U.S. patent application number 10/159495 was filed with the patent office on 2003-04-17 for methods, kits and compositions for the identification of nucleic acids electrostatically bound to matrices.
Invention is credited to Coull, James M., Johansen, Jack T..
Application Number | 20030073106 10/159495 |
Document ID | / |
Family ID | 26808905 |
Filed Date | 2003-04-17 |
United States Patent
Application |
20030073106 |
Kind Code |
A1 |
Johansen, Jack T. ; et
al. |
April 17, 2003 |
Methods, kits and compositions for the identification of nucleic
acids electrostatically bound to matrices
Abstract
This invention pertains to methods, kits and compositions
suitable for the detection, identification and/or quantitation of
nucleic acids which are electrostatically immobilized to matrices
using non-nucleotide probes which sequence specifically hybridize
to one or more target sequences of the nucleic acid but do not
otherwise substantially interact with the matrix. Once the nucleic
acid is immobilized, the detectable non-nucleotide probe/target
sequence complex, formed before or after the immobilization of the
nucleic acid, can be detected, identified or quantitated under a
wide range of assay conditions as a means to detect, identify or
quantitate the target sequence in the sample. Because it is
reversibly bound, the non-nucleotide probe/target sequence can
optionally be removed from the matrix for detecting, identifying or
quantitating the target sequence in the sample. Because the
non-nucleotide probe/target sequence is protected against
degradation, it is another advantage of this invention that the
sample can be treated with enzymes which degrade sample components,
either before or after the nucleic acid is bound to the matrix, in
order to "clean up" the sample (e.g. a complex biological sample
such as a cell lysate) and thereby improve the detection,
identification or quantitation of the target sequence in the
sample. The methods, kits and compositions of this invention are
therefore particularly well suited for the analysis, and
particularly single point mutation analysis, in a particle assay,
in an array assay, in a nuclease digestion/protection assay and/or
in a line assay format. When utilized in combination with
non-nucleotide "Beacon" probes, the invention is particularly well
suited for use in a self-indicating assay format.
Inventors: |
Johansen, Jack T.; (Concord,
MA) ; Coull, James M.; (Westford, MA) |
Correspondence
Address: |
BRIAN D. GILDEA
APPLIED BIOSYSTEMS
15 DEANGELO DRIVE
BEDFORD
MA
01730
US
|
Family ID: |
26808905 |
Appl. No.: |
10/159495 |
Filed: |
May 31, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10159495 |
May 31, 2002 |
|
|
|
09456773 |
Dec 8, 1999 |
|
|
|
6441152 |
|
|
|
|
60111439 |
Dec 8, 1998 |
|
|
|
Current U.S.
Class: |
435/6.16 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6816 20130101; C12Q 2563/131 20130101; C12Q 2525/107
20130101; C12Q 2565/627 20130101; C12Q 2545/114 20130101; C12Q
2565/1015 20130101; C12Q 1/6816 20130101; C12Q 2527/107 20130101;
C12Q 1/6834 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 001/68 |
Claims
We claim:
1. A kit for the analysis of a sample containing a nucleic acid
molecule comprising a target sequence, said kit comprising a matrix
and at least one non-nucleotide probe having a probing nucleobase
sequence that sequence specifically hybridizes, under suitable
hybridization conditions, to at least a portion of the target
sequence sought to be detected in said sample to thereby form a
non-nucleotide probe/target sequence complex and wherein the
backbone of the non-nucleotide probe or probes is sufficiently
neutral or positively charged, under electrostatic binding
conditions, that it exhibits little or no affinity for the
matrix.
2. The kit of claim 1, further comprising one or more reagents
suitable for modulating the electrostatic binding conditions of the
assay.
3. The kit of claim 1, further comprising enzymes that degrade
sample contaminants but not the non-nucleotide probe/target
sequence complex.
4. The kit of claim 1, wherein the components of the kit are
selected to detect organisms in food, beverages, water,
pharmaceutical products, personal care products, dairy products or
environmental samples.
5. The kit of claim 1, wherein the components of the kit are
selected to test raw materials, products or processes.
6. The kit of claim 1, wherein the components of the kit are
selected to examine clinical samples such as clinical specimens or
equipment, fixtures and products used to treat humans or
animals.
7. The kit of claim 1, wherein the components of the kit are
selected to detect a target sequence that is specific for a
genetically-based disease or is specific for a predisposition to a
genetically-based disease.
8. The kit of claim 1, wherein the components of the kit are
selected detect a target sequence in a forensic technique such as
prenatal screening, paternity testing, identity confirmation or
crime investigation.
9. The kit of claim 1, wherein the components of the kit are
selected to perform a homogeneous assay.
10. The kit of claim 1, wherein the matrix is provided in a form
suitable for performing a lateral flow assay.
11. The kit of claim 1, wherein the matrix is provided in a form
suitable for performing a line assay.
12. The kit of claim 1, wherein the kit comprises at least two
independently detectable non-nucleotide probes and comprises
components selected to perform a multiplex assay.
13. A kit for the analysis of a sample containing a nucleic acid
molecule comprising a target sequence, said kit comprising a matrix
and at least one non-nucleotide "Beacon" probe having a probing
nucleobase sequence that sequence specifically hybridizes, under
suitable hybridization conditions, to at least a portion of the
target sequence sought to be detected in said sample to thereby
form a non-nucleotide "Beacon" probe/target sequence complex and
wherein the backbone of the non-nucleotide probe or probes is
sufficiently neutral or positively charged, under electrostatic
binding conditions, that it exhibits little or no affinity for the
matrix.
14. The kit of claim 13, further comprising one or more reagents
suitable for modulating the electrostatic binding conditions of the
assay.
15. The kit of claim 13, further comprising enzymes that degrade
sample contaminants but not a non-nucleotide probe/target sequence
complex.
16. The kit of claim 13, wherein the components of the kit are
selected to detect organisms in food, beverages, water,
pharmaceutical products, personal care products, dairy products or
environmental samples.
17. The kit of claim 13, wherein the components of the kit are
selected to test raw materials, products or processes.
18. The kit of claim 13, wherein the components of the kit are
selected to examine clinical samples such as clinical specimens or
equipment, fixtures and products used to treat humans or
animals.
19. The kit of claim 13, wherein the components of the kit are
selected to detect a target sequence that is specific for a
genetically-based disease or is specific for a predisposition to a
genetically-based disease.
20. The kit of claim 13, wherein the components of the kit are
selected to detect a target sequence in a forensic technique such
as prenatal screening, paternity testing, identity confirmation or
crime investigation.
21. The kit of claim 13, wherein the components of the kit are
selected to perform a homogeneous assay.
22. The kit of claim 13, wherein the kit comprises at least two
independently detectable non-nucleotide "Beacon" probes and
comprises components selected to perform a multiplex assay.
23. The kit of claim 22, wherein the components are selected to
perform a multiplex self-indicating assay.
24. The kit of claim 13, wherein the matrix is provided in a form
suitable for performing a lateral flow assay.
25. The kit of claim 13, wherein the matrix is provided in a form
suitable for performing a line assay.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/456,73 filed on Dec. 8, 1999. This
application claims the benefit of U.S. Provisional Patent
Application Serial No. 60/111,439 filed on Dec. 8, 1998.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention is related to the field of probe-based
detection, analysis and quantitation of nucleic acids which are
electrostatically immobilized to matrices. The methods, kits and
compositions of this invention are particularly well suited for the
analysis, and particularly single point mutation analysis, in a
particle assay, in an array assay, in a nuclease
digestion/protection assay, in a line assay and/or in a
self-indicating assay format.
[0004] 2. Description of the Related Art
[0005] Nucleic acid hybridization is a fundamental process in
molecular biology. Probe-based assays are useful in the detection,
quantitation and analysis of nucleic acids. Nucleic acid probes
have long been used to analyze samples for the presence of nucleic
acid from bacteria, eucarya, fungi, virus or other organisms and
are also useful in examining genetically-based disease states or
clinical conditions of interest in single cells as well as in
tissues.
[0006] Sample prep methods which describe the repetitive capture
and release of target sequences to and from supports (e.g. magnetic
beads) as a means to remove non-target polynucleotides, debris and
impurities which tend to introduce background in a hybridization
assay are known in the art (See: Collins et al., U.S. Pat. No.
5,750,338). Generally, the sample prep methods of Collins et al.
can be used in most embodiments of traditional hybridization assays
provided however that the target nucleic acid is first immobilized
to a support and thereafter released from the support such that,
when released, it is substantially free of sample impurities,
debris, and extraneous polynucleotides. The Collins et al.
invention, however, requires that the probe or probes must be
associated with or capable of associating with the support under
binding conditions to thereby immobilize the nucleic acid of
interest to the support (See: Collins et al. at col. 4, line 55 to
col. 5, line 13).
[0007] A probe based sample prep method for removing contaminates
prior to PCR reaction has been described by Goldin et al. (See:
U.S. Pat. No. 5,200,314). This process requires an analyte-capture
probe having both an analyte binding region and a first specific
binding partner. Like the Collins et al. invention, the Goldin et
al. invention requires that the analyte-capture probe interact with
the support as the specific means through which the target sequence
becomes immobilized.
[0008] Polycationic solid supports have been used for the analysis
and purification of nucleic acids, including the purification of
polynucleotides from solutions containing contaminates (See: Arnold
et al.; U.S. Pat. No. 5,599,667). Arnold et al. describe assays
which use solid supports as a means to separate polynucleotides,
and hybrids thereof formed with a nucleotide probe, from
unhybridized probe (See: Abstract to U.S. Pat. No. 5,599,667). The
invention is premised upon ". . . the discovery that polycationic
solid supports can be used to selectively adsorb nucleotide
multimers according to their size (emphasis added), larger
multimers being more tightly bound to the support than smaller
ones." (See: Col. 4, lines 39-44). The methods can also be used to
separate the nucleotide multimers from non-nucleotidic material
(See: Col. 5, lines 25-28).
[0009] A substantial limitation of the Arnold et al. invention is
the interplay which exists between the composition of the cationic
solid support and the formulation of contacting solutions as well
as the interplay between two or more of the contacting solutions
(See: Col. 7, line 24 to Col. 8, line 32) which are required to
discriminate between nucleotide multimers (See: Col. 8, lines
39-41). An example of a laborious protocol for arriving at a proper
cation density for a solid support can be found at col. 9, lines
36-52 and the method for determining the buffer concentration
suitable for separating polynucleotides and nucleotide probes can
be found at col. 9, lines 53-63. Similarly, the separation solution
must be carefully designed (See: Col. 10. lines 9-12), presumably
using the laborious method of trial and error as described for
determining the cation density of the solid support. This
requirement for substantial optimization of assay conditions within
a very narrow operating range results because electrostatic
immobilization of nucleic acid is a relatively non-specific process
and therefore it is difficult to electrostatically immobilize a
negatively charged target nucleic acid to a cationic surface
without the positively charged matrix also exhibiting a strong
affinity for the negatively charged nucleic acid probe. Since the
separation of nucleotide multimers (nucleotide probe/target hybrids
from excess nucleotide probe) occurs within a narrow range of
conditions, which may not necessarily be optimal for the
discrimination of hybridization, the hybrids still immobilized
according to the Arnold et al. invention may not be truly
indicative of the presence of a target sequence. Consequently, the
applicability of the assays of Arnold et al. are of limited
practical utility.
[0010] An invention related to achieving nucleic acid has recently
been described (See: Gerdes et al.; WO98/46797). Gerdes et al. use
highly electropositive solid phase materials to capture nucleic
acids (See. p. 5, line 24 to p. 6, line 14) for repetitive
analyses. However, a substantial limitation of the Gerdes et al.
invention is that the nucleic acid must be irreversibly bound to
the highly electropositive solid phase material.
[0011] Methods for the high throughput screening for sequences or
genetic alterations in nucleic acid have been described (See:
Shuber, A. P.; U.S. Pat. No. 5,834,181). Shuber describes the
analysis of arrays of immobilized nucleic acids, and suggests
immobilization of the nucleic acid to nitocellulose or a charged
nylon membrane (See: col. 6, lines 41-64). Suggested purine and
pyrimidine containing polymers which may be used for analyzing
immobilized nucleic acid include peptide nucleic acid (See: col. 5,
lines 15-20), but the polymers must necessarily be tagged or
labeled since the detection methods rely on a tag or label being
incorporated into the polymer (See: col. 8, line 58 to col. 9, line
3). The assays of Shuber require a perfect complement between probe
and target sequence (See: col. 8, lines 52-57). In order to achieve
proper discrimination, a laborious empirical process of trial and
error is described for assay optimization (See: col. 7, line 16 to
col. 8). Conditions which require optimization of specific and
non-specific hybridization include the concentration of polymer,
the temperature of hybridization, the salt concentration, and the
presence or absence of unrelated nucleic acid (See: col. 8, lines
15-18).
[0012] Shuber does not expressly suggest performing a probe-based
hybridization assay on an electrostatically immobilized nucleic
acid and specifically does not describe or teach the analysis of
electrostatically immobilized nucleic acid using a non-nucleotide
probe such as a peptide nucleic acid. Furthermore, Shuber does not
suggest, disclose or teach any advantages, such the ability to work
within a broad range of assay conditions, of performing a peptide
nucleic acid-based analysis of nucleic acid electrostatically
immobilized to a matrix.
[0013] Pluskal et al. describe a comparison of DNA and peptide
nucleic acid (PNA) probe-based analysis of nucleic acid which has
been irreversibly crosslinked to charged nylon membrane (See:
Pluskal et al., American Society for Biochemistry, 85th Annual
Meeting, Washington, DC, May 1994). Pluskal et al. teach that while
PNA probes can be used to detect the irreversibly immobilized
nucleic acid under standard hybridization conditions, PNA works
very well under highly stringent hybridization and washing
conditions (See: The Section Entitled "Discussion"). Pluskal et al.
also teach the use of 1% BSA as a blocking agent to reduce
non-specific binding of the probe to the membrane (See: Section
Entitled "Discussion"). Because the nucleic acid of Pluskal et al.
has been irreversibly crosslinked to the nylon membrane, highly
stringent hybridization and washing conditions can be applied to
the membrane without reducing the amount of target nucleic acid
present on the support and available for analysis. Pluskal et al.
therefore demonstrate a rational for irreversibly linking the
nucleic acid to be analyzed to the support and using a blocking
agent when performing a PNA probe-based analysis using a charged
nylon membrane.
[0014] Methods for the protection of nucleic acid sequences from
nuclease degradation/digestion by hybridizing a nucleic acid analog
thereto have been described (See: Stanley et al.; U.S. Pat. No.
5,861,250). The methods and compositions described in Stanley et
al. are particularly well suited for ""cleaning up" a nucleic acid
sample by degrading all nucleic acid present except the target
sequence, . . . " (See: Stanley et al. at col. 7, lines 14-18).
Stanley et al. describe several means for separating hybridized
nucleic acid analog from non-hybridized nucleic acid analog,
including ion exchange chromatography (See: Col. 6, lines 62-64),
but they do not describe the simple electrostatic immobilization of
the target sequence or nucleic acid analog/target sequence complex
to a matrix as means to separate the hybridized nucleic acid analog
from non-hybridized nucleic acid analog or otherwise separate the
nucleic acid analog/target sequence complex from the other
components of a sample.
[0015] Methods and apparatus for the electroactive transport and
fixation of nucleic acids for analysis have been described (See:
Heller et al., U.S. Pat. No. 5,849,486). However, this invention
requires highly sophisticated instrumentation and devices to
transport, fix and/or analyze a sample.
[0016] Though van den Engh does not discuss the detection of
complex macromolecules such as nucleic acids, fluorescent reporter
beads and methods for detecting the presence or determining the
concentration of fluid bulk analytes such as pH, oxygen saturation
and ion content are known in the art (See: van den Engh et al.,
U.S. Pat. No. 5,747,349). According to van den Engh, "Reporter
beads are added to a fluid sample and the analyte concentration is
determined by measuring fluorescence of individual beads, for
example in a flow cytometer" (See: Abstract of U.S. Pat. No.
5,747,349). The beads of van den Engh et al. comprise a substrate
bead having a plurality of fluorescent reporter molecules
immobilized thereon wherein the fluorescent reporter molecules
comprise a fluorescent molecule whose fluorescent properties are a
function of the concentration of the particular analyte whose
presence or concentration is to be determined (See: U.S. Pat. No.
5,747,349 at col. 3, lns. 29-46). Thus, the beads of van den Engh
are inherently fluorescent and not the analytes or derivatives
thereof.
[0017] Recently, compositions containing at least one bead
conjugated to a solid support and further conjugated to at least
one macromolecule have been described in the art (See: Lough et
al., PCT/US97/20194). Claimed advantages of Lough et al. include
increased surface area for the immobilization of biological
particles or macromolecules as compared to flat surfaces as well as
the ability to use one chemistry for the immobilization of the
macromolecule to the bead and a different chemistry to attach the
bead to the support. Lough et al. define macromolecules to include
nucleic acids (See: p. 7, lns. 10-17) and further define peptide
nucleic acids (PNA) as being analogs of nucleic acids (See: p. 8,
lns. 4-9). The invention of Lough et al. is primarily directed to
analysis of immobilized macromolecules. Curiously however, a
probe-based assay is not described as a detection method but rather
Lough et al. focus on direct analysis of the immobilized
macromolecule be means such as MALDI-TOF mass spectrometry. Apart
from apparently being considered by Lough et al. to be an analog of
a nucleic acid, PNA is not otherwise mentioned in the disclosure
and no examples are provided which demonstrate that PNA is suitable
for the practice of the invention.
[0018] Despite its name, Peptide Nucleic Acid (PNA) is neither a
peptide, a nucleic acid nor is it an acid. Peptide Nucleic Acid
(PNA) is a non-naturally occurring polyamide which can hybridize to
nucleic acid (DNA and RNA) with sequence specificity (See: U.S.
Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331, 5,736,336,
5,773,571 or 5,786,461 as well as Eghohm et al., Nature 365:
566-568 (1993)). Being a non-naturally occurring molecule,
unmodified PNA is not known to be a substrate for the enzymes which
are known to degrade peptides or nucleic acids. Therefore, PNA
should be stable in biological samples, as well as have a long
shelf-life. Unlike nucleic acid hybridization which is very
dependent on ionic strength, the hybridization of a PNA with a
nucleic acid is fairly independent of ionic strength and is favored
at low ionic strength, conditions which strongly disfavor the
hybridization of nucleic acid to nucleic acid (Egholm et al.,
Nature, at p. 567). The effect of ionic strength on the stability
and conformation of PNA complexes has been extensively investigated
(Tomac et al., J. Am. Chem. Soc. 118:55 44-5552 (1996)). Sequence
discrimination is more efficient for PNA recognizing DNA than for
DNA recognizing DNA (Egholm et al., Nature, at p. 566). However,
the advantages in point mutation discrimination with PNA probes, as
compared with DNA probes, in a hybridization assay, appears to be
somewhat sequence dependent (Nielsen et al., Anti-Cancer Drug
Design 8:53-65, (1993) and Weiler et al., Nucl. Acids Res. 25:
2792-2799 (1997)).
[0019] Because the nucleic acids of a complex sample, such as a
cell lysate or PCR reaction mixture, can be concentrated and also
partially purified by immobilization to supports, probe-based
hybridization assays could be simplified if the presence of a
target nucleic acid could be specifically detected while the target
nucleic acid remained support bound; particularly if the conditions
for the treatment, analysis and/or detection of the target sequence
were operable within a broad range so that assay conditions did not
require substantial and laborious optimization. The ability to
perform such analyses using a flow cytometer, an array, a nuclease
digestion/protection assay, a line assay, a self-indicating assay
or in some combination of these assay formats would be particularly
beneficial.
SUMMARY OF THE INVENTION
[0020] This invention pertains to methods, kits and compositions
suitable for the detection, identification and/or quantitation of
nucleic acids which are electrostatically immobilized to matrices
using non-nucleotide probes which sequence specifically hybridize
to one or more target sequences of the nucleic acid but do not
otherwise substantially interact with the matrix. Once the nucleic
acid is immobilized, the detectable non-nucleotide probe/target
sequence complex, formed before or after the immobilization of the
nucleic acid, can be detected, identified or quantitated under a
wide range of assay conditions as a means to detect, identify or
quantitate the target sequence in the sample. Because it is
reversibly bound, the non-nucleotide probe/target sequence can
optionally be removed from the matrix for detecting, identifying or
quantitating the target sequence in the sample. Because the
non-nucleotide probe/target sequence is protected against
degradation, it is another advantage of this invention that the
sample can be treated with enzymes which degrade sample components,
either before or after the nucleic acid is bound to the matrix, in
order to "clean up" the sample (e.g. a complex biological sample
such as a cell lysate) and thereby improve the detection,
identification or quantitation of the target sequence in the
sample. Consequently, the methods, kits and compositions of this
invention have substantial advantages over all previously known or
described methods, kits or compositions because they facilitate the
simple processing and/or analysis of samples, and particularly
complex biological samples, under a wide range of assay
conditions.
[0021] In one embodiment, this invention is related to a
composition comprising a nucleic acid, having at least one target
sequence, which is electrostatically bound to a matrix under
suitable electrostatic binding conditions. The composition further
comprises a detectable, but not necessarily labeled, non-nucleotide
probe having a probing nucleobase sequence which is sequence
specifically hybridized to at least a portion of the target
sequence.
[0022] In another embodiment, this invention pertains to methods
for the detection, identification or quantitation of a target
sequence in a sample containing nucleic acid. One exemplary method
comprises contacting a sample with a matrix and at least one
non-nucleotide probe wherein the nucleic acid in the sample will
electrostatically bind to the matrix under suitable electrostatic
binding conditions. Additionally, the non-nucleotide probe will
hybridize, under suitable hybridization conditions, to at least a
portion of the target sequence, if present in the sample. The
method further comprises detecting, identifying or quantitating the
non-nucleotide probe/target sequence hybrid as a means to detect,
identify or quantitate the target sequence in the sample.
[0023] In still another embodiment, this invention pertains to
multiplex methods for the detection, identification or quantitation
of two or more target sequences of one or more nucleic acid
molecules which may be present in the same sample. One exemplary
method comprises contacting a sample with a matrix and two or more
independently detectable non-nucleotide probes wherein the nucleic
acid present in the sample will electrostatically bind to the
matrix under suitable electrostatic binding conditions.
Additionally, the two or more independently detectable
non-nucleotide probes will hybridize, under suitable hybridization
conditions, to at least a portion of the target sequences with
which each probe is designed to hybridize if present in the nucleic
acid of the sample. Consequently, if a particular target sequence
is electrostatically immobilized to the matrix, the independently
detectable non-nucleotide probe designed to hybridized to that
particular target sequence will become concentrated on the matrix
and be available for detection. Therefore, the method further
comprises detecting, identifying or quantitating each unique
independently detectable non-nucleotide probe/target sequence
hybrid which is electrostatically bound to said matrix as a means
to detect, identify or quantitate each unique target sequence
sought to be detected in the sample and in the same assay.
Optionally, the unique independently detectable non-nucleotide
probe/target sequence hybrid is released from the matrix by
adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0024] In still a further embodiment, this invention takes
advantage of the stability of nucleic acid analog/nucleic acid
complexes (See: Stanley et al.; U.S. Pat. No. 5,861,250) to thereby
further improve assay performance and/or otherwise decrease the
labor or complexity of sample preparation. One exemplary method
comprises contacting the sample with at least one non-nucleotide
probe wherein the non-nucleotide probe will hybridize, under
suitable hybridization conditions, to at least a portion of the
target sequence if present in the sample. The sample is also
contacted with a matrix wherein the nucleic acid molecule will
electrostatically bind to a matrix under suitable electrostatic
binding conditions. Either before or after immobilization to the
matrix, the sample containing the non-nucleotide probe/target
sequence complex is contacted with one or more enzymes capable
degrading sample contaminates, possibly including the nucleic acid
molecule but not the non-nucleotide probe/target sequence complex.
The method further comprises detecting, identifying or quantitating
the non-nucleotide probe/target sequence hybrid as a means to
detect, identify or quantitate the target sequence in the sample.
Optionally, the detectable non-nucleotide probe/target sequence
hybrid is released from the matrix by adjustment of conditions
outside the range required for electrostatic binding and thereby
facilitates detection of the unbound non-nucleotide probe/target
sequence hybrid, or just the detectable probe, as the means to
detect, identify or quantitate the target sequence in the
sample.
[0025] In yet another embodiment, this invention relates to a
method for the detection, identification or quantitation of a
target sequence of a nucleic acid molecule electrostatically
immobilized at a location on an array wherein the array comprises
nucleic acid molecules electrostatically bound at unique locations.
One exemplary method comprises contacting the array with at least
one non-nucleotide probe, wherein the non-nucleotide probe will
hybridize, under suitable hybridization conditions, to at least a
portion of the target sequence if present on the array. The
non-nucleotide probe/target sequence complex electrostatically
bound at a location on said array is then detected, identified or
quantitated as the means to determine the presence, absence or
amount of target sequence present at said array location. It is an
advantage of the invention that one or more enzymes capable
degrading sample contaminates, including the nucleic acid target
molecule but not the non-nucleotide probe/target sequence complex,
can also be added before analysis of the array to thereby improve
the performance of the array assay by degrading sample contaminates
which might otherwise lead to false positive results. Optionally,
the detectable non-nucleotide probe/target sequence hybrids can be
released from the matrix by adjustment of conditions outside the
range required for electrostatic binding and thereby facilitates
detection of the unbound non-nucleotide probe/target sequence
hybrid, or just the detectable probe, as the means to detect,
identify or quantitate target sequence in the sample. If the
non-nucleotide probes are independently detectable, the analysis of
the matrix can proceed in a multiplex format.
[0026] In yet a further embodiment, this invention is directed to a
method for the detection, identification or quantitation of a
target sequence of a nucleic acid molecule which may be present in
any of two or more samples of interest. The method comprises mixing
each of the two or more samples of interest with at least one
non-nucleotide probe, under suitable hybridization conditions. Next
a matrix is contacted, under suitable electrostatic binding
conditions, with at least a portion of each of the two or more
samples to thereby electrostatically immobilize the nucleic acid
components of each sample to the matrix, each at a unique location,
and thereby create a matrix array of samples. The non-nucleotide
probe/target sequence complex electrostatically bound at a location
on said array is then detected, identified or quantitated as the
means to determine the presence, absence or amount of target
sequence present at said array location. It is an advantage of the
invention that one or more enzymes capable degrading sample
contaminates, possibly including the nucleic acid target molecule
but not the non-nucleotide probe/target sequence complex, can also
be added before analysis of the array to thereby improve the
performance of the array assay by degrading sample contaminates
which might otherwise lead to false positive results. Optionally,
the detectable non-nucleotide probe/target sequence hybrids can be
released from the matrix by adjustment of conditions outside the
range required for electrostatic binding and thereby facilitates
detection of the unbound non-nucleotide probe/target sequence
hybrid, or just the detectable probe, as the means to detect,
identify or quantitate target sequence in the sample. If the
non-nucleotide probes are independently detectable, the analysis of
the matrix can proceed in a multiplex format.
[0027] In yet another embodiment, this invention is directed to
kits suitable for performing an assay which detects the presence,
absence or number of target sequences present in a sample. The kits
of this invention comprise a matrix and one or more non-nucleotide
probes and optionally one or more other reagents or compositions
which are selected to perform an assay of this invention or
otherwise simplify the performance of an assay used to detect,
identify or quantitate a target sequence in a sample.
[0028] The compositions, methods and kits of this invention are
particularly useful for the detection, identification and/or
enumeration of bacteria and eucarya (e.g. pathogens) in food,
beverages, water, pharmaceutical products, personal care products,
dairy products or environmental samples. The analysis of preferred
non-limiting beverages include soda, bottled water, fruit juice,
beer, wine or liquor products. Suitable compositions, methods and
kits will be particularly useful for the analysis of raw materials,
equipment, products or processes used to manufacture or store food,
beverages, water, pharmaceutical products, personal care products
dairy products or environmental samples.
[0029] Additionally, the compositions, methods and kits of this
invention are particularly useful for the detection of bacteria and
eucarya (e.g. pathogens) in clinical samples and clinical
environments. Suitable compositions, methods and kits will be
particularly useful for the analysis of clinical specimens,
equipment, fixtures or products used to treat humans or
animals.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1A and 1B are computer generated negatives of the image
of a photograph of tubes from an experiment using PCR to amplify a
nucleic acid comprising a target sequence to which a Linear Beacon
hybridizes to generate detectable signal.
[0031] FIGS. 2A and 2B are computer generated negatives or the
image of a photograph of the same polyacrylamide gel used to
analyze the content of the tubes shown in FIGS. 1A and 1B, before
(FIG. 2A) and after (FIG. 2B) ethidium bromide staining.
[0032] FIG. 3 is a computer generated negative of an image of a
photograph of tubes from an experiment using PCR to generate
different amplicons having a point mutation of a target sequence to
which a Linear Beacon hybridizes to generate detectable signal.
[0033] FIGS. 4A and 4B are computer generated negatives of an image
of a photograph of the same polyacrylamide gel used to analyze the
content of tubes shown in FIG. 3, before (FIG. 4A) and after (FIG.
4B) ethidium bromide staining.
[0034] FIG. 5 is a computer generated negative of an image of a
photograph of tubes from an experiment used to determine the range
of ionic strength suitable for electrostatic immobilization of
probes, target nucleic acids and probe/target nucleic acid
complexes.
[0035] FIGS. 6A and 6B are images of the same GAPS coated
microscope slide containing spotted samples, before (6A) and after
(6B) washing to remove material not otherwise electrostatically
immobilized.
DETAILED DESCRIPTION OF THE INVENTION
[0036] 1. Definitions:
[0037] a. As used herein, the term "nucleobase" shall include those
naturally occurring and those non-naturally occurring heterocyclic
moieties commonly known to those who utilize nucleic acid
technology or utilize peptide nucleic acid technology to thereby
generate polymers which can sequence specifically hybridize to
nucleic acids.
[0038] b. As used herein, the term "nucleobase sequence" is any
segment of a polymer which comprises nucleobase containing
subunits. Non-limiting examples of suitable polymers or polymers
segments include oligonucleotides, oligoribonucleotides, peptide
nucleic acids and analogs or chimeras thereof.
[0039] c. As used herein, the term "target sequence" is the
nucleobase sequence of a nucleic acid molecule of interest which is
sought to be detected in an assay and to which at least a portion
of the probing nucleobase sequence of the non-nucleotide probe is
intended to hybridize. The target sequence may comprise a subset of
the nucleic acid molecule or may be the entire nucleic acid
molecule of interest.
[0040] d. As used herein, the terms "label" and "detectable moiety"
shall be interchangeable and shall refer to moieties which can be
attached to a non-nucleotide probe, antibody or antibody fragment
to thereby render the non-nucleotide probe, antibody or antibody
fragment detectable by an instrument or method.
[0041] e. As used herein, the term "non-nucleotide probe" shall
mean a polymer which is not a polynucleotide but which comprises a
probing nucleobase sequence which is designed to hybridize to at
least a portion of the target sequence. A preferred non-limiting
example of a non-nucleotide probe is a peptide nucleic acid (PNA)
probe.
[0042] f. As used herein, the term "peptide nucleic acid" or "PNA"
shall be defined as a non-nucleotide polymer comprising two or more
PNA subunits (residues), including any of the compounds referred to
or claimed as peptide nucleic acids in U.S. Pat. Nos. 5,539,082,
5,527,675, 5,623,049, 5,714,331, 5,736,336, 5,773,571 or 5,786,461
(all of which are herein incorporated by reference). The term
"peptide nucleic acid" or "PNA" shall also apply to polymers
comprising two or more subunits of those nucleic acid mimics
described in the following publications: Diderichsen et al., Tett.
Lett. 37: 475-478 (1996); Fujii et al., Bioorg. Med. Chem. Lett. 7:
637-627 (1997); Jordan et al., Bioorg. Med. Chem. Lett. 7: 687-690
(1997); Krotz et al., Tett. Lett. 36: 6941-6944 (1995); Lagriffoul
et al., Bioorg. Med. Chem. Lett. 4: 1081-1082 (1994); Lowe et al.,
J. Chem. Soc. Perkin Trans. 1, (1997) 1: 539-546; Lowe et al., J.
Chem. Soc. Perkin Trans. 11: 547-554 (1997); Lowe et al., J. Chem.
Soc. Perkin Trans. 11:5 55-560 (1997); Petersen et al., Bioorg.
Med. Chem. Lett. 6: 793-796 (1996); Diederichsen, U., Bioorganic
& Med. Chem. Lett., 8: 165-168 (1998); Cantin et al., Tett.
Lett., 38: 4211-4214 (1997); Ciapetti et al., Tetrahedron, 53:
1167-1176 (1997); Lagriffoule et al., Chem. Eur. J., 3: 912-919
(1997) and WIPO patent application WO96/04000 by Shah et al. and
entitled "Peptide-based nucleic acid mimics (PENAMs)".
[0043] In preferred embodiments, a PNA is a polymer comprising two
or more subunits of the formula: 1
[0044] wherein, each J is the same or different and is selected
from the group consisting of H, R.sup.1, OR.sup.1, SR.sup.1,
NHR.sup.1, NR.sup.1.sub.2, F, Cl, Br and I. Each K is the same or
different and is selected from the group consisting of O, S, NH and
NR.sup.1. Each R.sup.1 is the same or different and is an alkyl
group having one to five carbon atoms which may optionally contain
a heteroatom or a substituted or unsubstituted aryl group. Each A
is selected from the group consisting of a single bond, a group of
the formula; --(CJ.sub.2).sub.s-- and a group of the formula;
--(CJ.sub.2).sub.sC(O)--, wherein, J is defined above and each s is
an whole number from one to five. The whole number t is 1 or 2 and
the whole number u is 1 or 2. Each L is the same or different and
is independently selected from the group consisting of J. adenine,
cytosine, guanine, thymine, uridine, 5-methylcytosine,
2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine,
hypoxanthine, pseudoisocytosine, 2-thiouracil, 2-thiothymidine,
other naturally occurring nucleobase analogs, other non-naturally
occurring nucleobases, substituted and unsubstituted aromatic
moieties, biotin, fluorescein and dabcyl. In the most preferred
embodiment, a PNA subunit consists of a naturally occurring or
non-naturally occurring nucleobase attached to the aza nitrogen of
the N-[2-(aminoethyl)]glycine backbone through a methylene carbonyl
linkage.
[0045] 2. Description
[0046] I. General:
[0047] Probes:
[0048] The probes used for the practice of this invention are
non-nucleotide probes which at a minimum comprise a probing
nucleobase sequence designed to hybridize to at least a portion of
a target sequence sought to be detected in a probe-based
hybridization assay. The non-nucleotide probes comprise a
sufficiently neutral or positively charged backbone such that they
exhibit little or no affinity for the matrix under a broad range of
assay conditions including substantial variations in pH, buffer
ionic strength, detergent concentration and/or chemical denaturant
concentration. This broad range of conditions under which little or
no interaction occurs between the non-nucleotide probe and the
matrix is a substantial advantage over the previous methods such as
those of Arnold et al. (U.S. Pat. No. 5,599,667) which required
substantial condition optimization to achieve discrimination of
between the non-specific binding of the nucleotide probe and the
target nucleic acid (or nucleotide probe/target nucleic acid
complex) to the matrix.
[0049] It is still another advantage of this invention that
substantial changes in the ionic strength of the assay have little
effect on the Tm of the non-nucleotide probe/target sequence hybrid
(See: (Egholm et al Nature 365: 566-568 (1993) and Tomac et al., J.
Am. Chem. Soc. 118:55 44-5552 (1996)). Consequently, this lack of
sensitivity of the hybrid to changes in ionic strength also
broadens the range of possible assay conditions.
[0050] The non-nucleotide probes may be labeled with a detectable
moiety or may be unlabeled provided however that the non-nucleotide
probe/target sequence hybrid is detectable when the probe is
unlabeled. The preferred non-nucleotide probes are PNA probes.
Preferred labeled non-nucleotide probes are non-nucleotide "Beacon"
probes (See: the Section entitled "Non-Nucleotide "Beacon" Probes,
below) because they are self-indicating. By self-indicating we mean
that the probes change detectable properties upon hybridization to
a target sequence and thereby reduce or eliminate the requirement
for the removal of excess probe. In one embodiment, the
self-indicating probes of this invention will rely on a change in
fluorescence which can be observed with the eye or otherwise
detected and/or quantitated with a fluorescence instrument.
[0051] Because it is an important feature of this invention that
the non-nucleotide probes do not substantially interact with the
matrix, the non-nucleotide probes of this invention may also be
designed, by appropriate modification, to have a particular net
charge. For example, certain choices of labels might cause the
non-nucleotide probe to have a net negative charge (See: Example
9). However, the net charge of the probe can be changed by adding
one or more positively charged moieties, such as by linking one or
more of compounds 7 or 8 as described by Gildea et al., Tett. Lett.
39: 7255-7258 (1998). By the alteration of net charge, the probes
can be designed to have any combination of desired labels and still
not exhibit an affinity for the matrix.
[0052] Unlabeled Non-Nucleotide Probes:
[0053] The non-nucleotide probes used for the practice of this
invention need not be labeled with a detectable moiety to be
operable within the methods of this invention. When using the
non-nucleotide probes it is possible to detect the non-nucleotide
probe/nucleic acid complex formed by hybridization of the probing
nucleobase sequence of the probe to the target sequence using an
antibody to the non-nucleotide probe/nucleic acid hybrid (complex).
As a non-limiting example, a PNA/nucleic acid complex could be
detected using an antibody which specifically interacts with the
complex under suitable antibody binding conditions. Suitable
antibodies to PNA/nucleic acid complexes and methods for their
preparation and use are described in WIPO Patent Application
WO95/17430 as well as U.S. Pat. No. 5,612,458, herein incorporated
by reference.
[0054] The antibody/PNA/nucleic acid complex formed by interaction
of the .alpha.-PNA/nucleic acid antibody with the PNA/nucleic acid
complex can be detected by several methods. For example, the
.alpha.-PNA/nucleic acid antibody could be labeled with a
detectable moiety. Suitable detectable moieties (labels) are
described herein. Thus, the presence, absence or quantity of the
detectable moiety is correlated with the presence, absence or
quantity of the antibody/PNA/nucleic acid complex and the target
sequence sought to be identified. Alternatively, the
antibody/PNA/nucleic acid complex is detected using a secondary
antibody which is labeled with a detectable moiety. Typically the
secondary antibody specifically binds to the .alpha.-PNA/nucleic
acid antibody under suitable antibody binding conditions. Thus, the
presence, absence or quantity of the detectable moiety is
correlated with the presence, absence or quantity of the
antibody/antibody/PNA/nucleic acid complex and the target sequence
sought to be identified. As used herein, the term antibody shall
include antibody fragments which specifically bind to other
antibodies or other antibody fragments.
[0055] Probing Nucleobase Sequence:
[0056] The probing nucleobase sequence of a non-nucleotide probe
used for the practice of this invention is the sequence recognition
portion of the construct. Therefore, the probing nucleobase
sequence is designed to hybridize to at least a portion of the
target sequence since it may be preferable to use two or more
probes designed to hybridize to the entire target sequence (See for
example: European Patent Application entitled "Method of
identifying a nucleic acid using triple helix formation of
adjacently annealed probes"; EP-A-849-363 as well as WIPO patent
application No. WO99/55916 entitled "Methods, Kits and Compositions
for Detecting and Quantitating Target Sequences". Preferably, the
probing nucleobase sequence hybridizes to the entire target
sequence. Detection of non-nucleotide probe hybridization to the
target sequence can be correlated with the presence, absence or
amount of target sequence present in a sample.
[0057] The probing nucleobase sequence of a non-nucleotide probe
will preferably be exactly complementary to all or a portion of the
target sequence. Alternatively, a substantially complementary
probing nucleobase sequence might be used since it has been
demonstrated that greater sequence discrimination can be obtained
when utilizing probes wherein there exists one or more point
mutations (base mismatch) between the probe and the target sequence
(See: Guo et al., Nature Biotechnology 15:331-335 (1997)).
[0058] With due consideration to the requirements of a
non-nucleotide probe for the assay format chosen and the target
sequence sought to be detected, the probing nucleobase sequence
will generally be chosen such that a stable complex is formed with
all or a portion of the target sequence, under suitable
hybridization conditions. Generally however, the non-nucleotide
probes suitable for the practice of this invention, will generally
have a probing nucleobase sequence in the range of 5-50 subunits.
More preferably, the probing nucleobase sequence will be in the
range of 7-25 subunits in length and most preferably in the range
of 12-20 subunits in length.
[0059] PNA Synthesis:
[0060] Methods for the chemical assembly of PNAs are well known
(See: U.S. Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331,
5,736,336, 5,773,571 or 5,786,571, herein incorporated by
reference). Chemicals and instrumentation for the support bound
automated chemical assembly of peptide nucleic acids are now
commercially available. Chemical assembly of a PNA is analogous to
solid phase peptide synthesis, wherein at each cycle of assembly
the oligomer possesses a reactive alkyl amino terminus which is
condensed with the next synthon to be added to the growing polymer.
Because standard peptide chemistry is utilized, natural and
non-natural amino acids are routinely incorporated into a PNA
oligomer. Because a PNA is a polyamide, it has a C-terminus
(carboxyl terminus) and an N-terminus (amino terminus). For the
purposes of the design of a hybridization probe suitable for
antiparallel binding to the target sequence (the preferred
orientation), the N-terminus of the probing nucleobase sequence of
the PNA probe is the equivalent of the 5'-hydroxyl terminus of an
equivalent DNA or RNA oligonucleotide.
[0061] PNA Labeling:
[0062] Labeling of a PNA is analogous to peptide labeling. Because
the synthetic chemistry of assembly is essentially the same, any
method commonly used to label a peptide can usually be adapted for
use in labeling a PNA. Thus, PNAs may be labeled with numerous
detectable moieties. Generally, any detectable moiety which can be
linked to a nucleic acid or peptide can be linked to a PNA.
[0063] Typically, the N-terminus of the PNA is labeled by reaction
with a moiety having a carboxylic acid group or activated
carboxylic acid group. One or more spacer moieties can be
introduced between the labeled moiety and the PNA oligomer.
Generally, the spacer moiety is incorporated prior to performing
the labeling reaction. However, the spacer may be embedded within
the label and thereby be incorporated during the labeling reaction.
Specialized reagents can be attached to the PNA. For example, a
terminal arylamine moiety can be generated by condensing a suitably
protected 4-aminobenzoic acid derivative with the amino terminus of
the PNA oligomer.
[0064] In one embodiment, the C-terminal end of the PNA is labeled
by first condensing a labeled moiety with the support upon which
the labeled PNA is to be assembled. Next, the first synthon of the
PNA is condensed with the labeled moiety. Alternatively, one or
more spacer moieties can be introduced between the labeled moiety
and the PNA oligomer (e.g. 8-amino-3,6-dioxaoctanoic acid). After
the PNA is completely assembled and labeled, the PNA is cleaved
from the support, deprotected and purified using standard
methodologies.
[0065] For example, the labeled moiety could be a lysine derivative
wherein the .epsilon.-amino group is labeled with a detectable
moiety such as 5(6)-carboxyfluorescein. Alternatively, the labeled
moiety could be a lysine derivative wherein, the .epsilon.-amino
group is derivatized with a 4-aminobenzoic acid moiety (e.g.
4-(N-(tert-butyloxycarbonyl)-amin- obenzamide). Condensation of the
lysine derivative with the support would be accomplished using
standard condensation (peptide) chemistry. The .alpha.-amino group
of the lysine derivative could then be deprotected and the PNA
assembly initiated by condensation of the first PNA synthon with
the .alpha.-amino group of the lysine amino acid. After complete
assembly, the PNA oligomer would then be cleaved from the support,
deprotected and purified using well known methodologies.
[0066] Alternatively, a functional group on the assembled, or
partially assembled, polymer is labeled with a donor or acceptor
moiety (e.g. a PNA Molecular Beacon or a Linear Beacon) while it is
still support bound. This method requires that an appropriate
protecting group be incorporated into the oligomer to thereby yield
a reactive functional to which the donor or acceptor moiety is
linked but has the advantage that the label (e.g. a fluorophore)
can be attached to any position within the polymer including within
the probing nucleobase sequence. For example, the .epsilon.-amino
group of a lysine could be protected with a
4-methyl-triphenylmethyl (Mtt), a 4-methoxy-triphenylmethyl (MMT)
or a 4,4'-dimethoxytriphenylmethyl (DMT) protecting group. The Mtt,
MMT or DMT groups can be removed from PNA (assembled using
commercially available Fmoc PNA monomers and polystyrene support
having a PAL linker; PerSeptive Biosystems, Inc., Framingham,
Mass.) by treatment of the resin under mildly acidic conditions.
Consequently, the donor or acceptor moiety can then be condensed
with the .epsilon.-amino group of the lysine amino acid. After
complete assembly and labeling, the polymer is then cleaved from
the support, deprotected and purified using well known
methodologies.
[0067] Alternatively, a label (including one of the donor or
acceptor moiety wherein the other of the donor or acceptor moiety
is linked to the PNA during assembly) is attached to the PNA after
it is fully assembled, cleaved from the support and optionally
purified. This method is preferable where the label is incompatible
with the cleavage, deprotection or purification regimes commonly
used to manufacture PNA. By this method, the PNA will generally be
labeled in solution by the reaction of a functional group on the
PNA and a functional group on the label. Those of ordinary skill in
the art will recognize that the composition of the coupling
solution will depend on the nature of PNA and the label. The
solution may comprise organic solvent, water or any combination
thereof. Generally, the organic solvent will be a polar
non-nucleophilic solvent. Non-limiting examples of suitable organic
solvents include acetonitrile, tetrahydrofuran, dioxane and
N,N'-dimethylformamide.
[0068] Generally the functional group on the PNA will be an amine
and the functional group on the label will be a carboxylic acid or
activated carboxylic acid. Non-limiting examples of activated
carboxylic acid functional groups include N-hydroxysuccinimidyl
esters. If the label is an enzyme, preferably the amine on the PNA
will be an arylamine. In aqueous solutions, the carboxylic acid
group of either of the PNA or label (depending on the nature of the
components chosen) can be activated with a water soluble
carbodiimide. The reagent, 1-(3-dimethylaminopropyl)-
-3-ethylcarbodiimide hydrochloride (EDC), is a commercially
available reagent sold specifically for aqueous amide forming
condensation reactions.
[0069] Generally, the pH of aqueous solutions will be modulated
with a buffer during the condensation reaction. Preferably, the pH
during the condensation is in the range of 4-10. When an arylamine
is condensed with the carboxylic acid, preferably the pH is in the
range of 4-7. When an alkylamine is condensed with a carboxylic
acid, preferably the pH is in the range of 7-10. Generally, the
basicity of non-aqueous reactions will be modulated by the addition
of non-nucleophilic organic bases. Non-limiting examples of
suitable bases include N-methylmorpholine, triethylamine and
N,N-diisopropylethylamine. Alternatively, the pH is modulated using
biological buffers such as (N-[2-hydroxyethyl]piperazine--
N'-[2-ethanesulfonic acid) (HEPES) or 4-morpholineethane-sulfonic
acid (MES) or inorganic buffers such as sodium bicarbonate.
[0070] Exemplary Labels:
[0071] Numerous detectable moieties may be used for the practice of
this invention. Suitable detectable or independently detectable
moieties will be chosen to be compatible with the assay to be
performed. Generally, the labels will be chosen so that the label
pair is neutral or positively charged so that when labeled, the
non-nucleotide probe does not exhibit a substantial affinity for
the matrix. Alternatively, the probe can be designed to incorporate
charges (generally positive charges) so that even if the net charge
of the labels is negative, the labeled probe is neutral or
positively charged and therefore exhibits little or no affinity for
the matrix.
[0072] Non-limiting examples of detectable moieties (labels)
suitable for use in the practice of this invention would include
dextran conjugates, a branched nucleic acid detection system,
chromophores, fluorochromes, spin labels, radioisotopes, mass
labels, enzymes, haptens and chemiluminescent compounds. Preferred
labeling reagents will be supplied as carboxylic acids or as the
N-hydroxysuccinidyl esters of carboxylic acids. Numerous amine
reactive labeling reagents are commercially available (as for
example from Molecular Probes, Eugene, Oreg.). Preferred
fluorochromes (fluorophores) include 5(6)-carboxyfluorescein (Flu),
6-((7-amino-4-methylcoumarin-3-acetyl)amino)hexanoic acid (Cou),
5(and 6)-carboxy-X-rhodamine (Rox), Cyanine 3 (Cy3) Dye, Cyanine
3.5 (Cy3.5) Dye, Cyanine 5 (Cy5) Dye, Cyanine 5.5 (Cy5.5) Dye
Cyanine 7 (Cy7) Dye, Cyanine 9 (Cy9) Dye (Cyanine dyes 3, 3.5, 5
and 5.5 are available as NHS esters from Amersham, Arlington
Heights, Ill.) or the Alexa dye series (Molecular Probes).
Preferred haptens include 5(6)-carboxyfluorescein,
2,4-dinitrophenyl, digoxigenin, and biotin. Preferred enzymes
include soybean peroxidase, alkaline phosphatase and horseradish
peroxidase. Other suitable labeling reagents and preferred methods
of attachment would be recognized by those of ordinary skill in the
art of PNA synthesis.
[0073] Non-Nucleotide "Beacon" Probes:
[0074] The labels attached to the non-nucleotide "Beacon" probes
comprise a set (hereinafter "Beacon Set(s)") of energy transfer
moieties comprising at least one energy transfer donor and at least
one energy transfer acceptor moiety. Typically, the Beacon Set will
include a single donor moiety and a single acceptor moiety.
Nevertheless, a Beacon Set may contain more than one donor moiety
and/or more than one acceptor moiety. The donor and acceptor
moieties operate such that one or more acceptor moieties accepts
energy transferred from the one or more donor moieties or otherwise
quench signal from the donor moiety or moieties. Though the
previously listed fluorophores (with suitable spectral properties)
might also operate as energy transfer acceptors, preferably, the
acceptor moiety is a quencher moiety. Preferably, the quencher
moiety is a non-fluorescent aromatic or heteroaromatic moiety. The
preferred quencher moiety is 4-((-4-(dimethylamino)phenyl)azo)
benzoic acid (dabcyl).
[0075] Transfer of energy between donor and acceptor moieties of a
non-nucleotide "Beacon" probe may occur through collision of the
closely associated moieties of a Beacon Set or through a
nonradiative process such as fluorescence resonance energy transfer
(FRET). For FRET to occur, transfer of energy between donor and
acceptor moieties of a Beacon Set requires that the moieties be
close in space and that the emission spectrum of a donor(s) have
substantial overlap with the absorption spectrum of the acceptor(s)
(See: Yaron et al. Analytical Biochemistry, 95: 228-235 (1979) and
particularly page 232, col. 1 through page 234, col. 1).
Alternatively, collision mediated (radiationless) energy transfer
may occur between very closely associated donor and acceptor
moieties whether or not the emission spectrum of a donor
moiety(ies) has a substantial overlap with the absorption spectrum
of the acceptor moiety(ies) (See: Yaron et al., Analytical
Biochemistry, 95: 228-235 (1979) and particularly page 229, col. 1
through page 232, col. 1). This process is referred to as
intramolecular collision since it is believed that quenching is
caused by the direct contact of the donor and acceptor moieties
(See: Yaron et al.).
[0076] (i) Linear Beacons:
[0077] In a preferred embodiment, the non-nucleotide "Beacon" probe
is a Linear Beacon as more fully described in co-pending patent
application U.S. Ser. No. 09/179,162 and WIPO publication
WO99/22018, entitled "Methods, Kits And Compositions Pertaining To
Linear Beacons", herein incorporated by reference.
[0078] (ii) PNA Molecular Beacons:
[0079] In a preferred embodiment, the non-nucleotide "Beacon" probe
is a PNA Molecular Beacon as more fully described in co-pending
patent application: U.S. Ser. No. 09/179,298 and WIPO publication
WO99/21881, entitled "Methods, Kits And Compositions Pertaining To
PNA Molecular Beacons", herein incorporated by reference.
[0080] Detecting Energy Transfer:
[0081] Hybrid formation of a non-nucleotide "Beacon" probe with a
target sequence can be monitored by measuring at least one physical
property of at least one member of the Beacon Set which is
detectably different when the hybridization complex is formed as
compared with when the non-nucleotide "Beacon" probe exists in the
absence of target sequence. We refer to this phenomenon as the
self-indicating property of non-nucleotide "Beacon" probes. This
change in detectable signal shall result from the change in
efficiency of energy transfer between the donor and acceptor which
results from hybridization of the non-nucleotide "Beacon" probes.
Preferably, the means of detection will involve measuring
fluorescence of a donor or acceptor fluorophore of a Beacon Set.
Most preferably, the Beacon Set will comprise at least one donor
fluorophore and at least one acceptor quencher such that the
fluorescence of the donor fluorophore is will be used to detect,
identify or quantitate hybridization of the non-nucleotide probe to
the target sequence.
[0082] Other Non-Nucleotide Self-Indicating Probes:
[0083] In another embodiment, the non-nucleotide probes of this
invention are self-indicating probes of the type described in WIPO
patent application WO97/45539. The self-indicating non-nucleotide
probes described in WO97/45539 differ as compared with
non-nucleotide "Beacon" probes primarily in that no quencher or
acceptor moiety is present in the probes of WO97/45539. Preferably
the probes of WO97/45539, as used in this invention, are
appropriately labeled peptide nucleic acids.
[0084] Detectable and Independently Detectable Moieties/Multiplex
Analysis:
[0085] In preferred embodiments of this invention, a multiplex
probe-based hybridization assay is performed. In a multiplex assay,
numerous conditions of interest are simultaneously examined.
Multiplex analysis relies on the ability to sort sample components
or the data associated therewith, during or after the assay is
completed. In preferred embodiments of the invention, distinct
independently detectable moieties are used to label the different
non-nucleotide probes of a set. The ability to differentiate
between and/or quantitate each of the independently detectable
moieties provides the means to multiplex a hybridization assay
because the data which correlates with the hybridization of each of
the distinctly (independently) labeled non-nucleotide probes to a
target sequence can be correlated with the presence, absence or
quantity of the target sequence sought to be detected in a sample.
Consequently, the probe-based multiplex assays of this invention
may be used to simultaneously detect the presence, absence or
amount of each of two or more target sequences which may be present
the same sample and in the same assay.
[0086] Spacer/Linker Moieties:
[0087] Generally, spacers are used to minimize the adverse effects
that bulky labeling reagents might have on hybridization properties
of probes. Linkers typically induce flexibility and randomness into
the probe or otherwise link two or more nucleobase sequences of a
probe. Preferred spacer/linker moieties for non-nucleotide probes
used for the practice of this invention consist of one or more
aminoalkyl carboxylic acids (e.g. aminocaproic acid) the side chain
of an amino acid (e.g. the side chain of lysine or ornithine)
natural amino acids (e.g. glycine), aminooxyalkylacids (e.g.
8-amino-3,6-dioxaoctanoic acid), alkyl diacids (e.g. succinic acid)
or alkyloxy diacids (e.g. diglycolic acid). Spacer/linker moieties
may also incidentally or intentionally be constructed to improve
the water solubility of the probe. The spacer/linker moieties may
also be designed to enhance the solubility of the oligomer.
[0088] Preferably, a spacer/linker moiety comprises one or more
linked compounds having the formula:
--Y--(O.sub.m--(CW.sub.2).sub.n).sub.o--Z--- . The group Y has the
formula: a single bond, --(CW.sub.2).sub.p--,
--C(O)(CW.sub.2).sub.p--, --C(S)(CW.sub.2).sub.p-- and
--S(O.sub.2)(CW.sub.2).sub.p. The group Z has the formula NH,
NR.sup.2, S or O. Each W is independently H, R.sup.2, --OR.sup.2,
F, Cl, Br or I; wherein, each R.sup.2 is independently selected
from the group consisting of: --CX.sub.3, --CX.sub.2CX.sub.3,
--CX.sub.2CX.sub.2CX.sub.3, --CX.sub.2CX(CX.sub.3).sub.2, and
--C(CX.sub.3).sub.3. Each X is independently H, F, Cl, Br or I.
Each m is independently 0 or 1. Each n, o and p are independently
whole numbers from 0 to 10.
[0089] Linked Polymer:
[0090] A linked polymer comprises two or more nucleobase sequences
which are linked by a linker. The probes of this invention include
linked polymers wherein the probing nucleobase sequence is linked
to one or more additional peptide nucleic acid, peptide or enzyme
molecules.
[0091] Hybridization Conditions/Stringency:
[0092] Those of ordinary skill in the art of nucleic acid
hybridization will recognize that factors commonly used to impose
or control stringency of hybridization include formamide
concentration (or other chemical denaturant reagent), salt
concentration (i.e., ionic strength), hybridization temperature,
detergent concentration, pH and the presence or absence of
chaotropes. Optimal stringency for a probe/target combination is
often found by the well known technique of fixing several of the
aforementioned stringency factors and then determining the effect
of varying a single stringency factor. The same stringency factors
can be modulated to thereby control the stringency of hybridization
of non-nucleotide probes to target sequences, except that the
hybridization of a PNA is fairly independent of ionic strength.
Ionic strength will not likely be a substantial factor in the
stringency of most non-nucleotide probes having a sufficiently
neutral or positively charged backbone. Optimal stringency for an
assay may be experimentally determined by examination of each
stringency factor until the desired degree of discrimination is
achieved.
[0093] Suitable Hybridization Conditions:
[0094] Generally, the more closely related the background causing
nucleic acid contaminates are to the target sequence, the more
carefully stringency must be controlled. Blocking probes may also
be used as a means to improve discrimination beyond the limits
possible by mere optimization of stringency factors. Suitable
hybridization conditions will thus comprise conditions under which
the desired degree of discrimination is achieved such that an assay
generates an accurate (within the tolerance desired for the assay)
and reproducible result. Aided by no more than routine
experimentation, those of skill in the art will easily be able to
determine appropriate hybridization conditions for performing an
assay.
[0095] Blocking Probes:
[0096] Blocking probes are non-nucleic acid or nucleic acid probes
which can be used to suppress the binding of the probing nucleobase
sequence of a probe to a hybridization site which is unrelated or
closely related to the target sequence (See: Coull et al.,
PCT/US97/21845, a.k.a. WO98/24933). Generally, the blocking probes
suppress the binding of the probing nucleobase sequence to closely
related non-target sequences because the blocking probe hybridizes
to the non-target sequence to form a more thermodynamically stable
complex than is formed by hybridization between the probing
nucleobase sequence and the non-target sequence. Thus, blocking
probes are typically unlabeled probes used in an assay to thereby
suppress non-specific signal. Because they are usually designed to
hybridize to closely related non-target sequence sequences,
typically a set of two or more blocking probes will be used in an
assay to thereby suppress non-specific signal from non-target
sequences which could be present and interfere with the performance
of the assay.
[0097] Suitable Electrostatic Binding Conditions:
[0098] It is an important feature of the present invention that the
electrostatic binding conditions be chosen such that the
non-nucleotide probe exhibit little or no affinity for the matrix
as compared with nucleic acid components of the sample. The
electrostatic immobilization of nucleic acids to matrices primarily
involves the formation of salt pairs between the nucleic acid and
the matrix. A salt pair comprises a charged species of the nucleic
acid interacting with a counter charged species of the matrix to
form an interaction which tends to stabilize the association of the
nucleic acid to the matrix. Variable factors which will most affect
electrostatic binding will involve modulation of one or both the pH
and/or ionic strength. The pH is an important factor since it may
affect the charge density on the matrix as well as the net charge
of the nucleic acid. Similarly, ionic strength will affect salt
pair stability since it is well known in the chromatographic arts
that increasing ionic strength will destabilize the interactions
formed between nucleic acids and anion exchange stationary phases.
For the purposes of this invention, electrostatic binding
conditions shall be conditions which allow for the reversible
binding of the nucleic acid of interest to a matrix through salt
pair formation.
[0099] Harmonization of Suitable Hybridization Conditions and
Suitable Electrostatic Binding Conditions:
[0100] When employing the methods, kits and compositions of this
invention, it is important to distinguish between suitable
hybridization conditions, wherein sequence specific hybridization
of a non-nucleotide probe to at target sequence is optimized, as
compared with electrostatic binding conditions which simply refer
to conditions under which the nucleic acid binds to the matrix but
the non-nucleotide probe or probes do not exhibit a substantial
affinity for the matrix. Typically, the electrostatic binding
conditions will be chosen such that the non-nucleic probe is
sufficiently neutral or positively charged. Because of the
differences in the charges of the backbones of nucleic acid and
non-nucleotide probes of this invention, there is a broad range of
conditions within which the nucleic acid of interest binds to the
matrix but the non-nucleotide probe or probes do not. This
principle is exemplified in Example 13 wherein it is clear that the
non-nucleotide probes do not interact with the matrix under any
conditions examined but the most nearly equivalent nucleic acid
probes can interact with the matrix under many of the conditions
tested whether or not the target sequence is present in the
sample.
[0101] Because it is an important feature of this invention that
the non-nucleotide probe hybridize to a nucleic acid which is
electrostatically bound to a matrix, it will be appreciated by one
of skill in the art that hybridization conditions (stringency
factors) and electrostatic binding conditions should be harmonized
within the context of the assay to be performed. Since pH and ionic
strength are factors to be considered in both stringency and
electrostatic binding and since the electrostatic binding
conditions are broad as compared with optimized stringency, it
should always be possible to easily fix the electrostatic binding
conditions and then optimize probe discrimination by modulation of
other stringency factors. In this respect, the methods of this
invention is far superior to current methods known in the art (e.g.
Arnold et al, U.S. Pat. No. 5,599,667). Aided by no more than
routine experimentation, those of skill in the art will easily be
able to harmonize the electrostatic binding conditions and suitable
hybridization conditions for performing an assay.
[0102] Matrices:
[0103] Generally, the matrix is merely a scaffold which is
potentially separable from the bulk fluid of the assay and which
comprises charged functional groups to which the nucleic acid
reversibly binds electrostatically. Typically, electrostatic
binding occurs by salt pair formation between charged groups of the
nucleic acid backbone and charged groups of the matrix. For binding
nucleic acids, the primary interactions will most likely involve
formation of a salt pair between the negatively charged phosphate
groups of the nucleic acid phosphodiester backbone and positively
charged functional groups of the matrix.
[0104] Non-limiting examples of suitable matrices include: polymers
which are insoluble in water or mixtures of water and water soluble
organic solvents; two and three dimensional surfaces such as a wall
of a tube, a glass frit or a wafer; beaded supports such as
magnetic beads, chromatographic packing supports, media and resins;
porous beaded supports such as chromatographic packing supports,
media and resins (e.g. anion exchange chromatography media), a cast
polymer such as a membrane (e.g. polyvinylidene difluoride, Teflon,
polyethylene, polypropylene or polysulfone); co-polymeric materials
and gels (e.g. polyacrylamide or agarose). In a preferred
embodiment, commercially available ion exchange chromatographic
media, and particularly the beaded media, will be used as the
matrix.
[0105] Matrix Shielding:
[0106] In certain preferred embodiments, the matrix may be
temporarily shielded from the assay components to thereby
temporarily delay the electrostatic binding of nucleic acid
components of the assay to the matrix. For example, it may be
preferable to partially or wholly shield the matrix from assay
components until a nucleic acid synthesis or amplification reaction
is partially or substantially completed so as to not inhibit the
synthesis or amplification (See for example: Example 12 of this
specification).
[0107] Those of skill in the art will recognize that partitioning
of reaction components may be obtained by preparing a reaction
vessel having suitable compartments. Preferably however, the matrix
will be shielded by the aid of a fluid which will serve as a
temporary barrier until the reaction components are mixed. Thus, a
preferable fluid will be a water miscible fluid which is viscous
and/or dense as compared with water such that it does not readily
blend with aqueous solutions until it is subjected to heating or
physical agitation. It will be appreciated by those of skill in the
art that a non-limiting example of such a fluid is glycerol.
[0108] Exemplary Assay Formats:
[0109] The methods, kits and compositions of this invention
substantially simplify the preparation and/or analysis of nucleic
acids of interest. It is also an advantage that they are generally
applicable to all types of samples and assay formats typically used
for the analysis of nucleic acids. Several non-limiting examples of
preferred assay formats which have been tested are described below.
These examples demonstrate the broad applicability of the methods,
kits and compositions of this invention. Generally, the assay
formats described below are not necessarily mutually exclusive and
one or more can be combined for the analysis of a particular
sample.
[0110] (i) Amplification Assay Formats:
[0111] This invention is applicable to samples wherein the nucleic
acid has been synthesized or amplified. Non-limiting examples of
preferred nucleic acid synthesis or nucleic acid amplification
reactions well known in the art include Polymerase Chain Reaction
(PCR), Ligase Chain Reaction (LCR), Strand Displacement
Amplification (SDA), Transcription-Mediated Amplification (TMA),
Rolling Circle Amplification (RCA) and Q-beta replicase. When
combined with non-nucleotide "Beacon" probes, these assay formats
can be performed in a self-indicating format, including real-time
as well as end-point determination when using a suitable instrument
such as a Prism 7700 (PE Biosystems, Foster City, Calif.). In a
self-indicating assay, once the components of the assay have been
combined, there is no need to disturb contents of the assay to
determine the result. Since the assay contents need not be
disturbed to determine the result, there must be some detectable or
measurable change which occurs and which can be observed or
quantitated without physically manipulating the contents of the
assay. Many self-indicating assays rely on a change in fluorescence
which can be observed with the eye or otherwise detected and/or
quantitated with a fluorescence instrument. Example 12 of this
specification describes self-indicating PCR assays suitable for
either real-time or end-point analysis.
[0112] (ii) Protection/Digestion Assays:
[0113] Other preferred assays of this invention are directed to the
detection of nucleic acids target sequences in samples;
particularly within complex biological samples. Complex biological
samples such as blood, urine, sputum and cell lysates typically
require substantial processing in order to remove the bulk matter,
such as protein, lipids, cellular debris, etc. which otherwise
reduce the sensitivity and/or reliability of a probe-based
hybridization assay. It has previously been demonstrated that
nucleic acid analogs, such as PNA, can hybridize to a target
sequence and thereby protect the nucleic acid target sequence from
digestion/degradation by nucleases (See: Stanley et al.; U.S. Pat.
No. 5,861,250). In this preferred assay format, one or more
detectable non-nucleic acid probes which can protect the nucleic
acid target from digestion/degradation, are hybridized to the one
or more target sequences under suitable hybridization conditions.
Preferably, the target sequence exists in a complex biological
sample. After the non-nucleic acid probe has been hybridized to the
nucleic acid target sequence, the sample is treated with one or
more enzymes such as proteases and/or nucleases which degrade the
sample components, possibly including the nucleic acid molecule of
interest but not the non-nucleotide probe/target sequence complex.
Because this treatment digests/degrades contaminating polymers and
debris, this treatment reduces or eliminates the sample complexity
and/or processing requirements normally associated with complex
biological samples. Since the one or more non-nucleotide
probe/target sequence hybrids, if present in the sample, are intact
after the enzyme treatment, they can be concentrated on a matrix
and detected as the means to detect, identify or quantitate the
target sequence in the sample of interest. An example of this assay
format is found in Example 14 of this specification. Optionally,
the detectable non-nucleotide probe/target sequence hybrid is
released from the matrix by adjustment of conditions outside the
range required for electrostatic binding and thereby facilitates
detection of the unbound non-nucleotide probe/target sequence
hybrid, or just the detectable probe, as the means to detect,
identify or quantitate the target sequence in the sample.
[0114] Advantageously, the presence of the matrix is not required
for protecting the target sequence from degradation. Therefore, the
matrix can either be present during the enzyme treatment or added
after the enzyme treatment to thereby electrostatically immobilize
the non-nucleotide probe/target sequence. In preferred embodiments,
the nucleic acid analog is a non-nucleotide "Beacon" probe and the
presence, absence or amount of self-indicating signal detected on
the matrix is used to determine the presence, absence or amount of
target sequence present in the sample or complex biological
sample.
[0115] In a preferred embodiment of this assay, the assay
temperature is adjusted and/or controlled so that imperfect hybrids
are preferentially dissociated in order to achieve a higher degree
of target sequence discrimination, including single point mutation
discrimination. Generally, this involves adjusting the temperature
of the assay to a point below the melting temperature of the
non-nucleotide probe/target sequence hybrid so that non-nucleotide
probe/non-target sequences are at least partially dissociated.
Since the non-nucleotide probe/non-target sequence hybrids are
generally less complementary as compared with the non-nucleotide
probe/target sequence hybrids, the optimal assay temperature is
typically within a fifteen degree range wherein this range is
defined as five degrees above and ten degree below the melting
temperature of the hybrid formed from the non-nucleotide probe and
the non-target sequence. For example, if the non-nucleotide
probe/non-target sequence sought to be discriminated in the assay
has a melting temperature of 70.degree. C., under assay conditions,
the preferred range for adjusting the temperature of the assay
would be between 75.degree. C. (+5.degree. C.) and 60.degree. C.
(-10.degree. C.).
[0116] Dissociation of the non-nucleotide probe/non-target
sequences makes the non-target sequences available for enzyme
degradation since they are no longer protected. Though
hybridization, particularly near the Tm, is an equilibrium process,
destruction of the non-target sequence prevents reassociation of
the non-nucleotide probe/non-target sequence hybrid and the
generation of the non-specific signal associated therewith.
[0117] As previously stated, the assay formats described herein are
not mutually exclusive to other assay formats. It is an important
feature of this invention that the non-nucleotide probe/target
sequence hybrid is reversibly bound to the matrix. Therefore the
non-nucleotide probe/target sequence hybrid can be released from
the matrix for subsequent analysis. Consequently, this
Protection/Digestion Assay can also be used merely for sample
preparation or as a confirmatory precursor assay to a secondary
assay. For example, the Protection/Digestion Assays can be combined
with other assay formats, such as for the analysis of arrays or for
sample preparation, before performing a line assay or cytometric
(flow or static) assay as described below.
[0118] (iii) Line Assays:
[0119] Another preferred assay format useful for the practice of
this invention is the line assay. A common line assay is a lateral
flow assay. Many methods and devices for lateral flow assays are
known (See: U.S. Pat. Nos. 5,916,521, 5,798,273, 5,770,460,
5,710,005, 5,415,994, 4,956,302 and 4,943,522, all of which are
herein incorporated). A classic example of a lateral flow assay is
a commercially available pregnancy test. In a classic pregnancy
test, a sample of urine is applied to a spot on a lateral flow
assay device. The lateral flow device comprises a fluid conducting
matrix, such as a filter or membrane, which causes the fluid (e.g.
urine) to passively flow (generally through capillary action) from
the spot of application to the other end of the conducting matrix.
Present within the lateral flow device (or otherwise added to the
urine sample prior to application to the device) is a detectable
antibody to the HCG hormone; said HCG hormone being present in the
urine sample only if the subject is pregnant. As the urine flows
laterally within the device, the HCG/antibody complex forms as the
components interact. Also within the device is a line (or other
geometric shape) of a substance (usually another antibody) to which
the HCG/antibody complex will bind and thereby concentrate to
produce a detectable signal.
[0120] Consequently, another embodiment of this invention
contemplates a line or lateral flow assay for the detection of a
nucleic acid target sequence. In the line assay of this invention,
a line, lines or other geometric shape of matrix is spatially fixed
on the device so that any non-nucleic acid probe/target sequence
complexes present in a sample can be concentrated on the line (or
other geometric shape) of the device as the sample (or sample
components) flow past. Preferably the assay is a lateral flow
assay. In the line assay of this invention, the detectable
non-nucleic acid probe can be added to the sample before or after
the target sequence is concentrated on the matrix of the line
device. Consequently, the target sequence in the sample is
determined by detecting, identifying or quantitating the
non-nucleic acid probe/target sequence complex as concentrated on
the line, lines or other geometric shape. Example 16 of this
specification is an example of a line assay. Optionally, the
non-nucleotide probe/target sequence hybrid is released from the
matrix by adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0121] (iv) Array Assay Formats:
[0122] In one embodiment, arrays are surfaces to which two or more
samples of interest have been immobilized, each at a unique
location. Arrays comprising nucleic acid have been described in the
literature. It is an advantage of this invention that nucleic acid
of a sample is easily electrostatically immobilized to a surface
under a broad range of conditions. Therefore, an array of samples
can be easily produced generally by just spotting (under
electrostatic binding conditions) two or more samples containing
nucleic acid at unique locations on a positively charged surface.
Because the location of each sample is known, arrays of
electrostatically immobilized nucleic acid can generally be used to
simultaneously detect, identify or quantitate one or more target
sequences in two or more samples of interest. Thus, an array of
electrostatically immobilized nucleic acid may be useful in
diagnostic applications or in screening compounds for leads which
might exhibit therapeutic utility. An example of an array assay is
Example 15 of this specification. Optionally, the non-nucleotide
probe/target sequence hybrid is released from the matrix by
adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0123] It is an advantage of this invention that the non-nucleotide
probe is not necessary for the immobilization of the nucleic acid
to the array matrix. Therefore, the non-nucleotide probe may be
added to the one or more samples before or after they are
electrostatically immobilized to the array matrix.
[0124] Arrays comprised of non-nucleotide probes/target sequence
hybrids have the additional advantage that they are highly stable
and should not be degraded by enzymes which degrade nucleic acid.
Therefore, these arrays, or the samples which are to be applied to
the array matrix, can be treated as described above in the Section
entitled "Digestion/Protection Assays" as a means to improve the
assay performance by the degradation of sample contaminates.
Regardless of whether the sample is treated with enzyme before or
after it is applied to the array matrix, it is important that the
non-nucleotide probe/target sequence be formed so that the target
sequence is protected against degradation.
[0125] (v) Flow or Static Cytometric Assays:
[0126] Flow and static cytometry are very useful for the analysis
of whole cells as well as particles. Because the matrices of this
invention can be beaded or particulate, this invention is
particularly well suited for the static or flow cytometric analysis
of particles containing nucleic acids electrostatically immobilized
thereto. According to this invention, the nucleic acid is
electrostatically immobilized to particles or beads. A
non-nucleotide probe is used to detect a target sequence of
interest present on the particles or beads and can be added before
or after the nucleic acid is immobilized. Detection, identification
or quantitation of the non-nucleotide probe/target sequence complex
in the static or flow cytometer is used as the means to detect,
identify or quantitate the target sequence in the sample of
interest. Example 13 of this specification utilizes a static
quantitation of fluorescence as the means to quantitate target
sequence electrostatically immobilized to beads. Optionally, the
non-nucleotide probe/target sequence hybrid is released from the
matrix by adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0127] Exemplary Applications For Using The Invention:
[0128] Because the methods, kits and compositions of this invention
may be used in a probe-based hybridization assay, this invention
will find utility in improving assays used to detect, identify of
quantitate the presence or amount of an organism or virus in a
sample through the detection of target sequences associated with
the organism or virus. (See: U.S. Pat. No. 5,641,631, entitled
"Method for detecting, identifying and quantitating organisms and
viruses" herein incorporated by reference). Similarly, this
invention will also find utility in an assay used in the detection,
identification or quantitation of one or more species of an
organism in a sample (See U.S. Pat. No. 5,288,611, entitled "Method
for detecting, identifying and quantitating organisms and viruses"
herein incorporated by reference). This invention will also find
utility in an assay used to determine the effect of antimicrobial
agents on the growth of one or more microorganisms in a sample
(See: U.S. Pat. No. 5,612,183, entitled "Method for determining the
effect of antimicrobial agents on growth using ribosomal nucleic
acid subunit subsequence specific probes" herein incorporated by
reference). This invention will also find utility in an assay used
to determine the presence or amount of a taxonomic group of
organisms in a sample (See: U.S. Pat. No. 5,601,984, entitled
"Method for detecting the presence of amount of a taxonomic group
of organisms using specific r-RNA subsequences as probes" herein
incorporated by reference).
[0129] The methods, kits and compositions of this invention are
particularly useful for the rapid, sensitive, reliable and
versatile detection of target sequences which are particular to
organisms which might be found in food, beverages, water,
pharmaceutical products, personal care products, dairy products or
environmental samples. The analysis of preferred beverages include
soda, bottled water, fruit juice, beer, wine or liquor products.
Consequently, the methods, kits and compositions of this invention
will be particularly useful for the analysis of raw materials,
equipment, products or processes used to manufacture or store food,
beverages, water, pharmaceutical products, personal care products,
dairy products or environmental samples.
[0130] Likewise, the methods, kits and compositions of this
invention are particularly useful for the rapid, sensitive,
reliable and versatile detection of target sequences which are
particular to organisms which might be found in clinical
environments. Consequently, the methods, kits and compositions of
this invention will be particularly useful for the analysis of
clinical specimens or equipment, fixtures or products used to treat
humans or animals. For example, the assay may be used to detect a
target sequence which is specific for a genetically-based disease
or is specific for a predisposition to a genetically-based disease.
Non-limiting examples of diseases include, .beta.-Thalassemia,
sickle cell anemia, Factor-V Leiden, cystic fibrosis and cancer
related targets such as p53, p10, BRC-1 and BRC-2.
[0131] II. Preferred Embodiments of the Invention:
[0132] Compositions:
[0133] In one embodiment, this invention pertains to compositions
suitable for detecting the presence of a target sequence in a
sample. A preferred composition comprises a nucleic acid, having a
target sequence, which is electrostatically bound to a matrix under
suitable electrostatic binding conditions. The composition further
comprises a non-nucleotide probe having a probing nucleobase
sequence which is sequence specifically hybridized to at least a
portion of the target sequence provided however that the
non-nucleotide probe does not substantially bind to the matrix
under suitable electrostatic binding conditions unless the target
sequence is present on the matrix. Therefore, the electrostatic
immobilization of the non-nucleotide probe/target sequence complex
to matrix is primarily determined by the interaction of the nucleic
acid with the matrix and not significantly dependent upon any
interactions of the non-nucleotide probe and the matrix.
[0134] Such compositions are well suited for the detection of the
presence of target sequences in samples since the nucleic acid
components of the sample become concentrated on the matrix.
Furthermore, the hybridized detectable non-nucleotide probe becomes
concentrated on the matrix such that the limit of detection of the
assay can be improved because the presence of the label is
localized and thereby more easily detected as compared with when it
is distributed in bulk fluid (See: Example 12).
[0135] Methods:
[0136] In another embodiment, this invention pertains to methods
for the detection, identification or quantitation of a target
sequence in a sample containing nucleic acid. One exemplary method
comprises contacting a sample with a matrix and at least one
non-nucleotide probe wherein the nucleic acid in the sample will
electrostatically bind to the matrix under suitable electrostatic
binding conditions. Additionally, the non-nucleotide probe will
hybridize, under suitable hybridization conditions, to at least a
portion of the target sequence, if present in the sample. The
method further comprises detecting, identifying or quantitating the
non-nucleotide probe/target sequence hybrid as a means to detect,
identify or quantitate the target sequence in the sample.
[0137] In still another embodiment, this invention pertains to
multiplex methods for the detection, identification or quantitation
of two or more target sequences of one or more nucleic acid
molecules which may be present in the same sample. One exemplary
method comprises contacting a sample with a matrix and two or more
independently detectable non-nucleotide probes wherein the nucleic
acid present in the sample will electrostatically bind to the
matrix under suitable electrostatic binding conditions.
Additionally, the two or more independently detectable
non-nucleotide probes will hybridize, under suitable hybridization
conditions, to at least a portion of the target sequences with
which each probe is designed to hybridize if present in the nucleic
acid of the sample. Consequently, if a particular target sequence
is electrostatically immobilized to the matrix, the independently
detectable non-nucleotide probe designed to hybridized to that
particular target sequence will become concentrated on the matrix
and be available for detection. Therefore, the method further
comprises detecting, identifying or quantitating each unique
independently detectable non-nucleotide probe/target sequence
hybrid which is electrostatically bound to said matrix as a means
to detect, identify or quantitate each unique target sequence
sought to be detected in the sample and in the same assay.
Optionally, the unique independently detectable non-nucleotide
probe/target sequence hybrids is released from the matrix by
adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0138] In still a further embodiment, this invention takes
advantage of the stability of nucleic acid analog/nucleic acid
complexes (See: Stanley et al.; U.S. Pat. No. 5,861,250) to thereby
further improve assay performance and/or otherwise decrease the
labor or complexity of sample preparation. One exemplary method
comprises contacting the sample with at least one non-nucleotide
probe wherein the non-nucleotide probe will hybridize, under
suitable hybridization conditions, to at least a portion of the
target sequence if present in the sample. The sample is also
contacted with a matrix wherein the nucleic acid molecule will
electrostatically bind to a matrix under suitable electrostatic
binding conditions. Either before or after immobilization to the
matrix, the sample containing the non-nucleotide probe/target
sequence complex is contacted with one or more enzymes capable
degrading sample contaminates, including the nucleic acid molecule
but not the non-nucleotide probe/target sequence complex. The
method further comprises detecting, identifying or quantitating the
non-nucleotide probe/target sequence hybrid as a means to detect,
identify or quantitate the target sequence in the sample provided
that the non-nucleotide probe/target sequence is first immobilized
to the matrix. Optionally, the detectable non-nucleotide
probe/target sequence hybrid is released from the matrix by
adjustment of conditions outside the range required for
electrostatic binding and thereby facilitates detection of the
unbound non-nucleotide probe/target sequence hybrid, or just the
detectable probe, as the means to detect, identify or quantitate
the target sequence in the sample.
[0139] In yet another embodiment, this invention relates to a
method for the detection, identification or quantitation of a
target sequence of a nucleic acid molecule electrostatically
immobilized at a location on an array wherein the array comprises
nucleic acid molecules electrostatically bound at unique locations.
One exemplary method comprises contacting the array with at least
one non-nucleotide probe, wherein the non-nucleotide probe will
hybridize, under suitable hybridization conditions, to at least a
portion of the target sequence if present on the array. The
non-nucleotide probe/target sequence complex electrostatically
bound at a location on said array is then detected, identified or
quantitated as the means to determine the presence, absence or
amount of target sequence present at said array location. It is an
advantage of the invention that one or more enzymes capable
degrading sample contaminates, including the nucleic acid target
molecule but not the non-nucleotide probe/target sequence complex,
can also be added before analysis of the array to thereby improve
the performance of the array assay by degrading sample contaminates
which might otherwise lead to false positive results. Optionally,
the detectable non-nucleotide probe/target sequence hybrids can be
released from the matrix by adjustment of conditions outside the
range required for electrostatic binding and thereby facilitates
detection of the unbound non-nucleotide probe/target sequence
hybrid, or just the detectable probe, as the means to detect,
identify or quantitate target sequence in the sample. If the
non-nucleotide probes are independently detectable, the analysis of
the matrix can proceed in a multiplex format.
[0140] In yet a further embodiment, this invention is directed to a
method for the detection, identification or quantitation of a
target sequence of a nucleic acid molecule which may be present in
any of two or more samples of interest. The method comprises mixing
each of the two or more samples of interest with at least one
non-nucleotide probe, under suitable hybridization conditions. Next
a matrix is contacted, under suitable electrostatic binding
conditions, with at least a portion of each of the two or more
samples to thereby electrostatically immobilize the nucleic acid
components of each sample to the matrix, each at a unique location,
and thereby create a matrix array of samples. The non-nucleotide
probe/target sequence complex electrostatically bound at a location
on said array is then detected, identified or quantitated as the
means to determine the presence, absence or amount of target
sequence present at said array location. It is an advantage of the
invention that one or more enzymes capable degrading sample
contaminates, including the nucleic acid target molecule but not
the non-nucleotide probe/target sequence complex, can also be added
before analysis of the array to thereby improve the performance of
the array assay by degrading sample contaminates which might
otherwise lead to false positive results. Optionally, the
detectable non-nucleotide probe/target sequence hybrids can be
released from the matrix by adjustment of conditions outside the
range required for electrostatic binding and thereby facilitates
detection of the unbound non-nucleotide probe/target sequence
hybrid, or just the detectable probe, as the means to detect,
identify or quantitate target sequence in the sample. If the
non-nucleotide probes are independently detectable, the analysis of
the matrix can proceed in a multiplex format.
[0141] Kits:
[0142] In yet another embodiment, this invention is directed to
kits suitable for performing an assay, as described herein, which
detects the presence, absence or number of target sequences in a
sample. The kits of this invention comprise a matrix and one or
more non-nucleotide probes and other reagents or compositions which
are selected to perform an assay or otherwise simplify the
performance of an assay used to detect, identify or quantitate a
target sequence in a sample. Suitable non-nucleotide probes,
matrices and methods have been previously described herein.
Typically, the kit will comprise a non-nucleotide probe, a matrix
and one or more reagents or buffers for fixing the electrostatic
binding conditions and/or hybridization conditions.
[0143] One embodiment of a preferred kit will comprise at least two
independently detectable non-nucleotide probes such that the
presence absence or amount of each independently detectable moiety
can be used to distinctly identify or quantitate each of at least
two target sequences which may be present in a sample in the same
assay (a multiplex assay). In a preferred embodiment, the kit will
comprise two or more non-nucleotide "Beacon" probes. Preferably,
the kit will be useful for performing a multiplex self-indicating
assay such as a self-indicating PCR assay.
[0144] Having described the preferred embodiments of the invention,
it will now become apparent to one of skill in the art that other
embodiments incorporating the concepts described herein may be
used. It is felt, therefore, that these embodiments should not be
limited to disclosed embodiments but rather should be limited only
by the spirit and scope of the following claims.
EXAMPLES
[0145] This invention is now illustrated by the following examples
which are not intended to be limiting in any way.
Example 1
Synthesis of DNA Oligonucleotides for Study
[0146] For this study, labeled and labeled DNA oligonucleotides
suitable as probes or as nucleic acids comprising a target sequence
were either synthesized using commercially available reagents and
instrumentation or obtained from commercial vendors. All DNAs were
obtained in purified form or purified using conventional methods.
The sequences of the DNA oligonucleotides prepared are illustrated
in Table 1, below. Methods and compositions for the synthesis and
purification of synthetic DNAs are well known to those of ordinary
skill in the art.
Example 2
Synthesis of
N-.alpha.-(Fmoc)-N-.epsilon.-(NH.sub.2)-L-Lysine-OH
[0147] To 20 mmol of
N-.alpha.-(Fmoc)-N-.epsilon.-(t-boc)-L-lysine-OH was added 60 mL of
2/1 dichloromethane (DCM)/trifluoroacetic acid (TFA). The solution
was allowed to stir until the tert-butyloxycarbonyl (t-boc) group
had completely been removed from the
N-.alpha.-(Fmoc)-N-.epsilon.-(- t-boc)-L-lysine-OH. The solution
was then evaporated to dryness and the residue redissolved in 15 mL
of DCM. An attempt was then made to precipitate the product by
dropwise addition of the solution to 350 mL of ethyl ether. Because
the product oiled out, the ethyl ether was decanted and the oil put
under high vacuum to yield a white foam. The white foam was
dissolved in 250 mL of water and the solution was neutralized to pH
4 by addition of saturated sodium phosphate (dibasic). A white
solid formed and was collected by vacuum filtration. The product
was dried in a vacuum oven at 35-40.degree. C. overnight. Yield
17.6 mmol, 88%.
Example 3
Synthesis of N-.alpha.-(Fmoc)-N-.epsilon.-(dabcyl)-L-Lysine-OH
[0148] To 1 mmol of
N-.alpha.-(Fmoc)-N-.epsilon.-(NH.sub.2)-L-Lysine-OH (Example 2) was
added 5 mL of N,N'-dimethylformamide (DMF) and 1.1 mmol of TFA.
This solution was allowed to stir until the amino acid had
completely dissolved.
[0149] To 1.1 mmol of 4-((4-(dimethylamino)phenyl)azo)benzoic acid,
succinimidyl ester (Dabcyl-NHS; Molecular Probes, P/N D-2245) was
added 4 mL of DMF and 5 mmol of diisopropylethylamine (DIEA). To
this stirring solution was added, dropwise, the
N-.alpha.-(Fmoc)-N-.epsilon.-(NH.sub.2)- -L-Lysine-OH solution
prepared as described above. The reaction was allowed to stir
overnight and was then worked up.
[0150] The solvent was vacuum evaporated and the residue
partitioned in 50 mL of DCM and 50 mL of 10% aqueous citric acid.
The layers were separated and the organic layer washed with aqueous
sodium bicarbonate and again with 10% aqueous citric acid. The
organic layer was then dried with sodium sulfate, filtered and
evaporated to an orange foam. The foam was crystallized from
acetonitrile (ACN) and the crystals collected by vacuum filtration.
Yield 0.52 mmol, 52%.
Example 4
Synthesis of
N-.alpha.-(Fmoc)-N-.epsilon.-(dabcyl)-L-Lysine-PAL-Peg/PS Synthesis
Support
[0151] The N-.alpha.-(Fmoc)-N-.epsilon.-(dabcyl)-L-Lysine-OH
(Example 2) was used to prepare a synthesis support useful for the
preparation of C-terminal dabcylated PNAs. The
fluorenylmethoxycarbonyl (Fmoc) group of 0.824 g of commercially
available Fmoc-PAL-Peg-PS synthesis support (PerSeptive Biosystems,
Inc.; P/N GEN913384) was removed by treatment, in a flow through
vessel, with 20% piperidine in DCM for 30 minutes. The support was
then washed with DCM. Finally, the support was washed with DMF and
dried with a flushing stream of argon.
[0152] A solution containing 0.302 g
N-.alpha.-(Fmoc)-N-.epsilon.-(dabcyl)- -L-Lysine-OH, 3.25 mL of
DMF, 0.173 g [O-(7-azabenzotriaol-1-yl)-1,1,3,3-t-
etramethyluronium hexafluorophosphate (HATU), 0.101 mL DIEA and
0.068 mL 2,6-lutidine was prepared by sequential combination of the
reagents. This solution was then added to the washed synthesis
support and allowed to react for 2 hours. The solution was then
flushed through the vessel with a stream of argon and the support
washed sequentially with DMF, DCM and DMF. The resin was then dried
with a stream of argon.
[0153] The support was the treated with 5 mL of standard
commercially available PNA capping reagent (PerSeptive Biosystems,
Inc., P/N GEN063102). The capping reagent was then flushed from the
vessel and the support was washed with DMF and DCM. The support was
then dried with a stream of argon. Finally, the synthesis support
was dried under high vacuum.
[0154] Final loading of the support was determined by analysis of
Fmoc loading of three samples of approximately 6-8 mg. Analysis
determined the loading to be approximately 0.145 mmol/g.
[0155] This synthesis support was packed into an empty PNA
synthesis column, as needed, and used to prepare PNA oligomers
having a C-terminal dabcyl quenching moiety attached to the PNA
oligomer through the .epsilon.-amino group of the C-terminal
L-lysine amino acid.
Example 5
Synthesis of PNA
[0156] PNAs were synthesized using commercially available reagents
and instrumentation obtained from PerSeptive Biosystems, Inc.
Double couplings were often performed to insure that the crude
product was of acceptable purity. Purity of the final PNAs was
determined by standard reversed-phase chromatographic methods and
the identity of the PNA confirmed by comparison of theoretical
calculated masses with results of mass analysis using a MALDI-TOF
mass spectrometer.
[0157] PNAs possessing a C-terminal dabcyl moiety were prepared by
performing the synthesis using the dabcyl-lysine modified synthesis
support prepared as described in Example 4. PNAs possessing an
N-terminal fluorescein moiety were treated with the appropriate
labeling reagents and linkers (as required) prior to cleavage from
the synthesis support (See: Example 6). Several methods are
available for labeling a PNA oligomer with fluorescein but
Applicants preferred method is described in Example 6. PNAs
comprising a Cy3 label (Amersham) were cleaved from the synthesis
support and HPLC purified using conventional methods prior to Cy3
labeling as described in Example 7.
Example 6
Preferred Procedure for Labeling of Support Bound PNA with
5(6)carboxyfluorescein
[0158] After proper reaction with linkers and removal of the
terminal amine protecting group, the resin was treated with 250
.mu.L of a solution containing 0.5M 5(6)carboxyfluorescein, 0.5M
N,N'-diisopropylcarbodiimide, 0.5M 1-hydroxy-7-azabenzotriazole
(HOAt) in DMF (See: Weber et al., Bioorganic & Medicinal
Chemistry Letters, 8: 597-600 (1998). After treatment the synthesis
support was washed and dried under high vacuum. The PNA oligomer
was then cleaved, deprotected and purified.
Example 7
General Procedure for Cy3 Labeling of PNAs
[0159] The purified amine containing PNA was dissolved in 1/1
DMF/water at a concentration of approximately 0.05 OD/.mu.L to
prepare a stock PNA solution. From the stock, approximately 30
nmole of PNA was added to a tube. To this tube was then added 125
.mu.L 0.1 M HEPES (pH 8.5), and enough 1/1 DMF/water to bring the
total volume to 250 .mu.L. This solution was thoroughly mixed. To a
prepackaged tube of Cy3 dye (Amersham), was added the entire 250
.mu.L solution prepared as described above. The tube was well mixed
and then allowed to react for 1 hour at ambient temperature.
[0160] After reaction, the solvent was removed by evaporation in a
speed-vac. The pellet was then dissolved in 400 .mu.L of a solution
containing 3:1 1% aqueous TFA/ACN. Optionally the solution was then
transferred to a 5000 MW Ultrafree (Millipore, P/N UFC3LCC25) or a
3000 MW (Amicon, P/N 42404) and filtered to remove excess dye. The
recovered product was then repurified using conventional reversed
phase chromatographic methods.
[0161] General Discussion of Examples 8 to 12:
[0162] The following Examples were performed to examine whether the
presence of target nucleic acids which had been electrostatically
bound to polyethylene imine (PEI) derivatized beads could be
specifically detected using labeled PNA probes wherein the labeled
(neutral) PNA would not become immobilized to the beads in the
absence of target nucleic acid but would hybridize, and therefore
become immobilized to the beads, if the target nucleic acid was
present. These experiments demonstrate an application which is
uniquely suited to PNA probes since they possess a neutral backbone
but nevertheless hybridize to nucleic acids with sequence
specificity.
[0163] Aided by the discussion and examples described herein, those
of skill in the art will appreciate that positively charged
matrices other than those coated with PEI are suitable for the
practice of the invention described herein. Similarly, those of
skill in the art will appreciate that all kinds of matrices or
supports, other than beads, are suitable for the practice of this
invention. Finally, those of skill in the art will also appreciate
that the non-nucleotide probes suitable for the practice of this
invention include present (e.g. PNA) and future constructs which
sequence specifically interact with nucleic acid and which are
either neutral or positively charged under conditions wherein a
nucleic acid will electrostatically bind to a charged matrix.
1TABLE 1 Oligodeoxynucleotide Probes and Constructs Seq. ID
Description Oligodeoxynucleotide Sequence No. KRASWT(24)
Biotin-GTG-GTA-GTTA-GGA-GCT-GGT-GG- C-GTA-OH 1 KRASMU(24)
Biotin-GTG-GTA-GTT-GGA-GCT-TGT-GGC-G- TA-OH 2 2 KRASMU(31)
Biotin-GTG-GTA-GTT-GGA-GCT-TGT-GGC-GT- A-GGC-AAG-A-OH 3 WT-15Flu
Flu-ACG-CCA-CCA-GCT-CCA-OH 4 MU-15Flu Flu-ACG-CCA-CAA-GCT-CCA-OH 5
pBR322 5' primer HO-GCT-TGT-TTC-GGC-GTG-GGT-AT-OH 6 pBR322 3'
primer HO-TAG-GTT-GAG-GCC-GTT-GAG-CA-OH 7 KRAS 5' primer
HO-ATG-ACT-GAA-TAT-AAA-CTT-GT-OH 8 KRAS 3' primer
HO-CTC-TAT-TGT-TGG-ATC-ATA-TT-OH 9 CompDNA
HO-TCA-CTA-GTC-CCT-TCA-AGG-CTA-GCA-GTA-TAA- 10
TGG-GTT-CTA-GGT-AAA-CGT-TCC-ACC-GTT-ACT-OH NonCompDNA
HO-AGT-AAC-GGT-GGA-ACG-TTT-ACC-TAG-AAC-CCA- 11
TTA-TAC-TGC-TAG-CCT-TGA-AGG-GAC-TAG-TGA-OH
[0164] All oligodeoxynucleotides are illustrated from the 5' to the
3'. Stock solutions of the oligodeoxynucleotides were generally
prepared by dissolving the dry powder in TE Buffer (TE Buffer: 10
mM TRIS pH 8.3, 1 mM EDTA).
[0165] Materials:
2 PEI-Silica beads (gel) Amicon P/N PAE-300-15 HP-Sepharose Q beads
Pharmacia Biotech P/N 17-1014-03
[0166] Commercially available PEI derivatized beads were chosen for
these experiments since they were readily available as well
characterized commercial anion exchange chromatography packing
materials having a high density of positively charged functional
groups per unit area at neutral pH (pH of 7). Because they
possessed a high density of positively charged functional groups at
neutral pH, they possessed a favorable binding capacity for
oligonucleotides which are negatively charged (because each
phosphodiester comprises a single negative charge the charge of
each nucleic acid is length dependent) at neutral pH.
[0167] PEI-Silica and PEI-Sepharose beads were determined to be
essentially interchangeable in all experiments performed. However,
the PEI-Silica beads were found to have an intrinsic (native)
fluorescence when illuminated on the UV transilluminator, and for
that reason may be less suitable in some applications.
3TABLE 2 PNA Probes Description PNA Sequence WT-15Flu
Flu-OO-ACG-CCA-CCA-GCT-CCA-NH.sub.2 MU-15Flu
Flu-OO-ACG-CCA-CAA-GCT-CCA-NH.sub.2 MU-15
H.sub.2N-OO-ACG-CCA-CAA-GCT-CCA-NH.sub.2 Blocker BK.RAS-Cy3
Cy3-O-ACG-CCA-CCA-GCT-CCA-K(dabcyl)-NH.sub.2 UQ-Cy3
Ce-OO-TGA-TTG-CGA-ATG-K(Cy3)-NH.sub.2 RASWT-Cy3
Cy3-OOE-ACG-CCA-CCA-GCT-CCA-E-NH.sub.2 BioP-15
Ac-OE-TTA-TAC-TGC-TAG-CCT-EO-K(Bio)-NH.sub.2
[0168] All PNA sequences are written from the amine to the carboxyl
terminus. Abbreviations are: Ac=acetyl;
Flu=5(6)-carboxyfluorescein; dabcyl=4-((4-(dimethylamino)
phenyl)azo)benzoic acid; Bio=biotin; O=8-amino-3,6-dioxaoctanoic
acid; K=the amino acid L-Lysine; E=the solubility enhancer "4" as
represented in Gildea et al., Tett. Lett. 39 (1998) 7255-7258;
Ce=the group obtained by capping the PNA with the charged moiety
"7" as represented in Gildea et al., Tett. Lett. 39 (1998)
7255-7258 and Cy3=the cyanine 3 dye from Amersham. Stock solutions
of PNAs are generally prepared by dissolving the purified probe in
a solution containing 1/1 N,N'-dimethylformamide (DMF)/water at a
concentration of approximately 0.05 OD (260 nm) per .mu.L.
[0169] DNA Plasmid Templates:
[0170] The plasmids, pKRASMU(31) and pKRASWT, were used as
templates in PCR amplification reactions and were generated by
cloning a PCR amplicon from human DNA into the pCR2.1 plasmid
(Invitrogen). The mutant human DNA was prepared from a cell line,
Calu-1, which contains a point mutation at base 129 of the K-ras
gene. The wild type human DNA was prepared from a cell line, NCI,
which contains two copies of the wild type K-ras gene. Clones were
screened by restriction fragment analysis and sequence analysis.
Large preparations of the plasmid were generated and quantitated
using standard techniques. The amplified region flanks the K-ras
mutation and was 111 bp in length. dsDNA Template (amplified region
only)
4 .cent.3'primer hyb. site.fwdarw. 3'
GAGATAACAACCTAGTATAAGCAGGTGTTTTACTAAGACTTA . . . 5'
CTCTATTGTTGGATCATATTCGTCCACAAAATGATTCTGAAT . . .
[0171]
5 .cent.Linear Beacon Hyb. site.fwdarw. . . .
ATCGACTTAGCAGTTCCGTGAGAACGGATGCGGTG (G/T) TC GAGGTT . . . . . .
TAGCTGTATCGTCAAGGCACTCTTGCCTACGCCA- C (C/A) AG CTCCAA . . .
[0172] . . . GATGGTGTTCAAATATAAGTCAGTA 5' Seq. ID No. 12 (wt), 13
(mu)
[0173] . . . CTACCACAAGTTTATATTCAGTCAT 3' Seq. ID No. 14, (wt), 15
(mu)
[0174] <-5' primer hyb. site->
[0175] The position and sequence of the point mutation of the
amplicons is illustrated in parenthesis. Plasmid pBR322 was
obtained from New England BioLabs; P/N 300-3S.
6TABLE 3 Salt Buffers: Buffer ID Buffer Components: A 0 mM NaCl, 10
mM TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20. B 100 mM NaCl, 10 mM
TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20. C 200 mM NaCl, 10 mM
TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20. D 300 mM NaCl, 10 mM
TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20. E 400 mM NaCl, 10 mM
TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20. F 500 mM NaCl, 10 mM
TRIS-Cl pH 8.0, 1 mM EDTA, 0.1% Tween-20.
[0176] Electrophoresis Supplies:
7 10-20% polyacrylamide gel: ESA, catalog # 80-0015 10 .times. Gel
Buffer: ESA, catalog # 80-0132 4 .times. loading dye: 50% glycerol,
0.1 M Bromphenol Blue, 0.01 M Xylene Cyanol, 4 .times. ESA Gel
Buffer (diluted from ESA# 80-0132)
Example 8
General Properties of Polyethylene imine (PEI) Beads
[0177] Polyethylene imine (PEI) beads were examined to determine
physical characteristics such as particle size and shape as well as
chemical properties such as binding capacity of nucleic acid.
Particle size and concentration of beads suspended per unit of
volume were determined using a hemacytometer (Hausser Scientific;
Horsham, Pa.; Model # 3900).
[0178] Using the hemacytometer, the Sepharose beads were found to
generally be spherical in shape and have a diameter in the range of
approximately 20 to 50 .mu.m with an estimated average diameter of
30 .mu.m. The concentration of the suspended Sepharose beads was
estimated to be approximately 50,000 beads/.mu.L, after being
washed (per manufactures instructions) and redissolved in deionized
water.
[0179] Using the hemacytometer, the silica beads were found to also
generally be spherical in shape and have a diameter in the range of
approximately 5 to 15 .mu.m with an estimated average diameter of
approximately 10 .mu.m. The concentration of the suspended silica
beads was estimated to be approximately 150,000-200,000
beads/.mu.L, after being washed (per manufactures instructions) and
redissolved in deionized water.
[0180] The capacity of the silica and Sepharose beads to bind
nucleic acid was examined in 100 mM TRIS-HCl pH 7.5. The capacity
of the Sepharose beads was approximated to be about 0.75 OD.sub.260
of nucleic acid per .mu.L of beads, or approximately 1.1 E-5
OD.sub.260 of nucleic acid per bead. The capacity of the silica
beads was approximated by applicant to be about 0.4 OD.sub.260 of
nucleic acid per .mu.L of beads, or approximately 0.8 E-6
OD.sub.260 of nucleic acid per bead. For all experiments conducted,
these binding capacities were high enough such that all the nucleic
acid of the sample was expected to be electrostatically bound to
the support given the amount of matrix present in the assay and the
electrostatic binding conditions used.
Example 9
Preliminary Studies on [Salt] and pH
[0181] As discussed above, the silica and Sepharose beads are
commercially available anion exchange chromatography media. As
anion exchange chromatography often utilizes a salt gradient or pH
gradient to elute materials which are electrostatically bound
thereto, the effect of modulation in salt concentration and pH
variation on the binding of PNA and/or DNA probes to Sepharose
beads was studied to determine suitable electrostatic binding
conditions for subsequent experimentation.
[0182] i. [Salt]
[0183] To individual tubes containing 5 .mu.L of Sepharose beads
and 94 .mu.L of one of each of six salt solutions (Salt Buffers
A-F, See: Table 3, above) was added 5 pmole (in 1 .mu.L of an
appropriate solvent) of either DNA WT-15Flu (Table 1) or PNA
WT-15Flu (Table 2) probe. The tubes were vortexed, briefly
centrifuged and then examined under UV light to determine whether
the fluorescently labeled probes were still predominately in
solution or whether they had adsorbed onto the surface of the
beads.
[0184] The PNA probe (PNA WT-15Flu, Table 2) was found to be
predominately adsorbed to the beads when in Salt Buffers A and B,
but predominately in solution when all the buffers of higher salt
concentration were used. This results indicated that the
fluorescein labeled PNA probe would only bind to the beads at low
ionic strength (approximately 200 mM NaCl or below).
[0185] By comparison, the fluorescein labeled DNA probe, (DNA
WT-15Flu, Table 1) of identical subunit length and nucleobase
sequence, was found to be substantially adsorbed to the beads
except when Buffer F was present. In Buffer F, some of the probe
was observed in the solution. This data indicated that at least 500
mM NaCl was required to disrupt the electrostatic interactions of
the 15-mer DNA probe and the PEI on the surface to thereby free the
probe from the matrix.
[0186] Though the difference of 200 mM NaCl to release the PNA
15mer as compared with 500 mM for release of the DNA 15mer was
significant enough to be useful for the practice of may embodiments
of this invention, the requirement for 200 mM NaCl to release PNA
probe from the PEI surface was surprising and therefore prompted
subsequent examination. Upon further analysis, the presence of the
fluorescein label (5(6)-carboxyfluorescein)- , which possess two
negative charges at neutral pH, was determined to be the primary
reason for the strong electrostatic interactions between the PNA
probe and the PEI derivatized beads.
[0187] By way of example, a Cy3-labeled PNA 15-mer (UQ-Cy3, Table
2) which comprised a positively charged capping group was examined
in the Salt Buffers listed in Table 3, above. It was found that the
Cy3 labeled PNA did not bind to the beads even in Salt Buffer A.
Furthermore, free fluorescein was found to be substantially
adsorbed to the beads in Salt Buffer A, whereas; the Cy3 dye did
not. Finally, it was determined that 1 .mu.L of the Sepharose beads
could adsorb as much as 5 pmole of 5(6)-carboxyfluorescein when in
Salt Buffer A. Consequently, this data suggests that it was the
fluorescein label and not the PNA portion of the oligomer which
exhibited the strong interaction with the PEI derivatized beads in
Salt Buffers A and B. Thus, it is believed that native PNA does not
substantially electrostatically bind to the PEI even under low salt
conditions (e.g. Salt Buffer A). This is consistent with
expectations since PNA is neutral and should therefore not be
expected to electrostatically bind to the PEI derivatized
beads.
[0188] ii. pH Effects:
[0189] Because the net charge on the PNA backbone should not change
dramatically at pH in the range of 5-10, the effect of modulation
in pH upon the binding of PNA to PEI derivatized beads was not
examined. However, the pH dependency of DNA binding to PEI
derivatized silica beads was examined to determine working
parameters for subsequent experimentation. The results of
experiments can be summarized as follows: At pH 7.3, the WT-15Flu
DNA probe stayed bound to the silica beads up to 0.8 M NaCl,
whereas; at pH 8.3, the same probe did not bind to the beads at
NaCl concentrations in excess of 0.1 M.
[0190] These results can be correlated with the number of expected
positively charged functional groups of the PEI support. The higher
capacity at pH 7.3 indicates that the support is more highly
charged (higher charge density) under these conditions. However, at
pH 8.3, the pH of the solution is approaching the pK of the
secondary amine of the PEI and therefore the support begins to
become neutralized (fewer positive charges per unit area). With
fewer positive charges, each bead has a lower affinity for the
negatively charged oligodeoxynucleotides. Therefore, less salt is
required to disrupt the electrostatic interactions and thereby
release the DNA into the solution.
Example 10
Preliminary Examination of Hybrid Formation of Immobilized DNA
[0191] A study was conducted to determine whether hybridization of
the PNA probes would occur with nucleic acid electrostatically
immobilized to the surface of the Sepharose beads. For this
experiment, 1 pmole of the MU-15Flu PNA probe was allowed to
hybridize to 0.5 pmole of the KRASMU(31) DNA target which was
either free in solution or electrostatically bound to Sepharose
beads (1 .mu.L of a 1:10 dilution of bead stock in Buffer E). "PNA
only" (probe) and "DNA only" (target sequence) controls were also
examined. The hybridization reactions were allowed to proceed for
approximately 2 minutes, after which, 1 .mu.L of the 1:10 dilution
of bead stock was added to the sample which did not initially
contain Sepharose beads.
[0192] The hybridization reaction contents were then suctioned into
individual capillary pipettes from which the liquid was wicked
thereby leaving behind the beads and any bound and fluorescently
labeled PNA/DNA hybrids. The "PNA only" and "DNA only" controls
were found to be non-fluorescent under UV light. However, by visual
inspection, both of the PNA/DNA hybridization reactions were
equally fluorescent. Consequently, this data indicates that the PNA
can hybridize with roughly equivalent efficiency to both the DNA
electrostatically immobilized to a Sepharose beads as well as it
can hybridize to the DNA free in solution.
Example 11
Efficiency of Electrostatic Capture and Release
[0193] A study was performed to determine the efficiency of the
electrostatic capture and release of nucleic acid at very low
nucleic acid concentrations. Because the amount of nucleic acid was
extremely small, the polymerase chain reaction (PCR) was used to
quantify the captured and recovered nucleic acid. The plasmid
pBR322 (New England Biolabs; PN/P/N 300-3S) was used at
concentrations ranging from 5 E+11 to 5 E+5 molecules
(approximately 1 attomole) per microliter.
[0194] Plasmid DNA was captured over a period of 5 minutes using 1
.mu.L of PEI-Silica beads in 20 .mu.L of 100 mM TRIS-HCl, pH 7.6.
After capture, the samples were pelleted by centrifugation, the
supernatants were removed, and the beads were washed with 1000
.mu.L of 100 mM TRIS-HCl pH 7.6 to removed non-specifically bound
material. The plasmid DNA was then released from the beads by
treatment with 10 .mu.L of a high salt buffer containing 2 M NaCl
and 100 mM TRIS-HCl pH 7.6. One microliter of each bead eluate was
then added to 99 .mu.L of 100 mM TRIS-HCl pH 7.6 to dilute the NaCl
concentration down to a level acceptable for PCR. Two microliters
of each diluted sample was then added to a 50 .mu.L PCR
reaction.
[0195] In addition, each PCR reaction also contained, 5 pmole of 5'
pBR322 primer, 5 pmole of 3' pBR322 primer, 3 mM MgCl.sub.2, 250
.mu.M NTPs, 2.0 units AmpliTaq DNA polymerase, 50 mM KCl, and 10 mM
Tris-HCl pH 8.3 (PCR reagents including 10.times. buffer, magnesium
chloride solution, AmpliTaq DNA polymerase, and nucleotide
triphosphates were obtained from Perkin-Elmer, Foster City,
Calif.). Reactions were performed in mini-eppendorf tubes using a
Perkin-Elmer 2400 thermocycler. The PCR protocol involved a 20
second warm up to 95.degree. C. (1st round only), followed by
denaturing at 95.degree. C. for 20 seconds, annealing at 56.degree.
C. for 20 seconds, and extension at 74.degree. C. for 20 seconds.
The denaturation-annealing-extension cycle was repeated for 30
cycles, followed by a final extension step at 74.degree. C. for 5
minutes.
[0196] All of the samples were run on a polyacrylamide gel after
PCR, and all contained detectable levels of the correct sized
amplicon, though the most dilute sample (5 E+5 input molecules) was
barely detectable. The amount of DNA in the PCR reaction was
actually 500 fold less (1 E+3 molecules) due the dilution necessary
to remove salt, as described above. In a control experiment run at
the same time, 1 E+3 molecules was the limit of detection of pBR322
by 30 cycles of PCR. These results suggest that at 5 E+5 molecules
of input template, the majority of the plasmid DNA initially added
to the matrix was captured and released.
Example 12
Self-indicating PCR Assays
[0197] Self-indicating and closed-tube assays are becoming
increasingly popular for their ability to streamline, simplify and
potentially automate routine nucleic acid analysis assays. Also,
closed-tube assays prevent carry-over contamination between samples
which is a major source of false positive results in nucleic acid
diagnostics. Since the concentration of detectable moieties is an
advantage associated with the electrostatic binding of nucleic
acids to matrices, it was envisioned that it might be possible to
create a self-indicating PCR assay wherein the fluorescence of the
matrix enclosed in the reaction, at the time the reaction
components are mixed, could be used to determine the result of a
PCR amplification by mere visual or instrument monitoring of the
tube during and/or after PCR was completed.
[0198] Point mutation analysis is another important objective of a
nucleic acid diagnostic test since accurate determination of a
specific point mutation of genetic material in a sample is often a
decisive factor in the proper identification of genetic disorders
and other disease states. As discussed in the specification,
blocker probes can be used to improve single point mutation
analysis of a probe-based assay beyond the limits which are
possible by the precise optimization or control of stringency.
Thus, it was envisioned that the use of PNA Blocker probes in
conjunction with Linear Beacons would facilitate the development of
a self-indicating probe based assay capable of point mutation
discrimination which would generate a result which could be
interpreted by visual inspection or by instrument analysis during
and/or after the PCR was completed.
[0199] For Examples A and B, asymmetric PCR was utilized because
asymmetric PCR yields a significant excess of single stranded
nucleic acid. Since it is possible to choose which of the strands
of the amplicon are preferentially amplified by judicious
adjustment of the ratio of 5' and 3' primers, it was possible to
design the assay so that the target sequence to which the
non-nucleotide probe hybridizes was contained within the over
produced single stranded nucleic acid of the asymmetric PCR
assay.
[0200] For Examples A and B, a Linear Beacon was chosen as the
non-nucleotide probe since Linear Beacons are inherently
non-fluorescent (or very slightly fluorescent) until hybridized to
the target sequence. This approach was advantageous since the
reaction cocktail containing the Linear Beacon would remain
relatively non-fluorescent throughout the assay and in theory, only
the beads would become fluorescent provided the target sequence was
generated and electrostatically bound to the matrix (beads). Thus,
the Linear Beacon (BK.RAS-Cy3; See Table 2, above) was designed to
hybridize to the over produced strand of a region of dsDNA (See:
illustration on p. 28) sought to be amplified and was added to the
PCR cocktail before thermocycling. The Linear PNA Beacon was
labeled with Cy3 since prior experiments had demonstrated that the
negatively charged fluorescein label exhibited an affinity for the
PEI coated beads at salt concentrations of less than 200 mM.
[0201] Though Linear Beacons may hybridize to the target sequence
during thermocycling, significant inhibition of the amplification
process was not observed. Consequently, the PCR amplification was
successfully monitored using the detectable fluorescent signal of
the Linear Beacon which was generated on the surface of the beads
in response to the activity of the PCR reaction. The data presented
conclusively demonstrates the feasibility of using Linear Beacons
for the detection or point mutation analysis of nucleic acid
electrostatically bound to a matrix which has been generated by
amplification in a closed tube assay. As evidenced by FIGS. 1 and
3, the result can be determined by mere visual inspection of the
final assay sample still in the tube. Since fluorescence is visible
to the naked eye, a sensitive instrument, such as a Prism 7700,
would be suitable for real-time or end-point automated sample
analysis. The figures further demonstrate that concentration of the
samples on the matrix makes it possible to improve the limits of
detection of the assay since the signal intensity on the beads is
far more intense than the signal generated by the bulk fluid when
the Linear Beacon is free in solution.
[0202] A. Asymmetric PCR with Linear Beacons
[0203] PCR Materials & Methods:
[0204] This experiment comprised five individual PCR reactions.
Variable factors examined within the set of five reactions included
the presence or absence of PEI derivatized Sepharose beads
(approximately 25,000 PEI-Sepharose beads), the presence or absence
of plasmid template (pKRASWT at 20 fmole per 50 .mu.L reaction (0.4
nM)) and the presence or absence of thermocycling (TMC). Table 4,
below, summarizes the composition of various tubes with respect to
these variable factors. In addition, each PCR reaction contained
1.5 .mu.L of 100% glycerol, 0.5 .mu.L of water (control) or
Sepharose beads, 45 pmole of KRAS 5' primer, 5 pmole of the KRAS 3'
primers, 3 mM MgCl.sub.2, 250 .mu.M NTPs, 2.0 units AmpliTaq DNA
polymerase, 50 mM KCl, 10 mM TRIS-Cl pH 8.3 and 50 pmole BK.RAS-Cy3
non-nucleotide probe (Linear Beacon) in a total volume of 50 .mu.L.
During preparation and prior to PCR, the tubes were carefully
handled to avoid mixing of components.
[0205] The PCR protocol involved a 20 second warm up to 95.degree.
C. (1st round only), followed by denaturing at 95.degree.C. for 5
seconds, annealing at 55.degree. C. for 30 seconds, and extension
at 74.degree. C. for 30 seconds. The
denaturation-annealing-extension cycle was repeated for 50 cycles,
followed by a final extension step at 74.degree. C. for 5
minutes.
[0206] After thermocycling, the tubes were placed on a
transilluminator and the fluorescence examined by eye. Thereafter,
the tubes were vortexed and then centrifuged for 2 minutes to
concentrate the beads at the tube bottom. No significant difference
was observed whether or not the tubes were vortexed and centrifuged
before viewing. This indicated that the glycerol did not affect the
end point result.
[0207] Notes:
[0208] 1. The glycerol was added to temporarily shield the beads
from the reaction components in the early stages of PCR so that the
process would not be substantially inhibited by electrostatic
binding of the primers to the matrix (beads) during the critical
early thermocycles. Subsequent investigations have demonstrated
that the presence of a temporary shield is not essential to achieve
an accurate result but is nevertheless preferred.
8TABLE 4 Variable Factors Tube # PEI-Beads Template TMC 1 --
pKRASWT no 2 -- -- yes 3 -- pKRASWT yes 4 Sepharose -- yes 5
Sepharose pKRASWT yes
[0209] Post PCR Workup/Analysis:
[0210] After PCR, tubes 1-5 were placed on a transilluminator to
visualize fluorescence and then photographed. FIG. 1A is a negative
of the scanned image of the photograph taken of the five
mini-eppendorf tubes immediately after PCR (tubes are labeled 1-5).
After the photograph was taken, 0.5 .mu.L of the PEI-Sepharose bead
stock was added to tubes 1-3. The five tubes were then vortexed,
centrifuged and again placed on the transilluminator and again
photographed. FIG. 1B is a negative of the scanned image of the
second photograph of the five mini-eppendorf tubes.
[0211] After re-photographing the tubes, the supernatants were
decanted and the beads were washed with 100 .mu.L of a solution
containing 50 mM NaCl and 100 mM TRIS-HCl pH 7.6. Washing involved
adding the wash buffer, vortexing briefly, centrifuging and then
decanting. The electrostatically bound nucleic acids were then
released from the beads for analysis by vortexing in a solution
containing 10 .mu.L of 0.05% ammonium hydroxide and 2.0 M NaCl.
Supernatants were removed and transferred to a microwell plate
where they were neutralized with 1 .mu.L 0.1 N hydrochloric acid.
To each well was added 4 .mu.L of 4.times. loading dye. Finally, 15
.mu.L of each sample was then run on a 10-20% gradient gel to
confirm nucleic acid amplification and identify product size.
[0212] FIGS. 2A and 2B are the negative of images of photographs of
the same 10-20% gradient polyacrylamide gel illuminated on a UV
transilluminator which were taken before and after ethidium bromide
staining, respectively.
[0213] Results:
[0214] Tube Images/Photographs
[0215] With regard to analysis of the images of the photographs,
please note that although black and white photographs were taken,
visual inspection of the tubes was consistent with the dark to
light contrast seen in the images except that the Cy3 dye appeared
as orange to the eye under the transilluminator. Furthermore, the
negative (generated electronically) of the scanned image is shown
since it is believed that the contrasts of the negative image are
superior for illustration and will be more accurately reproduced by
photocopying.
[0216] With reference to FIG. 1A, the results are as expected. Tube
1 was a control which was not exposed to thermocycling and
therefore little or no fluorescence was observed (the tube contents
appear clear in contrast to the background). Likewise, tubes 2 and
4 contained no template and therefore little or no fluorescence was
observed in solution (tube 2) or on the beads (tube 4) since no
amplification should have occurred. Tube 3, however, was
fluorescent as expected since amplification of the template should
have produced the 111 bp amplicon to which the Linear Beacon
hybridized to generate detectable signal. Nevertheless, since no
Sepharose was present, the solution was visibly orange as compared
with tubes 1, 2 and 4. Likewise, tube 5 contained highly
fluorescent (orange by eye; dark in the negative of the image)
beads as expected since amplification of the template should have
produced the 111 bp amplicon (electrostatically bound to the bead
matrix) to which the Linear Beacon hybridized to generate a
detectable signal.
[0217] With reference to FIG. 1B, the results are also as expected.
Specifically, the addition of the Sepharose beads to tubes 1-3 only
affected the fluorescence of tube 3. In particular, the orange
fluorescence which was observed to be in solution prior to the
addition of the Sepharose beads, was concentrated on the bead
surface (dark in the negative of the image) after bead addition.
Furthermore, the intensity of the fluorescence of tube 3, which
could be determined visually, was comparable to the fluorescence
intensity of the beads in tube 5. Thus, there appears to be no
difference in the result whether or not the matrix is added before
or after the PCR reaction is performed.
[0218] In summary, the data presented in FIGS. 1A and 1B indicate
that it is possible to perform self-indicating amplification assays
wherein signal of a probe can be concentrated on a matrix to which
an amplified target nucleic acid is electrostatically
immobilized.
[0219] Gel Photographs/Images:
[0220] Analysis of the PCR reactions by gel was performed to
determine the presence and size of amplicons to thereby confirm
that the visual analysis of the tubes correlated with expected
products of PCR amplification.
[0221] With reference to FIGS. 2A and 2B, the wells of the gel are
at the top of the photographs. Aliquots of each tube were added
near the top of the gel and electrophoretically directed towards
the bottom of the gel. Lanes 2 and 8 contain two different double
stranded DNA size markers; lane 2 is .O slashed.X174/HaeIII (New
England BioLabs #303-1S) and lane 8 is a 100 bp ladder (New England
BioLabs #323-1L). Band sizes are indicated in FIG. 2B. Lanes 3-6
contain samples of released nucleic acid isolated from the beads in
tubes 2 through 5 respectively and lane 7 contains material
released from the beads in tube 1.
[0222] With reference to FIG. 2A, the presence of inherently
fluorescent bands can be seen in lanes 4 and 6 (from tubes 3 and 5
respectively) toward the bottom of the image. The fluorescent bands
can be attributed to the presence of the Linear Beacon still
hybridized to the nucleic acid amplicon even after it has migrated
into the gel. This result is consistent with amplification in tubes
3 and 5 as indicated by the visual analysis of the tubes. By
comparison, there are no visible fluorescent bands in any of lanes
3, 5, and 7. This result is consistent with the lack of
amplification as indicated by visual analysis of the tubes.
[0223] With reference to FIG. 2B, all nucleic acid is fluorescent
because it is stained with ethidium bromide. Therefore, the size
markers in lanes 2 and 8 are now visible. Strong fluorescent bands
having a size consistent with the expected 111bp product are
visible in lanes 4 and 6 but are absent in lanes 3, 5 and 7. This
data confirms production of the intended amplicon only in tubes 3
and 5 and further confirms that the nucleic acid was recovered from
material originally electrostatically bound to the Sepharose
beads.
[0224] In summary, the data presented in FIGS. 1A and 1B, when
considered with the data presented in FIGS. 2A and 2B, conclusively
demonstrates that it is possible to perform self-indicating
amplification assays wherein signal of a probe can be concentrated
on a matrix to which an amplified target nucleic acid is
electrostatically immobilized.
[0225] Single Point Mutation Analysis
[0226] This experiment was used to examine whether or not it was
possible to achieve point mutation discrimination in the
self-indicating probe-based assay. Unless otherwise stated, this
experiment was conducted essentially as described in part A, above,
except that an unlabeled PNA oligomer (blocker probe) was added to
achieve single point mutation discrimination. Since control
reactions not containing the blocker probe were performed, a
comparison of the results obtained in the presence and absence of
blocker probe clearly demonstrates the remarkable improvement in
target sequence identification resulting from the presence of the
blocker probe.
9TABLE 5 Variable Factors Tube # PEI-Beads Template Blocker Probe 1
-- -- -- 2 -- pKRASWT -- 3 -- pKRASMU(31) -- 4 Sepharose -- -- 5
Sepharose pKRASWT -- 6 Sepharose pKRASMU(31) -- 7 Sepharose --
MU-15Blocker 8 Sepharose pKRASWT MU-15Blocker 9 Sepharose
pKRASMU(31) MU-15Blocker
[0227] PCR Materials & Methods:
[0228] This experiment comprised nine individual PCR reactions.
Variable factors examined within the set of nine reactions included
the presence or absence of PEI derivatized Sepharose beads
(approximately 25,000 PEI-Sepharose beads), the presence or absence
of plasmid template (pKRASWT or pKRASMU(31) at 100 fmole per 50
.mu.L reaction (0.4 nM)) and the presence or absence of 400 pmole
of PNA Blocker Probe (MU-15Blocker, See: Table 2). The total volume
of the PCR reactions including glycerol and beads was 50 .mu.L.
[0229] Table 5, below, summarizes the composition of various tubes
with respect to these variable factors. In addition, each PCR
reaction contained 45 pmole of the KRAS 5' primer, 5 pmole of the
KRAS3' primer (See: Table 1), 3 mM MgCl2, 250 .mu.M NTPs, 2.0 units
AmpliTaq DNA polymerase, 50 mM KCl, 10 mM TRIS-HCl pH 8.3, 50 pmole
BK.RAS-Cy3 (See: Table 2) non-nucleotide probe (Linear Beacon), 1.5
.mu.L of glycerol and 0.5 .mu.L of Sepharose beads or water
(control). The glycerol overlaid the beads to temporarily shield
the them from the reaction components in the early stages of PCR so
that the process would not be substantially inhibited by
electrostatic binding of the primers to the matrix (beads) during
the critical early thermocycles. During preparation and prior to
PCR, the tubes were carefully handled to avoid mixing of
components.
[0230] The PCR protocol involved a 20 second warm up to 95.degree.
C. (1st round only), followed by denaturing at 95.degree. C. or 5
seconds, annealing at 55.degree. C. for 30 seconds, and extension
at 74.degree. C. for 30 seconds. The
denaturation-annealing-extension cycle was repeated for 30
cycles.
[0231] Post PCR Workup/Analysis:
[0232] After PCR, tubes 1-9 were placed on a transilluminator to
visualize fluorescence and then photographed. FIG. 3 is a negative
of the scanned image of the photograph taken of the nine
mini-eppendorf tubes immediately after PCR (tubes are labeled
1-9).
[0233] After photographing, the tubes were vortexed briefly, then
centrifuged briefly to concentrate the beads. The supernatants were
removed and the beads were washed with 100 .mu.L 50 mM NaCl, 100 mM
TRIS-Cl pH 7.6. The electrostatically bound nucleic acids were then
released from the beads for analysis by vortexing in 10 .mu.L of a
solution containing 100 mM CAPSO pH 10.7 and 2 M NaCl. The solution
was then separated from the beads and 9 .mu.L of each of the
recovered solutions was combined with 3 .mu.L of 4.times. loading
dye. A sample from each tube was then run on a 10-20% gradient gel
to confirm nucleic acid amplification and identify product size.
FIGS. 4A and 4B are the negative of the images of photographs of
the same 10-20% gradient polyacrylamide gel illuminated on a UV
transilluminator which were taken before (FIG. 4A) and after (FIG.
4B) ethidium bromide staining.
[0234] Results:
[0235] Tube Images/Photographs
[0236] With reference to FIG. 3, tube 1 was a negative control
containing no template and as expected, is not fluorescent after
PCR (the tube contents resemble the background in the negative of
the image). However, the contents of tubes 2 and 3 were visibly
fluorescent under the transilluminator (darker than tube 1 in the
negative of the image). This was the expected result for tube 2,
since amplification of the template should have produced the 111 bp
amplicon containing a target sequence to which the Linear Beacon is
perfectly complementary. However, the amplicon generated in tube 3
contained a sequence containing a point mutation of the wild type
amplicon. However, in the absence of the blocker probe, the Linear
Beacon probe will at least partially hybridize to the mutant
amplicon generated from plasmid pKRASMU(31) under the hybridization
conditions present since the mutant and wild type amplicons are so
closely related. Partial hybridization causes enough fluorescent
signal generation to be visible to the eye under the
transilluminator. Since no Sepharose beads were present in tubes 2
and 3, the orange color (darkness of the negative image) of the
hybridized Linear Beacons is evenly distributed throughout the
solution. Because the signal was not concentrated it did not
produce a strong signal in the Figure.
[0237] The reagent composition of tubes 4 through 6 are identical
to tubes 1 though 3, respectively, except that PEI-Sepharose beads
were present during the PCR reaction. With reference to FIG. 3,
tube 4 was a negative control containing no template and as
expected, the solution and Sepharose beads are not fluorescent
after PCR as compared with tubes 5 and 6 (the tube contents and
beads resemble the background in the negative of the image). With
reference to tubes 5 and 6, the Sepharose beads at the bottom of
the tubes have become highly fluorescent with the intensity of tube
5 being slightly more intense as compared with tube 6. This result
is as expected since amplification of the template should have
produced the 111 bp amplicon (electrostatically bound to the bead
matrix) to which the Linear Beacon hybridized to generate
detectable signal. The fluorescent intensity of tube 6 is lower
since the Linear Beacon is not perfectly complementary to the
amplicon but can at least partially hybridize to generate
detectable signal under the hybridization conditions present.
Because there is little difference between tubes 5 and 6, visual
inspection of the tubes however, does not allow one to confirm
whether or not the sample contained mutant or wild type target
sequence and is therefore not necessarily suitable for single point
mutation analysis.
[0238] Upon comparison of tubes 2 and 3 with the intensity of
signal from tubes 5 and 6, it becomes clear that concentration of
the detectable fluorescent signal on the beads allows one to more
clearly detect a positive result since the beads in tubes 5 and 6
are more clearly positive as compared with the solutions in tubes 2
and 3.
[0239] The reagent composition of tubes 7 through 9 are identical
to tubes 4 though 6, respectively, except that in tubes 7-9, 400
pmole of MU15Blocker probe was added prior to PCR amplification.
With reference to FIG. 3, tube 7 was a negative control containing
no template and as expected, the Sepharose beads are not
fluorescent after PCR as compared with tubes 8 and 9 (the tube
contents and beads resemble the background in the negative of the
image). Because the blocker probe is present, only the beads in
tube 8 are clearly fluorescent as compared with the contents of
tubes 7 and 9. Thus, visual inspection of the tubes will allow one
to confirm whether or not the sample contained mutant or wild type
target sequence. Therefore, this self-indicating assay is suitable
for single point mutation/discrimination analysis. It will be
appreciated by those of ordinary skill in the art that quantitation
of detectable signal can be achieved by using an instrument, such
as a flow cytometer, and no more than routine experimentation.
[0240] In summary, the data presented in FIG. 3 indicates that it
is possible to perform homogeneous or closed tube amplification
assays wherein signal of a probe can be concentrated on a matrix to
which an amplified target nucleic acid is electrostatically
immobilized. Furthermore, when utilizing blocker probes, the assay
can be used for single point mutation analysis.
[0241] Gel Photographs/Images:
[0242] Analysis of the PCR reactions by gel was performed to
determine the presence and size of amplicons to thereby confirm
that the visual analysis of the tubes correlated with expected
products of PCR amplification.
[0243] With reference to FIGS. 4A and 4B, the wells of the gel are
at the top of the photographs. The images in FIGS. 4A and 4B are
not directly comparable since the photographs were made using
different exposure parameters. Aliquots of each tube were added
near the top of the gel and electrophoretically directed towards
the bottom of the gel. Lanes 1 and 12 contain two different double
stranded DNA size markers; lane 1 is 100 bp ladder (New England
BioLabs #323-1L) and lane 12 is a 1000 bp ladder (New England
BioLabs #323-2S). Band sizes are indicated in FIG. 4B. Lanes 2-4
contain 9 .mu.L of samples 1-3 respectively, lanes 5-10 contain
samples of released nucleic acid isolated from the beads in tubes 4
through 9 respectively, and lane 11 is a blank.
[0244] With reference to FIG. 4A, the presence of inherently
fluorescent bands can be seen in lanes 3, 4, 6, 7, and 9 (from
samples 2, 3, 5, 6 and 8 respectively) toward the bottom, and in
the middle of the image. The fluorescent bands at the bottom of the
image are most likely probe molecules which have migrated into the
gel. The fluorescent bands in the middle of the image can be
attributed to the presence of the Linear Beacon still hybridized to
the nucleic acid amplicon even after it has migrated into the gel.
This result is consistent with amplification in tubes 2, 3, 5, 6
and 8 as was indicated by the visual analysis and photographing of
the tubes. By comparison, there are no visible fluorescent bands in
any of lanes 2, 5, 8, and 10 (tubes 1, 4, 7 and 9). This result is
consistent with the lack of fluorescence observed in these
tubes.
[0245] With reference to FIG. 4B, all nucleic acid is fluorescent
because it is stained with ethidium bromide. Therefore, the size
markers in lanes 1 and 12 are now visible. Strong fluorescent bands
having a size consistent with the expected 111bp product are
visible in lanes 3, 4, 6, 7, 9 and 10 (tubes, 2, 3, 5, 6, 8 and 9)
but are absent in lanes 2, 5, and 8 (tubes 1, 4 and 7). This data
confirms production of the intended amplicons in tubes 2, 3, 5, 6,
8 and 9 and further confirms that the nucleic acid was recovered
from material originally electrostatically bound to the Sepharose
beads. Most noteworthy is the presence of a bands in both lanes 8
and 10 (tubes 7 and 9). These bands confirm that amplification
occurred in these samples. Therefore the lack of signal in tube 9
as compared with tube 7 can only be attributable to the presence of
the blocker probe which allow one to achieve point mutation
discrimination of the amplicon.
[0246] In summary, the data presented in FIGS. 4A and 4B, when
considered with the data presented in FIG. 3, conclusively
demonstrate that it is possible to perform self-indicating
probe-based assays suitable for single base discrimination (single
point mutation discrimination) wherein signal of a probe can be
concentrated on a matrix to which an amplified target nucleic acid
is electrostatically immobilized.
Example 13
Comparison of Assay Operating Range for PNA:DNA and DNA:DNA
Hybrids
[0247] This example is designed to compare the operating range for
electrostatic binding of non-nucleotide probes (e.g. PNA) with that
of the most nearly equivalent nucleic acid probes in an
electrostatic binding assay for a nucleic acid target molecule
which is nearly equivalent in size to the probe. The goal is
therefore to determine a range of ionic strength under which the
non-nucleotide and polynucleotide probes will bind to the matrix
only if the nucleic acid target is present. For this example, a PNA
probe (WT-15Flu PNA; See Table 2) and a DNA probe (WT-15Flu; See
Table 1) was diluted in water to a concentration of 5 .mu.M. The
nucleic acid target (KRASWT(21); See Table 1) was also diluted in
water to a concentration of 50 .mu.M.
10TABLE 6 Salt Buffers: Buffer ID Buffer Components: G 0 mM NaCl,
10 mM TRIS-Cl pH 8.0 H 100 mM NaCl, 10 mM TRIS-Cl pH 8.0 I 200 mM
NaCl, 10 mM TRIS-Cl pH 8.0 J 300 mM NaCl, 10 mM TRIS-Cl pH 8.0 K
400 mM NaCl, 10 mM TRIS-Cl pH 8.0 L 500 mM NaCl, 10 mM TRIS-Cl pH
8.0 M 600 mM NaCl, 10 mM TRIS-Cl pH 8.0 N 700 mM NaCl, 10 mM
TRIS-Cl pH 8.0
[0248] Next, four sets of eight eppendorf tubes were prepared with
100 .mu.L of each of the eight salt buffers described in Table 6.
The four sets of tubes comprised the following experimental
conditions: Into Set I was added the PNA probe but no nucleic acid
target (KRASWT(21). This is the "no target" control. Into Set II
was added the PNA probe and the nucleic acid target (KRASWT(21).
Into Set III was added the DNA probe but no nucleic acid target
(KRASWT(21). This is the "no target" control. Into Set IV was added
the DNA probe and the nucleic acid target (KRASWT(21).
[0249] These samples were prepared by adding one microliter of the
appropriate stock of PNA probe or DNA probe to each tube in Sets I,
II, III and IV to thereby achieve a final concentration of 250 nM
probe. To each tube in Sets II and IV was also added one microliter
of the stock of nucleic acid target (KRASWT(21) to thereby create a
sample having a final concentration of 2.5 .mu.M target. To the "no
target" control Sets I and III, one microliter of water was
added.
[0250] All tubes were vortexed briefly to mix.the ingredients, and
held at room temperature for approximately 5 minutes to allow
hybridization of the probes and targets. To each tube was then
added one microliter of PEI Sepharose particles suspended in water.
The tubes were vortexed briefly, allowed to stand at room
temperature for approximately 5 minutes, then centrifuged for 30
seconds to concentrate the particles at the bottom.
[0251] Tubes were then arranged over a UV light source
(transilluminator) and photographed. The negative image of the
photograph is presented as FIG. 5. Supernatants were then removed
and discarded. Next, 100 .mu.L of the appropriate salt buffer was
added back to the appropriate tubes. The PEI particles were
resuspended in the hybridization buffer by vortexing vigorously and
then each suspended particle sample was transferred to an
individual well in a microtiter plate. The samples in the
microtiter plate were immediately analyzed (Wallac, Victor, 1420
Multilabel Counter, Gaithersburg, Md.). The results of the analysis
of fluorescence on the beads is presented in Table 7.
[0252] Results:
[0253] Tube Images/Photographs
[0254] With reference to FIG. 5, the four sets of tubes are
arranged in order from top to bottom. Within each set, the tubes
are arranged in order of increasing salt concentration from left to
right. For example, the tube closest to the upper left comer of the
Figure is Set I, Buffer G (0.0 M NaCl), and the tube nearest the
lower right comer is Set IV, Buffer N (0.7 M NaCl).
[0255] With reference to FIG. 5, Set I, the lack of fluorescent
signal at the bottom of the tube indicates that the PNA probe has
very little affinity for the particles in the absence of the
nucleic acid target (KRASWT(21). In Set II by comparison, the PNA
probe is concentrated on the matrix to a salt concentration of
approximately 300 mM (See Salt Buffer J). This result is consistent
with hybridization of the probe to the target sequence
electrostatically bound to the matrix. The lack of probe
concentrated on the matrix at salt concentrations above 300 mM is
likely due to the lack of binding of the short nucleic acid target
(KRASWT(21) at those salt concentrations. Taken as a whole, the
data indicates that the PNA probe does not interact with the matrix
under any conditions of ionic strength examined. Thus, the
applicable range for the assay utilizing this PNA probe is at least
0-700 mM salt.
[0256] With reference to FIG. 5, Set III, the DNA probe is
substantially concentrated on the matrix up to a salt concentration
of approximately 300 mM (See Salt Buffer J) and weakly up to a salt
concentration of 400 mM (See Salt Buffer K). This data indicates
that the native DNA probe has a substantial inherent affinity for
the matrix. By comparison, Set IV, indicates that the probe/target
sequence hybrid raises the presence of probe strongly concentrated
on the matrix up to a salt concentration of approximately 400 mM
(See Salt Buffer K) and weakly up to a salt concentration of 500 mM
(See Salt Buffer L). Therefore the operating range for
discriminating probe from probe/target sequence complex when using
this all DNA system is approximately 300 to 500 mM salt. This a
very narrow operating range by comparison with the PNA probe. Note:
The apparent conflict between the results of Experiment 9 and the
results described above, wherein the PNA probe WT-15Flu detectably
binds to the matrix up to 100 mM salt (Exp. 9) but does not
interact with the support even in 0 mM salt, has been confirmed to
be condition dependent. The buffer in Experiment 9 contains
Tween-20 which appears to promote the interaction of the PNA probe
with the support. Additionally, the PNA probe in this experiment
was first added to water from the concentrated stock of 1/1
DMF:water which appears to decrease the interaction of the PNA
probe with the support. To avoid doubt, all data is consistent with
the fluorescein label being the primary source of interaction with
the matrix which was an apparent result of Experiment 9.
[0257] Quantitation of Particle Associated Fluorescence
[0258] The visual comparison of the tube was also confirmed by
quantitative analysis of fluorescence of the resuspended beads. The
quantitative fluorescence measurements as well as derived data for
the beads is presented in Table 7.
[0259] With reference to Table 7, the raw fluorescent reading from
each sample (Sets I-IV; rows B-E, respectively) of suspended
particles at each of the salt buffers (Buffers G-N; columns 2-9,
respectively) is presented. From this data the signal to noise data
for PNA probe (row F) and DNA probe (row G) is mathematically
derived from the raw fluorescence data. For example, the raw
fluorescent value obtained for Buffer G in Set I (column 2, row
B=738 rlu) was divided into the raw fluorescent value of Buffer G
in Set II (column 2, row C=12736 rlu) to obtain the S/N value for
the PNA probe in Buffer 0 of 17.3 rlu (12736.div.738=17.3 (column 2
row F)).
11TABLE 7 Bead Fluorescence Data 1 2 3 4 5 6 7 8 9 A Buffer# G H I
J K L M N B Set I 738 652 618 956 696 1052 992 1124 C Set II 12736
12052 11212 8610 1726 830 420 660 D Set III 36422 39807 33577 28001
7572 5750 5286 4640 E Set IV 36170 47133 46570 43731 43495 13020
2284 1710 F PNA S/N 17.3 18.5 18.1 9.0 2.5 0.8 0.4 0.6 G DNA S/N
1.0 1.2 1.4 1.6 5.7 2.3 0.4 0.4
[0260] The signal to noise ratio calculated from the quantitative
raw fluorescence data for the PNA probe agrees with the visual
analysis. A strong signal can be detected above the background from
0-300 mM salt (See: row F, columns 2-5). By comparison, only a weak
signal is detected for the DNA probe at salt concentrations of
between 300 and 500 mM (See: row G. columns 5-7).
[0261] Taken as a whole the visual data of FIG. 5 and the
quantitative data of Table 7 clearly demonstrates that the
non-nucleotide PNA probes operate within a substantially greater
range of salt concentrations as compared with the most nearly
equivalent DNA probes when used in an electrostatic immobilization
assay. The PNA probes also provide a substantially greater signal
to noise ratio as compared with the DNA probes. Consequently, the
data indicates several advantages which make the PNA probes the
superior choice for performing probe-based analysis of nucleic acid
electrostatically immobilized to a matrix.
Example 14
Single Point Mutation Discrimination Using a Protection/Digestion
Assay
[0262] This experiment was designed as a Protection/Digestion Assay
suitable for single point mutation discrimination. As designed, the
assay also demonstrates a means for improving the assay caused by
adjusting the temperature of the assay to a point where
non-specific hybrids begin to melt and the nucleic acid which
thereby causes the non-specific signal now becomes available as a
substrate to the enzyme. Digestion of the interfering non-target
sequence results in a substantial improvement in signal to noise
ratio of the assay. The assay was also substantially simplified by
use of a self-indicating Linear Beacon (BK.RAS-Cy3; See Table 2)
and electrostatic immobilization of the Linear Beacon/target
sequence hybrid to Sepharose particles which enabled the rapid
electrostatic capture and quantitation of the Linear Beacon/target
sequence hybrid.
[0263] Materials:
[0264] Mung Bean Nuclease and 10.times. buffer were obtained from
New England BioLabs. The enzyme is supplied at 10 units per
microliter. When the 10.times. buffer is diluted according to the
manufactures instructions, the buffer contains 50 mM sodium
acetate, 30 mM sodium chloride, 1 mM zinc chloride and has a pH of
5.0 at 25.degree. C.
[0265] Experimental:
[0266] This experiment comprised 6 samples in which the PNA probe
was hybridized to either the KRASWT(24) target (See: Table 1) or
the single base mismatch, KRASMU(24) target (See: Table 1). A no
target control and control samples without enzyme were also
performed. The assay was performed at 65.degree. C. This
temperature is below the Tm of the perfect complement
(BK.RAS-Cy3/KRASWT(24)) which has been measured to be approximately
81.degree. C. and very close to the Tm of the imperfect complement
(BK.RAS-Cy3/KRASMU(24)) which has been measured to be approximately
67.degree. C. under identical conditions. This temperature is
within the range of five degrees above and ten degree below the
melting temperature of the imperfect complement which is being
discriminated in the assay and which has a single point mutation as
compared with the target sequence KRASWT(24). The composition of
the six samples is summarized below:
[0267] Sample 1. KRASWT(24) target,+enzyme
[0268] Sample 2. KRASMU(24) target,+enzyme,
[0269] Sample 3. No Target+enzyme
[0270] Sample 4. KRASWT(24) target, no enzyme
[0271] Sample 5. KRASMU(24) target, no enzyme,
[0272] Sample 6. No Target, no enzyme
[0273] For this experiment, PNA probes and DNA targets were added
to a final concentration of 0.33 .mu.M in a 100 .mu.L volume of
1.times. mung bean nuclease buffer. Samples were heated to
95.degree. C. for 5 minutes to denature hybrids and then cooled to
65.degree. C. After 5 minutes of equilibration at 65.degree. C.,
samples 1-3 were treated with 0.3 .mu.L mung bean nuclease. Samples
4, 5 and 6 were not treated with nuclease. All samples were
vortexed briefly, then allowed to incubate for 10 minutes at
65.degree. C. After the incubation, all samples were treated with 1
.mu.L of PEI Sepharose particles, vortexed vigorously, then
centrifuged for 30 seconds to pellet the particles. Supernatants
were removed and the particles were resuspended in 100 .mu.L
1.times. mung bean nuclease buffer. The entire contents of each
tube was transferred to a microtiter plate and analyzed for
fluorescence using a Wallac, Victor, 1420 Multilabel Counter.
Fluorescence values are described in relative light units
(rlu).
[0274] Results:
[0275] Fluorescent measurements of the two "no target" controls,
sample #3 and sample #6, gave similar values, as would be expected
(400 and 466 rlu respectively). The "no target" values were
subtracted from the raw fluorescent values of the other samples to
obtain values minus background signal. The values minus background
signal for the remaining samples were as follows; sample #1, (4926
rlu); sample #2, (338 rlu); sample #4, (8896 rlu); and sample#5,
(2532 rlu).
[0276] Comparison of enzyme treated and untreated samples reveals
the relative benefits of nuclease treatment. Comparison of sample
#1 and sample #4 demonstrates a 45% loss of signal from the
complimentary target, KRASWT(24), when treated with the nuclease
((8896-4929).div.8896=45%). In contrast, comparison of sample #2
with sample #5 demonstrates an 87% loss of signal from the single
base mismatch target, KRASMU(24), from enzyme treatment
((2532-338).div.2532)=87%). As a result of the differential loss in
signal from the imperfect complement as compared with the perfect
complement, which is attributable to enzymatic digestion, there is
a corresponding increase in signal to noise ratio (fully
complimentary signal divided by mismatch signal, S/N) for the
assay. The S/N value for the sample which was not treated with
enzyme was 3.5 (8896.div.2532=3.5) and the S/N value for the sample
which was treated with enzyme was 14.6 (4926.div.338=14.6). Though
a loss of specific signal was observed in the enzyme treated
samples (compare raw fluorescence for sample #'s 1 and 2 with 4 and
5, respectively), the net gain in signal to noise was very
beneficial to the overall performance of the assay.
[0277] Taken as a whole, this data demonstrates that the
Protection/Digestion Assay can be combined with electrostatic
immobilization of the non-nucleotide probe/target sequence complex
to provide a rapid result. The non-nucleotide probe can be a Linear
Beacon and the assay self-indicating. Additionally, the result of
the assay can be substantially enhanced by judicious modulation of
assay temperature to thereby melt and digest nucleic acid which
caused false positive results.
Example 15
Array Assay
[0278] For this assay, a commercially available microscope slide
having a cationic surface was used to electrostatically immobilize
premixed samples containing nucleic acid and probe which had been
deposited on the slide into an array of spots. The microscope slide
was then washed to remove unhybridized probe and detect the target
sequence if present on the microscope slide.
[0279] Preparation of Probe, Targets, and Particles:
[0280] The cyanine-3 (Cy3) labeled PNA 15-mer (RASWT-Cy3), in a
solution of 50% aqueous N,N-dimethylformamide at a concentration of
570 pmol/.mu.L, was diluted to a concentration of 20 pmol/.mu.L in
hybridization buffer (12% aqueous formamide, 5 mM Tris
hydrochloride, 25 mM sodium chloride and 0.05% SDS at a pH of 7.5).
The DNA oligonucleotide 31-mer (KRASMU(31)), that was complementary
to RASWT-Cy3, in water at a concentration of 20 pmol/.mu.L was
diluted 221 fold to a concentration of 1 pmol/.mu.L in
hybridization buffer. The DNA oligonucleotide 60-mer (CompDNA),
that was non-complementary to RASWT-Cy3, in water at concentration
of 90 pmol/.mu.L, was diluted 90 fold to a concentration of 1
pmol/.mu.L in hybridization buffer.
[0281] Hybridization, Spotting and Data Acquisition:
[0282] Tube A: In a microfuge tube was combined 1 .mu.L of water
with 1 .mu.L of RASWT-Cy3 and 18 .mu.L of hybridization buffer.
[0283] Tube B: In a microfuge tube was combined 1 .mu.L of
KRASMU(31) with 1 .mu.L of RASWT-Cy3 and 18 .mu.L of hybridization
buffer.
[0284] Tube C: In a microfuge tube was combined 1 .mu.L of CompDNA
with 1 .mu.L of RASWT-Cy3 and 18 .mu.L of hybridization buffer.
[0285] Tubes A, B and C were incubated for 15 min at room
temperature and then 0.2 .mu.L of the solution from each tube was
applied as a row of droplets to a GAPS Coated Slide (Corning,
Corning N.Y.). The slide had a gamma-aminopropyl silane coated
surface. The slide was placed, for a period of approximately 20
min, in an oven maintained at 50.degree. C. until the spots had
dried. The slide was cooled to room temperature and imaged to
verify the location of the spots on the slide. A Genetic
Microsystems array microimager,(GMS 318, Woburn, Mass.) was used to
acquire slide images using the green laser according to the
manufacturer's instructions. The slide was then removed from the
imager and washed with hybridization buffer in a small tray with
gentle agitation for 5 min at room temperature. The slide was then
rinsed with deionized water, shaken to remove excess water, and
allowed to dry on the bench. The image of the washed slide was
again acquired.
[0286] Results:
[0287] FIGS. 6A and 6B are the images of the slide taken before and
after the wash step, respectively. Prior to washing there were
three visible spots labeled A, B & C, corresponding to the
reactions from Tubes A, B & C. However, after the wash step
(FIG. 6B), Spot A was no longer visible to the instrument. This
demonstrates that the PNA probe, in the absence of any nucleic
acid, was removed from the slide surface by the wash step. When the
complementary target KKRASMU(31) was present, the visible signal at
the array location was retained (Spot B), presumably due to
hybridization of the probe to the electrostatically immobilized
target. When a noncomplementary nucleic acid was used, most of the
PNA probe was washed away (Spot C). Taken as a whole, the data
demonstrates that it is possible to prepare a matrix array of
electrostatically immobilized nucleic acid and easily assay for the
presence of a target sequence located thereon using a
non-nucleotide probe.
Example 16
Line Assay
[0288] In the example, a line assay is performed wherein a
non-nucleotide probe/target sequence complex is captured using a
line of polycationic polymer on a commercially available membrane
material wherein reagents are allowed to wick into the membrane as
is typical of a lateral flow assay.
[0289] Preparation of Membrane:
[0290] Strips (2.5 cm.times.20 cm) of Millipore membrane (P/N WOPP,
Bedford, Mass.) were wet in a solution of 0.5% glutaraldehyde in
ethanol. The wet strips were placed on a piece of Whatman 3MM paper
in a fume hood. After 3 minutes, when the filter strips appeared
dry, they were removed from the hood and place on the platen of an
Ivek microstriper (Ivek Corp., Springfield, Vt.). A 3 mm wide line
of polyethylenamine (PEI) solution was then applied along the
midpoint of each membrane strip. The PEI solution was previously
prepared by dissolving 750,000 molecular weight PEI (Aldrich
Chemical, Milwaukee, Wis.) in water and adjusting the pH to 8.5
with dilute hydrochloric acid. The PEI solution was then diluted to
a final concentration of 1 mg of PEI per milliliter.
[0291] Once the filter strips were striped with the PEI solution,
they were allowed to dry overnight on the bench. The next day the
strips were washed with dilute hydrochloric acid, pH .about.3, for
45 minutes. The strips were then washed with water and placed on
Whatman 3MM paper to dry for 24 hrs. The strips were cut into
smaller pieces 1 cm wide by 2.5 cm long such that each strip had a
PEI line across its mid point. At one end, 5 mm of each piece was
sandwiched between two pieces of Whatman 3MM paper (2.times.1 cm)
using a small metal Bulldog clamp.
Preparation of Probe, Targets, and Particles
[0292] A biotinylated PNA 15-mer (BioP-15), in a solution of 50%
aqueous N,N-dimethylformamide at a concentration of 333 pmol/.mu.L,
was diluted 333 fold to final concentration of 1 pmol/.mu.L into
hybridization buffer (50% aqueous formamide, 20 mM Tris
hydrochloride, 100 mM sodium chloride and 0.1% SDS, pH of 7.5). The
DNA oligonucleotide 60-mer (CompDNA; See Table 1), complementary to
BioP-15 in water at a concentration of 90 pmol/.mu.L, was diluted
90 fold to a concentration of 1 pmol/.mu.L in hybridization buffer.
A DNA oligonucleotide 60-mer (NonCompDNA; See Table 1) that was
non-complementary to BioP-15, in water at a concentration of 221
pmol/.mu.L, was diluted 221 fold to a concentration of 1 pmol/.mu.L
in hybridization buffer. A suspension of streptavidin gold
particles (Arista Biologicals, Inc., Bethlehem, Pa.)), 40 nm
diameter, was diluted 20-fold with hybridization buffer.
[0293] Hybridization:
[0294] Tube A: In a microfuge tube was combined 2.5 .mu.L of
CompDNA with 2.5 .mu.L of BioP-15. The reaction was then incubated
for 2 min at room temperature and 20 .mu.L of 40 nm streptavidin
gold particles in hybridization solution was added.
[0295] Tube B: In a microfuge tube was combined 2.5 of .mu.L
NonCompDNA with 2.5 .mu.L of BioP-15. The reaction was then
incubated for 2 min at room temperature and 20 .mu.L of 40 nm
streptavidin gold particles in hybridization solution was
added.
[0296] Line Assay:
[0297] Tubes A and B were then incubated for 15 min. at room
temperature after addition of the gold particles. The contents of
the tubes were transferred onto a small piece of Parafilm lab film
(American Can Company). Onto different pieces of Parafilm were
spotted two 20 .mu.l droplets of hybridization buffer. Into each
drop was dipped the end of a membrane strip such that the buffer
wicked towards the end held by the Bulldog clamp. The filter strips
were held in contact with the liquid until entire droplet had
wicked into the membrane. The ends of the two strips were then
dipped separately into the contents of Tube A or Tube B that had
previously been transferred to clean sections of the lab film. Once
the entire A and B droplets had been wicked into their respective
filter strips, the filter ends were then separately dipped into 10
.mu.L droplets of hybridization buffer.
[0298] Results:
[0299] In the case of Tube A that contained the BioP-15 and its DNA
complement CompDNA, a red line formed across the filter strip
during the wicking of the Tube A contents into the filter strip. In
the case of Tube B, no line was seen. The results demonstrate the
feasibility of a simple line assay for detecting nucleic acids
using a cationic polymer as a capture zone on the membrane
filter.
[0300] Equivalents
[0301] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those of ordinary skill in the art that various
changes in form and details may be made therein without departing
from the spirit and scope of the invention as defined by the
appended claims. Those skilled in the art will be able to
ascertain, using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed in the
scope of the claims.
Sequence CWU 1
1
15 1 24 DNA Artificial Sequence misc_feature (1) 5' biotin label 1
gtggtagttg gagctggtgg cgta 24 2 24 DNA Artificial Sequence
misc_feature (1) 5' biotin label 2 gtggtagttg gagcttgtgg cgta 24 3
31 DNA Artificial Sequence misc_feature (1) 5' biotin 3 gtggtagttg
gagcttgtgg cgtaggcaag a 31 4 15 DNA Artificial Sequence
misc_feature (1) 5' fluorescein label 4 acgccaccag ctcca 15 5 15
DNA Artificial Sequence misc_feature (1) 5' fluorescein label 5
acgccacaag ctcca 15 6 20 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 6 gcttgtttcg
gcgtgggtat 20 7 20 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 7 taggttgagg
ccgttgagca 20 8 20 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 8 atgactgaat
ataaacttgt 20 9 20 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 9 ctctattgtt
ggatcatatt 20 10 60 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 10 tcactagtcc
cttcaaggct agcagtataa tgggttctag gtaaacgttc caccgttact 60 11 60 DNA
Artificial Sequence Description of Artificial Sequencesynthetic
probe, primer or target 11 agtaacggtg gaacgtttac ctagaaccca
ttatactgct agccttgaag ggactagtga 60 12 111 DNA Artificial Sequence
Description of Artificial Sequencesynthetic probe, primer or target
12 atgactgaat ataaacttgt ggtagttgga gcttgtggcg taggcaagag
tgccttgacg 60 attcagctaa ttcagaatca ttttgtggac gaatatgatc
caacaataga g 111 13 111 DNA Artificial Sequence Description of
Artificial Sequencesynthetic probe, primer or target 13 atgactgaat
ataaacttgt ggtagttgga gctggtggcg taggcaagag tgccttgacg 60
attcagctaa ttcagaatca ttttgtggac gaatatgatc caacaataga g 111 14 111
DNA Artificial Sequence Description of Artificial Sequencesynthetic
probe, primer or target 14 ctctattgtt ggatcatatt cgtccacaaa
atgattctga attagctgta tcgtcaaggc 60 actcttgcct acgccaccag
ctccaactac cacaagttta tattcagtca t 111 15 111 DNA Artificial
Sequence Description of Artificial Sequencesynthetic probe, primer
or target 15 ctctattgtt ggatcatatt cgtccacaaa atgattctga attagctgta
tcgtcaaggc 60 actcttgcct acgccacaag ctccaactac cacaagttta
tattcagtca t 111
* * * * *