U.S. patent application number 10/096790 was filed with the patent office on 2003-04-24 for combinatorial polyketide libraries produced using a modular pks gene cluster as scaffold.
Invention is credited to Ashley, Gary, Fu, Hong, Kao, Camilla M., Khosla, Chaitan, McDaniel, Robert.
Application Number | 20030077707 10/096790 |
Document ID | / |
Family ID | 23932708 |
Filed Date | 2003-04-24 |
United States Patent
Application |
20030077707 |
Kind Code |
A1 |
Khosla, Chaitan ; et
al. |
April 24, 2003 |
Combinatorial polyketide libraries produced using a modular PKS
gene cluster as scaffold
Abstract
Combinatorial libraries of polyketides can be obtained by
suitable manipulation of a host modular polyketide synthase gene
cluster such as that which encodes the PKS for erythromycin. The
combinatorial library is useful as a source of pharmaceutically
active compounds.
Inventors: |
Khosla, Chaitan; (Palo Alto,
CA) ; Ashley, Gary; (Alameda, CA) ; Fu,
Hong; (Stanford, CA) ; Kao, Camilla M.; (Palo
Alto, CA) ; McDaniel, Robert; (Palo Alto,
CA) |
Correspondence
Address: |
Kate H. Murashige
Morrison & Forerster LLP
Suite 500
3811 Valley Centre Drive
San Diego
CA
92130-2332
US
|
Family ID: |
23932708 |
Appl. No.: |
10/096790 |
Filed: |
March 12, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10096790 |
Mar 12, 2002 |
|
|
|
08846247 |
Apr 30, 1997 |
|
|
|
6391594 |
|
|
|
|
08846247 |
Apr 30, 1997 |
|
|
|
08486645 |
Jun 7, 1995 |
|
|
|
5712146 |
|
|
|
|
08486645 |
Jun 7, 1995 |
|
|
|
08238811 |
May 6, 1994 |
|
|
|
5672491 |
|
|
|
|
08238811 |
May 6, 1994 |
|
|
|
08164301 |
Dec 8, 1993 |
|
|
|
08164301 |
Dec 8, 1993 |
|
|
|
08123732 |
Sep 20, 1993 |
|
|
|
10096790 |
Mar 12, 2002 |
|
|
|
09311756 |
May 14, 1999 |
|
|
|
09311756 |
May 14, 1999 |
|
|
|
09164306 |
Oct 1, 1998 |
|
|
|
09164306 |
Oct 1, 1998 |
|
|
|
08896323 |
Jul 17, 1997 |
|
|
|
6066721 |
|
|
|
|
08896323 |
Jul 17, 1997 |
|
|
|
08675817 |
Jul 5, 1996 |
|
|
|
6080555 |
|
|
|
|
60076919 |
Mar 5, 1998 |
|
|
|
60003338 |
Jul 6, 1995 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/193; 435/254.2; 435/483 |
Current CPC
Class: |
C12P 17/08 20130101;
C07D 407/06 20130101; C07H 17/08 20130101; C12N 15/52 20130101;
C07D 309/36 20130101; C12N 9/93 20130101; C12P 7/26 20130101; C40B
40/00 20130101; C12P 17/162 20130101; C07D 311/92 20130101; C07D
323/00 20130101; C12P 17/06 20130101 |
Class at
Publication: |
435/69.1 ;
435/193; 435/254.2; 435/483 |
International
Class: |
C12P 021/02; C12N
009/10; C12N 001/18; C12N 015/74 |
Goverment Interests
[0002] This work was supported in part by a grant from the National
Institutes of Health, CA66736. The U.S. government has certain
rights in this invention.
Foreign Application Data
Date |
Code |
Application Number |
Jul 17, 1998 |
US |
PCT/US98/14911 |
Claims
1. A method for modifying the acyltransferase domain in a modular
polyketide synthase (PKS) comprising replacing a first region
encoding a first acyltransferase domain of a first PKS with a
second region encoding a second acyltransferase domain from a
second PKS.
2. The method of claim 1 wherein the first region and second region
only encode an acyltransferase domain.
3. The method of claim 1 wherein the first PKS is from
Saccharopolyspora erythraea.
4. The method of claim 1 wherein the second PKS is from
Saccharopolyspora erythraea.
5. The method of claim 1 wherein the first PKS and/or second PKS is
selected from the group consisting of rapamycin, avermectin,
FK-506, and tylosin.
6. The method of claim 1 wherein the first and/or second PKS is
selected from Streptomyces.
7. The method of claim 6 wherein the Streptomyces is Streptomyces
hygroscopicus.
8. The method of claim 1 wherein the replacement of the
acyltransferase domain is conducted by in vivo recombination.
9. The method of claim 8 wherein the recombination is via
homologous sequences framing the replacement region in a donor
plasmid and a receptor region in a recipient plasmid.
10. The method of claim 1 wherein the replacement of the
acyltransferase domain is conducted in vitro using restriction
enzymes.
11. A vector comprising the first or second PKS of claim 1 or the
PKS produced by the method of claim 1.
12. A host cell transformed with the vector of claim 11.
13. The host cell of claim 12 wherein said cell is a bacterial
cell.
14. The host cell of claim 12 wherein said bacterial cell is E.
coli.
15. The host cell of claim 12 wherein said cell is a
polyketide-producing organism.
16. The host cell of claim 12 wherein said polyketide-producing
organism is selected from the group consisting of a Streptomyces
species and a Saccharopolyspora species.
17. A method for altering the substrate specificity of a polyketide
synthase in a first polyketide-producing microorganism comprising
the steps of: (a) isolating a first and second genomic DNA segment,
each comprising a polyketide synthase wherein said first genomic
DNA segment is from said first polyketide-producing microorganism
and said second genomic DNA segment is from said first
polyketide-producing microorganism or a second polyketide-producing
microorganism; (b) identifying one or more discrete fragments of
said first genomic DNA segment, each of which encodes an
acyltransferase domain; (c) identifying one or more discrete
fragments of said second genomic DNA segment, each of which encodes
a related domain to said acyltransferase domain of said first
genomic DNA segment; and (d) transforming a cell of said first
polyketide-producing microorganism with one or more of said
fragments from step (c) under conditions suitable for the
occurrence of a homologous recombination event, leading to the
replacement of one or more of said fragments from said first
genomic DNA segment with one or more of said fragments from step
(c).
18. The method of claim 17 wherein said first polyketide-producing
microorganism is Saccharopolyspora erythraea.
19. The method of claim 17 wherein said second polyketide-producing
microorganism is Saccharopolyspora erythraea.
20. The method of claim 17 wherein said acyltransferase domain is
selected from a module of DEBS or a module of rapamycin
synthase.
21. The method of claim 17 wherein said first polyketide-producing
microorganism is Streptomyces.
22. The method of claim 21 wherein said Streptomyces is selected
from the group consisting of Streptomyces antibioticus,
Streptomyces mycarofaciens, Streptomyces avermitilis, Streptomyces
caelestis, Streptomyces tsukubaensis, Streptomyces fradiae,
Streptomyces platensis, Streptomyces violaceoniger, Streptomyces
ambofaciens, Streptomyces griseoplanus, and Streptomyces
venezuelae.
23. The method of claim 22 wherein said Streptomyces is selected
from the group consisting of Streptomyces caelestis and
Streptomyces venezuelae.
24. The method of claim 17 wherein said second polyketide-producing
microorganism is Streptomyces.
25. The method of claim 24 wherein said Streptomyces is selected
from the group consisting of Streptomyces antibioticus,
Streptomyces mycarofaciens, Streptomyces avermitilis, Streptomyces
hygroscopicus, Streptomyces caelestis, Streptomyces tsukubaensis,
Streptomyces fradiae, Streptomyces platensis, Streptomyces
violaceoniger, Streptomyces ambofaciens, and Streptomyces
venezuelae.
26. The method of claim 25 wherein said Streptomyces is selected
from the group consisting of Streptontyces caelestis, Streptomyces
hygroscopicus, and Streptomyces venezuelae.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/486,645 filed Jun. 7, 1995 which is continuation-in-part of U.S.
Ser. No. 08/238,811 filed May 6, 1994. The disclosures of these
applications are incorporated herein by reference.
TECHNICAL FIELD
[0003] The invention relates to the field of combinatorial
libraries. More particularly, it concerns construction of libraries
of polyketides synthesized by a multiplicity of polyketide
synthases derived from a naturally occurring PKS, as illustrated by
the erythromycin gene cluster.
BACKGROUND ART
[0004] Polyketides represent a large family of diverse compounds
ultimately synthesized from 2-carbon units through a series of
Claisen-type condensations and subsequent modifications. Members of
this group include antibiotics such as tetracyclines, anticancer
agents such as daunomycin, and immunosuppressants such as FK506 and
rapamycin. Polyketides occur in many types of organisms including
fungi and mycelial bacteria, in particular, the actinomycetes.
[0005] The polyketides are synthesized by polyketide synthases
(PKS). This group of enzymatically active proteins is considered in
a different category from the fatty acid synthases which also
catalyze condensation of 2-carbon units to result in, for example,
fatty acids and prostaglandins. Two major types of PKS are known
which are vastly different in their construction and mode of
synthesis. These are commonly referred to as Type I or "modular"
and Type II, "aromatic."
[0006] The PKS scaffold that is the subject of the present
invention is a member of the group designated Type I or "modular"
PKS. In this type, a set of separate active sites exists for each
step of carbon chain assembly and modification, but the individual
proteins contain a multiplicity of such separate active sites.
There may be only one multifunctional protein of this type, such as
that required for the biosynthesis of 6-methyl salicylic acid
(Beck, J. et al., Eur J Biochem (1990) 192:487-498; Davis, R. et
al., Abstracts of Genetics of Industrial Microorganism Meeting,
Montreal, Abstract P288 (1994)). More commonly, and in
bacterial-derived Type I PKS assemblies, there are several such
multifunctional proteins assembled to result in the end product
polyketide. (Cortes, J. et al., Nature (1990) 348:176; Donadio, S.
et al., Science (1991) 252:675; MacNeil, D. J. et al., Gene (1992)
115:119.)
[0007] The PKS for erythromycin, used as an illustrative system is
a modular PKS. Erythromycin was originally isolated from S.
erythraeus (since reclassified as Saccharopolyspora erythrea) which
was found in a soil sample from the Philippine archipelago. Cloning
the genes was described by Donadio, S. et al., Science (1991)
252:675. The particulars have been reviewed by Perun, T. J. in Drug
Action and Drug Resistance in Bacteria, Vol. 1, S. Mitsuhashi (ed.)
University Park Press, Baltimore, 1977. The antibiotic occurs in
various glycosylated forms, designated A, B and C during various
stages of fermentation. The entire erythromycin biosynthetic gene
cluster from S. erythraeus has been mapped and sequenced by Donadio
et al. in Industrial Microorganisms: Basic and Applied Molecular
Genetics (1993) R. H. Baltz, G. D. Hegeman, and P. L. Skatrud
(eds.) (Amer Soc Microbiol) and the entire PKS is an assembly of
three such multifunctional proteins usually designated DEBS-1,
DEBS-2, and DEBS-3, encoded by three separate genes.
[0008] Type II PKS, in contrast, include several proteins, each of
which is simpler than those found in Type I polyketide synthases.
The active sites in these enzymes are used iteratively so that the
proteins themselves are generally monofunctional or bifunctional.
For example, the aromatic PKS complexes derived from Streptomyces
have so far been found to contain three proteins encoded in three
open reading frames. One protein provides ketosynthase (KS) and
acyltransferase (AT) activities, a second provides a chain length
determining factor (CLDF) and a third is an acyl carrier protein
(ACP).
[0009] The present invention is concerned with PKS systems derived
from modular PKS gene clusters. The nature of these clusters and
their manipulation are further described below.
DISCLOSURE OF THE INVENTION
[0010] The invention provides recombinant materials for the
production of combinatorial libraries of polyketides wherein the
polyketide members of the library are synthesized by various PKS
systems derived from naturally occurring PKS systems by using these
systems as scaffolds. Generally, many members of these libraries
may themselves be novel compounds, and the invention further
includes novel polyketide members of these libraries. The invention
also includes methods to recover novel polyketides with desired
binding activities by screening the libraries of the invention.
[0011] Thus, in one aspect, the invention is directed to a
multiplicity of cell colonies comprising a library of colonies
wherein each colony of the library contains an expression vector
for the production of a different modular PKS, but derived from a
naturally occurring PKS. In a preferred embodiment, the different
PKS are derived from the erythromycin PKS. In any case, the library
of different modular PKS is obtained by modifying one or more of
the regions of a naturally occurring gene or gene cluster encoding
an enzymatic activity so as to alter that activity, leaving intact
the scaffold portions of the naturally occurring gene. In another
aspect, the invention is directed to a multiplicity of cell
colonies comprising a library of colonies wherein each colony of
the library contains a different modular PKS derived from a
naturally occurring PKS, preferably the erythromycin PKS. The
invention is also directed to methods to produce libraries of PKS
complexes and to produce libraries of polyketides by culturing
these colonies, as well as to the libraries so produced. In
addition, the invention is directed to methods to screen the
resulting polyketide libraries and to novel polyketides contained
therein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 is a diagram of the erythromycin PKS complex from S.
erythraeus showing the function of each multifunctional
protein.
[0013] FIG. 2 is a diagram of DEBS-1 from S. erythraeus showing the
functional regions separated by linker regions.
[0014] FIG. 3 shows a diagram of a vector containing the entire
erythromycin gene cluster.
[0015] FIG. 4 shows a method for the construction of the vector of
FIG. 3.
[0016] FIG. 5 shows the structures of several polyketides produced
by manipulating the erythromycin PKS gene cluster.
[0017] FIG. 6 shows the construction of derivative PKS gene
clusters from the vector of FIG. 3.
MODES OF CARRYING OUT THE INVENTION
[0018] It may be helpful to review the nature of the erythromycin
PKS complex and the gene cluster that encodes it as a model for
modular PKS, in general.
[0019] FIG. 1 is a diagrammatic representation of the gene cluster
encoding erythromycin. The erythromycin PKS protein assembly
contains three high-molecular-weight proteins (>200 kD)
designated DEBS-1, DEBS-2 and DEBS-3, each encoded by a separate
gene (Caffrey et al., FEBSLett (1992) 304:225). The diagram in FIG.
1 shows that each of the three proteins contains two modules of the
synthase--a module being that subset of reactivities required to
provide an additional 2-carbon unit to the molecule. As shown in
FIG. 1, modules 1 and 2 reside on DEBS-1; modules 3 and 4 on DEBS-2
and modules 5 and 6 on DEBS-3. The minimal module is typified in
module 3 which contains a ketosynthase (KS), an acyltransferase
(AT) and an acyl carrier protein (ACP). These three functions are
sufficient to activate an extender unit and attach it to the
remainder of the growing molecule. Additional activities that may
be included in a module relate to reactions other than the Claisen
condensation, and include a dehydratase activity (DH), an
enoylreductase activity (ER) and a ketoreductase activity (KR). The
first module also contains repeats of the AT and ACP activities
because it catalyzes the initial condensation, i.e. it begins with
a "loading domain" represented by AT and ACP, which determine the
nature of the starter unit. Although not shown, module 3 has a KR
region which has been inactivated by mutation. The "finishing" of
the molecule is regulated by the thioesterase activity (TE) in
module 6. This thioesterase appears to catalyze cyclization of the
macrolide ring thereby increasing the yield of the polyketide
product.
[0020] FIG. 2 shows a detailed view of the regions in the first two
modules which comprise the first open reading frame encoding
DEBS-1. The regions that encode enzymatic activities are separated
by linker or "scaffold"-encoding regions. These scaffold regions
encode amino acid sequences that space the enzymatic activities at
the appropriate distances and in the correct order. Thus, these
linker regions collectively can be considered to encode a scaffold
into which the various activities are placed in a particular order
and spatial arrangement. This organization is similar in the
remaining genes, as well as in other naturally occurring modular
PKS gene clusters.
[0021] The three DEBS-1, 2 and 3 proteins are encoded by the
genetic segments ery-AI, ery-AII and ery-AIII, respectively. These
reading frames are located on the bacterial chromosome starting at
about 10 kb distant from the erythromycin resistance gene (ermE or
eryR).
[0022] The detailed description above referring to erythromycin is
typical for modular PKS in general. Thus, rather than the
illustrated erythromycin, the polyketide synthases making up the
libraries of the invention can be derived from the synthases of
other modular PKS, such as those which result in the production of
rapamycin, avermectin, FK-506, FR-008, monensin, rifamycin,
soraphen-A, spinocyn, squalestatin, or tylosin, and the like.
[0023] Regardless of the naturally occurring PKS gene used as a
scaffold, the invention provides libraries, ultimately of
polyketides, by generating a variety of modifications in the
erythromycin PKS or other naturally occurring PKS gene cluster so
that the protein complexes produced by the cluster have altered
activities in one or more respects, and thus produce polyketides
other than the natural product of the PKS. By providing a large
number of different genes or gene clusters derived from a naturally
occurring PKS gene cluster, each of which has been modified in a
different way from the native cluster, an effectively combinatorial
library of polyketides can be produced as a result of the multiple
variations in these activities. All of the PKS encoding sequences
used in the present invention represent modular polyketide
synthases "derived from" a naturally occurring PKS, illustrated by
the erythromycin PKS. As will be further described below, the metes
and bounds of this derivation can be described on both the protein
level and the encoding nucleotide sequence level.
[0024] By a modular PKS "derived from" the erythromycin or other
naturally occurring PKS is meant a modular polyketide synthase (or
its corresponding encoding gene(s)) that retains the scaffolding of
all of the utilized portion of the naturally occurring gene. (Not
all modules need be included in the constructs.) On the constant
scaffold, at least one enzymatic activity is mutated, deleted or
replaced, so as to alter the activity. Alteration results when
these activities are deleted or are replaced by a different version
of the activity, or simply mutated in such a way that a polyketide
other than the natural product results from these collective
activities. This occurs because there has been a resulting
alteration of the starter unit and/or extender unit, and/or
stereochemistry, and/or chain length or cyclization and/or
reductive or dehydration cycle outcome at a corresponding position
in the product polyketide. Where a deleted activity is replaced,
the origin of the replacement activity may come from a
corresponding activity in a different naturally occurring
polyketide synthase or from a different region of the same PKS. In
the case of erythromycin, for example, any or all of the DEBS-1,
DEBS-2 and DEBS-3 proteins may be included in the derivative or
portions of any of these may be included; but the scaffolding of an
erythromycin PKS protein is retained in whatever derivative is
considered. Similar comments pertain to the corresponding ery-AI,
ery-AII and ery-AIII genes.
[0025] The derivative may contain preferably at least a
thioesterase activity from the erythromycin or other naturally
occurring PKS gene cluster.
[0026] In summary, a polyketide synthase "derived from" a naturally
occurring PKS contains the scaffolding encoded by all or the
portion employed of the naturally occurring synthase gene, contains
at least two modules that are functional, and contains mutations,
deletions, or replacements of one or more of the activities of
these functional modules so that the nature of the resulting
polyketide is altered. This definition applies both at the protein
and genetic levels. Particular preferred embodiments include those
wherein a KS, AT, KR, DH or ER has been deleted or replaced by a
version of the activity from a different PKS or from another
location within the same PKS. Also preferred are derivatives where
at least one noncondensation cycle enzymatic activity (KR, DH or
ER) has been deleted or wherein any of these activities has been
mutated so as to change the ultimate polyketide synthesized.
[0027] Thus, there are five degrees of freedom for constructing a
polyketide synthase in terms of the polyketide that will be
produced. First, the polyketide chain length will be determined by
the number of modules in the PKS. Second, the nature of the carbon
skeleton of the PKS will be determined by the specificities of the
acyl transferases which determine the nature of the extender units
at each position--e.g., malonyl, methyl malonyl, or ethyl malonyl,
etc. Third, the loading domain specificity will also have an effect
on the resulting carbon skeleton of the polyketide. Thus, the
loading domain may use a different starter unit, such as acetyl,
propionyl, and the like. Fourth, the oxidation state at various
positions of the polyketide will be determined by the dehydratase
and reductase portions of the modules. This will determine the
presence and location of ketone, alcohol, alkene substituents or
whether a single .sigma.-bond will result at particular locations
in the polyketide. Finally, the stereochemistry of the resulting
polyketide is a function of three aspects of the synthase. The
first aspect is related to the AT/KS specificity associated with
substituted malonyls as extender units, which affects
stereochemistry only when the reductive cycle is missing or when it
contains only a ketoreductase since the dehydratase would abolish
chirality. Second, the specificity of the ketoreductase will
determine the chirality of any .beta.-OH. Finally, the enoyl
reductase specificity for substituted malonyls as extender units
will influence the result when there is a complete KR/DH/ER
available.
[0028] In the working examples below, all of the foregoing
variables other than the loading domain specificity which controls
the starter unit have been varied.
[0029] Thus, the modular PKS systems, and in particular, the
erythromycin PKS system, permit a wide range of polyketides to be
synthesized. As compared to the aromatic PKS systems, a wider range
of starter units including aliphatic monomers (acetyl, propionyl,
butyryl, isovaleryl, etc.), aromatics (aminohydroxybenzoyl),
alicyclics (cyclohexanoyl), and heterocyclics (thiazolyl) are found
in various macrocyclic polyketides. Recent studies have shown that
modular PKSs have relaxed specificity for their starter units (Kao
et al. Science (1994), supra). Modular PKSs also exhibit
considerable variety with regard to the choice of extender units in
each condensation cycle. The degree of .beta.-ketoreduction
following a condensation reaction has also been shown to be altered
by genetic manipulation (Donadio et al. Science (1991), supra;
Donadio, S. et al Proc Natl Acad Sci USA (1993) 90:7119-7123).
Likewise, the size of the polyketide product can be varied by
designing mutants with the appropriate number of modules (Kao, C.
M. et al. J Am Chem Soc (1994) 116:11612-11613). Lastly, these
enzymes are particularly well-known for generating an impressive
range of asymmetric centers in their products in a highly
controlled manner. Thus, the combinatorial potential within modular
PKS pathways based on any naturally occurring modular, such as the
erythromycin PKS scaffold, is virtually unlimited.
Methods to Construct Multiple Modular PKS Derived from a Naturally
Occurring PKS
[0030] The derivatives of the a naturally occurring PKS can be
prepared by manipulation of the relevant genes. A large number of
modular PKS gene clusters have been mapped and/or sequenced,
including erythromycin and rapamycin, which have been completely
mapped and sequenced, and soraphen A, FK506 and oleandomycin which
have been partially sequenced, and candicidin, avermectin, and
nemadectin which have been mapped and partially sequenced.
Additional modular PKS gene clusters are expected to be available
as time progresses. These genes can be manipulated using standard
techniques to delete or inactivate activity encoding regions,
insert regions of genes encoding corresponding activities form the
same or different PKS system, or otherwise mutated using standard
procedures for obtaining genetic alterations. Of course, portions
of, or all of, the desired derivative coding sequences can be
synthesized using standard solid phase synthesis methods such as
those described by Jaye et al., J Biol Chem (1984) 259:6331 and
which are available commercially from, for example, Applied
Biosystems, Inc.
[0031] In order to obtain nucleotide sequences encoding a variety
of derivatives of the naturally occurring PKS, and thus a variety
of polyketides for construction of a library, a desired number of
constructs can be obtained by "mixing and matching" enzymatic
activity-encoding portions, and mutations can be introduced into
the native host PKS gene cluster or portions thereof.
[0032] Mutations can be made to the native sequences using
conventional techniques.
[0033] The substrates for mutation can be an entire cluster of
genes or only one or two of them; the substrate for mutation may
also be portions of one or more of these genes. Techniques for
mutation include preparing synthetic oligonucleotides including the
mutations and inserting the mutated sequence into the gene encoding
a PKS subunit using restriction endonuclease digestion. (See, e.g.,
Kunkel, T. A. Proc Natl Acad Sci USA (1985) 82:448; Geisselsoder et
al. BioTechniques (1987) 5:786.) Alternatively, the mutations can
be effected using a mismatched primer (generally 10-20 nucleotides
in length) which hybridizes to the native nucleotide sequence
(generally cDNA corresponding to the RNA sequence), at a
temperature below the melting temperature of the mismatched duplex.
The primer can be made specific by keeping primer length and base
composition within relatively narrow limits and by keeping the
mutant base centrally located. Zoller and Smith, Methods Enzymol
(1983) 100:468. Primer extension is effected using DNA polymerase,
the product cloned and clones containing the mutated DNA, derived
by segregation of the primer extended strand, selected. Selection
can be accomplished using the mutant primer as a hybridization
probe. The technique is also applicable for generating multiple
point mutations. See, e.g., Dalbie-McFarland et al. Proc Natl Acad
Sci USA (1982) 79:6409. PCR mutagenesis will also find use for
effecting the desired mutations.
[0034] Random mutagenesis of selected portions of the nucleotide
sequences encoding enzymatic activities can be accomplished by
several different techniques known in the art, e.g., by inserting
an oligonucleotide linker randomly into a plasmid, by irradiation
with X-rays or ultraviolet light, by incorporating incorrect
nucleotides during in vitro DNA synthesis, by error-prone PCR
mutagenesis, by preparing synthetic mutants or by damaging plasmid
DNA in vitro with chemicals. Chemical mutagens include, for
example, sodium bisulfite, nitrous acid, hydroxylamine, agents
which damage or remove bases thereby preventing normal base-pairing
such as hydrazine or formic acid, analogues of nucleotide
precursors such as nitrosoguanidine, 5-bromouracil, 2-aminopurine,
or acridine intercalating agents such as proflavine, acriflavine,
quinacrine, and the like. Generally, plasmid DNA or DNA fragments
are treated with chemicals, transformed into E. coli and propagated
as a pool or library of mutant plasmids.
[0035] In addition to providing mutated forms of regions encoding
enzymatic activity, regions encoding corresponding activities from
different PKS synthases or from different locations in the same PKS
synthase can be recovered, for example, using PCR techniques with
appropriate primers. By "corresponding" activity encoding regions
is meant those regions encoding the same general type of
activity--e.g., a ketoreductase activity in one location of a gene
cluster would "correspond" to a ketoreductase-encoding activity in
another location in the gene cluster or in a different gene
cluster; similarly, a complete reductase cycle could be considered
corresponding--e.g., KR/DH/ER would correspond to KR alone.
[0036] If replacement of a particular target region in a host
polyketide synthase is to be made, this replacement can be
conducted in vitro using suitable restriction enzymes or can be
effected in vivo using recombinant techniques involving homologous
sequences framing the replacement gene in a donor plasmid and a
receptor region in a recipient plasmid. Such systems,
advantageously involving plasmids of differing temperature
sensitivities are described, for example, in PCT application WO
96/40968.
[0037] The vectors used to perform the various operations to
replace the enzymatic activity in the host PKS genes or to support
mutations in these regions of the host PKS genes may be chosen to
contain control sequences operably linked to the resulting coding
sequences in a manner that expression of the coding sequences may
be effected in a appropriate host. However, simple cloning vectors
may be used as well.
[0038] If the cloning vectors employed to obtain PKS genes encoding
derived PKS lack control sequences for expression operably linked
to the encoding nucleotide sequences, the nucleotide sequences are
inserted into appropriate expression vectors. This need not be done
individually, but a pool of isolated encoding nucleotide sequences
can be inserted into host vectors, the resulting vectors
transformed or transfected into host cells and the resulting cells
plated out into individual colonies.
[0039] Suitable control sequences include those which function in
eucaryotic and procaryotic host cells. Preferred host include
fungal systems such as yeast and procaryotic hosts, but single cell
cultures of, for example, mammalian cells could also be used. There
is no particular advantage, however, in using such systems.
Particularly preferred are yeast and procaryotic hosts which use
control sequences compatible with Streptomyces spp. Suitable
controls sequences for single cell cultures of various types of
organisms are well known in the art. Control systems for expression
in yeast, including controls which effect secretion are widely
available are routinely used. Control elements include promoters,
optionally containing operator sequences, and other elements
depending on the nature of the host, such as ribosome binding
sites. Particularly useful promoters for procaryotic hosts include
those from PKS gene clusters which result in the production of
polyketides as secondary metabolites, including those from aromatic
(Type II) PKS gene clusters. Examples are act promoters, tcm
promoters, spiramycin promoters, and the like. However, other
bacterial promoters, such as those derived from sugar metabolizing
enzymes, such as galactose, lactose (lac) and maltose, are also
useful. Additional examples include promoters derived from
biosynthetic enzymes such as tryptophan (trp), the .beta.-lactamase
(bla), bacteriophage lambda PL, and T5. In addition, synthetic
promoters, such as the tac promoter (U.S. Pat. No. 4,551,433), can
be used.
[0040] Other regulatory sequences may also be desirable which allow
for regulation of expression of the PKS replacement sequences
relative to the growth of the host cell. Regulatory sequences are
known to those of skill in the art, and examples include those
which cause the expression of a gene to be turned on or off in
response to a chemical or physical stimulus, including the presence
of a regulatory compound. Other types of regulatory elements may
also be present in the vector, for example, enhancer sequences.
[0041] Selectable markers can also be included in the recombinant
expression vectors. A variety of markers are known which are useful
in selecting for transformed cell lines and generally comprise a
gene whose expression confers a selectable phenotype on transformed
cells when the cells are grown in an appropriate selective medium.
Such markers include, for example, genes which confer antibiotic
resistance or sensitivity to the plasmid. Alternatively, several
polyketides are naturally colored and this characteristic provides
a built-in marker for screening cells successfully transformed by
the present constructs.
[0042] The various PKS nucleotide sequences, or a cocktail of such
sequences, can be cloned into one or more recombinant vectors as
individual cassettes, with separate control elements, or under the
control of, e.g., a single promoter. The PKS subunits or cocktail
components can include flanking restriction sites to allow for the
easy deletion and insertion of other PKS subunits or cocktail
components so that hybrid PKSs can be generated. The design of such
unique restriction sites is known to those of skill in the art and
can be accomplished using the techniques described above, such as
site-directed mutagenesis and PCR.
[0043] As described above, particularly useful control sequences
are those which themselves, or using suitable regulatory systems,
activate expression during transition from growth to stationary
phase in the vegetative mycelium. The system contained in the
illustrated plasmid pCK7, i.e., the actI/actIII promoter pair and
the actII-ORF4, an activator gene, is particularly preferred.
Particularly preferred hosts are those which lack their own means
for producing polyketides so that a cleaner result is obtained.
Illustrative host cells of this type include the modified S.
coelicolor CH999 culture described in PCT application WO 96/40968
and similar strains of S. lividans.
[0044] The expression vectors containing nucleotide sequences
encoding a variety of PKS systems for the production of different
polyketides are then transformed into the appropriate host cells to
construct the library. In one straightforward approach, a mixture
of such vectors is transformed into the selected host cells and the
resulting cells plated into individual colonies and selected for
successful transformants. Each individual colony will then
represent a colony with the ability to produce a particular PKS
synthase and ultimately a particular polyketide. Typically, there
will be duplications in some of the colonies; the subset of the
transformed colonies that contains a different PKS in each member
colony can be considered the library. Alternatively, the expression
vectors can be used individually to transform hosts, which
transformed hosts are then assembled into a library. A variety of
strategies might be devised to obtain a multiplicity of colonies
each containing a PKS gene cluster derived from the naturally
occurring host gene cluster so that each colony in the library
produces a different PKS and ultimately a different polyketide. The
number of different polyketides that are produced by the library is
typically at least four, more typically at least ten, and
preferably at least 20, more preferably at least 50, reflecting
similar numbers of different altered PKS gene clusters and PKS gene
products. The number of members in the library is arbitrarily
chosen; however, the degrees of freedom outlined above with respect
to the variation of starter, extender units, stereochemistry,
oxidation state, and chain length is quite large.
[0045] Methods for introducing the recombinant vectors of the
present invention into suitable hosts are known to those of skill
in the art and typically include the use of CaCl.sub.2 or other
agents, such as divalent cations, lipofection, DMSO, protoplast
transformation and electroporation.
[0046] The polyketide producing colonies can be identified and
isolated using known techniques and the produced polyketides
further characterized. The polyketides produced by these colonies
can be used collectively in a panel to represent a library or may
be assessed individually for activity.
[0047] The libraries can thus be considered at three levels: (1) a
multiplicity of colonies each with a different PKS encoding
sequence encoding a different PKS cluster but all derived from a
naturally occurring PKS cluster; (2) colonies which contain the
proteins that are members of the PKS produced by the coding
sequences; and (3) the polyketides produced. Of course, combination
libraries can also be constructed wherein members of a library
derived, for example, from the erythromycin PKS can be considered
as a part of the same library as those derived from, for example,
the rapamycin PKS cluster.
[0048] Colonies in the library are induced to produce the relevant
synthases and thus to produce the relevant polyketides to obtain a
library of candidate polyketides. The polyketides secreted into the
media can be screened for binding to desired targets, such as
receptors, signaling proteins, and the like. The supernatants per
se can be used for screening, or partial or complete purification
of the polyketides can first be effected. Typically, such screening
methods involve detecting the binding of each member of the library
to receptor or other target ligand. Binding can be detected either
directly or through a competition assay. Means to screen such
libraries for binding are well known in the art.
[0049] Alternatively, individual polyketide members of the library
can be tested against a desired target. In this event, screens
wherein the biological response of the target is measured can more
readily be included.
EXAMPLES
[0050] The following examples are intended to illustrate, but not
to limit the invention.
Materials and Methods General Techniques:
[0051] Bacterial Strains, Plasmids, and Culture Conditions.
[0052] S. coelicolor CH999 described in WO 95/08548, published Mar.
30, 1995 was used as an expression host. DNA manipulations were
performed in Escherichia coli MC 1061. Plasmids were passaged
through E. coli ET12567 (dam dcm hsdS Cm.sup.r) (MacNeil, D. J. J
Bacteriol (1988) 170:5607) to generate unmethylated DNA prior to
transformation of S. coelicolor. E. coli strains were grown under
standard conditions. S. coelicolor strains were grown on R2YE agar
plates (Hopwood, D. A. et al. Genetic manipulation of Streptomyces.
A laboratory manual. The John Innes Foundation: Norwich, 1985).
pRM5, also described in WO 95/08548, includes a colEI replicon, an
appropriately truncated SCP2* Streptomyces replicon, two
act-promoters to allow for bidirectional cloning, the gene encoding
the actII-ORF4 activator which induces transcription from act
promoters during the transition from growth phase to stationary
phase, and appropriate marker genes. Engineered restriction sites
facilitate the combinatorial construction of PKS gene clusters
starting from cassettes encoding individual domains of naturally
occurring PKSs.
[0053] When pRM5 is used for expression of PKS, (i) all relevant
biosynthetic genes are plasmid-bome and therefore amenable to
facile manipulation and mutagenesis in E. coli, (ii) the entire
library of PKS gene clusters can be expressed in the same bacterial
host which is genetically and physiologically well-characterized
and presumably contains most, if not all, ancillary activities
required for in vivo production of polyketides, (iii) polyketides
are produced in a secondary metabolite-like manner, thereby
alleviating the toxic effects of synthesizing potentially bioactive
compounds in vivo, and (iv) molecules thus produced undergo fewer
side reactions than if the same pathways were expressed in
wild-type organisms or blocked mutants.
[0054] Manipulation of DNA and Organisms.
[0055] Polymerase chain reaction (PCR) was performed using Taq
polymerase (Perkin Elmer Cetus) under conditions recommended by the
enzyme manufacturer. Standard in vitro techniques were used for DNA
manipulations (Sambrook, et al. Molecular Cloning: A Laboratory
Manual (Current Edition)). E. coli was transformed with a Bio-Rad
E. Coli Pulsing apparatus using protocols provided by Bio-Rad. S.
coelicolor was transformed by standard procedures (Hopwood, D. A.
et al. Genetic manipulation of Streptomyces. A laboratory manual.
The John Innes Foundation: Norwich, 1985) and transformants were
selected using 2 ml of a 500 .mu.g/ml thiostrepton overlay.
[0056] Production and Purification of Polyketides.
[0057] For initial screening, all strains were grown at 30.degree.
C. as confluent lawns on 150 mm Petri plates containing 50 ml of
R2YE agar supplemented with 50 .mu.g/ml thiostrepton poured over a
125 mm disc of Whatman 52 filter paper. After 2-3 days of growth,
the agar disc was lifted from the dish and placed atop a layer of 6
mm glass beads mixed with 60 ml of liquid R2YE medium and 3 g of
Amberlite XAD-16 absorption resin in a 150 mm Petri dish. Growth
was continued for an additional 6 days at 30.degree. C. The agar
disc was removed, an the XAD-16 resin was collected by vacuum
filtration. After washing with water, the resin was shaken with 15
ml of ethanol for 30 min. The ethanol extract was decanted from the
resin, and the extraction was repeated twice more. The combined
ethanol extracts were then evaporated to dryness under reduced
pressure. The residue was dissolved in ethyl acetate, washed once
with saturated aqueous NaHCO.sub.3, then analyzed by HPLC
(water-acetonitrile-acetic acid gradient, C18-reversed phase) with
mass spectrometric detection. For purification, extracts were
separated on silica gel columns of silica gel preparative
thin-layer chromatography using ethyl acetate-hexane mixtures as
eluents.
Preparation A
Construction of the Complete Erythromycin PKS Gene Cluster
[0058] Recovery of the Erythromycin PKS Genes
[0059] Although various portions of the erythromycin PKS gene
cluster can be manipulated separately at any stage of the process
of preparing libraries, it may be desirable to have a convenient
source of the entire gene cluster in one place. Thus, the entire
erythromycin PKS gene cluster can be recovered on a single plasmid
if desired.
[0060] This is illustrated below utilizing derivatives of the
plasmid pMAK705 (Hamilton et al. J Bacteriol (1989) 171:4617) to
permit in vivo recombination between a temperature-sensitive donor
plasmid, which is capable of replication at a first, permissive
temperature and incapable of replication at a second,
non-permissive temperature, and recipient plasmid. The eryA genes
thus cloned gave pCK7, a derivative of pRM5 (McDaniel et al.
Science (1993) 262:1546). A control plasmid, pCK7f, was constructed
to carry a frameshift mutation in eryAI pCK7 and pCK7f possess a
ColEI replicon for genetic manipulation in E. coli as well as a
truncated SCP2* (low copy number) Streptomyces replicon.
[0061] These plasmids also contain the divergent actI/actIII
promoter pair and actII-ORF4, an activator gene, which is required
for transcription from these promoters and activates expression
during the transition from growth to stationary phase in the
vegetative mycelium. High-level expression of PKS genes occurs at
the onset of the stationary phase of mycelial growth. The
recombinant strains therefore produce the encoded polyketides as
secondary metabolites.
[0062] In more detail, pCK7 (FIG. 4), a shuttle plasmid containing
the complete eryA genes, which were originally cloned from pS1
(Tuan et al. Gene (1990) 90:21), was constructed as follows. The
modular DEBS PKS genes were transferred incrementally from a
temperature-sensitive "donor" plasmid, i.e., a plasmid capable of
replication at a first, permissive temperature and incapable of
replication at a second, non-permissive temperature, to a
"recipient" shuttle vector via a double recombination event, as
depicted in FIG. 5. A 25.6 kb SphI fragment from pS1 was inserted
into the SphI site of pMAK705 (Hamilton et al. J Bacteriol (1989)
171:4617) to give pCK6 (Cm.sup.R), a donor plasmid containing
eryAII, eryAIII, and the 3' end of eryAI. Replication of this
temperature-sensitive pSC101 derivative occurs at 30.degree. C. but
is arrested at 44.degree. C. The recipient plasmid, pCK5 (AP.sup.R,
Tc.sup.R), includes a 12.2 kb eryA fragment from the eryAI start
codon (Caffrey et al. FEBSLett (1992) 304:225) to the XcmI site
near the beginning of eryAII, a 1.4 kb EcoRI-BsmI pBR322 fragment
encoding the tetracycline resistance gene (Tc), and a 4.0 kb
NotI-EcoRI fragment from the end of eryAIII. PacI, NdeI, and
ribosome binding sites were engineered at the eryAI start codon in
pCK5. pCK5 is a derivative of pRM5 (described above). The 5' and 3'
regions of homology are 4.1 kb and 4.0 kb, respectively. MC1061 E.
coli was transformed with pCK5 and pCK6 and subjected to
carbenicillin and chloramphenicol selection at 30.degree. C.
Colonies harboring both plasmids (AP.sup.R, Cm.sup.R) were then
restreaked at 44.degree. C. on carbenicillin and chloramphenicol
plates. Only cointegrates formed by a single recombination event
between the two plasmids were viable. Surviving colonies were
propagated at 30.degree. C. under carbenicillin selection, forcing
the resolution of the cointegrates via a second recombination
event. To enrich for pCK7 recombinants, colonies were restreaked
again on carbenicillin plates at 44.degree. C. Approximately 20% of
the resulting colonies displayed the desired phenotype (AP.sup.R,
Tc.sup.S, Cm.sup.S). The final pCK7 candidates were thoroughly
checked via restriction mapping. A control plasmid, pCK7f, which
contains a frameshift error in eryAI, was constructed in a similar
manner. pCK7 and pCK7f were transformed into E. coli ET12567
(MacNeil J Bacteriol (1988) 170:5607) to generate unmethylated
plasmid DNA and subsequently moved into Streptomyces coelicolor
CH999.
[0063] Upon growth of CH999/pCK7 on R2YE medium, the organism
produced abundant quantities of two polyketides. The addition of
propionate (300 mg/L) to the growth medium resulted in
approximately a two-fold increase in yield of polyketide product.
Proton and .sup.13C NMR spectroscopy, in conjunction with
propionic-1-.sup.13C acid feeding experiments, confirmed the major
product as 6dEB (>40 mg/L). The minor product was identified as
8,8a-deoxyoleandolide (>10 mg/L), which apparently originates
from an acetate starter unit instead of propionate in the 6dEB
biosynthetic pathway. .sup.13C.sub.2 sodium acetate feeding
experiments confirmed the incorporation of acetate into the minor
product. Three high molecular weight proteins (>200 kDa),
presumably DEBS1, DEBS2, and DEBS3 (Caffrey et al. FEBS Lett (1992)
304:225), were also observed in crude extracts of CH999/pCK7 via
SDS-polyacrylamide gel electrophoresis. No polyketide products were
observed from CH999/pCK7f. The inventors hereby acknowledge support
provided by the American Cancer Society (IRG-32-34).
Example 1
Preparation of Cassettes from the Rapamycin PKS
[0064] A cosmid library of genomic DNA from Streptomyces
hygroscopicus ATCC 29253 was used to prepare DNA cassettes prepared
from the rapamycin PKS gene cluster to be used as replacements into
the enzymatic activity regions of the erythromycin gene cluster.
Cassettes were prepared by PCR amplification from appropriate
cosmids or subclones using the primer pairs listed in Table 1. (The
rapDH/ER/KR1 cassette sequence was amplified in two halves, then
joined at the engineered XhoI site.)
1TABLE 1 Primer pairs used for PCR amplification of rapamy- cin PKS
cassettes. All primers are listed from 5' to 3'. Module Primer
Sequence rapAT2 forward: TTTAGATCTGTGTTCGTCTTCCCGGGT reverse:
TTTCTGCAGCCAGTACCGCTGGTGCTGG- AA GGCGTA rapKR2 forward:
TTTCTGCAGGAGGGCACGGACCG- GGCGACT GCGGGT reverse:
TTTTCTAGAACCGGCGGCAGCGGCCCGCCG AGCAAT rapDH/KR4 forward:
TTCTGCAGAGCGTGGACCGGGCGGC- T reverse:
TTTTCTAGAGTCACCGGTAGAGGCGGCCCT rapDH/ER/KR1 forward:
TTTCTGCAGGGCGTGGACCGGGCGGCTGCC (left half) reverse:
TTTCTCGAGCACCACGCCCGCAGCCTCACC rapDH/ER/KR1 forward:
TTTCTCGAGGTCGGTCCGGAGGTCCAGGAT (right half) reverse:
TTTTCTAGAATCACCGGTAGAAGCAGCCCG
Example 2
Replacement of DEBS Modules By Rapamycin PKS Cassettes
[0065] a) Replacement of DEBS DH/ER/KR4.
[0066] A portion of the erythromycin gene of module 4
(eryDH/ER/KR4) was replaced either with the corresponding rapamycin
activities of the first rapamycin module (rapDH/ER/KR1) or of
module 4 of rapamycin (rapDH/KR4). The replacement utilized the
technique of Kao et al. Science (1994) 265:509-512. A donor plasmid
was prepared by first amplifying 1 kbp regions flanking the
DH/ER/KR4 of DEBS to contain a PstI site at the 3' end of the left
flank and an XbaI site at the 5' end of the right flank. The
fragments were ligated into a temperature-sensitive donor plasmid,
in a manner analogous to that set forth for KR6 in paragraph b) of
this example and the rapamycin cassettes prepared as described in
Example 1 were inserted into the PstI/XbaI sites. The recipient
plasmid was pCK7 described in Preparation A. The in vivo
recombination technique resulted in the expression plasmid
pKOS011-19 (eryDH/ER/KR4.fwdarw.rapDH/ER/KR1) and pKOS011-21
(eryDH/ER/KR4.fwdarw.rapDH/KR4). The junctions at which the PstI
and XbaI sites were introduced into DEBS in both vectors are as
follows:
[0067] GAGCCCCAGCGGTACTGGCTGCAG rap cassette
TCTAGAGCGGTGCAGGCGGCCCCG
[0068] The resulting expression vectors were transformed into S.
coelicolor CH999 and successful transformants grown as described
above. The transfonnant containing the rapDH/ER/KR1 cassette
produced the polyketide shown in FIG. 5 as 11-19a; the transformant
containing the plasmid with rapDH/KR4 cassette produced the
polyketide shown in FIG. 6 as 11-21a. As shown, these polyketides
differ from 6-deoxyerythronolide B by virtue of a 6,7 alkene in the
case of 11-21a and by the C6-methyl stereochemistry in the case of
11-19a.
[0069] b) Replacement of DEBS KR6.
[0070] In a manner analogous to that set forth in paragraph a),
plasmid pKOS011-25, wherein eryKR6 was replaced by rapDH/KR4, was
prepared by substituting regions flanking the KR6 domain of DEBS in
construction of the donor plasmid.
[0071] Approximately 1 kb regions flanking the eryKR6 domain were
PCR amplified with the following primers:
2 left forward 5'-TTTGGATCCGTTTTCGTCTTCCCAGGTCAG flank reverse
5'-TTTCTGCAGCCAGTACCGCTGGGGCTCGAA right forward
5'-TTTTCTAGAGCGGTGCAGGCGGCCCCGGCG flank reverse
5'-AAAATGCATCTATGAATTCCCTCCGCCCA
[0072] These fragments were then cloned into a pMAK705 derivative
in which the multiple cloning site region was modified to
accommodate the restriction sites of the fragments (i.e.,
BamHI/PstI for the left flank and XbaI/NsiI for the right flank).
Cassettes were then inserted into the PstI/XbaI sites of the above
plasmid to generate donor plasmids for the in vivo recombination
protocol. The resulting PstI and XbaI junctions engineered into
DEBS are as follows:
[0073] GAACACCAGCGCTTCTGGCTGCAG rap cassette
TCTAGAGACCGGCTCGCCGGTCGG
[0074] Transformants of S. coelicolor CH999 resulted in the
production of the polyketide shown in FIG. 5 as 11-25 a,b. Regions
flanking the KR6 domain of DEBS were used to construct the donor
plasmids.
[0075] c) Replacement of DEBS KR2.
[0076] The eryKR2 enzymatic activity was replaced in a series of
vectors using in vitro insertion into the Pst/XbaI sites of
pKAO263. pKAO263 is a derivative of pCK13 described in Kao, C. M. J
Am Chem Soc (1996) 118:9184-9185. It was prepared by introducing
the PstI and XbaI restriction sites positioned identically to those
in the analogous 2-module DEBS system described by Bedford, D. et
al. Chem an Biol (1996) 3:827-831. Three expression plasmids were
prepared: pKO2009-7 (eryKR2.fwdarw.rapDH/KR4); pKAO392
(eryKR2.fwdarw.rapKR2); and pKAO410 (eryKR2.fwdarw.rapDH/ER/KR1).
these plasmids, when transformed into S. coelicolor CH999, resulted
in the production of polyketides with the structures 9-7 a,b; 392
a,b; and 410 a,b,c in FIG. 5, respectively. An additional vector,
pKAO400 (eryKR2.fwdarw.rapKR4) produced the same results as
pKAO392.
[0077] d) Replacement of DEBS AT2.
[0078] The DEBS AT activity from module 2 was excised after
inserting restriction sites BamHI and PstI flanking the AT module 2
domain into pCK12 (Kao et al. J Am Chem Soc (1995) 112:9105-9106).
After digestion with BamHI/PstI, the Bg1II/PstI fragment containing
rapAT2 was inserted. The resulting engineered DEBS/rapAT2 junction
is as follows (BamHI/Bg1II ligation--GGATCT; PstI --CTGCAG):
[0079] AGTGCCTCCGACGGTGGATCT rapAT2 CTGCAGCCGGACCGCACCACCCCT
[0080] S. coelicolor CH999 transformed with the resulting plasmid,
pKOS008-51, produced the polyketides 8-51 a,b shown in FIG. 5.
Example 3
Excision of DEBS Reductive Cycle Domains
[0081] A duplex oligonucleotide linker (.DELTA.Rdx) was designed to
allow complete excision of reductive cycle domains. Two synthetic
oligonucleotides:
[0082]
5'-GCCGGACCGCACCACCCCTCGTGACGGAGAACCGGAGACGGAGAGCT-3'3'-ACGTCGGCCTG-
GCGTGGTGGGGAGCACTGCCTCTTGGCCTCTGCCTCTCGAGATC-5'
[0083] were designed to generate PstI- and XbaI-compatible ends
upon hybridization. This duplex linker was ligated into the PstI-
and XbaI-sites of the recombination donor plasmid containing the
appropriate left- and right-flanking regions of the reductive
domain to be excised. The in vivo recombination technique of
Example 2, paragraph a) was then used. The donor plasmid contained
the duplex linker .DELTA.Rdx having a PstI and XbaI compatible end
ligated into the PstI and XbaI sites of the plasmid modified to
contain the left and right flanking regions of the reductive domain
to be excised. The donor plasmids were recombined with recipient
plasmid pCK7 to generate pKOS011-13 (eryKR6.fwdarw..DELTA.Rdx) and
with recipient plasmid pCK13 to obtain pKOS005-4
(eryKR2.fwdarw..DELTA.Rdx). These plasmids generated, when
transformed into S. coelicolor CH999, the polyketides 11-13 a,b,c
and 5-4 a,b in FIG. 5, respectively.
Example 4
Summary of DEBS Constructs
[0084] Using the foregoing techniques, the DEBS constructs shown in
Table 2 were constructed.
3TABLE 2 Representative DEBS Constructs. plasmid modules genotype
products pKOS005-4 3 eryKR2 .fwdarw. .DELTA.Rdx 5-4a, b pKOS008-51
2 eryAT2 .fwdarw. rapAT2 8-51a, b pKOS009-7 3 eryKR2 .fwdarw.
rapDH/KR4 9-7a, b pKOS011-13 6 eryKR6 .fwdarw. .DELTA.Rdx 11-13a,
b, c pKOS011-19 6 eryDH/ER/KR4 .fwdarw. rapDH/ 11-19a, b ER/KR1
pKOS011-21 6 eryDH/ER/KR4 .fwdarw. rapDH/ 11-21a KR4 pKOS011-22 6
eryDH/ER/KR4 .fwdarw. .DELTA.Rdx 11-22a pKOS011-25 6 eryKR6
.fwdarw. rapDH/KR4 11-25a, b pKOS011-28 2 eryAT1 .fwdarw. rapAT2
11-28a, b pKOS014-9 2 eryAT2 .fwdarw. rapAT4 CK12a, b pKAO392 3
eryKR2 .fwdarw. rapKR2 392a, b pKAO404 3 eryKR2 .fwdarw. rapKR4
392a, b pKAO410 3 eryKR2 .fwdarw. rapDH/ER/KR1 410a, b, c
Example 5
Manipulation of Macrolide Ring Size by Directed Mutagenesis of
DEBS
[0085] Using the expression system of Kao, C. M. et al. Science
(1994) 265:509-512, the expression of DEBS1 alone (1+2), in the
absence of DEBS2 and DEBS3 (in plasmid pCK9), resulted in the
production of (2R,3S,4S,5R)-2,4-dimethyl-3,5-dihydroxy-n-heptanoic
acid L-lactone ("the heptanoic acid L-lactone" (PK3) (see FIG. 6A))
(1-3 mg/L), the expected triketide product of the first two modules
(Kao, C. M. et al. J Am Chem Soc (1994) 116:11612-11613). Thus, a
thioesterase is not essential for release of a triketide from the
enzyme complex.
[0086] Two additional deletion mutant PKS were constructed. The
first contained DEBS1 fused to the TE, and the second PKS included
the first five DEBS modules fused to the TE. Plasmids pCK12 and
pCK15 respectively contained the genes encoding the bimodular
("1+2+TE") and pentamodular ("1+2+3+4+5+TE") PKSs.
[0087] The 1+2+TE PKS in pCK12 contained a fusion of the
carboxy-terminal end of the acyl carrier protein of module 2
(ACP-2) to the carboxy-terminal end of the acyl carrier protein of
module 6 (ACP-6). Thus ACP-2 is essentially intact and is followed
by the amino acid sequence naturally found between ACP-6 and the
TE. Plasmid pCK12 contained eryA DNA originating from pS1 (Tuan, J.
S. et al. Gene (1990) 90:21). pCK12 is identical to pCK7 (Kao et
al. Science (1994), supra) except for a deletion between the
carboxy-tenninal ends of ACP-2 and ACP-6. The fusion occurs between
residues L3455 of DEBS1 and Q2891 of DEBS3. An SpeI site is present
between these two residues so that the DNA sequence at the fusion
is CTCACTAGTCAG.
[0088] The 1+2+3+4+5+TE PKS in pCK15 contained a fusion 76 amino
acids downstream of the .beta.-ketoreductase of module 5 (KR-5) and
five amino acids upstream of ACP-6. Thus, the fusion occurs towards
the carboxy-terminal end of the non-conserved region between KR-5
and ACP-5, and the recombinant module 5 was essentially a hybrid
between the wild type modules 5 and 6. Plasmid pCK15 contained eryA
DNA originating from pS1 (Tuan et al. Gene (1990), supra). pCK15 is
a derivative of pCK7 (Kao et al. Science (1994), supra) and was
constructed using the in vivo recombination strategy described
earlier (Kao et al. Science (1994), supra). pCK15 is identical to
pCK7 with the exception of a deletion between KR-5 and ACP-6, which
occurs between residues G1372 and A2802 of DEBS3, and the insertion
of a blunted a SalI fragment containing a kanamycin resistance gene
(Oka A. et al. J Mol Biol (1981) 147:217) into the blunted HindIII
site of pCK7. An arginine residue is present between G1372 and
A2802 so that the DNA sequence at the fusion is GGCCGCGCC.
[0089] Plasmids pCK12 and pCK15 were introduced into S. coelicolor
CH999 and polyketide products were purified from the transformed
strains according to methods previously described (Kao et al.
Science (1994), supra).
[0090] The products obtained from various transformants:
CH999/pCK12 and CH999/pCK15 as well as CH999/pCK9 described above,
are shown in FIGS. 6A, B and C.
[0091] CH999/pCK12 produced the heptanoic acid L-lactone (PK3) (20
mg/L) as determined by .sup.1H and .sup.13C NMR spectroscopy. This
triketide product is identical to that produced by CH999/pCK9,
which expresses the unmodified DEBS 1 protein alone described
above. However, CH999/pCK12 produced PK3 in significantly greater
quantities than did CH999/pCK9 (>10 mg/L vs. .about.1 mg/L),
indicating the ability of the TE to catalyze thiolysis of a
triketide chain attached to the ACP domain of module 2. CH999/pCK12
also produced significant quantities of PK4, a novel analog of PK3,
(10 mg/L), that resulted from the incorporation of an acetate start
unit instead of propionate. This is reminiscent of the ability of
CH999/pCK7, which expresses the intact PKS, to produce
8,8a-deoxyoleandolide (PK1) in addition to 6dEB (PK2) described
above.
[0092] Since PK4 was not detected in CH999/pCK9, its facile
isolation from CH999/pCK12 provides additional evidence for the
increased turnover rate of DEBS 1 due to the presence of the TE. In
other words, the TE can effectively recognize an intermediate bound
to a "foreign" module that is four acyl units shorter than its
natural substrate, 6dEB (PK2). However, since the triketide
products can probably cyclize spontaneously into PK3 and PK4 under
typical fermentation conditions (pH 7), it is not possible to
discriminate between a biosynthetic model involving
enzyme-catalyzed lactonization and one involving enzyme-catalyzed
hydrolysis followed by spontaneous lactonization. Thus, the ability
of the 1+2+TE PKS to recognize the C-5 hydroxyl of a triketide as
an incoming nucleophile is unclear.
[0093] CH999/pCK15, produced abundant quantities of
(8R,9S)-8,9-dihydro-8-methyl-9-hydroxy-10-deoxymethonolide ("the
10-deoxymethonolide (PK5) (10 mg/L), demonstrating that the
pentamodular PKS is active. PK5 was characterized using .sup.1H and
.sup.13C NMR spectroscopy of natural abundance and
.sup.13C-enriched material, homonuclear correlation spectroscopy
(COSY), heteronuclear correlation spectroscopy (HETCOR), mass
spectrometry, and molecular modeling. PK5 is an analog of
10-deoxymethonolide (Lambalot, R. H. et al. J Antibiotics (1992)
45:1981-1982), the aglycone of the macrolide antibiotic methymycin.
The production of PK5 by a pentamodular enzyme demonstrates that
active site domains in modules 5 and 6 in DEBS can be joined
without loss of activity. Thus, it appears that individual modules
as well as active sites are independent entities which do not
depend on association with neighboring modules to be functional.
The 12-membered lactone ring, formed by esterification of the
terminal carboxyl with the C-11 hydroxyl of the hexaketide product,
indicated the ability of the 1+2+3+4+5+TE PKS, and possibly the TE
itself, to catalyze lactonization of a polyketide chain one acyl
unit shorter than the natural product of DEBS, 6dEB. Indeed, the
formation of the PK5 may mimic the biosynthesis of the closely
related 12-membered hexaketide macrolide, methymycin, which
frequently occurs with the homologous 14-membered heptaketide
macrolides, picromycin and/or narbomycin (Cane, D. E. et al. J Am
Chem Soc (1993) 115:522-566). The erythromycin PKS scaffold can
thus be used to generate a wide range of macrolactones with shorter
as well as longer chain lengths.
[0094] The construction of the 1+2+3+4+5+TE PKS resulted in the
biosynthesis of a previously uncharacterized 12-membered
macrolactone that closely resembles, but is distinct from, the
aglycone of a biologically active macrolide. (See FIG. 6C.) The
apparent structural and functional independence of active site
domains and modules as well as relaxed lactonization specificity
suggest the existence of many degrees of freedom for manipulating
these enzymes to produce new modular PKSs.
* * * * *