U.S. patent application number 09/884455 was filed with the patent office on 2003-04-03 for hepatitis c virus protease.
Invention is credited to Choo, Qui-Lim, Houghton, Michael, Kuo, George.
Application Number | 20030064499 09/884455 |
Document ID | / |
Family ID | 24010295 |
Filed Date | 2003-04-03 |
United States Patent
Application |
20030064499 |
Kind Code |
A1 |
Houghton, Michael ; et
al. |
April 3, 2003 |
Hepatitis C virus protease
Abstract
The protease necessary for polyprotein processing in Hepatitis C
virus is identified, cloned, and expressed. Proteases, truncated
protease, and altered proteases are disclosed which are useful for
cleavage of specific polypeptides, and for assay and design of
antiviral agents specific for HCV.
Inventors: |
Houghton, Michael;
(Danville, CA) ; Choo, Qui-Lim; (El Cerrito,
CA) ; Kuo, George; (San Francisco, CA) |
Correspondence
Address: |
Chiron Corporation
4560 Horton Street
Emeryville
CA
94608-2916
US
|
Family ID: |
24010295 |
Appl. No.: |
09/884455 |
Filed: |
June 18, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09884455 |
Jun 18, 2001 |
|
|
|
09253675 |
Feb 18, 1999 |
|
|
|
09253675 |
Feb 18, 1999 |
|
|
|
08709177 |
Sep 6, 1996 |
|
|
|
5885799 |
|
|
|
|
08709177 |
Sep 6, 1996 |
|
|
|
08440548 |
May 12, 1995 |
|
|
|
5597691 |
|
|
|
|
08440548 |
May 12, 1995 |
|
|
|
08350884 |
Dec 6, 1994 |
|
|
|
5585258 |
|
|
|
|
08350884 |
Dec 6, 1994 |
|
|
|
07680296 |
Apr 4, 1991 |
|
|
|
5371017 |
|
|
|
|
07680296 |
Apr 4, 1991 |
|
|
|
07505433 |
Apr 4, 1990 |
|
|
|
Current U.S.
Class: |
435/219 ;
435/235.1; 435/5 |
Current CPC
Class: |
C12N 9/506 20130101;
C07K 14/005 20130101; C12N 9/90 20130101; C07K 14/00 20130101; C12N
9/0089 20130101; C07K 2319/02 20130101; C07K 2319/95 20130101; C12N
2770/24222 20130101; A61K 38/00 20130101; C07K 2319/00
20130101 |
Class at
Publication: |
435/219 ;
435/235.1; 435/5 |
International
Class: |
C12Q 001/70; C12N
009/50; C12N 007/00 |
Claims
What is claimed:
1. A composition comprising a purified proteolytic polypeptide
derived from Hepatitis C virus.
2. The composition of claim 1, wherein said polypeptide has a
partial internal sequence substantially as follows: Trp Thr Val Tyr
His Gly Ala Gly Thr Arg Thr.
3. The composition of claim 1, wherein said polypeptide has a
partial internal sequence substantially as follows: Leu Lys Gly Ser
Ser Gly Gly Pro Leu.
4. The composition of claim 2, wherein said polypeptide has
substantially the partial internal sequence:
13 Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Gly Met Val Ser
Lys Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr Ala Gln Gln Thr Arg
Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg Asp Lys Asn Gln
Val Glu Gly Glu Val Gln Ile Val Ser Thr Ala Ala Gln Thr Phe Leu Ala
Thr Cys Ile Asn Gly Val Cys Trp Thr Val Tyr His Gly Ala Gly Thr Arg
Thr Ile Ala Ser Pro Lys Gly Pro Val Ile Gln Met Tyr Thr Asn Val Asp
Gln Asp Leu Val Gly Trp Pro Ala Pro Gln Gly Ser Arg Ser Leu Thr Pro
Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp Val
Ile Pro Val Arg Arg Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg
Pro Ile Ser Tyr Leu Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ala
Gly His Ala Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala
Lys Ala Val Asp Phe Ile Pro Val Glu Asn Leu Glu Thr Thr Met
Arg.
5. The composition of claim 1, wherein said polypeptide has
substantially the amino acid sequence shown in FIG. 1.
6. A fusion protein, comprising: a suitable fusion partner, fused
to a proteolytic polypeptide derived from Hepatitis C virus.
7. The fusion protein of claim 6, wherein said fusion partner
comprises human superoxide dismutase.
8. The fusion protein of claim 6, wherein said proteolytic
polypeptide has a partial internal sequence substantially as
follows: Trp Thr Val Tyr His Gly Ala Gly Thr Arg Thr.
9. The fusion protein of claim 6, wherein said proteolytic
polypeptide has a partial internal sequence substantially as
follows: Leu Lys Gly Ser Ser Gly Gly Pro Leu.
10. The fusion protein of claim 6, wherein said proteolytic
polypeptide has as a partial internal sequence:
14 Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Gly Met Val Ser
Lys Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr Ala Gln Gln Thr Arg
Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg Asp Lys Asn Gln
Val Glu Gly Glu Val Gln Ile Val Ser Thr Ala Ala Gln Thr Phe Leu Ala
Thr Cys Ile Asn Gly Val Cys Trp Thr Val Tyr His Gly Ala Gly Thr Arg
Thr Ile Ala Ser Pro Lys Gly Pro Val Ile Gln Met Tyr Thr Asn Val Asp
Gln Asp Leu Val Gly Trp Pro Ala Pro Gln Gly Ser Arg Ser Leu Thr Pro
Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp Val
Ile Pro Val Arg Arg Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg
Pro Ile Ser Tyr Leu Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ala
Gly His Ala Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala
Lys Ala Val Asp Phe Ile Pro Val Glu Asn Leu Glu Thr Thr Met
Arg.
11. The fusion protein of claim 6, wherein said fusion partner is
ubiquitin.
12. A composition comprising a polynucleotide which encodes only
the HCV protease or an active HCV protease analog.
13. The composition of claim 12, wherein said polynucleotide
encodes the HCV protease of FIG. 1.
14. A composition comprising a polynucleotide which encodes a
fusion protein comprising: HCV protease or HCV protease analog; and
a fusion partner.
15. The composition of claim 14, wherein said fusion partner is
selected from the group consisting of hSOD, yeast a-factor, IL-2S,
ubiquitin, .beta.-galactosidase, .beta.-lactamase, horseradish
peroxidase, glucose oxidase, and urease.
16. The composition of claim 14, wherein said HCV protease or HCV
protease analog comprises a polypeptide having substantially the
following sequence:
15 Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Gly Met Val Ser
Lys Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr Ala Gln Gln Thr Arg
Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg Asp Lys Asn Gln
Val Glu Gly Glu Val Gln Ile Val Ser Thr Ala Ala Gln Thr Phe Leu Ala
Thr Cys Ile Asn Gly Val Cys Trp Thr Val Tyr His Gly Ala Gly Thr Arg
Thr Ile Ala Ser Pro Lys Gly Pro Val Ile Gln Met Tyr Thr Asn Val Asp
Gln Asp Leu Val Gly Trp Pro Ala Pro Gln Gly Ser Arg Ser Leu Thr Pro
Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp Val
Ile Pro Val Arg Arg Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg
Pro Ile Ser Tyr Leu Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ala
Gly His Ala Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala
Lys Ala Val Asp Phe Ile Pro Val Glu Asn Leu Glu Thr Thr Met
Arg.
17. The composition of claim 14, wherein said HCV protease or
analog comprises a polypeptide having substantially the
sequence:
16 Gly Thr Tyr Val Tyr Asn His Leu Thr Pro Leu Arg Asp Trp Ala His
Asn Gly Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Val Phe Ser Gln
Met Glu Thr Lys Leu Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp
Ile Ile Asn Gly Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu
Gly Pro Ala Asp Gly Met Val Ser Lys Gly Trp Arg Leu Leu Ala Pro Ile
Thr Ala Tyr Ala Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser
Leu Thr Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Ile Val Ser
Thr Ala Ala Gln Thr Phe Leu Ala Thr Cys Ile Ile Asn Gly Val Cys Trp
Thr Val Tyr His Gly Ala Gly Thr Arg Thr Ile Ala Ser Pro Lys Gly Pro
Val Ile Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Pro Ala
Ser Gln Gly Thr Arg Ser Leu Thr Pro Cys Thr Cys Gly Ser Ser Asp Leu
Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg Arg Arg Gly Asp
Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Ile Ser Tyr Leu Lys Gly Ser
Ser Gly Gly Pro Leu Leu Cys Pro Ala Gly His Ala Val Gly Ile Phe Arg
Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala Val Asp Phe Ile Pro Val
Glu Asn Leu Glu Thr Thr Met Arg Ser Pro Val Phe Thr Asp Asn Ser Ser
Pro Pro Val Val Pro Gln Ser Phe Gln Val Ala His Leu His Ala Pro Thr
Gly Ser Gly Lys Ser Thr Lys Val Pro Ala Ala.
18. The composition of claim 14, wherein said polypeptide has
substantially the sequence:
17 Gly Thr Tyr Val Tyr Asn His Leu Thr Pro Leu Arg Asp Trp Ala His
Asn Gly Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Val Phe Ser Gln
Met Glu Thr Lys Leu Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp
Ile Ile Asn Gly Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu
Gly Pro Ala Asp Gly Met Val Ser Lys Gly Trp Arg Leu Leu Ala Pro Ile
Thr Ala Tyr Ala Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser
Leu Thr Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Ile Val Ser
Thr Ala Ala Gln Thr Phe Leu Ala Thr Cys Ile Ile Asn Gly Val Cys Trp
Thr Val Tyr His Gly Ala Gly Thr Arg Thr Ile Ala Ser Pro Lys Gly Pro
Val Ile Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Pro Ala
Ser Gln Gly Thr Arg Ser Leu Thr Pro Cys Thr Cys Gly Ser Ser Asp Leu
Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg.
19. A method for assaying compounds for activity against hepatitis
C virus, comprising: providing an active hepatitis C virus
protease; contacting said protease with a compound capable of
inhibiting serine protease activity; and measuring inhibition of
the proteolytic activity of said hepatitis C virus protease.
20. An expression vector for producing HCV protease or HCV protease
analogs in a host cell, which vector comprises: a polynucleotide
encoding HCV protease or an HCV analog; transcriptional and
translational regulatory sequences functional in said host cell
operably linked to said HCV protease-encoding polynucleotide; and a
selectable marker.
21. The vector of claim 20, which further comprises a sequence
encoding a fusion partner, linked to said HCV protease-encoding
polynucleotide to form a fusion protein upon expression.
22. The vector of claim 21, wherein said fusion partner is selected
from the group consisting of hSOD, yeast .alpha.-factor, IL-2S,
ubiquitin, .beta.-galactosidase, .beta.-lactamase, horseradish
peroxidase, glucose oxidase, and urease.
23. The vector of claim 22, where in said fusion partner is
selected from the group consisting of ubiquitin, hSOD, and yeast
.alpha.-factor.
24. The vector of claim 20, wherein said HCV protease-encoding
polynucleotide encodes a polypeptide having the substantially the
following sequence:
18 Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro Ala Asp Gly Met Val Ser
Lys Gly Trp Arg Leu Leu Ala Pro Ile Thr Ala Tyr Ala Gln Gln Thr Arg
Gly Leu Leu Gly Cys Ile Ile Thr Ser Leu Thr Gly Arg Asp Lys Asn Gln
Val Glu Gly Glu Val Gln Ile Val Ser Thr Ala Ala Gln Thr Phe Leu Ala
Thr Cys Ile Asn Gly Val Cys Trp Thr Val Tyr His Gly Ala Gly Thr Arg
Thr Ile Ala Ser Pro Lys Gly Pro Val Ile Gln Met Tyr Thr Asn Val Asp
Gln Asp Leu Val Gly Trp Pro Ala Pro Gln Gly Ser Arg Ser Leu Thr Pro
Cys Thr Cys Gly Ser Ser Asp Leu Tyr Leu Val Thr Arg His Ala Asp Val
Ile Pro Val Arg Arg Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser Pro Arg
Pro Ile Ser Tyr Leu Lys Gly Ser Ser Gly Gly Pro Leu Leu Cys Pro Ala
Gly His Ala Val Gly Ile Phe Arg Ala Ala Val Cys Thr Arg Gly Val Ala
Lys Ala Val Asp Phe Ile Pro Val Glu Asn Leu Glu Thr Thr Met
Arg.
25. The vector of claim 20, wherein said HCV protease-encoding
polynucleotide encodes a polypeptide having the substantially the
following sequence:
19 Gly Thr Tyr Val Tyr Asn His Leu Thr Pro Leu Arg Asp Trp Ala His
Asn Gly Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Val Phe Ser Gln
Met Glu Thr Lys Leu Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp
Ile Ile Asn Gly Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu
Gly Pro Ala Asp Gly Met Val Ser Lys Gly Trp Arg Leu Leu Ala Pro Ile
Thr Ala Tyr Ala Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser
Leu Thr Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Ile Val Ser
Thr Ala Ala Gln Thr Phe Leu Ala Thr Cys Ile Ile Asn Gly Val Cys Trp
Thr Val Tyr His Gly Ala Gly Thr Arg Thr Ile Ala Ser Pro Lys Gly Pro
Val Ile Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Pro Ala
Ser Gln Gly Thr Arg Ser Leu Thr Pro Cys Thr Cys Gly Ser Ser Asp Leu
Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg.
26. The vector of claim 20, wherein said HCV protease-encoding
polynucleotide encodes a polypeptide having the substantially the
following sequence:
20 Gly Thr Tyr Val Tyr Asn His Leu Thr Pro Leu Arg Asp Trp Ala His
Asn Gly Leu Arg Asp Leu Ala Val Ala Val Glu Pro Val Val Phe Ser Gln
Met Glu Thr Lys Leu Ile Thr Trp Gly Ala Asp Thr Ala Ala Cys Gly Asp
Ile Ile Asn Gly Leu Pro Val Ser Ala Arg Arg Gly Arg Glu Ile Leu Leu
Gly Pro Ala Asp Gly Met Val Ser Lys Gly Trp Arg Leu Leu Ala Pro Ile
Thr Ala Tyr Ala Gln Gln Thr Arg Gly Leu Leu Gly Cys Ile Ile Thr Ser
Leu Thr Gly Arg Asp Lys Asn Gln Val Glu Gly Glu Val Gln Ile Val Ser
Thr Ala Ala Gln Thr Phe Leu Ala Thr Cys Ile Ile Asn Gly Val Cys Trp
Thr Val Tyr His Gly Ala Gly Thr Arg Thr Ile Ala Ser Pro Lys Gly Pro
Val Ile Gln Met Tyr Thr Asn Val Asp Gln Asp Leu Val Gly Trp Pro Ala
Ser Gln Gly Thr Arg Ser Leu Thr Pro Cys Thr Cys Gly Ser Ser Asp Leu
Tyr Leu Val Thr Arg His Ala Asp Val Ile Pro Val Arg Arg Arg Gly Asp
Ser Arg Gly Ser Leu Leu Ser Pro Arg Pro Ile Ser Tyr Leu Lys Gly Ser
Ser Gly Gly Pro Leu Leu Cys Pro Ala Gly His Ala Val Gly Ile Phe Arg
Ala Ala Val Cys Thr Arg Gly Val Ala Lys Ala Val Asp Phe Ile Pro Val
Glu Asn Leu Glu Thr Thr Met Arg Ser Pro Val Phe Thr Asp Asn Ser Ser
Pro Pro Val Val Pro Gln Ser Phe Gln Val Ala His Leu His Ala Pro Thr
Gly Ser Gly Lys Ser Thr Lys Val Pro Ala Ala.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part application of
U.S. Ser. No. 07/505,433, filed on Apr. 4, 1990.
TECHNICAL FIELD
[0002] This invention relates to the molecular biology and virology
of the hepatitis C virus (HCV). More specifically, this invention
relates to a novel protease produced by HCV, methods of expression,
recombinant protease, protease mutants, and inhibitors of HCV
protease.
BACKGROUND OF THE INVENTION
[0003] Non-A, Non-B hepatitis (NANBH) is a transmissible disease
(or family of diseases) that is believed to be virally induced, and
is distinguishable from other forms of virus-associated liver
disease, such as those caused by hepatitis A virus (HAV), hepatitis
B virus (HBV), delta hepatitis virus (HDV), cytomegalovirus (CMV)
or Epstein-Barr virus (EBV). Epidemiologic evidence suggests that
there may be three types of NANBH: the water-borne epidemic type;
the blood or needle associated type; and the sporadically occurring
(community acquired) type. However, the number of causative agents
is unknown. Recently, however, a new viral species, hepatitis C
virus (HCV) has been identified as the primary (if not only) cause
of blood-associated NANBH (BB-NANBH). See for example, PCT
WO89/046699; U.S. patent application Ser. No. 7/456,637, filed Dec.
21, 1989; and U.S. patent application Ser. No. 7/456,637, filed
Dec. 21, 1989, incorporated herein by reference. Hepatitis C
appears to be the major form of transfusion-associated hepatitis in
a number of countries, including the United States and Japan. There
is also evidence implicating HCV in induction of hepatocellular
carcinoma. Thus, a need exists for an effective method for treating
HCV infection: currently, there is none.
[0004] Many viruses, including adenoviruses, baculoviruses,
comoviruses, pico-maviruses, retroviruses, and togaviruses, rely on
specific, virally-encoded proteases for processing polypeptides
from their initial translated form into mature, active proteins. In
the case of picornaviruses, all of the viral proteins are believed
to arise from cleavage of a single polyprotein (B.D. Korant, CRC
Crit Rev Biotech (1988) 8:149-57).
[0005] S. Pichuantes et al, in "Viral Proteinases As Targets For
Chemotherapy" (Cold Spring Harbor Laboratory Press, 1989) pp.
215-22, disclosed expression of a viral protease found in HIV-1.
The HIV protease was obtained in the form of a fusion protein, by
fusing DNA encoding an HIV protease precursor to DNA encoding human
superoxide dismutase (hSOD), and expressing the product in E. coli.
Transformed cells expressed products of 36 and 10 kDa
(corresponding to the hSOD-protease fusion protein and the protease
alone), suggesting that the protease was expressed in a form
capable of autocatalytic proteolysis.
[0006] T. J. McQuade et al, Science (1990) 247:454-56 disclosed
preparation of a peptide mimic capable of specifically inhibiting
the HIV-1 protease. In HIV, the protease is believed responsible
for cleavage of the initial p55 gag precursor transcript into the
core structural proteins (pl7, p24, p8, and p7). Adding 1 .mu.M
inhibitor to HIV-infected peripheral blood lymphocytes in culture
reduced the concentration of processed HIV p24 by about 70%. Viral
maturation and levels of infectious virus were reduced by the
protease inhibitor.
DISCLOSURE OF THE INVENTION
[0007] We have now invented recombinant HCV protease, HCV protease
fusion proteins, truncated and altered HCV proteases, cloning and
expression vectors therefore, and methods for identifying antiviral
agents effective for treating HCV.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1 shows the sequence of HCV protease.
[0009] FIG. 2 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C20c.
[0010] FIG. 3 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C26d.
[0011] FIG. 4 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C8h.
[0012] FIG. 5 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C7f.
[0013] FIG. 6 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C3 1.
[0014] FIG. 7 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C35.
[0015] FIG. 8 shows the polynucleotide sequence and deduced amino
acid sequence of the clone C33c.
[0016] FIG. 9 schematically illustrates assembly of the vector
C7fC20cC300C200.
[0017] FIG. 10 shows the sequence of vector cf1SODp600.
MODES OF CARRYING OUT THE INVENTION
[0018] A. Definitions
[0019] The terms "Hepatitis C Virus" and "HCV" refer to the viral
species that is the major etiological agent of BB-NANBH, the
prototype isolate of which is identified in PCT WO89/046699; EPO
publication 318,216; U.S. Ser. No. 7/355,008, filed May 18, 1989;
and U.S. Ser. No. 7/456,637, the disclosures of which are
incorporated herein by reference. "HCV" as used herein includes the
pathogenic strains capable of causing hepatitis C, and attenuated
strains or defective interfering particles derived therefrom. The
HCV genome is comprised of RNA. It is known that RNA-containing
viruses have relatively high rates of spontaneous mutation,
reportedly on the order of 10.sup.-3 to 10.sup.-4 per incorporated
nucleotide (Fields & Knipe, "Fundamental Virology" (1986, Raven
Press, N.Y.)). As heterogeneity and fluidity of genotype are
inherent characteristics of RNA viruses, there will be multiple
strains/isolates, which may be virulent or avirulent, within the
HCV species.
[0020] Information on several different strains/isolates of HCV is
disclosed herein, particularly strain or isolate CDCIHCVI (also
called HCV1). Information from one strain or isolate, such as a
partial genomic sequence, is sufficient to allow those skilled in
the art using standard techniques to isolate new strains/isolates
and to identify whether such new strains/isolates are HCV. For
example, several different strains/isolates are described below.
These strains, which were obtained from a number of human sera (and
from different geographical areas), were isolated utilizing the
information from the genomic sequence of HCV1.
[0021] The information provided herein suggests that HCV may be
distantly related to the flaviviridae. The Flavivirus family
contains a large number of viruses which are small, enveloped
pathogens of man. The morphology and composition of Flavivirus
particles are known, and are discussed in M. A. Brinton, in "The
Viruses: The Togaviridae And Flaviviridae" (Series eds.
Fraenkel-Conrat and Wagner, vol. eds. Schlesinger and Schlesinger,
Plenum Press, 1986), pp. 327-374. Generally, with respect to
morphology, Flaviviruses contain a central nucleocapsid surrounded
by a lipid bilayer. Virions are spherical and have a diameter of
about 40-50 nm. Their cores are about 25-30 nm in diameter. Along
the outer surface of the virion envelope are projections measuring
about 5-10 nm in length with terminal knobs about 2 nm in diameter.
Typical examples of the family include Yellow Fever virus, West
Nile virus, and Dengue Fever virus. They possess positive-stranded
RNA genomes (about 11,000 nucleotides) that are slightly larger
than that of HCV and encode a polyprotein precursor of about 3500
amino acids. Individual viral proteins are cleaved from this
precursor polypeptide.
[0022] The genome of HCV appears to be single-stranded RNA
containing about 10,000 nucleotides. The genome is
positive-stranded, and possesses a continuous translational open
reading frame (ORF) that encodes a polyprotein of about 3,000 amino
acids. In the ORF, the structural proteins appear to be encoded in
approximately the first quarter of the N-terminal region, with the
majority of the polyprotein attributed to non-structural proteins.
When compared with all known viral sequences, small but significant
co-linear homologies are observed with the non-structural proteins
of the Flavivirus family, and with the pestiviruses (which are now
also considered to be part of the Flavivirus family).
[0023] A schematic alignment of possible regions of a flaviviral
polyprotein (using Yellow Fever Virus as an example), and of a
putative polyprotein encoded in the major ORF of the HCV genome, is
shown in FIG. 1. Possible domains of the HCV polyprotein are
indicated in the figure. The Yellow Fever Virus polyprotein
contains, from the amino terminus to the carboxy terminus, the
nucleocapsid protein (C), the matrix protein (M), the envelope
protein (E), and the non-structural proteins 1, 2 (a+b), 3, 4
(a+b), and 5 (NS1, NS2, NS3, NS4, and NS5). Based upon the putative
amino acids encoded in the nucleotide sequence of HCV1, a small
domain at the extreme N-terminus of the HCV polyprotein appears
similar both in size and high content of basic residues to the
nucleocapsid protein (C) found at the N-terminus of flaviviral
polyproteins. The non-structural proteins 2,3,4, and 5 (NS2-5) of
HCV and of yellow fever virus (YFV) appear to have counterparts of
similar size and hydropathicity, although the amino acid sequences
diverge. However, the region of HCV which would correspond to the
regions of YFV polyprotein which contains the M, E, and NS1 protein
not only differs in sequence, but also appears to be quite
different in size and hydropathicity. Thus, while certain domains
of the HCV genome may be referred to herein as, for example, NS1,
or NS2, it should be understood that these designations are for
convenience of reference only; there may be considerable
differences between the HCV family and flaviviruses that have yet
to be appreciated.
[0024] Due to the evolutionary relationship of the strains or
isolates of HCV, putative HCV strains and isolates are identifiable
by their homology at the polypeptide level. With respect to the
isolates disclosed herein, new ,HCV strains or isolates are
expected to be at least about 40% homologous, some more than about
70% homologous, and some even more than about 80% homologous: some
may be more than about 90% homologous at the polypeptide level. The
tehniques for determining amino acid sequence homology are known in
the art. For example, the amino acid sequence may be determined
directly and compared to the sequences provided herein.
Altematively the nucleotide sequence of the genomic material of the
putative HCV may be determined (usually via a cDNA intermediate),
the amino acid sequence encoded therein can be determined, and the
corresponding regions compared.
[0025] The term "HCV protease" refers to an enzyme derived from HCV
which exhibits proteolytic activity, specifically the polypeptide
encoded in the NS3 domain of the HCV genome. At least one strain of
HCV contains a protease believed to be substantially encoded by or
within the following sequence:
1 Arg Arg Gly Arg Glu Ile Leu Leu Gly Pro 10 Ala Asp Gly Met Val
Ser Lys Gly Trp Arg 20 Leu Leu Ala Pro Ile Thr Ala Tyr Ala Gln 30
Gln Thr Arg Gly Leu Leu Gly Cys Ile lle 40 Thr Set Leu Thr Gly Arg
Asp Lys Asn Gln 50 Val Glu Gly Glu Val Gln Ile Val Ser Thr 60 Ala
Ala Gln Thr Phe Leu Ala Thr CysI le 70 Asn Gly Val Cys Trp Thr Val
Tyr His Gly 80 Ala Gly Thr Arg Thr Ile Ala Ser Pro Lys 90 Gly Pro
Val Ile Gln Met Tyr Thr Asn Val 100 Asp Gln Asp Leu Val Gly Trp Pro
Ala Ser 110 Gln Gly Tbr Arg Ser Leu Thr Pro Cys Thr 120 Cys Gly Ser
Set Asp Leu Tyr Leu Val Thr 130 Arg His Ala Asp Val Ile Pro Val Arg
Arg 140 Arg Gly Asp Ser Arg Gly Ser Leu Leu Ser 150 Pro Arg Pro ile
Ser Tyr Leu Lys Gly Ser 160 Ser Gly Gly Pro Leu Leu Cys Pro Ala Gly
170 His Ala Val Gly Ile Phe Arg Ala Ala Val 180 Cys Thr Arg Gly Val
Ala Lys Ala Val Asp 190 Phe Ile Pro Val Glu Asn Leu Glu Thr Thr 200
Met Arg . . . 202
[0026] The above N and C termini are putative, the actual termini
being defmed by expression and processing in an appropriate host of
a DNA construct encoding the entire N53 domain. It is understood
that this sequence may vary from strai to strain, as RNA viruses
like HCV are known to exhibit a great deal of variation. Further,
the actual N and C termini may vary, as the protease is cleaved
from a precursor polyprotein: variations in the protease amino acid
sequence can result in cleavage from the polyprotein at different
points. Thus, the amino- and carboxy-termnini may differ from
strain to strain of H-CV. The first amino acid shown above
corresponds to residue 60 in FIG. 1. However, the minimum sequence
necessary for activity can be determined by routine methods. The
sequence may be truncated at either end by treating an appropriate
expression vector with an exonuclease (after cleavage at the 5' or
3' end of the coding sequence) to remove any desired number of base
pairs. The resulting coding polynucleotide is then expressed and
the sequence determined. In this manner the activity of the
resulting product may be correlated with the amino acid sequence: a
limited series of such experiments (removing progressively greater
numbers of base pairs) determines the minimum internal sequence
necessary for protease activity. We have found that the sequence
may be substantially truncated, particularly at the carboxy
terminus, apparently with full retention of protease activity. It
is presently believed that a portion of the protein at the carboxy
terminus may exhibit helicase activity. However, helicase activity
is not required of the HCV proteases of the invention. The amino
terminus may also be truncated to a degree without loss of protease
activity.
[0027] The amino acids underlined above are believed to be the
residues necessary for catalytic activity, based on sequence
homology to putative flavivirus serine proteases. Table I shows the
alignment of the three serine protease catalytic residues for HCV
protease and the protease obtained from Yellow Fever Virus, West
Nile Fever virus, Murray Valley Fever virus, and Kunjin virus.
Although the other four flavivirus protease sequences exhibit
higher homology with each other than with HCV, a degree of homology
is still observed with HCV. This homology, however, was not
sufficient for indication by currently available alignment
software. The indicated amino acids are numbered His.sub.79,
Asp.sub.103, and Ser.sub.161 in the sequence listed above
(His.sub.139, Asp.sub.163, and Ser.sub.221 in FIG. 1).
2TABLE 1 Alignment of Active Residues by Sequence Protease His Asp
Ser HCV CWTVYHGAG DQDLGWPAP LKGSSGGPL Yellow Fever FHTMWHVTR
KEDLVAYGG PSGTSGSPI West Nile Fever FHTLWHTTK KEDRLCYGG PTGTSGSPI
Murray Valley FHTLWHTTR KEDRVTYGG PIGTSGSPI Kunjin Virus FHTLWHTTK
KEDRLCYGG PTGTSGSPI
[0028] ALternatively, one can make catalytic residue assignments
based on structural homology. Table 2 shows alignment of HCV with
against the catalytic sites of several well-characterized serine
proteases based on structural considerations: protease A from
Streptomyces griseus, .alpha.-lytic protease, bovine trypsin,
chymotrypsin, and elastase (M. James et al, Can J Biochem (1978)
56:396). Again, a degree of homology is observed. The HCV residues
identified are numbered His.sub.79, Asp.sub.125, and Ser.sub.161 in
the sequence listed above.
3TABLE 2 Alignment of Active Residues by Structure Protease His Asp
Ser S. griseusA TAGHC NNDYGII GDSGGSL .alpha.-Lytic protease TAGHC
GNDRAWV GDSGGSW Bovine Trypsin SAAHC NNDIMLI GDSGGPV Chymotrypsin
TAAHC NNDITLL GDSGGPL Elastase TAAHC GYDIALL GDSGGPL HCV TVYHG
SSDLYLV GSSGGPL
[0029] The most direct manner to verify the residues essential to
the active site is to replace each residue individually with a
residue of equivalent stearic size. This is easily accomplished by
site-specific mutagenesis and similar methods known in the art. If
replacement of a particular residue with a residue of equivalent
size results in loss of activity, the essential nature of the
replaced residue is confirmed.
[0030] "HCV protease analogs" refer to polypeptides which vary from
the full length protease sequence by deletion, alteration and/or
addition to the amino acid sequence of the native protease. HCV
protease analogs include the truncated proteases described above,
as well as HCV protease muteins and fusion proteins comprising HCV
protease, truncated protease, or protease muteins. Alterations to
form HCV protease muteins are preferably conservative amino acid
substitutions, in which an amino acid is replaced with another
naturally-occurring amino acid of similar character. For example,
the following substitutions are considered "conservative":
Gly<.fwdarw.>Ala; Asp<.fwdarw.>Glu;
Val<.fwdarw.>Ile<.fwdarw.>Leu;
Lys<.fwdarw.>Arg;
Asn<.fwdarw.>Gln; and
Phe<.fwdarw.>Trp<.fwdarw.>Tyr.
[0031] Nonconservative changes are generally substitutions of one
of the above amino acids with an amino acid from a different group
(e.g., substituting Asn for Glu), or substituting Cys, Met, His, or
Pro for any of the above amino acids. Substitutions involving
common amino acids are conveniently performed by site specific
mutagenesis of an expression vector encoding the desired protein,
and subsequent expression of the altered form. One may also alter
amino acids by synthetic or semi-synthetic methods. For example,
one may convert cysteine or serine residues to selenocysteine by
appropriate chemical treatment of the isolated protein.
Alternatively, one may incorporate uncommon amino acids in standard
in vitro protein synthetic methods. Typically, the total number of
residues changed, deleted or added to the native sequence in the
muteins will be no more than about 20, preferably no more than
about 10, and most preferably no more than about 5.
[0032] The term fusion protein generally refers to a polypeptide
comprising an amino acid sequence drawn from two or more individual
proteins. In the present invention, "fusion protein" is used to
denote a polypeptide comprising the HCV protease, truncate, mutein
or a functional portion thereof, fused to a non-HCV protein or
polypeptide ("fusion partner"). Fusion proteins are most
conveniently produced by expression of a fused gene, which encodes
a portion of one polypeptide at the 5' end and a portion of a
different polypeptide at the 3' end, where the different portions
are joined in one reading frame which may be expressed in a
suitable host. It is presently preferred (although not required) to
position the HCV protease or analog at the carboxy terminus of the
fusion protein, and to employ a functional enzyme fragment at the
amino terminus. As the HCV protease is normally expressed within a
large polyprotein, it is not expected to include cell transport
signals (e.g., export or secretion signals). Suitable functional
enzyme fragments are those polypeptides which exhibit a
quantifiable activity when expressed fused to the HCV protease.
Exemplary enzymes include, without limitation, .beta.-galactosidase
(.beta.-gal), .beta.-lactamase, horseradish peroxidase (HRP),
glucose oxidase (GO), human superoxide dismutase (hSOD), urease,
and the like. These enzymes are convenient because the amount of
fusion protein produced can be quantified by means of simple
colorimetric assays. Alternatively, one may employ antigenic
proteins or fragments, to permit simple detection and
quantification of fusion proteins using antibodies specific for the
fusion partner. The presently preferred fusion partner is hSOD.
[0033] B. General Method
[0034] The practice of the present invention generally employs
conventional techniques of molecular biology, microbiology,
recombinant DNA, and immunology, which are within the skill of the
art. Such techniques are explained fully in the literature. See for
example J. Sambrook et al, "Molecular Cloning; A Laboratory Manual
(1989); "DNA Cloning", Vol. I and II (D. N Glover ed. 1985);
"Oligo-nucleotide Synthesis" (M J. Gait ed, 1984); "Nucleic Acid
Hybridization" (B. D. Hames & S. J. Higgins eds. 1984);
"Transcription And Translation" (B. D. Hames & S. J. Higgins
eds. 1984); "Animal Cell Culture" (R. I. Freshney ed. 1986);
"Immobilized Cells And Enzymes" (IRL Press, 1986); B. Perbal, "A
Practical Guide To Molecular Cloning" (1984); the series, "Methods
In Enzymology" (Academic Press, Inc.); "Gene Transfer Vectors For
Mammalian Cells" (J. H. Miller and M. P. Calos eds. 1987, Cold
Spring Harbor Laboratory); Meth Enzymol (1987) 154 and 155 (Wu and
Grossman, and Wu, eds., respectively); Mayer & Walker, eds.
(1987), "Immunochemical Methods In Cell And Molecular Biology"
(Academic Press, London); Scopes, "Protein Purification: Principles
And Practice", 2nd Ed (Springer-Verlag, N.Y., 1987); and "Handbook
Of Experimental Immunology", volumes I-IV (Weir and Blackwell, eds,
1986).
[0035] Both prokaryotic and eukaryotic host cells are useful for
expressing desired coding sequences when appropriate control
sequences compatible with the designated host are used. Among
prokaryotic hosts, E. coli is most frequently used. Expression
control sequences for prokaryotes include promoters, optionally
containing operator portions, and ribosome binding sites. Transfer
vectors compatible with prokaryotic hosts are commonly derived
from, for example, pBR322, a plasmid containing operons conferring
ampicillin and tetracycline resistance, and the various pUC
vectors, which also contain sequences conferring antibiotic
resistance markers. These plasmids are commercially available. The
markers may be used to obtain successful transformants by
selection. Commonly used prokaryotic control sequences include the
4-lactamase (penicillinase) and lactose promoter systems (Chang et
al, Nature (1977) 198:1056), the tryptophan (trp) promoter system
(Goeddel et al, Nuc Acids Res (1980) 8:4057) and the lambda-derived
P.sub.L promoter and N gene ribosome binding site (Shimatake et al,
Nature (1981) 292:128) and the hybrid tac promoter (De Boer et al,
Proc Nat Acad Sci USA (1983) 292:128) derived from sequences of the
trp and lac Uv5 promoters. The foregoing systems are particularly
compatible with E. coli; if desired, other prokaryotic hosts such
as strains of Bacillus or Pseudomonas may be used, with
corresponding control sequences.
[0036] Eukaryotic hosts include without limitation yeast and
mammalian cells in culture systems. Yeast expression hosts include
Saccharomyces, Klebsiella, Picia, and the like. Saccharomyces
cerevisiae and Saccharomyces carisbergensis and K. lactis are the
most commonly used yeast hosts, and are convenient fungal hosts.
Yeast-compatible vectors carry markers which permit selection of
successful transformants by conferring prototrophy to auxotrophic
mutants or resistance to heavy metals on wild-type strains. Yeast
compatible vectors may employ the 2.mu. origin of replication
(Broach et al, Meth Enzymol (1983) 101:307), the combination of
CEN3 and ARS 1 or other means for assuring replication, such as
sequences which will result in incorporation of an appropriate
fragment into the host cell genome. Control sequences for yeast
vectors are known in the art and include promoters for the
synthesis of glycolytic enzymes (Hess et al, J Adv Enzvme Reg
(1968) 7:149; Holland et al, Biochem (1978), 17:4900), including
the promoter for 3-phosphoglycerate kinase (R. Hitzeman et al, J
Biol Chem (1980) 255:2073). Terminators may also be included, such
as those derived from the enolase gene (Holland, J Biol Chem (1981)
256:1385). Particularly useful control systems are those which
comprise the glyceraldehyde-3 phosphate dehydrogenase (GAPDH)
promoter or alcohol dehydrogenase (ADH) regulatable promoter,
terminators also derived from GAPDH, and if secretion is desired, a
leader sequence derived from yeast a-factor (see U.S. Pat. No.
4,870,008, incorporated herein by reference).
[0037] A presently preferred expression system employs the
ubiquitin leader as the fusion partner. Copending application U.S.
Ser. No. 7/390,599 filed Aug. 7, 1989 disclosed vectors for high
expression of yeast ubiquitin fusion proteins. Yeast ubiquitin
provides a 76 amino acid polypeptide which is automatically cleaved
from the fused protein upon expression. The ubiquitin amino acid
sequence is as follows:
4 Gln Ile Phe Val Lys Thr Leu Thr Gly Lys Thr Ile Thr Leu Glu Val
Glu Ser Ser Asp Thr Ile Asp Asn Val Lys Set Lys Ile Gln Asp Lys Glu
Gly Ile Pro Pro Asp Gln Gln Arg Leu Ile Phe Ala Gly Lys Gln Leu Glu
Asp Gly Arg Thr Leu Set Asp Tyr Asn Ile Gln Lys Glu Ser Thr Leu His
Leu Val Leu Arg Leu Arg Gly Gly
[0038] See also Ozkaynak et al, Nature (1984) 312:663-66.
Polynucleotides encoding the ubiquitin polypeptide may be
synthesized by standard methods, for example following the
technique of Barr et al, J Biol Chem (1988) 268:1671-78 using an
Applied Biosystem 380A DNA synthesizer. Using appropriate linkers,
the ubiquitin gene may be inserted into a suitable vector and
ligated to a sequence encoding the HCV protease or a fragment
thereof.
[0039] In addition, the transcriptional regulatory region and the
transcriptional initiation region which are operably linked may be
such that they are not naturally associated in the wild-type
organism. These systems are described in detail in EPO 120,551,
published Oct. 3, 1984; EPO 116,201, published Aug. 22, 1984; and
EPO 164,556, published December 18, 1985, all of which are commonly
owned with the present invention, and are hereby incorporated
herein by reference in full.
[0040] Mammalian cell lines available as hosts for expression are
known in the art and include many immortalized cell lines available
from the American Type Culture Collection (ATCC), including HeLa
cells, Chinese hamster ovary (CHO) cells, baby hamster kidney 03HK)
cells, and a number of other cell lines. Suitable promoters for
mammalian cells are also known in the art and include viral
promoters such as that from Simian Virus 40 (SV40) (Fiers et al,
Nature (1978) 273:113), Rous sarcoma virus (RSV), adenovirus (ADV),
and bovine papilloma virus (BPV). Mammalian cells may also require
terminator sequences and poly-A addition sequences. Enhancer
sequences which increase expression may also be included, and
sequences which promote amplification of the gene may also be
desirable (for example methotrexate resistance genes). These
sequences are known in the art.
[0041] Vectors suitable for replication in mammalian cells are
known in the art, and may include viral replicons, or sequences
which insure integration of the appropriate sequences encoding HCV
epitopes into the host genome. For example, another vector used to
express foreign DNA is Vaccinia virus. In this case the
heterologous DNA is inserted into the Vaccinia genome. Techniques
for the insertion of foreign DNA into the vaccinia virus genome are
known in the art, and may utilize, for example, homologous
recombination. The heterologous DNA is generally inserted into a
gene which is non-essential to the virus, for example, the
thymidine kinase gene (tk, which also provides a selectable marker.
Plasmid vectors that greatly facilitate the construction of
recombinant viruses have been described (see, for example, Mackett
et al, J Virol (1984) 49:857; Chakrabarti et al, Mol Cell Biol
(1985) 5:3403; Moss, in GENE TRANSFER VECTORS FOR MAMMALIAN CELLS
(Miller and Calos, eds., Cold Spring Harbor Laboratory, NY, 1987),
p. 10). Expression of the HCV polypeptide then occurs in cells or
animals which are infected with the live recombinant vaccinia
virus.
[0042] In order to detect whether or not the HCV polypeptide is
expressed from the vaccinia vector, BSC 1 cells may be infected
with the recombinant vector and grown on microscope slides under
conditions which allow expression. The cells may then be
acetone-fixed, and immunofluorescence assays performed using serum
which is known to contain anti-HCV antibodies to a polypeptide(s)
encoded in the region of the HCV genome from which the HCV segment
in the recombinant expression vector was derived.
[0043] Other systems for expression of eukaryotic or viral genomes
include insect cells and vectors suitable for use in these cells.
These systems are known in the art, and include, for example,
insect expression transfer vectors derived from the baculovirus
Autographa californica nuclear polyhedrosis virus (AcNPV), which is
a helper-independent, viral expression vector. Expression vectors
derived from this system usually use the strong viral polyhedrin
gene promoter to drive expression of heterologous genes. Currently
the most commonly used transfer vector for introducing foreign
genes into AcNPV is pAc373 (see PCT WO891046699 and U.S. Ser. No.
7/456,637). Many other vectors known to those of skill in the art
have also been designed for improved expression. These include, for
example, pVL985 (which alters the polyhedrin start codon from ATG
to ATT, and introduces a BamHI cloning site 32 bp downstream from
the ATT; See Luckow and Summers, Virol (1989) 17:31). AcNPV
transfer vectors for high level expression of nonfused foreign
proteins are described in copending applications PCT WO89/046699
and U.S. Ser. No. 7/456,637. A unique BamHI site is located
following position -8 with respect to the translation initiation
codon ATG of the polyhedrin gene. There are no cleavage sites for
SmaI, PstI, BglIl, Xbal or SstI. Good expression of nonfused
foreign proteins usually requires foreign genes that ideally have a
short leader sequence containing suitable translation initiation
signals preceding an ATG start signal. The plasmid also contains
the polyhedrin polyadenylation signal and the ampicillin-resistance
(amp) gene and origin of replication for selection and propagation
in E. coli.
[0044] Methods for the introduction of heterologous DNA into the
desired site in the baculovirus virus are known in the arts (See
Summer and Smith, Texas Agricultural Experiment Station Bulletin
No. 1555; Smith et al, Mol Cell Biol (1983) 3:215&2165; and
Luckow and Summers, Virol (1989) 17:31). For example, the
heterologous DNA can be inserted into a gene such as the polyhedrin
gene by homologous recombination, or into a restriction enzyme site
engineered into the desired baculovirus gene. The inserted
sequences may be those which encode all or varying segments of the
polyprotein, or other offs which encode viral polypeptides. For
example, the insert could encode the following numbers of amino
acid segments from the polyprotein: amino acids 1-1078; amino acids
332-662; amino acids 406-662; amino acids 156-328, and amino acids
199-328.
[0045] The signals for post-translational modifications, such as
signal peptide cleavage, proteolytic cleavage, and phosphorylation,
appear to be recognized by insect cells. The signals required for
secretion and nuclear accumulation also appear to be conserved
between the invertebrate cells and vertebrate cells. Examples of
the signal sequences from vertebrate cells which are effective in
invertebrate cells are known in the art, for example, the human
interleukin-2 signal (IL2.sub.S) which signals for secretion from
the cell, is recognized and properly removed in insect cells.
[0046] Transformation may be by any known method for introducing
polynucleotides into a host cell, including, for example packaging
the polynucleotide in a virus and transducing a host cell with the
virus, and by direct uptake of the polynucleotide. The
transformation procedure used depends upon the host to be
transformed. Bacterial transformation by direct uptake generally
employs treatment with calcium or rubidium chloride (Cohen, Proc
Nat Acad Sci USA (1972) 69:2110; T. Maniatis et al, "Molecular
Cloning; A Laboratory Manual" (Cold Spring Harbor Press, Cold
Spring Harbor, N.Y., 1982). Yeast transformation by direct uptake
may be carried out using the method of Hinnen et al, Proc Nat Acad
Sci USA (1978) L5:1929. Mammalian transformations by direct uptake
may be conducted using the calcium phosphate precipitation
methodl,of Graham and Van der Eb, Virol (1978) 52:546, or the
various known modifications thereof. Other methods for introducing
recombinant polynucleotides into cells, particularly into mammalian
cells, include dextran-mediated transfection, calcium phosphate
mediated transfection, polybrene mediated transfection, protoplast
fusion, electroporation, encapsulation of the polynucleotide(s) in
liposomes, and direct microinjection of the polynucleotides into
nuclei.
[0047] Vector construction employs techniques which are known in
the art. Site-specific DNA cleavage is performed by treating with
suitable restriction enzymes under conditions which generally are
specified by the manufacturer of these commercially available
enzymes. In general, about 1 ug of plasmid or DNA sequence is
cleaved by 1 unit of enzyme in about 20 pL buffer solution by
incubation for 1-2 hr at 37.degree. C. After incubation with the
restriction enzyme, protein is removed by phenolchloroform
extraction and the DNA recovered by precipitation with ethanol. The
cleaved fragments may be separated using polyacrylamide or agarose
gel electrophoresis techniques, according to the general procedures
described in Meth Enzymol (1980) 65:499-560.
[0048] Sticky-ended cleavage fragments may be blunt ended using E.
coli DNA polymerase I (Klenow fragment) with the appropriate
deoxynucleotide triphosphates (dNTIPs) present in the mixture.
Treatment with S1 nuclease may also be used, resulting in the
hydrolysis of any single stranded DNA portions.
[0049] Ligations are carried out under standard buffer and
temperature conditions using T4 DNA ligase and ATP; sticky end
ligations require less ATP and less ligase than blunt end
ligations. When vector fragments are used as part of a ligation
mixture, the vector fragment is often treated with bacterial
alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase
to remove the 5'-phosphate, thus preventing religation of the
vector. Alternatively, restriction enzyme digestion of unwanted
fragments can be used to prevent ligation.
[0050] Ligation mixtures are transformed into suitable cloning
hosts, such as E. coli, and successful transformants selected using
the markers incorporated (e.g., antibiotic resistance), and
screened for the correct construction.
[0051] Synthetic oligonucleotides may be prepared using an
automated oligonucleotide synthesizer as described by Warner, DNA
(1984) 3:401. If desired, the synthetic strands may be labeled with
.sup.32P by treatment with polynucleotide kinase in the presence of
.sup.32P-ATP under standard reaction conditions.
[0052] DNA sequences, including those isolated from cDNA libraries,
may be modified by known techniques, for example by site directed
mutagenesis (see e.g., Zoller, Nuc Acids Res (1982) 10:6487).
Briefly, the DNA to be modified is packaged into phage as a single
stranded sequence, and converted to a double stranded DNA with DNA
polymerase, using as a primer a synthetic oligonucleotide
complementary to the portion of the DNA to be modified, where the
desired modification is included in the primer sequence. The
resulting double stranded DNA is transformed into a
phage-supporting host bacterium. Cultures of the transformed
bacteria which contain copies of each strand of the phage are
plated in agar to obtain plaques. Theoretically, 50% of the new
plaques contain phage having the mutated sequence, and the
remaining 50% have the original sequence. Replicates of the plaques
are hybridized to labeled synthetic probe at temperatures and
conditions which pernit hybridization with the correct strand, but
not with the unmodified sequence. The sequences which have been
identified by hybridization are recovered and cloned.
[0053] DNA libraries may be probed using the procedure of Grunstein
and Hogness Proc Nat Acad Sci USA (1975) 73:3961. Briefly, in this
procedure the DNA to be probed is immobilized on nitrocellulose
filters, denatured, and prehybridized with a buffer containing
0-50% formamide, 0.75 M NaCl, 75 mM Na citrate, 0.02% (wt/v) each
of bovine serum albumin, polyvinylpyrrolidone, and Ficoll.RTM., 50
mM NaH.sub.2PO.sub.4 (pH 6.5), 0.1% SDS, and 100 .mu.g/mL carrier
denatured DNA. The percentage of formamide in the buffer, as well
as the time and temperature conditions of the prehybridization and
subsequent hybridization steps depend on the stringency required.
Oligomeric probes which require lower stringency conditions are
generally used with low percentages of formamide, lower
temperatures, and longer hybridization times. Probes containing
more than 30 or 40 nucleotides, such as those derived from cDNA or
genomic sequences generally employ higher temperatures, e.g., about
40-42.degree. C., and a high percentage formamide, e.g., 50%.
Following prehybridization, 5'-.sup.32P-labeled oligonucleotide
probe is added to the buffer, and the filters are incubated in this
mixture under hybridization conditions. After washing, the treated
filters are subjected to autoradiography to show the location of
the hybridized probe; DNA in corresponding locations on the
original agar plates is used as the source of the desired DNA.
[0054] For routine vector constructions, ligation mixtures are
transformed into E. coli strain HB101 or other suitable hosts, and
successful transformants selected by antibiotic resistance or other
markers. Plasmids from the transformants are then prepared
according to the method of Clewell et al, Proc Nat Acad Sci USA
(1969) 62:1159, usually following chloramphenicol amplification
(Clewell, J Bacteriol (1972) 110:667). The DNA is isolated and
analyzed, usually by restriction enzyme analysis and/or sequencing.
Sequencing may be performed by the dideoxy method of Sanger et al,
Proc Nat Acad Sci USA (1977) 24:5463, as further described by
Messing et al, Nuc Acids Res (1981) 9:309, or by the method of
Maxam et al, Meth Enzymol (1980) 65:499. Problems with band
compression, which are sometimes observed in GC-rich regions, were
overcome by use of T-deazoguanosine according to Barr et al,
Biotechniques (1986) 4:428.
[0055] The enzyme-linked immunosorbent assay (ELISA) can be used to
measure either antigen or antibody concentrations. This method
depends upon conjugation of an enzyme to either an antigen or an
antibody, and uses the bound enzyme activity as a quantitative
label. To measure antibody, the known antigen is fixed to a solid
phase (e.g., a microtiter dish, plastic cup, dipstick, plastic
bead, or the like), incubated with test serum dilutions, washed,
incubated with anti-immunoglobulin labeled with an enzyme, and
washed again. Enzymes suitable for labeling are known in the art,
and include, for example, horseradish peroxidase (HRP). Enzyme
activity bound to the solid phase is usually measured by adding a
specific substrate, and determining product formation or substrate
utilization calorimetrically. The enzyme activity bound is a direct
function of the amount of antibody bound.
[0056] To measure antigen, a known specific antibody is fixed to
the solid phase, the test material containing antigen is added,
after an incubation the solid phase is washed, and a second
enzyme-labeled antibody is added. After washing, substrate is
added, and enzyme activity is measured colorimetrically, and
related to antigen concentration.
[0057] Proteases of the invention may be assayed for activity by
cleaving a substrate which provides detectable cleavage products.
As the HCV protease is believed to cleave itself from the genomic
polyprotein, one can employ this autocatalytic activity both to
assay expression of the protein and determine activity. For
example, if the protease is joined to its fusion partner so that
the HCV protease N-terminal cleavage signal (Arg--Arg) is included,
the expression product will cleave itself into fusion partner and
active HCV protease. One may then assay the products, for example
by western blot, to verify that the proteins produced correspond in
size to the separate fusion partner and protease proteins. It is
presently preferred to employ small peptide p-nitrophenyl esters or
methylcoumarins, as cleavage may then be followed by
spectrophotometric or fluorescent assays. Following the method
described by E. D. Matayoshi et al, Science (1990) 247:231-35, one
may attach a fluorescent label to one end of the substrate and a
quenching molecule to the other end: cleavage is then determined by
measuring the resulting increase in fluorescence. If a suitable
enzyme or antigen has been employed as the fusion partner, the
quantity of protein produced may easily be determined.
Alternatively, one may exclude the HCV protease N-terminal cleavage
signal (preventing self-cleavage) and add a separate cleavage
substrate, such as a fragment of the HCV NS3 domain including the
native processing signal or a synthetic analog.
[0058] In the absence of this protease activity, the HCV
polyprotein should remain in its unprocessed form, and thus render
the virus noninfectious. Thus, the protease is useful for assaying
pharmaceutical agents for control of HCV, as compounds which
inhibit the protease activity sufficiently will also inhibit viral
infectivity. Such inhibitors may take the form of organic
compounds, particularly compounds which mimic the cleavage site of
HCV recognized by the protease. Three of the putative cleavage
sites of the HCV polyprotein have the following amino acid
sequences:
5 Val-Ser-Ala-Arg-Arg // Gly-Arg-Glu-lle-Leu-Leu-Gly
Ala-lle-Leu-Arg-Arg // His-Val-Gly-Pro- Val-Ser-Cys-Gln-Arg //
Gly-Tyr-
[0059] These sites are characterized by the presence of two basic
anino acids immediately before the cleavage site, and are similar
to the cleavage sites recognized by other flavivirus proteases.
Thus, suitable protease inhibitors may be prepared which mimic the
basic/basic/small neutral motif of the HCV cleavage sites, but
substituting a nonlabile linkage for the peptide bond cleaved in
the natural substrate. Suitable inhibitors include peptide
trifluoromethyl ketones, peptide boronic acids, peptide
.alpha.-ketoesters, peptide difluoroketo compounds, peptide
aldehydes, peptide diketones, and the like. For example, the
peptide aldehyde N-acetyl-phenylalanyl-glycinaldehyde is a potent
inhibitor of the protease papain. One may conveniently prepare and
assay large mixtures of peptides using the methods disclosed in
U.S. patent application Ser. No. 7/189,318, filed May 2, 1988
(published as PCT WO89/10931), incorporated herein by reference.
This application teaches methods for generating mixtures of
peptides up to hexapeptides having all possible amino acid
sequences, and further teaches assay methods for identifying those
peptides capable of binding to proteases.
[0060] Other protease inhibitors may be proteins, particularly
antibodies and antibody derivatives. Recombinant expression systems
may be used to generate quantities of protease sufficient for
production of monoclonal antibodies (MAbs) specific for the
protease. Suitable antibodies for protease inhibition will bind to
the protease in a manner reducing or eliminating the enzymatic
activity, typically by obscuring the active site. Suitable MAbs may
be used to generate derivatives, such as Fab fragments, chimeric
antibodies, altered antibodies, univalent antibodies, and single
domain antibodies, using methods known in the art.
[0061] Protease inhibitors are screened using methods of the
invention. In general, a substrate is employed which mimics the
enzyme's natural substrate, but which provides a quantifiable
signal when cleaved. The signal is preferably detectable by
colorimetric or fluorometric means: however, other methods such as
HPLC or silica gel chromatography, GC-MS, nuclear magnetic
resonance, and the like may also be useful. After optimum substrate
and enzyme concentrations are determined, a candidate protease
inhibitor is added to the reaction mixture at a range of
concentrations. The assay conditions ideally should resemble the
conditions under which the protease is to be inhibited in vivo,
i.e., under physiologic pH, temperature, ionic strength, etc.
Suitable inhibitors will exhibit strong protease inhibition at
concentrations which do not raise toxic side effects in the
subject. Inhibitors which compete for binding to the protease
active site may require concentrations equal to or greater than the
substrate concentration, while inhibitors capable of binding
irreversibly to the protease active site may be added in
concentrations on the order of the enzyme concentration.
[0062] In a presently preferred embodiment, an inactive protease
mutein is employed rather than an active enzyme. It has been found
that replacing a critical residue within the active site of a
protease (e.g., replacing the active site Ser of a serine protease)
does not significantly alter the structure of the enzyme, and thus
preserves the binding specificity. The altered enzyme still
recognizes and binds to its proper substrate, but fails to effect
cleavage. Thus, in one method of the invention an inactivated HCV
protease is immobilized, and a mixture of candidate inhibitors
added inhibitors that closely mimic the enzyme's preferred
recognition sequence will compete more successfully for binding
than other candidate inhibitors. The poorly-binding candidates may
then be separated, and the identity of the strongly-binding
inhibitors determined For example, HCV protease may be prepared
substituting Ala for Ser.sub.221 (FIG. 1), providing an enzyme
capable of binding the HCV protease substrate, but incapable of
cleaving it. The resulting protease mutein is then bound to a solid
support, for example Sephadex.RTM. beads, and packed into a column.
A mixture of candidate protease inhibitors in solution is then
passed through the column and fractions collected. The last
fractions to elute will contain the strongest-binding compounds,
and provide the preferred protease inhibitor candidates.
[0063] Protease inhibitors may be administered by a variety of
methods, such as intravenously, orally, intramuscularly,
intraperitoneally, bronchially, intranasally, and so forth. The
preferred route of administration will depend upon the nature of
the inhibitor. Inhibitors prepared as organic compounds may often
be administered orally (which is generally preferred) if well
absorbed. Protein-based inhibitors (such as most antibody
derivatives) must generally be administered by parenteral
routes.
EXAMPLES
[0064] The examples presented below are provided as a further guide
to the practitioner of ordinary skill in the art, and are not to be
construed as limiting the invention in any way.
Example 1
[0065] (Preparation of HCV CDNA)
[0066] A genomic library of HCV CDNA was prepared as described in
PCT WO89/046699 and U.S. Ser. No. 7/456,637. This library, ATCC
accession no. 40394, has been deposited as set forth below.
Example 2
[0067] (Expression of the Polypeptide Encoded in Clone 5-1-1.)
[0068] (A) The HCV polypeptide encoded within clone 5-1-1 (see
Example 1) was expressed as a fusion-polypeptide with human
superoxide dismutase (SOD). This was accomplished by subcloning the
clone 5-1-1 CDNA insert into the expression vector pSODCFI (K.S.
Steimer et al, J Virol (1986) 58:9; EPO 138,111) as follows. The
SOD/5-1-1 expression vector was transformed into E. coli D1210
cells. These cells, named Cf1/5-1-1 in E. coli, were deposited as
set forth below and have an ATCC accession no. of 67967.
[0069] First, DNA isolated from pSODCF1 was treated with BamHI and
EcoRI, and the following linker was ligated into the linear DNA
created by the restriction enzymes:
GAT CCT GGA ATT CTG ATA AGA CCT TAA GAC TAT TIT AA
[0070] After cloning, the plasmid containing the insert was
isolated.
[0071] Plasmid containing the insert was restricted with EcoRI. The
HCV CDNA insert in clone 5-1-1 was excised with EcoRI, and ligated
into this EcoRI linearized plasmid DNA. The DNA mixture was used to
transform E. coli strain D1210 (Sadler et al, Gene (1980) 8:279).
Recombinants with the 5-1-1 cDNA in the correct orientation for
expressing the ORF shown in FIG. 1 were identified by restriction
mapping and nucleotide sequencing.
[0072] Recombinant bacteria from one clone were induced to express
the SOD-HCV.sub.5-1-1 polypeptide by growing the bacteria in the
presence of IPTG.
[0073] Three separate expression vectors, pcf1AB, pcf1CD, and
pcf1EF were created by ligating three new linkers, AB, CD, and EF
to a BamHI-EcoRI fragment derived by digesting to completion the
vector pSODCF1 with EcoRI and BamHI, followed by treatment with
alkaline phosphatase. The linkers were created from six oligomers,
A, B, C, D, E, and F. Each oligomer was phosphorylated by treatment
with kinase in the presence of ATP prior to annealing to its
complementary oligomer. The sequences of the synthetic linkers were
the following:
6 Name DNA Sequence (5' to 3') A GATC CTG AAT TCC TGA TAA B GAC TTA
AGG ACT ATT TTA A C GATC CGA ATT CTG TGA TAA D GCT TAA GAC ACT ATT
TTA A E GATC CTG GAA TTC TGA TAA F GAC CTT AAG ACT ATT TTA A
[0074] Each of the three linkers destroys the original EcoRI site,
and creates a new EcoRI site within the linker, but within a
different reading frame. Thus, the HCV cDNA EcoRI fragments
isolated from the clones, when inserted into the expression vector,
were in three different reading frames.
[0075] The HCV cDNA fragments in the designated .lambda.gt11 clones
were excised by digestion with EcoRI; each fragment was inserted
into pef1AB, pcf1CD, and pcf1EF. These expression constructs were
then transformed into D1210 E. coli cells, the transformants
cloned, and polypeptides expressed as described in part B
below.
[0076] (B3) Expression products of the indicated HCV cDNAs were
tested for antigenicity by direct immunological screening of the
colonies, using a modification of the method described in Helfman
et al, Proc Nat Acad Sci USA (1983), 80:31. Briefly, the bacteria
were plated onto nitrocellulose filters overlaid on ampicillin
plates to give approximately 40 colonies per filter. Colonies were
replica plated onto nitrocellulose filters, and the replicas were
regrown overnight in the presence of 2 mM IPTG and ampicllin. The
bacterial colonies were lysed by suspending the nitrocellulose
filters for about 15 to 20 min in an atmosphere saturated with
CHCl.sub.3 vapor. Each filter then was placed in an individual 100
mm Petri dish containing 10 mL of 50 mM Tris HCl, pH 7.5, 150 mM
NaCl, 5 mM MgCl.sub.2, 3% (w/v) BSA, 40 .mu.g/mL lysozyme, and 0.1
.mu.g/mL DNase. The plates were agitated gently for at least 8
hours at room temperature. The filters were rinsed in TBST (50 mM
Tris HCl, pH 8.0, 150 mM NaCl, 0.005% Tween.RTM. 20). After
incubation, the cell residues were rinsed and incubated for one
hour in TBS (TBST without Tween.RTM.) containing 10% sheep serum.
The filters were then incubated with pretreated sera in TBS from
individuals with NANBH, which-included 3 chimpanzees; 8 patients
with chronic NANBH whose sera were positive with respect to
antibodies to HCV C100-3 polypeptide (also called C100); 8 patients
with chronic NANBH whose sera were negative for anti-C100
antibodies; a convalescent patient whose serum was negative for
anti-C100 antibodies; and 6 patients with community-acquired NANBH,
including one whose sera was strongly positive with respect to
anti-C100 antibodies, and one whose sera was marginally positive
with respect to anti-C100 antibodies. The sera, diluted in TBS, was
pretreated by preabsorption with hSOD for at least 30 minutes at
37.degree. C. After incubation, the filters were washed twice for
30 min with TBST. The expressed proteins which bound antibodies in
the sera were labeled by incubation for 2 hours with
.sup.125I-labeled sheep anti-human antibody. After washing, the
filters were washed twice for 30 min with TBST, dried, and
autoradiographed.
Example 3
[0077] (Cloning of Full-Length SOD-Protease Fusion Proteins)
[0078] (A) pBR322-C200:
[0079] The nucleotide sequences of the HCV cDNAs used below were
determined essentially as described above, except that the cDNA
excised from these phages were substituted for the cDNA isolated
from clone 5-1-1.
[0080] Clone C33c was isolated using a hybridization probe having
the following sequence:
5' ATC AGG ACC GGG GTG AGA ACA ATT ACC ACT 3'
[0081] The sequence of the HCV CDNA in clone C33c is shown in FIG.
8, which also shows the amino acids encoded therein.
[0082] Clone 35 was isolated by screening with a synthetic
polynucleotide having the sequence:
5' AAG CCA CCG TGT GCG CTA GGG CTC AAG CCC 3'
[0083] Approximately 1 in 50,000 clones hybridized with the probe.
The polynucleotide and deduced amino acid sequences for C35 are
shown in FIG. 7.
[0084] Clone C31 is shown in FIG. 6, which also shows the amino
acids encoded therein. A C200 cassette was constructed by ligating
together a 718 bp fragment obtained by digestion of clone C33c DNA
with EcoRI and Hinfl, a 179 bp fragment obtained by digestion of
clone C31 DNA with HinfI and BglI, and a 377 bp fragment obtained
by digesting clone C35 DNA with BglI and EcoRI. The construct of
ligated fragments were inserted into the EcoRI site of pBR322,
yielding the plasmid pBR322-C200.
[0085] (B) C7f+C20c:
[0086] Clone 7f was isolated using a probe having the sequence:
5'-AGC AGA CAA GGG GCC TCC TAG GGT GCA TAA T-3'
[0087] The sequence of HCV cDNA in clone 7f and the amino acids
encoded therein are shown in FIG. 5.
[0088] Clone C20c is isolated using a probe having the following
sequence:
5'-TGC ATC AAT GGG GTG TGC TGG-3'
[0089] The sequence of HCV cDNA in clone C20c, and the amino acids
encoded therein are shown in FIG. 2.
[0090] Clones 7f and C20c were digested with EcoRI and SfaNI to
form 400 bp and 260 bp fragments, respectively. The fragments were
then cloned into the EcoRI site of pBR322 to form the vector
C7f+C20c, and transformed into HB101 cells.
[0091] S (C) C300:
[0092] Clone 8h was isolated using a probe based on the sequence of
nucleotides in clone 33c. The nucleotide sequence of the probe
was
5'-AGA GAC AAC CAT GAG GTC CCC GGT GIT C-3'.
[0093] The sequence of the HCV cDNA in clone 8h, and the amino
acids encoded therein, are shown in FIG. 4.
[0094] Clone C26d is isolated using a probe having the following
sequence:
5'-CTG TIG TGC CCC GCG GCA GCC-3'
[0095] The sequence and amino acid translation of clone C26d is
shown in FIG. 3.
[0096] Clones C26d and C33c (see part A above) were transformed
into the methylation minus E. coli strain GM48. Clone C26d was
digested with EcoRII and DdeI to provide a 100 bp fragment. Clone
C33c was digested with EcoRII and EcoRI to provide a 700 bp
fragment. Clone C8h was digested with EcoRI and DdeI to provide a
208 bp fragment These three fragments were then ligated into the
EcoRI site of pBR322, and transformed into E. coli HB101, to
provide the vector C300.
[0097] (D) Preparation of Full Length Clones:
[0098] A 600 bp fragment was obtained from C7f+C20c by digestion
with EcoRI and Nael, and ligated to a 945 bp NaeIEcoRI fragment
from C300, and the construct inserted into the EcoRI site of pGEM4Z
(commercially available from Promega) to form the vector
C7fC20cC300.
[0099] C7fC20cC300 was digested with NdeI and EcoRI to provide a
892 bp fragment, which was ligated with a 1160 bp fragment obtained
by digesting C200 with NdeI and EcoRI. The resulting construct was
inserted into the EcoRI site of pBR322 to provide the vector
C7fC20cC300C200. Construction of this vector is illustrated
schematically in FIG. 9.
Example 4
[0100] (Preparation of E. coli Expression Vectors)
[0101] (A) cf1SODP600:
[0102] This vector contains a full-length HCV protease coding
sequence fused to a functional hSOD leader. The vector
C7fC20cC300C200 was cleaved with EcoRI to provide a 2000 bp
fragment, which was then ligated into the EcoRI site of plasmid
cf1CD (Example 2A). The resulting vector encodes amino acids 1-151
of hSOD, and amino acids 946-1630 of HCV (numbered from the
beginning of the polyprotein, corresponding to amino acids 1-686 in
FIG. 1). The vector was labeled cf1SODp600 (sometimes referred to
as P600), and was transformed into E. coli D1210 cells. These
cells, ATCC accession no. 68275, were deposited as set forth
below.
[0103] (B) P190:
[0104] A truncated SOD-protease fusion polynucleotide was prepared
by excising a 600 bp EcoRI/Nael fragment from C7f+C20c, blunting
the fragment with Klenow fragment, ligating the blunted fragment
into the Klenow-blunted EcoRI site of cf1EF (Example 2A). This
polynucleotide encodes a fusion protein having amino acids 1-151 of
hSOD, and amino acids 1-199 of HCV protease.
[0105] (C) p300:
[0106] A longer truncated SOD-protease fusion polynucleotide was
prepared by excising an 892 bp EcoRI/NdeI fragment from
C7fC20cC300, blunting the fragment with Klenow fragment, ligating
the blunted fragment into the Klenow-blunted EcoRI site of cf1EF.
This polynucleotide encodes a fusion protein having amino acids
1-151 of hSOD, and amino acids 1-299 of HCV protease.
[0107] (D) P500:
[0108] A longer truncated SOD-protease fusion polynucleotide was
prepared by excising a 1550 bp EcoRI/EcoRI fragment from
C7fC20cC300, and ligating the fragment into the EcoRI site of cf1CD
to form P500. This polynucleotide encodes a fusion protein having
amino acids 1-151 of hSOD, and amino acids 946-1457 of HCV protease
(amino acids 1-513 in FIG. 1).
[0109] (E) FLAG/Protease Fusion
[0110] This vector contains a full-length HCV protease coding
sequence fused to the FLAG sequence, Hopp et al. (1988)
Biotechnology 6: 1204-1210. PCR was used to produce a HCV protease
gene with special restriction ends for cloning ease. Plasmid p500
was digested with EcoRI and NdeI to yield a 900 bp fragment. This
fragment and two primers were used in a polymerase chain reaction
to introduce a unique BglIl site at amino acid 1009 and a stop
codon with a SalI site at amino acid 1262 of the HCV-1, as shown in
FIG. 17 of WO 90/11089, published Oct. 4, 1990. The sequence of the
primers is as follows:
7 5' CCC GAG CAA GAT CTC CCG GCC C 3' and 5' CCC CGC TGC ATA AGC
AGT CGA CTT GGA 3'
[0111] After 30 cycles of PCR, the reaction was digested with BglII
and SalI, and the 710 bp fragment was isolated. This fragment wos
annealed and ligated to the following duplex:
8 MetAspTyrLysAspAspAspAspLysGlyArgGlu
CATGGACTACAAAGACGATGACGATAAAGGCCGGGA CTGATGTTTCTGCTACTGCTATTT-
CCGGCCCTCTAG
[0112] The duplex encodes the FLAG sequence, and initiator
methionine, and a 5' Ncol restriction site. The resulting NcoI/SalI
fragment was ligated into a derivative of pCF1.
[0113] This construct is then transformed into E. coli D1210 cells
and expression of the protease is induced by the addition of
IPTG.
[0114] The FLAG sequence was fused to the HCV protease to
facilitate purification. A calcium dependent monoclonal antibody,
which binds to the FLAG encoded peptide, is used to purify the
fusion protein without harsh eluting conditions.
Example 5
[0115] (E. coli Expression of SOD-Protease Fusion Proteins)
[0116] (A) E. coli D1210 cells were transformed with cf1SODp600 and
grown in Luria broth containing 100 .mu.g/mL ampicillin to an OD of
0.3-0.5. IPTG was then added to a concentration of 2 mM, and the
cells cultured to a final OD of 0.9 to 1.3. The cells were then
lysed, and the lysate analyzed by Western blot using anti-HCV sera,
as described in U.S. Ser. No. 7/456,637.
[0117] The results indicated the occurrence of cleavage, as no full
length product (theoretical Mr 93 kDa) was evident on the geL Bands
corresponding to the hSOD fusion partner and the separate HCV
protease appeared at relative molecular weights of about 34, 53,
and 66 kDa The 34 kDa band corresponds to the hSOD partner (about
20 kDa) with a portion of the NS3 domain, while the 53 and 66 kDa
bands correspond to HCV protease with varying degrees of (possibly
bacterial) processing.
[0118] (B) E. coli D1210 cells were transformed with P500 and grown
in Luria broth containing 100 .mu.g/mL ampicillin to an OD of
0.3-0.5. IPTG was then added to a concentration of 2 mM, and the
cells cultured to a final OD of 0.8 to 1.0. The cells were then
lysed, and the lysate analyzed as described above.
[0119] The results again indicated the occurrence of cleavage, as
no full length product (theoretical Mr 73 kDa) was evident on the
gel. Bands corresponding to the hSOD fusion partner and the
truncated HCV protease appeared at molecular weights of about 34
and 45 kDa, respectively.
[0120] (C) E. coli D1210 cells were transformed with vectors P300
and P190 and grown as described above.
[0121] The results from P300 expression indicated the occurrence of
cleavage, as no full length product (theoretical Mr 51 kDa) was
evident on the gel. A band corresponding to the hSOD fusion partner
appeared at a relative molecular weight of about 34. The
corresponding HCV protease band was not visible, as this region of
the NS3 domain is not recognized by the sera employed to detect the
products. However, appearance of the hSOD band at 34 kDa rather
than 51 kDa indicates that cleavage occurred.
[0122] The P190 expression product appeared only as the full
(encoded) length product without cleavage, forming a band at about
40 kDa, which corresponds to the theoretical molecular weight for
the uncleaved product. This may indicate that the minimum essential
sequence for HCV protease extends to the region between amino acids
199 and 299.
Example 6
[0123] (Purification of E. coli Expressed Protease)
[0124] The HCV protease and fragments expressed in Example 5 may be
purified as follows:
[0125] The bacterial cells in which the polypeptide was expressed
are subjected to osmotic shock and mechanical disruption, the
insoluble fraction containing the protease is isolated and
subjected to differential extraction with an alkaline-NaCl
solution, and the polypeptide in the extract purified by
chromatography on columns of S-Sepharose.RTM. and
Q-Sepharose.RTM..
[0126] The crude extract resulting from osmotic shock and
mechanical disruption is prepared by suspending 1 g of the packed
cells in 10 mL of a solution containing 0.02 M Tris HCl, pH 7.5, 10
mM EDTA, 20% sucrose, and incubating for 10 minutes on ice. The
cells are then pelleted by centrifugation at 4,000.times.g for 15
min at 4.degree. G. After the supernatant is removed, the cell
pellets are resuspended in 10 mL of Buffer A1 (0.01 M Tris HCl, pH
7.5, 1 mM EDTA, 14 mM .beta.-mercaptoethanol--".beta.ME"), and
incubated on ice for 10 minutes. The cells are again pelleted at
4,000.times.g for 15 minutes at 4.degree. G. After removal of the
clear supernatant (periplasmic fraction I), the cell pellets are
resuspended in Buffer Al, incubated on ice for 10 minutes, and
again centrifuged at 4,000.times.g for 15 minutes at 4.degree. G.
The clear supernatant (periplasmic fraction II) is removed, and the
cell pellet resuspended in 5 mL of Buffer T2 (0.02 M Tris HCl, pH
7.5, 14 mM .beta.ME, 1 mM EDTA, 1 mM PMSF). In order to disrupt the
cells, the suspension (5 mL) and 7.5 mL of Dyno-mrll lead-free acid
washed glass beads (0.10-0.15 mm diameter) (available from
Glen-Mills, Inc.) are placed in a Falcon tube and vortexed at top
speed for two minutes, followed by cooling for at least 2 min on
ice. The vortexing-cooling procedure is repeated another four
times. After vortexing, the slurry is filtered through a sintered
glass funnel using low suction, the glass beads washed twice with
Buffer A2, and the filtrate and washes combined.
[0127] The insoluble fraction of the crude extract is collected by
centrifugation at 20,000.times.g for 15 min at 4.degree. C., washed
twice with 10 mL Buffer A2, and resuspended in 5 mL of MILLI-Q
water.
[0128] A fraction containing the HCV protease is isolated from the
insoluble material by adding to the suspension NaOH (2 M) and NaCl
(2 M) to yield a fmal concentation of 20 mM each, vortexing the
mixture for 1 minute, centrifuging it 20,000.times.g for 20 min at
4.degree. C., and retaining the supernatant.
[0129] The partially purified protease is then purified by
SDS-PAGE. The protease may be identified by western blot, and the
band excised from the gel. The protease is then eluted from the
band, and analyzed to confmn its amino acid sequence. N-terminal
sequences may be analyzed using an automated amino acid sequencer,
while C-terminal sequences may be analyzed by automated amino acid
sequencing of a series of tryptic fragments.
Example 7
[0130] (Preparation of Yeast Expression Vector)
[0131] (A) P650 (SOD/Protease Fusion) This vector contains HCV
sequence, which includes the wild-type full-length HCV protease
coding sequence, fused at the 5' end to a SOD coding sequence. Two
fragments, a 441 bp EcoRIVBglII fragment from clone 1 lb and a 1471
bp BglII/EcoRI fragment from expression vector P500, were used to
reconstruct a wild-type, full-length HCV protease coding sequence.
These two fragments were ligated together with an EcoRI digested
pS356 vector to produce an expression cassette. The expression
cassette encodes the ADH2/GAPDH hybrid yeast promoter, human SOD,
the HCV protease, and a GAPDH transcription terminator. The
resulting vector was digested with BamHI and a 4052 bp fragment was
isolated. This fragment was ligated to the BamHI digested pAB24
vector to produce p650. p650 expresses a polyprotein containing,
from its amino terminal end, amino acids 1-154 of hSOD, an
oligopeptide --Asn--Leu--Gly--Ile--Arg--, and amino acids 819 to
1458 of HCV-1, as shown in FIG. 17 of WO 90/11089, published Oct.
4, 1990.
[0132] Clone 11b was isolated from the genomic library of HCV cDNA,
ATCC accession no. 40394, as described above in Example 3A, using a
hybridization probe having the following sequence:
5' CAC CTA TGT TrA TAA CCA TCT CAC TCC TCT 3'.
[0133] This procedure is also described in EPO Pub. No. 318 216,
Example IV.A.17.
[0134] The vector pS3EF, which is a pBR322 derivative, contains the
ADH2/GAPDH hybrid yeast promoter upstream of the human superoxide
dimutase gene, an adaptor, and a downstream yeast effective
transcription terminator. A similar expression vector containing
these control elements and the superoxide dismutase gene is
described in Cousens et al. (1987) Gene 61: 265, and in copending
application EPO 196,056, published Oct. 1, 1986. pS3EF, however,
differs from that in Cousens et al. in that the heterologous
proinsulin gene and the immunoglobulin hinge are deleted, and
Gln.sub.154 of SOD is followed by an
[0135] adaptor sequence which contains an EcoRI site. The sequence
of the adaptor is:
9 5' AAT TTG GGA ATT CCA TAA TTA ATT AAG 3' 3' AC CCT TAA GGT ATT
AAT TAA TTC AGCT 5'
[0136] The EcoRI site facilitates the insertion of heterologous
sequences. Once inserted into pS3EF, a SOD fusion is expressed
which contains an oligopeptide that links SOD to the heterologous
sequences. pS3EF is exactly the same as pS356 except that pS356
contains a different adaptor. The sequence of the adaptor is shown
below:
10 5' AAT TTG GGA ATT CCA TAA TGA G 3' 3' AC CCT TAA GGT ATT ACT
CAG CT 5'
[0137] pS356, ATCC accession no. 67683, is deposited as set forth
below.
[0138] Plasmid pAB24 is a yeast shuttle vector, which contains
pBR322 sequences, the complete 2p sequence for DNA replication in
yeast (Broach (1981) in: Molecular Biologv of the Yeast
Saccharomyces, Vol. 1, p. 445, Cold spring Harbor Press.) and the
yeast LEU2d gene derived from plasmid pC1/1, described in EPO Pub.
No. 116 201. Plasmid pAB24 was constructed by digesting YEp24 with
EcoRI and re-ligating the vector to remove the partial 2 micron
sequences. The resulting plasmid, YEp24deltaRI, was linearized with
Clal and ligated with the complete 2 micron plasmid which had been
linearized with ClaI. The resulting plasmid, pCBou, was then
digested with Xbal, and the 8605 bp vector fragment was gel
isolated. This isolated XbaI fragment was ligated with a 4460 bp
XbaI fragment containing the LEU.sup.2d gene isolated from pC1/1;
the orientation of LEU2d gene is in the same direction as the URA3
gene.
[0139] S. cerevisae, 2150-2-3 (pAB24-GAP-env2), accession no.
20827, is deposited with the American Type Culture Collection as
set forth below. The plasmid pAB24-GAP-env2 can be recovered from
the yeast cells by known techniques. The GAP-env2 expression
cassette can be removed by digesting pAB24GAPenv2 with BamHI. pAB24
is recovered by religating the vector without the BamnHI
insert.
Example 8
[0140] (Yeast Expression of SOD-Protease Fusion Protein)
[0141] p650 was transformed in S. cerevisae strain JSC310, Mata,
leu2, ura3-52, prbl-1122, pep4-3, prcl-407, cirl: DM15 (g418
resistance). The transformation is as described by Hinnen et al.
(1978) Proc Natl Acad Sci USA 75: 1929. The transformed cells were
selected on ura- plates with 8% glucose. The plates were incubated
at 30.degree. C. for 45 days. The tranformants were further
selected on leu- plates with 8% glucose putatively for high numbers
of the p650 plasmid. Colonies from the leu- plates were inoculated
into leu- medium with 3% glucose. These cultures were shaken at
30.degree. C. for 2 days and then diluted 1/20 into YEPD medium
with 2% glucose and shaken for 2 more days at 30.degree. C.
[0142] S. cerevisae JSC310 contains DM15 DNA, described in EPO Pub.
No. 340 986, published Nov. 8, 1989. This DM15 DNA enhances ADH2
regulated expression of heterologous proteins. pDM15, accession no.
40453, is deposited with the American Type Culture Collection as
set forth below.
Example 9
[0143] (Yeast Ubiquitin Expression of Mature HCV Protease)
[0144] Mature HCV protease is prepared by cleaving vector
C7fC20cC300C200 with EcoRI to obtain a 2 Kb coding sequence, and
inserting the sequence with the appropriate linkers into a
ubiquitin expression vector, such as that described in WO 88/02406,
published Apr. 7, 1988, or U.S. Ser. No. 7/390,599 filed Aug. 7,
1989, incorporated herein by reference. Mature HCV protease is
recovered upon expression of the vector in suitable hosts,
particularly yeast. Specifically, the yeast expression protocol
described in Example 8 is used to express a ubiquitin/HCV protease
vector.
Example 10
[0145] (Preparation of an In-Vitro Expression Vector)
[0146] (A) nGEMO-3ZIYeflow Fever Leader Vector
[0147] Four synthetic DNA fragments were annealed and ligated**
together to create a EcoRIlSacI Yellow Fever leader, which was
ligated to a EcoRI/SacI digested pGEM.RTM.-3Z vector from
Promega.RTM.. The sequence of the four fragments are listed
below:
11 YFK-1: 5' AAT TCG TAA ATC CTG TGT GCT AAT TGA GGT GCA TTG GTC
TGC AAA TCG AGT TGC TAG GCA ATA AAC ACA TT 3' YFK-2: 5' TAT TGC CTA
GCA ACT CGA TTT GCA GAC CAA TGC ACC TCA ATT AGC ACA CAG GAT TTA CG
3' YFK-3: 5' TGG ATT AAT TTT AAT CGT TCG TTG AGC GAT TAG CAG AGA
ACT GAC CAG AAC ATG TCT GAG CT 3' YFK-4: 5' CAG ACA TGT TCT GGT CAG
TTC TCT GCT AAT CGC TCA ACG AAC GAT TAA AAT TAA TCC AAA TGT GTT
3'.
[0148] For in-vitro translation of the HCV protease, the new
pGEM.RTM.-3Z/Yellow Fever leader vector was digested with BamHI and
blunted with Klenow.
[0149] (B) PvulI Construct from p6000
[0150] A clone p6000 was constructed from sequences available from
the genomic library of HCV cDNA, ATCC accession no. 40394. The HCV
encoding DNA sequence of p6000 is identical to nucleotide -275 to
nucleotide 6372 of FIG. 17 of WO 90/11089, published Oct. 4, 1990.
p6000 was digested with PvuII, and from the digest, a 2,864 bp
fragment was isolated. This 2,864 bp fragment was ligated to the
prepared pGEM.RTM.-3Z/Yellow Fever leader vector fragment,
described above.
Example 11
[0151] (In-Vitro Expression of HCV Protease)
[0152] (A) Transcription
[0153] The pGEM.RTM.-3Z7Yellow Fever leader/PvulI vector was
linearized with XbaI and transcribed using the materials and
protocols from Promega's Riboprobe.RTM. Gemini II Core system.
[0154] (B) Translation
[0155] The RNA produced by the above protocol was translated using
Promega's rabbit reticulocyte lysate, minus methionine, canine
pancreatic microsomal membranes, as well as, other necessary
materials and instructions from Promega.
[0156] Deposited Biological Materials:
[0157] The following materials were deposited with the American
Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville,
Md.:
12 Name Deposit Date Accession No. E. coli D1210, cf1SODp600 Mar 23
1990 68275 Cf1/5-1-1 in E. coli D1210 May 11 1989 67967
Bacteriophage .lambda.-gt11 cDNA Dec 01 1987 40394 library E. coli
HB101, pS356 Apr 29 1988 67683 plasmid DNA, pDM15 May 05 1988 40453
S. cerevisae, 2150-2-3 Dec 23 1986 20827 (pAB24-GAP-env2)
[0158] The above materials have been deposited with the ATCC under
the accession numbers indicated. These deposits will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for purposes of Patent
Procedure. These deposits are provided as a convenience to those of
skill in the art, and are not an admission that a deposit is
required under 35 U.S.C. .sctn.112. The polynucleotide sequences
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with the sequences described herein. A license may be
required to make, use or sell the deposited materials, and no such
license is granted hereby.
* * * * *