ. Thus,
TANGO 332 is involved in many of the physiological processes and
disorders in which BEF protein is involved. Like murine brevican
and other proteoglycans, TANGO 332 acts in vivo as a tissue
organizing protein, influences growth and maturation of tissues in
which it is expressed, modulates growth factor-mediated activities,
modulates structural features of tissues (e.g., collagen
fibrillogenesis), modulates tumor cell growth and invasivity, and
influences neurite growth and branching.
[0290] The signal peptide prediction program SIGNALP (Nielsen et
al. (1997) Protein Engineering 10:1-6) predicted that human TANGO
332 protein includes an approximately 22 (i.e., 20, 21, 22, 23, or
24) amino acid residue signal peptide (amino acid residues 1 to 22
of SEQ ID NO: 61; SEQ ID NO: 62) preceding the mature TANGO 332
protein (i.e., approximately amino acid residues 23 to 671 of SEQ
ID NO: 61; SEQ ID NO: 63). Human TANGO 332 protein is a secreted
protein, as assessed using the secretion assay described herein.
Secreted TANGO 332 proteins having approximate sizes of 148
kilodaltons and 100 kilodaltons could be detected using this
assay.
[0291] FIG. 7F depicts a hydrophilicity plot of human TANGO 332
protein. Relatively hydrophobic regions are above the dashed
horizontal line, and relatively hydrophilic regions are below the
dashed horizontal line. The hydrophobic region which corresponds to
amino acid residues 1 to 22 of SEQ ID NO: 61 is the signal sequence
of human TANGO 332 (SEQ ID NO: 62). As described elsewhere herein,
relatively hydrophilic regions are generally located at or near the
surface of a protein, and are more frequently effective immunogenic
epitopes than are relatively hydrophobic regions. For example, the
region of human TANGO 332 protein from about amino acid residue 445
to about amino acid residue 475 appears to be located at or near
the surface of the protein, while the region from about amino acid
residue 45 to about amino acid residue 62 appears not to be located
at or near the surface.
[0292] The predicted molecular weight of human TANGO 332 protein
without modification and prior to cleavage of the signal sequence
is about 71.7 kilodaltons. The predicted molecular weight of the
mature human TANGO 332 protein without modification and after
cleavage of the signal sequence is about 69.5 kilodaltons.
[0293] Biological function of TANGO 332 proteins, nucleic acids
encoding them, and modulators of these molecules
[0294] TANGO 332 proteins are involved in disorders which affect
both tissues in which they are normally expressed and tissues in
which they are normally not expressed. Based on the observation
that TANGO 332 is expressed in human adult brain tissue, TANGO 332
protein is involved in one or more biological processes which occur
in these tissues. In particular, TANGO 332 is involved in
modulating growth, proliferation, survival, differentiation, and
activity of cells including, but not limited to, adult brain cells
of the animal in which it is normally expressed. Thus, TANGO 332
has a role in disorders which affect these cells and their growth,
proliferation, survival, differentiation, interaction, and
activity. Examples of such disorders include, by way of example and
not limitation, disorders of neural connection establishment or
maintenance, impaired cognitive function, dementia, senility,
Alzheimer's disease, mental retardation, brain tumors (e.g.,
gliomas such as astrocytomas, endophytic and exophytic
retinoblastomas, ependymomas, gangliogliomas, mixed gliomas, nasal
gliomas, optic gliomas, and Schwannomas, and other brain cell
tumors such as medulloblastomas, pituitary adenomas, teratomas,
etc.), and the like.
[0295] Homology of human TANGO 332 with murine brevican protein and
with human brevican homolog BEF indicates that TANGO 332 has
physiological functions in humans analogous to the functions of
these proteins. Brevican is a member of the aggrecan/versican
family of proteoglycans, and has a hyaluronic acid-binding domain
in its amino terminal region and a lectin-like domain in its
carboxyl terminal region. Expression of brevican is highly specific
to brain tissue, and increases as the mammalian brain develops.
Thus, brevican is involved in maintaining the extracellular
environment of mature brain tissue and is a constituent of adult
brain extracellular matrix. TANGO 332 is involved in modulating
cell-to-cell adhesion, tissue and extracellular matrix invasivity
of cells, and the like. Thus, TANGO 332 is involved in disorders in
which these physiological processes are relevant. Such disorders
include, for example, loss of control of cell growth, tumor
metastasis, malformation of neurological connections, inflammation,
immune and autoimmune responses, and the like.
[0296] In addition, presence in TANGO 332 of extracellular link
domains indicates that this protein is involved in physiological
processes involving structure and function of extracellular
matrices and interaction of cells with such matrices and with each
other. This is further evidence that TANGO 332 is involved in
disorders such as inappropriate inflammation, tumor metastasis,
inappropriate leukocyte extravasation, localization, and
reactivity, and the like.
[0297] TANGO 332-related molecules can be used to modulate one or
more of the activities in which TANGO 332 is involved and can also
be used to prevent, diagnose, or treat one or more of the disorders
in which TANGO 332 is involved.
[0298] Tables A and B summarize sequence data corresponding to the
human proteins herein designated INTERCEPT 217, INTERCEPT 297,
TANGO 276, TANGO 292, TANGO 325, TANGO 331, and TANGO 332.
14TABLE A Protein SEQ ID NOs Depicted in ATCC .RTM. Designation
cDNA ORF Protein FIG. # Accession # INTERCEPT 217 1 2 3 1 PTA-147
INTERCEPT 297 9 10 11 2 PTA-147 TANGO 276 33 34 35 3 PTA-150 TANGO
292 38 39 40 4 207230 TANGO 325 46 47 48 5 PTA-147 TANGO 331 54 55
56 6 PTA-147 TANGO 332 59 60 61 7 PTA-151
[0299]
15TABLE B Protein Signal Mature Extracellular Transmembrane
Cytoplasmic Desig. Sequence Protein Domain(s) Domains(s) Domain(s)
SEQ ID NOs INTERCEPT 217 1-20 4 21-455 5 21-383 6 384-403 7 404-455
8 INTERCEPT 297 (1-18) (12) 19-371 13 19-47 14 (1-18) 12 69-88 28
110-118 15 48-68 19 138-144 29 162-175 16 89-109 20 193-215 30
234-260 17 119-137 21 284-292 31 313-319 18 145-161 22 337-371 32
176-192 23 216-233 24 261-283 25 293-312 26 320-336 27 TANGO 276
1-20 36 21-243 37 21-243 37 N/A N/A TANGO 292 1-17 41 18-226 42
18-113 43 114-138 44 139-226 45 TANGO 325 1-31 49 32-622 50 32-529
51 530-547 52 548-622 53 TANGO 331 1-24 57 25-353 58 25-353 58 N/A
N/A TANGO 332 1-22 62 23-671 63 23-671 63 N/A N/A Amino Acid
Residues
[0300] Various aspects of the invention are described in further
detail in the following subsections.
[0301] Isolated Nucleic Acid Molecules
[0302] One aspect of the invention pertains to isolated nucleic
acid molecules that encode a polypeptide of the invention or a
biologically active portion thereof, as well as nucleic acid
molecules sufficient for use as hybridization probes to identify
nucleic acid molecules encoding a polypeptide of the invention and
fragments of such nucleic acid molecules suitable for use as PCR
primers for the amplification or mutation of nucleic acid
molecules. As used herein, the term "nucleic acid molecule" is
intended to include DNA molecules (e.g., cDNA or genomic DNA) and
RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated
using nucleotide analogs. The nucleic acid molecule can be
single-stranded or double-stranded, but preferably is
double-stranded DNA.
[0303] An "isolated" nucleic acid molecule is one which is
separated from other nucleic acid molecules which are present in
the natural source of the nucleic acid molecule. Preferably, an
"isolated" nucleic acid molecule is free of sequences (preferably
protein-encoding sequences) which naturally flank the nucleic acid
(i.e., sequences located at the 5' and 3' ends of the nucleic acid)
in the genomic DNA of the organism from which the nucleic acid is
derived. For example, in various embodiments, the isolated nucleic
acid molecule can contain less than about 5 kilobases, 4 kilobases,
3 kilobases, 2 kilobases, 1 kilobases, 0.5 kilobases, or 0.1
kilobases of nucleotide sequences which naturally flank the nucleic
acid molecule in genomic DNA of the cell from which the nucleic
acid is derived. Moreover, an "isolated" nucleic acid molecule,
such as a cDNA molecule, can be substantially free of other
cellular material, or culture medium when produced by recombinant
techniques, or substantially free of chemical precursors or other
chemicals when chemically synthesized.
[0304] A nucleic acid molecule of the present invention, e.g., a
nucleic acid molecule having the nucleotide sequence of all or a
portion of SEQ ID NO: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55,
59, 60, 81, 82, and 92, or a complement thereof, or which has a
nucleotide sequence comprising one of these sequences, can be
isolated using standard molecular biology techniques and the
sequence information provided herein. Using all or a portion of the
nucleic acid sequences of SEQ ID NO: 1, 2, 9, 10, 33, 34, 38, 39,
46, 47, 54, 55, 59, 60, 81, 82, or 92 as a hybridization probe,
nucleic acid molecules of the invention can be isolated using
standard hybridization and cloning techniques (e.g., as described
in Sambrook et al., eds., Molecular Cloning: A Laboratory Manual,
2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989).
[0305] A nucleic acid molecule of the invention can be amplified
using cDNA, mRNA or genomic DNA as a template and appropriate
oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to all or a portion of
a nucleic acid molecule of the invention can be prepared by
standard synthetic techniques, e.g., using an automated DNA
synthesizer.
[0306] In another preferred embodiment, an isolated nucleic acid
molecule of the invention comprises a nucleic acid molecule which
is a complement of the nucleotide sequence of SEQ ID NO: 1, 2, 9,
10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or a
portion thereof. A nucleic acid molecule which is complementary to
a given nucleotide sequence is one which is sufficiently
complementary to the given nucleotide sequence that it can
hybridize to the given nucleotide sequence thereby forming a stable
duplex.
[0307] Moreover, a nucleic acid molecule of the invention can
comprise only a portion of a nucleic acid sequence encoding a full
length polypeptide of the invention for example, a fragment which
can be used as a probe or primer or a fragment encoding a
biologically active portion of a polypeptide of the invention. The
nucleotide sequence determined from the cloning one gene allows for
the generation of probes and primers designed for use in
identifying and/or cloning homologs in other cell types, e.g., from
other tissues, as well as homologs from other mammals. The
probe/primer typically comprises substantially purified
oligonucleotide. The oligonucleotide typically comprises a region
of nucleotide sequence that hybridizes under stringent conditions
to at least about 15, preferably about 25, more preferably about
50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 or more
consecutive nucleotides of the sense or anti-sense sequence of one
of any of SEQ ID NOs: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55,
59, 60, 81, 82, and 92, or of a naturally occurring mutant of one
of SEQ ID NO: 1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60,
81, 82, and 92.
[0308] Probes based on the sequence of a nucleic acid molecule of
the invention can be used to detect transcripts or genomic
sequences encoding the same protein molecule encoded by a selected
nucleic acid molecule. The probe comprises a label group attached
thereto, e.g., a radioisotope, a fluorescent compound, an enzyme,
or an enzyme co-factor. Such probes can be used as part of a
diagnostic test kit for identifying cells or tissues which
mis-express the protein, such as by measuring levels of a nucleic
acid molecule encoding the protein in a sample of cells from a
subject, e.g., detecting mRNA levels or determining whether a gene
encoding the protein has been mutated or deleted.
[0309] A nucleic acid fragment encoding a biologically active
portion of a polypeptide of the invention can be prepared by
isolating a portion of one of SEQ ID NO: 2, 10, 34, 39, 47, 55, 60,
82, and 92, expressing the encoded portion of the polypeptide
protein (e.g., by recombinant expression in vitro), and assessing
the activity of the encoded portion of the polypeptide.
[0310] The invention further encompasses nucleic acid molecules
that differ from the nucleotide sequence of SEQ ID NO: 1, 2, 9, 10,
33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92 due to
degeneracy of the genetic code and thus encode the same protein as
that encoded by the nucleotide sequence of SEQ ID NO: 2, 10, 34,
39, 47, 55, 60, 82, or 92.
[0311] In addition to the nucleotide sequences of SEQ ID NOs: 2,
10, 34, 39, 47, 55, 60, 82, and 92, it will be appreciated by those
skilled in the art that DNA sequence polymorphisms that lead to
changes in the amino acid sequence can exist within a population
(e.g., the human population). Such genetic polymorphisms can exist
among individuals within a population due to natural allelic
variation. An allele is one of a group of genes which occur
alternatively at a given genetic locus.
[0312] As used herein, the phrase "allelic variant" refers to a
nucleotide sequence which occurs at a given locus or to a
polypeptide encoded by the nucleotide sequence.
[0313] As used herein, the terms "gene" and "recombinant gene"
refer to nucleic acid molecules comprising an open reading frame
encoding a polypeptide of the invention. Such natural allelic
variations can typically result in 1-5% variance in the nucleotide
sequence of a given gene. Alternative alleles can be identified by
sequencing the gene of interest in a number of different
individuals. This can be readily carried out by using hybridization
probes to identify the same genetic locus in a variety of
individuals. Any and all such nucleotide variations and resulting
amino acid polymorphisms or variations that are the result of
natural allelic variation and that do not alter the functional
activity are intended to be within the scope of the invention.
[0314] Moreover, nucleic acid molecules encoding proteins of the
invention from other species (homologs), which have a nucleotide
sequence which differs from that of the specific proteins described
herein are intended to be within the scope of the invention.
Nucleic acid molecules corresponding to natural allelic variants
and homologs of a cDNA of the invention can be isolated based on
their identity to human nucleic acid molecules using the cDNAs
described herein, or a portion thereof, as a hybridization probe
according to standard hybridization techniques under stringent
hybridization conditions. For example, a cDNA encoding a soluble
form of a membrane-bound protein of the invention isolated based on
its hybridization to a nucleic acid molecule encoding all or part
of the membrane-bound form. Likewise, a cDNA encoding a
membrane-bound form can be isolated based on its hybridization to a
nucleic acid molecule encoding all or part of the soluble form.
[0315] Accordingly, in another embodiment, an isolated nucleic acid
molecule of the invention is at least 15 (25, 40, 60, 80, 100, 150,
200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1200,
1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000,
4500, or 4928) nucleotides in length and hybridizes under stringent
conditions to the nucleic acid molecule comprising the nucleotide
sequence, preferably the coding sequence, of SEQ ID NO: 1, 2, 9,
10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or a
complement thereof. As used herein, the term "hybridizes under
stringent conditions" is intended to describe conditions for
hybridization and washing under which nucleotide sequences at least
60% (65%, 70%, preferably 75%) identical to each other typically
remain hybridized to each other. Such stringent conditions are
known to those skilled in the art and can be found in Current
Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989),
6.3.1-6.3.6. A preferred, non-limiting example of stringent
hybridization conditions are hybridization in 6.times.sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by
one or more washes in 0.2.times. SSC, 0.1% SDS at 50-65.degree. C.
Preferably, an isolated nucleic acid molecule of the invention that
hybridizes under stringent conditions to the sequence of SEQ ID NO:
1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92,
or a complement thereof, corresponds to a naturally-occurring
nucleic acid molecule. As used herein, a "naturally-occurring"
nucleic acid molecule refers to an RNA or DNA molecule having a
nucleotide sequence that occurs in nature (e.g., encodes a natural
protein).
[0316] In addition to naturally-occurring allelic variants of a
nucleic acid molecule of the invention sequence that can exist in
the population, the skilled artisan will further appreciate that
changes can be introduced by mutation thereby leading to changes in
the amino acid sequence of the encoded protein, without altering
the biological activity of the protein. For example, one can make
nucleotide substitutions leading to amino acid substitutions at
"non-essential" amino acid residues. A "non-essential" amino acid
residue is a residue that can be altered from the wild-type
sequence without altering the biological activity, whereas an
"essential" amino acid residue is required for biological activity.
For example, amino acid residues that are not conserved or only
semi-conserved among homologs of various species may be
non-essential for activity and thus would be likely targets for
alteration. Alternatively, amino acid residues that are conserved
among the homologs of various species (e.g., murine and human) may
be essential for activity and thus would not be likely targets for
alteration.
[0317] Accordingly, another aspect of the invention pertains to
nucleic acid molecules encoding a polypeptide of the invention that
contain changes in amino acid residues that are not essential for
activity. Such polypeptides differ in amino acid sequence from SEQ
ID NO: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88, and
93-98, yet retain biological activity. In one embodiment, the
isolated nucleic acid molecule includes a nucleotide sequence
encoding a protein that includes an amino acid sequence that is at
least about 40% identical, 50%, 60%, 70%, 80%, 90%, 95%, or 98%
identical to the amino acid sequence of one of SEQ ID NO: 3-8,
11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88, and 93-98.
[0318] An isolated nucleic acid molecule encoding a variant protein
can be created by introducing one or more nucleotide substitutions,
additions or deletions into the nucleotide sequence of SEQ ID NO:
1, 2, 9, 10, 33, 34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92,
such that one or more amino acid residue substitutions, additions
or deletions are introduced into the encoded protein. Mutations can
be introduced by standard techniques, such as site-directed
mutagenesis and PCR-mediated mutagenesis. Preferably, conservative
amino acid substitutions are made at one or more predicted
non-essential amino acid residues. A "conservative amino acid
substitution" is one in which the amino acid residue is replaced
with an amino acid residue having a similar side chain. Families of
amino acid residues having similar side chains have been defined in
the art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), non-polar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Alternatively, mutations can be introduced randomly
along all or part of the coding sequence, such as by saturation
mutagenesis, and the resultant mutants can be screened for
biological activity to identify mutants that retain activity.
Following mutagenesis, the encoded protein can be expressed
recombinantly and the activity of the protein can be
determined.
[0319] In a preferred embodiment, a mutant polypeptide that is a
variant of a polypeptide of the invention can be assayed for: (1)
the ability to form protein:protein interactions with the
polypeptide of the invention; (2) the ability to bind a ligand of
the polypeptide of the invention (e.g., another protein identified
herein); (3) the ability to bind to a modulator or substrate of the
polypeptide of the invention; or (4) the ability to modulate a
physiological activity of the protein, such as one of those
disclosed herein.
[0320] The present invention encompasses antisense nucleic acid
molecules, i.e., molecules which are complementary to a sense
nucleic acid encoding a polypeptide of the invention, e.g.,
complementary to the coding strand of a double-stranded cDNA
molecule or complementary to an mRNA sequence. Accordingly, an
antisense nucleic acid can hydrogen bond to a sense nucleic acid.
The antisense nucleic acid can be complementary to an entire coding
strand, or to only a portion thereof, e.g., all or part of the
protein coding region (or open reading frame). An antisense nucleic
acid molecule can be antisense to all or part of a non-coding
region of the coding strand of a nucleotide sequence encoding a
polypeptide of the invention. The non-coding regions ("5' and 3'
un-translated regions") are the 5' and 3' sequences which flank the
coding region and are not translated into amino acids.
[0321] An antisense oligonucleotide can be, for example, about 5,
10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in
length. An antisense nucleic acid of the invention can be
constructed using chemical synthesis and enzymatic ligation
reactions using procedures known in the art. For example, an
antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or
variously modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of
the duplex formed between the antisense and sense nucleic acids,
e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be used. Examples of modified nucleotides which can
be used to generate the antisense nucleic acid include
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxymethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosin- e, inosine, N.sub.6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopenten- yladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been sub-cloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[0322] The antisense nucleic acid molecules of the invention are
typically administered to a subject or generated in situ such that
they hybridize with or bind to cellular mRNA and/or genomic DNA
encoding a selected polypeptide of the invention to thereby inhibit
expression, e.g., by inhibiting transcription and/or translation.
The hybridization can be by conventional nucleotide complementarity
to form a stable duplex, or, for example, in the case of an
antisense nucleic acid molecule which binds to DNA duplexes,
through specific interactions in the major groove of the double
helix. An example of a route of administration of antisense nucleic
acid molecules of the invention includes direct injection at a
tissue site. Alternatively, antisense nucleic acid molecules can be
modified to target selected cells and then administered
systemically. For example, for systemic administration, antisense
molecules can be modified such that they specifically bind to
receptors or antigens expressed on a selected cell surface, e.g.,
by linking the antisense nucleic acid molecules to peptides or
antibodies which bind to cell surface receptors or antigens. The
antisense nucleic acid molecules can also be delivered to cells
using the vectors described herein. To achieve sufficient
intracellular concentrations of the antisense molecules, vector
constructs in which the antisense nucleic acid molecule is placed
under the control of a strong pol II or pol III promoter are
preferred.
[0323] An antisense nucleic acid molecule of the invention can be
an alpha-anomeric nucleic acid molecule. An alpha-anomeric nucleic
acid molecule forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual beta-units, the
strands run parallel to each other (Gaultier et al. (1987) Nucleic
Acids Res. 15:6625-6641). The antisense nucleic acid molecule can
also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987)
Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue
(Inoue et al. (1987) FEBS Lett. 215:327-330).
[0324] The invention also encompasses ribozymes. Ribozymes are
catalytic RNA molecules with ribonuclease activity which are
capable of cleaving a single-stranded nucleic acid, such as an
mRNA, to which they have a complementary region. Thus, ribozymes
(e.g., hammerhead ribozymes as described in Haselhoff and Gerlach
(1988) Nature 334:585-591) can be used to catalytically cleave mRNA
transcripts to thereby inhibit translation of the protein encoded
by the mRNA. A ribozyme having specificity for a nucleic acid
molecule encoding a polypeptide of the invention can be designed
based upon the nucleotide sequence of a cDNA disclosed herein. For
example, a derivative of a Tetrahymena L-19 IVS RNA can be
constructed in which the nucleotide sequence of the active site is
complementary to the nucleotide sequence to be cleaved in a Cech et
al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No.
5,116,742. Alternatively, an mRNA encoding a polypeptide of the
invention can be used to select a catalytic RNA having a specific
ribonuclease activity from a pool of RNA molecules. See, e.g.,
Bartel and Szostak (1993) Science 261:1411-1418.
[0325] The invention also encompasses nucleic acid molecules which
form triple helical structures. For example, expression of a
polypeptide of the invention can be inhibited by targeting
nucleotide sequences complementary to the regulatory region of the
gene encoding the polypeptide (e.g., the promoter and/or enhancer)
to form triple helical structures that prevent transcription of the
gene in target cells. See generally Helene (1991) Anticancer Drug
Des. 6(6):569-84; Helene (1992) Ann. N.Y. Acad. Sci. 660:27-36; and
Maher (1992) Bioassays 14(12):807-15.
[0326] In various embodiments, the nucleic acid molecules of the
invention can be modified at the base moiety, sugar moiety or
phosphate backbone to improve, e.g., the stability, hybridization,
or solubility of the molecule. For example, the deoxyribose
phosphate backbone of the nucleic acids can be modified to generate
peptide nucleic acids (see Hyrup et al. (1996) Bioorganic &
Medicinal Chemistry 4(1): 5-23). As used herein, the terms "peptide
nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA
mimics, in which the deoxyribose phosphate backbone is replaced by
a pseudopeptide backbone and only the four natural nucleobases are
retained. The neutral backbone of PNAs has been shown to allow for
specific hybridization to DNA and RNA under conditions of low ionic
strength. The synthesis of PNA oligomers can be performed using
standard solid phase peptide synthesis protocols as described in
Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996) Proc. Natl.
Acad. Sci. USA 93: 14670-675.
[0327] PNAs can be used in therapeutic and diagnostic applications.
For example, PNAs can be used as antisense or anti-gene agents for
sequence-specific modulation of gene expression by, e.g., inducing
transcription or translation arrest or inhibiting replication. PNAs
can also be used, e.g., in the analysis of single base pair
mutations in a gene by, e.g., PNA directed PCR clamping; as
artificial restriction enzymes when used in combination with other
enzymes, e.g., S1 nucleases (Hyrup (1996), supra; or as probes or
primers for DNA sequence and hybridization (Hyrup (1996), supra;
Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93:
14670-675).
[0328] In another embodiment, PNAs can be modified, e.g., to
enhance their stability or cellular uptake, by attaching lipophilic
or other helper groups to PNA, by the formation of PNA-DNA
chimeras, or by the use of liposomes or other techniques of drug
delivery known in the art. For example, PNA-DNA chimeras can be
generated which can combine the advantageous properties of PNA and
DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and
DNA polymerases, to interact with the DNA portion while the PNA
portion would provide high binding affinity and specificity.
PNA-DNA chimeras can be linked using linkers of appropriate lengths
selected in terms of base stacking, number of bonds between the
nucleobases, and orientation (Hyrup (1996), supra). The synthesis
of PNA-DNA chimeras can be performed as described in Hyrup (1996),
supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63.
For example, a DNA chain can be synthesized on a solid support
using standard phosphoramidite coupling chemistry and modified
nucleoside analogs. Compounds such as
5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite can be
used as a link between the PNA and the 5' end of DNA (Mag et al.
(1989) Nucleic Acids Res. 17:5973-88).
[0329] PNA monomers are then coupled in a step-wise manner to
produce a chimeric molecule with a 5' PNA segment and a 3' DNA
segment (Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63).
[0330] Alternatively, chimeric molecules can be synthesized with a
5' DNA segment and a 3' PNA segment (Peterser et al. (1975)
Bioorganic Med. Chem. Lett. 5:1119-11124).
[0331] In other embodiments, the oligonucleotide can include other
appended groups such as peptides (e.g., for targeting host cell
receptors in vivo), or agents facilitating transport across the
cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad.
Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad.
Sci. USA 84:648-652; PCT Publication No. WO 88/09810) or the
blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134).
In addition, oligonucleotides can be modified with
hybridization-triggered cleavage agents (see, e.g., Krol et al.
(1988) Bio/Techniques 6:958-976) or intercalating agents (see,
e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the
oligonucleotide can be conjugated to another molecule, e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
[0332] Isolated Proteins and Antibodies
[0333] One aspect of the invention pertains to isolated proteins,
and biologically active portions thereof, as well as polypeptide
fragments suitable for use as immunogens to raise antibodies
directed against a polypeptide of the invention. In one embodiment,
the native polypeptide can be isolated from cells or tissue sources
by an appropriate purification scheme using standard protein
purification techniques. In another embodiment, polypeptides of the
invention are produced by recombinant DNA techniques. Alternative
to recombinant expression, a polypeptide of the invention can be
synthesized chemically using standard peptide synthesis
techniques.
[0334] An "isolated" or "purified" protein or biologically active
portion thereof is substantially free of cellular material or other
contaminating proteins from the cell or tissue source from which
the protein is derived, or substantially free of chemical
precursors or other chemicals when chemically synthesized. The
language "substantially free of cellular material" includes
preparations of protein in which the protein is separated from
cellular components of the cells from which it is isolated or
recombinantly produced. Thus, protein that is substantially free of
cellular material includes preparations of protein having less than
about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein
(also referred to herein as a "contaminating protein"). When the
protein or biologically active portion thereof is recombinantly
produced, it is also preferably substantially free of culture
medium, i.e., culture medium represents less than about 20%, 10%,
or 5% of the volume of the protein preparation. When the protein is
produced by chemical synthesis, it is preferably substantially free
of chemical precursors or other chemicals, i.e., it is separated
from chemical precursors or other chemicals which are involved in
the synthesis of the protein. Accordingly such preparations of the
protein have less than about 30%, 20%, 10%, 5% (by dry weight) of
chemical precursors or compounds other than the polypeptide of
interest.
[0335] Biologically active portions of a polypeptide of the
invention include polypeptides comprising amino acid sequences
sufficiently identical to or derived from the amino acid sequence
of the protein (e.g., the amino acid sequence shown in any of SEQ
ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88, and
93-98), which include fewer amino acids than the full length
protein, and exhibit at least one activity of the corresponding
full-length protein. Typically, biologically active portions
comprise a domain or motif with at least one activity of the
corresponding protein. A biologically active portion of a protein
of the invention can be a polypeptide which is, for example, 10,
25, 50, 100 or more amino acids in length. Moreover, other
biologically active portions, in which other regions of the protein
are deleted, can be prepared by recombinant techniques and
evaluated for one or more of the functional activities of the
native form of a polypeptide of the invention.
[0336] Preferred polypeptides have the amino acid sequence of one
of SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63,
83-88, and 93-98. Other useful proteins are substantially identical
(e.g., at least about 40%, preferably 50%, 60%, 70%, 80%, 90%, 95%,
or 99%) to any of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, and 93-98, and retain the functional activity
of the protein of the corresponding naturally-occurring protein yet
differ in amino acid sequence due to natural allelic variation or
mutagenesis.
[0337] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes (e.g., gaps can be introduced in the
sequence of a first amino acid or nucleic acid sequence for optimal
alignment with a second amino or nucleic acid sequence). The amino
acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are identical at that position. The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences (i.e., % identity=# of
identical positions/total # of positions (e.g., overlapping
positions).times.100). In one embodiment the two sequences are the
same length.
[0338] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
non-limiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in
Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
Such an algorithm is incorporated into the NBLAST and XBLAST
programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410.
BLAST nucleotide searches can be performed with the NBLAST program,
score 100, wordlength=12 to obtain nucleotide sequences homologous
to a nucleic acid molecules of the invention. BLAST protein
searches can be performed with the XBLAST program, score=50,
wordlength=3 to obtain amino acid sequences homologous to a protein
molecules of the invention. To obtain gapped alignments for
comparison purposes, Gapped BLAST can be utilized as described in
Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402.
Alternatively, PSI-Blast can be used to perform an iterated search
which detects distant relationships between molecules. Id. When
utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default
parameters of the respective programs (e.g., XBLAST and NBLAST) can
be used. See http://www.ncbi.nlm.nih.gov. Another preferred,
non-limiting example of a mathematical algorithm utilized for the
comparison of sequences is the algorithm of Myers and Miller,
(1988) CABIOS 4:11-17. Such an algorithm is incorporated into the
ALIGN program (version 2.0) which is part of the GCG sequence
alignment software package. When utilizing the ALIGN program for
comparing amino acid sequences, a PAM 120 weight residue table, a
gap length penalty of 12, and a gap penalty of 4 can be used.
[0339] The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, only exact matches
are counted.
[0340] The invention also provides chimeric or fusion proteins. As
used herein, a "chimeric protein" or "fusion protein" comprises all
or part (preferably biologically active) of a polypeptide of the
invention operably linked to a heterologous polypeptide (i.e., a
polypeptide other than the same polypeptide of the invention).
Within the fusion protein, the term "operably linked" is intended
to indicate that the polypeptide of the invention and the
heterologous polypeptide are fused in-frame to each other. The
heterologous polypeptide can be fused to the amino-terminus or the
carboxyl-terminus of the polypeptide of the invention.
[0341] One useful fusion protein is a GST fusion protein in which
the polypeptide of the invention is fused to the carboxyl terminus
of GST sequences. Such fusion proteins can facilitate the
purification of a recombinant polypeptide of the invention.
[0342] In another embodiment, the fusion protein contains a
heterologous signal sequence at its amino terminus. For example,
the native signal sequence of a polypeptide of the invention can be
removed and replaced with a signal sequence from another protein.
For example, the gp67 secretory sequence of the baculovirus
envelope protein can be used as a heterologous signal sequence
(Current Protocols in Molecular Biology, Ausubel et al., eds., John
Wiley & Sons, 1992). Other examples of eukaryotic heterologous
signal sequences include the secretory sequences of melittin and
human placental alkaline phosphatase (Stratagene; La Jolla,
Calif.). In yet another example, useful prokaryotic heterologous
signal sequences include the phoA secretory signal (Sambrook et
al., supra) and the protein A secretory signal (Pharmacia Biotech;
Piscataway, N.J.).
[0343] In yet another embodiment, the fusion protein is an
immunoglobulin fusion protein in which all or part of a polypeptide
of the invention is fused to sequences derived from a member of the
immunoglobulin protein family. The immunoglobulin fusion proteins
of the invention can be incorporated into pharmaceutical
compositions and administered to a subject to inhibit an
interaction between a ligand (soluble or membrane-bound) and a
protein on the surface of a cell (receptor), to thereby suppress
signal transduction in vivo. The immunoglobulin fusion protein can
be used to affect the bioavailability of a cognate ligand of a
polypeptide of the invention. Inhibition of ligand/receptor
interaction can be useful therapeutically, both for treating
proliferative and differentiative disorders and for modulating
(e.g., promoting or inhibiting) cell survival. Moreover, the
immunoglobulin fusion proteins of the invention can be used as
immunogens to produce antibodies directed against a polypeptide of
the invention in a subject, to purify ligands and in screening
assays to identify molecules which inhibit the interaction of
receptors with ligands.
[0344] Chimeric and fusion proteins of the invention can be
produced by standard recombinant DNA techniques. In another
embodiment, the fusion gene can be synthesized by conventional
techniques including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be carried out using anchor
primers which give rise to complementary overhangs between two
consecutive gene fragments which can subsequently be annealed and
re-amplified to generate a chimeric gene sequence (see, e.g.,
Ausubel et al., supra). Moreover, many expression vectors are
commercially available that already encode a fusion moiety (e.g., a
GST polypeptide). A nucleic acid encoding a polypeptide of the
invention can be cloned into such an expression vector such that
the fusion moiety is linked in-frame to the polypeptide of the
invention.
[0345] A signal sequence of a polypeptide of the invention (e.g.,
the signal sequence in one of SEQ ID NO: 3, 4, 11, 12, 35, 36, 40,
41, 48, 49, 56, 57, 61, 62, 83, 84, 93, and 94) can be used to
facilitate secretion and isolation of the secreted protein or other
proteins of interest. Signal sequences are typically characterized
by a core of hydrophobic amino acids which are generally cleaved
from the mature protein during secretion in one or more cleavage
events. Such signal peptides contain processing sites that allow
cleavage of the signal sequence from the mature proteins as they
pass through the secretory pathway. Thus, the invention pertains to
the described polypeptides having a signal sequence, as well as to
the signal sequence itself and to the polypeptide in the absence of
the signal sequence (i.e., the cleavage products). In one
embodiment, a nucleic acid sequence encoding a signal sequence of
the invention can be operably linked in an expression vector to a
protein of interest, such as a protein which is ordinarily not
secreted or is otherwise difficult to isolate. The signal sequence
directs secretion of the protein, such as from a eukaryotic host
into which the expression vector is transformed, and the signal
sequence is subsequently or concurrently cleaved. The protein can
then be readily purified from the extracellular medium by art
recognized methods. Alternatively, the signal sequence can be
linked to the protein of interest using a sequence which
facilitates purification, such as with a GST domain.
[0346] In another embodiment, the signal sequences of the present
invention can be used to identify regulatory sequences, e.g.,
promoters, enhancers, repressors. Since signal sequences are the
most amino-terminal sequences of a peptide, the nucleic acids which
flank the signal sequence on its amino-terminal side are likely
regulatory sequences which affect transcription. Thus, a nucleotide
sequence which encodes all or a portion of a signal sequence can be
used as a probe to identify and isolate signal sequences and their
flanking regions, and these flanking regions can be studied to
identify regulatory elements therein.
[0347] The present invention also pertains to variants of the
polypeptides of the invention. Such variants have an altered amino
acid sequence which can function as either agonists (mimetics) or
as antagonists. Variants can be generated by mutagenesis, e.g.,
discrete point mutation or truncation. An agonist can retain
substantially the same, or a subset, of the biological activities
of the naturally occurring form of the protein. An antagonist of a
protein can inhibit one or more of the activities of the naturally
occurring form of the protein by, for example, competitively
binding to a downstream or upstream member of a cellular signaling
cascade which includes the protein of interest. Thus, specific
biological effects can be elicited by treatment with a variant of
limited function. Treatment of a subject with a variant having a
subset of the biological activities of the naturally occurring form
of the protein can have fewer side effects in a subject relative to
treatment with the naturally occurring form of the protein.
[0348] Variants of a protein of the invention which function as
either agonists (mimetics) or as antagonists can be identified by
screening combinatorial libraries of mutants, e.g., truncation
mutants, of the protein of the invention for agonist or antagonist
activity. In one embodiment, a variegated library of variants is
generated by combinatorial mutagenesis at the nucleic acid level
and is encoded by a variegated gene library. A variegated library
of variants can be produced by, for example, enzymatically ligating
a mixture of synthetic oligonucleotides into gene sequences such
that a degenerate set of potential protein sequences is expressible
as individual polypeptides, or alternatively, as a set of larger
fusion proteins (e.g., for phage display). There are a variety of
methods which can be used to produce libraries of potential
variants of the polypeptides of the invention from a degenerate
oligonucleotide sequence. Methods for synthesizing degenerate
oligonucleotides are known in the art (see, e.g., Narang (1983)
Tetrahedron 39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323;
Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic
Acid Res. 11:477).
[0349] In addition, libraries of fragments of the coding sequence
of a polypeptide of the invention can be used to generate a
variegated population of polypeptides for screening and subsequent
selection of variants. For example, a library of coding sequence
fragments can be generated by treating a double stranded PCR
fragment of the coding sequence of interest with a nuclease under
conditions wherein nicking occurs only about once per molecule,
denaturing the double stranded DNA, re-naturing the DNA to form
double stranded DNA which can include sense/antisense pairs from
different nicked products, removing single stranded portions from
reformed duplexes by treatment with SI nuclease, and ligating the
resulting fragment library into an expression vector. By this
method, an expression library can be derived which encodes amino
terminal and internal fragments of various sizes of the protein of
interest.
[0350] Several techniques are known in the art for screening gene
products of combinatorial libraries made by point mutations or
truncation, and for screening cDNA libraries for gene products
having a selected property. The most widely used techniques, which
are amenable to high through-put analysis, for screening large gene
libraries typically include cloning the gene library into
replicable expression vectors, transforming appropriate cells with
the resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates isolation of the vector encoding the gene whose product
was detected. Recursive ensemble mutagenesis (REM), a technique
which enhances the frequency of functional mutants in the
libraries, can be used in combination with the screening assays to
identify variants of a protein of the invention (Arkin and Yourvan
(1992) Proc. Natl. Acad. Sci. USA 89:7811-7815; Delgrave et al.
(1993) Protein Engineering 6(3):327-331).
[0351] An isolated polypeptide of the invention, or a fragment
thereof, can be used as an immunogen to generate antibodies using
standard techniques for polyclonal and monoclonal antibody
preparation. The full-length polypeptide or protein can be used or,
alternatively, the invention provides antigenic peptide fragments
for use as immunogens. The antigenic peptide of a protein of the
invention comprises at least 8 (preferably 10, 15, 20, or 30 or
more) amino acid residues of the amino acid sequence of one of SEQ
ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58, 61-63, 83-88, and
93-98, and encompasses an epitope of the protein such that an
antibody raised against the peptide forms a specific immune complex
with the protein.
[0352] Preferred epitopes encompassed by the antigenic peptide are
regions that are located on the surface of the protein, e.g.,
hydrophilic regions. FIGS. 1F, 1M, 2D, 3E, 4E, 4M, 5F, 6D, and 7F
are hydrophobicity plots of the proteins of the invention. These
plots or similar analyses can be used to identify hydrophilic
regions.
[0353] An immunogen typically is used to prepare antibodies by
immunizing a suitable (i.e., immunocompetent) subject such as a
rabbit, goat, mouse, or other mammal or vertebrate. An appropriate
immunogenic preparation can contain, for example,
recombinantly-expressed or chemically-synthesized polypeptide. The
preparation can further include an adjuvant, such as Freund's
complete or incomplete adjuvant, or a similar immunostimulatory
agent.
[0354] Accordingly, another aspect of the invention pertains to
antibodies directed against a polypeptide of the invention. The
terms "antibody" and "antibody substance" as used interchangeably
herein refer to immunoglobulin molecules and immunologically active
portions of immunoglobulin molecules, i.e., molecules that contain
an antigen binding site which specifically binds an antigen, such
as a polypeptide of the invention. A molecule which specifically
binds to a given polypeptide of the invention is a molecule which
binds the polypeptide, but does not substantially bind other
molecules in a sample, e.g., a biological sample, which naturally
contains the polypeptide. Examples of immunologically active
portions of immunoglobulin molecules include F(ab) and F(ab').sub.2
fragments which can be generated by treating the antibody with an
enzyme such as pepsin. The invention provides polyclonal and
monoclonal antibodies. The term "monoclonal antibody" or
"monoclonal antibody composition", as used herein, refers to a
population of antibody molecules that contain only one species of
an antigen binding site capable of immunoreacting with a particular
epitope.
[0355] Polyclonal antibodies can be prepared as described above by
immunizing a suitable subject with a polypeptide of the invention
as an immunogen. Preferred polyclonal antibody compositions are
ones that have been selected for antibodies directed against (i.e.,
which bind specifically with) one or more polypeptides of the
invention. Particularly preferred polyclonal antibody preparations
are ones that contain only antibodies directed against one or more
polypeptides of the invention. Particularly preferred immunogen
compositions are those that contain no other human proteins such
as, for example, immunogen compositions made using a non-human host
cell for recombinant expression of a polypeptide of the invention.
In such a manner, the only human epitope or epitopes recognized by
the resulting antibody compositions raised against this immunogen
will be present as part of a polypeptide or polypeptides of the
invention.
[0356] The antibody titer in the immunized subject can be monitored
over time by standard techniques, such as with an enzyme linked
immunosorbent assay (ELISA) using immobilized polypeptide. If
desired, the antibody molecules can be harvested or isolated from
the subject (e.g., from the blood or serum of the subject) and
further purified by well-known techniques, such as protein A
chromatography to obtain the IgG fraction. Alternatively,
antibodies which bind specifically with a protein or polypeptide of
the invention can be selected (e.g., partially purified) or
purified using chromatographic methods, such as affinity
chromatography. For example, a recombinantly expressed and purified
(or partially purified) protein of the invention can be produced as
described herein, and covalently or non-covalently coupled with a
solid support such as, for example, a chromatography column. The
column thus exhibits specific affinity for antibody substances
which bind specifically with the protein of the invention, and
these antibody substances can be purified from a sample containing
antibody substances directed against a large number of different
epitopes, thereby generating a substantially purified antibody
substance composition, i.e., one that is substantially free of
antibody substances which do not bind specifically with the
protein. By a substantially purified antibody composition is meant,
in this context, that the antibody sample contains at most only 30%
(by dry weight) of contaminating antibodies directed against
epitopes other than those on the desired protein or polypeptide of
the invention, preferably at most 20%, more preferably at most 10%,
most preferably at most 5% (by dry weight), of the sample is
contaminating antibodies. A purified antibody composition means
that at least 99% of the antibodies in the composition are directed
against the desired protein or polypeptide of the invention.
[0357] At an appropriate time after immunization, e.g., when the
specific antibody titers are highest, antibody-producing cells can
be obtained from the subject and used to prepare monoclonal
antibodies by standard techniques, such as the hybridoma technique
originally described by Kohler and Milstein (1975) Nature
256:495-497, the human B cell hybridoma technique (Kozbor et al.
(1983) Immunol. Today 4:72), the EBV-hybridoma technique (Cole et
al. (1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss,
Inc., pp. 77-96) or trioma techniques. The technology for producing
hybridomas is well known (see generally Current Protocols in
Immunology (1994) Coligan et al. (eds.) John Wiley & Sons,
Inc., New York, N.Y.). Hybridoma cells producing a monoclonal
antibody of the invention are detected by screening the hybridoma
culture supernatants for antibodies that bind the polypeptide of
interest, e.g., using a standard ELISA assay.
[0358] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal antibody directed against a polypeptide of
the invention can be identified and isolated by screening a
recombinant combinatorial immunoglobulin library (e.g., an antibody
phage display library) with the polypeptide of interest. Kits for
generating and screening phage display libraries are commercially
available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog No. 27-9400-01; and the Stratagene SURFZAP.TM. Phage
Display Kit, Catalog No. 240612). Additionally, examples of methods
and reagents particularly amenable for use in generating and
screening antibody display library can be found in, for example,
U.S. Pat. No. 5,223,409; PCT Publication No. WO 92/18619; PCT
Publication No. WO 91/17271; PCT Publication No. WO 92/20791; PCT
Publication No. WO 92/15679; PCT Publication No. WO 93/01288; PCT
Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT
Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology
9:1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3:81-85;
Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993)
EMBO J. 12:725-734.
[0359] Additionally, recombinant antibodies, such as chimeric and
humanized monoclonal antibodies, comprising both human and
non-human portions, which can be made using standard recombinant
DNA techniques, are within the scope of the invention. A chimeric
antibody is a molecule in which different portions of the antibody
amino acid sequence are derived from different animal species, such
as those having a variable region derived from a murine monoclonal
antibody and a constant region derived from a human immunoglobulin.
(See, e.g., Cabilly et al., U.S. Pat. No. 4,816,567; and Boss et
al., U.S. Pat. No. 4,816,397). Humanized antibodies are antibody
molecules which are obtained from non-human species, which have one
or more complementarity-determining regions (CDRs) derived from the
non-human species, and which have a framework region derived from a
human immunoglobulin molecule. (See, e.g., Queen, U.S. Pat. No.
5,585,089). Such chimeric and humanized monoclonal antibodies can
be produced by recombinant DNA techniques known in the art, for
example using methods described in PCT Publication No. WO 87/02671;
European Patent Application 184,187; European Patent Application
171,496; European Patent Application 173,494; PCT Publication No.
WO 86/01533; U.S. Pat. No. 4,816,567; European Patent Application
125,023; Better et al. (1988) Science 240:1041-1043; Liu et al.
(1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al. (1987)
J. Immunol. 139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci.
USA 84:214-218; Nishimura et al. (1987) Cancer Res. 47:999-1005;
Wood et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J.
Natl. Cancer Inst. 80:1553-1559); Morrison (1985) Science
229:1202-1207; Oi et al. (1986) Bio/Techniques 4:214; U.S. Pat. No.
5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al.
(1988) Science 239:1534; and Beidler et al. (1988) J. Immunol.
141:4053-4060.
[0360] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Such antibodies can be
produced, for example, using transgenic mice which are incapable of
expressing endogenous immunoglobulin heavy and light chains genes,
but which can express human heavy and light chain genes. The
transgenic mice are immunized in the normal fashion with a selected
antigen, e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
using conventional hybridoma technology. The human immunoglobulin
transgenes harbored by the transgenic mice rearrange during B cell
differentiation, and subsequently undergo class switching and
somatic mutation. Thus, using such a technique, it is possible to
produce therapeutically useful IgG, IgA and IgE antibodies. For an
overview of this technology for producing human antibodies, see
Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a
detailed discussion of this technology for producing human
antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., U.S. Pat. No. 5,625,126; U.S.
Pat. No. 5,633,425; U.S. Pat. No. 5,569,825; U.S. Pat. No.
5,661,016; and U.S. Pat. No. 5,545,806. In addition, companies such
as Abgenix, Inc. (Freemont, Calif.), can be engaged to provide
human antibodies directed against a selected antigen using
technology similar to that described above.
[0361] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a murine antibody, is used to guide the selection
of a completely human antibody recognizing the same epitope
(Jespers et al., 1994, Bio/technology 12:899-903).
[0362] An antibody directed against a polypeptide of the invention
(e.g., monoclonal antibody) can be used to isolate the polypeptide
by standard techniques, such as affinity chromatography or
immunoprecipitation. Moreover, such an antibody can be used to
detect the protein (e.g., in a cellular lysate or cell supernatant)
in order to evaluate the abundance and pattern of expression of the
polypeptide. The antibodies can also be used diagnostically to
monitor protein levels in tissue as part of a clinical testing
procedure, e.g., to, for example, determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials, and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, beta-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0363] Further, an antibody substance can be conjugated with a
therapeutic moiety such as a cytotoxin, a therapeutic agent, or a
radioactive metal ion. Cytotoxins and cytotoxic agents include any
agent that is detrimental to cells. Examples include taxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicin,
doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids,
procaine, tetracaine, lidocaine, propranolol, puromycin, and
analogs or homologs of these compounds. Therapeutic agents include,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil, and decarbazine),
alkylating agents (e.g., mechlorethamine, thioepa chlorambucil,
melphalan, carmustine {BSNU}, lomustine {CCNU}, cyclothosphamide,
busulfan, dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin {formerly daunomycin} and doxorubicin),
antibiotics (e.g., dactinomycin {formerly actinomycin}, bleomycin,
mithramycin, and anthramycin {AMC}), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0364] The conjugates of the invention can be used to modify a
biological response; the drug moiety is not to be construed as
limited to classical chemical therapeutic agents. For example, the
drug moiety can be a protein or polypeptide which exhibits a
desired biological activity. Such proteins include, for example,
toxins such as abrin, ricin A, pseudomonas exotoxin, or diphtheria
toxin; proteins such as tumor necrosis factor, alpha-interferon,
beta-interferon, nerve growth factor, platelet derived growth
factor, tissue plasminogen activator; and biological response
modifiers such as lymphokines, interleukin-1 (IL-1), interleukin-2
(IL-2), interleukin-6 (IL-6), granulocyte macrophage colony
stimulating factor (GM-CSF), granulocyte colony stimulating factor
(G-CSF), and other growth factors.
[0365] Techniques for conjugating a therapeutic moiety with an
antibody substance are well known (see, e.g., Amon et al.,
"Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer
Therapy", in Monoclonal Antibodies and Cancer Therapy, Reisfeld et
al., eds., pp. 243-256, Alan R. Liss, Inc., 1985; Hellstrom et al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery, 2nd
Ed., Robinson et al., eds., pp. 623-653, Marcel Dekker, Inc., 1987;
Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological and Clinical
Applications, Pinchera et al., eds., pp. 475-506, 1985; "Analysis,
Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies
for Cancer Detection and Therapy, Baldwin et al., eds., pp.
303-316, Academic Press, 1985; and Thorpe et al., "The Preparation
And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol.
Rev. 62:119-58, 1982). Alternatively, an antibody can be conjugated
with a second antibody to form an antibody heteroconjugate as
described by Segal in U.S. Pat. No. 4,676,980.
[0366] Accordingly, in one aspect, the invention provides
substantially purified antibodies or fragment thereof, and
non-human antibodies or fragments thereof, which antibodies or
fragments specifically bind with a polypeptide having an amino acid
sequence which comprises a sequence selected from the group
consisting of
[0367] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0368] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0369] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0370] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM120 weight residue table, a gap length penalty of 12, and
a gap penalty of 4; and
[0371] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C.
[0372] In another aspect, the invention provides non-human
antibodies or fragments thereof, which antibodies or fragments
specifically bind with a polypeptide having an amino acid sequence
which comprises a sequence selected from the group consisting
of:
[0373] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0374] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0375] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0376] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM 120 weight residue table, a gap length penalty of 12,
and a gap penalty of 4; and
[0377] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM.) PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C. Such non-human antibodies
can be goat, mouse, sheep, horse, chicken, rabbit, or rat
antibodies. Alternatively, the non-human antibodies of the
invention can be chimeric and/or humanized antibodies. In addition,
the non-human antibodies of the invention can be polyclonal
antibodies or monoclonal antibodies.
[0378] In still a further aspect, the invention provides monoclonal
antibodies or fragments thereof, which antibodies or fragments
specifically bind with a polypeptide having an amino acid sequence
which comprises a sequence selected from the group consisting
of:
[0379] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0380] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0381] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0382] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM 120 weight residue table, a gap length penalty of 12,
and a gap penalty of 4; and
[0383] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C. The monoclonal antibodies
can be human, humanized, chimeric and/or non-human antibodies.
[0384] The substantially purified antibodies or fragments thereof
can specifically bind with a signal peptide, a secreted sequence,
an extracellular domain, a transmembrane or a cytoplasmic domain
cytoplasmic membrane of a polypeptide of the invention. In a
particularly preferred embodiment, the substantially purified
antibodies or fragments thereof, the non-human antibodies or
fragments thereof, and/or the monoclonal antibodies or fragments
thereof, of the invention specifically bind with a secreted
sequence or with an extracellular domain of one of INTERCEPT 217,
INTERCEPT 297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, and
TANGO 332. Preferably, the extracellular domain with which the
antibody substance binds has an amino acid sequence selected from
the group consisting of SEQ ID NOs: 6, 14-18, 37, 43, 51, 58, or
63.
[0385] Any of the antibody substances of the invention can be
conjugated with a therapeutic moiety or to a detectable substance.
Non-limiting examples of detectable substances that can be
conjugated with the antibody substances of the invention include an
enzyme, a prosthetic group, a fluorescent material (i.e., a
fluorophore), a luminescent material, a bioluminescent material,
and a radioactive material (e.g., a radionuclide or a substituent
comprising a radionuclide).
[0386] The invention also provides a kit containing an antibody
substance of the invention conjugated with a detectable substance,
and instructions for use. Still another aspect of the invention is
a pharmaceutical composition comprising an antibody substance of
the invention and a pharmaceutically acceptable carrier. In
preferred embodiments, the pharmaceutical composition contains an
antibody substance of the invention, a therapeutic moiety
(preferably conjugated with the antibody substance), and a
pharmaceutically acceptable carrier.
[0387] Still another aspect of the invention is a method of making
an antibody that specifically recognizes one of INTERCEPT 217,
INTERCEPT 297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, and
TANGO 332. This method comprises immunizing a vertebrate (e.g., a
mammal such as a rabbit, goat, or pig) with a polypeptide. The
polypeptide used as an immunogen has an amino acid sequence that
comprises a sequence selected from the group consisting of:
[0388] (i) SEQ ID NOs: 3-8, 11-32, 35-37, 40-45, 48-53, 56-58,
61-63, 83-88, and 93-98;
[0389] (ii) the amino acid sequence encoded by a cDNA of a clone
deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or PTA-151;
[0390] (iii) a fragment of at least 15 amino acid residues of the
amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37, 40-45, 48-53,
56-58, 61-63, 83-88, or 93-98;
[0391] (iv) an amino acid sequence which is at least 95% identical
to the amino acid sequence of SEQ ID NO: 3-8, 11-32, 35-37,40-45,
48-53, 56-58, 61-63, 83-88, or 93-98, wherein the percent identity
is determined using the ALIGN program of the GCG software package
with a PAM120 weight residue table, a gap length penalty of 12, and
a gap penalty of 4; and
[0392] (v) an amino acid sequence which is encoded by a nucleic
acid molecule, the complement of which hybridizes with a nucleic
acid molecule having the sequence of SEQ ID NO: 1, 2, 9, 10, 33,
34, 38, 39, 46, 47, 54, 55, 59, 60, 81, 82, or 92, or with a cDNA
of a clone deposited as ATCC.RTM. PTA-147, PTA-150, 207230, or
PTA-151, under conditions of hybridization of 6.times. SSC
(standard saline citrate buffer) at 45.degree. C. and washing in
0.2.times. SSC, 0.1% SDS at 65.degree. C.
[0393] After immunization, a sample is collected from the
vertebrate that contains an antibody that specifically recognizes
the polypeptide with which the vertebrate was immunized.
Preferably, the polypeptide is recombinantly produced using a
non-human host cell. Optionally, an antibody substance can be
further purified from the sample using techniques well known to
those of skill in the art. The method can further comprise making a
monoclonal antibody-producing cell from a cell of the vertebrate.
Optionally, antibodies can be collected from the antibody-producing
cell.
[0394] Recombinant Expression Vectors and Host Cells
[0395] Another aspect of the invention pertains to vectors,
preferably expression vectors, containing a nucleic acid encoding a
polypeptide of the invention (or a portion thereof). As used
herein, the term "vector" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked.
One type of vector is a "plasmid", which refers to a circular
double stranded DNA loop into which additional DNA segments can be
ligated. Another type of vector is a viral vector, wherein
additional DNA segments can be ligated into the viral genome.
Certain vectors are capable of autonomous replication in a host
cell into which they are introduced (e.g., bacterial vectors having
a bacterial origin of replication and episomal mammalian vectors).
Other vectors (e.g., non-episomal mammalian vectors) are integrated
into the genome of a host cell upon introduction into the host
cell, and thereby are replicated along with the host genome.
Moreover, certain vectors, expression vectors, are capable of
directing the expression of genes to which they are operably
linked. In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids (vectors).
However, the invention is intended to include such other forms of
expression vectors, such as viral vectors (e.g., replication
defective retroviruses, adenoviruses and adeno-associated viruses),
which serve equivalent functions.
[0396] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell. This means that the recombinant
expression vectors include one or more regulatory sequences,
selected on the basis of the host cells to be used for expression,
which is operably linked to the nucleic acid sequence to be
expressed. Within a recombinant expression vector, "operably
linked" is intended to mean that the nucleotide sequence of
interest is linked to the regulatory sequence(s) in a manner which
allows for expression of the nucleotide sequence (e.g., in an in
vitro transcription/translation system or in a host cell when the
vector is introduced into the host cell). The term "regulatory
sequence" is intended to include promoters, enhancers and other
expression control elements (e.g., polyadenylation signals). Such
regulatory sequences are described, for example, in Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990). Regulatory sequences include those which
direct constitutive expression of a nucleotide sequence in many
types of host cell and those which direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). It will be appreciated by
those skilled in the art that the design of the expression vector
can depend on such factors as the choice of the host cell to be
transformed, the level of expression of protein desired, and the
like. The expression vectors of the invention can be introduced
into host cells to thereby produce proteins or peptides, including
fusion proteins or peptides, encoded by nucleic acids as described
herein.
[0397] The recombinant expression vectors of the invention can be
designed for expression of a polypeptide of the invention in
prokaryotic (e.g., E. coli) or eukaryotic cells (e.g., insect cells
(using baculovirus expression vectors), yeast cells or mammalian
cells). Suitable host cells are discussed further in Goeddel,
supra. Alternatively, the recombinant expression vector can be
transcribed and translated in vitro, for example using T7 promoter
regulatory sequences and T7 polymerase.
[0398] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to a protein
encoded therein, usually to the amino terminus of the recombinant
protein. Such fusion vectors typically serve three purposes: 1) to
increase expression of recombinant protein; 2) to increase the
solubility of the recombinant protein; and 3) to aid in the
purification of the recombinant protein by acting as a ligand in
affinity purification. Often, in fusion expression vectors, a
proteolytic cleavage site is introduced at the junction of the
fusion moiety and the recombinant protein to enable separation of
the recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin and
enterokinase. Typical fusion expression vectors include pGEX
(Pharmacia Biotech Inc; Smith and Johnson (1988) Gene 67:31-40),
pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia,
Piscataway, N.J.) which fuse glutathione S-transferase (GST),
maltose E binding protein, or protein A, respectively, to the
target recombinant protein.
[0399] Examples of suitable inducible non-fusion E. coli expression
vectors include pTrc (Amann et al., (1988) Gene 69:301-315) and pET
11d (Studier et al., Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
Target gene expression from the pTrc vector relies on host RNA
polymerase transcription from a hybrid trp-lac fusion promoter.
Target gene expression from the pET 11d vector relies on
transcription from a T7 gn10-lac fusion promoter mediated by a
co-expressed viral RNA polymerase (T7 gnl1). This viral polymerase
is supplied by host strains BL21(DE3) or HMS174(DE3) from a
resident lambda prophage harboring a T7 gn1 gene under the
transcriptional control of the lacUV 5 promoter.
[0400] One strategy to maximize recombinant protein expression in
E. coli is to express the protein in a host bacteria with an
impaired capacity to proteolytically cleave the recombinant protein
(Gottesman, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, Calif. (1990) 119-128). Another strategy
is to alter the nucleic acid sequence of the nucleic acid to be
inserted into an expression vector so that the individual codons
for each amino acid are those preferentially utilized in E. coli
(Wada et al. (1992) Nucleic Acids Res. 20:2111-2118). Such
alteration of nucleic acid sequences of the invention can be
carried out by standard DNA synthesis techniques.
[0401] In another embodiment, the expression vector is a yeast
expression vector. Examples of vectors for expression in yeast S.
cerevisiae include pYepSec1 (Baldari et al. (1987) EMBO J.
6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943),
pJRY88 (Schultz et al. (1987) Gene 54:113-123), pYES2 (Invitrogen
Corporation, San Diego, Calif.), and pPicZ (Invitrogen Corp, San
Diego, Calif.).
[0402] Alternatively, the expression vector is a baculovirus
expression vector. Baculovirus vectors available for expression of
proteins in cultured insect cells (e.g., Sf 9 cells) include the
pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and
the pVL series (Lucklow and Summers (1989) Virology 170:31-39).
[0403] In yet another embodiment, a nucleic acid of the invention
is expressed in mammalian cells using a mammalian expression
vector. Examples of mammalian expression vectors include pCDM8
(Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO
J. 6:187-195). When used in mammalian cells, the expression
vector's control functions are often provided by viral regulatory
elements. For example, commonly used promoters are derived from
polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For
other suitable expression systems for both prokaryotic and
eukaryotic cells see chapters 16 and 17 of Sambrook et al.,
supra.
[0404] In another embodiment, the recombinant mammalian expression
vector is capable of directing expression of the nucleic acid
preferentially in a particular cell type (e.g., tissue-specific
regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art.
Non-limiting examples of suitable tissue-specific promoters include
the albumin promoter (liver-specific; Pinkert et al. (1987) Genes
Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton
(1988) Adv. Immunol. 43:235-275), in particular promoters of T cell
receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and
immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and
Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g.,
the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl.
Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund
et al. (1985) Science 230:912-916), and mammary gland-specific
promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and
European Application Publication No. 264,166).
Developmentally-regulated promoters are also encompassed, for
example the murine hox promoters (Kessel and Gruss (1990) Science
249:374-379) and the alpha-fetoprotein promoter (Campes and
Tilghman (1989) Genes Dev. 3:537-546).
[0405] The invention further provides a recombinant expression
vector comprising a DNA molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA
molecule is operably linked to a regulatory sequence in a manner
which allows for expression (by transcription of the DNA molecule)
of an RNA molecule which is antisense to the mRNA encoding a
polypeptide of the invention. Regulatory sequences operably linked
to a nucleic acid cloned in the antisense orientation can be chosen
which direct the continuous expression of the antisense RNA
molecule in a variety of cell types, for instance viral promoters
and/or enhancers, or regulatory sequences can be chosen which
direct constitutive, tissue specific or cell type specific
expression of antisense RNA. The antisense expression vector can be
in the form of a recombinant plasmid, phagemid, or attenuated virus
in which antisense nucleic acids are produced under the control of
a high efficiency regulatory region, the activity of which can be
determined by the cell type into which the vector is introduced.
For a discussion of the regulation of gene expression using
antisense genes see Weintraub et al. (Reviews--Trends in Genetics,
Vol. 1(1) 1986).
[0406] Another aspect of the invention pertains to host cells into
which a recombinant expression vector of the invention has been
introduced. The terms "host cell" and "recombinant host cell" are
used interchangeably herein. It is understood that such terms refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0407] A host cell can be any prokaryotic (e.g., E. coli) or
eukaryotic cell (e.g., insect cells, yeast or mammalian cells).
[0408] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid into a host cell, including
calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook, et al. (supra), and other
laboratory manuals.
[0409] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small fraction of cells may integrate the
foreign DNA into their genome. In order to identify and select
these integrants, a gene that encodes a selectable marker (e.g.,
for resistance to antibiotics) is generally introduced into the
host cells along with the gene of interest. Preferred selectable
markers include those which confer resistance to drugs, such as
G418, hygromycin and methotrexate. Cells stably transfected with
the introduced nucleic acid can be identified by drug selection
(e.g., cells that have incorporated the selectable marker gene will
survive, while the other cells die).
[0410] In another embodiment, the expression characteristics of an
endogenous nucleic acid within a cell, cell line, or microorganism
(e.g., a INTERCEPT 217, INTERCEPT 297, TANGO 276, TANGO 292, TANGO
325, TANGO 331, or TANGO 332 nucleic acid, as described herein) can
be modified by inserting a heterologous DNA regulatory element
(i.e., one that is heterologous with respect to the endogenous
gene) into the genome of the cell, stable cell line, or cloned
microorganism. The inserted regulatory element can be operatively
linked with the endogenous gene (e.g., INTERCEPT 217, INTERCEPT
297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, or TANGO 332) and
thereby control, modulate, or activate the endogenous gene. For
example, an endogenous INTERCEPT 217, INTERCEPT 297, TANGO 276,
TANGO 292, TANGO 325, TANGO 331, or TANGO 332 gene which is
normally "transcriptionally silent" (i.e., a INTERCEPT 217,
INTERCEPT 297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, or TANGO
332 gene which is normally not expressed, or is normally expressed
only at only a very low level) can be activated by inserting a
regulatory element which is capable of promoting expression of the
gene in the cell, cell line, or microorganism. Alternatively, a
transcriptionally silent, endogenous INTERCEPT 217, INTERCEPT 297,
TANGO 276, TANGO 292, TANGO 325, TANGO 331, or TANGO 332 gene can
be activated by inserting a promiscuous regulatory element that
works across cell types.
[0411] A heterologous regulatory element can be inserted into a
stable cell line or cloned microorganism such that it is
operatively linked with and activates expression of an endogenous
INTERCEPT 217, INTERCEPT 297, TANGO 276, TANGO 292, TANGO 325,
TANGO 331, or TANGO 332 gene, using techniques, such as targeted
homologous recombination, which are well known to those of skill in
the art (described e.g., in Chappel, U.S. Pat. No. 5,272,071; PCT
publication No. WO 91/06667, published May 16, 1991).
[0412] A host cell of the invention, such as a prokaryotic or
eukaryotic host cell in culture, can be used to produce a
polypeptide of the invention. Accordingly, the invention further
provides methods for producing a polypeptide of the invention using
the host cells of the invention. In one embodiment, the method
comprises culturing the host cell of invention (into which a
recombinant expression vector encoding a polypeptide of the
invention has been introduced) in a suitable medium such that the
polypeptide is produced. In another embodiment, the method further
comprises isolating the polypeptide from the medium or the host
cell.
[0413] The host cells of the invention can also be used to produce
non-human transgenic animals. For example, in one embodiment, a
host cell of the invention is a fertilized oocyte or an embryonic
stem cell into which a sequences encoding a polypeptide of the
invention have been introduced. Such host cells can then be used to
create non-human transgenic animals in which exogenous sequences
encoding a polypeptide of the invention have been introduced into
their genome or homologous recombinant animals in which endogenous
encoding a polypeptide of the invention sequences have been
altered. Such animals are useful for studying the function and/or
activity of the polypeptide and for identifying and/or evaluating
modulators of polypeptide activity. As used herein, a "transgenic
animal" is a non-human animal, preferably a mammal, more preferably
a rodent such as a rat or mouse, in which one or more of the cells
of the animal includes a transgene. Other examples of transgenic
animals include non-human primates, sheep, dogs, cows, goats,
chickens, amphibians, etc. A transgene is exogenous DNA which is
integrated into the genome of a cell from which a transgenic animal
develops and which remains in the genome of the mature animal,
thereby directing the expression of an encoded gene product in one
or more cell types or tissues of the transgenic animal. As used
herein, an "homologous recombinant animal" is a non-human animal,
preferably a mammal, more preferably a mouse, in which an
endogenous gene has been altered by homologous recombination
between the endogenous gene and an exogenous DNA molecule
introduced into a cell of the animal, e.g., an embryonic cell of
the animal, prior to development of the animal.
[0414] A transgenic animal of the invention can be created by
introducing nucleic acid encoding a polypeptide of the invention
(or a homologue thereof) into the male pronuclei of a fertilized
oocyte, e.g., by microinjection, retroviral infection, and allowing
the oocyte to develop in a pseudopregnant female foster animal.
Intronic sequences and polyadenylation signals can also be included
in the transgene to increase the efficiency of expression of the
transgene. A tissue-specific regulatory sequence(s) can be operably
linked to the transgene to direct expression of the polypeptide of
the invention to particular cells. Methods for generating
transgenic animals via embryo manipulation and microinjection,
particularly animals such as mice, have become conventional in the
art and are described, for example, in U.S. Pat. Nos. 4,736,866 and
4,870,009, U.S. Pat. No. 4,873,191 and in Hogan, Manipulating the
Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1986), and in Wakayama et al., 1999, Proc. Natl.
Acad. Sci. USA 96:14984-14989. Similar methods are used for
production of other transgenic animals. A transgenic founder animal
can be identified based upon the presence of the transgene in its
genome and/or expression of mRNA encoding the transgene in tissues
or cells of the animals. A transgenic founder animal can then be
used to breed additional animals carrying the transgene. Moreover,
transgenic animals carrying the transgene can further be bred to
other transgenic animals carrying other transgenes.
[0415] To create a homologous recombinant animal, a vector is
prepared which contains at least a portion of a gene encoding a
polypeptide of the invention into which a deletion, addition or
substitution has been introduced to thereby alter, e.g.,
functionally disrupt, the gene. In a preferred embodiment, the
vector is designed such that, upon homologous recombination, the
endogenous gene is functionally disrupted (i.e., no longer encodes
a functional protein; also referred to as a "knock out" vector).
Alternatively, the vector can be designed such that, upon
homologous recombination, the endogenous gene is mutated or
otherwise altered but still encodes functional protein (e.g., the
upstream regulatory region can be altered to thereby alter the
expression of the endogenous protein). In the homologous
recombination vector, the altered portion of the gene is flanked at
its 5' and 3' ends by additional nucleic acid of the gene to allow
for homologous recombination to occur between the exogenous gene
carried by the vector and an endogenous gene in an embryonic stem
cell. The additional flanking nucleic acid sequences are of
sufficient length for successful homologous recombination with the
endogenous gene. Typically, several kilobases of flanking DNA (both
at the 5' and 3' ends) are included in the vector (see, e.g.,
Thomas and Capecchi (1987) Cell 51:503 for a description of
homologous recombination vectors). The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced gene has homologously recombined with the
endogenous gene are selected (see, e.g., Li et al. (1992) Cell
69:915). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse) to form aggregation chimeras (see, e.g.,
Bradley in Teratocarcinomas and Embryonic Stem Cells: A Practical
Approach, Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A
chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal and the embryo brought to term.
Progeny harboring the homologously recombined DNA in their germ
cells can be used to breed animals in which all cells of the animal
contain the homologously recombined DNA by germline transmission of
the transgene. Methods for constructing homologous recombination
vectors and homologous recombinant animals are described further in
Bradley (1991) Current Opinion in Bio/Technology 2:823-829 and in
PCT Publication NOS. WO 90/11354, WO 91/01140, WO 92/0968, and WO
93/04169.
[0416] In another embodiment, transgenic non-human animals can be
produced which contain selected systems which allow for regulated
expression of the transgene. One example of such a system is the
cre/loxP recombinase system of bacteriophage P1. For a description
of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992)
Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a
recombinase system is the FLP recombinase system of Saccharomyces
cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355. If a
cre/loxP recombinase system is used to regulate expression of the
transgene, animals containing transgenes encoding both the Cre
recombinase and a selected protein are required. Such animals can
be provided through the construction of "double" transgenic
animals, e.g., by mating two transgenic animals, one containing a
transgene encoding a selected protein and the other containing a
transgene encoding a recombinase.
[0417] Clones of the non-human transgenic animals described herein
can also be produced according to the methods described in Wilmut
et al. (1997) Nature 385:810-813 and PCT Publication NOS. WO
97/07668 and WO 97/07669.
[0418] Pharmaceutical Compositions
[0419] The nucleic acid molecules, polypeptides, and antibodies
(also referred to herein as "active compounds") of the invention
can be incorporated into pharmaceutical compositions suitable for
administration. Such compositions typically comprise the nucleic
acid molecule, protein, or antibody and a pharmaceutically
acceptable carrier. As used herein the language "pharmaceutically
acceptable carrier" is intended to include any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0420] The invention includes methods for preparing pharmaceutical
compositions for modulating the expression or activity of a
polypeptide or nucleic acid of the invention. Such methods comprise
formulating a pharmaceutically acceptable carrier with an agent
which modulates expression or activity of a polypeptide or nucleic
acid of the invention. Such compositions can further include
additional active agents. Thus, the invention further includes
methods for preparing a pharmaceutical composition by formulating a
pharmaceutically acceptable carrier with an agent which modulates
expression or activity of a polypeptide or nucleic acid of the
invention and one or more additional active compounds.
[0421] The agent which modulates expression or activity can, for
example, be a small molecule. For example, such small molecules
include peptides, peptidomimetics, amino acids, amino acid analogs,
polynucleotides, polynucleotide analogs, nucleotides, nucleotide
analogs, organic or inorganic compounds (i.e., including
heteroorganic and organometallic compounds) having a molecular
weight less than about 10,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 5,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 1,000 grams per mole, organic or inorganic compounds
having a molecular weight less than about 500 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds.
[0422] It is understood that appropriate doses of small molecule
agents and protein or polypeptide agents depends upon a number of
factors within the ken of the ordinarily skilled physician,
veterinarian, or researcher. The dose(s) of these agents will vary,
for example, depending upon the identity, size, and condition of
the subject or sample being treated, further depending upon the
route by which the composition is to be administered, if
applicable, and the effect which the practitioner desires the agent
to have upon the nucleic acid or polypeptide of the invention.
Exemplary doses of a small molecule include milligram or microgram
amounts per kilogram of subject or sample weight (e.g., about 1
microgram per kilogram to about 500 milligrams per kilogram, about
100 micrograms per kilogram to about 5 milligrams per kilogram, or
about 1 microgram per kilogram to about 50 micrograms per
kilogram). Exemplary doses of a protein or polypeptide include
gram, milligram or microgram amounts per kilogram of subject or
sample weight (e.g., about 1 microgram per kilogram to about 5
grams per kilogram, about 100 micrograms per kilogram to about 500
milligrams per kilogram, or about 1 milligram per kilogram to about
50 milligrams per kilogram). It is furthermore understood that
appropriate doses of one of these agents depend upon the potency of
the agent with respect to the expression or activity to be
modulated. Such appropriate doses can be determined using the
assays described herein. When one or more of these agents is to be
administered to an animal (e.g., a human) in order to modulate
expression or activity of a polypeptide or nucleic acid of the
invention, a physician, veterinarian, or researcher can, for
example, prescribe a relatively low dose at first, subsequently
increasing the dose until an appropriate response is obtained. In
addition, it is understood that the specific dose level for any
particular animal subject will depend upon a variety of factors
including the activity of the specific agent employed, the age,
body weight, general health, gender, and diet of the subject, the
time of administration, the route of administration, the rate of
excretion, any drug combination, and the degree of expression or
activity to be modulated.
[0423] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or
subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediamine-tetraacetic
acid; buffers such as acetates, citrates or phosphates and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
pH can be adjusted with acids or bases, such as hydrochloric acid
or sodium hydroxide. The parenteral preparation can be enclosed in
ampules, disposable syringes or multiple dose vials made of glass
or plastic.
[0424] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersions. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL (BASF; Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof. The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0425] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g., a polypeptide or antibody)
in the required amount in an appropriate solvent with one or a
combination of ingredients enumerated above, as required, followed
by filtered sterilization. Generally, dispersions are prepared by
incorporating the active compound into a sterile vehicle which
contains a basic dispersion medium, and then incorporating the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying which yields a powder of the active ingredient
plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0426] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
[0427] Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches, and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0428] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from a pressurized
container or dispenser which contains a suitable propellant, e.g.,
a gas such as carbon dioxide, or a nebulizer.
[0429] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0430] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0431] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
having one or more monoclonal antibodies incorporated therein or
thereon; e.g., liposomes comprising a monoclonal antibody which
binds specifically with a virus antigen) can also be used as
pharmaceutically acceptable carriers. These can be prepared
according to methods known to those skilled in the art, for
example, as described in U.S. Pat. No. 4,522,811.
[0432] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0433] For antibodies, the preferred dosage is 0.1 mg/kg to 100
mg/kg of body weight (generally 10 mg/kg to 20 mg/kg). If the
antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg/kg
is usually appropriate. Generally, partially human antibodies and
fully human antibodies have a longer half-life within the human
body than other antibodies. Accordingly, lower dosages and less
frequent administration is often possible. Modifications such as
lipidation can be used to stabilize antibodies and to enhance
uptake and tissue penetration (e.g., into the brain). A method for
lipidation of antibodies is described by Cruikshank et al. ((1997)
J. Acquired Immune Deficiency Syndromes and Human Retrovirology
14:193).
[0434] The nucleic acid molecules of the invention can be inserted
into vectors and used as gene therapy vectors. Gene therapy vectors
can be delivered to a subject by, for example, intravenous
injection, local administration (U.S. Pat. No. 5,328,470), or by
stereotactic injection (see, e.g., Chen et al. (1994) Proc. Natl.
Acad. Sci. USA 91:3054-3057). The pharmaceutical preparation of the
gene therapy vector can include the gene therapy vector in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery vector can be produced intact from
recombinant cells, e.g., retroviral vectors, the pharmaceutical
preparation can include one or more cells which produce the gene
delivery system.
[0435] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0436] Uses and Methods of the Invention
[0437] The nucleic acid molecules, proteins, protein homologs, and
antibodies described herein can be used in one or more of the
following methods: a) screening assays; b) detection assays (e.g.,
chromosomal mapping, tissue typing, forensic biology); c)
predictive medicine (e.g., diagnostic assays, prognostic assays,
monitoring clinical trials, and pharmacogenomics); and d) methods
of treatment (e.g., therapeutic and prophylactic). For example,
polypeptides of the invention can to used for all of the purposes
identified herein in portions of the disclosure relating to
individual types of protein of the invention (e.g., INTERCEPT 217
proteins, INTERCEPT 297 proteins, TANGO 276 proteins, TANGO 292
proteins, TANGO 325 proteins, TANGO 331 proteins, and TANGO 332
proteins). The isolated nucleic acid molecules of the invention can
be used to express proteins (e.g., via a recombinant expression
vector in a host cell in gene therapy applications), to detect mRNA
(e.g., in a biological sample) or a genetic lesion, and to modulate
activity of a polypeptide of the invention. In addition, the
polypeptides of the invention can be used to screen drugs or
compounds which modulate activity or expression of a polypeptide of
the invention as well as to treat disorders characterized by
insufficient or excessive production of a protein of the invention
or production of a form of a protein of the invention which has
decreased or aberrant activity compared to the wild type protein.
In addition, the antibodies of the invention can be used to detect
and isolate a protein of the and modulate activity of a protein of
the invention.
[0438] This invention further pertains to novel agents identified
by the above-described screening assays and uses thereof for
treatments as described herein.
[0439] Screening Assays
[0440] The invention provides a method (also referred to herein as
a "screening assay") for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules or other drugs) which bind to polypeptide of the
invention or have a stimulatory or inhibitory effect on, for
example, expression or activity of a polypeptide of the
invention.
[0441] In one embodiment, the invention provides assays for
screening candidate or test compounds which bind to or modulate the
activity of the membrane-bound form of a polypeptide of the
invention or biologically active portion thereof. The test
compounds of the present invention can be obtained using any of the
numerous approaches in combinatorial library methods known in the
art, including: biological libraries; spatially addressable
parallel solid phase or solution phase libraries; synthetic library
methods requiring deconvolution; the "one-bead one-compound"
library method; and synthetic library methods using affinity
chromatography selection. The biological library approach is
limited to peptide libraries, while the other four approaches are
applicable to peptide, non-peptide oligomer or small molecule
libraries of compounds (Lam (1997) Anticancer Drug Des.
12:145).
[0442] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad.
Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678;
Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem.
Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem.
37:1233.
[0443] Libraries of compounds can be presented in solution (e.g.,
Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (U.S. Pat. No. 5,223,409), spores (Patent NOS. 5,571,698;
5,403,484; and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl.
Acad. Sci. USA 89:1865-1869) or phage (Scott and Smith (1990)
Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et
al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici
(1991) J. Mol. Biol. 222:301-310).
[0444] In one embodiment, an assay is a cell-based assay in which a
cell which expresses a membrane-bound form of a polypeptide of the
invention, or a biologically active portion thereof, on the cell
surface is contacted with a test compound and the ability of the
test compound to bind to the polypeptide determined. The cell, for
example, can be a yeast cell or a cell of mammalian origin.
Determining the ability of the test compound to bind to the
polypeptide can be accomplished, for example, by coupling the test
compound with a radioisotope or enzymatic label such that binding
of the test compound to the polypeptide or biologically active
portion thereof can be determined by detecting the labeled compound
in a complex. For example, test compounds can be labeled with
.sup.125I, .sup.35S, .sup.14C, or .sup.3H, either directly or
indirectly, and the radioisotope detected by direct counting of
radio-emission or by scintillation counting. Alternatively, test
compounds can be enzymatically labeled with, for example,
horseradish peroxidase, alkaline phosphatase, or luciferase, and
the enzymatic label detected by determination of conversion of an
appropriate substrate to product. In a preferred embodiment, the
assay comprises contacting a cell which expresses a membrane-bound
form of a polypeptide of the invention, or a biologically active
portion thereof, on the cell surface with a known compound which
binds the polypeptide to form an assay mixture, contacting the
assay mixture with a test compound, and determining the ability of
the test compound to interact with the, polypeptide, wherein
determining the ability of the test compound to interact with the
polypeptide comprises determining the ability of the test compound
to preferentially bind to the polypeptide or a biologically active
portion thereof as compared to the known compound.
[0445] In another embodiment, the assay involves assessment of an
activity characteristic of the polypeptide, wherein binding of the
test compound with the polypeptide or a biologically active portion
thereof alters (i.e., increases or decreases) the activity of the
polypeptide.
[0446] In another embodiment, an assay is a cell-based assay
comprising contacting a cell expressing a membrane-bound form of a
polypeptide of the invention, or a biologically active portion
thereof, on the cell surface with a test compound and determining
the ability of the test compound to modulate (e.g., stimulate or
inhibit) the activity of the polypeptide or biologically active
portion thereof. Determining the ability of the test compound to
modulate the activity of the polypeptide or a biologically active
portion thereof can be accomplished, for example, by determining
the ability of the polypeptide to bind to or interact with a target
molecule or to transport molecules across the cytoplasmic
membrane.
[0447] Determining the ability of a polypeptide of the invention to
bind to or interact with a target molecule can be accomplished by
one of the methods described above for determining direct binding.
As used herein, a "target molecule" is a molecule with which a
selected polypeptide (e.g., a polypeptide of the invention binds or
interacts with in nature, for example, a molecule on the surface of
a cell which expresses the selected protein, a molecule on the
surface of a second cell, a molecule in the extracellular milieu, a
molecule associated with the internal surface of a cell membrane or
a cytoplasmic molecule. A target molecule can be a polypeptide of
the invention or some other polypeptide or protein. For example, a
target molecule can be a component of a signal transduction pathway
which facilitates transduction of an extracellular signal (e.g., a
signal generated by binding of a compound to a polypeptide of the
invention) through the cell membrane and into the cell or a second
intercellular protein which has catalytic activity or a protein
which facilitates the association of downstream signaling molecules
with a polypeptide of the invention. Determining the ability of a
polypeptide of the invention to bind to or interact with a target
molecule can be accomplished by determining the activity of the
target molecule. For example, the activity of the target molecule
can be determined by detecting induction of a cellular second
messenger of the target (e.g., an mRNA, intracellular Ca.sup.2+,
diacylglycerol, IP3, and the like), detecting catalytic/enzymatic
activity of the target on an appropriate substrate, detecting the
induction of a reporter gene (e.g., a regulatory element that is
responsive to a polypeptide of the invention operably linked to a
nucleic acid encoding a detectable marker, e.g., luciferase), or
detecting a cellular response, for example, cellular
differentiation, or cell proliferation.
[0448] In yet another embodiment, an assay of the present invention
is a cell-free assay comprising contacting a polypeptide of the
invention or biologically active portion thereof with a test
compound and determining the ability of the test compound to bind
to the polypeptide or biologically active portion thereof. Binding
of the test compound to the polypeptide can be determined either
directly or indirectly as described above. In a preferred
embodiment, the assay includes contacting the polypeptide of the
invention or biologically active portion thereof with a known
compound which binds the polypeptide to form an assay mixture,
contacting the assay mixture with a test compound, and determining
the ability of the test compound to interact with the polypeptide,
wherein determining the ability of the test compound to interact
with the polypeptide comprises determining the ability of the test
compound to preferentially bind to the polypeptide or biologically
active portion thereof as compared to the known compound.
[0449] In another embodiment, an assay is a cell-free assay
comprising contacting a polypeptide of the invention or
biologically active portion thereof with a test compound and
determining the ability of the test compound to modulate (e.g.,
stimulate or inhibit) the activity of the polypeptide or
biologically active portion thereof. Determining the ability of the
test compound to modulate the activity of the polypeptide can be
accomplished, for example, by determining the ability of the
polypeptide to bind to a target molecule by one of the methods
described above for determining direct binding. In an alternative
embodiment, determining the ability of the test compound to
modulate the activity of the polypeptide can be accomplished by
determining the ability of the polypeptide of the invention to
further modulate the target molecule. For example, the catalytic
activity, the enzymatic activity, or both, of the target molecule
on an appropriate substrate can be determined as previously
described.
[0450] In yet another embodiment, the cell-free assay comprises
contacting a polypeptide of the invention or biologically active
portion thereof with a known compound which binds the polypeptide
to form an assay mixture, contacting the assay mixture with a test
compound, and determining the ability of the test compound to
interact with the polypeptide, wherein determining the ability of
the test compound to interact with the polypeptide comprises
determining the ability of the polypeptide to preferentially bind
to or modulate the activity of a target molecule.
[0451] The cell-free assays of the present invention are amenable
to use of both a soluble form or the membrane-bound form of a
polypeptide of the invention. In the case of cell-free assays
comprising the membrane-bound form of the polypeptide, it can be
desirable to utilize a solubilizing agent such that the
membrane-bound form of the polypeptide is maintained in solution.
Examples of such solubilizing agents include non-ionic detergents
such as n-octylglucoside, n-dodecylglucoside, n-octylmaltoside,
octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton
X-100, Triton X-114, Thesit, Isotridecypoly(ethylene glycol
ether).sub.n, 3-[(3-cholamidopropyl)dimethylamminio]-1-propane
sulfonate (CHAPS),
3-[(3-cholamidopropyl)dimethylamminio]-2-hydroxy-1-propane
sulfonate (CHAPSO), or N-dodecyl-N,N-dimethyl-3-ammonio-1-propane
sulfonate.
[0452] In one or more embodiments of the above assay methods of the
present invention, it can be desirable to immobilize either the
polypeptide of the invention or its target molecule to facilitate
separation of complexed from non-complexed forms of one or both of
the proteins, as well as to accommodate automation of the assay.
Binding of a test compound to the polypeptide, or interaction of
the polypeptide with a target molecule in the presence and absence
of a candidate compound, can be accomplished in any vessel suitable
for containing the reactants. Examples of such vessels include
microtiter plates, test tubes, and micro-centrifuge tubes. In one
embodiment, a fusion protein can be provided which adds a domain
that allows one or both of the proteins to be bound to a matrix.
For example, glutathione-S-transferase fusion proteins or
glutathione-S-transferase fusion proteins can be adsorbed onto
glutathione Sepharose beads (Sigma Chemical; St. Louis, Mo.) or
glutathione derivatized microtiter plates, which are then combined
with the test compound or the test compound and either the
non-adsorbed target protein or A polypeptide of the invention, and
the mixture incubated under conditions conducive to complex
formation (e.g., at physiological conditions for salt and pH).
Following incubation, the beads or microtiter plate wells are
washed to remove any unbound components and complex formation is
measured either directly or indirectly, for example, as described
above. Alternatively, the complexes can be dissociated from the
matrix, and the level of binding or activity of the polypeptide of
the invention can be determined using standard techniques.
[0453] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either the polypeptide of the invention or its target molecule can
be immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated polypeptide of the invention or target molecules can
be prepared from biotin-NHS (N-hydroxy-succinimide) using
techniques well known in the art (e.g., biotinylation kit, Pierce
Chemicals; Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96 well plates (Pierce Chemical).
Alternatively, antibodies reactive with the polypeptide of the
invention or target molecules but which do not interfere with
binding of the polypeptide of the invention to its target molecule
can be derivatized to the wells of the plate, and unbound target or
polypeptide of the invention trapped in the wells by antibody
conjugation. Methods for detecting such complexes, in addition to
those described above for the GST-immobilized complexes, include
immunodetection of complexes using antibodies reactive with the
polypeptide of the invention or target molecule, as well as
enzyme-linked assays which rely on detecting an enzymatic activity
associated with the polypeptide of the invention or target
molecule.
[0454] In another embodiment, modulators of expression of a
polypeptide of the invention are identified in a method in which a
cell is contacted with a candidate compound and the expression of
the selected mRNA or protein (i.e., the mRNA or protein
corresponding to a polypeptide or nucleic acid of the invention) in
the cell is determined. The level of expression of the selected
mRNA or protein in the presence of the candidate compound is
compared to the level of expression of the selected mRNA or protein
in the absence of the candidate compound. The candidate compound
can then be identified as a modulator of expression of the
polypeptide of the invention based on this comparison. For example,
when expression of the selected mRNA or protein is greater (i.e.,
statistically significantly greater) in the presence of the
candidate compound than in its absence, the candidate compound is
identified as a stimulator of the selected mRNA or protein
expression. Alternatively, when expression of the selected mRNA or
protein is less (i.e., statistically significantly less) in the
presence of the candidate compound than in its absence, the
candidate compound is identified as an inhibitor of the selected
mRNA or protein expression. The level of the selected mRNA or
protein expression in the cells can be determined by methods
described herein.
[0455] In yet another aspect of the invention, a polypeptide of the
inventions can be used as "bait proteins" in a two-hybrid assay or
three hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et
al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Bio/Techniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and PCT Publication
No. WO 94/10300), to identify other proteins, which bind to or
interact with the polypeptide of the invention and modulate
activity of the polypeptide of the invention. Such binding proteins
are also likely to be involved in the propagation of signals by the
polypeptide of the inventions as, for example, upstream or
downstream elements of a signaling pathway involving the
polypeptide of the invention.
[0456] This invention further pertains to novel agents identified
by the above-described screening assays and uses thereof for
treatments as described herein.
[0457] Detection Assays
[0458] Portions or fragments of the cDNA sequences identified
herein (and the corresponding complete gene sequences) can be used
in numerous ways as polynucleotide reagents. For example, these
sequences can be used to: (i) map their respective genes on a
chromosome and, thus, locate gene regions associated with genetic
disease; (ii) identify an individual from a minute biological
sample (tissue typing); and (iii) aid in forensic identification of
a biological sample. These applications are described in the
subsections below.
[0459] Chromosome Mapping
[0460] Once the sequence (or a portion of the sequence) of a gene
has been isolated, this sequence can be used to map the location of
the gene on a chromosome. Accordingly, nucleic acid molecules
described herein or fragments thereof, can be used to map the
location of the corresponding genes on a chromosome. The mapping of
the sequences to chromosomes is an important first step in
correlating these sequences with genes associated with disease.
[0461] Briefly, genes can be mapped to chromosomes by preparing PCR
primers (preferably 15-25 base pairs in length) from the sequence
of a gene of the invention. Computer analysis of the sequence of a
gene of the invention can be used to rapidly select primers that do
not span more than one exon in the genomic DNA, thus complicating
the amplification process. These primers can then be used for PCR
screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human gene
corresponding to the gene sequences will yield an amplified
fragment. For a review of this technique, see D'Eustachio et al.
((1983) Science 220:919-924).
[0462] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular sequence to a particular chromosome. Three
or more sequences can be assigned per day using a single thermal
cycler. Using the nucleic acid sequences of the invention to design
oligonucleotide primers, sub-localization can be achieved with
panels of fragments from specific chromosomes. Other mapping
strategies which can similarly be used to map a gene to its
chromosome include in situ hybridization (described in Fan et al.
(1990) Proc. Natl. Acad. Sci. USA 87:6223-27), pre-screening with
labeled flow-sorted chromosomes, and pre-selection by hybridization
to chromosome specific cDNA libraries. Fluorescence in situ
hybridization (FISH) of a DNA sequence to a metaphase chromosomal
spread can further be used to provide a precise chromosomal
location in one step. For a review of this technique, see Verma et
al. (Human Chromosomes: A Manual of Basic Techniques (Pergamon
Press, New York, 1988)).
[0463] Reagents for chromosome mapping can be used individually to
mark a single chromosome or a single site on that chromosome, or
panels of reagents can be used for marking multiple sites and/or
multiple chromosomes. Reagents corresponding to non-coding regions
of the genes actually are preferred for mapping purposes. Coding
sequences are more likely to be conserved within gene families,
thus increasing the chance of cross hybridizations during
chromosomal mapping.
[0464] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. (Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available
on-line through Johns Hopkins University Welch Medical Library).
The relationship between genes and disease, mapped to the same
chromosomal region, can then be identified through linkage analysis
(co-inheritance of physically adjacent genes), described in, e.g.,
Egeland et al. (1987) Nature 325:783-787.
[0465] Moreover, differences in the DNA sequences between
individuals affected and unaffected with a disease associated with
a gene of the invention can be determined. If a mutation is
observed in some or all of the affected individuals but not in any
unaffected individuals, then the mutation is likely to be the
causative agent of the particular disease. Comparison of affected
and unaffected individuals generally involves first looking for
structural alterations in the chromosomes such as deletions or
translocations that are visible from chromosome spreads or
detectable using PCR based on that DNA sequence. Ultimately,
complete sequencing of genes from several individuals can be
performed to confirm the presence of a mutation and to distinguish
mutations from polymorphisms.
[0466] Furthermore, the nucleic acid sequences disclosed herein can
be used to perform searches against "mapping databases", e.g.,
BLAST-type search, such that the chromosome position of the gene is
identified by sequence homology or identity with known sequence
fragments which have been mapped to chromosomes.
[0467] A polypeptide and fragments and sequences thereof and
antibodies which bind specifically with such polypeptides/fragments
can be used to map the location of the gene encoding the
polypeptide on a chromosome. This mapping can be performed by
specifically detecting the presence of the polypeptide/fragments in
members of a panel of somatic cell hybrids between cells obtained
from a first species of animal from which the protein originates
and cells obtained from a second species of animal, determining
which somatic cell hybrid(s) expresses the polypeptide, and noting
the chromosome(s) of the first species of animal that it contains.
For examples of this technique (see Pajunen et al., 1988,
Cytogenet. Cell Genet. 47:37-41 and Van Keuren et al., 1986, Hum.
Genet. 74:34-40). Alternatively, the presence of the polypeptide in
the somatic cell hybrids can be determined by assaying an activity
or property of the polypeptide (e.g., enzymatic activity, as
described in Bordelon-Riser et al., 1979, Som. Cell Genet.
5:597-613 and Owerbach et al., 1978, Proc. Natl. Acad. Sci. USA
75:5640-5644).
[0468] Tissue Typing
[0469] The nucleic acid sequences of the present invention can also
be used to identify individuals from minute biological samples. The
United States military, for example, is considering the use of
restriction fragment length polymorphism (RFLP) for identification
of its personnel. In this technique, an individual's genomic DNA is
digested with one or more restriction enzymes, and probed on a
Southern blot to yield unique bands for identification. This method
does not suffer from the current limitations of "Dog Tags" which
can be lost, switched, or stolen, making positive identification
difficult. The sequences of the present invention are useful as
additional DNA markers for RFLP (described in U.S. Pat. No.
5,272,057).
[0470] Furthermore, the sequences of the present invention can be
used to provide an alternative technique which determines the
actual base-by-base DNA sequence of selected portions of an
individual's genome. Thus, the nucleic acid sequences described
herein can be used to prepare two PCR primers from the 5' and 3'
ends of the sequences. These primers can then be used to amplify an
individual's DNA and subsequently sequence it.
[0471] Panels of corresponding DNA sequences from individuals,
prepared in this manner, can provide unique individual
identifications, as each individual will have a unique set of such
DNA sequences due to allelic differences. The sequences of the
present invention can be used to obtain such identification
sequences from individuals and from tissue. The nucleic acid
sequences of the invention uniquely represent portions of the human
genome. Allelic variation occurs to some degree in the coding
regions of these sequences, and to a greater degree in the
non-coding regions. It is estimated that allelic variation between
individual humans occurs with a frequency of about once per each
500 bases. Each of the sequences described herein can, to some
degree, be used as a standard against which DNA from an individual
can be compared for identification purposes. Because greater
numbers of polymorphisms occur in the non-coding regions, fewer
sequences are necessary to differentiate individuals. The
non-coding sequences of SEQ ID NO: 1, 9, 33, 38, 46, 54, 59, and 81
can comfortably provide positive individual identification with a
panel of perhaps 10 to 1,000 primers which each yield a non-coding
amplified sequence of 100 bases. If predicted coding sequences,
such as those in SEQ ID NO: 2, 10, 34, 39, 47, 55, 60, 82, and 92
are used, a more appropriate number of primers for positive
individual identification would be 500-2,000.
[0472] If a panel of reagents from the nucleic acid sequences
described herein is used to generate a unique identification
database for an individual, those same reagents can later be used
to identify tissue from that individual. Using the unique
identification database, positive identification of the individual,
living or dead, can be made from extremely small tissue
samples.
[0473] Use of Partial Gene Sequences in Forensic Biology
[0474] DNA-based identification techniques can also be used in
forensic biology. Forensic biology is a scientific field employing
genetic typing of biological evidence found at a crime scene as a
means for positively identifying, for example, a perpetrator of a
crime. To make such an identification, PCR technology can be used
to amplify DNA sequences taken from very small biological samples
such as tissues, e.g., hair or skin, or body fluids, e.g., blood,
saliva, or semen found at a crime scene. The amplified sequence can
then be compared to a standard, thereby allowing identification of
the origin of the biological sample.
[0475] The sequences of the present invention can be used to
provide polynucleotide reagents, e.g., PCR primers, targeted to
specific loci in the human genome, which can enhance the
reliability of DNA-based forensic identifications by, for example,
providing another "identification marker" (i.e., another DNA
sequence that is unique to a particular individual). As mentioned
above, actual base sequence information can be used for
identification as an accurate alternative to patterns formed by
restriction enzyme generated fragments. Sequences targeted to
non-coding regions are particularly appropriate for this use as
greater numbers of polymorphisms occur in the non-coding regions,
making it easier to differentiate individuals using this technique.
Examples of polynucleotide reagents include the nucleic acid
sequences of the invention or portions thereof, e.g., fragments
derived from non-coding regions having a length of at least 20 or
30 bases.
[0476] The nucleic acid sequences described herein can further be
used to provide polynucleotide reagents, e.g., labeled or labelable
probes which can be used in, for example, an in situ hybridization
technique, to identify a specific tissue, e.g., brain tissue. This
can be very useful in cases where a forensic pathologist is
presented with a tissue of unknown origin. Panels of such probes
can be used to identify tissue by species and/or by organ type.
[0477] Predictive Medicine
[0478] The present invention also pertains to the field of
predictive medicine in which diagnostic assays, prognostic assays,
pharmacogenomics, and monitoring clinical trials are used for
prognostic (predictive) purposes to thereby treat an individual
prophylactically. Accordingly, one aspect of the present invention
relates to diagnostic assays for determining expression of a
polypeptide or nucleic acid of the invention and/or activity of a
polypeptide of the invention, in the context of a biological sample
(e.g., blood, serum, cells, tissue) to thereby determine whether an
individual is afflicted with a disease or disorder, or is at risk
of developing a disorder, associated with aberrant expression or
activity of a polypeptide of the invention. The invention also
provides for prognostic (or predictive) assays for determining
whether an individual is at risk of developing a disorder
associated with aberrant expression or activity of a polypeptide of
the invention. For example, mutations in a gene of the invention
can be assayed in a biological sample. Such assays can be used for
prognostic or predictive purpose to thereby prophylactically treat
an individual prior to the onset of a disorder characterized by or
associated with aberrant expression or activity of a polypeptide of
the invention.
[0479] As an alternative to making determinations based on the
absolute expression level of a selected gene, determinations can be
based on normalized expression levels of the gene. A gene
expression level is normalized by correcting the absolute
expression level of the gene (e.g., an INTERCEPT 217, INTERCEPT
297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, or TANGO 332 gene
as described herein) by comparing its expression to expression of a
gene for which expression is not believed to be co-regulated with
the gene of interest, e.g., a housekeeping gene that is
constitutively expressed. Suitable genes for normalization include
housekeeping genes such as the actin gene. Such normalization
allows comparison of the expression level in one sample, e.g., a
patient sample, with the expression level in another sample, e.g.,
a sample obtained from a patient known not to be afflicted with a
disease or condition, or between samples obtained from different
sources.
[0480] Alternatively, the expression level can be assessed as a
relative expression level. To assess a relative expression level
for a gene (e.g., an INTERCEPT 217, INTERCEPT 297, TANGO 276, TANGO
292, TANGO 325, TANGO 331, or TANGO 332 gene, as described herein),
the level of expression of the gene is determined for 10 or more
samples (preferably 50 or more samples) of different isolates of
cells in which the gene is believed to be expressed, prior to
assessing the level of expression of the gene in the sample of
interest. The mean expression level of the gene detected in the
large number of samples is determined, and this value is used as a
baseline expression level for the gene. The expression level of the
gene assessed in the test sample (i.e., its absolute level of
expression) is divided by the mean expression value to yield a
relative expression level. Such a method can identify tissues or
individuals which are afflicted with a disorder associated with
aberrant expression of a gene of the invention.
[0481] Preferably, the samples used in the baseline determination
are generated either using cells obtained from a tissue or
individual known to be afflicted with a disorder (e.g., a disorder
associated with aberrant expression of one of the INTERCEPT 217,
INTERCEPT 297, TANGO 276, TANGO 292, TANGO 325, TANGO 331, or TANGO
332 genes) or using cells obtained from a tissue or individual
known not to be afflicted with the disorder. Alternatively, levels
of expression of these genes in tissues or individuals known to be
or not to be afflicted with the disorder can be used to assess
whether the aberrant expression of the gene is associated with the
disorder (e.g., with onset of the disorder, or as a symptom of the
disorder over time).
[0482] Another aspect of the invention provides methods for
expression of a nucleic acid or polypeptide of the invention or
activity of a polypeptide of the invention in an individual to
thereby select appropriate therapeutic or prophylactic agents for
that individual (referred to herein as "pharmacogenomics").
Pharmacogenomics allows for the selection of agents (e.g., drugs)
for therapeutic or prophylactic treatment of an individual based on
the genotype of the individual (e.g., the genotype of the
individual examined to determine the ability of the individual to
respond to a particular agent).
[0483] Yet another aspect of the invention pertains to monitoring
the influence of agents (e.g., drugs or other compounds) on the
expression or activity of a polypeptide of the invention in
clinical trials. These and other agents are described in further
detail in the following sections.
[0484] Diagnostic Assays
[0485] An exemplary method for detecting the presence or absence of
a polypeptide or nucleic acid of the invention in a biological
sample involves obtaining a biological sample from a test subject
and contacting the biological sample with a compound or an agent
capable of detecting a polypeptide or nucleic acid (e.g., mRNA,
genomic DNA) of the invention such that the presence of a
polypeptide or nucleic acid of the invention is detected in the
biological sample. A preferred agent for detecting mRNA or genomic
DNA encoding a polypeptide of the invention is a labeled nucleic
acid probe capable of hybridizing to mRNA or genomic DNA encoding a
polypeptide of the invention. The nucleic acid probe can be, for
example, a full-length cDNA, such as the nucleic acid of SEQ ID NO:
1, 9, 33, 38, 46, 54, 59, 62, or 81, or a portion thereof, such as
an oligonucleotide of at least 15, 30, 50, 100, 250 or 500
nucleotides in length and sufficient to specifically hybridize
under stringent conditions to a mRNA or genomic DNA encoding a
polypeptide of the invention. Other suitable probes for use in the
diagnostic assays of the invention are described herein.
[0486] A preferred agent for detecting a polypeptide of the
invention is an antibody capable of binding to a polypeptide of the
invention, preferably an antibody with a detectable label.
Antibodies can be polyclonal, or more preferably, monoclonal. An
intact antibody, or a fragment thereof (e.g., Fab or F(ab').sub.2)
can be used. The term "labeled", with regard to the probe or
antibody, is intended to encompass direct labeling of the probe or
antibody by coupling (i.e., physically linking) a detectable
substance to the probe or antibody, as well as indirect labeling of
the probe or antibody by reactivity with another reagent that is
directly labeled. Examples of indirect labeling include detection
of a primary antibody using a fluorescently labeled secondary
antibody and end-labeling of a DNA probe with biotin such that it
can be detected with fluorescently labeled streptavidin. The term
"biological sample" is intended to include tissues, cells and
biological fluids isolated from a subject, as well as tissues,
cells and fluids present within a subject. That is, the detection
method of the invention can be used to detect mRNA, protein, or
genomic DNA in a biological sample in vitro as well as in vivo. For
example, in vitro techniques for detection of mRNA include Northern
hybridizations and in situ hybridizations. In vitro techniques for
detection of a polypeptide of the invention include enzyme linked
immunosorbent assays (ELISAs), Western blots, immunoprecipitations
and immunofluorescence. In vitro techniques for detection of
genomic DNA include Southern hybridizations. Furthermore, in vivo
techniques for detection of a polypeptide of the invention include
introducing into a subject a labeled antibody directed against the
polypeptide. For example, the antibody can be labeled with a
radioactive marker whose presence and location in a subject can be
detected by standard imaging techniques.
[0487] In one embodiment, the biological sample contains protein
molecules from the test subject. Alternatively, the biological
sample can contain mRNA molecules from the test subject or genomic
DNA molecules from the test subject. A preferred biological sample
is a peripheral blood leukocyte sample isolated by conventional
means from a subject.
[0488] In another embodiment, the methods further involve obtaining
a control biological sample from a control subject, contacting the
control sample with a compound or agent capable of detecting a
polypeptide of the invention or mRNA or genomic DNA encoding a
polypeptide of the invention, such that the presence of the
polypeptide or mRNA or genomic DNA encoding the polypeptide is
detected in the biological sample, and comparing the presence of
the polypeptide or mRNA or genomic DNA encoding the polypeptide in
the control sample with the presence of the polypeptide or mRNA or
genomic DNA encoding the polypeptide in the test sample.
[0489] The invention also encompasses kits for detecting the
presence of a polypeptide or nucleic acid of the invention in a
biological sample (a test sample). Such kits can be used to
determine if a subject is suffering from or is at increased risk of
developing a disorder associated with aberrant expression of a
polypeptide of the invention (e.g., one of the disorders described
in the section of this disclosure wherein the individual
polypeptide of the invention is discussed). For example, the kit
can comprise a labeled compound or agent capable of detecting the
polypeptide or mRNA encoding the polypeptide in a biological sample
and means for determining the amount of the polypeptide or mRNA in
the sample (e.g., an antibody which binds the polypeptide or an
oligonucleotide probe which binds to DNA or mRNA encoding the
polypeptide). Kits can also include instructions for observing that
the tested subject is suffering from or is at risk of developing a
disorder associated with aberrant expression of the polypeptide if
the amount of the polypeptide or mRNA encoding the polypeptide is
above or below a normal level.
[0490] For antibody-based kits, the kit can comprise, for example:
(1) a first antibody (e.g., attached to a solid support) which
binds to a polypeptide of the invention; and, optionally, (2) a
second, different antibody which binds to either the polypeptide or
the first antibody and is conjugated to a detectable agent.
[0491] For oligonucleotide-based kits, the kit can comprise, for
example: (1) an oligonucleotide, e.g., a detectably labeled
oligonucleotide, which hybridizes to a nucleic acid sequence
encoding a polypeptide of the invention or (2) a pair of primers
useful for amplifying a nucleic acid molecule encoding a
polypeptide of the invention. The kit can also comprise, e.g., a
buffering agent, a preservative, or a protein stabilizing agent.
The kit can also comprise components necessary for detecting the
detectable agent (e.g., an enzyme or a substrate). The kit can also
contain a control sample or a series of control samples which can
be assayed and compared to the test sample contained. Each
component of the kit is usually enclosed within an individual
container and all of the various containers are within a single
package along with instructions for observing whether the tested
subject is suffering from or is at risk of developing a disorder
associated with aberrant expression of the polypeptide.
[0492] Prognostic Assays
[0493] The methods described herein can furthermore be utilized as
diagnostic or prognostic assays to identify subjects having or at
risk of developing a disease or disorder associated with aberrant
expression or activity of a polypeptide of the invention. For
example, the assays described herein, such as the preceding
diagnostic assays or the following assays, can be utilized to
identify a subject having or at risk of developing a disorder
associated with aberrant expression or activity of a polypeptide of
the invention (e.g., one of the disorders described in the section
of this disclosure wherein the individual polypeptide of the
invention is discussed). Alternatively, the prognostic assays can
be utilized to identify a subject having or at risk for developing
such a disease or disorder. Thus, the present invention provides a
method in which a test sample is obtained from a subject and a
polypeptide or nucleic acid (e.g., mRNA, genomic DNA) of the
invention is detected, wherein the presence of the polypeptide or
nucleic acid is diagnostic for a subject having or at risk of
developing a disease or disorder associated with aberrant
expression or activity of the polypeptide. As used herein, a "test
sample" refers to a biological sample obtained from a subject of
interest. For example, a test sample can be a biological fluid
(e.g., serum), cell sample, or tissue.
[0494] Furthermore, the prognostic assays described herein can be
used to determine whether a subject can be administered an agent
(e.g., an agonist, antagonist, peptidomimetic, protein, peptide,
nucleic acid, small molecule, or other drug candidate) to treat a
disease or disorder associated with aberrant expression or activity
of a polypeptide of the invention. For example, such methods can be
used to determine whether a subject can be effectively treated with
a specific agent or class of agents (e.g., agents of a type which
decrease activity of the polypeptide). Thus, the present invention
provides methods for determining whether a subject can be
effectively treated with an agent for a disorder associated with
aberrant expression or activity of a polypeptide of the invention
in which a test sample is obtained and the polypeptide or nucleic
acid encoding the polypeptide is detected (e.g., wherein the
presence of the polypeptide or nucleic acid is diagnostic for a
subject that can be administered the agent to treat a disorder
associated with aberrant expression or activity of the
polypeptide).
[0495] The methods of the invention can also be used to detect
genetic lesions or mutations in a gene of the invention, thereby
determining if a subject with the lesioned gene is at risk for a
disorder characterized aberrant expression or activity of a
polypeptide of the invention. In preferred embodiments, the methods
include detecting, in a sample of cells from the subject, the
presence or absence of a genetic lesion or mutation characterized
by at least one of an alteration affecting the integrity of a gene
encoding the polypeptide of the invention, or the mis-expression of
the gene encoding the polypeptide of the invention. For example,
such genetic lesions or mutations can be detected by ascertaining
the existence of at least one of: 1) a deletion of one or more
nucleotides from the gene; 2) an addition of one or more
nucleotides to the gene; 3) a substitution of one or more
nucleotides of the gene; 4) a chromosomal rearrangement of the
gene; 5) an alteration in the level of a messenger RNA transcript
of the gene; 6) an aberrant modification of the gene, such as of
the methylation pattern of the genomic DNA; 7) the presence of a
non-wild type splicing pattern of a messenger RNA transcript of the
gene; 8) a non-wild type level of the protein encoded by the gene;
9) an allelic loss of the gene; and 10) an inappropriate
post-translational modification of the protein encoded by the gene.
As described herein, there are a large number of assay techniques
known in the art which can be used for detecting lesions in a
gene.
[0496] In certain embodiments, detection of the lesion involves the
use of a probe/primer in a polymerase chain reaction (PCR) (see,
e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR
or RACE PCR, or, alternatively, in a ligation chain reaction (LCR)
(see, e.g., Landegran et al. (1988) Science 241:1077-1080; and
Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91:360-364), the
latter of which can be particularly useful for detecting point
mutations in a gene (see, e.g., Abravaya et al. (1995) Nucleic
Acids Res. 23:675-682). This method can include the steps of
collecting a sample of cells from a patient, isolating nucleic acid
(e.g., genomic, mRNA or both) from the cells of the sample,
contacting the nucleic acid sample with one or more primers which
specifically hybridize to the selected gene under conditions such
that hybridization and amplification of the gene (if present)
occurs, and detecting the presence or absence of an amplification
product, or detecting the size of the amplification product and
comparing the length to a control sample. PCR and/or LCR can be
desirable to use as a preliminary amplification step in conjunction
with any of the techniques used for detecting mutations described
herein.
[0497] Alternative amplification methods include: self-sustained
sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878), transcriptional amplification system (Kwoh, et
al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta
Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any
other nucleic acid amplification method, followed by the detection
of the amplified molecules using techniques well known to those of
skill in the art. These detection schemes are especially useful for
the detection of nucleic acid molecules if such molecules are
present in very low numbers.
[0498] In an alternative embodiment, mutations in a selected gene
from a sample cell can be identified by alterations in restriction
enzyme cleavage patterns. For example, sample and control DNA is
isolated, (optionally) amplified, digested with one or more
restriction endonucleases, and fragment length sizes are determined
by gel electrophoresis and compared. Differences in fragment length
sizes between sample and control DNA indicates mutations in the
sample DNA. Moreover, the use of sequence specific ribozymes (see,
e.g., U.S. Pat. No. 5,498,531) can be used to score for the
presence of specific mutations by development or loss of a ribozyme
cleavage site.
[0499] In other embodiments, genetic mutations can be identified by
hybridizing a sample and control nucleic acids, e.g., DNA or RNA,
to high density arrays containing hundreds or thousands of
oligonucleotides probes (Cronin et al. (1996) Human Mutation
7:244-255; Kozal et al. (1996) Nature Medicine 2:753-759). For
example, genetic mutations can be identified in two-dimensional
arrays containing light-generated DNA probes as described in Cronin
et al., supra. Briefly, a first hybridization array of probes can
be used to scan through long stretches of DNA in a sample and
control to identify base changes between the sequences by making
linear arrays of sequential overlapping probes. This step allows
the identification of point mutations. This step is followed by a
second hybridization array that allows the characterization of
specific mutations by using smaller, specialized probe arrays
complementary to all variants or mutations detected. Each mutation
array is composed of parallel probe sets, one complementary to the
wild-type gene and the other complementary to the mutant gene.
[0500] In yet another embodiment, any of a variety of sequencing
reactions known in the art can be used to directly sequence the
selected gene and detect mutations by comparing the sequence of the
sample nucleic acids with the corresponding wild-type (control)
sequence. Examples of sequencing reactions include those based on
techniques developed by Maxim and Gilbert ((1977) Proc. Natl. Acad.
Sci. USA 74:560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA
74:5463). It is also contemplated that any of a variety of
automated sequencing procedures can be utilized when performing the
diagnostic assays ((1995) Bio/Techniques 19:448), including
sequencing by mass spectrometry (see, e.g., PCT Publication No. WO
94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and
Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).
[0501] Other methods for detecting mutations in a selected gene
include methods in which protection from cleavage agents is used to
detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers
et al. (1985) Science 230:1242). In general, the technique of
mismatch cleavage entails providing heteroduplexes formed by
hybridizing (labeled) RNA or DNA containing the wild-type sequence
with potentially mutant RNA or DNA obtained from a tissue sample.
The double-stranded duplexes are treated with an agent which
cleaves single-stranded regions of the duplex such as which will
exist due to base pair mismatches between the control and sample
strands. RNA/DNA duplexes can be treated with RNase to digest
mismatched regions, and DNA/DNA hybrids can be treated with SI
nuclease to digest mismatched regions.
[0502] In other embodiments, either DNA/DNA or RNA/DNA duplexes can
be treated with hydroxylamine or osmium tetroxide and with
piperidine in order to digest mismatched regions. After digestion
of the mismatched regions, the resulting material is then separated
by size on denaturing polyacrylamide gels to determine the site of
mutation. See, e.g., Cotton et al. (1988) Proc. Natl. Acad. Sci.
USA 85:4397; Saleeba et al. (1992) Methods Enzymol. 217:286-295. In
a preferred embodiment, the control DNA or RNA can be labeled for
detection.
[0503] In still another embodiment, the mismatch cleavage reaction
employs one or more proteins that recognize mismatched base pairs
in double-stranded DNA (so called DNA mismatch repair enzymes) in
defined systems for detecting and mapping point mutations in cDNAs
obtained from samples of cells. For example, the mutY enzyme of E.
coli cleaves A at G/A mismatches and the thymidine DNA glycosylase
from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994)
Carcinogenesis 15:1657-1662). According to an exemplary embodiment,
a probe based on a selected sequence, e.g., a wild-type sequence,
is hybridized to a cDNA or other DNA product from a test cell(s).
The duplex is treated with a DNA mismatch repair enzyme, and the
cleavage products, if any, can be detected from electrophoresis
protocols or the like. See, e.g., U.S. Pat. No. 5,459,039.
[0504] In other embodiments, alterations in electrophoretic
mobility will be used to identify mutations in genes. For example,
single strand conformation polymorphism (SSCP) can be used to
detect differences in electrophoretic mobility between mutant and
wild type nucleic acids (Orita et al. (1989) Proc. Natl. Acad. Sci.
USA 86:2766; see also Cotton (1993) Mutat. Res. 285:125-144;
Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79). Single-stranded
DNA fragments of sample and control nucleic acids will be denatured
and allowed to re-nature. The secondary structure of
single-stranded nucleic acids varies according to sequence, and the
resulting alteration in electrophoretic mobility enables the
detection of even a single base change. The DNA fragments can be
labeled or detected with labeled probes. The sensitivity of the
assay can be enhanced by using RNA (rather than DNA), in which the
secondary structure is more sensitive to a change in sequence. In a
preferred embodiment, the subject method utilizes heteroduplex
analysis to separate double stranded heteroduplex molecules on the
basis of changes in electrophoretic mobility (Keen et al. (1991)
Trends Genet. 7:5).
[0505] In yet another embodiment, the movement of mutant or
wild-type fragments in polyacrylamide gels containing a gradient of
denaturant is assayed using denaturing gradient gel electrophoresis
(DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as
the method of analysis, DNA will be modified to insure that it does
not completely denature, for example by adding a `GC clamp` of
approximately 40 base pairs of high-melting GC-rich DNA by PCR. In
a further embodiment, a temperature gradient is used in place of a
denaturing gradient to identify differences in the mobility of
control and sample DNA (Rosenbaum and Reissner (1987) Biophys.
Chem. 265:12753).
[0506] Examples of other techniques for detecting point mutations
include, but are not limited to, selective oligonucleotide
hybridization, selective amplification, or selective primer
extension. For example, oligonucleotide primers can be prepared in
which the known mutation is placed centrally and then hybridized to
target DNA under conditions which permit hybridization only if a
perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki
et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230). Such allele
specific oligonucleotides are hybridized to PCR amplified target
DNA or a number of different mutations when the oligonucleotides
are attached to the hybridizing membrane and hybridized with
labeled target DNA.
[0507] Alternatively, allele specific amplification technology
which depends on selective PCR amplification can be used in
conjunction with the instant invention. Oligonucleotides used as
primers for specific amplification can carry the mutation of
interest in the center of the molecule (so that amplification
depends on differential hybridization; Gibbs et al. (1989) Nucleic
Acids Res. 17:2437-2448) or at the extreme 3' end of one primer
where, under appropriate conditions, mismatching can prevent or
reduce polymerase extension (Prossner (1993) Tibtech 11:238). In
addition, it can be desirable to introduce a novel restriction site
in the region of the mutation to create cleavage-based detection
(Gasparini et al. (1992) Mol. Cell Probes 6:1). Amplification can
also be performed using Taq ligase for amplification (Barany (1991)
Proc. Natl. Acad. Sci. USA 88:189). In such cases, ligation will
occur only if there is a perfect match at the 3' end of the 5'
sequence making it possible to detect the presence of a known
mutation at a specific site by looking for the presence or absence
of amplification.
[0508] The methods described herein can be performed, for example,
using pre-packaged diagnostic kits comprising at least one probe
nucleic acid or antibody reagent described herein, which can be
conveniently used, e.g., in clinical settings to diagnose patients
exhibiting symptoms or family history of a disease or illness
involving a gene encoding a polypeptide of the invention.
Furthermore, any cell type or tissue, preferably peripheral blood
leukocytes, in which the polypeptide of the invention is expressed
can be utilized in the prognostic assays described herein.
[0509] Pharmacogenomics
[0510] Agents, or modulators which have a stimulatory or inhibitory
effect on activity or expression of a polypeptide of the invention
as identified by a screening assay described herein can be
administered to individuals to treat (prophylactically or
therapeutically) disorders associated with aberrant activity of the
polypeptide. In conjunction with such treatment, the
pharmacogenomics (i.e., the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug) of the individual may be considered. Differences
in metabolism of therapeutics can lead to severe toxicity or
therapeutic failure by altering the relation between dose and blood
concentration of the pharmacologically active drug. Thus, the
pharmacogenomics of the individual permits the selection of
effective agents (e.g., drugs) for prophylactic or therapeutic
treatments based on a consideration of the individual's genotype.
Such pharmacogenomics can further be used to determine appropriate
dosages and therapeutic regimens. Accordingly, the activity of a
polypeptide of the invention, expression of a nucleic acid of the
invention, or mutation content of a gene of the invention in an
individual can be determined to thereby select appropriate agent(s)
for therapeutic or prophylactic treatment of the individual.
[0511] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, e.g.,
Linder (1997) Clin. Chem. 43(2):254-266. In general, two types of
pharmacogenetic conditions can be differentiated. Genetic
conditions transmitted as a single factor altering the way drugs
act on the body are referred to as "altered drug action." Genetic
conditions transmitted as single factors altering the way the body
acts on drugs are referred to as "altered drug metabolism". These
pharmacogenetic conditions can occur either as rare defects or as
polymorphisms. For example, glucose-6-phosphate dehydrogenase
(G6PD) deficiency is a common inherited enzymopathy in which the
main clinical complication is hemolysis after ingestion of oxidant
drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and
consumption of fava beans. 104721 As an illustrative embodiment,
the activity of drug metabolizing enzymes is a major determinant of
both the intensity and duration of drug action. The discovery of
genetic polymorphisms of drug metabolizing enzymes (e.g.,
N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6
and CYP2C 19) has provided an explanation as to why some patients
do not obtain the expected drug effects or show exaggerated drug
response and serious toxicity after taking the standard and safe
dose of a drug. These polymorphisms are expressed in two phenotypes
in the population, the extensive metabolizer (EM) and poor
metabolizer (PM). The prevalence of PM is different among different
populations. For example, the gene coding for CYP2D6 is highly
polymorphic and several mutations have been identified in PM, which
all lead to the absence of functional CYP2D6. Poor metabolizers of
CYP2D6 and CYP2C19 quite frequently experience exaggerated drug
response and side effects when they receive standard doses. If a
metabolite is the active therapeutic moiety, a PM will show no
therapeutic response, as demonstrated for the analgesic effect of
codeine mediated by its CYP2D6-formed metabolite morphine. The
other extreme are the so called ultra-rapid metabolizers who do not
respond to standard doses. Recently, the molecular basis of
ultra-rapid metabolism has been identified to be due to CYP2D6 gene
amplification.
[0512] Thus, the activity of a polypeptide of the invention,
expression of a nucleic acid encoding the polypeptide, or mutation
content of a gene encoding the polypeptide in an individual can be
determined to thereby select appropriate agent(s) for therapeutic
or prophylactic treatment of the individual. In addition,
pharmacogenetic studies can be used to apply genotyping of
polymorphic alleles encoding drug-metabolizing enzymes to the
identification of an individual's drug responsiveness phenotype.
This knowledge, when applied to dosing or drug selection, can avoid
adverse reactions or therapeutic failure and thus enhance
therapeutic or prophylactic efficiency when treating a subject with
a modulator of activity or expression of the polypeptide, such as a
modulator identified by one of the exemplary screening assays
described herein.
[0513] Monitoring of Effects During Clinical Trials
[0514] Monitoring the influence of agents (e.g., drug compounds) on
the expression or activity of a polypeptide of the invention (e.g.,
the ability to modulate aberrant cell proliferation chemotaxis,
and/or differentiation) can be applied not only in basic drug
screening, but also in clinical trials. For example, the
effectiveness of an agent, as determined by a screening assay as
described herein, to increase gene expression, protein levels, or
protein activity, can be monitored in clinical trials of subjects
exhibiting decreased gene expression, protein levels, or protein
activity. Alternatively, the effectiveness of an agent, as
determined by a screening assay, to decrease gene expression,
protein levels or protein activity, can be monitored in clinical
trials of subjects exhibiting increased gene expression, protein
levels, or protein activity. In such clinical trials, expression or
activity of a polypeptide of the invention and preferably, that of
other polypeptide that have been implicated in for example, a
cellular proliferation disorder, can be used as a marker of the
immune responsiveness of a particular cell.
[0515] For example, and not by way of limitation, genes, including
those of the invention, that are modulated in cells by treatment
with an agent (e.g., compound, drug or small molecule) which
modulates activity or expression of a polypeptide of the invention
(e.g., as identified in a screening assay described herein) can be
identified. Thus, to study the effect of agents on cellular
proliferation disorders, for example, in a clinical trial, cells
can be isolated and RNA prepared and analyzed for the levels of
expression of a gene of the invention and other genes implicated in
the disorder. The levels of gene expression (i.e., a gene
expression pattern) can be quantified by Northern blot analysis or
RT-PCR, as described herein, or alternatively by measuring the
amount of protein produced, by one of the methods as described
herein, or by measuring the levels of activity of a gene of the
invention or other genes. In this way, the gene expression pattern
can serve as a marker, indicative of the physiological response of
the cells to the agent. Accordingly, this response state can be
determined before, and at various points during, treatment of the
individual with the agent.
[0516] In a preferred embodiment, the present invention provides a
method for monitoring the effectiveness of treatment of a subject
with an agent (e.g., an agonist, antagonist, peptidomimetic,
protein, peptide, nucleic acid, small molecule, or other drug
candidate identified by the screening assays described herein)
comprising the steps of (i) obtaining a pre-administration sample
from a subject prior to administration of the agent; (ii) detecting
the level of the polypeptide or nucleic acid of the invention in
the pre-administration sample; (iii) obtaining one or more
post-administration samples from the subject; (iv) detecting the
level the of the polypeptide or nucleic acid of the invention in
the post-administration samples; (v) comparing the level of the
polypeptide or nucleic acid of the invention in the
pre-administration sample with the level of the polypeptide or
nucleic acid of the invention in the post-administration sample or
samples; and (vi) altering the administration of the agent to the
subject accordingly. For example, increased administration of the
agent can be desirable to increase the expression or activity of
the polypeptide to higher levels than detected, i.e., to increase
the effectiveness of the agent. Alternatively, decreased
administration of the agent can be desirable to decrease expression
or activity of the polypeptide to lower levels than detected, i.e.,
to decrease the effectiveness of the agent.
[0517] Methods of Treatment
[0518] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant expression or activity of a polypeptide of the invention
and/or in which the polypeptide of the invention is involved.
Disorders characterized by aberrant expression or activity of the
polypeptides of the invention are described elsewhere in this
disclosure.
[0519] Prophylactic Methods
[0520] In one aspect, the invention provides a method for
preventing in a subject, a disease or condition associated with an
aberrant expression or activity of a polypeptide of the invention,
by administering to the subject an agent which modulates expression
or at least one activity of the polypeptide. Subjects at risk for a
disease which is caused or contributed to by aberrant expression or
activity of a polypeptide of the invention can be identified by,
for example, any or a combination of diagnostic or prognostic
assays as described herein. Administration of a prophylactic agent
can occur prior to the manifestation of symptoms characteristic of
the aberrance, such that a disease or disorder is prevented or,
alternatively, delayed in its progression. Depending on the type of
aberrance, for example, an agonist or antagonist agent can be used
for treating the subject. The appropriate agent can be determined
based on screening assays described herein.
[0521] Therapeutic Methods
[0522] Another aspect of the invention pertains to methods of
modulating expression or activity of a polypeptide of the invention
for therapeutic purposes. The modulatory method of the invention
involves contacting a cell with an agent that modulates one or more
of the activities of the polypeptide. An agent that modulates
activity can be an agent as described herein, such as a nucleic
acid or a protein, a naturally-occurring cognate ligand of the
polypeptide, a peptide, a peptidomimetic, or other small molecule.
In one embodiment, the agent stimulates one or more of the
biological activities of the polypeptide. Examples of such
stimulatory agents include the active polypeptide of the invention
and a nucleic acid molecule encoding the polypeptide of the
invention that has been introduced into the cell. In another
embodiment, the agent inhibits one or more of the biological
activities of the polypeptide of the invention. Examples of such
inhibitory agents include antisense nucleic acid molecules and
antibodies. These modulatory methods can be performed in vitro
(e.g., by culturing the cell with the agent) or, alternatively, in
vivo (e.g., by administering the agent to a subject). As such, the
present invention provides methods of treating an individual
afflicted with a disease or disorder characterized by aberrant
expression or activity of a polypeptide of the invention. In one
embodiment, the method involves administering an agent (e.g., an
agent identified by a screening assay described herein), or
combination of agents that modulates (e.g., up-regulates or
down-regulates) expression or activity. In another embodiment, the
method involves administering a polypeptide of the invention or a
nucleic acid molecule of the invention as therapy to compensate for
reduced or aberrant expression or activity of the polypeptide.
[0523] Stimulation of activity is desirable in situations in which
activity or expression is abnormally low or down-regulated and/or
in which increased activity is likely to have a beneficial effect,
e.g., in wound healing. Conversely, inhibition of activity is
desirable in situations in which activity or expression is
abnormally high or up-regulated and/or in which decreased activity
is likely to have a beneficial effect.
[0524] The contents of all references, patents, and published
patent applications cited throughout this application are hereby
incorporated by reference.
[0525] Deposits of Clones
[0526] Clones encoding the proteins of the invention were deposited
with the American Type Culture Collection (ATCC.RTM. 10801
University Boulevard, Manassas, Va. 20110-2209) on Apr. 27, 1999
and May 27, 1999. These deposits will be maintained under the terms
of the Budapest Treaty on the International Recognition of the
Deposit of Microorganisms for the Purposes of Patent Procedure.
Each of these deposits was made merely as a convenience to those of
skill in the art. These deposits are not an admission that a
deposit is required under 35 U.S.C. .sctn.112.
[0527] Clones comprising cDNA molecules encoding human INTERCEPT
217, human INTERCEPT 297, human TANGO 325, and human TANGO 331 were
deposited with ATCC.RTM. on May 28, 1999, as part of a composite
deposit representing a mixture of five strains, each carrying one
recombinant plasmid harboring a particular cDNA clone. This deposit
was assigned Accession Number PTA-147.
[0528] To distinguish the strains and isolate a strain harboring a
particular cDNA clone, an aliquot of the mixture is streaked out to
single colonies on nutrient medium (e.g., Luria broth plates)
supplemented with 100 micrograms per milliliter ampicillin, single
colonies grown, and then plasmid DNA is extracted using a standard
mini-preparation procedure. Next, a sample of the DNA
mini-preparation is digested using a combination of the restriction
enzymes SalI, NotI, and SmaI, and the resultant products are
resolved on a 0.8% agarose gel using standard DNA electrophoresis
conditions. The digest liberates fragments as follows:
[0529] 1. human INTERCEPT 217 (clone EpT217): 2.9 kilobases
[0530] 2. human INTERCEPT 297 (clone EpT297): 1.2 kilobases and 0.3
kilobases (human INTERCEPT 297 has a SmaI cut site at about base
pair 1183).
[0531] 3. human TANGO 325 (clone EpT325): 2.2 kilobases
[0532] 4. human TANGO 331 (clone EpT331): 1.4 kilobases
[0533] The identity of the strains can be inferred from the
fragments liberated.
[0534] Human TANGO 276, human TANGO 292, and human TANGO 332 were
each deposited as single deposits. Their clone names, deposit
dates, and accession numbers are as follows:
[0535] 1. human TANGO 276: clone EpT276 was deposited with
ATCC.RTM. on May 28, 1999, and was assigned Accession Number
PTA-150.
[0536] 2. human TANGO 292: clone EpT292 was deposited with
ATCC.RTM. on Apr. 28, 1999, and was assigned Accession Number
207230.
[0537] 3. human TANGO 332: clone EpT332 was deposited with
ATCC.RTM. on May 28, 1999, and was assigned Accession Number
PTA-151.
[0538] Equivalents
[0539] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
100 1 2895 DNA Homo sapiens 1 gtcgacccac gcgtccgggg agcgcggcta
agagtgccgc accgcctcac aacctgggaa 60 ccggagagta ggggccgtcg
gctggcaaga acccgccgtg cctcctcggc aagggccatc 120 cggtgccacc
catgtcgcac tagagcagaa gagggtgagt cctgaactgc aacctgcaca 180
gagctgctct gtactgtccc tggtggtcgc cgccatgacc tggttggtgc tgctggggac
240 actgctctgc atgctgcgcg ttgggttagg caccccggac tccgagggtt
tcccgccccg 300 tgcgctccac aactgcccct acaaatgtat ctgcgctgcc
gacctgctaa gctgcactgg 360 cctagggctg caggacgtgc cagccgagtt
acctgccgct actgcggacc tcgacctgag 420 ccacaacgcg ctccagcgcc
tgcgccccgg ctggttggcg cccctcttcc agctgcgcgc 480 cctgcaccta
gaccacaacg aactagatgc gctgggtcgc ggcgtcttcg tcaacgccag 540
cggcctgagg ctgctcgatc tatcatctaa cacgttgcgg gcgcttggcc gccacgacct
600 cgacgggctg ggggcgctgg agaagctgct tctgttcaat aaccgcttgg
tgcacttgga 660 cgagcatgcc ttccacggcc tgcgcgcgct cagccatctc
tacctgggct gcaacgaact 720 cgcctcgttc tccttcgacc acctgcacgg
tctgagcgcc acccacctgc ttactctgga 780 cctctcctcc aaccggctgg
gacacatctc cgtacctgag ctggccgcgc tgccggcctt 840 cctcaagaac
ggcctctact tgcacaacaa ccctttgcct tgcgactgcc gcctctacca 900
cctgctacag cgctggcacc agcggggcct gagcgccgtg cgcgactttg cgcgcgagta
960 cgtatgcttg gccttcaagg tacccgcgtc ccgcgtgcgc ttcttccagc
acagccgcgt 1020 ctttgagaac tgctcgtcgg ccccagctct tggcctaaag
cggccggaag agcacctgta 1080 cgcgctggtg ggtcggtccc tgaggcttta
ctgcaacacc agcgtcccgg ccatgcgcat 1140 tgcctgggtt tcgccgcagc
aggagcttct cagggcgcca ggatcccgcg atggcagcat 1200 cgcggtgctg
gccgacggca gcttggccat aggcaacgta caggagcagc atgcgggact 1260
cttcgtgtgc ctggccactg ggccccgcct gcaccacaac cagacgcacg agtacaacgt
1320 gagcgtgcac tttccgcgcc cagagcccga ggctttcaac acaggcttca
ccacactgct 1380 gggctgtgcc gtgggccttg tgctcgtgct gctctacctg
ttcgccccac cctgccgctg 1440 ctgccgccgt gcctgcccgc tgccgccgct
ggccccaaac acccagcccg ctccaagagc 1500 tgagccgcac aagtcctcag
tactcagcac cacaccgcca gacgcaccca gcccgcaagg 1560 ccaagcgtcc
acaagcacgt agtctttctg gagccaggcc ggaggggcct caatggcccg 1620
cgtgcagctg gcagtagctg aggaattcga tctctacaac cctggaggcc tgcagctgaa
1680 ggctggctct gagtccgcca gctccatagg ctccgagggt cccatgacaa
cctagactgc 1740 cagggctccc ccacccaggc ccccaccctc ttgctgctcg
ccctgctccc tgcttcggtc 1800 cagagaactg gcagatactg gtgggaagca
ctgtgcctgg ccccccagct tcctgtatgg 1860 gcctcgaaac acaatgggcc
ttctcgctca ctggtagaga caggggttgt ggtccccaac 1920 ctgccttctg
ctctgcccct gcacaggacc caaaggcccc aggccctgca aggtgtgcta 1980
gttcctgctt tcccgcggac ttcctagtgc ccaaatgccc tgtgaggctg agagacccag
2040 gcccctgtgg ctttcaacac agcacagctg tggaagtggc tgtgttcttc
tacagcctgt 2100 ggaagaaccc ctgtagcaga gcctcccatc caccctcagg
ggctgaggca gctctcgagg 2160 agtggtgctc aagagctgac gcagggccac
ctccccttcc caagggggtg ggagggagtg 2220 ggcccacagg gaaaagaagg
cggctctgaa ggaagatctc gcccacaccc caggacagaa 2280 agaggaaaca
agcccgccct ctggtgaaat gggactccct ccatccacca acacccaacc 2340
tcctgaaagc ttcacaactt cacgcagagt ccggtggcag gcaccaggca ggaaaggctc
2400 ctcaagaggt tcctggtggt ctggcctaag ccccagccag aggccctgct
ctctctggcc 2460 tggggcatcc acccgttgtt ctgaaggcag agcccattct
gtgggctcac aagacacagt 2520 gaaggggatc atggcctgca cccctgcttt
tcagcagtaa aaagcccgaa aagcctggcg 2580 agcatggccg agctgggagg
gccgagccgg aactccacgt ccctcgagag caggagcctc 2640 ttaagggctg
gcactggtct cagcctaatg gctgaggcgg taccctggct tcatatgcat 2700
ctcactgctc ccactgcagg ggggcaggga aggggggtct gggagccctt catgtgtggg
2760 ggccgagctg ggggccccca tggccatcct ggacctcgct gctccagagt
ttaataaagg 2820 tagcacatgc ttattgctag aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 2880 aaaaagggcg gccgc 2895 2 1365 DNA Homo
sapiens 2 atgacctggt tggtgctgct ggggacactg ctctgcatgc tgcgcgttgg
gttaggcacc 60 ccggactccg agggtttccc gccccgtgcg ctccacaact
gcccctacaa atgtatctgc 120 gctgccgacc tgctaagctg cactggccta
gggctgcagg acgtgccagc cgagttacct 180 gccgctactg cggacctcga
cctgagccac aacgcgctcc agcgcctgcg ccccggctgg 240 ttggcgcccc
tcttccagct gcgcgccctg cacctagacc acaacgaact agatgcgctg 300
ggtcgcggcg tcttcgtcaa cgccagcggc ctgaggctgc tcgatctatc atctaacacg
360 ttgcgggcgc ttggccgcca cgacctcgac gggctggggg cgctggagaa
gctgcttctg 420 ttcaataacc gcttggtgca cttggacgag catgccttcc
acggcctgcg cgcgctcagc 480 catctctacc tgggctgcaa cgaactcgcc
tcgttctcct tcgaccacct gcacggtctg 540 agcgccaccc acctgcttac
tctggacctc tcctccaacc ggctgggaca catctccgta 600 cctgagctgg
ccgcgctgcc ggccttcctc aagaacggcc tctacttgca caacaaccct 660
ttgccttgcg actgccgcct ctaccacctg ctacagcgct ggcaccagcg gggcctgagc
720 gccgtgcgcg actttgcgcg cgagtacgta tgcttggcct tcaaggtacc
cgcgtcccgc 780 gtgcgcttct tccagcacag ccgcgtcttt gagaactgct
cgtcggcccc agctcttggc 840 ctaaagcggc cggaagagca cctgtacgcg
ctggtgggtc ggtccctgag gctttactgc 900 aacaccagcg tcccggccat
gcgcattgcc tgggtttcgc cgcagcagga gcttctcagg 960 gcgccaggat
cccgcgatgg cagcatcgcg gtgctggccg acggcagctt ggccataggc 1020
aacgtacagg agcagcatgc gggactcttc gtgtgcctgg ccactgggcc ccgcctgcac
1080 cacaaccaga cgcacgagta caacgtgagc gtgcactttc cgcgcccaga
gcccgaggct 1140 ttcaacacag gcttcaccac actgctgggc tgtgccgtgg
gccttgtgct cgtgctgctc 1200 tacctgttcg ccccaccctg ccgctgctgc
cgccgtgcct gcccgctgcc gccgctggcc 1260 ccaaacaccc agcccgctcc
aagagctgag ccgcacaagt cctcagtact cagcaccaca 1320 ccgccagacg
cacccagccc gcaaggccaa gcgtccacaa gcacg 1365 3 455 PRT Homo sapiens
3 Met Thr Trp Leu Val Leu Leu Gly Thr Leu Leu Cys Met Leu Arg Val 1
5 10 15 Gly Leu Gly Thr Pro Asp Ser Glu Gly Phe Pro Pro Arg Ala Leu
His 20 25 30 Asn Cys Pro Tyr Lys Cys Ile Cys Ala Ala Asp Leu Leu
Ser Cys Thr 35 40 45 Gly Leu Gly Leu Gln Asp Val Pro Ala Glu Leu
Pro Ala Ala Thr Ala 50 55 60 Asp Leu Asp Leu Ser His Asn Ala Leu
Gln Arg Leu Arg Pro Gly Trp 65 70 75 80 Leu Ala Pro Leu Phe Gln Leu
Arg Ala Leu His Leu Asp His Asn Glu 85 90 95 Leu Asp Ala Leu Gly
Arg Gly Val Phe Val Asn Ala Ser Gly Leu Arg 100 105 110 Leu Leu Asp
Leu Ser Ser Asn Thr Leu Arg Ala Leu Gly Arg His Asp 115 120 125 Leu
Asp Gly Leu Gly Ala Leu Glu Lys Leu Leu Leu Phe Asn Asn Arg 130 135
140 Leu Val His Leu Asp Glu His Ala Phe His Gly Leu Arg Ala Leu Ser
145 150 155 160 His Leu Tyr Leu Gly Cys Asn Glu Leu Ala Ser Phe Ser
Phe Asp His 165 170 175 Leu His Gly Leu Ser Ala Thr His Leu Leu Thr
Leu Asp Leu Ser Ser 180 185 190 Asn Arg Leu Gly His Ile Ser Val Pro
Glu Leu Ala Ala Leu Pro Ala 195 200 205 Phe Leu Lys Asn Gly Leu Tyr
Leu His Asn Asn Pro Leu Pro Cys Asp 210 215 220 Cys Arg Leu Tyr His
Leu Leu Gln Arg Trp His Gln Arg Gly Leu Ser 225 230 235 240 Ala Val
Arg Asp Phe Ala Arg Glu Tyr Val Cys Leu Ala Phe Lys Val 245 250 255
Pro Ala Ser Arg Val Arg Phe Phe Gln His Ser Arg Val Phe Glu Asn 260
265 270 Cys Ser Ser Ala Pro Ala Leu Gly Leu Lys Arg Pro Glu Glu His
Leu 275 280 285 Tyr Ala Leu Val Gly Arg Ser Leu Arg Leu Tyr Cys Asn
Thr Ser Val 290 295 300 Pro Ala Met Arg Ile Ala Trp Val Ser Pro Gln
Gln Glu Leu Leu Arg 305 310 315 320 Ala Pro Gly Ser Arg Asp Gly Ser
Ile Ala Val Leu Ala Asp Gly Ser 325 330 335 Leu Ala Ile Gly Asn Val
Gln Glu Gln His Ala Gly Leu Phe Val Cys 340 345 350 Leu Ala Thr Gly
Pro Arg Leu His His Asn Gln Thr His Glu Tyr Asn 355 360 365 Val Ser
Val His Phe Pro Arg Pro Glu Pro Glu Ala Phe Asn Thr Gly 370 375 380
Phe Thr Thr Leu Leu Gly Cys Ala Val Gly Leu Val Leu Val Leu Leu 385
390 395 400 Tyr Leu Phe Ala Pro Pro Cys Arg Cys Cys Arg Arg Ala Cys
Pro Leu 405 410 415 Pro Pro Leu Ala Pro Asn Thr Gln Pro Ala Pro Arg
Ala Glu Pro His 420 425 430 Lys Ser Ser Val Leu Ser Thr Thr Pro Pro
Asp Ala Pro Ser Pro Gln 435 440 445 Gly Gln Ala Ser Thr Ser Thr 450
455 4 20 PRT Homo sapiens 4 Met Thr Trp Leu Val Leu Leu Gly Thr Leu
Leu Cys Met Leu Arg Val 1 5 10 15 Gly Leu Gly Thr 20 5 435 PRT Homo
sapiens 5 Pro Asp Ser Glu Gly Phe Pro Pro Arg Ala Leu His Asn Cys
Pro Tyr 1 5 10 15 Lys Cys Ile Cys Ala Ala Asp Leu Leu Ser Cys Thr
Gly Leu Gly Leu 20 25 30 Gln Asp Val Pro Ala Glu Leu Pro Ala Ala
Thr Ala Asp Leu Asp Leu 35 40 45 Ser His Asn Ala Leu Gln Arg Leu
Arg Pro Gly Trp Leu Ala Pro Leu 50 55 60 Phe Gln Leu Arg Ala Leu
His Leu Asp His Asn Glu Leu Asp Ala Leu 65 70 75 80 Gly Arg Gly Val
Phe Val Asn Ala Ser Gly Leu Arg Leu Leu Asp Leu 85 90 95 Ser Ser
Asn Thr Leu Arg Ala Leu Gly Arg His Asp Leu Asp Gly Leu 100 105 110
Gly Ala Leu Glu Lys Leu Leu Leu Phe Asn Asn Arg Leu Val His Leu 115
120 125 Asp Glu His Ala Phe His Gly Leu Arg Ala Leu Ser His Leu Tyr
Leu 130 135 140 Gly Cys Asn Glu Leu Ala Ser Phe Ser Phe Asp His Leu
His Gly Leu 145 150 155 160 Ser Ala Thr His Leu Leu Thr Leu Asp Leu
Ser Ser Asn Arg Leu Gly 165 170 175 His Ile Ser Val Pro Glu Leu Ala
Ala Leu Pro Ala Phe Leu Lys Asn 180 185 190 Gly Leu Tyr Leu His Asn
Asn Pro Leu Pro Cys Asp Cys Arg Leu Tyr 195 200 205 His Leu Leu Gln
Arg Trp His Gln Arg Gly Leu Ser Ala Val Arg Asp 210 215 220 Phe Ala
Arg Glu Tyr Val Cys Leu Ala Phe Lys Val Pro Ala Ser Arg 225 230 235
240 Val Arg Phe Phe Gln His Ser Arg Val Phe Glu Asn Cys Ser Ser Ala
245 250 255 Pro Ala Leu Gly Leu Lys Arg Pro Glu Glu His Leu Tyr Ala
Leu Val 260 265 270 Gly Arg Ser Leu Arg Leu Tyr Cys Asn Thr Ser Val
Pro Ala Met Arg 275 280 285 Ile Ala Trp Val Ser Pro Gln Gln Glu Leu
Leu Arg Ala Pro Gly Ser 290 295 300 Arg Asp Gly Ser Ile Ala Val Leu
Ala Asp Gly Ser Leu Ala Ile Gly 305 310 315 320 Asn Val Gln Glu Gln
His Ala Gly Leu Phe Val Cys Leu Ala Thr Gly 325 330 335 Pro Arg Leu
His His Asn Gln Thr His Glu Tyr Asn Val Ser Val His 340 345 350 Phe
Pro Arg Pro Glu Pro Glu Ala Phe Asn Thr Gly Phe Thr Thr Leu 355 360
365 Leu Gly Cys Ala Val Gly Leu Val Leu Val Leu Leu Tyr Leu Phe Ala
370 375 380 Pro Pro Cys Arg Cys Cys Arg Arg Ala Cys Pro Leu Pro Pro
Leu Ala 385 390 395 400 Pro Asn Thr Gln Pro Ala Pro Arg Ala Glu Pro
His Lys Ser Ser Val 405 410 415 Leu Ser Thr Thr Pro Pro Asp Ala Pro
Ser Pro Gln Gly Gln Ala Ser 420 425 430 Thr Ser Thr 435 6 363 PRT
Homo sapiens 6 Pro Asp Ser Glu Gly Phe Pro Pro Arg Ala Leu His Asn
Cys Pro Tyr 1 5 10 15 Lys Cys Ile Cys Ala Ala Asp Leu Leu Ser Cys
Thr Gly Leu Gly Leu 20 25 30 Gln Asp Val Pro Ala Glu Leu Pro Ala
Ala Thr Ala Asp Leu Asp Leu 35 40 45 Ser His Asn Ala Leu Gln Arg
Leu Arg Pro Gly Trp Leu Ala Pro Leu 50 55 60 Phe Gln Leu Arg Ala
Leu His Leu Asp His Asn Glu Leu Asp Ala Leu 65 70 75 80 Gly Arg Gly
Val Phe Val Asn Ala Ser Gly Leu Arg Leu Leu Asp Leu 85 90 95 Ser
Ser Asn Thr Leu Arg Ala Leu Gly Arg His Asp Leu Asp Gly Leu 100 105
110 Gly Ala Leu Glu Lys Leu Leu Leu Phe Asn Asn Arg Leu Val His Leu
115 120 125 Asp Glu His Ala Phe His Gly Leu Arg Ala Leu Ser His Leu
Tyr Leu 130 135 140 Gly Cys Asn Glu Leu Ala Ser Phe Ser Phe Asp His
Leu His Gly Leu 145 150 155 160 Ser Ala Thr His Leu Leu Thr Leu Asp
Leu Ser Ser Asn Arg Leu Gly 165 170 175 His Ile Ser Val Pro Glu Leu
Ala Ala Leu Pro Ala Phe Leu Lys Asn 180 185 190 Gly Leu Tyr Leu His
Asn Asn Pro Leu Pro Cys Asp Cys Arg Leu Tyr 195 200 205 His Leu Leu
Gln Arg Trp His Gln Arg Gly Leu Ser Ala Val Arg Asp 210 215 220 Phe
Ala Arg Glu Tyr Val Cys Leu Ala Phe Lys Val Pro Ala Ser Arg 225 230
235 240 Val Arg Phe Phe Gln His Ser Arg Val Phe Glu Asn Cys Ser Ser
Ala 245 250 255 Pro Ala Leu Gly Leu Lys Arg Pro Glu Glu His Leu Tyr
Ala Leu Val 260 265 270 Gly Arg Ser Leu Arg Leu Tyr Cys Asn Thr Ser
Val Pro Ala Met Arg 275 280 285 Ile Ala Trp Val Ser Pro Gln Gln Glu
Leu Leu Arg Ala Pro Gly Ser 290 295 300 Arg Asp Gly Ser Ile Ala Val
Leu Ala Asp Gly Ser Leu Ala Ile Gly 305 310 315 320 Asn Val Gln Glu
Gln His Ala Gly Leu Phe Val Cys Leu Ala Thr Gly 325 330 335 Pro Arg
Leu His His Asn Gln Thr His Glu Tyr Asn Val Ser Val His 340 345 350
Phe Pro Arg Pro Glu Pro Glu Ala Phe Asn Thr 355 360 7 20 PRT Homo
sapiens 7 Gly Phe Thr Thr Leu Leu Gly Cys Ala Val Gly Leu Val Leu
Val Leu 1 5 10 15 Leu Tyr Leu Phe 20 8 52 PRT Homo sapiens 8 Ala
Pro Pro Cys Arg Cys Cys Arg Arg Ala Cys Pro Leu Pro Pro Leu 1 5 10
15 Ala Pro Asn Thr Gln Pro Ala Pro Arg Ala Glu Pro His Lys Ser Ser
20 25 30 Val Leu Ser Thr Thr Pro Pro Asp Ala Pro Ser Pro Gln Gly
Gln Ala 35 40 45 Ser Thr Ser Thr 50 9 1518 DNA Homo sapiens 9
gtcgacccac gcgtccggcg aaccccagcg tccgccgaca tggcctggac caagtaccag
60 ctgttcctgg ccgggctcat gcttgttacc ggctccatca acacgctctc
ggcaaaatgg 120 gcggacaatt tcatggccga gggctgtgga gggagcaagg
agcacagctt ccagcatccc 180 ttcctccagg cagtgggcat gttcctggga
gaattctcct gcctggctgc cttctacctc 240 ctccgatgca gagctgcagg
gcaatcagac tccagcgtag acccccagca gcccttcaac 300 cctcttcttt
tcctgccccc agcgctctgt gacatgacag ggaccagcct catgtatgtg 360
gctctgaaca tgaccagtgc ctccagcttc cagatgctgc ggggtgcagt gatcatattc
420 actggcctgt tctcggtggc cttcctgggc cggaggctgg tgctgagcca
gtggctgggc 480 atcctagcca ccatcgcggg gctggtggtc gtgggcctgg
ctgacctcct gagcaagcac 540 gacagtcagc acaagctcag cgaagtgatc
acaggggacc tgttgatcat catggcccag 600 atcatcgttg ccatccagat
ggtgctagag gagaagttcg tctacaaaca caatgtgcac 660 ccactgcggg
cagttggcac tgagggcctc tttggctttg tgatcctctc cctgctgctg 720
gtgcccatgt actacatccc cgccggctcc ttcagcggaa accctcgtgg gacactggag
780 gatgcattgg acgccttctg ccaggtgggc cagcagccgc tcattgccgt
ggcactgctg 840 ggcaacatca gcagcattgc cttcttcaac ttcgcaggca
tcagcgtcac caaggaactg 900 agcgccacca cccgcatggt gttggacagc
ttgcgcaccg ttgtcatctg ggcactgagc 960 ctggcactgg gctgggaggc
cttccatgca ctgcagatcc ttggcttcct catactcctt 1020 ataggcactg
ccctctacaa tgggctacac cgtccgctgc tgggccgcct gtccaggggc 1080
cggcccctgg cagaggagag cgagcaggag agactgctgg gtggcacccg cactcccatc
1140 aatgatgcca gctgaggttc cctggaggct tctactgcca cccgggtgct
ccttctccct 1200 gagactgagg ccacacaggc tggtgggccc cgaatgccct
atccccaagg cctcaccctg 1260 tcccctccct gcagaacccc cagggcagct
gctgccacag aagataacaa cacccaagtc 1320 ctctttttct cactaccacc
tgcagggtgg tgttacccag cccccacaag cctgagtgca 1380 gtggcagacc
tcagctctct ggacccctcc tacagcacta gagctaaatc atgaagttga 1440
attgtaggaa tttaccaccg tagtgtatct gaatcataaa ctagattatc ataaaaaaaa
1500 aaaaaaaagg gcggccgc 1518 10 1113 DNA Homo sapiens 10
atggcctgga ccaagtacca gctgttcctg gccgggctca tgcttgttac cggctccatc
60 aacacgctct cggcaaaatg ggcggacaat ttcatggccg agggctgtgg
agggagcaag 120 gagcacagct tccagcatcc cttcctccag gcagtgggca
tgttcctggg agaattctcc 180 tgcctggctg ccttctacct cctccgatgc
agagctgcag ggcaatcaga ctccagcgta 240 gacccccagc agcccttcaa
ccctcttctt ttcctgcccc cagcgctctg tgacatgaca 300 gggaccagcc
tcatgtatgt ggctctgaac atgaccagtg cctccagctt ccagatgctg 360
cggggtgcag tgatcatatt cactggcctg ttctcggtgg ccttcctggg ccggaggctg
420 gtgctgagcc agtggctggg catcctagcc accatcgcgg ggctggtggt
cgtgggcctg 480 gctgacctcc tgagcaagca cgacagtcag cacaagctca
gcgaagtgat cacaggggac 540 ctgttgatca tcatggccca gatcatcgtt
gccatccaga tggtgctaga ggagaagttc 600 gtctacaaac acaatgtgca
cccactgcgg gcagttggca ctgagggcct ctttggcttt 660 gtgatcctct
ccctgctgct ggtgcccatg tactacatcc ccgccggctc cttcagcgga 720
aaccctcgtg ggacactgga ggatgcattg gacgccttct gccaggtggg ccagcagccg
780 ctcattgccg tggcactgct gggcaacatc agcagcattg ccttcttcaa
cttcgcaggc 840 atcagcgtca ccaaggaact gagcgccacc acccgcatgg
tgttggacag cttgcgcacc 900 gttgtcatct gggcactgag cctggcactg
ggctgggagg ccttccatgc actgcagatc 960 cttggcttcc tcatactcct
tataggcact gccctctaca atgggctaca ccgtccgctg 1020 ctgggccgcc
tgtccagggg ccggcccctg gcagaggaga gcgagcagga gagactgctg 1080
ggtggcaccc gcactcccat caatgatgcc agc 1113 11 371 PRT Homo sapiens
11 Met Ala Trp Thr Lys Tyr Gln Leu Phe Leu Ala Gly Leu Met Leu Val
1 5 10 15 Thr Gly Ser Ile Asn Thr Leu Ser Ala Lys Trp Ala Asp Asn
Phe Met 20 25 30 Ala Glu Gly Cys Gly Gly Ser Lys Glu His Ser Phe
Gln His Pro Phe 35 40 45 Leu Gln Ala Val Gly Met Phe Leu Gly Glu
Phe Ser Cys Leu Ala Ala 50 55 60 Phe Tyr Leu Leu Arg Cys Arg Ala
Ala Gly Gln Ser Asp Ser Ser Val 65 70 75 80 Asp Pro Gln Gln Pro Phe
Asn Pro Leu Leu Phe Leu Pro Pro Ala Leu 85 90 95 Cys Asp Met Thr
Gly Thr Ser Leu Met Tyr Val Ala Leu Asn Met Thr 100 105 110 Ser Ala
Ser Ser Phe Gln Met Leu Arg Gly Ala Val Ile Ile Phe Thr 115 120 125
Gly Leu Phe Ser Val Ala Phe Leu Gly Arg Arg Leu Val Leu Ser Gln 130
135 140 Trp Leu Gly Ile Leu Ala Thr Ile Ala Gly Leu Val Val Val Gly
Leu 145 150 155 160 Ala Asp Leu Leu Ser Lys His Asp Ser Gln His Lys
Leu Ser Glu Val 165 170 175 Ile Thr Gly Asp Leu Leu Ile Ile Met Ala
Gln Ile Ile Val Ala Ile 180 185 190 Gln Met Val Leu Glu Glu Lys Phe
Val Tyr Lys His Asn Val His Pro 195 200 205 Leu Arg Ala Val Gly Thr
Glu Gly Leu Phe Gly Phe Val Ile Leu Ser 210 215 220 Leu Leu Leu Val
Pro Met Tyr Tyr Ile Pro Ala Gly Ser Phe Ser Gly 225 230 235 240 Asn
Pro Arg Gly Thr Leu Glu Asp Ala Leu Asp Ala Phe Cys Gln Val 245 250
255 Gly Gln Gln Pro Leu Ile Ala Val Ala Leu Leu Gly Asn Ile Ser Ser
260 265 270 Ile Ala Phe Phe Asn Phe Ala Gly Ile Ser Val Thr Lys Glu
Leu Ser 275 280 285 Ala Thr Thr Arg Met Val Leu Asp Ser Leu Arg Thr
Val Val Ile Trp 290 295 300 Ala Leu Ser Leu Ala Leu Gly Trp Glu Ala
Phe His Ala Leu Gln Ile 305 310 315 320 Leu Gly Phe Leu Ile Leu Leu
Ile Gly Thr Ala Leu Tyr Asn Gly Leu 325 330 335 His Arg Pro Leu Leu
Gly Arg Leu Ser Arg Gly Arg Pro Leu Ala Glu 340 345 350 Glu Ser Glu
Gln Glu Arg Leu Leu Gly Gly Thr Arg Thr Pro Ile Asn 355 360 365 Asp
Ala Ser 370 12 18 PRT Homo sapiens 12 Met Ala Trp Thr Lys Tyr Gln
Leu Phe Leu Ala Gly Leu Met Leu Val 1 5 10 15 Thr Gly 13 353 PRT
Homo sapiens 13 Ser Ile Asn Thr Leu Ser Ala Lys Trp Ala Asp Asn Phe
Met Ala Glu 1 5 10 15 Gly Cys Gly Gly Ser Lys Glu His Ser Phe Gln
His Pro Phe Leu Gln 20 25 30 Ala Val Gly Met Phe Leu Gly Glu Phe
Ser Cys Leu Ala Ala Phe Tyr 35 40 45 Leu Leu Arg Cys Arg Ala Ala
Gly Gln Ser Asp Ser Ser Val Asp Pro 50 55 60 Gln Gln Pro Phe Asn
Pro Leu Leu Phe Leu Pro Pro Ala Leu Cys Asp 65 70 75 80 Met Thr Gly
Thr Ser Leu Met Tyr Val Ala Leu Asn Met Thr Ser Ala 85 90 95 Ser
Ser Phe Gln Met Leu Arg Gly Ala Val Ile Ile Phe Thr Gly Leu 100 105
110 Phe Ser Val Ala Phe Leu Gly Arg Arg Leu Val Leu Ser Gln Trp Leu
115 120 125 Gly Ile Leu Ala Thr Ile Ala Gly Leu Val Val Val Gly Leu
Ala Asp 130 135 140 Leu Leu Ser Lys His Asp Ser Gln His Lys Leu Ser
Glu Val Ile Thr 145 150 155 160 Gly Asp Leu Leu Ile Ile Met Ala Gln
Ile Ile Val Ala Ile Gln Met 165 170 175 Val Leu Glu Glu Lys Phe Val
Tyr Lys His Asn Val His Pro Leu Arg 180 185 190 Ala Val Gly Thr Glu
Gly Leu Phe Gly Phe Val Ile Leu Ser Leu Leu 195 200 205 Leu Val Pro
Met Tyr Tyr Ile Pro Ala Gly Ser Phe Ser Gly Asn Pro 210 215 220 Arg
Gly Thr Leu Glu Asp Ala Leu Asp Ala Phe Cys Gln Val Gly Gln 225 230
235 240 Gln Pro Leu Ile Ala Val Ala Leu Leu Gly Asn Ile Ser Ser Ile
Ala 245 250 255 Phe Phe Asn Phe Ala Gly Ile Ser Val Thr Lys Glu Leu
Ser Ala Thr 260 265 270 Thr Arg Met Val Leu Asp Ser Leu Arg Thr Val
Val Ile Trp Ala Leu 275 280 285 Ser Leu Ala Leu Gly Trp Glu Ala Phe
His Ala Leu Gln Ile Leu Gly 290 295 300 Phe Leu Ile Leu Leu Ile Gly
Thr Ala Leu Tyr Asn Gly Leu His Arg 305 310 315 320 Pro Leu Leu Gly
Arg Leu Ser Arg Gly Arg Pro Leu Ala Glu Glu Ser 325 330 335 Glu Gln
Glu Arg Leu Leu Gly Gly Thr Arg Thr Pro Ile Asn Asp Ala 340 345 350
Ser 14 29 PRT Homo sapiens 14 Ser Ile Asn Thr Leu Ser Ala Lys Trp
Ala Asp Asn Phe Met Ala Glu 1 5 10 15 Gly Cys Gly Gly Ser Lys Glu
His Ser Phe Gln His Pro 20 25 15 9 PRT Homo sapiens 15 Asn Met Thr
Ser Ala Ser Ser Phe Gln 1 5 16 14 PRT Homo sapiens 16 Asp Leu Leu
Ser Lys His Asp Ser Gln His Lys Leu Ser Glu 1 5 10 17 27 PRT Homo
sapiens 17 Pro Ala Gly Ser Phe Ser Gly Asn Pro Arg Gly Thr Leu Glu
Asp Ala 1 5 10 15 Leu Asp Ala Phe Cys Gln Val Gly Gln Gln Pro 20 25
18 7 PRT Homo sapiens 18 Glu Ala Phe His Ala Leu Gln 1 5 19 21 PRT
Homo sapiens 19 Phe Leu Gln Ala Val Gly Met Phe Leu Gly Glu Phe Ser
Cys Leu Ala 1 5 10 15 Ala Phe Tyr Leu Leu 20 20 21 PRT Homo sapiens
20 Leu Leu Phe Leu Pro Pro Ala Leu Cys Asp Met Thr Gly Thr Ser Leu
1 5 10 15 Met Tyr Val Ala Leu 20 21 19 PRT Homo sapiens 21 Met Leu
Arg Gly Ala Val Ile Ile Phe Thr Gly Leu Phe Ser Val Ala 1 5 10 15
Phe Leu Gly 22 17 PRT Homo sapiens 22 Trp Leu Gly Ile Leu Ala Thr
Ile Ala Gly Leu Val Val Val Gly Leu 1 5 10 15 Ala 23 17 PRT Homo
sapiens 23 Val Ile Thr Gly Asp Leu Leu Ile Ile Met Ala Gln Ile Ile
Val Ala 1 5 10 15 Ile 24 18 PRT Homo sapiens 24 Gly Leu Phe Gly Phe
Val Ile Leu Ser Leu Leu Leu Val Pro Met Tyr 1 5 10 15 Tyr Ile 25 23
PRT Homo sapiens 25 Leu Ile Ala Val Ala Leu Leu Gly Asn Ile Ser Ser
Ile Ala Phe Phe 1 5 10 15 Asn Phe Ala Gly Ile Ser Val 20 26 20 PRT
Homo sapiens 26 Met Val Leu Asp Ser Leu Arg Thr Val Val Ile Trp Ala
Leu Ser Leu 1 5 10 15 Ala Leu Gly Trp 20 27 17 PRT Homo sapiens 27
Ile Leu Gly Phe Leu Ile Leu Leu Ile Gly Thr Ala Leu Tyr Asn Gly 1 5
10 15 Leu 28 20 PRT Homo sapiens 28 Arg Cys Arg Ala Ala Gly Gln Ser
Asp Ser Ser Val Asp Pro Gln Gln 1 5 10 15 Pro Phe Asn Pro 20 29 7
PRT Homo sapiens 29 Arg Arg Leu Val Leu Ser Gln 1 5 30 23 PRT Homo
sapiens 30 Gln Met Val Leu Glu Glu Lys Phe Val Tyr Lys His Asn Val
His Pro 1 5 10 15 Leu Arg Ala Val Gly Thr Glu 20 31 9 PRT Homo
sapiens 31 Thr Lys Glu Leu Ser Ala Thr Thr Arg 1 5 32 35 PRT Homo
sapiens 32 His Arg Pro Leu Leu Gly Arg Leu Ser Arg Gly Arg Pro Leu
Ala Glu 1 5 10 15 Glu Ser Glu Gln Glu Arg Leu Leu Gly Gly Thr Arg
Thr Pro Ile Asn 20 25 30 Asp Ala Ser 35 33 2811 DNA Homo sapiens 33
gtcgacccac gcgtccgcgg gacagctggc ctgaagctca gagccggggc gtgcgccatg
60 gccccacact gggctgtctg gctgctggca gcaaggctgt ggggcctggg
cattggggct 120 gaggtgtggt ggaaccttgt gccgcgtaag acagtgtctt
ctggggagct ggccacggta 180 gtacggcggt tctcccagac cggcatccag
gacttcctga cactgacgct gacggagccc 240 actgggcttc tgtacgtggg
cgcccgagag gccctgtttg ccttcagcat ggaggccctg 300 gagctgcaag
gagcgatctc ctgggaggcc cccgtggaga agaagactga gtgtatccag 360
aaagggaaga acaaccagac cgagtgcttc aacttcatcc gcttcctgca gccctacaat
420 gcctcccacc tgtacgtctg tggcacctac gccttccagc ccaagtgcac
ctacgtcgtg 480 agtgctgccc tcctacctcg gtgtccccag ccccccgccc
tcctcaccct tctctggact 540 cgtggatgtg gcccacagag ccctgccctt
aagcatctcc tcatcacctc tctctctgtc 600 cttagaacat gctcaccttc
actttggagc atggagagtt tgaagatggg aagggcaagt 660 gtccctatga
cccagctaag ggccatgctg gccttcttgt ggatggtgag ctgtactcgg 720
ccacactcaa caacttcctg ggcacggaac ccattatcct gcgtaacatg gggccccacc
780 actccatgaa gacagagtac ctggcctttt ggctcaacga acctcacttt
gtaggctctg 840 cctatgtacc tgagagtgtg ggcagcttca cgggggacga
cgacaaggtc tacttcttct 900 tcagggagcg ggcagtggag tccgactgct
atgccgagca ggtggtggct cgtgtggccc 960 gtgtctgcaa gggcgatatg
gggggcgcac ggaccctgca gaggaagtgg accacgttcc 1020 tgaaggcgcg
gctggcatgc tctgccccga actggcagct ctacttcaac cagctgcagg 1080
cgatgcacac cctgcaggac acctcctggc acaacaccac cttctttggg gtttttcaag
1140 cacagtgggg tgacatgtac ctgtcggcca tctgtgagta ccagttggaa
gagatccagc 1200 gggtgtttga gggcccctat aaggagtacc atgaggaagc
ccagaagtgg gaccgctaca 1260 ctgaccctgt acccaggccc tggttgtgat
ggctgcccag ccccgccatg ccggggccta 1320 ccactgcttt tcagaggagc
agggggcgcg gctggctgct gaaggctacc ttgtggctgt 1380 cgtggcaggc
ccgtcggtga ccttggaggc ccgggccccc ctggaaaacc tggggctggt 1440
gtggctggcg gtggtggccc tgggggctgt gtgcctggtg ctgctgctgc tggtgctgtc
1500 attgcgccgg cggctgcggg aagagctgga gaaaggggcc aaggctactg
agaggacctt 1560 ggtgtacccc ctggagctgc ccaaggagcc caccagtccc
cccttccggc cctgtcctga 1620 accagatgag aaactttggg atcctgtcgg
ttactactat tcagatggct cccttaagat 1680 agtacctggg catgcccggt
gccagcccgg tggggggccc ccttcgccac ctccaggcat 1740 cccaggccag
cctctgcctt ctccaactcg gcttcacctg gggggtgggc ggaactcaaa 1800
tgccaatggt tacgtgcgct tacaactagg aggggaggac cggggagggc tcgggcaccc
1860 cctgcctgag ctcgcggatg aactgagacg caaactgcag caacgccagc
cactgcccga 1920 ctccaacccc gaggagtcat cagtatgagg ggaaccccca
ccgcgtcggc gggaagcgtg 1980 ggaggtgtag ctcctacttt tgcacaggca
ccagctacct cagggacatg gcacgggcac 2040 ctgctctgtc tgggacagat
actgcccagc acccacccgg ccatgaggac ctgctctgct 2100 cagcacgggc
actgccactt ggtgtggctc accagggcac cagcctcgca gaaggcatct 2160
tcctcctctc tgtgaatcac agacacgcgg gaccccagcc gccaaaactt ttcaaggcag
2220 aagtttcaag atgtgtgttt gtctgtattt gcacatgtgt ttgtgtgtgt
gtgtatgtgt 2280 gtgtgcacgc gcgtgcgcgc ttgtggcata gccttcctgt
ttctgtcaag tcttcccttg 2340 gcctgggtcc tcctggtgag tcattggagc
tatgaagggg aaggggtcgt atcactttgt 2400 ctctcctacc cccactgccc
cgagtgtcgg gcagcgatgt acatatggag gtggggtgga 2460 cagggtgctg
tgccccttca gagggagtgc agggcttggg gtgggcctag tcctgctcct 2520
agggctgtga atgttttcag ggtgggggga gggagatgga gcctcctgtg tgtttggggg
2580 gaagggtggg tggggcctcc cacttggccc cggggttcag tggtatttta
tacttgcctt 2640 cttcctgtac agggctggga aaggctgtgt gaggggagag
aagggagagg gtgggcctgc 2700 tgtggacaat ggcatactct cttccagccc
taggaggagg gctcctaaca gtgtaactta 2760 ttgtgtcccc gcgtatttat
ttgttgtaaa tatttgagat ttttatattg a 2811 34 729 DNA Homo sapiens 34
atggccccac actgggctgt ctggctgctg gcagcaaggc tgtggggcct gggcattggg
60 gctgaggtgt ggtggaacct tgtgccgcgt aagacagtgt cttctgggga
gctggccacg 120 gtagtacggc ggttctccca gaccggcatc caggacttcc
tgacactgac gctgacggag 180 cccactgggc ttctgtacgt gggcgcccga
gaggccctgt ttgccttcag catggaggcc 240 ctggagctgc aaggagcgat
ctcctgggag gcccccgtgg agaagaagac tgagtgtatc 300 cagaaaggga
agaacaacca gaccgagtgc ttcaacttca tccgcttcct gcagccctac 360
aatgcctccc acctgtacgt ctgtggcacc tacgccttcc agcccaagtg cacctacgtc
420 gtgagtgctg ccctcctacc tcggtgtccc cagccccccg ccctcctcac
ccttctctgg 480 actcgtggat gtggcccaca gagccctgcc cttaagcatc
tcctcatcac ctctctctct 540 gtccttagaa catgctcacc ttcactttgg
agcatggaga gtttgaagat gggaagggca 600 agtgtcccta tgacccagct
aagggccatg ctggccttct tgtggatggt gagctgtact 660 cggccacact
caacaacttc ctgggcacgg aacccattat cctgcgtaac atggggcccc 720
accactcca 729 35 243 PRT Homo sapiens 35 Met Ala Pro His Trp Ala
Val Trp Leu Leu Ala Ala Arg Leu Trp Gly 1 5 10 15 Leu Gly Ile Gly
Ala Glu Val Trp Trp Asn Leu Val Pro Arg Lys Thr 20 25 30 Val Ser
Ser Gly Glu Leu Ala Thr Val Val Arg Arg Phe Ser Gln Thr 35 40 45
Gly Ile Gln Asp Phe Leu Thr Leu Thr Leu Thr Glu Pro Thr Gly Leu 50
55 60 Leu Tyr Val Gly Ala Arg Glu Ala Leu Phe Ala Phe Ser Met Glu
Ala 65 70 75 80 Leu Glu Leu Gln Gly Ala Ile Ser Trp Glu Ala Pro Val
Glu Lys Lys 85 90 95 Thr Glu Cys Ile Gln Lys Gly Lys Asn Asn Gln
Thr Glu Cys Phe Asn 100 105 110 Phe Ile Arg Phe Leu Gln Pro Tyr Asn
Ala Ser His Leu Tyr Val Cys 115 120 125 Gly Thr Tyr Ala Phe Gln Pro
Lys Cys Thr Tyr Val Val Ser Ala Ala 130 135 140 Leu Leu Pro Arg Cys
Pro Gln Pro Pro Ala Leu Leu Thr Leu Leu Trp 145 150 155 160 Thr Arg
Gly Cys Gly Pro Gln Ser Pro Ala Leu Lys His Leu Leu Ile 165 170 175
Thr Ser Leu Ser Val Leu Arg Thr Cys Ser Pro Ser Leu Trp Ser Met 180
185 190 Glu Ser Leu Lys Met Gly Arg Ala Ser Val Pro Met Thr Gln Leu
Arg 195 200 205 Ala Met Leu Ala Phe Leu Trp Met Val Ser Cys Thr Arg
Pro His Ser 210 215 220 Thr Thr Ser Trp Ala Arg Asn Pro Leu Ser Cys
Val Thr Trp Gly Pro 225 230 235 240 Thr Thr Pro 36 20 PRT Homo
sapiens 36 Met Ala Pro His Trp Ala Val Trp Leu Leu Ala Ala Arg Leu
Trp Gly 1 5 10 15 Leu Gly Ile Gly 20 37 223 PRT Homo sapiens 37 Ala
Glu Val Trp Trp Asn Leu Val Pro Arg Lys Thr Val Ser Ser Gly 1 5 10
15 Glu Leu Ala Thr Val Val Arg Arg Phe Ser Gln Thr Gly Ile Gln Asp
20 25 30 Phe Leu Thr Leu Thr Leu Thr Glu Pro Thr Gly Leu Leu Tyr
Val Gly 35 40 45 Ala Arg Glu Ala Leu Phe Ala Phe Ser Met Glu Ala
Leu Glu Leu Gln 50 55 60 Gly Ala Ile Ser Trp Glu Ala Pro Val Glu
Lys Lys Thr Glu Cys Ile 65 70 75 80 Gln Lys Gly Lys Asn Asn Gln Thr
Glu Cys Phe Asn Phe Ile Arg Phe 85 90 95 Leu Gln Pro Tyr Asn Ala
Ser His Leu Tyr Val Cys Gly Thr Tyr Ala 100 105 110 Phe Gln Pro Lys
Cys Thr Tyr Val Val Ser Ala Ala Leu Leu Pro Arg 115 120 125 Cys Pro
Gln Pro Pro Ala Leu Leu Thr Leu Leu Trp Thr Arg Gly Cys 130 135 140
Gly Pro Gln Ser Pro Ala Leu Lys His Leu Leu Ile Thr Ser Leu Ser 145
150 155 160 Val Leu Arg Thr Cys Ser Pro Ser Leu Trp Ser Met Glu Ser
Leu Lys 165 170 175 Met Gly Arg Ala Ser Val Pro Met Thr Gln Leu Arg
Ala Met Leu Ala 180 185 190 Phe Leu Trp Met Val Ser Cys Thr Arg Pro
His Ser Thr Thr Ser Trp 195 200 205 Ala Arg Asn Pro Leu Ser Cys Val
Thr Trp Gly Pro Thr Thr Pro 210 215 220 38 2498 DNA Homo sapiens 38
gtcgacccac gcgtccgcgg acgcgtgggc gcgcgggggc catccagacc ctgcggagag
60 cgaggcccgg agcgtcgccg aggtttgagg gcgccggaga ccgagggcct
ggcggccgaa 120 ggaaccgccc caagaagagc ctctggcccg ggggctgctg
gaacatgtgc ggggggacac 180 agtttgtttg acagttgcca gactatgttt
acgcttctgg ttctactcag ccaactgccc 240 acagttaccc tggggtttcc
tcattgcgca agaggtccaa aggcttctaa gcatgcggga 300 gaagaagtgt
ttacatcaaa agaagaagca aactttttca tacatagacg ccttctgtat 360
aatagatttg atctggagct cttcactccc ggcaacctag aaagagagtg caatgaagaa
420 ctttgcaatt atgaggaagc cagagagatt tttgtggatg aagataaaac
gattgcattt 480 tggcaggaat attcagctaa aggaccaacc acaaaatcag
atggcaacag agagaaaata 540 gatgttatgg gccttctgac tggattaatt
gctgctggag tatttttggt tatttttgga 600 ttacttggct actatctttg
tatcactaag tgtaataggc tacaacatcc atgctcttca 660 gccgtctatg
aaagggggag gcacactccc
tccatcattt tcagaagacc tgaggaggct 720 gccttgtctc cattgccgcc
ttctgtggag gatgcaggat taccttctta tgaacaggca 780 gtggcgctga
ccagaaaaca cagtgtttca ccaccaccac catatcctgg gcacacaaaa 840
ggatttaggg tatttaaaaa atctatgtct ctcccatctc actgactacc ttgtcatttt
900 ggtataagaa atttgtgtta tttgataggc cgggcatggt ggctcatgcc
tgtaatccca 960 gcactttggg aggccaggag ttcgagacca gcctggccaa
catggtgaaa cccggtctct 1020 actaaaaatt caaaaattac ctaggcgtca
tggggcatgc ctgtagtccc acctacttgg 1080 gaggctgaag caggagaatt
gctcgaacct gggaggcaga ggttgcagta agctgagatc 1140 acgccactgc
attccagcct gggcgacaga gcaagactcc atctcaaaaa taaaataaaa 1200
aaagaaagaa agaaaagaag aagaaaagag aagaaggaga aggagatgaa ggaggaggag
1260 gaggagaagg agaagaagaa gaagaagaag accacaaaag acatgactat
ccaacttttt 1320 atgacaaact gcaaggaata aaggaagaat aagtccatgt
actgtaccac agaagttctg 1380 tctgcatctt ggacctgaac ttgatcatta
tcagcttgat aagagacttt ttgactctat 1440 atccttgcag ttaagaagaa
agcacttttt tgtaatgttt gttttaatgg ttcaaaaaaa 1500 atctttctta
taaagagcat aggtagaatt agtgaactct ttggatcctt tgtacagata 1560
aaggttatag atttcttgtg ttgaatatta aaaaagcaag gatgtctaac cattaagatt
1620 atccaaagtc aggctgggcg cagtggctca cgcctgtaat cccagcactt
tgggagggat 1680 aggtgggcgg atcacctgag gtcaggagtt tgagaccagc
ctggccaaca tggcaaaacc 1740 ccgtctctac aaaaatacaa aagaaattag
ccagacatga tggcgggtgc ctctaatccc 1800 agctactggg gaggctgagg
tgggagaatc gcttgaactc gggaggtgga ggttgtagtg 1860 aggcgagatt
gtgccattgc actccaacct gggcgacaga gtgagactcc atctcaaaaa 1920
aaaaaaaaaa aaaaagatta tccaaaaaga tattggacct actctttctt aggatttttt
1980 tggcgggggg ttagaaatac ttcacagaat ttgacatttc agtataaatc
tgtgacctta 2040 atataatcac ttggttttat atgttaaatt attgcacagc
agtcatcata ttttgcagag 2100 tttagttctt aactcttgct gtcagtcatg
ttttattata ggtagtgggg tcagtagttt 2160 tcttcttcta aaaaatacta
tttgctatga agttagttct tcagaagata caagtttgca 2220 atgaaaagga
tttgcaaggg ttgttatgct atcaaataaa cagacctaaa atctaggaga 2280
cactagaact taatgaagtt gcccctgtta ctgattagta aatactccca tcttcgttgc
2340 aaaattatct ctctgtataa ctacatatga ttattttgaa atttgttaaa
cttcataagt 2400 aatagtttga gaatgtggaa aaagtaattt gcttttctgc
tcttaaaata atattgatta 2460 atgttaccag aaaaaaaaaa aaaaaaaagg
gcggccgc 2498 39 678 DNA Homo sapiens 39 atgtttacgc ttctggttct
actcagccaa ctgcccacag ttaccctggg gtttcctcat 60 tgcgcaagag
gtccaaaggc ttctaagcat gcgggagaag aagtgtttac atcaaaagaa 120
gaagcaaact ttttcataca tagacgcctt ctgtataata gatttgatct ggagctcttc
180 actcccggca acctagaaag agagtgcaat gaagaacttt gcaattatga
ggaagccaga 240 gagatttttg tggatgaaga taaaacgatt gcattttggc
aggaatattc agctaaagga 300 ccaaccacaa aatcagatgg caacagagag
aaaatagatg ttatgggcct tctgactgga 360 ttaattgctg ctggagtatt
tttggttatt tttggattac ttggctacta tctttgtatc 420 actaagtgta
ataggctaca acatccatgc tcttcagccg tctatgaaag ggggaggcac 480
actccctcca tcattttcag aagacctgag gaggctgcct tgtctccatt gccgccttct
540 gtggaggatg caggattacc ttcttatgaa caggcagtgg cgctgaccag
aaaacacagt 600 gtttcaccac caccaccata tcctgggcac acaaaaggat
ttagggtatt taaaaaatct 660 atgtctctcc catctcac 678 40 226 PRT Homo
sapiens 40 Met Phe Thr Leu Leu Val Leu Leu Ser Gln Leu Pro Thr Val
Thr Leu 1 5 10 15 Gly Phe Pro His Cys Ala Arg Gly Pro Lys Ala Ser
Lys His Ala Gly 20 25 30 Glu Glu Val Phe Thr Ser Lys Glu Glu Ala
Asn Phe Phe Ile His Arg 35 40 45 Arg Leu Leu Tyr Asn Arg Phe Asp
Leu Glu Leu Phe Thr Pro Gly Asn 50 55 60 Leu Glu Arg Glu Cys Asn
Glu Glu Leu Cys Asn Tyr Glu Glu Ala Arg 65 70 75 80 Glu Ile Phe Val
Asp Glu Asp Lys Thr Ile Ala Phe Trp Gln Glu Tyr 85 90 95 Ser Ala
Lys Gly Pro Thr Thr Lys Ser Asp Gly Asn Arg Glu Lys Ile 100 105 110
Asp Val Met Gly Leu Leu Thr Gly Leu Ile Ala Ala Gly Val Phe Leu 115
120 125 Val Ile Phe Gly Leu Leu Gly Tyr Tyr Leu Cys Ile Thr Lys Cys
Asn 130 135 140 Arg Leu Gln His Pro Cys Ser Ser Ala Val Tyr Glu Arg
Gly Arg His 145 150 155 160 Thr Pro Ser Ile Ile Phe Arg Arg Pro Glu
Glu Ala Ala Leu Ser Pro 165 170 175 Leu Pro Pro Ser Val Glu Asp Ala
Gly Leu Pro Ser Tyr Glu Gln Ala 180 185 190 Val Ala Leu Thr Arg Lys
His Ser Val Ser Pro Pro Pro Pro Tyr Pro 195 200 205 Gly His Thr Lys
Gly Phe Arg Val Phe Lys Lys Ser Met Ser Leu Pro 210 215 220 Ser His
225 41 17 PRT Homo sapiens 41 Met Phe Thr Leu Leu Val Leu Leu Ser
Gln Leu Pro Thr Val Thr Leu 1 5 10 15 Gly 42 209 PRT Homo sapiens
42 Phe Pro His Cys Ala Arg Gly Pro Lys Ala Ser Lys His Ala Gly Glu
1 5 10 15 Glu Val Phe Thr Ser Lys Glu Glu Ala Asn Phe Phe Ile His
Arg Arg 20 25 30 Leu Leu Tyr Asn Arg Phe Asp Leu Glu Leu Phe Thr
Pro Gly Asn Leu 35 40 45 Glu Arg Glu Cys Asn Glu Glu Leu Cys Asn
Tyr Glu Glu Ala Arg Glu 50 55 60 Ile Phe Val Asp Glu Asp Lys Thr
Ile Ala Phe Trp Gln Glu Tyr Ser 65 70 75 80 Ala Lys Gly Pro Thr Thr
Lys Ser Asp Gly Asn Arg Glu Lys Ile Asp 85 90 95 Val Met Gly Leu
Leu Thr Gly Leu Ile Ala Ala Gly Val Phe Leu Val 100 105 110 Ile Phe
Gly Leu Leu Gly Tyr Tyr Leu Cys Ile Thr Lys Cys Asn Arg 115 120 125
Leu Gln His Pro Cys Ser Ser Ala Val Tyr Glu Arg Gly Arg His Thr 130
135 140 Pro Ser Ile Ile Phe Arg Arg Pro Glu Glu Ala Ala Leu Ser Pro
Leu 145 150 155 160 Pro Pro Ser Val Glu Asp Ala Gly Leu Pro Ser Tyr
Glu Gln Ala Val 165 170 175 Ala Leu Thr Arg Lys His Ser Val Ser Pro
Pro Pro Pro Tyr Pro Gly 180 185 190 His Thr Lys Gly Phe Arg Val Phe
Lys Lys Ser Met Ser Leu Pro Ser 195 200 205 His 43 96 PRT Homo
sapiens 43 Phe Pro His Cys Ala Arg Gly Pro Lys Ala Ser Lys His Ala
Gly Glu 1 5 10 15 Glu Val Phe Thr Ser Lys Glu Glu Ala Asn Phe Phe
Ile His Arg Arg 20 25 30 Leu Leu Tyr Asn Arg Phe Asp Leu Glu Leu
Phe Thr Pro Gly Asn Leu 35 40 45 Glu Arg Glu Cys Asn Glu Glu Leu
Cys Asn Tyr Glu Glu Ala Arg Glu 50 55 60 Ile Phe Val Asp Glu Asp
Lys Thr Ile Ala Phe Trp Gln Glu Tyr Ser 65 70 75 80 Ala Lys Gly Pro
Thr Thr Lys Ser Asp Gly Asn Arg Glu Lys Ile Asp 85 90 95 44 25 PRT
Homo sapiens 44 Val Met Gly Leu Leu Thr Gly Leu Ile Ala Ala Gly Val
Phe Leu Val 1 5 10 15 Ile Phe Gly Leu Leu Gly Tyr Tyr Leu 20 25 45
88 PRT Homo sapiens 45 Cys Ile Thr Lys Cys Asn Arg Leu Gln His Pro
Cys Ser Ser Ala Val 1 5 10 15 Tyr Glu Arg Gly Arg His Thr Pro Ser
Ile Ile Phe Arg Arg Pro Glu 20 25 30 Glu Ala Ala Leu Ser Pro Leu
Pro Pro Ser Val Glu Asp Ala Gly Leu 35 40 45 Pro Ser Tyr Glu Gln
Ala Val Ala Leu Thr Arg Lys His Ser Val Ser 50 55 60 Pro Pro Pro
Pro Tyr Pro Gly His Thr Lys Gly Phe Arg Val Phe Lys 65 70 75 80 Lys
Ser Met Ser Leu Pro Ser His 85 46 2169 DNA Homo sapiens 46
gtcgacccac gcgtccggaa atgtcgttct tcagatttaa aaagaaaacc tttactgaat
60 cagctgagtg ttaataatac gaatttcctt ttcttgccaa ttctgatctg
aacagaaaat 120 ccaagaacag ggatatgtgt ggattacagt tttctctgcc
ttgcctacga ctgtttctgg 180 ttgttacctg ttatctttta ttattactcc
acaaagaaat acttggatgt tcgtctgttt 240 gtcagctctg cactgggaga
caaattaact gccgtaactt aggcctttcg agtattccta 300 agaattttcc
tgaaagtaca gtttttctgt atctgactgg gaataatata tcttatataa 360
atgaaagtga attaacagga cttcattctc ttgtagcatt gtatttggat aattctaaca
420 ttctgtatgt atatccaaaa gcctttgttc aattgaggca tctatatttt
ctatttctaa 480 ataataattt catcaaacgc ttagatcctg gaatatttaa
gggactttta aatcttcgta 540 atttatattt acagtataat caggtatctt
ttgttccgag aggagtattt aatgatctag 600 tttcagttca gtacttaaat
ctacaaagga atcgcctcac tgtccttggg agtggtacct 660 ttgttggtat
ggttgctctt cggatacttg atttatcaaa caataacatt ttgaggatat 720
cagaatcagg ctttcaacat cttgaaaacc ttgcttgttt gtatttagga agtaataatt
780 taacaaaagt accatcaaat gcctttgaag tacttaaaag tcttagaaga
ctttctttgt 840 ctcataatcc tattgaagca atacagccct ttgcatttaa
aggacttgcc aatctggaat 900 acctcctcct gaaaaattca agaattagga
atgttactag ggatgggttt agtggaatta 960 ataatcttaa acatttgatc
ttaagtcata atgatttaga gaatttaaat tctgacacat 1020 tcagtttgtt
aaagaattta atttacctta agttagatag aaacagaata attagcattg 1080
ataatgatac atttgaaaat atgggagcat ctttgaagat ccttaatctg tcatttaata
1140 atcttacagc cttgcatcca agggtcctta agccgttgtc ttcattgatt
catcttcagg 1200 caaattctaa tccttgggaa tgtaactgca aacttttggg
ccttcgagac tggctagcat 1260 cttcagccat tactctaaac atctattgtc
agaatccccc atccatgcgt ggcagagcat 1320 tacgttatat taacattaca
aattgtgtta catcttcaat aaatgtatcc agagcttggg 1380 ctgttgtaaa
atctcctcat attcatcaca agactactgc gctaatgatg gcctggcata 1440
aagtaaccac aaatggcagt cctctggaaa atactgagac tgagaacatt actttctggg
1500 aacgaattcc tacttcacct gctggtagat tttttcaaga gaatgccttt
ggtaatccat 1560 tagagactac agcagtgtta cctgtgcaaa tacaacttac
tacttctgtt accttgaact 1620 tggaaaaaaa cagtgctcta ccgaatgatg
ctgcttcaat gtcagggaaa acatctctaa 1680 tttgtacaca agaagttgag
aagttgaatg aggcttttga cattttgcta gcttttttca 1740 tcttagcttg
tgttttaatc atttttttga tctacaaagt tgttcagttt aaacaaaaac 1800
taaaggcatc agaaaactca agggaaaata gacttgaata ctacagcttt tatcagtcag
1860 caaggtataa tgtaactgcc tcaatttgta acacttcccc aaattctcta
gaaagtcctg 1920 gcttggagca gattcgactt cataaacaaa ttgttcctga
aaatgaggca caggtcattc 1980 tttttgaaca ttctgcttta taactcaact
aaatattgtc tataagaaac ttcagtgcca 2040 tggacatgat ttaaactgaa
acctccttat ataattatat actttagttg gaaatataat 2100 gaattatatg
aggttagcat tattaaaata tgtttttaat aaaaaaaaaa aaaaaaaaag 2160
ggcggccgc 2169 47 1866 DNA Homo sapiens 47 atgtgtggat tacagttttc
tctgccttgc ctacgactgt ttctggttgt tacctgttat 60 cttttattat
tactccacaa agaaatactt ggatgttcgt ctgtttgtca gctctgcact 120
gggagacaaa ttaactgccg taacttaggc ctttcgagta ttcctaagaa ttttcctgaa
180 agtacagttt ttctgtatct gactgggaat aatatatctt atataaatga
aagtgaatta 240 acaggacttc attctcttgt agcattgtat ttggataatt
ctaacattct gtatgtatat 300 ccaaaagcct ttgttcaatt gaggcatcta
tattttctat ttctaaataa taatttcatc 360 aaacgcttag atcctggaat
atttaaggga cttttaaatc ttcgtaattt atatttacag 420 tataatcagg
tatcttttgt tccgagagga gtatttaatg atctagtttc agttcagtac 480
ttaaatctac aaaggaatcg cctcactgtc cttgggagtg gtacctttgt tggtatggtt
540 gctcttcgga tacttgattt atcaaacaat aacattttga ggatatcaga
atcaggcttt 600 caacatcttg aaaaccttgc ttgtttgtat ttaggaagta
ataatttaac aaaagtacca 660 tcaaatgcct ttgaagtact taaaagtctt
agaagacttt ctttgtctca taatcctatt 720 gaagcaatac agccctttgc
atttaaagga cttgccaatc tggaatacct cctcctgaaa 780 aattcaagaa
ttaggaatgt tactagggat gggtttagtg gaattaataa tcttaaacat 840
ttgatcttaa gtcataatga tttagagaat ttaaattctg acacattcag tttgttaaag
900 aatttaattt accttaagtt agatagaaac agaataatta gcattgataa
tgatacattt 960 gaaaatatgg gagcatcttt gaagatcctt aatctgtcat
ttaataatct tacagccttg 1020 catccaaggg tccttaagcc gttgtcttca
ttgattcatc ttcaggcaaa ttctaatcct 1080 tgggaatgta actgcaaact
tttgggcctt cgagactggc tagcatcttc agccattact 1140 ctaaacatct
attgtcagaa tcccccatcc atgcgtggca gagcattacg ttatattaac 1200
attacaaatt gtgttacatc ttcaataaat gtatccagag cttgggctgt tgtaaaatct
1260 cctcatattc atcacaagac tactgcgcta atgatggcct ggcataaagt
aaccacaaat 1320 ggcagtcctc tggaaaatac tgagactgag aacattactt
tctgggaacg aattcctact 1380 tcacctgctg gtagattttt tcaagagaat
gcctttggta atccattaga gactacagca 1440 gtgttacctg tgcaaataca
acttactact tctgttacct tgaacttgga aaaaaacagt 1500 gctctaccga
atgatgctgc ttcaatgtca gggaaaacat ctctaatttg tacacaagaa 1560
gttgagaagt tgaatgaggc ttttgacatt ttgctagctt ttttcatctt agcttgtgtt
1620 ttaatcattt ttttgatcta caaagttgtt cagtttaaac aaaaactaaa
ggcatcagaa 1680 aactcaaggg aaaatagact tgaatactac agcttttatc
agtcagcaag gtataatgta 1740 actgcctcaa tttgtaacac ttccccaaat
tctctagaaa gtcctggctt ggagcagatt 1800 cgacttcata aacaaattgt
tcctgaaaat gaggcacagg tcattctttt tgaacattct 1860 gcttta 1866 48 622
PRT Homo sapiens 48 Met Cys Gly Leu Gln Phe Ser Leu Pro Cys Leu Arg
Leu Phe Leu Val 1 5 10 15 Val Thr Cys Tyr Leu Leu Leu Leu Leu His
Lys Glu Ile Leu Gly Cys 20 25 30 Ser Ser Val Cys Gln Leu Cys Thr
Gly Arg Gln Ile Asn Cys Arg Asn 35 40 45 Leu Gly Leu Ser Ser Ile
Pro Lys Asn Phe Pro Glu Ser Thr Val Phe 50 55 60 Leu Tyr Leu Thr
Gly Asn Asn Ile Ser Tyr Ile Asn Glu Ser Glu Leu 65 70 75 80 Thr Gly
Leu His Ser Leu Val Ala Leu Tyr Leu Asp Asn Ser Asn Ile 85 90 95
Leu Tyr Val Tyr Pro Lys Ala Phe Val Gln Leu Arg His Leu Tyr Phe 100
105 110 Leu Phe Leu Asn Asn Asn Phe Ile Lys Arg Leu Asp Pro Gly Ile
Phe 115 120 125 Lys Gly Leu Leu Asn Leu Arg Asn Leu Tyr Leu Gln Tyr
Asn Gln Val 130 135 140 Ser Phe Val Pro Arg Gly Val Phe Asn Asp Leu
Val Ser Val Gln Tyr 145 150 155 160 Leu Asn Leu Gln Arg Asn Arg Leu
Thr Val Leu Gly Ser Gly Thr Phe 165 170 175 Val Gly Met Val Ala Leu
Arg Ile Leu Asp Leu Ser Asn Asn Asn Ile 180 185 190 Leu Arg Ile Ser
Glu Ser Gly Phe Gln His Leu Glu Asn Leu Ala Cys 195 200 205 Leu Tyr
Leu Gly Ser Asn Asn Leu Thr Lys Val Pro Ser Asn Ala Phe 210 215 220
Glu Val Leu Lys Ser Leu Arg Arg Leu Ser Leu Ser His Asn Pro Ile 225
230 235 240 Glu Ala Ile Gln Pro Phe Ala Phe Lys Gly Leu Ala Asn Leu
Glu Tyr 245 250 255 Leu Leu Leu Lys Asn Ser Arg Ile Arg Asn Val Thr
Arg Asp Gly Phe 260 265 270 Ser Gly Ile Asn Asn Leu Lys His Leu Ile
Leu Ser His Asn Asp Leu 275 280 285 Glu Asn Leu Asn Ser Asp Thr Phe
Ser Leu Leu Lys Asn Leu Ile Tyr 290 295 300 Leu Lys Leu Asp Arg Asn
Arg Ile Ile Ser Ile Asp Asn Asp Thr Phe 305 310 315 320 Glu Asn Met
Gly Ala Ser Leu Lys Ile Leu Asn Leu Ser Phe Asn Asn 325 330 335 Leu
Thr Ala Leu His Pro Arg Val Leu Lys Pro Leu Ser Ser Leu Ile 340 345
350 His Leu Gln Ala Asn Ser Asn Pro Trp Glu Cys Asn Cys Lys Leu Leu
355 360 365 Gly Leu Arg Asp Trp Leu Ala Ser Ser Ala Ile Thr Leu Asn
Ile Tyr 370 375 380 Cys Gln Asn Pro Pro Ser Met Arg Gly Arg Ala Leu
Arg Tyr Ile Asn 385 390 395 400 Ile Thr Asn Cys Val Thr Ser Ser Ile
Asn Val Ser Arg Ala Trp Ala 405 410 415 Val Val Lys Ser Pro His Ile
His His Lys Thr Thr Ala Leu Met Met 420 425 430 Ala Trp His Lys Val
Thr Thr Asn Gly Ser Pro Leu Glu Asn Thr Glu 435 440 445 Thr Glu Asn
Ile Thr Phe Trp Glu Arg Ile Pro Thr Ser Pro Ala Gly 450 455 460 Arg
Phe Phe Gln Glu Asn Ala Phe Gly Asn Pro Leu Glu Thr Thr Ala 465 470
475 480 Val Leu Pro Val Gln Ile Gln Leu Thr Thr Ser Val Thr Leu Asn
Leu 485 490 495 Glu Lys Asn Ser Ala Leu Pro Asn Asp Ala Ala Ser Met
Ser Gly Lys 500 505 510 Thr Ser Leu Ile Cys Thr Gln Glu Val Glu Lys
Leu Asn Glu Ala Phe 515 520 525 Asp Ile Leu Leu Ala Phe Phe Ile Leu
Ala Cys Val Leu Ile Ile Phe 530 535 540 Leu Ile Tyr Lys Val Val Gln
Phe Lys Gln Lys Leu Lys Ala Ser Glu 545 550 555 560 Asn Ser Arg Glu
Asn Arg Leu Glu Tyr Tyr Ser Phe Tyr Gln Ser Ala 565 570 575 Arg Tyr
Asn Val Thr Ala Ser Ile Cys Asn Thr Ser Pro Asn Ser Leu 580 585 590
Glu Ser Pro Gly Leu Glu Gln Ile Arg Leu His Lys Gln Ile Val Pro 595
600 605 Glu Asn Glu Ala Gln Val Ile Leu Phe Glu His Ser Ala Leu 610
615 620 49 31 PRT Homo sapiens 49 Met Cys Gly Leu Gln Phe Ser Leu
Pro Cys Leu Arg Leu Phe Leu Val 1 5 10 15 Val Thr Cys Tyr Leu Leu
Leu Leu Leu His Lys Glu Ile Leu Gly 20 25 30 50 591 PRT Homo
sapiens 50 Cys Ser Ser Val Cys Gln Leu Cys Thr Gly
Arg Gln Ile Asn Cys Arg 1 5 10 15 Asn Leu Gly Leu Ser Ser Ile Pro
Lys Asn Phe Pro Glu Ser Thr Val 20 25 30 Phe Leu Tyr Leu Thr Gly
Asn Asn Ile Ser Tyr Ile Asn Glu Ser Glu 35 40 45 Leu Thr Gly Leu
His Ser Leu Val Ala Leu Tyr Leu Asp Asn Ser Asn 50 55 60 Ile Leu
Tyr Val Tyr Pro Lys Ala Phe Val Gln Leu Arg His Leu Tyr 65 70 75 80
Phe Leu Phe Leu Asn Asn Asn Phe Ile Lys Arg Leu Asp Pro Gly Ile 85
90 95 Phe Lys Gly Leu Leu Asn Leu Arg Asn Leu Tyr Leu Gln Tyr Asn
Gln 100 105 110 Val Ser Phe Val Pro Arg Gly Val Phe Asn Asp Leu Val
Ser Val Gln 115 120 125 Tyr Leu Asn Leu Gln Arg Asn Arg Leu Thr Val
Leu Gly Ser Gly Thr 130 135 140 Phe Val Gly Met Val Ala Leu Arg Ile
Leu Asp Leu Ser Asn Asn Asn 145 150 155 160 Ile Leu Arg Ile Ser Glu
Ser Gly Phe Gln His Leu Glu Asn Leu Ala 165 170 175 Cys Leu Tyr Leu
Gly Ser Asn Asn Leu Thr Lys Val Pro Ser Asn Ala 180 185 190 Phe Glu
Val Leu Lys Ser Leu Arg Arg Leu Ser Leu Ser His Asn Pro 195 200 205
Ile Glu Ala Ile Gln Pro Phe Ala Phe Lys Gly Leu Ala Asn Leu Glu 210
215 220 Tyr Leu Leu Leu Lys Asn Ser Arg Ile Arg Asn Val Thr Arg Asp
Gly 225 230 235 240 Phe Ser Gly Ile Asn Asn Leu Lys His Leu Ile Leu
Ser His Asn Asp 245 250 255 Leu Glu Asn Leu Asn Ser Asp Thr Phe Ser
Leu Leu Lys Asn Leu Ile 260 265 270 Tyr Leu Lys Leu Asp Arg Asn Arg
Ile Ile Ser Ile Asp Asn Asp Thr 275 280 285 Phe Glu Asn Met Gly Ala
Ser Leu Lys Ile Leu Asn Leu Ser Phe Asn 290 295 300 Asn Leu Thr Ala
Leu His Pro Arg Val Leu Lys Pro Leu Ser Ser Leu 305 310 315 320 Ile
His Leu Gln Ala Asn Ser Asn Pro Trp Glu Cys Asn Cys Lys Leu 325 330
335 Leu Gly Leu Arg Asp Trp Leu Ala Ser Ser Ala Ile Thr Leu Asn Ile
340 345 350 Tyr Cys Gln Asn Pro Pro Ser Met Arg Gly Arg Ala Leu Arg
Tyr Ile 355 360 365 Asn Ile Thr Asn Cys Val Thr Ser Ser Ile Asn Val
Ser Arg Ala Trp 370 375 380 Ala Val Val Lys Ser Pro His Ile His His
Lys Thr Thr Ala Leu Met 385 390 395 400 Met Ala Trp His Lys Val Thr
Thr Asn Gly Ser Pro Leu Glu Asn Thr 405 410 415 Glu Thr Glu Asn Ile
Thr Phe Trp Glu Arg Ile Pro Thr Ser Pro Ala 420 425 430 Gly Arg Phe
Phe Gln Glu Asn Ala Phe Gly Asn Pro Leu Glu Thr Thr 435 440 445 Ala
Val Leu Pro Val Gln Ile Gln Leu Thr Thr Ser Val Thr Leu Asn 450 455
460 Leu Glu Lys Asn Ser Ala Leu Pro Asn Asp Ala Ala Ser Met Ser Gly
465 470 475 480 Lys Thr Ser Leu Ile Cys Thr Gln Glu Val Glu Lys Leu
Asn Glu Ala 485 490 495 Phe Asp Ile Leu Leu Ala Phe Phe Ile Leu Ala
Cys Val Leu Ile Ile 500 505 510 Phe Leu Ile Tyr Lys Val Val Gln Phe
Lys Gln Lys Leu Lys Ala Ser 515 520 525 Glu Asn Ser Arg Glu Asn Arg
Leu Glu Tyr Tyr Ser Phe Tyr Gln Ser 530 535 540 Ala Arg Tyr Asn Val
Thr Ala Ser Ile Cys Asn Thr Ser Pro Asn Ser 545 550 555 560 Leu Glu
Ser Pro Gly Leu Glu Gln Ile Arg Leu His Lys Gln Ile Val 565 570 575
Pro Glu Asn Glu Ala Gln Val Ile Leu Phe Glu His Ser Ala Leu 580 585
590 51 498 PRT Homo sapiens 51 Cys Ser Ser Val Cys Gln Leu Cys Thr
Gly Arg Gln Ile Asn Cys Arg 1 5 10 15 Asn Leu Gly Leu Ser Ser Ile
Pro Lys Asn Phe Pro Glu Ser Thr Val 20 25 30 Phe Leu Tyr Leu Thr
Gly Asn Asn Ile Ser Tyr Ile Asn Glu Ser Glu 35 40 45 Leu Thr Gly
Leu His Ser Leu Val Ala Leu Tyr Leu Asp Asn Ser Asn 50 55 60 Ile
Leu Tyr Val Tyr Pro Lys Ala Phe Val Gln Leu Arg His Leu Tyr 65 70
75 80 Phe Leu Phe Leu Asn Asn Asn Phe Ile Lys Arg Leu Asp Pro Gly
Ile 85 90 95 Phe Lys Gly Leu Leu Asn Leu Arg Asn Leu Tyr Leu Gln
Tyr Asn Gln 100 105 110 Val Ser Phe Val Pro Arg Gly Val Phe Asn Asp
Leu Val Ser Val Gln 115 120 125 Tyr Leu Asn Leu Gln Arg Asn Arg Leu
Thr Val Leu Gly Ser Gly Thr 130 135 140 Phe Val Gly Met Val Ala Leu
Arg Ile Leu Asp Leu Ser Asn Asn Asn 145 150 155 160 Ile Leu Arg Ile
Ser Glu Ser Gly Phe Gln His Leu Glu Asn Leu Ala 165 170 175 Cys Leu
Tyr Leu Gly Ser Asn Asn Leu Thr Lys Val Pro Ser Asn Ala 180 185 190
Phe Glu Val Leu Lys Ser Leu Arg Arg Leu Ser Leu Ser His Asn Pro 195
200 205 Ile Glu Ala Ile Gln Pro Phe Ala Phe Lys Gly Leu Ala Asn Leu
Glu 210 215 220 Tyr Leu Leu Leu Lys Asn Ser Arg Ile Arg Asn Val Thr
Arg Asp Gly 225 230 235 240 Phe Ser Gly Ile Asn Asn Leu Lys His Leu
Ile Leu Ser His Asn Asp 245 250 255 Leu Glu Asn Leu Asn Ser Asp Thr
Phe Ser Leu Leu Lys Asn Leu Ile 260 265 270 Tyr Leu Lys Leu Asp Arg
Asn Arg Ile Ile Ser Ile Asp Asn Asp Thr 275 280 285 Phe Glu Asn Met
Gly Ala Ser Leu Lys Ile Leu Asn Leu Ser Phe Asn 290 295 300 Asn Leu
Thr Ala Leu His Pro Arg Val Leu Lys Pro Leu Ser Ser Leu 305 310 315
320 Ile His Leu Gln Ala Asn Ser Asn Pro Trp Glu Cys Asn Cys Lys Leu
325 330 335 Leu Gly Leu Arg Asp Trp Leu Ala Ser Ser Ala Ile Thr Leu
Asn Ile 340 345 350 Tyr Cys Gln Asn Pro Pro Ser Met Arg Gly Arg Ala
Leu Arg Tyr Ile 355 360 365 Asn Ile Thr Asn Cys Val Thr Ser Ser Ile
Asn Val Ser Arg Ala Trp 370 375 380 Ala Val Val Lys Ser Pro His Ile
His His Lys Thr Thr Ala Leu Met 385 390 395 400 Met Ala Trp His Lys
Val Thr Thr Asn Gly Ser Pro Leu Glu Asn Thr 405 410 415 Glu Thr Glu
Asn Ile Thr Phe Trp Glu Arg Ile Pro Thr Ser Pro Ala 420 425 430 Gly
Arg Phe Phe Gln Glu Asn Ala Phe Gly Asn Pro Leu Glu Thr Thr 435 440
445 Ala Val Leu Pro Val Gln Ile Gln Leu Thr Thr Ser Val Thr Leu Asn
450 455 460 Leu Glu Lys Asn Ser Ala Leu Pro Asn Asp Ala Ala Ser Met
Ser Gly 465 470 475 480 Lys Thr Ser Leu Ile Cys Thr Gln Glu Val Glu
Lys Leu Asn Glu Ala 485 490 495 Phe Asp 52 18 PRT Homo sapiens 52
Ile Leu Leu Ala Phe Phe Ile Leu Ala Cys Val Leu Ile Ile Phe Leu 1 5
10 15 Ile Tyr 53 75 PRT Homo sapiens 53 Lys Val Val Gln Phe Lys Gln
Lys Leu Lys Ala Ser Glu Asn Ser Arg 1 5 10 15 Glu Asn Arg Leu Glu
Tyr Tyr Ser Phe Tyr Gln Ser Ala Arg Tyr Asn 20 25 30 Val Thr Ala
Ser Ile Cys Asn Thr Ser Pro Asn Ser Leu Glu Ser Pro 35 40 45 Gly
Leu Glu Gln Ile Arg Leu His Lys Gln Ile Val Pro Glu Asn Glu 50 55
60 Ala Gln Val Ile Leu Phe Glu His Ser Ala Leu 65 70 75 54 1432 DNA
Homo sapiens misc_feature (14)..(14) unknown 54 acgcgtccgc
acanggccgg cgcggctggg agcgggtggg cggccgggag gccggagcag 60
cacggccgca ggacctggag ctccggctgc gtcttcccgc agcgctaccc gccatgcgcc
120 tgccgcgccg ggccgcgctg gggctcctgc cgcttctgct gctgctgccg
cccgcgccgg 180 aggccgccaa gaagccgacg ccctgccacc ggtgccgggg
gctggtggac aagtttaacc 240 aggggatggt ggacaccgca aagaagaact
ttggcggcgg gaacacggct tgggaggaaa 300 agacgctgtc caagtacgag
tccagcgaga ttcgcctgct ggagatcctg gaggggctgt 360 gcgagagcag
cgacttcgaa tgcaatcaga tgctagaggc gcaggaggag cacctggagg 420
cctggtggct gcagctgaag agcgaatatc ctgacttatt cgagtggttt tgtgtgaaga
480 cactgaaagt gtgctgctct ccaggaacct acggtcccga ctgtctcgca
tgccagggcg 540 gatcccagag gccctgcagc gggaatggcc actgcagcgg
agatgggagc agacagggcg 600 acgggtcctg ccggtgccac atggggtacc
agggcccgct gtgcactgac tgcatggacg 660 gctacttcag ctcgctccgg
aacgagaccc acagcatctg cacagcctgt gacgagtcct 720 gcaagacgtg
ctcgggcctg accaacagag actgcggcga gtgtgaagtg ggctgggtgc 780
tggacgaggg cgcctgtgtg gatgtggacg agtgtgcggc cgagccgcct ccctgcagcg
840 ctgcgcagtt ctgtaagaac gccaacggct cctacacgtg cgaagagtgt
gactccagct 900 gtgtgggctg cacaggggaa ggcccaggaa actgtaaaga
gtgtatctct ggctacgcga 960 gggagcacgg acagtgtgca gatgtggacg
agtgctcact agcagaaaaa acctgtgtga 1020 ggaaaaacga aaactgctac
aatactccag ggagctacgt ctgtgtgtgt cctgacggct 1080 tcgaagaaac
ggaagatgcc tgtgtgccgc cggcagaggc tgaagccaca gaaggagaaa 1140
gcccgacaca gctgccctcc cgcgaagacc tgtaatgtgc cggacttacc ctttaaatta
1200 ttcagaagga tgtcccgtgg aaaatgtggc cctgaggatg ccgtctcctg
cagtggacag 1260 cggcggggag aggctgcctg ctctctaacg gttgattctc
atttgtccct taaacagctg 1320 catttcttgg ttgttcttaa acagacttgt
atattttgat acagttcttt gtaataaaat 1380 tgaccattgt aggtaatcaa
aaaaaaaaaa aaaaaaaggg cggccgctag ac 1432 55 1059 DNA Homo sapiens
55 atgcgcctgc cgcgccgggc cgcgctgggg ctcctgccgc ttctgctgct
gctgccgccc 60 gcgccggagg ccgccaagaa gccgacgccc tgccaccggt
gccgggggct ggtggacaag 120 tttaaccagg ggatggtgga caccgcaaag
aagaactttg gcggcgggaa cacggcttgg 180 gaggaaaaga cgctgtccaa
gtacgagtcc agcgagattc gcctgctgga gatcctggag 240 gggctgtgcg
agagcagcga cttcgaatgc aatcagatgc tagaggcgca ggaggagcac 300
ctggaggcct ggtggctgca gctgaagagc gaatatcctg acttattcga gtggttttgt
360 gtgaagacac tgaaagtgtg ctgctctcca ggaacctacg gtcccgactg
tctcgcatgc 420 cagggcggat cccagaggcc ctgcagcggg aatggccact
gcagcggaga tgggagcaga 480 cagggcgacg ggtcctgccg gtgccacatg
gggtaccagg gcccgctgtg cactgactgc 540 atggacggct acttcagctc
gctccggaac gagacccaca gcatctgcac agcctgtgac 600 gagtcctgca
agacgtgctc gggcctgacc aacagagact gcggcgagtg tgaagtgggc 660
tgggtgctgg acgagggcgc ctgtgtggat gtggacgagt gtgcggccga gccgcctccc
720 tgcagcgctg cgcagttctg taagaacgcc aacggctcct acacgtgcga
agagtgtgac 780 tccagctgtg tgggctgcac aggggaaggc ccaggaaact
gtaaagagtg tatctctggc 840 tacgcgaggg agcacggaca gtgtgcagat
gtggacgagt gctcactagc agaaaaaacc 900 tgtgtgagga aaaacgaaaa
ctgctacaat actccaggga gctacgtctg tgtgtgtcct 960 gacggcttcg
aagaaacgga agatgcctgt gtgccgccgg cagaggctga agccacagaa 1020
ggagaaagcc cgacacagct gccctcccgc gaagacctg 1059 56 353 PRT Homo
sapiens 56 Met Arg Leu Pro Arg Arg Ala Ala Leu Gly Leu Leu Pro Leu
Leu Leu 1 5 10 15 Leu Leu Pro Pro Ala Pro Glu Ala Ala Lys Lys Pro
Thr Pro Cys His 20 25 30 Arg Cys Arg Gly Leu Val Asp Lys Phe Asn
Gln Gly Met Val Asp Thr 35 40 45 Ala Lys Lys Asn Phe Gly Gly Gly
Asn Thr Ala Trp Glu Glu Lys Thr 50 55 60 Leu Ser Lys Tyr Glu Ser
Ser Glu Ile Arg Leu Leu Glu Ile Leu Glu 65 70 75 80 Gly Leu Cys Glu
Ser Ser Asp Phe Glu Cys Asn Gln Met Leu Glu Ala 85 90 95 Gln Glu
Glu His Leu Glu Ala Trp Trp Leu Gln Leu Lys Ser Glu Tyr 100 105 110
Pro Asp Leu Phe Glu Trp Phe Cys Val Lys Thr Leu Lys Val Cys Cys 115
120 125 Ser Pro Gly Thr Tyr Gly Pro Asp Cys Leu Ala Cys Gln Gly Gly
Ser 130 135 140 Gln Arg Pro Cys Ser Gly Asn Gly His Cys Ser Gly Asp
Gly Ser Arg 145 150 155 160 Gln Gly Asp Gly Ser Cys Arg Cys His Met
Gly Tyr Gln Gly Pro Leu 165 170 175 Cys Thr Asp Cys Met Asp Gly Tyr
Phe Ser Ser Leu Arg Asn Glu Thr 180 185 190 His Ser Ile Cys Thr Ala
Cys Asp Glu Ser Cys Lys Thr Cys Ser Gly 195 200 205 Leu Thr Asn Arg
Asp Cys Gly Glu Cys Glu Val Gly Trp Val Leu Asp 210 215 220 Glu Gly
Ala Cys Val Asp Val Asp Glu Cys Ala Ala Glu Pro Pro Pro 225 230 235
240 Cys Ser Ala Ala Gln Phe Cys Lys Asn Ala Asn Gly Ser Tyr Thr Cys
245 250 255 Glu Glu Cys Asp Ser Ser Cys Val Gly Cys Thr Gly Glu Gly
Pro Gly 260 265 270 Asn Cys Lys Glu Cys Ile Ser Gly Tyr Ala Arg Glu
His Gly Gln Cys 275 280 285 Ala Asp Val Asp Glu Cys Ser Leu Ala Glu
Lys Thr Cys Val Arg Lys 290 295 300 Asn Glu Asn Cys Tyr Asn Thr Pro
Gly Ser Tyr Val Cys Val Cys Pro 305 310 315 320 Asp Gly Phe Glu Glu
Thr Glu Asp Ala Cys Val Pro Pro Ala Glu Ala 325 330 335 Glu Ala Thr
Glu Gly Glu Ser Pro Thr Gln Leu Pro Ser Arg Glu Asp 340 345 350 Leu
57 24 PRT Homo sapiens 57 Met Arg Leu Pro Arg Arg Ala Ala Leu Gly
Leu Leu Pro Leu Leu Leu 1 5 10 15 Leu Leu Pro Pro Ala Pro Glu Ala
20 58 329 PRT Homo sapiens 58 Ala Lys Lys Pro Thr Pro Cys His Arg
Cys Arg Gly Leu Val Asp Lys 1 5 10 15 Phe Asn Gln Gly Met Val Asp
Thr Ala Lys Lys Asn Phe Gly Gly Gly 20 25 30 Asn Thr Ala Trp Glu
Glu Lys Thr Leu Ser Lys Tyr Glu Ser Ser Glu 35 40 45 Ile Arg Leu
Leu Glu Ile Leu Glu Gly Leu Cys Glu Ser Ser Asp Phe 50 55 60 Glu
Cys Asn Gln Met Leu Glu Ala Gln Glu Glu His Leu Glu Ala Trp 65 70
75 80 Trp Leu Gln Leu Lys Ser Glu Tyr Pro Asp Leu Phe Glu Trp Phe
Cys 85 90 95 Val Lys Thr Leu Lys Val Cys Cys Ser Pro Gly Thr Tyr
Gly Pro Asp 100 105 110 Cys Leu Ala Cys Gln Gly Gly Ser Gln Arg Pro
Cys Ser Gly Asn Gly 115 120 125 His Cys Ser Gly Asp Gly Ser Arg Gln
Gly Asp Gly Ser Cys Arg Cys 130 135 140 His Met Gly Tyr Gln Gly Pro
Leu Cys Thr Asp Cys Met Asp Gly Tyr 145 150 155 160 Phe Ser Ser Leu
Arg Asn Glu Thr His Ser Ile Cys Thr Ala Cys Asp 165 170 175 Glu Ser
Cys Lys Thr Cys Ser Gly Leu Thr Asn Arg Asp Cys Gly Glu 180 185 190
Cys Glu Val Gly Trp Val Leu Asp Glu Gly Ala Cys Val Asp Val Asp 195
200 205 Glu Cys Ala Ala Glu Pro Pro Pro Cys Ser Ala Ala Gln Phe Cys
Lys 210 215 220 Asn Ala Asn Gly Ser Tyr Thr Cys Glu Glu Cys Asp Ser
Ser Cys Val 225 230 235 240 Gly Cys Thr Gly Glu Gly Pro Gly Asn Cys
Lys Glu Cys Ile Ser Gly 245 250 255 Tyr Ala Arg Glu His Gly Gln Cys
Ala Asp Val Asp Glu Cys Ser Leu 260 265 270 Ala Glu Lys Thr Cys Val
Arg Lys Asn Glu Asn Cys Tyr Asn Thr Pro 275 280 285 Gly Ser Tyr Val
Cys Val Cys Pro Asp Gly Phe Glu Glu Thr Glu Asp 290 295 300 Ala Cys
Val Pro Pro Ala Glu Ala Glu Ala Thr Glu Gly Glu Ser Pro 305 310 315
320 Thr Gln Leu Pro Ser Arg Glu Asp Leu 325 59 2730 DNA Homo
sapiens 59 gtcgacccac gcgtccgtcc tgcggcccca gcctctcctc acgctcgcgc
agtctccgcc 60 gcagtctcag ctgcagctgc aggactgagc cgtgcacccg
gaggagaccc ccggaggagg 120 cgacaaactt cgcagtgccg cgacccaacc
ccagccctgg gtagcctgca gcatggccca 180 gctgttcctg cccctgctgg
cagccctggt cctggcccag gctcctgcag ctttagcaga 240 tgttctggaa
ggagacagct cagaggaccg cgcttttcgc gtgcgcatcg cgggcgacgc 300
gccactgcag ggcgtgctcg gcggcgccct caccatccct tgccacgtcc actacctgcg
360 gccaccgccg agccgccggg ctgtgctggg ctctccgcgg gtcaagtgga
ctttcctgtc 420 ccggggccgg gaggcagagg tgctggtggc gcggggagtg
cgcgtcaagg tgaacgaggc 480 ctaccggttc cgcgtggcac tgcctgcgta
cccagcgtcg ctcaccgacg tctccctggc 540 gctgagcgag ctgcgcccca
acgactcagg tatctatcgc tgtgaggtcc agcacggcat 600 cgatgacagc
agcgacgctg tggaggtcaa ggtcaaaggg gtcgtctttc tctaccgaga 660
gggctctgcc cgctatgctt tctccttttc tggggcccag gaggcctgtg cccgcattgg
720 agcccacatc gccaccccgg agcagctcta tgccgcctac
cttgggggct atgagcaatg 780 tgatgctggc tggctgtcgg atcagaccgt
gaggtatccc atccagaccc cacgagaggc 840 ctgttacgga gacatggatg
gcttccccgg ggtccggaac tatggtgtgg tggacccgga 900 tgacctctat
gatgtgtact gttatgctga agacctaaat ggagaactgt tcctgggtga 960
ccctccagag aagctgacat tggaggaagc acgggcgtac tgccaggagc ggggtgcaga
1020 gattgccacc acgggccaac tgtatgcagc ctgggatggt ggcctggacc
actgcagccc 1080 agggtggcta gctgatggca gtgtgcgcta ccccatcgtc
acacccagcc agcgctgtgg 1140 tgggggcttg cctggtgtca agactctctt
cctcttcccc aaccagactg gcttccccaa 1200 taagcacagc cgcttcaacg
tctactgctt ccgagactcg gcccagcctt ctgccatccc 1260 tgaggcctcc
aacccagcct ccaacccagc ctctgatgga ctagaggcta tcgtcacagt 1320
gacagagacc ctggaggaac tgcagctgcc tcaggaagcc acagagagtg aatcccgtgg
1380 ggccatctac tccatcccca tcatggagga cggaggaggt ggaagctcca
ctccagaaga 1440 cccagcagag gcccctagga cgctcctaga atttgaaaca
caatccatgg taccgcccac 1500 ggggttctca gaagaggaag gtaaggcatt
ggaggaagaa gagaaatatg aagatgaaga 1560 agagaaagag gaggaagaag
aagaggagga ggtggaggat gaggctctgt gggcatggcc 1620 cagcgagctc
agcagcccgg gccctgaggc ctctctcccc actgagccag cagcccagga 1680
gaagtcactc tcccaggcgc cagcaagggc agtcctgcag cctggtgcat caccacttcc
1740 tgatggagag tcagaagctt ccaggcctcc aagggtccat ggaccaccta
ctgagactct 1800 gcccactccc agggagagga acctagcatc cccatcacct
tccactctgg ttgaggcaag 1860 agaggtgggg gaggcaactg gtggtcctga
gctatctggg gtccctcgag gagagagcga 1920 ggagacagga agctccgagg
gtgccccttc cctgcttcca gccacacggg cccctgaggg 1980 taccagggag
ctggaggccc cctctgaaga taattctgga agaactgccc cagcagggac 2040
ctcagtgcag gcccagccag tgctgcccac tgacagcgcc agccgaggtg gagtggccgt
2100 ggtccccgca tcaggtaatt ctgcccaagg ctcaactgcc ctctctatcc
tactcctttt 2160 cttccccctg cagctctggg tcacctgacc tgtagtcctt
taacccacca tcatcccaaa 2220 ctctcctgtc ctttgccttc attctcttac
ccacctctac ctatgggtct ccaatctcgg 2280 atatccacct tgtgggtatc
tcagctctcc gcgtctttac cctgtgatcc cagccccgcc 2340 actgaccatc
tgtgaccctt ccctgccatt gggccctcca cctgtggctc acatctcgcc 2400
agccccacag agcatcctca ggcctctcca agggtcctca tcacctattg cagccttcag
2460 ggctcggcct attttccact actcccttca tccgcctgtg tgccgtcccc
tttagctgcc 2520 tcctattgat ctcagggaag cctgggagtc ccttctcacc
cctcaacctc cggagtccag 2580 gagaacccgt acccccacag agccttaagc
aactacttct gtgaagtatt ttttgactgt 2640 ttcatggaaa acaagccttg
gaaataaatc tctattaaac cgctttgtaa ccaaaaaaaa 2700 aaaaaaaaaa
aaaaaaaaaa gggcggccgc 2730 60 2013 DNA Homo sapiens 60 atggcccagc
tgttcctgcc cctgctggca gccctggtcc tggcccaggc tcctgcagct 60
ttagcagatg ttctggaagg agacagctca gaggaccgcg cttttcgcgt gcgcatcgcg
120 ggcgacgcgc cactgcaggg cgtgctcggc ggcgccctca ccatcccttg
ccacgtccac 180 tacctgcggc caccgccgag ccgccgggct gtgctgggct
ctccgcgggt caagtggact 240 ttcctgtccc ggggccggga ggcagaggtg
ctggtggcgc ggggagtgcg cgtcaaggtg 300 aacgaggcct accggttccg
cgtggcactg cctgcgtacc cagcgtcgct caccgacgtc 360 tccctggcgc
tgagcgagct gcgccccaac gactcaggta tctatcgctg tgaggtccag 420
cacggcatcg atgacagcag cgacgctgtg gaggtcaagg tcaaaggggt cgtctttctc
480 taccgagagg gctctgcccg ctatgctttc tccttttctg gggcccagga
ggcctgtgcc 540 cgcattggag cccacatcgc caccccggag cagctctatg
ccgcctacct tgggggctat 600 gagcaatgtg atgctggctg gctgtcggat
cagaccgtga ggtatcccat ccagacccca 660 cgagaggcct gttacggaga
catggatggc ttccccgggg tccggaacta tggtgtggtg 720 gacccggatg
acctctatga tgtgtactgt tatgctgaag acctaaatgg agaactgttc 780
ctgggtgacc ctccagagaa gctgacattg gaggaagcac gggcgtactg ccaggagcgg
840 ggtgcagaga ttgccaccac gggccaactg tatgcagcct gggatggtgg
cctggaccac 900 tgcagcccag ggtggctagc tgatggcagt gtgcgctacc
ccatcgtcac acccagccag 960 cgctgtggtg ggggcttgcc tggtgtcaag
actctcttcc tcttccccaa ccagactggc 1020 ttccccaata agcacagccg
cttcaacgtc tactgcttcc gagactcggc ccagccttct 1080 gccatccctg
aggcctccaa cccagcctcc aacccagcct ctgatggact agaggctatc 1140
gtcacagtga cagagaccct ggaggaactg cagctgcctc aggaagccac agagagtgaa
1200 tcccgtgggg ccatctactc catccccatc atggaggacg gaggaggtgg
aagctccact 1260 ccagaagacc cagcagaggc ccctaggacg ctcctagaat
ttgaaacaca atccatggta 1320 ccgcccacgg ggttctcaga agaggaaggt
aaggcattgg aggaagaaga gaaatatgaa 1380 gatgaagaag agaaagagga
ggaagaagaa gaggaggagg tggaggatga ggctctgtgg 1440 gcatggccca
gcgagctcag cagcccgggc cctgaggcct ctctccccac tgagccagca 1500
gcccaggaga agtcactctc ccaggcgcca gcaagggcag tcctgcagcc tggtgcatca
1560 ccacttcctg atggagagtc agaagcttcc aggcctccaa gggtccatgg
accacctact 1620 gagactctgc ccactcccag ggagaggaac ctagcatccc
catcaccttc cactctggtt 1680 gaggcaagag aggtggggga ggcaactggt
ggtcctgagc tatctggggt ccctcgagga 1740 gagagcgagg agacaggaag
ctccgagggt gccccttccc tgcttccagc cacacgggcc 1800 cctgagggta
ccagggagct ggaggccccc tctgaagata attctggaag aactgcccca 1860
gcagggacct cagtgcaggc ccagccagtg ctgcccactg acagcgccag ccgaggtgga
1920 gtggccgtgg tccccgcatc aggtaattct gcccaaggct caactgccct
ctctatccta 1980 ctccttttct tccccctgca gctctgggtc acc 2013 61 671
PRT Homo sapiens 61 Met Ala Gln Leu Phe Leu Pro Leu Leu Ala Ala Leu
Val Leu Ala Gln 1 5 10 15 Ala Pro Ala Ala Leu Ala Asp Val Leu Glu
Gly Asp Ser Ser Glu Asp 20 25 30 Arg Ala Phe Arg Val Arg Ile Ala
Gly Asp Ala Pro Leu Gln Gly Val 35 40 45 Leu Gly Gly Ala Leu Thr
Ile Pro Cys His Val His Tyr Leu Arg Pro 50 55 60 Pro Pro Ser Arg
Arg Ala Val Leu Gly Ser Pro Arg Val Lys Trp Thr 65 70 75 80 Phe Leu
Ser Arg Gly Arg Glu Ala Glu Val Leu Val Ala Arg Gly Val 85 90 95
Arg Val Lys Val Asn Glu Ala Tyr Arg Phe Arg Val Ala Leu Pro Ala 100
105 110 Tyr Pro Ala Ser Leu Thr Asp Val Ser Leu Ala Leu Ser Glu Leu
Arg 115 120 125 Pro Asn Asp Ser Gly Ile Tyr Arg Cys Glu Val Gln His
Gly Ile Asp 130 135 140 Asp Ser Ser Asp Ala Val Glu Val Lys Val Lys
Gly Val Val Phe Leu 145 150 155 160 Tyr Arg Glu Gly Ser Ala Arg Tyr
Ala Phe Ser Phe Ser Gly Ala Gln 165 170 175 Glu Ala Cys Ala Arg Ile
Gly Ala His Ile Ala Thr Pro Glu Gln Leu 180 185 190 Tyr Ala Ala Tyr
Leu Gly Gly Tyr Glu Gln Cys Asp Ala Gly Trp Leu 195 200 205 Ser Asp
Gln Thr Val Arg Tyr Pro Ile Gln Thr Pro Arg Glu Ala Cys 210 215 220
Tyr Gly Asp Met Asp Gly Phe Pro Gly Val Arg Asn Tyr Gly Val Val 225
230 235 240 Asp Pro Asp Asp Leu Tyr Asp Val Tyr Cys Tyr Ala Glu Asp
Leu Asn 245 250 255 Gly Glu Leu Phe Leu Gly Asp Pro Pro Glu Lys Leu
Thr Leu Glu Glu 260 265 270 Ala Arg Ala Tyr Cys Gln Glu Arg Gly Ala
Glu Ile Ala Thr Thr Gly 275 280 285 Gln Leu Tyr Ala Ala Trp Asp Gly
Gly Leu Asp His Cys Ser Pro Gly 290 295 300 Trp Leu Ala Asp Gly Ser
Val Arg Tyr Pro Ile Val Thr Pro Ser Gln 305 310 315 320 Arg Cys Gly
Gly Gly Leu Pro Gly Val Lys Thr Leu Phe Leu Phe Pro 325 330 335 Asn
Gln Thr Gly Phe Pro Asn Lys His Ser Arg Phe Asn Val Tyr Cys 340 345
350 Phe Arg Asp Ser Ala Gln Pro Ser Ala Ile Pro Glu Ala Ser Asn Pro
355 360 365 Ala Ser Asn Pro Ala Ser Asp Gly Leu Glu Ala Ile Val Thr
Val Thr 370 375 380 Glu Thr Leu Glu Glu Leu Gln Leu Pro Gln Glu Ala
Thr Glu Ser Glu 385 390 395 400 Ser Arg Gly Ala Ile Tyr Ser Ile Pro
Ile Met Glu Asp Gly Gly Gly 405 410 415 Gly Ser Ser Thr Pro Glu Asp
Pro Ala Glu Ala Pro Arg Thr Leu Leu 420 425 430 Glu Phe Glu Thr Gln
Ser Met Val Pro Pro Thr Gly Phe Ser Glu Glu 435 440 445 Glu Gly Lys
Ala Leu Glu Glu Glu Glu Lys Tyr Glu Asp Glu Glu Glu 450 455 460 Lys
Glu Glu Glu Glu Glu Glu Glu Glu Val Glu Asp Glu Ala Leu Trp 465 470
475 480 Ala Trp Pro Ser Glu Leu Ser Ser Pro Gly Pro Glu Ala Ser Leu
Pro 485 490 495 Thr Glu Pro Ala Ala Gln Glu Lys Ser Leu Ser Gln Ala
Pro Ala Arg 500 505 510 Ala Val Leu Gln Pro Gly Ala Ser Pro Leu Pro
Asp Gly Glu Ser Glu 515 520 525 Ala Ser Arg Pro Pro Arg Val His Gly
Pro Pro Thr Glu Thr Leu Pro 530 535 540 Thr Pro Arg Glu Arg Asn Leu
Ala Ser Pro Ser Pro Ser Thr Leu Val 545 550 555 560 Glu Ala Arg Glu
Val Gly Glu Ala Thr Gly Gly Pro Glu Leu Ser Gly 565 570 575 Val Pro
Arg Gly Glu Ser Glu Glu Thr Gly Ser Ser Glu Gly Ala Pro 580 585 590
Ser Leu Leu Pro Ala Thr Arg Ala Pro Glu Gly Thr Arg Glu Leu Glu 595
600 605 Ala Pro Ser Glu Asp Asn Ser Gly Arg Thr Ala Pro Ala Gly Thr
Ser 610 615 620 Val Gln Ala Gln Pro Val Leu Pro Thr Asp Ser Ala Ser
Arg Gly Gly 625 630 635 640 Val Ala Val Val Pro Ala Ser Gly Asn Ser
Ala Gln Gly Ser Thr Ala 645 650 655 Leu Ser Ile Leu Leu Leu Phe Phe
Pro Leu Gln Leu Trp Val Thr 660 665 670 62 22 PRT Homo sapiens 62
Met Ala Gln Leu Phe Leu Pro Leu Leu Ala Ala Leu Val Leu Ala Gln 1 5
10 15 Ala Pro Ala Ala Leu Ala 20 63 649 PRT Homo sapiens 63 Asp Val
Leu Glu Gly Asp Ser Ser Glu Asp Arg Ala Phe Arg Val Arg 1 5 10 15
Ile Ala Gly Asp Ala Pro Leu Gln Gly Val Leu Gly Gly Ala Leu Thr 20
25 30 Ile Pro Cys His Val His Tyr Leu Arg Pro Pro Pro Ser Arg Arg
Ala 35 40 45 Val Leu Gly Ser Pro Arg Val Lys Trp Thr Phe Leu Ser
Arg Gly Arg 50 55 60 Glu Ala Glu Val Leu Val Ala Arg Gly Val Arg
Val Lys Val Asn Glu 65 70 75 80 Ala Tyr Arg Phe Arg Val Ala Leu Pro
Ala Tyr Pro Ala Ser Leu Thr 85 90 95 Asp Val Ser Leu Ala Leu Ser
Glu Leu Arg Pro Asn Asp Ser Gly Ile 100 105 110 Tyr Arg Cys Glu Val
Gln His Gly Ile Asp Asp Ser Ser Asp Ala Val 115 120 125 Glu Val Lys
Val Lys Gly Val Val Phe Leu Tyr Arg Glu Gly Ser Ala 130 135 140 Arg
Tyr Ala Phe Ser Phe Ser Gly Ala Gln Glu Ala Cys Ala Arg Ile 145 150
155 160 Gly Ala His Ile Ala Thr Pro Glu Gln Leu Tyr Ala Ala Tyr Leu
Gly 165 170 175 Gly Tyr Glu Gln Cys Asp Ala Gly Trp Leu Ser Asp Gln
Thr Val Arg 180 185 190 Tyr Pro Ile Gln Thr Pro Arg Glu Ala Cys Tyr
Gly Asp Met Asp Gly 195 200 205 Phe Pro Gly Val Arg Asn Tyr Gly Val
Val Asp Pro Asp Asp Leu Tyr 210 215 220 Asp Val Tyr Cys Tyr Ala Glu
Asp Leu Asn Gly Glu Leu Phe Leu Gly 225 230 235 240 Asp Pro Pro Glu
Lys Leu Thr Leu Glu Glu Ala Arg Ala Tyr Cys Gln 245 250 255 Glu Arg
Gly Ala Glu Ile Ala Thr Thr Gly Gln Leu Tyr Ala Ala Trp 260 265 270
Asp Gly Gly Leu Asp His Cys Ser Pro Gly Trp Leu Ala Asp Gly Ser 275
280 285 Val Arg Tyr Pro Ile Val Thr Pro Ser Gln Arg Cys Gly Gly Gly
Leu 290 295 300 Pro Gly Val Lys Thr Leu Phe Leu Phe Pro Asn Gln Thr
Gly Phe Pro 305 310 315 320 Asn Lys His Ser Arg Phe Asn Val Tyr Cys
Phe Arg Asp Ser Ala Gln 325 330 335 Pro Ser Ala Ile Pro Glu Ala Ser
Asn Pro Ala Ser Asn Pro Ala Ser 340 345 350 Asp Gly Leu Glu Ala Ile
Val Thr Val Thr Glu Thr Leu Glu Glu Leu 355 360 365 Gln Leu Pro Gln
Glu Ala Thr Glu Ser Glu Ser Arg Gly Ala Ile Tyr 370 375 380 Ser Ile
Pro Ile Met Glu Asp Gly Gly Gly Gly Ser Ser Thr Pro Glu 385 390 395
400 Asp Pro Ala Glu Ala Pro Arg Thr Leu Leu Glu Phe Glu Thr Gln Ser
405 410 415 Met Val Pro Pro Thr Gly Phe Ser Glu Glu Glu Gly Lys Ala
Leu Glu 420 425 430 Glu Glu Glu Lys Tyr Glu Asp Glu Glu Glu Lys Glu
Glu Glu Glu Glu 435 440 445 Glu Glu Glu Val Glu Asp Glu Ala Leu Trp
Ala Trp Pro Ser Glu Leu 450 455 460 Ser Ser Pro Gly Pro Glu Ala Ser
Leu Pro Thr Glu Pro Ala Ala Gln 465 470 475 480 Glu Lys Ser Leu Ser
Gln Ala Pro Ala Arg Ala Val Leu Gln Pro Gly 485 490 495 Ala Ser Pro
Leu Pro Asp Gly Glu Ser Glu Ala Ser Arg Pro Pro Arg 500 505 510 Val
His Gly Pro Pro Thr Glu Thr Leu Pro Thr Pro Arg Glu Arg Asn 515 520
525 Leu Ala Ser Pro Ser Pro Ser Thr Leu Val Glu Ala Arg Glu Val Gly
530 535 540 Glu Ala Thr Gly Gly Pro Glu Leu Ser Gly Val Pro Arg Gly
Glu Ser 545 550 555 560 Glu Glu Thr Gly Ser Ser Glu Gly Ala Pro Ser
Leu Leu Pro Ala Thr 565 570 575 Arg Ala Pro Glu Gly Thr Arg Glu Leu
Glu Ala Pro Ser Glu Asp Asn 580 585 590 Ser Gly Arg Thr Ala Pro Ala
Gly Thr Ser Val Gln Ala Gln Pro Val 595 600 605 Leu Pro Thr Asp Ser
Ala Ser Arg Gly Gly Val Ala Val Val Pro Ala 610 615 620 Ser Gly Asn
Ser Ala Gln Gly Ser Thr Ala Leu Ser Ile Leu Leu Leu 625 630 635 640
Phe Phe Pro Leu Gln Leu Trp Val Thr 645 64 456 PRT Sus scrofa 64
Met Asn Leu Asp Ile His Cys Glu Gln Leu Ser Asp Ala Arg Trp Thr 1 5
10 15 Glu Leu Leu Pro Leu Leu Gln Gln Tyr Glu Val Val Arg Leu Asp
Asp 20 25 30 Cys Gly Leu Thr Glu Glu His Cys Lys Asp Ile Gly Ser
Ala Leu Arg 35 40 45 Ala Asn Pro Ser Leu Thr Glu Leu Cys Leu Arg
Thr Asn Glu Leu Gly 50 55 60 Asp Ala Gly Val His Leu Val Leu Gln
Gly Leu Gln Ser Pro Thr Cys 65 70 75 80 Lys Ile Gln Lys Leu Ser Leu
Gln Asn Cys Ser Leu Thr Glu Ala Gly 85 90 95 Cys Gly Val Leu Pro
Ser Thr Leu Arg Ser Leu Pro Thr Leu Arg Glu 100 105 110 Leu His Leu
Ser Asp Asn Pro Leu Gly Asp Ala Gly Leu Arg Leu Leu 115 120 125 Cys
Glu Gly Leu Leu Asp Pro Gln Cys His Leu Glu Lys Leu Gln Leu 130 135
140 Glu Tyr Cys Arg Leu Thr Ala Ala Ser Cys Glu Pro Leu Ala Ser Val
145 150 155 160 Leu Arg Ala Thr Arg Ala Leu Lys Glu Leu Thr Val Ser
Asn Asn Asp 165 170 175 Ile Gly Glu Ala Gly Ala Arg Val Leu Gly Gln
Gly Leu Ala Asp Ser 180 185 190 Ala Cys Gln Leu Glu Thr Leu Arg Leu
Glu Asn Cys Gly Leu Thr Pro 195 200 205 Ala Asn Cys Lys Asp Leu Cys
Gly Ile Val Ala Ser Gln Ala Ser Leu 210 215 220 Arg Glu Leu Asp Leu
Gly Ser Asn Gly Leu Gly Asp Ala Gly Ile Ala 225 230 235 240 Glu Leu
Cys Pro Gly Leu Leu Ser Pro Ala Ser Arg Leu Lys Thr Leu 245 250 255
Trp Leu Trp Glu Cys Asp Ile Thr Ala Ser Gly Cys Arg Asp Leu Cys 260
265 270 Arg Val Leu Gln Ala Lys Glu Thr Leu Lys Glu Leu Ser Leu Ala
Gly 275 280 285 Asn Lys Leu Gly Asp Glu Gly Ala Arg Leu Leu Cys Glu
Ser Leu Leu 290 295 300 Gln Pro Gly Cys Gln Leu Glu Ser Leu Trp Val
Lys Ser Cys Ser Leu 305 310 315 320 Thr Ala Ala Cys Cys Gln His Val
Ser Leu Met Leu Thr Gln Asn Lys 325 330 335 His Leu Leu Glu Leu Gln
Leu Ser Ser Asn Lys Leu Gly Asp Ser Gly 340 345 350 Ile Gln Glu Leu
Cys Gln Ala Leu Ser Gln Pro Gly Thr Thr Leu Arg 355 360 365 Val Leu
Cys Leu Gly Asp Cys Glu Val Thr Asn Ser Gly Cys Ser Ser 370 375 380
Leu Ala Ser Leu Leu Leu Ala Asn Arg Ser Leu Arg Glu Leu Asp Leu 385
390 395 400 Ser Asn Asn Cys Val Gly Asp Pro Gly Val Leu Gln Leu Leu
Gly Ser 405 410 415 Leu Glu Gln Pro Gly Cys Ala Leu Glu Gln Leu Val
Leu Tyr Asp Thr 420 425 430
Tyr Trp Thr Glu Glu Val Glu Asp Arg Leu Gln Ala Leu Glu Gly Ser 435
440 445 Lys Pro Gly Leu Arg Val Ile Ser 450 455 65 834 PRT Mus sp.
65 Met Ala Pro His Trp Ala Val Trp Leu Leu Ala Ala Gly Leu Trp Gly
1 5 10 15 Leu Gly Ile Gly Ala Glu Met Trp Trp Asn Leu Val Pro Arg
Lys Thr 20 25 30 Val Ser Ser Gly Glu Leu Val Thr Val Val Arg Arg
Phe Ser Gln Thr 35 40 45 Gly Ile Gln Asp Phe Leu Thr Leu Thr Leu
Thr Glu His Ser Gly Leu 50 55 60 Leu Tyr Val Gly Ala Arg Glu Ala
Leu Phe Ala Phe Ser Val Glu Ala 65 70 75 80 Leu Glu Leu Gln Gly Ala
Ile Ser Trp Glu Ala Pro Ala Glu Lys Lys 85 90 95 Ile Glu Cys Thr
Gln Lys Gly Lys Ser Asn Gln Thr Glu Cys Phe Asn 100 105 110 Phe Ile
Arg Phe Leu Gln Pro Tyr Asn Ser Ser His Leu Tyr Val Cys 115 120 125
Gly Thr Tyr Ala Phe Gln Pro Lys Cys Thr Tyr Ile Asn Met Leu Thr 130
135 140 Phe Thr Leu Asp Arg Ala Glu Phe Glu Asp Gly Lys Gly Lys Cys
Pro 145 150 155 160 Tyr Asp Pro Ala Lys Gly His Thr Gly Leu Leu Val
Asp Gly Glu Leu 165 170 175 Tyr Ser Ala Thr Leu Asn Asn Phe Leu Gly
Thr Glu Pro Val Ile Leu 180 185 190 Arg Tyr Met Gly Thr His His Ser
Ile Lys Thr Glu Tyr Leu Ala Phe 195 200 205 Trp Leu Asn Glu Pro His
Phe Val Gly Ser Ala Phe Val Pro Glu Ser 210 215 220 Val Gly Ser Phe
Thr Gly Asp Asp Asp Lys Ile Tyr Phe Phe Phe Ser 225 230 235 240 Glu
Arg Ala Val Glu Tyr Asp Cys Tyr Ser Glu Gln Val Val Ala Arg 245 250
255 Val Ala Arg Val Cys Lys Gly Asp Met Gly Gly Ala Arg Thr Leu Gln
260 265 270 Lys Lys Trp Thr Thr Phe Leu Lys Ala Arg Leu Val Cys Ser
Ala Pro 275 280 285 Asp Trp Lys Val Tyr Phe Asn Gln Leu Lys Ala Val
His Thr Leu Arg 290 295 300 Gly Ala Ser Trp His Asn Thr Thr Phe Phe
Gly Val Phe Gln Ala Arg 305 310 315 320 Trp Gly Asp Met Asp Leu Ser
Ala Val Cys Glu Tyr Gln Leu Glu Gln 325 330 335 Ile Gln Gln Val Phe
Glu Gly Pro Tyr Lys Glu Tyr Ser Glu Gln Ala 340 345 350 Gln Lys Trp
Ala Arg Tyr Thr Asp Pro Val Pro Ser Pro Arg Pro Gly 355 360 365 Ser
Cys Ile Asn Asn Trp His Arg Asp Asn Gly Tyr Thr Ser Ser Leu 370 375
380 Glu Leu Pro Asp Asn Thr Leu Asn Phe Ile Lys Lys His Pro Leu Met
385 390 395 400 Glu Asp Gln Val Lys Pro Arg Leu Gly Arg Pro Leu Leu
Val Lys Lys 405 410 415 Asn Thr Asn Phe Thr His Val Val Ala Asp Arg
Val Pro Gly Leu Asp 420 425 430 Gly Ala Thr Tyr Thr Val Leu Phe Ile
Gly Thr Gly Asp Gly Trp Leu 435 440 445 Leu Lys Ala Val Ser Leu Gly
Pro Trp Ile His Met Val Glu Glu Leu 450 455 460 Gln Val Phe Asp Gln
Glu Pro Val Glu Ser Leu Val Leu Ser Gln Ser 465 470 475 480 Lys Lys
Val Leu Phe Ala Gly Ser Arg Ser Gln Leu Val Gln Leu Ser 485 490 495
Leu Ala Asp Cys Thr Lys Tyr Arg Phe Cys Val Asp Cys Val Leu Ala 500
505 510 Arg Asp Pro Tyr Cys Ala Trp Asn Val Asn Thr Ser Arg Cys Val
Ala 515 520 525 Thr Thr Ser Gly Arg Ser Gly Ser Phe Leu Val Gln His
Val Ala Asn 530 535 540 Leu Asp Thr Ser Lys Met Cys Asn Gln Tyr Gly
Ile Lys Lys Val Arg 545 550 555 560 Ser Ile Pro Lys Asn Ile Thr Val
Val Ser Gly Thr Asp Leu Val Leu 565 570 575 Pro Cys His Leu Ser Ser
Asn Leu Ala His Ala His Trp Thr Phe Gly 580 585 590 Ser Gln Asp Leu
Pro Ala Glu Gln Pro Gly Ser Phe Leu Tyr Asp Thr 595 600 605 Gly Leu
Gln Ala Leu Val Val Met Ala Ala Gln Ser Arg His Ser Gly 610 615 620
Pro Tyr Arg Cys Tyr Ser Glu Glu Gln Gly Thr Arg Leu Ala Ala Glu 625
630 635 640 Ser Tyr Leu Val Ala Val Val Ala Gly Ser Ser Val Thr Leu
Glu Ala 645 650 655 Arg Ala Pro Leu Glu Asn Leu Gly Leu Val Trp Leu
Ala Val Val Ala 660 665 670 Leu Gly Ala Val Cys Leu Val Leu Leu Leu
Leu Val Leu Ser Leu Arg 675 680 685 Arg Arg Leu Arg Glu Glu Leu Glu
Lys Gly Ala Lys Ala Ser Glu Arg 690 695 700 Thr Leu Val Tyr Pro Leu
Glu Leu Pro Lys Glu Pro Ala Ser Pro Pro 705 710 715 720 Phe Arg Pro
Gly Pro Glu Thr Asp Glu Lys Leu Trp Asp Pro Val Gly 725 730 735 Tyr
Tyr Tyr Ser Asp Gly Ser Leu Lys Ile Val Pro Gly His Ala Arg 740 745
750 Cys Gln Pro Gly Gly Gly Pro Pro Ser Pro Pro Pro Gly Ile Pro Gly
755 760 765 Gln Pro Leu Pro Ser Pro Thr Arg Leu His Leu Gly Gly Gly
Arg Asn 770 775 780 Ser Asn Ala Asn Gly Tyr Val Arg Leu Gln Leu Gly
Gly Glu Asp Arg 785 790 795 800 Gly Gly Ser Gly His Pro Leu Pro Glu
Leu Ala Asp Glu Leu Arg Arg 805 810 815 Lys Leu Gln Gln Arg Gln Pro
Leu Pro Asp Ser Asn Pro Glu Glu Ser 820 825 830 Ser Val 66 3503 DNA
Mus sp. 66 ggcacgaggt ggccggagtc aaacgcgagg gcagcgccag ggattggagc
tgcacgaaag 60 agggctgctg gactgaagtt tagaccctgg gtgtctgcca
tggccccaca ctgggctgtc 120 tggctgctgg cagcagggct gtggggcctg
ggcatcgggg ctgagatgtg gtggaacctt 180 gtgccccgga agacagtatc
ttctggggag ctggtcacag tagtgaggcg gttctcccag 240 acaggcatcc
aggacttcct gacactgacc ctgacagaac attctggcct tttatatgtg 300
ggggcccgag aggcgctgtt tgccttcagt gtagaggctc tggagctgca aggagcgatc
360 tcttgggagg ctccagctga gaagaaaatt gaatgtaccc agaaagggaa
gagcaaccag 420 accgaatgct tcaacttcat ccgcttcctt cagccataca
attcctccca tctgtatgtc 480 tgcggcacct atgccttcca gcccaagtgc
acctacatca acatgctcac gttcaccttg 540 gaccgtgcag aatttgagga
tgggaagggt aaatgcccat atgacccagc taagggtcac 600 accggactcc
ttgtggacgg tgagctgtac tcagccacac tcaataactt cctgggcaca 660
gagccggtta tccttcgata catggggacc caccactcca tcaagacaga gtacctggct
720 ttttggctga atgaacccca ctttgtaggc tctgcctttg tccctgagag
tgtgggaagc 780 ttcacgggag acgatgacaa gatctacttc ttcttcagtg
agcgggcagt ggagtatgac 840 tgctattccg agcaggtggt ggctcgtgtg
gcgagagtct gtaagggtga catgggggga 900 gcacggacgc tgcagaagaa
atggacgacg ttcctgaagg ctcggttggt gtgctcagcc 960 cctgactgga
aggtctactt caaccagctg aaggcggtgc acaccctgcg gggcgcctct 1020
tggcacaaca ccaccttctt cggggttttt caagcgcgat ggggcgatat ggacctgtct
1080 gcagtttgtg agtaccagtt ggaacagatc cagcaagtgt ttgagggtcc
ctacaaggag 1140 tacagtgagc aagcccagaa gtgggcccgc tatactgacc
cggtacccag ccctcggcct 1200 ggttcgtgta tcaacaactg gcaccgagac
aatggctaca ccagttccct ggaactgccg 1260 gacaacaccc tcaacttcat
caagaagcac cccctgatgg aggaccaggt gaagcctcgg 1320 ttgggccgcc
ccctacttgt gaagaagaac actaacttca cacacgtggt ggccgacagg 1380
gtcccagggc ttgatggtgc cacctataca gtgttgttca ttggtacagg agatggctgg
1440 ctgctgaagg ctgtgagcct ggggccctgg atccacatgg tggaggaact
gcaggtgttt 1500 gaccaggagc cagtggaaag tctggtgctg tctcagagca
agaaggtgct ctttgctggc 1560 tcccgctctc agctggttca gctgtctctg
gccgactgca caaagtaccg tttctgtgta 1620 gactgtgtcc tggccaggga
cccttactgt gcctggaatg tcaacaccag ccgctgtgtg 1680 gccaccacca
gtggtcgctc ggggtccttt ctggtccaac atgtggcgaa cttggacact 1740
tcaaagatgt gtaaccagta tggcattaaa aaagtcagat ctattcccaa gaacatcacc
1800 gttgtgtcag gcacagacct ggtcctaccc tgccacctct cgtccaattt
ggcccatgcc 1860 cactggacct tcggaagcca ggacctgcct gcagaacaac
ctggctcctt tctttatgac 1920 acgggactcc aggcgctggt ggtgatggcc
gcacagtccc gtcactctgg accctatcgt 1980 tgctattcag aggagcaggg
gacaagactg gctgcagaaa gctaccttgt tgctgtcgtg 2040 gccggctcgt
cggtgacact ggaggcacgg gctcccttgg aaaacctggg gctcgtgtgg 2100
ctcgctgtgg tggccctggg ggctgtgtgc ctggtgctgc tgctgctggt cctatcgctc
2160 cgccggcgac ttcgagaaga gctagaaaag ggtgccaagg catctgagag
gacactggtg 2220 taccccttgg aactgcccaa ggagcctgcc agtcccccct
tccgtcctgg ccccgaaact 2280 gatgagaaac tttgggatcc tgtcgggtac
tactattcgg atggctctct caagattgtg 2340 cctggtcacg cccggtgcca
gcctgggggt gggccccctt ccccacctcc tggcatacct 2400 ggccagcctc
tgccttctcc aactcggctc cacctaggag gtggtcggaa ctcaaatgcc 2460
aatggttatg tgcgtttaca gttgggcgga gaggaccgag gaggatctgg gcacccactg
2520 cctgagctcg cggatgaatt acgacggaaa ctacaacagc gccagccgct
gcctgactcc 2580 aacccagagg agtcttcagt atgaggggac ccccccacct
cattggcggg ggggggtctc 2640 atgggaggtg cactcttaac ttttgcacag
gcaccagcta cctcagggac atggcagggg 2700 cacttgctct gcctgggaca
gacactgccc atcatttgcc cggccgtgag gacctgctca 2760 gcatgggcac
tgccacttgg tgtggctcac caggacttca gcctcacagg agacacaccc 2820
tcctctgtga atttgagaca tgtgggaccc cagcagccaa aactttgcaa ggaagaggtt
2880 tcaagatgtg ggcgtgtttg tgcatatatg tgttggtatg catgtggaag
aatgtgtgtg 2940 tgtgtgtgtg tgtgttgtaa ctttcctgtc tctatcacgt
cttcccttgg cctggggtcc 3000 tcctggttga gtctttggag ctatgaaggg
gaagggggtc atagcacttt gcttctccta 3060 cccccagctg tcccaagctt
tggggcagtg atgtacatac ggggaaggga aggacagggt 3120 gttgtacccc
ttttggggga gtgcgggact cgggggtggg cctagccctg ctcctagggc 3180
tgtgaatgtt ttcagggcgg gggttggggg tggagatgga acctcctgct tcagggggag
3240 gggtgggcag ggcctcccac ttgccctccg ggttcggtgg tattttatat
ttgcgctctt 3300 ctgacagggc tgggaagggt tgttggggga gggaagggag
gaggtgggca tgctatggat 3360 actggcctat cctctccctg ctctgggaaa
agggctaaca gtgtaactta ttgtgtcccc 3420 acatatttat ttgttgtaaa
tatttgagta tttttatatt gacaaataaa atggagaaaa 3480 tgaaatttaa
aaaaaaaaaa aaa 3503 67 1529 PRT Homo sapiens 67 Met Arg Gly Val Gly
Trp Gln Met Leu Ser Leu Ser Leu Gly Leu Val 1 5 10 15 Leu Ala Ile
Leu Asn Lys Val Ala Pro Gln Ala Cys Pro Ala Gln Cys 20 25 30 Ser
Cys Ser Gly Ser Thr Val Asp Cys His Gly Leu Ala Leu Arg Ser 35 40
45 Val Pro Arg Asn Ile Pro Arg Asn Thr Glu Arg Leu Asp Leu Asn Gly
50 55 60 Asn Asn Ile Thr Arg Ile Thr Lys Thr Asp Phe Ala Gly Leu
Arg His 65 70 75 80 Leu Arg Val Leu Gln Leu Met Glu Asn Lys Ile Ser
Thr Ile Glu Arg 85 90 95 Gly Ala Phe Gln Asp Leu Lys Glu Leu Glu
Arg Leu Arg Leu Asn Arg 100 105 110 Asn His Leu Gln Leu Phe Pro Glu
Leu Leu Phe Leu Gly Thr Ala Lys 115 120 125 Leu Tyr Arg Leu Asp Leu
Ser Glu Asn Gln Ile Gln Ala Ile Pro Arg 130 135 140 Lys Ala Phe Arg
Gly Ala Val Asp Ile Lys Asn Leu Gln Leu Asp Tyr 145 150 155 160 Asn
Gln Ile Ser Cys Ile Glu Asp Gly Ala Phe Arg Ala Leu Arg Asp 165 170
175 Leu Glu Val Leu Thr Leu Asn Asn Asn Asn Ile Thr Arg Leu Ser Val
180 185 190 Ala Ser Phe Asn His Met Pro Lys Leu Arg Thr Phe Arg Leu
His Ser 195 200 205 Asn Asn Leu Tyr Cys Asp Cys His Leu Ala Trp Leu
Ser Asp Trp Leu 210 215 220 Arg Gln Arg Pro Arg Val Gly Leu Tyr Thr
Gln Cys Met Gly Pro Ser 225 230 235 240 His Leu Arg Gly His Asn Val
Ala Glu Val Gln Lys Arg Glu Phe Val 245 250 255 Cys Ser Gly His Gln
Ser Phe Met Ala Pro Ser Cys Ser Val Leu His 260 265 270 Cys Pro Ala
Ala Cys Thr Cys Ser Asn Asn Ile Val Asp Cys Arg Gly 275 280 285 Lys
Gly Leu Thr Glu Ile Pro Thr Asn Leu Pro Glu Thr Ile Thr Glu 290 295
300 Ile Arg Leu Glu Gln Asn Thr Ile Lys Val Ile Pro Pro Gly Ala Phe
305 310 315 320 Ser Pro Tyr Lys Lys Leu Arg Arg Ile Asp Leu Ser Asn
Asn Gln Ile 325 330 335 Ser Glu Leu Ala Pro Asp Ala Phe Gln Gly Leu
Arg Ser Leu Asn Ser 340 345 350 Leu Val Leu Tyr Gly Asn Lys Ile Thr
Glu Leu Pro Lys Ser Leu Phe 355 360 365 Glu Gly Leu Phe Ser Leu Gln
Leu Leu Leu Leu Asn Ala Asn Lys Ile 370 375 380 Asn Cys Leu Arg Val
Asp Ala Phe Gln Asp Leu His Asn Leu Asn Leu 385 390 395 400 Leu Ser
Leu Tyr Asp Asn Lys Leu Gln Thr Ile Ala Lys Gly Thr Phe 405 410 415
Ser Pro Leu Arg Ala Ile Gln Thr Met His Leu Ala Gln Asn Pro Phe 420
425 430 Ile Cys Asp Cys His Leu Lys Trp Leu Ala Asp Tyr Leu His Thr
Asn 435 440 445 Pro Ile Glu Thr Ser Gly Ala Arg Cys Thr Ser Pro Arg
Arg Leu Ala 450 455 460 Asn Lys Arg Ile Gly Gln Ile Lys Ser Lys Lys
Phe Arg Cys Ser Ala 465 470 475 480 Lys Glu Gln Tyr Phe Ile Pro Gly
Thr Glu Asp Tyr Arg Ser Lys Leu 485 490 495 Ser Gly Asp Cys Phe Ala
Asp Leu Ala Cys Pro Glu Lys Cys Arg Cys 500 505 510 Glu Gly Thr Thr
Val Asp Cys Ser Asn Gln Lys Leu Asn Lys Ile Pro 515 520 525 Glu His
Ile Pro Gln Tyr Thr Ala Glu Leu Arg Leu Asn Asn Asn Glu 530 535 540
Phe Thr Val Leu Glu Ala Thr Gly Ile Phe Lys Lys Leu Pro Gln Leu 545
550 555 560 Arg Lys Ile Asn Phe Ser Asn Asn Lys Ile Thr Asp Ile Glu
Glu Gly 565 570 575 Ala Phe Glu Gly Ala Ser Gly Val Asn Glu Ile Leu
Leu Thr Ser Asn 580 585 590 Arg Leu Glu Asn Val Gln His Lys Met Phe
Lys Gly Leu Glu Ser Leu 595 600 605 Lys Thr Leu Met Leu Arg Ser Asn
Arg Ile Thr Cys Val Gly Asn Asp 610 615 620 Ser Phe Ile Gly Leu Ser
Ser Val Arg Leu Leu Ser Leu Tyr Asp Asn 625 630 635 640 Gln Ile Thr
Thr Val Ala Pro Gly Ala Phe Asp Thr Leu His Ser Leu 645 650 655 Ser
Thr Leu Asn Leu Leu Ala Asn Pro Phe Asn Cys Asn Cys Tyr Leu 660 665
670 Ala Trp Leu Gly Glu Trp Leu Arg Lys Lys Arg Ile Val Thr Gly Asn
675 680 685 Pro Arg Cys Gln Lys Pro Tyr Phe Leu Lys Glu Ile Pro Ile
Gln Asp 690 695 700 Val Ala Ile Gln Asp Phe Thr Cys Asp Asp Gly Asn
Asp Asp Asn Ser 705 710 715 720 Cys Ser Pro Leu Ser Arg Cys Pro Thr
Glu Cys Thr Cys Leu Asp Thr 725 730 735 Val Val Arg Cys Ser Asn Lys
Gly Leu Lys Val Leu Pro Lys Gly Ile 740 745 750 Pro Arg Asp Val Thr
Glu Leu Tyr Leu Asp Gly Asn Gln Phe Thr Leu 755 760 765 Val Pro Lys
Glu Leu Ser Asn Tyr Lys His Leu Thr Leu Ile Asp Leu 770 775 780 Ser
Asn Asn Arg Ile Ser Thr Leu Ser Asn Gln Ser Phe Ser Asn Met 785 790
795 800 Thr Gln Leu Leu Thr Leu Ile Leu Ser Tyr Asn Arg Leu Arg Cys
Ile 805 810 815 Pro Pro Arg Thr Phe Asp Gly Leu Lys Ser Leu Arg Leu
Leu Ser Leu 820 825 830 His Gly Asn Asp Ile Ser Val Val Pro Glu Gly
Ala Phe Asn Asp Leu 835 840 845 Ser Ala Leu Ser His Leu Ala Ile Gly
Ala Asn Pro Leu Tyr Cys Asp 850 855 860 Cys Asn Met Gln Trp Leu Ser
Asp Trp Val Lys Ser Glu Tyr Lys Glu 865 870 875 880 Pro Gly Ile Ala
Arg Cys Ala Gly Pro Gly Glu Met Ala Asp Lys Leu 885 890 895 Leu Leu
Thr Thr Pro Ser Lys Lys Phe Thr Cys Gln Gly Pro Val Asp 900 905 910
Val Asn Ile Leu Ala Lys Cys Asn Pro Cys Leu Ser Asn Pro Cys Lys 915
920 925 Asn Asp Gly Thr Cys Asn Ser Asp Pro Val Asp Phe Tyr Arg Cys
Thr 930 935 940 Cys Pro Tyr Gly Phe Lys Gly Gln Asp Cys Asp Val Pro
Ile His Ala 945 950 955 960 Cys Ile Ser Asn Pro Cys Lys His Gly Gly
Thr Cys His Leu Lys Glu 965 970 975 Gly Glu Glu Asp Gly Phe Trp Cys
Ile Cys Ala Asp Gly Phe Glu Gly 980 985 990 Glu Asn Cys Glu Val Asn
Val Asp Asp Cys Glu Asp Asn Asp Cys Glu 995 1000
1005 Asn Asn Ser Thr Cys Val Asp Gly Ile Asn Asn Tyr Thr Cys Leu
1010 1015 1020 Cys Pro Pro Glu Tyr Thr Gly Glu Leu Cys Glu Glu Lys
Leu Asp 1025 1030 1035 Phe Cys Ala Gln Asp Leu Asn Pro Cys Gln His
Asp Ser Lys Cys 1040 1045 1050 Ile Leu Thr Pro Lys Gly Phe Lys Cys
Asp Cys Thr Pro Gly Tyr 1055 1060 1065 Val Gly Glu His Cys Asp Ile
Asp Phe Asp Asp Cys Gln Asp Asn 1070 1075 1080 Lys Cys Lys Asn Gly
Ala His Cys Thr Asp Ala Val Asn Gly Tyr 1085 1090 1095 Thr Cys Ile
Cys Pro Glu Gly Tyr Ser Gly Leu Phe Cys Glu Phe 1100 1105 1110 Ser
Pro Pro Met Val Leu Pro Arg Thr Ser Pro Cys Asp Asn Phe 1115 1120
1125 Asp Cys Gln Asn Gly Ala Gln Cys Ile Val Arg Ile Asn Glu Pro
1130 1135 1140 Ile Cys Gln Cys Leu Pro Gly Tyr Gln Gly Glu Lys Cys
Glu Lys 1145 1150 1155 Leu Val Ser Val Asn Phe Ile Asn Lys Glu Ser
Tyr Leu Gln Ile 1160 1165 1170 Pro Ser Ala Lys Val Arg Pro Gln Thr
Asn Ile Thr Leu Gln Ile 1175 1180 1185 Ala Thr Asp Glu Asp Ser Gly
Ile Leu Leu Tyr Lys Gly Asp Lys 1190 1195 1200 Asp His Ile Ala Val
Glu Leu Tyr Arg Gly Arg Val Arg Ala Ser 1205 1210 1215 Tyr Asp Thr
Gly Ser His Pro Ala Ser Ala Ile Tyr Ser Val Glu 1220 1225 1230 Thr
Ile Asn Asp Gly Asn Phe His Ile Val Glu Leu Leu Ala Leu 1235 1240
1245 Asp Gln Ser Leu Ser Leu Ser Val Asp Gly Gly Asn Pro Lys Ile
1250 1255 1260 Ile Thr Asn Leu Ser Lys Gln Ser Thr Leu Asn Phe Asp
Ser Pro 1265 1270 1275 Leu Tyr Val Gly Gly Met Pro Gly Lys Ser Asn
Val Ala Ser Leu 1280 1285 1290 Arg Gln Ala Pro Gly Gln Asn Gly Thr
Ser Phe His Gly Cys Ile 1295 1300 1305 Arg Asn Leu Tyr Ile Asn Ser
Glu Leu Gln Asp Phe Gln Lys Val 1310 1315 1320 Pro Met Gln Thr Gly
Ile Leu Pro Gly Cys Glu Pro Cys His Lys 1325 1330 1335 Lys Val Cys
Ala His Gly Thr Cys Gln Pro Ser Ser Gln Ala Gly 1340 1345 1350 Phe
Thr Cys Glu Cys Gln Glu Gly Trp Met Gly Pro Leu Cys Asp 1355 1360
1365 Gln Arg Thr Asn Asp Pro Cys Leu Gly Asn Lys Cys Val His Gly
1370 1375 1380 Thr Cys Leu Pro Ile Asn Ala Phe Ser Tyr Ser Cys Lys
Cys Leu 1385 1390 1395 Glu Gly His Gly Gly Val Leu Cys Asp Glu Glu
Glu Asp Leu Phe 1400 1405 1410 Asn Pro Cys Gln Ala Ile Lys Cys Lys
His Gly Lys Cys Arg Leu 1415 1420 1425 Ser Gly Leu Gly Gln Pro Tyr
Cys Glu Cys Ser Ser Gly Tyr Thr 1430 1435 1440 Gly Asp Ser Cys Asp
Arg Glu Ile Ser Cys Arg Gly Glu Arg Ile 1445 1450 1455 Arg Asp Tyr
Tyr Gln Lys Gln Gln Gly Tyr Ala Ala Cys Gln Thr 1460 1465 1470 Thr
Lys Lys Val Ser Arg Leu Glu Cys Arg Gly Gly Cys Ala Gly 1475 1480
1485 Gly Gln Cys Cys Gly Pro Leu Arg Ser Lys Arg Arg Lys Tyr Ser
1490 1495 1500 Phe Glu Cys Thr Asp Gly Ser Ser Phe Val Asp Glu Val
Glu Lys 1505 1510 1515 Val Val Lys Cys Gly Cys Thr Arg Cys Val Ser
1520 1525 68 4900 DNA Homo sapiens 68 cagagcaggg tggagagggc
ggtgggaggc gtgtgcctga gtgggctcta ctgccttgtt 60 ccatattatt
ttgtgcacat tttccctggc actctgggtt gctagccccg ccgggcactg 120
ggcctcagac actgcgcggt tccctcggag cagcaagcta aagaaagccc ccagtgccgg
180 cgaggaagga ggcggcgggg aaagatgcgc ggcgttggct ggcagatgct
gtccctgtcg 240 ctggggttag tgctggcgat cctgaacaag gtggcaccgc
aggcgtgccc ggcgcagtgc 300 tcttgctcgg gcagcacagt ggactgtcac
gggctggcgc tgcgcagcgt gcccaggaat 360 atcccccgca acaccgagag
actggattta aatggaaata acatcacaag aattacgaag 420 acagattttg
ctggtcttag acatctaaga gttcttcagc ttatggagaa taagattagc 480
accattgaaa gaggagcatt ccaggatctt aaagaactag agagactgcg tttaaacaga
540 aatcaccttc agctgtttcc tgagttgctg tttcttggga ctgcgaagct
atacaggctt 600 gatctcagtg aaaaccaaat tcaggcaatc ccaaggaaag
ctttccgtgg ggcagttgac 660 ataaaaaatt tgcaactgga ttacaaccag
atcagctgta ttgaagatgg ggcattcagg 720 gctctccggg acctggaagt
gctcactctc aacaataaca acattactag actttctgtg 780 gcaagtttca
accatatgcc taaacttagg acttttcgac tgcattcaaa caacctgtat 840
tgtgactgcc acctggcctg gctctccgac tggcttcgcc aaaggcctcg ggttggtctg
900 tacactcagt gtatgggccc ctcccacctg agaggccata atgtagccga
ggttcaaaaa 960 cgagaatttg tctgcagtgg tcaccagtca tttatggctc
cttcttgtag tgttttgcac 1020 tgccctgccg cctgtacctg tagcaacaat
atcgtagact gtcgtgggaa aggtctcact 1080 gagatcccca caaatcttcc
agagaccatc acagaaatac gtttggaaca gaacacaatc 1140 aaagtcatcc
ctcctggagc tttctcacca tataaaaagc ttagacgaat tgacctgagc 1200
aataatcaga tctctgaact tgcaccagat gctttccaag gactacgctc tctgaattca
1260 cttgtcctct atggaaataa aatcacagaa ctccccaaaa gtttatttga
aggactgttt 1320 tccttacagc tcctattatt gaatgccaac aagataaact
gccttcgggt agatgctttt 1380 caggatctcc acaacttgaa ccttctctcc
ctatatgaca acaagcttca gaccatcgcc 1440 aaggggacct tttcacctct
tcgggccatt caaactatgc atttggccca gaaccccttt 1500 atttgtgact
gccatctcaa gtggctagcg gattatctcc ataccaaccc gattgagacc 1560
agtggtgccc gttgcaccag cccccgccgc ctggcaaaca aaagaattgg acagatcaaa
1620 agcaagaaat tccgttgttc agctaaagaa cagtatttca ttccaggtac
agaagattat 1680 cgatcaaaat taagtggaga ctgctttgcg gatctggctt
gccctgaaaa gtgtcgctgt 1740 gaaggaacca cagtagattg ctctaatcaa
aagctcaaca aaatcccgga gcacattccc 1800 cagtacactg cagagttgcg
tctcaataat aatgaattta ccgtgttgga agccacagga 1860 atctttaaga
aacttcctca attacgtaaa ataaacttta gcaacaataa gatcacagat 1920
attgaggagg gagcatttga aggagcatct ggtgtaaatg aaatacttct tacgagtaat
1980 cgtttggaaa atgtgcagca taagatgttc aagggattgg aaagcctcaa
aactttgatg 2040 ttgagaagca atcgaataac ctgtgtgggg aatgacagtt
tcataggact cagttctgtg 2100 cgtttgcttt ctttgtatga taatcaaatt
actacagttg caccaggggc atttgatact 2160 ctccattctt tatctactct
aaacctcttg gccaatcctt ttaactgtaa ctgctacctg 2220 gcttggttgg
gagagtggct gagaaagaag agaattgtca cgggaaatcc tagatgtcaa 2280
aaaccatact tcctgaaaga aatacccatc caggatgtgg ccattcagga cttcacttgt
2340 gatgacggaa atgatgacaa tagttgctcc ccactttctc gctgtcctac
tgaatgtact 2400 tgcttggata cagtcgtccg atgtagcaac aagggtttga
aggtcttgcc gaaaggtatt 2460 ccaagagatg tcacagagtt gtatctggat
ggaaaccaat ttacactggt tcccaaggaa 2520 ctctccaact acaaacattt
aacacttata gacttaagta acaacagaat aagcacgctt 2580 tctaatcaga
gcttcagcaa catgacccag ctcctcacct taattcttag ttacaaccgt 2640
ctgagatgta ttcctcctcg cacctttgat ggattaaagt ctcttcgatt actttctcta
2700 catggaaatg acatttctgt tgtgcctgaa ggtgctttca atgatctttc
tgcattatca 2760 catctagcaa ttggagccaa ccctctttac tgtgattgta
acatgcagtg gttatccgac 2820 tgggtgaagt cggaatataa ggagcctgga
attgctcgtt gtgctggtcc tggagaaatg 2880 gcagataaac ttttactcac
aactccctcc aaaaaattta cctgtcaagg tcctgtggat 2940 gtcaatattc
tagctaagtg taacccctgc ctatcaaatc cgtgtaaaaa tgatggcaca 3000
tgtaatagtg atccagttga cttttaccga tgcacctgtc catatggttt caaggggcag
3060 gactgtgatg tcccaattca tgcctgcatc agtaacccat gtaaacatgg
aggaacttgc 3120 cacttaaagg aaggagaaga agatggattc tggtgtattt
gtgctgatgg atttgaagga 3180 gaaaattgtg aagtcaacgt tgatgattgt
gaagataatg actgtgaaaa taattctaca 3240 tgtgtcgatg gcattaataa
ctacacatgc ctttgcccac ctgagtatac aggtgagttg 3300 tgtgaggaga
agctggactt ctgtgcccag gacctgaacc cctgccagca cgattcaaag 3360
tgcatcctaa ctccaaaggg attcaaatgt gactgcacac cagggtacgt aggtgaacac
3420 tgcgacatcg attttgacga ctgccaagac aacaagtgta aaaacggagc
ccactgcaca 3480 gatgcagtga acggctatac gtgcatatgc cccgaaggtt
acagtggctt gttctgtgag 3540 ttttctccac ccatggtcct ccctcgtacc
agcccctgtg ataattttga ttgtcagaat 3600 ggagctcagt gtatcgtcag
aataaatgag ccaatatgtc agtgtttgcc tggctatcag 3660 ggagaaaagt
gtgaaaaatt ggttagtgtg aattttataa acaaagagtc ttatcttcag 3720
attccttcag ccaaggttcg gcctcagacg aacataacac ttcagattgc cacagatgaa
3780 gacagcggaa tcctcctgta taagggtgac aaagaccata tcgcggtaga
actctatcgg 3840 gggcgtgttc gtgccagcta tgacaccggc tctcatccag
cttctgccat ttacagtgtg 3900 gagacaatca atgatggaaa cttccacatt
gtggaactac ttgccttgga tcagagtctc 3960 tctttgtccg tggatggtgg
gaaccccaaa atcatcacta acttgtcaaa gcagtccact 4020 ctgaattttg
actctccact ctatgtagga ggcatgccag ggaagagtaa cgtggcatct 4080
ctgcgccagg cccctgggca gaacggaacc agcttccacg gctgcatccg gaacctttac
4140 atcaacagtg agctgcagga cttccagaag gtgccgatgc aaacaggcat
tttgcctggc 4200 tgtgagccat gccacaagaa ggtgtgtgcc catggcacat
gccagcccag cagccaggca 4260 ggcttcacct gcgagtgcca ggaaggatgg
atggggcccc tctgtgacca acggaccaat 4320 gacccttgcc ttggaaataa
atgcgtacat ggcacctgct tgcccatcaa tgcgttctcc 4380 tacagctgta
agtgcttgga gggccatgga ggtgtcctct gtgatgaaga ggaggatctg 4440
tttaacccat gccaggcgat caagtgcaag cacgggaagt gcaggctttc aggtctgggg
4500 cagccctact gtgaatgcag cagtggatac acgggggaca gctgtgatcg
agaaatctct 4560 tgtcgagggg aaaggataag agattattac caaaagcagc
agggctatgc tgcttgccaa 4620 acaaccaaga aggtgtcccg attagagtgc
agaggtgggt gtgcaggagg gcagtgctgt 4680 ggaccgctga ggagcaagcg
gcggaaatac tctttcgaat gcactgacgg ctcctccttt 4740 gtggacgagg
ttgagaaagt ggtgaagtgc ggctgtacga ggtgtgtgtc ctaaacacac 4800
tcccggcagc tctgtctttg gaaaaggttg tatacttctt gaccatgtgg gactaatgaa
4860 tgcttcatag tggaaatatt tgaaatatat tgtaaaatac 4900 69 348 PRT
Cricetulus griseus 69 Met His Leu Pro Pro Ala Ala Ala Val Gly Leu
Leu Leu Leu Leu Leu 1 5 10 15 Pro Pro Pro Ala Arg Val Ala Ser Arg
Lys Pro Thr Met Cys Gln Arg 20 25 30 Cys Arg Ala Leu Val Asp Lys
Phe Asn Gln Gly Met Ala Asn Thr Ala 35 40 45 Arg Lys Asn Phe Gly
Gly Gly Asn Thr Ala Trp Glu Glu Lys Ser Leu 50 55 60 Ser Lys Tyr
Glu Phe Ser Glu Ile Arg Leu Leu Glu Ile Met Glu Gly 65 70 75 80 Leu
Cys Asp Ser Asn Asp Phe Glu Cys Asn Gln Leu Leu Glu Gln His 85 90
95 Glu Glu Gln Leu Glu Ala Trp Trp Gln Thr Leu Lys Lys Glu Cys Pro
100 105 110 Asn Leu Phe Glu Trp Phe Cys Val His Thr Leu Lys Ala Cys
Cys Leu 115 120 125 Pro Gly Thr Tyr Gly Pro Asp Cys Gln Glu Cys Gln
Gly Gly Ser Gln 130 135 140 Arg Pro Cys Ser Gly Asn Gly His Cys Asp
Gly Asp Gly Ser Arg Gln 145 150 155 160 Gly Asp Gly Ser Cys Gln Cys
His Val Gly Tyr Lys Gly Pro Leu Cys 165 170 175 Ile Asp Cys Met Asp
Gly Tyr Phe Ser Leu Leu Arg Asn Glu Thr His 180 185 190 Ser Phe Cys
Thr Ala Cys Asp Glu Ser Cys Lys Thr Cys Ser Gly Pro 195 200 205 Thr
Asn Lys Gly Cys Val Glu Cys Glu Val Gly Trp Thr Arg Val Glu 210 215
220 Asp Ala Cys Val Asp Val Asp Glu Cys Ala Ala Glu Thr Pro Pro Cys
225 230 235 240 Ser Asn Val Gln Tyr Cys Glu Asn Val Asn Gly Ser Tyr
Thr Cys Glu 245 250 255 Glu Cys Asp Ser Thr Cys Val Gly Cys Thr Gly
Lys Gly Pro Ala Asn 260 265 270 Cys Lys Glu Cys Ile Ser Gly Tyr Ser
Lys Gln Lys Gly Glu Cys Ala 275 280 285 Asp Ile Asp Glu Cys Ser Leu
Glu Thr Lys Val Cys Lys Lys Glu Asn 290 295 300 Glu Asn Cys Tyr Asn
Thr Pro Gly Ser Phe Val Cys Val Cys Pro Glu 305 310 315 320 Gly Phe
Glu Glu Asp Arg Arg Cys Leu Cys Thr Asp Ser Arg Arg Arg 325 330 335
Ser Gly Arg Gly Lys Ser His Thr Ala Thr Leu Pro 340 345 70 1399 DNA
Cricetulus griseus 70 gtagccgggg gaacggccgg cgcgcttgcc ggtgggcgga
ggcgagactc cacagcagtt 60 ctctgccggt cgcccgcgag tgcacccgcc
atgcacctgc cgcccgctgc cgcagtcggg 120 ctgctactgc tgctgctgcc
gcctcccgcg cgcgtggcct cccggaagcc gacaatgtgc 180 cagaggtgcc
gggcgctggt ggacaagttc aaccagggga tggccaacac ggccaggaag 240
aatttcggcg gcggcaacac ggcgtgggag gagaagagtc tgtccaagta cgaattcagt
300 gagattcggc tcctggagat tatggagggc ctgtgtgaca gcaacgactt
tgaatgcaac 360 caactcttgg aacagcatga ggagcagcta gaggcctggt
ggcagacact gaagaaggag 420 tgccctaacc tatttgagtg gttctgtgta
cacacactga aagcatgctg tcttccaggc 480 acctatgggc cagactgtca
ggaatgccag ggtgggtctc agaggccttg tagcgggaat 540 ggccactgcg
acggagatgg cagcagacag ggcgacgggt cctgccagtg tcacgtagga 600
tacaaggggc cgctgtgtat cgactgcatg gatggctact tcagcttgct gaggaacgag
660 acccacagct tctgcacagc ctgtgatgag tcctgcaaga catgctcagg
tccaaccaac 720 aaaggctgtg tggagtgcga agtgggctgg acacgtgtgg
aggatgcctg tgtggatgtt 780 gacgagtgtg cagcagagac cccaccctgc
agcaatgtac agtactgtga aaatgtcaac 840 ggctcctaca catgtgaaga
gtgtgattct acctgtgtgg gctgcacagg aaaaggccca 900 gccaattgta
aagagtgtat ctctggctac agcaagcaga aaggagagtg tgcagatata 960
gatgaatgct cattagaaac aaaggtgtgt aagaaggaaa atgagaactg ctacaatact
1020 ccagggagct ttgtctgcgt gtgtccggaa ggtttcgagg aagacagaag
atgcttgtgt 1080 acagacagca gaaggcgaag tggcagagga aagtcccaca
cagccaccct cccatgagga 1140 tttgtgacgg gcatccaggt tcagaagctg
gactctcacc cttttaagtt attgagagga 1200 catcctatag aaaatgtggc
ccatggacat caaccccatt tctccaggaa gttttggagg 1260 aagaagctgc
ctgctttgaa acagtagata ctcacttggc cctttaaaac gctgcatttc 1320
ttggtggttc ttaaacagat tcgtatattt tgatactgtt ctttataata aaattgatca
1380 ttgaaggtca ccaggaaca 1399 71 528 PRT Homo sapiens 71 Met Ala
Gln Leu Phe Leu Pro Leu Leu Ala Ala Leu Val Leu Ala Gln 1 5 10 15
Ala Pro Ala Ala Leu Ala Asp Val Leu Glu Gly Asp Ser Ser Glu Asp 20
25 30 Arg Ala Phe Arg Val Arg Ile Ala Gly Asp Ala Pro Leu Gln Gly
Val 35 40 45 Leu Gly Gly Ala Leu Thr Ile Pro Cys His Val His Tyr
Leu Arg Pro 50 55 60 Pro Pro Ser Arg Arg Ala Val Leu Gly Ser Pro
Arg Val Lys Trp Thr 65 70 75 80 Phe Leu Ser Arg Gly Arg Glu Ala Glu
Val Leu Val Ala Arg Gly Val 85 90 95 Arg Val Lys Val Asn Glu Ala
Tyr Arg Phe Arg Val Ala Leu Pro Ala 100 105 110 Tyr Pro Ala Ser Leu
Thr Asp Val Ser Leu Ala Leu Ser Glu Leu Arg 115 120 125 Pro Asn Asp
Ser Gly Ile Tyr Arg Cys Glu Val Gln His Gly Ile Asp 130 135 140 Asp
Ser Ser Asp Ala Val Glu Ser Ser Gln Arg Tyr Pro Ile Gln Thr 145 150
155 160 Pro Arg Glu Ala Cys Tyr Gly Asp Met Asp Gly Phe Pro Gly Val
Arg 165 170 175 Asn Tyr Gly Val Val Asp Pro Asp Asp Leu Tyr Asp Val
Tyr Cys Tyr 180 185 190 Ala Glu Asp Leu Asn Gly Glu Leu Phe Leu Gly
Asp Pro Pro Glu Lys 195 200 205 Leu Thr Leu Glu Glu Ala Arg Ala Tyr
Cys Gln Glu Arg Gly Ala Glu 210 215 220 Ile Ala Thr Thr Gly Gln Leu
Tyr Ala Ala Trp Asp Gly Gly Leu Asp 225 230 235 240 His Cys Ser Pro
Gly Trp Leu Ala Asp Gly Ser Val Arg Tyr Pro Ile 245 250 255 Val Thr
Pro Ser Gln Arg Cys Gly Gly Gly Leu Pro Gly Val Lys Thr 260 265 270
Leu Phe Leu Phe Pro Asn Gln Thr Gly Phe Pro Asn Lys His Ser Arg 275
280 285 Phe Asn Val Tyr Cys Phe Arg Asp Ser Ala Gln Leu Leu Pro Ser
Leu 290 295 300 Arg Pro Pro Thr Gln Pro Pro Thr Gln Leu Asp Gly Leu
Glu Ala Ile 305 310 315 320 Val Thr Val Thr Glu Thr Leu Glu Glu Leu
Gln Leu Pro Gln Glu Ala 325 330 335 Thr Glu Ser Glu Ser Arg Gly Ala
Ile Tyr Ser Ile Pro Ile Met Glu 340 345 350 Asp Gly Gly Gly Gly Ser
Ser Thr Pro Glu Asp Pro Ala Glu Ala Pro 355 360 365 Arg Thr Leu Leu
Glu Phe Glu Thr Gln Ser Met Val Pro Pro Thr Gly 370 375 380 Phe Ser
Glu Glu Glu Gly Lys Ala Leu Glu Glu Glu Glu Lys Tyr Glu 385 390 395
400 Asp Glu Glu Glu Lys Glu Glu Glu Glu Glu Glu Glu Glu Val Glu Asp
405 410 415 Glu Ala Leu Trp Ala Trp Pro Ser Glu Leu Ser Ser Pro Gly
Pro Glu 420 425 430 Ala Ser Leu Pro Thr Glu Pro Ala Ala Gln Glu Glu
Ser Leu Ser Gln 435 440 445 Ala Pro Ala Arg Ala Val Leu Gln Pro Gly
Ala Ser Pro Leu Pro Asp 450 455 460 Gly Glu Ser Glu Ala Ser Arg Pro
Pro Arg Val His Gly Pro Pro Thr 465 470 475 480 Glu Thr Leu Pro Thr
Pro Arg Glu Arg Asn Leu Ala Ser Pro Ser Pro 485 490 495 Ser Thr Leu
Val Glu Ala Arg Glu Val Gly Glu Ala Thr Gly Gly Pro 500 505 510 Glu
Leu Ser Gly Val Pro Arg Gly Gly Ala Arg Thr Gln Phe
Ala Leu 515 520 525 72 883 PRT Mus sp. 72 Met Ile Pro Leu Leu Leu
Ser Leu Leu Ala Ala Leu Val Leu Thr Gln 1 5 10 15 Ala Pro Ala Ala
Leu Ala Asp Asp Leu Lys Glu Asp Ser Ser Glu Asp 20 25 30 Arg Ala
Phe Arg Val Arg Ile Gly Ala Ala Gln Leu Arg Gly Val Leu 35 40 45
Gly Gly Ala Leu Ala Ile Pro Cys His Val His His Leu Arg Pro Pro 50
55 60 Arg Ser Arg Arg Ala Ala Pro Gly Phe Pro Arg Val Lys Trp Thr
Phe 65 70 75 80 Leu Ser Gly Asp Arg Glu Val Glu Val Leu Val Ala Arg
Gly Leu Arg 85 90 95 Val Lys Val Asn Glu Ala Tyr Arg Phe Arg Val
Ala Leu Pro Ala Tyr 100 105 110 Pro Ala Ser Leu Thr Asp Val Ser Leu
Val Leu Ser Glu Leu Arg Pro 115 120 125 Asn Asp Ser Gly Val Tyr Arg
Cys Glu Val Gln His Gly Ile Asp Asp 130 135 140 Ser Ser Asp Ala Val
Glu Val Lys Val Lys Gly Val Val Phe Leu Tyr 145 150 155 160 Arg Glu
Gly Ser Ala Arg Tyr Ala Phe Ser Phe Ala Gly Ala Gln Glu 165 170 175
Ala Cys Ala Arg Ile Gly Ala Arg Ile Ala Thr Pro Glu Gln Leu Tyr 180
185 190 Ala Ala Tyr Leu Gly Gly Tyr Glu Gln Cys Asp Ala Gly Trp Leu
Ser 195 200 205 Asp Gln Thr Val Arg Tyr Pro Ile Gln Asn Pro Arg Glu
Ala Cys Ser 210 215 220 Gly Asp Met Asp Gly Tyr Pro Gly Val Arg Asn
Tyr Gly Val Val Gly 225 230 235 240 Pro Asp Asp Leu Tyr Asp Val Tyr
Cys Tyr Ala Glu Asp Leu Asn Gly 245 250 255 Glu Leu Phe Leu Gly Ala
Pro Pro Ser Lys Leu Thr Trp Glu Glu Ala 260 265 270 Arg Asp Tyr Cys
Leu Glu Arg Gly Ala Gln Ile Ala Ser Thr Gly Gln 275 280 285 Leu Tyr
Ala Ala Trp Asn Gly Gly Leu Asp Arg Cys Ser Pro Gly Trp 290 295 300
Leu Ala Asp Gly Ser Val Arg Tyr Pro Ile Ile Thr Pro Ser Gln Arg 305
310 315 320 Cys Gly Gly Gly Leu Pro Gly Val Lys Thr Leu Phe Leu Phe
Pro Asn 325 330 335 Gln Thr Gly Phe Pro Ser Lys Gln Asn Arg Phe Asn
Val Tyr Cys Phe 340 345 350 Arg Asp Ser Ala His Pro Ser Ala Ser Ser
Glu Ala Ser Ser Pro Ala 355 360 365 Ser Asp Gly Leu Glu Ala Ile Val
Thr Val Thr Glu Lys Leu Glu Glu 370 375 380 Leu Gln Leu Pro Gln Glu
Ala Met Glu Ser Glu Ser Arg Gly Ala Ile 385 390 395 400 Tyr Ser Ile
Pro Ile Ser Glu Asp Gly Gly Gly Gly Ser Ser Thr Pro 405 410 415 Glu
Asp Pro Ala Glu Ala Pro Arg Thr Pro Leu Glu Ser Glu Thr Gln 420 425
430 Ser Ile Ala Pro Pro Thr Glu Ser Ser Glu Glu Glu Gly Val Ala Leu
435 440 445 Glu Glu Glu Glu Arg Phe Lys Asp Leu Glu Ala Leu Glu Glu
Glu Lys 450 455 460 Glu Gln Glu Asp Leu Trp Val Trp Pro Arg Glu Leu
Ser Ser Pro Leu 465 470 475 480 Pro Thr Gly Ser Glu Thr Glu His Ser
Leu Ser Gln Val Ser Pro Pro 485 490 495 Ala Gln Ala Val Leu Gln Leu
Asp Ala Ser Pro Ser Pro Gly Pro Pro 500 505 510 Arg Phe Arg Gly Pro
Pro Ala Glu Thr Leu Leu Pro Pro Arg Glu Trp 515 520 525 Ser Ala Thr
Ser Thr Pro Gly Gly Ala Arg Glu Val Gly Gly Glu Thr 530 535 540 Gly
Ser Pro Glu Leu Ser Gly Val Pro Arg Glu Ser Glu Glu Ala Gly 545 550
555 560 Ser Ser Ser Leu Glu Asp Gly Pro Ser Leu Leu Pro Ala Thr Trp
Ala 565 570 575 Pro Val Gly Pro Arg Glu Leu Glu Thr Pro Ser Glu Glu
Lys Ser Gly 580 585 590 Arg Thr Val Leu Ala Gly Thr Ser Val Gln Ala
Gln Pro Val Leu Pro 595 600 605 Thr Asp Ser Ala Ser His Gly Gly Val
Ala Val Ala Pro Ser Ser Gly 610 615 620 Asp Cys Ile Pro Ser Pro Cys
His Asn Gly Gly Thr Cys Leu Glu Glu 625 630 635 640 Lys Glu Gly Phe
Arg Cys Leu Cys Leu Pro Gly Tyr Gly Gly Asp Leu 645 650 655 Cys Asp
Val Gly Leu His Phe Cys Ser Pro Gly Trp Glu Ala Phe Gln 660 665 670
Gly Ala Cys Tyr Lys His Phe Ser Thr Arg Arg Ser Trp Glu Glu Ala 675
680 685 Glu Ser Gln Cys Arg Ala Leu Gly Ala His Leu Thr Ser Ile Cys
Thr 690 695 700 Pro Glu Glu Gln Asp Phe Val Asn Asp Arg Tyr Arg Glu
Tyr Gln Trp 705 710 715 720 Ile Gly Leu Asn Asp Arg Thr Ile Glu Gly
Asp Phe Leu Trp Ser Asp 725 730 735 Gly Ala Pro Leu Leu Tyr Glu Asn
Trp Asn Pro Gly Gln Pro Asp Ser 740 745 750 Tyr Phe Leu Ser Gly Glu
Asn Cys Val Val Met Val Trp His Asp Gln 755 760 765 Gly Gln Trp Ser
Asp Val Pro Cys Asn Tyr His Leu Ser Tyr Thr Cys 770 775 780 Lys Met
Gly Leu Val Ser Cys Gly Pro Pro Pro Gln Leu Pro Leu Ala 785 790 795
800 Gln Ile Phe Gly Arg Pro Arg Leu Arg Tyr Ala Val Asp Thr Val Leu
805 810 815 Arg Tyr Arg Cys Arg Asp Gly Leu Ala Gln Arg Asn Leu Pro
Leu Ile 820 825 830 Arg Cys Gln Glu Asn Gly Leu Trp Glu Ala Pro Gln
Ile Ser Cys Val 835 840 845 Pro Arg Arg Pro Gly Arg Ala Leu Arg Ser
Met Asp Ala Pro Glu Gly 850 855 860 Pro Arg Gly Gln Leu Ser Arg His
Arg Lys Ala Pro Leu Thr Pro Pro 865 870 875 880 Ser Ser Leu 73 3153
DNA Mus sp. misc_feature (3043)..(3043) unknown 73 gaggctcccg
gcgagctggc gcccctgtct gggtcccgcg cgcccggccc tgctcgcgcc 60
cgcgcatcgc gccgcagtct cggtctgcgg ctgcgggacg tgacggcgtg cgcggagggg
120 acctcgcaag ttcttccatc agtgtgcaga atgataccac tgcttctgtc
cctgctggcc 180 gctctggtcc tgacccaagc ccctgccgcc ctcgctgatg
acctgaaaga agacagctcg 240 gaggatcgag ccttccgcgt gcgcatcggt
gccgcgcagc tgcggggcgt gctgggcggt 300 gccctggcca tcccatgcca
cgtccaccac ctgcggccgc cgcgcagccg ccgggccgcg 360 ccgggttttc
cccgggtcaa gtggaccttc ctgtccgggg accgggaggt agaggttctg 420
gtggctcgcg ggctgcgcgt caaggtaaac gaagcctacc ggttccgcgt ggcgctgcct
480 gcctaccccg catcgctcac ggatgtgtct ctagtattga gcgaactgcg
gcccaatgat 540 tccggggtct atcgctgcga ggtccagcac ggtatcgacg
acagcagtga tgctgtggag 600 gtcaaggtca aaggggtcgt cttcctctac
agagagggct ctgcgcgcta tgctttctcc 660 ttcgctggag cccaggaagc
ctgcgctcgc ataggagccc gaatcgccac cccggagcag 720 ctctatgctg
cctacctcgg cggctatgag cagtgtgatg caggctggct gtccgaccaa 780
actgtgaggt accccatcca gaacccacga gaggcctgct ctggagacat ggatggctat
840 cctggcgtgc ggaactacgg agtggtgggt cctgatgatc tctatgatgt
ctactgttat 900 gccgaagacc taaatggaga actgttccta ggcgcccctc
ccagcaagct gacatgggag 960 gaggctcggg actactgtct ggaacgtggt
gcacagatcg ctagcacagg ccagctgtac 1020 gcagcctgga atggtggcct
ggacagatgt agccctggct ggctggctga tggcagcgtg 1080 cgctatccca
tcatcacacc cagccaacgc tgtgggggcg gcctgccagg agtcaagacc 1140
ctcttcctct ttcccaacca gactggcttc cccagcaagc agaaccgctt caatgtctac
1200 tgcttccgag actctgccca tccctctgct tcctctgagg cctctagccc
agcctcagat 1260 ggacttgagg ccattgtcac agtgacagaa aagctggagg
aactgcagct gcctcaggaa 1320 gcgatggaga gcgagtctcg tggggccatc
tactccatcc ccatctcaga agatggggga 1380 ggaggaagct ccaccccaga
agacccagca gaggccccca ggactccgct agaatcggaa 1440 acccaatcca
ttgcaccacc taccgagtcc tcagaagagg aaggcgtagc cctggaggaa 1500
gaagaaagat tcaaagactt ggaggctctg gaggaagaga aggagcagga ggacctgtgg
1560 gtgtggccca gagagctcag cagccctctc cctactggct cagaaacaga
gcattcactc 1620 tcccaggtgt ccccaccagc ccaggcagtt ctacagctgg
atgcgtcacc ttctcctggg 1680 cctccaaggt tccgtggacc gcctgcagag
actttgctcc ccccgaggga gtggagcgcc 1740 acatctactc ctggtggggc
aagagaagta gggggggaaa ctgggagccc tgagctctct 1800 ggggttcctc
gagagagcga ggaggcaggg agctccagct tggaggatgg cccttcccta 1860
cttccagcta catgggcccc tgtgggtccc agggagctgg agaccccctc agaagagaag
1920 tctggaagaa ctgtcctggc aggcacctca gtgcaggccc agccagtgct
gcccaccgac 1980 agtgccagcc acggtggagt ggctgtggct ccctcatcag
gtgactgtat ccccagcccc 2040 tgccacaatg gtgggacatg cttggaggag
aaggagggtt tccgctgcct atgtttgcca 2100 ggctatgggg gggacctgtg
cgatgttggc cttcatttct gcagccctgg ctgggaggcc 2160 ttccagggag
cctgctacaa gcacttttcc acacgaagga gttgggagga ggcagaaagt 2220
cagtgccgag cgctaggtgc tcatctgacc agcatctgca cccctgagga gcaagacttt
2280 gtcaatgatc gataccggga gtaccagtgg attgggctca atgacaggac
catcgagggt 2340 gacttcttgt ggtcagatgg tgcccctctg ctctatgaaa
actggaaccc tgggcagcct 2400 gacagctact tcctgtctgg ggagaactgt
gtggtcatgg tgtggcatga ccagggacag 2460 tggagtgatg tgccctgcaa
ctaccatcta tcctacacct gcaagatggg gcttgtgtcc 2520 tgtgggcctc
caccacagct acccctggct caaatatttg gtcgccctcg gctgcgctac 2580
gcggtggata ctgtgcttcg atatcgatgc cgagacgggc tggctcagcg caacctgccg
2640 ttgatccgct gccaggagaa tgggctttgg gaggcccctc agatttcctg
tgtaccccgg 2700 aggcctggcc gtgctctgcg ctccatggac gccccagaag
gaccacgggg acagctctcg 2760 aggcacagga aggcaccgtt gacaccgccc
tccagtctct agggagcctg gaagactgct 2820 gcccccagca ggaccctctc
acatcaactg ccagtgctct tccccatgat agggggtgac 2880 gtgagagggg
tgggactgaa attcagagga cagcgctcga aggggtttct gggaaacact 2940
tgggtggctc cgccccctca cacaagggcc tcaggtttta cccggtaagt ccctaagtgc
3000 ctcaactgcc ctctcatgtc agctgcctcc ttgtccctcg atntcgtnag
gggacactgt 3060 gctattcgat cttgattgtc gaagagtttt taggatggag
taccagcaaa accaggtgga 3120 aataaagttg tctgaaccca aagaaaaaaa aaa
3153 74 74 000 75 75 000 76 76 000 77 77 000 78 78 000 79 79 000 80
80 000 81 2002 DNA gerbil 81 gtcgacccac gcgtccgctg cgttctcacc
cctggaccac cctgggagaa cagttgaccg 60 aagtttgttt ggcagttgct
gctggactat gtttctgctt ctggtggtac tcagccagct 120 gcccagactt
accctcgcgg ttcctcatac aagaagccta aagaattctg aacatgcccc 180
agaaggagtc tttgcatcaa aaaaagcagc aagcatcttt atgcaccgtc gcctcctata
240 caatagattt gatttagaac tcttcactcc cgggaacctg gagagagagt
gctatgagga 300 gttctgtagt tatgaagaag ccagagagat cctcggggac
aacgaagaaa tgatcacatt 360 ctggcgggaa tattcagtca aaggaccaac
cacaagatca gatgtcaaca aagagaaaat 420 tgatgttatg ggccttctga
ctggcttaat tgcggctgga gtattcttgg ttgtttttgg 480 cttacttggt
tactatctgt gtatcaccaa gtgtaatagg cagccatatc aaggttcttc 540
agctgtctac acaagaagga ccaggcacac accgtccatc attttcagaa cccatgagga
600 agctgtcttg tctccatcgt catcctcaga ggacgcggga ctaccttcct
atgaacaggc 660 agtagctctg accagaaaac acagtgtctc accaccacct
ccatatcctg ggccagcaaa 720 aggatttagg gtatttaaaa agtcaatgtc
actcccatct cactaagccc accttgccgc 780 cttgctgtgg tctgaataat
atgttcttcc tgaaacaaca acaacaaaaa aatttgcctg 840 ttcagctttt
tatgacaaag cacaaggaat aaaggaacac tatatacaga acagaattca 900
ccacagcccc gctttcagct ctgcccccaa ctggattgct gtcttggtaa gagacttcta
960 ccgtgcttcc tcgaagttaa gaagaaagtg cctttttgca atgtaaactg
tactggttca 1020 aacattcttg ctacagctag gtacctataa tccccacctt
caggagactt aggcgggagg 1080 gatgagagtt caaggccagc ctgggccctg
tcaggacgct gtctcaaaac aaagtttgtt 1140 atcaatagaa taattagaat
taacaaacta ggattttcag tcttaagtca tgatattgga 1200 tcttctcttc
agtaaggttt ctttttggct agaaatactt catagaattt gacattttgg 1260
tatacatctg tggccttgat acaatgactt gattttctgt tttaattagt gcagaggatt
1320 cagcaaattt gcaggtcttc attttgttcc ctcgctatcc atcgatcatg
tttcagtgta 1380 ttaagaggag tcagccaggc gtggtggccc acacctgtga
tcccagcact taggggggca 1440 taggcaggca gatctctgtg agctgaagga
cagcctggcc tacaaagtcc aggacaaccg 1500 agaccacaca gagaaacctt
gtcttgaaaa acaaaacaaa aacaagagag agagagagag 1560 agagagaaaa
gagatgtcaa gaggtttttg tttttttttt tttaaattac tatttatggg 1620
cctcacttgg aaaagtgctt gccatgcaaa tagaaggaca ggagttcaat cctcattacc
1680 cacatttgaa acaaataaca agaaaaacaa accaaaaaac caaaacaaac
aaaatcttga 1740 gaacttgagt gaataccggt aacctcaggg ctaggcactg
taactgaatc aggagcctcc 1800 agatccaggg aaacgctgtc tcaacaaata
aataaataag taagtcagtg aggtggtctt 1860 taaacccagc acttgagagc
caaaggcagg cagagctcag tgagttggag accagcctgg 1920 tctacaaagc
aagttctaag ggagccaggg cacagagaaa ccctgtctga aggaaaaaaa 1980
aaaaaaaaaa aagggcggcc gc 2002 82 675 DNA gerbil 82 atgtttctgc
ttctggtggt actcagccag ctgcccagac ttaccctcgc ggttcctcat 60
acaagaagcc taaagaattc tgaacatgcc ccagaaggag tctttgcatc aaaaaaagca
120 gcaagcatct ttatgcaccg tcgcctccta tacaatagat ttgatttaga
actcttcact 180 cccgggaacc tggagagaga gtgctatgag gagttctgta
gttatgaaga agccagagag 240 atcctcgggg acaacgaaga aatgatcaca
ttctggcggg aatattcagt caaaggacca 300 accacaagat cagatgtcaa
caaagagaaa attgatgtta tgggccttct gactggctta 360 attgcggctg
gagtattctt ggttgttttt ggcttacttg gttactatct gtgtatcacc 420
aagtgtaata ggcagccata tcaaggttct tcagctgtct acacaagaag gaccaggcac
480 acaccgtcca tcattttcag aacccatgag gaagctgtct tgtctccatc
gtcatcctca 540 gaggacgcgg gactaccttc ctatgaacag gcagtagctc
tgaccagaaa acacagtgtc 600 tcaccaccac ctccatatcc tgggccagca
aaaggattta gggtatttaa aaagtcaatg 660 tcactcccat ctcac 675 83 225
PRT gerbil 83 Met Phe Leu Leu Leu Val Val Leu Ser Gln Leu Pro Arg
Leu Thr Leu 1 5 10 15 Ala Val Pro His Thr Arg Ser Leu Lys Asn Ser
Glu His Ala Pro Glu 20 25 30 Gly Val Phe Ala Ser Lys Lys Ala Ala
Ser Ile Phe Met His Arg Arg 35 40 45 Leu Leu Tyr Asn Arg Phe Asp
Leu Glu Leu Phe Thr Pro Gly Asn Leu 50 55 60 Glu Arg Glu Cys Tyr
Glu Glu Phe Cys Ser Tyr Glu Glu Ala Arg Glu 65 70 75 80 Ile Leu Gly
Asp Asn Glu Glu Met Ile Thr Phe Trp Arg Glu Tyr Ser 85 90 95 Val
Lys Gly Pro Thr Thr Arg Ser Asp Val Asn Lys Glu Lys Ile Asp 100 105
110 Val Met Gly Leu Leu Thr Gly Leu Ile Ala Ala Gly Val Phe Leu Val
115 120 125 Val Phe Gly Leu Leu Gly Tyr Tyr Leu Cys Ile Thr Lys Cys
Asn Arg 130 135 140 Gln Pro Tyr Gln Gly Ser Ser Ala Val Tyr Thr Arg
Arg Thr Arg His 145 150 155 160 Thr Pro Ser Ile Ile Phe Arg Thr His
Glu Glu Ala Val Leu Ser Pro 165 170 175 Ser Ser Ser Ser Glu Asp Ala
Gly Leu Pro Ser Tyr Glu Gln Ala Val 180 185 190 Ala Leu Thr Arg Lys
His Ser Val Ser Pro Pro Pro Pro Tyr Pro Gly 195 200 205 Pro Ala Lys
Gly Phe Arg Val Phe Lys Lys Ser Met Ser Leu Pro Ser 210 215 220 His
225 84 17 PRT gerbil 84 Met Phe Leu Leu Leu Val Val Leu Ser Gln Leu
Pro Arg Leu Thr Leu 1 5 10 15 Ala 85 208 PRT gerbil 85 Val Pro His
Thr Arg Ser Leu Lys Asn Ser Glu His Ala Pro Glu Gly 1 5 10 15 Val
Phe Ala Ser Lys Lys Ala Ala Ser Ile Phe Met His Arg Arg Leu 20 25
30 Leu Tyr Asn Arg Phe Asp Leu Glu Leu Phe Thr Pro Gly Asn Leu Glu
35 40 45 Arg Glu Cys Tyr Glu Glu Phe Cys Ser Tyr Glu Glu Ala Arg
Glu Ile 50 55 60 Leu Gly Asp Asn Glu Glu Met Ile Thr Phe Trp Arg
Glu Tyr Ser Val 65 70 75 80 Lys Gly Pro Thr Thr Arg Ser Asp Val Asn
Lys Glu Lys Ile Asp Val 85 90 95 Met Gly Leu Leu Thr Gly Leu Ile
Ala Ala Gly Val Phe Leu Val Val 100 105 110 Phe Gly Leu Leu Gly Tyr
Tyr Leu Cys Ile Thr Lys Cys Asn Arg Gln 115 120 125 Pro Tyr Gln Gly
Ser Ser Ala Val Tyr Thr Arg Arg Thr Arg His Thr 130 135 140 Pro Ser
Ile Ile Phe Arg Thr His Glu Glu Ala Val Leu Ser Pro Ser 145 150 155
160 Ser Ser Ser Glu Asp Ala Gly Leu Pro Ser Tyr Glu Gln Ala Val Ala
165 170 175 Leu Thr Arg Lys His Ser Val Ser Pro Pro Pro Pro Tyr Pro
Gly Pro 180 185 190 Ala Lys Gly Phe Arg Val Phe Lys Lys Ser Met Ser
Leu Pro Ser His 195 200 205 86 95 PRT gerbil 86 Val Pro His Thr Arg
Ser Leu Lys Asn Ser Glu His Ala Pro Glu Gly 1 5 10 15 Val Phe Ala
Ser Lys Lys Ala Ala Ser Ile Phe Met His Arg Arg Leu 20 25 30 Leu
Tyr Asn Arg Phe Asp Leu Glu Leu Phe Thr Pro Gly Asn Leu Glu 35 40
45 Arg Glu Cys Tyr Glu Glu Phe Cys Ser Tyr Glu Glu Ala Arg Glu Ile
50 55 60 Leu Gly Asp Asn Glu Glu Met Ile Thr Phe Trp Arg Glu Tyr
Ser Val 65 70 75 80 Lys Gly Pro Thr Thr Arg Ser Asp Val Asn Lys Glu
Lys Ile Asp 85 90 95 87 25 PRT gerbil 87 Val Met Gly Leu Leu Thr
Gly Leu Ile Ala Ala Gly
Val Phe Leu Val 1 5 10 15 Val Phe Gly Leu Leu Gly Tyr Tyr Leu 20 25
88 88 PRT gerbil 88 Cys Ile Thr Lys Cys Asn Arg Gln Pro Tyr Gln Gly
Ser Ser Ala Val 1 5 10 15 Tyr Thr Arg Arg Thr Arg His Thr Pro Ser
Ile Ile Phe Arg Thr His 20 25 30 Glu Glu Ala Val Leu Ser Pro Ser
Ser Ser Ser Glu Asp Ala Gly Leu 35 40 45 Pro Ser Tyr Glu Gln Ala
Val Ala Leu Thr Arg Lys His Ser Val Ser 50 55 60 Pro Pro Pro Pro
Tyr Pro Gly Pro Ala Lys Gly Phe Arg Val Phe Lys 65 70 75 80 Lys Ser
Met Ser Leu Pro Ser His 85 89 89 000 90 90 000 91 91 000 92 962 DNA
Mus sp. 92 ccgtttctct ttaaccactt gcacggtctg gggttaaccc gcctgcggac
tctggacctc 60 tcctccaact ggctgaaaca tatctccatc cctgagttgg
ctgcactgcc aacttatctc 120 aagaacaggc tctacctgca caacaacccg
ctgccctgtg actgcagcct ctaccacctg 180 ctccggcgct ggcaccagcg
gggcctgagt gccctgcatg attttgaacg cgagtacaca 240 tgcttggtct
ttaaggtgtc agagtcccga gtgcgctttt ttgagcacag ccgggtcttc 300
aagaactgct ctgtggctgc agctccaggc ttagagctgc ctgaagagca gctgcacgcg
360 caggtgggcc agtccctgag gctcttctgc aacaccagtg tgcctgccac
tcgggtggcc 420 tgggtctccc cgaagaatga gctgcttgtg gcgccagcct
ctcaggatgg tagcatcgct 480 gtgttggctg atggcagctt agccataggc
agggtgcaag agcagcacgc aggcgtcttt 540 gtgtgcctgg ccagtgggcc
ccgcctgcac cacaaccaga cacttgagta caatgtgagt 600 gtgcaaaagg
ctcgccccga gccagagact ttcaacacag gctttaccac cctgctgggc 660
tgtattgtgg gcctggtgct ggtgttgctc tacttgtttg caccaccctg tcgtggctgc
720 tgtcactgct gtcagcgggc ctgccgcaac cgttgctggc cccgggcatc
cagtccactc 780 caggagctga gcgcacagtc ctccatgctt agcactacgc
caccagatgc acccagccgc 840 aaggccagtg tccacaagca tgtggtcttc
ctggagccgg gcaagaaggg cctcaatggc 900 cgtgtgcagc tcgcagtacc
tccagactcc gatctgtgca accccatggg cttgcaactc 960 aa 962 93 320 PRT
Mus sp. 93 Pro Phe Leu Phe Asn His Leu His Gly Leu Gly Leu Thr Arg
Leu Arg 1 5 10 15 Thr Leu Asp Leu Ser Ser Asn Trp Leu Lys His Ile
Ser Ile Pro Glu 20 25 30 Leu Ala Ala Leu Pro Thr Tyr Leu Lys Asn
Arg Leu Tyr Leu His Asn 35 40 45 Asn Pro Leu Pro Cys Asp Cys Ser
Leu Tyr His Leu Leu Arg Arg Trp 50 55 60 His Gln Arg Gly Leu Ser
Ala Leu His Asp Phe Glu Arg Glu Tyr Thr 65 70 75 80 Cys Leu Val Phe
Lys Val Ser Glu Ser Arg Val Arg Phe Phe Glu His 85 90 95 Ser Arg
Val Phe Lys Asn Cys Ser Val Ala Ala Ala Pro Gly Leu Glu 100 105 110
Leu Pro Glu Glu Gln Leu His Ala Gln Val Gly Gln Ser Leu Arg Leu 115
120 125 Phe Cys Asn Thr Ser Val Pro Ala Thr Arg Val Ala Trp Val Ser
Pro 130 135 140 Lys Asn Glu Leu Leu Val Ala Pro Ala Ser Gln Asp Gly
Ser Ile Ala 145 150 155 160 Val Leu Ala Asp Gly Ser Leu Ala Ile Gly
Arg Val Gln Glu Gln His 165 170 175 Ala Gly Val Phe Val Cys Leu Ala
Ser Gly Pro Arg Leu His His Asn 180 185 190 Gln Thr Leu Glu Tyr Asn
Val Ser Val Gln Lys Ala Arg Pro Glu Pro 195 200 205 Glu Thr Phe Asn
Thr Gly Phe Thr Thr Leu Leu Gly Cys Ile Val Gly 210 215 220 Leu Val
Leu Val Leu Leu Tyr Leu Phe Ala Pro Pro Cys Arg Gly Cys 225 230 235
240 Cys His Cys Cys Gln Arg Ala Cys Arg Asn Arg Cys Trp Pro Arg Ala
245 250 255 Ser Ser Pro Leu Gln Glu Leu Ser Ala Gln Ser Ser Met Leu
Ser Thr 260 265 270 Thr Pro Pro Asp Ala Pro Ser Arg Lys Ala Ser Val
His Lys His Val 275 280 285 Val Phe Leu Glu Pro Gly Lys Lys Gly Leu
Asn Gly Arg Val Gln Leu 290 295 300 Ala Val Pro Pro Asp Ser Asp Leu
Cys Asn Pro Met Gly Leu Gln Leu 305 310 315 320 94 16 PRT Mus sp.
94 Pro Phe Leu Phe Asn His Leu His Gly Leu Gly Leu Thr Arg Leu Arg
1 5 10 15 95 304 PRT Mus sp. 95 Thr Leu Asp Leu Ser Ser Asn Trp Leu
Lys His Ile Ser Ile Pro Glu 1 5 10 15 Leu Ala Ala Leu Pro Thr Tyr
Leu Lys Asn Arg Leu Tyr Leu His Asn 20 25 30 Asn Pro Leu Pro Cys
Asp Cys Ser Leu Tyr His Leu Leu Arg Arg Trp 35 40 45 His Gln Arg
Gly Leu Ser Ala Leu His Asp Phe Glu Arg Glu Tyr Thr 50 55 60 Cys
Leu Val Phe Lys Val Ser Glu Ser Arg Val Arg Phe Phe Glu His 65 70
75 80 Ser Arg Val Phe Lys Asn Cys Ser Val Ala Ala Ala Pro Gly Leu
Glu 85 90 95 Leu Pro Glu Glu Gln Leu His Ala Gln Val Gly Gln Ser
Leu Arg Leu 100 105 110 Phe Cys Asn Thr Ser Val Pro Ala Thr Arg Val
Ala Trp Val Ser Pro 115 120 125 Lys Asn Glu Leu Leu Val Ala Pro Ala
Ser Gln Asp Gly Ser Ile Ala 130 135 140 Val Leu Ala Asp Gly Ser Leu
Ala Ile Gly Arg Val Gln Glu Gln His 145 150 155 160 Ala Gly Val Phe
Val Cys Leu Ala Ser Gly Pro Arg Leu His His Asn 165 170 175 Gln Thr
Leu Glu Tyr Asn Val Ser Val Gln Lys Ala Arg Pro Glu Pro 180 185 190
Glu Thr Phe Asn Thr Gly Phe Thr Thr Leu Leu Gly Cys Ile Val Gly 195
200 205 Leu Val Leu Val Leu Leu Tyr Leu Phe Ala Pro Pro Cys Arg Gly
Cys 210 215 220 Cys His Cys Cys Gln Arg Ala Cys Arg Asn Arg Cys Trp
Pro Arg Ala 225 230 235 240 Ser Ser Pro Leu Gln Glu Leu Ser Ala Gln
Ser Ser Met Leu Ser Thr 245 250 255 Thr Pro Pro Asp Ala Pro Ser Arg
Lys Ala Ser Val His Lys His Val 260 265 270 Val Phe Leu Glu Pro Gly
Lys Lys Gly Leu Asn Gly Arg Val Gln Leu 275 280 285 Ala Val Pro Pro
Asp Ser Asp Leu Cys Asn Pro Met Gly Leu Gln Leu 290 295 300 96 197
PRT Mus sp. 96 Thr Leu Asp Leu Ser Ser Asn Trp Leu Lys His Ile Ser
Ile Pro Glu 1 5 10 15 Leu Ala Ala Leu Pro Thr Tyr Leu Lys Asn Arg
Leu Tyr Leu His Asn 20 25 30 Asn Pro Leu Pro Cys Asp Cys Ser Leu
Tyr His Leu Leu Arg Arg Trp 35 40 45 His Gln Arg Gly Leu Ser Ala
Leu His Asp Phe Glu Arg Glu Tyr Thr 50 55 60 Cys Leu Val Phe Lys
Val Ser Glu Ser Arg Val Arg Phe Phe Glu His 65 70 75 80 Ser Arg Val
Phe Lys Asn Cys Ser Val Ala Ala Ala Pro Gly Leu Glu 85 90 95 Leu
Pro Glu Glu Gln Leu His Ala Gln Val Gly Gln Ser Leu Arg Leu 100 105
110 Phe Cys Asn Thr Ser Val Pro Ala Thr Arg Val Ala Trp Val Ser Pro
115 120 125 Lys Asn Glu Leu Leu Val Ala Pro Ala Ser Gln Asp Gly Ser
Ile Ala 130 135 140 Val Leu Ala Asp Gly Ser Leu Ala Ile Gly Arg Val
Gln Glu Gln His 145 150 155 160 Ala Gly Val Phe Val Cys Leu Ala Ser
Gly Pro Arg Leu His His Asn 165 170 175 Gln Thr Leu Glu Tyr Asn Val
Ser Val Gln Lys Ala Arg Pro Glu Pro 180 185 190 Glu Thr Phe Asn Thr
195 97 20 PRT Mus sp. 97 Gly Phe Thr Thr Leu Leu Gly Cys Ile Val
Gly Leu Val Leu Val Leu 1 5 10 15 Leu Tyr Leu Phe 20 98 87 PRT Mus
sp. 98 Ala Pro Pro Cys Arg Gly Cys Cys His Cys Cys Gln Arg Ala Cys
Arg 1 5 10 15 Asn Arg Cys Trp Pro Arg Ala Ser Ser Pro Leu Gln Glu
Leu Ser Ala 20 25 30 Gln Ser Ser Met Leu Ser Thr Thr Pro Pro Asp
Ala Pro Ser Arg Lys 35 40 45 Ala Ser Val His Lys His Val Val Phe
Leu Glu Pro Gly Lys Lys Gly 50 55 60 Leu Asn Gly Arg Val Gln Leu
Ala Val Pro Pro Asp Ser Asp Leu Cys 65 70 75 80 Asn Pro Met Gly Leu
Gln Leu 85 99 24 DNA artificial sequence TANGO 331 human radiation
panel forward primer 99 attattcaga aggatgtccc gtgg 24 100 23 DNA
artificial sequence TANGO 331 human radiation panel reverse primer
100 cctcctgatt acctacaatg gtc 23
* * * * *
References