U.S. patent application number 10/165060 was filed with the patent office on 2003-04-24 for treatment of alpha-galactosidase a deficiency.
This patent application is currently assigned to Transkaryotic Therapies, Inc., a Delaware corporation. Invention is credited to Borowski, Marianne, Daniel, Peter F., Kinoshita, Carol M., Schuetz, Thomas J., Selden, Richard F., Treco, Douglas A., Williams, Melanie D..
Application Number | 20030077806 10/165060 |
Document ID | / |
Family ID | 23012821 |
Filed Date | 2003-04-24 |
United States Patent
Application |
20030077806 |
Kind Code |
A1 |
Selden, Richard F. ; et
al. |
April 24, 2003 |
Treatment of alpha-galactosidase a deficiency
Abstract
The invention provides highly purified .alpha.-Gal A, and
various methods for purifying it; .alpha.-Gal A preparations with
altered charge and methods for making those preparations;
.alpha.-Gal A preparations that have an extended circulating
half-life in a mammalian host, and methods for making same; and
methods and dosages for administering an .alpha.-Gal A preparation
to a subject.
Inventors: |
Selden, Richard F.;
(Wellesley, MA) ; Borowski, Marianne; (Winthrop,
MA) ; Kinoshita, Carol M.; (Bedford, MA) ;
Treco, Douglas A.; (Arlington, MA) ; Williams,
Melanie D.; (Natick, MA) ; Schuetz, Thomas J.;
(Framingham, MA) ; Daniel, Peter F.; (Natick,
MA) |
Correspondence
Address: |
LOUIS MYERS
Fish & Richardson P.C.
225 Franklin Street
Boston
MA
02110-2804
US
|
Assignee: |
Transkaryotic Therapies, Inc., a
Delaware corporation
|
Family ID: |
23012821 |
Appl. No.: |
10/165060 |
Filed: |
June 7, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10165060 |
Jun 7, 2002 |
|
|
|
09266014 |
Mar 11, 1999 |
|
|
|
09266014 |
Mar 11, 1999 |
|
|
|
08928881 |
Sep 12, 1997 |
|
|
|
6083725 |
|
|
|
|
09266014 |
Mar 11, 1999 |
|
|
|
PCT/US97/16603 |
Sep 12, 1997 |
|
|
|
60026041 |
Sep 13, 1996 |
|
|
|
Current U.S.
Class: |
435/207 |
Current CPC
Class: |
A61P 13/12 20180101;
C07K 2319/02 20130101; C07K 2319/00 20130101; C12Y 302/01022
20130101; A61P 9/00 20180101; A61P 3/00 20180101; A61P 3/08
20180101; A61K 38/00 20130101; C07K 14/61 20130101; A61P 25/02
20180101; C12N 9/2465 20130101 |
Class at
Publication: |
435/207 |
International
Class: |
C12N 009/38 |
Claims
What is claimed is:
1. A composition comprising a human .alpha.-Gal A preparation,
purified to at least 98% homogeneity, as measured by SDS-PAGE or
reverse phase HPLC.
2. A composition comprising a human .alpha.-Gal A preparation,
having a specific activity of at least 2.0.times.10.sup.6 units/mg
protein.
3. A method for producing an .alpha.-Gal A preparation comprising
various a Gal A glycoforms and purified to at least 98%
homogeneity, comprising separating the all A glycoforms from other
components on a hydrophobic interaction resin, wherein the
.alpha.-Gal A preparation is purified to at least 98% homogeneity
and wherein the purification does not include a lectin
chromatography step.
4. An .alpha.-Gal A preparation comprising various .alpha.-Gal A
glycoforms, purified to at least 98% homogeneity, produced by the
method of any one of claim 3.
5. A method for producing an .alpha.-Gal A preparation comprising
various .alpha.-Gal A glycoforms, purified to at least 98%
homogeneity, comprising: (a) binding the .alpha.-Gal A glycoforms
to a cation exchange resin at acidic pH in an equilibration buffer,
(b) washing the resin with the equilibration buffer to elute the
unbound material, and (c) eluting the .alpha.-Gal A glycoforms
using an elution solution selected from the group consisting of a
salt solution of 10-100 mM, a buffered solution of pH 45, and a
combination thereof wherein the .alpha.-Gal A preparation is
purified to at least 98% homogeneity.
6. An .alpha.-Gal A preparation comprising various .alpha.-Gal A
glycoforms, purified to at least 98% homogeneity, produced by the
method of claim 5.
7. A method for producing an .alpha.-Gal A preparation comprising
various .alpha.-Gal A glycoforms, purified to at least 98%
homogeneity, comprising separating the .alpha.-Gal A glycoforms in
a sample from the other components in the sample using a
purification procedure comprising a step selected from the group
consisting of chromatofocusing chromatography, metal chelate
affinity chromatography and immunoaffinity chromatography, wherein
the .alpha.-Gal A is purified to at least 98% homogeneity.
8. An .alpha.-Gal A preparation comprising various .alpha.-Gal A
glycoforms, purified to at least 98% homogeneity, produced by the
method of claim 7.
9. A human glycosylated .alpha.-Gal A preparation, wherein at least
35% of the oligosaccharides are charged.
10. A human glycosylated .alpha.-Gal A preparation, wherein the
preparation includes multiple glycoforms, comprising at least 20%
complex glycans with 2-4 sialic acid residues.
11. A human glycosylated .alpha.-Gal A preparation, wherein the
oligosaccharide charge, as measured by the Z number, is greater
than 100.
12. A human glycosylated .alpha.-Gal A preparation, wherein the
preparation includes multiple glycoforms, said glycoforms being at
least on average between 25-50% phosphorylated.
13. A human glycosylated .alpha.-Gal A preparation, wherein the
preparation includes multiple glycoforms, and, wherein between
50-75% of the total glycans are sialylated.
14. A method for producing a glycosylated a4Gal A preparation
having an increased oligosaccharide charge, comprising: (a)
introducing a polynucleotide which on expression codes for GlcNAc
transferase III (GnT-III) into an .alpha.-Gal A producing-cell or
introducing a regulatory sequence by homologous recombination that
regulates expression of an endogenous GnT-III gene; (b) culturing
the .alpha.-Gal A production cell under culture conditions which
results in expression of .alpha.-Gal A and GnT-III; and (c)
isolating the a Gal A preparation, wherein the .alpha.-Gal A
preparation has increased oligosaccharide charge as compared to
.alpha.-Gal A from an .alpha.-Gal A producing-cell that lacks the
polynucleotide in step (a).
15. The method of claim 14, wherein at least 35% of the
oligosaccharides are charged.
16. The method of claim 14, wherein the preparation includes
multiple glycoforms, comprising at least 20% complex glycans with
2-4 sialic acid residues.
17. The method of claim 14, wherein the oligosaccharide charge, as
measured by the Z number, is greater than 100.
18. The method of claim 14, wherein the preparation includes
multiple glycoforms, said glycoforms being at least on average
between 25-50%/ phosphorylated.
19. A glycosylated .alpha.-Gal A preparation having an increased
oligosaccharide charge produced by the method of any one of claims
14-18.
20. A method for producing a glycosylated .alpha.-Gal A preparation
with increased oligosaccharide charge, comprising: (a) introducing
a polynucleotide which on expression codes for sialyl transferase
into an .alpha.-Gal A producing-cell or introducing a regulatory
sequence by homologous recombination that regulates expression of
an endogenous sialyl transferase; (b) culturing the .alpha.-Gal A
production cell under culture conditions which results in
expression of .alpha.-Gal A and sialyl transferase; and (c)
isolating the .alpha.-Gal A preparation, wherein the .alpha.-Gal A
preparation has increased oligosaccharide charge as compared to
.alpha.-Gal A from an .alpha.-Gal A producing-cell that lacks the
polynucleotide in step (a).
21. The method for producing a glycosylated .alpha.-Gal A
preparation of claim 20, further comprising: (d) selecting for
.alpha.-Gal A glycoforms with increased size or increased charge by
fractionation or purification of the preparations of step (c).
22. A glycosylated .alpha.-Gal A preparation with increased
oligosaccharide charge produced by the method of any one of claims
20-21.
23. A method for producing a glycosylated .alpha.-Gal A preparation
with increased sialylation, comprising contacting an .alpha.-Gal A
production cell with a culture medium having an ammonium
concentration below 10 mM.
24. The method of claim 23, wherein the contacting step comprises
continuously or intermittently perfusing the .alpha.-Gal A
production cell with flesh culture medium to maintain the ammonium
concentration below 10 mM.
25. A method for producing a glycosylated .alpha.-Gal A preparation
having increased phosphorylation, comprising: (a) introducing a
polynucleotide which on expression codes for phosphoryl transferase
into an .alpha.-Gal A producing-cell or introducing a regulatory
sequence by homologous recombination that regulates expression of
an endogenous phosphoryl transferase; (b) culturing the .alpha.-Gal
A production cell under culture conditions which result in
expression of .alpha.-Gal A and phosphoryl transferase; and (c)
isolating the .alpha.-Gal A, wherein the isolated .alpha.-Gal A has
increased phosphorylation as compared to the .alpha.-Gal A produced
in a cell without the polynucleotide.
26. A glycosylated .alpha.-Gal A preparation having increased
phosphorylation produced by the method of claim 25.
27. A human glycosylated .alpha.-Gal A preparation with an extended
circulating half-life when administered to a patient, wherein the
preparation includes multiple glycoforms, comprising at least 20%
complex glycans with 2-4 sialic acid residues.
28. A human glycosylated .alpha.-Gal A preparation with an extended
circulating half-life when administered to a patient, wherein the
preparation includes multiple glycoforms, said glycoforms being at
least on average between 25-50/o phosphorylated.
29. A human glycosylated .alpha.-Gal A preparation with an extended
circulating half-life when administered to a patient, wherein the
preparation includes multiple glycoforms, and, wherein between
50-75% of the total glycans are sialylated.
30. A method for producing a glycosylated .alpha.-Gal A preparation
with a reduced number of sialic acid and terminal galactose
residues on the oligosaccharide chains, comprising: (a) contacting
.alpha.-Gal A with neuraminidase (sialidase) to remove sialic acid
residues, leaving the terminal galactose moieties exposed; and (b)
contacting the desialylated .alpha.-Gal A of step (a) with
.beta.-galactosidase to remove terminal galactose residues, such
that the desialylated, degalactosylated .alpha.-Gal A product of
step (b) has a reduced number of terminal sialic acid or galactose
residues on the oligosaccharide chains compared to .alpha.-Gal A
from uncontacted .alpha.-Gal A.
31. A method for producing a glycosylated .alpha.-Gal A with a
reduced number of terminal galactose residues on the
oligosaccharide chains, comprising: contacting .alpha.-Gal A with
.beta.-galactosidase to remove terminal galactose residues, such
that the product has a reduced number of terminal galactose
residues on the oligosaccharide chains compared to .alpha.-Gal A
from uncontacted .alpha.-Gal A.
32. A degalactosylated .alpha.-Gal A preparation produced according
to the method of claim 31.
33. A formulation comprising an .alpha.-Gal A preparation that is
substantially free of proteins other than .alpha.-Gal A.
34. A formulation comprising an .alpha.-Gal A preparation that is
substantially free of albumin.
35. A method for administering an .alpha.-Gal A preparation to a
subject, comprising administering a dose of between 0.05-5.0 mg of
the .alpha.-Gal A preparation weekly or biweekly.
36. The method of claim 35, wherein the dose is about 0.2 mg per kg
body weight biweekly.
37. The method of any one of claims 35-36, wherein the dose is
administered intramuscularly, orally, rectally, subcutaneously,
intra-arterially, intraperitoneally, intracerebrally, intranasally,
intrathecally, transmucosally, transdermally, or via
inhalation.
38. A method for delivering .alpha.-Gal A preparation to a subject,
comprising subcutaneously administering a dose ranging between
0.01-10 mg of the .alpha.-Gal A preparation per kg body weight
biweekly or weekly.
39. The method of any of claims 35-36, wherein the .alpha.-Gal A
preparation is administered using a delivery system selected from
the group consisting of pump delivery, encapsulated cell delivery,
liposomal delivery, needle-delivered injection, needle-less
injection, nebulizer, aeorosolizer, electroporation, and
transdermal patch.
40. A method of treating a patient with Fabry disease, comprising
administering an .alpha.-Gal A preparation to the patient in a dose
of between 0.05-5.0 mg of the .alpha.-Gal A preparation per kg body
weight weekly or biweekly.
41. The method of claim 40, wherein the dose is about 0.2 mg per kg
body weight biweekly.
42. A method for treating a patient with Fabry disease comprising
subcutaneously administering an .alpha.-Gal A preparation to the
patient in a dose ranging between 0.01-10 mg of the .alpha.-Gal A
preparation per kg body weight biweekly or weekly.
43. A method of treating a patient with atypical variant of Fabry
disease, comprising administering to the patient an .alpha.-Gal A
preparation at a dose of between 0.05-5.0 mg of the .alpha.-Gal A
preparation per kg body weight weekly or biweekly.
44. The method of claim 43, wherein the patient suffers from a
cardiovascular abnormality.
45. The method of claim 44, wherein the cardiovascular abnormality
is left ventricular hypertrophy (LVH).
Description
RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
Ser. No. 08/928,881, filed on Sep. 13, 1996, and PCT/US97/16603,
filed on Sep. 12, 1997, which are incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to methods and compositions
for the treatment of .alpha.-galactosidase A deficiency.
BACKGROUND OF THE INVENTION
[0003] Fabry disease is an X-linked inherited lysosomal storage
disease characterized by severe renal impairment, angiokeratomas,
and cardiovascular abnormalities, including ventricular enlargement
and mitral valve insufficiency. Fabry disease also affects the
peripheral nervous system, causing episodes of agonizing, burning
pain in the extremities. Fabry disease is caused by a deficiency in
the enzyme .alpha.-galactosidase A (.alpha.-Gal A). .alpha.-Gal A
is the lysosomal glycohydrolase that cleaves the terminal
.alpha.-galactosyl moieties of various glycoconjugates. Fabry
disease results in a blockage of the catabolism of the neutral
glycosphingolipid, ceramide trihexoside (CTH), and accumulation of
this enzyme substrate within cells and in the bloodstream.
[0004] Due to the X-linked inheritance pattern of the disease, most
Fabry disease patients are male. Although severely affected female
heterozygotes have been observed, female heterozygotes are often
asymptomatic or have relatively mild symptoms (such as a
characteristic opacity of the cornea). An atypical variant of Fabry
disease, exhibiting low residual .alpha.-Gal A activity and either
very mild symptoimis or apparently no other symptoms characteristic
of Fabry disease, correlates with left ventricular hypertrophy and
cardiac disease. Nakano et al., New Engl. J. Med. 333: 288-293
(1995). A reduction in .alpha.-Gal A may be the cause of such
cardiac abnormalities.
[0005] The cDNA and gene encoding human .alpha.-Gal A have been
isolated and sequenced. Human .alpha.-Gal A is expressed as a
429-amino acid polypeptide, of which the N-terminal 31 amino acids
are the signal peptide. The human enzyme has been expressed in
Chinese Hamster Ovary (CHO) cells (Desnick et al., U.S. Pat. No.
5,356,804; Ioannou et al., J. Cell Biol. 119:1137 (1992)); and
insect cells (Calhoun et al., WO 90/11353).
[0006] However, current preparations of .alpha.-Gal A have limited
efficacy. Methods for the preparation of .alpha.-Gal A with
relatively high purity depend on the use of affinity
chromatography, using a combination of lectin affinity
chromatography (concanavalin A (Con A) Sepharose.RTM.) and affinity
chromatography based on binding of .alpha.-Gal A to the substrate
analog N-6-aminohexanoyl-.alpha.-D-galacto- sylamine coupled to a
Sepharose.RTM. matrix. See, e.g., Bishop et al., J. Biol. Chem.
256: 1307-1316 (1981). The use of proteinaceous lectin affinity
resins and substrate analog resins is typically associated with the
continuous leaching of the affinity agent from the solid support
(Marikar et al., Anal. Biochem. 201: 306-310 (1992), resulting in
contamination of the purified product with the affinity agent
either free in solution or bound to eluted protein. Such
contaminants make the product unsuitable for use in pharmaceutical
preparations. Bound substrate analogs and lectins can also have
substantial negative effects on the enzymatic, functional, and
structural properties of proteins. Moreover, .alpha.-Gal A produced
by the methods in the prior art is rapidly eliminated by the
liver.
[0007] Thus, a need remains in the art for a purification protocol
using conventional chromatography resins, which are readily
available in supplies and quality suitable for large-scale
commercial use, and which produces an .alpha.-Gal A preparation
that is free of affinity agent. In addition, a need remains in the
art for .alpha.-Gal A preparations with an increased circulating
half-life and increased uptake in specific tissues other than
liver.
SUMMARY OF THE INVENTION
[0008] The invention provides highly purified .alpha.-Gal A
preparations, and various methods for purifying the .alpha.-Gal A
glycoforms. The invention also provides .alpha.-Gal A preparations
with altered charge and methods for making those preparations.
Charge alterations are achieved by increasing the sialic acid
content of .alpha.-Gal A and/or by increasing the phosphorylation
of .alpha.-Gal A. The invention further provides .alpha.-Gal A
preparations that have an extended circulating half-life in a
mammalian host, and methods for making same. Finally, the present
invention further provides methods and dosages for administering an
.alpha.-Gal A preparation to a subject. The .alpha.-Gal A
preparations of the present invention will be useful for treatment
of individuals with Fabry disease or atypical variants of Fabry
disease, e.g., specific populations of Fabry patients with
predominantly cardiovascular abnormalities, such as ventricular
enlargement, e.g., left ventricular hypertrophy (LVH), and/or
mitral valve insufficiency, or Fabry patients with predominantly
renal involvement.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 is a representation of the 210 bp probe that was used
to isolate an ax-Gal A cDNA from a human fibroblast cDNA library
(SEQ ID NO:1). The sequence is from exon 7 of the .alpha.-Gal A
gene. The probe was isolated from human genomic DNA by the
polymerase chain reaction (PCR). The regions underlined in the
figure correspond to the sequences of the amplification
primers.
[0010] FIG. 2 is a representation of the sequence of the DNA
fragment that completes the 5' end of the .alpha.-Gal A cDNA clone
(SEQ ID NO:2). This fragment was amplified from human genomic DNA
by PCR. The regions underlined correspond to the sequences of the
amplification primers. The positions of the NcoI and SacII
restriction endonuclease sites, which were used for subcloning as
described in Example 1, are also shown.
[0011] FIG. 3 is a representation of the sequence of .alpha.-Gal A
cDNA, including the sequence that encodes the signal peptide (SEQ
ID NO:3).
[0012] FIG. 4 is a schematic map of pXAG-16, an .alpha.-Gal A
expression construct that includes the CMV (cytomegalovirus)
promoter, exon 1, and first intron, the hGH signal peptide coding
sequence and first intron, the cDNA for .alpha.-Gal A (lacking the
.alpha.-Gal A signal peptide sequence) and the hGH 3' UTS. pcDNeo
indicates the position of the neo gene derived from plasmid
pcDNeo.
[0013] FIG. 5 is a schematic map of pXAG-28, an .alpha.-Gal A
expression construct that includes the collagen I.alpha.2 promoter
and first exon, a .beta.-actin intron, the hGH signal peptide
coding sequence and first intron, the cDNA for .alpha.-Gal A
(lacking the .alpha.-Gal A signal peptide sequence) and the hGH 3'
UTS. pcDNeo indicates the position of the neo gene derived from
plasmid pcDNeo.
[0014] FIG. 6 is a representation of the human .alpha.-Gal A amino
acid sequence (SEQ ID NO:4).
[0015] FIG. 7 is a representation of the cDNA sequence encoding
human .alpha.-Gal A (without signal peptide) (SEQ ID NO:5).
[0016] FIG. 8 is a chromatogram of the .alpha.-Gal A purification
step using Butyl Sepharose.RTM. resin. The absorbance at 280 nm
(plain line) and .alpha.-Gal A activity (dotted line) of selected
fractions is shown.
[0017] FIG. 9 is a schematic map of pGA213C.
[0018] FIG. 10 is a diagrammatic representation of the targeting
construct, pGA213C, and homologous recombination with the
endogenous a-galactosidase A locus. pGA213C is depicted as
targeting sequences aligned above corresponding sequences on the
X-chromosomal .alpha.-galactosidase A locus. Positions relative to
the methionine initiation codon, ATG, are indicated by the numbers
above the linear maps. The activation unit containing murine dhfr,
bacterial neo, and CMV promoter/aldolase intron sequences is shown
above the position (-221) into which they were inserted by DNA
cloning. .alpha.-galactosidase A coding sequences are indicated by
the darkened boxes. .alpha.-galactosidase A non-coding genomic
sequences are indicated by the lightly filled boxes. Large
arrowheads indicate the direction of transcription for dhfr and neo
expression cassettes. Splicing of the GA-GAL mRNA following
successful targeting and gene activation is indicated by the
segmented line below the map of the activated .alpha.-galactosidase
A (GA-GAL) locus.
DETAILED DESCRIPTION OF THE INVENTION
[0019] Introduction
[0020] The invention described herein relates to certain novel
.alpha.-Gal A preparations and methods for making them, as well as
methods for treating patients with Fabry disease or atypical
variants of Fabry disease using those preparations. Certain
contemplated representative embodiments are summarized and
described in greater detail below.
[0021] The invention uses .alpha.-Gal A produced in any cell (an
.alpha.-Gal A production cell) for the treatment of Fabry disease.
In a preferred embodiment, the invention uses human .alpha.-Gal A
produced using standard genetic engineering techniques (based on
introduction of the cloned .alpha.-Gal A gene or cDNA into a host
cell), or gene activation.
[0022] The invention provides preparations, and methods for making
same, that contain a higher purity .alpha.-Gal A than prepared in
the prior art. Using the purification methods of the present
invention, compositions of human .alpha.-Gal A preparations are
preferably purified to at least 98% homogeneity, more preferably to
at least 99% homogeneity, and most preferably to at least 99.5%
homogeneity, as measured by SDS-PAGE or reverse phase HPLC. The
specific activity of the .alpha.-Gal A preparations of the present
invention is preferably at least 2.0.times.10.sup.6 units/mg
protein, more preferably at least 3.0.times.10.sup.6 units/mg
protein, and most preferably at least 3.5.times.10.sup.6 units/mg
protein.
[0023] In one embodiment, .alpha.-Gal A preparation is purified by
separating the various glycoforms of .alpha.-Gal A from other
components on a hydrophobic interaction resin, but does not include
a lectin chromatography step. In a preferred embodiment, the
functional moiety of the hydrophobic interaction resin includes a
butyl group.
[0024] In an alternative embodiment, .alpha.-Gal A preparation is
purified by first binding the various glycoforms of .alpha.-Gal A
to a cation exchange resin in a column at acidic pH in an
equilibration buffer. The column is then washed with the
equilibration buffer to elute the unbound material, and the various
glycoforms of .alpha.-Gal A are eluted using, as an elution
solution, a salt solution of 10-100 mM, a buffered solution of pH
4-5, or a combination thereof. In a preferred embodiment, the
equilibration buffer has a pH of about 4.4.
[0025] In another alternative embodiment, .alpha.-Gal A preparation
is purified by separating the various glycoforms of .alpha.-Gal A
in a sample from the other components in the sample using a
purification procedure comprising a step of at least one of
chromatofocusing chromatography, metal chelate affinity
chromatography, or immunoaffinity chromatography as a purification
procedure.
[0026] The invention further provides .alpha.-Gal A preparations
and methods for making .alpha.-Gal A preparations that have
.alpha.-Gal A with altered charge. The preparations may include
different glycoforms of .alpha.-Gal A. Charge alterations are
achieved by increasing the sialic acid content of .alpha.-Gal A
preparations and/or by increasing the phosphorylation of
.alpha.-Gal A preparations.
[0027] The sialic acid content of .alpha.-Gal A preparations is
increased by (i) isolation of the highly charged and/or higher
molecular weight .alpha.-Gal A glycoforms during or after the
purification process; (ii) adding sialic acid residues using cells
genetically modified (either by conventional genetic engineering
methods or gene activation) to express a sialyl transferase gene or
cDNA; or (iii) fermentation or growth of cells expressing the
enzyme in a low ammonium environment.
[0028] The phosphorylation of .alpha.-Gal A preparations is
increased by (i) adding phosphate residues using cells genetically
modified (either by conventional genetic engineering methods or
gene activation) to express a phosphoryl transferase gene or cDNA;
or (ii) adding phosphatase inhibitors to the cultured cells.
[0029] Using the methods of the present invention, human
glycosylated .alpha.-Gal A preparations are obtained, wherein
between 35% and 85% of the oligosaccharides are charged. In a
preferred embodiment, at least 35% of the oligosaccharides are
charged. In a more preferred embodiment, at least 50% of the
oligosaccharides are charged.
[0030] Alternative preferred human glycosylated .alpha.-Gal A
preparations have multiple .alpha.-Gal A glycoforms with preferably
at least 20%, more preferably at least 50%, and most preferably at
least 70% complex glycans with 2-4 sialic acid residues. In an
alternative preferred embodiment, human glycosylated .alpha.-Gal A
preparations with multiple glycoforms have an oligosaccharide
charge, as measured by the Z number, greater than 100, preferably
greater than 150, and more preferably greater than 170. In another
alternative preferred embodiment, human glycosylated .alpha.-Gal A
preparations with multiple glycoforms have at least on average
between 16-50%, preferably 25-50%, more preferably at least 30%, of
glycoforms being phosphorylated. In another alternative embodiment,
the preparations with multiple glycoforms have between 50-75%,
preferably 60%, of the total glycans being sialylated.
[0031] In one embodiment of the present invention, a glycosylated
.alpha.-Gal A preparation having an increased oligosaccharide
charge is produced by first introducing a polynucleotide, which
encodes for GlcNAc transferase III (GnT-III), into an .alpha.-Gal A
production cell, or introducing a regulatory sequence by homologous
recombination that regulates expression of an endogenous GnT-III
gene. The .alpha.-Gal A production cell is then cultured under
culture conditions which results in expression of .alpha.-Gal A and
GnT-III. The final step consists of isolating the .alpha.-Gal A
preparation with increased oligosaccharide charge.
[0032] In an alternative embodiment of the present invention, a
glycosylated .alpha.-Gal A preparation having an increased
oligosaccharide charge is produced by first introducing a
polynucleotide, which encodes for a sialyl transferase, into an
.alpha.-Gal A production cell, or introducing a regulatory sequence
by homologous recombination that regulates expression of an
endogenous sialyl transferase gene. The .alpha.-Gal A production
cell is then cultured under culture conditions which results in
expression of .alpha.-Gal A and the sialyl transferase. The final
step consists of isolating the .alpha.-Gal A preparation with
increased oligosaccharide charge. Preferred sialyl transferases
include an .alpha.2,3-sialyl transferase and an .alpha.2,6-sialyl
transferase. In a preferred embodiment, this method includes the
additional step of selecting for .alpha.-Gal A glycoforms with
increased size or increase charge by fractionation or purification
of the preparation.
[0033] In another embodiment, a glycosylated .alpha.-Gal A
preparation with increased sialylation is obtained by contacting an
.alpha.-Gal A production cell with a culture medium having an
ammonium concentration below 10 mM, more preferably below 2 mM. In
a preferred embodiment, the low ammonium environment is achieved by
addition of glutamine synthetase to the culture medium. In an
alternative preferred embodiment, the low ammonium environment is
achieved by continuous or intermittent perfusion of the .alpha.-Gal
A production cell with fresh culture medium to maintain the
ammonium concentration below 10 mM, more preferably below 2 mM.
[0034] In yet another embodiment, a glycosylated .alpha.-Gal A
preparation with increased phosphorylation is obtained by first
introducing into an .alpha.-Gal A production cell a polynucleotide
which encodes for phosphoryl transferase, or by introducing a
regulatory sequence by homologous recombination that regulates
expression of an endogenous phosphoryl transferase gene. The
.alpha.-Gal A production cell is then cultured under culture
conditions which results in expression of .alpha.-Gal A and
phosphoryl transferase. The .alpha.-Gal A preparation with
increased phosphorylation compared to the .alpha.-Gal A produced in
a cell without the polynucleotide is then isolated. In a preferred
embodiment, the .alpha.-Gal A preparations produced by the methods
of the present invention have multiple glycoforms with between
16-50%, preferably 25-50%, more preferably at least 30%, of
glycoforms being phosphorylated. In a preferred embodiment, this
method includes the additional step of selecting for .alpha.-Gal A
glycoforms with increased size or increase charge by fractionation
or purification of the preparation.
[0035] In still another embodiment, a glycosylated .alpha.-Gal A
preparation with increased phosphorylation is obtained by adding a
phosphatase inhibitor, e.g., bromotetramisole, to cultured cells.
Low levels of bovine plasma alkaline phosphatase can be present in
the fetal calf serum used as a growth additive for cultured cells.
This raises the possibility that exposed Man-6-P epitopes on
secreted .alpha.-Gal A could be a substrate for serum alkaline
phosphatase. Bromotetramisole has been shown to be a potent
inhibitor of alkaline phosphatase; Ki=2.8 mM (Metaye et al.,
Biochem. Pharmacol. 15: 4263-4268 (1988)) and complete inhibition
is achieved at a concentration of 0.1 mM (Borgers & Thone,
Histochemistry 44: 277-280 (1975)). Therefore, a phosphatase
inhibitor, e.g., bromotetramisole can be added to cultured cells in
one embodiment to maximize the high-uptake form of .alpha.-Gal A
present in the culture medium by preventing hydrolysis of the
Man-6-P ester groups.
[0036] The invention further provides .alpha.-Gal A preparations,
and methods for making same, that have an extended circulating
half-life in a mammalian host. The circulating half-life and
cellular uptake is enhanced by (i) increasing the sialic acid
content of .alpha.-Gal A (achieved as above); (ii) increasing the
phosphorylation of .alpha.-Gal A (achieved as above); (iii)
PEGylation of .alpha.-Gal A;
[0037] or (iv) sequential removal of the sialic acid and terminal
galactose residues, or removal of terminal galactose residues, on
the oligosaccharide chains on .alpha.-Gal A.
[0038] Improved sialylation of .alpha.-Gal A preparations enhances
the circulatory half-life of exogenous .alpha.-Gal A. In addition,
improved sialylation of .alpha.-Gal A improves its uptake, relative
to that of hepatocytes, in non-hepatocytes such as liver
endothelial cells, liver sinusoidal cells, pulmonary cells, renal
cells, neural cells, endothelial cells, or cardiac cells. The human
glycosylated .alpha.-Gal A preparation with increased sialic acid
content preferably includes multiple glycoforms, with at least 20%
complex glycans having 2-4 sialic acid residues. An alternative
preferred human glycosylated .alpha.-Gal A preparation has multiple
glycoforms, wherein between 50-75%, preferably at least 60%, of the
total glycans are sialylated.
[0039] Phosphorylation of .alpha.-Gal A preparations also improves
the level of .alpha.-Gal A entering cells. The phosphorylation
occurs within the cells expressing the .alpha.-Gal A. One preferred
human glycosylated .alpha.-Gal A preparation of the present
invention preferably includes multiple glycoforms with at least on
average between 16-50%, preferably 25-50%, more preferably at least
30%, of the glycoforms, being phosphorylated.
[0040] In an alternate embodiment, the circulatory half-life of a
human .alpha.-Gal A preparation is enhanced by complexing
.alpha.-Gal A with polyethylene glycol. In a preferred embodiment,
the .alpha.-Gal A preparation is complexed using tresyl monomethoxy
PEG (TMPEG) to form a PEGylated-.alpha.-Gal A. The
PEGylated-.alpha.-Gal A is then purified to provide an isolated,
PEGylated-.alpha.-Gal A preparation. PEGylation of .alpha.-Gal A
increases the circulating half-life and in vivo efficacy of the
protein.
[0041] Sialylation affects the circulatory half-life and
biodistribution of proteins. Proteins with minimal or no sialic
acid are readily internalized by the asialoglycoprotein receptor
(Ashwell receptor) on hepatocytes by exposed galactose residues on
the protein. The circulating half-life of galactose-terminated
.alpha.-Gal A can be enhanced by sequentially (1) removing sialic
acid by contacting .alpha.-Gal A with neuramimidase (sialidase),
thereby leaving the terminal galactose moieties exposed, and (2)
removing the terminal galactoside residues by contacting the
desialylated .alpha.-Gal A with .beta.-galactosidase. The resulting
.alpha.-Gal A preparation has a reduced number of terminal sialic
acid and/or terminal galactoside residues on the oligosaccharide
chains compared to .alpha.-Gal A preparations not sequentially
contacted with neuramimidase and .beta.-galactosidase.
Alternatively, the circulating half-life of galactose-terminated
.alpha.-Gal A can be enhanced by only removing the terminal
galactoside residues by contacting the desialylated .alpha.-Gal A
with .beta.-galactosidase. The resulting .alpha.-Gal A preparation
has a reduced number of terminal galactoside residues on the
oligosaccharide chains compared to .alpha.-Gal A preparations not
contacted with .beta.-galactosidase. In a preferred embodiment,
following sequential contact with neuramimidase and
.beta.-galactosidase, the resulting .alpha.-Gal A preparations are
subsequently contacted with .beta.-hexosamimidase, thereby cleaving
the oligosaccharide to the trimannose core.
[0042] In addition, sialylation levels can vary depending on the
cell type used. Therefore, in another preferred embodiment,
sialylation of .alpha.-Gal A can be enhanced by screening for
mammalian cells, e.g., human cells, that have relatively high
sialyl transferase activity and using such cells as .alpha.-Gal A
production cells.
[0043] The invention further provides formulations of an
.alpha.-Gal A preparation that are substantially free of
non-.alpha.-Gal A proteins, such as albumin, non-.alpha.-Gal A
proteins produced by the host cell, or proteins isolated from
animal tissue or fluid. In one embodiment, the formulation further
comprises an excipient. Preferred excipients include mannitol,
sorbitol, glycerol, amino acids, lipids, EDTA, EGTA, sodium
chloride, polyethylene glycol, polyinylpyrollidone, dextran, or
combinations of any of these excipients. In another embodiment, the
formulation further comprises a non-ionic detergent. Preferred
non-ionic detergents include Polysorbate 20, Polysorbate 80, Triton
X-100, Triton X-114, Nonidet P-40, Octyl a-glucoside, Octyl
b-glucoside, Brij 35, Pluronic, and Tween 20. In a preferred
embodiment, the non-ionic detergent comprises Polysorbate 20 or
Polysorbate 80. A preferred formulation further comprises
phosphate-buffered saline, preferably at pH 6.
[0044] The present invention further provides methods for
administering an .alpha.-Gal A preparation to a subject. In a
preferred embodiment, the .alpha.-Gal A preparation is an
.alpha.-Gal A preparation with altered charge, e.g., increased
oligosaccharide charge, and/or extended circulating half-life as
described herein. The dose of administration is preferably between
0.05-5.0 mg, more preferably between 0.1-0.3 mg, of the .alpha.-Gal
A preparation per kilogram body weight weekly or biweekly. In a
preferred embodiment, the dose of administration is about 0.2 mg
per kilogram body weight biweekly. In these methods, the dose can
be administered intramuscularly, orally, rectally, subcutaneously,
intra-arterially, intraperitoneally, intracerebrally, intranasally,
intradermally, intrathecally, transmucosally, transdermally, or via
inhalation. In one embodiment, the method for delivering
.alpha.-Gal A preparation to a subject comprises subcutaneously
administering a dose ranging between 0.01-10.0 mg, preferably
0.1-5.0 mg, of the .alpha.-Gal A preparation per kg body weight
biweekly or weekly. The .alpha.-Gal A preparation can also be
administered intravenously, e.g., in a intravenous bolus injection,
in a slow push intravenous injection, or by continuous intravenous
injection. In any of the above methods, the .alpha.-Gal A
preparation can be delivered using a delivery system such as pump
delivery, encapsulated cell delivery, liposomal delivery,
needle-delivered injection, needle-less injection, nebulizer,
aeorosolizer, electroporation, and transdermal patch. Any of the
.alpha.-Gal A preparation described above can be administered by
these methods.
[0045] An individual who is suspected of having, or known to have,
Fabry disease may be treated by administration of the .alpha.-Gal A
preparation described above, using the above-described methods of
administration and doses. The present invention contemplates
treatment of individuals with Fabry disease generally ("Fabry
patients"), as well as atypical variants of Fabry disease, e.g.,
specific populations of Fabry patients with predominantly
cardiovascular abnormalities, defined here as Fabry patients with
ventricular enlargement, e.g., left ventricular hypertrophy (LVH),
and/or mitral valve insufficiency, or Fabry patients with
predominantly renal involvement.
[0046] .alpha.-Gal A
[0047] .alpha.-Gal A is a homodimeric glycoprotein that hydrolyses
the terminal X-galactosyl moieties from glycolipids and
glycoproteins.
[0048] The terms mature ".alpha.-Gal A" and "GA-GAL" and "SEQ ID
NO:5" (see FIG. 7) refer to .alpha.-Gal A without a signal peptide
(for .alpha.-Gal A with the signal peptide, see FIG. 3 and SEQ ID
NO:3). The term ".alpha.-Gal A preparation," as defined herein, is
used interchangeably with the term "glycosylated .alpha.-Gal A
preparation" and comprises various glycosylated .alpha.-Gal A
glycoforms.
[0049] A "signal peptide" is a peptide sequence that directs a
newly synthesized polypeptide to which the signal peptide is
attached to the endoplasmic reticulum (ER) for further
post-translational processing and distribution.
[0050] An "heterologous signal peptide," as used herein in the
context of .alpha.-Gal A, means a signal peptide that is not the
human .alpha.-Gal A signal peptide, typically the signal peptide of
some mammalian protein other than .alpha.-Gal A.
[0051] Skilled artisans will recognize that the human .alpha.-Gal A
DNA sequence (either cDNA [SEQ ID NO:5] or genomic DNA), or
sequences that differ from human .alpha.-Gal A DNA due to either
silent codon changes or to codon changes that produce conservative
amino acid substitutions, can be used to genetically modify
cultured human cells so that they will overexpress and secrete the
enzyme. Certain mutations in the .alpha.-Gal A DNA sequence may
encode polypeptides that retain or exhibit improved .alpha.-Gal A
enzymatic activity. For example, one would expect conservative
amino acid substitutions to have little or no effect on the
biological activity, particularly if they represent less than 10%
of the total number of residues in the protein. Conservative
substitutions typically include substitutions within the following
groups: glycine, alanine; valine, isoleucine, leucine; aspartic
acid, glutamic acid; asparagine, glutamine; serine, threonine;
lysine, arginine; and phenylalanine, tyrosine. See, for example,
U.S. Pat. No. 5,356,804, incorporated herein by reference.
[0052] Fabry Disease
[0053] Fabry disease is a genetic disorder caused by deficient
activity of the enzyme .alpha.-Gal A. By ".alpha.-Gal A
deficiency," it is meant any deficiency in the amount or activity
of this enzyme in a patient, resulting in abnormal accumulations of
neutral glycolipids (e.g., globotriaosylceramide) in histiocytes in
blood vessel walls, with angiokeratomas on the thighs, buttocks,
and genitalia, hypohidrosis, paresthesia in extremities, cornea
verticillata, and spoke-like posterior subcapsular cataracts. The
deposits of this material can result in pain, serious renal and
cardiovascular disease, and stroke. The glycolipid accumulation may
induce severe symptoms as typically observed in males who are
suffering from Fabry disease. Alternatively, the accumulation may
induce relatively mild symptoms, as can sometimes be seen in
heterozygous female carriers of the defective gene. Affected
individuals have a greatly shortened life expectancy; death usually
results from renal, cardiac, or cerebrovascular complications at
approximately age 40. There are no specific treatments for this
disease. Fabry disease, classified as a lysosomal storage disorder,
affects more than 15,000 people world-wide.
[0054] Fabry disease as defined above is a complex clinical
syndrome characterized by multiorgan and multisystem involvement.
Patients who manifest the combination of corneal dystrophy, skin
lesions (angiokeratomata), painful neuropathy, cerebral vascular
disease, cardiomyopathy, and renal dysfunction are categorized as
displaying the "classic" phenotype. There are, however, patients
who manifest some, but not all aspects of the classic phenotype.
These patients are classified as "atypical variants of Fabry
disease." There are several atypical variant phenotypes associated
with u.-galactosidase A deficiency. For example, some patients with
.alpha.-galactosidase A deficiency have a variation of Fabry
disease with only cardiac involvement, e.g., left ventricular
hypertrophy (LVH). There is also another variant phenotype in which
patients present with only renal involvement. Although both of
these variant phenotypes have been defined in male hemizygotes, the
variant forms of Fabry disease have also been described in female
heterozygotes as well.
[0055] Patients with the atypical cardiac variant generally present
with symptomatic disease later in life. The median age of diagnosis
for patients with the cardiac variant phenotype is approximately 52
years compared to approximately 29 years for the classic phenotype
(Desnick, et al., In The Metabolic and Molecular Bases of Inherited
Disease, 6th edition (1996). Scriver, et al., (eds), McGraw-Hill
(New York). pp. 2741-2784; Meikle, et al., J. Am. Med. Assoc. 281:
249 25-254 (1999)). Patients with this syndrome often present with
subtle symptoms of cardiac dysfunction such as exertional dyspnea.
Usually, standard echocardiographic analysis reveals that patients
with the cardiac variant phenotype are discovered to have left
ventricular hypertrophy (LVH) or asymmetric septal hypertrophy.
However, patients may also present with myocardial infarction or
cardiomyopathy (Scheidt, et al., New Engl. J. Med. 324: 395-399
(1991); Nakao, et al., New Engl. J. Med. 333: 288-293 (1995)).
These patients often undergo myocardial biopsies, and the pathology
of the variant syndrome is essentially similar to classic Fabry
disease: myocardial infiltration by deposited glycolipid.
.alpha.-galactosidase A enzyme assays in these patients reveal a
broad range of enzyme levels. For example, cardiac variant patients
have been reported to have as high as 30% of the normal levels of
.alpha.-galactosidase A enzyme activity, and, thus, up to now have
not been considered as candidates for .alpha.-Gal A replacement
therapy.
[0056] The inventors have now unexpectedly discovered that,
although atypical cardiac variant or atypical renal variant
patients may have .alpha.-galactosidase A enzyme activity levels
which are relatively high compared to patients with the classic
phenotype of Fabry disease, these patients can also benefit from
.alpha.-galactosidase A enzyme therapy. For example, patients can
have a mutation which produces a kinetically unstable .alpha.-Gal A
enzyme in the cell, and in these patients .alpha.-Gal A enzyme
levels can be augmented significantly by administration of
.alpha.-Gal A preparations of the present invention. Also, some
patients with the atypical cardiac variant phenotype have been
reported to have a point mutation in amino acid 215 of
.alpha.-galactosidase A. This amino acid in the unmutated protein
is an asparagine which is glycosylated (Eng, et al., Am. J. Hum.
Genet. 53: 1186-1197. (1993)). Thus, .alpha.-Gal A enzyme
replacement therapy with a properly glycosylated
.alpha.-galactosidase A preparations of the present invention can
be efficacious in these patients. Furthermore, patients with
atypical renal variant have been reported whose only clinical
manifestation of Fabry disease is mild proteinuria. Renal biopsy,
however, reveals the typical glycolipid inclusions of Fabry disease
and .alpha.-Gal A enzyme assay reveals lower than normal levels of
.alpha.-Gal A. However, because deposited ceramide trihexoside in
the kidney may be detected in shed renal tubular cells in the urine
sediment of these patients, administration of .alpha.-Gal A
preparations of the present invention can reduce these levels
substantially. Lysosomal enzymes such as .alpha.-Gal A are targeted
to the lysosomal compartment of a cell through interaction with the
mannose-6-phosphate (M6P) receptor, which binds to M6P residues
present in the oligosaccharide moieties of enzymes destined for the
lysosomal compartment. Kornfeld & Mellman, Ann. Rev. Cell Biol.
5: 483-525 (1989). The primary interaction occurs in the Golgi,
where enzymes bound to Golgi M6P receptors are segregated for
transport to the lysosomes. A secondary type of interaction is
believed to take place between extracellular .alpha.-Gal A and M6P
receptors at the cell surface. Enzymes that escape the routing
system are secreted by the cell via the constitutive secretory
pathway and are often recaptured by cell surface M6P receptors that
return the .alpha.-galactosidase A to the lysosome by the endocytic
pathway. Extracellular substances internalized by cells are
transported through the cytoplasm in endocytic vesicles, which fuse
with primary lysosomes and empty their contents into the lysosomes.
In this process, cell surface M6P receptors are also incorporated
into endocytic vesicles and transported to lysosomes. In
particular, the .alpha.-Gal A preparations of the present
invention, in which high levels of sialylation and/or
phosphorylation are present, are preferred for the treatment of
patients with atypical variants of Fabry disease. Such
preparations, for example, minimize the fraction of the injected
.alpha.-Gal A that is removed by hepatocytes and allow high levels
of .alpha.-Gal A uptake by non-liver cells, such as renal cells,
vascular cells, tubular cells, glomerular cells, cardiac myocytes
and cardiac vascular cells.
[0057] Extracellular .alpha.-Gal A bearing M6P residues may bind to
cell surface M6P receptors and be transported into the lysosomal
compartment. Once in the lysosomal compartment, .alpha.-Gal A can
carry out the appropriate function. It is this aspect of lysosomal
enzyme trafficking that makes .alpha.-galactosidase A enzyme
replacement therapy a feasible therapeutic treatment for Fabry
disease patients. Thus, even if a cell is genetically deficient in
producing .alpha.-Gal A, the cell may take up extracellular
.alpha.-Gal A if the .alpha.-Gal A is suitably glycosylated and the
deficient cell bears M6P receptors. In patents with Fabry disease,
vascular endothelial cells of the kidney and heart display severe
histopathologic abnormalities and contribute to the clinical
pathology of the disease. These cells, which carry M6P receptors,
are a particular therapeutic target of .alpha.-Gal A. An object of
the invention is to provide an .alpha.-Gal A preparation in which
M6P is present in the N-linked oligosaccharides.
[0058] The degree to which the N-linked oligosaccharides of
.alpha.-Gal A are modified by sialylation has a substantial effect
on .alpha.-Gal A pharmacokinetics and biodistribution. In the
absence of appropriate sialylation, .alpha.-Gal A is rapidly
cleared from the circulation due to binding by hepatic
asialoglycoprotein receptors (Ashwell receptors), followed by
internalization and degradation by hepatocytes. Ashwell &
Harford, Ann. Rev. Biochem. 51: 531-554 (1982). This decreases the
amount of .alpha.-Gal A available in the circulation for binding to
M6P receptors on cells which contribute to the clinical pathology
of Fabry disease, such as the vascular endothelial cells of the
kidney and heart. .alpha.-Gal A secreted by genetically-modified
human cells has glycosylation properties which are suitable for the
treatment of Fabry disease by either conventional pharmaceutical
administration of the purified secreted protein or by gene therapy,
without requiring additional enzymatic modification as has been
reported to be required for the lysosomal enzyme,
glucocerebrosidase, in which uptake of purified glucocerebrosidase
enzyme by clinically-relevant cells requires complex enzymatic
modification of the enzyme following purification from human
placenta. Beutler, New Engl. J. Med. 325:1354-1360(1991).
[0059] Cells Suitable for Production of .alpha.-Gal A
[0060] An individual suspected of having an .alpha.-Gal A
deficiency such as Fabry disease can be treated with purified human
.alpha.-Gal A obtained from cultured, genetically-modified cells,
preferably human cells.
[0061] When cells are to be genetically modified for the purposes
of treatment of Fabry disease, the cells may be modified by
conventional genetic engineering methods or by gene activation.
[0062] According to conventional methods, a DNA molecule that
contains an .alpha.-Gal A cDNA or genomic DNA sequence may be
contained within an expression construct and transfected into
primary, secondary, or immortalized cells by standard methods
including, but not limited to, liposome-, polybrene-, or DEAE
dextran-mediated transfection, electroporation, calcium phosphate
precipitation, microinjection, or velocity driven microprojectiles
("biolistics")(see, e.g., a copending application, U.S. Ser. No.
08/334,797, incorporated herein by reference). Alternatively, one
could use a system that delivers the genetic information by viral
vector. Viruses known to be useful for gene transfer include
adenoviruses, adeno-associated virus, herpes virus, mumps virus,
poliovirus, retroviruses, Sindbis virus, and vaccinia virus such as
canary pox virus.
[0063] Alternatively, the cells may be modified using a gene
activation ("GA") approach, such as described in U.S. Pat. Nos.
5,733,761 and 5,750,376, each incorporated herein by reference.
.alpha.-Gal A made by gene activation is referred to herein as
GA-GAL.
[0064] Accordingly, the term "genetically modified," as used herein
in reference to cells, is meant to encompass cells that express a
particular gene product following introduction of a DNA molecule
encoding the gene product and/or regulatory elements that control
expression of a coding sequence for the gene product. The DNA
molecule may be introduced by gene targeting or homologous
recombination, i.e., introduction of the DNA molecule at a
particular genomic site. Homologous recombination may be used to
replace the defective gene itself (the defective .alpha.-Gal A gene
or a portion of it could be replaced in a Fabry disease patient's
own cells with the whole gene or a portion thereof).
[0065] As used herein, the term "primary cell" includes cells
present in a suspension of cells isolated from a vertebrate tissue
source (prior to their being plated, i.e., attached to a tissue
culture substrate such as a dish or flask), cells present in an
explant derived from tissue, both of the previous types of cells
plated for the first time, and cell suspensions derived from these
plated cells.
[0066] "Secondary cells" refers to cells at all subsequent steps in
culturing. That is, the first time a plated primary cell is removed
from the culture substrate and replated (passaged), it is referred
to as a secondary cell, as are all cells in subsequent
passages.
[0067] A "cell strain" consists of secondary cells which have been
passaged one or more times;
[0068] exhibit a finite number of mean population doublings in
culture; exhibit the properties of contact-inhibited, anchorage
dependent growth (except for cells propagated in suspension
culture); and are not immortalized.
[0069] By "immortalized cell" is meant a cell from an established
cell line that exhibits an apparently unlimited lifespan in
culture.
[0070] Examples of primary or secondary cells include fibroblasts,
epithelial cells including mammary and intestinal epithelial cells,
endothelial cells, formed elements of the blood including
lymphocytes and bone marrow cells, glial cells, hepatocytes,
keratinocytes, muscle cells, neural cells, or the precursors of
these cell types. Examples of immortalized human cell lines useful
in the present methods include, but are not limited to, Bowes
Melanoma cells (ATCC Accession No. CRL 9607), Daudi cells (ATCC
Accession No. CCL 213), HeLa cells and derivatives of HeLa cells
(ATCC Accession Nos. CCL 2, CCL 2.1, and CCL 2.2), HL-60 cells
(ATCC Accession No. CCL 240), HT-1080 cells (ATCC Accession No. CCL
121), Jurkat cells (ATCC Accession No. TIB 152), KB carcinoma cells
(ATCC Accession No. CCL 17), K-562 leukemia cells (ATCC Accession
No. CCL 243), MCF-7 breast cancer cells (ATCC Accession No. BTH
22), MOLT-4 cells (ATCC Accession No. 1582), Namalwa cells (ATCC
Accession No. CRL 1432), Raji cells (ATCC Accession No. CCL 86),
RPMI 8226 cells (ATCC Accession No. CCL 155), U-937 cells (ATCC
Accession No. CRL 1593), WI-38VA13 sub line 2R4 cells (ATCC
Accession No. CLL 75.1), CCRF-CEM cells (ATCC Accession No. CCL
119), and 2780AD ovarian carcinoma cells (Van der Blick et al.,
Cancer Res. 48: 5927-5932,1988), as well as heterohybridoma cells
produced by fusion of human cells and cells of another species.
[0071] Following the genetic modification of human cells to produce
a cell which secretes .alpha.-Gal A, a clonal cell strain
consisting essentially of a plurality of genetically identical
cultured primary human cells or, where the cells are immortalized,
a clonal cell line consisting essentially of a plurality of
genetically identical immortalized human cells, may be generated.
In one embodiment, the cells of the clonal cell strain or clonal
cell line are fibroblasts. In a preferred embodiment the cells are
secondary human fibroblasts, e.g., BRS-11 cells.
[0072] After genetic modification, the cells are cultured under
conditions permitting secretion of .alpha.-Gal A. The protein is
isolated from the cultured cells by collecting the medium in which
the cells are grown, and/or lysing the cells to release their
contents, and then applying protein purification techniques.
[0073] Purification of .alpha.-Gal A from the Conditioned Medium of
Stably Transfected Cells
[0074] According to the methods of this invention, the .alpha.-Gal
A protein is isolated from the cultured cells (".alpha.-Gal A
production cells") by collecting the medium in which the cells are
grown, or lysing the cells to release their contents, and then
applying protein purification techniques without the use of lectin
affinity chromatography. The preferred purification process is
outlined in Example 2 below.
[0075] Alternative hydrophobic interaction resins, such as Source
Iso (Pharmacia), Macro-Prep( Methyl Support (Bio-Rad), TSK Butyl
(Tosohaas) or Phenyl Sepharose.RTM. (Pharmacia), can also be used
to purify .alpha.-Gal A. The column can be equilibrated in a
relatively high concentration of a salt, e.g., -1M ammonium sulfate
or 2 M sodium chloride, in a buffer of pH 5.6. The sample to be
purified is prepared by adjusting the pH and salt concentration to
those of the equilibration buffer. The sample is applied to the
column and the column is washed with equilibration buffer to remove
unbound material. The .alpha.-Gal A is eluted from the column with
a lower ionic strength buffer, water, or organic solvent in water,
e.g., 20% ethanol or 50% propylene glycol. Alternatively, the
.alpha.-Gal A can be made to flow through the column by using a
lower concentration of salt in the equilibration buffer and in the
sample or by using a different pH. Other proteins may bind to the
column, resulting in purification of the .alpha.-Gal A-containing
sample which did not bind the column. A preferred first
purification step is the use of a hydroxyapatite column.
[0076] An alternative step of purification can use a cation
exchange resin, e.g., SP Sepharose.RTM. 6 Fast Flow (Pharmacia),
Source 30S (Pharmacia), CM Sepharose.RTM. Fast Flow (Pharmacia),
Macro-Prep.RTM. CM Support (Bio-Rad) or Macro-Prep.RTM. High S
Support (Bio-Rad), to purify .alpha.-Gal A. The "first
chromatography step" is the first application of a sample to a
chromatography column (all steps associated with the preparation of
the sample are excluded). The .alpha.-Gal A can bind to the column
at pH 4.4. A buffer, such as 10 mM sodium acetate, pH 4.4, 10 mM
sodium citrate, pH 4.4, or other buffer with adequate buffering
capacity at approximately pH 4.4, can be used to equilibrate the
column. The sample to be purified is adjusted to the pH and ionic
strength of the equilibration buffer. The sample is applied to the
column and the column is washed after the load to remove unbound
material. A salt, such as sodium chloride or potassium chloride,
can be used to elute the .alpha.-Gal A from the column.
Alternatively, the .alpha.-Gal A can be eluted from the column with
a buffer of higher pH or a combination of higher salt concentration
and higher pH. The .alpha.-Gal A can also be made to flow through
the column during loading by increasing the salt concentration in
the equilibration buffer and in the sample load, by running the
column at a higher pH, or by a combination of both increased salt
and higher pH.
[0077] Another step of purification can use a Q Sephrarose.RTM. 6
Fast Flow for the purification of .alpha.-Gal A. Q Sepharose.RTM. 6
Fast Flow is a relatively strong anion exchange resin. A weaker
anion exchange resin such as DEAE Sepharose.RTM. Fast Flow
(Pharmacia) or Macro-Prep.RTM. DEAB (Bio-Rad) can also be used to
purify .alpha.-Gal A. The column is equilibrated in a buffer, e.g.,
10 mM sodium phosphate, pH 6. The pH of the sample is adjusted to
pH 6, and low ionic strength is obtained by dilution or
diafiltration of the sample. The sample is applied to the column
under conditions that bind .alpha.-Gal A. The column is washed with
equilibration buffer to remove unbound material. The .alpha.-Gal A
is eluted with application of salt, e.g., sodium chloride or
potassium chloride, or application of a lower pH buffer, or a
combination of increased salt and lower pH. The .alpha.-Gal A can
also be made to flow through the column during loading by
increasing the salt concentration in the load or by running the
column at a lower pH, or by a combination of both increased salt
and lower pH.
[0078] Another step of purification can use a Superdex.RTM. 200
(Pharmacia) size exclusion chromatography for purification of
.alpha.-Gal A. Other size exclusion chromatography resins such as
Sephacryl.RTM. S-200 HR or Bio-Gel.RTM. A-1.5 m can also be used to
purify .alpha.-Gal A. The preferred buffer for size exclusion
chromatography is 25 mM sodium phosphate, pH 6.0, containing 0.15 M
sodium chloride. Other formulation-compatible buffers can also be
used, e.g., 10 mM sodium or potassium citrate. The pH of the buffer
can be between pH 5 and pH 7 and should at contain a salt, e.g.,
sodium chloride or a mixture of sodium chloride and potassium
chloride.
[0079] Another step of purification can use a chromatofocusing
resin such as Polybuffer Exchanger PBE 94 (Pharmacia) to purify
.alpha.-Gal A. The column is equilibrated at relatively high pH
(e.g., pH 7 or above), the pH of the sample to be purified is
adjusted to the same pH, and the sample is applied to the column.
Proteins are eluted with a decreasing pH gradient to a pH such as
pH 4, using a buffer system, e.g., Polybuffer 74 (Pharmacia), which
had been adjusted to pH 4.
[0080] Alternatively, immunoaffinity chromatography can be used to
purify .alpha.-Gal A. An appropriate polyclonal or monoclonal
antibody to .alpha.-Gal A (generated by immunization with
.alpha.-Gal A or with a peptide derived from the .alpha.-Gal A
sequence using standard techniques) can be immobilized on an
activated coupling resin, e.g., NHS-activated Sepharose.RTM. 4 Fast
Flow (Pharmacia) or CNBr-activated Sepharose.RTM. 4 Fast Flow
(Pharmacia). The sample to be purified can be applied to the
immobilized antibody column at about pH 6 or pH 7. The column is
washed to remove unbound material. .alpha.-Gal A is eluted from the
column with typical reagents utilized for affinity column elution
such as low pH, e.g., pH 3, denaturant, e.g., guanidine HCl or
thiocyanate, or organic solvent, e.g., 50% propylene glycol in a pH
6 buffer. The purification procedure can also use a metal chelate
affinity resin, e.g., Chelating Sepharose.RTM. Fast Flow
(Pharmacia), to purify .alpha.-Gal A. The column is pre-charged
with metal ions, e.g., Cu.sup.2+, Zn.sup.2+, Ca.sup.2+, Mg.sup.2+
or Cd.sup.2+. The sample to be purified is applied to the column at
an appropriate pH, e.g., pH 6 to 7.5, and the column is washed to
remove unbound proteins. The bound proteins are eluted by
competitive elution with imidazole or histidine or by lowering the
pH using sodium citrate or sodium acetate to a pH less than 6, or
by introducing chelating agents, such as EDTA or EGTA.
[0081] According to the foregoing protocols, this invention
provides preparations with a higher purity .alpha.-Gal A
preparation than prepared in the prior art, purified to at least
98% homogeneity, more preferably to at least 99% homogeneity, and
most preferably to at least 99.5% homogeneity, as measured by
SDS-PAGE or reverse phase HPLC. The ac-Gal A preparations of the
present invention may comprise numerous .alpha.-Gal A glycoforms.
Accordingly, the term "homogeneity," as used herein in the context
of .alpha.-Gal A preparations, refers to preparations that are
substantially free (<2% of the total proteins) of proteins other
than .alpha.-Gal A. Examples of non-.alpha.-Gal A proteins such as
albumin, non-.alpha.-Gal A proteins produced by the host cell, and
non-.alpha.-Gal A proteins isolated from animal tissue or fluid.
The specific activity of the .alpha.-Gal A preparations of the
present invention is preferably at least 2.0.times.10.sup.6
units/mg protein, more preferably at least 3.0.times.10.sup.6
units/mg protein, and most preferably at least 3.5.times.10.sup.6
units/mg protein.
[0082] Improving Circulating Half-Life of .alpha.-Gal a
Preparations by Glycan Remodeling to Increase Oligosaccharide
Charge
[0083] The invention provides a glycoprotein modification program
for increased uptake of a therapeutic enzyme in specific tissues
other than liver and macrophages. Using the methods of the present
invention, human glycosylated .alpha.-Gal A preparations are
obtained, wherein between 35% and 85% of the oligosaccharides are
charged, preferably at least 50% of the oligosaccharides being
charged.
[0084] Protein N-glycosylation functions by modifying appropriate
asparagine residues of proteins with oligosaccharide structures,
thus influencing their properties and bioactivities. Kukuruzinska
& Lennon, Crit. Rev. Oral. Biol. Med. 9: 415-48 (1998). The
present invention provides an isolated .alpha.-Gal A preparation in
which a high percentage of the oligosaccharides are negatively
charged, primarily by the addition of one to four sialic acid
residues on complex glycans, or of one to two phosphate moieties on
high-mannose glycans, or of a single phosphate and a single sialic
acid on hybrid glycans. Smaller amounts of sulfated complex glycans
may also be present. A high proportion of charged structures serves
two main functions. First, capping of penultimate galactose
residues by 2,3- or 2,6-linked sialic acid prevents premature
removal from the circulation by the asialoglycoprotein receptor
present on hepatocytes. This receptor recognizes glycoproteins with
terminal galactose residues. Increasing the circulatory half-life
of .alpha.-Gal A gives important target organs such as heart and
kidney the opportunity to endocytose greater amounts of enzyme from
the plasma following enzyme infusion. Second, the presence of
Man-6-phosphate on high-mannose or hybrid glycans provides an
opportunity for receptor-mediated uptake by the cation-independent
Man-6-phosphate receptor (CI-MPR). This receptor-mediated uptake
occurs on the surface of many cells, including vascular endothelial
cells, which are a major storage site of CTH in Fabry patients.
Enzyme molecules with two Man-6-phosphate residues have a much
greater affinity for the CI-MPR than those with a single
Man-6-phosphate. Representative glycan structures are provided in
Table 1.
1TABLE 1 Representative Glycan Structures A biantennary glycan: 1 A
tetraantennary glycan: 2 A high-mannose glycan: 3 A phosphorylated
hybrid glycan: 4 A bisphosphorylated glycan: 5
[0085] N-glycoprotein biosynthesis involves a multitude of enzymes,
glycosyltransferases, and glycosidases. The majority of these
enzymes function in the endoplasmic reticulum(ER) and Golgi
apparatus in an ordered and well-orchestrated manner. The
complexity of N-glycosylation is augmented by the fact that
different asparagine residues within the same polypeptide may be
modified with different oligosaccharide structures, and various
proteins are distinguished from one another by the characteristics
of their carbohydrate moieties. Recent advances in molecular
genetics have expedited the identification, isolation, and
characterization of N-glycosylation genes. As a result, information
regarding relationships between N-glycosylation and other cellular
functions has emerged.
[0086] N-linked glycoprotein processing in the cell begins when an
oligosaccharide chain with a Glc.sub.3Man.sub.9GlcNAc.sub.2 is
added to an acceptor asparagine on a nascent peptide in the lumen
of the ER as a single unit. A fourteen sugar oligosaccharide chain
consisting of Glc.sub.3Man.sub.9GlcNAc.sub.2 is built up on
dolichol, a very long chain aliphatic alcohol: 6
[0087] This oligosaccharide is transferred as a single unit to an
acceptor asparagine residue on a nascent peptide chain in the lumen
of the ER. The large size of the glycan relative to the peptide may
guide protein folding. The three glucose residues serve as a signal
that the oligosaccharide is completed and ready for transfer by
oligosaccharyl transferase. This enzyme will also transfer
nonglucosylated oligosaccharides but at only a fraction of the rate
of the completed chain because these are sub-optimal substrates.
One form of carbohydrate deficient glycoprotein syndrome in humans
has been shown to be caused by a deficiency of Dolichol-P-Glc:
[0088] Man.sub.9GlcNAc.sub.2-PP-Dolichol glucosyl transferase, the
first enzyme in the glucose addition pathway, which results in
hypoglycosylation of serum proteins. Korner et al., Proc. Natl.
Acad Sci. USA 95: 13200-13205 (1998). After removal of the three
glucose residues and achievement of the correct conformation, the
newly synthesized glycoprotein is exported to the Golgi. Depending
on the accessibility of the glycan to Golgi mannosidases after
protein folding, the glycan chain may stay as a high mannose chain
with 5-9 mannose residues. Alternatively, the glycan chain may be
further processed to a trimannosyl core, and become an acceptor for
other glycosyl transferases that form complex chains by addition of
more GlcNAc residues, followed by Gal, NeuAc and Fuc. A third
possibility, if the protein has two lysine residues exactly 34
angstroms apart and in the correct spatial relationship to a high
mannose chain, is the addition of GlcNAc.alpha.-1-PO.sub.4 onto
carbon 6 of one, or sometimes two, mannose residues. Cuozzo et al.,
J. Biol. Chem. 273: 21069-21076 (1998). After removal of the
o-linked GlcNAc by a specific enzyme, a terminal M6P epitope is
generated which is recognized by a M6P receptor in the trans Golgi
network that then targets these enzymes to lysosomes in cells of
mesenchymal origin.
[0089] To target .alpha.-Gal A to as many different tissues as
possible, many different carbohydrate structures (glycoforms) are
useful. Matsuura et al., Glycobiology 8: 329-339 (1998) reported
that the glycan structures on human .alpha.-Gal A made in CHO cells
had 41% high-mannose glycans and the phosphorylation level was 24%.
However, the level of sialylated complex glycans was only 11%.
Thus, 2/3 of the complex chains were not sialylated, which results
in the rapid elimination of .alpha.-Gal A by the liver. The
.alpha.-Gal A produced in the human cells of the invention has a
higher percentage of charged oligosaccharides than the prior art
.alpha.-Gal A produced in CHO cells. For example, .alpha.-Gal A
synthesized in HT-1080 cells described herein is particularly
suitable, because .alpha.-Gal A produced in HT-1080 cells contains
approximately 15% neutral structures (high-mannose and hybrid),
approximately 16% phosphorylated glycans, and approximately 67%
complex glycans with 2 to 4 sialic acid residues. Thus, essentialy
all of the complex chains are sialylated as compared to .alpha.-Gal
A produced in CHO cells. HT-1080 cell .alpha.-Gal A has three
N-linked glycosylation sites. Two sites are processed to complex
glycans in the Golgi apparatus, while the third site is occupied by
a high-mannose glycan, 50% of which is modified by lysosomal
enzyme-specific phosphorylation to yield both monophosphorylated
and diphosphorylated species.
[0090] Four approaches are provided for carbohydrate remodeling on
a protein containing N-linked glycan chains. First, the proportion
of charged .alpha.-Gal A can be increased by selective isolation of
glycoforms during the purification process. The present invention
provides for increasing the proportion of highly charged and higher
molecular weight .alpha.-Gal A glycoforms by fractionation of
.alpha.-Gal A species on chromatography column resins during and/or
after the purification process. The more highly charged glycoform
species of .alpha.-Gal A contain more sialic acid and/or more
phosphate, and the higher molecular weight glycoforms would also
contain the fully glycosylated, most highly branched and highly
charged species. Selection of the charged species, or removal of
the non-glycosylated, poorly glycosylated or poorly sialylated
and/or phosphorylated .alpha.-Gal A species would result in a
population of .alpha.-Gal A glycoforms with more sialic acid and/or
more phosphate, therefore providing an .alpha.-Gal A preparation
with higher half-life and potential therapeutic efficiency.
[0091] This fractionation process can occur on, but is not limited
to, suitable chromatographic column resins utilized to purify or
isolate .alpha.-Gal A. For example, fractionation can occur on, but
is not limited to, cation exchange resins (such as
SP-Sepharose.RTM.), anion exchange resins (Q-Sepharose.RTM.),
affinity resins (Heparin Sepharose.RTM., lectin columns) size
exclusion columns (Superdex.RTM. 200) and hydrophobic interaction
columns (Butyl Sepharose.RTM.V) and other chromatographic column
resins known in the art.
[0092] Since .alpha.-Gal A is produced in cells as a heterogeneous
mixture of glycoforms which differ in molecular weight and charge,
.alpha.-Gal A tends to elute in relatively broad peaks from the
chromatography resins. Within these elutions, the glycoforms are
distributed in a particular manner depending on the nature of the
resin being utilized. For example, on size exclusion
chromatography, the largest glycoforms will tend to elute earlier
on the elution profile than the smaller glycoforms.
[0093] On ion exchange chromatography, the most negatively charged
glycoforms will tend to bind to a positively charged resin (such as
Q-Sepharose.RTM.) with higher affinity than the less negatively
charged glycoforms, and will therefore tend to elute later in the
elution profile. In contrast, these highly negatively charged
glycoforms may bind less tightly to a negatively charged resin,
such as SP Sepharose(g, than less negatively charges species, or
may not even bind at all.
[0094] Fractionation of the glycoform species on chromatographic
resins can be influenced by pH, ionic strength, buffer salt
selection, viscosity and/or other parameters such choice of resin
type. The use of various types of gradient elutions (straight line
linear gradients, curved, e.g., exponential gradients) or use of a
series of short step elutions to selectively elute .alpha.-Gal A
species from the chromatography column can also be optimized for
.alpha.-Gal A fractionation. All of these factors, alone or in
combination, can be optimized to achieve efficient fractionation of
the glycoforms. Fractionation can also occur after the purification
process is completed, on a particular chromatographic resin
selectively optimized for the fractionation and selection of the
desired glycoform population.
[0095] Selection of glycoform populations from the fractionated
at-Gal A species can be achieved after analysis of the eluted
.alpha.-Gal A glycoforms. The elution peak can be analyzed by
various techniques such as, but not limited to, SDS-PAGE,
isoelectric focusing, capillary electrophoresis, analytical ion
exchange HPLC, and/or analytical size exclusion HPLC. Particular
fractions can be selected which tend towards the desired size or
charge profile. Selection can occur at every chromatographic step
in the process, allowing for gradual achievement of the desired
glycoform population, or can be limited to a particular step or
steps if the efficiency of fractionation of the step(s) is high.
Fractionation can also occur after the purification process is
completed, on a particular chromatographic resin selectively
optimized for the fractionation and selection of the desired
glycoform population.
[0096] Fractionation and selection of highly charged and/or higher
molecular weight glycoforms of .alpha.-Gal A can be performed on
any .alpha.-Gal A preparation, such as that derived from
genetically modified cells such as cells modified by conventional
genetic engineering methods or by gene activation (GA). It can be
performed on cell lines grown in optimized systems to provide
higher sialylation and phosphorylation as described above, or
PEGylated .alpha.-Gal A as described below.
[0097] For example, in the .alpha.-Gal A purification process as
described herein, fractionation of .alpha.-Gal A glycoforms can
occur at various steps in the process. On the hydrophobic resin,
Butyl Sepharose.RTM. Fast Flow, the highest charged .alpha.-Gal A
glycoforms elute first, followed by the less highly charges
species. For Heparin Sepharose.RTM., the highest charged species
also elute first in the elution peak, followed by the less highly
charged species. The opposite occurs with Q-Sepharose.RTM., where
the least highly charged species eluting first, followed by the
most highly charged glycoforms. On size exclusion chromatography on
Superdex.RTM. 200, the highest molecular weight glycoforms elute
first followed by the lower molecular weight, less glycosylated
.alpha.-Gal A species. To allow for efficient fractionation of
particular .alpha.-Gal A glycoform populations, multiple
chromatographic steps can be combined, all of which fractionate on
different physical methods. For example, to obtain the .alpha.-Gal
A glycoforms containing the lowest pI (those containing the most
negative charge) limiting the pooling the early eluting butyl
fractions would enhance for the more highly charged .alpha.-Gal A.
Proceeding with this selected pool on the Heparin column, and again
limiting the pooling to the earlier, more highly negatively charged
.alpha.-Gal A species further enhances the proportion of low pI
.alpha.-Gal A glycoforms in the pool. Further fine tuning of the
glycoform population can be done at various steps of the
purification process by monitoring the size and charge distribution
of the elution pools by SDS-PAGE and isoelectric focusing. An
example of fractionation by size and charge is outlined below in
Example 2.4.
[0098] The second approach for carbohydrate remodeling involves
modifying certain glycoforms on the purified .alpha.-Gal A by
attachment of an additional terminal sugar residue using a purified
glycosyl transferase and the appropriate nucleotide sugar donor.
This treatment affects only those glycoforms that have an
appropriate free terminal sugar residue to act as an acceptor for
the glycosyl transferase being used. For example, .alpha.2,6-sialyl
transferase adds sialic acid in an a 2,6-linkage onto a terminal
Gal.beta.1,4GlcNAc-R acceptor, using CMP-sialic acid as the
nucleotide sugar donor. Commercially available enzymes and their
species of origin include: fucose .alpha.1,3 transferases III, V
and VI (humans); galactose .alpha.1,3 transferase (porcine);
galactose .beta.1,4 transferase (bovine); mannose .alpha.1,2
transferase (yeast); sialic acid .alpha.2,3 transferase (rat); and
sialic acid .alpha.2,6 transferase (rat). After the reaction is
completed, the glycosyl transferase can be removed from the
reaction mixture by a glycosyl transferase specific affinity column
consisting of the appropriate nucleotide bonded to a gel through a
6 carbon spacer by a pyrophosphate (GDP, UDP) or phosphate (CMP)
linkage or by other chromatographic methods known in the art. Of
the glycosyl transferases listed above, the sialyl transferases is
particularly useful for modification of enzymes, such as
.alpha.-Gal A, for enzyme replacement therapy in human patients.
Use of either sialyl transferase with
CMP-5-fluoresceinyl-neuraminic acid as the nucleotide sugar donor
yields a fluorescently labeled glycoprotein whose uptake and tissue
localization can be readily monitored.
[0099] The third approach for carbohydrate remodeling involves
glyco-engineering, e g, introduction of genes that affect
glycosylation mechanisms of the cell, of the .alpha.-Gal A
production cell to modify post-translational processing in the
Golgi apparatus is a preferred approach.
[0100] The fourth approach for carbohydrate remodeling involves
treating a:-Gal A with appropriate glycosidases to reduce the
number of different glycoforms present. For example, sequential
treatment of complex glycan chains with neuramimidase,
.beta.-galactosidase, and .beta.-hexosamimidase cleaves the
oligosaccharide to the trimannose core.
[0101] The structure of an N-linked glycan depends on the
accessibility of the glycan chain to Golgi processing mannosidases
after the protein has folded, and the presence in the Golgi of a
family of glycosyl transferases and the appropriate nucleotide
sugar donors. Many of the glycosyl transferases catalyze competing
reactions, which can result in the glycan chain being elongated in
several different and compatible ways, depending on which enzyme
reacts first. This results in microheterogeneity and the formation
of a complex family of glycoforms. Some structures are unique to a
single tissue, such as the modification of certain pituitary
hormones by the addition of GalNAc-4-SO.sub.4, or are limited to a
few organs.
[0102] An example of the latter is the formation of a so-called
bisecting GlcNAc (GlcNAc linked .beta.1,4 to the core
.beta.-mannose residue) on complex glycans of
glutamyltranspeptidase in kidney, but not in liver. A bisected
biantennary structure on .gamma.-glutamyltranspeptidase is shown
below: 7
[0103] In mammals, the enzyme responsible, GlcNAc transferase III
(GnT-III), is found in certain cells of the brain and kidney and in
certain cells of the liver in patients with hepatocarcinomas.
GnT-III catalyzes the addition of N-acetylglucosamine in .beta.1-4
linkage to the .beta.-linked mannose of the trimannosyl core of
N-linked sugar chains to produce a bisecting GlcNAc residue. The
mouse, rat, and human genes for GnT-III have been cloned. Ihara et
al., J. Biochem. (Tokyo) 113: 692-698 (1993).
[0104] The presence of additional GlcNAc T-III activity in human
cells can produce an increase in monophosphorylated hybrid glycans
at the expense of bi-, tri-, and tetrantennary complex glycans.
This should not affect the plasma half-life adversely, but may
increase targeting to vascular endothelial cells. A representative
structure is shown below: 8
[0105] Some of the .alpha.-Gal A is taken up by the kidney and
results in a significant decrease in the stored glycolipids.
Because the kidney can form N-glycans with bisecting GlcNAc
residues, renal epithelial cells can recognize glycoproteins with
this epitope with a particularly high specificity.
[0106] Elevated GnT-III activity can cause an imbalance in
branching on the trimannosyl core by inhibiting further branching
by GnT-II, IV, V, and Gal .beta.1,4-transferase at the substrate
level. Recently, a Chinese hamster ovary (CHO) cell line capable of
producing bisected oligosaccharides on glycoproteins was created by
overexpression of recombinant GnT-III. Sburlati et al., Biotechnol.
Progr. 14: 189-192 (1998). Interferon .beta. (IFN-.beta.) was
chosen as a model and potential therapeutic secreted heterologous
protein on which the effect of GnT-III-expression on product
glycosylation could be evaluated. IFN-.beta. with bisected
oligosaccharides was produced by the GnT-III-engineered CHO cells,
but not by the unmodified parental cell line.
[0107] The production of glycoprotein therapeutics requires
characterization of glycosylation with respect to the lot-to-lot
consistency. The `hypothetical N-glycan charge Z` has been used as
a parameter to characterize the protein glycosylation in a simple,
efficient manner. The determination of Z has been validated in
multiple repetitive experiments and proved to be highly accurate
and reliable. Hermentin et al., Glycobiology 6: 217-230 (1996). The
hypothetical N-glycan charge of a given glycoprotein is deduced
from the N-glycan mapping profile obtained via high performance
anion-exchange chromatography (HPAEC)/pulsed amperometric detection
(PAD). In HPAEC, N-glycans are clearly separated according to their
charge, e.g., their number of sialic acid residues, providing
distinct regions for neutral structures as well as for the mono-
di-, tri-, and tetrasialylated N-glycans. Z is defined as the sum
of the products of the respective areas (A) in the asialo,
monosialo, disialo, trisialo, tetrasialo, and pentasialo region,
each multiplied by the corresponding charge:
Z=A.sub.(asialo).multidot.+A.sub.(MS).multidot.1+A.sub.(DiS).multidot.2+A.-
sub.(TriS).multidot.3+A.sub.(TetraS).multidot.4[+A.sub.(pentaS).multidot.5-
]
Z=.SIGMA.A.sub.(i).multidot.(i)
[0108] where i is 0 in the asialo region, 1 in the monosialo (MS)
region, 2 in the disialo (DiS) region, 3 in the trisialo (TriS)
region, 4 in the tetrasialo (TetraS) region, and 5 in the
pentasialo (PentaS)region.
[0109] Thus, a glycoprotein with mostly C4-4* structures will
provide Z.congruent.400, a glycoprotein carrying largely C2-2*
structures will amount to Z.congruent.200, and a glycoprotein
carrying only high-mannose type or truncated structures will
provide Z.congruent.0.
[0110] Human glycosylated .alpha.-Gal A preparations of the present
invention have an oligosaccharide charge, as measured by the Z
number, greater than 100, preferably greater than 150, and more
preferably greater than 170.
[0111] Altering the Half-Life of Serum .alpha.-Gal A by
Phosphorylation
[0112] Phosphorylation of .alpha.-Gal A may be altered to affect
the circulating half-life of .alpha.-Gal A and the level of
.alpha.-Gal A entering cells. The phosphorylation is preferably
achieved within the cell expressing .alpha.-Gal A. Specifically
contemplated is obtaining a glycosylated .alpha.-Gal A preparation
with increased phosphorylation by first introducing into an
.alpha.-Gal A producing-cell a DNA sequence which encodes for
phosphoryl transferase, or by introducing a regulatory sequence by
homologous recombination that regulates expression of an endogenous
phosphoryl transferase gene. The .alpha.-Gal A production cell is
then cultured under culture conditions which result in expression
of .alpha.-Gal A and phosphoryl transferase. Isolation can then be
performed of the .alpha.-Gal A preparation with increased
phosphorylation compared to the .alpha.-Gal A produced in a cell
without the polynucleotide. Such phosphoryl transferases are well
known in the art. See, for example, U.S. Pat. Nos. 5,804,413 and
5,789,247, each incorporated herein by reference.
[0113] The concerted actions of two membrane-bound Golgi enzymes
are needed to generate a Man-6-phosphate recognition marker on a
lysosomal proenzyme. The first, UDP-N-acetylglucosamine:
glycoprotein N-acetylglucosamine-1-phosphotransferase (GlcNAc
phosphotransferase), requires a protein recognition determinant on
lysosomal enzymes that consists of two lysine residues exactly 34
.ANG. apart and in the correct spatial relationship to a high
mannose chain. The second,
N-acetylglucosamine-1-phosphodiestera-N-acetylglucosamimidase
(phosphodiester a-GlcNAcase), hydrolyzes the
.alpha.-GlcNAc-phosphate bond exposing the Man-6-phosphate
recognition site.
[0114] According to the methods of this invention, the .alpha.-Gal
A preparations produced by the methods of the present invention
have multiple glycoforms with between 16-50%, preferably 25-50%,
more preferably at least 30%, of glycoforms being
phosphorylated.
[0115] Altering the Half-Life of Serum .alpha.-Gal A by Increased
Sialylation
[0116] Increased sialylation of undersialylated glycans with
terminal galactose residues can be accomplished by transfection of
mammalian and preferably human cells with sialyl transferase
gene.
[0117] The present invention provides a glycosylated .alpha.-Gal A
preparation having an increased oligosaccharide charge produced by
first introducing a polynucleotide, which encodes for sialyl
transferase, into an .alpha.-Gal A producing-cell, or introducing a
regulatory sequence by homologous recombination that regulates
expression of an endogenous sialyl transferase gene. The
.alpha.-Gal A production cell is then cultured under culture
conditions which result in expression of .alpha.-Gal A and sialyl
transferase. The following step consists of isolating the
.alpha.-Gal A preparation with increased oligosaccharide charge.
Preferred sialyl transferases include an .alpha.2,3-sialyltransfe-
rase and an .alpha.2,6-sialyl transferase. These sialyl
transferases are well known. For example, see U.S. Pat. No.
5,858,751, incorporated herein by reference.
[0118] In a preferred embodiment, this method of increasing
sialylation includes the additional step of selecting for
.alpha.-Gal A glycoforms with increased size or increased charge by
fractionation or purification of the preparation (as discussed
below).
[0119] Alternatively, the invention provides for increasing
sialylation by maintaining cells in a low ammonium environment. In
particular, a glycosylated .alpha.-Gal A preparation with increased
sialylation is obtained by contacting an .alpha.-Gal A production
cell with a culture medium having an ammonium concentration below
10 mM, more preferably below 2 mM. Increased sialylation can be
accomplished by perfusion of production cells by which toxic
metabolites, such as ammonia, are periodically removed from the
culture medium. In a preferred embodiment, the low ammonium
environment is achieved by addition of the glutamine synthetase
gene or cDNA to the production cells. Alternatively, the low
ammonium environment is achieved by perfusion of the .alpha.-Gal A
production cell with fresh culture medium to maintain the ammonium
concentration below 10 mM, more preferably below 2 mM. The
production cells may be perfused continuously with fresh culture
medium with an ammonium concentration below 10 mM, more preferably
below 2 mM. Alternatively, the production cells may be perfused
intermittently with fresh culture medium. Intermittent perfusion,
as used herein, refers to either perfusion at regular, periodic
intervals of time, or after a measurement of the ammonium
concentration approaching the target concentration (i.e., 10 mM,
more preferably below 2 mM). The intermittent perfusions should be
at intervals sufficiently frequent such that the ammonium
concentration never exceeds the target concentration. The
production cells are perfused for a period of time necessary to
obtain an .alpha.-Gal A preparation with between 50-70%, preferably
60%, of the total glycans being sialylated.
[0120] Increasing Circulating Half-Life of Serum .alpha.-Gal A by
PEGylation of .alpha.-Gal A
[0121] Also according to this invention, the circulatory half-life
of a human glycosylated .alpha.-Gal A preparation is enhanced by
complexing .alpha.-Gal A with polyethylene glycol. Poly(ethylene
glycol) (PEG) is a water soluble polymer that when covalently
linked to proteins, alters their properties in ways that extend
their potential uses. Polyethylene glycol modification
("PEGylation") is a well established technique which has the
capacity to solve or ameliorate many of the problems of protein and
peptide pharmaceuticals.
[0122] The improved pharmacological performance of PEG-proteins
when compared with their unmodified counterparts prompted the
development of this type of conjugate as a therapeutic agent.
Enzyme deficiencies for which therapy with the native enzyme was
inefficient (due to rapid clearance and/or immunological reactions)
can now be treated with equivalent PEG-enzymes. For example,
PEG-adenosine deaminase has already obtained FDA approval. Delgado
et al., Crit. Rev. Ther. Drug Carrier Syst. 9: 249-304 (1992).
[0123] The covalent attachment of PEG to .alpha.-galactosidase from
green coffee beans alters the catalytic properties of the enzyme by
masking specific determinant sites on the molecule. This results in
an increase in Km and a decrease in Vmax values against
p-nitrophenyl substrate analogs. Wieder & Davis, J. Appl.
Biochem. 5: 337-47 (1983). .alpha.-galactosidase was still able to
cleave terminal galactose residues from human saliva blood group
substance B. Antibody and lectin-specific binding were lost from
PEG-o:-galactosidase. Antibodies generated from native
.alpha.-galactosidase can block enzyme activity, and this
inhibition is gradually lost when tested against preparations of
the enzyme with progressively higher amounts of PEG. By contrast,
antisera from animals immunized with PEG-.alpha.-galactosidase did
not inhibit enzyme activity in any .alpha.-galactosidase or
PEG-.alpha.-galactosidase preparation. These results indicate that
PEG tends to cover lectin-specific carbohydrate moieties and
antigenic determinants and that these sites probably remain cryptic
during in vivo processing of PEG-enzymes.
[0124] Covalent attachment of PEG to proteins requires activation
of the hydroxyl terminal group of the polymer with a suitable
leaving group that can be displaced by nucleophilic attack of the
.epsilon.-amino terminal of lysine and the a-amino group of the
N-terminus. Several chemical groups have been exploited to activate
PEG. For each particular application, different coupling methods
provide distinct advantages. Different methods of PEGylation have a
surprising and dramatic impact on factors such as retention of
bioactivity, stability and immunogenicity of the resulting
PEGylated proteins and peptides. Francis et al., Int. J. Hematol.
68(1): 1-18 (1998). For example, a linkerless PEGylation technique
attaches only PEG to the target molecule. More specifically, the
application of a biologically optimized PEGylation technique, using
tresyl monomethoxy PEG (TMPEG), to a variety of target proteins
reveals, as described by Francis et al., Int. J. Hematol. 68(1):
1-18 (1998), an exceptional ability to conserve biological activity
of the target. This, and the benefit of adding nothing other than
PEG (which has been shown to be safe for use in human
therapeutics), to the protein makes the method ideal for the
modification of .alpha.-Gal A.
[0125] Four possible sites for coupling PEG to proteins are the (1)
amino groups (N-terminus and lysine); (2) carboxyl groups (aspartic
acid and glutamic acid); (3) sulfhydryl groups (cysteine); and (4)
carbohydrate groups (aldehydes generated after periodate
treatment). Coupling to the carboxyl groups of proteins and to
aldehyde groups on carbohydrates requires a PEG reagent with a
nucleophilic amino group. This chemistry changes the pI of
.alpha.-Gal A after the negatively charged carboxyl groups are
bound by PEG. Any changes in pI may affect the biological activity
of .alpha.-Gal A. Furthermore, coupling PEG to the carbohydrate
chains may affect uptake of .alpha.-Gal A by the M6P receptor,
which is critical for biological activity. Sulfhydryl chemistry
also affects the physical structure of the molecule and is not
recommended.
[0126] Commonly used methods for PEGylation form an amide bond
between the amino groups of a protein and the methoxy group on
monomethoxy-PEG. NHS-PEG is commercially available and results in
an amide bond between the protein and PEG. However amide bond
formation changes pI due to the loss of the positive charge of the
--NH.sub.2 group.
[0127] A method for coupling PEG to .alpha.-Gal A without affecting
its pI uses tresyl-PEG.
[0128] Tresyl-PEG couples through amino groups and form a stable
secondary amine. Secondary amines offer the advantage of retaining
the positive charge of the amino group. The tresyl-PEG reagent is
commercially available and is stable as a lyophilized and
desiccated powder. Tresyl-PEG has been thoroughly characterized and
the reaction and by-products are well understood. Accordingly, in a
preferred embodiment, the .alpha.-Gal A preparation is complexed
using tresyl monomethoxy PEG (TMPEG) to form a
PEGylated-.alpha.-Gal A. The PEGylated-.alpha.-Gal A is then
purified to provide an isolated, PEGylated-.alpha.-Gal A. 9
[0129] .alpha.-Gal A contains 18 amino groups, 17 .epsilon.-amino
groups (lysine) and one .alpha.-amino group (N-terminus). The
reaction can be controlled to produce .alpha.-Gal A with minimal
substitutions and then molecules with one PEG per molecule, or a
lesser mean number of PEG moieties per molecule, can be purified
from the unsubstituted and multiply substituted forms. Multiple
substitutions on .alpha.-Gal A may not significantly affect
biological activity; therefore the final product may consist of a
heterogeneous mixture of one to 18 attached PEG molecules. The
level of substitution will depend on the level of retained
enzymatic activity. It should be noted that a decrease in enzymatic
activity can be offset by an enhanced therapeutic effect derived
from lengthening the circulatory half-life and reducing immune
recognition of .alpha.-Gal A. Thus, in developing a PEG-.alpha.-Gal
A product, the ratio of PEG to .alpha.-Gal A should be dependent on
biological activity, and not solely on enzymatic activity.
[0130] The PEGylation reaction requires a controlled pH, buffer
composition, and protein concentration. Proper reaction conditions
can be achieved by an ultrafiltration/diafiltration step, which is
currently used in the manufacturing process. Immediately before
reacting, tresyl-PEG is quickly solubilized in water with
continuous stirring. This solution is then added to the prepared
.alpha.-Gal A and allowed to react for a controlled amount of time
and at a controlled temperature (e.g., 2 hours at 250.degree. C.).
PEGylation can occur prior to the final purification process, which
will eliminate adding steps to the purification procedure. After
the coupling is complete, PEG-.alpha.-Gal A is processed by the
remaining steps of the purification process. Performing the
reaction before the Q column (anion exchange) allows for two
purification steps to remove the reaction byproducts. Since PEG
does not contain any negative charge, it will not be retained by
the Q Sepharose.RTM., and will elute in the void volume.
[0131] The amount of PEGylation can be measured by known
techniques. For example, fluorescamine fluoresces when bound to
.alpha.-amino and .epsilon.-amino groups of proteins. The percent
loss in fluorescence after PEGylation correlates to the percentage
of PEG bound to .alpha.-Gal A. Pierce's BCA assay for total protein
can be used to determine protein concentration. The
methylumbelliferyl-.alpha.-D-galactopyranoside (4-MUF-.alpha.-Gal)
activity assay is used to evaluate the effect of PEG-.alpha.-Gal A
enzymatic activity. .alpha.-Gal A contains M6P, which is required
for uptake into lysosomes. Interference from PEG on M6P receptor
recognition can be evaluated using a cell-based assay to monitor
cellular uptake of PEG-.alpha.-Gal A into lysosomes.
[0132] Methods of Administration of .alpha.-Gal A Preparation
[0133] Compositions of the present invention (i.e., comprising
various .alpha.-Gal A glycoforms) may be administered by any route
which is compatible with the .alpha.-Gal A preparation. The
purified .alpha.-Gal A preparation can be administered to
individuals who produce insufficient or defective .alpha.-Gal A
protein or who may benefit from .alpha.-Gal A therapy. Therapeutic
preparations of the present invention may be provided to an
individual by any suitable means, directly (e.g., locally, as by
injection, implantation or topical administration to a tissue
locus) or systemically (e.g., orally or parenterally).
[0134] The route of administration may be oral or parenteral,
including intravenous, subcutaneous, intra-arterial,
intraperitoneal, ophthalmic, intramuscular, buccal, rectal,
vaginal, intraorbital, intracerebral, intradermal, intracranial,
intraspinal, intraventricular, intrathecal, intracisternal,
intracapsular, intrapulmonary, intranasal, transmucosal,
transdermal, or via inhalation. Intrapulmonary delivery methods,
apparatus and drug preparation are described, for example, in U.S.
Pat. Nos. 5, 785, 049, 5,780,019, and 5,775,320, each incorporated
herein by reference. A preferred method of intradermal delivery is
by iontophoretic delivery via patches; one example of such delivery
is taught in U.S. Pat. No. 5,843,015, which is incorporated herein
by reference.
[0135] A particularly useful route of administration is by
subcutaneous injection. An .alpha.-Gal A preparation of the present
invention is formulated such that the total required dose may be
administered in a single injection of one or two milliliters. In
order to allow an injection volume of one or two milliliters, an
.alpha.-Gal A preparation of the present invention may be
formulated at a concentration in which the preferred dose is
delivered in a volume of one to two milliliters, or the .alpha.-Gal
A preparation may be formulated in a lyophilized form, which is
reconstituted in water or an appropriate physiologically compatible
buffer prior to administration. Subcutaneous injections of
.alpha.-Gal A preparations have the advantages of being convenient
for the patient, in particular by allowing self-administration,
while also resulting in a prolonged plasma half-life as compared
to, for example, intravenous administration. A prolongation in
plasma half-life results in maintenance of effective plasma
.alpha.-Gal A levels over longer time periods, the benefit of which
is to increase the exposure of clinically affected tissues to the
injected .alpha.-Gal A and, as a result, increase the uptake of a
.alpha.-Gal A into such tissues. This allows a more beneficial
effect to the patient and/or a reduction in the frequency of
administration. Furthermore, a variety of devices designed for
patient convenience, such as refillable injection pens and
needle-less injection devices, may be used with the .alpha.-Gal A
preparations of the present invention as discussed herein.
[0136] Administration may be by periodic injections of a bolus of
the preparation, or may be administered by intravenous or
intraperitoneal administration from a reservoir which is external
(e.g., an IV bag) or internal (e.g., a bioerodable implant, a
bioartificial organ, or a population of implanted .alpha.-Gal A
production cells). See, e.g., U.S. Pat. Nos. 4,407,957 and
5,798,113, each incorporated herein by reference. Intrapulmonary
delivery methods and apparatus are described, for example, in U.S.
Pat. Nos. 5,654,007, 5,780,014, and 5,814,607, each incorporated
herein by reference. Other useful parenteral delivery systems
include ethylene-vinyl acetate copolymer particles, osmotic pumps,
implantable infusion systems, pump delivery, encapsulated cell
delivery, liposomal delivery, needle-delivered injection,
needle-less injection, nebulizer, aeorosolizer, electroporation,
and transdermal patch. Needle-less injector devices are described
in U.S. Pat. Nos. 5,879,327; 5520,639; 5,846,233 and 5,704,911, the
specifications of which are herein incorporated by reference. Any
of the .alpha.-Gal A preparation described above can administered
in these methods.
[0137] The route of administration and the amount of protein
delivered can be determined by factors that are well within the
ability of skilled artisans to assess. Furthermore, skilled
artisans are aware that the route of administration and dosage of a
therapeutic protein may be varied for a given patient until a
therapeutic dosage level is obtained.
[0138] Pharmaceutical Formulation of .alpha.-Gal A Protein
[0139] This invention further provides novel formulations of an
.alpha.-Gal A preparation that are substantially free of
non-.alpha.-Gal A proteins, such as albumin, non-.alpha.-Gal A
proteins produced by the host cell, or proteins isolated from
animal tissue or fluid.
[0140] The preparation preferably comprises part of an aqueous or
physiologically compatible fluid suspension or solution. The
carrier or vehicle is physiologically compatible so that, in
addition to delivery of the desired preparation to the patient, it
does not otherwise adversely affect the patient's electrolyte
and/or volume balance. Useful solutions for parenteral
administration may be prepared by any of the methods well known in
the pharmaceutical art. See, e.g., REMINGTON'S PHARMACEUTICAL
SCIENCES (Gennaro, A., ed.), Mack Pub., 1990. Non-parenteral
formulations, such as suppositories and oral formulations, can also
be used.
[0141] Preferably the formulation contains an excipient.
Pharmaceutically acceptable excipients for .alpha.-Gal A which may
be included in the formulation are buffers such as citrate buffer,
phosphate buffer, acetate buffer, and bicarbonate buffer, amino
acids, urea, alcohols, ascorbic acid, phospholipids; proteins, such
as serum albumin, collagen, and gelatin; salts such as EDTA or
EGTA, and sodium chloride; liposomes; polyinylpyrollidone; sugars,
such as dextran, mannitol, sorbitol, and glycerol; propylene glycol
and polyethylene glycol (e.g., PEG-4000, PEG-6000); glycerol;
glycine or other amino acids; and lipids. Buffer systems for use
with .alpha.-Gal A preparations include citrate; acetate;
bicarbonate; and phosphate buffers (all available from Sigma).
Phosphate buffer is a preferred embodiment. A preferred pH range
for .alpha.-Gal A preparations is pH 4.5-7.4.
[0142] The formulation also preferably contains a non-ionic
detergent. Preferred non-ionic detergents include Polysorbate 20,
Polysorbate 80, Triton X-100, Triton X-114, Nonidet P-40, Octyl
.alpha.-glucoside, Octyl .beta.-glucoside, Brij 35, Pluronic, and
Tween 20 (all available from Sigma).
[0143] A particularly preferred formulation contains Polysorbate 20
or Polysorbate 80 non-ionic detergent and phosphate-buffered
saline, most preferably at pH 6.
[0144] For lyophilization of .alpha.-Gal A preparations, the
protein concentration can be 0.1-10 mg/mL. Bulking agents, such as
glycine, mannitol, albumin, and dextran, can be added to the
lyophilization mixture. In addition, possible cryoprotectants, such
as disaccharides, amino acids, and PEG, can be added to the
lyophilization mixture. Any of the buffers, excipients, and
detergents listed above, can also be added.
[0145] In a preferred formulation .alpha.-Gal A for injection is at
a concentration of 1 mg/mL.
[0146] Formulations for administration may include glycerol and
other compositions of high viscosity to help maintain the agent at
the desired locus. Biocompatible polymers, preferably
bioresorbable, biocompatible polymers (including, e.g., hyaluronic
acid, collagen, polybutyrate, lactide, and glycolide polymers and
lactide/glycolide copolymers) may be useful excipients to control
the release of the agent in vivo. Formulations for parenteral
administration may include glycocholate for buccal administration,
methoxysalicylate for rectal administration, or cutric acid for
vaginal administration. Suppositories for rectal administration may
be prepared by mixing an .alpha.-Gal A preparation of the invention
with a non-irritating excipient such as cocoa butter or other
compositions that are solid at room temperature and liquid at body
temperatures.
[0147] Formulations for inhalation administration may contain
lactose or other excipients, or may be aqueous solutions which may
contain polyoxyethylene-9-lauryl ether, glycocholate or
deoxycocholate. A preferred inhalation aerosol is characterized by
having particles of small mass density and large size. Particles
with mass densities less than 0.4 gram per cubic centimeter and
mean diameters exceeding 5 .mu.m efficiently deliver inhaled
therapeutics into the systemic circulation. Such particles are
inspired deep into the lungs and escape the lungs' natural
clearance mechanisms until the inhaled particles deliver their
therapeutic payload. (Edwards et al., Science 276: 1868-1872
(1997)). .alpha.-Gal A preparations of the present invention can be
administered in aerosolized form, for example by using methods of
preparation and formulations as described in U.S. Pat. Nos.
5,654,007, 5,780,014, and 5,814,607, each incorporated herein by
reference. Formulation for intranasal administration may include
oily solutions for administration in the form of nasal drops, or as
a gel to be applied intranasally.
[0148] Formulations for topical administration to the skin surface
may be prepared by dispersing the .alpha.-Gal A preparation with a
dermatological acceptable carrier such as a lotion, cream,
ointment, or soap. Particularly useful are carriers capable of
forming a film or layer over the skin to localize application and
inhibit removal. For topical administration to internal tissue
surfaces, the .alpha.-Gal A preparation may be dispersed in a
liquid tissue adhesive or other substance known to enhance
adsorption to a tissue surface. For example, several mucosal
adhesives and buccal tablets have been described for transmucosal
drug delivery, such as in U.S. Pat. Nos. 4,740,365, 4,764,378, and
5,780,045, each incorporated herein by reference.
Hydroxypropylcellulose or fibrinogen/thrombin solutions may also be
incorporated. Alternatively, tissue-coating solutions, such as
pectin-containing formulations may be used.
[0149] The preparations of the invention may be provided in
containers suitable for maintaining sterility, protecting the
activity of the active ingredients during proper distribution and
storage, and providing convenient and effective accessibility of
the preparation for administration to a patient. An injectable
formulation of an .alpha.-Gal A preparation might be supplied in a
stoppered vial suitable for withdrawal of the contents using a
needle and syringe. The vial would be intended for either single
use or multiple uses. The preparation can also be supplied as a
prefilled syringe. In some instances, the contents would be
supplied in liquid formulation, while in others they would be
supplied in a dry or lyophilized state, which in some instances
would require reconstitution with a standard or a supplied diluent
to a liquid state. Where the preparation is supplied as a liquid
for intravenous administration, it might be provided in a sterile
bag or container suitable for connection to an intravenous
administration line or catheter. In preferred embodiments, the
preparations of the invention are supplied in either liquid or
powdered formulations in devices which conveniently administer a
predetermined dose of the preparation; examples of such devices
include a needle-less injector for either subcutaneous or
intramuscular injection, and a metered aerosol delivery device. In
other instances, the preparation may be supplied in a form suitable
for sustained release, such as in a patch or dressing to be applied
to the skin for transdermal administration, or via erodible devices
for transmucosal administration. In instances where the preparation
is orally administered in tablet or pill form, the preparation
might be supplied in a bottle with a removable cover. The
containers may be labeled with information such as the type of
preparation, the name of the manufacturer or distributor, the
indication, the suggested dosage, instructions for proper storage,
or instructions for administration.
[0150] Dosages for Administration of .alpha.-Gal A Preparation
[0151] The present invention further provides methods for
administering an .alpha.-Gal A preparation to a patient with Fabry
disease, atypical variant of Fabry disease or any condition in
which a reduced level or mutant form of .alpha.-Gal A is present.
The dose of administration is preferably 0.05-5.0 mg, more
preferably between 0.1-0.3 mg, of the .alpha.-Gal A preparation per
kilogram body weight and is administered weekly or biweekly. In a
preferred embodiment, a dose of about 0.2 mg/kg is administered
biweekly. Regularly repeated doses of the protein are necessary
over the life of the patient. Subcutaneous injections can be used
to maintain longer term systemic exposure to the drug. The
subcutaneous dosage can be between 0.01-10.0 mg, preferably 0.1-5.0
mg, of the .alpha.-Gal A preparation per kg body weight biweekly or
weekly. Dosages of .alpha.-Gal A preparations that are administered
by intramuscular injections may be the same or different than those
injected subcutaneously; in a preferred embodiment, intramuscular
dosages are smaller and administered less frequently. The
.alpha.-Gal A preparation can also be administered intravenously,
e.g., in a intravenous bolus injection, in a slow push intravenous
injection, or by continuous intravenous injection. Continuous IV
infusion (e.g., over 2-6 hours) allows the maintenance of specific
levels in the blood.
[0152] An alternative preferred method for administering an
.alpha.-Gal A preparation to a patient involves administering a
preferred dose of an .alpha.-Gal A preparation weekly or biweekly
for a period of several years, e.g., up to three years, during
which time a patient is monitored clinically to evaluate the status
of his or her disease. Clinical improvement measured by, for
example, improvement in renal or cardiac function or patient's
overall well-being (e.g., pain), and laboratory improvement
measured by, for example, reductions in urine, plasma, or tissue
CTH levels, may be used to assess the patient's health status. In
the event that clinical improvement is observed after this
treatment and monitoring period, the frequency of .alpha.-Gal A
administration may be reduced. For example, a patient receiving
weekly injections of an .alpha.-Gal A preparation may change to
biweekly injections. Alternatively, a patient receiving biweekly
injections of an .alpha.-Gal A preparation may switch to monthly
injections. Following such a change in dosing frequency, the
patient should be monitored for another several years, e.g., a
three year period, in order to assess Fabry disease-related
clinical and laboratory measures. In a preferred embodiment, the
administered dose does not change if a change in dosing frequency
is made. This ensures that certain pharmacokinetic parameters (e.g.
maximal plasma concentration [C.sub.max], time to maximal plasma
concentration [t.sub.max], plasma, half-life [t.sub.1/2], and
exposure as measured by area under the curve [AUC]) remain
relatively constant following each administered dose. Maintenance
of these pharmacokinetic parameters will result in relatively
constant levels of receptor-mediated uptake of .alpha.-Gal A into
tissues as dose frequencies change.
[0153] A patient with atypical variant of Fabry disease, e.g.,
exhibiting predominantly cardiovascular abnormalities or renal
involvement, is treated with these same dosage regiments, i.e.,
from 0.05 mg/kg to 5 mg/kg weekly or biweekly. The dose is adjusted
as needed. For example, a patient with the cardiac variant
phenotype who is treated with .alpha.-galactosidase A enzyme
replacement therapy will have a change in the composition of their
heart and improved cardiac function following therapy. This change
can be measured with standard echocardiography which is able to
detect increased left ventricular wall thickness in patients with
Fabry disease (Goldman et al., J Am Coll Cardiol 7:1157-1161
(1986)). Serial echocardiographic measurements of left ventricular
wall thickness can be conducted during therapy, and a decrease in
ventricular wall size is indicative of a therapeutic response.
Patients undergoing .alpha.-gal A enzyme replacement therapy can
also be followed with cardiac magnetic resonance imaging (MRI). MRI
has the capability to assess the relative composition of a given
tissue. For example, cardiac MRI in patients with Fabry disease
reveals deposited lipid within the myocardium compared with control
patients (Matsui et al., Am Heart J 117: 472-474. (1989)). Serial
cardiac MRI evaluations in a patient undergoing enzyme replacement
therapy can reveal a change in the lipid deposition within a
patient's heart. Patients with the renal variant phenotype can also
benefit from a-galactosidase A enzyme replacement therapy. The
effect of therapy can be measured by standard tests of renal
function, such as 24-hour urine protein level, creatinine
clearance, and glomerular filtration rate. The following Examples
are presented in order to more fully illustrate the preferred
embodiments of the invention. These Examples should in no way be
construed as limiting the scope of the invention, as defined by the
appended claims.
EXAMPLE 1
Preparation and Use of Constructs Designed to Deliver and Express
.alpha.-Gal A
[0154] Two expression plasmids, pXAG-16 and pXAG-28, were
constructed. These plasmids contain human .alpha.-Gal A cDNA
encoding the 398 amino acids of the .alpha.-Gal A enzyme (without
the .alpha.-Gal A signal peptide); the human growth hormone (hGH)
signal peptide genomic DNA sequence, which is interrupted by the
first intron of the hGH gene; and the 3' untranslated sequence
(UTS) of the hGH gene, which contains a signal for polyadenylation.
Plasmid pXAG-16 has the human cytomegalovirus immediate-early (CMV
IE) promoter and first intron (flanked by non-coding exon
sequences), while pXAG-28 is driven by the collagen I.alpha.2
promoter and exon 1, and also contains the .beta.-actin gene's 5'
UTS, which contains the first intron of the .beta.-actin gene.
[0155] 1.1 Cloning of the Complete .alpha.-Gal A cDNA, and
Construction of the .alpha.-Gal A Expression Plasmid pXAG-16
[0156] The human .alpha.-Gal cDNA was cloned from a human
fibroblast cDNA library that was constructed as follows.
Poly-A.sup.+ mRNA was isolated from total RNA, and cDNA synthesis
was performed using reagents for the lambda ZapII.RTM. system
according to the manufacturer's instructions (Stratagene Inc.,
LaJolla, Calif.). Briefly, "first strand" cDNA was generated by
reverse transcription in the presence of an oligo-dT primer
containing an internal XhoI restriction endonuclease site.
Following treatment with RNase H, the cDNA was nick-translated with
DNA polymerase I to generate double stranded cDNA. This cDNA was
made blunt-ended with T4 DNA polymerase, and ligated to EcoRI
adaptors. The products of this ligation were treated with T4 DNA
kinase and digested with XhoI. The cDNA was fractionated by
Sephacryl.RTM.-400 chromatography. Large and medium size fractions
were pooled and the cDNAs ligated to EcoRI and XhoI-digested Lambda
ZapII arms. The products of this ligation were then packaged and
titered. The primary library had a titer of 1.2.times.10.sup.7
pfu/mL and an average insert size of 925 bp.
[0157] A 210 bp probe from exon 7 of the human .alpha.-Gal A gene
(FIG. 1, SEQ ID NO:1) was used to isolate the cDNA. The probe
itself was isolated from genomic DNA by the polymerase chain
reaction (PCR) using the following oligonucleotides:
[0158] 5'-CTGGGCTGTAGCTATGATAAAC-3' (Oligo 1; SEQ ID NO:6) and
[0159] 5'-TCTAGCTGAAGCAAAACAGTG-3' (Oligo 2; SEQ ID NO:7). The PCR
product was then used to screen the fibroblast cDNA library, and
positive clones were isolated and further characterized. One
positive clone, phage 3A, was subjected to the lambda ZapII.RTM.
system excision protocol (Stratagene, Inc., La Jolla, Calif.),
according to the manufacturer's instructions. This procedure
yielded plasmid pBSAG3A, which contains the .alpha.-Gal A cDNA
sequence in the pBluescriptSK-.TM. plasmid backbone. DNA sequencing
revealed that this plasmid did not contain the complete 5' end of
the cDNA sequence. Therefore, the 5' end was reconstructed using a
PCR fragment amplified from human genomic DNA. To accomplish this,
a 268 bp genomic DNA fragment (FIG. 2, SEQ ID NO:2) was amplified
using the following oligonucleotides: 5'-ATTGGTCCGCCCCTGAGGT-3'
(Oligo 3; SEQ ID NO:8) and 5'-TGATGCAGGAATCTGGCTCT-3' (Oligo 4; SEQ
ID NO:9). This fragment was subcloned into a "TA" cloning plasmid
(Invitrogen Corp., San Diego, Calif.) to generate plasmid
pTAAGEI.
[0160] Plasmid pBSAG3A, which contains the majority of the
.alpha.-Gal A cDNA sequence, and pTAAGEI, which contains the 5' end
of the .alpha.-Gal A cDNA, were each digested with SacII and NcoI.
The positions of the relevant SacII and NcoI sites within the
amplified DNA fragment are shown in FIG. 2. The 0.2 kb SacII-NcoI
fragment from pTAAGEI was isolated and ligated to equivalently
digested pBSAG3A. This plasmid, pAGAL, contains the complete
.alpha.-Gal A cDNA sequence, including the sequence encoding the
ax-Gal A signal peptide. The cDNA was completely sequenced (shown
in FIG. 3 including the .alpha.-Gal A signal peptide; SEQ ID NO:3)
and found to be identical to the published sequence for the human
.alpha.-Gal A cDNA (Genbank sequence HUMGALA).
[0161] The plasmid pXAG-16 was constructed via several
intermediates, as follows. First, pAGAL was digested with SacII and
XhoI and blunt-ended. Second, the ends of the complete .alpha.-Gal
A cDNA were ligated to XbaI linkers and subcloned into XbaI
digested pEF-BOS (Mizushima et al., Nucl. Acids Res. 18: 5322,
1990), creating pXAG-1. This construct contains the human
granulocyte-colony stimulating factor (G-CSF) 3' UTS and the human
elongation factor-1a (EF-1a) promoter flanking the cDNA encoding
.alpha.-Gal A plus the .alpha.-Gal A signal peptide, such that the
5' end of the .alpha.-Gal A cDNA is fused to the EF-la promoter. To
create a construct with the CMV IE promoter and first intron, the
.alpha.-Gal A cDNA and G-CSF 3' UTS were removed from pXAG-1 as a 2
kb XbaI-BamHI fragment. The fragment was blunt-ended, ligated to
BamHI linkers, and inserted into BamHI digested pCMVflpNeo (which
was constructed as described below). The orientation was such that
the 5' end of the .alpha.-Gal A cDNA was fused to the CMV IE
promoter region.
[0162] pCMVflpNeo was created as follows. A CMV IE gene promoter
fragment was amplified by PCR using CMV genomic DNA as a template
and the oligonucleotides:
[0163] 5'-TTTTGGATCCCTCGAGGACATTGATTATTGACTAG-3' (SEQ ID NO:10)
and
[0164] 5'-TTTTGGATCCCGTGTCAAGGACGGTGAC-3' (SEQ ID NO: 11). The
resulting product (a 1.6 kb fragment) was digested with BamHI,
yielding a CMV promoter-containing fragment with cohesive
BamHI-digested ends. The neo expression unit was isolated from
plasmid pMC1neopA (Stratagene Inc., La Jolla, Calif.) as a 1.1 kb
XhoI-BamHI fragment. The CMV promoter-containing and neo fragments
were inserted into a BamHI-, XhoI-digested plasmid (pUC12).
Notably, pCMVflpNeo contains the CMV IE promoter region, beginning
at nucleotide 546 and ending at nucleotide 2105 (of Genbank
sequence HS5MIEP), and the neomycin resistance gene driven by the
Herpes Simplex Virus (HSV) thymidine kinase promoter (the TKneo
gene) immediately 5' to the CMV IE promoter fragment. The direction
of transcription of the neo gene is the same as that of the CMV
promoter fragment. This intermediate construct was called
pXAG-4.
[0165] To add the hGH 3' UTS, the GCSF 3' UTS was removed from
pXAG-4 as an XbaI-SmaI fragment and the ends of pXAG-4 were made
blunt. The hGH 3' UTS was removed from pXGH5 (Selden et al., Mol.
Cell. Biol. 6: 3173-3179, 1986) as a 0.6 kb SmaI-EcoRI fragment.
After blunt-ending this fragment, it was ligated into pXAG-4
immediately after the blunt-ended XbaI site of pXAG-4. This
intermediate was called pXAG-7. The TKneo fragment was removed from
this plasmid as a HindIII-ClaI fragment and the ends of the plasmid
were blunted by "filling-in" with the Klenow fragment of DNA
polymerase I. A neomycin resistance gene driven by the SV40 early
promoter was ligated in as a blunted ClaI-BsmBI fragment from a
digest of pcDNeo (Chen et al., Mol. Cell. Biol. 7: 2745-2752,
1987), placing the neo transcription unit in the same orientation
as the .alpha.-Gal A transcription unit. This intermediate was
called pXAG-13.
[0166] To complete pXAG-16, which has the 26 amino acid hGH signal
peptide coding sequence and first intron of the hGH gene, a 2.0 kb
EcoRI-BamHI fragment of pXAG-13 was first removed. This fragment
included the .alpha.-Gal A cDNA and the hGH 3' UTS. This large
fragment was replaced with 3 fragments. The first fragment
consisted of a 0.3 kb PCR product of pXGH5, which contains the hGH
signal peptide coding sequence and includes the hGH first intron
sequence, from a synthetic BamHI site located just upstream of the
Kozak consensus sequence to the end of the hGH signal peptide
coding sequence. The following oligonucleotides were used to
amplify this fragment (Fragment 1): 5'-TTTTGGATCCACCATGGCTA-3'
(Oligo HGH101; SEQ ID NO:12) and 5'-TTTTGCCGGCACTGCCCTCTTGAA-3'
(Oligo HGH102; SEQ ID NO: 13). The second fragment consisted of a
0.27 kb PCR product containing sequences corresponding to the start
of the cDNA encoding the 398 amino acid .alpha.-Gal A enzyme (i e.,
lacking the .alpha.-Gal A signal peptide) to the NheI site. The
following oligonucleotides were used to amplify this fragment
(Fragment 2): 5'-TTTTCAGCTGGACAATGGATTGGC-3- ' (Oligo AG10; SEQ ID
NO:14) and 5'-TTTTGCTAGCTGGCGAATCC-3' (Oligo AG11; SEQ ID NO: 15).
The third fragment consisted of the NheI-EcoRI fragment of pXAG-7
containing the remaining .alpha.-Gal A sequence as well as the hGH
3' UTS (Fragment 3).
[0167] Fragment 1 (digested with BamHI and NaeI), Fragment 2
(digested with PvuII and NheI), and Fragment 3 were mixed with the
6.5 kb BamHI-EcoRI fragment of pXAG-13 containing the neo gene and
the CMV IE promoter and ligated together to generate plasmid
pXAG-16 (FIG. 4).
[0168] 1.2 Construction of the .alpha.-Gal A Expression Plasmid
pXAG-28
[0169] The human collagen I.alpha.2 promoter was isolated for use
in the .alpha.-Gal A expression construct pXAG-28 as follows. A 408
bp PCR fragment of human genomic DNA containing part of the human
collagen I.alpha.2 promoter was isolated using the following
oligonucleotides:
2 5'-TTTTGGATCCGTGTCCCATAGT (Oligo 72; SEQ ID NO:16) GTTTCCAA-3'
and 5'-TTTTGGATCCGCAGTCGTGGCCA (Oligo 73; SEQ ID NO:17)
GTACC-3'.
[0170] This fragment was used to screen a human leukocyte library
in EMBL3 (Clontech Inc., Palo Alto, Calif.). One positive clone
(phage 7H) containing a 3.8 kb EcoRI fragment was isolated and
cloned into pBSIISK+(Stratagene Inc., La Jolla, Calif.) at the
EcoRI site (creating pBS/7H.2). An AvrII site was introduced in
pBSIISK+by digesting with SpeI, which cleaves within the
pBSIISK+polylinker, "filling-in" with the Klenow fragment of DNA
polymerase 1, and inserting the oligonucleotide 5'-CTAGTCCTAGGA-3'
(SEQ ID NO: 18). This variant of pBSIISK+was digested with BamHI
and AvrII and ligated to the 121 bp BamHI-AvrII fragment of the
original 408 bp collagen I.alpha.2 promoter PCR fragment described
above, creating pBS/121COL.6.
[0171] The plasmid pBS/121COL.6 was digested with XbaI, which
cleaves within the pBSIISK+polylinker sequence, "filled-in" with
the Klenow fragment of DNA polymerase 1, and digested with AvrII.
The 3.8 kb BamHI-AvrII fragment of pBS/7H.2 was isolated and the
BamHI site made blunt-ended by treatment with Klenow enzyme. The
fragment was then digested with AvrII and ligated to the
AvrII-digested vector, thus creating the collagen promoter plasmid
pBS/121bpCOL7H.18.
[0172] Next the collagen promoter was fused to the 5' UTS of the
human .beta.-actin gene, which contains the first intron of the
human P-actin gene. To isolate this sequence, a 2 kb PCR fragment
was isolated from human genomic DNA using the following
oligonucleotides:
3 5'-TTTTGAGCACAGAGCCTCGCC (Oligo BA1; SEQ ID NO:19) T-3' and
5'-TTTTGGATCCGGTGAGCTGCG (Oligo BA2; SEQ ID NO:20)
AGAATAGCC-3'.
[0173] This fragment was digested with BamHI and BsiHKAI to release
a 0.8 kb fragment containing the .beta.-actin 5' UTS and intron. A
3.6 kb SalI-SrfI fragment was then isolated from the collagen
promoter plasmid pBS/121bpCOL7H.18 as follows. pBS/121bpCOL7H.18
was partially digested with BamHI (the BamHI site lies at the 5'
end of the collagen I.alpha.2 promoter fragment), made blunt-ended
by treatment with the Klenow fragment, and ligated to a SalI linker
(5'-GGTCGACC-3'), thereby placing a SalI site upstream of the
collagen I.alpha.2 promoter. This plasmid was then digested with
SalI and SrfI (the SrfI site lies 110 bp upstream of the collagen
I.alpha.2 promoter CAP site), and the 3.6 kb fragment was isolated.
The 0.8 and 3.6 kb fragments were combined with SalI- and
BamHI-digested pBSIISK-(Stratagene Inc., La Jolla, Calif.), and a
fragment composed of the following four oligonucleotides annealed
together (forming a fragment with a blunt end and a BsiHKAI
end):
4 (Oligo COL-1; SEQ ID NO:21) 5'-GGGCCCCCAGCCCCAGCCCTCCCATTG-
GTGGAGGCCCTTTTGGAGGC ACCCTAGGGCCAGGAAACTTTTGCCGTAT-3', (Oligo
COL-2; SEQ ID NO:22) 5'-AAATAGGGCAGATCCGGGCTTTATTATTTTAG-
CACCACGGCCGCCGA GACCGCGTCCGCCCCGCGAGCA-3', (Oligo COL-3; SEQ ID
NO:23) 5'-TGCCCTATTTATACGGCAAAAGTTTCCTGGCCCTAGGGTGCC- TCCAA AAGGGC
CTCCACCAATGGGAGGGCTGGGGCTGGGGGCCC-3', and (Oligo COL-4; SEQ ID
NO:24) 5'-CGCGGGGCGGACGCGGTCTCGGCGGCCGTGGT- GCTAAAATAATAAAG
CCCGGATC-3'.
[0174] These four oligonucleotides, when annealed, correspond to
the region beginning at the SrfI site of the collagen promoter and
continuing through the BsiHKAI site of the .beta.-actin promoter.
The resulting plasmid was designated pCOL/.beta.-actin.
[0175] To complete the construction of pXAG-28, the SalI-BamHI
fragment of pCOL/.beta.-actin, containing the collagen I.alpha.2
promoter and .beta.-actin 5' UTS, was isolated. This fragment was
ligated to two fragments from pXAG-16 (see Example 1.1 and FIG. 4):
(1) the 6.0 kb BamHI fragment (containing the neo gene, plasmid
backbone, the cDNA encoding the 398 amino acid .alpha.-Gal A
enzyme, and the hGH 3' UTS); and (2) the 0.3 kb BamHI-XhoI fragment
(which contains the SV40 poly A sequence from pcDneo). pXAG-28
contains the human collagen I.alpha.2 promoter fused to the human
.beta.-actin 5' UTS, the hGH signal peptide (which is interrupted
by the hGH first intron), the cDNA encoding the .alpha.-Gal A
enzyme, and the hGH 3' UTS. A map of the completed expression
construct pXAG-28 is shown in FIG. 5.
[0176] 1.3 Transfection and Selection of Fibroblasts Electroporated
with .alpha.-Gal A Expression Plasmids
[0177] In order to express .alpha.-Gal A in fibroblasts, secondary
fibroblasts were cultured and transfected according to published
procedures (Selden et al., WO 93/09222).
[0178] The plasmids pXAG-13, pXAG-16 and pXAG-28 were transfected
by electroporation into human foreskin fibroblasts to generate
stably transfected clonal cell strains, and the resulting
.alpha.-Gal A expression levels were monitored as described in
Example 1.4. Secretion of .alpha.-Gal A by normal foreskin
fibroblasts is in the range of 2-10 units/10.sup.6cells/24 hours.
In contrast, the transfected fibroblasts displayed mean expression
levels as shown in Table 2.
5TABLE 2 Mean .alpha.-Gal A expression levels (.+-. standard
deviation) pXAG-13: 420 .+-. 344 U/10.sup.6 cells/day N = 26 clonal
strains (range 3-1133 U/10.sup.6 cells/day) pXAG-16: 2,051 .+-.
1253 U/10.sup.6 cells/day N = 24 clonal strains (range 422-5200
U/10.sup.6 cells/day) pXAG-28: 141 .+-. 131 U/10.sup.6 cells/day N
= 38 clonal strains (range 20-616 U/10.sup.6 cells/day)
[0179] These data show that all three expression constructs are
capable of increasing .alpha.-Gal A expression many times that of
nontransfected fibroblasts. Expression by fibroblasts stably
transfected with pXAG-13, which encodes .alpha.-Gal A linked to the
.alpha.-Gal A signal peptide, was substantially lower than
expression by fibroblasts transfected with pXAG-16, which differs
only in that the signal peptide is the hGH signal peptide, the
coding sequence of which is interrupted by the first intron of the
hGH gene.
[0180] Each time the transfected cells were passaged, the secreted
.alpha.-Gal A activity was determined, the cells were counted, and
the cell density was calculated. Based on the number of cells
harvested and the time allowed for secretion of .alpha.-Gal A, the
specific expression rate of .alpha.-Gal A was determined and is
reported in Tables 3 and 4 as secreted units (of .alpha.-Gal A) per
106 cells per 24 hour period. Cell strains desirable for gene
therapy or for use in generation of material for purification of
.alpha.-Gal A should display stable growth and expression over
several passages. Data from the cell strains shown in Tables 3 and
4, which were stably transfected with the .alpha.-Gal A expression
construct pXAG-16, illustrate the fact that .alpha.-Gal A
expression is stably maintained during serial passage.
6TABLE 3 Growth and Expression of BRS-11 Cells Containing the
.alpha.-Gal A Expression Construct pXAG-16 Expression Cell Density
Passage (units/10.sup.6 cells/24 hr) (cells/cm.sup.2) 13 2601 4.80
.times. 10.sup.4 14 1616 4.40 .times. 10.sup.4 15 3595 4.40 .times.
10.sup.4
[0181]
7TABLE 4 Growth and Expression of HF503-242 Cells Containing the
.alpha.-Gal A Expression Construct PxAG-16 Expression Cell Density
Passage (units/10.sup.6 cells/24 hr) (cells/cm.sup.2) 5 4069 2.80
.times. 10.sup.4 6 7585 3.55 .times. 10.sup.4 7 5034 2.48 .times.
10.sup.4
[0182] 1.4 Quantification of .alpha.-Gal A Expression
[0183] The activity of .alpha.-Gal A activity was measured using
the water-soluble substrate
4-methylumbelliferyl-.alpha.-D-galactopyranoside (4-MUF-gal;
Research Products, Inc.) by a modification of the protocol
described by Ioannou et al., J. Cell Biol. 119:1137-1150 (1992).
The substrate was dissolved in substrate buffer (0.1 M
citrate-phosphate, pH 4.6) to a concentration of 1.69 mg/mL (5 mM).
Typically, 10 mL of culture supernatant was added to 75 mL of the
substrate solution. The tubes were covered and allowed to incubate
in a 37.degree. C. water bath for 60 minutes. At the end of the
incubation period, 2 mL of glycine-carbonate buffer (130 mM
glycine, 83 mM sodium carbonate, at pH 10.6), were used to stop the
reaction. The relative fluorescence of each sample was measured
using a model TK0100 fluorometer (Hoefer Scientific Instruments)
which has a fixed excitation wavelength of 365 nm and detects a
fixed emission wavelength of 460 nm. The readings of the samples
were compared to standards prepared from a 1 mM stock of
methylumbelliferone (Sigma Chemical Co.), and the amount of
hydrolyzed substrate was calculated. The activity of .alpha.-Gal A
is expressed in units; one unit of .alpha.-Gal A activity is
equivalent to one nanomole of substrate hydrolyzed per hour at
37.degree. C. Cell expression data were generally expressed as
units of .alpha.-Gal A activity secreted/10.sup.6 cells/24 hours.
This assay was also used to measure the amount of .alpha.-Gal
activity in cell lysates and in samples from various .alpha.-Gal
purification steps, as discussed below.
[0184] 1.5 Preparation of Gene-Activated .alpha.-Gal A (GA-GAL)
[0185] Production of gene-activated .alpha.-Gal A (GA-GAL) occurred
by insertion of regulatory and structural DNA sequences upstream of
the human .alpha.-Gal A coding sequence, using the GA technology
substantially as described in U.S. Pat. No. 5,733,761, herein
incorporated by reference. The precise insertion of the
gene-activating sequence occurs as a result of homologous
recombination between DNA present on a transfected DNA fragment and
genomic DNA sequences upstream of the .alpha.-Gal A locus in a
human cell. The gene-activating sequence itself contains
.alpha.-Gal A coding sequence up to, but not including, the signal
peptide cleavage site. Cells containing an activated .alpha.-Gal A
locus were isolated and subjected to drug selection to isolate
cells with increased GA-GAL production.
[0186] A targeting DNA fragment containing an appropriate
gene-activating sequence was introduced into host human cell lines
by electroporation. One such cell line is HT-1080, a certified cell
line available from ATCC (Rockville, Md.). The gene activation
plasmid (targeting construct) pGA213C containing such a DNA
fragment is shown in FIG. 9. This plasmid contains sequences
designed to activate a portion of the endogenous .alpha.-Gal A
locus in the host cell line, and contains sequences encoding the
signal peptide, but not human .alpha.-Gal A. The targeting
construct also contains expression cassettes for the bacterial neo
and mouse dhfr genes. These allow for the selection of stably
integrated targeting fragments (via the neo gene) and for
subsequent selection of the dhfr gene using step-wise methotrexate
(MTX) selection.
[0187] In addition, pGA213C contains sequences designed to target
chromosomal sequences upstream of the endogenous .alpha.-Gal A
locus by homologous recombination. Homologous recombination between
the endogenous .alpha.-Gal A locus and the 9.6 kb DNA fragment of
pGA213C is shown in FIG. 10.
[0188] pGA213C was constructed to delete 962 bp of genomic
sequences extending from positions -1183 to -222 relative to the
methionine initiation codon of .alpha.-Gal A, upon homologous
recombination of the pGA213C fragment with the X-chromosomal
.alpha.-Gal A locus. Transcriptional activation of the .alpha.-Gal
A locus occurs through precise targeting of the exogenous
regulatory sequences upstream of the .alpha.-Gal A coding region.
The resulting GA-GAL locus cause transcription to initiate from the
CMV promoter and to proceed through CMV exon 1, the aldolase intron
and the seven exons and six introns of the .alpha.-Gal A coding
sequence. Splicing of the large precursor mRNA joins the exogenous
CMV exon (inserted by targeting) with the entire endogenous first
exon of .alpha.-Gal A transcript. Translation of the GA-GAL mRNA
results in pre GA-GAL with a thirty one amino acid signal peptide.
Upon secretion from the host cell, the signal peptide is removed.
Correctly targeted cell lines are first identified by polymerase
chain reaction screening for the presence of the GA-GAL mRNA.
Clones producing the GA-GAL mRNA are also found to secrete
enzymatically active x-Gal A into the culture media. Subsequent
confirmation of targeting events is accomplished by restriction
enzyme digestion and Southern blot hybridization analysis of
genomic DNA.
[0189] Cells were exposed to stepwise methotrexate ("MTX")
selection. Following selection in 0.05 .mu.M MTX, a clone of cells
was isolated and subjected to 0.1 .mu.M MTX selection. From this
process a pool of cells resistant to 0.1 .mu.M MTX was isolated
(cell line RAG001), expanded in culture and characterized.
EXAMPLE 2
.alpha.-Gal A Purification
[0190] The following is a preferred method for producing,
purifying, and testing .alpha.-Gal A. The purification process
maintains .alpha.-Gal A in a soluble, active, native form
throughout the purification process. The protein is not exposed to
extremes of pH, organic solvents or detergents, is not
proteolytically cleaved during the purification process, and does
not form aggregates. The purification process is designed not to
alter the distribution of .alpha.-Gal A glycoforms.
[0191] 2.1 Purification of .alpha.-Gal A
[0192] Example 2.1 illustrates that .alpha.-Gal A may be purified
to near-homogeneity from the conditioned medium of cultured human
cell strains that have been stably transfected to produce the
enzyme. .alpha.-Gal A is isolated from .alpha.-Gal A containing
media using a series of five chromatographic steps. The five steps
utilize various separation principles which take advantage of
different physical properties of the enzyme to separate .alpha.-Gal
A from contaminating material. Included are hydrophobic interaction
chromatography on butyl Sepharose.RTM., ionic interaction on
hydroxyapatite, anion exchange chromatography on Q Sepharose.RTM.,
and size exclusion chromatography on Superdex.RTM. 200. In addition
to being the final step in the purification process, size exclusion
chromatography also serves as an effective means to exchange the
purified protein into a formulation-compatible buffer.
[0193] A. Use of Butyl Sepharose.RTM. Chromatography as a First
Step in the Purification of .alpha.-Gal A
[0194] Cold conditioned medium (1.34 liters) was clarified by
centrifugation and filtered through a 0.45 .mu.m cellulose acetate
filter using glass fiber prefilters. While stirring, the pH of the
cold, filtered medium was adjusted to 5.6 by the dropwise addition
of 1 N HCl, and ammonium sulfate was added to a final concentration
of 0.66 M by the dropwise addition of a stock solution (room
temperature) of 3.9 M ultrapure ammonium sulfate. The medium was
stirred for an additional 5 minutes at 4.degree. C., filtered as
before, and applied to a Butyl Sepharose.RTM. 4 Fast Flow column
(81 ml column volume, 2.5.times.16.5 cm; Pharmacia, Uppsala,
Sweden) that had been equilibrated in 10 mM MES-Tris, pH 5.6,
containing 0.66 M ammonium sulfate (buffer A). The chromatography
was performed at 4.degree. C. on a Gradi-Frac.TM. System
(Pharmacia, Uppsala, Sweden) equipped with in-line UV (280 nm) and
conductivity monitors for assessing total protein and salt
concentration, respectively. After sample application at a flow
rate of 10 ml/min, the column was washed with 10 column volumes of
buffer A. The .alpha.-Gal A was eluted from the Butyl
Sepharose.RTM. column with a 14 column volume linear gradient from
buffer A (containing ammonium sulfate) to 10 mM MES-Tris, pH 5.6
(no ammonium sulfate). Fractions were assayed for .alpha.-Gal A
activity by the 4-MUF-gal assay, and those containing appreciable
enzyme activity were pooled. As seen in FIG. 8 and the purification
summary (Table 5), this step removes approximately 99% of the
contaminating protein (pre-column sample=8.14 g total protein;
post-column sample=0.0638 g total protein).
8TABLE 5 Purification of .alpha.-Gal A from the Conditioned Medium
of Stably Transfected Human Fibroblasts Specific .alpha.-Gal A
Activity Fold Purification Volume Activity Total Prote (.times.10
.sup.6 Purification Percent Step (ml) (.times. 10.sup.6 Units) in
(mg) Units/mg) (Cumulative) Recovery Culture 1340 14.6 8140 0.0018
= 1 = 100 supernatant Buty 417 14.1 63.8 0.221 123 96.6 Sepharose
.RTM. Heparin 134 12.1 14.6 0.829 436 82.9 Sepharose .RTM. Hydroxy-
47 9.73 4.46 2.18 1220 66.6 apatite Q 31.5 8.91 3.31 2.69 1503 61.0
Sepharose .RTM. Superdex .RTM. 10 8.58 2.93 2.92 1634 59.0 200
[0195] B. Use of Heparin Sepharose.RTM. Chromatography as a Step
for Purification of .alpha.-Gal A
[0196] The Butyl Sepharose.RTM. column peak fractions were dialyzed
at 4.degree. C. against (4 liters) of 10 mM MES-Tris, pH 5.6
(changed once). The conductivity of the dialysate was adjusted to
1.0 mMHO at 4.degree. C. by addition of H.sub.2O or NaCl as
necessary. Afterward, the sample was applied to a column of Heparin
Sepharose.RTM. 6 Fast Flow (Pharmacia, Uppsala, Sweden; 29 ml
column volume, 2.5.times.6 cm) that had been equilibrated in 10 mM
MES-Tris, pH 5.6, containing 9 mM NaCl (buffer B). This was done at
4.degree. C. at a flow rate of 10 ml/min. In-line UV (280 nm) and
conductivity monitors measured total protein and salt
concentration. After the sample was applied, the column was washed
with 10 column volumes of buffer B followed by a 3 column volume
linear gradient to 8% buffer C/92% buffer B (where buffer C is 10
mM MES-Tris, pH 5.6, containing 250 mM NaCl) and a 10 column volume
wash with 8% buffer C. This was followed by elution of .alpha.-gal
A with a 1.5 column volume linear gradient to 29% buffer C and a
subsequent 10 column volume linear gradient to 35% buffer C.
Fractions were assayed for .alpha.-gal A activity, and those
containing appreciable activity were pooled.
[0197] C. Use of Hydroxyapatite Chromatography as a Step for
Purification of .alpha.-Gal A
[0198] The heparin pool was filtered and applied directly to a
column of Ceramic Hydroxyapatite HC (40 .mu.m; American
International Chemical, Natick, Mass.; 12 ml column volume,
1.5.times.6.8 cm) that had been equilibrated in 1 mM sodium
phosphate, pH 6.0 (buffer D). The chromatography was performed at
room temperature on a hybrid Gradi-Frac.TM./FPLC.RTM. System
(Pharmacia, Uppsala, Sweden) equipped with in-line UV (280 nm) and
conductivity monitors. After the sample was applied (5 ml/min), the
column was washed with 10 column volumes of buffer D. The
.alpha.-Gal A was eluted with a 7 column volume linear gradient to
42% buffer E/58% buffer D (where buffer E is 250 mM sodium
phosphate, pH 6.0) followed by a 10 column volume gradient to 52%
buffer E. Fractions were assayed for (x-Gal A activity, and the
fractions containing appreciable activity were pooled.
[0199] D. Use of Q Sepharose.RTM. Anion Exchange Chromatography as
a Step for Purification of .alpha.-Gal A
[0200] The hydroxyapatite pool was diluted approximately 1.5 fold
with H.sub.2O to a final conductivity of 3.4-3.6 mMHO at room
temperature. After filtering, the sample was applied to a column of
Q Sepharose.RTM. HP (Pharmacia, Uppsala, Sweden; 5.1 ml column
volume, 1.5.times.2.9 cm) equilibrated in 10% buffer G/90% buffer
F, where buffer F is 25 M sodium phosphate, pH 6.0, and buffer G is
25 mM sodium phosphate, pH 6.0, 250 mM NaCl. The chromatography was
performed at room temperature on the Gradi-Frac.TM./FPLC.RTM.
hybrid system (Pharmacia, Uppsala, Sweden), and total protein and
salt concentrations were monitored by the in-line monitors. The
sample was applied at a flow rate of 5 ml/min, then the following
steps were performed: (1) a 5 column volume wash at 10% buffer G,
(2) a 7 column volume wash at 12% buffer G, (3) a 3 column volume
linear gradient to 50% buffer G, (4) a I 0 column volume linear
gradient to 53% buffer G, (5) a 3 column volume gradient to I 00%
buffer G, and (6) a 10 column volume wash at 100% buffer G. The
.alpha.-Gal A eluted primarily during steps 3 and 4. Fractions
containing appreciable activity were pooled (the "Q pool").
[0201] E. Use of Superdex.RTM.-200 Gel Filtration Chromatography as
a Step for Purification of .alpha.-Gal A
[0202] The Q pool was concentrated approximately 5-fold using
Centriprep.RTM.-10 centrifugal concentrator units (Amicon, Beverly,
Mass.), and applied to a column of Superdex.RTM. 200 (Pharmacia,
Uppsala, Sweden; 189 ml column volume, 1.6.times.94 cm). The column
was equilibrated and eluted with 25 mM sodium phosphate, pH 6.0,
containing 150 mM NaCl. The chromatography was performed on an
FPLC.RTM. system (Pharmacia, Uppsala, Sweden) at room temperature
using an in-line UV monitor (280 nm) to follow elution of the
protein. The volume of the sample applied to the column was
.ltoreq.2 ml, the flow rate was 0.5 ml/min, and the fraction size
was 2 ml. Multiple column runs were performed; fractions were
assayed for .alpha.-Gal A activity and fractions containing
appreciable activity were pooled.
[0203] The pooled fractions from the Superdex.RTM. 200 column were
concentrated using Centriprep 10 units, aliquoted, snap-frozen, and
stored at -80.degree. C. for short periods of time. A summary of
this example of .alpha.-Gal A purification is shown in Table 5. The
final yield of .alpha.-Gal A was 59% of the starting material
activity, and the specific activity of the purified product was
2.92.times.10.sup.6 units/mg protein. The resulting product showed
a high level of purity after electrophoresis under reducing
conditions on a 4-15% SDS-polyacrylamide gel, which was
subsequently silver-stained.
SUMMARY
[0204] The purification process provides highly purified
.alpha.-Gal A. The majority of the purification occurs in the first
2 steps of the process, while the final three steps serve to polish
the material by removing the remaining minor contaminants. The last
step, size exclusion chromatography on Superdex.RTM. 200, also
serves to exchange the .alpha.-Gal A into a formulation-compatible
buffer.
[0205] 2.2 Size of .alpha.-Gal A Produced by Stably Transfected
Human Cells in Culture
[0206] The structural and functional properties of purified human
ax-Gal A were investigated. The resulting product showed a high
level of purity after electrophoresis under reducing conditions on
a 4-15% SDS-polyacrylamide gel, which was subsequently
silver-stained.
[0207] The molecular mass of .alpha.-Gal A was estimated by
MALDI-TOF mass spectrometry. These results demonstrate that the
molecular mass of the dimer is 102,353 Da, while that of the
monomer is 51,002 Da. The expected molecular mass of the monomer,
based on amino acid composition, is 45,400 Da. Therefore, the
carbohydrate content of the enzyme accounts for up to 5,600 Da of
the molecular weight.
[0208] 2.3 Carbohydrate Modification of .alpha.-Gal A Produced by
Stably Transfected Human Cells
[0209] The glycosylation pattern of .alpha.-Gal A produced in
accordance with the invention was also evaluated. Proper
glycosylation is important for optimal in vivo activity of
.alpha.-Gal A; .alpha.-Gal A expressed in non-glycosylating systems
is inactive or unstable. Hantzopolous et al., Gene 57: 159 (1987).
Glycosylation is also important for the internalization of
.alpha.-Gal A into the desired target cells, and affects the
circulating half-life of the enzyme in vivo. On each subunit of
.alpha.-Gal A, there are four sites available for addition of
asparagine-linked carbohydrate chains, of which only three are
occupied. Desnick et al., In THE METABOLIC AND MOLECULAR BASES OF
INHERITED DISEASE, (McGraw Hill, New York, 1995) pp 2741-2780.
[0210] A sample of .alpha.-Gal A produced by stably transfected
cells was treated with neuramimidase, which is isolated from A.
urafaciens, (Boehringer-Mannheim, Indianapolis, Ind.) to remove
sialic acid. This reaction was performed by treating 5 mg of
.alpha.-Gal A overnight with 10 mU of neuramimidase at room
temperature in a total volume of 10 mL of acetate buffered saline
(ABS, 20 mM sodium acetate, pH. 5.2, 150 mM NaCl).
[0211] Purified .alpha.-Gal A produced by stably transfected cells
was also dephosphorylated using alkaline phosphatase (calf
intestinal alkaline phosphatase, Boehringer-Mannheim, Indianapolis,
Ind.), by treating 5 mg of .alpha.-Gal A overnight at room
temperature with 15 U of alkaline phosphatase in ABS (pH raised to
7.5 with 1 M Tris).
[0212] The samples were analyzed by SDS-PAGE and/or isoelectric
focusing followed by Western blotting with an anti-.alpha.-Gal
A-specific antibody. The antibody used was a rabbit polyclonal
anti-peptide antibody, which was produced using a peptide
representing amino acids 68-81 of .alpha.-Gal A as an immunogen.
Following transfer of the protein to PVDF (Millipore, Bedford,
Mass.), the membrane was probed with a 1:2000 dilution of the
anti-serum in 2.5% blotto (non-fat dry milk in 20 mM Tris-HCl, pH
7.5, 0.05% Tween-20). This was followed by detection with goat
anti-rabbit IgG conjugated to horseradish peroxidase (Organo
Technique/Cappella, Durham, N.C.; 1:5000 dilution) and reagents of
the ECL chemiluminescence kit (Amersham, Arlington Heights,
Ind.).
[0213] Treatment of .alpha.-Gal A with neuramimidase followed by
SDS-PAGE analysis resulted in a shift in molecular mass
(approximately 1500-2000 Da or 4-6 sialic acids/monomer),
suggesting that there is extensive modification of .alpha.-Gal A
with sialic acid. For reference, the plasma form of .alpha.-Gal A
has 5-6 sialic acid residues per monomer, and the placental form
has 0.5-1.0 sialic acid residues per monomer. Bishop et al., J.
Biol. Chem. 256: 1307 (1981).
[0214] Another method used to examine the sialic acid and M6P
modifications of .alpha.-Gal A was isoelectric focusing (IEF),
where the samples are separated on the basis of their isoelectric
point (pI) or net charge. Thus, removal of charged residues such as
sialic acid or phosphate from .alpha.-Gal A would be expected to
alter the mobility of the protein in the IEF system.
[0215] To perform the IEF experiment, samples of .alpha.-Gal A
produced in accordance with the invention were treated with
neuramimidase and/or alkaline phosphatase, mixed 1:1 with 2.times.
Novex sample buffer (with 8 M urea, pH 3.0-7.0), and loaded onto a
6 M urea IEF gel (5.5% polyacrylamide) made using Pharmalyte.RTM.
(Pharmacia, Uppsala, Sweden; pH 3.0-6.5; Pharmalyte.RTM. 4-6.5 and
2.5-5.5, 0.25 mL each per gel). Isoelectric point standards
(Bio-Rad) were also included. Following electrophoresis, the gel
was transferred to PVDF, and Western blot analysis performed as
described above.
[0216] Neuramimidase treatment of the enzyme increased the pI of
all three isoforms, indicating that all were modified to some
extent by sialic acid. These data suggest that the .alpha.-Gal A
preparations produced as described herein should have a desirable
plasma half-life, indicating that this material is well suited for
pharmacological use. Further, treatment of neuramimidase-treated
.alpha.-Gal A with alkaline phosphatase further increased the pI of
a portion of the protein to approximately 5.0-5.1, indicating that
the enzyme bears one or more M6P residues. This modification is
required for efficient internalization of .alpha.-Gal A by the
target cells.
[0217] The N-linked carbohydrate chains of .alpha.-Gal A were
analyzed by ion-exchange HPLC (Glyco-Sep C) and labeling of the
non-reducing end with the fluorescent compound 2-amino benzamide
(AB). The results of the analysis of AB-glycans from three separate
.alpha.-Gal A preparations are summarized in Table 6. All three
preparations had a Z number greater than 170. Further, over 67% of
the glycans were sialylated, over 16% of the glycans were
phosphorylated, and less than 16% were neutral. These results
compared very favorably compared to results reported in the prior
art. For example, Desnick et al., (U.S. Pat. No. 5,356,804)
reported that over 60% of the glycans were neutral, with only 11%
being sialylated.
9TABLE 6 Results of Analysis of AB-glycans from GA-GAL % % % % %
Treatment Z number Neutral Mono- Di- Tri- Tetra- None 170.04 16.83
22.8 39.45 15.34 5.58 None 177.71 14.22 20.63 44.62 14.2 6.31 None
171.68 15.81 20.73 43.2 14.33 5.39 Mean (N = 3) 173.14 15.62 21.39
42.42 14.62 5.76 Neuraminidase 24.36 85.25 5.14 9.61 ND ND Alk.
Phosphatase 150.93 23.38 24.47 34.28 13.58 4.29
[0218]
10 GA-GALpreparations of the present Desnick et al., Percent of
Total: invention U.S. Pat. No. 5,356,804 Total P-glycans 16.62 24.1
Total Sialylated 67.57 11 Total Neutral 15.62 62.9 (hih-mannose and
hybrid)
[0219] Further detailed characterizations of the purified GA-GAL
preparations are provided in Table 7.
11TABLE 7 GA-GAL Purified Bulk Assay 40-173-KH 42-202-KH Specific
activity 2.75 2.80 SDS-PAGE Coomassie 100% 100% SDS-PAGE Silver
stain 99.6% 100% Reverse phase HPLC 100% 99.94 Size exclusion 0%
0.01% chromatography Internalization by foreskin 123.6% 94.3%
fibroblasts
[0220] 2.4 Increasing Proportion of Charged .alpha.-Gal A by
fractionation of .alpha.-Gal A Species
[0221] As discussed above, fractionation of .alpha.-Gal A
glycoforms can occur at various steps in the purification process
as described herein. In the present example, .alpha.-Gal A
glycoforms were fractionated by size and by charge. It is also
possible to fractionate .alpha.-Gal A by a combination of these or
other chromatographic techniques as described above.
[0222] For size fractionation of .alpha.-Gal A glycoforms, size
exclusion chromatography was performed on a Superdex.RTM. 200
column (Pharmacia, 1.6 cm by 94.1 cm) equilibrated in phosphate
buffered saline at pH 6. .alpha.-Gal A (2.6 mg in 1 mL) was loaded
onto the column, and the column was eluted at 0.35 mL/min.
Fractions were collected across the elution profile, and the
fractions comprising the broad elution peak of .alpha.-Gal A were
analyzed by SDS-PAGE, then visualized with silver stain. The
fractions at the leading edge of the peak contained .alpha.-Gal A
of the highest molecular weight, and as the fractions continued
across the peak, the apparent molecular weight of the .alpha.-Gal A
gradually decreased. Fractions of .alpha.-Gal A were then selected
and pooled to provide .alpha.-Gal A preparation of the desired
molecular weight ranges.
[0223] For fractionation of .alpha.-Gal A glycoforms by charge,
.alpha.-Gal A was fractionated by Q-Sepharose.RTM. chromatography.
The Q-Sepharose.RTM. column (1.5 cm by 9.4 cm) was equilibrated in
20 mM sodium phosphate, pH 6.0, containing 30 mM NaCl and the flow
rate was maintained at 5 mL/min. .alpha.-Gal A in (130 mg in 166
mL) was loaded onto the column, washed with equilibration buffer
then eluted with 20 mM sodium phosphate, pH 6.0, containing 130 mM
NaCl. For more extensive fractionation, a gradient elution (e.g.,
10 column volumes) from the equilibration buffer to the elution
buffer can be used. Fractions were collected across the elution
profile, and the fractions comprising the elution peak of
.alpha.-Gal A were analyzed by SDS-PAGE, then visualized by silver
stain. The lowest molecular weight species observed on the gel
eluted in the wash and at the leading edge of the peak, the highest
molecular weight glycoforms eluted towards the end of the peak. The
lower molecular weight species correspond to the less negatively
charged glycoforms of .alpha.-Gal A, which bind less tightly to the
positively charged Q-Sepharose.RTM. column (comprised of a
quaternary amine substituted resin). The .alpha.-Gal A species of
highest negative charge eluted later in the elution profile and
have a higher molecular weight, as analyzed by SDS-PAGE. The
fractionation by charge was confirmed by isoelectric focusing of
the eluted fractions or of selected pools.
[0224] Thus, both the fractionation by size and the fractionation
by charge permitted the select ion of highly charged glycoforms of
.alpha.-Gal A.
[0225] 2.5 Mannose or Mannose-6-Phosphate (M6P) Mediated
Internalization of .alpha.-Gal A
[0226] For the .alpha.-Gal A produced by stably transfected cells
to be an effective therapeutic agent 1:5 for .alpha.-Gal A
deficiencies, the enzyme must be internalized by the affected
cells. .alpha.-Gal A is minimally active at physiological pH
levels, for example, in the blood or interstitial fluids.
.alpha.-Gal A metabolizes accumulated lipid substrates optimally
only when internalized in the acidic environment of the lysosome.
This internalization is mediated by the binding of .alpha.-Gal A to
M6P receptors, which are expressed on the cell surface and deliver
the enzyme to the lysosome via the endocytic pathway. The M6P
receptor is ubiquitously expressed; most somatic cells express M6P
to some extent. The mannose receptor, which is specific for exposed
mannose residues on glycoproteins, is less prevalent. The mannose
receptors are generally found only on macrophage and
macrophage-like cells, and provide an additional means of
.alpha.-Gal A entry into these cell types.
[0227] In order to demonstrate M6P-mediated internalization of
.alpha.-Gal A, skin fibroblasts from a Fabry disease patient (NIGMS
Human Genetic Mutant Cell Repository) were cultured overnight in
the presence of increasing concentrations of purified .alpha.-Gal A
of the invention. Some of the samples contained 5 mM soluble M6P,
which competitively inhibits binding to and internalization by the
M6P receptor. Other samples contained 30 mg/mL mannan, which
inhibits binding to and internalization by the mannose receptor.
Following incubation, the cells were washed and harvested by
scraping into lysis buffer (10 mM Tris, pH 7.2, 100 mM NaCl, 5 mM
EDTA, 2 mM Pefabloc.TM. (Boehringer-Mannheim, Indianapolis, Ind.)
and 1% NP-40). The lysed samples were then assayed for protein
concentration and .alpha.-Gal A activity. The results are expressed
as units of .alpha.-Gal A activity/mg cell protein. The Fabry cells
internalized .alpha.-Gal A in a dose-dependent manner. This
internalization was inhibited by M6P, but there was no inhibition
with mannan. Therefore, internalization of .alpha.-Gal A in Fabry
fibroblasts is mediated by the M6P receptor, but not by the mannose
receptor.
[0228] .alpha.-Gal A is also internalized in vitro by endothelial
cells, important target cells for the treatment of Fabry disease.
Human umbilical vein endothelial cells (HUVECs) were cultured
overnight with 7500 units of .alpha.-Gal A; some of the wells
contained M6P. After the incubation period, cells were harvested
and assayed for .alpha.-Gal A as described above. The cells
incubated with .alpha.-Gal A had enzyme levels almost 10-fold those
of control (no incubation with .alpha.-Gal A) cells. M6P inhibited
the intracellular accumulation of .alpha.-Gal A, suggesting that
the internalization of .alpha.-Gal A by HUVECs is mediated by the
M6P receptor. Thus, the human .alpha.-Gal A of the invention is
internalized by clinically relevant cells.
[0229] Few cultured human cell lines are known to express the
mannose receptor. However, a mouse macrophage-like cell line
(J774.E) which bears mannose receptors but few if any M6P receptors
can be used to determine whether purified .alpha.-Gal A of the
invention is internalized via the mannose receptor. Diment et al.,
J. Leukocyte Biol. 42: 485-490 (1987). J774.E cells were cultured
overnight in the presence of 10,000 units/mL .alpha.-Gal A.
Selected samples also contained 2 mM M6P, and others contained 100
mg/mL mannan. The cells were washed and harvested as described
above, and the total protein and .alpha.-Gal A activity of each
sample was determined. M6P does not inhibit the uptake of
.alpha.-Gal A by these cells, while mannan decreases the
accumulated .alpha.-Gal A levels by 75%. Thus, the .alpha.-Gal A of
the invention may be internalized by the mannose receptor in cell
types that express this particular cell surface receptor.
EXAMPLE 3
Pharmaceutical Formulation
[0230] Preparation of Buffer Solutions and Formulations
[0231] .alpha.-Gal A Purified Bulk is diluted to final
concentration with .alpha.-Gal A Diluent. Based on the volume of
purified bulk to be formulated, the concentration of .alpha.-Gal A
(mg/mL), and the desired concentration of .alpha.-Gal A in the
final formulation, the volume of .alpha.-Gal A diluent required is
determined. .alpha.-Gal A diluent is prepared within 24 hours of
use by mixing appropriate quantities of WFI, sodium chloride, and
sodium phosphate monobasic, and adjusting the pH to 6.0 with sodium
hydroxide solution. The composition of .alpha.-Gal A Diluent is
listed in Table 8.
12TABLE 8 COMPOSITION OF .alpha.-GAL A DILUENT (per Liter)
Component Part Number Quantity Sodiumchloride(USP) 100-1916 8.8 g
Sodium hydroxide, 5N 200-1903 qs to adjust pH to 6.0 Sodium
phosphate, 100-1913 3.5 g monobasic (USP) Water for Injection (USP)
100-2301 qs ad 1.0 L
[0232] One liter or smaller volumes of .alpha.-Gal A Diluent are
filtered by vacuum filtration using sterile 0.2 mm nylon filters
(Nalge Nunc International, Rochester, NY). Larger volumes are
filtered by positive pressure using a peristaltic pump and 0.2 mm
Suporg capsule filters (Pall, Port Washington, NY). All filters are
subjected to post-filtration bubble point integrity testing. Mixing
and filtration steps are performed in a certified Class 100 laminar
flow hood. .alpha.-Gal A diluent is added to .alpha.-Gal A purified
bulk in a mixing vessel to give a 1 mg/ml final solution. Then, the
appropriate volume of polysorbate 20 (Tween 20, Spectrum) is added
to reach a final concentration of 0.02%.
EXAMPLE 4
Desialylated Degalactosylated .alpha.-Gal A
[0233] To explore the effect of glycosylation on the
biodistribution of .alpha.-Gal A, a purified preparation of
.alpha.-Gal A was sequentially deglycosylated and each form
injected into mice. The organs of the mice were collected at four
hours post-injection and immunohistochemistry on the tissues
performed to visualize possible changes in the biodistribution of
the protein.
[0234] The .alpha.-Gal A was first treated with neuramimidase
(sialidase) to remove sialic acid residues, leaving galactose
moieties exposed. A portion of this sialidase-treated was further
reacted with P-galactosidase to remove galactose residues; this
left N-acetylglucosamine (GlcNAC) residues exposed. The GlcNACs
were then removed by N-acetylglucosamimidase, leaving the core
mannose groups on the protein. Untreated .alpha.-Gal A (control) or
one of the treated forms of the protein were injected via the tall
vein into mice. Four hours after the injections, the liver, spleen,
heart, kidney and lungs from the mice were collected, preserved,
and immunostained for detection of .alpha.-Gal A.
[0235] When compared to control animals receiving untreated
protein, mice receiving the sialidase treated enzyme (galactose
residues exposed) had more .alpha.-Gal A localized in the liver and
correspondingly less of the enzyme in other examined organs.
Additionally, the staining pattern in the liver was quite
different. In control animals, the .alpha.-Gal A localized to
primarily the Kupffer cells and endothelial cells with only
moderate hepatocyte staining. In animals receiving the sialidase
treated .alpha.-Gal A, the enzyme localized only to the
hepatocytes, consistent with the known biodistribution of the
asialoglycoprotein receptor. This effect of deglycosylation on the
biodistribution was reversed when the galactose residues were
removed by P-galactosidase. The staining pattern observed in the
liver of the mice receiving this protein without galactose moieties
was similar to that of the control animals; the majority of the
staining was in Kupffer cells and endothelial cells, with minimal
hepatocyte staining. Further treatment of the .alpha.-Gal A with
N-acetylglucosamimidase did not alter the staining pattern from
that observed for the .beta.-galactosidase treated protein; that
is, removal of the N-acetylglucosamine residues seemed to have
little effect on the biodistribution of .alpha.-Gal A.
EXAMPLE 5
Correction of Fabry Fibroblasts by Human Fibroblasts Expressing
.alpha.-Gal A
[0236] For gene therapy, an implant of autologous cells producing
.alpha.-Gal A must produce the enzyme in a form modified
appropriately to "correct" the .alpha.-Gal A deficiency in target
cells. To assess the effect of .alpha.-Gal A production by
transfected human fibroblasts on Fabry cells, fibroblasts harvested
from Fabry disease patients (NIGMS Human Genetics Mutant Cell
Repository) were co-cultured with an .alpha.-Gal A production cell
strain (BRS-11) in Transwells.RTM. (Costar, Cambridge, Mass.).
Fabry cells were cultured in 12-well tissue culture dishes, some of
which contained inserts (Transwells.RTM., 0.4 mm pore size) having
a surface on which cells can be grown. The growth matrix of the
insert is porous and allows macromolecules to pass from the upper
to the lower milieu. One set of inserts contained normal human
foreskin (HF) fibroblasts, which secrete minimal levels of
.alpha.-Gal A, while another set contained the stably transfected
human fibroblast strain, BRS-11, which secretes large amounts of
.alpha.-Gal A. In the wells co-cultured with .alpha.-Gal A
production cells, .alpha.-Gal A can enter the medium bathing the
Fabry cells, and potentially be internalized by the Fabry
cells.
[0237] The data in Table 9 show that Fabry cells internalized the
secreted .alpha.-Gal A. The intracellular levels of .alpha.-Gal A
were monitored for 3 days. Those cells cultured alone (no insert)
or in the presence of non-transfected foreskin fibroblasts (HF
insert) had very low intracellular levels of .alpha.-Gal A
activity. The Fabry cells cultured with the .alpha.-Gal A
production (BRS-11 insert) cells, however, exhibited enzyme levels
similar to those of normal cells by the end of Day 2 (normal
fibroblasts have 25-80 units .alpha.-Gal A/mg protein). That the
correction is attributable to .alpha.-Gal A taken up via the M6P
receptor is demonstrated by the inhibition with M6P (BRS-11
insert+M6P).
13TABLE 9 CORRECTION OF FABRY FIBROBLASTS BY HUMAN FIBROBLASTS
EXPRESSING .alpha.-Gal A ACTIVITY (units/mg total protein) BRS-11
insert + Time no insert HF insert BRS-11 insert M6P Day 1 2 .+-. 1
2 .+-. 1 13 .+-. 1 4 .+-. 1 Day 2 2 .+-. 1 2 .+-. 1 40 .+-. 11 6
.+-. 2 Day 3 2 .+-. 1 5 .+-. 1 85 .+-. 1 9 .+-. 1
[0238] The foregoing description has been presented only for the
purposes of illustration and is not intended to limit the invention
to the precise form disclosed, but by the claims appended hereto.
In the specification and the appended claims, the singular forms
include plural references, unless the context clearly dictates
otherwise. All patents and publications cited in this specification
are incorporated by reference.
Sequence CWU 1
1
24 1 210 DNA Artificial Sequence Description of Artificial Sequence
Human fibroblast library probe exon 7, including amplification
primers. 1 ctgggctgta gctatgataa accggcagga gattggtgga cctcgctctt
ataccatcgc 60 agttgcttcc ctgggtaaag gagtggcctg taatcctgcc
tgcttcatca cacagctcct 120 ccctgtgaaa aggaagctag ggttctatga
atggacttca aggttaagaa gtcacataaa 180 tcccacaggc actgttttgc
ttcagctaga 210 2 268 DNA Artificial Sequence Description of
Artificial Sequence 5' end of cDNA clone including amplification
primers. 2 attggtccgc ccctgaggtt aatcttaaaa gcccaggtta cccgcggaaa
tttatgctgt 60 ccggtcaccg tgacaatgca gctgaggaac ccagaactac
atctgggctg cgcgcttgcg 120 cttcgcttcc tggccctcgt ttcctgggac
atccctgggg ctagagcact ggacaatgga 180 ttggcaagga cgcctaccat
gggctggctg cactgggagc gcttcatgtg caaccttgac 240 tgccaggaag
agccagattc ctgcatca 268 3 1343 DNA Homo sapiens 3 ccgcgggaaa
tttatgctgt ccggtcaccg tgacaatgca gctgaggaac ccagaactac 60
atctgggctg cgcgcttgcg cttcgcttcc tggccctcgt ttcctgggac atccctgggg
120 ctagagcact ggacaatgga ttggcaagga cgcctaccat gggctggctg
cactgggagc 180 gcttcatgtg caaccttgac tgccaggaag agccagattc
ctgcatcagt gagaagctct 240 tcatggagat ggcagagctc atggtctcag
aaggctggaa ggatgcaggt tatgagtacc 300 tctgcattga tgactgttgg
atggctcccc aaagagattc agaaggcaga cttcaggcag 360 accctcagcg
ctttcctcat gggattcgcc agctagctaa ttatgttcac agcaaaggac 420
tgaagctagg gatttatgca gatgttggaa ataaaacctg cgcaggcttc cctgggagtt
480 ttggatacta cgacattgat gcccagacct ttgctgactg gggagtagat
ctgctaaaat 540 ttgatggttg ttactgtgac agtttggaaa atttggcaga
tggttataag cacatgtcct 600 tggccctgaa taggactggc agaagcattg
tgtactcctg tgagtggcct ctttatatgt 660 ggccctttca aaagcccaat
tatacagaaa tccgacagta ctgcaatcac tggcgaaatt 720 ttgctgacat
tgatgattcc tggaaaagta taaagagtat cttggactgg acatctttta 780
accaggagag aattgttgat gttgctggac cagggggttg gaatgaccca gatatgttag
840 tgattggcaa ctttggcctc agctggaatc agcaagtaac tcagatggcc
ctctgggcta 900 tcatggctgc tcctttattc atgtctaatg acctccgaca
catcagccct caagccaaag 960 ctctccttca ggataaggac gtaattgcca
tcaatcagga ccccttgggc aagcaagggt 1020 accagcttag acagggagac
aactttgaag tgtgggaacg acctctctca ggcttagcct 1080 gggctgtagc
tatgataaac cggcaggaga ttggtggacc tcgctcttat accatcgcag 1140
ttgcttccct gggtaaagga gtggcctgta atcctgcctg cttcatcaca cagctcctcc
1200 ctgtgaaaag gaagctaggg ttctatgaat ggacttcaag gttaagaagt
cacataaatc 1260 ccacaggcac tgttttgctt cagctagaaa atacaatgca
gatgtcatta aaagacttac 1320 tttaaaaaaa aaaaaaactc gag 1343 4 398 PRT
Homo sapiens 4 Leu Asp Asn Gly Leu Ala Arg Thr Pro Thr Met Gly Trp
Leu His Trp 1 5 10 15 Glu Arg Phe Met Cys Asn Leu Asp Cys Gln Glu
Glu Pro Asp Ser Cys 20 25 30 Ile Ser Glu Lys Leu Phe Met Glu Met
Ala Glu Leu Met Val Ser Glu 35 40 45 Gly Trp Lys Asp Ala Gly Tyr
Glu Tyr Leu Cys Ile Asp Asp Cys Trp 50 55 60 Met Ala Pro Gln Arg
Asp Ser Glu Gly Arg Leu Gln Ala Asp Pro Gln 65 70 75 80 Arg Phe Pro
His Gly Ile Arg Gln Leu Ala Asn Tyr Val His Ser Lys 85 90 95 Gly
Leu Lys Leu Gly Ile Tyr Ala Asp Val Gly Asn Lys Thr Cys Ala 100 105
110 Gly Phe Pro Gly Ser Phe Gly Tyr Tyr Asp Ile Asp Ala Gln Thr Phe
115 120 125 Ala Asp Trp Gly Val Asp Leu Leu Lys Phe Asp Gly Cys Tyr
Cys Asp 130 135 140 Ser Leu Glu Asn Leu Ala Asp Gly Tyr Lys His Met
Ser Leu Ala Leu 145 150 155 160 Asn Arg Thr Gly Arg Ser Ile Val Tyr
Ser Cys Glu Trp Pro Leu Tyr 165 170 175 Met Trp Pro Phe Gln Lys Pro
Asn Tyr Thr Glu Ile Arg Gln Tyr Cys 180 185 190 Asn His Trp Arg Asn
Phe Ala Asp Ile Asp Asp Ser Trp Lys Ser Ile 195 200 205 Lys Ser Ile
Leu Asp Trp Thr Ser Phe Asn Gln Glu Arg Ile Val Asp 210 215 220 Val
Ala Gly Pro Gly Gly Trp Asn Asp Pro Asp Met Leu Val Ile Gly 225 230
235 240 Asn Phe Gly Leu Ser Trp Asn Gln Gln Val Thr Gln Met Ala Leu
Trp 245 250 255 Ala Ile Met Ala Ala Pro Leu Phe Met Ser Asn Asp Leu
Arg His Ile 260 265 270 Ser Pro Gln Ala Lys Ala Leu Leu Gln Asp Lys
Asp Val Ile Ala Ile 275 280 285 Asn Gln Asp Pro Leu Gly Lys Gln Gly
Tyr Gln Leu Arg Gln Gly Asp 290 295 300 Asn Phe Glu Val Trp Glu Arg
Pro Leu Ser Gly Leu Ala Trp Ala Val 305 310 315 320 Ala Met Ile Asn
Arg Gln Glu Ile Gly Gly Pro Arg Ser Tyr Thr Ile 325 330 335 Ala Val
Ala Ser Leu Gly Lys Gly Val Ala Cys Asn Pro Ala Cys Phe 340 345 350
Ile Thr Gln Leu Leu Pro Val Lys Arg Lys Leu Gly Phe Tyr Glu Trp 355
360 365 Thr Ser Arg Leu Arg Ser His Ile Asn Pro Thr Gly Thr Val Leu
Leu 370 375 380 Gln Leu Glu Asn Thr Met Gln Met Ser Leu Lys Asp Leu
Leu 385 390 395 5 1197 DNA Homo sapiens 5 ctggacaatg gattggcaag
gacgcctacc atgggctggc tgcactggga gcgcttcatg 60 tgcaaccttg
actgccagga agagccagat tcctgcatca gtgagaagct cttcatggag 120
atggcagagc tcatggtctc agaaggctgg aaggatgcag gttatgagta cctctgcatt
180 gatgactgtt ggatggctcc ccaaagagat tcagaaggca gacttcaggc
agaccctcag 240 cgctttcctc atgggattcg ccagctagct aattatgttc
acagcaaagg actgaagcta 300 gggatttatg cagatgttgg aaataaaacc
tgcgcaggct tccctgggag ttttggatac 360 tacgacattg atgcccagac
ctttgctgac tggggagtag atctgctaaa atttgatggt 420 tgttactgtg
acagtttgga aaatttggca gatggttata agcacatgtc cttggccctg 480
aataggactg gcagaagcat tgtgtactcc tgtgagtggc ctctttatat gtggcccttt
540 caaaagccca attatacaga aatccgacag tactgcaatc actggcgaaa
ttttgctgac 600 attgatgatt cctggaaaag tataaagagt atcttggact
ggacatcttt taaccaggag 660 agaattgttg atgttgctgg accagggggt
tggaatgacc cagatatgtt agtgattggc 720 aactttggcc tcagctggaa
tcagcaagta actcagatgg ccctctgggc tatcatggct 780 gctcctttat
tcatgtctaa tgacctccga cacatcagcc ctcaagccaa agctctcctt 840
caggataagg acgtaattgc catcaatcag gaccccttgg gcaagcaagg gtaccagctt
900 agacagggag acaactttga agtgtgggaa cgacctctct caggcttagc
ctgggctgta 960 gctatgataa accggcagga gattggtgga cctcgctctt
ataccatcgc agttgcttcc 1020 ctgggtaaag gagtggcctg taatcctgcc
tgcttcatca cacagctcct ccctgtgaaa 1080 aggaagctag ggttctatga
atggacttca aggttaagaa gtcacataaa tcccacaggc 1140 actgttttgc
ttcagctaga aaatacaatg cagatgtcat taaaagactt actttaa 1197 6 22 DNA
Artificial Sequence Description of Artificial Sequence PCR Primer 6
ctgggctgta gctatgataa ac 22 7 21 DNA Artificial Sequence
Description of Artificial Sequence PCR Primer 7 tctagctgaa
gcaaaacagt g 21 8 19 DNA Artificial Sequence Description of
Artificial Sequence PCR Primer 8 attggtccgc ccctgaggt 19 9 20 DNA
Artificial Sequence Description of Artificial Sequence PCR Primer 9
tgatgcagga atctggctct 20 10 35 DNA Artificial Sequence Description
of Artificial Sequence PCR Primer 10 ttttggatcc ctcgaggaca
ttgattattg actag 35 11 28 DNA Artificial Sequence Description of
Artificial Sequence PCR Primer 11 ttttggatcc cgtgtcaagg acggtgac 28
12 20 DNA Artificial Sequence Description of Artificial Sequence
PCR Primer 12 ttttggatcc accatggcta 20 13 24 DNA Artificial
Sequence Description of Artificial Sequence PCR Primer 13
ttttgccggc actgccctct tgaa 24 14 24 DNA Artificial Sequence
Description of Artificial Sequence PCR Primer 14 ttttcagctg
gacaatggat tggc 24 15 20 DNA Artificial Sequence Description of
Artificial Sequence PCR Primer 15 ttttgctagc tggcgaatcc 20 16 30
DNA Artificial Sequence Description of Artificial Sequence PCR
Primer 16 ttttggatcc gtgtcccata gtgtttccaa 30 17 28 DNA Artificial
Sequence Description of Artificial Sequence PCR Primer 17
ttttggatcc gcagtcgtgg ccagtacc 28 18 12 DNA Artificial Sequence
Description of Artificial Sequence Insertion Oligo 18 ctagtcctag ga
12 19 22 DNA Artificial Sequence Description of Artificial Sequence
PCR Primer 19 ttttgagcac agagcctcgc ct 22 20 30 DNA Artificial
Sequence Description of Artificial Sequence Partial Collagen
Promoter 20 ttttggatcc ggtgagctgc gagaatagcc 30 21 76 DNA
Artificial Sequence Description of Artificial Sequence Partial
Collagen Promoter 21 gggcccccag ccccagccct cccattggtg gaggcccttt
tggaggcacc ctagggccag 60 gaaacttttg ccgtat 76 22 69 DNA Artificial
Sequence Description of Artificial Sequence Partial Collagen
Promoter 22 aaatagggca gatccgggct ttattatttt agcaccacgg ccgccgagac
cgcgtccgcc 60 ccgcgagca 69 23 86 DNA Artificial Sequence
Description of Artificial Sequence Partial Collagen promoter 23
tgccctattt atacggcaaa agtttcctgg ccctagggtg cctccaaaag ggcctccacc
60 aatgggaggg ctggggctgg gggccc 86 24 55 DNA Artificial Sequence
Description of Artificial Sequence PCR Primer 24 cgcggggcgg
acgcggtctc ggcggccgtg gtgctaaaat aataaagccc ggatc 55
* * * * *