U.S. patent application number 09/891943 was filed with the patent office on 2003-04-24 for novel human beta2 integrin alpha subunit.
This patent application is currently assigned to ICOS Corporation. Invention is credited to Gallatin, W. Michael, Van der Vieren, Monica.
Application Number | 20030077278 09/891943 |
Document ID | / |
Family ID | 46256170 |
Filed Date | 2003-04-24 |
United States Patent
Application |
20030077278 |
Kind Code |
A1 |
Gallatin, W. Michael ; et
al. |
April 24, 2003 |
Novel human beta2 integrin alpha subunit
Abstract
Methods to inhibit inflammation and macrophage infiltration
following spinal cord injury are disclosed along with methods to
modulate TNF.alpha. release from cells expressing .alpha..sub.d are
disclosed.
Inventors: |
Gallatin, W. Michael;
(Mercer Island, WA) ; Van der Vieren, Monica;
(Seattle, WA) |
Correspondence
Address: |
MARSHALL, O'TOOLE, GERSTEIN, MURRAY & BORUN
6300 SEARS TOWER
233 SOUTH WACKER DRIVE
CHICAGO
IL
60606-6402
US
|
Assignee: |
ICOS Corporation
|
Family ID: |
46256170 |
Appl. No.: |
09/891943 |
Filed: |
June 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09891943 |
Jun 26, 2001 |
|
|
|
09193043 |
Nov 16, 1998 |
|
|
|
09193043 |
Nov 16, 1998 |
|
|
|
08943363 |
Oct 3, 1997 |
|
|
|
08943363 |
Oct 3, 1997 |
|
|
|
08605672 |
Feb 22, 1996 |
|
|
|
08605672 |
Feb 22, 1996 |
|
|
|
08362652 |
Dec 21, 1994 |
|
|
|
08362652 |
Dec 21, 1994 |
|
|
|
08286889 |
Aug 5, 1994 |
|
|
|
08286889 |
Aug 5, 1994 |
|
|
|
08173497 |
Dec 23, 1993 |
|
|
|
Current U.S.
Class: |
424/144.1 ;
435/334 |
Current CPC
Class: |
A01K 2217/05 20130101;
A61K 2039/505 20130101; C07K 2319/00 20130101; G01N 2333/70553
20130101; C07K 14/70553 20130101; C07K 16/2845 20130101; C12Q
1/6818 20130101; A61K 38/00 20130101; G01N 33/6893 20130101 |
Class at
Publication: |
424/144.1 ;
435/334 |
International
Class: |
A61K 039/395; C12N
005/06 |
Claims
What is claimed is:
1. A method for inhibiting macrophage infiltration at the site of a
central nervous system injury comprising the step of administering
to an individual an effective amount of an anti-.alpha..sub.d
monoclonal antibody.
2. The method according to claim I wherein the anti-.alpha..sub.d
monoclonal antibody blocks binding between .alpha..sub.d and a
binding partner.
3. The method according to claim 2 wherein the binding partner is
VCAM-1.
4. The method according to claim 1 where the anti-.alpha..sub.d
monoclonal antibody is selected from the group consisting of the
monoclonal antibody secreted by hybridoma 226H and the monoclonal
antibody secreted by hybridoma 236L.
5. The method according to any one of claims 1 through 4 wherein
the central nervous system injury is a spinal cord injury.
6. A method for reducing inflammation at the site of a central
nervous system injury comprising the step of administering to an
individual an effective amount of an anti-.alpha..sub.d monoclonal
antibody.
7. The method according to claim 6 wherein the anti-.alpha..sub.d
monoclonal antibody blocks binding between .alpha..sub.d and a
binding partner.
8. The method according to claim 7 wherein the binding partner is
VCAM-1.
9. The method according to claim 6 where the anti-.alpha..sub.d
monoclonal antibody is selected from the group consisting of the
monoclonal antibody secreted by hybridoma 226H and the monoclonal
antibody secreted by hybridoma 236L.
10. The method according to any one of claims 6 through 9 wherein
the central nervous system injury is a spinal cord injury.
11. A method for modulating TNF.alpha. release from macrophages
comprising the step of contacting said macrophages with an
affective amount of an immunospecific ad monoclonal antibody.
12. A method for modulating TNF.alpha. release from splenic
phagocytes comprising the step of contacting said phagocytes with
an affective amount of an immunospecific .alpha..sub.d monoclonal
antibody.
13. The method according to claim 12 where in the
anti-.alpha..sub.d monoclonal antibody inhibits TNF.alpha.
release.
14. The method according to claim 13 wherein the immunospecific
anti-.alpha..sub.d monoclonal antibody is selected from the group
consisting of the monoclonal antibody secreted by hybridoma 205C
and the monoclonal antibody secreted by hybridoma 205E.
Description
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No: 08/943,363 filed Oct. 3, 1997, which is
pending, which a continuation-in-part of U.S. patent application
Ser. No. 08/605,672, filed Feb. 22, 1996, which issued as U.S. Pat.
No. 5,817,515 on Oct. 6, 1998, which is a continuation-in-part of
U.S. application Ser. No. 08/362,652, filed Dec. 21, 1994, which
issued as U.S. Pat. No. 5,766,850 on Jun. 16, 1998, which is a
continuation-in-part of U.S. application Ser. No. 08/286,889, filed
Aug. 5, 1994, which issued as U.S. Pat. No. 5,470,953 on Nov. 28,
1995, which in turn is a continuation-in-part of U.S. application
Ser. No. 08/173,497, filed Dec. 23, 1993, which issued as U.S. Pat.
No. 5,437,958 on Aug. 1, 1995.
BACKGROUND OF THE INVENTION
[0002] The integrins are a class of membrane-associated molecules
which actively participate in cellular adhesion. Integrins are
transmembrane heterodimers comprising an .alpha. subunit in
noncovalent association with a .beta. subunit. To date, at least
fourteen a subunits and eight .beta. subunits have been identified
[reviewed in Springer, Nature 346:425-434 (1990)]. The .beta.
subunits are generally capable of association with more than one
.alpha. subunit and the heterodimers sharing a common .beta.
subunit have been classified as subfamilies within the integrin
population.
[0003] One class of human integrins, restricted to expression in
white blood cells, is characterized by a common .beta..sub.2
subunit. As a result of this cell-specific expression, these
integrins are commonly referred to as the leukocyte integrins,
Leu-CAMs or leukointegins. Because of the common .beta..sub.2
subunit, an alternative designation of this class is the
.beta..sub.2 integrins. The .beta..sub.2 subunit (CD18) has
previously been isolated in association with one of three distinct
.alpha. subunits, CD11a, CD11b or CD11c. The isolation of a cDNA
encoding human CD18 is described in Kishimoto, et al., Cell
48:681-690 (1987). In official WHO nomenclature, the heterodimeric
proteins are referred to as CD11a/CD18, CD11b/CD18, and CD11c/CD18;
in common nomenclature they are referred to as LFA-1, Mac-1 or Mo1
and p150,95 or LeuM5, respectively [Cobbold, et al., in Leukocyte
Typing III, McMichael (ed), Oxford Press, p.788 (1987)]. The human
.beta..sub.2 integrin .alpha. subunits CD11a, CD11b and CD11c have
been demonstrated to migrate under reducing condition in
electrophoresis with apparent molecular weights of approximately
180 kD, 155 kD and 150 kD, respectively, and DNAs encoding these
subunits have been cloned [CD11a, Larson, et al., J. Cell Biol.
108:703-712 (1989); CD11b, Corbi, et al., J. Biol. Chem.
263:12403-12411 (1988) and CD11c, Corbi, et al. EMBO J. 6:4023-4028
(1987)]. Putative homologs of the human .beta..sub.2 integrin
.alpha. and .beta. chains, defined by approximate similarity in
molecular weight, have been variously identified in other species
including monkeys and other primates [Letvin, et al., Blood
61:408-410 (1983)], mice [Sanchez-Madrid, et al., J. Exp. Med.
154:1517 (1981)], and dogs [Moore, et al., Tissue Antigens
36:211-220 (1990)].
[0004] The absolute molecular weights of presumed homologs from
other species have been shown to vary significantly [see, e.g.,
Danilenko et al., Tissue Antigens 40:13-21 (1992)], and in the
absence of sequence information, a definitive correlation between
human integrin subunits and those identified in other species has
not been possible. Moreover, variation in the number of members in
a protein family has been observed between different species.
Consider, for example, that more IgA isotypes have been isolated in
rabbits than in humans [Burnett, et al., EMBO J.8:4041-4047 (1989)
and Schneiderman, et al., Proc. Natl. Acad. Sci. (USA) 86:7561-7565
(1989)]. Similarly, in humans, at least six variants of the
metallothionine protein have been previously identified [Karin and
Richards, Nature 299:797-802 (1982) and Varshney, et al., Mol.
Cell. Biol. 6:26-37, (1986)], whereas in the mouse, only two such
variants are in evidence [Searle, et al., Mol. Cell. Biol.
4:1221-1230 (1984)]. Therefore, existence of multiple members of a
protein family in one species does not necessarily imply that
corresponding family members exist in another species.
[0005] In the specific context of .beta..sub.2 integrins, in dogs
it has been observed that the presumed canine .beta..sub.2
counterpart to the human CD18 is capable of dimer formation with as
many as four potentially distinct .alpha. subunits [Danilenko, et
al., supra]. Antibodies generated by immunizing mice with canine
splenocytes resulted in monoclonal antibodies which
immunoprecipitated proteins tentatively designated as canine
homologs to human CD18, CD11a, CD11b and CD11c based mainly on
similar, but not identical, molecular weights. Another anti-canine
splenocyte antibody, Ca11.8H2, recognized and immunoprecipitated a
fourth .alpha.-like canine subunit also capable of association with
the .beta..sub.2 subunit, but having a unique molecular weight and
restricted in expression to a subset of differentiated tissue
macrophages.
[0006] Antibodies generated by immunization of hamsters with murine
dendritic cells resulted in two anti-integrin antibodies [Metlay,
et al., J. Exp. Med 171:1753-1771 (1990)]. One antibody, 2E6,
immunoprecipitated a predominant heterodimer with subunits having
approximate molecular weights of 180 kD and 90 kD in addition to
minor bands in the molecular weight range of 150-160 kD. The second
antibody, N418, precipitated another apparent heterodimer with
subunits having approximate molecular weights of 150 kD and 90 Kd.
Based on cellular adhesion blocking studies, it was hypothesized
that antibody 2E6 recognized a murine counterpart to human CD18.
While the molecular weight of the N418 antigen suggested
recognition of a murine homolog to human CD11c/CD18, further
analysis indicated that the murine antigen exhibited a tissue
distribution pattern which was inconsistent with that observed for
human CD11c/CD18.
[0007] The antigens recognized by the canine Ca11.8H2 antibody and
the murine N418 antibody could represent a variant species (e.g., a
glycosylation or splice variant) of a previously identified canine
or murine .alpha. subunit. Alternatively, these antigens may
represent unique canine and murine integrin .alpha. subunits. In
the absence of specific information regarding primary structure,
these alternatives cannot be distinguished.
[0008] In humans, CD11a/CD18 is expressed on all leukocytes.
CD11b/CD18 and CD11c/CD18 are essentially restricted to expression
on monocytes, granulocytes, macrophages and natural killer (NK)
cells, but CD11c/CD18 is also detected on some B-cell types. In
general, CD11a/CD18 predominates on lymphocytes, CD11b/CD18 on
granulocytes and CD11c/CD18 on macrophages [see review, Arnaout,
Blood 75:1037-1050 (1990)]. Expression of the .alpha. chains,
however, is variable with regard to the state of activation and
differentiation of the individual cell types [See review, Larson
and Springer, Immunol.Rev. 114:181-217 (1990).]
[0009] The involvement of the .beta..sub.2 integrins in human
immune and inflammatory responses has been demonstrated using
monoclonal antibodies which are capable of blocking .beta..sub.2
integrin-associated cell adhesion. For example, CD11 a/CD18,
CD11b/CD18 and CD11c/CD18 actively participate in natural killer
(NK) cell binding to lymphoma and adenocarcinoma cells [Patarroyo,
et al., Immunol.Rev. 114:67-108 (1990)], granulocyte accumulation
[Nourshargh, et al., J. Immunol. 142:3193-3198 (1989)],
granulocyte-independent plasma leakage [Arfors, et al., Blood
69:338-340 (1987)], chemotactic response of stimulated leukocytes
[Arfors, et al., supra] and leukocyte adhesion to vascular
endothelium [Price, et al., J. Immunol. 139:4174-4177 (1987) and
Smith, et al., J. Clin. Invest. 83:2008-2017 (1989)]. The
fundamental role of .beta..sub.2 integrins in immune and
inflammatory responses is made apparent in the clinical syndrome
referred to as leukocyte adhesion deficiency (LAD), wherein
clinical manifestations include recurrent and often life
threatening bacterial infections. LAD results from heterogeneous
mutations in the .beta..sub.2 subunit [Kishimoto, et al., Cell
50:193-202 (1987)] and the severity of the disease state is
proportional to the degree of the deficiency in .beta..sub.2
subunit expression. Formation of the complete integrin heterodimer
is impaired by the .beta..sub.2 mutation [Kishimoto, et al.,
supra].
[0010] Interestingly, at least one antibody specific for CD18 has
been shown to inhibit human immunodeficiency virus type-1 (mV-1)
syncytia formation in vitro, albeit the exact mechanism of this
inhibition is unclear [Hildreth and Orentas, Science 244:1075-1078
(1989)]. This observation is consistent with the discovery that a
principal counterreceptor of CD11a/CD18, ICAM-1, is also a surface
receptor for the major group of rhinovirus serotypes [Greve, et
al., Cell 56:839 (1989)].
[0011] The significance of .beta..sub.2 integrin binding activity
in human immune and inflammatory responses underscores the
necessity to develop a more complete understanding of this class of
surface proteins. Identification of yet unknown members of this
subfamily, as well as their counterreceptors, and the generation of
monoclonal antibodies or other soluble factors which can alter
biological activity of the .beta..sub.2 integrins will provide
practical means for therapeutic intervention in .beta..sub.2
integrin-related immune and inflammatory responses.
BRIEF DESCRIPTION OF THE INVENTION
[0012] In one aspect, the present invention provides novel purified
and isolated polynucleotides (e.g., DNA and RNA transcripts, both
sense and anti-sense strands) encoding a novel human .beta..sub.2
integrin .alpha. subunit, .alpha..sub.d, and variants thereof
(i.e., deletion, addition or substitution analogs) which possess
binding and/or immunological properties inherent to .alpha..sub.d.
Preferred DNA molecules of the invention include cDNA, genomic DNA
and wholly or partially chemically synthesized DNA molecules. A
presently preferred polynucleotide is the DNA as set forth in SEQ
ID NO: 1, encoding the polypeptide of SEQ ID NO: 2. Also provided
are recombinant plasmid and viral DNA constructions (expression
constructs) which include .alpha..sub.d encoding sequences, wherein
the .alpha..sub.d encoding sequence is operatively linked to a
homologous or heterologous transcriptional regulatory element or
elements.
[0013] Also provided by the present invention are isolated and
purified mouse and rat polynucleotides which exhibit homology to
polynucleotides encoding human .alpha..sub.d. A preferred mouse
polynucleotide is set forth in SEQ ID NO: 52; a preferred rat
polynucleotide is set forth in SEQ ID NO: 54.
[0014] As another aspect of the invention, prokaryotic or
eukaryotic host cells transformed or transfected with DNA sequences
of the invention are provided which express .alpha..sub.d
polypeptide or variants thereof Host cells of the invention are
particularly useful for large scale production of .alpha..sub.d
polypeptide, which can be isolated from either the host cell itself
or from the medium in which the host cell is grown. Host cells
which express .alpha..sub.d polypeptide on their extracellular
membrane surface are also useful as immunogens in the production of
.alpha..sub.d-specific antibodies. Preferably, host cells
transfected with .alpha..sub.d will be co-transfected to express a
.beta..sub.2 integrin subunit in order to allow surface expression
of the heterodimer.
[0015] Also provided by the present invention are purified and
isolated .alpha..sub.d polypeptides, fragments and variants thereof
Preferred .alpha..sub.d polypeptides are as set forth in SEQ ID NO:
2. Novel .alpha..sub.d products of the invention may be obtained as
isolates from natural sources, but, along with .alpha..sub.d
variant products, are preferably produced by recombinant procedures
involving host cells of the invention. Completely glycosylated,
partially glycosylated and wholly de-glycosylated forms of the
.alpha..sub.d polypeptide may be generated by varying the host cell
selected for recombinant production and/or post-isolation
processing. Variant .alpha..sub.d polypeptides of the invention may
comprise water soluble and insoluble .alpha..sub.d polypeptides
including analogs wherein one or more of the amino acids are
deleted or replaced: (1) without loss, and preferably with
enhancement, of one or more biological activities or immunological
characteristics specific for .alpha..sub.d; or (2) with specific
disablement of a particular ligand/receptor binding or signalling
function. Fusion polypeptides are also provided, wherein
.alpha..sub.d amino acid sequences are expressed contiguously with
amino acid sequences from other polypeptides. Such fusion
polypeptides may possess modified biological, biochemical, and/or
immunological properties in comparison to wild-type .alpha..sub.d.
Analog polypeptides including additional amino acid (e.g., lysine
or cysteine) residues that facilitate multimer formation are
contemplated.
[0016] Also comprehended by the present invention are polypeptides
and other non-peptide molecules which specifically bind to
.alpha..sub.d. Preferred binding molecules include antibodies
(e.g., monoclonal and polyclonal antibodies), counterreceptors
(e.g., membrane-associated and soluble forms) and other ligands
(e.g., naturally occurring or synthetic molecules), including those
which competitively bind .alpha..sub.d in the presence
of.alpha..sub.d monoclonal antibodies and/or specific
counterreceptors. Binding molecules are useful for purification of
.alpha..sub.d polypeptides and identifying cell types which express
.alpha..sub.d. Binding molecules are also useful for modulating
(i.e., inhibiting, blocking or stimulating) of in vivo binding
and/or signal transduction activities of .alpha..sub.d.
[0017] Assays to identify .alpha..sub.d binding molecules are also
provided, including in vitro assays such as immobilized ligand
binding assays, solution binding assays, and scintillation
proximity assays, as well as cell based assays such as di-hybrid
screening assays, split hybrid screening assays, and the like. Cell
based assays provide for a phenotypic change in a host cell as a
result of specific binding interaction or disruption of a specific
binding interaction, thereby permitting indirect quantitation or
measurement of some specific binding interaction.
[0018] In vitro assays for identifying antibodies or other
compounds that modulate the activity of .alpha..sub.d may involve,
for example, immobilizing .alpha..sub.d or a natural ligand to
which .alpha..sub.d binds, detectably labelling the nonimmobilized
binding partner, incubating the binding partners together and
determining the effect of a test compound on the amount of label
bound wherein a reduction in the label bound in the presence of the
test compound compared to the amount of label bound in the absence
of the test compound indicates that the test agent is an inhibitor
of .alpha..sub.d binding.
[0019] Another type of in vitro assay for identifying compounds
that modulate the interaction between .alpha..sub.d and a ligand
involves immobilizing .alpha..sub.d or a fragment thereof on a
solid support coated (or impregnated with) a fluorescent agent,
labeling the ligand with a compound capable of exciting the
fluorescent agent, contacting the immobilized .alpha..sub.d with
the labeled ligand in the presence and absence of a putative
modulator compound, detecting light emission by the fluorescent
agent, and identifying modulating compounds as those compounds that
affect the emission of light by the fluorescent agent in comparison
to the emission of light by the fluorescent agent in the absence of
a modulating compound. Alternatively, the .alpha..sub.d ligand may
be immobilized and .alpha..sub.d may be labeled in the assay.
[0020] A cell based assay method contemplated by the invention for
identifying compounds that modulate the interaction between
.alpha..sub.d and a ligand involves transforming or transfecting
appropriate host cells with a DNA construct comprising a reporter
gene under the control of a promoter regulated by a transcription
factor having a DNA-binding domain and an activating domain,
expressing in the host cells a first hybrid DNA sequence encoding a
first fusion of part or all of .alpha..sub.d and either the DNA
binding domain or the activating domain of the transcription
factor, expressing in the host cells a second hybrid DNA sequence
encoding part or all of the ligand and the DNA binding domain or
activating domain of the transcriptionfactor which is-not
incorporated in the first fusion, evaluating the effect of a
putative modulating compound on the interaction between
.alpha..sub.d and the ligand by detecting binding of the ligand to
.alpha..sub.d in a particular host cell by measuring the production
of reporter gene product in the host cell in the presence or
absence of the putative modulator, and identifying modulating
compounds as those compounds altering production of the reported
gene product in comparison to production of the reporter gene
product in the absence of the modulating compound. Presently
preferred for use in the assay are the lexA promoter, the lexA DNA
binding domain, the GAL4 -transactivation domain, the lacZ reporter
gene, and a yeast host cell.
[0021] A modified version of the foregoing assay may be used in
isolating a polynucleotide encoding a protein that binds to
.alpha..sub.d by transforming or transfecting appropriate host
cells with a DNA construct comprising a reporter gene under the
control of a promoter regulated by a transcription factor having a
DNA-binding domain and an activating domain, expressing in the host
cells a first hybrid DNA sequence encoding a first fusion of part
or all of .alpha..sub.d and either the DNA binding domain or the
activating domain of the transcription factor, expressing in the
host cells a library of second hybrid DNA sequences encoding second
fusions of part or all of putative .alpha..sub.d binding proteins
and the DNA binding domain or activating domain of the
transcription factor which is not incorporated in the first fusion,
detecting binding of an .alpha..sub.d binding protein to
.alpha..sub.d in a particular host cell by detecting the production
of reporter gene product in the host cell, and isolating second
hybrid DNA sequences encoding .alpha..sub.d binding protein from
the particular host cell.
[0022] In a preferred embodiment utilizing the split hybrid assay,
the invention provides a method to identify an inhibitor of binding
between an .alpha..sub.d protein or fragment thereof and an
.alpha..sub.d binding protein or binding fragment thereof
comprising the steps of: (a) transforming or transfecting a host
cell with a first DNA expression construct comprising a first
selectable marker gene encoding a first selectable marker protein
and a repressor gene encoding a repressor protein, said repressor
gene under transcriptional control of a promoter; (b) transforming
or transfecting said host cell with a second DNA expression
construct comprising a second selectable marker gene encoding a
second selectable marker protein and a third selectable marker gene
encoding a third selectable marker protein, said third selectable
marker gene under transcriptional control of an operator, said
operator specifically acted upon by said repressor protein such
that interaction of said repressor protein with said operator
decreases expression of said third selectable marker protein; (c)
transforming or transfecting said host cell with a third DNA
expression construct comprising a fourth selectable marker gene
encoding a fourth selectable marker protein and an .alpha..sub.d
fusion protein gene encoding an .alpha..sub.d protein or fragment
thereof in frame with either a DNA binding domain of a
transcriptional activation protein or a transactivating domain of
said transcriptional activation protein; (d) transforming or
transfecting said hostcell with a fourth DNA expression construct
comprising a fifth selectable marker gene encoding a fifth
selectable marker protein and a second fusion protein gene encoding
an .alpha..sub.d binding protein or binding fragment thereof in
frame with either the DNA binding domain of said transcriptional
activation protein or the transactivating domain of said
transcriptional activation protein, whichever is not included in
first fusion protein gene; (e) growing said host cell under
conditions which permit expression of said .alpha..sub.d protein or
fragment thereof and said .alpha..sub.d binding protein or fragment
thereof such that said .alpha..sub.d protein or fragment thereof
and .alpha..sub.d binding protein or binding fragment thereof
interact bringing into proximity said DNA binding domain and said
transactivating domain reconstituting said transcriptional
activating protein; said transcriptional activating protein acting
on said promoter to increase expression of said repressor protein;
said repressor protein interacting with said operator such that
said third selectable marker protein is not expressed; (f)
detecting absence of expression of said selectable gene; (g)
growing said host cell in the presence of a test inhibitor of
binding between said .alpha..sub.d protein or fragment thereof and
said .alpha..sub.d binding protein or fragment thereof; and (h)
comparing expression of said selectable marker protein in the
presence and absence of said test inhibitor wherein decreased
expression of said selectable marker protein is indicative of an
ability of the test inhibitor to inhibit binding between said
.alpha..sub.d protein or fragment thereof and said .alpha..sub.d
binding protein or binding fragment thereof such that said
transcriptional activating protein is not reconstituted, expression
of said repressor protein is not increased, and said operator
increases expression of said selectable marker protein.
[0023] The invention comprehends host cells wherein the various
genes and regulatory sequences are encoded on a single DNA molecule
as well as host cells wherein one or more of the repressor gene,
the selectable marker gene, the .alpha..sub.d fusion protein gene,
and the .alpha..sub.d binding protein gene are encoded on distinct
DNA expression constructs. In a preferred embodiment, the host
cells are transformed or transfected with DNA encoding the
repressor gene, the selectable marker gene, the .alpha..sub.d
fusion protein gene, and the .sub.d fusion binding protein gene,
each encoded on a distinct expression construct. Regardless of the
number of DNA expression constructs introduced, each transformed or
transfected DNA expression construct further comprises a selectable
marker gene sequence, the expression of which is used toconfirm
that transfection or transformation was, in fact, accomplished.
Selectable marker genes encoded on individually transformed or
transfected DNA expression constructs are distinguishable from the
selectable marker under transcriptional regulation of the tet
operator in that expression of the selectable marker gene regulated
by the tet operator is central to the preferred embodiment; i.e.,
regulated expression of the selectable marker gene by the tet
operator provides a measurable phenotypic change in the host cell
that is used to identify a binding protein inhibitor. Selectable
marker genes encoded on individually transformed or transfected DNA
expression constructs are provided as determinants of successful
transfection or transformation of the individual DNA expression
constructs. Preferred host cells of the invention include
transformed S. cerevisiae strains designated YI596 and YI584 which
were deposited Aug. 13, 1996 with the American Type Culture
Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, and
assigned Accession Numbers ATCC 74384 and ATCC 74385,
respectively.
[0024] The host cells of the invention include any cell type
capable of expressing the .alpha..sub.d and .alpha..sub.d binding
proteins required as described above and which are capable of being
transformed or transfected with functional promoter and operator
sequences which regulate expression of the heterologous proteins
also as described. In a preferred embodiment, the host cells are of
either mammal, insect or yeast origin. Presently, the most
preferred host cell is a yeast cell. The preferred yeast cells of
the invention can be selected from various strains, including the
S. cerevisiae yeast transformants described in Table 1. Alternative
yeast specimens include S. pombe, K. lactis, P. pastoris, S.
carlsbergensis and C. albicans. Preferred mammalian host cells of
the invention include Chinese-hamster ovary (CHO), COS, HeLa, 3T3,
CV1, LTK, 293T3, Rat1, PC12 or any other transfectable cell line of
human or rodent origin. Preferred insect cell lines include SF9
cells.
[0025] In a preferred embodiment, the selectable marker gene is
regulated by an operator and encodes an enzyme in a pathway for
synthesis of a nutritional requirement for said host cell such that
expression of said selectable marker protein is required for growth
of said host cell on media lacking said nutritional requirement.
Thus, as in a preferred embodiment where a repressor protein
interacts with the operator, transcription of the selectable
markergene is down-regulated and the host cells are identified by
an inability to grow on media lacking the nutritional requirement
and an ability to grow on media containing the nutritional
requirement. In a most preferred embodiment, the selectable marker
gene encodes the HIS3 protein, and host cells transformed or
transfected with a HIS3-encoding DNA expression construct are
selected following growth on media in the presence and absence of
histidine. The invention, however, comprehends any of a number of
alternative selectable marker genes regulated by an operator. Gene
alternatives include, for example, URA3, LEU2, LYS2 or those
encoding any of the multitude of enzymes required in various
pathways for production of a nutritional requirement which can be
definitively excluded from the media of growth. In addition,
conventional reporter genes such as chloramphenicol
acetyltransferase (CAT), firefly luciferase, .beta.-galactosidase
(.beta.-gal), secreted alkaline phosphatase (SEAP), green
fluorescent protein (GFP), human growth hormone (hGH),
.beta.-glucuronidase, neomycin, hygromycin, thymidine kinase (TK)
and the like may be utilized in the invention.
[0026] In the preferred embodiment, the host cells include a
repressor protein gene encoding the tetracycline resistance protein
which acts on the tet operator to decrease expression of the
selectable marker gene. The invention, however, also encompasses
alternatives to the tet repressor and operator, for example, E.
coli trp repressor and operator, his repressor and operator, and
lac operon repressor and operator.
[0027] The DNA binding domain and transactivating domain components
of the fusion proteins may be derived from the same transcription
factor or from different transcription factors as long as bringing
the two domains into proximity through binding between
.alpha..sub.d and the .alpha..sub.d binding protein permits
formation of a functional transcriptional activating protein that
increases expression of the repressor protein with high efficiency.
A high efficiency transcriptional activating protein is defined as
having both a DNA binding domain exhibiting high affinity binding
for the recognized promoter sequence and a transactivating domain
having high affinity binding for transcriptional machinery proteins
required to express repressor gene mRNA. The DNA binding domain
component of a fusion protein of the invention can be derived from
any of a number of different proteins including, for example, LexA
or Gal4. Similarly, the transactivating component of the
invention's fusion proteins can be derived from a number of
different transcriptional activating proteins, including for
example, Gal4 or VP16.
[0028] The promoter sequence of the invention which regulates
transcription of the repressor protein can be any sequence capable
of driving transcription in the chosen host cell. The promoter may
be a DNA sequence specifically recognized by the chosen DNA binding
domain of the invention, or any other DNA sequence with which the
DNA binding domain of the fusion protein is capable of high
affinity interaction. In a preferred embodiment of the invention,
the promoter sequence of the invention is either a HIS3 or alcohol
dehydrogenase (ADH) promoter. In a presently most preferred
embodiment, the ADH promotor is employed in the invention. The
invention, however, encompasses numerous alternative promoters,
including, for example, those derived from genes encoding HIS3,
ADH, URA3, LEU2 and the like.
[0029] The methods of the invention encompass any and all of the
variations in host cells as described above. In particular, the
invention encompasses a method wherein: the host cell is a yeast
cell; the selectable marker gene encodes HIS3; transcription of the
selectable marker gene is regulated by the tet operator; the
repressor protein gene encodes the tetracycline resistance protein;
transcription of the tetracycline resistance protein is regulated
by the HIS3 promoter; the DNA binding domain is derived from LexA;
and the transactivating domain is derived from VP16. In another
embodiment, the invention encompasses a method wherein: the host
cell is a yeast cell; the selectable marker gene encodes HIS3;
transcription of the selectable marker gene is regulated by the tet
operator; the repressor protein gene encodes the tetracycline
resistance protein; transcription of the tetracycline resistance
protein is regulated by the alcohol dehydrogenase promoter; the DNA
binding domain is derived from LexA; and the transactivating domain
is derived from VP16.
[0030] In alternative embodiments of the invention wherein the host
cell is a mammalian cell, variations include the use of mammalian
DNA expression constructs to encode the .alpha..sub.d and
.alpha..sub.d binding fusion genes, the repressor gene, and the
selectable marker gene, and use of selectable marker genes encoding
antibiotic or drug resistance markers (i.e., neomycin, hygromycin,
thymidine kinase).
[0031] There are at least three different types of libraries used
for the identification of small molecule modulators. These include:
(1) chemical libraries, (2) natural product libraries, and (3)
combinatorial libraries comprised of random peptides,
oligonucleotides or organic molecules.
[0032] Chemical libraries consist of structural analogs of known
compounds or compounds that are identified as "hits" via natural
product screening. Natural product libraries are collections of
microorganisms, animals, plants, or marine organisms which are used
to create mixtures for screening by: (1) fermentation and
extraction of broths from soil, plant or marine microorganisms or
(2) extraction of plants or marine organisms. Combinatorial
libraries are composed of large numbers of peptides,
oligonucleotides or organic compounds as a mixture. They are
relatively easy to prepare by traditional automated synthesis
methods, PCR, cloning or proprietary synthetic methods. Of
particular interest are peptide and oligonucleotide combinatorial
libraries. Still other libraries of interest include peptide,
protein, peptidomimetic, multiparallel synthetic collection,
recombinatorial, and polypeptide libraries.
[0033] Hybridoma cell lines which produce antibodies specific for
.alpha..sub.d are also comprehended by the invention. Techniques
for producing hybridomas which secrete monoclonal antibodies are
well known in the art. Hybridoma cell lines may be generated after
immunizing an animal with purified .alpha..sub.d, variants of
.alpha..sub.d or cells which express .alpha..sub.d or a variant
thereof on the extracellular membrane surface. Immunogen cell types
include cells which express .alpha..sub.d in vivo, or transfected
prokaryotic or eukaryotic cell lines which normally do not normally
express .alpha..sub.d in vivo. Presently preferred antibodies of
the invention are secreted by hybridomas designated 169A, 169B,
170D, 170F, 170E, 170X, 170H, 188A, 188B, 188C, 188E, 188F, 188G,
1881, 188J, 188K, 188L, 188M, 188N, 188P, 188R, 188T, 195A, 195C,
195D, 195E, 195H, 197A-1, 197A-2, 197A-3, 197A-4, 199A, 199H, 199M,
205A, 205C, 205E, 212A, 212D, 217G, 217H, 217I, 217K, 217L, 217M,
226A, 226B, 226C, 226D, 226E, 226F, 226G, 226H, 226I, 236A, 236B,
236C, 236F, 236G, 236H, 236I, 236K, 237L, 236M, 240F, 240G, 240H,
and 236L.
[0034] The value of the information contributed through the
disclosure of the DNA and amino acid sequences of .alpha..sub.d is
manifest. In one series of examples, the disclosed .alpha..sub.d
CDNA sequence makes possible the isolation of the human
.alpha..sub.d genomic DNA sequence, including transcriptional
control elements for the genomic sequence. Identification of
.alpha..sub.d allelic variants and heterologous species (e.g., rat
or mouse) DNAs is also comprehended. Isolation of the human
.alpha..sub.d genomic DNA and heterologous species DNAs can be
accomplished by standard DNA/DNA hybridization techniques, under
appropriately stringent conditions, using all or part of the
.alpha..sub.d cDNA sequence as a probe to screen an appropriate
library. Alternatively, polymerase chain reaction (PCR) using
oligonucleotide primers that are designed based on the known cDNA
sequence can be used to amplify and identify genomic .alpha..sub.d
DNA sequences. Synthetic DNAs encoding the .alpha..sub.d
polypeptide, including fragments and other variants thereof, may be
produced by conventional synthesis methods.
[0035] DNA sequence information of the invention also makes
possible the development, by homologous recombination or "knockout"
strategies [see, e.g., Kapecchi, Science 244:1288-1292 (1989)], to
produce rodents that fail to express a functional .alpha..sub.d
polypeptide or that express a variant .alpha..sub.d polypeptide.
Such rodents are useful as models for studying the activities of
.alpha..sub.d and .alpha..sub.d modulators in vivo.
[0036] DNA and amino acid sequences of the invention also make
possible the analysis of .alpha..sub.d epitopes which actively
participate in counterreceptor binding as well as epitopes which
may regulate, rather than actively participate in, binding.
Identification of epitopes which may participate in transmembrane
signal transduction is also comprehended by the invention.
[0037] DNA of the invention is also useful for the detection of
cell types which express .alpha..sub.d polypeptide. Standard
DNA/RNA hybridization techniques which utilize .alpha..sub.d DNA to
detect .alpha..sub.d RNA may be used to determine the constitutive
level of .alpha..sub.d transcription within a cell, as well as
changes in the level of transcription in response to internal or
external agents. Identification of agents which modify
transcription and/or translation of .alpha..sub.d can, in turn, be
assessed for potential therapeutic or prophylactic value. DNA of
the invention also makes possible in situ hybridization of
.alpha..sub.d DNA to cellular RNA to determine the cellular
localization of .alpha..sub.d specific messages within complex cell
populations and tissues.
[0038] DNA of the invention is also useful for identification of
non-human polynucleotide sequences which display homology to human
.alpha..sub.d sequences. Possession of non-human .alpha..sub.d DNA
sequences permits development of animal models (including, for
example, transgenic models) of the human system.
[0039] As another aspect of the invention, monoclonal or polyclonal
antibodies specific for .alpha..sub.d may be employed in
immunohistochemical analysis to localize .alpha..sub.d to
subcellular compartments or individual cells within tissues.
Immunohistochemical analyses of this type are particularly useful
when used in combination with in situ hybridization to localize
both .alpha..sub.d mRNA and polypeptide products of the
.alpha..sub.d gene.
[0040] Identification of cell types which express .alpha..sub.d may
have significant ramifications for development of therapeutic and
prophylactic agents. It is anticipated that the products of the
invention related to .alpha..sub.d can be employed in the treatment
of diseases wherein macrophages are an essential element of the
disease process. Animal models for many pathological conditions
associated with macrophage activity have been described in the art.
For example, in mice, macrophage recruitment to sites of both
chronic and acute inflammation is reported by Jutila, et al., J.
Leukocyte Biol. 54:30-39 (1993). In rats, Adams, et al,
[Transplantation 53:1115-1119(1992) and Transplantation 56:794-799
(1993)] describe a model for graft arteriosclerosis following
heterotropic abdominal cardiac allograft transplantation.
Rosenfeld, et al., [Arteriosclerosis 7:9-23 (1987) and
Arteriosclerosis 7:24-34 (1987)] describe induced atherosclerosis
in rabbits fed a cholesterol supplemented diet. Hanenberg, et al.,
[Diabetologia 32:126-134 (1989)] report the spontaneous development
of insulin-dependent diabetes in BB rats. Yamada et al.,
[Gastroenterology 104:759-771 (1993)] describe an induced
inflammatory bowel disease, chronic granulomatous colitis, in rats
following injections of streptococcal peptidoglycan-polysaccharide
polymers. Cromartie, et al., [J. Exp. Med. 146:1585-1602 (1977)]
and Schwab, et al., [Infection and Immunity 59:4436-4442 (1991)]
report that injection of streptococcal cell wall protein into rats
results in an arthritic condition characterized by inflammation of
peripheral joints and subsequent joint destruction. Finally,
Huitinga, et al., [Eur. J. Immunol 23:709-715 (1993) describe
experimental allergic encephalomyelitis, a model for multiple
sclerosis, in Lewis rats. In each of these models, .alpha..sub.d
antibodies, other .alpha..sub.d binding proteins, or soluble forms
of .alpha..sub.d are utilized to attenuate the disease state,
presumably through inactivation of macrophage activity.
[0041] Pharmaceutical compositions for treatment of these and other
disease states are provided by the invention. Pharmaceutical
compositions are designed for the purpose of inhibiting interaction
between .alpha..sub.d and its ligand(s) and include various soluble
and membrane-associated forms of .alpha..sub.d (comprising the
entire .alpha..sub.d polypeptide, or fragments thereof which
actively participate in .alpha..sub.d binding), soluble and
membrane-associated forms of .alpha..sub.d binding proteins
(including antibodies, ligands, and the like), intracellular or
extracellular modulators of .alpha..sub.d binding activity, and/or
modulators of .alpha..sub.d and/or .alpha..sub.d-ligand polypeptide
expression, including modulators of transcription, translation,
post-translational processing and/or intracellular transport.
[0042] The invention also comprehends methods for treatment of
disease states in which .alpha..sub.d binding, or localized
accumulation of cells which express .alpha..sub.d, is implicated,
wherein a patient suffering from said disease state is provided an
amount of a pharmaceutical composition of the invention sufficient
to modulate levels of .alpha..sub.d binding or to modulate
accumulation of cell types which express .alpha..sub.d. The method
of treatment of the invention is applicable to disease states such
as, but not limited to, Type I diabetes, atherosclerosis, multiple
sclerosis, asthma, psoriasis, lung inflammation, acute respiratory
distress syndrome and rheumatoid arthritis.
[0043] The invention also provides methods for inhibiting
macrophage infiltration at the site of a central nervous system
injury comprising the step of administering to an individual an
effective amount of an anti-.alpha..sub.d monoclonal antibody. In
one aspect, the methods comprise use of an anti-.alpha..sub.d
monoclonal antibody that blocks binding between .alpha..sub.d and a
binding partner. In one embodiment, the binding partner is VCAM-1.
In a preferred embodiment, the anti-.alpha..sub.d monoclonal
antibody is selected from the group consisting of the monoclonal
antibody secreted by hybridoma 226H and the monoclonal antibody
secreted by hybridoma 236L. In a most preferred embodiment, methods
of the invention are for a central nervous system injury which is a
spinal cord injury.
[0044] The invention further provides methods for reducing
inflammation at the site of a central nervous system injury
comprising the step of administering to an individual an effective
amount of an anti-.alpha..sub.d monoclonal antibody. In one aspect,
the methods comprise use of an anti-.alpha..sub.d monoclonal
antibody that blocks binding between .alpha..sub.d and a binding
partner. In one embodiment, the binding partner is VCAM-1. In a
preferred embodiment, the anti-.alpha..sub.d monoclonal antibody is
selected from the group consisting of the monoclonal antibody
secreted by hybridoma 226H and the monoclonal antibody secreted by
hybridoma 236L. In a most preferred embodiment, methods of the
invention are for a central nervous system injury which is a spinal
cord injury.
[0045] Hybridomas 226H and 236L were received on Nov. 11, 1998 by
the American Type Culture Collection, 10801 University Boulevard,
Masassas, Va. 20110-2209 under terms of the Budapest Treaty and
assigned Accession Nos: ______ and ______, respectively.
[0046] The invention also provides methods for modulating
TNF.alpha. release from macrophage or splenic phagocytes comprising
the step of contacting said phagocytes with an affective amount of
an immunospecific .alpha..sub.d monoclonal antibody. In a preferred
aspect, the method methods of the invention comprise an
anti-monoclonal antibody that inhibits TNF.alpha. release. In a
preferred embodiment, the methods of the invention comprise use of
an immunospecific anti-.alpha..sub.d monoclonal antibody that is
selected from the group consisting of the monoclonal antibody
secreted by hybridoma 205C and the monoclonal antibody secreted by
hybridoma 205E.
[0047] Methods of the invention are contemplated wherein useful
antibodies include fragments of anti-.alpha..sub.d monoclonal
antibodies, including for example, Fab or F(ab').sub.2 fragments.
Methods utilizing modified antibodies are also embraced by the
invention. Modified antibodies include, for example, single chain
antibodies, chimeric antibodies, and CDR-grafted antibodies,
including compounds which include CDR sequences which specifically
recognize a polypeptide of the invention, as well as humanized
antibodies. Methods comprising use of human antibodies are also
contemplated. Techniques for identifying and isolating human
antibodies are disclosed infra.
[0048] The invention also provides methods for inhibiting
macrophage infiltration at the site of a central nervous system
injury comprising the step of administering to an individual an
effective amount of a small molecule that inhibits .alpha..sub.d
binding. In particular, the methods of the invention comprising a
central nervous system injury which is a spinal cord injury. Small
molecules specific for .alpha..sub.d binding are identified and
isolated from libraries as discussed above.
[0049] The invention further provides methods for reducing
inflammation at the site of a central nervous system injury
comprising the step of administering to an individual an effective
amount of a small molecule that inhibits .alpha..sub.d binding. In
particular, the methods of the invention comprising a central
nervous system injury which is a spinal cord injury. Small
molecules specific for .alpha..sub.d binding are identified and
isolated from libraries as discussed above.
[0050] The invention further embraces methods to detect and
diagnose Crohn's disease comprising the steps of obtaining tissue
samples from a patient; staining the sample with anti-.alpha..sub.d
monoclonal antibodies, and comparing the staining pattern to that
on tissue obtained from a known normal donor. In instances wherein
staining differences between the two tissue samples can be
detected, the patient can be further tested for possible Crohn's
disease.
[0051] The invention also contemplates use of .alpha..sub.d as a
target for removal of pathogenic cell populations expressing
.alpha..sub.d on the cell surface. In one aspect, the hypervariable
region of an .alpha..sub.d monoclonal antibody is cloned and
expressed in the context of a complement-fixing human isotype.
Cloning the hypervariable region in this manner will provide a
binding partner for .alpha..sub.d, which unpon binding in vivo,
will lead to complement binding and subsequent cell death.
Alternatively, the anti-.alpha..sub.d monoclonal antibody is
conjugated to a cytotoxic compound and binding of the antibody to
.alpha..sub.d on the pathogenic cell type leads to cell death.
BRIEF DESCRIPTION OF THE DRAWING
[0052] Numerous other aspects and advantages of the present
invention will be apparent upon consideration of the following
description thereof, reference being made to the drawing
wherein:
[0053] FIG. 1A through 1D comprises an alignment of the human amino
acid sequences of CD11b (SEQ ID NO:3), CD11c (SEQ ID NO:4) and
.alpha..sub.d (SEQ ID NO:2).
DETAILED DESCRIPTION OF THE INVENTION
[0054] The present invention is illustrated by the following
examples relating to the isolation of a cDNA clone encoding
.alpha..sub.d from a human spleen cDNA library. More particularly,
Example 1 illustrates the use of anti-canine .alpha..sub.TM1
antibody in an attempt to detect a homologous human protein.
Example 2 details purification of canine .alpha..sub.TM1 and
N-terminal sequencing of the polypeptide to design oligonucleotide
primers for PCR amplification of the canine .alpha..sub.TM1 gene.
Example 3 addresses large scale purification of canine
.alpha..sub.TM1 for internal sequencing in order to design
additional PCR primers. Example 4 describes use of the PCR and
internal sequence primers to amplify a fragment of the canine
.alpha..sub.TM1 gene. Example 5 addresses cloning of the human
.alpha..sub.d-encoding cDNA sequence. Example 6 describes Northern
blot hybridization analysis of human tissues and cells for
expression of .alpha..sub.d mRNA. Example 7 details the
construction of human .alpha..sub.d expression plasmids and
transfection of COS cells with the resulting plasmids. Example 8
addresses ELISA analysis of .alpha..sub.d expression in transfected
COS cells. Example 9 describes FACS analysis of COS cells
transfected with human .alpha..sub.d expression plasmids. Example
10 addresses immunoprecipitation of CD18 in association with
.alpha..sub.d in co-transfected COS cells. Example 11 relates to
stable transfection of .alpha..sub.d expression constructs in
Chinese hamster ovary cells. Example 12 addresses CD18-dependent
binding of .alpha..sub.d to the intercellular adhesion molecule
ICAM-R, an ICAM-R mutant protein, and complement fact iC3b. Example
13 describes scintillation proximity screening assays to identify
inhibitors or enhancers (i.e., modulators) of .alpha..sub.d
ligand/anti-ligand binding interactions. Example 14 addresses
construction of expression plasmids which encode soluble forms of
.alpha..sub.d, and binding analyses of the expression products.
Example 15 relates to production of .alpha..sub.d-specific
polyclonal sera and monoclonal antibodies. Example 16 describes
flow cytometry analysis using .alpha..sub.d monoclonal antibodies.
Example 17 addresses expression of .alpha..sub.d on human
monocytes. Example 18 describes analysis of .alpha..sub.d tissue
distribution, expression of .alpha..sub.d on peripheral blood
leukocytes, expression in inflammatory and non-inflammatory
synovium using anti-.alpha..sub.d polyclonal serum, expression in
disease lung and liver, human bone marrow, and PBMC from breast
cancer patients. Example 19 addresses upregulation of .alpha..sub.d
expression in vitro and in vivo. Example 20 describes isolation of
rat cDNA sequences which show homology to human .alpha..sub.d gene
sequences. Example 21 addresses tissue specific expression of rat
.alpha..sub.d mRNA. Example 22 relates to construction of full
length rat .alpha..sub.d expression plasmids, rat .alpha..sub.d I
domain expression plasmids, including I domain/IgG fusion proteins,
production of monoclonal antibodies to full length and I domain
fusion proteins, and production of polyclonal antisera to rat
.alpha..sub.d I domain sequences fused to human IgG4. Example 23
describes specificity of monoclonal antibody 199M. Example 24
presents results from a T cell proliferation assay using rat
.alpha..sub.d expressing macrophages. Example 25 describes
immunoprecipitation of rat .alpha..sub.d from bone marrow. Example
26 describes rat .alpha..sub.d expression in various animal models.
Example 27 relates to an assay for inhibition of NK-tumor
cell-induced target cell lysis using .alpha..sub.d monoclonal
antibodies. Example 28 addresses isolation of mouse cDNA sequences
which show homology to human .alpha..sub.d gene sequences. Example
29 describes isolation of auditional mouse .alpha..sub.d cDNA
clones used to confirm sequence analysis. Example 30 relates to in
situ hybridization analysis of various mouse tissues to determine
tissue and cell specific expression of the putative mouse homolog
to human .alpha..sub.d. Example 31 describes generation of
expression constructs which encode the putative mouse homolog of
human .alpha..sub.d. Example 32 addresses design of a "knock-out"
mouse wherein the gene encoding the putative mouse homolog of human
.alpha..sub.d is disrupted. Example 33 describes isolation of
rabbit cDNA clones which show homology to human .alpha..sub.d
encoding sequences. Example 34 describes isolation of monkey
.alpha..sub.d. Example 35 relates to characterization of the
antigen recognized by monoclonal antibody 217L. Example 36
describes animal models of human disease states wherein modulation
of .alpha..sub.d is assayed for therapeutic capabilities. Example
37 describes expression of .alpha..sub.d in animal model disease
states. 38 addresses the role of .alpha..sub.d in spinal cord
injury. Example 39 describes .alpha..sub.d expression in Crohn's
disease. Example 40 relates to TNF.alpha. release from rat spleen
cells that express .alpha..sub.d. Example 41 described methods to
modulate TNF.alpha. release from spleen cells using .alpha..sub.d
monoclonal antibodies. Example 42 characterizes .alpha..sub.d
expression on eosinophils. Example 43 relates to further
characterization of .alpha..sub.d binding to VCAM-1. Example 44
described use of .alpha..sub.d as a target for removal of
pathogenic cell populations.
EXAMPLE 1
Attempt to Detect a Human Homolog of Canine .alpha..sub.TM1
[0055] The monoclonal antibody Ca11.8H2 [Moore, et al., supra]
specific for canine .alpha..sub.TM1 was tested for cross-reactivity
on human peripheral blood leukocytes in an attempt to identify a
human homolog of canine .alpha..sub.TM1. Cell preparations
(typically 1.times.10.sup.6 cells) were incubated with undiluted
hybridoma supernatant or a purified mouse IgG-negative control
antibody (10 .mu.g/ml) on ice in the presence of 0.1% sodium azide.
Monoclonal antibody binding was detected by subsequent incubation
with FITC-conjugated horse anti-mouse IgG (Vector Laboratories,
Burlingame, Calif.) at 6 .mu.g/ml. Stained cells were fixed with 2%
w/v paraformaldehyde in phosphate buffered saline (PBS) and were
analyzed with a Facstar Plus fluorescence-activated cell sorter
(Becton Dickinson, Mountain View, Calif.). Typically, 10,000 cells
were analyzed using logarithmic amplification for fluorescence
intensity.
[0056] The results indicated that Ca11.8H2 did not cross-react with
surface proteins expressed on human peripheral blood leukocytes,
while the control cells, neoplastic canine peripheral blood
lymphocytes, were essentially all positive for .alpha..sub.TM1.
[0057] Because the monoclonal antibody Ca11.8H2 specific for the
canine a subunit did not cross react with a human homolog,
isolation of canine .alpha..sub.TM1 DNA was deemed a necessary
prerequisite to isolate a counterpart human gene if one
existed.
EXAMPLE 2
Affinity Purification of Canine .alpha..sub.TM1 for N-Terminal
Sequencing
[0058] Canine .alpha..sub.TM1 was affinity purified in order to
determine N-terminal amino acid sequences for oligonucleotide
probe/primer design. Briefly, anti-.alpha..sub.TM1 monoclonal
antibody Ca11.8H2 was coupled to Affigel.RTM. 10 chromatographic
resin (BioRad, Hercules, Calif.) and protein was isolated by
specific antibody-protein interaction. Antibody was conjugated to
the resin, according to the BioRad suggested protocol, at a
concentration of approximately 5 mg antibody per ml of resin.
Following the conjugation reaction, excess antibody was removed and
the resin blocked with three volumes of 0.1 M ethanolamine. The
resin was then washed with thirty column volumes of phosphate
buffered saline (PBS).
[0059] Twenty-five grams of a single dog spleen were homogenized in
250 ml of buffer containing 0.32 M sucrose in 25 mM Tris-HCl, Ph
8.0, with protease inhibitors. Nuclei and cellular debris were
pelleted with centrifugation at 1000 g for 15 minutes. Membranes
were pelleted from the supernatant with centrifugation at 100,000 g
for 30 minutes. The membrane pellet was resuspended in 200 ml lysis
buffer (50 mM NaCl, 50 mM borate, pH 8.0, with 2% NP40) and
incubated for 1 hour on ice. Insoluble material was then pelleted
by centrifugation at 100,000 g for 60 minutes. Ten milliliters of
the cleared lysate were transferred to a 15 ml polypropylene tube
with 0.5 ml Ca11.8H2-conjugated Affigel.RTM. 10 resin described
above. The tube was incubated overnight at 4.degree. C. with
rotation and the resin subsequently washed with 50 column volumes
D-PBS. The resin was then transferred to a microfuge tube and
boiled for ten minutes in 1 ml Laemmli (non-reducing) sample buffer
containing 0.1 M Tris-HCl, pH 6.8, 2% SDS, 20% glycerol and 0.002%
bromophenol blue. The resin was pelleted by centrifugation and
discarded; the supernatant was treated with {fraction (1/15)}
volume .beta.-mercaptoethanol (Sigma, St. Louis, Mo.) and run on a
7% polyacrylamide gel. The separated proteins were transferred to
Immobilon PVDF membrane (Millipore, Bedford, Mass.) as follows.
[0060] The gels were washed once in deionized,
Millipore.RTM.-filtered water and equilibrated for 15-45 minutes in
10 mM 3-[cyclohexylamino]-1-p- ropanesulfonic acid (CAPS) transfer
buffer, pH 10.5, with 10% methanol. Immobilon membranes were
moistened with methanol, rinsed with filtered water, and
equilibrated for 15-30 minutes in CAPS transfer buffer. The initial
transfer was carried out using a Biorad transfer apparatus at 70
volts for 3 hours. The Immobilon membrane was removed after
transfer and stained in filtered 0.1% R250 Coomassie stain for 10
minutes. Membranes were destained in 50% methanol/10% acetic acid
three times, ten minutes each time. After destaining, the membranes
were washed in filtered water and air-dried.
[0061] Protein bands of approximately 150 kD, 95 kD, 50 kD and 30
kD were detected. Presumably the 50 kD and 30 kD bands resulted
from antibody contamination. N-terminal sequencing was then
attempted on both the 150 kD and 95 kD bands, but the 95 kD protein
was blocked, preventing sequencing. The protein band of 150 kD was
excised from the membrane and directly sequenced with an Applied
Biosystems (Foster City, Calif.) Model 473A protein sequencer
according to the manufacturer's instructions. The resulting amino
acid sequence is set in SEQ ID NO:5 using single letter amino acid
designations.
1 FNLDVEEPMVFQ (SEQ ID NO:5)
[0062] The identified sequence included the FNLD sequence
characteristic of .alpha. subunits of the integrin family [Tamura,
et al., J. Cell. Biol. 111:1593-1604 (1990)].
Primer Design and Attempt to Amplify Canine .alpha..sub.TM1
Sequences
[0063] From the N-terminal sequence information, three
oligonucleotide probes were designed for hybridization: a)
"Tommer," a fully degenerate oligonucleotide; b) "Patmer," a
partially degenerate oligonucleotide; and c) "Guessmer," a
nondegenerate oligonucleotide based on mammalian codon usage. These
probes are set out below as SEQ ID NOS: 6, 7 and 8, respectively.
Nucleic acid symbols are in accordance with 37 C.F.R. .sctn.1.882
for these and all other nucleotide sequences herein.
2 5'-TTYAAYYTGGAYGTNGARGARCCNATGGTNTTYC (SEQ ID NO:6) A-3'
5'-TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCC (SEQ ID NO:7) AA-3'
5'-TTCAACCTGGACGTNGAASANCCCATGGTCTTCC (SEQ ID NO:8) AA-3'
[0064] Based on sequencing data, no relevant clones were detected
using these oligonucleotides in several low stringency
hybridizations to a canine spleen/peripheral blood macrophage cDNA
library cloned into .lambda.ZAP.RTM. (Stratagene, La Jolla,
Calif.).
[0065] Four other oligonucleotide primers, designated 5' Deg, 5'
Spec, 3' Deg and 3' Spec (as set out in SEQ ID NOS:9, 10, 11 and
12, respectively, wherein Deg indicates degenerate and Spec
indicates non-degenerate) were subsequently designed based on the
deduced N-terminal sequence for attempts to amplify canine
.alpha..sub.TM1 sequences by PCR from phage library DNA purified
from plate lysates of the Stratagene library described above.
3 5'-TTYAAYYTNGAYGTNGARGARCC-3' (SEQ ID NO:9)
5'-TTYAAYYTGGACGTNGAAGA-3' (SEQ ID NO:10) 5'-TGRAANACCATNGGYTC-3'
(SEQ ID NO:11) 5'-TTGGAAGACCATNGGYTC-3' (SEQ ID NO:12)
[0066] The .alpha..sub.TM1 oligonucleotide primers were paired with
T3 or T7 vector primers, as set out in SEQ ID NOS:13 and 14,
respectively, which hybridize to sequences flanking the polylinker
region in the Bluescript.RTM. phagemid found in
.lambda.ZAP.RTM..
4 5'-ATTAACCCTCACTAAAG-3' (SEQ ID NO:13) 5'-AATACGACTCACTATAG-3'
(SEQ ID NO:14)
[0067] The PCR amplification was carried out in Taq buffer
(Boehringer Mannheim, Indianapolis, Ind.) containing magnesium with
150 ng of library DNA, 1 .mu.g of each primer, 200 .mu.M dNTPs and
2.5 units Taq polymerase (Boehringer Mannheim) and the products
were separated by electrophoresis on a 1% agarose gel in
Tris-Acetate-EDTA (TAE) buffer with 0.25 .mu.g/ml ethidium bromide.
DNA was transferred to a Hybond.RTM. (Amersham, Arlington Heights,
Ill.) membrane by wicking overnight in 10.times.SSPE. After
transfer, the immobilized DNA was denatured with 0.5 M NaOH with
0.6 M NaCl, neutralized with 1.0 M Tris-HCl, pH 8.0, in 1.5 M NaCl,
and washed with 2.times.SSPE before UV crosslinking with a
Stratalinker (Stratagene) crosslinking apparatus. The membrane was
incubated in prehybridization buffer (5.times.SSPE,
4.times.Denhardts, 0.8% SDS, 30% formamide) for 2 hr at 50.degree.
C. with agitation.
[0068] Oligonucleotide probes 5' Deg, 5' Spec, 3' Deg and 3' Spec
(SEQ ID NOS: 9, 10, 11 and 12, respectively) were labeled using a
Boehringer Mannheim kinase buffer with 100-300 .mu.gCi
.gamma.P.sup.32-dATP and 1-3 units of polynucleotide kinase for 1-3
hr at 37.degree. C. Unincorporated label was removed with
Sephadex.RTM. G-25 fine (Pharmacia, Piscataway, N.J.)
chromatography using 10 mM Tris-HCl, pH 8.0, 1 mM EDTA (TE) buffer
and the flow-through added directly to the prehybridization
solution. Membranes were probed for 16 hr at 42.degree. C. with
agitation and washed repeatedly, with a final stringency wash of
1.times.SSPE/0.1% SDS at 50.degree. for 15 min. The blot was then
exposed to Kodak X-Omat AR film for 1-4 hours at -80.degree. C.
[0069] The oligonucleotides 5' Deg, 5' Spec, 3' Deg and 3' Spec
only hybridized to PCR products from the reactions in which they
were used as primers and failed to hybridize as expected to PCR
products from the reactions in which they were not used as primers.
Thus, it was concluded that none of the PCR products were specific
for .alpha..sub.TM1 because no product hybridized with all of the
appropriate probes.
EXAMPLE 3
Large Scale Affinity Purification of Canine .alpha..sub.TM1 for
Internal Sequencing
[0070] In order to provide additional amino acid sequence for
primer design, canine .alpha..sub.TM1 was purified for internal
sequencing. Three sections of frozen spleen (approximately 50 g
each) and frozen cells from two partial spleens from adult dogs
were used to generate protein for internal sequencing. Fifty grams
of spleen were homogenized in 200-300 ml borate buffer with a
Waring blender. The homogenized material was diluted with 1 volume
of buffer containing 4% NP-40, and the mixture then gently agitated
for at least one hour. The resulting lysate was cleared of large
debris by centrifugation at 2000 g for 20 min, and then filtered
through either a Corning (Corning, N.Y.) prefilter or a Corning 0.8
micron filter. The lysate was further clarified by filtration
through the Corning 0.4 micron filter system.
[0071] Splenic lysate and the antibody-conjugated Affigel.RTM. 10
resin described in Example 2 were combined at a 150:1 volume ratio
in 100 ml aliquots and incubated overnight at 4.degree. C. with
rocking. The lysate was removed after centrifugation at 1000 g for
5 minutes, combined with more antibody-conjugated Affigel.RTM. 10
resin and incubated overnight as above. The absorbed resin aliquots
were then combined and washed with 50 volumes D-PBS/0.1% Tween.RTM.
20 and the resin transferred to a 50 ml Biorad column. Adsorbed
protein was eluted from the resin with 3-5-volumes of 0.1 M glycine
(pH 2.5); fractions of approximately 900 .mu.l were collected and
neutralized with 100 .mu.l 1 M Tris buffer, pH 8.0. Aliquots of 15
.mu.l were removed from each fraction and boiled in an equal volume
of 2.times.Laemmli sample buffer with {fraction (1/15)} volume 1 M
dithiothreitol (DTT). These samples were electrophoresed on 8%
Novex (San Diego, Calif.) polyacrylamide gels and visualized either
by Coomassie stain or by silver stain using a Daiichi kit
(Enprotech, Natick, Mass.) according to the manufacturer's
suggested protocol. Fractions which contained the largest amounts
of protein were combined and concentrated by vacuum. The remaining
solution was diluted by 50% with reducing Laemmli sample buffer and
run on 1.5 mm 7% polyacrylamide gels in Tris-glycine/SDS buffer.
Protein was transferred from the gels to Immobilon membrane by the
procedure described in Example 2 using the Hoefer transfer
apparatus.
[0072] The protein bands corresponding to canine .alpha..sub.TM1
were excised from 10 PVDF membranes and resulted in approximately
47 .mu.g total protein. The bands were destained in 4 ml 50%
methanol for 5 minutes, air dried and cut into 1.times.2 mm pieces.
The membrane pieces were submerged in 2 ml 95% acetone at 4.degree.
C. for 30 minutes with occasional vortexing and then air dried.
[0073] Prior to proteolytic cleavage of the membrane bound protein,
3 mg of cyanogen bromide (CNBr) (Pierce, Rockford, Ill.) were
dissolved in 1.25 ml 70% formic acid. This solution was then added
to a tube containing the PVDF membrane pieces and the tube
incubated in the dark at room temperature for 24 hours. The
supernatant (S1) was then removed to another tube and the membrane
pieces washed with 0.25 ml 70% formic acid. This supernatant (S2)
was removed and added to the previous supernatant (S1). Two
milliliters of Milli Q water were added to the combined
supernatants (S1 and S2) and the solution lyophilized. The PVDF
membrane pieces were dried under nitrogen and extracted again with
1.25 ml 60% acetonitrile, 0.1% tetrafluoroacetic acid (TFA) at
42.degree. C. for 17 hours. This supernatant (S3) was removed and
the membrane pieces extracted again with 1.0 ml 80% acetonitrile
with 0.08% TFA at 42.degree. C. for 1 hour. This supernatant (S4)
was combined with the previous supernatants (S1, S2 and S3) and
vacuum dried.
[0074] The dried CNBr fragments were then dissolved in 63 .mu.l 8 M
urea, 0.4 M NH.sub.4HCO.sub.3. The fragments were reduced in 5
.mu.l 45 mM dithiothreitol (DTT) and subsequently incubated at
50.degree. C. for 15 minutes. The solution was then cooled to room
temperature and the fragments alkylated by adding 5 .mu.l 100 mM
iodoacetamide (Sigma, St. Louis, Mo.). Following a 15 minute
incubation at room temperature, the sample was diluted with 187
.mu.l Milli Q water to a final urea concentration of 2.0 M. Trypsin
(Worthington, Freehold, N.J.) was then added at a ratio of 1:25
(w:w) of enzyme to protein and the protein digested for 24 hours at
37.degree. C. Digestion was terminated with addition of 30 .mu.l
TFA.
[0075] The protein fragments were then separated with high
performance liquid chromatography (HPLC) on a Waters 625 LC system
(Millipore, Milford, Mass.) using a 2.1.times.250 mm, 5 micron
Vydac C-18 column (Vydac, Hesperia, Calif.) equilibrated in 0.05%
TFA and HPLC water (buffer A). The peptides were eluted with
increasing concentration of 80% acetonitrile in 0.04% TFA (buffer
B) with a gradient of 38-75% buffer B for 65-95 minutes and 75-98%
buffer B for 95-105 minutes. Peptides were fractionated at a flow
rate of 0.2 ml/minute and detected at 210 nm.
[0076] Following fractionation, the amino acid sequence of the
peptides was analyzed by automated Edman degradation performed on
an Applied Biosystems Model 437A protein sequencer using the
manufacturer's standard cycles and the Model 610A Data Analysis
software program, Version 1.2.1. All sequencing reagents were
supplied by Applied Biosystems. The amino acid sequences of seven
of the eight internal fragments are set out below wherein "X"
indicates the identity of the amino acid was not certain.
5 VFQEXGAGFGQ (SEQ ID NO:15) LYDXVAATGLXQPI (SEQ ID NO:16)
PLEYXDVIPQAE (SEQ ID NO:17) FQEGFSXVLX (SEQ ID NO:18)
TSPTFIXMSQENVD (SEQ ID NO:19) LVVGAPLEVVAVXQTGR (SEQ ID NO:20)
LDXKPXDTA (SEQ ID NO:21)
Primer Design
[0077] One internal amino acid sequence (set out in SEQ ID NO:22)
obtained was-then used to design a fully degenerate oligonucleotide
primer, designated p4(R) as set out in SEQ ID NO:23.
6 FGEQFSE (SEQ ID NO:22) 5'-RAANCCYTCYTGRAAACTYTC-3' (SEQ ID
NO:23)
EXAMPLE 4
PCR Cloning of a Canine .alpha..sub.TM1 Fragment
[0078] The 5' portion of the canine .alpha..sub.TM1 gene was
amplified from double-stranded canine splenic cDNA by PCR.
Generation of Double Stranded Canine Spleen cDNA
[0079] One gram of frozen material from a juvenile dog spleen was
ground in liquid nitrogen on dry ice and homogenized in 20 ml
RNA-Stat 60 buffer (Tel-Test B, Inc, Friendswood, Tex.). Four ml
chloroform were added, and the solution extracted by centrifugation
at 12,000 g for 15 minutes. RNA was precipitated from the aqueous
layer with 10 ml ethanol. Poly A.sup.+ RNA was then selected on
Dynal Oligo dT Dynabeads.RTM. (Dynal, Oslo, Norway). Five aliquots
of 100 .mu.g total RNA were combined and diluted with an equal
volume of 2.times.binding buffer (20 mM Tris-HCl, pH 7.5, 1.0 M
LiCl, 1 mM EDTA, 0.1% SDS). RNA was then incubated 5 minutes with
the Oligo dT Dynabeads.RTM. (1.0 ml or 5 mg beads for all the
samples). Beads were washed with buffer containing 10 mM Tris-HCl,
pH 7.5, 0.15 M LiCl, 1 mM EDTA and 0.1% SDS, according to the
manufacturer's suggested protocol prior to elution of poly A.sup.+
mRNA with 2 mM EDTA, pH 7.5. Double-stranded cDNA was then
generated using the eluted poly A.sup.+ mRNA and the Boehringer
Mannheim cDNA Synthesis Kit according to the manufacturer's
suggested protocol.
Isolation of a Partial Canine .alpha..sub.TM1 cDNA
[0080] Oligonucleotide primers 5' Deg (SEQ ID NO:9) and p4(R) (SEQ
ID NO: 23) were employed in a standard PCR reaction using 150 ng
double-stranded cDNA, 500 ng of each primer, 200 .mu.M dNIPs and
1.5 units Taq polymerase (Boehringer Mannheim) in Taq buffer
(Boehringer Mannheim) with magnesium. The resulting products (1
.mu.l of the original reaction) were subjected to a second round of
PCR with the same primers to increase product yield. This band was
eluted from a 1% agarose gel onto Schleicher & Schuell (Keene,
N.H.) NA45 paper in a buffer containing 10 mM Tris-HCl, pH 8, 1 mM
EDTA, 1.5 M NaCl at 65.degree. C., precipitated, and ligated into
the pCR.TM.II vector (Invitrogen, San Diego, Calif.) using the TA
cloning kit (Invitrogen) and the manufacturer's suggested protocol.
The ligation mixture was transformed by electroporation into XL-1
Blue bacteria (Stratagene). One clone, 2.7, was determined to
contain sequences corresponding to .alpha..sub.TM1 peptide
sequences which were not utilized in design of the primers.
[0081] Sequencing was performed with an Applied Biosystems 373A DNA
sequencer (Foster City, Calif.) with a Dye-deoxy terminator cycle
sequence kit (ABI) in which fluorescent-labeled dNTPs were
incorporated in an asymmetric PCR reaction [McCabe, "Production of
Single Stranded DNA by Asymmetric PCR," in PCR Protocols: A Guide
to Methods and Applications, Innis, et al. (eds.) pp. 76-83
Academic Press: New York (1990)] as follows. Samples were held at
96.degree. C. for 4 minutes and subjected to 25 cycles of the step
sequence: 96.degree. C., for 15 seconds; 50.degree. C. for 1
second; 60.degree. C. for 4 minutes. Sequence data was
automatically down-loaded into sample files on the computer that
included chromatogram and text files. The sequence of the entire
insert of clone 2.7 is set out in SEQ ID NO:24.
[0082] Attempts to isolate the full length canine .alpha..sub.TM1
cDNA from the Stratagene library (as described in Example 2) were
unsuccessful. Approximately 1.times.10.sup.6 phage plaques were
screened by hybridization under low stringency conditions using 30%
formamide with clone 2.7 as a probe, but no positive clones
resulted. Attempts to amplify relevant sequences downstream from
those represented in clone 2.7 using specific oligonucleotides
derived from clone 2.7 or degenerate primers based on amino acid
sequence from other peptide fragments paired with a degenerate
oligonucleotide based on the conserved .alpha. subunit amino acid
motif GFFKR [Tamura, et al., supra] were also unsuccessful.
EXAMPLE 5
Cloning of a Putative Human Homolog of Canine .alpha..sub.TM1
[0083] To attempt the isolation of a human sequence homologous to
canine .alpha..sub.TM1 the approximately 1 kb canine
.alpha..sub.TM1 fragment from clone 2.7 was used as a probe. The
probe was generated by PCR under conditions described in Example 2
using NT2 (as set out in SEQ ID NO:25) and p4(R) (SEQ ID NO:23)
primers.
7 5'-GTNTTYCARGARGAYGG-3' (SEQ ID NO:25)
[0084] The PCR product was purified using the Qiagen (Chatsworth,
Ga.) Quick Spin kit and the manufacturer's suggested protocol. The
purified DNA (200 ng) was labeled with 200 .mu.Ci
.alpha..sup.32PdCTP using the Boehringer Mannheim Random Prime
Labelling kit and the manufacturer's suggested protocol.
Unincorporated isotope was removed with Sephadex.RTM. G25 (fine)
gravity chromatography. The probe was denatured with 0.2 N NaOH and
neutralized with 0.4 M Tris-HCl, pH 8.0, before use.
[0085] Colony lifts on Hybond.RTM. filters (Amersham) of a human
spleen cDNA library in pCDNA/Amp (Invitrogen, San Diego, Calif.)
were prepared. The filters were initially denatured and neutralized
as described in Example 2 and subsequently incubated in a
prehybridization solution (8 MI/filter) with 30% formamide at
50.degree. C. with gentle agitation for 2 hours. Labeled probe as
described above was added to this solution and incubated with the
filters for 14 hours at 42.degree. C. The filters were washed twice
in 2.times.SSC/0.1% SDS at 37.degree. C. and twice in
2.times.SSC/0.1% SDS at 50.degree. C. Final stringency washes were
1.times.SSC/0.1% SDS, twice at 65.degree. C. (1.times.SSC is 150 MM
NaCl, 15 mM sodium citrate, pH 7.0). Filters were exposed to Kodak
X-Omat AR film for six hours with an intensifying screen. Colonies
giving signals on duplicate lifts were streaked on LB medium with
magnesium (LBM)/carbenicillin plates and incubated overnight at
37.degree. C. Resulting streaked colonies were lifted with
Hybond.RTM. filters and these filters were treated as above. The
filters were hybridized under more stringent conditions with the 1
kb probe from clone 2.7, labeled as previously described, in a 50%
formamide hybridization solution at 50.degree. C. for 3 hours.
Probed filters were washed with a final stringency of
0.1.times.SSC/0.1% SDS at 65.degree. C. and exposed to Kodak X-Omat
AR film for 2.5 hours at -80.degree. C. with an intensifying
screen. Positive colonies were identified and cultured in
LBM/carbenicillin medium overnight. DNA from the cultures was
prepared using the Promega Wizard.RTM. miniprep kit according to
the manufacturer's suggested protocol and the resulting DNA was
sequenced.
[0086] The initial screening resulted in 18 positive clones, while
the secondary screening under more stringent hybridization
conditions produced one positive clone which was designated 19A2.
The DNA and deduced amino acid sequences of the human .alpha..sub.d
clone 19A2 are set out in SEQ ID NOS: 1 and 2, respectively.
Characteristics of the Human .alpha..sub.d cDNA and Predicted
Polypeptide
[0087] Clone 19A2 encompasses-the entire coding region for the
mature protein, plus 48 bases (16 amino acid residues) of the 5'
upstream signal sequence and 241 bases of 3' untranslated sequence
which do not terminate in a polyadenylation sequence. The core
molecular weight of the mature protein is predicted to be around
125 kD. The extracellular domain is predicted to encompass
approximately amino acid residues 17 through 1108 of SEQ ID NO:2.
This extracellular region is contiguous with about a 20 amino acid
region homologous to the human CD11c transmembrane region (residues
1109 through 1128 of SEQ ID NO:2). The cytoplasmic domain comprises
approximately 30 amino acids (about residues 1129 through 1161 of
SEQ ID NO:2). The protein also contains a region (around residues
150 through 352) of approximately 202 amino acids homologous to the
I (insertion) domain common to CD11a, CD11b and CD11c [Larson and
Springer, supra], .alpha..sub.E [Shaw, et al., J. Biol. Chem.
269:6016-6025 (1994)] and in VLA-1 and VLA-2, [Tamura, et al.,
supra]. The I domain in other integrins has been shown to
participate in ICAM binding [Landis, et al., J. Cell. Biol.
120:1519-1527 (1993); Diamond, et al., J. Cell. Biol. 120:1031-1043
(1993)], suggesting that .alpha..sub.d may also bind members of the
ICAM family of surface molecules. This region has not been
demonstrated to exist in any other integrin subunits.
[0088] The deduced amino acid sequence of .alpha..sub.d shows
approximately 36% identity to that of CD11a, approximately 60%
identity to CD11b and approximately 66% identity to CD11c. An
alignment of amino acid sequences for (CD11b SEQ ID NO:3), CD11c
(SEQ ID NO:4) and .alpha..sub.d (SEQ ID NO:2) is presented in FIG.
1.
[0089] The cytoplasmic domains of .alpha. subunits in .beta..sub.2
integrins are typically distinct from one another within the same
species, while individual .alpha. subunits show high degrees of
homology across species boundaries. Consistent with these
observations, the cytoplasmic region of .alpha..sub.d differs
markedly from CD11a, CD11b, and CD11c except for a membrane
proximal GFFKR amino acid sequence which has been shown to be
conserved among all .alpha. integrins [Rojiani, et al.,
Biochemistry 30: 9859-9866 (1991)]. Since the cytoplasmic tail
region of integrins has been implicated in "inside out" signaling
and in avidity regulation [Landis et al., supra], it is possible
that .alpha..sub.d interacts with cytosolic molecules distinct from
those interacting with CD11a, CD11b, and CD11c, and, as a result,
participates in signaling pathways distinct from those involving
other .beta..sub.2 integrins.
[0090] The extracellular domain of .alpha..sub.d contains a
conserved DGSGS amino acid sequence adjacent the I-domain; in
CD11b, the DGSGS sequence is a metal-binding region required for
ligand interaction [Michishita, et al. Cell 72:857-867 (1993)].
Three additional putative cation binding sites in CD11b and CD11 c
are conserved in the .alpha..sub.d sequence at amino acids 465-474,
518-527, and 592-600 in clone 19A2 (SEQ ID NO:1). The .alpha..sub.d
I-domain is 36%, 62%, and 57% identical to the corresponding
regions in CD11a, CD11b, and CD11c, respectively, and the
relatively low sequence homology in this region suggests that
.alpha..sub.d may interact with a set of extracellular proteins
distinct from proteins with which other known .beta..sub.2
integrins interact. Alternatively, the affinity of .alpha..sub.d
for known .beta..sub.2 integrin ligands, for example, ICAM-1,
ICAM-2 and/or ICAM-R, may be distinct from that demonstrated for
the other .beta..sub.2 integrin/ICAM interactions. [See Example
12.]
Isolation of Additional Human .alpha..sub.d cDNA Clones for
Sequence Verification
[0091] In order to confirm the DNA sequence encoding human
.alpha..sub.d, additional human cDNAs were isolated by
hybridization from a human splenic oligo dt-primed cDNA library
(Invitrogen) in pcDNA/Amp (described in Example 5) which was size
selected by agarose gel electrophoresis for cDNA greater than 3 kb
in length. The probe for hybridization was derived from a 5' region
of .alpha..sub.d as described below. Hybridization conditions were
the same as described above for the isolation of the initial human
.alpha..sub.d clone, except that following hybridization, filters
were washed twice in 2.times.SSC/0.1% SDS at room temperature and
once in 2.times.SSC/0.1% SDS at 42.degree. C. Filters were exposed
to Kodak X-Omat AR film overnight.
[0092] The 5' .alpha..sub.d hybridization probe was generated by
PCR from the 19A2 clone using primers CD11c 5' For (SEQ ID NO:94)
and CD11c 5' Rev (SEQ ID NO:95) under the following conditions.
Samples were held at 94.degree. C. for four minutes and subjected
to 30 cycles of the temperature step sequence i) 94.degree. C., for
15 seconds; ii) 5 .degree. C., for 30 seconds; and iii) 72.degree.
C., for 1 minute in a Perkin-Elmer 9600 thermocycler.
8 CD11c 5' For: (5')CTGGTCTGGAGGTGCCTTCCTG(3') (SEQ ID NO:94) CD11c
5' Rev: (5')CCTGAGCAGGAGCACCTGGCC(3') (SEQ ID NO:95)
[0093] The amplification product was purified using the BioRad
(Hercules, Calif.) Prep-A-Gene kit according to manufacturer's
suggested protocol. The resulting 5' .alpha..sub.d probe was
approximately 720 bases long, corresponding to the region from
nucleotide 1121 to nucleotide 1839 in SEQ ID NO:1. The purified DNA
(approximately 50 ng) was labeled with .sup.32P-dCTP using a
Boehringer Mannheim (Indianapolis, Ind.) Random Prime Labeling kit
according to manufacturer's suggested protocol. Unincorporated
isotope was removed using Centrisep.RTM. Spin Columns (Princeton
Separations, Adelphia, N.J.) according to manufacturer's suggested
protocol. Labeled probe was added to the filters in a
prehybridization solution containing 45% formamide and incubation
allowed to proceed overnight at 50.degree. C. Following incubation,
the filters were washed as described above.
[0094] Thirteen colonies gave signals on duplicate lifts. Positive
colonies were picked from master plates, diluted in LBM and
carbenicillin (100 .mu.g/ml) and plated at varying dilutions onto
Hybond.RTM. (Amersham) filters. Duplicate filters were hybridized
with the same solution from the primary hybridization and following
hybridization, the filters were washed at a final stringency of
2.times.SSC/0.1% SDS at 42.degree. C. and exposed to film.
[0095] Ten of the originally identified thirteen positive colonies
were confirmed in the secondary screen. Of these ten clones, two
(designated A7.Q and A8.Q) were sequenced and determined to encode
human .alpha..sub.d. Clone A7.Q was found to be approximately 2.5
kb in length, including a 5' leader, part of a coding region, and
an additional 60 bases of 5' untranslated sequence. The incomplete
coding region was determined to have resulted from an aberrantly
spliced intron region at corresponding nucleotide 2152 of SEQ ID
NO:1. Clone A8.Q was determined to be approximately 4 kb in length,
spanning the entire .alpha..sub.d coding region and also including
an intron sequence at corresponding base 305 of SEQ ID NO:1. In
comparison to the originally isolated .alpha..sub.d clone (SEQ ID
NO:1), one difference was observed in that both A7.Q and A8.Q
clones were determined to have a three base CAG codon insertion
occurring at base 1495. Sequences for clones A7.Q AND A8.Q are set
out in SEQ ID NOs: 96 and 97, respectively, and a composite human
sequence derived from clones A7.Q and A8.Q, and its corresponding
deduced amino acid sequence, are set out in SEQ ID NOs: 98 and 99,
respectively.
EXAMPLE 6
Northern Analysis of Human .alpha..sub.d Expression in Tissues
[0096] In order to determine the relative level of expression and
tissue specificity of .alpha..sub.d, Northern analysis was
performed using fragments from clone 19A2 as probes. Approximately
10 .mu.g of total RNA from each of several human tissues or
cultured cell lines were loaded on a formaldehyde agarose gel in
the presence of 1 .mu.g of ethidium bromide. After electrophoresis
at 100 V for 4 hr, the RNA was transferred to a nitrocellulose
membrane (Schleicher & Schuell) by wicking in 10.times.SSC
overnight. The membrane was baked 1.5 hr at 80.degree. C. under
vacuum. Prehybridization solution containing 50% formamide in
3-(N-morpholino)propane sulfonic acid (MOPS) buffer was used to
block the membrane for 3 hr at 42.degree. C. Fragments of clone
19A2 were labeled with the Boehringer Mannheim Random Prime kit
according to the manufacturer's instructions including both
.alpha.P.sup.32dCTP and .alpha.P.sup.32dTTP. Unincorporated label
was removed on a Sephadex.RTM. G25 column in TE buffer. The
membrane was probed with 1.5.times.10.sup.6 counts per ml of
prehybridization buffer. The blot was then washed successively with
2.times.SSC/0.1% SDS at room temperature, 2.times.SSC/0.1% SDS at
42.degree. C., 2.times.SSC/0.1% SDS at 50.degree. C.,
1.times.SSC/0.1% SDS at 50.degree. C., 0.5.times.SSC/0.1% SDS at
50.degree. C. and 0.1.times.SSC/0.1% SDS at 50.degree. C. The blot
was then exposed to film for 19 hr.
[0097] Hybridization using a BstXI fragment from clone 19A2
(corresponding to nucleotides 2011 to 3388 in SEQ ID NO:1) revealed
a weak signal in the approximately 5 kb range in liver, placenta,
thymus, and tonsil total RNA. No signal was detected in kidney,
brain or heart samples. The amount of RNA present in the kidney
lane was minimal, as determined with ethidium bromide staining.
[0098] When using a second fragment of clone 19A2 (encompassing the
region from bases 500 to 2100 in SEQ ID NO:1), RNA transcripts of
two different sizes were detected in a human multi-tissue Northern
(MTN) blot using polyA.sup.+ RNA (Clontech). An approximately 6.5
kb band was observed in spleen and skeletal muscle, while a 4.5 kb
band was detected in lung and peripheral blood leukocytes. The
variation in sizes observed could be caused by tissue specific
polyadenylation, cross reactivity of the probe with other integrin
family members, or hybridization with alternatively spliced
mRNAs.
[0099] Northern analysis using a third fragment from clone 19A2,
spanning nucleotides 2000 to 3100 in SEQ ID NO:1, gave results
consistent with those using the other clone 19A2 fragments.
[0100] RNA from three myeloid lineage cell lines was also probed
using the fragments corresponding to nucleotides 500 to 2100 and
2000 to 3100 in SEQ ID NO:1. A THP-1 cell line, previously
stimulated with PMA, gave a diffuse signal in the same size range
(approximately 5.0 kb), with a slightly stronger intensity than the
tissue signals. RNA from unstimulated and DMSO-stimulated HL-60
cells hybridized with the .alpha..sub.d probe at the same intensity
as the tissue samples, however, PMA treatment seemed to increase
the signal intensity. Since PMA and DMSO drive HL-60 cell
differentiation toward monocyte/macrophage and granulocyte
pathways, respectively, this result suggests enhanced .alpha..sub.d
expression in monocyte/macrophage cell types. U937 cells expressed
the .alpha..sub.d message and this signal did not increase with PMA
stimulation. No band was detected in Molt, Daudi, H9, JY, or Jurkat
cells.
EXAMPLE 7
Transient Expression of Human .alpha..sub.d Constructs
[0101] The human clone 19A2 lacks an initiating methionine codon
and possibly some of the 5' signal sequence. Therefore, in order to
generate a human expression plasmid containing 19A2 sequences, two
different strategies were used. In the first, two plasmids were
constructed in which signal peptide sequences derived from genes
encoding either CD11b or CD11c were spliced into clone 19A2 to
generate a chimeric .alpha..sub.d sequence. In the second approach,
a third plasmid was constructed in which an adenosine base was
added at position 0 in clone 19A2 to encode an initiating
methionine.
[0102] The three plasmids contained different regions which encoded
the 5' portion of the .alpha..sub.d sequence or the chimeric
.alpha..sub.d sequence. The .alpha..sub.d region was PCR amplified
(see conditions in Example 2) with a specific 3' primer BamRev (set
out below in SEQ ID NO:26) and one of three 5' primers. The three
5' primers contained in sequence: (1) identical nonspecific bases
at positions 1-6 allowing for digestion, an EcoRI site from
positions 7-12 and a consensus Kozak sequence from positions 13-18;
(2) a portion of the CD11b (primer ERIB) or CD11c (primer ER1C)
signal sequence, or an adenosine (primer ER1D); and (3) an
additional 15-17 bases specifically overlapping 5' sequences from
clone 19A2 to allow primer annealing. Primers ER1B, ER1C or ER1D
are set out in SEQ ID NOS:27, 28 or 29, respectively, where the
initiating methionine codon is underlined and the EcoRI site is
double underlined.
9 (SEQ ID NO:26) 5'-CCACTGTCAGGATGCCCGTG-3' (SEQ ID NO:27)
5'-AGTTACGAATTCGCCACCATGGCTCTACGGGTGCTTCTTCTG-3' (SEQ ID NO: 28)
5'-AGTTACGAATTCGCCACCATGACTCGGACTGT- GCTTCTTCTG-3' (SEQ ID NO: 29)
5'-AGTTACGAATTCGCCACCATGACCTTCGGCACTGTG-3'
[0103] The resulting PCR product was digested with EcoRI and
BamHI.
[0104] All three plasmids contained a common second .alpha..sub.d
region (to be inserted immediately downstream from the 5' region
described in the previous paragraph) including the 3' end of the
.alpha..sub.d clone. The second .alpha..sub.d region, which
extended from nucleotide 625 into the XhaI site in the vector 3'
polylinker region of clone 19A2, was isolated by digestion of clone
19A2 with BamHI and XhaI.
[0105] Three ligation reactions were prepared in which the 3'
.alpha..sub.d BamHI/XhaI fragment was ligated to one of the three
5' .alpha..sub.d EcoRI/BamHI fragments using Boehringer Mannheim
ligase buffer and T4 ligase (1 unit per reaction). After a 4 hour
incubation at 14.degree. C., an appropriate amount of vector
pcDNA.3 (Invitrogen) digested with EcoRI and XhaI was added to each
reaction with an additional unit of ligase. Reactions were allowed
to continue for another 14 hours. One tenth of the reaction mixture
was then transformed into competent XL-1 Blue cells. The resulting
colonies were cultured and the DNA isolated as in Example 5.
Digestion with EcoRI identified three clones which were positive
for that restriction site, and thus, the engineered signal
sequences. The clones were designated pATM.B1 (CD11b .alpha..sub.d,
from primer ER1B), pATM.C10 (CD11c/.alpha..sub.d, from primer ER1C)
and pATM.D12 (adenosine/.alpha..sub.d from primer ER1d). The
presence of the appropriate signal sequences in each clone was
verified by nucleic acid sequencing.
[0106] Expression from the .alpha..sub.d plasmids discussed above
was effected by cotransfection of COS cells with the individual
plasmids and a CD18 expression plasmid, pRC.CD18. As a positive
control, COS cells were also co-transfected with the plasmid
pRC.CD18 and a CD11a expression plasmid, pDC.CD11A.
[0107] Cells were passaged in culture medium
(DMEM/10%FBS/pen-strep) into 10 cm Corning tissue culture-treated
petri dishes at 50% confluency 16 hours prior to transfection.
Cells were removed from the plates with Versene buffer (0.5 mM
NaEDTA in PBS) without-trypsin for all procedures. Before
transfection, the plates were washed once with serum-free DMEM.
Fifteen micrograms of each plasmid were added to 5 ml transfection
buffer (DMEM with 20 .mu.g/ml DEAE-Dextran and 0.5 mM chloroquine)
on each plate. After 1.5 hours incubation at 37.degree. C., the
cells were shocked for 1 minute with 5 ml DMEM/10% DMSO. This DMSO
solution was then replaced with 10 ml/plate culture medium.
[0108] Resulting transfectants were analyzed by ELISA, FACS, and
immunoprecipitation as described in Examples 8, 9, and 10.
EXAMPLE 8
ELISA Analysis of COS Transfectants
[0109] In order to determine if the COS cells co-transfected with
CD18 expression plasmid pRC.CD18 and an .alpha..sub.d plasmid
expressed .alpha..sub.d on the cell surface in association with
CD18, ELISAs were performed using primary antibodies raised against
CD18 (e.g., TS1/18 purified from ATCC HB203). As a positive
control, ELISAs were also performed on cells co-transfected with
the CD18 expression plasmid and a CD11a expression plasmid,
pDC.CD11A. The primary antibodies in this control included CD18
antibodies and anti-CD11a antibodies (e.g., TS1/22 purified from
ATCC HB202).
[0110] For ELISA, cells from each plate were removed with Versene
buffer and transferred to a single 96-well flat-bottomed Corning
tissue culture plate. Cells were allowed to incubate in culture
media 2 days prior to assay. The plates were then washed twice with
150 .mu.l/well D-PBS/0.5% teleost skin gelatin (Sigma) solution.
This buffer was used in all steps except during the development.
All washes and incubations were performed at room temperature. The
wells were blocked with gelatin solution for 1 hour. Primary
antibodies were diluted to 10 .mu.g/ml in gelatin solution and 50
.mu.l were then added to each well. Triplicate wells were set up
for each primary antibody. After 1 hour incubation, plates were
washed 3.times.with 150 .mu.l/well gelatin solution. Secondary
antibody (goat anti-mouse Ig/HRP-Fc specific [Jackson, West Grove,
Pa.]) at a 1:3500 dilution was added at 50 .mu.l/well and plates
were incubated for 1 hour. After three washes, plates were
developed for 20 minutes with 100 .mu.l/well o-phenyldiamine (OPD)
(Sigma) solution (1 mg/ml OPD in citrate buffer) before addition of
50 .mu.l/well 15% sulfuric acid.
[0111] Analysis of transfectants in the ELISA format with anti-CD18
specific antibodies revealed no significant expression above
background in cells transfected only with the plasmid encoding
CD18. Cells co-transfected with plasmid containing CD11a and CD18
showed an increase in expression over background when analyzed with
CD18 specific antibodies or with reagents specific for CD11a.
Further analysis of cells co-transfected with plasmids encoding
CD18 and one of the .alpha..sub.d expression constructs (PATM.C10
or pATM.D12) revealed that cell surface expression of CD18 was
rescued by concomitant expression of .alpha..sub.d. The increase in
detectable CD18 expression in COS cells transfected with pATM.C10
or pATM.D12 was comparable to that observed in co-transfected
CD11a/CD18 positive control cells.
EXAMPLE 9
FACS Analysis of COS Transfectants
[0112] For FACS analysis, cells in petri dishes were fed with fresh
culture medium the day after transfection and allowed to incubate 2
days prior to the assay. Transfectant cells were removed from the
plates with 3 ml Versene, washed once with 5 ml FACS buffer
(DMEM/2% FBS/0.2% sodium azide) and diluted to 500,000 cells/sample
in 0.1 ml FACS buffer. Ten microliters of either 1 mg/ml
FITC-conjugated CD18, CD11a, or CD11b specific antibodies (Becton
Dickinson) or 800 .mu.g/ml CFSE-conjugated murine 23F2G (anti-CD18)
(ATCC HB 11081) were added to each sample. Samples were then
incubated on ice for 45 minutes, washed 3.times.with 5 ml/wash FACS
buffer and resuspended in 0.2 ml FACS buffer. Samples were
processed on a Becton Dickinson FACscan and the data analyzed using
Lysys II software (Becton Dickinson).
[0113] COS cells transfected with CD18 sequences only did not stain
for CD18, CD11a or CD11b. When co-transfected with CD11a/CD18,
about 15% of the cells stained with antibodies to CD11a or CD18.
All cells transfected with CD18 and any .alpha..sub.d construct
resulted in no detectable staining for CD11a and CD11b. The
pATM.B1, pATM.C10 and pATM.D12 groups stained 4%, 13% and 8%
positive for CD18, respectively. Fluorescence of the positive
population in the CD11a/CD18 group was 4-fold higher than
background. In comparison, the co-transfection of .alpha..sub.d
constructs with the CD18 construct produced a positive population
that showed a 4- to 7-fold increase in fluorescence intensity over
background.
EXAMPLE 10
Biotin-Labeled Immunoprecipitation of Human .alpha..sub.d CD18
Complexes from Co-transfected COS Cells
[0114] Immunoprecipitation was attempted on cells co-transfected
with CD18 and each of the .alpha..sub.d expression plasmids
separately described in Example 7 in order to determine if
.alpha..sub.d could be isolated as part of the .alpha..beta.
heterodimer complex characteristic of integrins.
[0115] Transfected cells (1-3.times.10.sup.8 cells/group) were
removed from petri dishes with Versene buffer and washed 3 times in
50 ml/group D-PBS. Each sample was labeled with 2 mg Sulpho-NHS
Biotin (Pierce, Rockford, Ill.) for 15 minutes at room temperature.
The reaction was quenched by washing 3 times in 50 ml/sample cold
D-PBS. Washed cells were resuspended in 1 ml lysis buffer (1% NP40,
50 mM Tris-HCl, pH 8.0, 0.2 M NaCl, 2 mM Ca.sup.++, 2 mM Mg.sup.++,
and protease inhibitors) and incubated 15 minutes on ice. Insoluble
material was pelleted by centrifugation at 10,000 g for 5 minutes,
and the supernatant removed to fresh tubes. In order to remove
material non-specifically reactive with mouse immunoglobulin, a
pre-clearance step was initially performed. Twenty-five micrograms
of mouse immunoglobulin (Cappel, West Chester, Pa.) was incubated
with supernatants at 4.degree. C. After 2.5 hr, 100 .mu.l (25
.mu.g) rabbit anti-mouse Ig conjugated Sepharose.RTM. (prepared
from Protein A Sepharose.RTM. 4B and rabbit anti-mouse IgG, both
from Zymed, San Francisco, Calif.) was added to each sample;
incubation was continued at 4.degree. C. with rocking for 16 hours.
Sepharose.RTM. beads were removed from the supernatants by
centrifugation. After pre-clearance, the supernatants were then
treated with 20 .mu.g anti-CD18 antibody (TS1.18) for 2 hours at
4.degree. C. Antibody/antigen complexes were isolated from
supernatants by incubation with 100 .mu.l/sample rabbit
anti-mouse/Protein A-Sepharose.RTM. preparation described above.
Beads were washed 4 times with 10 mM HEPES, 0.2 M NaCl, and 1%
Triton-X 100.RTM.. Washed beads were pelleted and boiled for 10
minutes in 20 .mu.l 2.times.Laemmli sample buffer with 2%
.beta.-mercaptoethanol. Samples were centrifuged and run on an 8%
prepoured Novex polyacrylamide gel (Novex) at 100 V for 30 minutes.
Protein was transferred to nitrocellulose membranes (Schleicher
& Schuell) in TBS-T buffer at 200 mAmps for 1 hour. Membranes
were blocked for 2 hr with 3% BSA in TBS-T. Membranes were treated
with 1:6000 dilution of Strep-avidin horse radish peroxidase (POD)
(Boehringer Mannheim) for 1 hour, followed by 3 washes in TBS-T.
The Amersham Enhanced Chemiluminescence kit was then used according
to the manufacturer's instructions to develop the blot. The
membrane was exposed to Hyperfilm.RTM. MP (Amersham) for 0.5 to 2
minutes.
[0116] Immunoprecipitation of CD18 complexes from cells transfected
with pRC.CD18 and either pATM.B1, pATM.C10 or pATM.D12 revealed
surface expression of a heterodimeric species consisting of
approximately 100 kD .beta. chain, consistent with the predicted
size of CD18, and an .alpha. chain of approximately 150 kD,
corresponding to .alpha..sub.d.
Example 11
Stable Transfection of Human .alpha..sub.d in Chinese Hamster Ovary
Cells
[0117] To determine whether .alpha..sub.d is expressed on the cell
surface as a heterodimer in association with CD18, cDNAs encoding
each chain were both transiently and stably transfected into a cell
line lacking both .alpha..sub.d and CD18.
[0118] For these experiments, .alpha..sub.d cDNA was augmented with
additional leader sequences and a Kozak consensus sequence, as
described in Example 7, and subcloned into expression vector
pcDNA3. The final construct, designated pATM.D12, was
co-transfected with a modified commercial vector, pDC1.CD18
encoding human CD18 into dihydrofolate reductase (DHFR).sup.-
Chinese hamster ovary (CHO) cells. The plasmid pDC1.CD18 encodes a
DHFR.sup.+ marker and transfectants can be selected using an
appropriate nucleoside-deficient medium. The modifications which
resulted in pDC1.CD18 are as follows.
[0119] The plasmid pRC/CMV (Invitrogen) is a mammalian expression
vector with a cytomegalovirus promoter and ampicillin resistance
marker gene. A DHFR gene from the plasmid pSC1190-DHFR was inserted
into pRC/CMV 5' of the SV40 origin of replication. In addition, a
polylinker from the 5' region of the plasmid pH2G-DHF was ligated
into the pRC/CMV/DHFR construct, 3' to the DHFR gene. CD18 encoding
sequences are subsequently cloned into the resulting plasmid
between the 5' flanking polylinker region and the bovine growth
hormone poly A encoding region.
[0120] Surface expression of CD18 was analyzed by flow cytometry
using the monoclonal antibody TS1/18. Heterodimer formation
detected between .alpha..sub.d and CD18 in this cell line was
consistent with the immunoprecipitation described in Example 10
with transient expression in COS cells.
EXAMPLE 12
Human .alpha..sub.d Binds ICAM-R in a CD18-dependent Fashion
[0121] In view of reports that demonstrate interactions between the
leukocyte integrins and intercellular adhesion molecules (ICAMs)
which mediate cell-cell contact [Hynes, Cell 69:11-25 (1992)], the
ability of CHO cells expressing .alpha..sub.d/CD18 to bind ICAM-1,
ICAM-R, or VCAM-1 was assessed by two methods.
[0122] In replicate assays, soluble ICAM-1, ICAM-R, or VCAM-1 IgGI
fusion proteins were immobilized on plastic and the ability of
.alpha..sub.d/CD18 CHO transfected cells to bind the immobilized
ligand was determined. Transfected cells were labeled internally
with calcein, washed in binding buffer (RPMI with 1% BSA), and
incubated in either buffer only (with or without 10 ng/ml PMA) or
buffer with anti-CD18 monoclonal antibodies at 10 .mu.g/ml.
Transfected cells were added to 96-well Immulon.RTM. 4 microtiter
plates previously coated with soluble ICAM-1/IgG1, ICAM-R/IgG1 or
VCAM-1/IgG1 fusion protein, or bovine serum albumin (BSA) as a
negative control. Design of the soluble forms of these adhesion
molecules is described and fully disclosed in co-pending and
co-owned U.S. patent application Ser. No. 08/102,852, filed Aug. 5,
1993. Wells were blocked with 1% BSA in PBS prior to addition of
labeled cells. After washing the plates by immersion in PBS with
0.1% BSA for 20 minutes, total fluorescence remaining in each well
was measured using a Cytofluor.RTM. 2300 (Millipore, Milford,
Mass.).
[0123] In experiments with immobilized ICAMs, .alpha..sub.d/CD18
co-transfectants consistently showed a 3-5 fold increase in binding
to ICAM-R/IgG1 wells over BSA coated wells. The specificity and
CD18-dependence of this binding was demonstrated by the inhibitory
effects of anti-CD18 antibody TS1/18. The binding of cells
transfected with CD11a/CD18 to ICAM-1/IgG1 wells was comparable to
the binding observed with BSA coated wells. CD11a/CD18 transfected
cells showed a 2-3 fold increase in binding to ICAM-1/IgG1 wells
only following pretreatment with PMA. PMA treatment of
.alpha..sub.d/CD18 transfectants did not affect binding to
ICAM-1/IgG1 or ICAM-R/IgG1 wells. No detectable binding of
.alpha..sub.d/CD18 transfectants to VCAM-1/IgG1 wells was
observed.
[0124] Binding of .alpha..sub.d/CD18-transfected cells to soluble
ICAM-1/IgG1, ICAM-R/IgG1, or VCAM-1/IgG1 fusion proteins was
determined by flow cytometry. Approximately one million
.alpha..sub.d/CD18-transfect- ed CHO cells (grown in spinner flasks
for higher expression) per measurement were suspended in 100 .mu.l
binding buffer (RPMI and 1% BSA) with or without 10 .mu.g/ml
anti-CD18 antibody. After a 20 minute incubation at room
temperature, the cells were washed in binding buffer and soluble
ICAM-1/IgG1 or ICAM-R/gG1 fusion protein was added to a final
concentration of 5 .mu.g/ml. Binding was allowed to proceed for 30
minute at 37.degree. C., after which the cells were washed three
times and resuspended in 100 .mu.l binding buffer containing
FITC-conjugated sheep anti-human IgG1 at a 1:100 dilution. After a
30 minute incubation, samples were washed three times and suspended
in 200 .mu.l binding buffer for analysis with a Becton Dickinson
FACScan.
[0125] Approximately 40-50% of the .alpha..sub.d/CD18 transfectants
indicated binding to ICAM-R/IgG1, but no binding to ICAM-1/IgG1 or
VCAM-1/IgG1 proteins. Pretreatment of transfected cells with PMA
has no effect on .alpha..sub.d/CD18 binding to either ICAM-1/IgG1,
ICAM-R/IgG1 or VCAM-1/IgG1, which was consistent with the
immobilized adhesion assay. Binding by ICAM-R was reduced to
background levels after treatment of .alpha..sub.d/CD18
transfectants with anti-CD18 antibody TS1/18.
[0126] The collective data from these two binding assays illustrate
that .alpha..sub.d/CD18 binds to ICAM-R and does so preferentially
as compared to ICAM-1 and VCAM-1. The ad/CD18 binding preference
for ICAM-R over ICAM-1 is opposite that observed with CD11a/CD18
and CD11b/CD18. Thus modulation of .alpha..sub.d/CD18 binding may
be expected to selectively affect normal and pathologic immune
function where ICAM-R plays a prominent role. Moreover, results of
similar assays, in which antibodies immunospecific for various
extracellular domains of ICAM-R were tested for their ability to
inhibit binding of ICAM-R to .alpha..sub.d/CD18 transfectants,
indicated that .alpha..sub.d/CD18 and CD11a/CD18 interact with
different domains of ICAM-R.
[0127] The failure of CD11a/CD18 to bind ICAM-1/IgG1 or ICAM-R/IgG1
in solution suggests that the affinity of binding between CD11
a/CD18 and ICAM-1 or ICAM-R is too low to permit binding in
solution. Detection of .alpha..sub.d/CD18 binding to ICAM-R/IgG1,
however, suggests an unusually high binding affinity.
[0128] In the assays described above, the VCAM-1/Ig fusion protein
comprised the seven extracellular immunoglobulin-like domains. The
fusion protein was produced in transfected CHO cells and protein
yield determined by sandwich ELISA. The seven domain VCAM-1 fusion
protein from CHO cell supernatant was employed without purification
and protein yield was found to be extremely low. Because of the low
protein yield in the VCAM-1 preparations, .alpha..sub.d/CD18
binding to VCAM-1 was re-examined using a commercial VCAM-1
preparation (R & D Systems, Minneapolis, Minn.) in order to
determine if the low VCAM-1 concentration resulted in undetectable
.alpha..sub.d binding.
[0129] As before, CHO cells expressing .alpha..sub.d and CD18 were
utilized in adhesion assays employing immobilized recombinant
adhesion molecules. Using flow cytometry, it was shown that
.alpha..sub.d-transfected CHO cells expressed both .alpha..sub.d
and CD18 and none of the other .beta..sub.2 integrins. The
transfected CHO cells were also shown to express neither of the two
known VCAM-1 binding partner proteins, .alpha..sub.4.beta..sub.1
and .alpha..sub.4.beta..sub.7- . The parental CHO cell line was
shown to express no .alpha..sub.4 or .beta..sub.2 integrins.
Binding experiments were carried out essentially as described
above.
[0130] Results indicated that .alpha..sub.d-transfected CHO cells
bound immobilized VCAM-1 at a rate of approximately 14.2% as
compared to binding to immobilized BSA at a rate of 7.5% and to
immobilized E-selection at a rate of 2.8%. In addition, binding to
immobilized VCAM-1 was essentially blocked (3.0% binding) in the
presence of a monoclonal antibody specific for the first domain of
VCAM-1. The parental CHO cells did not bind either VCAM-1,
E-selection or BSA (all binding rates were less than 2%). Binding
of the transfected CHO cells also decreased with serial passage of
the cells which was consistent with the observed decrease in
.alpha..sub.d surface expression over the same time period.
[0131] In order to determine if cells which naturally express
.alpha..sub.d/CD18 utilize VCAM-1 as a binding partner, peripheral
blood eosinophils were isolated and cultured five to seven days in
the presence of 10 ng/ml IL-5 in order to increase .alpha..sub.d
expression. Flow cytometry indicated that IL-5 incubation increased
.alpha..sub.d expression two- to four-fold, but had no effect on
.alpha..sub.4 expression.
[0132] Results indicated that the cultured eosinophils bound
immobilized VCAM-1 at a rate of approximately 28.8% and that the
binding was partially inhibited by both an anti-CD18 monoclonal
antibody (binding rate 17.1%) and a monoclonal antibody against
.alpha..sub.4 (binding rate 18.1%). Contrary to the preliminary
results above with low levels and/or impure VCAM-1, these data
suggest that .alpha..sub.d.beta..sub.2 is a ligand for VCAM-1.
[0133] The FACS adhesion assay described above was used to test the
binding of an ICAM-R mutant E37A/Ig to CHO cells expressing
.alpha..sub.d/CD18. E37A/Ig has been shown to obviate binding to an
LFA-1/Ig chimera [Sadhu, et al., Cell Adhesion and Communication
2:429440 (1994)]. The mutant protein was expressed in a soluble
form from stably transfected CHO cell line and purified over a
Prosep.RTM. A column as described by Sadhu, et al, supra.
[0134] E37A/Ig binding with the .alpha..sub.d/CD18 transfectants
was not detected in repeated assays. The mean fluorescence
intensity (MFI) of the E37A/Ig chimera detected by FITC-conjugated
anti-human antibody was identical to the MFI of the detecting
antibody alone, indicating there was no detectable signal above
background using the E37A/Ig mutant protein in the assay.
Similarly, in an ELISA, carried out as described in Example 14, the
E37A/Ig mutant did not appear to bind immobilized
.alpha..sub.d/CD18.
.alpha..sub.d Binding to iC3b
[0135] Complement component C3 can be proteolytically cleaved to
form the complex iC3b, which initiates the alternative pathway of
complement activation and leads ultimately to cell-mediated
destruction of a target. Both CD11b and CD11c have been implicated
in iC3b binding and subsequent phagocytosis of iC3b-coated
particles. A peptide fragment in the CD11b I domain has recently
been identified as the site of iC3b interaction [Ueda, et al.,
Proc.Natl.Acad.Sci.(USA) 91:10680-10684 (1994)]. The region of iC3b
binding is highly conserved in CD11b, CD11c, and .alpha..sub.d,
suggesting an .alpha..sub.d/iC3b binding interaction.
[0136] Binding of .alpha..sub.d to iC3b is performed using
transfectants or cell lines naturally expressing .alpha..sub.d (for
example, PMA-stimulated HL60 cells) and iC3b-coated sheep red blood
cells (sRBC) in a rosette assay [Dana, et al., J. Clin.Invest.
73:153-159 (1984)]. The abilities of .alpha..sub.dCD18 CHO
transfectants, VLA4-CHO transfectants (negative control) and
PMA-stimulated HL60 cells (positive control) to form rosettes are
compared in the presence and absence of an anti-CD18 monoclonal
antibody (for example TS1/18.1).
EXAMPLE 13
Screening by Scintillation Proximity Assay ID of Modulators of
.alpha..sub.d Binding
[0137] Specific inhibitors of binding between the .alpha..sub.d
ligands of the present invention and their binding partners
(.alpha..sub.d ligand/anti-ligand pair) may be determined by a
variety of means, such as scintillation proximity assay techniques
as generally described in U.S. pat. No. 4,271,139, Hart and
Greenwald, Mol.Immunol. 12:265-267 (1979), and Hart and Greenwald,
J.Nuc.Med 20:1062-1065 (1979), each of which is incorporated herein
by reference.
[0138] Briefly, one member of the .alpha..sub.d ligand/anti-ligand
pair is bound to a solid support either directly or indirectly.
Indirect capture would involve a monoclonal antibody, directly
bound to the support, which recognizes a specific epitope at the
C-terminus of the soluble integrin .beta. chain protein. This
epitope would be either the hemagglutinin protein or the
mycobacterial IIIE9 epitope [Anderson, et al., J. Immunol.
141:607-613 (1988). A fluorescent agent is also bound to the
support. Alternatively, the fluorescent agent maybe integrated into
the solid support as described in U.S. Pat. No. 4,568,649,
incorporated herein by reference. The non-support bound member of
the .alpha..sub.d ligand/anti-ligand pair is labeled with a
radioactive compound that emits radiation capable of exciting the
fluorescent agent. When the ligand binds the radiolabeled
anti-ligand, the label is brought sufficiently close to the
support-bound fluorescer to excite the fluorescer and cause
emission of light. When not bound, the label is generally too
distant from the solid support to excite the fluorescent agent, and
light emissions are low. The emitted light is measured and
correlated with binding between the ligand and the anti-ligand.
Addition of a binding inhibitor to the sample will decrease the
fluorescent emission by keeping the radioactive label from being
captured in the proximity of the solid support. Therefore, binding
inhibitors may be identified by their effect on fluorescent
emissions from the samples. Potential anti-ligands to .alpha..sub.d
may also be identified by similar means.
[0139] The soluble recombinant .alpha..sub.d/CD18 leucine zipper
construct (see Example 14) is used in a scintillation proximity
assay to screen for modulators of CAM binding by the following
method. The recombinant integrin is immobilized with a nonblocking
anti-.alpha. subunit or anti-.beta. subunit antibody previously
coated on a scintillant-embedded plate. Chemical library compounds
and a specific biotinylated CAM/Ig chimera are added to the plate
simultaneously. Binding of the CAM/Ig chimera is detected by
labeled strepavidin. In the assay, ICAM-1/Ig and ICAM-R/Ig are
biotinylated with NHS-Sulfo-biotin LC (long chain, Pierce)
according to manufacturers suggested protocol. Labeled proteins are
still reactive with CAM specific antibodies and can be shown to
react with immobilized LFA-1 by ELISA, with detection by
Strepavidin-HRP and subsequent development with OPD.
[0140] Alternatively, the recombinant leucine zipper protein is
purified, or partially purified and coated directly on the
scintillant embedded plate. Unlabelled CAM/Ig chimera and chemical
library compounds are added simultaneously. Bound CAM/Ig is
detected with .sup.125I-labeled anti-human Ig.
[0141] As yet another alternative, purified CAM/Ig protein is
immobilized on the scintillant plate. Chemical library compounds
and concentrated supernatant from cells expressing recombinant
leucine zipper integrin are added to the plate. Binding of the
recombinant integrin is detected with a labeled, non-blocking
.alpha. or .beta. subunit antibody.
Screening for Small Molecule Modulators
[0142] As an alternative to scintillation proximity assays,
.alpha..sub.d binding partners and inhibitors of the same can be
identified using ELISA-like assays as described below.
[0143] Soluble .alpha..sub.d/CD18 leucine zipper (LZ) construct
(see Example 14) was captured from tissue culture supernatants
using the anti-.alpha..sub.d antibody 212D (see Example 15). The
212D antibody was immobilized on 96-well Immulon.RTM. IV plates
(Costar) in bicarbonate coating buffer (pH 9.5) overnight at
4.degree. C. The same protocol was used to immobilize the
anti-CD11a antibody TS2/4.1 for immobilization of a LFA-1 leucine
zipper (LFA-1LZ) fusion protein; LFA-1 was used as a negative
control for VCAM-1 binding and a positive control for ICAM-1
binding. The plates were blocked with 300 .mu.l/well 3% bovine
serum albumin for one hour and washed in D-PBS. Tissue culture
supernatants from stable CHO transfectants expressing either
.alpha..sub.d/CD18LZ or LFA-1LZ were added at 100 .mu.l/well and
allowed to incubate for 6 to 8 hours at 4.degree. C. The plates
were washed twice with Tris-buffered saline with Tween.RTM. 20
(TBS-T), followed by one wash with TBS (no Tween.RTM.) containing 2
mM each calcium chloride, magnesium chloride, and manganese
chloride. The latter served as assay and wash buffer during the
remainder of the assay.
[0144] After integrin capture, the plates were washed three times
with 250 .mu.l/well TBS. Purified CAM/Ig (see Example 12) was added
to each well following serial 2:3 dilutions starting at a
concentration of 10 to 20 .mu.g/ml. CAM/Igs were allowed to bind
for two hours at room temperature before plates were washed as
above. Bound fusion protein was detected with horseradish
peroxidase-conjugated goat anti-human Ig antibody (Jackson Labs)
followed by development with o-phenyldiarnine (OPD).
[0145] Results indicated that while ICAM-1/Ig caused a 5- to 7-fold
increase in signal when bound to LFA-1LZ, it failed to bind
.alpha..sub.d/CD18LZ. In contrast, VCAM-1/Ig exhibited a 5-fold
increase in signal above background in wells containing
.alpha..sub.d/CD18LZ, but not in wells with LFA-1LZ. An ICAM-R
mutant E37A/lg (see Example 12) did not bind either integrin.
[0146] The .alpha..sub.d specific monoclonal antibodies 212D, 217L,
217I, 217H, 217G, 217K, and 217M were tested for the ability to
inhibit VCAM-1 binding to immobilized .alpha..sub.d/CD18. In
addition, anti-VCAM-1 monoclonal antibodies 130K, 130P and IG11B1
(Caltag) were used to determine reaction specificity. The
anti-.alpha..sub.d monoclonal antibodies were used at 5 .mu.g/ml
and the anti-VCAM-1 antibodies at 25 .mu.g/ml; the higher
anti-VCAM-1 antibody concentration was used in view of the fact
that VCAM-1 is in solution in the assay system.
[0147] Partial blocking (50%) resulted in the wells treated with
either 217I or 20 130K and 130P used together. The combination of
130K/130P also completely inhibits the interaction of VLA-4 and
VCAM-1 which suggested that .alpha..sub.d and VLA-4 bind to
distinct sites on VCAM-1 and the possibility of developing
antagonists which selectively interfere with .alpha..sub.d/VCAM-1
binding.
[0148] This assay can be adapted as follows to perform high
throughput screening assays for inhibitors of .alpha..sub.d
binding. VCAM-1/Ig is biotinylated and used as above in the
presence of pooled chemical compounds previously solubilized in
DMSO; bound VCAM-1/Ig is then detected with a strepavidin-europium
(Eu) complex. The strepavidin-Eu complex is activated by chelation
resulting in measurable light emission. Changes, or more
particularly a decrease, in emission is indicative of inhibition of
VCAM-l.alpha..sub.d binding, presumably as a result of action by
one or more compounds in the pool of small molecules, which are
then assayed individually or in smaller groupings.
EXAMPLE 14
Soluble Human .alpha..sub.d Expression Constructs
[0149] The expression of full-length, soluble human
.alpha..sub.d/CD18 heterodimeric protein provides easily purified
material for immunization and binding assays. The advantage of
generating soluble protein is that it can be purified from
supernatants rather than from cell lysates (as with full-length
membrane-bound .alpha..sub.d/CD18); recovery in therefore improved
and impurities reduced.
[0150] The soluble .alpha..sub.d expression plasmid was constructed
as follows. A nucleotide fragment corresponding to the region from
bases 0 to 3161 in SEQ ID NO:1, cloned into plasmid pATM.D12, was
isolated by digestion with HindIII and AatII. A PCR fragment
corresponding to bases 3130 to 3390 in SEQ ID NO:1, overlapping the
HindIII/AatII fragment and containing an addition MluI restriction
site at the 3' terminus, was amplified from pATM.D12 with primers
sHAD.5 and sHAD.3 set out in SEQ ID NOS:30 and 31,
respectively.
10 5'-TTGCTGACTGCCTGCAGTTC-3' (SEQ ID NO:30)
5'-GTTCTGACGCGTAATGGCATTGTAGACCTCGTC (SEQ ID NO:31) TTC-3'
[0151] The PCR amplification product was digested with AatII and
MluI and ligated to the HindIII/AatII fragment. The resulting
product was ligated into HindIII/MluI-digested plasmid pDC1.s.
[0152] This construct is co-expressed with soluble CD18 in stably
transfected CHO cells, and expression is detected by
autoradiographic visualization of immunoprecipitated CD18 complexes
derived from .sup.35S-methionine labeled cells. The construct is
also co-expressed with CD18 in 293 cells [Berman, et al., J. Cell.
Biochem. 52:183-195 (1993)].
Soluble Full-length .alpha..sub.d Construct
[0153] Alternative .alpha..sub.d expression constructs are also
contemplated by the invention. In order to facilitate expression
and purification of an intact .alpha..sub.d/CD18 heterodimer,
soluble .alpha..sub.d and CD18 expression plasmids will be
constructed to include a "leucine zipper" fusion sequence which
should stabilize the heterodimer during purification [Chang, et
al., Proc.Natl.Acad Sci.(USA), 91: 11408-11412 (1994)]. Briefly,
DNA encoding the acidic and basic amino acid strands of the zipper
have been generated by primer annealing using oligonucleotides
described in Chang, et al. The DNA sequences have been further
modified to include additional Mlu1 and Xba1 restriction sites at
the 5' and 3' ends, respectively, of the DNA to facilitate
subcloning into .alpha..sub.d or CD18 expression constructs
previously described. In addition, sequences representing either
hemagglutinin protein or a polyhistidine sequence have been added,
as well as a stop codon inserted after the Xba1 site. The
hemagglutinin or polyhistidine sequences are incorporated to
facilitate affinity purification of the expressed protein.
Sequences encoding the basic strand of the zipper are incorporated
on the plasmid vector expressing CD18; the acidic strand is
inserted on the .alpha. chain construct. Upon expression of the
modified .alpha..sub.d and CD18 proteins in a host cell, it is
presumed that interaction between the acidic and basic strands of
the zipper structure will stabilize the heterodimer and permit
isolation of the intact .alpha..sub.d/CD18 molecule by affinity
purification as described above.
[0154] Plasmids were constructed for expression of soluble
.alpha..sub.d and CD18 with acidic and basic "leucine zipper"
sequences and transfected into COS cells by the DEAE/Dextran method
described in Example 7. The resulting protein was referred to as
.alpha..sub.d/CD18LZ. Hemagglutinin and polyhistidine tags were not
incorporated into .alpha..sub.d/CD18LZ. Transfected cells were
grown for 14 days in reduced serum (2%) conditions. Supernatants
harvested every five days from transfected cells were assayed for
protein production by ELISA as described in Example 8. Briefly, the
.alpha..sub.d/CD18LZ heterodimer was immobilized on plates coated
with anti-.alpha..sub.d monoclonal antibody 169B (see Example 15).
The .alpha..sub.d/CD18LZ complex was detected by addition of a
biotinylated anti-CD18 monoclonal antibody, TS1/18.1 (see Example
8), followed by addition of strepavidin/horse radish peroxidase
(HRP) conjugate and o-phenyldiamine (OPD). Protein was clearly
detectable in the supernatants.
Binding Assays Using Soluble Full Length .alpha..sub.d Expression
Products
[0155] Functional binding assays using the soluble full length
.alpha..sub.d/CD18LZ heterodimer described above were performed by
immobilizing the heterodimer on plates coated with monoclonal
antibody 169B or a non-blocking anti-CD18 monoclonal antibody (see
Example 15). Wells were blocked with fish skin gelatin to prevent
non-specific binding before addition of CAM/Ig chimeras (see
Example 12) at a starting concentration of 10 .mu.g/ml. Binding of
the chimeras to .alpha..sub.d/CD18 was detected with a
goat-anti-human Ig HRP conjugate (Jackson Labs) and subsequent
development with OPD.
[0156] VCAM-1/Ig was observed to bind to captured
.alpha..sub.d/CD18LZ at a 3-5 fold higher level than to captured
CD11a/CD18. ICAM-1/Ig and ICAM-2/Ig bound soluble CD11a/CD18
heterodimer approximately 15 and 10 fold above background,
respectively, but did not bind .alpha..sub.d/CD18. VCAM-1 binding
was reduced approximately 50% in the presence of the VCAM-1
specific antibodies 130K and 130P used in combination.
[0157] The binding assay was also performed with the ICAMAIg
protein immobilized on 96-well plates followed by addition of
recombinant soluble integrin in cellular supernatant. Binding of
the soluble integrins were detected with an unlabeled non-blocking
.alpha. or .beta. subunit specific murine antibody, followed by
incubation with HRP-conjugated goat anti-mouse antibody and
development with OPD.
[0158] Results indicated that a non-blocking antibody detected
.alpha..sub.d/CD18LZ binding to ICAM-R/Ig 10 fold greater than
binding detected in control well containing no antibody. Soluble
.alpha..sub.d/CD18 binding was not detected with immobilized
ICAM-1/Ig, however binding was detected between .alpha..sub.d/CD18
and immobilized CD11b/CD18 and CD11a/CD18 15 and 5 fold,
respectively, greater than background binding.
[0159] Because previous studies have demonstrated that CD11b and
CD11c bind lipopolysaccharide (LPS) [Wright, Curr.Opin.Immunol.
3:83-90 (1991); Ingalls and Golenbock, J.Exp.Med 181:1473-1479
(1995)], LPS binding to .alpha..sub.d/CD18 was also assessed using
flow cytometry and plate-based assays. Results indicated that
FITC-labelled LPS isolated from S.Minnesota and S.typhosa (both
obtained from Sigma) at 20 .mu.g/ml were able to weakly bind
.alpha..sub.d/CD18 transfected CHO cells. No binding was observed
with un-transfected control CHO cells. In ELISA format assays,
biotinylated LPS [Luk, et al., Alan. Biochem. 232:217-224 (1995)]
at 0.5-3.0 .mu.g bound immobilized .alpha..sub.d/CD18LZ with a
signal four fold greater that the capture antibody and blocking
reagent alone. Apparent binding of LPS to CD11a/CD18 was discounted
by subtracting from each experimental value background binding to
anti-CD11a antibody TS2/4.
[0160] In order to identify other ligands for .alpha..sub.d/CD18,
the recombinant .alpha..sub.d/CD18LZ protein is used in a two tier
study. Binding of various cell types to immobilized protein is used
to determine which cells express .alpha..sub.d ligands on the cell
surface. Antibody inhibition is then used to determine if the
observed cell binding results from interaction with known surface
adhesion molecules. If no inhibition results,
co-immunoprecipitation with .alpha..sub.d/CD18LZ bound to proteins
from lysates of cells which will bind .alpha..sub.d is used to
attempt to identify the ligand.
Soluble Human .alpha..sub.d I Domain Expression Constructs
[0161] It has previously been reported that the I domain in CD11a
can be expressed as an independent structural unit that maintains
ligand binding capabilities and antibody recognition [Randi and
Hogg, J.Biol.Chem. 269:12395-12398 (1994); Zhout, et al.,
J.Biol.Chem. 269:17075-17079 (1994); Michishita, et al., Cell
72:857-867 (1993)]. To generate a soluble fusion protein comprising
the .alpha..sub.d I domain and human IgG4, the .alpha..sub.d I
domain is amplified by PCR using primers designed to add flanking
BamHI and XhoI restriction sites to facilitate subcloning. These
primers are set out in SEQ ID NOS:32 and 33 with restriction sites
underlined.
11 (SEQ ID NO:32) 5'-ACGTATGCAGGATCCCATCAAGAGATGGACATCGC- T-3' (SEQ
ID NO:33) 5'-ACTGCATGTCTCGAGGCTGAAGCC- TTCTTGGGACATC-3'
[0162] The C nucleotide immediately 3' to the BamHI site in SEQ ID
NO:32 corresponds to nucleotide 435 in SEQ ID NO:1; the G
nucleotide 3' to the XhoI site in SEQ ID NO:33 is complementary to
nucleotide 1067 in SEQ ID NO:1. The amplified I domain is digested
with the appropriate enzymes, the purified fragment ligated into
the mammalian expression vector pDCs and the prokaryotic expression
vector pGEX-4T-3 (Pharmacia) and the I domain fragment sequenced.
The fusion protein is then expressed in COS, CHO or E. coli cells
transfected or transformed with an appropriate expression
construct.
[0163] Given the affinity of .alpha..sub.d for ICAM-R, expression
of the .alpha..sub.d I domain may be of sufficient affinity to be a
useful inhibitor of cell adhesion in which .alpha..sub.d
participates.
Analysis of Human .alpha..sub.d I Domain/IgG4 Fusion Proteins
[0164] Protein was resolved by SDS-PAGE under reducing and
non-reducing conditions and visualized by either silver staining or
Coomassie staining. Protein was then transferred to Immobilon PVDF
membranes and subjected to Western blot analysis using anti-human
IgG monoclonal antibodies or anti-bovine Ig monoclonal
antibodies.
[0165] Protein detected was determined to migrate at about 120 kD
under non-reducing conditions and at about 45 kD under reducing
conditions. Minor bands were also detected on non-reducing gels at
approximately 40-50 kD which were reactive with the anti-human, but
not anti-bovine, antibodies. A 200 kD minor band was determined to
be bovine Ig by Western blot.
Binding Assays Using I Domain Expression Products
[0166] The ability of the I domain to specifically recognize
ICAM-R/IgG chimeric protein was tested in an ELISA format. Serial
dilutions of .alpha..sub.d I domain IgG4 fusion protein
(I.alpha..sub.d/IgG4) in TBS were incubated with ICAM-1/IgG,
ICAM-R/IgG, VCAM-1/IgG, or an irrelevant IgG1 myeloma protein
immobilized on Immulon.RTM. IV RIA/EIA plates. CD11a I domain/IgG
chimeric protein and human IgG4/kappa myeloma protein were used as
negative controls. Bound IgG4 was detected with the biotinylated
anti-IgG4 monoclonal antibody BP6023 followed by addition of
strepavidin-peroxidase conjugate and development with substrate
o-phenyldiamine.
[0167] In repeated assays, no binding of the CD11a/IgG4 protein or
the IgG4 myeloma protein was detected with any of the immobilized
proteins. The Iad/IgG4 protein did not bind to fish skin gelatin or
bovine serum albumin blocking agents, human IgG1, or ICAM-1/IgG. A
two to three fold increase in binding signal over background was
detected in ICAM-R/IgG protein coated wells using 1-5 .mu.g/ml
concentrations of I.alpha..sub.d/IgG4 protein. The signal in
VCAM-1/IgG protein coated wells was 7-10 fold higher than
background. In previous assays, .alpha..sub.d/CD18 transfected CHO
cells did not bind VCAM-1/IgG protein, suggesting that VCAM-1
binding may be characteristic of isolated I domain amino acid
sequences.
Additional .alpha..sub.d I Domain Constructs
[0168] Additional .alpha..sub.d I domain constructs are generated
in the same fashion as the previous construct, but incorporating
more amino acids around the .alpha..sub.d I domain. Specific
constructs include: i) sequences from exon 5 (amino acids 127-353
in SEQ ID NO:2), preceding the current construct, ii) the EF-hand
repeats (amino acids 17-603 in SEQ ID NO:2) following the I domain,
and iii) the alpha chain truncated at the transmembrane region
(amino acids 17-1029 in SEQ ID NO:2), with an IgG4 tail for
purification and detection purposes. These constructs are ligated
into either the mammalian expression vector pDCS 1 or the
prokaryotic expression vector pGEX-4T-3 (Pharmacia) and the I
domain sequenced. The fusion proteins are then be expressed in COS,
CHO, or E.coli cells transformed or transfected with an appropriate
expression construct. Protein are purified on a ProSepA.RTM. column
(Bioprocessing Limited, Durham, England), tested for reactivity
with the anti-IgG4 monoclonal antibody HP6023 and visualized on
polyacrylamide gels with Coomassie staining.
[0169] In order to construct an expression plasmid for the entire
.alpha..sub.d polypeptide, pATM.D12, described supra, is modified
to express an .alpha.-IgG4 fusion protein by the following method.
IgG4 encoding DNA is isolated from the vector pDCS 1 by PCR using
primers which individually incorporate a 5' AatII restriction site
(SEQ ID NO:89) and a 3' Xba1 restriction site (SEQ ID NO:90).
12 5'-CGCTGTGACGTCAGAGTTGAGTCCAAATATGG- (SEQ ID NO:89) 3'
5'-GGTGACACTATAGAATAGGGC-3' (SEQ ID NO:90)
[0170] Plasmid pATM.D 12 is digested with AatII and Xba1, and the
appropriately digested and purified IgG4 PCR product ligated into
the linear vector.
EXAMPLE 15
Production of Human .alpha..sub.d--Specific Monoclonal
Antibodies
[0171] 1. Transiently transfected cells from Example 7 were washed
three times in Dulbecco's phosphate buffered saline (D-PBS) and
injected at 5.times.10.sup.6 cells/mouse into Balb/c mice with 50
.mu.g/mouse muramyl dipeptidase (Sigma) in PBS. Mice were injected
two more times in the same fashion at two week intervals. The
pre-bleed and immunized serum from the mice were screened by FACS
analysis as outlined in Example 9 and the spleen from the mouse
with the highest reactivity to cells transfected with
.alpha..sub.d/CD18 was fused. Hybridoma culture supernatants were
then screened separately for lack of reactivity against COS cells
transfected with CD11a/CD18 and for reactivity with cells
co-transfected with an .alpha..sub.d expression plasmid and
CD18.
[0172] This method resulted in no monoclonal antibodies.
[0173] 2. As an alternative for production of monoclonal
antibodies, soluble .alpha..sub.d I domain/IgG4 fusion protein was
affinity purified from supernatant of stably transfected CHO cells
and used to immunize Balb/c mice as described above. Hybridomas
were established and supernatants from these hybridomas were
screened by ELISA for reactivity against .alpha..sub.d I domain
fusion protein. Positive cultures were then analyzed for reactivity
with full length .alpha..sub.d/CD18 complexes expressed on CHO
transfectants.
[0174] Mouse 1908 received three initial immunizations of
.alpha..sub.d/CD18 transfected CHO cells and two subsequent boosts
with soluble .alpha..sub.d/CD18 heterodimer. Two final
immunizations included 50 .mu.g/mouse .alpha..sub.d I domain/IgG4
fusion protein. The fusion produced 270 IgG-producing wells.
Supernatant from 45 wells showed at least 7-fold higher binding to
I.alpha..sub.d/IgG4 fusion protein than to human IgG4 by ELISA.
None of the supernatants reacted to .alpha..sub.d/ CD18 transfected
CHO cells as determined by FACS analysis.
[0175] To determine whether the supernatants were able to recognize
integrin alpha subunit proteins in another context, fresh frozen
splenic sections were stained with supernatants from 24 of the 45
wells. Three supernatants were determined to be positive: one
stained large cells in the red pulp, while two others stained
scattered cells in the red pulp and also trabeculae.
[0176] These supernatants were further analyzed by their ability to
immunoprecipitate biotinylated CD18 complexes from either
.alpha..sub.d/CD18 transfected CHO cells or PMA-stimulated HL60
cells. Fusion wells with supernatants that recognized protein in
detergent lysates (which should not be as conformationally
constrained as protein expressed as heterodimers) were selected for
further subcloning. Monoclonal antibodies which recognize protein
in detergent may be more useful in immunoprecipitation of
heterodimeric complexes from transfectants, tissues, and cell
lines.
[0177] 3. As another alternative to monoclonal antibody production,
CD18 complexes were immunoprecipitated from human spleen lysates
with the anti-CD18 monoclonal antibody 23F2G after preclearance of
CD11a/CD18 (using monoclonal antibody TS2/4) and CD11b/CD18 (using
monoclonal antibody Mo-1). Five Balb/c mice, ten to twelve weeks
old, were immunized by subcutaneous injection with approximately 30
.mu.g of resulting protein in complete Freund's adjuvant on day 0,
followed by two boosts of 30 .mu.g immunogen/mouse on days 28 and
43 in incomplete Freund's adjuvant. Test sera were drawn ten days
following the final boost and reactivity was assessed by using
1:500 dilution of each serum to detect 1 .mu.g/lane immunogen in a
Western blot. Sera from three mice detected bands of approximately
95 and 150 kD; no signal was seen in lanes treated with a 1:50
dilution of preimmune sera. The 150 kD band was presumed to
represent .alpha..sub.d in an in vivo glycosylation state. In
addition, all post immune sera immunoprecipitated protein from
lysates of biotinylated .alpha..sub.d/CD18 CHO cells that migrated
at appropriate molecular weights on SDS-PAGE to represent the
heterodimer. From these results, mouse #2212 was selected and was
further immunized by intraperitoneal injection on day 64 with 30
.mu.g immunogen in PBS. The mouse was sacrificed four days later,
and the spleen was sterilely removed.
[0178] A single-cell suspension was formed by grinding the spleen
between the frosted ends of two glass microscope slides submerged
in serum-free RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM
sodium pyruvate, 100 units/ml penicillin, and 100 .mu.g/ml
streptomycin (RPMI) (Gibco, Canada). The cell suspension was
filtered through a sterile 70-mesh Nitex cell strainer (Becton
Dickinson, Parsippany, N.J.), and the filtrate washed twice by
centrifugation at 200.times.g for 5 minutes. The resulting pellet
was resuspended in 20 ml serum-free RPMI. Thymocytes taken from
three naive Balb/c mice were prepared in a similar manner.
[0179] Prior to fusion, NS-1 myeloma cells, kept in log phase in
RPMI with 10% Fetaldone serum (FCS) (Hyclone Laboratories, Inc.,
Logan, Utah) for three days prior to fusion, were pelleted by
centrifugation at 200.times.g for 5 minutes, washed twice as
described in the foregoing paragraph, and counted. Approximately
2.times.10.sup.8 spleen cells were combined with 4.times.10.sup.7
NS-1 cells, and the resulting mixture pelleted by centrifugation at
200.times.g. The supernatant was discarded. The cell pellet
dislodged by tapping the tube and 2 ml of 50% PEG 1500 in 75 mM
Hepes (pH 8.0, 37.degree. C.) (Boehringer Mannheim) was added over
the course of one minute with stirring. An additional 14 ml of
serum-free RPMI was subsequently added over the next seven minutes,
followed by immediate addition of 16 ml RPMI. The resulting mixture
was centrifuged at 200.times.g for 10 minutes and the supernatant
was discarded. The pellet was resuspended in 200 ml RPMI containing
15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM
thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and
1.5.times.10.sup.6 thymocytes/ml, and dispensed into ten 96-well
flat bottom tissue culture plates (Corning, United Kingdom) at 200
.mu.l/well. Cells were fed on days 2, 4, and 6 days post-fusion by
aspirating approximately 100 .mu.l from each well with an 18 G
needle (Becton Dickinson), and adding 100 .mu.l/well plating medium
described above, except containing 10 units/ml IL-6 and lacking
thymocytes.
[0180] On day 7-10 post-fusion, supernatant from each well was
screened by antibody capture ELISA, testing for the presence of
mouse IgG. Immulon.RTM. 4 plates (Dynatech, Cambridge, Mass.) were
coated with 50 .mu.l/well goat anti-mouse IgA, IgG, or IgM (Organon
Teknika) diluted 1:5000 in 50 mM carbonate buffer, pH 9.6, at
4.degree. C. Plates were washed 3.times.with PBS containing 0.5%
Tween.RTM. 20 (PBST) and 50 .mu.l culture supernatant from each
well was added. After incubation at 37.degree. C. for 30 minutes,
wells were washed with PBST as above, and 50 .mu.l of horseradish
peroxidase conjugated goat anti-mouse IgG(fc) (Jackson
ImmunoResearch, West Grove, Pa.) diluted 1:3500 in PBST was added
to each well. Plates were incubated as above, washed 4.times.with
PBST and 100 .mu.l substrate, consisting of 1 mg/ml o-phenylene
diamine (Sigma) and 0.1 .mu.l/ml 30% H.sub.2O.sub.2 in 100 mM
Citrate, pH 4.5, was added. The color reaction was stopped after
five minutes with addition of 50 .mu.l 15% H.sub.2 SO.sub.4.
Absorbance at 490nm was determined for each well using a plate
reader (Dynatech).
[0181] Hybridomas were further characterized as follows.
Supernatants from IgG-producing cultures were analyzed by flow
cytometry for reactivity to .alpha..sub.d/CD18-transformed CHO
cells but not to JY cells (a B-cell line positive for LFA-1, but
not other .beta..sub.2 integrins as observed in previous in-house
staining experiments). Briefly, 5.times.10.sup.5
.alpha..sub.d/CD18-transformed CHO or .alpha..sub.d/CD18.sup.- JY
cells were suspended in 50 .mu.l RPMI containing 2% FBS and 10 mM
NaN.sub.3 (FACS buffer). Individual cell suspensions were added to
50 .mu.IgG positive hybridoma culture supernatant in wells of
96-well round bottomed plates (Corning). After a 30 minute
incubation on ice, cells were washed twice by pelleting in a
clinical centrifuge, supernatant from each well was discarded, and
pellets resuspended in 200-300 .mu.l FACS buffer. The last wash was
replaced with 50 .mu.l/well of a 1:100 dilution of a F(ab').sub.2
fragment of sheep anti-mouse IgG (H+L)-FITC conjugate (Sigma, St.
Louis, Mo.) prepared in FACS Buffer. After incubation as described
above, cells were washed twice with Dulbecco's PBS (D-PBS)
supplemented with 10 mM NaN.sub.3, and finally resuspended in D-PBS
containing 1% paraformaldehyde. Samples were then transferred to
polystyrene tubes for flow cytometric analysis (FACS) with a Becton
Dickinson FACsan analyzer.
[0182] The fusion yielded four cultures deemed positive by both
criteria. When the secondary screen was repeated on expanded
supernatants approximately four days later, three of the four
cultures remained positive. The three wells, designated 169A, 169B,
169D were cloned two to three times, successively, by doubling
dilution in RPMI, 15% FBS, 100 mM sodium hypoxanthine, 16 mM
thymidine, and 10 units/ml IL-6. Wells of clone plates were scored
visually after four days and the number of colonies in the least
dense wells were recorded. Selected wells of the each cloning were
assayed by FACS after 7-10 days. Activity was found in two of the
cultures, 169A and 169B. In the final cloning, positive wells
containing single colonies were expanded in RPMI with 11% FBS.
Antibody from clonal supernatants of 169A and 169B were isotyped
using IsoStrip kit (Boehringer Mannheim) according to manufacturer
instructions and found to be of the IgG1 isotype.
[0183] Immunoprecipitation of .alpha..sub.d/CD18 complexes from CHO
transfectants and PMA-stimulated HL60 cells was used as a tertiary
screen for specificity. Hybridomas 169A and 169B precipitated
appropriate bands from CHO lines, and a single .alpha. chain
species of 150-160 kD from HL60 cells as determined by SDS-PAGE.
Hybridomas 169A and 169B were deposited May 31, 1995 with the
American Type Culture Collection, 12301 Parklawn Drive, Rockville,
Md. 20852 and assigned Accession Numbers HB 11907 and HB 11906,
respectively.
[0184] In order to more fully characterize binding properties of
169A and 169B, the ability of each antibody to inhibit binding of
the other or the anti-CD18 antibody TS1/18.1 to soluble
.alpha..sub.d/CD18 was tested. Soluble full length
.alpha..sub.d/CD18 was immobilized by each unlabeled antibody
separately in a 96-well plate format, and biotinylated antibodies
were used to detect protein bound by the same or different
unlabeled antibodies. Binding was detected using a goat anti-mouse
Ig/HRP conjugate followed by addition of OPD substrate. Results
indicated that antibody 169A was able to block binding of
biotinylated 169A and TS1/18.1, while the antibody 169B blocked
binding only of itself.
[0185] 4. Another mouse (#2214), immunized by the same protocol as
mouse #2212, was selected and further immunized by a pre-fusion
boost on day 70 with 30 .mu.g purified .alpha..sub.d from spleen
lysates in PBS. The mouse was sacrificed four days later, and the
spleen was sterilely removed.
[0186] The fusion and cloning of positive cells were carried out as
described above. The fusion produced five anti-.alpha..sub.d
monoclonal hybridomas designated 170D, 170F, 170E, 170X, and 170H
which were isotyped as IgG.sub.1 using the IsoStrip kit (Boehringer
Mannheim) according to the manufacturer's instructions.
[0187] 5. Still another mouse, #2211, immunized by the same initial
protocol as mouse #2212 and mouse #2214, was selected and further
immunized on day 88 with 30 .mu.g immunogen and a pre-fusion boost
of 30 .mu.g immunogen on day 203. The mouse was sacrificed four
days later, and the spleen was removed and fusion carried out as
described above. Hybridoma supernatant was screened by antibody
capture ELISA and by flow cytometry as detailed in the above
paragraphs.
[0188] Fifteen positive hybridomas were identified, designated
188A, 188B, 188C, 188E, 188F, 188G, 188I, 188J, 188K, 188L, 188M,
188N, 188P, 188R and 188T, and isotyped in an ELISA assay. Briefly,
Immulon.RTM. 4 plates (Dynatech, Cambridge, Mass.) were coated at
4.degree. C. with 50 .mu.l/well goat anti-mouse IgA,G,M (Organon
Teknika) diluted 1:5000 in 50 mM carbonate buffer, pH 9.6. Plates
were blocked for 30 minutes at 37.degree. C. with 1% BSA in PBS,
washed three times with PBS/0.05% Tween.RTM. 20 (PBST) and 50 .mu.l
culture supernatant (diluted 1:10 in PBST) added. After incubation
and washing as above, 50 .mu.l of horseradish peroxidase conjugated
rabbit anti-mouse IgG.sub.1, G.sub.2a, or G.sub.3 (Zymed, San
Francisco, Calif.), diluted 1:1000 in PBST with 1% normal goat
serum, was added. Plates were incubated as above, washed four times
with PBST, after which 100 .mu.l substrate, consisting of 1 mg/ml
o-phenylene diamine (Sigma) and 0.1 .mu.l/ml 30% H.sub.2O.sub.2 in
100 mM citrate, pH 4.5, was added. The color reaction was stopped
in 5 minutes with the addition of 50 .mu.l of 15% H.sub.2SO.sub.4.
A.sub.490 was read on a plate reader (Dynatech) and all fifteen
antibodies were determined to be IgG1.
[0189] The excess spleen cells from mouse #2211 were frozen in a
cryovial and stored in liquid nitrogen. The cryovial was thawed
quickly by placing into a 37.degree. C. water bath, and moving it
in a circular motion just until contents were melted. Cells were
transferred to a 15 ml centrifuge tube where warm RPMI containing
11% FBS was added slowly 1 ml at a time, allowing three to five
minutes between additions. Another 5 ml warm RPMI was added and
after a five minute wait, the tube was centrifuged at 200.times.g
for five minutes and supernatant aspirated. Cells were resuspended
in RPMI and a fusion carried out as described above. Hybridoma
supernatant was screened by antibody capture and flow cytometry as
described above.
[0190] The fusion yielded five clones designated 195A, 195C, 195D,
195E and 195H. The clones were isotyped by the ELISA procedure as
described above; monoclonal antibodies 195A, 195C, 195D and 195E
were-determined to be IgG.sub.1 and 195H was determined to be
IgG.sub.2a.
[0191] 6. In another attempt to generate anti-.alpha..sub.d
monoclonal antibodies, mouse #2213 was immunized using the same
protocol as mice 2214, 2211, and 2212, but also further immunized
on day 414 and 441 with 30 .mu.g of human .alpha..sub.d/CD18
leucine zipper (LZ) bound to Sepharose.RTM. beads. The immunogen
for mouse #2213 was prepared by immunoprecipitating human
.alpha..sub.d/CD18LZ (Example 14) with an anti-CD18 monoclonal
antibody and protein A Sepharose.RTM.. The precipitated complex was
resuspended as a slurry at a 1:1 ratio with PBS prior to injection.
The mouse was sacrificed four days after the booster immunization.
The spleen was removed and a fusion carried out as previously
described above.
[0192] Positive hybridomas were identified by ELISA using human
.alpha..sub.d/CD18LZ immobilized with the F(ab)' .sub.2 fragment of
a non-blocking anti-CD18 antibody. Briefly, the F(ab)' .sub.2
fragments were coated at 100 ng/well onto Immulon.RTM. 4 ELISA
plates overnight at 4.degree. C. After the buffer was aspirated,
the wells were blocked for 30 minutes at 37.degree. C. with 0.5%
fish skin gelatin (Sigma). After washing three times in PBST, 50
.mu.l/well of supernatant from CHO cells, previously transformed
with a plasmid encoding soluble .alpha..sub.d/CD18LZ, was added and
the plates incubated at 37.degree. C. for 30 minutes. The washing
steps were repeated and 50 .mu.l/well hybridoma supernatant was
added. Detection of monoclonal antibody was carried out as
described above. Positive wells were assayed by flow cytometry
using CHO cells transformed with .alpha..sub.d/CD18-encoding DNA as
described above and two positive hybridomas designated 212A and
212D were identified. Antibodies secreted by the hybridomas were
isotyped as IgG1 using the isotype ELISA procedure described
above.
[0193] 7. In yet another method to generate anti-human
.alpha..sub.d monoclonal antibodies, mice were immunized with
.alpha..sub.d/CD18LZ Sepharose.RTM. beads, prepared as described
above, and each mouse receiving 30 .mu.g immunogen on day 0, day
36, and day 66. Mouse #2477 was selected for fusion after screening
the mouse sera by the recombinant protein ELISA format as described
above. The fusion, selection, and cloning procedures were carried
out using the methods described-above for fusion 212. Seven
positive hybridomas, 217F, 217G, 217H, 217I, 217K, 217L, and 217M
were identified, but hybridoma 217F lost reactivity as determined
by flow cytometry during the last round of cloning. Antibodies from
the six remaining hybridoma lines were isotyped as previously
described and all were found to be IgG1.
[0194] 8. In another method to generate .alpha..sub.d monoclonal
antibodies, mouse #2480 was immunized by the same protocol as mouse
#2477 but further immunized by interperitoneal injection on days
217 and 218 with 30 .mu.g .alpha..sub.d/CD18LZ. The mouse was
sacrificed on day 221, the spleen removed and fusion carried out as
described above. Hybridoma supernatant was screened by ELISA as
described and flow cytometry to determine reactivity to JY cells
previously transfected with DNA encoding .alpha..sub.d/CD18. The
screening procedures were carried out as described above. The
fusion produced three positive hybridomas 240F, 240G, and 240H,
which secreted antibodies isotyped by the ELISA method to all be
IgG1. A fourth hybridoma, 240I, was later characterized to also be
an IgG1 isotype.
[0195] 9. In order to identify antibodies capable of inhibiting
functional .alpha..sub.d binding, soluble .alpha..sub.d/CD18LZ (see
Example 14) is used for immunization. The protein is isolated on an
affinity chromatography resin from supernatant of transiently
transfected COS cells and the resin-bound .alpha..sub.d used as an
immunogen. A selected mouse is immunized as described above and
given a final boost two weeks after the initial immunization.
Immunization by this technique prevents possible changes in protein
conformation often associated with detergent lysis of cells.
Additional mice are immunized with recombinant protein, also
resin-bound, but were not initially immunized with protein purified
from cell lysate.
[0196] Hybridomas, prepared as described above, which result from
the immunization are screened by ELISA on the recombinant protein
immobilized from a cell supernatant using the Fab fragment of a
non-blocking antibody. Alternatively, flow cytomotry is used to
assay for reactivity to JY cells previously transfected with
.alpha..sub.d cDNA.
[0197] 10. As another alternative, monoclonal antibodies are
generated as follows. Affinity purified .alpha..sub.d/CD18
heterodimeric protein from detergent lysates of stably transfected
CHO cells is used with 50 .mu.g/ml muramyl dipeptidase to immunize
Balb/c mice as described above. Mice receive three immunizations
before serum reactivity against .alpha..sub.d/CD18 is determined by
immunoprecipitation of biotinylated complexes in the CHO
transfectants. Hybridomas from positive animals are established
according to standard protocols, after which hybridoma cultures are
selected by flow cytometry using .alpha..sub.d/CD18 transfectants.
CD11a/CD18 transfectants are utilized to control for CD18-only
reactivity.
[0198] 11. As another alternative for monoclonal antibody
production, Balb/c mice undergo an immunization/immunosuppression
protocol designed to reduce reactivity to CHO cell determinants on
transfectants used for immunization. This protocol involves
immunization with untransfected CHO cells and subsequent killing of
CHO-reactive B-cell blasts with cyclophosphamide treatment. After
three rounds of immunization and cyclophosphamide treatment are
performed, the mice are immunized with .alpha..sub.d/CD18 CHO
transfected cells as described above.
[0199] 12. As another alternative, CD18 complexes from detergent
lysates of PMA stimulated HL60 cells are enriched by preclearance
as described above. Other .beta.2 integrins are cleared on the same
columns. Immunization with the resulting complexes, hybridoma
production, and screening protocols are performed as described
supra.
Production of Polyclonal Sera
[0200] Purified .alpha..sub.d I domain/IgG4 chimera (Example 14)
was used to generate polyclonal anti-serum in rabbits. The
.alpha..sub.d I domain/IgG4 antigen was injected at 100
.mu.g/rabbit initially in complete Freund's adjuvant, followed by
three boosts with the same amount of protein in incomplete Freund's
adjuvant. Test bleeds were assayed after the third and fourth
injections. Rabbit immunoglobulin (Ig) was purified from the serum
on a protein A-Sepharose.RTM. column and precleared of anti-human
IgG reactivity on a human IgG/Affigel.RTM. 10 column. Reactivity by
ELISA to the I domain chimera, but not to human IgG, was used to
confirm complete preclearance.
[0201] The precleared polyclonal sera was used to immunoprecipitate
protein from detergent lysates of surface-biotinylated CHO cells
previously transfected with .alpha..sub.d and CD18 expression
vectors. Immunoprecipitation was carried out by the method
previously described in Example 10. The precleared sera recognized
a protein complex of the same molecular weight as that precipitated
by anti-CD18 monoclonal antibody TS1.18. In addition, the sera
recognized a single band of appropriate size in a Western blot of
CD18 complexes from .alpha..sub.d/CD18 transfected CHO cells.
Affinity purified integrins CD11a/CD18, CD11b/CD18, and VLA4 from
human spleen were not recognized by the rabbit polyclonal sera. The
sera failed to react with .alpha..sub.d-transfected CHO cells in
solution, as determined by flow cytometry. It was therefore
concluded that the polyclonal rabbit sera was only capable of
recognizing denatured .alpha..sub.d I domain/IgG4 proteins.
[0202] In an attempt to produce polyclonal antisera against
.alpha..sub.d/CD18, a mouse was immunized 3 times with
.alpha..sub.d transfected CHO cells (D6.CHO, .alpha..sub.d/CD18)
with adjuvant peptide and once with purified .alpha..sub.d/CD18
heterodimer. A final boost included only .alpha..sub.d/CD18
heterodimer. Approximately 100 .mu.l immunized serum was precleared
by addition of approximately 10.sup.8 LFA-1-transfected CHO cells
for 2 hours at 4.degree. C. The resulting serum was assayed for
.alpha..sub.d reactivity at dilutions of 1/5000, 1/10000, 1/20000
and 1/40000 on normal human spleen. The polyclonal antibody was
reactive at a dilution of 1/20000, while a 1/40000 dilution stained
very weakly.
EXAMPLE 16
Flow Cytometric Analysis Using Anti-.alpha..sub.d Monoclonal
Antibodies
[0203] Several primary and immortalized cell lines were used in a
survey with the anti-.alpha..sub.d monoclonal antibodies 212D,
217K, and 217L. Cell staining was performed and analyzed according
to the methods described in Example 17. Primary
CD8.sup.+/CD56.sup.- and CD4.sup.-/CD8.sup.-/CD56.sup.+ cell lines
specific for MAGE-3 (melanoma associated proteins) peptides were
strongly positive for CD11b and CD11c, but were not stained by any
of the .alpha..sub.d antibodies. MAGE-3 peptide-specific cells are
expanded from peripheral blood mononuclear cell populations using
peptide-loaded antigen presenting cells (APCs, either dendritic
cells or monocytes). Repeated stimulations under limiting dilution
conditions, combined with phenotypic selection, result in clonal
cytolytic lines which will specifically kill target cells bearing
the native protein from which the peptides were derived.
[0204] Dendritic cells from peripheral blood, cultured for seven
days in the presence of cytokines IL4 and GM-CSF, were stained
strongly by antibodies to CD11a, CD11b, and CD11c, as well as the
217L anti-.alpha..sub.d antibody. The antibodies 212D, 217K, 217I,
217H, and 217M did not react with these cells nor with dendritic
cells, obtained from a variety of donors, in repeated experiments.
By day 14 of culture, the surface expression of the 217L antigen
had waned and the staining disappeared completely by day 21. During
the culture period, CD11b and CD11c expression remained at a high
level (2 to 3 logs over background staining).
EXAMPLE 17
Human Monocyte Expression of .alpha..sub.d
Purification of Human Monocytes from Peripheral Blood
[0205] Approximately 300 ml of blood was drawn from a volunteer
donor into 3.8% sodium citrate buffer (Sigma). The blood was
diluted to 480 ml with endotoxin-free PBS (Sigma), and 30 ml of
diluted blood was carefully layered onto 17 ml of Histopaque in a
50 ml centrifuge tube. The gradients were spun for 30 minutes at
1500 rpm in a Beckman Tabletop Centrifuge. The cellular layer,
representing mononuclear cells, was collected from each gradient
and transferred to a new 50 ml tube. The volume was increased to 50
ml with endotoxin-free PBS, 0.1% BSA (endotoxin free), and the
tubes centrifuged for 15 minutes at 1500 rpm in a Beckman Tabletop
Centrifuge. The supernatant was discarded and the cells resuspended
in a small volume of PBS/BSA and subsequently pooled.
[0206] A second gradient (which uses Percoll [Denholm and Wolber,
J. Immunol. Meth. 144:247-251 (1991)]) was required to purify
monocytes from the mixed population of cells obtained as described
above. Briefly, 10 ml of 10.times.Hanks buffer (Gibco) was mixed
with 600 .mu.l of 1.0 N HCL. To this mixture, 60 ml of Percoll
(Pharmacia, Piscataway, N.J.) was added and the mixture stirred
slowly until all Percoll was in solution. The pH of the Percoll
solution was adjusted to 7.0, after which 8.0 ml of gradient
mixture was added to six 15 ml round-bottomed polystyrene tubes.
Exactly 4.0 ml of cell suspension was added to each gradient and
the tubes inverted several times to mix thoroughly. The gradients
were centrifuged for 25 minutes in a fixed-angle rotor at 1690 rpm
at room temperature. The monocyte fraction, which appeared as a
thin white band in the gradients, was collected and transferred to
new 50 ml centrifuge tubes. The volume was adjusted to 50 ml with
PBS/0.1% BSA and the cells pelleted by centrifugation. The cell
pellets were resuspended in a small volume and pooled and cell
number determined using a hemacytometer. Cells were resuspended in
FACS buffer (RPI 1640, 2.0% FBS, 0.2% sodium azide) and adjusted to
one million cells(condition, i.e., one million cells were used for
each FACS staining condition to assay for various cellular
markers.
FACS Staining and Analysis
[0207] Single antibody cell staining was carried out using
antibodies immunospecific for .alpha..sub.d or cell markers
directly conjugated with a fluorescent tag detectable marker. The
mouse anti-human .alpha..sub.d antibodies 212D or 217L were added
to cells at 10 .mu.g/ml after which the mixture was incubated on
ice for 30 minutes and washed three times. Ten microliters of
directly conjugated cell markers, CD3-FITC (Becton-Dickinson)
(specific for T cells) or CD33 -FITC (Becton-Dickinson) (specific
for monocytes) were added to additional cell samples, while 10
.mu.l of a secondary antibody, anti-mouse FITC (Sigma), was added
to the 212D and 217L stained cells. All samples were incubated on
ice for 30 minutes in the dark, washed three times, and resuspended
in 300 .mu.l of 2.0% paraformaldehyde. Samples were processed on a
Becton Dickinson FACScan and the data analyzed using Lysys II
software (Becton Dickinson).
[0208] In the first experiment, monocytes represented 68% and
T-cells 18% of the total cells purified using the double-gradient
method. There was a significant amount of staining of both cell
types cells for .alpha..sub.d by both 212D and 217L, 55% and 65% of
the cells respectively. Based on later experiments, there appeared
to be some donor-to-donor variation in the relative amount of
.alpha..sub.d staining on freshly isolated human monocytes,
although the isolated monocytes always stained positive. When human
IgG (used at 1 mg/ml for 10 minutes on ice prior to addition of
primary antibody) was added to the cells to block any potential Fc
receptor binding problems, there was no change in the .alpha..sub.d
staining. When these cells were cultured in suspension using Hydron
coated dishes (Interferon Sciences) in 10% FBS/RPM-1640 and
analyzed for .alpha..sub.d expression, there was loss of surface
expression within 24 hours which continued to diminish over a seven
day time course. Relative to expression of other integrins on
freshly isolated human monocytes, including CD11a, CD11b, and
CD11c, the .alpha..sub.d staining was lower.
2-color FACS Staining of Human Monocytes for .alpha..sub.d
[0209] For 2-color FACS staining, both 212D and 217L antibodies
were biotinylated using NHS-LC-biotin (Pierce) according to
manufacturer's instruction. In a separate experiment, cells were
isolated as described above and stained using biotinylated 212D and
217L antibodies and a biotinylated control IgG1 antibody at 10
.mu.g/ml on ice for 30 minutes. The cells were washed three times
in FACS buffer (modified to include D-PBS, 2% FBS, and 0.2% sodium
azide), and resuspended in 1.0 ml FACS buffer. Both 10 .mu.l
FITC-conjugated CD33 (specific for monocytes) and 5 .mu.l
streptavidin PE (PharMingen) were added to cell suspensions.
Samples were incubated on ice for 30 minutes in the dark, washed 3
times in FACS buffer, and resuspended in 300 .mu.l 1%
paraformaldehyde. Samples were processed by FACS as described
above.
[0210] Of the two antibodies, 217L showed significant staining on
CD33.sup.+ cells compared to the control. Antibody 212D also
stained this cell type, but the number of CD33.sup.+ cells staining
was significantly less than observed with antibody 217L. This
result was consistent in two separate experiments. In related
experiments using biotinylated antibodies 212D and 217L,
217L-biotin consistently stained more cells than 212D-biotin.
[0211] Mononuclear cells representing a mixture of lymphocytes and
monocytes obtained before Percoll gradient separation were also
examined by 2-color analysis as above, and double-stained for 212D
and 217L-biotin in combination with FITC-conjugated antibodies
immunospecific for CD3 (T cells), CD4 (helper T cells), CD5
(thymocytes, mature T cells, sub-populations of B cells), CD8
(cytotoxic/suppressor T cells), CD14 (monocytes, neutrophils,
follicular dendritic reticulum cells), CD20 (B cells), and CD56 (NK
cells, subsets of T cells) (Becton Dickinson). No discernible
.alpha..sub.d positive populations of cells co-expressed with these
cellular markers.
EXAMPLE 18
Analysis of .alpha..sub.d Distribution
[0212] Tissue distribution of .alpha..sub.d/CD18 was determined
using polyclonal anti-serum generated as described in Example
15.
[0213] Purified rabbit polyclonal antibody was used at
concentrations ranging between 120 ng/ml and 60 .mu.g/ml for
immunocytochemical analysis of frozen human spleen sections.
Sections of 6 micron thickness were layered onto Superfrost Plus
Slides (VWR) and stored at -70.degree. C. Prior to use, slides were
removed from -70.degree. C. and placed at 55.degree. C. for 5
minutes. Sections were then fixed in cold acetone for 2 minutes and
air dried. Sections were blocked in a solution containing 1% BSA,
30% normal human sera and 5% normal rabbit sera for 30 minutes at
room temperature. Primary antibody was applied to each section for
1 hour at room temperature. Unbound antibody was removed by washing
the slides 3 times in TBS buffer for 5 minutes per wash. Next, a
rabbit anti-mouse IgG link antibody was applied to each section in
the same TBS buffer. A mouse alkaline phosphatase anti-alkaline
phosphatase (APAAP) antibody, incubated for 30 minutes at room
temperature, was used to detect the second antibody. Slides were
then washed 3 times in TBS buffer. Fast Blue substrate (Vector
Labs) was applied and color development stopped by immersion in
water. Slides were counterstained in Nuclear Fast Red (Sigma) and
rinsed in water before mounting with Aqua Mount (Baxter). Staining
was detected in the splenic red pulp with this reagent, but not
with an irrelevant rabbit polyclonal Ig preparation or the
unpurified preimmune serum from the same animal.
[0214] Once mouse serum was determined to have specific
.alpha..sub.d reactivity, it was used to stain various lymphoid and
non-lymphoid tissues. Monoclonal antibodies recognizing CD18,
CD11a, CD11b, and CD11c were used in the same experiment as
controls. Staining of normal spleen sections with .alpha..sub.d
polyclonal sera, and monoclonal antibodies to CD11a, CD11b, CD11c,
and CD18 revealed the following results. The pattern observed with
.alpha..sub.d polyclonal sera did not display the same pattern of
labeling as CD11a, CD11b, CD11c, or CD18. There is a distinct
pattern of labeling with some cells located in the marginal zone of
the white pulp and a distinct labeling of cells peripheral to the
marginal zone. This pattern was not observed with the other
antibodies. Individual cells scattered throughout the red pulp were
also labeled which may or may not be the same population or subset
seen with CD11a and CD18.
[0215] Labeling with CD11c did display some cells staining in the
marginal zone, but the antibody did not show the distinct ring
pattern around the white pulp when compared to .alpha..sub.d
polyclonal sera, nor did labeling in the red pulp give the same
pattern of staining as .alpha..sub.d polyclonal sera.
[0216] Therefore, the labeling pattern seen with .alpha..sub.d
polyclonal serum was unique compared to that seen using antibodies
to the other .beta..sub.2 integrins (CD11a, CD11b, CD11c, and
CD18), and suggests that the in vivo distribution of .alpha..sub.d
in man is distinct from that of other .beta..sub.2 integrins.
Characterization of Human .alpha..sub.d Expression with Monoclonal
Antibodies
[0217] Antibodies secreted by hybridomas 169A and 169B were used to
analyze human .alpha..sub.d expression in frozen tissue sections by
immunocytochemistry and on cell lines and peripheral blood
leukocytes by flow cytometry. Hybridoma supernatants used in both
sets of experiments were undiluted.
Tissue Staining
[0218] All stains were carried out as described above, except for
liver sections which were stained in the following manner. After
acetone fixation, sections were quenched in 1% H.sub.2O.sub.2 and
1% sodium azide in TBS for 15 minutes at room temperature. After
primary antibody staining, a rabbit anti-mouse antibody directly
conjugated to peroxidase was applied for 30 minutes at room
temperature. Slides were washed 3 times in TBS buffer. A swine
anti-rabbit antibody, directly conjugated to peroxidase, was
incubated for 30 minutes at room temperature to detect the second
antibody. Slides were then washed 3 times in TBS buffer and AEC
substrate (Vector Labs) was applied and to allow color development.
Slides were counterstained with Hematoxylin Gill's No. 2 (Sigma),
and subsequently rinsed in water before dehydration and
mounting.
[0219] In spleen sections, the majority of expression was localized
to the splenic red pulp on cells identified by morphology as
granulocytes and macrophages. A large number of granulocytes were
stained, while only a subset of macrophages gave signal. A small
number of follicular dendritic cells in the white pulp also were
weakly stained by the .alpha..sub.d antibodies. CD11a and CD18
staining was detected throughout the red and white pulp. CD11c
staining was more pronounced in large cells presumed to be
macrophages in the splenic white pulp and in the marginal zone
surrounding the white pulp; diffuse staining in the red pulp was
also noted. CD11b appeared to have distribution overlapping with
but not identical to .alpha..sub.d in the red pulp, with no white
pulp involvement.
[0220] Integrin expression in normal and (rheumatoid) arthritic
synovial tissue was compared. Minimal staining with all
anti-integrin antibodies (including antibodies specifically
immunoreactive with CD11a, CD11b, CD11c, CD18, as well as
.alpha..sub.d) was noted in normal tissue, with a widespread
distribution on resident cells, presumably macrophages. In the
inflamed synovium, expression of all integrins was more localized
to cells clustered around lymphatic vessels. While .alpha..sub.d
and CD11b expression patterns were similar, CD11c did not appear to
be as strongly expressed and was restricted to a subset of
leukocytes.
[0221] In the dog, CD11b, but not .alpha..sub.d, expression was
observed on liver macrophages, or Kuppfer cells. Staining of normal
human liver sections (as previously described for staining of dog
liver section, supra) confirmed the conservation of this staining
pattern in humans. In addition, CD11c was detected at low levels.
In sections from a hepatitis patient, all leukointegrin staining
was higher than observed on normal liver, while .alpha..sub.d
expression was detected on macrophages and granulocytes in these
samples.
[0222] Minimal staining of normal human colon sections was observed
with anti-.alpha..sub.d antibodies; faint smooth muscle staining
and leukocyte staining was observed. All leukointegrins were
detected at higher levels in sections from patients with Crohn's
disease.
[0223] Normal lung showed a limited number of weakly
.alpha..sub.d-positive cells; these were determined by morphology
to be macrophages and neutrophils. In lung tissue from a patent
with emphysema, .alpha..sub.d staining was observed on neutrophils
and on macrophages containing hemosiderin, an iron-containing
pigment, indicating red cell engulfment by these cells.
[0224] Sections of normal brain and plaque lesions from patients
with multiple sclerosis (MS) were examined for integrin expression.
In normal brain, .alpha..sub.d staining was less intense than that
of CD11a, CD11b, and CD11c, and restricted to cells typed as
microglial cells by morphology and CD68 staining. CD11b positive
cells were located surrounding vessels and throughout the tissue.
CD11c.sup.+ cells appeared to be located within vessels, whereas
.alpha..sub.d.sup.+ cells surrounded the vessels. In MS tissue
sections, .alpha..sub.d expression was found on both -microglial
cells and on a non-macrophage leukocyte subset; .alpha..sub.d.sup.+
cells were located within plaque lesions, as well as throughout the
cortex. The .alpha..sub.d signal was equivalent in intensity to
CD11c, but lower than that of CD11b.
[0225] Both thoracic aorta and abdominal aorta sections from PDAY
(Pathobiological Determinants of Atherosclerosis in Youth, LSU
Medical Center) tissue samples were analyzed with
anti-leukointegrin and anti-CAM antibodies. The lesions examined
were consistent with aortic fatty streaks which consisted of
subintimal aggregates of large foam cells (mostly macrophages with
ingested lipid) and infiltrates of smaller leukocytes. Single label
studies with monoclonal antibodies specific for .alpha..sub.d and
the other .beta..sub.2 integrin .alpha. chains (CD11a, CD11b, and
CD11c), plus a macrophage marker (CD68) revealed that the majority
of lipid-laden macrophages expressed a moderate level of
.alpha..sub.d and CD18, while expressing CD11a and CD11c at weak or
weak to moderate levels, respectively. CD11b was faintly expressed,
and then by only a subset of macrophages.
[0226] Double label studies were conducted to determine the
relative localization of .alpha..sub.d and ICAM-R antigens in the
aortic sections. Since foam cells in these sections stained with
the antibody Ham 56, specific for a macrophage marker, but not with
antibodies to smooth muscle actin, it was determined that the foam
cells were not derived from subintimal smooth muscle cells. CD68
positive macrophages expressing .alpha..sub.d were surrounded by
and interspersed with small ICAM-R positive leukocytes. There
appeared to be a limited number of small leukocytes which were CD68
negative but stained with both .alpha..sub.d and ICAM-R
antibodies.
[0227] Distribution of .alpha..sub.d in normal tissues appeared to
be on resident leukocytes in a pattern overlapping with but not
identical to that of CD11b and CD11c, two other leukointegrin
.alpha. chains which have previously been characterized as having
restricted leukocyte distribution. Cellular morphology indicated
that .alpha..sub.d staining is largely confined to macrophages and
granulocytes, with limited lymphocyte staining. Generally, tissue
inflammation appeared to increase the number and types of
leukocytes observed in a particular tissue, along with increased
staining of leukointegrins, including .alpha..sub.d. Since the
cellular and spatial distribution of the leukointegrins was not
identical in pathologic tissues, it was inferred that distinct
functions and ligands exist for each family member, including
.alpha..sub.d, in specific contexts.
[0228] Interestingly, .alpha..sub.d expression in early
atherosclerotic lesions appeared to be more pronounced than that of
CD11a, CD11b, and CD11c, suggesting that .alpha..sub.d may play a
central role in the establishment of these lesions. The apposed
distribution of .alpha..sub.d and ICAM-R positive cells, supported
by evidence suggesting an interaction between .alpha..sub.d and
ICAM-R, suggests that .alpha..sub.d may be involved in leukocyte
recruitment or activation at early stages in these lesions.
Cell Line and Peripheral Blood Leukocyte Staining
[0229] The antibodies 169A and 169B stained a promyeolmonocytic
cell line, HL60, by FACS. Surface expression of .alpha..sub.d in
these cells is negatively affected by PMA stimulation, which is
reported to induce differentiation along a macrophage pathway, but
is unaffected by DMSO, which induces granulocyte differentiation
[Collins, et al., Blood 70:1233-1244 (1987)]. The FACS profiles of
169A and 169B were antithetical with PMA stimulation to those
observed with anti-CD11b and anti-CD11c monoclonal antibodies. A
monocyte cell line, THP-1, also exhibited weak staining with 169A
and 169B. In addition, a subset of cells in the lymphocyte and
monocyte gates of peripheral blood leukocytes appeared to be weakly
positive by FACS. A subset of peripheral blood monocytes stained
weakly with 169A and 169B, while B lymphocytes were found to have
no surface expression of .alpha..sub.d. The CD8.sup.+ subset of T
lymphocytes was .alpha..sub.d.sup.+. In addition, antibodies 169A
and 169B failed to detect antigen on the B cell lines, JY, Ramos, a
basophilic line, KU812, and T cell lines, Jurkat, SKW, and Molt
16.
[0230] In light of the results with HL60 cells, granulocytes were
isolated from peripheral blood by ficoll/hypaque gradient
centrifugation and subsequent red blood cells lysis. All
preparations were found to be >90% PMNs by visualization of
nuclear morphology in acetic acid. Separate populations were
stimulated for 30 minutes with 50 ng/ml PMA or 10.sup.-8 M formyl
peptide (fMLP) to release potential intracellular integrin stores.
Unstimulated populations exhibited low, but significant expression
of 169A and 169B antigens over an IgG1 control, with a detectable
increase observed upon stimulation. On PMNs, levels of
.alpha..sub.d and CD11c surface expression were more similar than
that observed on HL60 cells. The antibody 169B was used
subsequently to precipitate a heterodimeric molecule from a
detergent lysate of biotinylated PMNs with subunit sizes of
approximately 150 and 95 kD appropriate to .alpha..sub.d and CD18,
respectively.
[0231] The presence of .alpha..sub.d on PMNs could not be
anticipated from the information known about canine .alpha..sub.d
expression. Canine neutrophils, unlike their human counterparts,
express the T helper cell marker CD4, and also integrin VLA-4, and
therefore may have different ligands and functions in the dog than
in the human.
Staining of PBL Subgroups
[0232] The present study was undertaken to determine the
distribution of this .beta..sub.2 integrin in human peripheral
blood leukocytes. In addition, the cell surface density of
.alpha..sub.d relative to other .beta..sub.2 integrins was
compared. Finally, the acute regulation of .alpha..sub.d expression
in purified human eosinophils was also evaluated.
[0233] Human peripheral blood leukocytes were separated by density
gradient centrifugation into a mononuclear cell fraction
(containing monocytes, lymphocytes, and basophils) and granulocytes
(neutrophils and eosinophils) [Warner, et al., J. Immunol.Meth.
105:107-110 (1987)]. For some experiments, eosinophils were
purified using CD16 immunomagnetic selection to purities greater
than 95% [Hansel, et al., J.Immunol.Meth. 122:97-103 (1989)]. Skin
mast cells were enzymatically dispersed from human skin and
enriched as previously described [Lawrence, et al., J.Immunol.
139:3062-3069 (1987)].
[0234] Cells were labelled with appropriate dilutions of monoclonal
antibody specific for either CD11a (MHM24), CD11b (H5A4), CD11c
(BU-15), or .alpha..sub.d (169A). A murine control IgG.sub.1, was
also employed. Cells were washed and then incubated with
phycoerythrin-conjugated goat-anti-mouse IgG. In some experiments,
cells were incubated with excess murine IgG and FITC-labelled
murine monoclonal antibody or goat polyclonal antibody specific for
a particular cell (e.g., CD3, CD4, or CD8 for T-cells; CD16+
lymphocytes for NK cells; anti-IgE for basophils [Bochner, et al.,
J.Immunol.Meth. 125:265-271 (1989)]. The samples were then examined
by flow cytometry (Coulter EPICS Profile) using appropriate gating
to identify cell subsets.
[0235] For studies with human eosinophils in which acute
upregulation of .alpha..sub.d expression was examined, cells were
stimulated for 15 minutes at 37.degree. C. with phorbol ester (10
ng/ml), RANTES (100 ng/ml) [Schall, Cytokine 3:165-183 (1991)], or
IL-5 (10 ng/ml) prior to labeling with the various monoclonal
antibodies as described above.
[0236] Results showed that .alpha..sub.d was present on all
peripheral blood eosinophils, basophils, neutrophils, monocytes,
and NK cells. A small subset (approximately 30%) of CD8.sup.+
lymphocytes was also found to express .alpha..sub.d. Skin mast
cells and CD4.sup.+ lymphocytes did not express .alpha..sub.d. In
general, CD11a and CD11b are present at a higher density on
leukocytes then .alpha..sub.d, the latter being expressed at
relatively low levels similar to CD11c. Among leukocytes, monocytes
and CD8.sup.+ cells have the highest density of .alpha..sub.d,
while eosinophils have the lowest level of .alpha..sub.d
expression. Expression on neutrophils, basophils, and NK cells was
intermediate.
[0237] Stimulation of peripheral eosinophils with the CC chemokine
RANTES caused no change in the expression of any of the
.beta..sub.2 integrins. Treatment with phorbol ester, however,
produced a two to three fold increase in expression of both CD11b
and .alpha..sub.d, but did not effect expression of CD11a or CD11c.
IL-5 treatment resulted in the selective upregulation of CD11b
expression without affecting levels of the other integrin
subunits.
[0238] Combined, these results indicate that in peripheral blood
leukocytes, .alpha..sub.d is generally expressed at a level
comparable to CD11c. Highest levels are found on monocytes and a
subset of CD8.sup.+ lymphocytes. Human skin mast cells do not
express .alpha..sub.d. Purified eosinophils appear to have
pre-formed intracytoplasmic storage pools of CD11b and
.alpha..sub.d. However, the differential upregulation shown by IL-5
versus PMA suggests that these storage pools are separate from each
other.
[0239] Staining patterns for peripheral blood leukocyte (PBL)
subgroups were also determined by flow cytometry using a
combination of gating and surface markers, as described above, in
an attempt to more precisely define the 169 A/B negative lymphocyte
group. PBL were isolated on Ficoll as previously described and
stained separately with 169A, 169B and monoclonal antibodies to
CD14 (monocyte/macrophage marker), CD20 (B cell), CD56 (NK cell), T
cell receptor .alpha./.beta. (T cell), CD16 (neutrophils, NKs), and
.alpha.4 (a negative marker for neutrophils). Gates were defined by
size and marker distribution.
[0240] Results indicated that cells in the CD14+ monocyte gate
exhibited low levels of 169A and 169B staining. A bimodal
expression pattern observed in earlier experiments in the
lymphocyte gate was resolved by increasing forward scatter. The
mixed TCR.sup.+/CD20.sup.+ population appeared to have low, but
homogenous levels of 169A/B expression, whereas a population mapped
at slightly higher side scatter (cellular complexity), which
stained 50% positive for CD56, appeared to have a distinctly 169A/B
negative population. The negative population was also not
recognized by TCR, CD20, CD14, or CD16 antibodies.
Synovial Distribution of .alpha..sub.d
[0241] In order to determine cellular distribution of
.alpha..sub.d, other .beta..sub.2 integrins and their
counterreceptors in inflammatory and non-inflammatory synovium,
monoclonal antibodies to the various .beta..sub.2 integrin and
immunoglobulin supergene families were used in immunohistological
studies. Protein expression was determined in normal,
osteoarthritic and rheumatoid synovial tissue samples.
[0242] Results indicated that the synovial lining cell layer
expressed high levels of VCAM-1, CD11b/CD18 and .alpha..sub.d/CD18.
In these cells, CD11c/CD18 expression is restricted and CD11a/CD18
is generally not detected. In rheumatoid arthritis synovitis,
expression of .beta..sub.2 integrins in the synovial cell layer
increases in proportion to the degree of hyperplasia. The ratio of
cells which express CD11c increases significantly, approaching that
of CD11b and .alpha..sub.d, but there is no increase in CD11a
expression.
[0243] In the sublining areas of the tissue, aggregates and diffuse
infiltrates of CD3/CD11a/ICAM-R.sup.+ lymphocytes are interspersed
among CD68/CD11b/.alpha..sub.d.sup.+ macrophages. A significant
number of aggregates demonstrate intense .alpha..sub.d staining,
particularly in T cell rich areas.
[0244] The synovial endothelium variably expressed ICAM-1 and
ICAM-2 with minimal evidence of ICAM-R expression.
[0245] Combined, these results indicate that synovial macrophages
and macrophage-like synovial cells constitutively express high
levels of the .beta..sub.2 integrins CD11b and .alpha..sub.d. In
synovitis, there is an expansion of this subset of cells in both
the lining and sublining areas, along with an apparent increase in
expression of CD11c. Specific populations of rheumatoid synovial T
lymphocytes, in addition to expressing CD11a and ICAM-R, also
express high levels of .alpha..sub.d, the latter molecule having
been shown above to be expressed at low levels by peripheral blood
lymphocytes.
.alpha..sub.d Expression in Disease Lung and Liver Tissue
[0246] Lung tissue from an individual with sarcoidosis and liver
tissue from two individuals with cirrhosis were sectioned at 6
.mu.m thickness and air dried on Superfrost Plus (VWR Scientific)
slides for 15 minutes at room temperature. Prior to use, slides
were incubated at 50.degree. C. for approximately 5 minutes.
Sections were fixed in cold (4.degree. C.) acetone (EM Science) for
2 minutes at room temperature and allowed to air dry at room
temperature. Sections were placed in a solution of 100 ml
1.times.TBS, 1.1 ml 30% H.sub.2O.sub.2 (Sigma), 1.0 ml 10%
NaN.sub.3 (Sigma), for 15 minutes at room temperature to remove
endogenous peroxidase activity. Each section was blocked with 150
.mu.l of a solution containing 20% normal human serum (Boston
Biomedica), 5% normal rat serum (Harlan), and 2% BSA (Sigma) in
1.times.TBS for 30 minutes at room temperature. After incubation,
the solution was gently blotted from the sections. Primary
monoclonal antibody was prepared at a protein concentration of 10
.mu.g/ml in blocking solution and 75 .mu.l applied to each tissue
section for 1 hour at room temperature. After incubation, sections
were washed three times in 1.times.TBS for 5 minutes each wash to
remove unbound antibody. Excess TBS was removed by aspirating
around the tissue following the final wash. Biotinylated rat
anti-mouse antibody (Jackson Laboratories) was diluted 1:400 in
blocking solution and 75 .mu.l was applied to each section for 30
minutes at room temperature. Slides were washed two times with
1.times.TBS for 5 minutes each wash. Peroxidase conjugated goat
anti-biotin antibody (Vector Laboratories) was diluted 1:200 in
blocking solution and 75 .mu.l was applied to each section for 30
minutes at room temperature. Slides were washed two times in
1.times.TBS for 5 minutes each wash. Substrate
3-amino-9-ethylcarbazol- e (AEC) (Vector Laboratories) or 3,3'
-diaminobenzidine (DAB) substrate (Vector Laboratories) was applied
and color development stopped by immersion in water. Slides were
counterstained in Gill's hematoxylin #2 (Sigma) and rinsed in water
before mounting with either Aquamount (Baxter) or Cytoseal
(VWR).
[0247] In the sarcoidosis lung, only the 217L monoclonal antibody
stained cells and the majority of 217L epitope expression was
localized to granulomas. Giant cells within the granulomas appeared
to be negative for the 217L antigen. Expression of the 217L epitope
was localized to cells that morphologically appeared to be
epithelioid histiocytes, highly differentiated phagocytic cells of
macrophage lineage. Distribution of other integrins was observed to
overlap with that of the 217L epitope in the sarcoidosis lung, but
the expression patterns were not identical. For example, antibodies
immunospecific for all other integrins labeled cells in the
granulomas as well as the giant cells which were negative for 217L
staining.
[0248] Sections from a second patient diagnosed with sarcoidosis
were negative for expression of the 217L epitope, however it is
unclear from pathology reports whether this patient had received
steroidal immunosuppressants, the most common form of
treatment.
[0249] In sections from the cirrhotic liver tissue,
anti-.alpha..sub.d antibodies labeled foam cells in the connective
tissue between hepatic nodules as well as a subset of lymphocytes.
Distribution of CD11c overlapped with .alpha..sub.d expression but
was not identical; anti-CD11c antibody also labeled a subset of
foam cells but labeled more macrophages and lymphocytes than
anti-.alpha..sub.d antibody. There was no apparent overlap in the
distribution of CD11a and CD11b expression with .alpha..sub.d
expression.
[0250] Antibody 217L also stained phagocytic-type cells which were
clustered and isolated from the populations identified by both 212D
and 217L. Antibodies to CD11b and CD11c stained the 217L.sup.+
clusters in a dissimilar fashion.
[0251] In related experiments, antibodies 212D and 217L were used
to stain human splenic tissue sections as well as serial sections
from spleens of the non-human primate M. nemestina. Splenocytes
isolated from fresh human and monkey splenic tissue were also
evaluated by flow cytometry for .alpha..sub.d expression. Both
antibodies 212D and 217L recognized human and monkey splenocytes.
By both ICC and FACS, the .alpha..sub.d.sup.+ population
represented about 20% of total cells, unlike in rodents which
exhibit a greater percentage of .alpha..sub.d.sup.+ cells. The
positive population appeared to be morphologically identical to
macrophages.
Human Bone Marrow Staining
[0252] Human bone marrow samples were obtained from the iliac bone
of healthy bone marrow donors according to standard techniques. The
original sample was diluted 1:3 in Iscove's medium and centrifuged
for 20 minutes at 2000 RPM. The buffy coat layer was carefully
collected, washed once, and hemolyzed using hemolytic buffer (0.83%
ammonium chloride, 0.1% sodium bicarbonate, EDTA free). Cells were
resuspended in PBS with 15% FBS, aliquoted at 100,000 cells/tube in
100 .mu.l, and put on ice. Immunostaining was performed as
previously described. Briefly, monoclonal mouse anti-human
.alpha..sub.d antibody 212D or 217L or mouse anti-human CD18 or
mouse anti-human CD50 (ICAM-R specific) antibody was individually
added to each cell sample at a final concentration of 10 .mu.g/ml
and the mixture incubated on ice for 20 minutes. The cells were
washed twice and incubated for an additional 20 minutes with goat
anti-mouse FITC. Cells were washed twice and resuspended in 1%
paraformaldehyde. Fluorescence was measured using a Fluorescence
Activated Cell Sorter FACSCAN (Becton Dickinson).
[0253] Results from four experiments indicated that .alpha..sub.d
expression as determined using antibody 212D was found on 13 to 43%
of the cells (median 27%) and on 6 to 55% of cells (median 21%)
using antibody 217L. CD18 expression was observed on 60-96% of
cells (median 71%) and CD50 on 86-99% of cells (median 94%).
Expression of .alpha..sub.d on Peripheral Blood Mononuclear Cells
from Patients with Breast Cancer
[0254] Peripheral blood mononuclear cells were isolated using
Ficoll separation of blood samples from patients with high risk
breast cancer, i.e., those patients having breast cancer with poor
prognosis features, who had undergone bone marrow transplantation.
Cells were screened by immunostaining for the expression of
.alpha..sub.d as described above.
[0255] Results indicated that .alpha..sub.d expression as
determined using antibody 212D was found on 20% of cells and on 13%
of the cells using antibody 217L. Antibody 212D also stained a
subpopulation of small cells which appeared most likely to be
lymphocytes. The percentage of cells expressing .alpha..sub.d were
comparable to that generally observed in a normal blood donor.
[0256] In addition, antibody 212D appeared to stain not only large
cells that were CD14.sup.+, but also much smaller cells which were
tentatively identified as CD3.sup.+. This result was observed both
in blood and in bone marrow.
[0257] The variation of the number of cells expressing
.alpha..sub.d might be explained by a variation in the cell
composition of the bone marrow aspirate from donor to donor (e.g.,
the amount of bone marrow in comparison to the amount of
circulating blood).
EXAMPLE 19
Upregulation of .alpha..sub.d Expression
[0258] Because leukocyte integrins are generally upregulated during
hemodialysis and contribute to the immune alterations observed in
chronic renal failure [Rabb, et al., J. Am. Soc. Nephrol.
6:1445-1450 (1995) and Rabb, et al., Am. J. Kidnet Dis. 23:155-166
(1994)], .alpha..sub.d/CD18 surface expression was examined during
hemodialysis and chronic renal failure. In addition, expression of
.alpha..sub.d/CD18 in vitro following PKC stimulation was also
investigated.
[0259] Whole blood samples were obtained from five randomly chosen
hospital patients with non-renal conditions. Blood samples were
incubated with PMA at 50 ng/ml for 30 minutes at 37.degree. C.
prior to surface staining and flow cytometry. Blood samples were
also collected from patients with chronic renal failure. Patients
were stable, non-diabetics who were undergoing dialysis three times
a week. Baseline samples were obtained prior to beginning dialysis,
and subsequent samples were drawn at 15 minutes and 180 minutes
during dialysis with a cuprophane membrane. Blood samples from
normal subjects having no known diseases were used as negative
controls.
[0260] For cell staining, 5 .mu.g of antibodies 169A and 169B (and
a negative control 1B7) were incubated with 100 .mu.l whole blood
in the dark for 15 minutes. Becton Dickinson lysing reagent (2 ml)
was added to each mixture and incubation continued for 10 minutes
in the dark. Cells were then pelleted and suspended in PBS. The
cells were again pelleted by centrifugation and mixed with a
secondary FITC-conjugated antibody and incubated for 30 minutes in
the dark. Cells were then washed with PBS, centrifuged, aspirated,
and resuspended in 1.0% formalin.
[0261] Flow cytometry was carried out using the procedure of Rabb,
et al. [J. Am. Soc. Nephrol. 6:1445-450 (1995)]. Samples were
analyzed using Simulset Software (Becton Dickinson) on a FACScan
flow cytometer (Becton Dickinson). A minimum of 22,000 cells was
analyzed for each sample. Granulocyte, monocyte, and lymphocyte
subsets were gated by forward light scatter and side light scatter.
Cell subset purity was assessed by CD45 staining and CD14
staining.
[0262] Results indicated that .alpha..sub.d/CD18 expression can be
detected in samples drawn from normal human subjects; expression
was greatest on monocytes and lowest on lymphocytes. Expression on
neutrophils was intermediate between monocytes and lymphocytes.
Staining with antibody 169B was weaker than with antibody 169A. PMA
treatment upregulated .alpha..sub.d/CD18 expression, particularly
on neutrophils and monocytes.
[0263] In samples from the renal failure patients,
.alpha..sub.d/CD18 expression was detectable on neutrophils,
monocytes, and lymphocytes prior to the onset of dialysis. After 15
minutes of dialysis using the leukocyte activating membrane, a
minor increase in .alpha..sub.d/CD18 expression was detected.
Expression on monocytes and lymphocytes actually decreased by the
end of treatment. This result indicates that .alpha..sub.d/CD18
expression is distinct from that observed for CD11a/CD18,
CD11b/CD18, and L-selection expression following dialysis.
EXAMPLE 20
Isolation of Rat cDNA Clones
[0264] In view of the existence of both canine and human
.alpha..sub.d subunits, attempts were made to isolate homologous
genes in other species, including rat (this example) and mouse
(Example 20, infra).
[0265] A partial sequence of a rat cDNA showing homology to the
human .alpha..sub.d gene was obtained from a rat splenic
.lambda.gt10 library (Clontech). The library was plated at
2.times.10.sup.4 pfu/plate onto 150 mm LBM/agar plates. The library
was lifted onto Hybond.RTM. membranes (Amersham), denatured 3
minutes, neutralized 3 minutes and washed 5 minutes with buffers as
described in standard protocols [Sambrook, et al., Molecular
Cloning: a laboratory manual, p.2.110]. The membranes were placed
immediately into a Stratalinker (Stratagene) and the DNA
crosslinked using the autocrosslinking setting. The membranes were
prehybridized and hybridized in 30% or 50% formamide, for low and
high stringency conditions, respectively. Membranes were initially
screened with a .sup.32P-labeled probe generated from the human
.alpha..sub.d cDNA, corresponding to bases 500 to 2100 in clone
19A2 (SEQ ID NO:1). The probe was labeled using Boehringer
Mannheim's Random Prime Kit according to manufacturer's suggested
protocol. Filters were washed with 2.times.SSC at 55.degree. C.
[0266] Two clones, designated 684.3 and 705.1, were identified
which showed sequence homology to human .alpha..sub.d, human CD11b,
and human CD11c. Both clones aligned to the human .alpha..sub.d
gene in the 3' region of the gene, starting at base 1871 and
extending to base 3012 for clone 684.3, and bases 1551 to 3367 for
clone 705.1.
[0267] In order to isolate a more complete rat sequence which
included the 5' region, the same library was rescreened using the
same protocol as employed for the initial screening, but using a
mouse probe generated from clone A 1160 (See Example 20, infra).
Single, isolated plaques were selected from the second screening
and maintained as single clones on LBM/agar plates. Sequencing
primers 434FL and 434FR (SEQ ID NOS:34 and 35, respectively) were
used in a standard PCR protocol to generate DNA for sequencing.
13 5'-TATAGACTGCTGGGTAGTCCCCAC-3' (SEQ ID NO:34)
5'-TGAAGATTGGGGGTAAATAACAGA-3' (SEQ ID NO:35)
[0268] DNA from the PCR was purified using a Quick Spin Column
(Qiagen) according to manufacturer's suggested protocol.
[0269] Two clones, designated 741.4 and 741.11, were identified
which overlapped clones 684.3 and 705.1; in the overlapping
regions, clones 741.1 and 741.11 were 100% homologous to clones
684.3 and 705.1. A composite rat cDNA having homology to the human
.alpha..sub.d gene is set out in SEQ ID NO:36; the predicted amino
acid sequence is set forth in SEQ ID NO:37.
Cloning of the 5' end of Rat .alpha..sub.d
[0270] A 5' cDNA fragment for the rat .alpha..sub.d gene was
obtained using a Clonetech rat spleen RACE cloning kit according to
manufacturer's suggested protocol. The gene specific
oligonucleotides used were designated 741.11#2R and 741.2#1R (SEQ
ID NOS:59 and 58, respectively).
14 5'-CCAAAGCTGGCTGCATCCTCTC-3' (SEQ ID NO:59)
5'-GGCCTTGCAGCTGGACAATG-3' (SEQ ID NO:58)
[0271] Oligo 741.11#2R encompasses base pairs 131-152 in SEQ ID
NO:36, in the reverse orientation and 741.2#1R encompasses bases
pairs 696-715 in SEQ ID NO:36, also in the reverse orientation. A
primary PCR was carried out using the 3' -most oligo, 741.2#1R. A
second PCR followed using oligo 741.11#2R and DNA generated from
the primary reaction. A band of approximately 300 base pairs was
detected on a 1% agarose gel.
[0272] The secondary PCR product was ligated into plasmid pCRTAII
(Invitrogen) according to manufacturer's suggested protocol. White
(positive) colonies were picked and added to 100 .mu.l LBM
containing 1 .mu.l of a 50 mg/ml carbenicillin stock solution and 1
.mu.l M13 K07 phage culture in individual wells in a round bottom
96 well tissue culture plate. The mixture was incubated at
37.degree. C. for 30 minutes to one hour. Following the initial
incubation period, 100 .mu.l of LBM (containing 1 .mu.l of 50 mg/ml
carbenicillin and a 1:250 dilution of a 10 mg/ml kanamycin stock
solution) were added and the incubation was continued overnight at
37.degree. C.
[0273] Using a sterile 96 well metal transfer prong, supernatant
from the 96 well plate was transferred to four Amersham Hybond.RTM.
nylon filters. The filters were denatured, neutralized and cross
linked by standard protocols. The filters were prehybridized in 20
mis of prehybridization buffer (5xSSPE; 5.times.Denhardts; 1% SDS;
50 ugs/ml denatured salmon sperm DNA) at 50.degree. C. for several
hours while shaking.
[0274] Oligo probes 741.11#1 and 741.11#1R (SEQ ID NOS:56 and 57,
respectively), encompassing base pairs 86-105 (SEQ ID NO:36) in the
forward and reverse orientation respectively, were labeled as
follows.
15 5'-CCTGTCATGGGTCTAACCTG-3' (SEQ ID NO:56)
5'-AGGTTAGACCCATGACAGG-3' (SEQ ID NO:57)
[0275] Approximately 65 WP oligo DNA in 12 .mu.l dH.sub.2O was
heated to 65.degree. C. for two minutes. Three .mu.l of 10 mCi/ml
.gamma.-.sup.32P-ATP were added to the tube along with 4 .mu.l
5.times.Kinase Buffer (Gibco) and 1 .mu.l T4 DNA Kinase (Gibco).
The mixture was incubated at 37.degree. C. for 30 minutes.
Following incubation, 16 .mu.l of each labeled oligo probe were
added to the prehybridization buffer and filters and hybridization
was continued overnight at 42.degree. C. The filters were washed
three times in 5.times.SSPE; 0.1% SDS for 5 minutes per wash at
room temperature, and autoradiographed for 6 hours. Positive clones
were expanded and DNA purified using the Magic Mini Prep Kit
(Promega) according to manufacturer's suggested protocol. Clone 2F7
was selected for sequencing and showed 100% homology to clone
741.11 in the overlapping region. The complete rat .alpha..sub.d
nucleic acid sequence is set out in SEQ ID NO:54; the amino acid
sequence is set out in SEQ ID NO:55.
Characteristics of the Rat cDNA and Amino Acid Sequences
[0276] Neither nucleic acid nor amino acid sequences have
previously been reported for rat .alpha. subunits in .beta..sub.2
integrins. However sequence comparisons to reported human
.beta..sub.2 integrin .alpha. subunits suggests that the isolated
rat clone and its predicted amino acid sequence are most closely
related to .alpha..sub.d nucleotide and amino acid sequences.
[0277] At the nucleic acid level, the isolated rat cDNA clone shows
80% identity in comparison to the human .alpha..sub.d cDNA; 68%
identity in comparison to human CD11b; 70% identity in comparison
to human CD11c; and 65% identity in comparison to mouse CD11b. No
significant identity is found in comparison to human CD11a and to
mouse CD11a.
[0278] At the amino acid level, the predicted rat polypeptide
encoded by the isolated cDNA shows 70% identity in comparison to
human .alpha..sub.d polypeptide; 28% identity in comparison to
human CD11a; 58% identity in comparison to human CD11b; 61%
identity in comparison to human CD11c; 28% identity in comparison
to mouse CD11a; and 55% identity in comparison to mouse CD11b.
EXAMPLE 21
Northern Analysis of Rat Tissue For .alpha..sub.d Expression
[0279] RNA was obtained from a panel of Lewis rat tissues in order
to perform Northern analysis using a rat .alpha..sub.d probe.
Samples included total RNA from normal spleen, kidney, liver, lung,
and bone marrow, in addition to poly(A.sup.+) RNA from normal
spleen, brain, spinal cord, thymus, skin, small intestine, and rat
antigen activated T cells and diseased EAE (experimental allergic
encephalomyelitis) spleen and lymph node. The experiments were
carried out using the techniques described in Example 6.
[0280] The .alpha..sub.d probe was selected from a region of the
rat cDNA encompassing nucleotides 1184 to 3008 in SEQ ID NO:54
which represents the area having the lowest degree of homology with
rat CD11c and rat CD11b. The 1124 bp probe was generated by a
restriction enzyme digestion with EcoRI of 10 .mu.g rat
.alpha..sub.d cDNA clone 684.3. The fragment was gel purified and
used in a random primed labelling reaction as described in Example
6. The Northern blot was prehybridized, hybridized and washed as
described in Example 6 except the probe was added to the
hybridization buffer at 5.5.times.10.sup.5 cpm/ml.
[0281] After autoradiography for five days, bands were detected in
lanes containing total spleen RNA as well as poly(A.sup.+) RNA from
a normal rat as well as a spleen from a rat with active EAE, where
the amount of RNA was significantly greater than that from normal
spleen. The transcript size detected was consistent with the size
of the full length rat cDNA clone.
EXAMPLE 22
Production and Characterization of Rodent .alpha..sub.d-Specific
Antibodies-Antibodies against Rat .alpha..sub.d I Domain/Hu IgG4
Fusion Proteins
[0282] In view of the fact that the I domain of human .beta..sub.2
integrins has been demonstrated to participate in ligand binding,
it was assumed that the same would be true for rat .alpha..sub.d
protein. Monoclonal antibodies immunospecific for the rat
.alpha..sub.d I domain may therefore be useful in rat models of
human disease states wherein .alpha..sub.d binding is
implicated.
[0283] Oligos "rat alpha-DI5" (SEQ ID NO:87) and "rat alpha-DI3"
(SEQ ID NO:88) were generated from the rat .alpha..sub.d sequence
corresponding to base pairs 469-493 and base pairs 1101-1125 (in
the reverse orientation), respectively, in SEQ ID NO:54. The oligos
were used in a standard PCR reaction to generate a rat
.alpha..sub.d DNA fragment containing the I domain spanning base
pairs 459-1125 in SEQ ID NO:54. The PCR product was ligated into
vector pCRTAII (Invitrogen) according to manufacturer's suggested
protocol. A positive colony was selected and expanded for DNA
purification using a Qiagen (Chatswoth, Ga.) Midi Prep kit
according to manufacturer's protocol. The DNA was digested with
XhoI and BgIII in a standard restriction enzyme digest and a 600
base pair band was gel purified which was subsequently ligated into
pDCS1/HuIgG4 expression vector. A positive colony was selected,
expanded and DNA purified with a Quiagen Maxi Prep Kit.
[0284] COS cells were plated at half confluence on 100 mm culture
dishes and grown overnight at 37.degree. C. in 7% CO.sub.2. Cells
were rinsed once with 5 ml DMEM. To 5 ml DMEM, 50 .mu.l
DEAE-Dextran, 2 .mu.l chloroquine and 15 .mu.g rat .alpha..sub.d I
domain/HulgG4 DNA described above was added. The mixture was added
to the COS cells and incubated at 37.degree. C. for 3 hours. Media
was then removed and 5 ml 10% DMSO in CMF-PBS was added for exactly
one minute. The cells were gently rinsed once with DMEM. Ten ml
DMEM containing 10% FBS was added to the cells and incubation
continued overnight at 37.degree. C. in 7% CO.sub.2. The next day,
media was replaced with fresh media and incubation continued for
three additional days. The media was harvested and fresh media was
added to the plate. After three days, the media was collected again
and the plates discarded. The procedure was repeated until 2 liters
of culture supernatant were collected.
[0285] Supernatant collected as described above was loaded onto a
ProsepA.RTM. column (Bioprocessing Limited) and protein purified as
described below.
[0286] The column was initially washed with 15 column volumes of
Wash Buffer containing 35 mM Tris and 150 mM NaCl, pH 7.5.
Supernatant was loaded at a slow rate of less than approximately 60
column volumes per hour. After loading, the column was washed with
15 column volumes of Wash Buffer, 15 column volumes of 0.55 M
diethanolamine, pH 8.5, and 15 column volumes 50 mM citric acid, pH
5.0. Protein was eluted with 50 mM citric acid, pH 3.0. Protein was
neutralized with 1.0 M Tris, pH 8.0, and dialyzed in sterile
PBS.
[0287] The rat .alpha..sub.d I domain protein was analyzed as
described in Example 14. The detected protein migrated in the same
manner as observed with human I domain protein.
Production of Monoclonal Antibodies to Rat .alpha..sub.dI
Domain/HuIgG4 Fusion Proteins
[0288] Mice were individually immunized with 50 .mu.g purified rat
.alpha..sub.d I domain/HuIgG4 fusion protein previously emulsified
in an equal volume of Freunds Complete Adjuvant (FCA) (Sigma).
Approximately 200 .mu.l of the antigen/adjuvant preparation was
injected at 4 sites in the back and flanks of each of the mice. Two
weeks later the mice were boosted with an injection of 100 .mu.l
rat .alpha..sub.d I domain/HuIgG4 antigen (50 .mu.g/mouse)
previously emulsified in an equal volume of Freunds Incomplete
Adjuvant (FIA). After two additional weeks, the mice were boosted
with 50 .mu.g antigen in 200 .mu.l PBS injected intravenously.
[0289] To evaluate serum titers in the immunized mice,
retro-orbital bleeds were performed on the animals ten days
following the third immunization. The blood was allowed to clot and
serum isolated by centrifugation. The serum was used in an
immunoprecipitation on biotinylated (BIP) rat splenocytes. Serum
from each mouse immunoprecipitated protein bands of expected
molecular weight for rat .alpha..sub.d and rat CD18. One mouse was
selected for the fusion and was boosted a fourth time as described
above for the third boost.
[0290] The hybridoma supernatants were screened by antibody
capture, described as follows. Immulon.RTM. 4 plates (Dynatech,
Cambridge, Mass.) were coated at 4.degree. C. with 50 .mu.l/well
goat anti-mouse IgA, IgG or IgM (Organon Teknika) diluted 1:5000 in
50 mM carbonate buffer, pH 9.6. Plates were washed 3.times.with PBS
containing 0.05% Tween.RTM. 20 (PBST) and 50 .mu.l culture
supernatant was added. After incubation at 37.degree. C. for 30
minutes, and washing as described above, 50 .mu.l horseradish
peroxidase-conjugated goat anti-mouse IgG9(Fc) (Jackson
ImmunoResearch, West Grove, Pa.) diluted 1:3500 in PBST was added.
Plates were incubated as described above and washed 4.times.with
PBST. Immediately thereafter, 100 .mu.l substrate, containing 1
mg/ml o-phenylene diamine (Sigma) and 0.1 .mu.l/ml 30%
H.sub.2O.sub.2 in 100 mM citrate, pH4.5, was added. The color
reaction was stopped after 5 minutes with the addition of 50 .mu.l
15% H.sub.2SO.sub.4. Absorbance at 490 nm was read on a Dynatech
plate reader.
[0291] Supernatant from antibody-containing wells was also analyzed
by ELISA with immobilized rat .alpha..sub.d I domain/HuIgG4 fusion
protein. An ELISA with HuIgG4 antibody coated plates served as a
control for reactivity against the IgG fusion partner. Positive
wells were selected for further screening by BIP on rat splenocyte
lysates using techniques described below.
Production of Polyclonal Sera To Rat .alpha..sub.d I domain/HuIgG4
Fusion Protein
[0292] Two rabbits were prebled prior to immunization with 100
.mu.g purified rat .alpha..sub.d I domain/HuIgG4 fusion protein in
complete Freund's adjuvant. Injections were repeated at the same
dose every three weeks in incomplete Freunds adjuvant (IFA). After
three injections the rabbits were test bled and the collected sera
used in a standard immunoprecipitation on rat splenocyte lysates.
It was determined that sera from both rabbits were immunoreactive
with rat .alpha..sub.d. The rabbits were boosted again with 100 ug
antigen in IFA, and the collected sera assayed for increased
immunoreactivity with rat .alpha..sub.d by immunoprecipitation. The
animals were given a final boost and 10 days later, bled out and
sera collected.
Rat .alpha..sub.d Histology
[0293] Rabbit polyclonal sera generated against rat .alpha..sub.d
"I" domain was used in immunohistochemical staining of rat tissue
sections by the technique described in Example 18. The staining
pattern detected on frozen and on paraffin embedded rat spleen
sections was essentially identical to that observed with the
antibodies against human .alpha..sub.d, with staining individual
cells throughout the red pulp. The staining pattern differed from
that observed with monoclonal antibodies against rat CD11a, CD11b
and CD18. In addition, a positive staining pattern was seen in the
thymus on individual cells throughout the cortex. Neither of these
tissue gave any signal when stained with the rabbit preimmune
sera.
Analysis of Antibody Specificity
[0294] Rats were sacrificed by asphyxiation with CO.sub.2 and
spleens were removed using standard surgical techniques.
Splenocytes were harvested by gently pushing the spleen through a
wire mesh with a 3 cc syringe plunger in 20 mls RPMI. Cells were
collected into a 50 ml conical tube and washed in the appropriate
buffer.
[0295] Cells were washed three times in cold D-PBS and resuspended
at a density of 10.sup.8 to 10.sup.9 cells in 40 ml PBS. Four mg of
NHS-Biotin (Pierce) was added to the cell suspension and the
reaction was allowed to continue for exactly 15 minutes at room
temperature. The cells were pelleted and washed three times in cold
D-PBS.
[0296] Cells were resuspended at a density of 10.sup.8 cells/ml in
cold lysis Buffer (1% NP40; 50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 2
mM CaCl; 2 mM MgCl; 1:100 solution of pepstain, leupeptine, and
aprotinin, added just before adding to cells; and 0.0001 g PMSF
crystals, added just before adding to cells). Lysates were vortexed
for approximately 30 seconds, incubated for 5 minute at room
temperature, and further incubated for 15 minutes on ice. Lysates
were centrifuged for 10 minutes at 10,000.times.g to pellet the
insoluble material. Supernatant was collected into a new tube and
stored at between 4.degree. C. and -20.degree. C.
[0297] One ml cell lysate was precleared by incubation with 200
.mu.l of a protein A Sepharose.RTM. slurry (Zymed) overnight at
4.degree. C. Precleared lysate was aliquoted into Eppendorf tubes
at 50 .mu.l/tube for each antibody to be tested. Twenty-five .mu.l
of polyclonal serum or 100 to 500 .mu.l of monoclonal antibody
supernatant were added to the precleared lysates and the resulting
mixture incubated for 2 hours at 4.degree. C. with rotation. One
hundred .mu.l rabbit anti-mouse IgG (Jackson) bound to protein A
Sepharose.RTM. beads in a PBS slurry was then added and incubation
continued for 30 minutes at room temperature with rotation. Beads
were pelleted with gentle centrifugation, and washed three times
with cold Wash Buffer (10 mM HEPES; 0.2 M NaCl; 1% Trition X-100).
Supernatant was removed by aspiration, and 20 .mu.l 2.times.SDS
sample buffer containing 10% .beta.-mercaptoethanol was added. The
sample was boiled for 2 minutes in a water bath, and the sample
loaded onto a 5% SDS PAGE gel. Following separation, the proteins
were transferred to nitrocellulose at constant current overnight.
The nitrocellulose filters were blocked with 3% BSA in TBS-T for 1
hour at room temperature and the blocking buffer was removed. A
1:6000 dilution of Strepavidin-HRP conjugate (Jackson) in 0.1% BSA
TBS-T was added and incubation continued for 30 minutes at room
temperature. Filters were washed three times for 15 minutes each
with TBS-T and autoradiographed using Amersham's ECL kit according
to manufacturer's suggested protocol.
Production of Monoclonal Antibodies to Full Length Rat
.alpha..sub.d Protein
[0298] Rat .alpha..sub.d was purified from rat splenocytes to
prepare an immunogen for generating anti-rat .alpha..sub.d
monoclonal antibodies. Spleens from approximately 50 normal female
Lewis rats, 12-20 weeks of age, were collected and a single cell
suspension was made from the tissue by forcing it through a fine
wire screen. Red blood cells were removed by lysis in buffer
containing 150 mM NH.sub.4Cl, 10 mM KHCO.sub.3, 0.1 mM EDTA, pH
7.4, and remaining leukocytes were washed two times with phosphate
buffered saline (PBS). The splenocytes were pelleted by
centrifugation and lysed in buffer containing 50 mM Tris, 150 mM
NaCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM PMSF, leupeptin, pepstatin and
1% Triton X-100.RTM.. Splenocyte lysis was carried out on ice for
30 minutes with one ml of lysis buffer per 5.times.10.sup.8
splenocytes. Insoluble material was removed by centrifugation.
[0299] CD11a, CD11b and CD11c were removed from the spleen lysate
by immunoprecipitation as follows. A 750 .mu.l volume of a Protein
A-Sepharose.RTM. slurry was incubated with 2 mg rabbit anti-mouse
immunoglobulin at 4.degree. C. for 30 minutes. The rabbit
anti-mouse-Protein A-Sepharose.RTM. was washed three times with
lysis buffer and suspended in a final volume of 1.5 ml of lysis
buffer. Approximately 200 .mu.g each of rat .beta..sub.2 integrin
specific monoclonal antibodies, 515F (specific for rat CD11a),
OX-42 (specific for rat CD11b) and 100 g (specific for rat CD11c)
were each added to 50 ml of the rat spleen lysate. Following a 30
minute incubation at 4.degree. C., 500 .mu.l of the rabbit
anti-mouse-Protein A-Sepharose.RTM. was added to the spleen lysates
and mixed with end-over-end rotation for 30 minutes at 4.degree. C.
The lysate was centrifuged at 2500.times.g for 10 minutes to pellet
the CD11a, CD11b, and CD11c bound to the rabbit anti-mouse-Protein
A-Sepharose.RTM., and the supernatant transferred to a clean 50 ml
centrifuge tube. Immunoprecipitation with the antibodies 515F,
OX-42, and 100 g was repeated two additional times to insure
complete removal of CD11a, CD11b, and CD11c.
[0300] .beta..sub.2 integrins remaining in the lysate were isolated
using affinity purification. Approximately 250 .mu.l of a slurry of
anti-rat CD18 monoclonal antibody 20C5B conjugated to
CNBr-Sepharose.RTM. was added to the lysates and mixed with
end-over-end rotation for 30 minutes at 4.degree. C.
Antibody/antigen complexes were pelleted by centrifugation at
2500.times.g for ten minutes and the pellet washed three times with
lysis buffer before being stored at 4.degree. C.
Immunization of Armenian Hamsters
[0301] 1. Armenian hamsters, six to eight weeks old, were initially
immunized with approximately 50 .mu.g of a recombinant protein
consisting of the I domain of rat .alpha..sub.d fused to the human
IgG.sub.4 heavy chain emulsified in complete Freund's adjuvant.
Primary immunization was followed by subsequent immunizations with
rat .alpha..sub.d I domain/HuIgG.sub.4 emulsified in incomplete
Freund's adjuvant on Days 14, 33, and 95. Two separate fusions,
designated 197 and 199, were subsequently performed.
[0302] Four days prior to fusion 197 (day 306), one hamster was
administered a combination of rat .alpha..sub.d protein purified
from splenocytes and CHO cells transfected with rat .alpha..sub.d.
The fusion boost was given three days prior to the fusion (day 307)
with purified rat .alpha..sub.d protein and ad transfected CHO
cells. Rat .alpha..sub.d transfected CHO cells were prepared as
described below.
[0303] A gene segment encoding full length rat .alpha..sub.d
protein was inserted into the pDC1 vector and transfected by
electroporation into CHO cells together with a human CD18-pRC
construct. Transfected cells were grown in the presence of
hypoxanthine to select for cells successfully transfected with the
pRC construct and in the presence of g418 to select for cells
transfected with the pDC1 construct. After 3 weeks, the cells were
stained with the rat .alpha..sub.d specific rabbit polyclonal sera
and sorted by FACS. A small percentage of the cells which expressed
the highest levels of surface ad (approximately 3% of the total
population) were collected and further expanded. FACS selection was
repeated several times to provide a population cells with high
levels of ad surface expression.
[0304] The .alpha..sub.d transfected cells were also characterized
by flow cytometry using a rat .alpha..sub.d specific polyclonal
sera and a human CD18 specific monoclonal antibody, TS1.18.1.
Results confirmed that the transfected CHO cells expressed high
levels of both rat .alpha..sub.d and human CD18.
[0305] Finally, ad and CD18 expression in the cells was evaluated
by immunoprecipitation. A rat .alpha..sub.d specific rabbit
polyclonal sera was found to immunoprecipitate proteins with two
distinct molecular weights: the higher molecular weight protein(s)
being approximately 170 kD, and the lower molecular weight
protein(s) 95 kD. These findings were consistent with expression of
a rat .alpha..sub.d/human CD18 heterodimeric complex on the surface
of the transfected CHO cells.
[0306] On the day of the fusion, the spleen was removed and a
single-cell suspension was formed by grinding the tissue between
frosted ends of two glass microscope slides submerged in serum free
RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate,
100 units/ml penicillin, and 100 .mu.g/ml streptomycin (RPMl)
(Gibco, Canada). The cell suspension was filtered through sterile
70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, N.J.),
and washed twice by centrifuging at 200.times.g for five minutes
and resuspending the pellet in 20 ml serum free RPMl. Thymocytes
taken from three naive Balb/c mice were prepared in a similar
manner. NS-1 myeloma cells, kept in log phase in RPMl with 10%
Fetaclone serum (FBS) (Hyclone Laboratories, Inc. Logan, Utah) for
three days prior to fusion, were centrifuged at 200.times.g for
five minutes, and the pellet was washed twice as previously
described.
[0307] Approximately 1.15.times.10.sup.8 spleen cells were combined
with 5.8.times.10.sup.7 NS-1 cells, centrifuged and the supernatant
removed by aspiration. The cell pellet was dislodged by tapping the
tube and seven ml of 37.degree. C. PEG 1500 (50% in 75 mM Hepes, pH
8.0) (Boehringer Mannheim) was added with stirring over the course
of one minute, followed by adding 14 ml of serum free RPMl over
seven minutes. An additional eight ml RPMI was added and the cells
were centrifuged at 200.times.g for 10 minutes. The supernatant was
removed and the pellet resuspended in 200 ml RPMl containing 15%
FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM
thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and
1.5.times.10.sup.6 thymocytes/ml. The suspension was dispensed into
ten 96-well flat bottom tissue culture plates (Corning, United
Kingdom) at 200 .mu.l/well and the cells were fed on days 4, 5, 6,
and 7 days post fusion by aspirating approximately 100 .mu.l from
each well with an 18 G needle (Becton Dickinson) and adding 100
.mu.l plating medium described above except lacking thymocytes.
[0308] On day 10, supernatants from the fusion wells were screened
by flow cytometry for reactivity to rat .alpha..sub.d/human CD18
transfected CHO cells. Approximately 5.times.10.sup.5 rat
.alpha..sub.d transfected CHO cells were suspended in 50 .mu.l RPMI
containing 2.0% FBS and 0.05% sodium azide and added to
approximately 100 .mu.l of hybridoma culture supernatant in
96-well, round-bottomed plates. Positive controls for staining
included rabbit anti-.alpha..sub.d polyclonal sera and TS1/18
(anti-human CD18). Cells were incubated for 30 minutes on ice,
washed three times in FACS buffer (RPMI, 2.0% FBS, 0.05% NaAzide),
and incubated for 30 minutes on ice with a FITC-conjugated goat
anti-hamster antibody (Jackson ImmunolResearch Labs) at a final
dilution of 1:200 in FACS buffer. Cells were washed three times in
FACS buffer and resuspended in 200 ml of FACS buffer. Samples were
analyzed with a Becton Dickinson FACscan analyzer. To insure that
positive clone wells were specific for rat .alpha..sub.d, the
screen was repeated with non-transfected CHO cells. Wells which met
the criteria of reacting with rat .alpha..sub.d CHO transfectants
and not the untransfected CHO cells were cloned.
[0309] Following primary screening, cells from positive wells were
cloned initially by doubling dilution and subsequently by limiting
dilution in RPMI, 15% FBS 100 mM sodium hypoxanthine, 16 mM
thymidine, and 10 units/ml IL-6. In the limiting dilution step, the
percentage of wells showing growth was determined and clonality was
predicted using a Poisson distribution analysis. Wells showing
growth were analyzed by FACS after 10-12 days. After final cloning,
positive wells were expanded in RPMI and 11% FBS. Cloning yielded
one culture deemed positive by these criteria, from which four
separate subclones designated 197A-1, 197A-2, 197A-3, and 197A-4
were expanded.
[0310] Prior to fusion 199, a second hamster was boosted on day 307
with 2.3.times.10.sup.6 rat .alpha..sub.d. (RAD)-transfected CHO
cells. Two final immunizations were administered four days prior to
the fusion (day 334) and again three days prior to the fusion (day
335). The boost on day 334 consisted of 2.times.10.sup.6 rat
.alpha..sub.d transfected CHO cells and 200 .mu.l of purified rat
.alpha..sub.d bound to Sepharose.RTM. (described previously)
administered by intraperitoneal injection. The day 335 boost
consisted of 5.times.10.sup.6 rat .alpha..sub.d transfected CHO
cells, also administered by intraperitoneal injection. The fusion
and screening protocols for fusion 199 were identical to fusion
197, and three hybridomas, designated 199A, 199H, and 199M, with
supernatant reactive with rat .alpha..sub.d were identified and
cloned.
[0311] 2. A second immunization was carried out using the same
protocols which led up to fusions 197 and 199. After the day 334
boost, there were no further immunizations until days 394 and 395.
Prior to the fusion, the hamsters were administered
2.times.10.sup.6 RAD-transfected CHO cells along with 300 .mu.l of
purified rat .alpha..sub.d-Sepharose.RTM. which was administered
interpertoneally. The fusion and screening protocols for the
subsequent fusion 205 were identical to those of fusions 199 and
197, except that during cloning, Armenian hamster ELISA reagents,
e.g. goat anti-Armenian hamster antibodies (Jackson ImmunolResearch
Labs), were used as an initial screen. Positive wells identified by
this method were subsequently screened by FACS as described. Fusion
205 yielded three separate positive clones named 205A, 205C,
205E.
[0312] 3. In another method to generate anti-rat .alpha..sub.d
monoclonal antibodies, 6 to 12 week old BALB/c mice were immunized
on day 1 with purified rat .alpha..sub.d -Sepharose.RTM.
administered subcutaneously in complete Fruend's adjuvant. A second
boost was administered by the same route on day 25 with the same
immunogen in incomplete Freund's adjuvant. A third boost identical
to the second was performed on day 42. No further boosts were
carried out until the pre-fusion boosts which consisted of 400
.mu.l (for fusion 226) and 250 .mu.l (for fusion 236) purified rat
.alpha..sub.d-Sepharose.RTM. injected intraperitoneally. Each
volume contained approximately 10 to 15 .mu.g antigen as determined
by Coomassie staining. The prefusion boosts for fusion 226 occurred
on days 62 and 63 and the fusion was performed on day 66. For
fusion 236, the prefusion boosts were performed on days 132 and 133
and the fusion was performed on day 136. Both fusion protocols
differed from that used for the Armenian hamster fusions described
above in that a 5:1 ratio of splenocytes to NS-1 cells was used as
compared to a ratio of 2:1 in the Armenian hamster fusions. The
fusion protocol was otherwise identical to the Armenian hamster
protocol.
[0313] The screening and cloning protocols for fusions 226 and 236
were identical to those used in fusions 197, 199, and 205, except
that an initial screen by ELISA was performed. In the ELISA, a goat
anti-mouse whole molecule was employed to capture the mouse
antibody from hybridoma supernatant and a goat anti-mouse horse
radish peroxidase conjugate was used to detect mouse antibody.
Positive supernatants were subsequently screened by FACS as
described for fusions 197 through 205.
[0314] Fusion 226 yielded nine positive clones designated 226A,
226B, 226C, 226D, 226E, 226F, 226G, 226H, and 226I. Fusion 236
yielded ten positive clones designated 236A, 236B, 236C, 236F,
236G, 236H, 236I, 236K, 236L, and 236M. Monoclonal antibodies
generated from these clones were isotyped by ELISA as described in
Example 15. All antibodies were found to be of the IgG1
isotype.
Characterization of Monoclonal Antibodies to Rat .alpha..sub.d
[0315] In order to characterize the anti-rat .alpha..sub.d
antibodies, biotin labeled spleens lysates were prepared as
described in Example 22, section D, above. Lysates were precleared
prior to use in immunoprecipitations. Initially, 50 .mu.g/ml of
normal murine immunoglobulin was added to the lysate and the
resulting solution mixed with end-over-end rotation for 30 minutes
at 4.degree. C. A 75 .mu.l slurry of a protein A-Sepharose.RTM.
coated with rabbit anti-mouse immunoglobulin was added and mixing
was continued with end-over-end rotation for 30 minutes. The rabbit
anti-mouse coated protein A beads were pelleted by centrifugation
at 15,000 rpm in a table-top microfuge for five minutes at
4.degree. C. and the supernatant collected. The pelleted material
was discarded.
[0316] For each cloned hybridoma, approximately 300 .mu.l of
supernatant was placed into a Eppendorf microfuge tube, to which
was added 30 .mu.l 10% Triton X-100.RTM., 30 .mu.l of a
100.times.stock solution of pepstatin, leupeptin and aprotinin, 100
.mu.g PMSF crystals, and 50 .mu.l of precleared biotinylated rat
spleen lysate. Samples were vortexed gently and placed onto an
end-over-end rotator at 4.degree. C. for 30 minutes. A control
sample was prepared by adding 10 mg/ml of a rabbit anti-rat
.alpha..sub.d specific polyclonal antibody to 50 .mu.l of rat
spleen lysate.
[0317] Following a 30 minute incubation, 75 .mu.l of protein
A-Sepharose.RTM. beads in a PBS slurry was added to each sample and
incubated with end-over-end rotation at 4.degree. C. for 30
minutes. The protein A-coupled beads were pelleted by
centrifugation at 15,000 rpm in a table-top microfuge for 5 minutes
at 4.degree. C. and the supernatant was collected. The pelleted
beads were washed sequentially with a series of 1 ml detergent
washes as follows: buffer #1 containing 10 mM Tris, 400 mM NaCl,
1.0% Triton X-100.RTM., pH 8.0; buffer #2 containing 10 mM Tris,
400 mM NaCl, 0.5% Triton X-100.RTM., pH 8.0; buffer #3 containing
10 mM Tris, 400 mM NaCl, 1.0% Triton X-100 , 0.1% deoxycholate, pH
8.0; and buffer #4 containing 10 mM Tris, 400 mM NaCl, 0.5 M
LiCl.sub.2, pH 8.0. A final washed was carried out with wash buffer
#1. Beads were vortexed gently between each wash and pelleted using
a tabletop microfuge. Supernatants were removed by transfer
pipette, and after the final wash, all remaining buffer was removed
from the beads by Hamilton syringe. A 50 .mu.l aliquot of SDS
sample buffer containing Bromphenol Blue and Pyronine Y dyes and
.beta.-mercaptoethanol at a final concentration of 10% was added to
each pellet. The mixture was vortexed vigorously for 1-2 minutes
and incubated at room temperature for 5-10 minutes. Samples were
centrifuged for 5 minutes at 15,000 rpm in a table-top microfuge at
4.degree. C. and released protein was collected and transferred to
a new microfuge tube. Aliquots from each sample were boiled for
four minutes in a water bath before loading onto 7.5% SDS-PAGE
gels. Following separation by PAGE, proteins were transferred to
nitrocellulose filters for one hour at 200 mAmps, and the filters
were blocked in a solution of 3.0% BSA/TBS-T overnight at 4.degree.
C. A solution of 0.1% BSA-TBS-T containing a 1:6000 dilution of
streptavidin-OPD was added to each filter and incubation allowed to
continue for one hour at room temperature. The filters were washed
five times for ten minutes each in TBS-T, and developed using
Amersham's ECL kit according to the manufacturer's suggested
protocol.
[0318] Clone 199M was found to immunoprecipitate a heterodimeric
protein. The larger protein subunit had an approximate molecular
weight of 170-175 kD which was consistent with the size of the
protein immunoprecipitated by the rabbit anti-rat .alpha..sub.d
polyclonal control. A second protein was also precipitated with an
approximate molecular weight of 95 kD, consistent with the weight
of CD18.
EXAMPLE 23
Specificity of Monoclonal Antibody 199M
[0319] A CNBr-Sepharose.RTM. affinity column with conjugated 199M
monoclonal antibody was used to affinity purify rat .alpha..sub.d
from spleen cell lysates. Briefly, approximately
1.3.times.10.sup.10 rat spleen cells were lysed in buffer
consisting of 150 mM NaCl, 10 mM PMSF, 10 mM Tris, 1% Triton
X-100.RTM., pH 8.0. Cells in the buffer were incubated for 30
minutes on ice and centrifuged at approximately 10,000.times.g for
30 minutes at 4.degree. C.
[0320] Antibody 199M was conjugated to CNBr-activated
Sepharose.RTM. 4B (Pharmacia) by the following method. One gram of
the activated resin was suspended in 1 mM HCl for 15 minutes and
washed three times with 15 ml of 1 mM HCl and once with 15 ml
coupling buffer containing 0.1 mM HCO.sub.3, 0.5 M NaCl, pH 8.0.
Antibody 199M in coupling buffer was added to resin suspension at a
final concentration of approximately 10-20 mg/ml and the mixture
incubated overnight at 4.degree. C. The following day the
conjugated resin was pelleted by centrifugation and the supernatant
removed. Unreacted groups on the resin were blocked by incubation
in 0.1 M Tris, pH 8.0 for one hour at room temperature. The
conjugated resin was washed with 0.1 M citric acid, pH 3.0, and
stored in lysis buffer as a 1:2 slurry containing 0.1% sodium
azide.
[0321] For affinity purification, spleen cells were incubated with
end-over-end mixing overnight with 0.4 ml of the 199M-conjugated
Sepharose.RTM. resin. The resin was then pelleted by centrifugation
and washed four times with 15 ml lysis buffer. Aliquots of
approximately 100 .mu.l of each gel were boiled briefly in reducing
sample buffer containing 0.1 M Tris-HCl, pH 6.8, 2.0% SDS, 20%
glycerol, 0.0002% bromophenol blue, 10% .beta.-mercaptoethanol
(final concentration 5%) and loaded onto and proteins resolved
using a 6.0% polyacrylamide SDS gel (SDS-PAGE).
[0322] The affinity purified material was found to contain two
major and one minor protein species when separated on SDS-PAGE. A
prominent protein band with a molecular weight of 90 kD was
consistent with the known size of CD18 and this band was not
sequenced. A second prominent band of 160 kD was detected which was
consistent with the predicted molecular weight for ad. In addition,
a minor band with an apparent molecular weight of 200 kD was also
detected. Both the 160 kD and 200 kD species were further analyzed
by amino terminal protein sequencing with the results compared to
the amino acid sequence predicted by the rat .alpha..sub.d cDNA, as
well as to the known amino acid sequences for CD11c and CD11b. The
sequence of both the 160 and 200 kD bands were found to be
consistent with the amino acid sequence predicted by cloned rat
.alpha..sub.d, suggesting that there may be two forms of
.alpha..sub.d, perhaps resulting from splice variants or
glycosylation differences.
EXAMPLE 24
T Cell Proliferation Assay Using Rat .alpha..sub.d-Expressing
Macrophages
[0323] Macrophages expressing .alpha..sub.d isolated from rat
spleens were used as antigen presenting cells (APC) to stimulate a
myelin basic protein specific T cell line designated LR-21.
Briefly, rats were injected intravenously with a 100 .mu.l volume
of iron particles (BioMag, Cambridge, Mass.). The following day a
single cell suspension was prepared from the spleens and
.alpha..sub.d.sup.+ macrophages which had phagocytosed iron
particles were collected using a magnet. Flow cytomotery and
immunoprecipitation indicated that 50 to 80% of the cells which
phagocytose iron are .alpha..sub.d .sup.+.
[0324] The results indicated that spleen macrophages expressing
.alpha..sub.d were very poor APC's compared to other APC such as
thymic macrophages. The monoclonal antibody designated 205C was
also tested in the proliferation assay with the .alpha..sub.d
positive macrophages and the LR-21 cell line. Proliferation assays
were then carried out as follows.
[0325] Spleen macrophages positive for .alpha..sub.d expression
were suspended at a density of 6.times.10.sup.6 cells/ml in RPMI
containing 5% normal rat serum and 100 .mu.l of the macrophage
suspension was added to each well. Cells from the LR-21 line were
suspended at 1.times.10.sup.6 cell/ml in RPMI with 5% normal rat
serum and 50 .mu.l of the suspension was added to each well.
Monoclonal antibody 205C was added to each well in a volume of 50
.mu.l to a final concentration of 50, 10 and 2 .mu.g/ml. Plates
were incubated at 37.degree. C. for 72 hours and 1 .mu.Ci
.sup.3H-thymidine was added for the final 24 hours of incubation.
Cells were harvested onto glass fiber mats and .sup.3H
incorporation determined using a Direct Beta Counter (Packard
Matrix 96).
[0326] Results from the experiments indicate that high
concentrations of antibody 205C (10 and 50 .mu.g/ml) are able to
reduce T cell proliferation in a dose dependent manner.
EXAMPLE 25
Immunoprecipitation of .alpha..sub.d from Rat Bone Marrow
[0327] Bone marrow cells were harvested from a Lewis rat by
flushing the femur bone with PBS. The cells were washed,
biotinylated, and immunoprecipitated, essentially as described in
Example 18, using 20 .mu.g purified monoclonal antibodies to
immunoprecipitate protein from 100 .mu.l of precleared cell
lysates. Detection of immunoprecipitated protein was carried out in
the manner as previously described.
[0328] The rat .alpha..sub.d monoclonal antibody 205C
immunoprecipitated two bands which migrated at 160 kD and 95 kD.
Bands of this size were consistent with the size for the .alpha.
and .beta. chains in .alpha..sub.d/CD18 as observed in
immunoprecipitation of proteins from spleen cell lysates using the
same antibody. Antibodies against rat CD11a, CD11b, or CD11c
immunoprecipitated alpha chains distinct from .alpha..sub.d and all
antibodies co-immunoprecipitated a protein having a molecular
weight consistent with that known for CD18.
EXAMPLE 26
Expression of .alpha..sub.d in Animal Models
[0329] Preliminary results indicated that rat .alpha..sub.d is
selectively expressed by subpopulations of macrophages, including
cortical macrophages in the thymus, Kupffer cells in the liver,
perivascular cells in the central nervous system, a subset of
peritoneal macrophages, and resident bone marrow macrophages. In
addition, a subset of thioglycolate macrophages showed upregulation
of .alpha..sub.d expression following stimulation with
dexamethasone. The observed macrophage-restricted expression of rat
.alpha..sub.d suggested further analysis of expression in various
animal models.
Expression of Rat .alpha..sub.d in Phenylhydrazine Model
[0330] The administration of phenylhydrazine to animals results in
massive red blood cell (rbc) damage which leads to a transient
anemia. Damaged rbcs are cleared from circulation by red pulp
macrophages, resulting in significant splenomegaly. It is proposed
that macrophages which express .alpha..sub.d may be involved in the
clearance of damaged rbcs and other foreign material from
circulation.
[0331] To test this hypothesis, groups of rats were treated with
saline alone or phenylhydrazine dissolved in saline and
administrated by intraperitoneal injection at a dosage of 100 mg/kg
body weight. In some experiments rats were treated with a
polyclonal antiserum generated to the "I domain" of rat
.alpha..sub.d.
[0332] At various time points following phenylhydrazine
administration, animals were sacrificed. Spleen weight and
hematocrit were used as parameters of rbcs clearance. In addition,
kidney, spleen and liver were collected for histopathologic
evaluation, which included immunostaining for CD11a, CD11b, CD11c
and .alpha..sub.d.
[0333] Gross findings indicated that four days following treatment
with phenylhydrazine (saline controls and .alpha..sub.d treatment)
rats developed a dramatic splenomegaly, while hematocrit levels
dropped. Treatment with the .alpha..sub.d polyclonal serum had no
effect on spleen weight or the drop in hematocrit induced with
phenylhydrazine.
[0334] Tissue from saline and day 4 phenylhydrazine treated rats
were sectioned at 4 .mu.m thickness and air dried on Superfrost
Plus (VWR Scientific) slides at room temperature for 15 minutes.
Prior to use, slides were incubated at 50.degree. C. for
approximately 5 minutes. Sections were fixed in cold (4.degree. C.)
acetone (EM Science) for 2 minutes at room temperature and allowed
to dry at room temperature. Sections were placed in 100 ml
1.times.TBS, 1.1 ml 30% H.sub.2O.sub.2 (Sigma), 1 ml 10% NaN.sub.3
(Sigma) for 15 minutes at room temperature to remove endogenous
peroxidase activity. Each section was blocked using 150 .mu.l of a
solution containing 30% normal rat serum (Harlan Bioproducts), 2%
BSA (Sigma) in 1.times.TBS for 30 minutes at room temperature,
after which the solution was gently blotted from the sections. Each
section received 75 .mu.l of biotinylated hamster anti-rat
.alpha..sub.d antibody 205C at a protein concentration of 13.3
.mu.g/ml diluted in blocking solution, for 1 hour at room
temperature. After incubation, the sections were washed three times
in 1.times.TBS for 5 minutes each to remove any unbound antibody.
Excess TBS was removed by aspirating around the tissue following
the final wash. Peroxidase-conjugated goat anti-biotin antibody
(Vector Laboratories) was diluted 1:200 in blocking solution and 75
.mu.l was applied to each section for 30 minutes at room
temperature. After incubation, slides were washed two times in
1.times.TBS for 5 minutes each wash. AEC substrate (Vector
Laboratories) was applied and color development stopped by
immersion in water. Slides were counterstained in Gill's
hematoxylin #2 (Sigma) and rinsed in water, after which they were
successively dehydrated in 70%, 95%, 100% EtOH, and Xylene.
Sections were then mounted with cytoseal (VWR).
[0335] In the saline-treated rat spleen sections, the majority of
ad expression was localized in the splenic red pulp on cells
identified morphologically as macrophages, granulocytes, and a
subpopulation of lymphocytes. In the phenylhydrazine-treated rat
spleens, however, the splenic red pulp had undergone morphological
changes such that the only cell type identified was a population of
large macrophages which had engulfed damaged red blood cells. The
majority of these large macrophages were observed to expressed
.alpha..sub.d. Also in the phenylhydrazine-treated rat, there
appeared to be an increase in the number of macrophages in the
splenic white pulp that expressed .alpha..sub.d.
[0336] A double label experiment to determine expression of
.alpha..sub.d and CD11c was also performed on a
phenylhydrazine-treated rat spleen. As previously described,
.alpha..sub.d expression was detected on large macrophages in the
splenic red pulp that appeared to have engulfed damaged red blood
cells. CD11c expression was also detected on large macrophages in
the splenic red pulp and there appeared to be more CD11c positive
cells in the red pulp than .alpha..sub.d positive cells. The
majority of macrophages expressing .alpha..sub.d also expressed
CD11c even though a small subset of .alpha..sub.d positive
macrophages were observed that did not express CD11c. There was
also a population of CD11c positive macrophages that did not
express .alpha..sub.d.
[0337] Immunohistology analysis therefore indicates that there
appears to be an upregulation of CD11c expression in the spleen of
phenylhydrazine treated animals compared to the saline controls on
day 4. Expression of the other integrins, CD11a, CD11b and
.alpha..sub.d, however, appears to be unaffected by the
phenylhydrazine treatment. Treatment with polyclonal "I" domain
.alpha..sub.d antibody also showed no effect on the uptake of rbcs
by the red pulp macrophages, but the majority of macrophages that
are engulfing rbcs are .alpha..sub.d positive. The .alpha..sub.d
positive macrophages which had engulfed damaged rbcs were not
present in spleens collected 7 days after phenylhydrazine
administration.
[0338] A double label experiment was then performed on the day 4
phenylhydrazine-treated rat spleens using an apoptosis assay and
ICC with biotin-conjugated antibody 205C. Tissue from normal rat
and day four phenylhydrazine-treated rats were sectioned at 4
microns thickness and air dried on Superfrost Plus slides (VWR
Scientific) at room temperature for 15 minutes and stored at
-20.degree. C. Prior to use, slides were warmed to 50.degree. C.
Warmed slides were placed in buffer containing 100 ml 1.times.TBS,
1.1 ml 30% H.sub.2O.sub.2 (Sigma), 1 ml 10% NaN.sub.3 (Sigma) for
15 minutes at room temperature to remove endogenous peroxidase
activity. Each section was blocked using 150 .mu.l of a solution
containing 20% normal rat serum (Harlan Bioproducts), 2% BSA
(Sigma) in 1.times.TBS for 10 minutes at 37.degree. C., after which
the solution was gently blotted from the sections. Each section was
incubated for 30 minutes at 37.degree. C. with 75 .mu.l
biotinylated hamster anti-rat .alpha..sub.d antibody 205C at a
protein concentration of 26.6 .mu.g/ml diluted in blocking
solution. Sections were then washed three times for five minutes
each in 1.times.TBS to remove unbound antibody. Excess TBS was
removed by aspirating around the tissue following the final wash.
Alkaline phosphatase-conjugated avidin/biotin complex (Vector
Laboratories) prepared according to the manufacturer's instructions
was applied to each section for 20 minutes at 37.degree. C. After
incubation, slides were washed two times for five minutes each in
1.times.TBS. Sections were fixed for five minutes with 4%
paraformaldehyde (Sigma) at 4.degree. C. Sections were then rinsed
in 1.times.PBS and placed in CSK buffer (100 mM NaCl, 300 mM
sucrose, 10 mM pipes pH 6.8, 3 mM MgCl.sub.2, 0.5%
Triton-X-100.RTM.) for two minutes at 4.degree. C. Sections were
rinsed in 1.times.PBS for two minutes at room temperature after
which the sections were washed three times for five minutes each
with 1.times.PBS. TUNEL reaction mixture (Boehringer Mannheim) was
applied to each section for 60 minutes at 37.degree. C. After
incubation, the sections were washed three times in 1.times.PBS for
5 minutes each wash. The apoptosis kit methodology is similar to in
situ hybridization; the TUNEL reagent (which is FITC conjugated)
hybridizes to "nicked" DNA. Converter-POD (a peroxidase conjugated
antibody which recognizes the FITC tag on the TUNEL reagent) was
applied to each section for 30 minutes at 37.degree. C. and the
sections were washed three times for five minutes each with
1.times.PBS. AEC (Vector Laboratories) was applied and color
development stopped by immersion in water. Sections were mounted
with Aquamount (VWR).
[0339] In the model, numerous cells in both the red and white pulp
regions of the spleen were undergoing apoptosis, but large
macrophages in the red pulp (which expressed .alpha..sub.d and
disappeared on day 7 of the model) that had engulfed RBCs were not
found to be undergoing apoptosis.
Cell Type Analysis of Rat .alpha..sub.d Expression on Normal Rat
Spleen
[0340] In order to determine which rat cell types express
.alpha..sub.d, a double label staining was performed on normal rat
spleen. Sections of normal rat spleen were prepared as described
above through the rat serum blocking step. After the addition of
primary cell marker antibodies, alkaline phosphatase-conjugated
goat anti-mouse antibody (Jackson Laboratories) was diluted 1:500,
in the same diluent used for the primary antibodies, and 75 .mu.l
was applied to each section for 30 minutes at room temperature.
Slides were washed two times in 1.times.TBS for five minutes each
wash. Alkaline phosphatase conjugated donkey anti-goat antibody
(Jackson Laboratories) was diluted 1:300, in antibody diluent, and
75 .mu.l was applied to each section for 30 minutes at room
temperature. After washing and blocking as above, each section
received 75 .mu.l of biotinylated hamster anti-rat .alpha..sub.d
antibody (205C), at a protein concentration of 20 .mu.g/ml, for 1
hour 45 minutes each and then washed to remove unbound antibody.
Excess TBS was removed by aspirating around the tissue following
the final wash. Peroxidase conjugated goat anti-biotin (Vector
Laboratories) was diluted 1:200, in antibody diluent, and 75 .mu.l
was applied to each section for 45 minutes at room temperature.
Slides were washed two times 1.times.TBS for five minutes each
wash. AEC substrate (Vector Laboratories) was applied and color
development was stopped by immersion in water. Fast Blue substrate
(Vector Laboratories) was then applied and color development was
stopped by immersion in water. Slides were then mounted with
Aquamount (Baxter).
[0341] Dual antibody immunocytochemistry was performed using
antibodies to CD5, CD2, CD4, CD8, NK marker, or HIS 45 (a T cell
marker) in conjunction with anti-.alpha..sub.d antibody in an
attempt to determine the phenotype of cells expressing
.alpha..sub.d. No double labeled cells were detected with
CD2/.alpha..sub.d or HIS 45/.alpha..sub.d. In the splenic red pulp
of a normal rat .alpha..sub.d labeled clusters of small cells which
were found to also express CD5. It was not determined if the CD5
positive cells were T cells or B cells. A small population of
.alpha..sub.d expressing cells in the red pulp were also determined
to express CD4. In addition, a subset of NK cells and CD8 positive
cells were also identified that expressed .alpha..sub.d. Therefore,
.alpha..sub.d expression in the spleen was found on a subset of T
cells, possibly a subset of B cells, a subset of NK cells, and
subset of macrophages.
Expression of .alpha..sub.d on Large Granulocytic Leukocytes (LGL)
Tumor Cells from the F344 Rat Model
[0342] A rat model for LGL-leukemia was designed in the F344 rat
using tumor cells received from the National Cancer Institute which
were injected intravenously into 3 male F344 rats (1 million cells
each). The disease took three months to manifest, at which time
several of the animals were sacrificed and tissues examined by FACS
and histochemical analysis.
[0343] For FACS analysis, a portion of the spleen was removed and a
single-cell suspension prepared as described in example below.
Briefly, the splenic tissue was minced into smaller pieces with
scissors and passed through a wire mesh screen in the presence of
D-PBS. The cells were pelleted by centrifugation and resuspended in
30 ml D-PBS. Histopaque gradients (Sigma) were prepared by layering
5.0 ml of the cell suspension over 5.0 ml of Histopaque within a 15
ml centrifuge tube. The gradients were centrifuged for 30 minutes
at 1500 rpm using a Beckman Tabletop Centrifuge and the cellular
layer collected, washed once in D-PBS, and counted by
hemacytometer. The cells were resuspended in FACS buffer
(RPMI-1640/2% FBS, 0.2% sodium azide) to a density of
1.times.10.sup.6 cells/sample.
[0344] The cells were two-color stained by incubation with the
hamster anti-rat .alpha..sub.d antibody 205C conjugated to biotin
(10 .mu.g/ml) and one of a series of antibodies against rat
cellular markers that were FITC conjugated. These second antibodies
included anti-macrophage-FITC, anti-CD3-FITC, and anti-IgM
(B-cell)-FITC antibodies (all from PharMingen), in addition to a
FITC-conjugated antibody with NK cell specificity (Harlan). The
FITC conjugated antibodies were each used at 10 .mu.l/sample.
[0345] The samples were first incubated on ice for 30 minutes with
205C-biotin antibody, washed three times in FACS buffer, and
resuspended in 1.0 ml FACS buffer. The FITC conjugates were added
along with 5 .mu.l streptavidin-PE (Pharmigen) and the samples
placed on ice for 30 minutes. After incubation, the samples were
washed three times in FACS buffer and resuspended in 200 .mu.l FACS
buffer. Samples were examined using a Becton Dickinson FACscan and
the data analyzed using Lysis II software (Becton Dickinson).
[0346] The results overwhelmingly demonstrated expression of
.alpha..sub.d on the surface of NK, or LGL, cells. Cells which
stained positive for B-cell and T-cell markers did not reveal
.alpha..sub.d expression and cells which stained using the
macrophage marker showed only a slight degree of .alpha..sub.d
expression. It is believed that, at this point in the disease, the
spleen is composed predominantly of NK tumor cells, consistent with
the observation that a large population of spleen cells stained for
expression of both the NK marker and .alpha..sub.d.
[0347] These observations were also consistent with results from a
parallel experiment using peripheral blood cells also collected
from the same animals and processed as above for FACS. Results
using peripheral blood cells indicated that circulating NK cells
also express .alpha..sub.d, while cells expressing other cellular
markers in the blood did not show .alpha..sub.d expression. Results
using peripheral blood cells, however, were not as dramatic as the
splenic cell results presumably due to a difference in the
percentage of different cell types present in the spleen and
peripheral blood.
[0348] In subsequent FACS analysis of rat spleen cells from these
model animals, identical results were obtained. Upon further
analysis using the above method of cell preparation, the LGL tumor
cells have also shown staining for expression of CD18 as well as
CD11a, CD11b, and CD11c.
[0349] Histochemical analysis was carried out on both normal and NK
F344 diseased tissue using the ICC procedure described above.
Preliminary data indicated that .alpha..sub.d was expressed in NK
F344 tumor lung and liver tissue, but was either not detected or
was expressed in very low levels in normal respective tissue.
Diseased lung tissue showed expression of .alpha..sub.d on small
and large clusters of cells, as well as individual cells throughout
the lung. The NK F344 liver showed weak labeling around vessels and
other cells throughout the tissue. Antibodies to the other
.beta..sub.2 integrins indicated these molecules are expressed at
similar levels in both normal and diseased tissue although labeling
patterns did vary.
[0350] In parallel analyses, the normal rat thymus showed slight
.alpha..sub.d expression in scattered cells in the cortex, while
the F344 NK thymus showed an increased level of .alpha..sub.d
expression. While the normal spleen showed expression in the red
pulp, the NK spleen had cluster labeling throughout the tissue.
[0351] The NK spleen was then tested at weekly intervals from onset
of the disease which indicated that the level of expression of
.alpha..sub.d increased up until the third week and then dropped
off at the fourth week.
EXAMPLE 27
Assay for Inhibition of NK-Tumor Cell-Induced Target Cell Lysis
Using Anti-.alpha..sub.d Monoclonal Antibodies
[0352] A specific function of NK cells is to target and kill
virally-infected and foreign cells. To assay the ability of NK
cells to lyse a specific target cell, target cells are labeled with
.sup.51chromium and as lysis occurs, increasing radioactivity is
detected in the medium. It was postulated that .alpha..sub.d,
previously shown to be expressed on NK cells, might participate in
NK targeted cell killing. To test this hypothesis, tumor cells were
pre-incubated with .alpha..sub.d antibodies in order to assess the
role of .alpha..sub.d in a functional assay.
Preparation of .alpha..sub.d Positive NK-tumor Effector Cells
[0353] F344 rats were injected with NK tumor cells, originally
obtained from the National Cancer Institute and passaged through
animals three to four weeks prior to removal of the spleen. The
spleen was removed and was minced into small pieces which were
passed through a wire-mesh screen in the presence of D-PBS. The
resultant cell suspension was centrifuged at 1500 rpm in a Beckman
tabletop centrifuge for 10 minutes at room temperature. The
supernatant was aspirated and the cell pellet resuspended in 30 ml
D-PBS.
[0354] Histopaque separation of mononuclear cells from blood was
then carried out as follows. Five ml Histopaque (Sigma) was added
to six 15 ml centrifuge tubes on top of which was layered 5.0 ml of
the cell suspension described above. The cells were centrifuged at
1500 rpm for 30 minutes in a Beckman Tabletop centrifuge at room
temperature. The cellular layer was collected, pooled and counted
by hemacytometer. Several dilutions of the isolated tumor cells
were prepared in D-PBS buffer and subsequently incubated in the
presence or absence of anti-rat .alpha..sub.d antibodies at a
concentration of 50 .mu.g/ml. Control antibodies included an
anti-rat CD18 antibody and an anti-rat ICAM-1 antibody which were
also incubated with the cells at 50 .mu.g/ml concentration. Tumor
cells were pre-incubated with antibodies at 37.degree. C. for
approximately 30 minutes prior to the assay.
Chromium Labeling of Yak-1 Target Cells
[0355] Yak-1 cells (ATCC), a mouse lymphoma cell line, were
cultured in 10% FBS/RPMI 1640. Cells were harvested by
centrifugation and resuspended at a density of approximately
1.times.10.sup.7 cells in 1.5 to 4.0 ml of RPMI "test media" made
from 500 ml RPMI 1640, 5 ml Pen-Strep antibiotic solution, and 10
ml FBS. Approximately 200 to 300 .mu.Ci of .sup.51chromium was
added to the Yak-1 cell suspension which were then incubated at
37.degree. C. for 45 to 60 minutes with gentle mixing. Following
incubation, the volume was increased to 50 ml with test media and
the cells pelleted by centrifugation. The supernatant was discarded
and cells were suspended in 1 to 3 ml test media and adjusted to a
density of 5.times.10.sup.4 cells/ml. Non-labeled Yak-1 cells were
also prepared at a concentration of 1.times.10.sup.7 cell/ml to use
as autologous controls.
[0356] The activity of labeled cells was determined by assaying 100
.mu.l of the labeled cell suspension in triplicate using a gamma
counter.
Short-Term Chromium Release Assay
[0357] NK effector cells of each dilution were plated in triplicate
in a volume of 100 .mu.l test media in a 96-well microtiter plate
and 100 .mu.l labeled Yak-1 cells were added to each well.
Autologous, i.e., spontaneous or background, release was obtained
by incubating 100 .mu.l of labeled cells with non-labeled Yak cells
at each of the effector dilutions. Total .sup.51chromium release
was obtained by adding 1.0% Triton.RTM. to target cells in one set
of wells. Spontaneous release was measured by the amount of
.sup.51chromium found in wells with only target cells. Incubation
of effector/target cells was carried out for four hours at
37.degree. C. after which the plates were centrifuged and 100 .mu.l
supernatant collected from each well and radioactivity
measured.
[0358] Cytolytic activity was calculated by using the following
formula: 1 % cytolytic activity = cmp of sample - spontaneous
release cpm 100 % release cmp - spontaneous release cmp .times.
100
[0359] Results indicated that neither hamster anti-rat
.alpha..sub.d antibodies (including 199M and 205C) nor mouse
anti-rat .alpha..sub.d antibodies (226A, 226B, 226C, 226D, 226F,
226G, 226H, and 226I) effected the ability of NK tumor cells to
kill or lyse the labeled target cells.
EXAMPLE 28
Isolation of Mouse cDNA Clones
[0360] Isolation of a mouse .alpha..sub.d homolog was
attempted.
[0361] Cross-species hybridization was performed using two
PCR-generated probes: a 1.5 kb fragment corresponding to bases 522
to 2047 from human clone 19A2 (SEQ ID NO:1), and a 1.0 kb rat
fragment which corresponds to bases 1900 to 2900 in human clone
19A2 (SEQ ID NO:1). The human probe was generated by PCR using
primer pairs designated ATM-2 and 9-10.1 set out in SEQ ID NOS:38
and 39, respectively; the rat probe was generated using primer
pairs 434L and 434R, set out in SEQ ID NOS:34 and 35, respectively.
Samples were incubated at 94.degree. C. for 4 minutes and subjected
to 30 cycles of the temperature step sequence: 94.degree. C.;
50.degree. C. 2 minutes; 72.degree. C., 4 minutes.
16 5'-GTCCAAGCTGTCATGGGCCAG-3' (SEQ ID NO:38)
5'-GTCCAGCAGACTGAAGAGCACGG-3' (SEQ ID NO:39)
[0362] The PCR products were purified using the Qiagen Quick Spin
kit according to manufacturer's suggested protocol, and
approximately 180 in DNA was labeled with 200 .mu.Ci
[.sup.32P]-dCTP using a Boehringer Mannheim Random Primer Labeling
kit according to manufacturer's suggested protocol. Unincorporated
isotope was removed using a Centri-sep Spin Column (Princeton
Separations, Adelphia, N.J.) according to manufacturer's suggested
protocol. The probes were denatured with 0.2 N NaOH and neutralized
with 0.4 M Tris-HCl, pH 8.0, before use.
[0363] A mouse thymic oligo dT-primed cDNA library in lambda
ZAP.RTM. II (Stratagene) was plated at approximately 30,000 plaques
per 15 cm plate. Plaque lifts on nitrocellulose filters (Schleicher
& Schuell, Keene, N.H.) were incubated at 50.degree. C. with
agitation for 1 hour in a prehybridization solution (8 ml/lift)
containing 30% formamide. Labeled human and rat probes were added
to the prehybridization solution and-incubation continued overnight
at 50.degree. C. Filters were washed twice in 2.times.SSC/0.1% at
room temperature, once in 2.times.SSC/0.1% SDS at 37.degree. C.,
and once in 2.times.SSC/0.1% SDS at 42.degree. C. Filters were
exposed on Kodak X-Omat AR film at -80.degree. C. for 27 hours with
an intensifying screen.
[0364] Four plaques giving positive signals on duplicate lifts were
restreaked on LB medium with magnesium (LBM)/carbenicillin (100
mg/ml) plates and incubated overnight at 37.degree. C. The phage
plaques were lifted with Hybond.RTM. filters (Amersham), probed as
in the initial screen, and exposed on Kodak X-Omat AR film for 24
hours at -80.degree. C. with an intensifying screen.
[0365] Twelve plaques giving positive signals were transferred into
low Mg.sup.++ phage diluent containing 10 mM Tris-HCl and 1 mM
MgCl.sub.2. Insert size was determined by PCR amplification using
T3 and T7 primers (SEQ ID NOS:13 and 14, respectively) and the
following reaction conditions. Samples were incubated at 94.degree.
C. for 4 minutes and subjected to 30 cycles of the temperature step
sequence: 94.degree. C., for 15 seconds; 50.degree. C., for 30
seconds; and 72.degree. C. for 1 minute.
[0366] Six samples produced distinct bands that ranged in size from
300 bases to 1 kb. Phagemids were released via co-infection with
helper phage and recircularized to generate Bluescript.RTM. SK
(Stratagene). The resulting colonies were cultured in
LBM/carbenicillin (100 mg/ml) overnight. DNA was isolated with a
Promega Wizard.RTM. miniprep kit (Madison, Wis.) according to
manufacturer's suggested protocol. EcoRI restriction analysis of
purified DNA confirmed the molecular weights which were detected
using PCR. Insert DNA was sequenced with M13 and M13 reverse. 1
primers set out in SEQ ID NOS:40 and 41, respectively.
17 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO:40)
5'-GGAAACAGCTATGACCATG-3' (SEQ ID NO:41)
[0367] Sequencing was performed as described in Example 4.
[0368] Of the six clones, only two, designated 10.3-1 and 10.5-2,
provided sequence information and were identical 600 bp fragments.
The 600 bp sequence was 68% identical to a corresponding region of
human .alpha..sub.d, 40% identical to human CD11a, 58% identical to
human CD11c, and 54% identical to mouse CD11b. This 600 bp fragment
was then utilized to isolate a more complete cDNA encoding a
putative mouse .alpha..sub.d homolog.
[0369] A mouse splenic cDNA library (oligo dT and random-primed) in
lambda Zap.RTM. II (Stratagene) was plated at 2.5.times.10.sup.4
phage/15 cm LBM plate. Plaques were lifted on Hybond.RTM. nylon
transfer membranes (Amersham), denatured with 0.5 M NaOH/1.5 M
NaCl, neutralized with 0.5 M Tris Base/1.5 M NaCl/11.6 HCl, and
washed in 2.times.SSC. The DNA was cross-linked to filters by
ultraviolet irradiation.
[0370] Approximately 500,000 plaques were screened using probes
10.3-1 and 10.5-2 previously labeled as described supra. Probes
were added to a prehybridization solution and incubated overnight
at 50.degree. C. The filters were washed twice in 2.times.SSC/0.1%
SDS at room temperature, once in 2.times.SSC/0.1% SDS at 37.degree.
C., and once in 2.times.SSC/0.1% SDS at 42.degree. C. Filters were
exposed on Kodak X-Omat AR film for 24 hours at -80.degree. C. with
an intensifying screen. Fourteen plaques giving positive signals on
duplicate lifts were subjected to a secondary screen identical to
that for the initial screen except for additional final high
stringency washes in 2.times.SSC/0.1% SDS at 50.degree. C., in
0.5.times.SSC/0.1% SDS at 50.degree. C., and at 55.degree. C. in
0.2.times.SSC/0.1% SDS. The filters were exposed on Kodak X-Omat AR
film at -80.degree. C. for 13 hours with an intensifying
screen.
[0371] Eighteen positive plaques were transferred into low
Mg.sup.++ phage diluent and insert size determined by PCR
amplification as described above. Seven of the samples gave single
bands that ranged in size from 600 bp to 4 kb. EcoRI restriction
analysis of purified DNA confirmed the sizes observed from PCR and
the DNA was sequenced with primers M13 and M13 reverse.1 (SEQ ID
NOS:40 and 41, respectively).
[0372] One clone designated B3800 contained a 4 kb insert which
corresponded to a region 200 bases downstream of the 5' end of the
human .alpha..sub.d 19A2 clone and includes 553 bases of a 3 '
untranslated region. Clone B3800 showed 77% identity to a
corresponding region of human .alpha..sub.d, 44% identity to a
corresponding region of human CD11a, 59% identity to a
corresponding region of human CD11c, and 51% identity to a
corresponding region of mouse CD11b. The second clone A1160 was a
1.2 kb insert which aligned to the 5' end of the coding region of
human .alpha..sub.d approximately 12 nucleic acids downstream of
the initiating methionine. Clone A1160 showed 75% identity to a
corresponding region of human .alpha..sub.d, 46% identity to a
corresponding region of human CD11a, 62% identity to a
corresponding region of human CD11c, and 66% identity to a
corresponding region of mouse CD11b.
[0373] Clone A1160, the fragment closer to the 5 end of human clone
19A2, is 1160 bases in length, and shares a region of overlap with
clone B3800 starting at base 205 and continuing to base 1134. Clone
A1160 has a 110-base insertion (bases 704-814 of clone A1160) not
present in the overlapping region of clone B3800. This insertion
occurs at a probable exon-intron boundary [Fleming, et al., i
J.Immunol. 150:480-490 (1993)] and was removed before subsequent
ligation of clones A1160 and B3800.
Rapid Amplification of 5' cDNA End of the Putative Mouse
.alpha..sub.d Clone
[0374] RACE PCR [Frohman, "RACE: Rapid Amplification of cDNA Ends,"
in PCR Protocols: A Guide to Methods and Applications, Innis, et
al. (eds.) pp. 28-38, Academic Press:New York (1990)] was used to
obtain missing 5' sequences of the putative mouse .alpha..sub.d
clone, including 5' untranslated sequence and initiating
methionine. A mouse splenic RACE-Ready kit (Clontech, Palo Alto,
Calif.) was used according to the manufacturer's suggested
protocol. Two antisense, gene-specific primers, A1160 RACE1-primary
and A1160 RACE2-nested (SEQ ID NOS:42 and 43), were designed to
perform primary and nested PCR.
18 5'-GGACATGTTCACTGCCTCTAGG-3' (SEQ ID NO:42)
5'-GGCGGACAGTCAGACGACTGTCCTG-3' (SEQ ID NO:43)
[0375] The primers, SEQ ID NOS:42 and 43, correspond to regions
starting 302 and 247 bases from the 5' end, respectively. PCR was
performed as described, supra, using the 5' anchor primer (SEQ ID
NO:44) and mouse spleen cDNA supplied with the kit.
19 (SEQ ID NO:44) 5'-CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGA-
TAG-3'
[0376] Electrophoresis of the PCR product revealed a band
approximately 280 bases in size, which was subcloned using a TA
cloning kit (Invitrogen) according to manufacturer's suggested
protocol. Ten resulting colonies were cultured, and the DNA
isolated and sequenced. An additional 60 bases of 5' sequence were
identified by this method, which correspond to bases 1 to 60 in SEQ
ID NO:45.
Characteristics of the Mouse cDNA and Predicted Amino Acid
Sequence
[0377] A composite sequence of the mouse cDNA encoding a putative
homolog of human .alpha..sub.d is set out in SEQ ID NO:45. Although
homology between the external domains of the human and mouse clones
is high, homology between the cytoplasmic domains is only 30%. The
observed variation may indicate C-terminal functional differences
between the human and mouse proteins. Alternatively, the variation
in the cytoplasmic domains may result from splice variation, or may
indicate the existence of an additional .beta..sub.2 integrin
gene(s).
[0378] At the amino acid level, the mouse cDNA predicts a protein
(SEQ ID NO:46) with 28% identity to mouse CD11a, 53% identity to
mouse CD11b, 28% identity to human CD11a, 55% identity to human
CD11b, 59% identity to human CD11c, and 70% identity to human
.alpha..sub.d. Comparison of the amino acid sequences of the
cytoplasmic domains of human .alpha..sub.d and the putative mouse
homolog indicates regions of the same length, but having divergent
primary structure. Similar sequence length in these regions
suggests species variation rather than splice variant forms. When
compared to the predicted rat polypeptide, Example 20, supra, mouse
and rat cytoplasmic domains show greater than 60% identity.
EXAMPLE 29
Isolation of Additional Mouse .alpha..sub.d cDNA Clones for
Sequence Verification
[0379] In order to verify the nucleic and amino acids sequences
describe in Example 28 for mouse .alpha..sub.d, additional mouse
sequences were isolated for the purposes of confirmation.
[0380] Isolation of mouse cDNA by hybridization with two homologous
.alpha..sub.d probes (3' and 5' ) was performed using both a mouse
splenic random primed library and an oligo dT-primed cDNA library
in lambda ZAP.RTM. II (Strategene). The library was plated at
5.times.10.sup.5 phage per 15 cm LBM plate. Plaques were lifted on
Hybond.RTM. nylon membranes (Amersham), and the membranes were
denatured (0.5 M NaOH/1.5 M NaCl), neutralized (0.5 M Tris Base/1.5
M NaCl/11.6 M HCl) and washed (2.times.SSC salt solution). DNA was
cross-lined to filters by ultraviolet irradiation.
[0381] Probes were generated using primers described below in a PCR
reaction under the following conditions. Samples were held at
94.degree. C. for 4 minutes and then run through 30 cycles of the
temperature step sequence (94.degree. C. for 15 seconds; 50.degree.
C. for 30 seconds; 72.degree. C. for 1 minute in a Perkin-Elmer
9600 thermocycler).
[0382] The 3' probe was approximately 900 bases long and spanned a
region from nucleotides 2752 to 3651 (in SEQ ID NO:1) (5'
.fwdarw.3' ) and was produced with primers 11.b-1/2FOR11 and
11.b-1/2REV2 as shown in SEQ ID NOS:69 and 74, respectively. This
probe was used in a first set of lifts.
[0383] The 5' probe was approximately 800 bases long and spanned a
region from nucleotides 149 to 946 (in SEQ ID NO:1) (5' .fwdarw.3')
and was produced with primers 11.b-1/2FOR1 and 11.a-1/1REV1 as
shown in SEQ ID NOS:50 and 85, respectively). This probe was used
in a second set of lifts.
[0384] In a third set of lifts, both probes described above were
used together on the same plates.
[0385] Approximately 500,000 plaques were screened using the two
probes from above which were labeled in the same way as described
in Example 20. Labeled probes were added to a prehybridization
solution, containing 45% formamide, and incubated overnight at
50.degree. C. Filters were washed twice in 2.times.SSC/0.1% SDS at
room temperature (22.degree. C.). A final wash was carried out in
2.times.SSC/0.1% SDS at 50.degree. C. Autoradiography was for 19
hours at -80.degree. C. on Kodak X-Omat AR film with an
intensifying screen.
[0386] Thirteen plaques giving positive signals on at least
duplicate lifts were subjected to a secondary screen performed as
described for the initial screen except that both the 3' and 5'
labeled probes were used for hybridization and an additional final
wash was incorporated using 2.times.SSC/0.1% SDS at 65.degree. C.
Autoradiography was performed as described above for 2.5 hours.
[0387] Thirteen plaques (designated MS2P1 through MS2P13) giving
positive signals were transferred into low Mg.sup.++ phage diluent.
Insert size was determined by PCR amplification (Perkin-Elmer 9600
thermocycler) using T3 and T7 primers which anneal to
Bluescript.RTM. phagemid in ZAP.RTM. II (sequence previously
described) under the same conditions shown above. Band sizes ranged
from 500 bases to 4Kb. Phagemids were isolated, prepared, and
sequenced with M13 and M13 reverse. 1 primers (SEQ ID NOS:40 and
41, respectively). Five of the thirteen clones; MS2P-3, MS2P-6,
MS2P-9, MS2P-12, and MS2P-13, were sequenced, and together,
represented a region from approximately base 200 at the 5 ' end to
about 300 bases past a first stop codon at the 3' end.
[0388] Automated sequencing was performed as described in Example 4
by first using M13 and M13 reverse.1 primers (SEQ ID NOS:40 and 41,
respectively) to sequence the ends of each clone and to determine
its position relative to construct #17 (SEQ ID NO:45). Each clone
was then completely sequenced using the appropriate primers (listed
below) for that particular region.
20 11.b-1/2FOR1 5'-GCAGCCAGCTTCGGACAGAC-3' (SEQ ID NO:50)
11.a-1/1FOR2 5'-CCGCCTGCCACTGGCGTGTGC-3' (SEQ ID NO:60)
11.a-1/1FOR3 5'-CCCAGATGAAGGACTTCGTCAA-3' (SEQ ID NO:61)
11.b-1/2FOR4 5'-GCTGGGATCATTCGCTATGC-3' (SEQ ID NO:62) 11.b-1/2FOR5
5'-CAATGGATGGACCAGTTCTGG-3' (SEQ ID NO:63) 11.b-1/2FOR6
5'-CAGATCGGCTCCTACTTTGG-3' (SEQ ID NO:64) 11.b-1/2FOR7
5'-CATGGAGCCTCGAGACAGG-3' (SEQ ID NO:65) 11.b-1/2FOR8
5'-CCACTGTCCTCGAAGCTGGAG-3' (SEQ ID NO:66) 11.b-1/2FOR9
5'-CTTCGTCCTGTGCTGGCTGTGGGCTC-3 (SEQ ID NO:67) 11.b-1/2FOR10
5'-CGCCTGGCATGTGAGGCTGAG-3' (SEQ ID NO:68) 11.b-1/2FOR11
5'-CCGTGATCAGTAGGCAGGAAG-3' (SEQ ID NO:69) 11.b-1/2FOR12
5'-GTCACAGAGGGAACCTCC-3' (SEQ ID NO:70) 11.b-1/2FOR13
5'-GCTCCTGAGTGAGGCTGAAATCA-3' (SEQ ID NO:71) 11.b-1/2FOR14
5'-GAGATGCTGGATCTACCATCTGC-3' (SEQ ID NO:72) 11.b-1/2FOR15
5'-CTGAGCTGGGAGATTTTTATGG-3' (SEQ ID NO:73) 11.b-1/2REV2
5'-GTGGATCAGCACTGAAATCTG-3' (SEQ ID NO:74) 11.b-1/2REV3
5'-CGTTTGAAGAAGCCAAGCTTG-3' (SEQ ID NO:75) 11.b-1/2REV4
5'-CACAGCGGAGGTGCAGGCAG-3' (SEQ ID NO:76) 11.b-1/2REV5
5'-CTCACTGCTTGCGCTGGC-3' (SEQ ID NO:77) 11.b-1/2REV6
5'-CGGTAAGATAGCTCTGCTGG-3' (SEQ ID NO:78) 11.b-1/2REV7
5'-GAGCCCACAGCCAGCACAGG-3' (SEQ ID NO:79) 11.b-1/2REV8
5'-GATCCAACGCCAGATCATACC-3' (SEQ ID NO:80) 11.b-1/2REV9
5'-CACGGCCAGGTCCACCAGGC-3' (SEQ ID NO:81) 11.b-1/2REV10
5'-CACGTCCCCTAGCACTGTCAG-3' (SEQ ID NO:82) 11.b-1/2REV11
5'-CCATGTCCACAGAACAGAGAG-3' (SEQ ID NO:51) 11.b-1/2RRV12
5'-TTGACGAAGTCCTTCATCTGGG-3' (SEQ ID NO:83) 11.b-1/2REV13
5'-GAACTGCAAGCTGGAGCCCAG-3' (SEQ ID NO:84) 11.a-1/1REV1
5'-CTGGATGCTGCGAAGTGCTAC-3' (SEQ ID NO:85) 11.a-1/1REV2
5'-GCCTTGGAGCTGGACGATGGC-3' (SEQ ID NO:86)
[0389] Sequences were edited, aligned, and compared to a previously
isolated mouse .alpha..sub.d sequence (construct #17, SEQ ID
NO:45).
[0390] Alignment of the new sequences revealed an 18 base deletion
in construct #17 beginning at nucleotide 2308; the deletion did not
cause a shift in the reading frame. Clone MS2P-9, sequenced as
described above, also revealed the same 18 base deletion. The
deletion has been observed to occur in 50% of mouse clones that
include the region but has not been detected in rat or human
.alpha..sub.d clones. The eighteen base deletion is characterized
by a 12 base palindromic sequence AAGCAGGAGCTCCTGTGT (SEQ ID
NO:91). This inverted repeat in the nucleic acid sequence is
self-complementary and may form a loop out, causing cleavage during
reverse transcription. The mouse .alpha..sub.d sequence which
includes the additional 18 bases is set forth in SEQ ID NO:52; the
deduced amino acid sequence is set forth in SEQ ID NO:53.
EXAMPLE 30
In situ Hybridizations in Mouse
[0391] Tissue distribution was then determined for mouse
.alpha..sub.d in order to provide a comparison to that in humans,
described in Example 6.
[0392] A single stranded 200 bp mRNA probe was generated from a DNA
template, corresponding to nucleotides 3460 to 3707 in the
cytoplasmic tail region of the murine cDNA, by in vitro RNA
transcription incorporating .sup.35S-UTP (Amersham).
[0393] Whole mouse embryos (harvested at days 11-18 after
fertilization) and various mouse tissues, including spleen, kidney,
liver, intestine, and thymus, were hybridized in situ with the
radiolabeled single-stranded mRNA probe.
[0394] Tissues were sectioned at 6 .mu.m thickness, adhered to
Vectabond (Vector Laboratories, Inc., Burlingame, Calif.) coated
slides, and stored at -70.degree. C. Prior to use, slides were
removed from -70.degree. C. and placed at 50.degree. C. for
approximately 5 minutes. Sections were fixed in 4% paraformaldehyde
for 20 minutes at 4.degree. C., dehydrated with an increasing
ethanol gradient (70-95-100%) for 1 minute at 4.degree. C. at each
concentration, and air dried for 30 minutes at room temperature.
Sections were denatured for 2 minutes at 70.degree. C. in 70%
formamide/2.times.SSC, rinsed twice in 2.times.SSC, dehydrated with
the ethanol gradient described supra and air dried for 30 minutes.
Hybridization was carried out overnight (12-16 hours) at 55.degree.
C. in a solution containing .sup.35S-labeled riboprobes at
6.times.10.sup.5 cpm/section and diethylpyrocarbonate
(DEPC)-treated water to give a final concentration of 50%
formamide, 0.3 M NaCl, 20 mM Tris-HCl, pH 7.5, 10% dextran sulfate,
1.times.Denhardt's solution, 100 mM dithiothreitol (DTT) and 5 mM
EDTA. After hybridization, sections were washed for 1 hour at room
temperature in 4.times.SSC10 mM DTT, 40 minutes at 60.degree. C. in
50% formamide/2.times.SSC/10 mM DTT, 30 minutes at room temperature
in 2.times.SSC, and 30 minutes at room temperature in
0.1.times.SSC. The sections were dehydrated, air dried for 2 hours,
coated with Kodak NTB2 photographic emulsion, air dried for 2
hours, developed (after storage at 4.degree. C. in complete
darkness) and counterstained with hematoxylin/eosin.
[0395] Spleen tissue showed a strong signal primarily in the red
pulp. This pattern is consistent with that of tissue macrophage
distribution in the spleen, but does not exclude other cell
types.
EXAMPLE 31
Generation of Mouse Expression Constructs
[0396] In order to construct an expression plasmid including mouse
cDNA sequences exhibiting homology to human .alpha..sub.d, inserts
from clones A1160 and B3800 were ligated. Prior to this ligation,
however, a 5' leader sequence, including an initiating methionine,
was added to clone A1160. A primer designated "5' PCR leader" (SEQ
ID NO:47) was designed to contain: (1) identical nonspecific bases
at positions 1-6 allowing for digestion; (2) a BamHII site
(underlined in SEQ ID NO:47) from positions 7-12 to facilitate
subcloning into an expression vector; (3) a consensus Kozak
sequence from positions 13-18, (4) a signal sequence including a
codon for an initiating methionine (bold in SEQ ID NO:47), and (5)
an additional 31 bases of specifically overlapping 5' sequence from
clone A1160 to allow primer annealing. A second primer designated
"3' end frag" (SEQ ID NO:48) was used with primer "5' PCR leader"
to amplify the insert from clone A1160.
21 5'-AGTTACGGATCCGGCACCATGACCTTCGGC (SEQ ID NO: 47)
ACTGTGATCCTCCTGTGTG-3' 5'-GCTGGACGATGGCATCCAC-3' (SEQ ID NO:
48)
[0397] The resulting PCR product did not digest with BamHII,
suggesting that an insufficient number of bases preceded the
restriction site, prohibiting recognition by the enzyme. The length
of the "tail" sequence preceding the BamHII site in the 5' primer
(SEQ ID NO:47) was increased and PCR was repeated on the
amplification product from the first PCR. A 5' primer, designated
mAD.5'.2 (SEQ ID NO:49), was designed with additional nonspecific
bases at positions 1-4 and an additional 20 bases specifically
overlapping the previously employed "5' PCR leader" primer
sequences.
22 5'-GTAGAGTTACGGATCCGGCACCAT-3' (SEQ ID NO: 49)
[0398] Primers "mAD.5'.2" and "3' end frag" were used together in
PCR with the product from the fist amplification as template. A
resulting secondary PCR product was subcloned into plasmid pCRtmII
(Invitrogen) according to manufacturer's suggested protocol and
transformed into competent One shot cells (Invitrogen). One clone
containing the PCR product was identified by restriction enzyme
analysis using BamHI and EcoRI and sequenced. After the sequence
was verified, the insert was isolated by digestion with BamHII and
EcoRI and gel purified.
[0399] The insert from clone B3800 was isolated by digestion with
EcoRI and NotI, gel purified, and added to a ligation reaction
which included the augmented A1160 BamHII/EcoRI fragment. Ligation
was allowed to proceed for 14 hours at 14.degree. C. Vector pcDNA.3
(Invitrogen), digested with BamHI and NotI, was added to the
ligation reaction with additional ligase and the reaction was
continued for another 12 hours. An aliquot of the reaction mixture
was transformed into competent E. coli cells, the resulting
colonies cultured, and one positive clone identified by PCR
analysis with the primers 11.b-1/2FOR1 and 11.b-1/2REV11 (SEQ ID
NOS:50 and 51, respectively). These primers bridge the A1160 and
B3800 fragments, therefore detection of an amplification product
indicates the two fragments were ligated. The sequence of the
positive clone was verified with the primers set out in SEQ ID
NOS:50 and 51, which amplify from base 100 to 1405 after the
initiating methionine.
EXAMPLE 32
Construction of a Knock-out Mouse
[0400] In order to more accurately assess the immunological role of
the protein encoded by the putative mouse .alpha..sub.d cDNA, a
"knock-out" mouse is designed wherein the genomic DNA sequence
encoding the putative .alpha..sub.d homolog is disrupted by
homologous recombination. The significance of the protein encoded
by the disrupted gene is thereby assessed by the absence of the
encoded protein. Generation of "knock-out" mice is described in
Deng, et al. Mol. Cell. Biol. 13:2134-2140 (1993).
[0401] Design of such a mouse begins with construction of a plasmid
containing sequences to be "knocked out" by homologous
recombination events. A 750 base pair fragment of the mouse cDNA
(corresponding to nucleotides 1985 to 2733 in SEQ ID NO:45) was
used to identify a mouse genomic sequence encoding the putative
mouse .alpha..sub.d homolog from a .lambda.FIXII genomic library.
Primary screening resulted in 14 positive plaques, seven of which
were confirmed by secondary screening. Liquid lysates were obtained
from two of the plaques giving the strongest signal and the
.lambda. DNA was isolated by conventional methods. Restriction
mapping and Southern analysis confirmed the authenticity of one
clone, designated 14-1, and the insert DNA was isolated by
digestion with NotI. This fragment was cloned into Bluescript.RTM.
SKII.sup.+.
[0402] In order to identify a restriction fragment of approximately
9 to 14 kb, a length reported to optimize the probability of
homologous recombination events, Southern hybridization was
performed with the 750 bp cDNA probe. Prior to hybridization, a
restriction map was constructed for clone 14-1. A 12 kb fragment
was identified as a possible candidate and this fragment was
subcloned into pBluescript.RTM. SKII.sup.+ in a position wherein
the mouse DNA is flanked by thymidine kinase encoding cassettes.
Further analysis of this clone with an I domain probe
(corresponding to nucleotides 454-1064 in SEQ ID NO:45) indicated
that the clone did not contain I domain encoding sequences.
[0403] Using the same I domain probe, the .lambda.FIXII genomic
library was rescreened. Initially, six positive clones were
detected, one of which remained positive upon secondary screening.
DNA isolated from this clone reacted strongly in Southern analysis
with an I domain probe. No reactivity was detected using the
original 750 bp probe, however, indicating that this clone included
regions 5' to nucleotides 1985-2773 of SEQ ID NO:45.
[0404] Alternatively, the lack of hybridization to the 750 bp probe
may have suggested that the clone was another member of the
integrin family pf proteins. To determine if this explanation was
plausible, the 13 kb insert was subcloned into pBluescript.RTM.
SKII.sup.+. Purified DNA was sequenced using primers corresponding
to .alpha..sub.d I domain nucleic acid sequences 441-461,-591-612,
717-739, and reverse 898-918 in SEQ ID NO:52. Sequence information
was obtained using only the first 4441-4461 primer, and only the 5'
-most exon of the I domain was efficiently amplified. The remainder
of the I domain was not amplified. The resulting clone therefore
comprised exon 6 of the mouse .alpha..sub.d gene, and intronic
sequences to the 3' and 5' end of the exon. Exon 7 was not
represented in the clone. After sequencing, a construct is
generated containing neomycin resistance and thymidine kinase
genes.
[0405] The neomycin resistance (neo.sup.r ) gene is inserted into
the resulting plasmid in a manner that interrupts the protein
coding sequence of the genomic mouse DNA. The resulting plasmid
therefore contains a neor gene within the mouse genomic DNA
sequences, all of which are positioned within a thymidine kinase
encoding region. Plasmid construction in this manner is required to
favor homologous recombination over random recombination [Chisaka,
et al., Nature 355:516-520 (1992)].
[0406] An alternative strategy was used to generate constructs
useful for production of .alpha..sub.d knock out mice. Two sets of
oligonucleotide primers were submitted to Genome Systems, Inc. (St.
Louis, Mo.) for high stringency PCR analysis of a large-insert
library made from genomic DNA of embryonic stem cells. The primers
corresponded to the first and last exons of the I domain in
.alpha..sub.d. Three clones were identified, two of which,
designated 1117 and 1118, were reactive with both primers and one,
designated 1119, which only the primers from the last exon could
amplify.
Identification of a Mouse Genomic .alpha..sub.d DNA
[0407] Plasmid DNA was prepared from bacterial lysates of clones
1117 and 1118 according to manufacturer's instructions (Genome
Systems, Inc.) The .alpha..sub.d inserts were verified by PCR using
the oligonucleotides madk.f1 (SEQ ID NO:104) and madk.r1 (SEQ ID
NO:105) and madk.r2 (SEQ ID NO:106).
23 madk.f1 TGT CCA GGA CAA GAG ATG GAC ATT GC SEQ ID NO: 104
madk.r1 GAG CTA TTT CAT AGC AAG AAT GGG SEQ ID NO: 105 madk.r2 TAT
AGC ATA GCG AAT GAT CC SEQ ID NO: 106
[0408] Aliquots of both plasmids were digested with restriction
enzymes BamHI, PstI, SacI, SalI, SmaI, xbaI, and XhoI (Boehringer
Mannheim). Each digest sample was resolved on 0.8% agarose gel and
the polynucleotides transferred onto Hybond.RTM.-N.sup.+ nucleic
acid transfer membrane (Amersham) for analysis. The blot was probed
with .sup.32P-random primed DNA generated using a 1.6 kb template
obtained by PCR using oligos madfor 1 (SEQ ID NO:107 ) and madrev 1
(SEQ ID NO:108).
24 madfor 1 ATG GTC CGT GGA GTT GTG ATC SEQ ID NO: 107 madrev 1 TCG
AGA TCC ACC AAA CTG CAC SEQ ID NO: 108
[0409] Hybridization was carried out at 42.degree. C. overnight in
SSPE buffer with 50% formamide. The labeled blot was washed five
times in 2.times.SSPE at room temperature. Radiolabeled bands were
visualized by exposure of the blot to Kodak X-Omat autoradiography
film at -70.degree. C. for two hours.
[0410] Two fragments of interest were identified from clone 1118: a
SacI fragment of 4.1 kb and an XbaI fragment of 8.3 kb. The entire
sample contents from the SacI and XbaI digests of clone 1118 were
ligated into the vector pBluescriptR KS.sup.+ without further
purification, and following ligation, the entire reaction contents
were transformed into calcium-competent preparations of the E. coli
strain TG1/lambda SmR. Resulting colonies were isolated and
cultured overnight in 200 .mu.l selective medium containing M13KO7
helper virus to replicate single stranded DNA. A 10 .mu.l aliquot
of supernatant from each well was then blotted onto
Hybond.RTM.-N.sup.+ transfer membrane and hybridized with the same
probe and protocol as described above. Cultures were expanded from
nine positive clones and plasmid DNA was isolated from each culture
using a Wizard.RTM. Plus Miniprep DNA Purification System
(Promega). Restriction digests and PCR were used to confirm
presence and size of inserts in the isolated plasmids.
[0411] Three clones were subjected to sequence analysis using the
vector primers T3 and T7 and oligonucleotide primers corresponding
to murine .alpha..sub.d sequences. Sequence comparison of these
three clones with the murine cDNA using Geneworks software
indicated that all three contained both exons 1 and 2 of murine
.alpha..sub.d. The longest clone, referred to as A, was an XbaI
clone of 8280 kb length, and the two shorter clones, referred to as
E and H, were identical SacI clones of 4112 kb length. The 8280 kb
XbaI clone was selected for further development.
EXAMPLE 33
Cloning of Rabbit .alpha..sub.d
Construction and Screening of the Rabbit cDNA Library
[0412] Identification of human .alpha..sub.d homologs in rats and
mice led to the investigation of the existence of a rabbit homolog
which would be useful in rabbit models of human disease states
described infra.
[0413] Poly A.sup.+ RNA was prepared from a whole rabbit spleen
using an Invitrogen FastTrack kit (San Diego, Calif.) according to
manufacturer's suggested protocol and reagents supplied with the
kit. From 1.65 g tissue, 73 .mu.g poly A.sup.+ RNA were isolated.
The rabbit spleen RNA was used to construct a ZAP.RTM. Express cDNA
library using a kit from Stratagene (La Jolla, Calif.). Resulting
cDNA was directionally cloned into EcoRI and XhoI sites in the
lambda arms of a pBK-CMV phagemid vector. Gigapack.RTM. II Gold
(Stratagene) was used to package the lambda arms into phage
particles. The resulting library titer was estimated to be
approximately 8.times.10.sup.5 particles, with an average insert
size of 1.2 kb.
[0414] The library was amplified once by plating for confluent
plaque growth and cell lysate was collected. The amplified library
was plated at approximately 30,000 plaque forming units (pfu) per
150 mm plate with E. coli and the resulting mixture incubated for
12-16 hrs at 37.degree. C. to allow plaque formation. Phage DNA was
transferred onto Hybond.RTM. N.sup.+ nylon membranes (Amersham,
Arlington Heights, Ill.). The membranes were hybridized with a
mixture of two random primed radiolabeled mouse .alpha..sub.d PCR
DNA probes. The first probe was generated from a PCR product
spanning nucleotides 149-946 in SEQ ID NO:52. The second probe was
from a PCR product spanning nucleotides 2752-3651 in SEQ ID NO:52.
Probes were labeled by random priming (Boehringer Mannheim Random
Primed DNA Labeling Kit) and the reaction mixture was passed over a
Sephadex.RTM. G-50 column to remove unincorporated nucleotides. The
hybridization solution was composed of 5.times.SSPE,
5.times.Denhardts, 1% SDS, 40% Formamide and the labeled probes at
1.times.10.sup.6 dpm/ml. Hybridization was carried out at
42.degree. C. for 16-18 hours. Filters were washed extensively in
2.times.SSPE/0.1% SDS at room temperature and exposed to X-ray film
to visualize any hybridizing plaques.
[0415] Two clones with significant sequence homology to human
.alpha..sub.d were identified. Clone #2 was approximately 800 bp in
length and mapped to the 5 ' end of human .alpha..sub.d. Clone #2
includes an initiating methionine and complete leader sequence.
Clone #7 was approximately 1.5 kb and includes an initiating
methionine. The 5' end of clone #7 overlapped that of clone #2,
while the 3' sequences terminated at a point beyond the I domain
sequences. Clone #7 was completely sequenced by the primer walking
method. The nucleotide and deduced amino acid sequences for clone
#7 are set out in SEQ ID NOs: 100 and 101, respectively.
[0416] The predicted N terminal amino acid sequence for rabbit
.alpha..sub.d as determined from clones #2 and #7 indicated a
protein with 73% identity with human ad, 65% identity with mouse
.alpha..sub.d, and 58% identity with mouse CD11b, human CD11b, and
human CD11c. The nucleic acid sequence for clone #2 is set out in
SEQ ID NO: 92; the predicted amino acid sequence is set out in SEQ
ID NO:93 Isolation of a full length rabbit .alpha..sub.d cDNA was
attempted using labeled rabbit clone # 7 and rescreening the cDNA
library from which the fragment was derived. Twenty-five additional
clones were identified with one, designated clone 49, determined to
be the largest. Clone 49 was completely sequenced using the nested
deletions technique. The nucleotide and amino acid sequences for
clone 49 are set out in SEQ ID NOs: 102 and 103, respectively.
Since clones #7 and #49 did not overlap, oligonucleotides were
designed to be used as primers in a PCR with first strand rabbit
spleen cDNA to isolate the missing sequence.
[0417] The relationship of the putative amino acid sequence of
these two partial clones with that of other leukointegrins is
described in Table 1.
25TABLE 1 Percent identity of .beta..sub.2 integrin family members
on the amino acid level. Human .alpha..sub.d Rabbit #7 Rabbit #49
Human .alpha..sub.d 100 74 80 Mouse .alpha..sub.d 70 67 74 Rat
.alpha..sub.d 70 66 73 Mouse CD11a random* 28 28 Mouse CD11b 55 59
53 Human CD11a 36 28 28 Human CD11b 60 58 55 Human CD11c 66 59 62
*If <25% identity, it is just random alignment and not
significant.
[0418] Isolation of a rabbit .alpha..sub.d clone allows expression
of the protein, either on the surface of transfectants or as a
soluble full length or truncated form. This protein is then used as
an immunogen for the production of monoclonal antibodies for use in
rabbit models of human disease states.
EXAMPLE 34
Isolation of Monkey .alpha..sub.d
Preparation of affinity columns
[0419] In order to prepare an affinity column resin to isolate
.alpha..sub.d from monkey spleen, 10 mg each of the anti-human
.alpha..sub.d antibodies 212D and 217L were dialyzed overnight
against coupling buffer containing 0.1 M NaHCO.sub.3, 0.5 M NaCl,
pH 8.3. Approximately 1.0 g of CNBr Sepharose.RTM. 4B (Pharmacia,
Piscataway N.J.) was prepared according to the manufacturer's
recommended protocol and 1.0 ml of the resin combined with each of
the dialyzed antibodies. The resulting slurry was mixed by rotation
overnight at 4.degree. C. and coupled resin obtained by
centrifugation for 5 minutes at 1000 rpm in a Beckman tabletop
centrifuge. The nonabsorbed supernatant fraction was collected and
assayed for the presence of uncoupled protein by spectrophotometer.
Results indicated that all available antibody had bound to the gel
matrix. Uncoupled active groups on the resins were blocked with 1 M
ethanolamine for 2 hours at room temperature and the resins washed
in a series of alternating high and low pH changes in Coupling
buffer followed by a final wash using acetate buffer containing 0.1
M NaC.sub.2H.sub.3O.sub.23H.sub.2O and 0.5 M NaCl, pH 4.0. Both
resins were stored at 4.degree. C. in Coupling buffer.
Preparation of Monkey Spleen
[0420] Female macaque spleens were obtained from the University of
Washington's Regional Primate Center. Spleen tissue was injected
with 100 U/ml collagenase D (Sigma) and minced into small pieces.
Tissue pieces were then suspended in a small volume of Lysis Buffer
containing 50 mM Tris, 150 mM NaCl, 2 mM CaCl.sub.2, 2 mM
MgCl.sub.2, pH 8.0, with 1.0% Triton-X100.RTM. detergent and stored
at -70.degree. C. Protease inhibitors PLA (a mixture of Pepstatin
A, leupeptin, and aprotinin, each from Sigma) and 4-(2-aminoethyl)
benzene sulfonyl fluoride-HCl (AEBSF) (Nova Biochem, La Jolla,
Calif.) were added to prevent proteolysis of protein during
storage. Tissue was stored until a total of six macaque spleens was
obtained.
[0421] Spleen tissue from the six monkeys was pooled and
homogenized in a Waring blender, three cycles of ten seconds each,
in TSA Lysis Buffer containing 25 mM Tris, 0.15 M NaCl, 0.02%
NaN.sub.3, 1.0% Triton.RTM., 1.times.PLA and 0.1 mM AEBSF. Lysate
was collected and placed on a rocking platform for one hour at
4.degree. C., and then centrifuged for 15 minutes at 3000 rpm in a
Beckman tabletop centrifuge. Supernatant was collected and the
pelleted cellular debris discarded. A total volume of 550 ml of
lysate was collected and precleared by incubating the lysate for 2
hours at 4.degree. C. with CNBr Sepharose previously treated in 1 M
ethanolamine in order to block reactive sites. Following
incubation, the resin was removed by centrifugation and the
supernatant collected.
Affinity Purification and Sequencing
[0422] The spleen lysate prepared as described above was divided in
half and combined individually with the 212D- and 217L-prepared
CNBr Sepharose.RTM. gels. The resulting slurries were mixed with
rotation for three days at 4.degree. C., after which the
nonabsorbed fraction was collected by centrifugation at 10 minutes
1500 rpm in a Beckman tabletop centrifuge and saved. The gels were
transferred to 15 ml centrifuge tubes and washed sequentially in
several volumes of D-PBS. Aliquots of approximately 100 .mu.l of
each gel were boiled briefly in reducing sample buffer containing
0.1 M Tris-HCl, pH 6.8, 2.0% SDS, 20% glycerol, 0.0002% bromophenol
blue, 10% .beta.-mercaptoethanol (final concentration 5%) and
loaded onto and proteins resolved using a 6.0% polyacrylamide SDS
gel (SDS-PAGE). The gel was Coomasie stained and proteins having
molecular weights consistent with .alpha..sub.d and CD18 were
detected along with a number of background proteins.
[0423] In an attempt to improve purification of the protein having
the molecular weight similar to .alpha..sub.d, two 100 .mu.l
aliquots of each gel with bound protein were washed by different
means. In one method, gels were washed several times in buffer
containing 150 mM NaCl, 10 mM Tris, 1.0% Triton-X100.RTM., pH 8.0,
and in a second method, gels were washed identically, but bound
protein was eluted in a final wash with 0.05 M glycine, pH 2.4. As
before, the eluted protein was boiled briefly in reducing sample
buffer and resolved on a 6.0% SDS-PAGE gel. Coomasie staining
detected only proteins consistent with .alpha..sub.d and CD18 from
the resin washed in low pH glycine buffer, thus this isolation
method was chosen. In order to isolate protein for sequencing, the
remaining CNBr Sepharose.RTM. resin was washed four times as
described above and approximately three quarters of the resin
suspended in 2.0 ml 0.05 M glycine, pH 2.4, and vortexed
vigorously. The resin was pelleted by centrifugation for 3 minutes
and the nonabsorbed fraction collected. The gel was then washed
once more in glycine buffer and this wash pooled with the previous
nonabsorbed fraction. The pooled fractions were dialyzed against
D-PBS overnight at 4.degree. C. with two changes. After dialysis,
the samples were dried down to reduce volumes to 1.0 ml.
[0424] For sequencing, the eluates were separated on 7.0% resolving
gels and proteins transferred to Immobilon (PVDF) membranes
(Millipore, Bedford Mass.) as described in Example 2. Briefly, the
gels were washed once in deionized water and equilibrated for 15 to
45 minutes in 10 mM cyclohexylamino-propanesulfoic acid buffer
(CAPS), pH 10.5, with 10% methanol. PVDF membranes were rinsed in
both methanol and distilled water, then equilibrated in CAPS
transfer buffer for 15 to 30 minutes. Proteins were transferred to
PVDF membranes for 3 hours at 70 volts after which they were
stained in filtered 0.1% R250 Coomasie stain for 10 minutes.
Membranes were washed to destained in 50% methanol/10% acetic acid
three times, 10 minutes each wash, washed once more in filtered
water, and dried.
[0425] Two predominant protein bands of approximately 150 kD and 95
kD were detected from both the 212D- and 217L-coupled resins which
were consistent with proteins detected on the previously run
analytical scale gels. A less distinct band was observed on the
membrane derived from 217L-coupled resin located directly beneath
the protein at 150 kD, but the band was not detected after the
membrane was dried. The 150 kD band from each membrane was excised
from the membrane and directly sequenced with an Applied BiQsystems
(Foster City, Calif.) Model 473A protein sequencer according to the
manufacturer's suggested method.
[0426] Results indicated that the amino terminal sequence of the
monkey protein isolated using 212D-coupled resin had the amino acid
sequence as set out in SEQ ID NO:109, and the amino terminus of the
protein isolated using 217L-coupled resin had the sequence shown in
SEQ ID NO:110. The "X" in SEQ ID NO:110 indicates an indeterminable
residue.
26 212D-Couple Protein NLDVEEPTIFQEDA SEQ ID NO: 109 217L-Coupled
Protein NLDVEEPTIFXEDA SEQ ID NO: 110
[0427] A comparison of the monkey sequences with the amino terminal
sequences of human .alpha..sub.d and other .alpha. chains in the
.beta..sub.2 integrin family is shown in Table 2.
27TABLE 2 Comparison of Monkey .alpha..sub.d Amino Terminal
Sequence With Human .beta..sub.2 a Subunits SEQ ID PROTEIN NO:
AMINO TERMINAL SEQUENCE Monkey .alpha..sub.D 111 F N L D V E E P T
I F Q E D A Human .alpha..sub.D 112 F N L D V E E P T I F Q E D A G
G Human CD11c 113 F N L D T E E L T A F V D S A G Human CD11b 114 F
N L D T E N A M T F Q E N A R G
[0428] Based on the sequence identify, it can be concluded that
both 212D and 217L recognize .alpha..sub.d in both macaque and
human.
EXAMPLE 35
Characterization of 217L Antigen
[0429] Based on the N-terminal sequence of protein precipitated
from monkey spleen in the previous example, it can be concluded
that antibodies 217L and 212D recognize .alpha..sub.d protein in
both monkey and human. Immunocytochemical (ICC) analysis and
immunoprecipitation experiments, however, indicate that 217L has
additional reactivity unshared by 212D. FACS and ICC experiments
using antibodies to all .alpha. chains ruled out cross-reactivity
of 217L with CD11c, the most closely related leukointegrin .alpha.
chain, and CD11b. Therefore, it may be that the 217L antibody also
recognizes either a conformational, glycosylation, or splice
variant of .alpha..sub.d or a novel .alpha. chain which shares
sequence homology with .alpha..sub.d.
[0430] The unique distribution of the antigen recognized by
antibody 217L in sarcoid lung tissue (see Example 18), with a
non-overlapping staining pattern in relationship to CD11c, suggests
that the antigen may have biological significance. Therefore, in
order to more fully understand the significance of the 217L
antigen, analysis of the protein and underlying DNA encoding the
protein are required and various approaches are contemplated.
[0431] Immunoprecipitation of a protein complex from human
dendritic cells or peripheral blood is carried out using the
antibody 217L, followed by N-terminal sequence of the precipitated
proteins. Sequence analysis will reveal whether the protein
recognized on peripheral blood cells shares amino terminal identity
with .alpha..sub.d. The protein precipitated from dendritic cells
or peripheral blood cells is then treated with deglycosylating
enzymes and compared to CD11c and .alpha..sub.d precipitated from
other sources to provide a comparison of molecular weight of the
primary amino acid sequence.
[0432] Additionally, a cDNA library generated from dendritic cell
RNA is probed with the entire .alpha..sub.d cDNA under low
stringency. Reactive clones are analyzed by nucleic acid sequencing
over the entire length of the clone in order to determine if
non-.alpha..sub.d sequences exist in the clones.
EXAMPLE 36
Animal Models For Determining .alpha..sub.d Therapeutic Utility
[0433] Immunohistologic data in dog and in situ hybridization in
rats and mice has determined that in spleen .alpha..sub.d is
expressed primarily by macrophages present in red pulp and in lymph
nodes, .alpha..sub.d is found in medullary cords and sinuses. The
expression pattern is remarkably similar to what has been reported
for two murine antigens defined by the monoclonal antibodies F4/80
and SK39. While biochemical characterization of these murine
antigens has demonstrated that they are distinct from
.alpha..sub.d, it is highly probably that .alpha..sub.d defines the
same macrophage subset as the murine F4/80 and SK39 antigens.
[0434] In mouse, SK39-positive macrophages have been identified in
splenic red pulp where they may participate in the clearance of
foreign materials from circulation, and in medulla of lymph nodes
[Jutila, et al., J. Leukocyte Biol. 54:30-39 (1993)]. SK39-positive
macrophages have also been reported at sites of both acute and
chronic inflammation. Furthermore, monocytes recruited to
thioglycolate-inflamed peritoneal cavities also express the SK39
antigen. Collectively, these findings suggest that, if SK39.sup.+
cells are also .alpha..sub.d.sup.+, then these cells are
responsible for the clearance of foreign materials in the spleen
and participate in inflammation where macrophages play a
significant role.
[0435] While the function of .alpha..sub.d remains unclear, other
more well characterized .beta..sub.2 integrins have been shown to
participate in a wide variety of adhesion events that facilitate
cell migration, enhance phagocytosis, and promote cell-cell
interactions, events which all lead to upregulation of inflammatory
processes. Therefore, it is highly plausible that interfering with
the normal .alpha..sub.d function may also interfere with
inflammation where macrophages play a significant role. Such an
anti-inflammatory effect could result from: i) blocking macrophage
recruitment to sites of inflammation, ii) preventing macrophage
activation at the site of inflammation or iii) interfering with
macrophage effector functions which damage normal host tissue
through either specific autoimmune responses or as a result of
bystander cell damage.
[0436] Disease states in which there is evidence of macrophages
playing a significant role in the disease process include multiple
sclerosis, arthritis, graft atherosclerosis, some forms of diabetes
and inflammatory bowel disease. Animal models, discussed below,
have been shown to reproduce many of the aspects of these human
disorders. Inhibitors of .alpha..sub.d function are tested in these
model systems to determine if the potential exists for treating the
corresponding human diseases.
Graft Arteriosclerosis
[0437] Cardiac transplantation is now the accepted form of
therapeutic intervention for some types of end-state heart disease.
As the use of cyclosporin A has increased one year survival rates
to 80%, the development of progressive graft arteriosclerosis has
emerged as the leading cause of death in cardiac transplants
surviving beyond the first year. Recent studies have found that the
incidence of significant graft arteriosclerosis 3 years following a
cardiac transplant is in the range of 36-44% [Adams, et al.,
Transplantation 53:1115-1119 (1992); Adams, et al., Transplantation
56:794-799 (1993)].
[0438] Graft arteriosclerosis typically consists of diffuse,
occlusive, intimal lesions which affect the entire coronary vessel
wall, and are often accompanied by lipid deposition. While the
pathogenesis of graft arteriosclerosis remains unknown, it is
presumably linked to histocompatibility differences between donor
and recipient, and is immunologic in nature. Histologically, the
areas of intimal thickening are composed primarily of macrophages,
although T cells are occasionally seen. It is therefore possible
that macrophages expressing .alpha..sub.d may play a significant
role in the induction and/or development of graft arteriosclerosis.
In such a case, monoclonal antibodies or small molecule inhibitors
(for example, soluble ICAM-R) of .alpha..sub.d function could be
given prophylactically to individuals who received heart
transplants and are at risk of developing graft
arteriosclerosis.
[0439] Although atherosclerosis in heart transplants presents the
greatest threat to life, graft arteriosclerosis is also seen in
other solid organ transplants, including kidneys and livers.
Therapeutic use of .alpha..sub.d blocking agents could prevent
graft arteriosclerosis in other organ transplants and reduce
complications resulting from graft failure.
[0440] One model for graft arteriosclerosis in the rat involves
heterotopic cardiac allografts transplanted across minor
histocompatibility barriers. When Lewis cardiac allografts are
transplanted into MHC class I and II compatible F-344 recipients,
80% of the allografts survive at least 3 weeks, while 25% of the
grafts survive indefinitely. During this low-grade graft rejection,
arteriosclerosis lesions form in the donor heart. Arterial lesions
in 120 day old allografts typically have diffuse fibrotic intimal
thickening indistinguishable in appearance from graft
arteriosclerosis lesions found in rejecting human cardiac
allografts.
[0441] Rats are transplanted with hearts mismatched at minor
histocompatibility antigens, for example Lewis into F-344.
Monoclonal antibodies specific for rat .alpha..sub.d or small
molecule inhibitors of .alpha..sub.d are given periodically to
transplant recipients. Treatment is expected to reduce the
incidence of graft arteriosclerosis in non-rejecting donor hearts.
Treatment of rats with .alpha..sub.d monoclonal antibodies or small
molecule inhibitors may not be limited to prophylactic treatments.
Blocking .alpha..sub.d function is also be expected to reduce
macrophage mediated inflammation and allow reversal of arterial
damage in the graft.
Atherosclerosis in Rabbits Fed Cholesterol
[0442] Rabbits fed an atherogenic diet containing a cholesterol
supplement for approximately 12-16 weeks develop intimal lesions
that cover most of the lumenal surface of the ascending aorta
[Rosenfeld, et al., Arteriosclerosis 7:9-23 (1987); Rosenfeld, et
al., Arteriosclerosis 7:24-34 (1987)]. The atherosclerotic lesions
seen in these rabbits are simmer to those in humans. Lesions
contain large numbers of T cells, most of which express CD45RO, a
marker associated with memory T cells. Approximately half of the
infiltrating T cells also express MHC class II antigen and some
express the IL-2 receptor suggesting that many of the cells are in
an activated state.
[0443] One feature of the atherosclerotic lesions found in
cholesterol fed rabbits, but apparently absent in rodent models, is
the accumulation of foam cell-rich lesions. Foam cell macrophages
are believed to result from the uptake of oxidized low-density
lipoprotein (LDL) by specific receptors. Oxidized LDL particles
have been found to be toxic for some cell types including
endothelial cells and smooth muscle cells. The uptake of
potentially toxic, oxidized LDL particles by macrophages serves as
an irritant and drives macrophage activation, contributing to the
inflammation associated with atherosclerotic lesions.
[0444] Once monoclonal antibodies have been generated to rabbit
.alpha..sub.d, cholesterol fed rabbits are treated. Treatments
include prophylactic administration of .alpha..sub.d monoclonal
antibodies or small molecule inhibitors, to demonstrate that
.alpha..sub.d.sup.+ macrophages are involved in the disease
process. Additional studies would demonstrate that monoclonal
antibodies to .alpha..sub.d or small molecule inhibitors are
capable of reversing vessel damage detected in rabbits fed an
atherogenic diet.
Insulin-dependent Diabetes
[0445] BB rats spontaneously develop insulin-dependent diabetes at
70-150 days of age. Using immunohistochemistry, MHC class II.sup.+,
ED1.sup.+ macrophages can be detected infiltrating the islets early
in the disease. Many of the macrophages appear to be engaged in
phagocytosis of cell debris or normal cells. As the disease
progresses, larger numbers of macrophages are found infiltrating
the islets, although significant numbers of T cells, and later B
cells, also appear to be recruited to the site [Hanenberg, et al.,
Diabetologia 32:126-134 (1989)].
[0446] Development of diabetes in BB rats appears to depend on both
early macrophage infiltration and subsequent T cells recruitment.
Treatment of BB rats with silica particles, which are toxic to
macrophages, has been effective in blocking the early macrophage
infiltration of the islets. In the absence of early macrophage
infiltration, subsequent tissue damage by an autoaggressive
lymphocyte population fails to occur. Administration of monoclonal
antibody OX-19 (specific for rat CDS) or monoclonal antibody OX-8
(specific for rat CD8), which block the T cell-associated phase of
the disease, is also effective in suppressing the development of
diabetes.
[0447] The central role of macrophages in the pathology of this
model makes it attractive for testing inhibitors of .alpha..sub.d
function. Rats genetically predisposed to the development of
insulin-dependent diabetes are treated with monoclonal antibodies
to .alpha..sub.d or small molecule inhibitors and evaluated for the
development of the disease. Preventing or delaying clinical onset
is evidence that .alpha..sub.d plays a pivotal role in macrophage
damage to the islet cells.
Inflammatory Bowel Disease (Crohn's Disease, Ulcerative
Colitis)
[0448] Animal models used in the study of inflammatory bowel
disease (IBD) are generally elicited by intrarectal administration
of noxious irritants (e.g. acetic acid or trinitrobenzene sulfonic
acid/ethanol). Colonic inflammation induced by these agents is the
result of chemical or metabolic injury and lacks the chronic and
spontaneously relapsing inflammation associated with human IBD.
However, a recently described model using subserosal injections of
purified peptidoglycan-polysaccharid- e (PG-PS) polymers from
either group A or group D streptococci appears to be a more
physiologically relevant model for human IBD [Yamada, et al.,
Gastroenterology 104:759-771 (1993)].
[0449] In this model PG-PS is injected into the subserosal layer of
the distal colon. The resulting inflammatory response is biphasic
with an initial acute episode three days after injection, which is
followed by a spontaneous chronic phase three to four weeks later.
The late phase response is granulomatous in nature, and results in
colonic thickening, adhesions, colonic nodules and mucosal lesions.
In addition to mucosal injury, PG-PS colitis frequently leads to
arthritis anemia and granulomatous hepatitis. The extraintestinal
manifestations of the disease make the model attractive for
studying Crohn's colitis in that a significant number of patients
with active Crohn's disease suffer from arthritic joint disease and
hepatobillary inflammation.
[0450] Granulomatous lesions are the result of chronic inflammation
which leads to the recruitment and subsequent activation of cells
of the monocyte/macrophage lineage. Presence of granulomatous
lesions in Crohn's disease and the above animal model make this an
attractive clinical target for .alpha..sub.d monoclonal antibodies
or other inhibitors of .alpha..sub.d function. Inhibitors of
.alpha..sub.d function are expected to block the formation of
lesions associated with IBD or even reverse tissue damage seen in
the disease.
Arthritis
[0451] Arthritis appears to be a multi-factorial disease process
involving a variety of inflammatory cell types including
neutrophils, T lymphocytes and phagocytic macrophages. Although a
variety of arthritis models exist, preparations of streptococcal
cell wall proteoglycan produce a disorder most similar to the human
disease.
[0452] In rats, streptococcal cell wall induces inflammation of
peripheral joints characterized by repeated episodes of disease
progression followed by remission and eventually resulting in joint
destruction over a period of several months [Cromartie, et al.,
J.Exp.Med. 146:1585-1602 (1977); Schwab et al., Infection and
Immunity 59:4436-4442 (1991)]. During the chronic phase of the
disease, mononuclear phagocytes or macrophages are believed to play
a major role in destruction of the synovium. Furthermore, agents
which suppress the recruitment of macrophages into the synovium
effectively reduce the inflammation and pathology characteristic of
arthritis.
[0453] A central role for the macrophage in synovium destruction
that leads to arthritis predicts that monoclonal antibodies to
.alpha..sub.d or inhibitors of .alpha..sub.d function may have
therapeutic potential in the treatment of this disease. As in other
models previously described, .alpha..sub.d monoclonal antibodies or
small molecule inhibitors administered prophylactically are
expected to block or moderate joint inflammation and prevent
destruction of the synovium. Agents that interfere with
.alpha..sub.d function may also moderate ongoing inflammation by
preventing the recruitment of additional macrophages to the joint
or blocking macrophage activation. The net result would be to
reverse ongoing destruction of the joint and facilitate tissue
repair.
Multiple Sclerosis
[0454] Although pathogenesis of multiple sclerosis (MS) remains
unclear, it is generally accepted that the disease is mediated by
CD4.sup.+ T cells which recognize autoantigens in the central
nervous system and initiate an inflammatory cascade. The resulting
immune response results in the recruitment of additional
inflammatory cells, including activated macrophages which
contribute to the disease. Experimental autoimmune
encephalomyelitis (EAE) is an animal model which reproduces some
aspects of MS. Recently, monoclonal antibodies reactive with
CD11b/CD18 [Huitinga, et al., Eur. J. Immunol. 23:709-715 (1993)]
present on inflammatory macrophages have been shown to block both
clinical and histologic disease. The results suggest that
monoclonal antibodies or small molecule inhibitors to .alpha..sub.d
are likely to be effective in blocking the inflammatory response in
EAE. Such agents also have important therapeutic applications in
the treatment of MS.
Immune Complex Alveolitis
[0455] Alveolar macrophages located in the alveolar ducts, airways,
connective tissue, and pleural spaces of the lung represent the
lung's first line of defense against inhaled environmental agents.
In response to stimulation by agents, including bacterial-derived
LPS, IFN-.gamma. and immune complexes, alveolar macrophages release
a variety of potent inflammatory mediators, including highly
reactive oxygen radicals and nitrogen intermediates. While
superoxide anions, hydrogen peroxide and nitric oxide (NO.cndot.)
have important functions in eradicating pathogens and lysing tumor
targets, these agents can have injurious effects on normal
tissues.
[0456] In a rat model of immune complex alveolitis, NO.cndot.
release from alveolar macrophages has been shown to mediate much of
the lung damage [Mulligan, et al., Proc.Natl.Acad.Sci. (USA)
88:638-6342 (1991)]. NO.cndot. has also been implicated as a
mediator in other immune complex mediated injuries including dermal
vasculitis [Mulligan, et al., supra] and could potentially play a
role in diseases such as glomerulonephritis.
[0457] NO.cndot. mediated tissue damage is not limited to
inflammation involving immune complexes. For example, microglial
cell stimulated, by agents such as PMA, LPS or IFN-.gamma., produce
NO.cndot. at levels capable of kiling oligodendrocytes [Merrill, et
al., Immunol. 151:2132 (1993)]. Pancreatic islet cells have also
been found to be sensitive to NO.cndot. , and macrophage release of
this mediator has been implicated in the tissue damage which leads
to diabetes [Kroncke, et al., BBRC 175:752-758 (1991)]. More
recently, it was conclusively demonstrated that NO.cndot. release
plays a role in endotoxic shock [MacMicking, et al., Cell
81:641-650 (1995)]. When administered lipopolysaccharide (LPS),
normal wild-type mice experience a severe, progressive decline in
arterial pressure resulting in death. Mice deficient in inducible
nitric oxide, however, experience a much less severe decline in
arterial pressure in response to LPS, and all survive the
treatment.
[0458] In vitro assays indicate that blockage of .alpha..sub.d is
effective at blocking some aspects of macrophage (or leukocyte
which express .alpha..sub.d, in general) activation, including
NO.cndot. release. Alveolar macrophages stimulated with IFN-.gamma.
in the presence of anti-.alpha..sub.d polyclonal anti-serum
(generated in rabbits against a rat .alpha..sub.d I domain
polypeptide) were found to produce significantly less
nitrite/nitrate--breakdown products of NO.cndot. than macrophages
treated with control anti-serum. This finding indicates that
monoclonal antibodies to .alpha..sub.d, particularly to the
I-domain, may be potent anti-inflammatory agents with potential
uses in MS, diabetes, lung inflammation and endotoxic shock.
Furthermore, in contrast to CD18, which effects the function of a
wide variety of leukocyte types, the limited distribution of
.alpha..sub.d may make this a more attractive target than CD18 for
preventing macrophage (or leukocyte which express .alpha..sub.d, in
general) activation.
[0459] Rat IgG immune complex-induced alveolitis is a widely used
experimental model important in understanding acute lung injury.
The injury is elicited by instilling anti-bovine serum albumin
(BSA) antibodies into lungs via tracheal cannulation, followed by
an intravenous injection of BSA. The formation of immune complexes
in the microvasculature of the lung leads to complement activation
and the recruitment of neutrophils into the lung. Presumably,
formation of immune complexes in the lung following extravasation
of leukocytes from the blood and subsequent leukocyte movement
across lung epithelium. The subsequent release of mediators,
including radicals, TNF-.alpha. and nitric oxide (NO.cndot.), from
activated endothelial cells, neutrophils and macrophages which
participate in progression of the disease. Pathologic features of
the disease include increased vascular permeability leading to
edema and the presence of large numbers of erythrocytes and PMNs
present in the alveolar spaces.
[0460] Polyclonal anti-serum specific for the I domain of
.alpha..sub.d was tested in a rat model of immune complex-induced
alveolitis. The anti-.alpha..sub.d polyclonal serum was
administered via tracheal cannulation at the same time anti-BSA was
introduced into the lungs. Lung injury was subsequently elicited by
intravenous administration of BSA along with a trace amount of
.sup.125I-labeled BSA (approximately 800,000 cpm) to quantitate
edema resulting from lung injury. Lung injury was allowed to
proceed for four hours and damage was assessed using a lung
permeability value, is defined as the ratio of .sup.125I-labeled
BSA in the lung compared to the amount of label present in the 1.0
ml of blood. Typically lung permeability values for positive
control rates range between 0.6 and 0.8, while negative controls
(rats not receiving BSA) have permeability index values in the
range of 0.1-0.2.
[0461] Initial studies indicated that treatment with
anti-.alpha..sub.d polyclonal anti-serum reduced lung permeability
values by greater that 50%, representing a dramatic moderation of
lung injury. Historically, treatments with anti-CD18 have reduced
permeability values by 60%. These findings indicate that
.alpha..sub.d may be the most important .beta..sub.2 integrin
during acute lung injury, however it cannot be precisely determined
if the effect of the anti-sera prohibits leukocyte extravasation
from the blood, or movement across lung epithelia.
[0462] As additional proof that .alpha..sub.d moderates lung
injury, TNF-alpha levels in the bronchoalveolar lavage fluid were
evaluated. Treatment with the anti-.alpha..sub.d anti-serum was
found to reduce TNF-alpha levels approximately four-fold. TNF-alpha
has long been viewed as an important mediator in acute lung
inflammation, and responsible for the recruitment of inflammatory
cells into sites of inflammation, cell activation and tissue
damage. Presumably, anti-.alpha..sub.d anti-serum blocks activation
of resident alveolar macrophages during the formation of immune
complex alveolitis, and thereby moderates the release of
TNF-.alpha. and NO.cndot., and reduces subsequent tissue damage
caused by these agents and the recruitment of neutrophils.
F344 Rat Model of LGL leukemia
[0463] LGL leukemia in the F344 rat was first described in the
early to mid 1980's as a transplantable leukemia with stable NK
cell activity. This leukemia has been suggested as a possible model
for human T gamma lymphoma and T-cell Chronic Lymphocytic Leukemia
[Ward and Reynolds, Am. J. Pathol. 111:1-10 (1982); Stromberg, Am.
J. Pathol. 119:517-519 (1985); Reynolds, et al. J. Immunol.
132:534-540 (1984)]. This model provides abundant cells for studies
of LGL and NK cell function. Of particular interest is the presence
of .alpha..sub.d on the surface of these cells as detected using
hamster anti-rat antibody 205C through FACS analysis described in
Example 26. In view of this observation, the roles of .alpha..sub.d
in vitro (for example, using the cytolytic assays previously
described) and in vivo were examined.
[0464] The pathologic features of LGL leukemia include severe
splenomegaly, a pale mottled liver, enlargement of peripheral lymph
nodes and petechial hemorrhages in lung, brain, and lymph node.
Because .alpha..sub.d is present in the red pulp of normal rat
spleen (on splenic macrophages), and the hallmark of LGL leukemia
is severe splenomegaly, it was hypothesized that the .alpha..sub.d
positive NK tumor cells may also "home" or tether to a yet defined
ligand and proliferate here. To test this hypothesis, tumor cells
were radiolabeled and injected with and without .alpha..sub.d
antibody treatment into recipient rats. Spleens from these animals
were removed after three hours and the presence of NK tumor cells
determined. A more complete description of the methods used and
experimental results are as follows.
[0465] Tumor cells, obtained from the spleens of rats with LGL
leukemia and prepared as described below, were adoptively
transferred to recipient rats 2 to 4 weeks prior to each
experiment. From previous studies by histology and FACS analysis,
it was known that a rapid proliferation of the tumor and resulting
splenomegaly occurs about three to four weeks after adoptive
transfer. In the first experiment, a spleen was removed from an
animal that had been exposed to tumor cells for four weeks. A
single-cell suspension was made by mincing up the spleen into
smaller pieces with scissors and passing these pieces through a
mesh screen in the presence of D-PBS. The cell suspension was
collected in a 50 ml tube and centrifuged for 10 minutes at 1500
rpm in a Beckman tabletop centrifuge at room temperature. The
supernatant was discarded, and the cells resuspended in 30 ml of
D-PBS. Approximately 5.0 ml of this cell suspension was layered
onto 5.0 ml of Histopaque, and the gradients centrifuged for 30
minutes at 1500 rpm. The cellular layer from these gradients was
collected, pooled, and counted by hemacytometer. The cell number
was adjusted so that each recipient rat received 1.0.times.10.sup.7
cells, with a slight overestimation to account for cell loss during
washes and preparing syringes. The cells were suspended in NK "test
media" (RPMI-1640 plus antibiotics, plus 2% FBS) and labeled with
10 mCi of .sup.51chromium for one hour at 37.degree. C. After
incubation, the volume of the cell suspension was increased to 50
ml with test media and the cells pelleted by centrifugation for 10
minutes, 1200 rpm. The supernatant was discarded and the cells
washed two more times as described. The labeled cells were
suspended at a final concentration of 1.times.10.sup.7 cells/ml and
preincubated in the presence or absence of anti-rat .alpha..sub.d
antibodies as well as a control IgG1 antibody prior to injection
into recipient rats. The final concentration of-antibody used per
animal was adjusted to 5.5 mg/kg, or approximately 1 mg/animal. A
minimum of four animals was used for each condition.
[0466] Recipient rats were weighed and injected subcutaneously with
150 to 200 .mu.l ACE solution (containing 0.25 ml Ketamine, 0.2 ml
Ace and 0.8 ml Rompin) to anesthetize. From each antibody
treatment, 1.0.times.10.sup.7 cells were injected intravenously
into animals. Approximately 300 .mu.l of each cell suspension was
examined using a gamma counter to determine the total cpm
injected/rat. The labeled NK cells were allowed to circulate in the
rats for three hours after which the animals were sacrificed and
1.0 ml of peripheral blood drawn by aortic puncture. Spleens were
removed from each animal, weighed, and counted using a gamma
counter. To determine the percentage of cells returning to the
spleen, the counts per minute (cpm)/spleen were divided by the
total known cpm injected into the rat. To determine the cpm in
peripheral blood, an assumption was made that blood represents
about 6.0% of the total rat's weight. The cpm in 1.0 ml blood was
multiplied by 6.0% of the animal's total weight to determine total
cpm in blood. This number was then divided by the total number of
cpm's injected into each animal to obtain the percentage of cpm
remaining in blood.
[0467] In the first experiment, antibodies 226B, 226G, 226H, 226I,
20C5B (a non-blocking CD18 antibody) and a control antibody were
used. Antibodies 226B and 226G appeared to significantly reduce the
number of cells returning to the spleen as compared to the control
antibody and the other two 226 antibodies; approximately 7 to 8% of
the labeled cells returned to the spleen after incubation with the
control antibodies, while approximately 6% of the cells returned to
the spleen after incubation with 226B and 226G antibodies. The
percentage of total cpm in blood, between 0.9 and 1.4%, did not
show a marked difference between treatment groups with the
exception of 226B, which had lower values than all other
groups.
[0468] In a second experiment, several adjustments were made to the
protocol defined above. First, an increase to four animals per
condition was made, and second, the spleen from a tumor-bearing rat
was removed at 2.5 weeks post-adoptive transfer rather than four
weeks as above. The NK cells were prepared in exactly the same
manner and injected into recipient animals following incubation
with either antibody 226B or 226G or a control antibody at the
doses defined above. Again, the labeled cells were allowed to
circulate for three hours after which the animals were sacrificed
and blood and spleens collected as above. In addition, the tissues
from two of the animals/condition were removed to determine other
locations of the tumor cells. These tissues included liver, brain,
thymus, lung, long bone (for bone marrow) and kidney.
[0469] The results indicated that, in the control IgG1 ,
approximately 32% of tumor cells were in the spleen, whereas both
226B and 226G showed reduced numbers, 28% and 29%, respectively, of
labeled cells in the spleen. The percentage of cells in the blood
were similar for each antibody, approximately 3 to 4% of the total
cpm's were found in blood, with 226G antibody treatment slightly
less than the other two groups.
[0470] The tissue distribution was similar between treatment groups
with liver showing 27% of total cpm, brain 0.05%, thymus 0.10%,
lung 15%, kidney 0.80%, and long bone 1.3%.
[0471] In a third experiment, an increase in the number of animal
per condition (n=6 or 7) was made in an attempt to detect
statistical differences between the three treatment groups above.
Again, the spleen from an animal injected with tumor cells two
weeks prior to the experiment was used and prepared by the same
method described above. The cells were labeled in the same manner
and injected into the animals and allowed to circulate for three
hours. In this experiment, only blood samples and spleens were
collected from animals due to the large number of animals used.
[0472] The results were consistent with the second experiment in
that approximately 30% of labeled cells were observed to have
returned to the spleen in the control group, while only 25% in 226B
antibody-treated cells and 27% in 226G antibody-treated cells were
found in the spleen. The blood values again did not show major
differences between groups, with approximately 17% of the total
cpm's found in blood in the control group and 15.8% and 14.75%,
respectively. were found for 226B and 226G treated groups.
[0473] To determine if three hours was an optimum time point to
examine differences between treatment groups, a small adjustment
was made in a fourth experiment.- Again, cells were isolated and
prepared in the same way for injection into recipient animals,
except that an additional anti-CD18 antibody 20C5B was added to the
panel of test antibodies. In addition, only four animal were used
for each condition. In this experiment, the cells were allowed to
circulate for only 30 minutes after injection, at which point blood
samples were drawn and spleen removed from the animals.
[0474] At the 30 minute time point, the total cpm in the spleen was
reduced from values observed in the second and third experiments to
12 to 13%. There were no apparent differences between all treatment
groups in the spleen samples, although two of the four animal in
the group treated with antibody 226B did have slightly lower
values. The blood values were again similar between all groups,
with approximately 6 to 7% of the total cpm found in blood. The
only marked difference between blood groups was a larger spread in
data points from 226B and 226G antibody-treated animals. These
findings suggest that .alpha..sub.d plays a role in the homing of
leukemia cells to the spleen. Experiments indicate that homing
requires several hours and maximum inhibition with the
.alpha..sub.d specific monoclonal antibodies occurs at 3 hours.
Macaque Models for Multiple Sclerosis and Atherosclerosis
[0475] Monoclonal antibodies 212D and 217L were shown by
immunocytochemical staining and immunoprecipitation to cross-react
with macaque splenocytes. The specificity of recognition was
confined by immunoprecipitation and amino terminal sequencing of an
.alpha..sub.d species homolog from macaque spleen (Example 34). In
view of these previous observations, the two antibodies were used
to stain tissues obtained from macaques in either experimental
autoimmune encephalitis (EAE) or atherosclerosis studies. Both of
these diseases are marked by infiltration into lesions of
phagocytotic macrophages which take up myelin basic protein (MBP)
in the EAE or low density lipoprotein in atherosclerosis. MBP or
lipid-laden macrophages can be identified morphorologically or by
staining with Oil Red O (ORO) or antibody Ham 56 (Dako,
Carpinteria, Calif.). The protocol employed in these studies is as
described in Example 18 to characterize .alpha..sub.d expression in
human tissues.
[0476] Sections from macaque brains with EAE were marked by
infiltration of lymphocytes and macrophages. Expression of
.alpha..sub.d was localized to a subset of macrophages in lesions
which stained with ORO indicating previous uptake of MBP. Lesions
which were negative for ORO staining were also negative for
.alpha..sub.d expression. This result suggested a direct
correlation between ORO staining and .alpha..sub.d. Similar results
were observed using antibodies 217K, 217I, and 217H.
[0477] Atherosclerosis lesions were obtained from either thoracic
or abdominal arteries of macaques on high fat diets. Lesions occur
in both locations in humans, but those which progress
pathologically are more often located in the abdominal aorta. The
lesions tested in this study were separated into five different
stages (I through V) and normal. Stage (IV/V) lesions were derived
from the abdominal aorta and the remainder were derived from the
thoracic aorta.
[0478] Early stage lesions (I/II) showed little macrophage
infiltration and low or even absent levels of .alpha..sub.d
expression. In later stage lesions, foam cell infiltration was
greater and .alpha..sub.d expression was detectable.
[0479] Staining patterns for other leukointegrin .alpha. chain
subunits were overlapping with, but not identical to, .alpha..sub.d
expression in both tissues. Most notably, expression of .alpha.
subunits of non-.alpha..sub.d leukointegrins was detected on
lymphocytes that did not stain with anti-.alpha..sub.d
antibodies.
[0480] These results suggest that .alpha..sub.d expression may be
characteristic of phagocytotic macrophages in both animal models.
It is unclear, however, whether .alpha..sub.d is directly involved
in phagocytosis or some downstream process such as antigen
presentation.
EXAMPLE 37
Expression of .alpha..sub.d in Preclinical Models
[0481] In order to assess differential expression of .alpha..sub.d
in various disease states, tissue sections from animal disease
models were stained with anti-.alpha..sub.d polyclonal serum
produced as described above (see Example 22). Tissue from normal
and diseased rats was sectioned at 6 .mu.m thickness and air dried
on Superfrost Plus (VWR Scientific) slides at room temperature
overnight. After drying, sections were stored at -70.degree. C.
until use. Prior to use, slides were removed from -70.degree. C.
and placed at 50.degree. C. for approximately 5 minutes. Sections
were fixed in cold (4.degree. C.) acetone (Stephens Scientific) for
10 minutes at room temperature and allowed to dry at room
temperature. Each section was blocked with 150 .mu.l of a solution
containing 30% normal rat serum (Harlan Bioproducts), 5% normal
goat serum (Vector Laboratories) and 1% bovine serum (BSA) (Sigma
Chemical Company) in 1.times.TBS for 30 minutes at room
temperature, after which the solution was gently blotted from the
sections. Rabbit polyclonal serum, at a protein concentration of 34
.mu.g/ml, and preimmune serum from the same rabbit, at a protein
concentration of 38.5 .mu.g/ml, were diluted in the blocking
solution and 100 .mu.l separately applied to each tissue section
for 30 minutes 37.degree. C. The serum solution was blotted from
the sections and unbound antibody removed by washing three times in
1.times.TBS for 5 minutes. Excess TBS was removed by blotting
following the final wash. Biotinylated goat anti-rabbit antibody
from a Elite Rabbit lgG Vectastain ABC kit (Vector) was prepared
according to manufacturer's suggested protocol and 100 .mu.l of the
resulting solution was applied to each section for 15 minutes at
37.degree. C. Slides were washed two times in 1.times.TBS for five
minutes in each wash, after which 100 .mu.l of streptavidin-gold
conjugate (Goldmark Biologicals), diluted 1:100 in 5% normal rat
serum and 1% BSA, was applied to each section for one hour at room
temperature. Slides were washed three times with TBS for five
minutes each wash, and 100 .mu.l of 1% glutaraldehyde (Sigma) in
TBS buffer was applied for five minutes at room temperature. Slides
were again washed three times in TBS for five minutes each wash,
and five times in sterile deionized water for three minutes each
wash. Excess liquid was blotted from each slide and two drops each
of silver enhancing and initiating solution (Goldmark Biologicals)
were applied to each section. The reaction was allowed to proceed
for 20-30 minutes at room temperature, after which the sections
were rinsed thoroughly in sterile deionized water, air dried
overnight at room temperature and mounted with Cytoseal 60 (VWR).
As controls, tissue sections were labeled with monoclonal
antibodies recognizing CD11a, CD11b, CD11c and CD18 in the same
experiments by identical protocols.
[0482] Labeling with .alpha..sub.d polyclonal sera and monoclonal
antibodies to CD11a, CD11b, CD11c, and CD18 revealed a staining
pattern for .alpha..sub.d different from than observed for the
other a subunits.
[0483] In normal lung tissue, .alpha..sub.d expression was detected
on respiratory epithelium of the bronchi (but not the epithelium in
the alveolar spaces) and on individual cells which appear to be
alveolar macrophages within the airspaces. The signal observed with
the polyclonal serum was significantly higher than the background
signal level with the pre-immune serum control. In pulmonary
granuloma tissue, 24 and 96 hours after administration of glycan, a
different signal was detected with the .alpha..sub.d staining
respiratory epithelium throughout the alveolar area and a stronger
signal detected on what appear to be alveolar macrophages
throughout the airways. In the lung tissue from animals which had
presumably recovered from the disease (sacrificed 16 days after
administration of glycan), no signal was observed with the
.alpha..sub.d antibody. very little background was observed with
the pre-immunization serum in each of these tissues.
[0484] Using rat lung tissue from an antigen-induced asthma model,
a very strong signal was detected with .alpha..sub.d antibody in
the respiratory epithelium of both the bronchi and the alveolar
spaces. The signal was significantly higher than the background
signal level in the pre-immunization serum control.
Preclinical Model--L. monocytogenes
[0485] Evidence suggests that .alpha..sub.d positive macrophages in
the spleen red pulp are involved in the clearance of damaged rbcs
and other particles from circulation. It is hypothesized that
bacterial agents are also cleared from circulation by the
.alpha..sub.d positive macrophages in the spleen red pulp.
Non-infectious agents which would not require the induction of an
antigen-specific T cell response would be eliminated directly by
the red pulp macrophages. In contrast, opportunistic infectious
agents cleared by the red pulp macrophage do require a product T
cell immune response for the eradication of the bacteria. It was
therefore proposed that .alpha..sub.d expression on red pulp
macrophages may serve to regulate macrophage/T cell interactions
either by regulating the movement of macrophages from the red pulp
into the marginal zones or by acting as an accessory molecule
involved in macrophage/T cell interactions leading T cell
activation.
[0486] To investigate the role of .alpha..sub.d during immune
responses to infectious agents, .alpha..sub.d expression is
evaluated in the spleen using a murine model of Listeria
monocytogens. Expression of .alpha..sub.d is examined on red pulp
macrophages which have phagocytosed bacteria. Antibodies to
.alpha..sub.d are also tested in the model to determine the role
played by .alpha..sub.d in the induction of a protective T cell
response to L. monocytogenes.
EXAMPLE 38
The Role of .alpha..sub.d in Spinal Cord Injury
[0487] After central nervous system (CNS) trauma, the immune
response involves a mixture of invading neutrophils, natural killer
cells and phagocytic monocytes/macrophages [Means, et al., J
Neurophathol & Exp. Neurol., 42:707-719 (1983)]. This response
includes the release of inflammatory mediators, induction of
reactive microglia, infiltration of platelets, endothelial damage
with enhanced vascular permeability and development of edema.
Recent observations suggest that post-traumatic inflammation in the
spinal cord contributes to chronic deficits, partly through
demyelination or through more direct damage to neurons and axons
[Blight, A. R., Central Nervous System Trauma, 2:299-315 (1985)].
In addition, a recent study reported that the number of
macrophages/microglia was significantly correlated with the amount
of tissue damage at each level of the spinal cord following impact
injury [Carlson, et al., Exp. Neurol., 151:71-81 (1998)]. Both
neutrophils and macrophages phagocytose debris which in turn
induces an oxidative burst resulting in the production of reactive
oxygen species. These antibacterial agents, although efficacious,
can lead to damage in surrounding healthy tissue. Thus, it is
possible that the infiltration of leukocytes and concomitant
production of reactive oxygen species is involved with the spread
of secondary injury beyond the initial impact site. This hypothesis
is supported by studies in which blocking of neutrophil or
macrophage infiltration led to decreases in the extent of injury
following stroke or spinal cord injury [Blight, Neurosci,
60:263-273 (1994)].
[0488] In order to assess the role of .alpha..sub.d in spinal cord
injury, a rat model was utilized in combination with monoclonal
antibodies to .alpha..sub.d, some of which block binding to its
ligand VCAM-1. In this model, complete transection at the fourth
thoracic (T) spinal cord segment is introduced, which consistently
produces autonomic dysreflexia [Krassioukov, et al., Am. J.
Physiol. 268:H2077-H2083 (1995)]. This model is advantageous
because the small surgical lesion produces a well-defined, narrow
zone of primary tissue destruction that facilitates analysis of the
effects of cord injury on the area.
[0489] All experiments were carried out in accordance with policies
established in the "Guide to Care and Use of Experimental Animals"
as prepared by the Canadian Counsel on Animal Care. Forty-two male
Wistar rats (Charles River) weighing 270-320 grams were initially
administered atropine (0.5 mg/kg) and diazepam (2.5 mg/kg) by
intraperitoneal injection. After ten minutes, the rats were
anaesthetized by intraperitoneal injection with sodium
pentobarbital (35 mg/kg). Supplemental injections of anaesthetic (2
mg/kg) were administered during surgery as necessary. The rats were
placed on a heating pad during surgery and the body temperature was
kept close to 37.degree. C. The dorsal process of the third
thoracic (T3) vertebra was removed and a laminectomy was performed
to expose the spinal cord under microscopic guidance. The cord was
completely transected at the T4 spinal segment with a scalpel
blade. The muscles and skin above the laminectomy were closed and
the animals recovered under a heat lamp. Postoperative care of the
paraplegic rats was conducted as previously described [Krassioukov
et al., Neurosci. 70:211-226 (1996)]. After recovery from surgery,
food and water were provided ad libitum. Animals survived for two
days following surgery.
[0490] The rats (four to five per group) were divided into the
following treatment groups: (1) 1 mg/kg of either .alpha..sub.d
monoclonal antibodies 226H, 236L, 226B, or an irrelevant
isotype-matched IgG1 kappa antibody 1B7 and (2) 5 mg/kg of either
.alpha..sub.d monoclonal antibodies 226H, 236L, or the control 1B7.
Each mouse received only one antibody in the treatment regimen.
[0491] Antibodies were selected following in vitro binding assays
using recombinant human VCAM-1 fused to an immunoglobulin region
and a CHO cell line expressing rat .alpha..sub.d and human CD18. A
panel of antibodies was examined for the ability of individual
antibodies to block .alpha..sub.d binding to VCAM-1. Results from
the binding assays indicated that some antibodies did not block
binding ("non-blockers"), some block binding in the range of 50%
("medium blockers"), while others block binding in the range of 75%
to 85% ("strong blockers). Representative antibodies from the
non-blocking, medium blocking and strong blocking groups were
chosen for use as described below.
[0492] All monoclonal antibodies were administered via tail vein
injection on the day before surgery, immediately after surgery, and
the following day. Antibodies were diluted in phosphate buffered
saline, pH 7.2, without calcium chloride or magnesium chloride to
ensure an adequate volume for ease of injection. In another control
group, 15 mg/kg of methylprednisolone (MP) was injected via the
trail vein at 30 minutes, 2 hours, and 24 hours following a
complete transection of the spinal cord. An additional control
group of rats had transected spinal cords as described above, but
received no accompanying treatment.
[0493] Two days after surgery, the animals were deeply
anaesthetized with an intraperitoneal injection of 3 g/kg urethane
(Aldrich Chemical Company, Inc., Milwaukee, Wis., USA) prior to
transcardial perfusion. After opening of the thoracic cavity,
heparin was injected into the left ventricle. The rats were
perfused with 250 ml of oxygenated tissue culture medium, pH 7.4,
(Dulbecco's modified Eagle medium; Gibco BRL) followed by 500 ml of
4% formaldehyde fixative in 0.1 M phosphate buffer (pH 7.4). The
thoracic spinal cord caudal to the transection (T4-8) was removed
for examination as described previously [Krenz and Weaver, Neurosci
85:443-458 (1998)]. Following overnight postfixation in the same
fixative, the spinal cord portions were cryoprotected with 10%,
20%, and 30% sucrose solutions in PBS at 4.degree. C. The spinal
cord portions were then cut into horizontal sections (50 .mu.m) on
a cryostat. Sections were stained with 1% cresyl violet, pH 4,
using standard procedures to visualize the polymorphonuclear
leukocytes, cleared in xylene, and coverslipped with DPX mountant
(BDH Laboratory Supplies, Poole, U.K.). The number of
macrophages/microglia exhibiting a rounded, phagocytic morphology
and neutrophils exhibiting the characteristic multilobed nuclei
following cresyl violet staining were counted in the area of the
cord at the lesion site. Quantitation of immune cells was performed
using bright field microscopy and a 40.times.objective lens fitted
with a grid (total area of 0.08 mm.sup.2). Three sample areas,
starting at the edge of the transected cord and moving caudally and
from one lateral edge to the other were examined for immune cells.
The procedure resulted in an average total quantified area of
spinal cord of 2.72 mm.sup.2. The process was then repeated in
another spinal cord section. The sample areas were selected from
horizontal sections of the cord with the largest grey matter
(border between lamina V and VII) because the inflammatory response
was most prominent in the grey matter. The total number of
macrophages and neutrophils counted in each sample area was divided
by the total sample area (mm.sup.2) to acquire the mean number of
macrophages and neutrophils per mm.sup.2 in each treatment group.
The antibody-treated groups (1 mg/kg and 5 mg/kg) were compared to
the respective irrelevant IgG-matched control at the same dose and
to a non-drug treated transection control. In a further comparison,
the groups most significantly lowering the mean number of immune
cells were compared to MP treated animals and to surgery control
animals. All cell counting was carried out blind with respect to
the identification of the treatment group.
[0494] Results indicated that activated microglia and/or blood
macrophages identified as mononuclear, round cells with large
translucent cytoplasm were evident in the lesion site two days
after transection. Control animals that received no accompanying ad
antibody or corticosteroid treatment were found to have an average
of 396.+-.27 macrophage/microglia per mm.sup.2 at the site of the
cord injury. Treatment with the irrelevant IgG1 antibody 1B7 at the
lower dose (1 mg/kg) increased the number of macrophage/microglia
to 462.+-.46 per mm.sup.2, but this value was not significantly
different than control animals which received no antibody
treatment. Of the .alpha..sub.d antibodies tested, 226H and 236L at
1 mg/kg each led to significant reductions in the average number of
macrophages per mm.sup.2 compared to the 1B7 antibody and to the
transection control. Specifically, 226H administration reduced
macrophage/microglia per mm.sup.2 to 147.+-.17 and 236L
administration reduced macrophage/microglia per mm.sup.2 to
131.+-.8 compared to both 1B7 and animals receiving no treatment.
In contrast, injection of .alpha..sub.d antibody 226B at 1 mg/kg
reduced the number of macrophages/microglia per mm.sup.2 to
327.+-.65, which was not significantly different from the control
values. MP treatment led to an observation of 250.+-.24
macrophage/microglia per mm.sup.2, which was significantly less
than control animals but greater than that detected in animals
treated with 226H and 236L .alpha..sub.d antibodies. This result
was unexpected since methylprednisolone is the most widely used
drug for clinical treatment of acute spinal cord injury.
[0495] When the dose of .alpha..sub.d antibodies was increased to 5
mg/kg, the average number of macrophage/microglia per mm.sup.2 with
226H and 236L treatment was significantly lower than the control,
but the number was not significantly different from the number in
animals treated with the irrelevant IgG1 isotype matched control
antibody.
[0496] The results with respect to neutrophilic leukocytes (NLs)
indicated that the majority was detected either singly or in
aggregates throughout the gray matter. Only a small portion of the
visible NLs were detected in the white matter on each side of the
grey matter. Moreover, some neutrophils were found adhering to the
lumenal surface of venules and arterioles in the spinal tissue
sections. In animals that received no treatment, the average number
of NLs per mm.sup.2 was 295.+-.56 and in those treated with 1 mg/kg
1B7, the number of NLs increased significantly to 503.+-.93. No
.alpha.d antibody treatment significantly reduced the number of NLs
when compared to the control animals that received no treatment.
Specifically, 226H and 226B at 1 mg/kg provided an increased number
of NLs per mm.sup.2 to 361.+-.80 and 332.+-.43, respectively.
Compared to 1B7 treated animals, treatment with 236L at 1 mg/kg and
MP both significantly decreased the number of NLs per mm.sup.2 to
263.+-.47 and 193.+-.39, respectively. These observations, however,
were not significantly different from the control group which
received no treatment.
[0497] At 5 mg/kg, 1B7 treatment increased the average number of
NLs to 343.+-.37, but the observed increase was not significant
compared to the non-treated animal group. Compared to 1B7
treatment, antibody 226H decreased the average number of NL present
to 236.+-.38, but the reduction was not significant compared to
animals that received no treatment. In contrast, 236L reduced the
number of NL to 190.+-.17 per mm.sup.2 which was significant
compared to animals receiving 1B7 treatment.
[0498] These results indicate that .alpha..sub.d monoclonal
antibodies at low doses reduce the number of leukocytes in injured
spinal cord, possibly through the disruption of an interaction with
VCAM-1 which would be consistent with previously reported
observations. Other reports using antibodies against the best known
counterreceptor for VCAM-1, VLA-4, showed decreased infiltration of
VLA-4 positive cells into the brain and prevention of clinical and
pathological signs of experimental allergic encephalomyelitis
(EAE). Similarly anti-TNF.alpha. treatment was shown to inhibit the
incidence and severity of EAE and one mechanism of action was by
inhibiting VCAM-1 expression on spinal cord vessels leading to
significant reduction in leukocyte entry into the CNS. These
previous observations suggest that blocking the interaction of
.alpha..sub.d on the surface of leukocytes with VCAM-1 on the
surface of endothelial cells or glial cells may be responsible for
the observed attenuated inflammatory response.
[0499] Because one of the antibodies, 226I, that blocked macrophage
infiltration did not block binding between .alpha..sub.d and
VCAM-1, these results suggest that the mode of inhibition by the
antibody can include blocking between .alpha..sub.d binding
partners other than VCAM-1. One possibility is the existence of a
rat counterpart to ICAM-R. Previous observations have indicated
that, in addition to VCAM-1, .alpha..sub.d also binds to ICAM-R,
although with much less affinity that to VCAM-. Interestingly,
ICAM-R appears to be absent on endothelial cells and is expressed
primarily on resting monocytes, lymphocytes and neutrophils
precluding its involvement in leukocyte-endothelial adhesion under
normal circumstances. It has been suggested that ICAM-R has a role
in the initial phases of leukocyte cell-cell contact and that
ICAM-R is involved in the regulation of the LFA-1/ICAM-1 leukocyte
intercellular interaction. The role of ICAM-R in the early
leukocyte interaction has been shown to be induction of cell
aggregation. Disruption of the initial contacts which give rise to
aggregation reduces the effectiveness of the immune response. It
has also been shown that the interaction of another ligand for
ICAM-R, LFA-1 induces a switch of LFA-1 to its activated state at
the intercellular contact site. It is possible that co-expression
of .alpha..sub.d and ICAM-R on resting leukocytes could work in
much the same way and that interaction between the two proteins may
promote contact-dependent leukocyte activation events. Conversely,
disruption of the interactions, for example, through use of an
.alpha..sub.d antibody, could account for the reduced entry of
leukocytes into the spinal cord.
[0500] Several explanations could account for the increase in
macrophage infiltration. Most simply, the result may be a
phenomenon of the system. Alternatively, the higher dose of
antibody may have resulted in cross-linking of Fc.gamma.R on the
mature macrophages, resulting in an initial burst of chemokine
production that attracted additional leukocytes to the injury site.
In the same way, chemokine production could explain the greater
numbers of both neutrophils and macrophages at the injury site
after treatment with 1B7 that occurred in the majority of cases.
Another possible explanation for. the observed results is
inter-animal variability since the .alpha..sub.d antibodies were
tested in outbred strains of Wistar rats. For example, different
groups of rats could have slightly different states of
immunocompetence. In order to test this possibility, the
experiments are replicated using both a low and high dose of the
monoclonal antibodies at the same time in animals from the same or
related litters.
EXAMPLE 39
Expression of .alpha..sub.d in Crohn's Disease
[0501] Previous work (Example 18) indicated that leukointegrins are
detected at higher levels in tissue sections from patients with
Crohn's disease. In order to assess the degree to which
.alpha..sub.d expression is modulated in Crohn's disease,
expression was examined in tissue sections from diseased and normal
colon as follows.
[0502] Colon tissue from five individuals with Crohn's disease and
a normal colon were sectioned at 6 .mu.m thickness and air dried on
Superfrost Plus (VWR Scientific) slides for five minutes at room
temperature. Slides were stored at -20.degree. C. until the assay
was performed. Prior to use, slides were incubated at 50.degree. C.
for approximately two minutes. Sections were fixed in cold
(4.degree. C.) acetone (EM Science) for two minutes and allowed to
air dry at room temperature. Sections were placed in buffer
containing 100 ml 1.times.TBS, 1.1 ml 30% H.sub.2O.sub.2 (Sigma),
and 1.0 ml 10% NaN.sub.3 (Sigma) for 15 minutes at room temperature
to remove endogenous peroxidase activity. Each section was
incubated in 150 .mu.l of a blocking solution containing 20% normal
human serum (Boston Biomedica), 5% normal rat serum (Harlan), and
2% BSA (Sigma) in 1.times.TBS for 30 minutes at room temperature.
After incubation, the solution was gently blotted from the
sections. Primary monoclonal antibody was prepared at a protein
concentration of 10 .mu.g/ml in blocking solution and 75 .mu.l was
applied to each tissue section for one hour at room temperature.
After incubation, sections were washed three times for five minutes
each in 1.times.TBS to remove unbound antibody. Excess TBS was
removed by aspirating around the tissue following the final wash.
Biotinylated rat anti-mouse antibody (Jackson Laboratories) was
diluted 1:400 in blocking solution and 75 .mu.l was applied to each
section for 30 minutes at room temperature. Slides were washed two
times with 1.times.TBS for five minutes each wash.
Peroxidase-conjugated avidin/biotin complex (Vector Laboratories)
was prepared by adding 9 .mu.l reagent A and 9 .mu.l reagent B,
both reagents supplied by the manufacturer, to 782 .mu.l
1.times.TBS, and 75 .mu.l of the resulting mixture was applied to
each section for 30 minutes at room temperature. Slides were washed
two times in 1.times.TBS for five minutes each wash. Substrate 3,3'
-diaminobenzidine (DAB) (Vector Laboratories) was applied and color
development was stopped by immersion in water. One drop of 1% osmic
acid (VWR) was applied to each section for approximately 15 seconds
to enhance the signal intensity and the reaction was stopped by
immersion in water. Sections were counterstained in Gill's
hematoxylin #2 (Sigma) and rinsed in water before dehydrating and
mounting with Cytoseal (VWR).
[0503] In the normal colon, no labeling was detected with
antibodies 217L, 217K, or 212D. Antibody 240I labeled numerous
cells in lymphoid aggregates as well as lymphocytes and eosinophils
scattered in the lamina propria. Antibody 240I also labeled cell
types that appeared to be either macrophages or activated
lymphocytes. Staining with antibody 169A was similar to that of
antibody 240I. Antibody 169B labeled lymphocytes and macrophages
scattered in the lamina propria and submucosa, in addition to a
subset of smooth muscle cells around arteries and in the muscularis
externa.
[0504] With the Crohn's colon samples, the labeling patterns
observed with the individual antibodies overlapped but the
expression patterns were not identical. No labeling was detected
with antibodies 212D or 217K. Antibody 240I labeled granulomas with
differential expression on the multinucleated giant cells in the
lymphoid aggregates and labeled lymphocytes in the lymphoid
aggregates. Antibody 240I labeled eosinophils and lymphocytes
scattered in the lamina propria. Antibody 217L also labeled
granulomas with different expression on the multinucleated giant
cells in the lymphoid aggregates. Antibody 217L labeled a small
subset of lymphomas in the lamina propia and submucosa which were
also labeled with 240I. The staining pattern of antibody 169A was
very similar to that found for 240I except that 169A labeled fewer
lymphocytes. Antibody 169B staining was similar to the 169A pattern
except that 169B also labeled a subset of smooth muscle cells
around the vessels and in the muscularis externa.
EXAMPLE 40
TNF.alpha. Release from Rat Spleen .alpha..sub.d .sup.+ Cells
[0505] In order to characterize a unique splenic subpopulation of
.alpha..sub.d .sup.+ cells with respect to the ability to produce
cytokine upon stimulation, the following experiments were
conducted.
[0506] Lewis rats were injected subcutaneously in the rear flank
with 100 .mu.l of a 1:1 emulsion of Complete Freund's Adjuvant
(CFA) in PBS and the animals were sacrificed seven days later. The
spleens were harvested and a single cell suspension was prepared by
standard procedures. B cells, CD4.sup.+ T helper cells, and
macrophages were selectively removed using monoclonal antibodies
against CD4 (antibody W3/25, E.A.A.C.C. No: 84112002), CD11b
(antibody OX42, E.A.A.C.C. No: 87081803) and CD45Ra/b (antibody
OX33, Pharmingen) pre-armed onto an anti-mouse IgG magnetic bead
conjugate. The CD4 antibody identifies T cells, the CD11b antibody
identifies macrophage, monocytes, granulocytes, and natural killer
cells, and the CD45Ra/b antibody recognizes B cells, T cell
subsets, monocytes, granulocytes, and macrophage. A magnet was then
used to remove the antibody-coated cells. The non-adherent cells
were collected and a positive selection was carried out using
biotinylated rat anti-.alpha..sub.d monoclonal antibodies 205C and
226G, followed by incubation with Streptavidin magnetic beads. The
antibody-coated cells were collected using a magnet and suspended
at 5.times.10.sup.5 cells/mil in growth media (RPMI 1640 including
2% normal Lewis rat serum, penicillin/streptomycin sodium pyruvate;
L-glutamine).
[0507] Two ml of cell suspension was added to individual wells on a
24 well plate coated with 3 .mu.g/ml anti-rat CD3 monoclonal
antibody (G418, Pharmingen), irrelevant control antibody, or no
antibody. The plate was incubated at 37.degree. C. in 7% CO.sub.2
and supernatants from each well were collected after 20 hours, 48
hours, and 72 hours. Supernatants were aliquoted and stored at
-70.degree. C. immediately upon collection. Prior to the assay,
supernatants were diluted 1:2 and placed into an anti-rat TNFA
detection assay (Biosource).
[0508] Results indicated that after stimulation with the anti-CD3
monoclonal antibody, the .alpha..sub.d .sup.+ cells released
approximately 280 pg/ml TNFA after 20 hours compared to
approximately 40 pg/ml with the antibody control and media only
treatment groups.
EXAMPLE 41
Modulation of TNF.alpha. Release from Activated Splenocytes With
.alpha..sub.d Antibodies
[0509] In order to assess the role of .alpha..sub.d .sup.+
phagocytic splenocytes in an inflammatory response, the following
experiments were performed.
[0510] Because it has previously been shown that .alpha..sub.d
.sup.+ splenic macrophages phagocytose magnetic particles injected
into rats, cells of this type were collected in the following
manner. Four mice were injected intravenously with 200 .mu.l of a
magnetic bead suspension (amine-conjugated, Perspective
Biosystems). After 24 hours, spleens were removed and a single-cell
suspension was prepared by passing the tissue through a wire-mesh
screen. The cells were isolated using a magnet and washed one time
in PBS containing magnesium and calcium, placed into culture in
RPMI/10% FBS medium, and grown under the following six conditions:
(i) no treatment; (ii) with hamster anti-rat .alpha..sub.d
monoclonal antibody 205C (10 .mu.g/ml) that crossreacts with mouse
.alpha..sub.d; (iii) with hamster anti-rat .alpha..sub.d monoclonal
antibody 205E (10 .mu.g/ml) which also crossreacts with mouse
.alpha..sub.d; (iv) with lipopolysaccharide (LPS); (v) with LPS and
monoclonal antibody 205C (10 .mu.g/ml); and (vi) with LPS and
monoclonal antibody 205E (10 .mu.g/ml) that also crossreacts with
mouse .alpha..sub.d.
[0511] Where indicated, the cells were first treated with the
antibody for 30 minutes after which a 200 .mu.l sample of
conditioned medium was collected to represent the initial time
point (t=0). LPS (10 ng/ml) was then added to wells as indicated
above and aliquots of media were collected at 0.5 hour, 1 hour, 2
hours, and 4 hours and assayed for released TNF.alpha. by ELISA
using a murine TNF.alpha. kit (ENDOGEN, #005452). Upon collection,
samples were immediately frozen until assay. Just prior to assay,
the conditioned media was diluted 1:1 and assayed according to the
manufacturer's suggested protocol.
[0512] Results indicated that splenocytes which had not been
activated with LPS showed no significant release of TNF.alpha. into
the media regardless of prior antibody treatment. Splenocytes which
had been treated with LPS released TN.alpha. into the media at a
detectable level, while the LPS-activated cells treated with either
205C or 205E antibody showed significantly lower levels of
TNF.alpha. release. These results were consistent over all time
points tested and confirmed in subsequently repeated assays. In
addition, the same results were observed in later experiments with
splenocytes that were not isolated using magnetic beads. Finally,
preliminary results indicated that IL-1.beta. release from
splenocytes was similarly inhibited by the anti-.alpha..sub.d
monoclonal antibodies.
EXAMPLE 42
Characterization of .alpha..sub.d Expression on Eosinophils
[0513] Previous observations indicated that .alpha..sub.d is
expressed on all peripheral blood eosinophils (Example 18). In
order to further examine the expression and function of
.alpha..sub.d on human eosinophils, the following analyses were
carried out.
Expression of .alpha..sub.d Integrin on Human Granulocytes
[0514] Expression of .alpha..sub.d on human granulocytes was
examined on cells prepared as follows. Normodense eosinophils
(i.e., those with a normal specific gravity of greater than 1.09)
were isolated from peripheral blood of allergic volunteers by
density gradient centrifugation, hypotonic erythrocyte lysis, and
immunomagnetic negative selection as previously described [Hansel,
et al., J. Immunol. Meth.145:105 (1991)]. Neutrophils were purified
from peripheral blood of normal volunteers by density gradient
centrifugation and hypotonic erythrocyte lysis alone [Bochner, et
al., J. Immunol;. 145:1832 (1990)]. Respective purities of the cell
types always exceeded 95%. Enrichment of peripheral blood for
basophils was performed using a double-percoll density gradient
separation which increased the number of basophils to 3-10% of the
total leukocyte count [Bochner, et al, J. Immunol. Meth. 125:265
(1989)]. Expression of integrins on the freshly isolated cells from
blood following stimulation in culture was evaluated using single
color indirect immunofluorescence and flow cytometry as previously
described [Bochner, et al., J. Immunol. Meth. 125:265 (1989);
Matsumoto, et al., Blood 86:1437 (1995)]. Dual color detection of
basophils (using anti-IgE) was also performed. All samples were
fixed in 0.1% paraformaldehyde (Sigma) and analyzed using an EPICS
Profile II flow cytometer (Coulter). Approximately 10,000 events
were collected and displayed on a four-log scale yielding values
for means fluorescence intensity (MFI).
[0515] Results indicated that eosinophils express all four of the
.beta..sub.2 integrins. The level of surface expression of
.alpha..sub.d integrin was greater than that of CD11c, but less
than expression of .alpha..sub.4 integrin (CD49d), CD11a, or CD11b.
Results also indicated that basophils have slightly higher levels
of .alpha..sub.d integrin expression as compared to
neutrophils.
Regulation of .alpha..sub.d Integrin Surface Expression on Human
Eosinophils
[0516] Initial studies were performed to determine whether
eosinophils could rapidly mobilize intracellular stores of
.alpha..sub.d .beta..sub.2 as has been reported for neutrophils
[Van der Vieren, et al, Immunity 3:683 (1995)]. Purified peripheral
blood eosinophils (prepared as described above) were incubated for
15 minutes with either PMA or the calcium ionophore A23 187 and the
surface expression of several a chains of the .beta..sub.2 integrin
family was measured by indirect immunofluorescence (described
above).
[0517] Results indicated that both PMA at 50 ng/ml and calcium
ionophore at 1 .mu.M significantly increased expression of
.alpha..sub.d and CD11b. Within minutes of adding PMA, expression
increased and reached significantly increased levels by ten
minutes. This observation suggested that eosinophils have
cytoplasmic stores of .alpha..sub.d .beta..sub.2 which, similar to
CD11b stores, can be rapidly mobilized to the cell surface.
[0518] In view of these results, other eosinophil-active stimuli
were tested for acute effects on .alpha..sub.d .beta..sub.2
expression. Incubation of eosinophils for fifteen minutes with MDC
(100 nM), IL-5 (10 ng/ml), RANTES (100 ng/ml), and eotaxin (100
.mu.M) failed to alter .alpha..sub.d integrin expression.
[0519] Previous observations have indicated that many eosinophil
responses can be enhanced by prolonged exposure to certain
cytokines, such as IL-5, in a phenomenon referred to as "priming"
[Walsh, et al., Immunol. 71:258 (1990)]. Experiments were therefore
designed to examine if priming eosinophil cultures with IL-5 would
lead to changes in surface expression of .alpha..sub.d integrin.
Purified eosinophils, prepared as described above, were incubated
for four days with 10 ng/ml IL-5 and expression of various
integrins assayed as described above.
[0520] Results indicated that while expression of .alpha..sub.d
integrin on the cell surface increased four to five fold, the level
of .alpha..sub.4 integrin expression remained unchanged. The
kinetics of the increase in .alpha..sub.d integrin expression
indicated a statistically significant increase in expression
after-four to seven days of culture. In contrast, levels of
.alpha..sub.4 integrin did not change significantly. The kinetics
of enhanced .alpha..sub.d expression with PMA exposure was similar
to that of CD11b, suggesting that these two leukointegrins might
exist in similar or identical intracellular compartments. The
location of this compartment for either integrin in eosinophils is
not known; however, in neutrophils, preformed stores of CD11b have
been localized to specific granules [Todd, et al., J. Clin. Invest.
74:1280 (1984); Bainton, et al., J. Exp. Med. 166:1641 (1641)].
[0521] Because late phase bronchoalveolar lavage (BAL) eosinophils
express many characteristics of cytokine-primed eosinophils
[Kroegel, et al., Ann. Rev. Respir. Dis. 143:A45 (1991); Sedgewick
et al., J. Immunol. 149:3710 (1992)], expression of .alpha..sub.d
on this cell type was also examined. BAL cells were obtained from
allergic patients who had undergone an endobronchial segmental
allergen challenge with either ragweed or D. petrynissinus extract
18 hours previously as described [Kroegel, et al., J. Clin. Allergy
Immunol. 93725 (1994)]. Eosinophil purity in the late phase BAL
fluid was 19.+-.4%.
[0522] Results indicated that late phase BAL eosinophils also
showed a statistically significant increase in .alpha..sub.d
integrin expression, with levels similar to those seen after three
days of culture stimulated with IL-5. In examining levels of
.alpha..sub.d integrin on late phase BAL eosinophils, i.e., cells
which have already undergone cell adhesion and migration to get to
the airway lumen, levels of expression intermediate to those seen
on freshly isolated and IL-5 cultured eosinophils were observed.
These data suggest that at least a portion of the elevated levels
of .alpha..sub.d found after IL-5 culture is likely due to
increased transcription and translation of .alpha..sub.d
integrin.
Eosinophils Expressing .alpha..sub.d Bind to VCAM-1
[0523] Although .alpha..sub.d integrin has been shown to bind
ICAM-R and possibly mediate leukocyte-leukocyte adhesion [Van der
Vieren, et al., Immunity 3:683 (1995)], experiments were designed
to examine other possible ligands for .alpha..sub.d expressed on
eosinophils. In part because of previous studies suggesting
.beta..sub.2 integin-dependent, CD11b-independent eosinophil
adhesion to VCAM-1 [Matsumoto, et al., Blood 86:1437 (1995)],
initial studies were performed using immobilized recombinant
VCAM-1.
[0524] For both freshly purified and cultured eosinophils,
.sup.51Cr-labeled cell adhesion to VCAM-1 (250 ng/ml) or BSA (1%)
coated wells was performed for 30 minutes at 37.degree. C. as
previously described [Matsumoto, et al., Blood 86:1437 (1995)]. In
some experiments, cells were preincubated for 30 minutes at
4.degree. C. with saturating concentrations of one or more of the
following blocking monoclonal antibodies prior to examining
adhesion: anti-CD18 (7E4), anti-CD11a (MHM24), anti-CD11b (clone
44), anti-CD11c (BU-15), anti-.alpha..sub.d (240I), and
anti-.alpha..sub.4 (HP2/1).
[0525] For transfected and parental CHO cells, adhesion was
performed using coated plates identical to those employed for
eosinophil adhesion. Examination of the transformed CHO cells
indicated that .alpha..sub.d expression was relatively low, and as
a result, the interaction between CHO transfectants and VCAM-1 was
not as strongly detected as that between eosinophils and VCAM-1. A
modification of a previously described gentle washing technique
[Shanley, et al., J. Immunol. 160:1014 (1998)] was therefore
employed. This technique allowed non-adherent cells to be dislodged
from the inverted plate with centrifugation at 1.times.g for 30
minutes at 20.degree. C. Remaining adherent cells were then removed
using 0.1 M EDTA (Sigma) and counted by flow cytometry. In addition
to VCAM-1, E-selection (100 ng/ml) was also used to coat wells in
some adhesion experiments. In addition to the blocking monoclonal
antibodies used in the eosinophil studies, immobilized VCAM-1 was
pretreated with an appropriate dilution of F(ab' ).sub.2
anti-VCAM-1 monoclonal antibody prior to the addition of CHO
cells.
[0526] Results indicated that freshly isolated eosinophils adhered
to VCAM-1 and monoclonal antibody blocking of .alpha..sub.4
integrin effectively inhibited adhesion. Blocking with the
anti-CD11b antibody had no effect. Adhesion could also be
significantly and consistently inhibited by anti-.alpha..sub.d
monoclonal antibody 240I, albeit to a lesser degree (approximately
30% inhibition) than that observed using the anti-.alpha..sub.4
antibody.
[0527] Even more striking were results of VCAM-1 adhesion
experiments in which IL-5 cultured eosinophils, expressing enhanced
levels of .alpha..sub.d integrin, were employed. Under these
conditions, monoclonal antibodies to CD 18, .alpha..sub.d or
.alpha..sub.4 integrins were equally effective in reducing adhesion
to background levels, while a combination of blocking antibodies to
CD11a, CD11b, an CD11c had no effect. It was also observed that
IL-5 cultured eosinophils displayed enhanced background adhesion
and reduced VCAM-1 adhesion compared to that seen with freshly
isolated eosinophils. Based on monoclonal antibody blocking studies
with freshly isolated eosinophils, adhesion to VCAM-1 was mainly
mediated through .alpha..sub.4 integrins. However, in IL-5-cultured
eosinophils, adhesion to VCAM-1 was equally mediated by
.alpha..sub.4 and .alpha..sub.d integrins. Together, these data are
the first to demonstrate activation-dependent regulation of
.alpha..sub.d .beta..sub.2 integrin expression and function on
human eosinophils and document a novel function for .alpha..sub.d
.beta..sub.2 as an alternative ligand for VCAM-1.
[0528] Based on the result that .alpha..sub.d integrins on
eosinophils bind to VCAM-1 and can be upregulated with IL-5, this
leuko-integrin may play a role in cytokine-primed eosinophil
recruitment to inflammatory sites.
EXAMPLE 43
CHO Cells Expressing .alpha..sub.d Bind VCAM-1
[0529] To further verify that .alpha..sub.d.beta..sub.2 functions
as a ligand VCAM-1, CHO transfectants were generated expressing
human .alpha..sub.d and .beta..sub.2 integrin chains as
follows.
[0530] Chinese hamster ovary cells were transfected as described in
Example 11. The .alpha..sub.d.beta..sub.2-transfected CHO cells
were cultured in DMEM/F12 media with 1 mM pyruvate and 2 mM
L-glutamine (Biofluids) supplemented with 10% dialyzed FBS, 100
U/ml penicillin, 100 .mu.g/ml streptomycin, and 600 .mu.g/ml G418
(all from Life Technologies). Media for culture of the parental CHO
cell line was similar except that non-dialyzed FBS (Life
Technologies) was used and 0.1 mM hypoxanthine and 16 nM thymidine
(Sigma) were used in place of the G418. The transfected cells
expressed .alpha..sub.d and .beta..sub.2 integrin chains at modest
levels and did not express CD11a, CD11b, CD11c, or .alpha..sub.4
integrins. The parental CHO cell line failed to express any of
these integrins. Adhesion assays were performed as described above
in Example 42.
[0531] Results indicated that the .alpha..sub.d.beta..sub.2
transfected CHO cells adhered to VCAM-1 coated wells. Adhesion was
effectively blocked by an F(ab' ).sub.2 monoclonal antibody against
the first-domain of VCAM-1 as well as by monoclonal antibodies
against either CD18 or ad. In contrast, parental non-transfected
CHO cells failed to adhere to VCAM-1 and neither cell type
displayed significant adherence to wells coated with
E-selectin.
[0532] The finding that the monoclonal antibody to the
.alpha..sub.4 integrin binding site in the first domain of VCAM-1
completely blocked .alpha..sub.d .beta..sub.2 integrin dependent
VCAM-1 adhesion strongly suggested that the
.alpha..sub.d.beta..sub.2 binding site is near or identical to that
for .alpha..sub.4 integrins. Since there is little amino acid
homology between .alpha..sub.d and .alpha..sub.4 integrins, this
result was unexpected. Whether .alpha..sub.d.beta..sub.2 integrins
can bind to other a4 integrin ligands, such as fibronectin or
mucosal addressin cell adhesion molecule-1, is unknown.
VCAM-1 Regions Required for .alpha..sub.d Binding
[0533] The first two domains of VCAM-1 have been shown to support
binding of .alpha..sub.4 integrins and relevant amino acids in
those domains have been identified. In order to determine whether
.alpha..sub.d shares similar sites of recognition in the VCAM-1
molecules, a plasmid was constructed containing sequences for
domains 1 and 2 of VCAM-1 fused to human immunoglobulin Fc. In
addition, a modified version of the two domain VCAM-1 expression
construct was generated by PCR to include a substitution mutation
wherein alanine at residue 40 was replaced with an aspartate
residue. The two expression constructs were transiently transfected
into COS cells using the DEAE-Dextran protocol previously
described. Protein was purified from the culture supernatant using
Protein A Sepharose.RTM. as previously described.
[0534] The ability of CHO cells expressing either
.alpha..sub.4.beta..sub.- 1 or .alpha..sub.d.beta..sub.2 to bind a
five domain VCAM-1/Ig fusion protein or ICAM-1/Ig fusion protein
was tested as follows. CAMs were immobilized on 96 well microtiter
plates at 0.5 .mu.g/well in bicarbonate buffer (pH 9.5). Plates
were blocked with 1% fish gelatin and treated with either buffer,
irrelevant antibody or a blocking VCAM-1 antibody. The
.alpha..sub.d or a4 transformed CHO cells were treated with either
buffer only, irrelevant antibody of a monoclonal antibody specific
for the alpha chain (130K or 2171 for .alpha..sub.d or .alpha.4.1
for .alpha..sub.4) or a blocking alpha chain antibody. Cells were
washed before addition to the CAM-coated wells at a density of
100,000 cells per well. Cells were incubated in the presence of the
immobilized antibody for twenty minutes before addition of 5%
glutaraldehyde. Following fixation, plates were washed with
distilled water and cells were stained with 1% crystal violet,
After destaining with 66% ethanol for several hours, absorbance at
570 nm was measured on a Dynatech plate reader.
[0535] Results indicated that both .alpha..sub.d.beta..sub.2 and
.alpha..sub.4.beta..sub.1 recognized the five domain and two domain
forms of VCAM-1 to equivalent degrees indicating that additional
domains might not be required for binding. While differences were
detected between the .alpha..sub.d/VCAM-1 binding and
.alpha..sub.4NCAM-12 binding, it is likely that the differences
resulted from differential expression in the transformed CHO cells.
Binding of both cell lines was blocked by the VCAM-1 antibody (50
to 100%), .alpha..sub.4 antibody (100%) and .alpha..sub.d antibody
(50%). The .alpha..sub.4 transfected line did not recognize the
mutant VCAM-1 and binding of the .alpha..sub.d cell line to the
mutant was 50% of that detected with wild-type VCAM-1. Neither CHO
cell line exhibited binding of ICAM-1/Ig. Combined, these results
suggest that both .alpha..sub.d and .alpha..sub.4 recognize domains
1 and 2 of VCAM-1 and recognize overlapping, but not identical,
epitopes.
EXAMPLE 44
Targeting .alpha..sub.d as a Tumor Antigen
[0536] Spatially and temporally restricted expression of
.alpha..sub.d suggests that the molecule may serve as a target for
removal of pathogenic cell populations that express .alpha..sub.d
on the surface. Several previous observations lead to this
possibility.
[0537] For example, compared to other leukointegrins, .alpha..sub.d
expression is less widespread. Expression Of .alpha..sub.d appears
to be limited to a specialized and/or highly differentiated subset
of leukocytes. Unlike other leukointegrins, .alpha..sub.d
expression appears to be subject to regulation as evidenced by
rapid down regulation on primary or transformed cells in culture.
Monoclonal antibodies to .alpha..sub.d show variable reactivity
even though the antibodies are specific for .alpha..sub.d. For
example, the anti .alpha..sub.d antibody 212D shows limited
reactivity with normal tissue and highly differentiated myeloid
cells as compared to reactivity observed with another
anti-.alpha..sub.d monoclonal antibody 217L. Interestingly,
knockout .alpha..sub.d mice survive until birth and beyond, but
this observation provides little information relating to the
biological function of .alpha..sub.d. Finally, .alpha..sub.d
expression has been detected on an estimated 70% of canine
leukemias, and high levels of .alpha..sub.d expression have been
detected on freshly isolated NK leukemia cells from F344 rats
(Example 26). While tumor cells would be a preferred population for
clearance using .alpha..sub.d as the target, any undesirable cell
type that expresses .alpha..sub.d might also be cleared in the
manner described below.
[0538] One or more antibodies are selected with preference for
those exhibiting low level reactivity with normal tissue. One
possibility would be antibody 212D for reasons discussed above.
Appropriate control antibodies are also selected, including an
irrelevant antibody as negative control. Blood and tumor samples
are obtained from leukemia and lymphoma patients and screened by
immunocytochemistry and for cell surface expression with analysis
by FAS can, immunoprecipitation and Western blot analysis using the
selected antibodies. Detection of positive staining would then lead
to alternative procedures in developing the clearance method.
[0539] In one approach, the hypervariable region of the positive
staining antibody selected above is cloned and expressed in the
context of a complement-fixing human isotype. After subcloning and
isotype switching, specification and reactivity is again assessed
as described above including, for example, FACS analysis, histology
on normal tissue, and immunoprecipitation. A cassette vector was
developed for the purpose of expressing a chosen hypervariable
region in a human IgGI context. In addition, a series of primers
were designed and synthesized to facilitate amplification of a
hypervariable region of an antibody of interest from a hybridoma
cell line [Gavilondo-Cowley, et al., in HYBRIDOMA, Vol 9 No; 5,
1990, Mary Anne Leibert Inc., Publishers, Media, Pa., pp.407-417].
The resulting antibody is then tested in vitro to determine if its
binding in the presence of complement results in cell death.
Preferably, the in vitro assay is carried out using tumor cells.
Control assays will determine if the monoclonal antibody exhibits
the same activity in cell cultures that do not express
.alpha..sub.d.
[0540] The monoclonal antibody is also tested to determine if
binding results in internalization which indicates that the
antibody can be conjugated with a cytotoxic drug.
[0541] A preclinical model is developed wherein in vivo cytolytic
activity is examined. In one example, equivalency is examined in
the F344 rat model (Example 26). Another model is the SCID/Hu
system wherein human cells have been transplanted. For example,
myeloid U937 cells, Jurkat T cells, or human colon carcinoma HTC166
cells are transplanted into mice, tumors are harvested, and the
tumors are stained for surface antigens using anti-.alpha..sub.d
antibodies (e.g., 212D and 217L). Detection of .alpha..sub.d
expression leads to use of the antibodies in vivo to remove
tumors.
EXAMPLE 44
Human Anti-.alpha..sub.d Monoclonal Antibodies
[0542] Human monoclonal antibodies are identified by screening
antibody repertoires displayed on filamentous phage as previously
described [Waterhouse, et al., Nucl. Acids Res. 21:2265-2266
(1993); Parsons, et al., Protein Engineering 9:1043-1049 (1996)].
Briefly, functional V-gene segments from non-immunized human donors
are used to construct a repertoire of single-chain Fv (scFv)
fragments displayed on the surface of phage. Fragments are cloned
in a phagemid vector which permits both phage displayed and soluble
scFv to be produced without subcloning. A histidine tag has been
incorporated to allow rapid purification of scFv by nickel chelate
chromatography. Use of this library format generally permits
isolation of human monoclonal antibody fragments in less than two
weeks. Isolation is carried out as previously described [Marks, et
al., J Mol. Biol 222:581-597 (1991), Vaughan, et al, Nature
Biotechnol. 14:309-314 (1996)]. Preferably antibodies are
identified that specifically recognize the I domain
EXAMPLE 45
Anti-.alpha..sub.d Antibody Treatment in Motheaten Mice
[0543] In motheaten mutant mice [Koo, et al., J Immunol.
147:1194-1200 (1992); Koo. et al., J. Immunol. 151:6733-6741
(1993)], the autosomal recessive me.sup.v gene occurs spontaneously
as a point mutation of the hematopoietic cell protein tyrosine
phosphatase in C57BL/6 mice. Homozygotes develop a chronic
myelomonocytic inflammation involving accumulation of
myelomonocytic cells in the lung and skin which results in
interstitial pneumonitis, thymic atrophy, and T cell and NK cell
dysfunction. The inflammatory condition is transferable by bone
marrow cell of these mice indicating that the me.sup.v mutation is
due to a stem cell defect in the myelomonocytic pathway. Since
.alpha..sub.d is present in myeloid cells, a procedure was
undertaken to assess any inhibitory effects on the immunopathologic
changes with anti-.alpha..sub.d monoclonal antibody treatment in
normal mice following bone marrow transplant from motheaten mutant
mice.
[0544] C57BL/6J (B6)-me.sup.v/me.sup.v and their normal+/-siblings
(B6)-+/-mice were obtained from the Jackson Laboratory, Bar Harbor,
Me. Mice were maintained in a pathogen free environment with food
and water provided .alpha..sub.d libitum. All mice were six to ten
weeks old.
[0545] At Day -1, all mice received 2 .mu.g/ml .alpha.-NK1.1
antibody, PK136, Pharmingen) in 0.5 ml PBS via-intraperitoneal
injection. At Day 0, all B6 +/-mice were irradiated with 750 Rad.
Bone marrow was harvested from (B6) me.sup.v/me.sup.v as previously
described. Cells removed from tibia and femur were transferred to
supplemented RPMI culture media and incubated for two hours prior
to intravenous injection into the irradiated mice. Mice were
immediately treated with either anti-.alpha..sub.d antibody 205C or
irrelevant antibody at 5 mg/kg in 200 .mu.l PBS via intraperitoneal
injection. Purified 205C hamster anti-rat cross-reactive to mouse
.alpha..sub.d monoclonal antibody has been described above. As a
negative control, one group of mice received an equal volume saline
injection. On Days 4 through 25, mice were treated with either
antibody or saline injection every other day for a total often
treatments and animals were monitored for changes in weight and
signs of disease. In general, observations for each group were
continued for a total of two months.
[0546] A moribund state is the endpoint in the assay. Animals that
become very sick, however, are sacrificed. Survival rate among the
groups are assessed and histological analyses of tissue are used as
additional indicators of the efficacy of .alpha..sub.d antibody
treatment. A similar study looking at the therapeutic properties of
.alpha..sub.d antibodies is conducted to complement the
prophylactic study described above.
[0547] As of day 35, none of the mice treated with the
.alpha..sub.d antibody had dies, while two of the nine mice in the
saline treated group had died and three of the remaining seven were
developing conditions typical of the syndrome. In the group treated
with irrelevant antibody, three of the eight had died.
EXAMPLE 46
Expression of .alpha..sub.d on Human Leukemias
[0548] Leukemias can be divided into two classes, myeloid and
lymphoid, according to cell lineage and both of these classes can
be further distinguished as acute or chronic. Because of the
apparent restriction of .alpha..sub.d expression to myeloid lineage
cells, it was hypothesized that myeloid, but not lymphocytic,
leukemias express .alpha..sub.d. A second line of inquiry, if the
first hypothesis was correct, was to determine if .alpha..sub.d
expression varied according to pathogenicity, thereby implying a
disease-related function for .alpha..sub.d on these cells.
[0549] Expression of .alpha..sub.d on peripheral blood cells has
been detected using antibodies 212D and 217L as described in
Example 18. In the examination of leukemia cells, normal bone
marrow cells were first analyzed by flow cytometric methods for
.alpha..sub.d expression to establish a baseline for this cell
type. Antibodies 212D and 217L were used to stain patient samples
according to standard protocols and both antibodies exhibited weak
reactivity with monocytes in the marrow. Antibody 212D was only
marginally positive.
[0550] Flow cytometric analysis of leukemic cells from either
peripheral blood or bone marrow of patients indicated the presence
of 212D and 217L epitopes on myeloid blasts and monoblasts in three
actue myelogenous leukemia (AML) patients. Expression was also
observed on cells from a patient with chronic lymphocytic leukemia
(CLL). Cells from another AML patient were evaluated at a later
date and found to be .alpha..sub.d positive. Expression of
.alpha..sub.d on the cells was 50 to 100% higher than control
monoclonal antibodies, but significantly lower than CD11a, CD11b,
and CD11c expression levels.
[0551] In light of these results, the U937 cell line, a myeloid
lineage leukemia equivalent to stage M-4 (on a differentiation
scale of M1-M5) AML cells, was also evaluated. The expression
patterns of CD11a, CD11b, CD11c, and .alpha..sub.d were similar to
those of AML patient cells. Interestingly, the presence of
cell-surface .alpha..sub.d protein was dependent on culture
conditions. Rich medium with high serum levels (Iscove's Modified
Dulbecco's Medium, 20% FBS) supported .alpha..sub.d expression,
while basic culture medium (RPMI, 10% FBS) did not.
[0552] The finding that .alpha..sub.d expression was detected on
lymphoblasts from a CLL patient indicates that .alpha..sub.d can be
expressed in lymphocyte-lineage cells and is consistent with other
data (i.e., .alpha..sub.d expression on rat CD5.sup.+ cells and
canine CD8.sup.+ cells). The relatively high level expression of
other leukointegrins on these cells would preclude use of these
cells to examine .alpha..sub.d function in a reproducible fashion,
and suggests that the functional redundancy of this family would
compensate for inhibition of one member in these cell types. In
fact, .alpha..sub.d expression by these cells may be coincidental
to aberrant transcription.
[0553] While these experiments did not fully support the initial
hypotheses, the presence of .alpha..sub.d protein on both myeloid
and lymphoid lineage leukemias suggests that a broad patient
population may benefit from use of anti-.alpha..sub.d therapies
aimed at tumor removal rather than functional inhibition.
[0554] Numerous modifications and variations in the invention as
set forth in the above illustrative examples are expected to occur
to those skilled in the art. Consequently only such limitations as
appear in the appended claims should be placed on the invention.
Sequence CWU 1
1
114 1 3726 DNA Homo sapiens CDS (3)..(3485) 1 tg acc ttc ggc act
gtg ctt ctt ctg agt gtc ctg gct tct tat cat 47 Thr Phe Gly Thr Val
Leu Leu Leu Ser Val Leu Ala Ser Tyr His 1 5 10 15 gga ttc aac ctg
gat gtg gag gag cct acg atc ttc cag gag gat gca 95 Gly Phe Asn Leu
Asp Val Glu Glu Pro Thr Ile Phe Gln Glu Asp Ala 20 25 30 ggc ggc
ttt ggg cag agc gtg gtg cag ttc ggt gga tct cga ctc gtg 143 Gly Gly
Phe Gly Gln Ser Val Val Gln Phe Gly Gly Ser Arg Leu Val 35 40 45
gtg gga gca ccc ctg gag gtg gtg gcg gcc aac cag acg gga cgg ctg 191
Val Gly Ala Pro Leu Glu Val Val Ala Ala Asn Gln Thr Gly Arg Leu 50
55 60 tat gac tgc gca gct gcc acc ggc atg tgc cag ccc atc ccg ctg
cac 239 Tyr Asp Cys Ala Ala Ala Thr Gly Met Cys Gln Pro Ile Pro Leu
His 65 70 75 atc cgc cct gag gcc gtg aac atg tcc ttg ggc ctg acc
ctg gca gcc 287 Ile Arg Pro Glu Ala Val Asn Met Ser Leu Gly Leu Thr
Leu Ala Ala 80 85 90 95 tcc acc aac ggc tcc cgg ctc ctg gcc tgt ggc
ccg acc ctg cac aga 335 Ser Thr Asn Gly Ser Arg Leu Leu Ala Cys Gly
Pro Thr Leu His Arg 100 105 110 gtc tgt ggg gag aac tca tac tca aag
ggt tcc tgc ctc ctg ctg ggc 383 Val Cys Gly Glu Asn Ser Tyr Ser Lys
Gly Ser Cys Leu Leu Leu Gly 115 120 125 tcg cgc tgg gag atc atc cag
aca gtc ccc gac gcc acg cca gag tgt 431 Ser Arg Trp Glu Ile Ile Gln
Thr Val Pro Asp Ala Thr Pro Glu Cys 130 135 140 cca cat caa gag atg
gac atc gtc ttc ctg att gac ggc tct gga agc 479 Pro His Gln Glu Met
Asp Ile Val Phe Leu Ile Asp Gly Ser Gly Ser 145 150 155 att gac caa
aat gac ttt aac cag atg aag ggc ttt gtc caa gct gtc 527 Ile Asp Gln
Asn Asp Phe Asn Gln Met Lys Gly Phe Val Gln Ala Val 160 165 170 175
atg ggc cag ttt gag ggc act gac acc ctg ttt gca ctg atg cag tac 575
Met Gly Gln Phe Glu Gly Thr Asp Thr Leu Phe Ala Leu Met Gln Tyr 180
185 190 tca aac ctc ctg aag atc cac ttc acc ttc acc caa ttc cgg acc
agc 623 Ser Asn Leu Leu Lys Ile His Phe Thr Phe Thr Gln Phe Arg Thr
Ser 195 200 205 ccg agc cag cag agc ctg gtg gat ccc atc gtc caa ctg
aaa ggc ctg 671 Pro Ser Gln Gln Ser Leu Val Asp Pro Ile Val Gln Leu
Lys Gly Leu 210 215 220 acg ttc acg gcc acg ggc atc ctg aca gtg gtg
aca cag cta ttt cat 719 Thr Phe Thr Ala Thr Gly Ile Leu Thr Val Val
Thr Gln Leu Phe His 225 230 235 cat aag aat ggg gcc cga aaa agt gcc
aag aag atc ctc att gtc atc 767 His Lys Asn Gly Ala Arg Lys Ser Ala
Lys Lys Ile Leu Ile Val Ile 240 245 250 255 aca gat ggg cag aag tac
aaa gac ccc ctg gaa tac agt gat gtc atc 815 Thr Asp Gly Gln Lys Tyr
Lys Asp Pro Leu Glu Tyr Ser Asp Val Ile 260 265 270 ccc cag gca gag
aag gct ggc atc atc cgc tac gct atc ggg gtg gga 863 Pro Gln Ala Glu
Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val Gly 275 280 285 cac gct
ttc cag gga ccc act gcc agg cag gag ctg aat acc atc agc 911 His Ala
Phe Gln Gly Pro Thr Ala Arg Gln Glu Leu Asn Thr Ile Ser 290 295 300
tca gcg cct ccg cag gac cac gtg ttc aag gtg gac aac ttt gca gcc 959
Ser Ala Pro Pro Gln Asp His Val Phe Lys Val Asp Asn Phe Ala Ala 305
310 315 ctt ggc agc atc cag aag cag ctg cag gag aag atc tat gca gtt
gag 1007 Leu Gly Ser Ile Gln Lys Gln Leu Gln Glu Lys Ile Tyr Ala
Val Glu 320 325 330 335 gga acc cag tcc agg gca agc agc tcc ttc cag
cac gag atg tcc caa 1055 Gly Thr Gln Ser Arg Ala Ser Ser Ser Phe
Gln His Glu Met Ser Gln 340 345 350 gaa ggc ttc agc aca gcc ctc aca
atg gat ggc ctc ttc ctg ggg gct 1103 Glu Gly Phe Ser Thr Ala Leu
Thr Met Asp Gly Leu Phe Leu Gly Ala 355 360 365 gtg ggg agc ttt agc
tgg tct gga ggt gcc ttc ctg tat ccc cca aat 1151 Val Gly Ser Phe
Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Asn 370 375 380 atg agc
ccc acc ttc atc aac atg tct cag gag aat gtg gac atg agg 1199 Met
Ser Pro Thr Phe Ile Asn Met Ser Gln Glu Asn Val Asp Met Arg 385 390
395 gac tct tac ctg ggt tac tcc acc gag cta gcc ctg tgg aag ggg gta
1247 Asp Ser Tyr Leu Gly Tyr Ser Thr Glu Leu Ala Leu Trp Lys Gly
Val 400 405 410 415 cag aac ctg gtc ctg ggg gcc ccc cgc tac cag cat
acc ggg aag gct 1295 Gln Asn Leu Val Leu Gly Ala Pro Arg Tyr Gln
His Thr Gly Lys Ala 420 425 430 gtc atc ttc acc cag gtg tcc agg caa
tgg agg aag aag gcc gaa gtc 1343 Val Ile Phe Thr Gln Val Ser Arg
Gln Trp Arg Lys Lys Ala Glu Val 435 440 445 aca ggg acg cag atc ggc
tcc tac ttc ggg gcc tcc ctc tgc tcc gtg 1391 Thr Gly Thr Gln Ile
Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser Val 450 455 460 2 1161 PRT
Homo sapiens 2 Thr Phe Gly Thr Val Leu Leu Leu Ser Val Leu Ala Ser
Tyr His Gly 1 5 10 15 Phe Asn Leu Asp Val Glu Glu Pro Thr Ile Phe
Gln Glu Asp Ala Gly 20 25 30 Gly Phe Gly Gln Ser Val Val Gln Phe
Gly Gly Ser Arg Leu Val Val 35 40 45 Gly Ala Pro Leu Glu Val Val
Ala Ala Asn Gln Thr Gly Arg Leu Tyr 50 55 60 Asp Cys Ala Ala Ala
Thr Gly Met Cys Gln Pro Ile Pro Leu His Ile 65 70 75 80 Arg Pro Glu
Ala Val Asn Met Ser Leu Gly Leu Thr Leu Ala Ala Ser 85 90 95 Thr
Asn Gly Ser Arg Leu Leu Ala Cys Gly Pro Thr Leu His Arg Val 100 105
110 Cys Gly Glu Asn Ser Tyr Ser Lys Gly Ser Cys Leu Leu Leu Gly Ser
115 120 125 Arg Trp Glu Ile Ile Gln Thr Val Pro Asp Ala Thr Pro Glu
Cys Pro 130 135 140 His Gln Glu Met Asp Ile Val Phe Leu Ile Asp Gly
Ser Gly Ser Ile 145 150 155 160 Asp Gln Asn Asp Phe Asn Gln Met Lys
Gly Phe Val Gln Ala Val Met 165 170 175 Gly Gln Phe Glu Gly Thr Asp
Thr Leu Phe Ala Leu Met Gln Tyr Ser 180 185 190 Asn Leu Leu Lys Ile
His Phe Thr Phe Thr Gln Phe Arg Thr Ser Pro 195 200 205 Ser Gln Gln
Ser Leu Val Asp Pro Ile Val Gln Leu Lys Gly Leu Thr 210 215 220 Phe
Thr Ala Thr Gly Ile Leu Thr Val Val Thr Gln Leu Phe His His 225 230
235 240 Lys Asn Gly Ala Arg Lys Ser Ala Lys Lys Ile Leu Ile Val Ile
Thr 245 250 255 Asp Gly Gln Lys Tyr Lys Asp Pro Leu Glu Tyr Ser Asp
Val Ile Pro 260 265 270 Gln Ala Glu Lys Ala Gly Ile Ile Arg Tyr Ala
Ile Gly Val Gly His 275 280 285 Ala Phe Gln Gly Pro Thr Ala Arg Gln
Glu Leu Asn Thr Ile Ser Ser 290 295 300 Ala Pro Pro Gln Asp His Val
Phe Lys Val Asp Asn Phe Ala Ala Leu 305 310 315 320 Gly Ser Ile Gln
Lys Gln Leu Gln Glu Lys Ile Tyr Ala Val Glu Gly 325 330 335 Thr Gln
Ser Arg Ala Ser Ser Ser Phe Gln His Glu Met Ser Gln Glu 340 345 350
Gly Phe Ser Thr Ala Leu Thr Met Asp Gly Leu Phe Leu Gly Ala Val 355
360 365 Gly Ser Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Asn
Met 370 375 380 Ser Pro Thr Phe Ile Asn Met Ser Gln Glu Asn Val Asp
Met Arg Asp 385 390 395 400 Ser Tyr Leu Gly Tyr Ser Thr Glu Leu Ala
Leu Trp Lys Gly Val Gln 405 410 415 Asn Leu Val Leu Gly Ala Pro Arg
Tyr Gln His Thr Gly Lys Ala Val 420 425 430 Ile Phe Thr Gln Val Ser
Arg Gln Trp Arg Lys Lys Ala Glu Val Thr 435 440 445 Gly Thr Gln Ile
Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser Val Asp 450 455 460 Val Asp
Ser Asp Gly Ser Thr Asp Leu Ile Leu Ile Gly Ala Pro His 465 470 475
480 Tyr Tyr Glu Gln Thr Arg Gly Gly Gln Val Ser Val Cys Pro Leu Pro
485 490 495 Arg Gly Gln Arg Val Gln Trp Gln Cys Asp Ala Val Leu Arg
Gly Glu 500 505 510 Gln Gly His Pro Trp Gly Arg Phe Gly Ala Ala Leu
Thr Val Leu Gly 515 520 525 Asp Val Asn Glu Asp Lys Leu Ile Asp Val
Ala Ile Gly Ala Pro Gly 530 535 540 Glu Gln Glu Asn Arg Gly Ala Val
Tyr Leu Phe His Gly Ala Ser Glu 545 550 555 560 Ser Gly Ile Ser Pro
Ser His Ser Gln Arg Ile Ala Ser Ser Gln Leu 565 570 575 Ser Pro Arg
Leu Gln Tyr Phe Gly Gln Ala Leu Ser Gly Gly Gln Asp 580 585 590 Leu
Thr Gln Asp Gly Leu Met Asp Leu Ala Val Gly Ala Arg Gly Gln 595 600
605 Val Leu Leu Leu Arg Ser Leu Pro Val Leu Lys Val Gly Val Ala Met
610 615 620 Arg Phe Ser Pro Val Glu Val Ala Lys Ala Val Tyr Arg Cys
Trp Glu 625 630 635 640 Glu Lys Pro Ser Ala Leu Glu Ala Gly Asp Ala
Thr Val Cys Leu Thr 645 650 655 Ile Gln Lys Ser Ser Leu Asp Gln Leu
Gly Asp Ile Gln Ser Ser Val 660 665 670 Arg Phe Asp Leu Ala Leu Asp
Pro Gly Arg Leu Thr Ser Arg Ala Ile 675 680 685 Phe Asn Glu Thr Lys
Asn Pro Thr Leu Thr Arg Arg Lys Thr Leu Gly 690 695 700 Leu Gly Ile
His Cys Glu Thr Leu Lys Leu Leu Leu Pro Asp Cys Val 705 710 715 720
Glu Asp Val Val Ser Pro Ile Ile Leu His Leu Asn Phe Ser Leu Val 725
730 735 Arg Glu Pro Ile Pro Ser Pro Gln Asn Leu Arg Pro Val Leu Ala
Val 740 745 750 Gly Ser Gln Asp Leu Phe Thr Ala Ser Leu Pro Phe Glu
Lys Asn Cys 755 760 765 Gly Gln Asp Gly Leu Cys Glu Gly Asp Leu Gly
Val Thr Leu Ser Phe 770 775 780 Ser Gly Leu Gln Thr Leu Thr Val Gly
Ser Ser Leu Glu Leu Asn Val 785 790 795 800 Ile Val Thr Val Trp Asn
Ala Gly Glu Asp Ser Tyr Gly Thr Val Val 805 810 815 Ser Leu Tyr Tyr
Pro Ala Gly Leu Ser His Arg Arg Val Ser Gly Ala 820 825 830 Gln Lys
Gln Pro His Gln Ser Ala Leu Arg Leu Ala Cys Glu Thr Val 835 840 845
Pro Thr Glu Asp Glu Gly Leu Arg Ser Ser Arg Cys Ser Val Asn His 850
855 860 Pro Ile Phe His Glu Gly Ser Asn Gly Thr Phe Ile Val Thr Phe
Asp 865 870 875 880 Val Ser Tyr Lys Ala Thr Leu Gly Asp Arg Met Leu
Met Arg Ala Ser 885 890 895 Ala Ser Ser Glu Asn Asn Lys Ala Ser Ser
Ser Lys Ala Thr Phe Gln 900 905 910 Leu Glu Leu Pro Val Lys Tyr Ala
Val Tyr Thr Met Ile Ser Arg Gln 915 920 925 Glu Glu Ser Thr Lys Tyr
Phe Asn Phe Ala Thr Ser Asp Glu Lys Lys 930 935 940 Met Lys Glu Ala
Glu His Arg Tyr Arg Val Asn Asn Leu Ser Gln Arg 945 950 955 960 Asp
Leu Ala Ile Ser Ile Asn Phe Trp Val Pro Val Leu Leu Asn Gly 965 970
975 Val Ala Val Trp Asp Val Val Met Glu Ala Pro Ser Gln Ser Leu Pro
980 985 990 Cys Val Ser Glu Arg Lys Pro Pro Gln His Ser Asp Phe Leu
Thr Gln 995 1000 1005 Ile Ser Arg Ser Pro Met Leu Asp Cys Ser Ile
Ala Asp Cys Leu Gln 1010 1015 1020 Phe Arg Cys Asp Val Pro Ser Phe
Ser Val Gln Glu Glu Leu Asp Phe 025 1030 1035 104 Thr Leu Lys Gly
Asn Leu Ser Phe Gly Trp Val Arg Glu Thr Leu Gln 1045 1050 1055 Lys
Lys Val Leu Val Val Ser Val Ala Glu Ile Thr Phe Asp Thr Ser 1060
1065 1070 Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala Phe Met Arg Ala
Gln Met 1075 1080 1085 Glu Met Val Leu Glu Glu Asp Glu Val Tyr Asn
Ala Ile Pro Ile Ile 1090 1095 1100 Met Gly Ser Ser Val Gly Ala Leu
Leu Leu Leu Ala Leu Ile Thr Ala 105 1110 1115 112 Thr Leu Tyr Lys
Leu Gly Phe Phe Lys Arg His Tyr Lys Glu Met Leu 1125 1130 1135 Glu
Asp Lys Pro Glu Asp Thr Ala Thr Phe Ser Gly Asp Asp Phe Ser 1140
1145 1150 Cys Val Ala Pro Asn Val Pro Leu Ser 1155 1160 3 1153 PRT
Homo sapiens 3 Met Ala Leu Arg Val Leu Leu Leu Thr Ala Leu Thr Leu
Cys His Gly 1 5 10 15 Phe Asn Leu Asp Thr Glu Asn Ala Met Thr Phe
Gln Glu Asn Ala Arg 20 25 30 Gly Phe Gly Gln Ser Val Val Gln Leu
Gln Gly Ser Arg Val Val Val 35 40 45 Gly Ala Pro Gln Glu Ile Val
Ala Ala Asn Gln Arg Gly Ser Leu Tyr 50 55 60 Gln Cys Asp Tyr Ser
Thr Gly Ser Cys Glu Pro Ile Arg Leu Gln Val 65 70 75 80 Pro Val Glu
Ala Val Asn Met Ser Leu Gly Leu Ser Leu Ala Ala Thr 85 90 95 Thr
Ser Pro Pro Gln Leu Leu Ala Cys Gly Pro Thr Val His Gln Thr 100 105
110 Cys Ser Glu Asn Thr Tyr Val Lys Gly Leu Cys Phe Leu Phe Gly Ser
115 120 125 Asn Leu Arg Gln Gln Pro Gln Lys Phe Pro Glu Ala Leu Arg
Gly Cys 130 135 140 Pro Gln Glu Asp Ser Asp Ile Ala Phe Leu Ile Asp
Gly Ser Gly Ser 145 150 155 160 Ile Ile Pro His Asp Phe Arg Arg Met
Lys Glu Phe Val Ser Thr Val 165 170 175 Met Glu Gln Leu Lys Lys Ser
Lys Thr Leu Phe Ser Leu Met Gln Tyr 180 185 190 Ser Glu Glu Phe Arg
Ile His Phe Thr Phe Lys Glu Phe Gln Asn Asn 195 200 205 Pro Asn Pro
Arg Ser Leu Val Lys Pro Ile Thr Gln Leu Leu Gly Arg 210 215 220 Thr
His Thr Ala Thr Gly Ile Arg Lys Val Val Arg Glu Leu Phe Asn 225 230
235 240 Ile Thr Asn Gly Ala Arg Lys Asn Ala Phe Lys Ile Leu Val Val
Ile 245 250 255 Thr Asp Gly Glu Lys Phe Gly Asp Pro Leu Gly Tyr Glu
Asp Val Ile 260 265 270 Pro Glu Ala Asp Arg Glu Gly Val Ile Arg Tyr
Val Ile Gly Val Gly 275 280 285 Asp Ala Phe Arg Ser Glu Lys Ser Arg
Gln Glu Leu Asn Thr Ile Ala 290 295 300 Ser Lys Pro Pro Arg Asp His
Val Phe Gln Val Asn Asn Phe Glu Ala 305 310 315 320 Leu Lys Thr Ile
Gln Asn Gln Leu Arg Glu Lys Ile Phe Ala Ile Glu 325 330 335 Gly Thr
Gln Thr Gly Ser Ser Ser Ser Phe Glu His Glu Met Ser Gln 340 345 350
Glu Gly Phe Ser Ala Ala Ile Thr Ser Asn Gly Pro Leu Leu Ser Thr 355
360 365 Val Gly Ser Tyr Asp Trp Ala Gly Gly Val Phe Leu Tyr Thr Ser
Lys 370 375 380 Glu Lys Ser Thr Phe Ile Asn Met Thr Arg Val Asp Ser
Asp Met Asn 385 390 395 400 Asp Ala Tyr Leu Gly Tyr Ala Ala Ala Ile
Ile Leu Arg Asn Arg Val 405 410 415 Gln Ser Leu Val Leu Gly Ala Pro
Arg Tyr Gln His Ile Gly Leu Val 420 425 430 Ala Met Phe Arg Gln Asn
Thr Gly Met Trp Glu Ser Asn Ala Asn Val 435 440 445 Lys Gly Thr Gln
Ile Gly Ala Tyr Phe Gly Ala Ser Leu Cys Ser Val 450 455 460 Asp Val
Asp Ser Asn Gly Ser Thr Asp Leu Val Leu Ile Gly Ala Pro 465 470 475
480 His Tyr Tyr Glu Gln Thr Arg Gly Gly Gln Val Ser Val Cys Pro Leu
485 490 495 Pro Arg Gly Gln Arg Ala Arg Trp Gln Cys Asp Ala Val Leu
Tyr Gly 500 505 510 Glu Gln Gly Gln Pro Trp Gly Arg Phe Gly Ala Ala
Leu Thr Val Leu 515 520 525
Gly Asp Val Asn Gly Asp Lys Leu Thr Asp Val Ala Ile Gly Ala Pro 530
535 540 Gly Glu Glu Asp Asn Arg Gly Ala Val Tyr Leu Phe His Gly Thr
Ser 545 550 555 560 Gly Ser Gly Ile Ser Pro Ser His Ser Gln Arg Ile
Ala Gly Ser Lys 565 570 575 Leu Ser Pro Arg Leu Gln Tyr Phe Gly Gln
Ser Leu Ser Gly Gly Gln 580 585 590 Asp Leu Thr Met Asp Gly Leu Val
Asp Leu Thr Val Gly Ala Gln Gly 595 600 605 His Val Leu Leu Leu Arg
Ser Gln Pro Val Leu Arg Val Lys Ala Ile 610 615 620 Met Glu Phe Asn
Pro Arg Glu Val Ala Arg Asn Val Phe Glu Cys Asn 625 630 635 640 Asp
Gln Val Val Lys Gly Lys Glu Ala Gly Glu Val Arg Val Cys Leu 645 650
655 His Val Gln Lys Ser Thr Arg Asp Arg Leu Arg Glu Gly Gln Ile Gln
660 665 670 Ser Val Val Thr Tyr Asp Leu Ala Leu Asp Ser Gly Arg Pro
His Ser 675 680 685 Arg Ala Val Phe Asn Glu Thr Lys Asn Ser Thr Arg
Arg Gln Thr Gln 690 695 700 Val Leu Gly Leu Thr Gln Thr Cys Glu Thr
Leu Lys Leu Gln Leu Pro 705 710 715 720 Asn Cys Ile Glu Asp Pro Val
Ser Pro Ile Val Leu Arg Leu Asn Phe 725 730 735 Ser Leu Val Gly Thr
Pro Leu Ser Ala Phe Gly Asn Leu Arg Pro Val 740 745 750 Leu Ala Glu
Asp Ala Gln Arg Leu Phe Thr Ala Leu Phe Pro Phe Glu 755 760 765 Lys
Asn Cys Gly Asn Asp Asn Ile Cys Gln Asp Asp Leu Ser Ile Thr 770 775
780 Phe Ser Phe Met Ser Leu Asp Cys Leu Val Val Gly Gly Pro Arg Glu
785 790 795 800 Phe Asn Val Thr Val Thr Val Arg Asn Asp Gly Glu Asp
Ser Tyr Arg 805 810 815 Thr Gln Val Thr Phe Phe Phe Pro Leu Asp Leu
Ser Tyr Arg Lys Val 820 825 830 Ser Thr Leu Gln Asn Gln Arg Ser Gln
Arg Ser Trp Arg Leu Ala Cys 835 840 845 Glu Ser Ala Ser Ser Thr Glu
Val Ser Gly Ala Leu Lys Ser Thr Ser 850 855 860 Cys Ser Ile Asn His
Pro Ile Phe Pro Glu Asn Ser Glu Val Thr Phe 865 870 875 880 Asn Ile
Thr Phe Asp Val Asp Ser Lys Ala Ser Leu Gly Asn Lys Leu 885 890 895
Leu Leu Lys Ala Asn Val Thr Ser Glu Asn Asn Met Pro Arg Thr Asn 900
905 910 Lys Thr Glu Phe Gln Leu Glu Leu Pro Val Lys Tyr Ala Val Tyr
Met 915 920 925 Val Val Thr Ser His Gly Val Ser Thr Lys Tyr Leu Asn
Phe Thr Ala 930 935 940 Ser Glu Asn Thr Ser Arg Val Met Gln His Gln
Tyr Gln Val Ser Asn 945 950 955 960 Leu Gly Gln Arg Ser Leu Pro Ile
Ser Leu Val Phe Leu Val Pro Val 965 970 975 Arg Leu Asn Gln Thr Val
Ile Trp Asp Arg Pro Gln Val Thr Phe Ser 980 985 990 Glu Asn Leu Ser
Ser Thr Cys His Thr Lys Glu Arg Leu Pro Ser His 995 1000 1005 Ser
Asp Phe Leu Ala Glu Leu Arg Lys Ala Pro Val Val Asn Cys Ser 1010
1015 1020 Ile Ala Val Cys Gln Arg Ile Gln Cys Asp Ile Pro Phe Phe
Gly Ile 1025 1030 1035 1040 Gln Glu Glu Phe Asn Ala Thr Leu Lys Gly
Asn Leu Ser Phe Asp Trp 1045 1050 1055 Tyr Ile Lys Thr Ser His Asn
His Leu Leu Ile Val Ser Thr Ala Glu 1060 1065 1070 Ile Leu Phe Asn
Asp Ser Val Phe Thr Leu Leu Pro Gly Gln Gly Ala 1075 1080 1085 Phe
Val Arg Ser Gln Thr Glu Thr Lys Val Glu Pro Phe Glu Val Pro 1090
1095 1100 Asn Pro Leu Pro Leu Ile Val Gly Ser Ser Val Gly Gly Leu
Leu Leu 1105 1110 1115 1120 Leu Ala Leu Ile Thr Ala Ala Leu Tyr Lys
Leu Gly Phe Phe Lys Arg 1125 1130 1135 Gln Tyr Lys Asp Met Met Ser
Glu Gly Gly Pro Pro Gly Ala Glu Pro 1140 1145 1150 Gln 4 1163 PRT
Homo sapiens 4 Met Thr Arg Thr Arg Ala Ala Leu Leu Leu Phe Thr Ala
Leu Ala Thr 1 5 10 15 Ser Leu Gly Phe Asn Leu Asp Thr Glu Glu Leu
Thr Ala Phe Arg Val 20 25 30 Asp Ser Ala Gly Phe Gly Asp Ser Val
Val Gln Tyr Ala Asn Ser Trp 35 40 45 Val Val Val Gly Ala Pro Gln
Lys Ile Ile Ala Ala Asn Gln Ile Gly 50 55 60 Gly Leu Tyr Gln Cys
Gly Tyr Ser Thr Gly Ala Cys Glu Pro Ile Gly 65 70 75 80 Leu Gln Val
Pro Pro Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu 85 90 95 Ala
Ser Thr Thr Ser Pro Ser Gln Leu Leu Ala Cys Gly Pro Thr Val 100 105
110 His His Glu Cys Gly Arg Asn Met Tyr Leu Thr Gly Leu Cys Phe Leu
115 120 125 Leu Gly Pro Thr Gln Leu Thr Gln Arg Leu Pro Val Ser Arg
Gln Glu 130 135 140 Cys Pro Arg Gln Glu Gln Asp Ile Val Phe Leu Ile
Asp Gly Ser Gly 145 150 155 160 Ser Ile Ser Ser Arg Asn Phe Ala Thr
Met Met Asn Phe Val Arg Ala 165 170 175 Val Ile Ser Gln Phe Gln Arg
Pro Ser Thr Gln Phe Ser Leu Met Gln 180 185 190 Phe Ser Asn Lys Phe
Gln Thr His Phe Thr Phe Glu Glu Phe Arg Arg 195 200 205 Thr Ser Asn
Pro Leu Ser Leu Leu Ala Ser Val His Gln Leu Gln Gly 210 215 220 Phe
Thr Tyr Thr Ala Thr Ala Ile Gln Asn Val Val His Arg Leu Phe 225 230
235 240 His Ala Ser Tyr Gly Ala Arg Arg Asp Ala Ile Lys Ile Leu Ile
Val 245 250 255 Ile Thr Asp Gly Lys Lys Glu Gly Asp Ser Leu Asp Tyr
Lys Asp Val 260 265 270 Ile Pro Met Ala Asp Ala Ala Gly Ile Ile Arg
Tyr Ala Ile Gly Val 275 280 285 Gly Leu Ala Phe Gln Asn Arg Asn Ser
Trp Lys Glu Leu Asn Asp Ile 290 295 300 Ala Ser Lys Pro Ser Gln Glu
His Ile Phe Lys Val Glu Asp Phe Asp 305 310 315 320 Ala Leu Lys Asp
Ile Gln Asn Gln Leu Lys Glu Lys Ile Phe Ala Ile 325 330 335 Glu Gly
Thr Glu Thr Ile Ser Ser Ser Ser Phe Glu Leu Glu Met Ala 340 345 350
Gln Glu Gly Phe Ser Ala Val Phe Thr Pro Asp Gly Pro Val Leu Gly 355
360 365 Ala Val Gly Ser Phe Thr Trp Ser Gly Gly Ala Phe Leu Tyr Pro
Pro 370 375 380 Asn Met Ser Pro Thr Phe Ile Asn Met Ser Gln Glu Asn
Val Asp Met 385 390 395 400 Arg Asp Ser Tyr Leu Gly Tyr Ser Thr Glu
Leu Ala Leu Trp Lys Gly 405 410 415 Val Gln Ser Leu Val Leu Gly Ala
Pro Arg Tyr Gln His Ile Gly Lys 420 425 430 Ala Val Ile Phe Ile Gln
Val Ser Arg Gln Trp Arg Met Lys Ala Glu 435 440 445 Val Ile Gly Thr
Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser 450 455 460 Val Asp
Val Asp Thr Asp Gly Ser Thr Asp Leu Val Leu Ile Gly Ala 465 470 475
480 Pro His Tyr Tyr Glu Gln Thr Arg Gly Gly Gln Val Ser Val Cys Pro
485 490 495 Leu Pro Arg Gly Trp Arg Arg Trp Trp Cys Asp Ala Val Leu
Tyr Gly 500 505 510 Glu Gln Gly His Pro Trp Gly Arg Phe Gly Ala Ala
Leu Thr Val Leu 515 520 525 Gly Asp Val Asn Gly Asp Lys Leu Thr Asp
Val Val Ile Gly Ala Pro 530 535 540 Gly Glu Glu Glu Asn Arg Gly Ala
Val Tyr Leu Phe His Gly Val Leu 545 550 555 560 Gly Pro Ser Ile Ser
Pro Ser His Ser Gln Arg Ile Ala Gly Ser Gln 565 570 575 Leu Ser Ser
Arg Leu Gln Tyr Phe Gly Gln Ala Leu Ser Gly Gly Gln 580 585 590 Asp
Leu Thr Gln Asp Gly Leu Val Asp Leu Ala Val Gly Ala Arg Gly 595 600
605 Gln Val Leu Leu Leu Arg Thr Arg Pro Val Leu Trp Val Gly Val Ser
610 615 620 Met Gln Phe Ile Pro Ala Glu Ile Pro Arg Ser Ala Phe Glu
Cys Arg 625 630 635 640 Glu Gln Val Val Ser Glu Gln Thr Leu Val Gln
Ser Asn Ile Cys Leu 645 650 655 Tyr Ile Asp Lys Arg Ser Lys Asn Leu
Leu Gly Ser Arg Asp Leu Gln 660 665 670 Ser Ser Val Thr Leu Asp Leu
Ala Leu Ala Pro Gly Arg Leu Ser Pro 675 680 685 Arg Ala Ile Phe Gln
Glu Thr Lys Asn Arg Ser Leu Ser Arg Val Arg 690 695 700 Val Leu Gly
Leu Lys Ala His Cys Glu Asn Phe Asn Leu Leu Leu Pro 705 710 715 720
Ser Cys Val Glu Asp Ser Val Ile Pro Ile Ile Leu Arg Leu Asn Phe 725
730 735 Thr Leu Val Gly Lys Pro Leu Leu Ala Phe Arg Asn Leu Arg Pro
Met 740 745 750 Leu Ala Ala Leu Ala Gln Arg Tyr Phe Thr Ala Ser Leu
Pro Phe Glu 755 760 765 Lys Asn Cys Gly Ala Asp His Ile Cys Gln Asp
Asn Leu Gly Ile Ser 770 775 780 Phe Ser Phe Pro Gly Leu Lys Ser Leu
Leu Val Gly Ser Asn Leu Glu 785 790 795 800 Leu Asn Ala Glu Val Met
Val Trp Asn Asp Gly Glu Asp Ser Tyr Gly 805 810 815 Thr Thr Ile Thr
Phe Ser His Pro Ala Gly Leu Ser Tyr Arg Tyr Val 820 825 830 Ala Glu
Gly Gln Lys Gln Gly Gln Leu Arg Ser Leu His Leu Thr Cys 835 840 845
Cys Ser Ala Pro Val Gly Ser Gln Gly Thr Trp Ser Thr Ser Cys Arg 850
855 860 Ile Asn His Leu Ile Phe Arg Gly Gly Ala Gln Ile Thr Phe Leu
Ala 865 870 875 880 Thr Phe Asp Val Ser Pro Lys Ala Val Gly Leu Asp
Arg Leu Leu Leu 885 890 895 Ile Ala Asn Val Ser Ser Glu Asn Asn Ile
Pro Arg Thr Ser Lys Thr 900 905 910 Ile Phe Gln Leu Glu Leu Pro Val
Lys Tyr Ala Val Tyr Ile Val Val 915 920 925 Ser Ser His Glu Gln Phe
Thr Lys Tyr Leu Asn Phe Ser Glu Ser Glu 930 935 940 Glu Lys Glu Ser
His Val Ala Met His Arg Tyr Gln Val Asn Asn Leu 945 950 955 960 Gly
Gln Arg Asp Leu Pro Val Ser Ile Asn Phe Trp Val Pro Val Glu 965 970
975 Leu Asn Gln Glu Ala Val Trp Met Asp Val Glu Val Ser His Pro Gln
980 985 990 Asn Pro Ser Leu Arg Cys Ser Ser Glu Lys Ile Ala Pro Pro
Ala Ser 995 1000 1005 Asp Phe Leu Ala His Ile Gln Lys Asn Pro Val
Leu Asp Cys Ser Ile 1010 1015 1020 Ala Gly Cys Leu Arg Phe Arg Cys
Asp Val Pro Ser Phe Ser Val Gln 1025 1030 1035 1040 Glu Glu Leu Asp
Phe Thr Leu Lys Gly Asn Leu Ser Phe Gly Trp Val 1045 1050 1055 Arg
Gln Ile Leu Gln Lys Lys Val Ser Val Val Ser Val Ala Glu Ile 1060
1065 1070 Ile Phe Asp Thr Ser Val Tyr Ser Gln Leu Pro Gly Gln Glu
Ala Phe 1075 1080 1085 Met Arg Ala Gln Thr Ile Thr Val Leu Glu Lys
Tyr Lys Val His Asn 1090 1095 1100 Pro Ile Pro Leu Ile Val Gly Ser
Ser Ile Gly Gly Leu Leu Leu Leu 1105 1110 1115 1120 Ala Leu Ile Thr
Ala Val Leu Tyr Lys Val Gly Phe Phe Lys Arg Gln 1125 1130 1135 Tyr
Lys Glu Met Met Glu Glu Ala Asn Gly Gln Ile Ala Pro Glu Asn 1140
1145 1150 Gly Thr Gln Thr Pro Ser Pro Pro Ser Glu Lys 1155 1160 5
12 PRT dog 5 Phe Asn Leu Asp Val Glu Glu Pro Met Val Phe Gln 1 5 10
6 35 DNA Artificial Sequence Description of Artificial Sequence
primer 6 ttyaayytgg aygtngarga rccnatggtn ttyca 35 7 36 DNA
Artificial Sequence Description of Artificial Sequence primer 7
ttcaacctgg acgtggagga gcccatggtg ttccaa 36 8 36 DNA Artificial
Sequence Description of Artificial Sequence primer 8 ttcaacctgg
acgtngaasa ncccatggtc ttccaa 36 9 23 DNA Artificial Sequence
Description of Artificial Sequence primer 9 ttyaayytng aygtngarga
rcc 23 10 20 DNA Artificial Sequence Description of Artificial
Sequence primer 10 ttyaayytgg acgtngaaga 20 11 17 DNA Artificial
Sequence Description of Artificial Sequence primer 11 tgraanacca
tnggytc 17 12 18 DNA Artificial Sequence Description of Artificial
Sequence primer 12 ttggaagacc atnggytc 18 13 17 DNA Artificial
Sequence Description of Artificial Sequence primer 13 attaaccctc
actaaag 17 14 17 DNA Artificial Sequence Description of Artificial
Sequence primer 14 aatacgactc actatag 17 15 11 PRT dog 15 Val Phe
Gln Glu Xaa Gly Ala Gly Phe Gly Gln 1 5 10 16 14 PRT dog 16 Leu Tyr
Asp Xaa Val Ala Ala Thr Gly Leu Xaa Gln Pro Ile 1 5 10 17 12 PRT
dog 17 Pro Leu Glu Tyr Xaa Asp Val Ile Pro Gln Ala Glu 1 5 10 18 10
PRT dog 18 Phe Gln Glu Gly Phe Ser Xaa Val Leu Xaa 1 5 10 19 14 PRT
dog 19 Thr Ser Pro Thr Phe Ile Xaa Met Ser Gln Glu Asn Val Asp 1 5
10 20 17 PRT dog 20 Leu Val Val Gly Ala Pro Leu Glu Val Val Ala Val
Xaa Gln Thr Gly 1 5 10 15 Arg 21 9 PRT dog 21 Leu Asp Xaa Lys Pro
Xaa Asp Thr Ala 1 5 22 7 PRT dog 22 Phe Gly Glu Gln Phe Ser Glu 1 5
23 21 DNA Artificial Sequence Description of Artificial Sequence
primer 23 raanccytcy tgraaactyt c 21 24 1006 DNA dog 24 ttcaacctgg
acgtggagga gcccatggtg ttcaagagga tggagctggc tttggacaga 60
gcgtggccca gcttggcgga tctagactcg tggtgggagc ccccctggag gtggtggcgg
120 tcaaccaaac aggaaggttg tatgactgtg tggctgccac tggccttgtc
aacccatacc 180 cctgcacaca cccccagatg ctgtgaacat gtccctgggt
ctgtccctgt cagccgccgc 240 cagtcgcccc tggctgctgg cctgtggccc
aaccatgcac agagcctgtg gggagaatat 300 gtatgcagaa ggcttttgcc
tcctgttgga ctcccatctg cagaccattt ggacagtacc 360 tgctgcccta
ccagagtgtc caagtcaaga gatggacatt gtcttcctga ttgatggttc 420
tggcagtatg agcaaagtga ctttaaacaa atgaaggatt tgtgagagct gtgatgggac
480 agtttgaggg cacccaaacc ctgttctcac tgatacagta tcccacctcc
ctgaagatcc 540 acttcacctt cacgcaattc cagagcagct ggaaccctct
gagcctggtg gatcccattg 600 tccaactgga cggcctgaca tatacagcca
cgggcatccg gaaagtggtg gaggaactgt 660 ttcatagtaa gaatggggcc
cgtaaaagtg ccaagaagat cctcattgtc atcacagatg 720 gcaaaaatac
aaagaccccc tggagtacga ggacgtatcc ccaggcagag agagcggatc 780
atccgctatg ccattggggt gggagatgct ttctggaaac ccagtgccaa gcaggagctg
840 gacaacattg gctcagagcc ggctcaggac catgtgttca gggtggacaa
ctttgcagca 900 ctcagcagca tccaggagca gctgcaggag aagatctttg
cactcgaagg aacccagtcg 960 acgacaagta gctctttcca acatgagatg
ttccaagaag ggttca 1006 25 17 DNA Artificial Sequence Description of
Artificial Sequence primer 25 gtnttycarg argaygg 17 26 20 DNA
Artificial Sequence Description of Artificial Sequence primer 26
ccactgtcag gatgcccgtg 20 27 42 DNA Artificial Sequence Description
of Artificial Sequence primer 27 agttacgaat tcgccaccat ggctctacgg
gtgcttcttc tg 42 28 42 DNA Artificial Sequence Description of
Artificial Sequence primer 28 agttacgaat tcgccaccat gactcggact
gtgcttcttc tg 42 29 36 DNA Artificial Sequence Description of
Artificial Sequence primer 29 agttacgaat tcgccaccat gaccttcggc
actgtg 36 30 20 DNA Artificial Sequence Description of Artificial
Sequence primer 30 ttgctgactg cctgcagttc 20 31 36 DNA Artificial
Sequence Description of Artificial Sequence primer 31 gttctgacgc
gtaatggcat tgtagacctc gtcttc 36 32 36 DNA Artificial Sequence
Description of Artificial Sequence primer 32 acgtatgcag gatcccatca
agagatggac atcgct
36 33 37 DNA Artificial Sequence Description of Artificial Sequence
primer 33 actgcatgtc tcgaggctga agccttcttg ggacatc 37 34 24 DNA
Artificial Sequence Description of Artificial Sequence primer 34
tatagactgc tgggtagtcc ccac 24 35 24 DNA Artificial Sequence
Description of Artificial Sequence primer 35 tgaagattgg gggtaaataa
caga 24 36 3528 DNA Rattus rattus CDS (1)..(3453) Description of
Artificial Sequence primer 36 ggc tgg gcc ctg gct tcc tgt cat ggg
tct aac ctg gat gtg gag gaa 48 Gly Trp Ala Leu Ala Ser Cys His Gly
Ser Asn Leu Asp Val Glu Glu 1 5 10 15 ccc atc gtg ttc aga gag gat
gca gcc agc ttt gga cag act gtg gtg 96 Pro Ile Val Phe Arg Glu Asp
Ala Ala Ser Phe Gly Gln Thr Val Val 20 25 30 cag ttt ggt gga tct
cga ctc gtg gtg gga gcc cct ctg gag gcg gtg 144 Gln Phe Gly Gly Ser
Arg Leu Val Val Gly Ala Pro Leu Glu Ala Val 35 40 45 gca gtc aac
caa aca gga cgg ttg tat gac tgt gca cct gcc act ggc 192 Ala Val Asn
Gln Thr Gly Arg Leu Tyr Asp Cys Ala Pro Ala Thr Gly 50 55 60 atg
tgc cag ccc atc gta ctg cgc agt ccc cta gag gca gtg aac atg 240 Met
Cys Gln Pro Ile Val Leu Arg Ser Pro Leu Glu Ala Val Asn Met 65 70
75 80 tcc ctg ggc ctg tct ctg gtg act gcc acc aat aac gcc cag ttg
ctg 288 Ser Leu Gly Leu Ser Leu Val Thr Ala Thr Asn Asn Ala Gln Leu
Leu 85 90 95 gct tgt ggt cca act gca cag aga gct tgt gtg aag aac
atg tat gcg 336 Ala Cys Gly Pro Thr Ala Gln Arg Ala Cys Val Lys Asn
Met Tyr Ala 100 105 110 aaa ggt tcc tgc ctc ctt ctc ggc tcc agc ttg
cag ttc atc cag gca 384 Lys Gly Ser Cys Leu Leu Leu Gly Ser Ser Leu
Gln Phe Ile Gln Ala 115 120 125 gtc cct gcc tcc atg cca gag tgt cca
aga caa gag atg gac att gct 432 Val Pro Ala Ser Met Pro Glu Cys Pro
Arg Gln Glu Met Asp Ile Ala 130 135 140 ttc ctg att gat ggt tct ggc
agc att aac caa agg gac ttt gcc cag 480 Phe Leu Ile Asp Gly Ser Gly
Ser Ile Asn Gln Arg Asp Phe Ala Gln 145 150 155 160 atg aag gac ttt
gtc aaa gct ttg atg gga gag ttt gcg agc acc agc 528 Met Lys Asp Phe
Val Lys Ala Leu Met Gly Glu Phe Ala Ser Thr Ser 165 170 175 acc ttg
ttc tcc ctg atg caa tac tcg aac atc ctg aag acc cat ttt 576 Thr Leu
Phe Ser Leu Met Gln Tyr Ser Asn Ile Leu Lys Thr His Phe 180 185 190
acc ttc act gaa ttc aag aac atc ctg gac cct cag agc ctg gtg gat 624
Thr Phe Thr Glu Phe Lys Asn Ile Leu Asp Pro Gln Ser Leu Val Asp 195
200 205 ccc att gtc cag ctg caa ggc ctg acc tac aca gcc aca ggc atc
cgg 672 Pro Ile Val Gln Leu Gln Gly Leu Thr Tyr Thr Ala Thr Gly Ile
Arg 210 215 220 aca gtg atg gaa gag cta ttt cat agc aag aat ggg tcc
cgt aaa agt 720 Thr Val Met Glu Glu Leu Phe His Ser Lys Asn Gly Ser
Arg Lys Ser 225 230 235 240 gcc aag aag atc ctc ctt gtc atc aca gat
ggg cag aaa tac aga gac 768 Ala Lys Lys Ile Leu Leu Val Ile Thr Asp
Gly Gln Lys Tyr Arg Asp 245 250 255 ccc ctg gag tat agt gat gtc att
ccc gcc gca gac aaa gct ggc atc 816 Pro Leu Glu Tyr Ser Asp Val Ile
Pro Ala Ala Asp Lys Ala Gly Ile 260 265 270 att cgt tat gct att ggg
gtg gga gat gcc ttc cag gag ccc act gcc 864 Ile Arg Tyr Ala Ile Gly
Val Gly Asp Ala Phe Gln Glu Pro Thr Ala 275 280 285 ctg aag gag ctg
aac acc att ggc tca gct ccc cca cag gac cac gtg 912 Leu Lys Glu Leu
Asn Thr Ile Gly Ser Ala Pro Pro Gln Asp His Val 290 295 300 ttc aag
gta ggc aac ttt gca gca ctt cgc agc atc cag agg caa ctt 960 Phe Lys
Val Gly Asn Phe Ala Ala Leu Arg Ser Ile Gln Arg Gln Leu 305 310 315
320 cag gag aaa atc ttc gcc att gag gga act caa tca agg tca agt agt
1008 Gln Glu Lys Ile Phe Ala Ile Glu Gly Thr Gln Ser Arg Ser Ser
Ser 325 330 335 tcc ttt cag cac gag atg tca caa gaa ggt ttc agt tca
gct ctc aca 1056 Ser Phe Gln His Glu Met Ser Gln Glu Gly Phe Ser
Ser Ala Leu Thr 340 345 350 tcg gat gga ccc gtt ctg ggg gcc gyg gga
agc ttc agc tgg tcc gga 1104 Ser Asp Gly Pro Val Leu Gly Ala Xaa
Gly Ser Phe Ser Trp Ser Gly 355 360 365 ggt gcc ttc tta tat ccc cca
aat acg aga ccc acc ttt atc aac atg 1152 Gly Ala Phe Leu Tyr Pro
Pro Asn Thr Arg Pro Thr Phe Ile Asn Met 370 375 380 tct cag gag aat
gtg gac atg aga gac tcc tac ctg ggt tac tcc acc 1200 Ser Gln Glu
Asn Val Asp Met Arg Asp Ser Tyr Leu Gly Tyr Ser Thr 385 390 395 400
gca gtg gcc ttt tgg aag ggg gtt cac agc ctg atc ctg ggg gcc ccg
1248 Ala Val Ala Phe Trp Lys Gly Val His Ser Leu Ile Leu Gly Ala
Pro 405 410 415 cgt cac cag cac acg ggg aag gtt gtc atc ttt acc cag
gaa gcc agg 1296 Arg His Gln His Thr Gly Lys Val Val Ile Phe Thr
Gln Glu Ala Arg 420 425 430 cat tgg agg ccc aag tct gaa gtc aga ggg
aca cag atc ggc tcc tac 1344 His Trp Arg Pro Lys Ser Glu Val Arg
Gly Thr Gln Ile Gly Ser Tyr 435 440 445 ttc ggg gcc tct ctc tgt tct
gtg gac gtg gat aga gat ggc agc acy 1392 Phe Gly Ala Ser Leu Cys
Ser Val Asp Val Asp Arg Asp Gly Ser Xaa 450 455 460 gac ctg gtc ctg
atc gga gcc ccc cat tac tat gag cag acc cga ggg 1440 Asp Leu Val
Leu Ile Gly Ala Pro His Tyr Tyr Glu Gln Thr Arg Gly 465 470 475 480
ggg cag gtc tca gtg tkc ccc gtg ccc ggt gtg agg ggc agg tgg cag
1488 Gly Gln Val Ser Val Xaa Pro Val Pro Gly Val Arg Gly Arg Trp
Gln 485 490 495 tgt gag gcc acc ctc cac ggg gag cag grc cat cct tgg
ggc cgc ttt 1536 Cys Glu Ala Thr Leu His Gly Glu Gln Xaa His Pro
Trp Gly Arg Phe 500 505 510 ggg gtg gct ctg aca gtg ctg ggg gac gta
aac ggg gac aat ctg gca 1584 Gly Val Ala Leu Thr Val Leu Gly Asp
Val Asn Gly Asp Asn Leu Ala 515 520 525 gac gtg gct att ggt gcc cct
gga gag gag gag agc aga ggt gct gtc 1632 Asp Val Ala Ile Gly Ala
Pro Gly Glu Glu Glu Ser Arg Gly Ala Val 530 535 540 tac ata ttt cat
gga gcc tcg aga ctg gag atc atg ccc tca ccc agc 1680 Tyr Ile Phe
His Gly Ala Ser Arg Leu Glu Ile Met Pro Ser Pro Ser 545 550 555 560
cag cgg gtc act ggc tcc cag ctc tcc ctg aga ctg cag tat ttt ggg
1728 Gln Arg Val Thr Gly Ser Gln Leu Ser Leu Arg Leu Gln Tyr Phe
Gly 565 570 575 cag tca ttg agt ggg ggt cag gac ctt aca cag gat ggc
ctg gtg gac 1776 Gln Ser Leu Ser Gly Gly Gln Asp Leu Thr Gln Asp
Gly Leu Val Asp 580 585 590 ctg gcc gtg gga gcc cag ggg cac gta ctg
ctg ctc agg agt ctg cct 1824 Leu Ala Val Gly Ala Gln Gly His Val
Leu Leu Leu Arg Ser Leu Pro 595 600 605 ctg ctg aaa gtg gag ctc tcc
ata aga ttc gcc ccc atg gag gtg gca 1872 Leu Leu Lys Val Glu Leu
Ser Ile Arg Phe Ala Pro Met Glu Val Ala 610 615 620 aag gct gtg tac
cag tgc tgg gaa agg act ccc act gtc ctc gaa gct 1920 Lys Ala Val
Tyr Gln Cys Trp Glu Arg Thr Pro Thr Val Leu Glu Ala 625 630 635 640
gga gag gcc act gtc tgt ctc act gtc cac aaa ggc tca cct gac ctg
1968 Gly Glu Ala Thr Val Cys Leu Thr Val His Lys Gly Ser Pro Asp
Leu 645 650 655 tta ggt aat gtc caa ggc tct gtc agg tat gat ctg gcg
tta gat ccg 2016 Leu Gly Asn Val Gln Gly Ser Val Arg Tyr Asp Leu
Ala Leu Asp Pro 660 665 670 ggc cgc ctg att tct cgt gcc att ttt gat
gag act aag aac tgc act 2064 Gly Arg Leu Ile Ser Arg Ala Ile Phe
Asp Glu Thr Lys Asn Cys Thr 675 680 685 ttg acg gga agg aag act ctg
ggg ctt ggt gat cac tgc gaa aca gtg 2112 Leu Thr Gly Arg Lys Thr
Leu Gly Leu Gly Asp His Cys Glu Thr Val 690 695 700 aag ctg ctt ttg
ccg gac tgt gtg gaa gat gca gtg agc cct atc atc 2160 Lys Leu Leu
Leu Pro Asp Cys Val Glu Asp Ala Val Ser Pro Ile Ile 705 710 715 720
ctg cgc ctc aac ttt tcc ctg gtg aga gac tct gct tca ccc agg aac
2208 Leu Arg Leu Asn Phe Ser Leu Val Arg Asp Ser Ala Ser Pro Arg
Asn 725 730 735 ctg cat cct gtg ctg gct gtg ggc tca caa gac cac ata
act gct tct 2256 Leu His Pro Val Leu Ala Val Gly Ser Gln Asp His
Ile Thr Ala Ser 740 745 750 ctg ccg ttt gag aag aac tgt aag caa gaa
ctc ctg tgt gag ggg gac 2304 Leu Pro Phe Glu Lys Asn Cys Lys Gln
Glu Leu Leu Cys Glu Gly Asp 755 760 765 ctg ggc atc agc ttt aac ttc
tca ggc ctg cag gtc ttg gtg gtg gga 2352 Leu Gly Ile Ser Phe Asn
Phe Ser Gly Leu Gln Val Leu Val Val Gly 770 775 780 ggc tcc cca gag
ctc act gtg aca gtc act gtg tgg aat gag ggt gag 2400 Gly Ser Pro
Glu Leu Thr Val Thr Val Thr Val Trp Asn Glu Gly Glu 785 790 795 800
gac agc tat gga act tta gtc aag ttc tac tac cca gca ggg cta tct
2448 Asp Ser Tyr Gly Thr Leu Val Lys Phe Tyr Tyr Pro Ala Gly Leu
Ser 805 810 815 tac cga cgg gta aca ggg act cag caa cct cat cag tac
cca cta cgc 2496 Tyr Arg Arg Val Thr Gly Thr Gln Gln Pro His Gln
Tyr Pro Leu Arg 820 825 830 ttg gcc tgt gag gct gag ccc gct gcc cag
gag gac ctg agg agc agc 2544 Leu Ala Cys Glu Ala Glu Pro Ala Ala
Gln Glu Asp Leu Arg Ser Ser 835 840 845 agc tgt agc att aat cac ccc
atc ttc cga gaa ggt gca aag acc acc 2592 Ser Cys Ser Ile Asn His
Pro Ile Phe Arg Glu Gly Ala Lys Thr Thr 850 855 860 ttc atg atc aca
ttc gat gtc tcc tac aag gcc ttc cta gga gac agg 2640 Phe Met Ile
Thr Phe Asp Val Ser Tyr Lys Ala Phe Leu Gly Asp Arg 865 870 875 880
ttg ctt ctg agg gcc aaa gcc agc agt gag aat aat aag cct gat acc
2688 Leu Leu Leu Arg Ala Lys Ala Ser Ser Glu Asn Asn Lys Pro Asp
Thr 885 890 895 aac aag act gcc ttc cag ctg gag ctc cca gtg aag tac
acc gtc tat 2736 Asn Lys Thr Ala Phe Gln Leu Glu Leu Pro Val Lys
Tyr Thr Val Tyr 900 905 910 acc ctg atc agt agg caa gaa gat tcc acc
aac cat gtc aac ttt tca 2784 Thr Leu Ile Ser Arg Gln Glu Asp Ser
Thr Asn His Val Asn Phe Ser 915 920 925 tct tcc cac ggg ggg aga agg
caa gaa gcc gca cat cgc tat cgt gtg 2832 Ser Ser His Gly Gly Arg
Arg Gln Glu Ala Ala His Arg Tyr Arg Val 930 935 940 aat aac ctg agt
cca ctg aag ctg gcc gtc aga gtt aac ttc tgg gtc 2880 Asn Asn Leu
Ser Pro Leu Lys Leu Ala Val Arg Val Asn Phe Trp Val 945 950 955 960
cct gtc ctt ctg aac ggt gtg gct gtg tgg gac gtg act ctg agc agc
2928 Pro Val Leu Leu Asn Gly Val Ala Val Trp Asp Val Thr Leu Ser
Ser 965 970 975 cca gca cag ggt gtc tcc tgc gtg tcc cag atg aaa cct
cct cag aat 2976 Pro Ala Gln Gly Val Ser Cys Val Ser Gln Met Lys
Pro Pro Gln Asn 980 985 990 ccc gac ttt ctg acc cag att cag aga cgt
tct gtg ctg gac tgc tcc 3024 Pro Asp Phe Leu Thr Gln Ile Gln Arg
Arg Ser Val Leu Asp Cys Ser 995 1000 1005 att gct gac tgc ctg cac
tcc cgc tgt gac atc ccc tcc ttg gac atc 3072 Ile Ala Asp Cys Leu
His Ser Arg Cys Asp Ile Pro Ser Leu Asp Ile 1010 1015 1020 cag gat
gaa ctt gac ttc att ctg agg ggc aac ctc agc ttc ggc tgg 3120 Gln
Asp Glu Leu Asp Phe Ile Leu Arg Gly Asn Leu Ser Phe Gly Trp 1025
1030 1035 1040 gtc agt cag aca ttg cag gaa aag gtg ttg ctt gtg agt
gag gct gaa 3168 Val Ser Gln Thr Leu Gln Glu Lys Val Leu Leu Val
Ser Glu Ala Glu 1045 1050 1055 atc act ttc gac aca tct gtg tac tcc
cag ctg cca gga cag gag gca 3216 Ile Thr Phe Asp Thr Ser Val Tyr
Ser Gln Leu Pro Gly Gln Glu Ala 1060 1065 1070 ttt ctg aga gcc cag
gtg gag aca acg tta gaa gaa tac gtg gtc tat 3264 Phe Leu Arg Ala
Gln Val Glu Thr Thr Leu Glu Glu Tyr Val Val Tyr 1075 1080 1085 gag
ccc atc ttc ctc gtg gcg ggc agc tcg gtg gga ggt ctg ctg tta 3312
Glu Pro Ile Phe Leu Val Ala Gly Ser Ser Val Gly Gly Leu Leu Leu
1090 1095 1100 ctg gct ctc atc aca gtg gta ctg tac aag ctt ggc tyc
tyc aaa cgt 3360 Leu Ala Leu Ile Thr Val Val Leu Tyr Lys Leu Gly
Xaa Xaa Lys Arg 1105 1110 1115 1120 cag tac aaa gaa atg ctg gac ggc
aag gct gca gat cct gtc aca gcc 3408 Gln Tyr Lys Glu Met Leu Asp
Gly Lys Ala Ala Asp Pro Val Thr Ala 1125 1130 1135 ggc cag gca gat
ttc ggc tgt gag act cct cca tat ctc gtg agc 3453 Gly Gln Ala Asp
Phe Gly Cys Glu Thr Pro Pro Tyr Leu Val Ser 1140 1145 1150
taggaatcca ctctcctgcc tatctctgna atgaagattg gtcctgccta tgagtctact
3513 ggcatgggaa cgagt 3528 37 1151 PRT Rattus rattus 37 Gly Trp Ala
Leu Ala Ser Cys His Gly Ser Asn Leu Asp Val Glu Glu 1 5 10 15 Pro
Ile Val Phe Arg Glu Asp Ala Ala Ser Phe Gly Gln Thr Val Val 20 25
30 Gln Phe Gly Gly Ser Arg Leu Val Val Gly Ala Pro Leu Glu Ala Val
35 40 45 Ala Val Asn Gln Thr Gly Arg Leu Tyr Asp Cys Ala Pro Ala
Thr Gly 50 55 60 Met Cys Gln Pro Ile Val Leu Arg Ser Pro Leu Glu
Ala Val Asn Met 65 70 75 80 Ser Leu Gly Leu Ser Leu Val Thr Ala Thr
Asn Asn Ala Gln Leu Leu 85 90 95 Ala Cys Gly Pro Thr Ala Gln Arg
Ala Cys Val Lys Asn Met Tyr Ala 100 105 110 Lys Gly Ser Cys Leu Leu
Leu Gly Ser Ser Leu Gln Phe Ile Gln Ala 115 120 125 Val Pro Ala Ser
Met Pro Glu Cys Pro Arg Gln Glu Met Asp Ile Ala 130 135 140 Phe Leu
Ile Asp Gly Ser Gly Ser Ile Asn Gln Arg Asp Phe Ala Gln 145 150 155
160 Met Lys Asp Phe Val Lys Ala Leu Met Gly Glu Phe Ala Ser Thr Ser
165 170 175 Thr Leu Phe Ser Leu Met Gln Tyr Ser Asn Ile Leu Lys Thr
His Phe 180 185 190 Thr Phe Thr Glu Phe Lys Asn Ile Leu Asp Pro Gln
Ser Leu Val Asp 195 200 205 Pro Ile Val Gln Leu Gln Gly Leu Thr Tyr
Thr Ala Thr Gly Ile Arg 210 215 220 Thr Val Met Glu Glu Leu Phe His
Ser Lys Asn Gly Ser Arg Lys Ser 225 230 235 240 Ala Lys Lys Ile Leu
Leu Val Ile Thr Asp Gly Gln Lys Tyr Arg Asp 245 250 255 Pro Leu Glu
Tyr Ser Asp Val Ile Pro Ala Ala Asp Lys Ala Gly Ile 260 265 270 Ile
Arg Tyr Ala Ile Gly Val Gly Asp Ala Phe Gln Glu Pro Thr Ala 275 280
285 Leu Lys Glu Leu Asn Thr Ile Gly Ser Ala Pro Pro Gln Asp His Val
290 295 300 Phe Lys Val Gly Asn Phe Ala Ala Leu Arg Ser Ile Gln Arg
Gln Leu 305 310 315 320 Gln Glu Lys Ile Phe Ala Ile Glu Gly Thr Gln
Ser Arg Ser Ser Ser 325 330 335 Ser Phe Gln His Glu Met Ser Gln Glu
Gly Phe Ser Ser Ala Leu Thr 340 345 350 Ser Asp Gly Pro Val Leu Gly
Ala Xaa Gly Ser Phe Ser Trp Ser Gly 355 360 365 Gly Ala Phe Leu Tyr
Pro Pro Asn Thr Arg Pro Thr Phe Ile Asn Met 370 375 380 Ser Gln Glu
Asn Val Asp Met Arg Asp Ser Tyr Leu Gly Tyr Ser Thr 385 390 395 400
Ala Val Ala Phe Trp Lys Gly Val His Ser Leu Ile Leu Gly Ala Pro 405
410 415 Arg His Gln His Thr Gly Lys Val Val Ile Phe Thr Gln Glu Ala
Arg 420 425 430 His Trp Arg Pro Lys Ser Glu Val Arg Gly Thr Gln Ile
Gly Ser Tyr 435 440 445 Phe Gly Ala Ser Leu Cys Ser Val Asp Val Asp
Arg Asp Gly Ser Xaa 450 455 460 Asp Leu Val Leu Ile Gly Ala Pro His
Tyr Tyr Glu Gln Thr Arg Gly 465 470 475 480 Gly Gln Val Ser Val Xaa
Pro Val Pro Gly Val Arg Gly Arg Trp Gln 485 490 495 Cys
Glu Ala Thr Leu His Gly Glu Gln Xaa His Pro Trp Gly Arg Phe 500 505
510 Gly Val Ala Leu Thr Val Leu Gly Asp Val Asn Gly Asp Asn Leu Ala
515 520 525 Asp Val Ala Ile Gly Ala Pro Gly Glu Glu Glu Ser Arg Gly
Ala Val 530 535 540 Tyr Ile Phe His Gly Ala Ser Arg Leu Glu Ile Met
Pro Ser Pro Ser 545 550 555 560 Gln Arg Val Thr Gly Ser Gln Leu Ser
Leu Arg Leu Gln Tyr Phe Gly 565 570 575 Gln Ser Leu Ser Gly Gly Gln
Asp Leu Thr Gln Asp Gly Leu Val Asp 580 585 590 Leu Ala Val Gly Ala
Gln Gly His Val Leu Leu Leu Arg Ser Leu Pro 595 600 605 Leu Leu Lys
Val Glu Leu Ser Ile Arg Phe Ala Pro Met Glu Val Ala 610 615 620 Lys
Ala Val Tyr Gln Cys Trp Glu Arg Thr Pro Thr Val Leu Glu Ala 625 630
635 640 Gly Glu Ala Thr Val Cys Leu Thr Val His Lys Gly Ser Pro Asp
Leu 645 650 655 Leu Gly Asn Val Gln Gly Ser Val Arg Tyr Asp Leu Ala
Leu Asp Pro 660 665 670 Gly Arg Leu Ile Ser Arg Ala Ile Phe Asp Glu
Thr Lys Asn Cys Thr 675 680 685 Leu Thr Gly Arg Lys Thr Leu Gly Leu
Gly Asp His Cys Glu Thr Val 690 695 700 Lys Leu Leu Leu Pro Asp Cys
Val Glu Asp Ala Val Ser Pro Ile Ile 705 710 715 720 Leu Arg Leu Asn
Phe Ser Leu Val Arg Asp Ser Ala Ser Pro Arg Asn 725 730 735 Leu His
Pro Val Leu Ala Val Gly Ser Gln Asp His Ile Thr Ala Ser 740 745 750
Leu Pro Phe Glu Lys Asn Cys Lys Gln Glu Leu Leu Cys Glu Gly Asp 755
760 765 Leu Gly Ile Ser Phe Asn Phe Ser Gly Leu Gln Val Leu Val Val
Gly 770 775 780 Gly Ser Pro Glu Leu Thr Val Thr Val Thr Val Trp Asn
Glu Gly Glu 785 790 795 800 Asp Ser Tyr Gly Thr Leu Val Lys Phe Tyr
Tyr Pro Ala Gly Leu Ser 805 810 815 Tyr Arg Arg Val Thr Gly Thr Gln
Gln Pro His Gln Tyr Pro Leu Arg 820 825 830 Leu Ala Cys Glu Ala Glu
Pro Ala Ala Gln Glu Asp Leu Arg Ser Ser 835 840 845 Ser Cys Ser Ile
Asn His Pro Ile Phe Arg Glu Gly Ala Lys Thr Thr 850 855 860 Phe Met
Ile Thr Phe Asp Val Ser Tyr Lys Ala Phe Leu Gly Asp Arg 865 870 875
880 Leu Leu Leu Arg Ala Lys Ala Ser Ser Glu Asn Asn Lys Pro Asp Thr
885 890 895 Asn Lys Thr Ala Phe Gln Leu Glu Leu Pro Val Lys Tyr Thr
Val Tyr 900 905 910 Thr Leu Ile Ser Arg Gln Glu Asp Ser Thr Asn His
Val Asn Phe Ser 915 920 925 Ser Ser His Gly Gly Arg Arg Gln Glu Ala
Ala His Arg Tyr Arg Val 930 935 940 Asn Asn Leu Ser Pro Leu Lys Leu
Ala Val Arg Val Asn Phe Trp Val 945 950 955 960 Pro Val Leu Leu Asn
Gly Val Ala Val Trp Asp Val Thr Leu Ser Ser 965 970 975 Pro Ala Gln
Gly Val Ser Cys Val Ser Gln Met Lys Pro Pro Gln Asn 980 985 990 Pro
Asp Phe Leu Thr Gln Ile Gln Arg Arg Ser Val Leu Asp Cys Ser 995
1000 1005 Ile Ala Asp Cys Leu His Ser Arg Cys Asp Ile Pro Ser Leu
Asp Ile 1010 1015 1020 Gln Asp Glu Leu Asp Phe Ile Leu Arg Gly Asn
Leu Ser Phe Gly Trp 1025 1030 1035 1040 Val Ser Gln Thr Leu Gln Glu
Lys Val Leu Leu Val Ser Glu Ala Glu 1045 1050 1055 Ile Thr Phe Asp
Thr Ser Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala 1060 1065 1070 Phe
Leu Arg Ala Gln Val Glu Thr Thr Leu Glu Glu Tyr Val Val Tyr 1075
1080 1085 Glu Pro Ile Phe Leu Val Ala Gly Ser Ser Val Gly Gly Leu
Leu Leu 1090 1095 1100 Leu Ala Leu Ile Thr Val Val Leu Tyr Lys Leu
Gly Xaa Xaa Lys Arg 1105 1110 1115 1120 Gln Tyr Lys Glu Met Leu Asp
Gly Lys Ala Ala Asp Pro Val Thr Ala 1125 1130 1135 Gly Gln Ala Asp
Phe Gly Cys Glu Thr Pro Pro Tyr Leu Val Ser 1140 1145 1150 38 21
DNA Artificial Sequence Description of Artificial Sequence primer
38 gtccaagctg tcatgggcca g 21 39 23 DNA Artificial Sequence
Description of Artificial Sequence primer 39 gtccagcaga ctgaagagca
cgg 23 40 18 DNA Artificial Sequence Description of Artificial
Sequence primer 40 tgtaaaacga cggccagt 18 41 19 DNA Artificial
Sequence Description of Artificial Sequence primer 41 ggaaacagct
atgaccatg 19 42 22 DNA Artificial Sequence Description of
Artificial Sequence primer 42 ggacatgttc actgcctcta gg 22 43 25 DNA
Artificial Sequence Description of Artificial Sequence primer 43
ggcggacagt cagacgactg tcctg 25 44 38 DNA Artificial Sequence
Description of Artificial Sequence primer 44 ctggttcggc ccacctctga
aggttccaga atcgatag 38 45 3519 DNA Mus musculus CDS (52)..(3516)
Description of Artificial Sequence primer 45 gctttctgaa ggttccagaa
tcgatagtga attcgtgggc actgctcaga t atg gtc 57 Met Val 1 cgt gga gtt
gtg atc ctc ctg tgt ggc tgg gcc ctg gct tcc tgt cat 105 Arg Gly Val
Val Ile Leu Leu Cys Gly Trp Ala Leu Ala Ser Cys His 5 10 15 ggg tct
aac ctg gat gtg gag aag ccc gtc gtg ttc aaa gag gat gca 153 Gly Ser
Asn Leu Asp Val Glu Lys Pro Val Val Phe Lys Glu Asp Ala 20 25 30
gcc agc ttc gga cag act gtg gtg cag ttt ggt gga tct cga ctc gtg 201
Ala Ser Phe Gly Gln Thr Val Val Gln Phe Gly Gly Ser Arg Leu Val 35
40 45 50 gtg gga gcc cct ctg gag gcg gtg gca gtc aac caa aca gga
cag tcg 249 Val Gly Ala Pro Leu Glu Ala Val Ala Val Asn Gln Thr Gly
Gln Ser 55 60 65 tct gac tgt ccg cct gcc act ggc gtg tgc cag ccc
atc tta ctg cac 297 Ser Asp Cys Pro Pro Ala Thr Gly Val Cys Gln Pro
Ile Leu Leu His 70 75 80 att ccc cta gag gca gtg aac atg tcc ctg
ggc ctg tct ctg gtg gct 345 Ile Pro Leu Glu Ala Val Asn Met Ser Leu
Gly Leu Ser Leu Val Ala 85 90 95 gac acc aat aac tcc cag ttg ctg
gct tgt ggt cca act gca cag aga 393 Asp Thr Asn Asn Ser Gln Leu Leu
Ala Cys Gly Pro Thr Ala Gln Arg 100 105 110 gct tgt gca aag aac atg
tat gca aaa ggt tcc tgc ctc ctt ctg ggc 441 Ala Cys Ala Lys Asn Met
Tyr Ala Lys Gly Ser Cys Leu Leu Leu Gly 115 120 125 130 tcc agc ttg
cag ttc atc cag gca atc cct gct acc atg cca gag tgt 489 Ser Ser Leu
Gln Phe Ile Gln Ala Ile Pro Ala Thr Met Pro Glu Cys 135 140 145 cca
gga caa gag atg gac att gct ttc ctg att gat ggc tcc ggc agc 537 Pro
Gly Gln Glu Met Asp Ile Ala Phe Leu Ile Asp Gly Ser Gly Ser 150 155
160 att gat caa agt gac ttt acc cag atg aag gac ttc gtc aaa gct ttg
585 Ile Asp Gln Ser Asp Phe Thr Gln Met Lys Asp Phe Val Lys Ala Leu
165 170 175 atg ggc cag ttg gcg agc acc agc acc tcg ttc tcc ctg atg
caa tac 633 Met Gly Gln Leu Ala Ser Thr Ser Thr Ser Phe Ser Leu Met
Gln Tyr 180 185 190 tca aac atc ctg aag act cat ttt acc ttc acg gaa
ttc aag agc agc 681 Ser Asn Ile Leu Lys Thr His Phe Thr Phe Thr Glu
Phe Lys Ser Ser 195 200 205 210 ctg agc cct cag agc ctg gtg gat gcc
atc gtc cag ctc caa ggc ctg 729 Leu Ser Pro Gln Ser Leu Val Asp Ala
Ile Val Gln Leu Gln Gly Leu 215 220 225 acg tac aca gcc tcg ggc atc
cag aaa gtg gtg aaa gag cta ttt cat 777 Thr Tyr Thr Ala Ser Gly Ile
Gln Lys Val Val Lys Glu Leu Phe His 230 235 240 agc aag aat ggg gcc
cga aaa agt gcc aag aag ata cta att gtc atc 825 Ser Lys Asn Gly Ala
Arg Lys Ser Ala Lys Lys Ile Leu Ile Val Ile 245 250 255 aca gat ggg
cag aaa ttc aga gac ccc ctg gag tat aga cat gtc atc 873 Thr Asp Gly
Gln Lys Phe Arg Asp Pro Leu Glu Tyr Arg His Val Ile 260 265 270 cct
gaa gca gag aaa gct ggg atc att cgc tat gct ata ggg gtg gga 921 Pro
Glu Ala Glu Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val Gly 275 280
285 290 gat gcc ttc cgg gaa ccc act gcc cta cag gag ctg aac acc att
ggc 969 Asp Ala Phe Arg Glu Pro Thr Ala Leu Gln Glu Leu Asn Thr Ile
Gly 295 300 305 tca gct ccc tcg cag gac cac gtg ttc aag gtg ggc aat
ttt gta gca 1017 Ser Ala Pro Ser Gln Asp His Val Phe Lys Val Gly
Asn Phe Val Ala 310 315 320 ctt cgc agc atc cag cgg caa att cag gag
aaa atc ttt gcc att gaa 1065 Leu Arg Ser Ile Gln Arg Gln Ile Gln
Glu Lys Ile Phe Ala Ile Glu 325 330 335 gga acc gaa tca agg tca agt
agt tcc ttt cag cac gag atg tca caa 1113 Gly Thr Glu Ser Arg Ser
Ser Ser Ser Phe Gln His Glu Met Ser Gln 340 345 350 gaa ggt ttc agc
tca gct ctc tca atg gat gga cca gtt ctg ggg gct 1161 Glu Gly Phe
Ser Ser Ala Leu Ser Met Asp Gly Pro Val Leu Gly Ala 355 360 365 370
gtg gga ggc ttc agc tgg tct gga ggt gcc ttc ttg tac ccc tca aat
1209 Val Gly Gly Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro Ser
Asn 375 380 385 atg aga tcc acc ttc atc aac atg tct cag gag aac gag
gat atg agg 1257 Met Arg Ser Thr Phe Ile Asn Met Ser Gln Glu Asn
Glu Asp Met Arg 390 395 400 gac gct tac ctg ggt tac tcc acc gca ctg
gcc ttt tgg aag ggg gtc 1305 Asp Ala Tyr Leu Gly Tyr Ser Thr Ala
Leu Ala Phe Trp Lys Gly Val 405 410 415 cac agc ctg atc ctg ggg gcc
cct cgc cac cag cac acg ggg aag gtt 1353 His Ser Leu Ile Leu Gly
Ala Pro Arg His Gln His Thr Gly Lys Val 420 425 430 gtc atc ttt acc
cag gaa tcc agg cac tgg agg ccc aag tct gaa gtc 1401 Val Ile Phe
Thr Gln Glu Ser Arg His Trp Arg Pro Lys Ser Glu Val 435 440 445 450
aga ggg aca cag atc ggc tcc tac ttt ggg gca tct ctc tgt tct gtg
1449 Arg Gly Thr Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser
Val 455 460 465 gac atg gat aga gat ggc agc act gac ctg gtc ctg att
gga gtc ccc 1497 Asp Met Asp Arg Asp Gly Ser Thr Asp Leu Val Leu
Ile Gly Val Pro 470 475 480 cat tac tat gag cac acc cga ggg ggg cag
gtg tcg gtg tgc ccc atg 1545 His Tyr Tyr Glu His Thr Arg Gly Gly
Gln Val Ser Val Cys Pro Met 485 490 495 cct ggt gtg agg agc agg tgg
cat tgt ggg acc acc ctc cat ggg gag 1593 Pro Gly Val Arg Ser Arg
Trp His Cys Gly Thr Thr Leu His Gly Glu 500 505 510 cag ggc cat cct
tgg ggc cgc ttt ggg gcg gct ctg aca gtg cta ggg 1641 Gln Gly His
Pro Trp Gly Arg Phe Gly Ala Ala Leu Thr Val Leu Gly 515 520 525 530
gac gtg aat ggg gac agt ctg gcg gat gtg gct att ggt gca ccc gga
1689 Asp Val Asn Gly Asp Ser Leu Ala Asp Val Ala Ile Gly Ala Pro
Gly 535 540 545 gag gag gag aac aga ggt gct gtc tac ata ttt cat gga
gcc tcg aga 1737 Glu Glu Glu Asn Arg Gly Ala Val Tyr Ile Phe His
Gly Ala Ser Arg 550 555 560 cag gac atc gct ccc tcg cct agc cag cgg
gtc act ggc tcc cag ctc 1785 Gln Asp Ile Ala Pro Ser Pro Ser Gln
Arg Val Thr Gly Ser Gln Leu 565 570 575 ttc ctg agg ctc caa tat ttt
ggg cag tca tta agt ggg ggt cag gac 1833 Phe Leu Arg Leu Gln Tyr
Phe Gly Gln Ser Leu Ser Gly Gly Gln Asp 580 585 590 ctt aca cag gat
ggc ctg gtg gac ctg gcc gtg gga gcc cag ggg cac 1881 Leu Thr Gln
Asp Gly Leu Val Asp Leu Ala Val Gly Ala Gln Gly His 595 600 605 610
gtg ctg ctg ctt agg agt ctg cct ttg ctg aaa gtg ggg atc tcc att
1929 Val Leu Leu Leu Arg Ser Leu Pro Leu Leu Lys Val Gly Ile Ser
Ile 615 620 625 aga ttt gcc ccc tca gag gtg gca aag act gtg tac cag
tgc tgg gga 1977 Arg Phe Ala Pro Ser Glu Val Ala Lys Thr Val Tyr
Gln Cys Trp Gly 630 635 640 agg act ccc act gtc ctc gaa gct gga gag
gcc acc gtc tgt ctc act 2025 Arg Thr Pro Thr Val Leu Glu Ala Gly
Glu Ala Thr Val Cys Leu Thr 645 650 655 gtc cgc aaa ggt tca cct gac
ctg tta ggt gat gtc caa agc tct gtc 2073 Val Arg Lys Gly Ser Pro
Asp Leu Leu Gly Asp Val Gln Ser Ser Val 660 665 670 agg tat gat ctg
gcg ttg gat ccg ggc cgt ctg att tct cgt gcc att 2121 Arg Tyr Asp
Leu Ala Leu Asp Pro Gly Arg Leu Ile Ser Arg Ala Ile 675 680 685 690
ttt gat gag acg aag aac tgc act ttg acc cga agg aag act ctg ggg
2169 Phe Asp Glu Thr Lys Asn Cys Thr Leu Thr Arg Arg Lys Thr Leu
Gly 695 700 705 ctt ggt gat cac tgc gaa aca atg aag ctg ctt ttg cca
gac tgt gtg 2217 Leu Gly Asp His Cys Glu Thr Met Lys Leu Leu Leu
Pro Asp Cys Val 710 715 720 gag gat gca gtg acc cct atc atc ctg cgc
ctt aac tta tcc ctg gca 2265 Glu Asp Ala Val Thr Pro Ile Ile Leu
Arg Leu Asn Leu Ser Leu Ala 725 730 735 ggg gac tct gct cca tcc agg
aac ctt cgt cct gtg ctg gct gtg ggc 2313 Gly Asp Ser Ala Pro Ser
Arg Asn Leu Arg Pro Val Leu Ala Val Gly 740 745 750 tca caa gac cat
gta aca gct tct ttc ccg ttt gag aag aac tgt gag 2361 Ser Gln Asp
His Val Thr Ala Ser Phe Pro Phe Glu Lys Asn Cys Glu 755 760 765 770
ggg aac ctg ggc gtc agc ttc aac ttc tca ggc ctg cag gtc ttg gag
2409 Gly Asn Leu Gly Val Ser Phe Asn Phe Ser Gly Leu Gln Val Leu
Glu 775 780 785 gta gga agc tcc cca gag ctc act gtg aca gta aca gtt
tgg aat gag 2457 Val Gly Ser Ser Pro Glu Leu Thr Val Thr Val Thr
Val Trp Asn Glu 790 795 800 ggt gag gac agc tat gga acc tta atc aag
ttc tac tac cca gca gag 2505 Gly Glu Asp Ser Tyr Gly Thr Leu Ile
Lys Phe Tyr Tyr Pro Ala Glu 805 810 815 cta tct tac cga cgg gtg aca
aga gcc cag caa cct cat ccg tac cca 2553 Leu Ser Tyr Arg Arg Val
Thr Arg Ala Gln Gln Pro His Pro Tyr Pro 820 825 830 cta cgc ctg gca
tgt gag gct gag ccc acg ggc cag gag agc ctg agg 2601 Leu Arg Leu
Ala Cys Glu Ala Glu Pro Thr Gly Gln Glu Ser Leu Arg 835 840 845 850
agc agc agc tgt agc atc aat cac ccc atc ttc cga gaa ggt gcc aag
2649 Ser Ser Ser Cys Ser Ile Asn His Pro Ile Phe Arg Glu Gly Ala
Lys 855 860 865 gcc acc ttc atg atc aca ttt gat gtc tcc tac aag gcc
ttc ctg gga 2697 Ala Thr Phe Met Ile Thr Phe Asp Val Ser Tyr Lys
Ala Phe Leu Gly 870 875 880 gac agg ttg ctt ctg agg gcc agc gca agc
agt gag aat aat aag cct 2745 Asp Arg Leu Leu Leu Arg Ala Ser Ala
Ser Ser Glu Asn Asn Lys Pro 885 890 895 gaa acc agc aag act gcc ttc
cag ctg gag ctt ccg gtg aag tac acg 2793 Glu Thr Ser Lys Thr Ala
Phe Gln Leu Glu Leu Pro Val Lys Tyr Thr 900 905 910 gtc tat acc gtg
atc agt agg cag gaa gat tct acc aag cat ttc aac 2841 Val Tyr Thr
Val Ile Ser Arg Gln Glu Asp Ser Thr Lys His Phe Asn 915 920 925 930
ttc tca tct tcc cac ggg gag aga cag aaa gag gcc gaa cat cga tat
2889 Phe Ser Ser Ser His Gly Glu Arg Gln Lys Glu Ala Glu His Arg
Tyr 935 940 945 cgt gtg aat aac ctg agt cca ttg acg ctg gcc atc agc
gtt aac ttc 2937 Arg Val Asn Asn Leu Ser Pro Leu Thr Leu Ala Ile
Ser Val Asn Phe 950 955 960 tgg gtc ccc atc ctt ctg aat ggt gtg gcc
gtg tgg gat gtg act ctg 2985 Trp Val Pro Ile Leu Leu Asn Gly Val
Ala Val Trp Asp Val Thr Leu 965 970 975 agg agc cca gca cag ggt gtc
tcc tgt gtg tca cag agg gaa cct cct 3033 Arg Ser Pro Ala Gln Gly
Val Ser Cys Val Ser Gln Arg Glu Pro Pro 980 985 990 caa cat tcc gac
ctt ctg acc cag atc caa gga cgc tct gtg ctg gac 3081 Gln His Ser
Asp Leu Leu Thr Gln Ile Gln Gly Arg Ser Val Leu Asp 995 1000
1005
1010 tgc gcc atc gcc gac tgc ctg cac ctc cgc tgt gac atc ccc tcc
ttg 3129 Cys Ala Ile Ala Asp Cys Leu His Leu Arg Cys Asp Ile Pro
Ser Leu 1015 1020 1025 ggc acc ctg gat gag ctt gac ttc att ctg aag
ggc aac ctc agc ttc 3177 Gly Thr Leu Asp Glu Leu Asp Phe Ile Leu
Lys Gly Asn Leu Ser Phe 1030 1035 1040 ggc tgg atc agt cag aca ttg
cag aaa aag gtg ttg ctc ctg agt gag 3225 Gly Trp Ile Ser Gln Thr
Leu Gln Lys Lys Val Leu Leu Leu Ser Glu 1045 1050 1055 gct gaa atc
aca ttc aac aca tct gtg tat tcc cag ctg ccg gga cag 3273 Ala Glu
Ile Thr Phe Asn Thr Ser Val Tyr Ser Gln Leu Pro Gly Gln 1060 1065
1070 gag gca ttt ctg aga gcc cag gtg tca acg atg cta gaa gaa tac
gtg 3321 Glu Ala Phe Leu Arg Ala Gln Val Ser Thr Met Leu Glu Glu
Tyr Val 1075 1080 1085 1090 gtc tat gag ccc gtc ttc ctc atg gtg ttc
agc tca gtg gga ggt ctg 3369 Val Tyr Glu Pro Val Phe Leu Met Val
Phe Ser Ser Val Gly Gly Leu 1095 1100 1105 ctg tta ctg gct ctc atc
act gtg gcg ctg tac aag ctt ggc ttc ttc 3417 Leu Leu Leu Ala Leu
Ile Thr Val Ala Leu Tyr Lys Leu Gly Phe Phe 1110 1115 1120 aaa cgt
cag tat aaa gag atg ctg gat cta cca tct gca gat cct gac 3465 Lys
Arg Gln Tyr Lys Glu Met Leu Asp Leu Pro Ser Ala Asp Pro Asp 1125
1130 1135 cca gcc ggc cag gca gat tcc aac cat gag act cct cca cat
ctc acg 3513 Pro Ala Gly Gln Ala Asp Ser Asn His Glu Thr Pro Pro
His Leu Thr 1140 1145 1150 tcc tag 3519 Ser 1155 46 1155 PRT Mus
musculus 46 Met Val Arg Gly Val Val Ile Leu Leu Cys Gly Trp Ala Leu
Ala Ser 1 5 10 15 Cys His Gly Ser Asn Leu Asp Val Glu Lys Pro Val
Val Phe Lys Glu 20 25 30 Asp Ala Ala Ser Phe Gly Gln Thr Val Val
Gln Phe Gly Gly Ser Arg 35 40 45 Leu Val Val Gly Ala Pro Leu Glu
Ala Val Ala Val Asn Gln Thr Gly 50 55 60 Gln Ser Ser Asp Cys Pro
Pro Ala Thr Gly Val Cys Gln Pro Ile Leu 65 70 75 80 Leu His Ile Pro
Leu Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu 85 90 95 Val Ala
Asp Thr Asn Asn Ser Gln Leu Leu Ala Cys Gly Pro Thr Ala 100 105 110
Gln Arg Ala Cys Ala Lys Asn Met Tyr Ala Lys Gly Ser Cys Leu Leu 115
120 125 Leu Gly Ser Ser Leu Gln Phe Ile Gln Ala Ile Pro Ala Thr Met
Pro 130 135 140 Glu Cys Pro Gly Gln Glu Met Asp Ile Ala Phe Leu Ile
Asp Gly Ser 145 150 155 160 Gly Ser Ile Asp Gln Ser Asp Phe Thr Gln
Met Lys Asp Phe Val Lys 165 170 175 Ala Leu Met Gly Gln Leu Ala Ser
Thr Ser Thr Ser Phe Ser Leu Met 180 185 190 Gln Tyr Ser Asn Ile Leu
Lys Thr His Phe Thr Phe Thr Glu Phe Lys 195 200 205 Ser Ser Leu Ser
Pro Gln Ser Leu Val Asp Ala Ile Val Gln Leu Gln 210 215 220 Gly Leu
Thr Tyr Thr Ala Ser Gly Ile Gln Lys Val Val Lys Glu Leu 225 230 235
240 Phe His Ser Lys Asn Gly Ala Arg Lys Ser Ala Lys Lys Ile Leu Ile
245 250 255 Val Ile Thr Asp Gly Gln Lys Phe Arg Asp Pro Leu Glu Tyr
Arg His 260 265 270 Val Ile Pro Glu Ala Glu Lys Ala Gly Ile Ile Arg
Tyr Ala Ile Gly 275 280 285 Val Gly Asp Ala Phe Arg Glu Pro Thr Ala
Leu Gln Glu Leu Asn Thr 290 295 300 Ile Gly Ser Ala Pro Ser Gln Asp
His Val Phe Lys Val Gly Asn Phe 305 310 315 320 Val Ala Leu Arg Ser
Ile Gln Arg Gln Ile Gln Glu Lys Ile Phe Ala 325 330 335 Ile Glu Gly
Thr Glu Ser Arg Ser Ser Ser Ser Phe Gln His Glu Met 340 345 350 Ser
Gln Glu Gly Phe Ser Ser Ala Leu Ser Met Asp Gly Pro Val Leu 355 360
365 Gly Ala Val Gly Gly Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro
370 375 380 Ser Asn Met Arg Ser Thr Phe Ile Asn Met Ser Gln Glu Asn
Glu Asp 385 390 395 400 Met Arg Asp Ala Tyr Leu Gly Tyr Ser Thr Ala
Leu Ala Phe Trp Lys 405 410 415 Gly Val His Ser Leu Ile Leu Gly Ala
Pro Arg His Gln His Thr Gly 420 425 430 Lys Val Val Ile Phe Thr Gln
Glu Ser Arg His Trp Arg Pro Lys Ser 435 440 445 Glu Val Arg Gly Thr
Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys 450 455 460 Ser Val Asp
Met Asp Arg Asp Gly Ser Thr Asp Leu Val Leu Ile Gly 465 470 475 480
Val Pro His Tyr Tyr Glu His Thr Arg Gly Gly Gln Val Ser Val Cys 485
490 495 Pro Met Pro Gly Val Arg Ser Arg Trp His Cys Gly Thr Thr Leu
His 500 505 510 Gly Glu Gln Gly His Pro Trp Gly Arg Phe Gly Ala Ala
Leu Thr Val 515 520 525 Leu Gly Asp Val Asn Gly Asp Ser Leu Ala Asp
Val Ala Ile Gly Ala 530 535 540 Pro Gly Glu Glu Glu Asn Arg Gly Ala
Val Tyr Ile Phe His Gly Ala 545 550 555 560 Ser Arg Gln Asp Ile Ala
Pro Ser Pro Ser Gln Arg Val Thr Gly Ser 565 570 575 Gln Leu Phe Leu
Arg Leu Gln Tyr Phe Gly Gln Ser Leu Ser Gly Gly 580 585 590 Gln Asp
Leu Thr Gln Asp Gly Leu Val Asp Leu Ala Val Gly Ala Gln 595 600 605
Gly His Val Leu Leu Leu Arg Ser Leu Pro Leu Leu Lys Val Gly Ile 610
615 620 Ser Ile Arg Phe Ala Pro Ser Glu Val Ala Lys Thr Val Tyr Gln
Cys 625 630 635 640 Trp Gly Arg Thr Pro Thr Val Leu Glu Ala Gly Glu
Ala Thr Val Cys 645 650 655 Leu Thr Val Arg Lys Gly Ser Pro Asp Leu
Leu Gly Asp Val Gln Ser 660 665 670 Ser Val Arg Tyr Asp Leu Ala Leu
Asp Pro Gly Arg Leu Ile Ser Arg 675 680 685 Ala Ile Phe Asp Glu Thr
Lys Asn Cys Thr Leu Thr Arg Arg Lys Thr 690 695 700 Leu Gly Leu Gly
Asp His Cys Glu Thr Met Lys Leu Leu Leu Pro Asp 705 710 715 720 Cys
Val Glu Asp Ala Val Thr Pro Ile Ile Leu Arg Leu Asn Leu Ser 725 730
735 Leu Ala Gly Asp Ser Ala Pro Ser Arg Asn Leu Arg Pro Val Leu Ala
740 745 750 Val Gly Ser Gln Asp His Val Thr Ala Ser Phe Pro Phe Glu
Lys Asn 755 760 765 Cys Glu Gly Asn Leu Gly Val Ser Phe Asn Phe Ser
Gly Leu Gln Val 770 775 780 Leu Glu Val Gly Ser Ser Pro Glu Leu Thr
Val Thr Val Thr Val Trp 785 790 795 800 Asn Glu Gly Glu Asp Ser Tyr
Gly Thr Leu Ile Lys Phe Tyr Tyr Pro 805 810 815 Ala Glu Leu Ser Tyr
Arg Arg Val Thr Arg Ala Gln Gln Pro His Pro 820 825 830 Tyr Pro Leu
Arg Leu Ala Cys Glu Ala Glu Pro Thr Gly Gln Glu Ser 835 840 845 Leu
Arg Ser Ser Ser Cys Ser Ile Asn His Pro Ile Phe Arg Glu Gly 850 855
860 Ala Lys Ala Thr Phe Met Ile Thr Phe Asp Val Ser Tyr Lys Ala Phe
865 870 875 880 Leu Gly Asp Arg Leu Leu Leu Arg Ala Ser Ala Ser Ser
Glu Asn Asn 885 890 895 Lys Pro Glu Thr Ser Lys Thr Ala Phe Gln Leu
Glu Leu Pro Val Lys 900 905 910 Tyr Thr Val Tyr Thr Val Ile Ser Arg
Gln Glu Asp Ser Thr Lys His 915 920 925 Phe Asn Phe Ser Ser Ser His
Gly Glu Arg Gln Lys Glu Ala Glu His 930 935 940 Arg Tyr Arg Val Asn
Asn Leu Ser Pro Leu Thr Leu Ala Ile Ser Val 945 950 955 960 Asn Phe
Trp Val Pro Ile Leu Leu Asn Gly Val Ala Val Trp Asp Val 965 970 975
Thr Leu Arg Ser Pro Ala Gln Gly Val Ser Cys Val Ser Gln Arg Glu 980
985 990 Pro Pro Gln His Ser Asp Leu Leu Thr Gln Ile Gln Gly Arg Ser
Val 995 1000 1005 Leu Asp Cys Ala Ile Ala Asp Cys Leu His Leu Arg
Cys Asp Ile Pro 1010 1015 1020 Ser Leu Gly Thr Leu Asp Glu Leu Asp
Phe Ile Leu Lys Gly Asn Leu 025 1030 1035 1040 Ser Phe Gly Trp Ile
Ser Gln Thr Leu Gln Lys Lys Val Leu Leu Leu 1045 1050 1055 Ser Glu
Ala Glu Ile Thr Phe Asn Thr Ser Val Tyr Ser Gln Leu Pro 1060 1065
1070 Gly Gln Glu Ala Phe Leu Arg Ala Gln Val Ser Thr Met Leu Glu
Glu 1075 1080 1085 Tyr Val Val Tyr Glu Pro Val Phe Leu Met Val Phe
Ser Ser Val Gly 1090 1095 1100 Gly Leu Leu Leu Leu Ala Leu Ile Thr
Val Ala Leu Tyr Lys Leu Gly 105 1110 1115 1120 Phe Phe Lys Arg Gln
Tyr Lys Glu Met Leu Asp Leu Pro Ser Ala Asp 1125 1130 1135 Pro Asp
Pro Ala Gly Gln Ala Asp Ser Asn His Glu Thr Pro Pro His 1140 1145
1150 Leu Thr Ser 115 47 49 DNA Artificial Sequence Description of
Artificial Sequence primer 47 agttacggat ccggcaccat gaccttcggc
actgtgatcc tcctgtgtg 49 48 19 DNA Artificial Sequence Description
of Artificial Sequence primer 48 gctggacgat ggcatccac 19 49 24 DNA
Artificial Sequence Description of Artificial Sequence primer 49
gtagagttac ggatccggca ccat 24 50 20 DNA Artificial Sequence
Description of Artificial Sequence primer 50 gcagccagct tcggacagac
20 51 21 DNA Artificial Sequence Description of Artificial Sequence
primer 51 ccatgtccac agaacagaga g 21 52 3803 DNA Mus musculus CDS
(1)..(3483) Description of Artificial Sequence primer 52 atg gtc
cgt gga gtt gtg atc ctc ctg tgt ggc tgg gcc ctg gct tcc 48 Met Val
Arg Gly Val Val Ile Leu Leu Cys Gly Trp Ala Leu Ala Ser 1 5 10 15
tgt cat ggg tct aac ctg gat gtg gag aag ccc gtc gtg ttc aaa gag 96
Cys His Gly Ser Asn Leu Asp Val Glu Lys Pro Val Val Phe Lys Glu 20
25 30 gat gca gcc agc ttc gga cag act gtg gtg cag ttt ggt gga tct
cga 144 Asp Ala Ala Ser Phe Gly Gln Thr Val Val Gln Phe Gly Gly Ser
Arg 35 40 45 ctc gtg gtg gga gcc cct ctg gag gcg gtg gca gtc aac
caa aca gga 192 Leu Val Val Gly Ala Pro Leu Glu Ala Val Ala Val Asn
Gln Thr Gly 50 55 60 cag tcg tct gac tgt ccg cct gcc act ggc gtg
tgc cag ccc atc tta 240 Gln Ser Ser Asp Cys Pro Pro Ala Thr Gly Val
Cys Gln Pro Ile Leu 65 70 75 80 ctg cac att ccc cta gag gca gtg aac
atg tcc ctg ggc ctg tct ctg 288 Leu His Ile Pro Leu Glu Ala Val Asn
Met Ser Leu Gly Leu Ser Leu 85 90 95 gtg gct gac acc aat aac tcc
cag ttg ctg gct tgt ggt cca act gca 336 Val Ala Asp Thr Asn Asn Ser
Gln Leu Leu Ala Cys Gly Pro Thr Ala 100 105 110 cag aga gct tgt gca
aag aac atg tat gca aaa ggt tcc tgc ctc ctt 384 Gln Arg Ala Cys Ala
Lys Asn Met Tyr Ala Lys Gly Ser Cys Leu Leu 115 120 125 ctg ggc tcc
agc ttg cag ttc atc cag gca atc cct gct acc atg cca 432 Leu Gly Ser
Ser Leu Gln Phe Ile Gln Ala Ile Pro Ala Thr Met Pro 130 135 140 gag
tgt cca gga caa gag atg gac att gct ttc ctg att gat ggc tcc 480 Glu
Cys Pro Gly Gln Glu Met Asp Ile Ala Phe Leu Ile Asp Gly Ser 145 150
155 160 ggc agc att gat caa agt gac ttt acc cag atg aag gac ttc gtc
aaa 528 Gly Ser Ile Asp Gln Ser Asp Phe Thr Gln Met Lys Asp Phe Val
Lys 165 170 175 gct ttg atg ggc cag ttg gcg agc acc agc acc tcg ttc
tcc ctg atg 576 Ala Leu Met Gly Gln Leu Ala Ser Thr Ser Thr Ser Phe
Ser Leu Met 180 185 190 caa tac tca aac atc ctg aag act cat ttt acc
ttc acg gaa ttc aag 624 Gln Tyr Ser Asn Ile Leu Lys Thr His Phe Thr
Phe Thr Glu Phe Lys 195 200 205 agc agc ctg agc cct cag agc ctg gtg
gat gcc atc gtc cag ctc caa 672 Ser Ser Leu Ser Pro Gln Ser Leu Val
Asp Ala Ile Val Gln Leu Gln 210 215 220 ggc ctg acg tac aca gcc tcg
ggc atc cag aaa gtg gtg aaa gag cta 720 Gly Leu Thr Tyr Thr Ala Ser
Gly Ile Gln Lys Val Val Lys Glu Leu 225 230 235 240 ttt cat agc aag
aat ggg gcc cga aaa agt gcc aag aag ata cta att 768 Phe His Ser Lys
Asn Gly Ala Arg Lys Ser Ala Lys Lys Ile Leu Ile 245 250 255 gtc atc
aca gat ggg cag aaa ttc aga gac ccc ctg gag tat aga cat 816 Val Ile
Thr Asp Gly Gln Lys Phe Arg Asp Pro Leu Glu Tyr Arg His 260 265 270
gtc atc cct gaa gca gag aaa gct ggg atc att cgc tat gct ata ggg 864
Val Ile Pro Glu Ala Glu Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly 275
280 285 gtg gga gat gcc ttc cgg gaa ccc act gcc cta cag gag ctg aac
acc 912 Val Gly Asp Ala Phe Arg Glu Pro Thr Ala Leu Gln Glu Leu Asn
Thr 290 295 300 att ggc tca gct ccc tcg cag gac cac gtg ttc aag gtg
ggc aat ttt 960 Ile Gly Ser Ala Pro Ser Gln Asp His Val Phe Lys Val
Gly Asn Phe 305 310 315 320 gta gca ctt cgc agc atc cag cgg caa att
cag gag aaa atc ttt gcc 1008 Val Ala Leu Arg Ser Ile Gln Arg Gln
Ile Gln Glu Lys Ile Phe Ala 325 330 335 att gaa gga acc gaa tca agg
tca agt agt tcc ttt cag cac gag atg 1056 Ile Glu Gly Thr Glu Ser
Arg Ser Ser Ser Ser Phe Gln His Glu Met 340 345 350 tca caa gaa ggt
ttc agc tca gct ctc tca atg gat gga cca gtt ctg 1104 Ser Gln Glu
Gly Phe Ser Ser Ala Leu Ser Met Asp Gly Pro Val Leu 355 360 365 ggg
gct gtg gga ggc ttc agc tgg tct gga ggt gcc ttc ttg tac ccc 1152
Gly Ala Val Gly Gly Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro 370
375 380 tca aat atg aga tcc acc ttc atc aac atg tct cag gag aac gag
gat 1200 Ser Asn Met Arg Ser Thr Phe Ile Asn Met Ser Gln Glu Asn
Glu Asp 385 390 395 400 atg agg gac gct tac ctg ggt tac tcc acc gca
ctg gcc ttt tgg aag 1248 Met Arg Asp Ala Tyr Leu Gly Tyr Ser Thr
Ala Leu Ala Phe Trp Lys 405 410 415 ggg gtc cac agc ctg atc ctg ggg
gcc cct cgc cac cag cac acg ggg 1296 Gly Val His Ser Leu Ile Leu
Gly Ala Pro Arg His Gln His Thr Gly 420 425 430 aag gtt gtc atc ttt
acc cag gaa tcc agg cac tgg agg ccc aag tct 1344 Lys Val Val Ile
Phe Thr Gln Glu Ser Arg His Trp Arg Pro Lys Ser 435 440 445 gaa gtc
aga ggg aca cag atc ggc tcc tac ttt ggg gca tct ctc tgt 1392 Glu
Val Arg Gly Thr Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys 450 455
460 tct gtg gac atg gat aga gat ggc agc act gac ctg gtc ctg att gga
1440 Ser Val Asp Met Asp Arg Asp Gly Ser Thr Asp Leu Val Leu Ile
Gly 465 470 475 480 gtc ccc cat tac tat gag cac acc cga ggg ggg cag
gtg tcg gtg tgc 1488 Val Pro His Tyr Tyr Glu His Thr Arg Gly Gly
Gln Val Ser Val Cys 485 490 495 ccc atg cct ggt gtg agg agc agg tgg
cat tgt ggg acc acc ctc cat 1536 Pro Met Pro Gly Val Arg Ser Arg
Trp His Cys Gly Thr Thr Leu His 500 505 510 ggg gag cag ggc cat cct
tgg ggc cgc ttt ggg gcg gct ctg aca gtg 1584 Gly Glu Gln Gly His
Pro Trp Gly Arg Phe Gly Ala Ala Leu Thr Val 515 520 525 cta ggg gac
gtg aat ggg gac agt ctg gcg gat gtg gct att ggt gca 1632 Leu Gly
Asp Val Asn Gly Asp Ser Leu Ala Asp Val Ala Ile Gly Ala 530 535 540
ccc gga gag gag gag aac aga ggt gct gtc tac ata ttt cat gga gcc
1680 Pro Gly Glu Glu Glu Asn Arg Gly Ala Val Tyr Ile Phe His Gly
Ala 545 550 555 560 tcg aga cag gac atc gct ccc tcg cct agc cag cgg
gtc act ggc tcc 1728 Ser Arg Gln Asp Ile Ala Pro Ser Pro Ser Gln
Arg Val Thr Gly Ser 565 570 575 cag ctc ttc ctg
agg ctc caa tat ttt ggg cag tca tta agt ggg ggt 1776 Gln Leu Phe
Leu Arg Leu Gln Tyr Phe Gly Gln Ser Leu Ser Gly Gly 580 585 590 cag
gac ctt aca cag gat ggc ctg gtg gac ctg gcc gtg gga gcc cag 1824
Gln Asp Leu Thr Gln Asp Gly Leu Val Asp Leu Ala Val Gly Ala Gln 595
600 605 ggg cac gtg ctg ctg ctt agg agt ctg cct ttg ctg aaa gtg ggg
atc 1872 Gly His Val Leu Leu Leu Arg Ser Leu Pro Leu Leu Lys Val
Gly Ile 610 615 620 tcc att aga ttt gcc ccc tca gag gtg gca aag act
gtg tac cag tgc 1920 Ser Ile Arg Phe Ala Pro Ser Glu Val Ala Lys
Thr Val Tyr Gln Cys 625 630 635 640 tgg gga agg act ccc act gtc ctc
gaa gct gga gag gcc acc gtc tgt 1968 Trp Gly Arg Thr Pro Thr Val
Leu Glu Ala Gly Glu Ala Thr Val Cys 645 650 655 ctc act gtc cgc aaa
ggt tca cct gac ctg tta ggt gat gtc caa agc 2016 Leu Thr Val Arg
Lys Gly Ser Pro Asp Leu Leu Gly Asp Val Gln Ser 660 665 670 tct gtc
agg tat gat ctg gcg ttg gat ccg ggc cgt ctg att tct cgt 2064 Ser
Val Arg Tyr Asp Leu Ala Leu Asp Pro Gly Arg Leu Ile Ser Arg 675 680
685 gcc att ttt gat gag acg aag aac tgc act ttg acc cga agg aag act
2112 Ala Ile Phe Asp Glu Thr Lys Asn Cys Thr Leu Thr Arg Arg Lys
Thr 690 695 700 ctg ggg ctt ggt gat cac tgc gaa aca atg aag ctg ctt
ttg cca gac 2160 Leu Gly Leu Gly Asp His Cys Glu Thr Met Lys Leu
Leu Leu Pro Asp 705 710 715 720 tgt gtg gag gat gca gtg acc cct atc
atc ctg cgc ctt aac tta tcc 2208 Cys Val Glu Asp Ala Val Thr Pro
Ile Ile Leu Arg Leu Asn Leu Ser 725 730 735 ctg gca ggg gac tct gct
cca tcc agg aac ctt cgt cct gtg ctg gct 2256 Leu Ala Gly Asp Ser
Ala Pro Ser Arg Asn Leu Arg Pro Val Leu Ala 740 745 750 gtg ggc tca
caa gac cat gta aca gct tct ttc ccg ttt gag aag aac 2304 Val Gly
Ser Gln Asp His Val Thr Ala Ser Phe Pro Phe Glu Lys Asn 755 760 765
tgt aag cag gag ctc ctg tgt gag ggg aac ctg ggc gtc agc ttc aac
2352 Cys Lys Gln Glu Leu Leu Cys Glu Gly Asn Leu Gly Val Ser Phe
Asn 770 775 780 ttc tca ggc ctg cag gtc ttg gag gta gga agc tcc cca
gag ctc act 2400 Phe Ser Gly Leu Gln Val Leu Glu Val Gly Ser Ser
Pro Glu Leu Thr 785 790 795 800 gtg aca gta aca gtt tgg aat gag ggt
gag gac agc tat gga acc tta 2448 Val Thr Val Thr Val Trp Asn Glu
Gly Glu Asp Ser Tyr Gly Thr Leu 805 810 815 atc aag ttc tac tac cca
gca gag cta tct tac cga cgg gtg aca aga 2496 Ile Lys Phe Tyr Tyr
Pro Ala Glu Leu Ser Tyr Arg Arg Val Thr Arg 820 825 830 gcc cag caa
cct cat ccg tac cca cta cgc ctg gca tgt gag gct gag 2544 Ala Gln
Gln Pro His Pro Tyr Pro Leu Arg Leu Ala Cys Glu Ala Glu 835 840 845
ccc acg ggc cag gag agc ctg agg agc agc agc tgt agc atc aat cac
2592 Pro Thr Gly Gln Glu Ser Leu Arg Ser Ser Ser Cys Ser Ile Asn
His 850 855 860 ccc atc ttc cga gaa ggt gcc aag gcc acc ttc atg atc
aca ttt gat 2640 Pro Ile Phe Arg Glu Gly Ala Lys Ala Thr Phe Met
Ile Thr Phe Asp 865 870 875 880 gtc tcc tac aag gcc ttc ctg gga gac
agg ttg ctt ctg agg gcc agc 2688 Val Ser Tyr Lys Ala Phe Leu Gly
Asp Arg Leu Leu Leu Arg Ala Ser 885 890 895 gca agc agt gag aat aat
aag cct gaa acc agc aag act gcc ttc cag 2736 Ala Ser Ser Glu Asn
Asn Lys Pro Glu Thr Ser Lys Thr Ala Phe Gln 900 905 910 ctg gag ctt
ccg gtg aag tac acg gtc tat acc gtg atc agt agg cag 2784 Leu Glu
Leu Pro Val Lys Tyr Thr Val Tyr Thr Val Ile Ser Arg Gln 915 920 925
gaa gat tct acc aag cat ttc aac ttc tca tct tcc cac ggg gag aga
2832 Glu Asp Ser Thr Lys His Phe Asn Phe Ser Ser Ser His Gly Glu
Arg 930 935 940 cag aaa gag gcc gaa cat cga tat cgt gtg aat aac ctg
agt cca ttg 2880 Gln Lys Glu Ala Glu His Arg Tyr Arg Val Asn Asn
Leu Ser Pro Leu 945 950 955 960 acg ctg gcc atc agc gtt aac ttc tgg
gtc ccc atc ctt ctg aat ggt 2928 Thr Leu Ala Ile Ser Val Asn Phe
Trp Val Pro Ile Leu Leu Asn Gly 965 970 975 gtg gcc gtg tgg gat gtg
act ctg agg agc cca gca cag ggt gtc tcc 2976 Val Ala Val Trp Asp
Val Thr Leu Arg Ser Pro Ala Gln Gly Val Ser 980 985 990 tgt gtg tca
cag agg gaa cct cct caa cat tcc gac ctt ctg acc cag 3024 Cys Val
Ser Gln Arg Glu Pro Pro Gln His Ser Asp Leu Leu Thr Gln 995 1000
1005 atc caa gga cgc tct gtg ctg gac tgc gcc atc gcc gac tgc ctg
cac 3072 Ile Gln Gly Arg Ser Val Leu Asp Cys Ala Ile Ala Asp Cys
Leu His 1010 1015 1020 ctc cgc tgt gac atc ccc tcc ttg ggc acc ctg
gat gag ctt gac ttc 3120 Leu Arg Cys Asp Ile Pro Ser Leu Gly Thr
Leu Asp Glu Leu Asp Phe 1025 1030 1035 1040 att ctg aag ggc aac ctc
agc ttc ggc tgg atc agt cag aca ttg cag 3168 Ile Leu Lys Gly Asn
Leu Ser Phe Gly Trp Ile Ser Gln Thr Leu Gln 1045 1050 1055 aaa aag
gtg ttg ctc ctg agt gag gct gaa atc aca ttc aac aca tct 3216 Lys
Lys Val Leu Leu Leu Ser Glu Ala Glu Ile Thr Phe Asn Thr Ser 1060
1065 1070 gtg tat tcc cag ctg ccg gga cag gag gca ttt ctg aga gcc
cag gtg 3264 Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala Phe Leu Arg
Ala Gln Val 1075 1080 1085 tca acg atg cta gaa gaa tac gtg gtc tat
gag ccc gtc ttc ctc atg 3312 Ser Thr Met Leu Glu Glu Tyr Val Val
Tyr Glu Pro Val Phe Leu Met 1090 1095 1100 gtg ttc agc tca gtg gga
ggt ctg ctg tta ctg gct ctc atc act gtg 3360 Val Phe Ser Ser Val
Gly Gly Leu Leu Leu Leu Ala Leu Ile Thr Val 1105 1110 1115 1120 gcg
ctg tac aag ctt ggc ttc ttc aaa cgt cag tat aaa gag atg ctg 3408
Ala Leu Tyr Lys Leu Gly Phe Phe Lys Arg Gln Tyr Lys Glu Met Leu
1125 1130 1135 gat cta cca tct gca gat cct gac cca gcc ggc cag gca
gat tcc aac 3456 Asp Leu Pro Ser Ala Asp Pro Asp Pro Ala Gly Gln
Ala Asp Ser Asn 1140 1145 1150 cat gag act cct cca cat ctc acg tcc
taggaatcta ctttcctgta 3503 His Glu Thr Pro Pro His Leu Thr Ser 1155
1160 tatctccaca attacgagat tggttttgct tttgcctatg aatctactgg
catgggaaca 3563 agttctcttc agctctgggc tagcctggga aacttcccag
aaatgatgcc ctacctcctg 3623 agctgggaga tttttatggt ttgcccatgt
gtcagatttc agtgctgatc cacttttttt 3683 gcaagagcag gaatggggtc
agcataaatt tacatatgga taagaactaa cacaagactg 3743 agtaatatgc
tcaatattca atgtattgct tgtataaatt tttaaaaaat aaaatgaaan 3803 53 1161
PRT Mus musculus 53 Met Val Arg Gly Val Val Ile Leu Leu Cys Gly Trp
Ala Leu Ala Ser 1 5 10 15 Cys His Gly Ser Asn Leu Asp Val Glu Lys
Pro Val Val Phe Lys Glu 20 25 30 Asp Ala Ala Ser Phe Gly Gln Thr
Val Val Gln Phe Gly Gly Ser Arg 35 40 45 Leu Val Val Gly Ala Pro
Leu Glu Ala Val Ala Val Asn Gln Thr Gly 50 55 60 Gln Ser Ser Asp
Cys Pro Pro Ala Thr Gly Val Cys Gln Pro Ile Leu 65 70 75 80 Leu His
Ile Pro Leu Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu 85 90 95
Val Ala Asp Thr Asn Asn Ser Gln Leu Leu Ala Cys Gly Pro Thr Ala 100
105 110 Gln Arg Ala Cys Ala Lys Asn Met Tyr Ala Lys Gly Ser Cys Leu
Leu 115 120 125 Leu Gly Ser Ser Leu Gln Phe Ile Gln Ala Ile Pro Ala
Thr Met Pro 130 135 140 Glu Cys Pro Gly Gln Glu Met Asp Ile Ala Phe
Leu Ile Asp Gly Ser 145 150 155 160 Gly Ser Ile Asp Gln Ser Asp Phe
Thr Gln Met Lys Asp Phe Val Lys 165 170 175 Ala Leu Met Gly Gln Leu
Ala Ser Thr Ser Thr Ser Phe Ser Leu Met 180 185 190 Gln Tyr Ser Asn
Ile Leu Lys Thr His Phe Thr Phe Thr Glu Phe Lys 195 200 205 Ser Ser
Leu Ser Pro Gln Ser Leu Val Asp Ala Ile Val Gln Leu Gln 210 215 220
Gly Leu Thr Tyr Thr Ala Ser Gly Ile Gln Lys Val Val Lys Glu Leu 225
230 235 240 Phe His Ser Lys Asn Gly Ala Arg Lys Ser Ala Lys Lys Ile
Leu Ile 245 250 255 Val Ile Thr Asp Gly Gln Lys Phe Arg Asp Pro Leu
Glu Tyr Arg His 260 265 270 Val Ile Pro Glu Ala Glu Lys Ala Gly Ile
Ile Arg Tyr Ala Ile Gly 275 280 285 Val Gly Asp Ala Phe Arg Glu Pro
Thr Ala Leu Gln Glu Leu Asn Thr 290 295 300 Ile Gly Ser Ala Pro Ser
Gln Asp His Val Phe Lys Val Gly Asn Phe 305 310 315 320 Val Ala Leu
Arg Ser Ile Gln Arg Gln Ile Gln Glu Lys Ile Phe Ala 325 330 335 Ile
Glu Gly Thr Glu Ser Arg Ser Ser Ser Ser Phe Gln His Glu Met 340 345
350 Ser Gln Glu Gly Phe Ser Ser Ala Leu Ser Met Asp Gly Pro Val Leu
355 360 365 Gly Ala Val Gly Gly Phe Ser Trp Ser Gly Gly Ala Phe Leu
Tyr Pro 370 375 380 Ser Asn Met Arg Ser Thr Phe Ile Asn Met Ser Gln
Glu Asn Glu Asp 385 390 395 400 Met Arg Asp Ala Tyr Leu Gly Tyr Ser
Thr Ala Leu Ala Phe Trp Lys 405 410 415 Gly Val His Ser Leu Ile Leu
Gly Ala Pro Arg His Gln His Thr Gly 420 425 430 Lys Val Val Ile Phe
Thr Gln Glu Ser Arg His Trp Arg Pro Lys Ser 435 440 445 Glu Val Arg
Gly Thr Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys 450 455 460 Ser
Val Asp Met Asp Arg Asp Gly Ser Thr Asp Leu Val Leu Ile Gly 465 470
475 480 Val Pro His Tyr Tyr Glu His Thr Arg Gly Gly Gln Val Ser Val
Cys 485 490 495 Pro Met Pro Gly Val Arg Ser Arg Trp His Cys Gly Thr
Thr Leu His 500 505 510 Gly Glu Gln Gly His Pro Trp Gly Arg Phe Gly
Ala Ala Leu Thr Val 515 520 525 Leu Gly Asp Val Asn Gly Asp Ser Leu
Ala Asp Val Ala Ile Gly Ala 530 535 540 Pro Gly Glu Glu Glu Asn Arg
Gly Ala Val Tyr Ile Phe His Gly Ala 545 550 555 560 Ser Arg Gln Asp
Ile Ala Pro Ser Pro Ser Gln Arg Val Thr Gly Ser 565 570 575 Gln Leu
Phe Leu Arg Leu Gln Tyr Phe Gly Gln Ser Leu Ser Gly Gly 580 585 590
Gln Asp Leu Thr Gln Asp Gly Leu Val Asp Leu Ala Val Gly Ala Gln 595
600 605 Gly His Val Leu Leu Leu Arg Ser Leu Pro Leu Leu Lys Val Gly
Ile 610 615 620 Ser Ile Arg Phe Ala Pro Ser Glu Val Ala Lys Thr Val
Tyr Gln Cys 625 630 635 640 Trp Gly Arg Thr Pro Thr Val Leu Glu Ala
Gly Glu Ala Thr Val Cys 645 650 655 Leu Thr Val Arg Lys Gly Ser Pro
Asp Leu Leu Gly Asp Val Gln Ser 660 665 670 Ser Val Arg Tyr Asp Leu
Ala Leu Asp Pro Gly Arg Leu Ile Ser Arg 675 680 685 Ala Ile Phe Asp
Glu Thr Lys Asn Cys Thr Leu Thr Arg Arg Lys Thr 690 695 700 Leu Gly
Leu Gly Asp His Cys Glu Thr Met Lys Leu Leu Leu Pro Asp 705 710 715
720 Cys Val Glu Asp Ala Val Thr Pro Ile Ile Leu Arg Leu Asn Leu Ser
725 730 735 Leu Ala Gly Asp Ser Ala Pro Ser Arg Asn Leu Arg Pro Val
Leu Ala 740 745 750 Val Gly Ser Gln Asp His Val Thr Ala Ser Phe Pro
Phe Glu Lys Asn 755 760 765 Cys Lys Gln Glu Leu Leu Cys Glu Gly Asn
Leu Gly Val Ser Phe Asn 770 775 780 Phe Ser Gly Leu Gln Val Leu Glu
Val Gly Ser Ser Pro Glu Leu Thr 785 790 795 800 Val Thr Val Thr Val
Trp Asn Glu Gly Glu Asp Ser Tyr Gly Thr Leu 805 810 815 Ile Lys Phe
Tyr Tyr Pro Ala Glu Leu Ser Tyr Arg Arg Val Thr Arg 820 825 830 Ala
Gln Gln Pro His Pro Tyr Pro Leu Arg Leu Ala Cys Glu Ala Glu 835 840
845 Pro Thr Gly Gln Glu Ser Leu Arg Ser Ser Ser Cys Ser Ile Asn His
850 855 860 Pro Ile Phe Arg Glu Gly Ala Lys Ala Thr Phe Met Ile Thr
Phe Asp 865 870 875 880 Val Ser Tyr Lys Ala Phe Leu Gly Asp Arg Leu
Leu Leu Arg Ala Ser 885 890 895 Ala Ser Ser Glu Asn Asn Lys Pro Glu
Thr Ser Lys Thr Ala Phe Gln 900 905 910 Leu Glu Leu Pro Val Lys Tyr
Thr Val Tyr Thr Val Ile Ser Arg Gln 915 920 925 Glu Asp Ser Thr Lys
His Phe Asn Phe Ser Ser Ser His Gly Glu Arg 930 935 940 Gln Lys Glu
Ala Glu His Arg Tyr Arg Val Asn Asn Leu Ser Pro Leu 945 950 955 960
Thr Leu Ala Ile Ser Val Asn Phe Trp Val Pro Ile Leu Leu Asn Gly 965
970 975 Val Ala Val Trp Asp Val Thr Leu Arg Ser Pro Ala Gln Gly Val
Ser 980 985 990 Cys Val Ser Gln Arg Glu Pro Pro Gln His Ser Asp Leu
Leu Thr Gln 995 1000 1005 Ile Gln Gly Arg Ser Val Leu Asp Cys Ala
Ile Ala Asp Cys Leu His 1010 1015 1020 Leu Arg Cys Asp Ile Pro Ser
Leu Gly Thr Leu Asp Glu Leu Asp Phe 1025 1030 1035 1040 Ile Leu Lys
Gly Asn Leu Ser Phe Gly Trp Ile Ser Gln Thr Leu Gln 1045 1050 1055
Lys Lys Val Leu Leu Leu Ser Glu Ala Glu Ile Thr Phe Asn Thr Ser
1060 1065 1070 Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala Phe Leu Arg
Ala Gln Val 1075 1080 1085 Ser Thr Met Leu Glu Glu Tyr Val Val Tyr
Glu Pro Val Phe Leu Met 1090 1095 1100 Val Phe Ser Ser Val Gly Gly
Leu Leu Leu Leu Ala Leu Ile Thr Val 1105 1110 1115 1120 Ala Leu Tyr
Lys Leu Gly Phe Phe Lys Arg Gln Tyr Lys Glu Met Leu 1125 1130 1135
Asp Leu Pro Ser Ala Asp Pro Asp Pro Ala Gly Gln Ala Asp Ser Asn
1140 1145 1150 His Glu Thr Pro Pro His Leu Thr Ser 1155 1160 54
3597 DNA Rattus rattus CDS (40)..(3522) Description of Artificial
Sequence primer 54 agctttacag ctctctactt ctcagtgcac tgctcagtg atg
gcc ggt gga gtt 54 Met Ala Gly Gly Val 1 5 gtg atc ctc ctg tgt ggc
tgg gtc ctg gct tcc tgt cat ggg tct aac 102 Val Ile Leu Leu Cys Gly
Trp Val Leu Ala Ser Cys His Gly Ser Asn 10 15 20 ctg gat gtg gag
gaa ccc atc gtg ttc aga gag gat gca gcc agc ttt 150 Leu Asp Val Glu
Glu Pro Ile Val Phe Arg Glu Asp Ala Ala Ser Phe 25 30 35 gga cag
act gtg gtg cag ttt ggt gga tct cga ctc gtg gtg gga gcc 198 Gly Gln
Thr Val Val Gln Phe Gly Gly Ser Arg Leu Val Val Gly Ala 40 45 50
cct ctg gag gcg gtg gca gtc aac caa aca gga cgg ttg tat gac tgt 246
Pro Leu Glu Ala Val Ala Val Asn Gln Thr Gly Arg Leu Tyr Asp Cys 55
60 65 gca cct gcc act ggc atg tgc cag ccc atc gta ctg cgc agt ccc
cta 294 Ala Pro Ala Thr Gly Met Cys Gln Pro Ile Val Leu Arg Ser Pro
Leu 70 75 80 85 gag gca gtg aac atg tcc ctg ggc ctg tct ctg gtg act
gcc acc aat 342 Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu Val Thr
Ala Thr Asn 90 95 100 aac gcc cag ttg ctg gct tgt ggt cca act gca
cag aga gct tgt gtg 390 Asn Ala Gln Leu Leu Ala Cys Gly Pro Thr Ala
Gln Arg Ala Cys Val 105 110 115 aag aac atg tat gcg aaa ggt tcc tgc
ctc ctt ctc ggc tcc agc ttg 438 Lys Asn Met Tyr Ala Lys Gly Ser Cys
Leu Leu Leu Gly Ser Ser Leu 120 125 130 cag ttc atc cag gca gtc cct
gcc tcc atg cca gag tgt cca aga caa 486 Gln Phe Ile Gln Ala Val Pro
Ala Ser Met Pro Glu Cys Pro Arg Gln 135 140 145 gag atg gac att gct
ttc ctg att gat ggt tct ggc agc att aac caa 534 Glu Met Asp Ile Ala
Phe Leu Ile Asp Gly Ser Gly Ser Ile Asn Gln 150 155
160 165 agg gac ttt gcc cag atg aag gac ttt gtc aaa gct ttg atg gga
gag 582 Arg Asp Phe Ala Gln Met Lys Asp Phe Val Lys Ala Leu Met Gly
Glu 170 175 180 ttt gcg agc acc agc acc ttg ttc tcc ctg atg caa tac
tcg aac atc 630 Phe Ala Ser Thr Ser Thr Leu Phe Ser Leu Met Gln Tyr
Ser Asn Ile 185 190 195 ctg aag acc cat ttt acc ttc act gaa ttc aag
aac atc ctg gac cct 678 Leu Lys Thr His Phe Thr Phe Thr Glu Phe Lys
Asn Ile Leu Asp Pro 200 205 210 cag agc ctg gtg gat ccc att gtc cag
ctg caa ggc ctg acc tac aca 726 Gln Ser Leu Val Asp Pro Ile Val Gln
Leu Gln Gly Leu Thr Tyr Thr 215 220 225 gcc aca ggc atc cgg aca gtg
atg gaa gag cta ttt cat agc aag aat 774 Ala Thr Gly Ile Arg Thr Val
Met Glu Glu Leu Phe His Ser Lys Asn 230 235 240 245 ggg tcc cgt aaa
agt gcc aag aag atc ctc ctt gtc atc aca gat ggg 822 Gly Ser Arg Lys
Ser Ala Lys Lys Ile Leu Leu Val Ile Thr Asp Gly 250 255 260 cag aaa
tac aga gac ccc ctg gag tat agt gat gtc att ccc gcc gca 870 Gln Lys
Tyr Arg Asp Pro Leu Glu Tyr Ser Asp Val Ile Pro Ala Ala 265 270 275
gac aaa gct ggc atc att cgt tat gct att ggg gtg gga gat gcc ttc 918
Asp Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val Gly Asp Ala Phe 280
285 290 cag gag ccc act gcc ctg aag gag ctg aac acc att ggc tca gct
ccc 966 Gln Glu Pro Thr Ala Leu Lys Glu Leu Asn Thr Ile Gly Ser Ala
Pro 295 300 305 cca cag gac cac gtg ttc aag gta ggc aac ttt gca gca
ctt cgc agc 1014 Pro Gln Asp His Val Phe Lys Val Gly Asn Phe Ala
Ala Leu Arg Ser 310 315 320 325 atc cag agg caa ctt cag gag aaa atc
ttc gcc att gag gga act caa 1062 Ile Gln Arg Gln Leu Gln Glu Lys
Ile Phe Ala Ile Glu Gly Thr Gln 330 335 340 tca agg tca agt agt tcc
ttt cag cac gag atg tca caa gaa ggt ttc 1110 Ser Arg Ser Ser Ser
Ser Phe Gln His Glu Met Ser Gln Glu Gly Phe 345 350 355 agt tca gct
ctc aca tcg gat gga ccc gtt ctg ggg gcc gtg gga agc 1158 Ser Ser
Ala Leu Thr Ser Asp Gly Pro Val Leu Gly Ala Val Gly Ser 360 365 370
ttc agc tgg tcc gga ggt gcc ttc tta tat ccc cca aat acg aga ccc
1206 Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Asn Thr Arg
Pro 375 380 385 acc ttt atc aac atg tct cag gag aat gtg gac atg aga
gac tcc tac 1254 Thr Phe Ile Asn Met Ser Gln Glu Asn Val Asp Met
Arg Asp Ser Tyr 390 395 400 405 ctg ggt tac tcc acc gca gtg gcc ttt
tgg aag ggg gtt cac agc ctg 1302 Leu Gly Tyr Ser Thr Ala Val Ala
Phe Trp Lys Gly Val His Ser Leu 410 415 420 atc ctg ggg gcc ccg cgt
cac cag cac acg ggg aag gtt gtc atc ttt 1350 Ile Leu Gly Ala Pro
Arg His Gln His Thr Gly Lys Val Val Ile Phe 425 430 435 acc cag gaa
gcc agg cat tgg agg ccc aag tct gaa gtc aga ggg aca 1398 Thr Gln
Glu Ala Arg His Trp Arg Pro Lys Ser Glu Val Arg Gly Thr 440 445 450
cag atc ggc tcc tac ttc ggg gcc tct ctc tgt tct gtg gac gtg gat
1446 Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser Val Asp Val
Asp 455 460 465 aga gat ggc agc acy gac ctg gtc ctg atc gga gcc ccc
cat tac tat 1494 Arg Asp Gly Ser Xaa Asp Leu Val Leu Ile Gly Ala
Pro His Tyr Tyr 470 475 480 485 gag cag acc cga ggg ggg cag gtc tca
gtg ttc ccc gtg ccc ggt gtg 1542 Glu Gln Thr Arg Gly Gly Gln Val
Ser Val Phe Pro Val Pro Gly Val 490 495 500 agg ggc agg tgg cag tgt
gag gcc acc ctc cac ggg gag cag ggc cat 1590 Arg Gly Arg Trp Gln
Cys Glu Ala Thr Leu His Gly Glu Gln Gly His 505 510 515 cct tgg ggc
cgc ttt ggg gtg gct ctg aca gtg ctg ggg gac gta aac 1638 Pro Trp
Gly Arg Phe Gly Val Ala Leu Thr Val Leu Gly Asp Val Asn 520 525 530
ggg gac aat ctg gca gac gtg gct att ggt gcc cct gga gag gag gag
1686 Gly Asp Asn Leu Ala Asp Val Ala Ile Gly Ala Pro Gly Glu Glu
Glu 535 540 545 agc aga ggt gct gtc tac ata ttt cat gga gcc tcg aga
ctg gag atc 1734 Ser Arg Gly Ala Val Tyr Ile Phe His Gly Ala Ser
Arg Leu Glu Ile 550 555 560 565 atg ccc tca ccc agc cag cgg gtc act
ggc tcc cag ctc tcc ctg aga 1782 Met Pro Ser Pro Ser Gln Arg Val
Thr Gly Ser Gln Leu Ser Leu Arg 570 575 580 ctg cag tat ttt ggg cag
tca ttg agt ggg ggt cag gac ctt aca cag 1830 Leu Gln Tyr Phe Gly
Gln Ser Leu Ser Gly Gly Gln Asp Leu Thr Gln 585 590 595 gat ggc ctg
gtg gac ctg gcc gtg gga gcc cag ggg cac gta ctg ctg 1878 Asp Gly
Leu Val Asp Leu Ala Val Gly Ala Gln Gly His Val Leu Leu 600 605 610
ctc agg agt ctg cct ctg ctg aaa gtg gag ctc tcc ata aga ttc gcc
1926 Leu Arg Ser Leu Pro Leu Leu Lys Val Glu Leu Ser Ile Arg Phe
Ala 615 620 625 ccc atg gag gtg gca aag gct gtg tac cag tgc tgg gaa
agg act ccc 1974 Pro Met Glu Val Ala Lys Ala Val Tyr Gln Cys Trp
Glu Arg Thr Pro 630 635 640 645 act gtc ctc gaa gct gga gag gcc act
gtc tgt ctc act gtc cac aaa 2022 Thr Val Leu Glu Ala Gly Glu Ala
Thr Val Cys Leu Thr Val His Lys 650 655 660 ggc tca cct gac ctg tta
ggt aat gtc caa ggc tct gtc agg tat gat 2070 Gly Ser Pro Asp Leu
Leu Gly Asn Val Gln Gly Ser Val Arg Tyr Asp 665 670 675 ctg gcg tta
gat ccg ggc cgc ctg att tct cgt gcc att ttt gat gag 2118 Leu Ala
Leu Asp Pro Gly Arg Leu Ile Ser Arg Ala Ile Phe Asp Glu 680 685 690
act aag aac tgc act ttg acg gga agg aag act ctg ggg ctt ggt gat
2166 Thr Lys Asn Cys Thr Leu Thr Gly Arg Lys Thr Leu Gly Leu Gly
Asp 695 700 705 cac tgc gaa aca gtg aag ctg ctt ttg ccg gac tgt gtg
gaa gat gca 2214 His Cys Glu Thr Val Lys Leu Leu Leu Pro Asp Cys
Val Glu Asp Ala 710 715 720 725 gtg agc cct atc atc ctg cgc ctc aac
ttt tcc ctg gtg aga gac tct 2262 Val Ser Pro Ile Ile Leu Arg Leu
Asn Phe Ser Leu Val Arg Asp Ser 730 735 740 gct tca ccc agg aac ctg
cat cct gtg ctg gct gtg ggc tca caa gac 2310 Ala Ser Pro Arg Asn
Leu His Pro Val Leu Ala Val Gly Ser Gln Asp 745 750 755 cac ata act
gct tct ctg ccg ttt gag aag aac tgt aag caa gaa ctc 2358 His Ile
Thr Ala Ser Leu Pro Phe Glu Lys Asn Cys Lys Gln Glu Leu 760 765 770
ctg tgt gag ggg gac ctg ggc atc agc ttt aac ttc tca ggc ctg cag
2406 Leu Cys Glu Gly Asp Leu Gly Ile Ser Phe Asn Phe Ser Gly Leu
Gln 775 780 785 gtc ttg gtg gtg gga ggc tcc cca gag ctc act gtg aca
gtc act gtg 2454 Val Leu Val Val Gly Gly Ser Pro Glu Leu Thr Val
Thr Val Thr Val 790 795 800 805 tgg aat gag ggt gag gac agc tat gga
act tta gtc aag ttc tac tac 2502 Trp Asn Glu Gly Glu Asp Ser Tyr
Gly Thr Leu Val Lys Phe Tyr Tyr 810 815 820 cca gca ggg cta tct tac
cga cgg gta aca ggg act cag caa cct cat 2550 Pro Ala Gly Leu Ser
Tyr Arg Arg Val Thr Gly Thr Gln Gln Pro His 825 830 835 cag tac cca
cta cgc ttg gcc tgt gag gct gag ccc gct gcc cag gag 2598 Gln Tyr
Pro Leu Arg Leu Ala Cys Glu Ala Glu Pro Ala Ala Gln Glu 840 845 850
gac ctg agg agc agc agc tgt agc att aat cac ccc atc ttc cga gaa
2646 Asp Leu Arg Ser Ser Ser Cys Ser Ile Asn His Pro Ile Phe Arg
Glu 855 860 865 ggt gca aag acc acc ttc atg atc aca ttc gat gtc tcc
tac aag gcc 2694 Gly Ala Lys Thr Thr Phe Met Ile Thr Phe Asp Val
Ser Tyr Lys Ala 870 875 880 885 ttc cta gga gac agg ttg ctt ctg agg
gcc aaa gcc agc agt gag aat 2742 Phe Leu Gly Asp Arg Leu Leu Leu
Arg Ala Lys Ala Ser Ser Glu Asn 890 895 900 aat aag cct gat acc aac
aag act gcc ttc cag ctg gag ctc cca gtg 2790 Asn Lys Pro Asp Thr
Asn Lys Thr Ala Phe Gln Leu Glu Leu Pro Val 905 910 915 aag tac acc
gtc tat acc ctg atc agt agg caa gaa gat tcc acc aac 2838 Lys Tyr
Thr Val Tyr Thr Leu Ile Ser Arg Gln Glu Asp Ser Thr Asn 920 925 930
cat gtc aac ttt tca tct tcc cac ggg ggg aga agg caa gaa gcc gca
2886 His Val Asn Phe Ser Ser Ser His Gly Gly Arg Arg Gln Glu Ala
Ala 935 940 945 cat cgc tat cgt gtg aat aac ctg agt cca ctg aag ctg
gcc gtc aga 2934 His Arg Tyr Arg Val Asn Asn Leu Ser Pro Leu Lys
Leu Ala Val Arg 950 955 960 965 gtt aac ttc tgg gtc cct gtc ctt ctg
aac ggt gtg gct gtg tgg gac 2982 Val Asn Phe Trp Val Pro Val Leu
Leu Asn Gly Val Ala Val Trp Asp 970 975 980 gtg act ctg agc agc cca
gca cag ggt gtc tcc tgc gtg tcc cag atg 3030 Val Thr Leu Ser Ser
Pro Ala Gln Gly Val Ser Cys Val Ser Gln Met 985 990 995 aaa cct cct
cag aat ccc gac ttt ctg acc cag att cag aga cgt tct 3078 Lys Pro
Pro Gln Asn Pro Asp Phe Leu Thr Gln Ile Gln Arg Arg Ser 1000 1005
1010 gtg ctg gac tgc tcc att gct gac tgc ctg cac ttc cgc tgt gac
atc 3126 Val Leu Asp Cys Ser Ile Ala Asp Cys Leu His Phe Arg Cys
Asp Ile 1015 1020 1025 ccc tcc ttg gac atc cag gat gaa ctt gac ttc
att ctg agg ggc aac 3174 Pro Ser Leu Asp Ile Gln Asp Glu Leu Asp
Phe Ile Leu Arg Gly Asn 1030 1035 1040 1045 ctc agc ttc ggc tgg gtc
agt cag aca ttg cag gaa aag gtg ttg ctt 3222 Leu Ser Phe Gly Trp
Val Ser Gln Thr Leu Gln Glu Lys Val Leu Leu 1050 1055 1060 gtg agt
gag gct gaa atc act ttc gac aca tct gtg tac tcc cag ctg 3270 Val
Ser Glu Ala Glu Ile Thr Phe Asp Thr Ser Val Tyr Ser Gln Leu 1065
1070 1075 cca gga cag gag gca ttt ctg aga gcc cag gtg gag aca acg
tta gaa 3318 Pro Gly Gln Glu Ala Phe Leu Arg Ala Gln Val Glu Thr
Thr Leu Glu 1080 1085 1090 gaa tac gtg gtc tat gag ccc atc ttc ctc
gtg gcg ggc agc tcg gtg 3366 Glu Tyr Val Val Tyr Glu Pro Ile Phe
Leu Val Ala Gly Ser Ser Val 1095 1100 1105 gga ggt ctg ctg tta ctg
gct ctc atc aca gtg gta ctg tac aag ctt 3414 Gly Gly Leu Leu Leu
Leu Ala Leu Ile Thr Val Val Leu Tyr Lys Leu 1110 1115 1120 1125 ggc
ttc tyc aaa cgt cag tac aaa gaa atg ctg gac ggc aag gct gca 3462
Gly Phe Xaa Lys Arg Gln Tyr Lys Glu Met Leu Asp Gly Lys Ala Ala
1130 1135 1140 gat cct gtc aca gcc ggc cag gca gat ttc ggc tgt gag
act cct cca 3510 Asp Pro Val Thr Ala Gly Gln Ala Asp Phe Gly Cys
Glu Thr Pro Pro 1145 1150 1155 tat ctc gtg agc taggaatcca
ctctcctgcc tatctctgca atgaagattg 3562 Tyr Leu Val Ser 1160
gtcctgccta tgagtctact ggcatgggaa cgagt 3597 55 1161 PRT Rattus
rattus 55 Met Ala Gly Gly Val Val Ile Leu Leu Cys Gly Trp Val Leu
Ala Ser 1 5 10 15 Cys His Gly Ser Asn Leu Asp Val Glu Glu Pro Ile
Val Phe Arg Glu 20 25 30 Asp Ala Ala Ser Phe Gly Gln Thr Val Val
Gln Phe Gly Gly Ser Arg 35 40 45 Leu Val Val Gly Ala Pro Leu Glu
Ala Val Ala Val Asn Gln Thr Gly 50 55 60 Arg Leu Tyr Asp Cys Ala
Pro Ala Thr Gly Met Cys Gln Pro Ile Val 65 70 75 80 Leu Arg Ser Pro
Leu Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu 85 90 95 Val Thr
Ala Thr Asn Asn Ala Gln Leu Leu Ala Cys Gly Pro Thr Ala 100 105 110
Gln Arg Ala Cys Val Lys Asn Met Tyr Ala Lys Gly Ser Cys Leu Leu 115
120 125 Leu Gly Ser Ser Leu Gln Phe Ile Gln Ala Val Pro Ala Ser Met
Pro 130 135 140 Glu Cys Pro Arg Gln Glu Met Asp Ile Ala Phe Leu Ile
Asp Gly Ser 145 150 155 160 Gly Ser Ile Asn Gln Arg Asp Phe Ala Gln
Met Lys Asp Phe Val Lys 165 170 175 Ala Leu Met Gly Glu Phe Ala Ser
Thr Ser Thr Leu Phe Ser Leu Met 180 185 190 Gln Tyr Ser Asn Ile Leu
Lys Thr His Phe Thr Phe Thr Glu Phe Lys 195 200 205 Asn Ile Leu Asp
Pro Gln Ser Leu Val Asp Pro Ile Val Gln Leu Gln 210 215 220 Gly Leu
Thr Tyr Thr Ala Thr Gly Ile Arg Thr Val Met Glu Glu Leu 225 230 235
240 Phe His Ser Lys Asn Gly Ser Arg Lys Ser Ala Lys Lys Ile Leu Leu
245 250 255 Val Ile Thr Asp Gly Gln Lys Tyr Arg Asp Pro Leu Glu Tyr
Ser Asp 260 265 270 Val Ile Pro Ala Ala Asp Lys Ala Gly Ile Ile Arg
Tyr Ala Ile Gly 275 280 285 Val Gly Asp Ala Phe Gln Glu Pro Thr Ala
Leu Lys Glu Leu Asn Thr 290 295 300 Ile Gly Ser Ala Pro Pro Gln Asp
His Val Phe Lys Val Gly Asn Phe 305 310 315 320 Ala Ala Leu Arg Ser
Ile Gln Arg Gln Leu Gln Glu Lys Ile Phe Ala 325 330 335 Ile Glu Gly
Thr Gln Ser Arg Ser Ser Ser Ser Phe Gln His Glu Met 340 345 350 Ser
Gln Glu Gly Phe Ser Ser Ala Leu Thr Ser Asp Gly Pro Val Leu 355 360
365 Gly Ala Val Gly Ser Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro
370 375 380 Pro Asn Thr Arg Pro Thr Phe Ile Asn Met Ser Gln Glu Asn
Val Asp 385 390 395 400 Met Arg Asp Ser Tyr Leu Gly Tyr Ser Thr Ala
Val Ala Phe Trp Lys 405 410 415 Gly Val His Ser Leu Ile Leu Gly Ala
Pro Arg His Gln His Thr Gly 420 425 430 Lys Val Val Ile Phe Thr Gln
Glu Ala Arg His Trp Arg Pro Lys Ser 435 440 445 Glu Val Arg Gly Thr
Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys 450 455 460 Ser Val Asp
Val Asp Arg Asp Gly Ser Xaa Asp Leu Val Leu Ile Gly 465 470 475 480
Ala Pro His Tyr Tyr Glu Gln Thr Arg Gly Gly Gln Val Ser Val Phe 485
490 495 Pro Val Pro Gly Val Arg Gly Arg Trp Gln Cys Glu Ala Thr Leu
His 500 505 510 Gly Glu Gln Gly His Pro Trp Gly Arg Phe Gly Val Ala
Leu Thr Val 515 520 525 Leu Gly Asp Val Asn Gly Asp Asn Leu Ala Asp
Val Ala Ile Gly Ala 530 535 540 Pro Gly Glu Glu Glu Ser Arg Gly Ala
Val Tyr Ile Phe His Gly Ala 545 550 555 560 Ser Arg Leu Glu Ile Met
Pro Ser Pro Ser Gln Arg Val Thr Gly Ser 565 570 575 Gln Leu Ser Leu
Arg Leu Gln Tyr Phe Gly Gln Ser Leu Ser Gly Gly 580 585 590 Gln Asp
Leu Thr Gln Asp Gly Leu Val Asp Leu Ala Val Gly Ala Gln 595 600 605
Gly His Val Leu Leu Leu Arg Ser Leu Pro Leu Leu Lys Val Glu Leu 610
615 620 Ser Ile Arg Phe Ala Pro Met Glu Val Ala Lys Ala Val Tyr Gln
Cys 625 630 635 640 Trp Glu Arg Thr Pro Thr Val Leu Glu Ala Gly Glu
Ala Thr Val Cys 645 650 655 Leu Thr Val His Lys Gly Ser Pro Asp Leu
Leu Gly Asn Val Gln Gly 660 665 670 Ser Val Arg Tyr Asp Leu Ala Leu
Asp Pro Gly Arg Leu Ile Ser Arg 675 680 685 Ala Ile Phe Asp Glu Thr
Lys Asn Cys Thr Leu Thr Gly Arg Lys Thr 690 695 700 Leu Gly Leu Gly
Asp His Cys Glu Thr Val Lys Leu Leu Leu Pro Asp 705 710 715 720 Cys
Val Glu Asp Ala Val Ser Pro Ile Ile Leu Arg Leu Asn Phe Ser 725 730
735 Leu Val Arg Asp Ser Ala Ser Pro Arg Asn Leu His Pro Val Leu Ala
740 745 750 Val Gly Ser Gln Asp His Ile Thr Ala Ser Leu Pro Phe Glu
Lys Asn 755 760 765 Cys Lys Gln Glu Leu Leu Cys Glu Gly Asp Leu Gly
Ile Ser Phe Asn 770 775 780 Phe Ser Gly Leu Gln Val Leu Val Val Gly
Gly Ser Pro Glu Leu Thr 785 790 795 800 Val Thr Val Thr Val Trp Asn
Glu Gly Glu Asp Ser Tyr Gly Thr Leu 805 810 815 Val Lys Phe Tyr
Tyr Pro Ala Gly Leu Ser Tyr Arg Arg Val Thr Gly 820 825 830 Thr Gln
Gln Pro His Gln Tyr Pro Leu Arg Leu Ala Cys Glu Ala Glu 835 840 845
Pro Ala Ala Gln Glu Asp Leu Arg Ser Ser Ser Cys Ser Ile Asn His 850
855 860 Pro Ile Phe Arg Glu Gly Ala Lys Thr Thr Phe Met Ile Thr Phe
Asp 865 870 875 880 Val Ser Tyr Lys Ala Phe Leu Gly Asp Arg Leu Leu
Leu Arg Ala Lys 885 890 895 Ala Ser Ser Glu Asn Asn Lys Pro Asp Thr
Asn Lys Thr Ala Phe Gln 900 905 910 Leu Glu Leu Pro Val Lys Tyr Thr
Val Tyr Thr Leu Ile Ser Arg Gln 915 920 925 Glu Asp Ser Thr Asn His
Val Asn Phe Ser Ser Ser His Gly Gly Arg 930 935 940 Arg Gln Glu Ala
Ala His Arg Tyr Arg Val Asn Asn Leu Ser Pro Leu 945 950 955 960 Lys
Leu Ala Val Arg Val Asn Phe Trp Val Pro Val Leu Leu Asn Gly 965 970
975 Val Ala Val Trp Asp Val Thr Leu Ser Ser Pro Ala Gln Gly Val Ser
980 985 990 Cys Val Ser Gln Met Lys Pro Pro Gln Asn Pro Asp Phe Leu
Thr Gln 995 1000 1005 Ile Gln Arg Arg Ser Val Leu Asp Cys Ser Ile
Ala Asp Cys Leu His 1010 1015 1020 Phe Arg Cys Asp Ile Pro Ser Leu
Asp Ile Gln Asp Glu Leu Asp Phe 025 1030 1035 1040 Ile Leu Arg Gly
Asn Leu Ser Phe Gly Trp Val Ser Gln Thr Leu Gln 1045 1050 1055 Glu
Lys Val Leu Leu Val Ser Glu Ala Glu Ile Thr Phe Asp Thr Ser 1060
1065 1070 Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala Phe Leu Arg Ala
Gln Val 1075 1080 1085 Glu Thr Thr Leu Glu Glu Tyr Val Val Tyr Glu
Pro Ile Phe Leu Val 1090 1095 1100 Ala Gly Ser Ser Val Gly Gly Leu
Leu Leu Leu Ala Leu Ile Thr Val 105 1110 1115 1120 Val Leu Tyr Lys
Leu Gly Phe Xaa Lys Arg Gln Tyr Lys Glu Met Leu 1125 1130 1135 Asp
Gly Lys Ala Ala Asp Pro Val Thr Ala Gly Gln Ala Asp Phe Gly 1140
1145 1150 Cys Glu Thr Pro Pro Tyr Leu Val Ser 1155 1160 56 20 DNA
Artificial Sequence Description of Artificial Sequence primer 56
cctgtcatgg gtctaacctg 20 57 19 DNA Artificial Sequence Description
of Artificial Sequence primer 57 aggttagacc catgacagg 19 58 20 DNA
Artificial Sequence Description of Artificial Sequence primer 58
ggccttgcag ctggacaatg 20 59 22 DNA Artificial Sequence Description
of Artificial Sequence primer 59 ccaaagctgg ctgcatcctc tc 22 60 21
DNA Artificial Sequence Description of Artificial Sequence primer
60 ccgcctgcca ctggcgtgtg c 21 61 22 DNA Artificial Sequence
Description of Artificial Sequence primer 61 cccagatgaa ggacttcgtc
aa 22 62 20 DNA Artificial Sequence Description of Artificial
Sequence primer 62 gctgggatca ttcgctatgc 20 63 21 DNA Artificial
Sequence Description of Artificial Sequence primer 63 caatggatgg
accagttctg g 21 64 20 DNA Artificial Sequence Description of
Artificial Sequence primer 64 cagatcggct cctactttgg 20 65 19 DNA
Artificial Sequence Description of Artificial Sequence primer 65
catggagcct cgagacagg 19 66 21 DNA Artificial Sequence Description
of Artificial Sequence primer 66 ccactgtcct cgaagctgga g 21 67 26
DNA Artificial Sequence Description of Artificial Sequence primer
67 cttcgtcctg tgctggctgt gggctc 26 68 21 DNA Artificial Sequence
Description of Artificial Sequence primer 68 cgcctggcat gtgaggctga
g 21 69 21 DNA Artificial Sequence Description of Artificial
Sequence primer 69 ccgtgatcag taggcaggaa g 21 70 18 DNA Artificial
Sequence Description of Artificial Sequence primer 70 gtcacagagg
gaacctcc 18 71 23 DNA Artificial Sequence Description of Artificial
Sequence primer 71 gctcctgagt gaggctgaaa tca 23 72 23 DNA
Artificial Sequence Description of Artificial Sequence primer 72
gagatgctgg atctaccatc tgc 23 73 22 DNA Artificial Sequence
Description of Artificial Sequence primer 73 ctgagctggg agatttttat
gg 22 74 21 DNA Artificial Sequence Description of Artificial
Sequence primer 74 gtggatcagc actgaaatct g 21 75 21 DNA Artificial
Sequence Description of Artificial Sequence primer 75 cgtttgaaga
agccaagctt g 21 76 20 DNA Artificial Sequence Description of
Artificial Sequence primer 76 cacagcggag gtgcaggcag 20 77 18 DNA
Artificial Sequence Description of Artificial Sequence primer 77
ctcactgctt gcgctggc 18 78 20 DNA Artificial Sequence Description of
Artificial Sequence primer 78 cggtaagata gctctgctgg 20 79 20 DNA
Artificial Sequence Description of Artificial Sequence primer 79
gagcccacag ccagcacagg 20 80 21 DNA Artificial Sequence Description
of Artificial Sequence primer 80 gatccaacgc cagatcatac c 21 81 20
DNA Artificial Sequence Description of Artificial Sequence primer
81 cacggccagg tccaccaggc 20 82 21 DNA Artificial Sequence
Description of Artificial Sequence primer 82 cacgtcccct agcactgtca
g 21 83 22 DNA Artificial Sequence Description of Artificial
Sequence primer 83 ttgacgaagt ccttcatctg gg 22 84 21 DNA Artificial
Sequence Description of Artificial Sequence primer 84 gaactgcaag
ctggagccca g 21 85 21 DNA Artificial Sequence Description of
Artificial Sequence primer 85 ctggatgctg cgaagtgcta c 21 86 21 DNA
Artificial Sequence Description of Artificial Sequence primer 86
gccttggagc tggacgatgg c 21 87 33 DNA Artificial Sequence
Description of Artificial Sequence primer 87 gtaagatctc cagagtgtcc
aagacaagag atg 33 88 33 DNA Artificial Sequence Description of
Artificial Sequence primer 88 cttctcgagt gtgagagctg aactgaaacc ttc
33 89 32 DNA Artificial Sequence Description of Artificial Sequence
primer 89 cgctgtgacg tcagagttga gtccaaatat gg 32 90 21 DNA
Artificial Sequence Description of Artificial Sequence primer 90
ggtgacacta tagaataggg c 21 91 18 DNA Mus musculus 91 aagcaggagc
tcctgtgt 18 92 852 DNA rabbit CDS (61)..(852) 92 tgatctccct
ccaggccact gttccctctc cacttcccct caccgctgca ctgctcagag 60 atg gcc
ctt ggg gct gtg gtc ctc ctt ggg gtc ctg gct tct tac cac 108 Met Ala
Leu Gly Ala Val Val Leu Leu Gly Val Leu Ala Ser Tyr His 1 5 10 15
gga ttc aac ttg gac gtg atg agc ggt gat ctt cca gga aga cgc agc 156
Gly Phe Asn Leu Asp Val Met Ser Gly Asp Leu Pro Gly Arg Arg Ser 20
25 30 ggg ctt cgg gca gag cgt gat gca gtt tgg gga tct cga ctc gtg
gtg 204 Gly Leu Arg Ala Glu Arg Asp Ala Val Trp Gly Ser Arg Leu Val
Val 35 40 45 gga gcc ccc ctg gcg gtg gtg tcg gcc aac cac aca gga
cgg ctg tac 252 Gly Ala Pro Leu Ala Val Val Ser Ala Asn His Thr Gly
Arg Leu Tyr 50 55 60 gag tgt gcg cct gcc tcc ggc acc tgc acg ccc
att ttc cca ttc atg 300 Glu Cys Ala Pro Ala Ser Gly Thr Cys Thr Pro
Ile Phe Pro Phe Met 65 70 75 80 ccc ccc gaa gcc gtg aac atg tcc ctg
ggc ctg tcc ctg gca gcc tcc 348 Pro Pro Glu Ala Val Asn Met Ser Leu
Gly Leu Ser Leu Ala Ala Ser 85 90 95 ccc aac cat tcc cag ctg ctg
gct tgt ggc ccg acc gtg cat aga gcc 396 Pro Asn His Ser Gln Leu Leu
Ala Cys Gly Pro Thr Val His Arg Ala 100 105 110 tgc ggg gag gac gtg
tac gcc cag ggt ttc tgt gtg ctg ctg gat gcc 444 Cys Gly Glu Asp Val
Tyr Ala Gln Gly Phe Cys Val Leu Leu Asp Ala 115 120 125 cac gca cag
ccc atc ggg act gtg cca gct gcc ctg ccc gag tgc cca 492 His Ala Gln
Pro Ile Gly Thr Val Pro Ala Ala Leu Pro Glu Cys Pro 130 135 140 gat
caa gag atg gac att gtc ttc ctg att gac ggc tct ggc agc att 540 Asp
Gln Glu Met Asp Ile Val Phe Leu Ile Asp Gly Ser Gly Ser Ile 145 150
155 160 agc tca aat gac ttc cgc aag atg aag gac ttt gtc aga gct gtg
atg 588 Ser Ser Asn Asp Phe Arg Lys Met Lys Asp Phe Val Arg Ala Val
Met 165 170 175 gac cag ttc aag gac acc aac acc cag ttc tcg ctg atg
cag tac tcc 636 Asp Gln Phe Lys Asp Thr Asn Thr Gln Phe Ser Leu Met
Gln Tyr Ser 180 185 190 aat gtg ctg gtg aca cat ttc acc ttc agc agc
ttc cgg aac agc tcc 684 Asn Val Leu Val Thr His Phe Thr Phe Ser Ser
Phe Arg Asn Ser Ser 195 200 205 aat cct cag ggc cta gtg gag ccc att
gtg cag ctg aca ggc ctc acg 732 Asn Pro Gln Gly Leu Val Glu Pro Ile
Val Gln Leu Thr Gly Leu Thr 210 215 220 ttc acg gcc aca ggg atc ctg
aaa gtg gtg aca gag ctg ttt caa acc 780 Phe Thr Ala Thr Gly Ile Leu
Lys Val Val Thr Glu Leu Phe Gln Thr 225 230 235 240 aag aac ggg gcc
cgc gaa agt gcc aag aag atc ctc atc gtc atc aca 828 Lys Asn Gly Ala
Arg Glu Ser Ala Lys Lys Ile Leu Ile Val Ile Thr 245 250 255 gat ggg
cag aag tac aaa gcg gca 852 Asp Gly Gln Lys Tyr Lys Ala Ala 260 93
264 PRT rabbit 93 Met Ala Leu Gly Ala Val Val Leu Leu Gly Val Leu
Ala Ser Tyr His 1 5 10 15 Gly Phe Asn Leu Asp Val Met Ser Gly Asp
Leu Pro Gly Arg Arg Ser 20 25 30 Gly Leu Arg Ala Glu Arg Asp Ala
Val Trp Gly Ser Arg Leu Val Val 35 40 45 Gly Ala Pro Leu Ala Val
Val Ser Ala Asn His Thr Gly Arg Leu Tyr 50 55 60 Glu Cys Ala Pro
Ala Ser Gly Thr Cys Thr Pro Ile Phe Pro Phe Met 65 70 75 80 Pro Pro
Glu Ala Val Asn Met Ser Leu Gly Leu Ser Leu Ala Ala Ser 85 90 95
Pro Asn His Ser Gln Leu Leu Ala Cys Gly Pro Thr Val His Arg Ala 100
105 110 Cys Gly Glu Asp Val Tyr Ala Gln Gly Phe Cys Val Leu Leu Asp
Ala 115 120 125 His Ala Gln Pro Ile Gly Thr Val Pro Ala Ala Leu Pro
Glu Cys Pro 130 135 140 Asp Gln Glu Met Asp Ile Val Phe Leu Ile Asp
Gly Ser Gly Ser Ile 145 150 155 160 Ser Ser Asn Asp Phe Arg Lys Met
Lys Asp Phe Val Arg Ala Val Met 165 170 175 Asp Gln Phe Lys Asp Thr
Asn Thr Gln Phe Ser Leu Met Gln Tyr Ser 180 185 190 Asn Val Leu Val
Thr His Phe Thr Phe Ser Ser Phe Arg Asn Ser Ser 195 200 205 Asn Pro
Gln Gly Leu Val Glu Pro Ile Val Gln Leu Thr Gly Leu Thr 210 215 220
Phe Thr Ala Thr Gly Ile Leu Lys Val Val Thr Glu Leu Phe Gln Thr 225
230 235 240 Lys Asn Gly Ala Arg Glu Ser Ala Lys Lys Ile Leu Ile Val
Ile Thr 245 250 255 Asp Gly Gln Lys Tyr Lys Ala Ala 260 94 22 DNA
Artificial Sequence Description of Artificial Sequence primer 94
ctggtctgga ggtgccttcc tg 22 95 21 DNA Artificial Sequence
Description of Artificial Sequence primer 95 cctgagcagg agcacctggc
c 21 96 2499 DNA Homo sapiens 96 atgaccttcg gcactgtgct tcttctgagt
gtcctggctt cttatcatgg attcaacctg 60 gatgtggagg agcctacgat
cttccaggag gatgcaggcg gctttgggca gagcgtggtg 120 cagttcggtg
gatctcgact cgtggtggga gcacccctgg aggtggtggc ggccaaccag 180
acgggacggc tgtatgactg cgcagctgcc accggcatgt gccagcccat cccgctgcac
240 atccgccctg aggccgtgaa catgtccttg ggcctgaccc tggcagcctc
caccaacggc 300 tcccggctcc tggcctgtgg cccgaccctg cacagagtct
gtggggagaa ctcatactca 360 aagggttcct gcctcctgct gggctcgcgc
tgggagatca tccagacagt ccccgacgcc 420 acgccagagt gtccacatca
agagatggac atcgtcttcc tgattgacgg ctctggaagc 480 attgaccaaa
atgactttaa ccagatgaag ggctttgtcc aagctgtcat gggccagttt 540
gagggcactg acaccctgtt tgcactgatg cagtactcaa acctcctgaa gatccacttc
600 accttcaccc aattccggac cagcccgagc cagcagagcc tggtggatcc
catcgtccaa 660 ctgaaaggcc tgacgttcac ggccacgggc atcctgacag
tggtgacaca gctatttcat 720 cataagaatg gggcccgaaa aagtgccaag
aagatcctca ttgtcatcac agatgggcag 780 aagtacaaag accccctgga
atacagtgat gtcatccccc aggcagagaa ggctggcatc 840 atccgctacg
ctatcggggt gggacacgct ttccagggac ccactgccag gcaggagctg 900
aataccatca gctcagcgcc tccgcaggac cacgtgttca aggtggacaa ctttgcagcc
960 cttggcagca tccagaagca gctgcaggag aagatctatg cagttgaggg
aacccagtcc 1020 agggcaagca gctccttcca gcacgagatg tcccaagaag
gcttcagcac agccctcaca 1080 atggatggcc tcttcctggg ggctgtgggg
agctttagct ggtctggagg tgccttcctg 1140 tatcccccaa atatgagccc
caccttcatc aacatgtctc aggagaatgt ggacatgagg 1200 gactcttacc
tgggttactc caccgagcta gccctgtgga agggggtaca gaacctggtc 1260
ctgggggccc cccgctacca gcataccggg aaggctgtca tcttcaccca ggtgtccagg
1320 caatggagga agaaggccga agtcacaggg acgcagatcg gctcctactt
cggggcctcc 1380 ctctgctccg tggatgtgga cagcgatggc agcaccgacc
tgatcctcat tggggccccc 1440 cattactatg agcagacccg agggggccag
gtgtccgtgt gtcccttgcc tagggggagg 1500 gtgcagtggc agtgtgacgc
tgttctccgt ggtgagcagg gccacccctg gggccgcttt 1560 ggggcagccc
tgacagtgtt gggggatgtg aatgaggaca agctgataga cgtggccatt 1620
ggggccccgg gagagcagga gaaccggggt gctgtctacc tgtttcacgg agcctcagaa
1680 tccggcatca gcccctccca cagccagcgg attgccagct cccagctctc
ccccaggctg 1740 cagtattttg ggcaggcgct gagtgggggt caggacctca
cccaggatgg actgatggac 1800 ctggccgtgg gggcccgggg ccaggtgctc
ctgctcagga gtctgccggt gctgaaagtg 1860 ggggtggcca tgagattcag
ccctgtggag gtggccaagg ctgtgtaccg gtgctgggaa 1920 gagaagccca
gtgccctgga agctggggac gccaccgtct gtctcaccat ccagaaaagc 1980
tcactggacc agctaggtga catccaaagc tctgtcaggt ttgatctggc actggaccca
2040 ggtcgtctga cttctcgtgc cattttcaat gaaaccaaga accccacttt
gactcgaaga 2100 aaaaccctgg gactggggat tcactgtgaa accctgaagc
tgcttttgcc agtgaggact 2160 ttgggttctg ggaaggggga gagaggagga
gcccaaggct ggcctggagc acccccgttc 2220 tctgctgagc gaggtgggaa
gggttaggat gttggggctg gagagaggga cattagggca 2280 ggagaacctg
gctccacggc ttggagggag cactgtcagg gcagtgggga gtggatgcag 2340
tggaggagga cttgtggtgg agcgtagaga ggacagcagg ttcttgaaag cctgttctct
2400 ctcaggattg tgtggaggat gtggtgagcc ccatcattct gcacctcaac
ttctcactgg 2460 tgagagagcc catcccctcc ccccagaacc tgcgtcctg 2499 97
3956 DNA Homo sapiens 97 tttaactgca ccaactttaa aatacgctat
tggagctgga attaccgcgg ctgctggcac 60 cagacttgcc ctccaatgga
tcctcgttaa aggatttaaa gtggactcat tccaattaca 120 gggcctcgaa
agagtcctgt attgttattt ttcgtcacta cctccccggg tcgggagtgg 180
gtaatttgcg cgcctgctgc cttccttgga tgtggtagcc gtttctcagg ctccctctcc
240 ggaatcgaac cctgattccc cgtcacccgt ggtcaccatg gtaggcacgt
gcagttcggt 300 ggatctcgac tcgtggtggg agcacccctg gaggtggtgg
cggccaacca gacgggacgg 360 ctgtatgact gcgcagctgc caccggcatg
tgccagccca tcccgctgca catccgccct 420 gaggccgtga acatgtcctt
gggcctgacc ctggcagcct ccaccaacgg ctcccggctc 480 ctggcctgtg
gcccgaccct gcacagagtc tgtggggaga actcatactc aaagggttcc 540
tgcctcctgc tgggctcgcg ctgggagatc atccagacag tccccgacgc cacgccagag
600 tgtccacatc aagagatgga catcgtcttc ctgattgacg gctctggaag
cattgaccaa 660 aatgacttta accagatgaa gggctttgtc caagctgtca
tgggccagtt tgagggcact 720 gacaccctgt ttgcactgat gcagtactca
aacctcctga agatccactt caccttcacc 780 caattccgga ccagcccgag
ccagcagagc ctggtggatc ccatcgtcca actgaaaggc 840 ctgacgttca
cggccacggg catcctgaca gtggtgacac agctatttca tcataagaat 900
ggggcccgaa aaagtgccaa gaagatcctc attgtcatca cagatgggca gaagtacaaa
960 gaccccctgg aatacagtga tgtcatcccc caggcagaga aggctggcat
catccgctac 1020 gctatcgggg tgggacacgc tttccaggga cccactgcca
ggcaggagct gaataccatc 1080 agctcagcgc ctccgcagga ccacgtgttc
aaggtggaca actttgcagc ccttggcagc 1140 atccagaagc agctgcagga
gaagatctat gcagttgagg gaacccagtc cagggcaagc 1200 agctccttcc
agcacgagat
gtcccaagaa ggcttcagca cagccctcac aatggatggc 1260 ctcttcctgg
gggctgtggg gagctttagc tggtctggag gtgccttcct gtatccccca 1320
aatatgagcc ccaccttcat caacatgtct caggagaatg tggacatgag ggactcttac
1380 ctgggttact ccaccgagct agccctgtgg aagggggtac agaacctggt
cctgggggcc 1440 ccccgctacc agcataccgg gaaggctgtc atcttcaccc
aggtgtccag gcaatggagg 1500 aagaaggccg aagtcacagg gacgcagatc
ggctcctact tcggggcctc cctctgctcc 1560 gtggatgtgg acagcgatgg
cagcaccgac ctgatcctca ttggggcccc ccattactat 1620 gagcagaccc
gagggggcca ggtgtccgtg tgtcccttgc ctagggggag ggtgcagtgg 1680
cagtgtgacg ctgttctccg tggtgagcag ggccacccct ggggccgctt tggggcagcc
1740 ctgacagtgt tgggggatgt gaatgaggac aagctgatag acgtggccat
tggggccccg 1800 ggagagcagg agaaccgggg tgctgtctac ctgtttcacg
gagcctcaga atccggcatc 1860 agcccctccc acagccagcg gattgccagc
tcccagctct cccccaggct gcagtatttt 1920 gggcaggcgc tgagtggggg
tcaggacctc acccaggatg gactgatgga cctggccgtg 1980 ggggcccggg
gccaggtgct cctgctcagg agtctgccgg tgctgaaagt gggggtggcc 2040
atgagattca gccctgtgga ggtggccaag gctgtgtacc ggtgctggga agagaagccc
2100 agtgccctgg aagctgggga cgccaccgtc tgtctcacca tccagaaaag
ctcactggac 2160 cagctaggtg acatccaaag ctctgtcagg tttgatctgg
cactggaccc aggtcgtctg 2220 acttctcgtg ccattttcaa tgaaaccaag
aaccccactt tgactcgaag aaaaaccctg 2280 ggactgggga ttcactgtga
aaccctgaag ctgcttttgc cagattgtgt ggaggatgtg 2340 gtgagcccca
tcattctgca cctcaacttc tcactggtga gagagcccat cccctccccc 2400
cagaacctgc gtcctgtgct ggccgtgggc tcacaagacc tcttcactgc ttctctcccc
2460 ttcgagaaga actgtgggca agatggcctc tgtgaagggg acctgggtgt
caccctcagc 2520 ttctcaggcc tgcagaccct gaccgtgggg agctccctgg
agctcaacgt gattgtgact 2580 gtgtggaacg caggtgagga ttcctacgga
accgtggtca gcctctacta tccagcaggg 2640 ctgtcgcacc gacgggtgtc
aggagcccag aagcagcccc atcagagtgc cctgcgcctg 2700 gcatgtgaga
cagtgcccac tgaggatgag ggcctaagaa gcagccgctg cagtgtcaac 2760
caccccatct tccatgaggg ctctaacggc accttcatag tcacattcga tgtctcctac
2820 aaggccaccc tgggagacag gatgcttatg agggccagtg caagcagtga
gaacaataag 2880 gcttcaagca gcaaggccac cttccagctg gagctcccgg
tgaagtatgc agtctacacc 2940 atgatcagca ggcaggaaga atccaccaag
tacttcaact ttgcaacctc cgatgagaag 3000 aaaatgaaag aggctgagca
tcgataccgt gtgaataacc tcagccagcg agatctggcc 3060 atcagcatta
acttctgggt tcctgtcctg ctgaacgggg tggctgtgtg ggatgtggtc 3120
atggaggccc catctcagag tctcccctgt gtttcagaga gaaaacctcc ccagcattct
3180 gacttcctga cccagatttc aagaagtccc atgctggact gctccattgc
tgactgcctg 3240 cagttccgct gtgacgtccc ctccttcagc gtccaggagg
agctggattt caccctgaag 3300 ggcaatctca gtttcggctg ggtccgcgag
acattgcaga agaaggtgtt ggtcgtgagt 3360 gtggctgaaa ttacgttcga
cacatccgtg tactcccagc ttccaggaca ggaggcattt 3420 atgagagctc
agatggagat ggtgctagaa gaagacgagg tctacaatgc cattcccatc 3480
atcatgggca gctctgtggg ggctctgcta ctgctggcgc tcatcacagc cacactgtac
3540 aagcttggct tcttcaaacg ccactacaag gaaatgctgg aggacaagcc
tgaagacact 3600 gccacattca gtggggacga tttcagctgt gtggccccaa
atgtgccttt gtcctaataa 3660 tccactttcc tgtttatctc taccactgtg
ggctggactt gcttgcaacc ataaatcaac 3720 ttacatggaa acaacttctg
catagatctg cactggccta agcaacctac caggtgctaa 3780 gcaccttctc
ggagagatag agattgtcaa tgtttttaca tatctgtcca tctttttcag 3840
caatgaccca ctttttacag aagcaggcat ggtgccagca taaattttca tatgcttaag
3900 aattgtcaca tgaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa ctttag
3956 98 3785 DNA Homo sapiens CDS (1)..(3483) 98 atg acc ttc ggc
act gtg ctt ctt ctg agt gtc ctg gct tct tat cat 48 Met Thr Phe Gly
Thr Val Leu Leu Leu Ser Val Leu Ala Ser Tyr His 1 5 10 15 gga ttc
aac ctg gat gtg gag gag cct acg atc ttc cag gag gat gca 96 Gly Phe
Asn Leu Asp Val Glu Glu Pro Thr Ile Phe Gln Glu Asp Ala 20 25 30
ggc ggc ttt ggg cag agc gtg gtg cag ttc ggt gga tct cga ctc gtg 144
Gly Gly Phe Gly Gln Ser Val Val Gln Phe Gly Gly Ser Arg Leu Val 35
40 45 gtg gga gca ccc ctg gag gtg gtg gcg gcc aac cag acg gga cgg
ctg 192 Val Gly Ala Pro Leu Glu Val Val Ala Ala Asn Gln Thr Gly Arg
Leu 50 55 60 tat gac tgc gca gct gcc acc ggc atg tgc cag ccc atc
ccg ctg cac 240 Tyr Asp Cys Ala Ala Ala Thr Gly Met Cys Gln Pro Ile
Pro Leu His 65 70 75 80 atc cgc cct gag gcc gtg aac atg tcc ttg ggc
ctg acc ctg gca gcc 288 Ile Arg Pro Glu Ala Val Asn Met Ser Leu Gly
Leu Thr Leu Ala Ala 85 90 95 tcc acc aac ggc tcc cgg ctc ctg gcc
tgt ggc ccg acc ctg cac aga 336 Ser Thr Asn Gly Ser Arg Leu Leu Ala
Cys Gly Pro Thr Leu His Arg 100 105 110 gtc tgt ggg gag aac tca tac
tca aag ggt tcc tgc ctc ctg ctg ggc 384 Val Cys Gly Glu Asn Ser Tyr
Ser Lys Gly Ser Cys Leu Leu Leu Gly 115 120 125 tcg cgc tgg gag atc
atc cag aca gtc ccc gac gcc acg cca gag tgt 432 Ser Arg Trp Glu Ile
Ile Gln Thr Val Pro Asp Ala Thr Pro Glu Cys 130 135 140 cca cat caa
gag atg gac atc gtc ttc ctg att gac ggc tct gga agc 480 Pro His Gln
Glu Met Asp Ile Val Phe Leu Ile Asp Gly Ser Gly Ser 145 150 155 160
att gac caa aat gac ttt aac cag atg aag ggc ttt gtc caa gct gtc 528
Ile Asp Gln Asn Asp Phe Asn Gln Met Lys Gly Phe Val Gln Ala Val 165
170 175 atg ggc cag ttt gag ggc act gac acc ctg ttt gca ctg atg cag
tac 576 Met Gly Gln Phe Glu Gly Thr Asp Thr Leu Phe Ala Leu Met Gln
Tyr 180 185 190 tca aac ctc ctg aag atc cac ttc acc ttc acc caa ttc
cgg acc agc 624 Ser Asn Leu Leu Lys Ile His Phe Thr Phe Thr Gln Phe
Arg Thr Ser 195 200 205 ccg agc cag cag agc ctg gtg gat ccc atc gtc
caa ctg aaa ggc ctg 672 Pro Ser Gln Gln Ser Leu Val Asp Pro Ile Val
Gln Leu Lys Gly Leu 210 215 220 acg ttc acg gcc acg ggc atc ctg aca
gtg gtg aca cag cta ttt cat 720 Thr Phe Thr Ala Thr Gly Ile Leu Thr
Val Val Thr Gln Leu Phe His 225 230 235 240 cat aag aat ggg gcc cga
aaa agt gcc aag aag atc ctc att gtc atc 768 His Lys Asn Gly Ala Arg
Lys Ser Ala Lys Lys Ile Leu Ile Val Ile 245 250 255 aca gat ggg cag
aag tac aaa gac ccc ctg gaa tac agt gat gtc atc 816 Thr Asp Gly Gln
Lys Tyr Lys Asp Pro Leu Glu Tyr Ser Asp Val Ile 260 265 270 ccc cag
gca gag aag gct ggc atc atc cgc tac gct atc ggg gtg gga 864 Pro Gln
Ala Glu Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val Gly 275 280 285
cac gct ttc cag gga ccc act gcc agg cag gag ctg aat acc atc agc 912
His Ala Phe Gln Gly Pro Thr Ala Arg Gln Glu Leu Asn Thr Ile Ser 290
295 300 tca gcg cct ccg cag gac cac gtg ttc aag gtg gac aac ttt gca
gcc 960 Ser Ala Pro Pro Gln Asp His Val Phe Lys Val Asp Asn Phe Ala
Ala 305 310 315 320 ctt ggc agc atc cag aag cag ctg cag gag aag atc
tat gca gtt gag 1008 Leu Gly Ser Ile Gln Lys Gln Leu Gln Glu Lys
Ile Tyr Ala Val Glu 325 330 335 gga acc cag tcc agg gca agc agc tcc
ttc cag cac gag atg tcc caa 1056 Gly Thr Gln Ser Arg Ala Ser Ser
Ser Phe Gln His Glu Met Ser Gln 340 345 350 gaa ggc ttc agc aca gcc
ctc aca atg gat ggc ctc ttc ctg ggg gct 1104 Glu Gly Phe Ser Thr
Ala Leu Thr Met Asp Gly Leu Phe Leu Gly Ala 355 360 365 gtg ggg agc
ttt agc tgg tct gga ggt gcc ttc ctg tat ccc cca aat 1152 Val Gly
Ser Phe Ser Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Asn 370 375 380
atg agc ccc acc ttc atc aac atg tct cag gag aat gtg gac atg agg
1200 Met Ser Pro Thr Phe Ile Asn Met Ser Gln Glu Asn Val Asp Met
Arg 385 390 395 400 gac tct tac ctg ggt tac tcc acc gag cta gcc ctg
tgg aag ggg gta 1248 Asp Ser Tyr Leu Gly Tyr Ser Thr Glu Leu Ala
Leu Trp Lys Gly Val 405 410 415 cag aac ctg gtc ctg ggg gcc ccc cgc
tac cag cat acc ggg aag gct 1296 Gln Asn Leu Val Leu Gly Ala Pro
Arg Tyr Gln His Thr Gly Lys Ala 420 425 430 gtc atc ttc acc cag gtg
tcc agg caa tgg agg aag aag gcc gaa gtc 1344 Val Ile Phe Thr Gln
Val Ser Arg Gln Trp Arg Lys Lys Ala Glu Val 435 440 445 aca ggg acg
cag atc ggc tcc tac ttc ggg gcc tcc ctc tgc tcc gtg 1392 Thr Gly
Thr Gln Ile Gly Ser Tyr Phe Gly Ala Ser Leu Cys Ser Val 450 455 460
gat gtg gac agc gat ggc agc acc gac ctg atc ctc att ggg gcc ccc
1440 Asp Val Asp Ser Asp Gly Ser Thr Asp Leu Ile Leu Ile Gly Ala
Pro 465 470 475 480 cat tac tat gag cag acc cga ggg ggc cag gtg tcc
gtg tgt ccc ttg 1488 His Tyr Tyr Glu Gln Thr Arg Gly Gly Gln Val
Ser Val Cys Pro Leu 485 490 495 cct agg ggg agg gtg cag tgg cag tgt
gac gct gtt ctc cgt ggt gag 1536 Pro Arg Gly Arg Val Gln Trp Gln
Cys Asp Ala Val Leu Arg Gly Glu 500 505 510 cag ggc cac ccc tgg ggc
cgc ttt ggg gca gcc ctg aca gtg ttg ggg 1584 Gln Gly His Pro Trp
Gly Arg Phe Gly Ala Ala Leu Thr Val Leu Gly 515 520 525 gat gtg aat
gag gac aag ctg ata gac gtg gcc att ggg gcc ccg gga 1632 Asp Val
Asn Glu Asp Lys Leu Ile Asp Val Ala Ile Gly Ala Pro Gly 530 535 540
gag cag gag aac cgg ggt gct gtc tac ctg ttt cac gga gcc tca gaa
1680 Glu Gln Glu Asn Arg Gly Ala Val Tyr Leu Phe His Gly Ala Ser
Glu 545 550 555 560 tcc ggc atc agc ccc tcc cac agc cag cgg att gcc
agc tcc cag ctc 1728 Ser Gly Ile Ser Pro Ser His Ser Gln Arg Ile
Ala Ser Ser Gln Leu 565 570 575 tcc ccc agg ctg cag tat ttt ggg cag
gcg ctg agt ggg ggt cag gac 1776 Ser Pro Arg Leu Gln Tyr Phe Gly
Gln Ala Leu Ser Gly Gly Gln Asp 580 585 590 ctc acc cag gat gga ctg
atg gac ctg gcc gtg ggg gcc cgg ggc cag 1824 Leu Thr Gln Asp Gly
Leu Met Asp Leu Ala Val Gly Ala Arg Gly Gln 595 600 605 gtg ctc ctg
ctc agg agt ctg ccg gtg ctg aaa gtg ggg gtg gcc atg 1872 Val Leu
Leu Leu Arg Ser Leu Pro Val Leu Lys Val Gly Val Ala Met 610 615 620
aga ttc agc cct gtg gag gtg gcc aag gct gtg tac cgg tgc tgg gaa
1920 Arg Phe Ser Pro Val Glu Val Ala Lys Ala Val Tyr Arg Cys Trp
Glu 625 630 635 640 gag aag ccc agt gcc ctg gaa gct ggg gac gcc acc
gtc tgt ctc acc 1968 Glu Lys Pro Ser Ala Leu Glu Ala Gly Asp Ala
Thr Val Cys Leu Thr 645 650 655 atc cag aaa agc tca ctg gac cag cta
ggt gac atc caa agc tct gtc 2016 Ile Gln Lys Ser Ser Leu Asp Gln
Leu Gly Asp Ile Gln Ser Ser Val 660 665 670 agg ttt gat ctg gca ctg
gac cca ggt cgt ctg act tct cgt gcc att 2064 Arg Phe Asp Leu Ala
Leu Asp Pro Gly Arg Leu Thr Ser Arg Ala Ile 675 680 685 ttc aat gaa
acc aag aac ccc act ttg act cga aga aaa acc ctg gga 2112 Phe Asn
Glu Thr Lys Asn Pro Thr Leu Thr Arg Arg Lys Thr Leu Gly 690 695 700
ctg ggg att cac tgt gaa acc ctg aag ctg ctt ttg cca gat tgt gtg
2160 Leu Gly Ile His Cys Glu Thr Leu Lys Leu Leu Leu Pro Asp Cys
Val 705 710 715 720 gag gat gtg gtg agc ccc atc att ctg cac ctc aac
ttc tca ctg gtg 2208 Glu Asp Val Val Ser Pro Ile Ile Leu His Leu
Asn Phe Ser Leu Val 725 730 735 aga gag ccc atc ccc tcc ccc cag aac
ctg cgt cct gtg ctg gcc gtg 2256 Arg Glu Pro Ile Pro Ser Pro Gln
Asn Leu Arg Pro Val Leu Ala Val 740 745 750 ggc tca caa gac ctc ttc
act gct tct ctc ccc ttc gag aag aac tgt 2304 Gly Ser Gln Asp Leu
Phe Thr Ala Ser Leu Pro Phe Glu Lys Asn Cys 755 760 765 ggg caa gat
ggc ctc tgt gaa ggg gac ctg ggt gtc acc ctc agc ttc 2352 Gly Gln
Asp Gly Leu Cys Glu Gly Asp Leu Gly Val Thr Leu Ser Phe 770 775 780
tca ggc ctg cag acc ctg acc gtg ggg agc tcc ctg gag ctc aac gtg
2400 Ser Gly Leu Gln Thr Leu Thr Val Gly Ser Ser Leu Glu Leu Asn
Val 785 790 795 800 att gtg act gtg tgg aac gca ggt gag gat tcc tac
gga acc gtg gtc 2448 Ile Val Thr Val Trp Asn Ala Gly Glu Asp Ser
Tyr Gly Thr Val Val 805 810 815 agc ctc tac tat cca gca ggg ctg tcg
cac cga cgg gtg tca gga gcc 2496 Ser Leu Tyr Tyr Pro Ala Gly Leu
Ser His Arg Arg Val Ser Gly Ala 820 825 830 cag aag cag ccc cat cag
agt gcc ctg cgc ctg gca tgt gag aca gtg 2544 Gln Lys Gln Pro His
Gln Ser Ala Leu Arg Leu Ala Cys Glu Thr Val 835 840 845 ccc act gag
gat gag ggc cta aga agc agc cgc tgc agt gtc aac cac 2592 Pro Thr
Glu Asp Glu Gly Leu Arg Ser Ser Arg Cys Ser Val Asn His 850 855 860
ccc atc ttc cat gag ggc tct aac ggc acc ttc ata gtc aca ttc gat
2640 Pro Ile Phe His Glu Gly Ser Asn Gly Thr Phe Ile Val Thr Phe
Asp 865 870 875 880 gtc tcc tac aag gcc acc ctg gga gac agg atg ctt
atg agg gcc agt 2688 Val Ser Tyr Lys Ala Thr Leu Gly Asp Arg Met
Leu Met Arg Ala Ser 885 890 895 gca agc agt gag aac aat aag gct tca
agc agc aag gcc acc ttc cag 2736 Ala Ser Ser Glu Asn Asn Lys Ala
Ser Ser Ser Lys Ala Thr Phe Gln 900 905 910 ctg gag ctc ccg gtg aag
tat gca gtc tac acc atg atc agc agg cag 2784 Leu Glu Leu Pro Val
Lys Tyr Ala Val Tyr Thr Met Ile Ser Arg Gln 915 920 925 gaa gaa tcc
acc aag tac ttc aac ttt gca acc tcc gat gag aag aaa 2832 Glu Glu
Ser Thr Lys Tyr Phe Asn Phe Ala Thr Ser Asp Glu Lys Lys 930 935 940
atg aaa gag gct gag cat cga tac cgt gtg aat aac ctc agc cag cga
2880 Met Lys Glu Ala Glu His Arg Tyr Arg Val Asn Asn Leu Ser Gln
Arg 945 950 955 960 gat ctg gcc atc agc att aac ttc tgg gtt cct gtc
ctg ctg aac ggg 2928 Asp Leu Ala Ile Ser Ile Asn Phe Trp Val Pro
Val Leu Leu Asn Gly 965 970 975 gtg gct gtg tgg gat gtg gtc atg gag
gcc cca tct cag agt ctc ccc 2976 Val Ala Val Trp Asp Val Val Met
Glu Ala Pro Ser Gln Ser Leu Pro 980 985 990 tgt gtt tca gag aga aaa
cct ccc cag cat tct gac ttc ctg acc cag 3024 Cys Val Ser Glu Arg
Lys Pro Pro Gln His Ser Asp Phe Leu Thr Gln 995 1000 1005 att tca
aga agt ccc atg ctg gac tgc tcc att gct gac tgc ctg cag 3072 Ile
Ser Arg Ser Pro Met Leu Asp Cys Ser Ile Ala Asp Cys Leu Gln 1010
1015 1020 ttc cgc tgt gac gtc ccc tcc ttc agc gtc cag gag gag ctg
gat ttc 3120 Phe Arg Cys Asp Val Pro Ser Phe Ser Val Gln Glu Glu
Leu Asp Phe 1025 1030 1035 1040 acc ctg aag ggc aat ctc agt ttc ggc
tgg gtc cgc gag aca ttg cag 3168 Thr Leu Lys Gly Asn Leu Ser Phe
Gly Trp Val Arg Glu Thr Leu Gln 1045 1050 1055 aag aag gtg ttg gtc
gtg agt gtg gct gaa att acg ttc gac aca tcc 3216 Lys Lys Val Leu
Val Val Ser Val Ala Glu Ile Thr Phe Asp Thr Ser 1060 1065 1070 gtg
tac tcc cag ctt cca gga cag gag gca ttt atg aga gct cag atg 3264
Val Tyr Ser Gln Leu Pro Gly Gln Glu Ala Phe Met Arg Ala Gln Met
1075 1080 1085 gag atg gtg cta gaa gaa gac gag gtc tac aat gcc att
ccc atc atc 3312 Glu Met Val Leu Glu Glu Asp Glu Val Tyr Asn Ala
Ile Pro Ile Ile 1090 1095 1100 atg ggc agc tct gtg ggg gct ctg cta
ctg ctg gcg ctc atc aca gcc 3360 Met Gly Ser Ser Val Gly Ala Leu
Leu Leu Leu Ala Leu Ile Thr Ala 1105 1110 1115 1120 aca ctg tac aag
ctt ggc ttc ttc aaa cgc cac tac aag gaa atg ctg 3408 Thr Leu Tyr
Lys Leu Gly Phe Phe Lys Arg His Tyr Lys Glu Met Leu 1125 1130 1135
gag gac aag cct gaa gac act gcc aca ttc agt ggg gac gat ttc agc
3456 Glu Asp Lys Pro Glu Asp Thr Ala Thr Phe Ser Gly Asp Asp Phe
Ser 1140 1145 1150 tgt gtg gcc cca aat gtg cct ttg tcc taataatcca
ctttcctgtt 3503 Cys Val Ala Pro Asn Val Pro Leu Ser 1155 1160
tatctctacc actgtgggct ggacttgctt gcaaccataa atcaacttac atggaaacaa
3563 cttctgcata gatctgcact ggcctaagca acctaccagg tgctaagcac
cttctcggag 3623 agatagagat tgtcaatgtt tttacatatc tgtccatctt
tttcagcaat gacccacttt 3683 ttacagaagc aggcatggtg ccagcataaa
ttttcatatg cttaagaatt gtcacatgaa 3743 aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaacttt ag 3785 99 1161 PRT Homo sapiens 99 Met Thr
Phe Gly Thr Val Leu Leu Leu Ser Val Leu Ala Ser Tyr His 1 5 10 15
Gly Phe Asn Leu Asp Val Glu Glu Pro Thr Ile Phe Gln Glu Asp Ala 20
25 30 Gly Gly Phe Gly Gln Ser Val Val Gln Phe Gly Gly Ser Arg Leu
Val 35 40 45 Val Gly Ala Pro Leu Glu Val Val Ala Ala Asn Gln Thr
Gly Arg Leu 50 55 60 Tyr Asp Cys Ala Ala Ala Thr Gly Met Cys Gln
Pro
Ile Pro Leu His 65 70 75 80 Ile Arg Pro Glu Ala Val Asn Met Ser Leu
Gly Leu Thr Leu Ala Ala 85 90 95 Ser Thr Asn Gly Ser Arg Leu Leu
Ala Cys Gly Pro Thr Leu His Arg 100 105 110 Val Cys Gly Glu Asn Ser
Tyr Ser Lys Gly Ser Cys Leu Leu Leu Gly 115 120 125 Ser Arg Trp Glu
Ile Ile Gln Thr Val Pro Asp Ala Thr Pro Glu Cys 130 135 140 Pro His
Gln Glu Met Asp Ile Val Phe Leu Ile Asp Gly Ser Gly Ser 145 150 155
160 Ile Asp Gln Asn Asp Phe Asn Gln Met Lys Gly Phe Val Gln Ala Val
165 170 175 Met Gly Gln Phe Glu Gly Thr Asp Thr Leu Phe Ala Leu Met
Gln Tyr 180 185 190 Ser Asn Leu Leu Lys Ile His Phe Thr Phe Thr Gln
Phe Arg Thr Ser 195 200 205 Pro Ser Gln Gln Ser Leu Val Asp Pro Ile
Val Gln Leu Lys Gly Leu 210 215 220 Thr Phe Thr Ala Thr Gly Ile Leu
Thr Val Val Thr Gln Leu Phe His 225 230 235 240 His Lys Asn Gly Ala
Arg Lys Ser Ala Lys Lys Ile Leu Ile Val Ile 245 250 255 Thr Asp Gly
Gln Lys Tyr Lys Asp Pro Leu Glu Tyr Ser Asp Val Ile 260 265 270 Pro
Gln Ala Glu Lys Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val Gly 275 280
285 His Ala Phe Gln Gly Pro Thr Ala Arg Gln Glu Leu Asn Thr Ile Ser
290 295 300 Ser Ala Pro Pro Gln Asp His Val Phe Lys Val Asp Asn Phe
Ala Ala 305 310 315 320 Leu Gly Ser Ile Gln Lys Gln Leu Gln Glu Lys
Ile Tyr Ala Val Glu 325 330 335 Gly Thr Gln Ser Arg Ala Ser Ser Ser
Phe Gln His Glu Met Ser Gln 340 345 350 Glu Gly Phe Ser Thr Ala Leu
Thr Met Asp Gly Leu Phe Leu Gly Ala 355 360 365 Val Gly Ser Phe Ser
Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Asn 370 375 380 Met Ser Pro
Thr Phe Ile Asn Met Ser Gln Glu Asn Val Asp Met Arg 385 390 395 400
Asp Ser Tyr Leu Gly Tyr Ser Thr Glu Leu Ala Leu Trp Lys Gly Val 405
410 415 Gln Asn Leu Val Leu Gly Ala Pro Arg Tyr Gln His Thr Gly Lys
Ala 420 425 430 Val Ile Phe Thr Gln Val Ser Arg Gln Trp Arg Lys Lys
Ala Glu Val 435 440 445 Thr Gly Thr Gln Ile Gly Ser Tyr Phe Gly Ala
Ser Leu Cys Ser Val 450 455 460 Asp Val Asp Ser Asp Gly Ser Thr Asp
Leu Ile Leu Ile Gly Ala Pro 465 470 475 480 His Tyr Tyr Glu Gln Thr
Arg Gly Gly Gln Val Ser Val Cys Pro Leu 485 490 495 Pro Arg Gly Arg
Val Gln Trp Gln Cys Asp Ala Val Leu Arg Gly Glu 500 505 510 Gln Gly
His Pro Trp Gly Arg Phe Gly Ala Ala Leu Thr Val Leu Gly 515 520 525
Asp Val Asn Glu Asp Lys Leu Ile Asp Val Ala Ile Gly Ala Pro Gly 530
535 540 Glu Gln Glu Asn Arg Gly Ala Val Tyr Leu Phe His Gly Ala Ser
Glu 545 550 555 560 Ser Gly Ile Ser Pro Ser His Ser Gln Arg Ile Ala
Ser Ser Gln Leu 565 570 575 Ser Pro Arg Leu Gln Tyr Phe Gly Gln Ala
Leu Ser Gly Gly Gln Asp 580 585 590 Leu Thr Gln Asp Gly Leu Met Asp
Leu Ala Val Gly Ala Arg Gly Gln 595 600 605 Val Leu Leu Leu Arg Ser
Leu Pro Val Leu Lys Val Gly Val Ala Met 610 615 620 Arg Phe Ser Pro
Val Glu Val Ala Lys Ala Val Tyr Arg Cys Trp Glu 625 630 635 640 Glu
Lys Pro Ser Ala Leu Glu Ala Gly Asp Ala Thr Val Cys Leu Thr 645 650
655 Ile Gln Lys Ser Ser Leu Asp Gln Leu Gly Asp Ile Gln Ser Ser Val
660 665 670 Arg Phe Asp Leu Ala Leu Asp Pro Gly Arg Leu Thr Ser Arg
Ala Ile 675 680 685 Phe Asn Glu Thr Lys Asn Pro Thr Leu Thr Arg Arg
Lys Thr Leu Gly 690 695 700 Leu Gly Ile His Cys Glu Thr Leu Lys Leu
Leu Leu Pro Asp Cys Val 705 710 715 720 Glu Asp Val Val Ser Pro Ile
Ile Leu His Leu Asn Phe Ser Leu Val 725 730 735 Arg Glu Pro Ile Pro
Ser Pro Gln Asn Leu Arg Pro Val Leu Ala Val 740 745 750 Gly Ser Gln
Asp Leu Phe Thr Ala Ser Leu Pro Phe Glu Lys Asn Cys 755 760 765 Gly
Gln Asp Gly Leu Cys Glu Gly Asp Leu Gly Val Thr Leu Ser Phe 770 775
780 Ser Gly Leu Gln Thr Leu Thr Val Gly Ser Ser Leu Glu Leu Asn Val
785 790 795 800 Ile Val Thr Val Trp Asn Ala Gly Glu Asp Ser Tyr Gly
Thr Val Val 805 810 815 Ser Leu Tyr Tyr Pro Ala Gly Leu Ser His Arg
Arg Val Ser Gly Ala 820 825 830 Gln Lys Gln Pro His Gln Ser Ala Leu
Arg Leu Ala Cys Glu Thr Val 835 840 845 Pro Thr Glu Asp Glu Gly Leu
Arg Ser Ser Arg Cys Ser Val Asn His 850 855 860 Pro Ile Phe His Glu
Gly Ser Asn Gly Thr Phe Ile Val Thr Phe Asp 865 870 875 880 Val Ser
Tyr Lys Ala Thr Leu Gly Asp Arg Met Leu Met Arg Ala Ser 885 890 895
Ala Ser Ser Glu Asn Asn Lys Ala Ser Ser Ser Lys Ala Thr Phe Gln 900
905 910 Leu Glu Leu Pro Val Lys Tyr Ala Val Tyr Thr Met Ile Ser Arg
Gln 915 920 925 Glu Glu Ser Thr Lys Tyr Phe Asn Phe Ala Thr Ser Asp
Glu Lys Lys 930 935 940 Met Lys Glu Ala Glu His Arg Tyr Arg Val Asn
Asn Leu Ser Gln Arg 945 950 955 960 Asp Leu Ala Ile Ser Ile Asn Phe
Trp Val Pro Val Leu Leu Asn Gly 965 970 975 Val Ala Val Trp Asp Val
Val Met Glu Ala Pro Ser Gln Ser Leu Pro 980 985 990 Cys Val Ser Glu
Arg Lys Pro Pro Gln His Ser Asp Phe Leu Thr Gln 995 1000 1005 Ile
Ser Arg Ser Pro Met Leu Asp Cys Ser Ile Ala Asp Cys Leu Gln 1010
1015 1020 Phe Arg Cys Asp Val Pro Ser Phe Ser Val Gln Glu Glu Leu
Asp Phe 1025 1030 1035 1040 Thr Leu Lys Gly Asn Leu Ser Phe Gly Trp
Val Arg Glu Thr Leu Gln 1045 1050 1055 Lys Lys Val Leu Val Val Ser
Val Ala Glu Ile Thr Phe Asp Thr Ser 1060 1065 1070 Val Tyr Ser Gln
Leu Pro Gly Gln Glu Ala Phe Met Arg Ala Gln Met 1075 1080 1085 Glu
Met Val Leu Glu Glu Asp Glu Val Tyr Asn Ala Ile Pro Ile Ile 1090
1095 1100 Met Gly Ser Ser Val Gly Ala Leu Leu Leu Leu Ala Leu Ile
Thr Ala 1105 1110 1115 1120 Thr Leu Tyr Lys Leu Gly Phe Phe Lys Arg
His Tyr Lys Glu Met Leu 1125 1130 1135 Glu Asp Lys Pro Glu Asp Thr
Ala Thr Phe Ser Gly Asp Asp Phe Ser 1140 1145 1150 Cys Val Ala Pro
Asn Val Pro Leu Ser 1155 1160 100 1318 DNA rabbit CDS (17)..(1255)
100 aattcggcac gagctt ggg gct gtg gtc ctc ctt ggg gtc ctg gct tct
tac 52 Gly Ala Val Val Leu Leu Gly Val Leu Ala Ser Tyr 1 5 10 cac
gga ttc aac ttg gac gtg gat gag ccg gtg atc ttc cag gaa gac 100 His
Gly Phe Asn Leu Asp Val Asp Glu Pro Val Ile Phe Gln Glu Asp 15 20
25 gca gcg ggc ttc ggg cag agc gtg atg cag ttt gga gga tct cga ctc
148 Ala Ala Gly Phe Gly Gln Ser Val Met Gln Phe Gly Gly Ser Arg Leu
30 35 40 gtg gtg gga gcc ccc ctg gcg gtg gtg tcg gcc aac cac aca
gga cgg 196 Val Val Gly Ala Pro Leu Ala Val Val Ser Ala Asn His Thr
Gly Arg 45 50 55 60 ctg tac gag tgt gcg cct gcc tcc ggc acc tgc acg
ccc att ttc cca 244 Leu Tyr Glu Cys Ala Pro Ala Ser Gly Thr Cys Thr
Pro Ile Phe Pro 65 70 75 ttc atg ccc ccc gaa gcc gtg aac atg tcc
ctg ggc ctg tcc ctg gca 292 Phe Met Pro Pro Glu Ala Val Asn Met Ser
Leu Gly Leu Ser Leu Ala 80 85 90 gcc tcc ccc aac cat tcc cag ctg
ctg gct tgt ggc ccg acc gtg cat 340 Ala Ser Pro Asn His Ser Gln Leu
Leu Ala Cys Gly Pro Thr Val His 95 100 105 aga gcc tgc ggg gag gac
gtg tac gcc cag ggt ttc tgt gtg ctg ctg 388 Arg Ala Cys Gly Glu Asp
Val Tyr Ala Gln Gly Phe Cys Val Leu Leu 110 115 120 gat gcc cac gca
cag ccc atc ggg act gtg cca gct gcc ctg ccc gag 436 Asp Ala His Ala
Gln Pro Ile Gly Thr Val Pro Ala Ala Leu Pro Glu 125 130 135 140 tgc
cca gat caa gag atg gac att gtc ttc ctg att gac ggc tct ggc 484 Cys
Pro Asp Gln Glu Met Asp Ile Val Phe Leu Ile Asp Gly Ser Gly 145 150
155 agc att agc tca aat gac ttc cgc aag atg aag gac ttt gtc aga gct
532 Ser Ile Ser Ser Asn Asp Phe Arg Lys Met Lys Asp Phe Val Arg Ala
160 165 170 gtg atg gac cag ttc aag gac acc aac acc cag ttc tcg ctg
atg cag 580 Val Met Asp Gln Phe Lys Asp Thr Asn Thr Gln Phe Ser Leu
Met Gln 175 180 185 tac tcc aat gtg ctg gtg aca cat ttc acc ttc agc
agc ttc cgg aac 628 Tyr Ser Asn Val Leu Val Thr His Phe Thr Phe Ser
Ser Phe Arg Asn 190 195 200 agc tcc aat cct cag ggc cta gtg gag ccc
att gtg cag ctg aca ggc 676 Ser Ser Asn Pro Gln Gly Leu Val Glu Pro
Ile Val Gln Leu Thr Gly 205 210 215 220 ctc acg ttc acg gcc aca ggg
atc ctg aaa gtg gtg aca gag ctg ttt 724 Leu Thr Phe Thr Ala Thr Gly
Ile Leu Lys Val Val Thr Glu Leu Phe 225 230 235 caa acc aag aac ggg
gcc cgc gaa agt gcc aag aag atc ctc atc gtc 772 Gln Thr Lys Asn Gly
Ala Arg Glu Ser Ala Lys Lys Ile Leu Ile Val 240 245 250 atc aca gat
ggg cag aag tac aaa gac ccc ctg cac tac agt gct gtc 820 Ile Thr Asp
Gly Gln Lys Tyr Lys Asp Pro Leu His Tyr Ser Ala Val 255 260 265 atc
cca cag gca gag cag gcg ggc atc atc cgc tac gcc atc ggg gtg 868 Ile
Pro Gln Ala Glu Gln Ala Gly Ile Ile Arg Tyr Ala Ile Gly Val 270 275
280 ggg gac gcg ttc cag aaa ccc aca gcc agg cag gag ctg gac acc atc
916 Gly Asp Ala Phe Gln Lys Pro Thr Ala Arg Gln Glu Leu Asp Thr Ile
285 290 295 300 gcc tcc gag ccg ccc gac gcc cac gtg ttc cag gtg gac
aat ttc tca 964 Ala Ser Glu Pro Pro Asp Ala His Val Phe Gln Val Asp
Asn Phe Ser 305 310 315 gca ctc agc agc atc caa aag cag ctg tat gac
agg atc ttt gcc gtc 1012 Ala Leu Ser Ser Ile Gln Lys Gln Leu Tyr
Asp Arg Ile Phe Ala Val 320 325 330 gag gga acc ctg tca tcg gca agc
acc tcc ttc cag cat gag atg tcc 1060 Glu Gly Thr Leu Ser Ser Ala
Ser Thr Ser Phe Gln His Glu Met Ser 335 340 345 caa gag ggc ttc agc
tca ctt ctc acc acg gaa gga ccg gtg ctg ggg 1108 Gln Glu Gly Phe
Ser Ser Leu Leu Thr Thr Glu Gly Pro Val Leu Gly 350 355 360 gct gtg
ggc agc ttc gat tgg tcc ggg ggt gct ttc ctg tac ccc ccc 1156 Ala
Val Gly Ser Phe Asp Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro 365 370
375 380 ggc ggg agc ccc acc ttc atc aac atg tct cag cag aac gtg gac
atg 1204 Gly Gly Ser Pro Thr Phe Ile Asn Met Ser Gln Gln Asn Val
Asp Met 385 390 395 agg gac tcc tac ctg ggt gag gaa ggg gtg ggg gtg
ggg aca ggt ggg 1252 Arg Asp Ser Tyr Leu Gly Glu Glu Gly Val Gly
Val Gly Thr Gly Gly 400 405 410 agc tgaggcttgg ggtggggtgg
ggctgggctg ggaggggagg gaagaggagg 1305 Ser ggagaggcaa aga 1318 101
413 PRT rabbit 101 Gly Ala Val Val Leu Leu Gly Val Leu Ala Ser Tyr
His Gly Phe Asn 1 5 10 15 Leu Asp Val Asp Glu Pro Val Ile Phe Gln
Glu Asp Ala Ala Gly Phe 20 25 30 Gly Gln Ser Val Met Gln Phe Gly
Gly Ser Arg Leu Val Val Gly Ala 35 40 45 Pro Leu Ala Val Val Ser
Ala Asn His Thr Gly Arg Leu Tyr Glu Cys 50 55 60 Ala Pro Ala Ser
Gly Thr Cys Thr Pro Ile Phe Pro Phe Met Pro Pro 65 70 75 80 Glu Ala
Val Asn Met Ser Leu Gly Leu Ser Leu Ala Ala Ser Pro Asn 85 90 95
His Ser Gln Leu Leu Ala Cys Gly Pro Thr Val His Arg Ala Cys Gly 100
105 110 Glu Asp Val Tyr Ala Gln Gly Phe Cys Val Leu Leu Asp Ala His
Ala 115 120 125 Gln Pro Ile Gly Thr Val Pro Ala Ala Leu Pro Glu Cys
Pro Asp Gln 130 135 140 Glu Met Asp Ile Val Phe Leu Ile Asp Gly Ser
Gly Ser Ile Ser Ser 145 150 155 160 Asn Asp Phe Arg Lys Met Lys Asp
Phe Val Arg Ala Val Met Asp Gln 165 170 175 Phe Lys Asp Thr Asn Thr
Gln Phe Ser Leu Met Gln Tyr Ser Asn Val 180 185 190 Leu Val Thr His
Phe Thr Phe Ser Ser Phe Arg Asn Ser Ser Asn Pro 195 200 205 Gln Gly
Leu Val Glu Pro Ile Val Gln Leu Thr Gly Leu Thr Phe Thr 210 215 220
Ala Thr Gly Ile Leu Lys Val Val Thr Glu Leu Phe Gln Thr Lys Asn 225
230 235 240 Gly Ala Arg Glu Ser Ala Lys Lys Ile Leu Ile Val Ile Thr
Asp Gly 245 250 255 Gln Lys Tyr Lys Asp Pro Leu His Tyr Ser Ala Val
Ile Pro Gln Ala 260 265 270 Glu Gln Ala Gly Ile Ile Arg Tyr Ala Ile
Gly Val Gly Asp Ala Phe 275 280 285 Gln Lys Pro Thr Ala Arg Gln Glu
Leu Asp Thr Ile Ala Ser Glu Pro 290 295 300 Pro Asp Ala His Val Phe
Gln Val Asp Asn Phe Ser Ala Leu Ser Ser 305 310 315 320 Ile Gln Lys
Gln Leu Tyr Asp Arg Ile Phe Ala Val Glu Gly Thr Leu 325 330 335 Ser
Ser Ala Ser Thr Ser Phe Gln His Glu Met Ser Gln Glu Gly Phe 340 345
350 Ser Ser Leu Leu Thr Thr Glu Gly Pro Val Leu Gly Ala Val Gly Ser
355 360 365 Phe Asp Trp Ser Gly Gly Ala Phe Leu Tyr Pro Pro Gly Gly
Ser Pro 370 375 380 Thr Phe Ile Asn Met Ser Gln Gln Asn Val Asp Met
Arg Asp Ser Tyr 385 390 395 400 Leu Gly Glu Glu Gly Val Gly Val Gly
Thr Gly Gly Ser 405 410 102 1484 DNA rabbit CDS (1)..(1482) 102 gat
gtc cag agc tcc atc agc tat gat ctg gca ctg gac cca ggc cgc 48 Asp
Val Gln Ser Ser Ile Ser Tyr Asp Leu Ala Leu Asp Pro Gly Arg 1 5 10
15 ctg gtc tct cgg gcc att ttt caa gag acc cag aac cag act tta act
96 Leu Val Ser Arg Ala Ile Phe Gln Glu Thr Gln Asn Gln Thr Leu Thr
20 25 30 cga agg aag acc ctg ggg ctg ggg cgt cac tgt gaa acc atg
agg cta 144 Arg Arg Lys Thr Leu Gly Leu Gly Arg His Cys Glu Thr Met
Arg Leu 35 40 45 ctt ttg cca gac tgc gta gag gac gtg gtg aac ccc
atc gtc ctg cac 192 Leu Leu Pro Asp Cys Val Glu Asp Val Val Asn Pro
Ile Val Leu His 50 55 60 ctc aac ttc tcc ctg gag gga cag cca atc
ctc tca tcc cag aat ctg 240 Leu Asn Phe Ser Leu Glu Gly Gln Pro Ile
Leu Ser Ser Gln Asn Leu 65 70 75 80 cgc cct gtg ctg gcc acg ggc tcg
cag gac cac ttc att gcc tcc ctc 288 Arg Pro Val Leu Ala Thr Gly Ser
Gln Asp His Phe Ile Ala Ser Leu 85 90 95 ccc ttt gag aag aac tgc
gga caa gat cgc ctg tgt gag ggg gac ctg 336 Pro Phe Glu Lys Asn Cys
Gly Gln Asp Arg Leu Cys Glu Gly Asp Leu 100 105 110 agc atc agc ttc
aac ttc tcg ggc ttg aat acc ctg ctg gtg ggg ctc 384 Ser Ile Ser Phe
Asn Phe Ser Gly Leu Asn Thr Leu Leu Val Gly Leu 115 120 125 tcc ctg
gag ctc aca gtg aca gtg acc gtg cgg aat gag ggc gag gac 432 Ser Leu
Glu Leu Thr Val Thr Val Thr Val Arg Asn Glu Gly Glu Asp 130 135 140
tcc tat ggg acc gcc atc acc ctc tac tac cca gca ggg cta tcc tac
480 Ser Tyr Gly Thr Ala Ile Thr Leu Tyr Tyr Pro Ala Gly Leu Ser Tyr
145 150 155 160 agg cgg gtg tcg ggc cag aca caa ccc tgg cag cgc ccc
ctg cac ctc 528 Arg Arg Val Ser Gly Gln Thr Gln Pro Trp Gln Arg Pro
Leu His Leu 165 170 175 gca tgt gag gct gta cct acc gag agc gag ggc
ttg agg agt acc agc 576 Ala Cys Glu Ala Val Pro Thr Glu Ser Glu Gly
Leu Arg Ser Thr Ser 180 185 190 tgc agc gtc aac cac ccc atc ttc caa
ggg ggt gct cag ggc act ttc 624 Cys Ser Val Asn His Pro Ile Phe Gln
Gly Gly Ala Gln Gly Thr Phe 195 200 205 gta gtc aag ttc gat gtc tcc
tcc aag gcc agc ctg ggt gac agg ttg 672 Val Val Lys Phe Asp Val Ser
Ser Lys Ala Ser Leu Gly Asp Arg Leu 210 215 220 ctc atg ggg gcc agt
gcc agc agt gag aat aat aag cct gcg agc aac 720 Leu Met Gly Ala Ser
Ala Ser Ser Glu Asn Asn Lys Pro Ala Ser Asn 225 230 235 240 aag acc
tcc ttt gag ctg gaa ctg cca gtg aaa tac gct gtc tac atg 768 Lys Thr
Ser Phe Glu Leu Glu Leu Pro Val Lys Tyr Ala Val Tyr Met 245 250 255
atg atc aca agg cac gaa ggc tcc acc agg ttc ttc aac ttt tcc act 816
Met Ile Thr Arg His Glu Gly Ser Thr Arg Phe Phe Asn Phe Ser Thr 260
265 270 tcc gct gag aag agc agc aaa gag gcc gag cac cgc tat cgg gtg
aac 864 Ser Ala Glu Lys Ser Ser Lys Glu Ala Glu His Arg Tyr Arg Val
Asn 275 280 285 aac ctg agt ctg cga gat gtg gcc gtc agc gtg gac ttc
tgg gcc ccc 912 Asn Leu Ser Leu Arg Asp Val Ala Val Ser Val Asp Phe
Trp Ala Pro 290 295 300 gtg cag ctg aac gga gca gct gtg tgg gac gtg
gcg gtg gag gcc cct 960 Val Gln Leu Asn Gly Ala Ala Val Trp Asp Val
Ala Val Glu Ala Pro 305 310 315 320 gcc cag agc ctg ccc tgt gcg cgg
gag agg gaa cct ccg agg acc tct 1008 Ala Gln Ser Leu Pro Cys Ala
Arg Glu Arg Glu Pro Pro Arg Thr Ser 325 330 335 gac ctg agc cgg gtc
ccg ggg agt ccc gtg ctg gac tgc agc gtt gcg 1056 Asp Leu Ser Arg
Val Pro Gly Ser Pro Val Leu Asp Cys Ser Val Ala 340 345 350 cac tgc
ctg agg ttc cgc tgc cac atc ccc tcc ttc agc gcc aag gag 1104 His
Cys Leu Arg Phe Arg Cys His Ile Pro Ser Phe Ser Ala Lys Glu 355 360
365 gag ctc cac ttc acc ctg aag ggc aac ctc agc ttc gcc tgg gtc agc
1152 Glu Leu His Phe Thr Leu Lys Gly Asn Leu Ser Phe Ala Trp Val
Ser 370 375 380 cag atg ctg caa aag aag gtg tcg gtg gtg agt gtg gcc
gag atc acc 1200 Gln Met Leu Gln Lys Lys Val Ser Val Val Ser Val
Ala Glu Ile Thr 385 390 395 400 ttc aac agg gcc gtg tac tcc caa gtt
ccg ggc gag gag ccc ttt atg 1248 Phe Asn Arg Ala Val Tyr Ser Gln
Val Pro Gly Glu Glu Pro Phe Met 405 410 415 aga gcc cag gtg gag acg
gtg ctg gag gag tat gag gag cac gac ccc 1296 Arg Ala Gln Val Glu
Thr Val Leu Glu Glu Tyr Glu Glu His Asp Pro 420 425 430 gtc ccc ctg
gtg gtg ggc agc tgt gtg ggc ggc ctg ctg ctg ctg gct 1344 Val Pro
Leu Val Val Gly Ser Cys Val Gly Gly Leu Leu Leu Leu Ala 435 440 445
ctc atc tca gcc acc ctg tac aag ctt ggc ttc ttc aag cgc cgg tac
1392 Leu Ile Ser Ala Thr Leu Tyr Lys Leu Gly Phe Phe Lys Arg Arg
Tyr 450 455 460 aag gag atg ctg ggc gag aaa ccg gga gac gcg gcc acc
ttc ccc ggg 1440 Lys Glu Met Leu Gly Glu Lys Pro Gly Asp Ala Ala
Thr Phe Pro Gly 465 470 475 480 gag gac gcc agc tgc ggg gct tca gat
ttg cct ttg tcc cag tg 1484 Glu Asp Ala Ser Cys Gly Ala Ser Asp Leu
Pro Leu Ser Gln 485 490 103 494 PRT rabbit 103 Asp Val Gln Ser Ser
Ile Ser Tyr Asp Leu Ala Leu Asp Pro Gly Arg 1 5 10 15 Leu Val Ser
Arg Ala Ile Phe Gln Glu Thr Gln Asn Gln Thr Leu Thr 20 25 30 Arg
Arg Lys Thr Leu Gly Leu Gly Arg His Cys Glu Thr Met Arg Leu 35 40
45 Leu Leu Pro Asp Cys Val Glu Asp Val Val Asn Pro Ile Val Leu His
50 55 60 Leu Asn Phe Ser Leu Glu Gly Gln Pro Ile Leu Ser Ser Gln
Asn Leu 65 70 75 80 Arg Pro Val Leu Ala Thr Gly Ser Gln Asp His Phe
Ile Ala Ser Leu 85 90 95 Pro Phe Glu Lys Asn Cys Gly Gln Asp Arg
Leu Cys Glu Gly Asp Leu 100 105 110 Ser Ile Ser Phe Asn Phe Ser Gly
Leu Asn Thr Leu Leu Val Gly Leu 115 120 125 Ser Leu Glu Leu Thr Val
Thr Val Thr Val Arg Asn Glu Gly Glu Asp 130 135 140 Ser Tyr Gly Thr
Ala Ile Thr Leu Tyr Tyr Pro Ala Gly Leu Ser Tyr 145 150 155 160 Arg
Arg Val Ser Gly Gln Thr Gln Pro Trp Gln Arg Pro Leu His Leu 165 170
175 Ala Cys Glu Ala Val Pro Thr Glu Ser Glu Gly Leu Arg Ser Thr Ser
180 185 190 Cys Ser Val Asn His Pro Ile Phe Gln Gly Gly Ala Gln Gly
Thr Phe 195 200 205 Val Val Lys Phe Asp Val Ser Ser Lys Ala Ser Leu
Gly Asp Arg Leu 210 215 220 Leu Met Gly Ala Ser Ala Ser Ser Glu Asn
Asn Lys Pro Ala Ser Asn 225 230 235 240 Lys Thr Ser Phe Glu Leu Glu
Leu Pro Val Lys Tyr Ala Val Tyr Met 245 250 255 Met Ile Thr Arg His
Glu Gly Ser Thr Arg Phe Phe Asn Phe Ser Thr 260 265 270 Ser Ala Glu
Lys Ser Ser Lys Glu Ala Glu His Arg Tyr Arg Val Asn 275 280 285 Asn
Leu Ser Leu Arg Asp Val Ala Val Ser Val Asp Phe Trp Ala Pro 290 295
300 Val Gln Leu Asn Gly Ala Ala Val Trp Asp Val Ala Val Glu Ala Pro
305 310 315 320 Ala Gln Ser Leu Pro Cys Ala Arg Glu Arg Glu Pro Pro
Arg Thr Ser 325 330 335 Asp Leu Ser Arg Val Pro Gly Ser Pro Val Leu
Asp Cys Ser Val Ala 340 345 350 His Cys Leu Arg Phe Arg Cys His Ile
Pro Ser Phe Ser Ala Lys Glu 355 360 365 Glu Leu His Phe Thr Leu Lys
Gly Asn Leu Ser Phe Ala Trp Val Ser 370 375 380 Gln Met Leu Gln Lys
Lys Val Ser Val Val Ser Val Ala Glu Ile Thr 385 390 395 400 Phe Asn
Arg Ala Val Tyr Ser Gln Val Pro Gly Glu Glu Pro Phe Met 405 410 415
Arg Ala Gln Val Glu Thr Val Leu Glu Glu Tyr Glu Glu His Asp Pro 420
425 430 Val Pro Leu Val Val Gly Ser Cys Val Gly Gly Leu Leu Leu Leu
Ala 435 440 445 Leu Ile Ser Ala Thr Leu Tyr Lys Leu Gly Phe Phe Lys
Arg Arg Tyr 450 455 460 Lys Glu Met Leu Gly Glu Lys Pro Gly Asp Ala
Ala Thr Phe Pro Gly 465 470 475 480 Glu Asp Ala Ser Cys Gly Ala Ser
Asp Leu Pro Leu Ser Gln 485 490 104 26 DNA Artificial Sequence
Description of Artificial Sequence primer 104 tgtccaggac aagagatgga
cattgc 26 105 24 DNA Artificial Sequence Description of Artificial
Sequence primer 105 gagctatttc atagcaagaa tggg 24 106 20 DNA
Artificial Sequence Description of Artificial Sequence primer 106
tatagcatag cgaatgatcc 20 107 21 DNA Artificial Sequence Description
of Artificial Sequence primer 107 atggtccgtg gagttgtgat c 21 108 21
DNA Artificial Sequence Description of Artificial Sequence primer
108 tcgagatcca ccaaactgca c 21 109 14 PRT monkey 109 Asn Leu Asp
Val Glu Glu Pro Thr Ile Phe Gln Glu Asp Ala 1 5 10 110 14 PRT
monkey 110 Asn Leu Asp Val Glu Glu Pro Thr Ile Phe Xaa Glu Asp Ala
1 5 10 111 15 PRT monkey 111 Phe Asn Leu Asp Val Glu Glu Pro Thr
Ile Phe Gln Glu Asp Ala 1 5 10 15 112 17 PRT Homo sapiens 112 Phe
Asn Leu Asp Val Glu Glu Pro Thr Ile Phe Gln Glu Asp Ala Gly 1 5 10
15 Gly 113 16 PRT Homo sapiens 113 Phe Asn Leu Asp Thr Glu Glu Leu
Thr Ala Phe Val Asp Ser Ala Gly 1 5 10 15 114 17 PRT Homo sapiens
114 Phe Asn Leu Asp Thr Glu Asn Ala Met Thr Phe Gln Glu Asn Ala Arg
1 5 10 15 Gly
* * * * *