U.S. patent application number 10/105504 was filed with the patent office on 2003-04-24 for synthetic antigen presenting matrix.
This patent application is currently assigned to The Scripps Research Institute. Invention is credited to Brunmark, Anders, Cai, Zeling, Jackson, Michael, Peterson, Per A., Sprent, Jonathan.
Application Number | 20030077318 10/105504 |
Document ID | / |
Family ID | 23583206 |
Filed Date | 2003-04-24 |
United States Patent
Application |
20030077318 |
Kind Code |
A1 |
Cai, Zeling ; et
al. |
April 24, 2003 |
Synthetic antigen presenting matrix
Abstract
Materials and methods for activating T lymphocytes with
specificity for particular antigenic peptides are described, as
well as the use of activated T lymphocytes in vitro for the
treatment of a variety of disease conditions. In particular, a
method for producing a synthetic antigen presenting cell line for
activating T lymphocytes to a specific peptide is described.
Inventors: |
Cai, Zeling; (San Diego,
CA) ; Sprent, Jonathan; (Leucadia, CA) ;
Brunmark, Anders; (San Diego, CA) ; Jackson,
Michael; (Del Mar, CA) ; Peterson, Per A.;
(Rancho Santa Fe, CA) |
Correspondence
Address: |
OLSON & HIERL, LTD.
36th Floor
20 North Wacker Drive
Chicago
IL
60606
US
|
Assignee: |
The Scripps Research
Institute
|
Family ID: |
23583206 |
Appl. No.: |
10/105504 |
Filed: |
March 25, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10105504 |
Mar 25, 2002 |
|
|
|
09042492 |
Mar 16, 1998 |
|
|
|
6362001 |
|
|
|
|
09042492 |
Mar 16, 1998 |
|
|
|
08400338 |
Mar 8, 1995 |
|
|
|
Current U.S.
Class: |
424/450 ;
514/19.1; 514/19.3; 514/2.3; 514/3.8; 514/4.3; 530/350 |
Current CPC
Class: |
C07K 14/005 20130101;
C12N 2501/50 20130101; A61P 37/00 20180101; A61K 2039/5158
20130101; C12N 2760/20222 20130101; C12N 2830/80 20130101; C12N
15/85 20130101; C12N 2501/51 20130101; A61P 35/00 20180101; A61P
31/12 20180101; C12N 2830/75 20130101; C12N 2830/002 20130101; C12N
5/0601 20130101; Y10S 530/827 20130101; A61P 37/04 20180101; C12N
5/0636 20130101; C12N 2502/50 20130101; A61P 43/00 20180101; A61P
31/18 20180101; Y10S 530/812 20130101; C12N 2760/18822 20130101;
C07K 14/70503 20130101; C12N 2760/16122 20130101; C07K 14/70539
20130101; A61K 38/00 20130101; C12N 2502/99 20130101 |
Class at
Publication: |
424/450 ; 514/12;
530/350 |
International
Class: |
A61K 009/127; A61K
038/17; C07K 014/74 |
Goverment Interests
[0002] The invention described herein was made with government
support under Contract No. CA 38355 by the National Institutes of
Health. The government has certain rights in this invention.
Claims
We claim:
1. A synthetic antigen-presenting matrix comprising: a) a solid
support; b) an extracellular portion of a Class I MHC molecules
capable of binding to a selected peptide and being operably linked
to the solid support; and c) an extracellular portion of an
assisting molecule operably linked to the solid support such that
the extracellular portion of the MHC and assisting molecules are
present in sufficient numbers to activate a population of T-cell
lymphocytes against the peptide when the peptide is bound to the
extracellular portion of the MHC molecule.
2. The matrix of claim 1 wherein the extracellular portion of the
MHC molecule is linked to the solid support by a transmembrane
domain of an MHC molecule.
3. The matrix of claim 1 wherein the support is a solid
surface.
4. The matrix of claim 1 wherein the extracellular portion of the
MHC molecule is linked to an epitope which reacts with an antibody
to link the portion to the solid support.
5. The matrix of claim 1 wherein the extracellular portion of the
MHC molecule is linked to (His)6 which reacts with nickel to link
the portion to the solid support.
6. The matrix of claim 1 wherein the solid support is a porous
material.
7. The matrix of claim 1 wherein the assisting molecule is a
costimulatory molecule.
8. The matrix of claim 7 wherein the costimulatory molecule is a
member of the group consisting of B7.1 and B7.2.
9. The matrix of claim 1 wherein the assisting molecule is an
adhesion molecule.
10. The matrix of claim 9 wherein the adhesion molecule is a member
of the group consisting of ICAM-1, ICAM-2, ICAM-3 and LFA-3.
11. The matrix of claim 1 having a gene for two assisting molecules
the first assisting molecule being a costimulatory molecule and the
second assisting molecule being an adhesion molecule.
12. The matrix of claim 1 wherein the peptide is bound to the
extracellular portion of the MHC molecule.
13. The matrix of claim 1 wherein the extracellular portion of the
MHC molecule is empty.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
09/042,492, filed on Mar. 16, 1998, which, in turn, is a division
of U.S. Ser. No. 08/400,338, filed on Mar. 8, 1995, now
abandoned.
TECHNICAL FIELD
[0003] The present invention relates to materials and methods of
activating T-cells with specificity for particular antigenic
peptides, the use of activated T-cells in vivo for the treatment of
a variety of disease conditions, and compositions appropriate for
these uses.
BACKGROUND
[0004] The efficiency with which the immune system cures or
protects individuals from infectious disease has always been
intriguing to scientists, as it has been believed that it might be
possible to activate the immune system to combat other types of
diseases. Such diseases include cancer, AIDS, hepatitis and
infectious disease in immunosuppressed patients. While various
procedures involving the use of antibodies have been applied in
those types of diseases, few if any successful attempts using
cytotoxic T-cells have been recorded. Theoretically, cytotoxic
T-cells would be the preferable means of treating the types of
disease noted above. However, no procedures have been available to
specifically activate cytotoxic T-cells.
[0005] Cytotoxic T-cells, or CD8 cells as they are presently known,
represent the main line of defense against viral infections. CD8
lymphocytes specifically recognize and kill cells which are
infected by a virus. Thus, the cost of eliminating a viral
infection is the accompanying loss of the infected cells. The
T-cell receptors on the surface of CD8 cells cannot recognize
foreign antigens directly. In contrast to antibodies, antigen must
first be presented to the receptors.
[0006] The presentation of antigen to CD8 T-cells is accomplished
by major histocompatibility complex (MHC) molecules of the Class I
type. The major histocompatibility complex (MHC) refers to a large
genetic locus encoding an extensive family of glycoproteins which
play an important role in the immune response. The MHC genes, which
are also referred to as the HLA (human leucocyte antigen) complex,
are located on chromosome 6 in humans. The molecules encoded by MHC
genes are present on cell surfaces and are largely responsible for
recognition of tissue transplants as "non-self". Thus,
membrane-bound MHC molecules are intimately involved in recognition
of antigens by T-cells.
[0007] MHC products are grouped into three major classes, referred
to as I, II, and III. T-cells that serve mainly as helper cells
express CD4 and primarily interact with Class II molecules, whereas
CD8-expressing cells, which mostly represent cytotoxic effector
cells, interact with Class I molecules.
[0008] Class I molecules are membrane glycoproteins with the
ability to bind peptides derived primarily from intracellular
degradation of endogenous proteins. Complexes of MHC molecules with
peptides derived from viral, bacterial and other foreign proteins
comprise the ligand that triggers the antigen responsiveness of
T-cells. In contrast, complexes of MHC molecules with peptides
derived from normal cellular products play a role in "teaching" the
T-cells to tolerate self-peptides, in the thymus. Class I molecules
do not present entire, intact antigens; rather, they present
peptide fragments thereof, "loaded" onto their "peptide binding
groove".
[0009] For many years, immunologists have hoped to raise specific
cytotoxic cells targeting viruses, retroviruses and cancer cells.
While targeting against viral diseases in general may be
accomplished in vivo by vaccination with live or attenuated
vaccines, no similar success has been achieved with retroviruses or
with cancer cells. Moreover, the vaccine approach has not had the
desired efficacy in immunosuppressed patients. At least one
researcher has taken the rather non-specific approach of "boosting"
existing CD8 cells by incubating them in vitro with IL-2, a growth
factor for T-cells. However, this protocol (known as LAK cell
therapy) will only allow the expansion of those CD8 cells which are
already activated. As the immune system is always active for one
reason or another, most of the IL-2 stimulated cells will be
irrelevant for the purpose of combatting the disease. In fact, it
has not been documented that this type of therapy activates any
cells with the desired specificity. Thus, the benefits of LAK cell
therapy are controversial at best, and the side effects are
typically so severe that many studies have been discontinued.
[0010] Several novel molecules which appear to be involved in the
peptide loading process have recently been identified. It has also
been noted that Class I molecules without bound peptide (i.e.,
"empty" molecules) can be produced under certain restrictive
circumstances. These "empty" molecules are often unable to reach
the cell surface, however, as Class I molecules without bound
peptide are very thermolabile. Thus, the "empty" Class I molecules
disassemble during their transport from the interior of the cell to
the cell surface.
[0011] The presentation of Class I MHC molecules bound to peptide
alone has generally ineffective in activating CD8 cells. In nature,
the CD8 cells are activated by antigen-presenting cells which
present not only a peptide-bound Class I MHC molecule, but also a
costimulatory molecule. Such costimulatory molecules include B7
which is now recognized to be two subgroups designated as B7.1 and
B7.2. It has also been found that cell adhesion molecules such as
integrins assist in this process.
[0012] When the CD8 T-cell interacts with an antigen-presenting
cell having the peptide bound by a Class I MHC and costimulatory
molecule, the CD8 T-cell is activated to proliferate and becomes an
armed effector T-cell. See, generally, Janeway and Travers,
Immunobiology, published by Current Biology Limited, London (1994),
incorporated by reference.
[0013] Accordingly, what is needed is a means to activate T-cells
so that they proliferate and become cytotoxic. It would be useful
if the activation could be done in vitro and the activated
cytotoxic T-cells reintroduced into the patient. It would also be
desirable if the activation could be done by a synthetic
antigen-presenting matrix comprised of a material such as cells
which not only presents the selected peptide, but also presents
other costimulatory factors which increase the effectiveness of the
activation.
[0014] It would also be advantageous if it was possible to select
the peptide so that substantially only those CD8 cells cytotoxic to
cells presenting that peptide would be activated.
BRIEF SUMMARY OF THE INVENTION
[0015] The present invention relates to a synthetic
antigen-presenting system for presenting an MHC molecule complexed
to a peptide and an assisting molecule to a T-cell to activate the
T-cell.
[0016] In one embodiment, the system relates to a synthetic
antigen-presenting matrix having a support and at least the
extracellular portion of a Class I MHC molecule capable of binding
to a selected peptide operably linked to the support. The matrix
also includes at least an extracellular portion of an assisting
molecule operably linked to the support. The two extracellular
portions are present in sufficient numbers to activate a population
of T-cell lymphocytes against the peptide when the peptide is bound
to the extracellular portion of the MHC molecule.
[0017] It has been found that an antigen-presenting matrix having
both an MHC molecule or a portion of a MHC molecule together with
an assisting molecule, or at least an extracellular portion of an
assisting molecule, provides a synergistic reaction in activating
T-cell lymphocytes against the peptide. Examples of assisting
molecules are costimulatory molecules such as B7.1 and B7.2 or
adhesion molecules such as ICAM-1 and LFA-3. It has been found that
a specifically effective synergistic reaction results from an
antigen-presenting matrix having MHC molecules bound with a
peptide, a costimulatory molecule, and an adhesion molecule.
[0018] The support used for the matrix can take several different
forms. Examples for the support include solid support such as
metals or plastics, porous materials such as resin or modified
cellulose columns, microbeads, microtiter plates, red blood cells
and liposomes.
[0019] Another type of support is a cell fragment, such as a cell
membrane fragment or an entire cell. In this embodiment, the matrix
is actually cells which have been transfected to present MHC
molecules and assisting molecules on the cell surface. This is done
by producing a cell line containing at least one expressible Class
I MHC nucleotide sequence for the MHC heavy chain, preferably a
cDNA sequence, operably linked to a first promoter and an
expressible .beta.-2 microglobulin nucleotide sequence operably
linked to a second promoter. The MHC heavy chain and the .beta.-2
microglobulin associate together form the MHC molecule which binds
to the peptide. The MHC protein binds with the antigenic peptide
and presents it on the surface of the cell. The cell also includes
a gene for a nucleotide sequence of an assisting molecule operably
linked to a third promoter. The assisting molecule is also
presented on the surface of the cell. These molecules are presented
on the surface of the cell in sufficient numbers to activate a
population of T-cell lymphocytes against the peptide when the
peptide is bound to the complexes.
[0020] The cell line is synthetic in that at least one of the genes
described above is not naturally present in the cells from which
the cell line is derived. It is preferable to use a poikilotherm
cell line because MHC molecules are thermolabile. A range of
species are useful for this purpose. See, for example, U.S. Pat.
No. 5,314,813 to Petersen et al. which discusses numerous species
for this use and is incorporated by reference. It is preferred to
use eukaryotic cells and insect cells in particular.
[0021] In one embodiment, it is particularly preferred to have at
least two assisting molecules, one being a costimulatory molecule
and the other being an adhesion molecule. It has been found that
this combination has a synergistic effect, giving even greater
T-cell activation than either of the individual molecules combined.
It has also been found to be advantageous and preferable to have at
least one of the transfected genes under control of an inducible
promoter.
[0022] Using the present invention, it is possible to introduce the
peptide to the cell while it is producing MHC molecules and allow
the peptide to bind the MHC molecules while they are still within
the cell. Alternatively, the MHC molecules can be expressed as
empty molecules on the cell surface and the peptide introduced to
the cells after the molecules are expressed on the cell surface. In
this latter procedure, the use of poikilotherm cells is
particularly advantageous because empty MHC molecules, those not
yet complexed or bound with peptides, are thermolabile.
[0023] Class I MHC molecules have been expressed in insect cells
such as Drosophila melanogaster (fruit fly) cells. Since Drosophila
does not have all the components of a mammalian immune system, the
various proteins involved in the peptide loading machinery should
be absent from such cells. The lack of peptide loading machinery
allows the Class I molecules to be expressed as empty molecules at
the cell surface.
[0024] Another advantage of using insect cells such as the
Drosophila system is that Drosophila cells prefer a temperature of
28.degree. C. rather than 37.degree. C. This fact is very
important, because empty Class I molecules are thermolabile and
tend to disintegrate at 37.degree. C. By incubating the Class
I-expressing Drosophila cells with peptides that can bind to the
Class I molecule, it is possible to get virtually every Class I
molecule to contain one and the same peptide. The cells are
accordingly very different from mammalian cells, where the Class I
molecules contain many different types of peptides, most of which
are derived from our own, innocuous cellular proteins.
[0025] The present invention also relates to methods for producing
activated CD8 cells in vitro. One method comprises contacting, in
vitro, CD8 cells with one of the antigen-presenting matrices
described above for a time period sufficient to activate, in an
antigen-specific manner, the CD8 cells. The method may further
comprise (1) separating the activated CD8 cells from the
antigen-presenting matrix; (2) suspending the activated CD8 cells
in an acceptable carrier or excipient; and (3) administering the
suspension to an individual in need of treatment. The antigens may
comprise native or undegraded proteins or polypeptides, or they may
comprise antigenic polypeptides which have been cleaved into
peptide fragments comprising at least 8 amino acid residues prior
to incubation with the human Class I MHC molecules.
[0026] In another variation, the invention relates to methods
treating conditions in patients and specifically killing target
cells in a human patient. The method comprises (1) obtaining a
fluid sample containing resting or naive CD8 cells from the
patient; (2) contacting, in vitro, the CD8 cells with an
antigen-presenting matrix for a time period sufficient to activate,
in an antigen-specific manner, the CD8 cells; and (3) administering
the activated CD8 cells to the patient. The invention also relates
to the method of treating a medical condition by administration of
an antigen-presenting matrix in a suitable suspension. In various
embodiments the condition may comprise cancer, tumors, neoplasia,
viral or retroviral infection, autoimmune or autoimmune-type
conditions. In one embodiment, the method of administering the
matrix comprises intravenous injection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIGS. 1-3 diagram the construction of expression plasmids
pRmHa-2 and pRmHa-3. In FIG. 1, pRmHa-2 construction is shown; in
FIG. 2, pRmHa-3 construction is shown; and in FIG. 3, the pRmHa-3
vector is illustrated, showing the restriction, polylinker,
promoter, and polyadenylation sites, as well as a site at which a
nucleotide sequence may be inserted for expression;
[0028] FIGS. 4 and 5 show peptide-induced thermostabilization of
HLA B27 and HLA A2.1 expressed on the surface of Drosophila cells
by HIV peptides. The mean fluorescence of each cell population is
shown plotted against the incubation conditions;
[0029] FIG. 6 illustrates data from an experiment designed to
determine whether insect cells can process antigen and load it onto
the Class I molecules, and whether the latter can present either
endogenously or exogenously derived antigen to T cells. Schneider 2
(SC2) or 3T3 cells transfected with K.sup.b/.beta.2 were incubated
with ovalbumin protein (OvPro) or ovalbumin peptide, OVA 24 (OvPep)
in isotonic (Iso) or hypertonic (Hyp) media. (Murine cell line
BALB/3T3 is available from the ATCC under accession number CCL
163.) After treatment, cells were cocultured with the T cell
hybridoma B3/CD8. B3/CD8 is a T cell hybridoma between B3 (Carbone,
et al., J. Exp. Med. 169: 603-12 (1989)), cytotoxic T cell specific
for ovalbumin peptide 253-276 presented by H-2K.sup.b Class I
molecules, and CD8- bearing IL-2-secreting cell line. Upon
antigenic stimulation, B3/CD8 produces IL-2, measured by .sup.3H
thymidine incorporation in IL-2-dependent cell line CTLL (Gillis,
et al., J. Immunol. 120: 2027 91978)). Thus, by measuring the
amount of IL-2 produced, one can assay for T cell recognition. The
supernatant from the cocultures were analyzed for IL-2 by .sup.3H
thymidine incorporation by the IL-2-dependent cell line CTLL (ATCC
No. TIB 214). The amount of .sup.3H thymidine incorporated is
plotted against the initial cell treatments;
[0030] FIG. 7 illustrates the expression of B7.1, ICAM-1 and MHC on
the surface of transfected Drosophila (fly) cells according to the
present invention;
[0031] FIG. 8 is a graph showing results of a
fluorescence-activated cell sorter experiment using recombinant
L.sup.d mouse MHC linked to red blood cells;
[0032] FIG. 9 is a graph showing results of a
fluorescence-activated cell sorter experiment using recombinant
K.sup.b mouse MHC linked to red blood cells; and
[0033] FIG. 10 is a graph demonstrates binding of recombinant
K.sup.b to microtiter plates by use of labeled antibodies.
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention relates to a synthetic
antigen-presenting system which can be used to activate T-cell
lymphocytes. The system activates cytotoxic CD8 cells which then
proliferate and then are activated to seek out and destroy target
cells. The present invention can be used to activate T-cells in
vitro and the activated T-cells are then returned to the patient
from which they were originally derived or may be used in vivo
activation of T-cells.
[0035] The synthetic antigen-presenting system of the present
invention has two major components. The first component is at least
the extracellular portion of the Class I MHC molecule which is
capable of binding to a selected peptide. The second major
component is at least the extracellular portion of an assisting
molecule which assists in the activation of T-cells. In each case,
an extracellular portion is used, but it in certain embodiments,
the entire molecules are used.
[0036] For ease of description, MHC molecules will be discussed
generally, with the understanding that an extracellular portion of
the MHC molecule may be used. The portion of the MHC molecule
necessary for the present invention is the part which binds to the
selected peptide and presents the peptide to the T-cell.
[0037] The peptide is selected to activate the appropriate T-cell,
depending on the treatment to be conducted. For example, in the
treatment of particular cancers, certain antigenic peptides are
presented on the surface of the cancer cells which will react with
activated T-cells. Thus, it is appropriate to use a peptide
selected to activate the appropriate T-cells which will then bind
with and destroy the cancer cells.
[0038] The present invention allows the MHC molecules to be
produced by cells with the peptide already complexed with the MHC
molecule or to produce empty MHC molecules which do not yet have a
peptide complexed with them. This latter embodiment is particularly
useful since it allows the peptide to be chosen after the MHC
molecules are prepared.
[0039] A Class I MHC molecule includes a heavy chain, sometimes
referred to as an alpha chain, and a .beta.-2 microglobulin. As
discussed herein, the extracellular portion of the Class I MHC
molecule is made up of an extracellular portion of an MHC heavy
chain together with the .beta.-2 microglobulin.
[0040] In preparing the extracellular portions of MHC to be linked
to a support, soluble molecules are prepared as discussed below.
These molecules generally lack the transmembrane and cytoplasmic
domain in the MHC molecule.
[0041] The assisting molecule helps facilitate the activation of
the T-cell when it is presented with a peptide/MHC molecule
complex. The present invention includes two major categories of
assisting molecules. The first category is composed of
costimulatory molecules such as B7.1 (previously known as B7 and
also known as CD80) and B7.2 (also known as CD86) which binds to
CD28 on T-cells.
[0042] The other major category of assisting molecules of the
present invention are adhesion molecules. These include the various
ICAM molecules, which include ICAM-1, ICAM-2, ICAM-3 and LFA-3. It
has been found that the combination of a peptide bound to an MHC
molecule used in conjunction with one of these assisting molecules
activates the T-cells to an extent previously not seen.
[0043] An even greater synergistic reaction has been achieved by
using a peptide-bound MHC molecule in conjunction with both a
costimulatory molecule and an adhesion molecule.
[0044] In accordance with the present invention, the MHC molecule
and the assisting molecule are operably linked to a support such
that the MHC and assisting molecules are present in sufficient
numbers to activate a population of T-cells lymphocytes against the
peptide when the peptide is bound to the extracellular portion of
the MHC molecule. The peptide can be bound to the MHC molecule
before or after the MHC molecule is linked to the support.
[0045] The support can take on many different forms. It can be a
solid support such as a plastic or metal material, it can be a
porous material such as commonly used in separation columns, it can
be a liposome or red blood cell, or it can even be a cell or cell
fragment. As discussed in more detail below, in the case where a
cell serves as a support, the MHC and assisting molecules can be
produced by the cell. The MHC molecule is then linked to the cell
by at least the transmembrane domain if not also the cytoplasmic
domain which would not be present in a soluble form of MHC.
[0046] The extracellular portions of MHC molecule and assisting
molecule can be linked to a support by providing an epitope which
reacts to an antibody immobilized on the support. In addition, the
MHC or assisting molecules can be produced with or linked to
(His).sub.6 which would react with nickel in forming part of the
support. Other means to immobilize or link MHC molecules to a
support are well known in the art.
[0047] As discussed above, the support can be a cell membrane or an
entire cell. In such a case, an eukaryotic cell line is modified to
become a synthetic antigen-presenting cell line for use with T-cell
lymphocytes. For ease of description, antigen-presenting cells will
also be called stimulator cells. Because empty MHC molecules are
thermolabile, it is preferred that the cell culture be poikilotherm
and various cell lines are discussed in detail below.
[0048] A culture of cells is first established. The culture is then
transfected with an expressible Class I MHC heavy chain gene which
is operably linked to a promoter. The gene is chosen so that it is
capable of expressing the Class I MHC heavy chain. The cell line is
also transfected with an expressible .beta.-2 microglobulin gene
which is operably linked to a second promoter. The gene is chosen
such it is capable of expressing .beta.-2 microglobulin that forms
MHC molecules with the MHC heavy chain. In the case of soluble
extracellular portions of MHC molecules to be used with solid
supports and the like, a truncated MHC heavy chain gene is used as
discussed in more detail below.
[0049] The culture is also transfected with an expressible
assisting molecule gene operably linked to a third promoter. The
assisting molecule gene is capable of being expressed as an
assisting molecule which interacts with the molecule on the T-cell
lymphocytes. As discussed below, each of these genes can be
transfected using various methods, but the preferred method is to
use more than one plasmid.
[0050] The cell line transfected is chosen because it lacks at
least one of the genes being introduced. It has been found that
insect cells are advantageous not only because they are
poikilothermic, but because they lack these genes and the
mechanisms which would otherwise produce MHC molecules bound to
peptides. This allows for greater control over the production of
peptide-bound MHC molecules, and the production of empty MHC
molecules. The MHC heavy chain is preferably from,a different
species, more preferably, a homeotherm such as mammals and,
optimally, humans.
[0051] The preferred cell line is a stable poikilotherm cell line
that has the first promoter being inducible to control the
expression of the MHC heavy chain. It is preferred that the cell
assembles empty MHC molecules and presents them on the cell surface
so that the peptides can be chosen as desired.
[0052] The resulting MHC molecules bind to the peptide and are
present in sufficient numbers with the assisting molecules on the
surface of the cell to activate a population of T-cell lymphocytes
against the peptide when the peptide is bound to the MHC cells.
[0053] In a further embodiment, a second assisting molecule gene is
also transfected into the cell culture. In this case, the first
assisting molecule gene can be for a costimulatory molecule and the
second assisting molecule gene can be for an adhesion molecule.
[0054] It is preferred that at least one of the genes and, in
particular, the MHC heavy chain gene be linked to an inducible
promoter. This allows control over the production of MHC molecules
so that they are only produced at a time when the peptide of
interest is available and presented in the culture to react with
the produced MHC molecules. This minimizes undesirable MHC
molecule/peptide complexes.
[0055] Where the cell line already produces one or more of the
desired molecules, it is only necessary to transfect the culture
with an expressible gene for the gene which is lacking in the
cells. For example, if the cells already present the MHC molecules
on their surface, it is only necessary to transfect the culture
with an expressible genes for the assisting molecule.
[0056] The peptide can be introduced into the cell culture at the
time the cells are producing MHC molecules. Through methods such as
osmotic shock, the peptides can be introduced in the cell and bind
to the produced MHC molecules. Alternatively, particularly in the
case poikilotherm cell lines, the MHC molecules will be presented
empty on the cell surface. The peptide can then be added to the
culture and bound to the MHC molecules as desired.
[0057] After the cells are produced having MHC and assisting
molecules on their surfaces, they can be lyophilized and the
fragments of the cells used to activate the population of T-cell
lymphocytes.
[0058] Transfected cultures of cells can be used to produced
extracellular portions of MHC molecules and assisting molecules.
The use of extracellular portions in conjunction with supports such
as solid supports has certain advantages of production. Where
living cells are used to provide a synthetic antigen-presenting
cell, at least three genes, two to produce the MHC molecule and one
for the assisting molecule must be introduced to the cell. Often,
additional genes such as for antibiotic resistance are also
transfected.
[0059] Where a solid support system is being used, one cell line
can produce the extracellular portions of MHC molecules while
another cell line produces the extracellular portion of the
assisting molecule. The MHC molecule portions and the assisting
molecule portions can then be harvested from their respective
cultures. The molecules are then linked to an appropriate support
in sufficient numbers to activate a population of T-cell
lymphocytes against a peptide when the peptide is bound to the
extracellular portion of the MHC molecule. From a production
standpoint, two different cultures can be used, but it is also
possible to use the same culture, however, requiring that the
culture be transfected with the additional gene for the
extracellular portion of the assisting molecule.
[0060] A further modification of this embodiment is to provide a
third culture of cells which is transfected with an expressible
second assisting molecule gene. In this example, the second culture
of cells produces extracellular portions of the costimulatory
molecule while the third culture of cells produce an extracellular
portion of an adhesion molecule. The adhesion molecule portions are
harvested and linked to the support.
[0061] The present invention also relates to a method for
activating CD8 T-cells against a selected peptide. The method
relates to providing a cell line presenting MHC molecules binding a
peptide and assisting molecules on their surfaces. Naive ICD8
T-cells can be obtained by removal from a patient to be treated.
The cultured cells are then contacted with the CD8 T-cells for a
sufficient period of time to activate the CD8 T-cell lymphocytes
resulting in proliferation and transforming the T-cells into armed
effector cells.
[0062] The activated CD8 T-cells can then be separated from the
cell line and put into a suspension in an acceptable carrier and
administered to the patient. An alternative method involves the use
of the synthetic antigen-presenting matrix to activate the CD8
cells.
[0063] It is preferred that human genes are used and, therefore,
human molecule analogs are produced. As shown in prior U.S. Pat.
No. 5,314,813, murine systems provide particularly useful models
for testing the operation of T-cell activation and demonstrate the
applicability of the process for human systems. See also Sykulev et
al., Immunity 1:15-22 (1994).
[0064] 1. Human Class I MHC Molecules
[0065] Class I MHC molecules comprise a heavy chain and a
.beta.-microglobulin protein. A human Class I MHC heavy chain of
the present invention is selected from the group comprising HLA-A,
HLA-B, HLA-C, HLA-E, HLA-F, and HLA-G, and more preferably, from
the group comprising HLA-A, HLA-B, and HLA-C. The heavy chains are
useful in either soluble or insoluble form. In the soluble ("sol")
form, a stop codon is engineered into the nucleotide sequence
encoding the HLA molecule of choice preceding the transmembrane
domain.
[0066] While it is possible to isolate nucleotide sequences
encoding human Class I MHC heavy chains from known, established
cell lines carrying the appropriate variants--e.g., transformed
cell lines JY, BM92, WIN, MOC, and MG--it is more practical to
synthesize the nucleotide sequence from a portion of the gene via
polymerase chain reaction (PCR), using the appropriate primers.
This method has been successfully used to clone full-length HLA
cDNA; for example, the sequences for HLA-A25, HLA-A2, HLA-B7,
HLA-B57, HLA-B51, and HLA-B37 are deposited in the GenBank database
under accession nos. M32321, M32322, M32317, M32318, M32319 and
M32320, respectively. Known, partial and putative HLA amino acid
and nucleotide sequences, including the consensus sequence, are
published (see, e.g., Zemmour and Parham, Immunogenetics 33:
310-320 (1991)), and cell lines expressing HLA variants are known
and generally available as well, many from the American Type
Culture Collection ("ATCC"). Therefore, using PCR, it is possible
to synthesize human Class I MHC-encoding nucleotide sequences which
may then be operatively linked to a vector and used to transform an
appropriate cell and expressed therein.
[0067] Particularly preferred methods for producing the Class I MHC
heavy chain, .beta.-2 microglobulin proteins and assisting
molecules of the present invention rely on the use of preselected
oligonucleotides as primers in a polymerase chain reaction (PCR) to
form PCR reaction products as described herein. Gene preparation is
typically accomplished by primer extension, preferably by primer
extension in a polymerase chain reaction (PCR) format.
[0068] If the genes are to be produced by (PCR) amplification, two
primers, i.e., a PCR primer pair, must be used for each coding
strand of nucleic acid to be amplified. (For the sake of
simplicity, synthesis of an exemplary HLA heavy chain variant
sequence will be discussed, but it is expressly to be understood
that the PCR amplification method described is equally applicable
to the synthesis of .beta.-2 microglobulin, costimulatory
molecules, adhesion molecules, and all HLA variants, including
those whose complete sequences are presently unknown.)
[0069] The first primer becomes part of the antisense (minus or
complementary) strand and hybridizes to a nucleotide sequence
conserved among HLA (plus or coding) strands. To produce coding DNA
homologs, first primers are therefore chosen to hybridize to (i.e.
be complementary to) conserved regions within the MHC genes,
preferably, the consensus sequence or similar, conserved regions
within each HLA group--i.e., consensus sequences within HLA-A,
HLA-B, HLA-C, and the less-polymorphic groups, HLA-E, -F, and
-G.
[0070] Second primers become part of the coding (plus) strand and
hybridize to a nucleotide sequence conserved among minus strands.
To produce the HLA-coding DNA homologs, second primers are
therefore chosen to hybridize with a conserved nucleotide sequence
at the 5' end of the HLA-coding gene such as in that area coding
for the leader or first framework region. In the amplification of
the coding DNA homologs the conserved 5' nucleotide sequence of the
second primer can be complementary to a sequence exogenously added
using terminal deoxynucleotidyl transferase as described by Loh et
al., Science 243: 217-220 (1989). One or both of the first and
second primers can contain a nucleotide sequence defining an
endonuclease recognition site. The site can be heterologous to the
immunoglobulin gene being amplified and typically appears at or
near the 5' end of the primer.
[0071] The high turn over rate of the RNA polymerase amplifies the
starting polynucleotide as has been described by Chamberlin et al.,
The Enzymes, ed. P. Boyer, PP. 87-108, Academic Press, New York
(1982). Another advantage of T7 RNA polymerase is that mutations
can be introduced into the polynucleotide synthesis by replacing a
portion of cDNA with one or more mutagenic oligodeoxynucleotides
(polynucleotides) and transcribing the partially-mismatched
template directly as has been previously described by Joyce et al.,
Nuc. Acid Res. 17: 711-722 (1989). Amplification systems based on
transcription have been described by Gingeras et al., in PCR
Protocols, A Guide to Methods and Applications, pp 245-252,
Academic Press, Inc., San Diego, Calif. (1990).
[0072] PCR amplification methods are described in detail in U.S.
Pat. Nos. 4,683,192, 4,683,202, 4,800,159, and 4,965,188, and at
least in several texts including "PCR Technology: Principles and
Applications for DNA Amplification", H. Erlich, ed., Stockton
Press, New York (1989); and "PCR Protocols: A Guide to Methods and
Applications", Innis et al., eds., Academic Press, San Diego,
Calif. (1990). Various preferred methods and primers used herein
are described hereinafter and are also described in Nilsson, et
al., Cell 58: 707 (1989), Ennis, et al., PNAS USA 87: 2833-7
(1990), and Zemmour, et al., Immunogenetics 33: 310-20 (1991), for
example. In particular, it is preferred to design primers from
comparison of 5' and 3' untranslated regions of HLA alleles (e.g.,
-A, -B, -C, -E, -F, or -G alleles), with selection of conserved
sequences. Restriction sites may also be incorporated into the 5'
and 3' primers to enable the amplification products to be subcloned
into sequencing or expression vectors. It may also be helpful to
place a 4-base spacer sequence proximal to the restriction site to
improve the efficiency of cutting amplification products with
enzymes.
[0073] The following primers are preferred for amplification of
HLA-A, -B, -C, -E, -F, and -G cDNA, preferably in separate
reactions. Resulting cDNAs may then be cloned and sequenced as
described herein. These primers are appropriate for use in
amplifying all known and presently unknown types of HLA.
1 HLA A (SEQ ID NO 1) 5' primer: 5'CC ACC ATG GCC GTC ATG GCG CCC
3' (SEQ ID NO 2) 3'primer: 5'GG TCA CAC TTT ACA AGC TCT GAG 3' HLA
B (SEQ ID NO 3) 5' primer: 5'CC ACC ATG CTG GTC ATG GCG CCC 3' (SEQ
ID NO 4) 3'primer: 5'GG ACT CGA TGT GAG AGA CAC ATC 3' HLA C (SEQ
ID NO 5) 5' primer: 5'CC ACC ATG CGG GTC ATG GCG CCC 3' (SEQ ID NO
6) 3' primer: 5'GG TCA GGC TTT ACA AGC GAT GAG 3' HLA E (SEQ ID NO
7) 5' primer: 5'CC ACC ATG CGG GTA GAT GCC CTC C 3' (SEQ ID NO 8)
3' primer: 5'GG TTA CAA GCT GTG AGA CTC AGA 3' HLA F (SEQ ID NO 9)
5' primer: 5'CC ACC ATG GCG CCC CGA AGC CTC 3' (SEQ ID NO 10) 3'
primer: 5'GG TCA CAC TTT ATT AGC TGT GAG A 3' HLA G (SEQ ID NO 11)
5' primer: 5'CC ACC ATG GCG CCC CGA ACC CTC 3' (SEQ ID NO 12) 3'
primer: 5'GG TCA CAA TTT ACA AGC CGA GAG 3'
[0074] In preferred embodiments only one pair of first and second
primers is used per amplification reaction. The amplification
reaction products obtained from a plurality of different
amplifications, each using a plurality of different primer pairs,
are then combined. However, the present invention also relates to
DNA homolog production via co-amplification (using two pairs of
primers), and multiplex amplification (using up to about 8, 9 or 10
primer pairs).
[0075] It preferred embodiments, the PCR process is used not only
to produce a variety of human Class I-encoding DNA molecules, but
also to induce mutations which may emulate those observed in the
highly-polymorphic HLA loci, or to create diversity from a single
parental clone and thereby provide a Class I MHC molecule-encoding
DNA "library" having a greater heterogeneity. In addition to the
mutation inducing variations described in the above referenced U.S.
Pat. No. 4,683,195 and such as discussed in U.S. Pat. No.
5,314,813.
[0076] 2. DNA Expression Vectors
[0077] A vector of the present invention is a nucleic acid
(preferably DNA) molecule capable of autonomous replication in a
cell and to which a DNA segment, e.g., gene or polynucleotide, can
be operatively linked so as to bring about replication of the
attached segment. One of the nucleotide segments to be operatively
linked to vector sequences encodes at least a portion of a
mammalian Class I MHC heavy chain. Preferably, the entire
peptide-coding sequence of the MHC heavy chain is inserted into the
vector and expressed; however, it is also feasible to construct a
vector which also includes some non-coding MHC sequences as well.
Preferably, non-coding sequences of MHC are excluded.
Alternatively, a nucleotide sequence for a soluble ("sol") form of
an Class I MHC heavy chain may be utilized; the "sol" form differs
from the non-sol form in that it contains a "stop" codon inserted
at the end of the alpha 3 domain or prior to the transmembrane
domain. Another preferred vector includes a nucleotide sequence
encoding at least a portion of a mammalian .beta.-2 microglobulin
molecule operatively linked to the vector for expression. Still
another preferred vector includes a nucleotide sequence encoding at
least a portion of a mammalian assisting molecule operably linked
to the vector for expression. It is also feasible to construct a
vector including nucleotide sequences encoding a Class I MHC heavy
chain and a .beta.-2 microglobulin and an assisting molecule, or
some combination of these.
[0078] A preferred vector comprises a cassette that includes one or
more translatable DNA sequences operatively linked for expression
via a sequence of nucleotides adapted for directional ligation. The
cassette preferably includes DNA expression control sequences for
expressing the polypeptide or protein that is produced when a
translatable DNA sequence is directionally inserted into the
cassette via the sequence of nucleotides adapted for directional
ligation. The cassette also preferably includes a promoter sequence
upstream from the translatable DNA sequence, and a polyadenylation
sequence downstream from the mammalian MHC heavy chain sequence.
The cassette may also include a selection marker, albeit it is
preferred that such a marker be encoded in a nucleotide sequence
operatively linked to another expression vector sequence.
[0079] The choice of vector to which a cassette of this invention
is operatively linked depends directly, as is well known in the
art, on the functional properties desired, e.g., vector replication
and protein expression, and the host cell to be transformed, these
being limitations inherent in the art of constructing recombinant
DNA molecules.
[0080] In various embodiments, a vector is utilized for the
production of polypeptides useful in the present invention,
including MHC variants and antigenic peptides. Exemplary vectors
include the plasmids pUC8, pUC9, pUC18, pBR322, and pBR329
available from BioRad Laboratories (Richmond, Calif.), pPL and
pKK223 available from Pharmacia (Piscataway, N.J.), and pBS and M13
mp9 (Stratagene, La Jolla, Calif.). Other exemplary vectors include
pCMU (Nilsson, et al., Cell 58: 707 (1989)). Other appropriate
vectors may also be synthesized, according to known methods; for
example, vectors pCMU/K.sup.b and pCMUII used in various
applications herein are modifications of pCMUIV (Nilsson, et al.,
supra).
[0081] In addition, there is preferably a sequence upstream of the
translatable nucleotide sequence encoding a promoter sequence.
Preferably, the promoter is conditional (e.g., inducible). A
preferred conditional promoter used herein is a metallothionein
promoter or a heat shock promoter.
[0082] Vectors may be constructed utilizing any of the well-known
vector construction techniques. Those techniques, however, are
modified to the extent that the translatable nucleotide sequence to
be inserted into the genome of the host cell is flanked "upstream"
of the sequence by an appropriate promoter and, in some variations
of the present invention, the translatable nucleotide sequence is
flanked "downstream" by a polyadenylation site. This is
particularly preferred when the "host" cell is an insect cell and
the nucleotide sequence is transmitted via transfection.
Transfection may be accomplished via numerous methods, including
the calcium phosphate method, the DEAE-dextran method, the stable
transfer method, electroporation, or via the liposome mediation
method. Numerous texts are available which set forth known
transfection methods and other procedures for introducing
nucleotides into cells; see, e.g., Current Protocols in Molecular
Biology, John Wiley & Sons, NY (1991).
[0083] The vector itself may be of any suitable type, such as a
viral vector (RNA or DNA), naked straight-chain or circular DNA, or
a vesicle or envelope containing the nucleic acid material and any
polypeptides that are to be inserted into the cell. With respect to
vesicles, techniques for construction of lipid vesicles, such as
liposomes, are well known. Such liposomes may be targeted to
particular cells using other conventional techniques, such as
providing an antibody or other specific binding molecule on the
exterior of the liposome. See, e.g., A. Huang, et al., J. Biol.
Chem. 255: 8015-8018 (1980). See, e.g., Kaufman, Meth. Enzymol.
185: 487-511 (1990).
[0084] In a preferred embodiment, the vector also contains a
selectable marker. After expression, the product of the
translatable nucleotide sequence may then be purified using
antibodies against that sequence. One example of a selectable
marker is neomycin resistance. A plasmid encoding neomycin
resistance, such as phshsneo, phsneo, or pcopneo, may be included
in each transfection such that a population of cells that express
the gene(s) of choice may be ascertained by growing the
transfectants in selection medium.
[0085] A preferred vector for use according to the present
invention is a plasmid; more preferably, it is a high-copy-number
plasmid. It is also desirable that the vector contain an inducible
promoter sequence, as inducible promoters tend to limit selection
pressure against cells into which such vectors (which are often
constructed to carry non-native or chimeric nucleotide sequences)
have been introduced. It is also preferable that the vector of
choice be best suited for expression in the chosen host. If the
host cell population is a Drosophila cell culture, then a
compatible vector includes vectors functionally equivalent to those
such as p25-lacZ (see Bello and Couble, Nature 346: 480 (1990)) or
pRmHa-1, -2, or -3 (see Bunch, et al., Nucl. Acids Res. 16:
1043-1061 (1988)). In the preferred embodiment, the vector is
pRmHa-3, which is shown in FIG. 3. This vector includes a
metallothionein promoter, which is preferably upstream of the site
at which the MHC sequence is inserted, and the polyadenylation site
is preferably downstream of said MHC sequence. Insect cells and, in
particular, Drosophila cells are preferred hosts according to the
present invention. Drosophila cells such as Schneider 2 (S2) cells
have the necessary trans-acting factors required for the activation
of the promoter and are thus even more preferred.
[0086] The expression vector pRmHa-3 is based on the bacterial
plasmid pRmHa-1 (FIG. 2), the latter of which is based on plasmid
pUC18 and is deposited with the American Type Culture Collection
(ATCC, Rockville, Md.), having the accession number 37253. The
pRmHa-3 vector contains the promoter, the 5' untranslated leader
sequence of the metallothionein gene (sequences 1-421, SEQ ID NO
13) with the R1 and Stu sites removed; see FIG. 3). It also
contains the 3' portion of the Drosophila ADH gene (sequence
#6435-7270, SEQ ID NO 14) including the polyadenylation site.
Therefore, cloned DNA will be transcriptionally regulated by the
metallothionein promoter and polyadenylated. Construction of the
pRmHa-1 plasmid is described in Bunch, et al., Nucl. Acids Res. 16:
1043-1061 (1988). Construction of the pRmHa-3 and pRmHa-2 plasmids
(the latter of which has a metallothionein promoter sequence that
may be removed as an Eco RI fragment) is illustrated in FIGS. 1, 2,
and 3. With regard to pRmHa-3, a preferred plasmid for use
according to the present invention, Pst I, Sph I and Hind III are
in the promoter fragment and therefore are not unique. Xba is in
the ADH fragment (4 bases from its 3' end) and is also not unique.
The following restriction sites are, however, unique in pRmHa-3:
Eco RI, Sac I, Kpn I, Sma I, Bam III, Sal I, Hinc 2, and Acc I.
[0087] A cassette in a DNA expression vector of this invention is
the region of the vector that forms, upon insertion of a
translatable DNA sequence, a sequence of nucleotides capable of
expressing, in an appropriate host, a fusion protein of this
invention. The expression-competent sequence of nucleotides is
referred to as a cistron. Thus, the cassette preferably comprises
DNA expression control elements operatively linked to one or more
translatable DNA sequences. A cistron is formed when a translatable
DNA sequence is directionally inserted (directionally ligated)
between the control elements via the sequence of nucleotides
adapted for that purpose. The resulting translatable DNA sequence,
namely the inserted sequence, is, preferably, operatively linked in
the appropriate reading frame.
[0088] DNA expression control sequences comprise a set of DNA
expression signals for expressing a structural gene product and
include both 5' and 3' elements, as is well known, operatively
linked to the cistron such that the cistron is able to express a
structural gene product. The 5' control sequences define a promoter
for initiating transcription and a ribosome binding site
operatively linked at the 5' terminus of the upstream translatable
DNA sequence.
[0089] Thus, a DNA expression vector of this invention provides a
system for cloning translatable DNA sequences into the cassette
portion of the vector to produce a cistron capable of expressing a
fusion protein of this invention.
[0090] 3. Cell Lines
[0091] A preferred cell line of the present invention is capable of
continuous growth in culture and capable of expressing mammalian
Class I MHC molecules and assisting molecules on the surface of its
cells. Any of a variety of transformed and non-transformed cells or
cell lines are appropriate for this purpose, including bacterial,
yeast, insect, and mammalian cell lines. (See, e.g., Current
Protocols in Molecular Biology, John Wiley & Sons, NY (1991),
for summaries and procedures for culturing and using a variety of
cell lines, e.g., E. coli and S. cerevisiae.)
[0092] Preferably, the cell line is a eukaryotic cell line. More
preferably, the cell line is poikillothermic (i.e., less sensitive
to temperature challenge than mammalian cell lines). More
preferably, it is an insect cell line. Various insect cell lines
are available for use according to the present invention, including
moth (ATCC CCL 80), armyworm (ATCC CRL 1711), mosquito larvae (ATCC
lines CCL 125, CCL 126, CRL 1660, CRL 1591, CRL 6585, CRL 6586) and
silkworm (ATCC CRL 8851). In a preferred embodiment, the cell line
is a Drosophila cell line such as a Schneider cell line (see
Schneider, J. Embryol. Exp. Morph. 27: 353-365 (1972)); preferably,
the cell line is a Schneider 2 (S2) cell line (S2/M3) adapted for
growth in M3 medium (see Lindquist, et al., Drosophila Information
Service 58: 163 (1982)).
[0093] Schneider cells may be prepared substantially as follows.
Drosophila melanogaster (Oregon-R) eggs are collected over about a
4 hour interval and are dechlorinated in 2.5% aqueous sodium
hypochlorite and surface-sterilized by immersion in 70% ethanol for
20 minutes, followed by an additional 20 minutes in 0.05%
HgCl.sub.2 in 70% ethanol. After being rinsed thoroughly in sterile
distilled water, the eggs are transferred to petri dishes
containing sterile Metricel black filters backed with Millipore
prefilters, both previously wetted with culture medium. The eggs
are placed overnight in a 22.degree. C. incubator and removed for
culturing when 20-24 hours old. The embryos are each cut into
halves or thirds, then placed in 0.2% trypsin (1:250, Difco) in
Rinaldini's salt solution (Rinaldini, Nature (London) 173:
1134-1135 (1954)) for 20-45 minutes at room temperature. From
100-300 embryos are used to initiate each culture.
[0094] After the addition of fetal bovine serum (FBS), the
fragments are centrifuged at 100.times.g for 2-3 minutes,
resuspended in 1.25 ml culture medium and seeded into glass T-9
flasks. The cultures are maintained at about 22-27.degree.
C..+-.0.5.degree. C., with a gaseous phase of ambient air.
Schneider's culture medium (Schneider, J. Exp. Zool. 156: 91-104
(1964); Schneider, J. Embryol. Exp. Morph. 15: 271-279 (1966))
containing an additional 500 mg bacteriological peptone per 100 ml
medium and supplemented with 15% inactivated FBS is preferably
used. The pH (preferably 6.7-6.8) is monitored with 0.01% phenol
red. The cell lines are preferably maintained by subculturing every
3-7 days. The cells readily attach to the glass but not so firmly
as to require trypsin treatment; typically, simple pipetting is
adequate to flush most of the cells from the bottom of the flasks.
The morphological appearance of the cells is described in
Schneider, J. Embryol. Exp. Morph. 27: 353-365 (1972). They are
essentially epithelial-like in appearance and range from about 5-11
.mu.m in diameter and 11-35 [m in length. Small pockets containing
rounded cells may be dispersed randomly throughout the other
cells.
[0095] Preferably, the Schneider 2 (S2) cells are maintained in
Schneider's Drosophila medium plus 10% FBS including penicillin
(100 unit/ml) and streptomycin (100 mg/ml). It is preferable to
keep the cells at a density of more than 0.5.times.10.sup.5/ml, and
to grow them at a 24-30.degree. C. temperature range. The cells
tend to double in fewer than 24 hours and grow to high cell
density, i.e., about 2.times.10.sup.7/ml or greater. The cells may
also be frozen in 90% FBS and 10% DMSO, for later use or analysis.
One may place the cells at -70.degree. C. and then store in liquid
nitrogen. preferred cell line according to the present invention,
identified as Schneider 2 (S2) cells, has been deposited pursuant
to Budapest Treaty requirements with the American Type Culture
Collection (ATCC), Rockville, Md., on Feb. 18, 1992, and was
assigned accession number CRL 10974.
[0096] Cells of the present invention are transfected with cDNAs
encoding (human) MHC heavy chains, .beta.-2 microglobulin and one
or more assisting molecules, which have each been inserted into
(i.e., operatively linked to) an expression vector. In a more
preferred embodiment, the vector comprises Drosophila expression
plasmid pRmHa-3, into which expressible nucleotide sequences
encoding human Class I MHC heavy chains, human .beta.-2
microglobulin or human assisting molecules have been inserted using
techniques disclosed herein. Preferably, the cDNAs encoding MHC
heavy chains, those encoding .beta.-2 microglobulin and those
encoding assisting molecules are operatively linked to separate
expression plasmids and are cotransfected into the cultured cells.
Alternatively, the cDNAs encoding MHC heavy chains, .beta.-2
microglobulin and assisting molecules may be operatively linked to
the same expression plasmid and cotransfected via that same
plasmid. In another variation, cDNAs encoding MHC heavy chains,
.beta.-2 microglobulin, assisting molecules, and a cytokine such as
IL-2 are operatively linked to expression plasmids and are
cotransfected into a cell line of the present invention. Selection
of HLA genes, construction of appropriate vectors and primer
selection are described in greater detail above.
[0097] Successfully transformed cells, i.e., cells that contain an
expressible human nucleotide sequence according to the present
invention, can be identified via well-known techniques. For
example, cells resulting from the introduction of a cDNA or rDNA of
the present invention can be cloned to produce monoclonal colonies.
Cells from those colonies can be harvested, lysed, and their DNA
content examined for the presence of the rDNA using a method such
as that described by Southern, J. Mol. Biol. 98: 503 (1975). In
addition to directly assaying for the presence of rDNA, successful
transformation or transfection may be confirmed by well-known
immunological methods when the rDNA is capable of directing the
expression of a subject chimeric polypeptide. For example, cells
successfully transformed with an expression vector may produce
proteins displaying particular antigenic properties which are
easily determined using the appropriate antibodies. In addition,
successful transformation/transfection may be ascertained via the
use of an additional vector bearing a marker sequence, such as
neomycin resistance, as described hereinabove.
[0098] It is also preferable that the culture be stabile and
capable of sustained growth at reduced temperatures. For example,
it is preferred that the culture be maintained at about room
temperature, e.g., about 24-27.degree. C. In other embodiments, the
culture is maintained at higher temperatures, particularly during
the process of activating CD8 cells. It is thus preferred that a
culture according to the present invention be capable of
withstanding a temperature challenge of about 30.degree. C. to
about 37.degree. C. Addition of 0-2 microglobulin to a culture
stabilizes the Class I MHC to at least a 30.degree. C. challenge;
addition of .beta.-2 microglobulin and peptides results in greater
thermostability at higher temperatures, i.e., at 37.degree. C.
[0099] In order to prepare the culture for expression of empty--or
more preferably, peptide-loaded--MHC molecules, the culture may
first require stimulation, e.g., via CUSO.sub.4 induction, for a
predetermined period of time. After a suitable induction
period--e.g., about 12-48 hours, peptides may be added at a
predetermined concentration (e.g., about 100 .mu.g/ml). Peptides
may be prepared as discussed below. After a further incubation
period--e.g., for about 12 hours at 27.degree. C.--the culture is
ready for use in the activation of CD8 cells. While this additional
incubation period may be shortened or perhaps omitted, the culture
tends to become increasingly stable to temperature challenge if it
is allowed to incubate for a time prior to addition of resting or
naive CD8 cells. For example, cultures according to the present
invention to which peptide has been added are capable of expressing
significant amounts of peptide-loaded Class I MHC molecules even
when incubated for extended periods of time at 37.degree. C.
[0100] Nutrient media useful in the culturing of transformed host
cells are well known in the art and can be obtained from numerous
commercial sources. In embodiments wherein the host cell is
mammalian, a "serum-free" medium is preferably used.
[0101] 4. Human .beta.-2 Microglobulin and Assisting Molecules
[0102] In order to establish a cell line capable of producing
therapeutically useful amounts of surface-expressed human Class I
MHC molecules, it is preferable to cotransfect a cell line of the
present invention with a vector operably linked to a nucleotide
sequence encoding .beta.-2 microglobulin in order to effect
appropriate levels of expression of human MHC molecules in the cell
line. While the nucleotide sequence encoding mammalian .beta.-2
microglobulin such as mouse .beta.-2 microglobulin increases the
stability of the human Class I MHC molecules expressed in the cell
lines of the present invention, it is preferable to cotransfect the
cell line with a vector operably linked to an expressible
nucleotide sequence encoding a human .beta.-2 microglobulin.
[0103] As discussed above, a preferred vector according to the
present invention includes a nucleotide sequence encoding at least
a portion of a mammalian .beta.-2 microglobulin molecule
operatively linked to the vector for expression. The gene for the
assisting molecules can be linked to the same or another vector. It
is also feasible to construct a vector including nucleotide
sequences encoding both a Class I MHC heavy chain and a .beta.-2
microglobulin.
[0104] The sequencing and primers used for the assisting molecules
are discussed in more detail below. However, the protocols are
similar.
[0105] A human .beta.-2 microglobulin cDNA sequence has been
published (see Suggs, et al., PNAS 78: 6613-17, 1981) and the
sequence was used as a template for a polymerase chain reaction
(PCR) using the following primers:
2 5' primer: 5'GCTTGGATCCAGATCTACCATGTCTCGCTCCGTG (SEQ ID NO 15)
GCCTTAGCTGTGCTCGCGCTACTCTC 3' 3' primer
5'GGATCCGGATGGTTACATGTCGCGATCCCACTTA (SEQ ID NO 16) AC 3'
[0106] The primers are used in a standard PCR reaction (see above
and references cited therein). The reaction products are extracted
with phenol, purified using a GENECLEAN.RTM. kit (Bio 101, San
Diego, Calif.), digested with Bam HI and cloned into the Bam HI
site of pBS (Stratagene, La Jolla, Calif.). After verification of
the sequence, this Bam HI fragment is cloned into the Bam HI site
of an appropriate expression vector. In the preferred embodiment,
human .beta.-2 microglobulin cDNA is synthesized and operably
linked to expression vector pRmHa-3.
[0107] 5. Peptides
[0108] Virtually all cellular proteins in addition to viral
antigens are capable of being used to generate relevant peptide
fragments that serve as potential Class I MHC ligand. In most
mammalian cells, then, any particular MHC peptide complex would
represent only a small proportion of the total MHC encoded
molecules found on the cell surface. Therefore, in order to produce
surface-expressed human Class I MHC molecules that have an
increased capacity to specifically activate CD8 cells, it is
preferable to isolate and load peptide fragments of appropriate
size and antigenic characteristics onto Class I molecules.
[0109] The peptides of the present invention bind to Class I MHC
molecules. The binding occurs under biological conditions which can
be created in vivo as well as in vitro. The exact nature of the
binding of the peptides need not be known for practice of the
invention.
[0110] In a preferred embodiment, the peptides to be loaded onto
the Class I MHC molecules are antigenic. It is also preferred that
the peptides be of a uniform size, preferably 8-mers or 9-mers, and
most preferably, 8-mers. It is also preferable that the peptides
prepared for loading onto the MHC molecules be of a single species;
i.e., that all peptides loaded onto the MHC be identical in size
and sequence. In this manner, it is possible to produce
monoantigenic peptide-loaded MHC molecules.
[0111] Peptides may be presented to the cells via various means.
Preferably, peptides are presented in a manner which allows them to
enter an intracellular pool of peptides. For example, peptides may
be presented via osmotic loading. Typically, peptides are added to
the culture medium. The peptides may be added to the culture in the
form of an intact polypeptide or protein which is subsequently
degraded via cellular processes, e.g., via enzymatic degradation.
Alternatively, the intact polypeptide or protein may be degraded
via some other means such as chemical digestion (e.g. cyanogen
bromide) or proteases (e.g. chymotrypsin) prior to its addition to
the cell culture. In other embodiments, the peptides are presented
in smaller segments which may or may not comprise epitopic amino
acid sequences.
[0112] In a preferred embodiment, a sufficient amount of protein(s)
or peptide(s) is added to the cell culture to allow the Class I MHC
molecules to bind and subsequently present a large density of the
peptide--preferably, with the same kind of peptide attached to each
MHC--on the surface of human Class I MHC-expressing cells of the
present invention. It is also preferred to allow the human Class I
MHC heavy chains and human .beta.-2 microglobulin to bind--i.e., to
form heterodimers--prior to presenting peptide to the MHC molecules
intracellularly.
[0113] In another embodiment of the invention, peptides are added
to transfected cells of the present invention in order to enhance
the thermostability of the MHC molecules expressed by the cells. As
noted above, peptides are preferably added to the culture medium.
Antigenic peptides that bind to the Class I molecules serve to
thermostabilize the MHC molecules and also increase the cell
surface expression. Cultures with added peptides which bind to the
MHC molecules are thus significantly less susceptible to
temperature challenge than cultures without added peptide.
[0114] In one embodiment of the present invention, antigenic
peptides are presented to the transformed/transfected cell line in
various forms. For example, an entire protein or other antigenic
polypeptide may be degraded chemically or enzymatically, for
example, and added to the cell line in this form. For example, a
protein of interest is degraded with chymotrypsin and the resultant
mixture of peptide "fragments" is added to a transformed or
transfected cell culture; these cells are then allowed to "choose"
the appropriate peptides (which are often smaller peptides,
preferably 8 mers or 9 mers) to load onto the Class I MHC
molecules. Alternatively, an entire protein or polypeptide sequence
may be cloned into an appropriate vector and inserted into a
procaryotic cell, whereby the cell generates significant amounts of
the antigenic polypeptide which are then harvested, purified, and
digested into peptides which are then added to the
transformed/transfected eukaryotic cell culture. The cells again
would be allowed to "choose" the peptides to load onto the
expressed MHC.
[0115] 6. Isolation of Resting or Precursor CD8 Cells
[0116] Resting (or naive or precursor) CD8 cells--i.e., T-cells
that have not been activated to target a specific antigen--are
preferably extracted from the patient prior to incubation of the
CD8 cells with the transformed cultures of the present invention.
It is also preferred that precursor CD8 cells be harvested from a
patient prior to the initiation of other treatment or therapy which
may interfere with the CD8 cells' ability to be specifically
activated. For example, if one is intending to treat an individual
with a neoplasia or tumor, it is preferable to obtain a sample of
cells and culture same prior to the initiation of chemotherapy or
radiation treatment.
[0117] Methods of extracting and culturing lymphocytes are well
known. For example, U.S. Pat. No. 4,690,915 to Rosenberg describes
a method of obtaining large numbers of lymphocytes via
lymphocytopheresis. Appropriate culturing conditions used are for
mammalian cells, which are typically carried out at 37.degree.
C.
[0118] Various methods are also available for separating out and/or
enriching cultures of precursor CD8 cells. Some examples of general
methods for cell separation include indirect binding of cells to
specifically-coated surfaces. In another example, human peripheral
blood lymphocytes (PBL), which include CD8 cells, are isolated by
Ficoll-Hypaque gradient centrifugation (Pharmacia, Piscataway,
N.J.). PBL lymphoblasts may be used immediately thereafter or may
be stored in liquid nitrogen after freezing in FBS containing 10%
DMSO (Sigma Chemical Co., St. Louis, Mo.), which conserves cell
viability and lymphocyte functions.
[0119] Alternative methods of separating out and/or enriching
cultures of precursor cells include both positive and negative
selection procedures. For positive selection, after
lymphocyte-enriched PBL populations are prepared from whole blood,
sub-populations of CD8 lymphocytes are isolated therefrom by
affinity-based separation techniques directed at the presence of
the CD8 receptor antigen. These affinity-based techniques include
flow microfluorimetry, including fluorescence-activated cell
sorting (FACS), cell adhesion, and like methods. (See, e.g., Scher
and Mage, in Fundamental Immunology, W. E. Paul, ed., pp. 767-780,
River Press, NY (1984).) Affinity methods may utilize anti-CD8
receptor antibodies as the source of affinity reagent.
Alternatively, the natural ligand, or ligand analogs, of CD8
receptor may be used as the affinity reagent. Various anti-T-cell
and anti-CD8 monoclonal antibodies for use in these methods are
generally available from a variety of commercial sources, including
the American Type Culture Collection (Rock ville, Md.) and
Pharmingen (San Diego, Calif.).
[0120] Negative selection procedures are utilized to effect the
removal of non-CD8 from the CD8 population. This technique results
in the enrichment of CD8 cells from the T- and B-cell population of
leucophoresed patients. Depending upon the antigen designation,
different antibodies may be appropriate. (For a discussion and
review of nomenclature, antigen designation, and assigned
antibodies for human leucocytes, including T-cells, see Knapp, et
al., Immunology Today 10: 253-258 (1989) and Janeway et al.,
Immunobiology, supra.) For example, monoclonal antibodies OKT4
(anti-CD4, ATCC No. CRL 8002) OKT 5 (ATCC Nos. CRL 8013 and 8016),
OKT 8 (anti-CD8, ATCC No. CRL 8014), and OKT 9 (ATCC No. CRL 8021)
are identified in the ATCC Catalogue of Cell Lines and Hybridomas
(ATCC, Rockville, Md.) as being reactive with human T lymphocytes,
human T-cell subsets, and activated T-cells, respectively. Various
other antibodies are available for identifying and isolating T-cell
species.
[0121] In a further embodiment, CD8 cells can be isolated by
combining both negative and positive selection procedures. (See,
e.g. Cai and Sprent, J. Exp. Med. 179: 2005-2015 (1994)).
[0122] Preferably, the PBLs are then purified. For example, Ficoll
gradients may be utilized for this purpose. The purified PBLs would
then be mixed with syngeneic Drosophila cells preincubated with the
appropriate antigenic peptides.
[0123] 7. In Vitro Activation of CD8 Cells
[0124] In order to optimize the in vitro conditions for the
generation of specific cytotoxic T-cells, the culture of
antigen-presenting cells is maintained in an appropriate medium. In
the preferred embodiment, the antigen-presenting cells are
Drosophila cells, which are preferably maintained in serum-free
medium (e.g. Excell 400).
[0125] Prior to incubation of the antigen-presenting cells with the
cells to be activated, e.g., precursor CD8 cells, an amount of
antigenic peptide is added to the antigen-presenting cell culture,
of sufficient quantity to become loaded onto the human Class I
molecules to be expressed on the surface of the antigen-presenting
cells. According to the present invention, a sufficient amount of
peptide is an amount that will allow about 200 to about 500,000 and
preferably about 200 to 1,000 or more, human Class I MHC molecules
loaded with peptide to be expressed on the surface of each
antigen-presenting cell. Preferably, the antigen-presenting cells
are incubated with >20 g/ml peptide.
[0126] Resting or precursor CD8 cells are then incubated in culture
with the appropriate antigen-presenting cells for a time period
sufficient to activate and further enrich for a population of CD8
cells. Preferably, the CD8 cells shall thus be activated in an
antigen-specific manner. The ratio of resting or precursor CD8
(effector) cells to antigen-presenting cells may vary from
individual to individual and may further depend upon variables such
as the amenability of an individual's lymphocytes to culturing
conditions and the nature and severity of the disease condition or
other condition for which the within-described treatment modality
is used. Preferably, however, the lymphocyte:antigen-presenting
cell (e.g. Drosophila cell) ratio is preferably in the range of
about 30:1 to 300:1. For example, in one embodiment,
3.times.10.sup.7 human PBL and 1.times.10.sup.6 live Drosophila
cells were admixed and maintained in 20 ml of RPMI 1640 culture
medium.
[0127] The effector/antigen-presenting culture may be maintained
for as long a time as is necessary to activate and enrich for a
population of a therapeutically useable or effective number of CD8
cells. In general terms, the optimum time is between about one and
five days, with a "plateau"--i.e. a "maximum" specific CD8
activation level--generally being observed after five days of
culture. In one embodiment of the present invention, in vitro
activation of CD8 cells is detected within a brief period of time
after transfection of a cell line. In one embodiment, transient
expression in a transfected cell line capable of activating CD8
cells is detectable within 48 hours of transfection. This clearly
indicates that either stable or transient cultures of transformed
cells expressing human Class I MHC molecules are effective in
activating CD8 cells.
[0128] Preferably, the enrichment and concordant activation of CD8
cells is optimal within one week of exposure to antigen-presenting
cells. Thereafter, in a preferred embodiment, the enriched and
activated CD8 cells are further purified by isolation procedures
including site restriction, rosetting with antibody-red blood cell
preparations, column chromatography and the like. Following the
purification, the resulting CD8 cell preparation is further
expanded by maintenance in culture for a period of time to obtain a
population of 10.sup.9 activated CD8 cells. This period may vary
depending on the replication time of the cells but may generally be
14 days. Activation and expansion of CD8 cells has been described
by Riddell et al., Curr. Opin. Immunol., 5: 484-491(1993).
[0129] 8. Separation of CD8 Cells from Drosophila Cells
[0130] Activated CD8 cells may be effectively separated from the
stimulator (e.g., Drosophila) cells using one of a variety of known
methods. For example, monoclonal antibodies specific for the
stimulator cells, for the peptides loaded onto the stimulator
cells, or for the CD8 cells (or a segment thereof) may be utilized
to bind their appropriate complementary ligand. Antibody-tagged
cells may then be extracted from the stimulator-effector cell
admixture via appropriate means, e.g., via well-known
immunoprecipitation or immunoassay methods.
[0131] 9. Administration of Activated CD8 Cells
[0132] Effective, cytotoxic amounts of the activated CD8 cells can
vary between in vitro and in vivo uses, as well as with the amount
and type of cells that are the ultimate target of these killer
cells. The amount will also vary depending on the condition of the
patient and should be determined via consideration of all
appropriate factors by the practitioner. Preferably, however, about
1.times.10.sup.6 to about 1.times.10.sup.12, more preferably about
1.times.10.sup.8 to about 1.times.10.sup.11, and even more
preferably, about 1.times.10.sup.9 to about 1.times.10.sup.10
activated CD8 cells are utilized for adult humans, compared to
about 5.times.10.sup.6-5.times.10.sup.7 cells used in mice.
[0133] Preferably, as discussed above, the activated CD8 cells are
harvested from the Drosophila cell culture prior to administration
of the CD8 cells to the individual being treated. It is important
to note, however, that unlike other present and proposed treatment
modalities, the present method uses a cell culture system (i.e.,
Drosophila cells) that are not tumorigenic. Therefore, if complete
separation of Drosophila cells and activated CD8 cells is not
achieved, there is no inherent danger known to be associated with
the administration of a small number of Drosophila cells, whereas
administration of mammalian tumor-promoting cells may be extremely
hazardous.
[0134] Methods of re-introducing cellular components are known in
the art and include procedures such as those exemplified in U.S.
Pat. No. 4,844,893 to Honsik, et al. and U.S. Pat. No. 4,690,915 to
Rosenberg. For example, administration of activated CD8 cells via
intravenous infusion is appropriate.
[0135] 10. HLA Typing
[0136] As noted previously, HLA haplotypes/allotypes vary from
individual to individual and, while it is not essential to the
practice of the present invention, it is often helpful to determine
the individual's HLA type. The HLA type may be determined via
standard typing procedures and the PBLs purified by Ficoll
gradients. The purified PBLs would then be mixed with syngeneic
Drosophila cells preincubated with the appropriate antigenic
peptides--e.g., in therapeutic applications relating to viral
infections, cancers, or malignancies, peptides derived from viral-
or cancer-specific proteins.
[0137] Continuing to use viral or malignant conditions as an
example, in those instances in which specific peptides of a
particular viral- or cancer-specific antigen have been
characterized, the synthesized peptides encoding these epitopes
will preferably be used. In cases in which the preferred antigenic
peptides have not been precisely determined, protease digests of
viral- or cancer-specific proteins may be used. As a source for
such antigen, cDNA encoding viral- or cancer-specific proteins is
cloned into a bacterial expression plasmid and used to transform
bacteria, e.g., via methods disclosed herein.
[0138] After HLA typing, if Drosophila cells expressing the
preferred HLA are not available, cDNAs encoding the preferred HLA
may be cloned via use of the polymerase chain reaction. The primers
disclosed in section B.1. above (SEQ ID NO 1 through SEQ ID NO 12)
may be used to amplify the appropriate HLA-A, -B, -C, -E, -F, or -G
cDNAs in separate reactions which may then be cloned and sequenced
as described in the methods disclosed for HLA A2.1 below. Stable
cell lines expressing the cloned HLA may then be established in the
Drosophila cells. Alternatively, a population of insect cells
transiently expressing a bulk population of cloned recombinant
molecules from the PCR reaction may be used for in vitro CD8
activation.
EXAMPLES
[0139] The following examples are intended to illustrate, but not
limit, the present invention.
Example 1
Expression of Human Class I MHC Molecules
[0140] A. Preparation of pRmHa-3 Expression Vector
[0141] The pRmHa-3 expression vector for use in expressing MHC
proteins in Drosophila Schneider 2 (S2) cells as described in this
invention was constructed by ligating a Sph I linearized pRmHa-1
DNA expression vector with a DNA fragment resulting from a Sph I
restriction digest of a pRmHa-2 expression vector as described
below. The ligating of pRmHa-1 with the pRmHa-2 fragment in this
manner was performed to remove one of two Eco RI restriction
endonuclease cloning sites present in pRmHa-1. Thus, the resultant
pRmHa-3 expression vector contained only one Eco RI restriction
site in the multiple cloning site (polylinker) into which various
MHC-encoding DNA fragments were inserted as described in the
Examples.
[0142] 1 Preparation of pRmHa-1 Expression Vector
[0143] The pRmHa-1 expression vector, containing a metallothionein
promoter, metal response consensus sequences (designated MT) and an
alcohol dehydrogenase (ADH) gene containing a polyadenylation
signal isolated from Drosophila melanogaster, was constructed as
described by Bunch et al., Nucl. Acids Res. 16: 1043-61 (1988). A
schematic of the final pRmHa-1 construct is shown in FIG. 2. The
plasmid expression vector, pUC18, having the ATCC accession number
37253, was used as the source vector from which subsequent vectors
described herein were derived. The pUC18 plasmid contains the
following restriction sites from 5' to 3' in the multiple cloning
site, all of which are not illustrated in the schematic
representations of the pUC18-derived vectors in FIG. 1: Eco RI; Sac
I; Kpn I; Sma I and Sma I located at the same position; Bam HI; Xba
I; Sal I, Acc I and Hinc II located at the same position; Pst I;
Sph I and Hind III. The pUC18 vector was first digested with Hind
III to form a linearized pUC18. Blunt ends were then created by
filling in the Hind III ends with DNA polymerase I large fragment
as described by Maniatis et al., Molecular Cloning: A Laboratory
Manual, eds. Cold Spring Harbor Laboratory, New York (1982).
[0144] The resultant linearized blunt-ended pUC18 vector was
ligated with a 740 base pair (bip) Hinf I fragment from the
Drosophila melanogaster ADH gene containing a polyadenylation
signal. The ligated ADH allele was first isolated from the plasmid
pSACI, described by Goldberg et al., PNAS USA 77: 5794-5798 (1980),
by digestion with Hinf I followed by blunt ending with Klenow
resulting in the nucleotide sequence listed in SEQ ID NO 14. The
pSACI vector containing the ADH allele was constructed by
subcloning into pBR322 (ATCC accession number 31344) a 4.7 kilobase
(kb) Eco RI fragment of Drosophila DNA selected from a
bacteriophage lambda library containing random, high molecular
weight (greater than 15 kb). The 5'Hinf I restriction site occurred
naturally in the ADH gene at position 1770 as described by
Kreitman, Nature 304: 412-417 (1983). The 3Hinf I site was derived
from the pUC18 vector into which the ADH gene had been cloned. This
position was four bases 3' to the Xba I site at position 2500 of
the ADH gene. The ADH segment extended from the 35 bp upstream of
the polyadenylation/cleavage sequence in the 3' untranslated
portion of the ADH mRNA to 700 bp downstream of the polyadenylation
signal. The resultant pUC18-derived vector containing the ADH gene
fragment was designated pHA-1 as shown in FIG. 1.
[0145] The 421 bp Eco RI/Stu I MT gene fragment was obtained from a
clone containing DNA of approximately 15.3 kb in a Drosophila
melanogaster genomic DNA library. The library, prepared with a Mbo
I partial digestion of imaginal DNA, was cloned in the lambda
derivative EMBL4. The fragment contained the MT promoter and metal
response consensus elements of the Drosophila MT gene (Maroni et
al., Genetics 112: 493-504 (1986)). This region, containing the
promoter and transcription start site at nucleotide 1+,
corresponded to position -370 to nucleotide position +54 of the MT
gene (SEQ ID NO 13). The resultant fragment was then ligated into
pHA-1 expression vector prepared above that was previously
linearized with Eco RI and Sma I. The 3' blunt end in MT created by
the Stu I digest was compatible with the blunt end in pHA-1 created
by the Sma I digest. The resultant pUC18-derived vector containing
a 5'Drosophila MT gene fragment and a 3' ADH gene fragment was
designated pRmHa-1. The pRmHa-1 expression vector, shown in FIG. 2,
contained the origin of replication (ori) and the beta-lactamase
gene conferring resistance to ampicillin (Amp.sup.r) from pUC18 as
shown in FIG. 1 on the pHa-1 vector. The diagram of pRmHa-1 also
shows the 5' to 3' contiguous positions of the MT gene fragment,
the multiple cloning site and the ADH gene fragment. The pRmHa-1
vector was used as described in c. below in the construction of the
pRmHa-3 expression vector.
[0146] 2. Preparation of pRmHa-2 Expression Vector
[0147] The construction of pRmHa-2 is shown in FIG. 1. For
constructing the pRmHa-2 expression vector, the MT fragment
prepared above was inserted into the pUC18-derived vector pHA-1 as
described for constructing pRmHa-1 above with a few modifications.
An Eco RI linker was added to the Stu I site of the Eco RI/Stu
I-isolated MT gene fragment prepared above to form a
metallothionein fragment having Eco RI restriction sites on both
ends. The resultant fragment was then ligated into the ADH
fragment-containing pUC18 expression vector that was previously
linearized with Eco RI. The resultant pUC18-derived vector
containing a 5' Drosophila MT gene fragment and a 3' ADH gene
fragment having two Eco RI restriction sites 5' to the multiple
cloning site was designated pRmHa-2. The pRmHa-2 expression vector,
shown in FIG. 1, contained the origin of replication (ori) and the
beta-lactamase gene conferring resistance to ampicillin (Amp.sup.r)
from pUC18. The diagram of pRmHa-2 also shows the 5' to 3'
contiguous positions of the MT gene fragment, the multiple cloning
site and the ADH gene fragment. The pRmHa-2 vector was used along
with pRmHa-1 as described in c. below in the construction of the
pRmHa-3 expression vector.
[0148] 3. Preparation of pRmHa-3 Expression Vector
[0149] To prepare the pRmHa-3 expression vector that had only one
Eco RI restriction site, a fragment from pRmHa-2 was ligated into
pRmHa-1. For this construction, pRmHa-2, prepared in b. above, was
first digested with Sph I. The resultant Sph I fragment beginning
in the middle of the MT gene and extending to the Sph I site in the
multiple cloning site was first isolated from the pRmHa-2 vector
and then ligated into pRmHa-1 prepared in A.1. above. The pRmHa-1
vector was previously modified to remove the Eco RI restriction
site 5' to the MT gene fragment then linearized with Sph I. This
process is schematically illustrated in FIG. 2. To remove the Eco
RI site in pRmHa-1, the vector was first digested with Eco RI to
form a linearized vector, then blunt ended with Mung Bean nuclease
and religated.
[0150] The pRmHa-1 vector lacking an Eco RI site was then digested
with Sph I to remove the region corresponding to the Sph I fragment
insert from pRmHa-2 and form a linearized pRmHa-1 vector. The Sph I
fragment from pRmHa-2 was then ligated into the Sph I linearized
pRmHa-1 to form the pRmHa-3 expression vector. A schematic of the
pRmHa-3 vector is shown in FIG. 3. The relative positions of the
various restriction sites from the pUC18 vector from which pRmHa-3
was derived are indicated on the figure. In addition, the relative
positions and lengths of the MT and ADH gene fragments separated by
the multiple cloning site (polylinker) into which the MHC gene of
interest is cloned are indicated on the figure. The pRmHa-3 vector,
being derived from pUC18, contains the pUC18 origin of replication
and beta-lactamase gene conferring ampicillin resistance. Thus, MHC
encoding DNA fragments as prepared in this invention and cloned
into the multiple cloning site of pRmHa-3 were transcriptionally
regulated by the MT promoter and polyadenylated via the ADH
gene.
[0151] B. cDNA Synthesis
[0152] Detailed descriptions of the cDNA of Class I MHC molecules
of various HLA groups can be found in U.S. Pat. No. 5,314,813 to
Peterson et al. which has been incorporated by reference.
[0153] cDNAs encoding any preferred HLA may be cloned via use of
the polymerase chain reaction. The primers disclosed in section
B.1. above (SEQ ID NO 1 through SEQ ID NO 12) may be used to
amplify the appropriate HLA-A, -B, -C, -E, -F, or -G cDNAs in
separate reactions which may then be cloned and sequenced as
described in the methods disclosed for HLA A2.1 above. Preparation
of cDNA from human cells is carried out as described in Ennis, et
al., PNAS USA 87: 2833-2837 (1990). Briefly, a blood sample is
obtained from the individual and cells are collected after
centrifugation and used to prepare total RNA. First strand cDNA is
synthesized by using oligo(dT) and avian myeloblastosis virus
reverse transcriptase. The resulting cDNA is used in a PCR
amplification reaction utilizing the appropriate primer(s) as noted
in section B.1. above, and a GENEAMP.RTM. kit and thermal cycler
(Perkin-Elmer/Cetus). Reaction conditions are preferably as
follows. 110 ng cDNA template and 50 picomoles of each
oligonucleotide primer are used. Thirty cycles are run as follows:
(a) one minute at 94.degree. C.; (b) one minute at 60.degree. C.;
and (c) one minute, 30 seconds at 72.degree. C. The PCR reaction is
then heated to 100.degree. C. for 10 minutes to kill the Taq
polymerase and the ends of the DNA made blunt by T4 polymerase
(Stratagene, San Diego, Calif.).
[0154] To synthesize HLA A2.2, cDNA encoding a complete A2.2 (see
Holmes, et al., J. Immunol. 139: 936-41 (1987), for the published
sequence) is cloned into an M13mp19 plasmid, a commercially
available bacteriophage vector (Stratagene, La Jolla, Calif.). cDNA
is synthesized by PCR using primers derived from the published
sequence of A2. The cDNA is released from an M13mp19 clone as a Not
I (overhang filled with Klenow)/Eco RI fragment. (Klenow fragments
are part of the E. coli DNA polymerase I molecule, produced by the
treatment of E. coli DNA pol I with subtilisin. They are used to
"fill out" 5' or 3' overhangs at the ends of DNA molecules produced
by restriction nucleases.) The Not I/Eco RI fragment is inserted
into pSP64T digested with Bg III (ends filled with Klenow) and Eco
RI. pSP64T is an SP6 cloning vector designed to provide 5' and 3'
flanking regions from an mRNA which is efficiently translated
(.beta.-globin) to any cDNA which contains its own initiation
codon. This translation SP6 vector was constructed by digesting
pSP64-X.beta.m with Bal I and Bst EII, filling in the staggered
ends with T4 DNA polymerase and adding a Bgl II linker by ligation.
Bal I cuts the .beta.-globin cDNA two bases upstream of the ATG
(start codon) and Bst EII cuts eight bases upstream of the TAA
(stop codon). There is only one Bgl II site in pSP64T so that
restriction enzymes cutting in the polylinker fragment, from Pst I
to Eco RI can still be used to linearize the plasmid for
transcription. (See Kreig and Melton, Nucleic Acid Res. 12:
7057-7070, (1984), which also describes the construction of the
plasmid pSP64-X.beta.m.) The resulting plasmid is cleaved with Eco
RI (end filled with Klenow) and Hind III which is cloned into the
pCMUII polylinker between Hind III (5') and Stu I (3'). (See Paabo,
et al., EMBO J. 5: 1921-1927 (1986).) The entire cDNA is removed as
a Hind III (end filled with Klenow) Bam HI fragment which is cloned
into pRmHa-3 cleaved with Sma I and Bam HI.
[0155] HLA A2.2 soluble form was prepared by engineering a stop
codon into the above-described A2.2 cDNA immediately preceding the
transmembrane domain. The modification is achieved by cleaving the
A2.2 cDNA cloned in the eukaryotic expression vector pCMUII between
Hind III 5' and Stu I 3' (see above) with Mbo II and Bam HI
inserting the following oligonucleotides:
3 5' primer: 5'GGAGCCGTGACTGACTGAG 3' (SEQ ID NO 17) 3' primer:
5'CCCTCGGCACTGACTGACTCCTAG 3' (SEQ ID NO 18)
[0156] The resulting recombinant plasmid is cleaved with Hind III,
the overhanging end filled with Klenow, then cut with Bam HI
releasing a restriction fragment which is cloned into pRmHa-3 in
the same way as A2.2 full length.
[0157] 1. Construction of Murine ICAM-1 Expression Vector
[0158] Spleen cells were isolated from Balb/c mice. The spleen
cells were stimulated with conA; mRNA was isolated using the FAST
TRACK.RTM. kit (Invitrogen, San Diego, Calif.) according to the
manufacturers' instructions. cDNA was synthesized from the mRNA
using AMV reverse transcriptase kit (Promega, Madison, Wis.)
according to the manufacturers' instructions. Based on the
published cDNA nucleotide sequence (Siu, G. et al., J. Immunol.
143, 3813-3820 (1989) the following oligonucleotides were
synthesized as PCR primers:
4 5': TTTAGAATTCAC CATGGCTTCA (SEQ ID NO 46) ACCCGTGCCA AG 3':
TTTAGTCGACTC AGGGAGGTGG (SEQ ID NO 47) GGCTTGTCC
[0159] The cDNA synthesized was subjected to PCR using these
primers. The product was cleaved with the restriction enzymes Eco
RI and Sal I and ligated into pRmHa-3, which had been digested with
the restriction enzymes Eco RI and Sal I.
[0160] 2. Construction of Murine B7.1 Expression Vector
[0161] Spleen calls were isolated from Balb/c mice and stimulated
with conA. Messenger RNA was isolated using the FAST TRACK.RTM. kit
(Invitrogen, San Diego, Calif.) according to the manufacturer's
instructions. cDNA was synthesized from the mRNA using AMV reverse
transcriptase kit (Promega, Madison, Wis.) according to the
manufacturer's instructions.
[0162] Based on the published cDNA nucleotide sequence (Freeman, et
al., J. Exp. Med. 174: 625-631 (1991)) the following
oligonucleotides were synthesized as PCR primers:
5 5': TTTAGAATTCAC CATGGCTTGC (SEQ ID NO 48) AATTGTCAGT TG 3':
TTTAGTCGACCT AAAGGAAGAC (SEQ ID NO 49) GGTCTGTTC
[0163] The cDNA synthesized was subjected to PCR using these
primers. The product was cleaved with the restriction enzymes Eco
RI and Sal I and ligated into pRmHa-3, which had been digested with
the restriction enzymes Eco RI and Sal I.
[0164] 3. Construction of Murine B7.2 Expression Vector
[0165] IC-21 cells (obtained from ATCC) were propagated in RPMI
1640 medium containing 10% Fetal Calf Serum. mRNA was isolated from
these cells using the FAST TRACK.RTM. kit (Invitrogen, San Diego,
Calif.) according to the manufacturer's instructions. cDNA was
synthesized from the mRNA using AMV reverse transcriptase kit
(Promega, Madison, Wis.) according to the manufacturer's
instructions. Based on the published cDNA nucleotide sequence
(Freeman, et al., J. Exp. Med. 178: 2185-2192 (1993)) the following
oligonucleotides were synthesized as PCR primers:
6 5': TTTAGAATTCAC CATGGACCCC (SEQ ID NO 50) AGATGCACCA TGGG 3':
TTTAGTCGACTC ACTCTGCATT (SEQ ID NO 51) TGGTTTTGCT GA
[0166] The cDNA synthesized was subjected to PCR using these
primers. The product was cleaved with the restriction enzymes Eco
RI and Sal I and ligated into pRmHa-3, which had been digested with
the restriction enzymes Eco RI and Sal I.
[0167] The above expression constructs were transfected into
Drosophila S2 cells using the calcium phosphate method as listed in
Table 1. Stable cell lines were selected by including 500 .mu.g/ml
Geneticin in the cell culture medium.
7TABLE 1 Trans- MHC I B7.1 ICAM-1 fected (L.sup.d) .beta.2 (CD 80)
B7.2 (CD54) phsneo Cells .mu.g .mu.g .mu.g .mu.g .mu.g .mu.g 1 A 12
12 1 2 B 8 8 8 1 3 C 8 8 8 1 4 C 8 8 8 1 5 D 6 6 6 6 1 6 E 6 6 6 6
1 7 F 6 6 6 6 1 8 G 4.8 4.8 4.8 4.8 4.8 1
[0168] Human accessory and costimulatory molecules were cloned from
human cell lines demonstrated to express these proteins by FACS
analysis with monoclonal antibodies specific for the particular
proteins. Adhesion molecules belonging to the integrin family,
ICAM-I (CD54) and LFA-3 (CD58), were cloned from human cell lines
K562 and HL60, respectively. The K562 cells, originated from human
chronic myelogenous leukemia, were obtained from ATCC (CCL-243) and
cultured under conditions recommended (i.e., RPMI with 10% fetal
calf serum at 37 degrees C. with 5% CO.sub.2). HL60 cells,
originated from a human promyelocytic leukemia, and were obtained
from ATCC (CCL-240) and were cultured according to ATCC's
recommendations. Costimulatory molecules B7.1 and B7.2 were also
cloned from K562 and HL60 cells respectively.
[0169] 4. cDNA
[0170] Messenger RNA samples were prepared from each cell line from
RNA isolated by the modified guanidinium thiocyanate method
(Chromczynski, et al. Anal. Biochem. 162: 156-159, 1987) followed
by poly A+ RNA selection on oligo(dt)-cellulose columns (Sambrook,
J., et al, Molecular Cloning: A Laboratory Manual, Second Edition,
6.22-6.34, Cold Spring Harbor laboratory, CSH, NY), Induction of
HL60 cells with vitamin D3 (usually required to express some cell
surface molecules) was not required to obtain the B7.2 and LFA-3
molecules, the proteins were expressed in the absence of induction.
cDNA was prepared using AMV reverse transcriptase kit according to
the manufacturers' instructions (Promega, Madison Wis.).
[0171] 5. PCR Primers
[0172] PCR primers were designed and synthesized after obtaining
copies of the known sequences from the GENEWORKS database
(Intelligenetics) and considering the ends needed to clone into the
appropriate vectors. They are as follows with the top sequence of
each protein the 5'primer and the bottom one the 3'primer:
8 B7.1 5'-ACCCTTGAAT CCATGGGCCA CACACGGAGG CAG-3' (SEQ ID NO 52)
5'-ATTACCGGAT CCTTATACAG GGCGTACACT TTCCCTTCT-3' (SEQ ID NO 53)
B7.2 5'-ACCCTTGAGC TCATGGATCC CCAGTGCACT ATG-3' (SEQ ID NO 54)
5'-ATTACCCCCG GGTTAAAAAC ATGTATCACT TTTGTCGCAT GA-3' (SEQ ID NO 55)
LFA-3 5'-ACCCTTGAGC TCATGGTTGC TGGGAGCGAC GCGGGG-3' (SEQ ID NO 56)
5'-ATTACCGGAT CCTTAAAGAA CATTCATATA CAGCACAATA CA-3' (SEQ ID NO 57)
ICAM-1 5'-ACCCTTGAAT TCATGGCTCC CAGCAGCCCC CGGCCC-3' (SEQ ID NO 58)
5'-ATTACCGGAT CCTCAGGGAG GCGTGGCTTG TGTGTTCGG-3' (SEQ ID NO 59)
[0173] 6. Expression of DNA Fragment
[0174] The cDNA preparations from each of the cell lines was used
to clone the desired proteins. The polymerase chain reaction was
used to generate cDNA fragments utilizing the appropriate PCR
primer (see above). The appropriate DNA fragments were cloned into
the Drosophila fly vector pRMHA-3. Plasmid preparations have been
prepared from all of the preparations and are now ready for
transfection into the fly cells.
[0175] Human .beta.-2 microglobulin cDNA is prepared using a
published partial cDNA sequence (see Suggs, et al., PNAS 78:
6613-17, 1981) is used as a template for a polymerase chain
reaction (PCR) with the following primers:
9 5' primer 5'GCTTGGATCCAGATCTACCATGTCTCGCTCCGTG (SEQ ID NO 15)
GCCTTAGCTGTGCTCGCGCTACTCTC 3' 3' primer
5'GGATCCGGATGGTTACATGTCGCGATCCCACTTA (SEQ ID NO 16) AC 3'
[0176] The primers are used in a standard PCR reaction (see
Nilsson, et al., Cell 58: 707 (1989)). The reaction products are
extracted with phenol, purified using a GENECLEAN.RTM. kit (Bio
101, San Diego, Calif.), digested with Bam HI and cloned into the
Bam HI site of pBS (Stratagene, La Jolla, Calif.). After
verification of the sequence, this Bam HI fragment is cloned into
the Bam HI site of pRmHa-3.
[0177] As noted in the Examples, murine Class I cDNA was utilized
in various instances. Murine Class I cDNA was prepared as
follows.
[0178] H-2K.sup.b: cDNA encoding a complete K.sup.b molecule is
obtained from an expression plasmid pCMU/K.sup.b constructed as
follows. A partial H-2K.sup.b cDNA missing the leader sequence and
most of the alpha I domain is prepared according to the method of
Reyes, et al., PNAS 79: 3270-74 (1982), producing pH202. This cDNA
is used to generate a full-length molecule. The missing sequence is
provided using a genomic clone encoding H-2K.sup.b (Caligan, et
al., Nature 291: 35-39, 1981) as a template in a PCR reaction,
using a 5' primer flanked by a Not I site, followed by 21
nucleotides encoding the last seven amino acids of the leader
sequence and 18 nucleotides complementary to the beginning of the
alpha I domain and a 3' primer complementary to the region
encompassing the Sty I site. The resulting fragment is ligated with
pH202 at the Sty I site. The 5' sequence encoding the remainder of
the signal sequence is obtained form the D.sub.b cDNA (see below)
as a Bam HI/Not I fragment. The entire coding sequence is cleaved
from the expression plasmid as a Bam HI fragment and cloned into
pRmHa-3 cleaved with Bam HI.
[0179] H-2L.sup.d: cDNA encoding a complete L.sup.d molecule is
obtained from an expression plasmid pCMUIV/L.sup.d (see Joly and
Oldstone, Gene 97: 213, 1991). The complete cDNA is cleaved from a
eukaryotic expression vector pCMUI/L.sup.d as a Bam HI fragment and
cloned into pRmHa-3 as K.sup.b.
[0180] As noted previously, the pCMU vector (pCMUIV) is derived
from eukaryotic expression vector pC81G as described in Nilsson, et
al., supra. Vector pC81G, in turn, is derived from pA81G (Paabo, et
al., Cell 33: 445-453 (1983)) according to the method disclosed in
Paabo, et al., EMBO J. 5: 1921-7 (1986).
[0181] H-2D.sup.b: cDNA encoding a complete D.sup.b molecule is
obtained from expression plasmid pCMUIV/D.sup.b (see Joly and
Oldstone, Science 253: 1283-85, 1991). The complete cDNA is cleaved
from a eukaryotic expression vector pCMUIV/D.sup.b as a Bam HI
fragment and cloned into pRmHa-3 as K.sup.b.
[0182] Murine .beta.-2 microglobulin: full-length murine .beta.-2
microglobulin cDNA is obtained as a Hind III (5) (filled with
KLENOW fragment (large fragment of DNA polymerase I))/Bgl II (3)
fragment from pSV2neo (ATCC No. 37149) mouse .beta.-2 microglobulin
cDNA and cloned into pRmHa-3 cleaved with Sma I and Bam HI.
[0183] Vector phshsneo confers neomycin (G418) resistance and is a
derivative of phsneo (pUChsneo) with an additional heat-shock
promoter (hs) sequence, which may be synthesized from
commercially-available pUC8 as described in Steller, et al., EMBO
J. 4: 167 (1985). The heat shock promoter contained in these
vectors is the hsp70 promoter. Other useful vectors conferring
neomycin resistance (G418 resistance) include cosmid vector smart2
(ATCC 37588), which is expressed under the control of Drosophila
hsp70 promoter, and plasmid vector pcopneo (ATCC 37409).
[0184] C. Insertion of Genes into Expression Vectors
[0185] The restriction products are subjected to electrophoresis on
a 1% agarose gel (Maniatis, et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory (1982)). The restriction
fragments encoding the cDNAs are excised from the gel and purified
away from the agarose using GENECLEAN.RTM. kit according to
manufacturers' directions (Bio 101, San Diego, Calif.). The
expression plasmid pRmHa-3 (FIG. 3) is cleaved with the appropriate
restriction enzymes in ONE PHOR ALL.RTM. buffer according to the
manufacturer's directions (Pharmacia, Piscataway, N.J.) and treated
with alkaline phosphatase as described in the manufacturer's
literature (Boehringer Mannheim, Indianapolis, Ind.). One hundred
ng of cleaved and phosphatased pRmHa-3 vector is mixed with 300 ng
of agarose gel purified Class I MHC heavy chain cDNA or .beta.-2
microglobulin cDNA and ligated using T4 DNA ligase and ONE PHOR
ALL.RTM. buffer as described in the manufacturers' literature.
After incubation at 16.degree. C. for five hours, the ligation
mixture is used to transform competent E. coli JM83 (Maniatis, et
al., supra (1982)).
[0186] Methods disclosed in Maniatis, et al., supra are used to
prepare the cDNA needed. The presence of the MHC heavy chain cDNA
and its orientation in the vector is determined by restriction
mapping. Bacteria containing the vector with the cDNA in the
correct orientation relative to the metallothionein promoter are
used for large scale preparation of DNA using the alkaline lysis
method and cesium chloride gradient purification. The amount of DNA
obtained is determined spectrophotometrically.
[0187] D. Transfection and Labeling of S2 Cells
[0188] S2 cells are grown in Schneider medium (Gibco/BRL, Grand
Island, N.Y.) supplemented with 10% fetal calf serum (heat treated
for one hour at 55.degree. C.), 100 units/ml penicillin, 100 mg/ml
streptomycin, and 1 mM glutamine. (For convenience, this
supplemented medium is hereinafter referred to as Schneider
medium.) Cells are grown at 27.degree. C. and typically passaged
every seven days by diluting 1:17 in fresh medium. Cells are
converted to growth in serum free media (Excell 400 or 4101
supplemented with 100 units/ml penicillin, 100 mg/ml streptomycin,
1 mM glutamine, and 500 .mu.g/ml G418 (JRH Biosciences, Lenexa,
Kans.) by initial dilution at 50% Schneider/50% Excell 401. One
week later, cells may be passaged into 10% Schneider medium/90%
Excell 401 and one week later into 100% Excell 401. Cells are
maintained in this medium and passaged every seven days by diluting
2:17 in fresh medium.
[0189] 15.times.10.sup.6 S2 cells at a concentration of 10.sup.6
cells per ml are plated out in 85 mm petri dishes. Twelve hours
later, calcium phosphate/DNA precipitates, prepared as described
below (1 ml) are added dropwise to the cells. After 48 hours, the
supernatant is carefully removed and the cells transferred to a 175
cm.sup.2 flask in a total volume of 50 ml in Schneider medium
containing 500 .mu.g/ml Geneticin (G418) (Gibco/BRL, Grand Island,
N.Y.). After 21 days, 20 ml of the culture is removed to a fresh
flask containing 30 ml of Schneider medium containing 500 .mu.g/ml
G418. Ten days later, a stable population of cells that weakly
adhered to the flask and grew with a doubling time of approximately
24 hours is obtained and these cells are subsequently cultured and
passaged in the selection media as described above. Frozen aliquots
of these cells are prepared by collecting 5-20.times.10.sup.6 cells
by centrifugation and resuspending them in 1 ml of cell freezing
media (93% fetal calf serum/7% dimethylsulfoxide). Aliquots are
then placed at -70.degree. C. for one week and subsequently
transferred to liquid nitrogen storage.
[0190] Calcium phosphate precipitates are prepared as described by
Paabo, et al. (EMBO J. 5: 1921-27 (1986)), except that 25 .mu.g of
DNA is used per transfection. The following combinations of DNA are
used to prepare the indicated transfectant:
[0191] (a) MHC Class I heavy chain alone: 23 .mu.g heavy chain
expression vector DNA+2 .mu.g of phshsneo DNA.
[0192] (b) MHC Class I heavy chain+.beta.-2 microglobulin: 11.5
.mu.g heavy chain expression vector DNA+11.5 .mu.g of .beta.-2
microglobulin (human or mouse) expression vector DNA+2 .mu.g of
phshsneo DNA.
[0193] Other combinations of mouse genes are presented in Table
1.
[0194] Twenty-four hours prior to metabolic labeling, cells are
plated out at a cell density of 35.times.10.sup.6 cells/ml (10
ml/85 mm petri dish) in Schneider medium containing 1 mM
CuSO.sub.4. Thirty minutes prior to labelling the medium is
aspirated from the dishes and the cells are washed with 2.times.10
ml of PBS and then incubated in Graces insect medium minus
methionine and cysteine (special order from Gibco/BRL, Grand
Island, N.Y.) for 20 minutes, and then in 1 ml of this medium
containing 0.1 mCi .sup.35S Trans label (New England Nuclear;
duPont, Boston, Mass.). After the labelling period, the labelling
solution is aspirated and the cells are either lysed immediately on
ice, with ice cold PBS/1% Triton X100 (1 ml) or after a chase
period in the presence of methionine containing Schneider or Excell
400 medium (5 ml) (JRH Biosciences). The chase medium is collected
if soluble Class I MHC molecules are being analyzed.
[0195] The following operations are all carried out with the
lysates kept cold (less than 8.degree. C.). The lysates were
collected into Eppendorf tubes, centrifuged in a microfuge tube for
15 minutes at 13,000.times.g, transferred to a fresh tube
containing 100 .mu.l of a 10% slurry of protein A sepharose and
placed on an end-over-end rotator for two hours. Following a
further centrifugation in the microfuge for 15 minutes, the cell
lysates are ready for analysis.
[0196] In experiments utilizing murine MHC, S2 cells were
transfected with the murine MHC recombinants described above using
the CaPO.sub.4 precipitation method; each heavy chain is
transfected either alone or as a 50:50 mix with the vector encoding
.beta.-2 microglobulin. A plasmid encoding neomycin resistance,
phshsneo DNA, is included in each transfection such that a
population of cells that stably expressed MHC Class I could be
obtained by growing the transfectants in selection medium
(Geneticin G418-sulphate, Gibco/BRL, Grand Island, N.Y.).
[0197] E. Peptide Generation
[0198] Antigenic peptides according to the present invention may be
obtained from naturally-occurring sources or may be synthesized
using known methods. In various examples disclosed herein, peptides
are synthesized on an Applied Biosystems synthesizer, ABI 431A
(Foster City, Calif.) and subsequently purified by HPLC. Isolation
or synthesis of "random" peptides may also be appropriate,
particularly when one is attempting to ascertain a particular
epitope in order to load an empty NMC molecule with a peptide most
likely to stimulate precursor CD8 cells. One may produce a mixture
of "random" peptides via use of proteasomes (see, e.g., Example
2.B.6) or by subjecting a protein or polypeptide to a degradative
process--e.g., digestion with chymotrypsin--or peptides may be
synthesized. While we have observed that the cell lines of the
present invention are able to degrade proteins and polypeptides
into smaller peptides capable of being loaded onto human Class I
MHC molecules, it is preferable to introduce smaller
peptides--e.g., 8-mers and 9-mers--directly into the cell culture
to facilitate a more rapid loading and expression process.
[0199] If, one is synthesizing peptides, e.g., random 8-, 9- and
18-amino acid peptides, all varieties of amino acids are preferably
incorporated during each cycle of the synthesis. It should be
noted, however, that various parameters--e.g., solvent
incompatibility of certain amino acids--may result in a mixture
which contains peptides lacking certain amino acids. The process
should thus be adjusted as needed--i.e., by altering solvents and
reaction conditions--to produce the greatest variety of
peptides.
[0200] As noted hereinabove, murine heavy chains complexed with
human .beta.-2 microglobulin were stable at temperatures
approximately 6-8 degrees higher than if complexed with murine
.beta.2. It was also observed that the stabilities imparted by
peptide and xenogeneic .beta.-2 microglobulin are additive. A large
increase in the thermostability of the Class I molecules occurs if
8-9 mers are used, as compared to 12-25 mers; indeed, the
difference between the stabilization imparted by the 8-9 mers
compared with the larger peptides might be even greater than what
was observed previously, for even though the peptides have been
purified by HPLC, it is likely that there is some contamination of
the larger peptides by 8-9 mers.
[0201] It is now shown that the thermostability of a Class I
molecule is apparently dependent on: (1) the origin of .beta.-2
microglobulin; (2) the presence of peptide; and (3) the length and
sequence of this peptide.
[0202] Previous work (U.S. Pat. No. 5,314,813 to Peterson et al.;
Jackson et al., PNAS USA-89: 12117-12121 (1992)) has shown that
Class I MHC heavy chains can bind peptide either alone or when they
are associated with .beta.-2 microglobulin. Surface expression of
peptide-loaded human Class I MHC, however, appears to be best
facilitated by loading the molecules with peptide after the heavy
chains have complexed with .beta.-2 microglobulin.
[0203] 1. Expression of Human MHC
[0204] Once we determined that the thermostability of a Class I
molecules is dependent on the origin of .beta.-2 microglobulin, the
presence of peptide, and the length and sequence of this peptide,
we utilized this information in the creation of cell lines capable
of specifically activating CD8 cells via the expression of
peptide-loaded human Class I MHC molecules.
[0205] Thermolability appears to be an inherent property of Class I
molecules; it has presumably evolved to ensure that Class I
molecules which contain either no peptide or a peptide of poor
binding properties (that confers little thermostability)
self-destruct. In this way, the cell minimizes the number of empty
Class I molecules on its surface, for such a situation would
presumably be dangerous in that exogenously derived peptides could
be bound and presented. Human Class I molecules expressed in insect
cells with human .beta.2 are not stable to extended incubation at
37.degree. C.; neither are human Class I molecules expressed in the
mutant cell line T2 which has been shown to be deficient in peptide
loading onto the Class I molecules (Hosken and Bevan, Science 248:
367-70 (1990); Cerundolo, et al., Nature 345: 449-452 (1990)).
Thus, it seems that the affinity between the heavy chain and
.beta.-2 microglobulin has been carefully conserved through
co-evolution of the molecules such that empty Class I molecules, or
those carrying poorly-binding peptides, self-destruct at the body
temperature of the "host" organism.
[0206] Human Class I MHC molecules were expressed in S2 cells. Cell
lines co-expressing human .beta.-2 microglobulin and HLA A2.2Y, HLA
A2.1, HLA B7, or HLA B27 were established using
previously-described methods. Briefly, cDNAs encoding the above
proteins were cloned into the Drosophila expression vector pRmHa-3
and cotransfected with a human .beta.-2 microglobulin-containing
plasmid and phshsneo plasmid into S2 cells via methods disclosed
herein. Three to four weeks later, the population of
G418-resistanT-cells was diluted 1:5 with fresh selection media.
Once a healthy growing population of cells was obtained, CuSO.sub.4
was added to an aliquot of cells and 24 hours later, cells were
analyzed via flow cytometry using a monoclonal antibody W6/32 (ATCC
HB95, Bethesda, Md.) which recognizes a monomorphic determinant of
human Class I heavy chains when they are in association with
.beta.-2 microglobulin. (See Barnstable, et al., Cell 14: 9
(1978).) High levels of surface expression of each of the human
Class I molecules were induced by the addition of CuSO.sub.4 (data
not shown). These stable populations were sorted for high
expressing cells using cytofluorimetry as described below. It is
these sorted populations of cells which were used for all
subsequent experiments.
[0207] Twenty-four hours prior to FACS analysis, CuSO.sub.4 is
added to the stably transfected S2 cells (3-4.times.10.sup.6
cells/ml) to a final concentration of 1 mM, thereby "switching on"
expression from the transfected genes. Cells are plated out in
24-well cluster dishes (2 ml per well). Eight hours prior to FACS
analysis, the CuSO.sub.4 medium is replaced with fresh medium (1
ml) with or without peptide at a concentration of 50 .mu.g/ml.
37.degree. C. temperature challenges are carried out by
transferring the dishes onto a flat surface in a 37.degree. C. room
at various time intervals prior to harvesting the cells for
analysis.
[0208] To analyze surface expression of Class I MHC on the S2
cells, aliquots of cells, (5.times.10.sup.5) are transferred into
tubes on ice, collected by centrifugation (1,000.times.g for 4
minutes), resuspended in 3 ml of PBS/1% BSA, 0.02% sodium azide,
collected by centrifugation and resuspended in PBS/BSA (0.5 ml)
containing the appropriate primary antibody (ascites fluids Y3,
28:14:8S, 30.5.7, W6/32, diluted 1:200). Rabbit antisera are
diluted 1:500 and B22.293 hybridoma supernatant is used directly.
After a one hour incubation on ice, cells are washed twice in 3 ml
of PBS/BSA and resuspended in 0.5 ml of PBS/BSA containing FITC
labelled secondary antibody (Cappell, Durham, N.C.) and 1 ng/ml
propidium iodide. After a 30 minute incubation on ice, cells are
washed once with PBS/BSA and resuspended in this buffer at a
concentration of 1.times.10.sup.6/ml. Samples are then analyzed by
FACS 440 (Becton Dickinson). Dead cells stained with propidium
iodide, are excluded by including a live gate in the analysis.
[0209] For cell sorting, the same procedure outlined above is used,
except that all staining operations are carried out in a sterile
hood. Solutions, including antibodies, are filter-sterilized, and
Schneider media or Excell 400 is used in place of PBS/BSA. Cells
that specifically bound the primary antibody are sorted using a
Becton Dickinson cell sorter. Sorted cells (2-8.times.10.sup.5) are
washed once in medium before plating out at a concentration of
2.times.10.sup.5 cells/ml.
[0210] F. Loading of Membrane-Bound Empty MHC Molecules by in vitro
Incubation with Peptides
[0211] In order to demonstrate that the human Class I molecules
expressed on the surface of the Drosophila cells were empty, the
cells were incubated at 37.degree. C. for two hours and the cell
surface expression was analyzed by cytofluorimetry. The surface
expression of both HLA B27 and A2.1 is greatly reduced if cells are
incubated at 37.degree. C. for 2 hours; however, preincubating the
cells in HIV peptides known to bind to the Class I molecules
affords significant thermal stability to the Class I, while
peptides that do not bind have little effect (see FIG. 4). (A
9-amino acid peptide ILKEPVHGV (SEQ ID NO 42) from the POL protein
of HIV binds and stabilizes HLA A2.1. A nine-amino-acid peptide
from the Vpr protein of HIV binds and stabilizes B27 (FRIGCRHSR;
SEQ ID NO 41). These data show that the human Class I molecules
expressed on the surface of Drosophila cells are empty and can be
stabilized by binding specific HIV peptides.
[0212] FIGS. 4 and 5 show peptide-induced thermostabilization of
HLA B27 and HLA A2.1 expressed on the surface of Drosophila cells
by HIV peptides. Drosophila cells expressing either HLA B27 or A2.1
were incubated with peptides where indicated and then either
maintained at 28.degree. C. or incubated at 37.degree. C. for two
hours prior to analysis of the surface expression of the Class I
molecules by use of the antibody W6/32 (from ATCC HB95) and
cytofluorimetry. The mean fluorescence of each cell population is
shown plotted against the incubation conditions The HIV POL peptide
(ILKEPVHGV, SEQ ID NO 42) stabilizes A2.1 but not B27 (FIG. 4),
while the HIV Vpr peptide (FRIGCRHSR, SEQ ID NO 41) stabilizes B27,
but not A2.1 (FIG. 5).
Example 2
Preparation of Synthetic Antigen-Presenting Cells
[0213] A. Osmotic Loading
[0214] Osmotic loading of SC2 and 3T3 cells with ovalbumin protein
was carried out as described by Moore, et al., Cell 54: 777-785
(1988). The assay procedure is as follows. In a 96-well dish,
1.times.10.sup.5 Drosophila cells (with or without peptide/protein
loaded) or 3T3 cells were cocultured with 1.times.10.sup.5 B3/CD8
T-cell hybridoma cells in 200 .mu.l of RPMI media supplemented with
10% fetal bovine serum. After 24 hours of incubation, 100 .mu.l of
the supernatant from these cultures was added to 100 .mu.l of RPMI
containing 5,000 CTLL cells. The cells were cocultured for 24 hours
at 37.degree. C. when 1 .mu.Ci of .sup.3H thymidine (Amersham) was
added. After a further incubation of 15 hours at 37.degree. C., the
incorporation of radiolabel into the CTLL cells was determined by
scintillation counting.
[0215] Assays conducted with murine MHC also verified that the
insect cells are capable of loading peptide onto the Class I
molecules. Cells expressing as few as 200-500 MHC molecules
containing a particular antigen can be detected by a T-cell. As the
Drosophila cells do not accumulate chromium, an antigen
presentation assay based on B3/CD8, a T-cell hybridoma, was used.
B3/CD8 is a hybridoma between B3, cytotoxic T-cell specific for
ovalbumin peptide 253-276 presented by H-2K.sup.b Class I
molecules, and CD8- bearing IL-2-secreting cell line (see Carbone,
et al., supra, 1989). Ulpon antigenic stimulation, B3/CD8 produces
IL-2, measured by 3H thymidine incorporation in IL-2-dependenT-cell
line CTLL (Gillis, et al., J. Immunol. 120: 2027 91978)). Thus, by
measuring the amount of IL-2 produced, one can assay for T-cell
recognition.
[0216] In order to provide an intracellular pool of ovalbumin
protein from which OVA peptides can be derived, ovalbumin (Sigma
Chem. Co., Mo.) was osmotically loaded into the cells as described
by Moore, et al, supra (1988). Immediately after loading, the cells
were mixed with the T-cell hybridoma. After two days' incubation,
the medium was removed and assayed for IL-2. The amount of IL-2 was
determined by the ability of the medium to support the growth of
the IL-2-dependenT-cell line CTLL (Gillis, et al., supra, 1978),
and growth was quantitated by the amount of radioactive thymidine
incorporated into the cells.
[0217] S2 or 3T3 cells transfected with K.sup.b/.beta.2 were
incubated with ovalbumin protein (OvPro) or ovalburnin peptide, OVA
24 (OvPep) in isotonic (Iso) or hypertonic (Hyp) media. (Murine
cell line BALB/3T3 is available from the ATCC under accession
number CCL 163.) After treatment, cells were cocultured with the T
cell hybridoma B3/CD8. B3/CD8 is a T cell hybridoma between B3
(Carbone, et al., J. Exp. Med. 169: 603-12 (1989)), cytotoxic T
cell specific for ovalbumin peptide 253-276 presented by H-2K.sup.b
Class I molecules, and CD8- bearing IL-2-secreting cell line. Upon
antigenic stimulation, B3/CD8 produces IL-2, measured by .sup.3H
thymidine incorporation in IL-2-dependent cell line CTLL (Gillis,
et al., J. Immunol. 120: 2027 91978)). Thus, by measuring the
amount of IL-2 produced, one can assay for T cell recognition. The
supernatant from the cocultures were analyzed for IL-2 by .sup.3H
thymidine incorporation by the IL-2-dependent cell line CTLL (ATCC
No. TIB 214). The amount of .sup.3H thymidine incorporated is
plotted against the initial cell treatments. ]It can be seen in
FIG. 6 that the T-cells responded well to the Drosophila cells if
the ovalbumin peptide was added to the culture medium, but no
recognition occurred if the cells were loaded with the ovalburnin
protein. The MHC Class I molecules expressed on the cell surface of
the insect cell are fully functional in that they can bind peptide
if it is added to the culture medium and can present it in the
correct context for it to be recognized by a T-cell.
[0218] B. Optimization of In Vitro Conditions
[0219] For the optimization of in vitro conditions for the
generation of specific cytotoxic T-cells, the culture of Drosophila
cell stimulator cells is preferably maintained in serum-free medium
(e.g. Excell 400). Drosophila cell stimulator cells are preferably
incubated with >20 .mu.g/ml peptide. The effector:stimulator
ratio (lymphocyte:Drosophila cell ratio) is preferably in the range
of about 30:1 to 300:1. The maximum specific CD8 is generally
observed after five days of culture. The culture of target cells
for killing assay is preferably maintained in a serum-free
medium.
Example 3
Stimulation of Proliferation and Differentiation of Armed Effector
T-Cells
[0220] We have found that Drosophila S2 cells transfected with MHC
class I molecules and specific assisting molecules are able to
stimulate primary responses from T-cells in vitro. We present data
below in this example from a mouse model system. In this example,
constructs coding for mouse MHC class I (L.sup.d) molecules,
.beta.2 microglobulin, specific assisting molecules and CD8 cells
from lymph nodes of T-cell receptor transgenic mice.
[0221] The data in FIG. 7 provides evidence that the transfected
Drosophila S2 cells express the protein products of the transfected
murine genes. Flow cytometry using a fluorescence-activated cell
sorter (FACS) and fluorescently labelled antibodies were used to
demonstrate the expression of class I (L.sup.d) and the specific
assisting molecules B7.1 (CD80) and ICAM-1 (CD54) molecules by
transfected Drosophila S2 cells. Transfected cells were separated
with a FACS to obtain cells expressing L.sup.d molecules and were
then maintained in vitro.
[0222] The transfection of Drosophila S2 cells is summarized in
Table 2. The data show L.sup.d, B7.1 and ICAM-1 expression measured
by flow cytometry on the cell lines after induction with CuSO.sub.4
It is apparent that, relative to the control antibody (ctr Ab), all
of the transfectants express L.sup.d molecules on the cell surface.
Likewise, cells cotransfected with L.sup.d and B7.1 (L.sup.d.B7)
express B7.1 but not ICAM-1, whereas cells cctransfected with
L.sup.d and ICAM-1 (L.sup.d.ICAM) express ICAM-1 but not B7.1;
triple transfection with L.sup.d, B7.1 and ICAM-1 (L.sup.d.B7.ICAM)
led to expression of all three molecules.
[0223] Using a standard tissue culture system (Cai, Z. and Sprent,
J. (1994) J. Exp. Med. 179: 2005-2015), doses of 5.times.10.sup.4
purified CD8+ 2C lymph node (LN) cells were cultured at 37.degree.
C. with doses of 3.times.10.sup.5 transfected fly cells.+-.peptides
(10 .mu.M final concentration). Peptides were synthesized by R. W.
Johnson Pharmaceutical Research Institute (Sykulev, et al.(1994)
Immunity 1: 15-22. Proliferative responses were measured by adding
.sup.3HTdR (1 .mu.Ci/well) 8 hours prior to harvest. IL-2
production was measured by removing supernatants from the cultures
at 48 hours and adding 50 .mu.l supernatant to an IL-2 responsive
indicator cell line (CTLL); proliferation of the indicator line was
measured by addition of .sup.3HTdR. The data shown in Table 2 are
the means of triplicate cultures. The transfected Drosophila S2
cells die rapidly at 37.degree. C. and fail to incorporate
.sup.3HTdR at this temperature.
[0224] The data in Table 2 demonstrate that the transfectants are
able to stimulate primary responses of mouse T-cells.
[0225] Table 2. Capacity of transfected fly cells to stimulate
primary proliferative responses and IL-2 production by CD8.sup.+
lymph node cells from 2C T-cell receptor transgenic mice.
10TABLE 2 .sup.3HTdR incorporation (cpm .times. 10.sup.3) with
transfected fly cells expressing: L.sup.d + B7.1 L.sup.d + combined
Peptides L.sup.d + L.sup.d + B7.1 + with Assay added L.sup.d B7.1
ICAM-1 ICAM-1 L.sup.d ICAM-1 Proliferation -- 0.2 0.1 0.3 0.2 --
(Day 3) p2Ca 0.2 0.3 1.5 142.0 1.5 QL9 0.2 60.9 73.9 263.7 132.9
IL-2 -- 0.3 0.2 0.1 1.2 -- Production p2Ca 0.2 0.2 0.1 64.6 0.3
(Day 2) QL9 0.1 0.4 0.2 158.6 0.5
[0226] The 2C T-cell receptor (TCR) is strongly reactive to L.sup.d
molecules complexed with certain peptides, e.g. p2Ca or QL9. These
two peptides have moderate to high affinity for soluble L.sup.d
molecules, 4.times.10.sup.6 M.sup.-1 for p2Ca, and 4.times.10.sup.9
M.sup.-1 for QL9 (Sykulev. et al.). When complexed to soluble
L.sup.d molecules, the two peptides also have high binding affinity
for soluble 2C TCR molecules. However, in both TCR binding and
L.sup.d binding, the QL9 peptide clearly has a higher affinity than
the p2Ca peptide.
[0227] Table 2 shows that proliferative responses and IL-2
production by the responder 2C cells to the weaker peptide, p2Ca,
requires that the stimulator Ld-transfected cells coexpress both
B7.1 and ICAM-1; a mixture of cells expressing either L.sup.d+B7.1
or L.sup.d+ICAM-1 is nonstimulatory. By contrast, with the stronger
peptide, QL9, L.sup.d fly cells expressing either B7 or ICAM elicit
clearly-significant responses, although combined expression of B7
and ICAM generates much higher responses. In contrast to these
findings on T-cell proliferation, IL-2 production in response to
the QL9 peptide requires joint expression of B7 and ICAM;
expression of these molecules on separate cells is ineffective.
[0228] The results show that Drosophila cells transfected with
murine class I molecules and costimulatory molecules induce murine
T-cells to mount primary proliferative responses and lymphokine
(IL-2) production in response to peptide antigens. The system is
also applicable to human T-cells and could be used to stimulate
unprimed (or primed) T-cells specific for tumor-specific antigens
in vitro; in vivo infusion of clonally-expanded T-cells specific
for tumor-specific antigens might be therapeutic for patients with
cancer. Infusion of T-cells specific for viral antigens would be
useful in patients with viral infections, e.g. HIV.
Example 4
Immobilization of Biotinylated MHC Molecules on Avidin-Coated Red
Blood Cells
[0229] NHS-LC-biotin, neutravidin and biotin-BMCC were purchased
from Pierce (Rockford, Ill.). Sheep red blood cells were obtained
from the Colorado Serum Company (Denver, Colo.). Drosophila S2
cells expressing L.sup.d and recombinant L.sup.d were prepared as
described in Examples 1 and 2. Monoclonal antibodies 30.5.7
(anti-L.sup.d) and 1B2 (anti-clonotypic antibody to the 2C T cell
receptor) were used as hybridoma cell culture supernatants.
[0230] The protocol used is described by Muzykantov and Taylor
(Anal. Biochem. (1994) 223, 142-148). Briefly, SRBC were washed 4
times in phosphate buffered saline (PBS), biotinylated using
NHS-LC-biotin, washed again 4 times in PBS, incubated with
neutavidin, and finally washed 4 times and stored at 4.degree. C.
in PBS containing 3% fetal calf serum and 0.02% sodium azide.
[0231] Recombinant L.sup.d was biotinylated using biotin-BMCC, a
maleimide-coupled biotin which reacts with thiol groups. L.sup.d
displays a free thiol group, the side chain of cystein 121, which
is not in the peptide binding site. Biotinylation was performed as
recommended by the manufacturer. Unreacted biotin was removed using
Centricon 10.
[0232] Biotinylated L.sup.d was immobilized by incubation at a
final concentration of 0.2 mg/ml with avidin-coated SRBC for 30
minutes followed by washing in DMEM containing 10% fetal calf
serum. SRBC with attached L.sup.d were used immediately.
[0233] T'-cells expressing the 2C TCR transgene from lymph nodes of
mice were purified by magnetic depletion. Purified T-cells were
consistently 97-98% positive for staining in flow cytofluorometry
using the anti-clonotypic antibody 1B2.
[0234] Immobilization of biotinylated L.sup.d on avidin-coated SRBC
was done as indicated above. Attachment was assessed using flow
cytofluorometry using anti-L.sup.d antibody 30.5.7
[0235] A typical experiment is represented in FIG. 8. The negative
control (cells minus antibody) is shown in dotted lines. The filled
peak comprises cells labeled with fluorescent antibody. 99.78% of
the cells were labeled. Fluorescence intensity was in the same
range than the highest levels of intensity that we observed for
L.sup.d on synthetic antigen presenting cells.
[0236] K.sup.b was also biotinylated using the same procedure. We
could immobilize biotinylated K.sup.b on avidin-coated SRBC as
assessed by flow cytofluorometry (FIG. 9). 99.88% of the cells were
labeled.
[0237] Rosetting experiments verified that the attached MHC
molecules interacted functionally with T-cells. Drosophila S2 cells
expressing L.sup.d, L.sup.d-coated SRBC were incubated with QL9
peptide (0.02 mM) or an irrelevant peptide (MCMV, 0.02 nM) for 30
min on ice; 2C+ T cells were then added, the proportion being 10
2C+ T'cells for 1 Drosophila S2 cell, or 10 SRBC for 1 2C+ T cell;
the mixture was pelleted and kept on ice for at least 30 min. Cells
were then carefully resuspended and rosettes were counted, a
rosette being a Drosophila S2 cell bound to at least 3 2C+ T cells,
or a 2C+ T cell bound to at least 3 SRBC. Rosettes were observed in
all cases. Typically, 30-40% of the lymphocytes were included in
rosettes when QL9 peptide was added. No rosette was observed in the
presence of the irrelevant peptide, although occasional attachment
of a few single cells was observed.
[0238] These examples describe a new method to immobilize high
amounts of MHC class I molecules on various surfaces (fly cells,
red blood cells, latex beads) in native conformation as judged by
monoclonal antibody binding and resetting experiments (T cell
receptor binding). This method can be extended to other synthetic
surfaces including artificial phospholipid membranes.
Phosphatidylethanolamine as well as avidin-coupled phospholipids
are particularly relevant to our studies. These phospholipids are
commercially available from Lipex Biomembrane Inc., Vancouver, BC,
Canada.
Example 5
Immobilization of Biotinylated MHC Molecules on Avidin-Coated Latex
Beads
[0239] Six micron diameter latex sulfate beads were purchased from
Interfacial Dynamics Corporation (Portland, Oreg.) and biotinylated
according to the protocol described in Example 4.
[0240] Avidin-coated latex beads were prepared using a 1%
suspension of the latex beads incubated in PBS containing 1 mg/ml
of neutravidin for one hour at room temperature. An equal volume of
PBS containing 10% fetal calf serum was then added. After one hour
of incubation at room temperature, the beads were washed 3 times
and used for binding of recombinant biotinylated L.sup.d.
[0241] Recombinant biotinylated L.sup.d was immobilized by
incubation at a final concentration of 0.2 mg/ml with avidin-coated
latex beads for 30 minutes followed by washing in DEMEM containing
10% fetal calf serum. SRBC with attached L.sup.d were used
immediately.
[0242] Rosetting experiments verified that the attached MHC
molecules on latex beads interacted functionally with T-cells.
Drosophila S2 cells expressing recombinant L.sup.d and
L.sup.d-coated latex beads were incubated with QL9 peptide (0.02
mM) or an irrelevant peptide (MCMV, 0.02 mM) for 30 min on ice; 2C+
T cells were then added, the proportion being 10 2C+ T cells for 1
Drosophila S2 cell, or L.sup.d-coated latex beads for 1 2C+ T cell;
the mixture was pelleted and kept on ice for at least 30 min. Cells
were then carefully resuspended and rosettes were counted, a
rosette being a Drosophila S2 cell bound to at least 3 2C+ T cells,
or a 2C+ T cell bound to at least 3 latex beads. Rosettes were
observed in all cases. Typically, 30-40% of the lymphocytes were
included in rosettes when QL9 peptide was added. No rosette was
observed in the presence of the irrelevant peptide, although
occasional attachment of a few single cells was observed.
Example 6
Immobilization and Detection of Recombinant Protein Bound to
Various Solid Supports Such as Plastic Microwell Plates
[0243] The MHC molecules were immobilized by direct binding to
microtiter plates (Corning) and detected as follows:
[0244] K.sup.b was diluted to desired concentration in PBS, e.g.
0.001 mg/ml for 100 ng /well. 100 .mu.l of diluted K.sup.b was
added to each well on the plastic microtiter plate. The plate was
incubated for 1 hour at room temperature. After incubation, the
plate was washed once with PBS and 200 .mu.l 2% bovine serum
albumin (BSA) in PBS+(0.05%) and Tween (PBST) was added, and
incubated for another hour at room temperature. The plate was
washed three times with PBST and biotinylated anti-K.sup.b mAb was
added (1:2500) in 2% BSA in PBS. The plate was incubated another
hour at room temperature and washed three times with PBST. Avidin
conjugated HRP was added (1:2500) in 2% BSA in PBS. Following
another hour of incubation at room temperature, the plate was
washed three times with PBST and H.sub.2O.sub.2 or thophenyldiamine
was added. The reaction was stopped with H.sub.2SO.sub.4. Reaction
product was detected calorimetrically at 490 nm.
[0245] FIG. 10 shows the results of detecting the presence of MHC
K.sup.b molecules using three different monoclonal antibodies.
[0246] Recombinant MHC K.sup.b molecules can alternatively be bound
through biotin-avidin linked interactions with the substrate. In
this embodiment, the microwell plates were coated with 100 .mu.l
avidin diluted in PBS to a concentration of 0.001 mg/ml. Excess
avidin was removed by a PBS wash. The above procedure for
presenting and detecting K.sup.b binding followed.
[0247] Recombinant MHC molecules may alternatively be immobilized
by a linkage based on a poly-histidine tag added to the MHC
interacting with the nickel bound to the substrate.
[0248] The above procedure for binding and detection is followed
using nickel chelate coated microwell plates (Xenopore) and
recombinant MHC molecules with a poly-histidine tag expressed using
vector pRmHa/His.sub.6 described above.
Example 7
Direct Binding of Peptide to Soluble, Empty Class I MHC Molecules
In Vitro
[0249] A. Procedures
[0250] H-2K.sup.b: prepared as described above in Example 1.B.
[0251] H-2K.sup.b Sol: K.sup.b sol cDNA is a derivative of K.sup.b,
encoding the extracellular position of the Class I MHC molecule.
K.sup.b sol cDNA may be produced by PCR according to known methods,
such as those described in Ennis, et al., PNAS USA 87: 2833-7
(1990) and Zemmour, et al., Immunogenetics 33: 310-20 (1991).
Specifically, cDNA encoding a truncated K.sup.b molecule with a
stop codon inserted at the end of the alpha 3 domain at amino acid
position +275 is excised from the pCMU expression plasmid as a Bam
HI fragment and cloned into pRmHa-3 as K.sup.b cDNA. The K.sup.b
sol cDNA is a derivative of the complete K.sup.b cDNA (see above)
which is used as a template in a PCR reaction using a 5'
oligonucleotide that encompassed the Sty I site, and the following
3' oligonucleotide: 5' ATATGGATCCTCACCATCTCAGGGTGAGGGGC 3'(SEQ ID
NO 43) The resulting PCR fragment is blunt-end cloned into the Sma
I site of pBS (Stratagene, La Jolla, Calif.), sequenced, and the
remaining 5' sequence of K.sup.b cloned into the Sty I site. A cDNA
encoding the complete K.sup.bsol protein could be obtained as a Bam
HI restriction fragment.
[0252] H-2D.sup.b and H-2L.sup.d are prepared as discussed in
Example 1.B. above.
[0253] The cDNAs encoding K.sup.b .alpha.1.alpha.2.alpha.3 domains
(274 residues) and murine .beta.-2 microglobulin (99 residues) were
respectively cloned into the unique Bam HI site of an expression
vector harboring the metallothionein promoter pRMHa-3 (Bunch, et
al., Nucleic Acid Res. 16: 1043-1061 (1988)). Drosophila S2/M3
cells were transformed with these recombinant plasmids in addition
to plasmid phshsneo (containing a neomycin-resistance gene) by the
calcium-phosphate precipitation method described previously. The
transformed cells selected against neomycin-analog antibiotics G418
were grown at 27.degree. C. in serum-free medium and soluble
heavy-chain K.sup.b and .beta.-2 microglobulin were co-expressed by
the addition of 0.7 mM CuSO.sub.4.
[0254] The soluble, assembled heterodimer of K.sup.b was purified
from the culture supernatants by affinity chromatography using
anti-K.sup.b monoclonal antibody Y3, followed by ion-exchange
chromatography on a Pharmacia Mono Q FPLC column according to the
instructions of the manufacturer (Pharmacia, Piscataway, N.J.).
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) of the K.sup.b
preparation followed by staining with Coomassie blue showed only
one band of relative molecular mass (Mr) at about 32,000 and one
band of Mr at about 12,000 with no detectable impurities. The
highly-purified K.sup.b was dialyzed against phosphate-buffered
saline (PBS), filter-sterilized, and used for further study.
Extinction coefficient of the soluble K.sup.b ("K.sup.bsol")
protein (43.2 kDa) is 69,200 M.sup.-1 cm.sup.-1 at 280 nm.
[0255] The purified K.sup.b sol (0.3 .mu.M) in PBS with or without
1% TX-100 were exposed to varying temperatures (i.e., 4.degree.,
23.degree., 32.degree., 37.degree., 42.degree., and 47.degree. C.)
for one hour. The proteins were then immunoprecipitated by
incubating with the monoclonal antibody Y3 and protein A sepharose
beads (Pharmacia, Piscataway, N.J.) at 4.degree. C. for two hours,
respectively. The samples were analyzed by 12.5% SDS-PAGE, followed
by staining with Coomassie blue. The two thick bands on the gel are
heavy and light chains of antibody Y3. In another procedure,
K.sup.bsol (0.3 .mu.M) were incubated with 50 .mu.M of peptides in
PBS at 23.degree. C. for two hours to allow for K.sup.bsol-peptide
complex formation. After the addition of 1% TX-100, the samples
were exposed to 12.degree. C., 37.degree. C., or 47.degree. C.
temperatures for one hour. The complexes were immunoprecipitated
and analyzed by SDS-PAGE as described above. In a third procedure,
K.sup.bsol (2.7 .mu.M) were incubated with 50 .mu.M of OVA-8, VSV-8
or SEV-9 peptides, respectively, at 23.degree. C. for two hours.
The samples were applied on a 5% polyacrylamide IEF gel. IEF was
run from pH 5-7 and the gel was stained with silver.
[0256] Next, VSV-8 peptide was radioiodinated using the
chloramine-T method (Hunter, et al., Nature 194: 495-6 (1962)) and
free .sup.125I was removed by C.sub.18 column (OPC cartridge,
Applied Biosystems, Foster City, Calif.). The labelled peptide was
further purified by C.sub.18 reverse-phase HPLC. After elution, the
labelled peptide was lyophilized and resuspended in PBS.
[0257] The specific activity of [.sup.125I]VSV-8 (about 250
Ci/mmole) was determined spectrophotometrically by using extinction
coefficient of tyrosine at 274 nm (1420 M.sup.-1 cm.sup.-1). First,
K.sup.bsol (0.5 .mu.M) was mixed with [.sup.125I]VSV-8 (1.5 nM) and
unlabelled VSV-8 (50 nM) at 23.degree. C. for 16 hours to allow for
complex formation. A portion of the sample was analyzed by gel
filtration (Superose 12, Pharmacia, Piscataway, N.J.) in PBS. After
elution, radioactivity contained in each fraction (0.05 ml) was
measured. Protein was monitored by absorbance at 280 nm.
[0258] In a second procedure, [.sup.125I]VSV-8 (0.39 nM) was mixed
with various concentrations of K.sup.bsol in PBS containing 1%
bovine serum albumin (BSA). After incubation at 23.degree. C. for
2-16 hours, K.sup.bsol-peptide complexes were separated from free
peptide by small gel filtration (BIO-GEL.RTM. P30, BioRad,
Richmond, Calif.) in PBS. P30 gel filtration permitted over 95%
separation of bound and free peptide within about 5 minutes.
Radioactivity of bound and free peptides was measured and the data
were analyzed by linear regression. At maximal levels of K.sup.bsol
offered, about 65% of the total labelled peptides were bound. This
maximal binding capacity of labelled peptide to K.sup.bsol protein
deteriorated over time, presumably due to radiation by .sup.125I
bound to VSV-8.
[0259] In a third procedure, each sample contained 0.39 nM of
[.sup.125I]VSV-8 (about 18,000 cpm), unlabelled peptides at the
indicated concentration, and 30 nM of K.sup.bsol that gives about
50% of the [.sup.125I]VSV-8 binding in the absence of unlabelled
peptide at a final volume of 72 .mu.l. All components were
dissolved and diluted in PBS containing 1% BSA. After incubation
for 2-16 hours at 23.degree. C., 50 .mu.l samples were analyzed by
P30 gel filtration as described above. The dissociation constants
for unlabelled peptides were determined from molar concentrations
of [.sup.125I]VSV-8 and unlabelled peptides giving 50% inhibition
of [.sup.125I]VSV-8 binding to K.sup.bsol as described. (See
Muller, et al., Meth. Enzymol. 92: 589-601 (1983).)
[0260] K.sup.bsol (0.3 .mu.M) and [.sup.125I]VSV-8 (0.39 nM) were
then incubated at 4.degree. C., 23.degree. C., and 37.degree. C.,
and the association was determined at various times by P30 gel
filtration. Murine .beta.-2 microglobulin was added, when
necessary, before the incubation at the indicated concentration.
The murine .beta.-2 microglobulin was prepared by affinity
chromatography using anti-.beta.-2 microglobulin polyclonal
antibody K355 from culture supernatants of the recombinant
Drosophila cells. (See also Logdberg, et al., Molec. Immun. 14:
577-587 (1979).) In another experiment, K.sup.bsol (0.3 .mu.M or
1.8 .mu.M) and [.sup.125I]VSV-8 (2.4 nM) were incubated at
23.degree. C. for two hours, and the peptide-K.sup.bsol complexes
were isolated by P30 gel filtration. The samples contained very
small amounts of [.sup.125I]VSV-8 and K.sup.bsol complexes (at the
maximum, 2.4 nM) and empty K.sup.bsol at final concentration of
about 50 to 300 nM. To some samples, 3 .mu.M of .beta.-2
microglobulin, 3 .mu.M of .beta.-2 microglobulin plus 20 .mu.M of
unlabelled VSV-8, 20 .mu.M of unlabelled VSV-8, or 1% TX-100 were
added. The samples were incubated for various times at 37.degree.
C. and the degree of dissociation was determined by passage over
P30 columns.
[0261] B. Discussion
[0262] Class I MHC molecules present antigenic peptides to
cytotoxic T lymphocytes. Direct binding of peptide to Class I
molecules in vitro has been hampered by either the presence of
previously bound peptides at the binding site (Chen and Perham,
Nature 337: 743-5 (1989)) or the lack of binding specificity. (See,
e.g., Frelinger, et al., J. Exp. Med. 172: 827-34 (1990); Choppin,
et al., J. Exp. Med. 172: 889-99 (1990); Chen, et al., J. Exp. Med.
172: 931-6 (1990).) In vitro analysis of peptide binding to
soluble, empty Class I molecules purified from Drosophila cells
transformed with truncated H-2K.sup.bsol and murine .beta.-2
microglobulin genes is disclosed herein. The results demonstrate
that peptide binding is very rapid and naturally processed peptides
(octapeptides; see, e.g., Van Bleek, et al., Nature 348: 213-6
(1990); Falk, et al., Nature 351: 290-6 (1991)) have the highest
affinities to K.sup.bsol of the nanomolar range and indicate that
K.sup.bsol complexed with octapeptides are stable, whereas those
complexed with slightly shorter or longer peptides are short-lived.
Interactions between free heavy chain and .beta.-2 microglobulin is
basically reversible in the absence of detergent. Peptides
spontaneously bind to empty Class I molecules without dissolution
of .beta.-2 microglobulin. However, excess .beta.-2 microglobulin
apparently promotes the binding of peptide to empty Class I as a
consequence of reassociation of free heavy chain with .beta.-2
microglobulin under conditions where the heterodimers are
unstable.
[0263] Soluble H-.sub.2K.sup.b molecules (composed of the
.alpha.160 2.alpha.3 domain of heavy chain) and murine .beta.-2
microglobulin, were purified from the culture supernatants of
Drosophila cells which were concomitantly transformed with the
truncated heavy chain and .beta.-2 microglobulin genes. Preliminary
examinations suggested that Drosophila cells express Class I MHC
molecules devoid of endogenous peptides on the cell surface. Some
of the properties of empty Class I molecules include the
observation that they are less stable at 37.degree. C. and their
structure is stabilized by the binding of peptide. (See, e.g.,
Schumacher, et al., Cell 62: 563-7 (1990); Ljunggren, et al.,
Nature 346: 476-80 (1990).) To confirm that purified soluble
K.sup.b are also empty, their thermal stability in detergent-free
solution was examined. Surprisingly, the proteins heated for one
hour at 47.degree. C. were well recovered by immunoprecipitation
using a conformational antibody, Y3. This unexpected result led us
to add detergent, 1% Triton X-100 (polyoxyethylene (9) octyl phenyl
ether), to the protein solution, since similar experiments to test
the stability of Class I molecules have always been conducted in
detergent lysates (See Schumacher, et al., cited supra). The
results obtained in the presence of detergent show that the
purified K.sup.bsol is now unstable at 37.degree. C. This and other
lines of evidence suggest that K.sup.bsol heterodimer disassembles
into the heavy chain and .beta.-2 microglobulin at elevated
temperatures and that detergent may prevent .beta.-2 microglobulin
from reassociating with dissociated free heavy chain (see below).
Second, the possibility of stabilizing purified K.sup.bsol with
peptides was studied. The results of the first-described
examination demonstrated that the proteins can be stabilized only
when they are mixed with octapeptide (vesicular stomatitis virus
nucleocapsid protein [VSV-8], see Table 3 below) which is shown to
be a naturally processed peptide (see Van Bleek, et al., cited
supra). These observations are consistent with the characteristics
of empty Class I molecules mentioned above.
[0264] Independent support that the purified K.sup.bsol molecules
are empty is provided by isoelectric focusing (IEF) under native
conditions (data not shown). The soluble K.sup.b purified from
Drosophila cells exhibited a much simpler pattern than HLA-A2
molecules purified from human lymphoblastoid cell lines (see FIG. 3
in Silver, et al., Nature 350: 619-22 (1991)). The complicated
pattern of HLA-A2 on IEF is presumed to be the result of the
presence of heterogeneous peptides bound to the molecules. The
simple band of purified K.sup.bsol indicates the absence of
endogenous peptides. In addition, the incubation of K.sup.bsol with
antigenic peptides caused the distinct shifts of band on IEF gel,
reflecting the change in isoelectric point of K.sup.bsol due to the
peptide binding. It should be noted that such band-shifting was not
observed in HLA-A2 molecules when they were simply mixed with
peptides, unless HLA-A2 are incubated with peptides in
"reconstituting conditions" after removal of previously bound
endogenous peptides. Taken together, these observations on native
IEF also indicate that soluble K.sup.b purified from Drosophila
cells are empty.
[0265] The association of .sup.125I-labelled VSV-8 with K.sup.bsol
was demonstrated by gel filtration (not shown). The radioactivity
of high molecular weight materials corresponds to
peptide-K.sup.bsol complexes, while that of low molecular weight
materials represents free peptides. Unlabelled VSV and ovalbumin
(OVA) peptides could compete with the labelled VSV-8 (see below),
arguing that [.sup.125I]VSV-8 is bound specifically to K.sup.bsol
molecules. Reversed-phase HPLC revealed that K.sup.b-bound
[.sup.125I]VSV-8 has the identical retention time to the input
peptide. The binding to K.sup.bsol of the labelled VSV-8 was
saturable, exhibiting a dissociation constant (K.sub.D) of about 33
nM (not shown). From the x-axis of the Scatchard plot, it was noted
that about 65% of the labelled VSV-8 is able to bind to
K.sup.b.
[0266] To determine affinities of various peptides to K.sup.b,
competitive radioimmunoassays (RIA) using [.sup.125I]VSV-8 were
carried out (data not shown). The inhibitory peptides used for the
RIA are listed in Table 3. K.sub.D for each peptide is summarized
in Table 3 as well.
11TABLE 3 Various Antigenic Peptides* Used in Present Studies
K.sub.D(M) Code Sequence VSV-7 GYVYQGL 5.3 .times. 10.sup.-8 VSV-8
RGYVYQGL 3.7 .times. 10.sup.-9 VSV-9N LRGYVYQGL 7.3 .times.
10.sup.-9 VSV-10N DLRGYVYQGL 3.9 .times. 10.sup.-7 VSV-9C RGYVYQGLK
6.9 .times. 10.sup.-9 VSV-10C RGYVYQGLKS 2.1 .times. 10.sup.-8
OVA-8 SIINFEKL 4.1 .times. 10.sup.-9 OVA-9N ESIINFEKL 8.9 .times.
10.sup.-8 OVA-10N LESIINFEKL 2.8 .times. 10.sup.-7 OVA-9C SIINFEKLT
1.1 .times. 10.sup.-8 OVA-10C SIINFEKLTE 1.4 .times. 10.sup.-8
OVA-24 EQLESIINFEKLTEWTSSNVMEER 7.1 .times. 10.sup.-5 SEV-9
FAPGNYPAL 2.7 .times. 10.sup.-9 VSV-8: Vesicular stomatitis virus
nucleocapsid protein 52-59 (Van Bleek, et al., Nature 348: 213-216
(1990)) OVA-8: Ovalbumin 257-264 (Carbone, et al., J. Exp. Med.
169: 603-12 (1989)); SEV-9: Sendai virus nucleoprotein 324-332
(Schumacher, et al., Nature 350: 703-706 (1991)) *All peptides were
purified by C.sub.18 reversed-phase HPLC to exclude contaminating
shorter peptides with different binding properties. The 3-letter
code designations and SEQ ID NO for each peptide are given below.
VSV-7 GlyTyrValTyrGln (SEQ ID NO 40, residue nos. 4-10) GlyLeu
VSV-8 ArgGlyTyrValTyr (SEQ ID NO 40, residue nos. 3-10) GlnGlyLeu
VSV-9N LeuArgGlyTyrVal (SEQ ID NO 40, residue nos. 2-10)
TyrGlnGlyLeu VSV-10N AspLeuArgGlyTyr (SEQ ID NO 40) ValTyrGlnGlyLeu
VSV-9C ArgGlyTyrValTyr (SEQ ID NO 44, residue nos. 1-9)
GlnGlyLeuLys VSV-10C ArgGlyTyrValTyr (SEQ ID NO 44) GlnGlyLeuLysSer
OVA-8 SerIleIleAsnPhe (SEQ ID NO 39, residue nos. 5-12) GluLysLeu
OVA-9N GluSerIleIleAsn (SEQ ID NO 39, residue nos. 4-12)
PheGluLysLeu OVA-10N LeuGluSerIleIle (SEQ ID NO 39, residue nos.
3-12) AsnPheGluLysLeu OVA-9C SerIleIleAsnPhe (SEQ ID NO 39, residue
nos. 5-13) GluLysLeuThr OVA-10C SerIleIleAsnPhe (SEQ ID NO 39,
residue nos. 5-14) GluLysLeuThrGlu OVA-24 GluGlnLeuGluSer (SEQ ID
NO 39) IIeIleAsnPheGlu LysLeuThrGlu-Trp ThrSerSerAsnVal
MetGluGluArg SEV-9 PheAlaProGlyAsn (SEQ ID NO 45) TyrProAlaLeu
[0267] The peptides of naturally processed size (8 mer for VSV and
OVA, and 9 mer for sendai virus nucleoprotein [SEV]) had the
highest and remarkably similar affinities from the range of 2.7 to
4.1 nM. this exceedingly high affinity of the natural peptides is
consistent with recent observations. (See, e.g., Schumacher, et
al., Nature 350: 703-6 (1991); Christnick, et al., Nature 352:
67-70 (1991).) However, peptides that were shorter or longer by as
little as one or two residues lowered the affinity by a factor of
from 2 to 100. This reduction of the affinity is even more drastic
for a much longer peptide; i.e., the affinity of 24 mer peptide
(OVA-24) is more than 10,000-fold lower than that of OVA-8. These
results help to explain why earlier reports using longer peptides
claim the affinity of micromolar range. (See, e.g., Frelinger, et
al. and Choppin, et al., both cited supra.) It is of particular
interest that the extension of peptides at the carboxyl terminus is
much less destructive of the affinity than extension at the amino
terminus. According to the three-dimensional structure of HLA-A2,
the peptide-binding groove is formed by two long .alpha. helices on
the antiparallel .beta. strands, and the cleft is about 25
angstroms long, which is proposed to accommodate an extended
peptide chain of about eight residues (see, e.g., Bjorkman, et al.,
Nature 329: 506-12 (1987)). At one end of the cleft, the .alpha.1
and .alpha.2 helices come close together tightly, while at the
other end, the cleft is fairly open. It is now speculated that both
VSV and OVA peptide bind to the cleft in the same orientation *and
the carboxyl terminus of the peptides might interact with the
relatively open end of the cleft so that the extension of peptide
at the carboxyl terminus does not cause severe steric
hindrance.
[0268] Examinations were then performed to determine the rate of
peptide binding to K.sup.b at 4.degree. C. and 23.degree. C.,
respectively (not shown). Binding was very rapid, especially at
23.degree. C., with a half-time of about 5 minutes even in
extremely low concentrations of labelled peptides (about 0.4 nM).
This contrasts with previous observations, which show a half-time
of association of about two hours. (See, e.g., Choppin, et al.,
cited supra.) Again, only 65% of the total labelled peptide was
able to bind. The addition of excess .beta.-2 microglobulin did not
affect the peptide-binding kinetics at such low temperatures that
K.sup.b heterodimer is stable (remained to be assembled). This
implies that exchange of .beta.-2 microglobulin is not a
prerequisite for peptide binding; i.e., peptides can spontaneously
bind to empty Class I molecules without dissociation of .beta.-2
microglobulin. In contrast, excess free .beta.-2 microglobulin
apparently promotes peptide binding at 37.degree. C. (data not
shown). As the concentration of added .beta.-2 microglobulin
increased, more peptides bound to K.sup.b molecules. Since empty
K.sup.b are unstable at 37.degree. C., a fraction of heterodimers
must be dissociated to the heavy chain and .beta.-2 microglobulin
and thereby, the heterodimer must be in equilibrium with free heavy
chain and free .beta.-2 microglobulin. Then, the addition of
.beta.-2 microglobulin should shift the equilibrium toward the
formation of heterodimer that can bind peptides. This view is
supported by recent observations that there are substantial numbers
of Class I free heavy chains on the normal cell surface and
exogenously added .beta.-2 microglobulin facilitates peptide
binding to empty Class I molecules on cells as a consequence of the
reassociation of .beta.-2 microglobulin with free heavy chain.
(See, e.g., Rock, et al., Cell 65: 611-620 (1991); Kozlowski, et
al., Nature 349: 74-77 (1991); Vitiello, et al., Science 250:
1423-6 (1990).)
[0269] The dissociation kinetics of peptide at 37.degree. C. were
then observed. Immediately after isolating [.sup.125I]VSV-8 and
K.sup.b complexes by gel filtration, the samples containing either
50 or 300 nM K.sup.b were exposed to 37.degree. C. temperatures.
Some samples were supplemented with 3 .mu.M .beta.-2 microglobulin
and/or 20 .mu.M unlabelled VSV-8, or 1% TX-100. The dissociation of
labelled peptides from K.sup.b was measured at various times (not
shown). In the presence of a large excess of unlabelled peptides,
the dissociation rate of peptide followed first-order kinetics with
a half-time dissociation of about 36 minutes (a dissociation rate
constant of 3.2.times.10.sup.-4 s.sup.-1). This unexpected,
relatively rapid dissociation of labelled peptide does not agree
with some current views of stable peptide-Class I complexes. In
fact, the results ascertained (not shown) demonstrated that K.sup.b
and VSV-8 complexes are stable. This discrepancy must arise from
the 10-fold lower affinity of radiolabelled VSV-8 (33 nM) compared
with that of unlabelled VSV-8 (3.7 nM).
[0270] The first-order kinetics were also observed when the
detergent was added instead of unlabelled peptide, indicating that
the detergent makes the peptide dissociation process irreversible.
In contrast, the peptide dissociation profile did not follow the
first-order kinetics in the absence of unlabelled peptide or the
detergent. This suggests that the peptide association/dissociation
is reversible and the binding of peptide is dependent on the
concentration of heterodimer (compare the kinetics between 50 nM
and 300 nM of K.sup.b). This became more evident when excess
.beta.-2 microglobulin was added. These results support the
previous argument that interaction between the heavy chain,
.beta.-2 microglobulin and peptide are basically reversible at
37.degree. C., if not entirely, in the absence of detergent. It is
probable that a detergent such as TX-100 may prevent .beta.-2
microglobulin from reassociating with free heavy chain at
37.degree. C. This could reasonably explain why K.sup.b once heated
to elevated temperatures in the absence of detergent can be
efficiently immunoprecipitated by conformational antibody (not
shown). Interestingly, the addition of .beta.-2 nicroglobulin did
not suppress the peptide dissociation in the presence of excess
unlabelled peptides, indicating that labelled peptides are released
from the complexes without dissociation of .beta.-2 microglobulin.
It should be remembered, however, that the affinity of
[.sup.125I]VSV-8 is about 10-fold lower than that of the natural
peptides. Therefore, this is not necessarily the case for the
natural peptides.
[0271] The study using in vitro peptide-binding assay systems
suggests that peptide binding to Class I molecules is a simple mass
action and a ligand-receptor interaction. The approach used herein
allows characterization of the peptide binding specificity to Class
I molecules and of the interaction of peptide-Class I complexes
with the T-cell receptor.
Example 8
Therapeutic Applications
[0272] A. Class I Molecule Bank
[0273] A reservoir or "bank" of insect cell lines may be
established and maintained, with each cell line expressing one of
the 50 to 100 most common Class I MHC heavy chain, a
.beta.-microglobulin molecule, as well as at least one assisting
molecule. cDNAs encoding these proteins may be cloned based on HLA
variants obtained from cell lines containing same--e.g., via the
polymerase chain reaction (see Ennis, et al., PNAS USA 87: 2833-7
(1990))--and inserted into the appropriate vector, such as an
insect expression vector, to generate cell lines expressing each
HLA variant.
[0274] Testing according to the following protocol, for example,
can be used to determine which peptides derived from the virus of
choice bind the best to the different Class I MHC molecules. The
various cultures may appropriately be labeled or catalogued to
indicate which Class I MHC molecules are best for use with
particular peptides. Alternatively, transient cultures may be
established as needed. As discussed herein, after approximately 48
hours' incubation of a culture of insect cells with a vector, that
culture is apparently capable of expressing empty MHC molecules
which may be loaded with the peptide(s) of choice for the purpose
of activating CD8 cells.
[0275] B. Preparation of "Special" Cell Lines
[0276] After HLA typing, if insect cell lines expressing the
preferred HLA are not available, cDNAs encoding the preferred HLA
and assisting molecules may be cloned via use of the polymerase
chain reaction. The primers disclosed in section B.1. above (SEQ ID
NO 1 through SEQ ID NO 12) may be used to amplify the appropriate
HLA-A, -B, -C, -E, -F, or -G cDNAs in separate reactions which may
then be cloned and sequenced as described in the methods disclosed
in Example 1, section 1 above. DNA is then purified from the PCR
reaction using a GENECLEAN.RTM. kit (Bio 101, San Diego, Calif.)
and ligated directly into the Sma I site of pRmHa-3. Individual
clones are isolated, the sequences verified, and stable Drosophila
cell lines expressing the HLA established. Alternatively, a bulk
population of recombinant plasmids may be grown in large scale and
DNA purified by cesium chloride gradients. The purified DNA is then
used to transfect S2 cells using calcium phosphate precipitation
techniques. After 24 hours, the precipitate is washed off the cells
and replaced with fresh Schneider media containing 1 mM CuSO.sub.4.
Forty-eight hours later, the bulk population of transiently
transfected cells is used for in vitro activation of CD8 after
incubation with syngeneic peptides or protease digests of specific
proteins.
[0277] Stable cell lines expressing the cloned HLA may then be
established. Alternatively, a population of insect cells
transiently expressing a bulk population of cloned recombinant
molecules from the PCR reaction may be used for in vitro CD8
activation.
[0278] It is also possible to activate haplotype-specific CD8s in
vitro using insect cells expressing Class I MHC incubated with
peptides where the cell line-expressed MHC is not the expressed
element in vivo. This provides a unique opportunity to proliferate
CD8 cells which recognize a specific antigen associated with a
particular MHC which would not be possible in vivo due to allelic
restriction. For example, a peptide (NP) from the nuclear protein
of Influenza virus is ordinarily restricted to the D.sup.b
molecule; however, we have found that such a peptide can bind to
K.sup.b (albeit more weakly than to D.sup.b) and can generate a
degree of thermal stability to the K.sup.b (see FIG. 3).
Furthermore, K.sup.b-expressing Drosophila cells preincubated with
the NP peptide and cocultured with splenocytes from a B6 mouse
results in the in vitro activation of CD8 which specifically
recognize the K.sup.b molecule associated with the NP peptide. In
addition, the reciprocal experiment using a K.sup.b-restricted
peptide (OVA) derived from ovalbumin and D.sup.b-expressing
Drosophila cells results in the proliferation of CD8 which
specifically recognize D.sup.b containing the OVA peptide. Such
CD8s are able to kill cells (EL4 OVA) transfected with cDNA
encoding the ovalbumin protein, indicating that in vivo, some
D.sup.b molecules are loaded with the OVA peptide.
[0279] This system therefore provides a unique opportunity to
proliferate CD8 against specific antigens presented by a Class I
molecule which, in vivo, is not the restriction element for that
peptide. Although enough antigen is presented in vivo by said Class
I for the cell to be recognized by CD8 and killed, it is not enough
to proliferate such CD8s in vivo. By loading empty Class I
molecules expressed by Drosophila cells with peptide, we are able
to override the in vivo restriction by providing an excess of
antigenic peptide to the Class I molecule in a non-competitive
environment such that enough antigen is presented by the Class I to
activate the specific CD8 recognizing this complex.
[0280] C. AIDS Treatment
[0281] I vitro activated cells may be administered to patients for
in vivo therapy. Preferably, the Class I MHC genotype (haplotype)
of the individual is first determined. Conventional tissue typing
is appropriate for this purpose and may be performed at the
treatment center or by some appropriate commercial operation. Once
the individual's HLA type(s) is (are) determined, the best
combination of peptides and Class I MHC molecules suitable for the
individual patient is ascertained and prepared as noted above and
the appropriate insect cell lines and peptides are provided.
Resting or precursor CD8 (T) cells from the blood of the patient
are then stimulated with the appropriate peptide-loaded MHC
produced by the insect cell culture. After activation, the CD8
cells are reintroduced into the patient's bloodstream, and the
disease process in the patient continues to be monitored. Methods
of removing and re-introducing cellular components are known in the
art and include procedures such as those exemplified in U.S. Pat.
No. 4,844,893 to Honsik, et al. and U.S. Pat. No. 4,690,915 to
Rosenberg.
[0282] Additional treatments may be administered as necessary until
the disease is sufficiently remediated. Similar treatment protocols
are appropriate for use with other immunosuppressed individuals,
including transplant patients, elderly patients, and the like.
[0283] D. Cancer Treatment
[0284] In cancer patients, a treatment procedure similar to that
described above is utilized. However, in such patients, it should
be anticipated that conventional therapy to reduce the tumor mass
may precede the immune therapy described herein. Therefore, it is
preferred that blood samples from the putative patient be obtained
and stored (e.g. via freezing) prior to the commencement of
conventional therapy such as radiation or chemotherapy, which tends
to destroy immune cells. Since few, if any, forms of cancer arise
in direct response to viral infection, target peptides for immune
treatment are less readily observed. However, recent studies
indicate that mutations in the oncogenes ras, neu, and p53
contribute to cancer in as much as 50% of all cancer cases. Thus,
peptides derived from these mutated regions of the molecules are
prime candidates as targets for the present therapy. Pursuant to
the protocols disclosed herein, the best combination of peptides
and Class I molecules for the individual patient may be determined
and administered.
[0285] For example, many tumors express antigens that are
recognized in vitro by CD8 cells derived from the affected
individual. Such antigens which are not expressed in normal cells
may thus be identified, as well as the HLA type that presents them
to the CD8 cells, for precisely targeted immunotherapy using the
methods of the present invention. For example, van der Bruggen, et
al. have described an antigen whose expression is directed by a
specific gene and which antigen appears to be presented by HLA Al
(Science 254: 1643-1647 (1991)). As various human tumor antigens
are isolated and described, they become good candidates for
immunotherapeutic applications as described herein.
[0286] In another, alternative therapeutic mode, it may be feasible
to administer the in vitro activated CD8 cells of the present
invention in conjunction with other immunogens. For example, the
Large Multivalent Immunogen disclosed in U.S. Pat. No. 5,045,320
may be administered in conjunction with activated CD8 cells.
[0287] It is also possible that cytokines such as IL-2 and IL-4,
which mediate differentiation and activation of T-cells, may be
administered as well, as cytokines are able to stimulate the T-cell
response against tumor cells in vivo. It is believed that IL-2
plays a major role in the growth and differentiation of CD8
precursors and in CD8 proliferation. The administration of IL-2 to
cancer patients is frequently associated with an improved
anti-tumor response which is likely related to induction of
tumor-specific T-cells. However, the best therapeutic effects of
IL-2 might be obtained by continuous local rather than systemic
administration of IL-2, thus minimizing the IL-2 toxicity and
prolonging its biological activity. One may achieve local delivery
via transfecting tumor cells with an IL-2 gene construct.
[0288] IL-2 eDNA is constructed as described by Karasuyama and
Melchers in Eur. J. Immunol. 18: 97-104 (1988). The complete cDNA
sequence of IL-2 is obtained as an Xho I fragment from the plasmid
pBMGneo IL-2 (see Karasuyama and Melchers, supra) and directly
ligated into the Sal I site in pRmHa-3. Recombinant pRmHa-3 plasmid
with the insert in the correct orientation (determined via
restriction mapping with Hind III) is purified by cesium gradients
and used to cotransfect S2 cells using the calcium phosphate
technique. (A mixture of plasmid DNA was prepared for this purpose:
10 .mu.g pRmHa-3 containing IL-2 cDNA, 6 .mu..mu.g each of pRmHa-3
plasmid containing MHC Class I heavy chain or .beta.-2
microglobulin and 2 .mu.g of phshsneo DNA.) Stable cell lines which
are inducible via CuSO.sub.4 to express heavy chain, .beta.-2
microglobulin and IL-2 were obtained by growing the transfectants
in G418 medium. These stable cell lines were coated with peptide
and used in the in vitro assay as described above. Tumor cells
transfected with IL-2 are observed to enhance the CTL (CD8)
activity against the parental tumor cells and bypass CD4 and T
helper function in the induction of an antitumor or cytotoxic
response in vivo. Therefore, increasing the potential of the
Drosophila system via cotransfection with the IL-2 gene is
suggested herein.
[0289] The foregoing is intended to be illustrative of the present
invention, but not limiting. Numerous variations and modifications
may be effected without departing from the true spirit and scope of
the invention.
Sequence CWU 1
1
59 1 23 DNA Artificial Sequence Synthetic PCR primer (SPP) 1
ccaccatggc cgtcatggcg ccc 23 2 23 DNA Artificial Sequence Synthetic
PCR primer (SPP) 2 ggtcacactt tacaagctct gag 23 3 23 DNA Artificial
Sequence Synthetic PCR primer (SPP) 3 ccaccatgct ggtcatggcg ccc 23
4 23 DNA Artificial Sequence Synthetic PCR Primer (SPP) 4
ggactcgatg tgagagacac atc 23 5 23 DNA Artificial Sequence Synthetic
PCR Primer (SPP) 5 ccaccatgcg ggtcatggcg ccc 23 6 23 DNA Artificial
Sequence Synthetic PCR Primer (SPP) 6 ggtcaggctt tacaagcgat gag 23
7 23 DNA Artificial Sequence Synthetic PCR Primer (SPP) 7
ccaccatgcg ggtagatgcc ctc 23 8 23 DNA Artificial Sequence Synthetic
PCR Primer (SPP) 8 ggttacaagc tgtgagactc aga 23 9 23 DNA Artificial
Sequence Synthetic PCR Primer (SPP) 9 ccaccatggc gccccgaagc ctc 23
10 23 DNA Artificial Sequence Synthetic PCR Primer (SPP) 10
ggtcacactt tattagctgt gag 23 11 23 DNA Artificial Sequence
Synthetic PCR Primer (SPP) 11 ccaccatggc gccccgaacc ctc 23 12 23
DNA Artificial Sequence Synthetic PCR Primer (SPP) 12 ggtcacaatt
tacaagccga gag 23 13 427 DNA Drosophila Melanogaster 13 aattcgttgc
aggacaggat gtggtgcccg atgtgactag ctctttgctg caggccgtcc 60
tatcctctgg ttccgataag agacccagaa ctccggcccc ccaccgccca ccgccacccc
120 catacatatg tggtacgcaa gtaagagtgc ctgcgcatgc cccatgtgcc
ccaccaagag 180 ttttgcatcc catacaagtc cccaaagtgg agaaccgaac
caattcttcg cgggcagaac 240 aaaagcttct gcacacgtct ccactcgaat
ttggagccgg ccggcgtgtg caaaagaggt 300 gaatcgaacg aaagacccgt
gtgtaaagcc gcgtttccaa aatgtataaa accgagagca 360 tctggccaat
gtgcatcagt tgtggtcagc agcaaaatca agtgaatcat ctcagtgcaa 420 ctaaagg
427 14 740 DNA Drosophila Melanogaster 14 attcgatgca cactcacatt
cttctcctaa tacgataata aaactttcca tgaaaaatat 60 ggaaaaatat
atgaaaattg agaaatccaa aaaactgata aacgctctac ttaattaaaa 120
tagataaatg ggagcggctg gaatggcgga gcatgaccaa gttcctccgc caatcagtcg
180 taaaacagaa gtcgtggaaa gcggatagaa agaatgttcg atttgacggg
caagcatgtc 240 tgctatgtgg cggattgcgg aggaattgca ctggagacca
gcaaggttct catgaccaag 300 aatatagcgg tgtgagtgag cgggaagctc
ggtttctgtc cagatcgaac tcaaaactag 360 tccagccagt cgctgtcgaa
actaattaag ttaatgagtt tttcatgtta gtttcgcgct 420 gagcaacaat
taagtttatg tttcagttcg gcttagattt cgctgaagga cttgccactt 480
tcaatcaata ctttagaaca aaatcaaaac tcattctaat agcttggtgt tcatcttttt
540 ttttaatgat aagcattttg tcgtttatac tttttatatt tcgatattaa
accacctatg 600 aagttcattt taatcgccag ataagcaata tattgtgtaa
atatttgtat tctttatcag 660 gaaattcagg gagacgggga agttactatc
tactaaaagc caaacaattt cttacagttt 720 tactctctct actctagagt 740 15
60 DNA Artificial Sequence Synthetic PCR Primer (SPP) 15 gcttggatcc
agatctacca tgtctcgctc cgtggcctta gctgtgctcg cgctactctc 60 16 36 DNA
Artificial Sequence Synthetic PCR Primer (SPP) 16 ggatccggat
ggttacatgt cgcgatccca cttaac 36 17 19 DNA Artificial Sequence
Synthetic PCR Primer (SPP) 17 ggagccgtga ctgactgag 19 18 24 DNA
Artificial Sequence Synthetic PCR primer (SPP) 18 ccctcggcac
tgactgactc ctag 24 19 38 DNA Artificial Sequence Synthetic
Expression Vector Fragment 19 gatccttatt agatctcacc atcaccatca
ccattgag 38 20 38 DNA Artificial Sequence Synthetic expression
vector fragment 20 tcgactcaat ggtgatggtg atggtgagat ctaataag 38 21
3875 DNA Artificial Sequence Synthetic Expression Vector Fragment
21 ttgcaggaca ggatgtggtg cccgatgtga ctagctcttt gctgcaggcc
gtcctatcct 60 ctggttccga taagagaccc agaactccgg ccccccaccg
cccaccgcca cccccataca 120 tatgtggtac gcaagtaaga gtgcctgcgc
atgccccatg tgccccacca agagctttgc 180 atcccataca agtccccaaa
gtggagaacc gaaccaattc ttcgcgggca gaacaaaagc 240 ttctgcacac
gtctccactc gaatttggag ccggccggcg tgtgcaaaag aggtgaatcg 300
aacgaaagac ccgtgtgtaa agccgcgttt ccaaaatgta taaaaccgag agcatctggc
360 caatgtgcat cagttgtggt cagcagcaaa atcaagtgaa tcatctcagt
gcaactaaag 420 gggaattcga gctcggtacc cggggatcct tattagatct
caccatcacc atcaccattg 480 agtcgacctg caggcatgca agctattcga
tgcacactca cattcttctc ctaatacgat 540 aataaaactt tccatgaaaa
atatggaaaa atatatgaaa attgagaaat ccaaaaaact 600 gataaacgct
ctacttaatt aaaatagata aatgggagcg gcaggaatgg cggagcatgg 660
ccaagttcct ccgccaatca gtcgtaaaac agaagtcgtg gaaagcggat agaaagaatg
720 ttcgatttga cgggcaagca tgtctgctat gtggcggatt gcggaggaat
tgcactggag 780 accagcaagg ttctcatgac caagaatata gcggtgagtg
agcgggaagc tcggtttctg 840 tccagatcga actcaaaact agtccagcca
gtcgctgtcg aaactaatta agttaatgag 900 tttttcatgt tagtttcgcg
ctgagcaaca attaagttta tgtttcagtt cggcttagat 960 ttcgctgaag
gacttgccac tttcaatcaa tactttagaa caaaatcaaa actcattcta 1020
atagcttggt gttcatcttt ttttttaatg ataagcattt tgtcgtttat actttttata
1080 tttcgatatt aaaccaccta tgaagtctat tttaatcgcc agataagcaa
tatattgtgt 1140 aaatatttgt attctttatc aggaaattca gggagacggg
aagttactat ctactaaaag 1200 ccaaacaatt tcttacagtt ttactctctc
tactctagag tagcttggca ctggccgtcg 1260 ttttacaacg tcgtgactgg
gaaaaccctg gcgttaccca acttaatcgc cttgcagcac 1320 atcccccttt
cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 1380
agttgcgcag cctgaatggc gaatggcgcc tgatgcggta ttttctcctt acgcatctgt
1440 gcggtatttc acaccgcata tggtgcactc tcagtacaat ctgctctgat
gccgcatagt 1500 taagccagcc ccgacacccg ccaacacccg ctgacgcgcc
ctgacgggct tgtctgctcc 1560 cggcatccgc ttacagacaa gctgtgaccg
tctccgggag ctgcatgtgt cagaggtttt 1620 caccgtcatc accgaaacgc
gcgagacgaa agggcctcgt gatacgccta tttttatagg 1680 ttaatgtcat
gataataatg gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc 1740
gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac
1800 aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt
attcaacatt 1860 tccgtgtcgc ccttattccc ttttttgcgg cattttgcct
tcctgttttt gctcacccag 1920 aaacgctggt gaaagtaaaa gatgctgaag
atcagttggg tgcacgagtg ggttacatcg 1980 aactggatct caacagcggt
aagatccttg agagttttcg ccccgaagaa cgttttccaa 2040 tgatgagcac
ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc 2100
aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag
2160 tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt
gctgccataa 2220 ccatgagtga taacactgcg gccaacttac ttctgacaac
gatcggagga ccgaaggagc 2280 taaccgcttt tttgcacaac atgggggatc
atgtaactcg ccttgatcgt tgggaaccgg 2340 agctgaatga agccatacca
aacgacgagc gtgacaccac gatgcctgta gcaatggcaa 2400 caacgttgcg
caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 2460
tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg
2520 gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt
atcattgcag 2580 cactggggcc agatggtaag ccctcccgta tcgtagttat
ctacacgacg gggagtcagg 2640 caactatgga tgaacgaaat agacagatcg
ctgagatagg tgcctcactg attaagcatt 2700 ggtaactgtc agaccaagtt
tactcatata tactttagat tgatttaaaa cttcattttt 2760 aatttaaaag
gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 2820
gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag
2880 atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg
ctaccagcgg 2940 tggtttgttt gccggatcaa gagctaccaa ctctttttcc
gaaggtaact ggcttcagca 3000 gagcgcagat accaaatact gtccttctag
tgtagccgta gttaggccac cacttcaaga 3060 actctgtagc accgcctaca
tacctcgctc tgctaatcct gttaccagtg gctgctgcca 3120 gtggcgataa
gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 3180
agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca
3240 ccgaactgag atacctacag cgtgagcatt gagaaagcgc cacgcttccc
gaagggagaa 3300 aggcggacag gtatccggta agcggcaggg tcggaacagg
agagcgcacg agggagcttc 3360 cagggggaaa cgcctggtat ctttatagtc
ctgtcgggtt tcgccacctc tgacttgagc 3420 gtcgattttt gtgatgctcg
tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 3480 cctttttacg
gtcctggcct tttgctggcc ttttgctcac atgtctttcc tgcgttatcc 3540
cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc
3600 cgaaccgacc gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc
caatacgcaa 3660 accgcctctc cccgcgcgtt ggccgattca ttaatgcagc
tggcacgaca ggtttcccga 3720 ctggaaagcg ggcagtgagc gcaacgcaat
taatgtgagt tagctcactc attaggcacc 3780 ccaggcttta cactttatgc
ttccggctcg tatgttgtgt ggaattgtga gcggataaca 3840 atttcacaca
ggaaacagct atgacatgat taccg 3875 22 71 DNA Artificial Sequence
Synthetic expression vector fragment 22 gatccttatt agatcttacc
catacgacgt cccagattac gctcgatctc accatcacca 60 tcaccattga g 71 23
71 DNA Artificial Sequence Synthetic expression vector fragment 23
tcgactcaat ggtgatggtg atggtgagat cgagcgtaat ctgggacgtc gtatgggtaa
60 gatctaataa g 71 24 3908 DNA Artificial Sequence Synthetic
expression vector fragment 24 ttgcaggaca ggatgtggtg cccgatgtga
ctagctcttt gctgcaggcc gtcctatcct 60 ctggttccga taagagaccc
agaactccgg ccccccaccg cccaccgcca cccccataca 120 tatgtggtac
gcaagtaaga gtgcctgcgc atgccccatg tgccccacca agagctttgc 180
atcccataca agtccccaaa gtggagaacc gaaccaattc ttcgcgggca gaacaaaagc
240 ttctgcacac gtctccactc gaatttggag ccggccggcg tgtgcaaaag
aggtgaatcg 300 aacgaaagac ccgtgtgtaa agccgcgttt ccaaaatgta
taaaaccgag agcatctggc 360 caatgtgcat cagttgtggt cagcagcaaa
atcaagtgaa tcatctcagt gcaactaaag 420 gggaattcga gctcggtacc
cggggatcct tattagatct tacccatacg acgtcccaga 480 ttacgctcga
tctcaccatc accatcacca ttgagtcgac ctgcaggcat gcaagctatt 540
cgatgcacac tcacattctt ctcctaatac gataataaaa ctttccatga aaaatatgga
600 aaaatatatg aaaattgaga aatccaaaaa actgataaac gctctactta
attaaaatag 660 ataaatggga gcggcaggaa tggcggagca tggccaagtt
cctccgccaa tcagtcgtaa 720 aacagaagtc gtggaaagcg gatagaaaga
atgttcgatt tgacgggcaa gcatgtctgc 780 tatgtggcgg attgcggagg
aattgcactg gagaccagca aggttctcat gaccaagaat 840 atagcggtga
gtgagcggga agctcggttt ctgtccagat cgaactcaaa actagtccag 900
ccagtcgctg tcgaaactaa ttaagttaat gagtttttca tgttagtttc gcgctgagca
960 acaattaagt ttatgtttca gttcggctta gatttcgctg aaggacttgc
cactttcaat 1020 caatacttta gaacaaaatc aaaactcatt ctaatagctt
ggtgttcatc ttttttttta 1080 atgataagca ttttgtcgtt tatacttttt
atatttcgat attaaaccac ctatgaagtc 1140 tattttaatc gccagataag
caatatattg tgtaaatatt tgtattcttt atcaggaaat 1200 tcagggagac
gggaagttac tatctactaa aagccaaaca atttcttaca gttttactct 1260
ctctactcta gagtagcttg gcactggccg tcgttttaca acgtcgtgac tgggaaaacc
1320 ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc
tggcgtaata 1380 gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg
cagcctgaat ggcgaatggc 1440 gcctgatgcg gtattttctc cttacgcatc
tgtgcggtat ttcacaccgc atatggtgca 1500 ctctcagtac aatctgctct
gatgccgcat agttaagcca gccccgacac ccgccaacac 1560 ccgctgacgc
gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga 1620
ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac
1680 gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata
atggtttctt 1740 agacgtcagg tggcactttt cggggaaatg tgcgcggaac
ccctatttgt ttatttttct 1800 aaatacattc aaatatgtat ccgctcatga
gacaataacc ctgataaatg cttcaataat 1860 attgaaaaag gaagagtatg
agtattcaac atttccgtgt cgcccttatt cccttttttg 1920 cggcattttg
ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg 1980
aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc
2040 ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa
gttctgctat 2100 gtggcgcggt attatcccgt attgacgccg ggcaagagca
actcggtcgc cgcatacact 2160 attctcagaa tgacttggtt gagtactcac
cagtcacaga aaagcatctt acggatggca 2220 tgacagtaag agaattatgc
agtgctgcca taaccatgag tgataacact gcggccaact 2280 tacttctgac
aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg 2340
atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg
2400 agcgtgacac cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta
ttaactggcg 2460 aactacttac tctagcttcc cggcaacaat taatagactg
gatggaggcg gataaagttg 2520 caggaccact tctgcgctcg gcccttccgg
ctggctggtt tattgctgat aaatctggag 2580 ccggtgagcg tgggtctcgc
ggtatcattg cagcactggg gccagatggt aagccctccc 2640 gtatcgtagt
tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga 2700
tcgctgagat aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat
2760 atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag
gtgaagatcc 2820 tttttgataa tctcatgacc aaaatccctt aacgtgagtt
ttcgttccac tgagcgtcag 2880 accccgtaga aaagatcaaa ggatcttctt
gagatccttt ttttctgcgc gtaatctgct 2940 gcttgcaaac aaaaaaacca
ccgctaccag cggtggtttg tttgccggat caagagctac 3000 caactctttt
tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc 3060
tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg
3120 ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt
cttaccgggt 3180 tggactcaag acgatagtta ccggataagg cgcagcggtc
gggctgaacg gggggttcgt 3240 gcacacagcc cagcttggag cgaacgacct
acaccgaact gagataccta cagcgtgagc 3300 attgagaaag cgccacgctt
cccgaaggga gaaaggcgga caggtatccg gtaagcggca 3360 gggtcggaac
aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata 3420
gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg
3480 ggcggagcct atggaaaaac gccagcaacg cggccttttt acggtcctgg
ccttttgctg 3540 gccttttgct cacatgtctt tcctgcgtta tcccctgatt
ctgtggataa ccgtattacc 3600 gcctttgagt gagctgatac cgctcgccgc
agccgaaccg accgagcgca gcgagtcagt 3660 gagcgaggaa gcggaagagc
gcccaatacg caaaccgcct ctccccgcgc gttggccgat 3720 tcattaatgc
agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 3780
aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc
3840 tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca
gctatgacat 3900 gattaccg 3908 25 41 DNA Artificial Sequence
Synthetic expression vector fragment 25 gatccttatt agatctcacc
atcaccatca ccattgttga g 41 26 41 DNA Artificial Sequence Synthetic
expression vector fragment 26 tcgactcaac aatggtgatg gtgatggtga
gatctaataa g 41 27 3878 DNA Artificial Sequence Synthetic
expression vector 27 ttgcaggaca ggatgtggtg cccgatgtga ctagctcttt
gctgcaggcc gtcctatcct 60 ctggttccga taagagaccc agaactccgg
ccccccaccg cccaccgcca cccccataca 120 tatgtggtac gcaagtaaga
gtgcctgcgc atgccccatg tgccccacca agagctttgc 180 atcccataca
agtccccaaa gtggagaacc gaaccaattc ttcgcgggca gaacaaaagc 240
ttctgcacac gtctccactc gaatttggag ccggccggcg tgtgcaaaag aggtgaatcg
300 aacgaaagac ccgtgtgtaa agccgcgttt ccaaaatgta taaaaccgag
agcatctggc 360 caatgtgcat cagttgtggt cagcagcaaa atcaagtgaa
tcatctcagt gcaactaaag 420 gggaattcga gctcggtacc cggggatcct
tattagatct caccatcacc atcaccattg 480 ttgagtcgac ctgcaggcat
gcaagctatt cgatgcacac tcacattctt ctcctaatac 540 gataataaaa
ctttccatga aaaatatgga aaaatatatg aaaattgaga aatccaaaaa 600
actgataaac gctctactta attaaaatag ataaatggga gcggcaggaa tggcggagca
660 tggccaagtt cctccgccaa tcagtcgtaa aacagaagtc gtggaaagcg
gatagaaaga 720 atgttcgatt tgacgggcaa gcatgtctgc tatgtggcgg
attgcggagg aattgcactg 780 gagaccagca aggttctcat gaccaagaat
atagcggtga gtgagcggga agctcggttt 840 ctgtccagat cgaactcaaa
actagtccag ccagtcgctg tcgaaactaa ttaagttaat 900 gagtttttca
tgttagtttc gcgctgagca acaattaagt ttatgtttca gttcggctta 960
gatttcgctg aaggacttgc cactttcaat caatacttta gaacaaaatc aaaactcatt
1020 ctaatagctt ggtgttcatc ttttttttta atgataagca ttttgtcgtt
tatacttttt 1080 atatttcgat attaaaccac ctatgaagtc tattttaatc
gccagataag caatatattg 1140 tgtaaatatt tgtattcttt atcaggaaat
tcagggagac gggaagttac tatctactaa 1200 aagccaaaca atttcttaca
gttttactct ctctactcta gagtagcttg gcactggccg 1260 tcgttttaca
acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag 1320
cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc
1380 aacagttgcg cagcctgaat ggcgaatggc gcctgatgcg gtattttctc
cttacgcatc 1440 tgtgcggtat ttcacaccgc atatggtgca ctctcagtac
aatctgctct gatgccgcat 1500 agttaagcca gccccgacac ccgccaacac
ccgctgacgc gccctgacgg gcttgtctgc 1560 tcccggcatc cgcttacaga
caagctgtga ccgtctccgg gagctgcatg tgtcagaggt 1620 tttcaccgtc
atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc ctatttttat 1680
aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt cggggaaatg
1740 tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat
ccgctcatga 1800 gacaataacc ctgataaatg cttcaataat attgaaaaag
gaagagtatg agtattcaac 1860 atttccgtgt cgcccttatt cccttttttg
cggcattttg ccttcctgtt tttgctcacc 1920 cagaaacgct ggtgaaagta
aaagatgctg aagatcagtt gggtgcacga gtgggttaca 1980 tcgaactgga
tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 2040
caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg
2100 ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt
gagtactcac 2160 cagtcacaga aaagcatctt acggatggca tgacagtaag
agaattatgc agtgctgcca 2220 taaccatgag tgataacact gcggccaact
tacttctgac aacgatcgga ggaccgaagg 2280 agctaaccgc ttttttgcac
aacatggggg atcatgtaac tcgccttgat cgttgggaac 2340 cggagctgaa
tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg 2400
caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat
2460 taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg
gcccttccgg 2520 ctggctggtt tattgctgat aaatctggag ccggtgagcg
tgggtctcgc ggtatcattg 2580 cagcactggg gccagatggt aagccctccc
gtatcgtagt tatctacacg acggggagtc 2640 aggcaactat ggatgaacga
aatagacaga tcgctgagat aggtgcctca ctgattaagc 2700 attggtaact
gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 2760
tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt
2820 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa
ggatcttctt 2880 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac
aaaaaaacca ccgctaccag 2940 cggtggtttg tttgccggat caagagctac
caactctttt tccgaaggta actggcttca 3000 gcagagcgca gataccaaat
actgtccttc tagtgtagcc gtagttaggc caccacttca 3060 agaactctgt
agcaccgcct acatacctcg
ctctgctaat cctgttacca gtggctgctg 3120 ccagtggcga taagtcgtgt
cttaccgggt tggactcaag acgatagtta ccggataagg 3180 cgcagcggtc
gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 3240
acaccgaact gagataccta cagcgtgagc attgagaaag cgccacgctt cccgaaggga
3300 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc
acgagggagc 3360 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg
gtttcgccac ctctgacttg 3420 agcgtcgatt tttgtgatgc tcgtcagggg
ggcggagcct atggaaaaac gccagcaacg 3480 cggccttttt acggtcctgg
ccttttgctg gccttttgct cacatgtctt tcctgcgtta 3540 tcccctgatt
ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 3600
agccgaaccg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg
3660 caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg
acaggtttcc 3720 cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg
agttagctca ctcattaggc 3780 accccaggct ttacacttta tgcttccggc
tcgtatgttg tgtggaattg tgagcggata 3840 acaatttcac acaggaaaca
gctatgacat gattaccg 3878 28 47 DNA Artificial Sequence Synthetic
expression vector fragment 28 gatccttatt agatctgctt ggcgccatcc
tcaatttggg ggttgag 47 29 47 DNA Artificial Sequence Synthetic
expression vector fragment 29 tcgactcaac ccccaaattg aggatggcgc
caagcagatc taataag 47 30 3883 DNA Artificial Sequence Synthetic
expression vector 30 ttgcaggaca ggatgtggtg cccgatgtga ctagctcttt
gctgcaggcc gtcctatcct 60 tggttccgat aagagaccca gaactccggc
cccccaccgc ccaccgccac ccccatacat 120 atgtggtacg caagtaagag
tgcctgcgca tgccccatgt gccccaccaa gagctttgca 180 tcccatacaa
gtccccaaag tggagaaccg aaccaattct tcgcgggcag aacaaaagct 240
tctgcacacg tctccactcg aatttggagc cggccggcgt gtgcaaaaga ggtgaatcga
300 acgaaagacc cgtgtgtaaa gccgcgtttc caaaatgtat aaaaccgaga
gcatctggcc 360 aatgtgcatc agttgtggtc agcagcaaaa tcaagtgaat
catctcagtg caactaaagg 420 ggaattcgag ctcggtaccc ggggatcctt
attagatctg cttggcgcca tcctcaattt 480 gggggttgag tcgacctgca
ggcatgcaag ctattcgatg cacactcaca ttcttctcct 540 aatacgataa
taaaactttc catgaaaaat atggaaaaat atatgaaaat tgagaaatcc 600
aaaaaactga taaacgctct acttaattaa aatagataaa tgggagcggc aggaatggcg
660 gagcatggcc aagttcctcc gccaatcagt cgtaaaacag aagtcgtgga
aagcggatag 720 aaagaatgtt cgatttgacg ggcaagcatg tctgctatgt
ggcggattgc ggaggaattg 780 cactggagac cagcaaggtt ctcatgacca
agaatatagc ggtgagtgag cgggaagctc 840 ggtttctgtc cagatcgaac
tcaaaactag tccagccagt cgctgtcgaa actaattaag 900 ttaatgagtt
tttcatgtta gtttcgcgct gagcaacaat taagtttatg tttcagttcg 960
gcttagattt cgctgaagga cttgccactt tcaatcaata ctttagaaca aaatcaaaac
1020 tcattctaat agcttggtgt tcatcttttt ttttaatgat aagcattttg
tcgtttatac 1080 tttttatatt tcgatattaa accacctatg aagtctattt
taatcgccag ataagcaata 1140 tattgtgtaa atatttgtat tctttatcag
gaaattcagg gagacgggaa gttactatct 1200 actaaaagcc aaacaatttc
ttacagtttt actctctcta ctctagagta gcttggcact 1260 ggccgtcgtt
ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct 1320
tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc
1380 ttcccaacag ttgcgcagcc tgaatggcga atggcgcctg atgcggtatt
ttctccttac 1440 gcatctgtgc ggtatttcac accgcatatg gtgcactctc
agtacaatct gctctgatgc 1500 cgcatagtta agccagcccc gacacccgcc
aacacccgct gacgcgccct gacgggcttg 1560 tctgctcccg gcatccgctt
acagacaagc tgtgaccgtc tccgggagct gcatgtgtca 1620 gaggttttca
ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt 1680
tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg
1740 aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata
tgtatccgct 1800 catgagacaa taaccctgat aaatgcttca ataatattga
aaaaggaaga gtatgagtat 1860 tcaacatttc cgtgtcgccc ttattccctt
ttttgcggca ttttgccttc ctgtttttgc 1920 tcacccagaa acgctggtga
aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 1980 ttacatcgaa
ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg 2040
ttttccaatg atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga
2100 cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact
tggttgagta 2160 ctcaccagtc acagaaaagc atcttacgga tggcatgaca
gtaagagaat tatgcagtgc 2220 tgccataacc atgagtgata acactgcggc
caacttactt ctgacaacga tcggaggacc 2280 gaaggagcta accgcttttt
tgcacaacat gggggatcat gtaactcgcc ttgatcgttg 2340 ggaaccggag
ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc 2400
aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca
2460 acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc
gctcggccct 2520 tccggctggc tggtttattg ctgataaatc tggagccggt
gagcgtgggt ctcgcggtat 2580 cattgcagca ctggggccag atggtaagcc
ctcccgtatc gtagttatct acacgacggg 2640 gagtcaggca actatggatg
aacgaaatag acagatcgct gagataggtg cctcactgat 2700 taagcattgg
taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 2760
tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat
2820 cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga
tcaaaggatc 2880 ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg
caaacaaaaa aaccaccgct 2940 accagcggtg gtttgtttgc cggatcaaga
gctaccaact ctttttccga aggtaactgg 3000 cttcagcaga gcgcagatac
caaatactgt ccttctagtg tagccgtagt taggccacca 3060 cttcaagaac
tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc 3120
tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga
3180 taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct
tggagcgaac 3240 gacctacacc gaactgagat acctacagcg tgagcattga
gaaagcgcca cgcttcccga 3300 agggagaaag gcggacaggt atccggtaag
cggcagggtc ggaacaggag agcgcacgag 3360 ggagcttcca gggggaaacg
cctggtatct ttatagtcct gtcgggtttc gccacctctg 3420 acttgagcgt
cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 3480
caacgcggcc tttttacggt cctggccttt tgctggcctt ttgctcacat gtctttcctg
3540 cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
gataccgctc 3600 gccgcagccg aaccgaccga gcgcagcgag tcagtgagcg
aggaagcgga agagcgccca 3660 atacgcaaac cgcctctccc cgcgcgttgg
ccgattcatt aatgcagctg gcacgacagg 3720 tttcccgact ggaaagcggg
cagtgagcgc aacgcaatta atgtgagtta gctcactcat 3780 taggcacccc
aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 3840
ggataacaat ttcacacagg aaacagctat gacatgatta ccg 3883 31 879 DNA
Homo Sapiens 31 gaattcatgg gccacacacg gaggcaggga acatcaccat
ccaagtgtcc atacctcaat 60 ttctttcagc tcttggtgct ggctggtctt
tctcacttct gttcaggtgt tatccacgtg 120 accaaggaag tgaaagaagt
ggcaacgctg tcctgtggtc acaatgtttc tgttgaagag 180 ctggcacaaa
ctcgcatcta ctggcaaaag gagaagaaaa tggtgctgac tatgatgtct 240
ggggacatga atatatggcc cgagtacaag aaccggacca tctttgatat cactaataac
300 ctctccattg tgatcctggc tctgcgccca tctgacgagg gcacatacga
gtgtgttgtt 360 ctgaagtatg aaaaagacgc tttcaagcgg gaacacctgg
ctgaagtgac gttatcagtc 420 aaagctgact tccctacacc tagtatatct
gactttgaaa ttccaacttc taatattaga 480 aggataattt gctcaacctc
tggaggtttt ccagagcctc acctctcctg gttggaaaat 540 ggagaagaat
taaatgccat caacacaaca gtttcccaag atcctgaaac tgagctctat 600
gctgttagca gcaaactgga tttcaatatg acaaccaacc acagcttcat gtgtctcatc
660 aagtatggac atttaagagt gaatcagacc ttcaactgga atacaaccaa
gcaagagcat 720 tttcctgata acctgctccc atcctgggcc attaccttaa
tctcagtaaa tggaattttt 780 gtgatatgct gcctgaccta ctgctttgcc
ccaagatgca gagagagaag gaggaatgag 840 agattgagaa gggaaagtgt
acgccctgta taaggattc 879 32 738 DNA Homo Sapiens 32 gaattcatgg
gccacacacg gaggcaggga acatcaccat ccaagtgtcc atacctcaat 60
ttctttcagc tcttggtgct ggctggtctt tctcacttct gttcaggtgt tatccacgtg
120 accaaggaag tgaaagaagt ggcaacgctg tcctgtggtc acaatgtttc
tgttgaagag 180 ctggcacaaa ctcgcatcta ctggcaaaag gagaagaaaa
tggtgctgac tatgatgtct 240 ggggacatga atatatggcc cgagtacaag
aaccggacca tctttgatat cactaataac 300 ctctccattg tgatcctggc
tctgcgccca tctgacgagg gcacatacga gtgtgttgtt 360 ctgaagtatg
aaaaagacgc tttcaagcgg gaacacctgg ctgaagtgac gttatcagtc 420
aaagctgact tccctacacc tagtatatct gactttgaaa ttccaacttc taatattaga
480 aggataattt gctcaacctc tggaggtttt ccagagcctc acctctcctg
gttggaaaat 540 ggagaagaat taaatgccat caacacaaca gtttcccaag
atcctgaaac tgagctctat 600 gctgttagca gcaaactgga tttcaatatg
acaaccaacc acagcttcat gtgtctcatc 660 aagtatggac atttaagagt
gaatcagacc ttcaactgga atacaaccaa gcaagagcat 720 tttcctgata acggattc
738 33 1002 DNA Homo Sapiens 33 gagctcatgg atccccagtg cactatggga
ctgagtaaca ttctctttgt gatggccttc 60 ctgctctctg gtgctgctcc
tctgaagatt caagcttatt tcaatgagac tgcagacctg 120 ccatgccaat
ttgcaaactc tcaaaaccaa agcctgagtg agctagtagt attttggcag 180
gaccaggaaa acttggttct gaatgaggta tacttaggca aagagaaatt tgacagtgtt
240 cattccaagt atatgggccg cacaagtttt gattcggaca gttggaccct
gagacttcac 300 aatcttcaga tcaaggacaa gggcttgtat caatgtatca
tccatcacaa aaagcccaca 360 ggaatgattc gcatccacca gatgaattct
gaactgtcag tgcttgctaa cttcagtcaa 420 cctgaaatag taccaatttc
taatataaca gaaaatgtgt acataaattt gacctgctca 480 tctatacacg
gttacccaga acctaagaag atgagtgttt tgctaagaac caagaattca 540
actatcgagt atgatggtat tatgcagaaa tctcaagata atgtcacaga actgtacgac
600 gtttccatca gcttgtctgt ttcattccct gatgttacga gcaatatgac
catcttctgt 660 attctggaaa ctgacaagac gcggctttta tcttcacctt
tctctataga gcttgaggac 720 cctcagcctc ccccagacca cattccttgg
attacagctg tacttccaac agttattata 780 tgtgtgatgg ttttctgtct
aattctatgg aaatggaaga agaagaagcg gcctcgcaac 840 tcttataaat
gtggaaccaa cacaatggag agggaagaga gtgaacagac caagaaaaga 900
gaaaaaatcc atatacctga aagatctgat gaagcccagc gtgtttttaa aagttcgaag
960 acatcttcat gcgacaaaag tgatacatgt ttttaagggc cc 1002 34 751 DNA
Homo Sapiens 34 gagctcatgg atccccagtg cactatggga ctgagtaaca
ttctctttgt gatggccttc 60 ctgctctctg gtgctgctcc tctgaagatt
caagcttatt tcaatgagac tgcagacctg 120 ccatgccaat ttgcaaactc
tcaaaaccaa agcctgagtg agctagtagt attttggcag 180 gaccaggaaa
acttggttct gaatgaggta tacttaggca aagagaaatt tgacagtgtt 240
cattccaagt atatgggccg cacaagtttt gattcggaca gttggaccct gagacttcac
300 aatcttcaga tcaaggacaa gggcttgtat caatgtatca tccatcacaa
aaagcccaca 360 ggaatgattc gcatccacca gatgaattct gaactgtcag
tgcttgctaa cttcagtcaa 420 cctgaaatag taccaatttc taatataaca
gaaaatgtgt acataaattt gacctgctca 480 tctatacacg gttacccaga
acctaagaag atgagtgttt tgctaagaac caagaattca 540 actatcgagt
atgatggtat tatgcagaaa tctcaagata atgtcacaga actgtacgac 600
gtttccatca gcttgtctgt ttcattccct gatgttacga gcaatatgac catcttctgt
660 attctggaaa ctgacaagac gcggctttta tcttcacctt tctctataga
gcttgaggac 720 cctcagcctc ccccagacca cattggggcc c 751 35 1611 DNA
Homo Sapiens 35 gaattcatgg ctcccagcag cccccggccc gcgctgcccg
cactcctggt cctgctcggg 60 gctctgttcc caggacctgg caatgcccag
acatctgtgt ccccctcaaa agtcatcctg 120 ccccggggag gctccgtgct
ggtgacatgc agcacctcct gtgaccagcc caagttgttg 180 ggcatagaga
ccccgttgcc taaaaaggag ttgctcctgc ctgggaacaa ccggaaggtg 240
tatgaactga gcaatgtgca agaagatagc caaccaatgt gctattcaaa ctgccctgat
300 gggcagtcaa cagctaaaac cttcctcacc gtgtactgga ctccagaacg
ggtggaactg 360 gcacccctcc cctcttggca gccagtgggc aagaacctta
ccctacgctg ccaggtggag 420 ggtggggcac cccgggccaa cctcaccgtg
gtgctgctcc gtggggagaa ggagctgaaa 480 cgggagccag ctgtggggga
gcccgctgag gtcacgacca cggtgctggt gaggagagat 540 caccatggag
ccaatttctc gtgccgcact gaactggacc tgcggcccca agggctggag 600
ctgtttgaga acacctcggc cccctaccag ctccagacct ttgtcctgcc agcgactccc
660 ccacaacttg tcagcccccg ggtcctagag gtggacacgc aggggaccgt
ggtctgttcc 720 ctggacgggc tgttcccagt ctcggaggcc caggtccacc
tggcactggg ggaccagagg 780 ttgaacccca cagtcaccta tggcaacgac
tccttctcgg ccaaggcctc agtcagtgtg 840 accgcagagg acgagggcac
ccagcggctg acgtgtgcag taatactggg gaaccagagc 900 caggagacac
tgcagacagt gaccatctac agctttccgg cgcccaacgt gattctgacg 960
aagccagagg tctcagaagg gaccgaggtg acagtgaagt gtgaggccca ccctagagcc
1020 aaggtgacgc tgaatggggt tccagcccag ccactgggcc cgagggccca
gctcctgctg 1080 aaggccaccc cagaggacaa cgggcgcagc ttctcctgct
ctgcaaccct ggaggtggcc 1140 ggccagctta tacacaagaa ccagacccgg
gagcttcgtg tcctgtatgg cccccgactg 1200 gacgagaggg attgtccggg
aaactggacg tggccagaaa attcccagca gactccaatg 1260 tgccaggctt
gggggaaccc attgcccgag ctcaagtgtc taaaggatgg cactttccca 1320
ctgcccatcg gggaatcagt gactgtcact cgagatcttg agggcaccta cctctgtcgg
1380 gccaggagca ctcaagggga ggtcacccgc gaggtgaccg tgaatgtgct
ctccccccgg 1440 tatgagattg tcatcatcac tgtggtagca gccgcagtca
taatgggcac tgcaggcctc 1500 agcacgtacc tctataaccg ccagcggaag
atcaagaaat acagactaca acaggcccaa 1560 aaagggaccc ccatgaaacc
gaacacacaa gccacgcctc cctgaggatc c 1611 36 1452 DNA Homo Sapiens 36
gaattcatgg ctcccagcag cccccggccc gcgctgcccg cactcctggt cctgctcggg
60 gctctgttcc caggacctgg caatgcccag acatctgtgt ccccctcaaa
agtcatcctg 120 ccccggggag gctccgtgct ggtgacatgc agcacctcct
gtgaccagcc caagttgttg 180 ggcatagaga ccccgttgcc taaaaaggag
ttgctcctgc ctgggaacaa ccggaaggtg 240 tatgaactga gcaatgtgca
agaagatagc caaccaatgt gctattcaaa ctgccctgat 300 gggcagtcaa
cagctaaaac cttcctcacc gtgtactgga ctccagaacg ggtggaactg 360
gcacccctcc cctcttggca gccagtgggc aagaacctta ccctacgctg ccaggtggag
420 ggtggggcac cccgggccaa cctcaccgtg gtgctgctcc gtggggagaa
ggagctgaaa 480 cgggagccag ctgtggggga gcccgctgag gtcacgacca
cggtgctggt gaggagagat 540 caccatggag ccaatttctc gtgccgcact
gaactggacc tgcggcccca agggctggag 600 ctgtttgaga acacctcggc
cccctaccag ctccagacct ttgtcctgcc agcgactccc 660 ccacaacttg
tcagcccccg ggtcctagag gtggacacgc aggggaccgt ggtctgttcc 720
ctggacgggc tgttcccagt ctcggaggcc caggtccacc tggcactggg ggaccagagg
780 ttgaacccca cagtcaccta tggcaacgac tccttctcgg ccaaggcctc
agtcagtgtg 840 accgcagagg acgagggcac ccagcggctg acgtgtgcag
taatactggg gaaccagagc 900 caggagacac tgcagacagt gaccatctac
agctttccgg cgcccaacgt gattctgacg 960 aagccagagg tctcagaagg
gaccgaggtg acagtgaagt gtgaggccca ccctagagcc 1020 aaggtgacgc
tgaatggggt tccagcccag ccactgggcc cgagggccca gctcctgctg 1080
aaggccaccc cagaggacaa cgggcgcagc ttctcctgct ctgcaaccct ggaggtggcc
1140 ggccagctta tacacaagaa ccagacccgg gagcttcgtg tcctgtatgg
cccccgactg 1200 gacgagaggg attgtccggg aaactggacg tggccagaaa
attcccagca gactccaatg 1260 tgccaggctt gggggaaccc attgcccgag
ctcaagtgtc taaaggatgg cactttccca 1320 ctgcccatcg gggaatcagt
gactgtcact cgagatcttg agggcaccta cctctgtcgg 1380 gccaggagca
ctcaagggga ggtcacccgc gaggtgaccg tgaatgtgct ctccccccgg 1440
tatgagggat cc 1452 37 726 DNA Homo Sapiens 37 gagctcatgg ttgctgggag
cgacgcgggg cgggccctgg gggtcctcag cgtggtctgc 60 ctgctgcact
gctttggttt catcagctgt ttttcccaac aaatatatgg tgttgtgtat 120
gggaatgtaa ctttccatgt accaagcaat gtgcctttaa aagaggtcct atggaaaaaa
180 caaaaggata aagttgcaga actggaaaat tctgaattca gagctttctc
atcttttaaa 240 aatagggttt atttagacac tgtgtcaggt agcctcacta
tctacaactt aacatcatca 300 gatgaagatg agtatgaaat ggaatcgcca
aatattactg ataccatgaa gttctttctt 360 tatgtgcttg agtctcttcc
atctcccaca ctaacttgtg cattgactaa tggaagcatt 420 gaagtccaat
gcatgatacc agagcattac aacagccatc gaggacttat aatgtactca 480
tgggattgtc ctatggagca atgtaaacgt aactcaacca gtatatattt taagatggaa
540 aatgatcttc cacaaaaaat acagtgtact cttagcaatc cattatttaa
tacaacatca 600 tcaatcattt tgacaacctg tatcccaagc agcggtcatt
caagacacag atatgcactt 660 atacccatac cattagcagt aattacaaca
tgtattgtgc tgtatatgaa tgttctttaa 720 ggatcc 726 38 657 DNA Homo
Sapiens 38 gagctcatgg ttgctgggag cgacgcgggg cgggccctgg gggtcctcag
cgtggtctgc 60 ctgctgcact gctttggttt catcagctgt ttttcccaac
aaatatatgg tgttgtgtat 120 gggaatgtaa ctttccatgt accaagcaat
gtgcctttaa aagaggtcct atggaaaaaa 180 caaaaggata aagttgcaga
actggaaaat tctgaattca gagctttctc atcttttaaa 240 aatagggttt
atttagacac tgtgtcaggt agcctcacta tctacaactt aacatcatca 300
gatgaagatg agtatgaaat ggaatcgcca aatattactg ataccatgaa gttctttctt
360 tatgtgcttg agtctcttcc atctcccaca ctaacttgtg cattgactaa
tggaagcatt 420 gaagtccaat gcatgatacc agagcattac aacagccatc
gaggacttat aatgtactca 480 tgggattgtc ctatggagca atgtaaacgt
aactcaacca gtatatattt taagatggaa 540 aatgatcttc cacaaaaaat
acagtgtact cttagcaatc cattatttaa tacaacatca 600 tcaatcattt
tgacaacctg tatcccaagc agcggtcatt caagacacag aggatcc 657 39 23 PRT
Artificial Sequence Synthetic ovalbumin antigenic peptide 39 Gln
Leu Glu Ser Ile Ile Asn Phe Glu Lys Leu Thr Glu Trp Thr Ser 1 5 10
15 Ser Asn Val Met Glu Glu Arg 20 40 10 PRT Artificial Sequence
Synthetic vesicular stomatitis antigenic peptide 40 Asp Leu Arg Gly
Tyr Val Tyr Gln Gly Leu 1 5 10 41 9 PRT Artificial Sequence
Synthetic HIV antigenic peptide 41 Phe Arg Ile Gly Cys Arg His Ser
Arg 1 5 42 9 PRT Artificial Sequence Synthetic HIV antigenic
peptide 42 Ile Leu Lys Glu Pro Val His Gly Val 1 5 43 32 DNA
Artificial Sequence Synthetic PCR primer (SPP) 43 atatggatcc
tcaccatctc agggtgaggg gc 32 44 10 PRT Artificial Sequence Synthetic
vesicular stomatitis antigenic peptide 44 Arg Gly Tyr Val Tyr Gln
Gly Leu Lys Ser 1 5 10 45 9 PRT Artificial Sequence Synthetic
Sendai virus antigenic peptide 45 Phe Ala Pro Gly Asn Tyr Pro Ala
Leu 1 5 46 34 DNA Artificial Sequence Synthetic PCR primer (SPP) 46
tttagaattc accatggctt caacccgtgc caag 34 47 31 DNA Artificial
Sequence Synthetic PCR primer (SPP) 47 tttagtcgac tcagggaggt
ggggcttgtc c 31 48 34 DNA Artificial Sequence Synthetic PCR primer
(SPP) 48 tttagaattc accatggctt gcaattgtca gttg 34 49 31 DNA
Artificial Sequence Synthetic PCR primer (SPP) 49 tttagtcgac
ctaaaggaag acggtctgtt c 31 50 36 DNA Artificial Sequence Synthetic
PCR primer (SPP) 50 tttagaattc accatggacc ccagatgcac catggg 36 51
34 DNA Artificial Sequence Synthetic PCR primer (SPP) 51 tttagtcgac
tcactctgca tttggttttg ctga 34 52 33 DNA Artificial Sequence
Synthetic PCR primer (SPP) 52 acccttgaat ccatgggcca cacacggagg cag
33 53 39 DNA Artificial Sequence Synthetic PCR primer (SPP) 53
attaccggat ccttatacag ggcgtacact ttcccttct 39 54 33 DNA
Artificial Sequence Synthetic PCR primer (SPP) 54 acccttgagc
tcatggatcc ccagtgcact atg 33 55 42 DNA Artificial Sequence
Synthetic PCR primer (SPP) 55 attacccccg ggttaaaaac atgtatcact
tttgtcgcat ga 42 56 36 DNA Artificial Sequence Synthetic PCR primer
(SPP) 56 acccttgagc tcatggttgc tgggagcgac gcgggg 36 57 42 DNA
Artificial Sequence Synthetic PCR primer (SPP) 57 attaccggat
ccttaaagaa cattcatata cagcacaata ca 42 58 36 DNA Artificial
Sequence Synthetic PCR Primer (SPP) 58 acccttgaat tcatggctcc
cagcagcccc cggccc 36 59 39 DNA Artificial Sequence Synthetic PCR
Primer (SPP) 59 attaccggat cctcagggag gcgtggcttg tgtgttcgg 39
* * * * *