U.S. patent application number 10/124759 was filed with the patent office on 2003-03-20 for growth hormone releasing hormone expression system and methods of use, including use in animals.
This patent application is currently assigned to Baylor College of Medicine and GeneMedicine, Baylor College of Medicine and GeneMedicine. Invention is credited to Draghia-Akli, Ruxandra, Eastman, Eric M., Li, Xuyang, Schwartz, Robert J..
Application Number | 20030055017 10/124759 |
Document ID | / |
Family ID | 26732050 |
Filed Date | 2003-03-20 |
United States Patent
Application |
20030055017 |
Kind Code |
A1 |
Schwartz, Robert J. ; et
al. |
March 20, 2003 |
Growth hormone releasing hormone expression system and methods of
use, including use in animals
Abstract
Vectors which establish controlled expression of recombinant
GHRH genes within tissues at certain levels. The vector includes a
5' flanking region which includes necessary sequences for
expression of a nucleic acid cassette, a 3' flanking region
including a 3' UTR and/or 3' NCR, and a linker which connects the
5' flanking region to a nucleic acid sequence. The linker has a
position for inserting a nucleic acid cassette. The linker does not
contain the coding sequence of a gene that the linker is naturally
associated with. The 3' flanking region is 3' to the position for
inserting the nucleic acid cassette.
Inventors: |
Schwartz, Robert J.;
(Houston, TX) ; Draghia-Akli, Ruxandra; (Houston,
TX) ; Li, Xuyang; (Lewisville, TX) ; Eastman,
Eric M.; (Highland, MD) |
Correspondence
Address: |
LYON & LYON LLP
633 WEST FIFTH STREET
SUITE 4700
LOS ANGELES
CA
90071
US
|
Assignee: |
Baylor College of Medicine and
GeneMedicine
|
Family ID: |
26732050 |
Appl. No.: |
10/124759 |
Filed: |
April 16, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10124759 |
Apr 16, 2002 |
|
|
|
09122171 |
Jul 24, 1998 |
|
|
|
6423693 |
|
|
|
|
60062608 |
Oct 20, 1997 |
|
|
|
60053609 |
Jul 24, 1997 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/320.1; 435/455; 536/23.5 |
Current CPC
Class: |
C07K 14/60 20130101;
A61K 38/25 20130101; C07K 2319/00 20130101; A01K 2227/105 20130101;
A61K 48/00 20130101; A01K 67/0275 20130101; A01K 2217/00 20130101;
A01K 2267/03 20130101; C12N 15/8509 20130101; A01K 67/0278
20130101; A61K 48/0008 20130101; A01K 2217/05 20130101; A01K
2207/15 20130101; A01K 2267/02 20130101; A61K 48/0058 20130101;
C12N 15/85 20130101; C12N 2799/021 20130101 |
Class at
Publication: |
514/44 ;
536/23.5; 435/455; 435/320.1 |
International
Class: |
A61K 048/00; C07H
021/04; C12N 015/85 |
Goverment Interests
[0002] The work herein was supported by grants from the United
States Government. The United States Government may have certain
rights in the invention.
Claims
We claim:
1. A vector for expression of a nucleic acid sequence in a cell,
comprising: a nucleic acid cassette containing a nucleotide
sequence encoding GHRH; a 5' flanking region including one or more
sequences necessary for expression of said nucleic acid cassette,
wherein said sequences include a promoter; a linker connecting said
5' flanking region to a nucleic acid, said linker having a position
for inserting said nucleic acid cassette, wherein said linker lacks
the coding sequence of a gene with which it is naturally
associated; and a 3' flanking region, including a 3' UTR or a 3'
NCR or both, wherein said 3' flanking region is 3' to said position
for inserting said nucleic acid cassette, and wherein said 3'
flanking region comprises a sequence from a 3'-UTR.
2. The vector of claim 1, wherein said GHRH is human GHRH.
3. The vector of claim 2, wherein said nucleotide sequence encoding
for human GHRH is a synthetic sequence.
4. The vector of claim 3, wherein said nucleotide sequence encoding
for human GHRH has the sequence of SEQ ID NO. 2.
5. The vector of claim 1, wherein said promoter is a promoter from
a skeletal .alpha.-actin gene.
6. The vector of claim 5, wherein said promoter from a skeletal
.alpha.-actin gene is from a chicken.
7. The vector of claim 5, wherein said promoter from a skeletal
.alpha.-actin gene is from a human.
8. The vector of claim 1, wherein said 3'-UTR is a growth hormone
3'-UTR.
9. The vector of claim 8, wherein said growth hormone 3'-UTR is
from a human growth hormone gene.
10. The vector of claim 8, wherein an ALU repeat or ALU repeat-like
sequence is deleted from said 3' UTR.
11. The vector of claim 1, wherein said GHRH is human GHRH, said
promoter is from a chicken skeletal .alpha.-actin gene, and said
3'-UTR is from a human growth hormone gene.
12. The vector of claim 1, wherein said 5' flanking region or said
3' flanking region or both regulates expression of said nucleic
acid cassette predominately in a specific tissue.
13. The vector of claim 12, wherein said specific tissue is
myogenic.
14. The vector of claim 1, wherein said 5' flanking region includes
a promoter, a TATA box, a Cap site and a first intron and
intron/exon boundary in appropriate relationship for expression of
said nucleic acid cassette.
15. The vector of claim 14, wherein said 5' flanking region further
comprises a 5' mRNA leader sequence inserted between said promoter
and said nucleic acid cassette.
16. The vector of claim 1, wherein said vector further comprises an
intron/5' UTR from a chicken skeletal .alpha.-actin gene.
17. The vector of claim 1, wherein said vector further comprises an
antibiotic resistance gene.
18. The vector of claim 1, wherein said vector comprises a
nucleotide sequence which is the same as the nucleotide sequence of
plasmid PSK-GHRH.
19. A formulation for delivery and expression of a human GHRH gene
in a cell, said formulation comprising a vector of claim 1 in a
solution having between 0.5% and 50% PVP.
20. The formulation of claim 19, wherein said solution includes
about 5% PVP.
21. A transgenic animal having a plurality of cells containing the
vector of claim 1.
22. The transgenic animal of claim 21, wherein said cell is a germ
or somatic cell.
23. A cell transformed with a vector of claim 1.
24. The transformed cell of claim 23, wherein said cell is
myogenic.
25. A method for transfection of a cell in situ, comprising the
step of contacting said cell with a vector of claim 1 for
sufficient time to transfect said cell.
26. The method of claim 25, wherein transfection of said cell is
performed in vivo.
27. The method of claim 26, wherein said contacting is performed in
the presence of an about 5% PVP solution.
28. The method of claim 25, wherein transfection of said cell is
performed ex vivo, further comprising the steps of cotransfecting
said vector with a selectable marker and selecting the transformed
cells.
29. A method for delivery and expression of a GHRH gene in a
plurality of cells, comprising the steps of: (a) transfecting said
plurality of cells with a vector of claim 1; and (b) incubating
said plurality of cells under conditions allowing expression of a
nucleic acid sequence in said vector, wherein said nucleic acid
sequence encodes GHRH.
30. The method of claim 29, wherein said GHRH is hGHRH and said
cells are human cells.
31. The method of claim 30, wherein said contacting is performed in
the presence of an about 5% PVP solution.
32. A method for treating a disease or condition, comprising the
steps of transfecting a cell in situ with a vector of claim 1.
33. The method of claim 32, wherein said disease or condition is a
localized disease or condition.
34. The method of claim 32, wherein said disease of condition is a
systemic disease or condition.
35. The method of claim 32, wherein said disease or condition to be
treated is selected from the group consisting of osteoporosis,
cachexia, and growth disorders.
36. A method of expressing growth hormone releasing (GHRH) in a
non-human vertebrate animal comprising the step of: inserting a DNA
carrier vehicle containing a gene sequence encoding a growth
hormone releasing hormone polypeptide sequence operatively linked
to a vertebrate gene promoter into said non-human vertebrate animal
tissue under conditions where said gene is expressed and produces
growth hormone releasing hormone.
37. The method of claim 36 wherein said gene sequence encodes for a
growth hormone releasing hormone having one of the following
sequences: SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ
ID NO.9, or SEQ ID NO.11.
38. The method of claim 36 wherein said vertebrate animal is one of
the following species; porcine, bovine, equine, canine, feline,
caprine, avian (chicken, turkey, duck), ovine or fish.
39. The method of claim 36 wherein the gene sequence in said DNA
carrier vehicle contains no intervening sequences.
40. The method of claim 36, wherein said promoter is from a
skeletal a-actin gene.
41. The method of claim 36, wherein said DNA carrier vehicle is
injected into said animal muscle.
42. The method of claim 36, wherein said DNA carrier vehicle is a
plasmid DNA vector capable of infecting said vertebrate animals in
various tissues.
43. The method of claim 36, wherein said DNA carrier vehicle is an
adenovirus or adeno-associated virus capable of infecting said
vertebrate animals in various tissues.
44. The method of claim 43, wherein the promoter--GHRHcDNA-3' UTR
is incorporated into said adeno-associated virus.
45. The method of claim 36, wherein said vectors encode for an
Arg-Arg sequence before a tyrosine or a histidine.
46. The method of claim 36, wherein said DNA carrier vehicle
includes a gene switch.
47. The method of claim 36, wherein said gene sequence is a
chimeric synthetic cDNA encoding GHRH comprising a mouse specific
fragment and a species specific fragment and wherein the mouse
specific fragment contains the first 45 nucleotides and encodes the
first 15 amino acids of the mouse GHRH, and said mouse specific
fragment is fused in frame with the species-specific fragment
contains 87 nucleotides and encodes the 16th to 44th amino acids of
a species-specific GHRH, said chimeric sequence providing
resistance against dipeptidases.
48. The method of claim 47, wherein said species-specific fragment
for GHRH encodes a polypeptide from one of the following animal
species; porcine, bovine, equine, canine, feline, caprine, avian
(chicken, turkey, duck) ovine or fish.
49. The method of claim 47, wherein said species-specific fragment
of GHRH encodes DNA sequence encodes for one of the following GHRH
polypeptides: SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8,
SEQ ID NO.9, or SEQ ID NO.11.
Description
STATEMENT OF RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/122,171, titled "GROWTH HORMONE RELEASING
HORMONE EXPRESSION SYSTEM AND METHODS OF USE, INCLUDING USE IN
ANIMALS," filed Jul. 24, 1998, which claims priority to U.S. Patent
Application No. 60/062,608, filed Oct. 20, 1997 and U.S. Patent
Application No. 60/053,609, filed Jul. 24, 1997, all of which are
incorporated herein by reference in their entirety, including any
drawings.
FIELD OF THE INVENTION
[0003] The present invention is in the field of recombinant DNA
technology. This invention relates to vectors which encode stable
messenger RNA (mRNA) and methods of using such vectors. In
particular, this invention relates to vectors which establish
controlled expression of recombinant genes within a tissue; the
expression may be at levels which are useful for gene therapy and
other applications. The invention further relates to vectors able
to express growth hormone releasing hormone (GHRH) and gene
sequences inserted into vectors that control the production of
growth hormone releasing hormone in non-human vertebrate animals.
The invention is directed further to the use of these vectors in
the respective non-human animals to further growth and strengthen
their immune systems.
BACKGROUND OF THE INVENTION
[0004] None of the information provided herein is admitted to be
prior art to the present invention, but is provided only to aid the
understanding of the reader.
[0005] Growth hormone (GH) secretion by the anterior pituitary is
stimulated by growth hormone releasing hormone (GHRH) and inhibited
by stomatostatin (SS), both hypothalamic hormones (Scanlong, M. F.
et al., 1996, Hormone Research 149-154). GH enhances protein
synthesis, lypolysis, and epiphyseal growth, and is implicated in
the regulation of the immune system. GH increases circulating
insulin-like growth factor I (IGF-1) levels, which in turn,
mediates growth in the liver and peripheral tissues.
[0006] The GHRH-GH-IGF-I axis undergoes dramatic changes during the
aging process and in the elderly (Iranmanesh et al., 1991, J. Clin.
Endocrin. & Metab. 73:1081-1088; D'Costa A. P. et al., 1993, J.
Reproduction & Fertility--Suppl. 46:87-98,) with decreased GH
production rate and GH half-life, decreased IGF-I response to GH
and GHRH stimuli that lead to osteoporosis, increase in fat and
decrease in lean body mass and tissue function (Corpas et al.,
1993, Endocrine Rev. 14:20-39).
[0007] In addition, genetic disorders of growth have also been
ascribed to defects in the GHRH-GH-IGF-I axis, as those of GHRH
receptor (Cao, Wagner, Hindmarsh, Eble, & Mullis, 1995,
Pediatr. Res. 38:962-966), GH gene (Cogan et al., 1993, J. Clin.
Endocrin. & Metab. 76:1224-1228; Vnencak-Jones et al., 1988,
PNAS 85:5615-5619), GH receptor (Amselem et al., 1993, Human Molec.
Gen. 2:355-359; Amselem et al., 1991, Paediatrica
Scandinavica--Supplement 377:81-86; Meacham et al., 1993, J. Clin.
Endocrin. & Metab. 77:1379-1383) and pit-1 (Parks et al, 1993,
Hormone Research 40:54-61) a pituitary specific transcription
factor. In many cases growth retardation (GR) is a secondary
manifestation of an unrelated primary affection (Turner syndrome,
chronic renal failure, ovary resistant syndrome) or the exact cause
of GR can not be established (Parks et al., in Molecular
Endocrinology: Basic Concepts and Clinical Correlations (ed.
Weintraub, B. D., Raven Press Ltd., New York, 1995) p.473-490).
[0008] In these cases of GR where the GHRH-GH-IGF-I axis is
unaffected and in elderly, as well as in nonstatural related
catabolic conditions (burn, sepsis, trauma associated pathology,
chronic obstructive pulmonary disease), GH or GHRH replacement
therapy is efficient.
[0009] Recombinant GH therapy is currently used in clinics, but a
large number of studies have shown that side effects occur
frequently, including edema, hypertension, carpal tunnel syndrome,
hyperinsulinemia and impaired glucose tolerance (Marcus et al.,
1990, J. Clin. Endocrin. & Metab. 70:519-527; Salomon et al.,
1989, New Engl. J. Med. 321:1797-1803).
[0010] GH and IGF-1 also have beneficial effects on immune function
(LeRoith, D. et al., Endocrinology 137:1071-1079 (1996)); Kotzmann,
H. et al., Neuroendocrinology 60:618-625 (1994)). In farm animals,
GHRH is galactopoietic (stimulates milk production) with no
alteration in milk composition, increases the feed to milk
conversion and sustains growth, mostly through increased lean body
mass (Enright, W. J. et al., Journal of Animal Science 71:2395-2405
(1993); Enright, W. J. et al., Journal of Dairy Science 69:344-351
(1986)).
[0011] Studies have shown that relatively small amounts of GHRH are
required to stimulate the production and secretion of GH in all
species. Some benefits of increasing GH in non-human vertebrate
animals are improved growth rates, an increase in lean body mass,
an increase in feed efficiency in pigs, beef cattle and sheep,
increased milk production in dairy cows and goats, and enhanced
production of lean meat and egg production in poultry.
[0012] GH also enhances the immune system in animals. In animals
GHRH will have a great therapeutic utility in the treatment of
cachexia in chronic diseases such as cancer, diabetes, due to
growth hormone production abnormalities, enhancement of burn and
wound healing, bone healing, retardation of the aging process and
osteoporosis. However, the greatest use will be in agricultural
animals. Intramuscular injection of DNA vector can persist for
several months to produce sustained levels of GHRH. The
intramuscular delivery of GHRH vector represents a practical method
for improving performance in livestock animals.
[0013] Current limitations of recombinant GHRH therapy are the high
cost of recombinant proteins, the short half-life of the peptides
in vivo and the requirement for frequent administration (1-3
times/day) of either subcutaneous or intravenous injections. Using
a GHRH injectable DNA plasmid based vector will enhance endogenous
GH secretion in vertebrate animals with GH deficiencies in a manner
more closely mimicking the natural process and in a less expensive
manner than classical therapies.
SUMMARY OF THE INVENTION
[0014] The present invention is based in part on the identification
of certain nucleic acid sequences which confer advantageous tissue
targeting, expression, and secretion properties. Such sequences are
utilized in the construction of plasmid vectors encoding GHRH, for
delivery and expression of the GHRH coding sequences.
[0015] Expression of these vectors can be tissue specific. These
vectors are useful in facilitating enhanced expression in tissues
as well as in targeting expression with tissue specificity. These
vectors can be used to treat diseases by gene therapy by
restricting expression of a gene encoded on the vector to targeted
tissues. Vectors containing such sequences are able to provide gene
delivery and controlled expression of recombinant genes within
tissues; such expression can be at levels that are useful for gene
therapy and other applications. These vectors can also be used to
create transgenic animals for research or livestock
improvement.
[0016] The ability of the expression vector to provide enhanced
product secretion as well as direct expression to specific tissues
allows the vector to be used for treating numerous diseases. The
above vectors can be used in gene therapy where a vector encoding a
therapeutic product is introduced into a tissue so that the tissue
will express the therapeutic product. For example, the above
vectors may be used for treating muscle atrophy associated with
neurological, muscular, or systemic disease or aging by causing
tissues to express certain trophic factors.
[0017] In addition, the vectors can be used for gene replacement of
inherited genetic defects or acquired hormone deficiencies, for
vaccination in humans or animals to induce immune responses, or for
creating transgenic animals. The transgenic animals can be used as
models for studying human diseases, for assessing and exploring
novel therapeutic methods, to assess the effects of chemical and
physical carcinogens, and to study the effect of various genes and
genetic regulatory elements. Furthermore, transgenic animals can be
used to develop commercially important livestock species. The above
vectors can also be used to transform cells to produce particular
proteins and RNA in vi tro .
[0018] Expression of such vectors having a GHRH encoding sequence
in the body of a vertebrate, e.g., a human, can produce both direct
and indirect effects. The GHRH produces direct effects by the
direct action of the GHRH polypeptide. However, indirect effects
may also be produced due to the effect of the GHRH inducing or
turning on the expression of other genes, or modulating the
activity of other gene products. In particular, expression of GHRH
can affect the levels of GH and IGF-I.
[0019] In a first aspect, the present invention features a vector
for expression of a nucleic acid sequence in tissue by encoding
stable mRNA. The vector includes a 5' flanking region which
includes necessary sequences for the expression of a nucleic acid
cassette, which include a promoter sequence, preferably an actin
gene promoter sequence, more preferably a skeletal actin gene. The
vector also includes a 3' flanking region, which includes a 3' UTR
and/or a 3' NCR, which enhances secretion of the product expressed
from the nucleic acid cassette. Preferably the 3' UTR is from the
3' region of a growth hormone gene, more preferably from a human
growth hormone gene. Alternatively, in related vectors, the 3'
sequences may be selected to provide a higher level of retention of
the product within a tissue, e.g., within a muscle tissue, rather
than enhancing secretion. Such sequences can, for example, be from
a skeletal .alpha.-actin gene. The vector also includes a linker
which connects the 5' flanking region to a nucleic acid. The linker
does not contain the coding sequence of a gene that the linker is
naturally associated with. That is, the linker is not the normal
gene associated with the 5' and 3' regions. Preferably, the linker
includes a sequence coding for a GHRH gene, more preferably human
GHRH. The 3' flanking region is 3' to the position for inserting
coding sequence or the nucleic acid cassette.
[0020] The term "flanking region" as used herein refers to
nucleotide sequences on either side of an associated gene. Flanking
regions can be either 3' or 5' to a particular gene in question. In
general, flanking sequences contain elements necessary for
regulation of expression of a particular gene. Such elements
include, but are not limited to, sequences necessary for efficient
expression, as well as tissue specific expression. Examples of
sequences necessary for efficient expression can include specific
regulatory sequences or elements adjacent to or within the protein
coding regions of DNA. These elements, located adjacent to the
gene, are termed cis-acting elements. The signals are recognized by
other diffusible biomolecules in trans to alter the transcriptional
activity. These biomolecules are termed trans-acting factors.
Trans-acting factors and cis-acting elements have been shown to
contribute to the timing and developmental expression pattern of a
gene. Cis-acting elements are usually thought of as those that
regulate transcription and are usually found within promoter
regions and within upstream (5' ) or downstream (3' ) DNA flanking
regions.
[0021] Flanking DNA with regulatory elements that regulate
expression of genes in tissue may also include modulatory or
regulatory sequences which are regulated by specific factors, such
as glucocorticoids, androgens, progestins, antiprogestins (PCT
US93/04399; PCT US96/04324), vitamin D.sub.3 and its metabolites,
vitamin A and its metabolites, retinoic acid, calcium as well as
others.
[0022] "Modulatory" or "regulatory" sequences as used herein refer
to sequences which may be in the 3' or 5' flanking region, where
such sequences can enhance activation and/or suppression of the
transcription of the associated gene.
[0023] "Responsive" or "respond" as used herein refers to the
enhancement of activation and/or suppression of gene transcription
as discussed below.
[0024] "Metabolite" as used herein refers to any product from the
metabolism of the regulatory factors which regulate gene
expression.
[0025] In addition to the above, either or both of the 3' or 5'
flanking regions can cause tissue specificity. Such tissue
specificity provides expression predominantly in a specified cell
or tissue.
[0026] "Predominantly" as used herein means that the gene
associated with the 3' or 5' flanking region is expressed to a
higher degree only in the specific tissue as compared to low
expression or lack of expression in nonspecific tissue. The 3' or
5' flanking regions singularly or together as used herein may
provide expression of the associated gene in other tissues but to a
lower degree than expression in tissues or cells where expression
is predominate. Expression is preferentially in the specified
tissue. Such predominant expression can be compared with the same
magnitude of difference as will be found in the natural expression
of the gene (i.e. as found in a cell in vivo) in that particular
tissue or cell type as compared with other nonspecific tissues or
cells. Such differences can be observed by analysis of mRNA levels
or expression of natural gene products, recombinant gene products,
or reporter genes. Furthermore, northern analysis, X gal
immunofluorescence or CAT assays as discussed herein and as known
in the art can be used to detect such differences.
[0027] The 3' flanking region contains sequences or regions, e.g.
3' UTR and/or 3' NCR, which regulate expression of a nucleic acid
sequence with which it is associated. The 3' flanking regions can
provide tissue-specific expression to an associated gene. The 3'
flanking region also contains a transcriptional termination
signal.
[0028] The term "3' flanking region" as used herein includes that
portion of a naturally occurring sequence 3' to the transcribed
portion of the gene which are responsible for mRNA processing
and/or tissue-specific expression. That portion can be readily
defined by known procedures. For example, the portions of a 3'
flanking region which are responsible for mRNA stability and/or
tissue-specific expression can be mapped by mutational analysis or
various clones created to define the desired 3' flanking region
activity in a selected vector system.
[0029] The 3' flanking region can contain a 3' UTR and/or a 3' NCR.
The term "3' untranslated region" or "3' UTR" refers to the
sequence at the 3' end of structural gene which is transcribed from
the DNA but not translated into protein. This 3' UTR region does
not contain a poly(A) sequence, but generally contains a site at
which a poly(A) sequence is added. Poly (A) sequences are only
added after the transcriptional process.
[0030] Myogenic-specific 3' UTR sequences can be used to allow for
specific stability in muscle cells or other tissues. As described
below, myogenic-specific sequences refers to gene sequences
normally expressed in muscle cells, e.g., skeletal, heart and
smooth muscle cells. Myogenic specific mRNA stability provides an
increase in mRNA stability within myogenic cells. The increase in
stability provides increased expression. The 3' UTR and 3' NCR
sequences singularly or together can provide a higher level of mRNA
accumulation through increased mRNA stability. Thus, increased
expression and/or stability of mRNA leads to increased levels of
protein production.
[0031] The term "3' non-coding region" or "3' NCR" is a region
which is adjacent to the 3' UTR region of a structural gene. The 3'
NCR region generally contains a transcription termination signal.
Once transcription occurs and prior to translation, the RNA
sequence encoded by the 3' NCR is usually removed so that the
poly(A) sequence can be added to the MRNA. The 3' NCR sequences can
also be used to allow mRNA stability as described above. The 3' NCR
may also increase the transcription rate of the nucleic acid
cassette.
[0032] Either or both of the 3' UTR and 3' NCR sequences can be
selected from a group of myogenic-specific genes. Examples of
myogenic-specific genes include the skeletal .alpha.-actin gene,
fast myosin-light chain 1/3 gene, myosin-heavy chain gene, troponin
T gene, acetylcholine receptor subunit genes and muscle creatinine
kinase gene.
[0033] In reference to 3' flanking regions of this invention, the
term "growth hormone" refers to a gene product identified as a
growth hormone, for example, human growth hormone or bovine growth
hormone. Homologous gene sequences are known in the art for a
variety of different vertebrate animals. In different embodiments,
the vectors can incorporate 3' sequences, including 3' UTR
sequences from such growth hormone genes. The 3' sequence can be
modified from the sequence naturally found in the animal, for
example by the deletion of ALU repeat sequence from human growth
hormone 3' UTR. The deletion of ALU repeats or ALU repeat-like
sequences can be performed with a variety of 3' sequences; such
deletion generally reduces the rate of homologous recombination. A
variety of other modifications may also be made without destroying
the tissue targeting, stabilizing, and secretion properties of the
3' sequence.
[0034] The 5' flanking region is located 5' to the associated gene
or nucleic acid sequence to be expressed. As with the 3' flanking
region, the 5' flanking region can be defined by known procedures.
For example, the active portion of the 5' flanking region can be
mapped by mutational analysis or various clones of the 5' flanking
region created to define the desired activity in a selected vector.
The 5' flanking region can include, in addition to the above
regulatory sequences or elements, a promoter, a TATA box, and a CAP
site, which are in an appropriate relationship sequentially and
positionally for the expression of an associated gene.
[0035] In this invention, "sequences necessary for expression" are
those elements of the 5' flanking region which are sequentially and
positionally in an appropriate relationship to cause controlled
expression of a gene within a nucleic acid cassette. Expression is
controlled to certain levels within tissues such that the expressed
gene is useful for gene therapy and other applications involving
gene delivery. The 5' sequence can contain elements which regulate
tissue-specific expression or can include portions of a naturally
occurring 5' element responsible for tissue-specific
expression.
[0036] The term "promoter," as used herein refers to a recognition
site on a strand of DNA to which RNA polymerase binds. The promoter
usually is a DNA fragment of about 100 to about 200 base pairs (in
eukaryotic genes) in the 5' flanking DNA upstream of the CAP site
or the transcriptional initiation start site. The promoter forms an
"initiation complex" with RNA polymerase to initiate and drive
transcriptional activity. The complex can be modified by activating
sequences termed "enhancers" or inhibitory sequences termed
"silencers". The promoter can be one which is naturally (i.e.,
associated as if it were within a cell in vivo) or non-naturally
associated with a 5' flanking region.
[0037] A variety of promoters can be used. Some examples include
thymidine kinase promoter, myogenic-specific promoters including
skeletal .alpha.-actin gene promoter, fast myosin light chain 1
promoter, myosin heavy chain promoter, troponin T promoter, and
muscle creatinine kinase promoter, as well as non-specific
promoters including the cytomegalovirus immediate early promoter,
and Rous Sarcoma virus LTR. These promoters or other promoters used
with the present invention can be mutated in order to increase
expression of the associated gene. Furthermore a promoter may be
used by itself or in combination with elements from other
promoters, as well as various enhancers, transcript stabilizers, or
other sequences capable of enhancing function of the vector.
[0038] "Mutation" as used herein refers to a change in the sequence
of genetic material from normal, causing a change in the functional
characteristics of the gene. This includes gene mutations where
only a single base is changed in the natural gene promoter
sequences or multiple bases are changed.
[0039] The term "intron" as used herein refers to a section of DNA
occurring in a transcribed portion of a gene which is included in a
precursor RNA but is then excised during processing of the
transcribed RNA before translation occurs. Intron sequences are
therefore not found in mRNA nor translated into protein. The term
"exon" as used herein refers to a portion of a gene that is
included in a transcript of a gene and survives processing of the
RNA in the cell to become part of a mature mRNA. Exons generally
encode three distinct functional regions of the RNA transcript. The
first, located at the 5' end which is not translated into protein,
termed the 5' untranslated region (5' UTR), signals the beginning
of RNA transcription and contains sequences that direct the mRNA to
the ribosomes and cause the mRNA to be bound by ribosomes so that
protein synthesis can occur. The second contains the information
that can be translated into the amino acid sequence of the protein
or function as a bioactive RNA molecule. The third, located at the
3' end is not translated into protein, i.e. 3' UTR, contains the
signals for termination of translation and for the addition of a
polyadenylation tail (poly(A). In particular, the 3' UTR as defined
above can provide mRNA stability. The intron/exon boundary will be
that portion in a particular gene where an intron section connects
to an exon section. The terms "TATA box" and "CAP site" are used as
they are recognized in the art.
[0040] The term "linker" as used herein refers to DNA which
contains the recognition site for a specific restriction
endonuclease. Linkers may be ligated to the ends of DNA fragments
prepared by cleavage with some other enzyme. In particular, the
linker provides a recognition site for inserting the nucleic acid
cassette which contains a specific nucleic sequence to be
expressed. This recognition site may be but is not limited to an
endonuclease site in the linker, such as Cla-I, Not-I, Xmal,
Bgl-II, Pac-I, Xhol, Nhel, Sfi-I. A linker can be designed so that
the unique restriction endo-nuclease site contains a start codon
(e.g. AUG) or stop codon (e.g. TAA, TGA, TCA) and these critical
codons are reconstituted when a sequence encoding a protein is
ligated into the linker. Such linkers commonly include an NcoI or
SphI site.
[0041] The term "leader" as used herein refers to a DNA sequence at
the 5' end of a structural gene which is transcribed and translated
along with the gene. The leader usually results in the protein
having an n-terminal peptide extension sometimes called a
pro-sequence. For proteins destined for either secretion to the
extracellular medium or the membrane, this signal sequence directs
the protein into endoplasmic reticulum from which it is discharged
to the appropriate destination. The leader sequence normally is
encoded by the desired nucleic acid, synthetically derived or
isolated from a different gene sequence. A variety of leader
sequences from different proteins can be used in the vectors of the
present invention. Some non-limiting examples include gelsolin,
albumin, fibrinogen and other secreted serum proteins.
[0042] The term "vector" as used herein refers to a nucleic acid,
e.g., DNA derived from a plasmid, cosmid, phasmid or bacteriophage
or synthesized by chemical or enzymatic means, into which one or
more fragments of nucleic acid may be inserted or cloned which
encode for particular genes. The vector can contain one or more
unique restriction sites for this purpose, and may be capable of
autonomous replication in a defined host or organism such that the
cloned sequence is reproduced. The vector may have a linear,
circular, or supercoiled configuration and may be complexed with
other vectors or other materials for certain purposes. The
components of a vector can include but are not limited to a DNA
molecule incorporating: (1) a sequence encoding a therapeutic or
desired product; and (2) regulatory elements for transcription,
translation, RNA stability and replication.
[0043] The vector can be used to provide expression of a nucleic
acid sequence in tissue. In the present invention this expression
is enhanced by providing stability to an mRNA transcript from the
nucleic acid sequence and/or secretion of the therapeutic protein.
Expression includes the efficient transcription of an inserted gene
or nucleic acid sequence within the vector. Expression products may
be proteins including but not limited to pure protein
(polypeptide), glycoprotein, lipoprotein, phosphoprotein, or
nucleoprotein. Expression products may also be RNA. The nucleic
acid sequence is contained in a nucleic acid cassette. Expression
of the nucleic acid can be continuous or controlled by endogenous
or exogenous stimuli.
[0044] The term "control" or "controlled" as used herein relates to
the expression of gene products (protein or RNA) at sufficiently
high levels such that a therapeutic effect is obtained. Levels that
are sufficient for therapeutic effect are lower than the toxic
levels. Levels of expression for therapeutic effect within selected
tissues corresponds to reproducible kinetics of uptake, elimination
from cell, post--translational processing, and levels of gene
expression, and, in certain instances, regulated expression in
response to certain endogenous or exogenous stimuli (e.g.,
hormones, drugs).
[0045] The term "nucleic acid cassette" as used herein refers to
the genetic material of interest which codes for a protein or RNA.
The nucleic acid cassette is positionally and sequentially oriented
within the vector such that the nucleic acid in the cassette can be
transcribed into RNA, and when necessary, translated into a protein
in the transformed tissue or cell. Preferably, the cassette has 3'
and 5' ends adapted for ready insertion into a vector, e.g., it has
restriction endonuclease sites at each end. In the vectors of this
invention, a nucleic acid cassette contains a sequence coding for
growth hormone releasing hormone (GHRH), e.g., human GHRH.
[0046] The term "tissue" as used herein refers to a collection of
cells specialized to perform a particular function or can include a
single cell. The cells may be of the same type or of different
types.
[0047] The term "gene", e.g., "myogenic genes," as used herein
refers to those genes exemplified herein and their equivalence in
other animal species or other tissues. Homologous sequences (i.e.
sequences having a common evolutionary origin representing members
of the same superfamily) or analogous sequences (i.e. sequences
having common properties though a distinct evolutionary origin) are
also included so long as they provide equivalent properties to
those described herein. It is important in this invention that the
chosen sequence provide the enhanced levels of expression,
expression of the appropriate product, and/or tissue-specific
expression as noted herein. Those in the art will recognize that
the minimum sequences required for such functions are encompassed
by the above definition. These minimum sequences are readily
determined by standard techniques exemplified herein.
[0048] The term "myogenic" refers to muscle tissue or cells. The
muscle tissue or cells can be in vivo, in vitro, or in vitro tissue
culture and capable of differentiating into muscle tissue. Myogenic
cells include skeletal, heart and smooth muscle cells. Genes are
termed "myogenic" or "myogenic-specific" if they are expressed or
expressed preferentially in myogenic cells. Vectors are termed
"myogenic" or "myogenic-specific" if they function preferentially
in myogenic muscle tissue or cells. Myogenic activity of vectors
can be determined by transfection of these vectors into myogenic
cells in culture, injected into intact muscle tissue, or injected
into mammalian oocytes to be stably incorporated into the genome to
generate transgenic animals which express the protein or RNA of
interest in myogenic cells.
[0049] The term "non-myogenic" refers to tissue or cells other than
muscle. The tissues or cells can be in vivo, in vitro, or in vitro
tissue culture.
[0050] In a preferred embodiment, the vector described above may
have its 5' flanking region from myogenic genes, in particular the
skeletal a-actin gene, e.g., a chicken skeletal .alpha.-actin gene.
Specifically, this can include a promoter sequence which may be
linked with other 5' UTR sequences, which can include an intron.
While vectors using the chicken skeletal .alpha.-actin promoter
and/or other 5' flanking sequences are exemplified herein, the 5'
sequences for .alpha.-actin genes are highly conserved, therefore,
such 5' .alpha.-actin sequences can be utilized from other
vertebrate species, including, for example, human.
[0051] In preferred embodiments, the 3' UTR is from a growth
hormone gene, preferably from a human growth hormone gene, and
preferably includes a poly(A) signal. This sequence can be linked
immediately following the natural translation termination codon for
a cDNA sequence coding for the protein or RNA to be expressed. As
discussed above, these regions can be further and more precisely
defined by routine methodology, e.g., deletion or mutation analysis
or their equivalents.
[0052] The 5' or 3' sequences may have a sequence identical to the
sequence as naturally found, but may also have changed sequences
which provide equivalent function to a vector in which such 5' or
3' sequences are incorporated. Such a change, for example, could be
a change of ten nucleotides in any of the above regions. In
particular, such changes can include the deletion of ALU repeat
sequences from the 3' UTR. This is only an example and is
non-limiting.
[0053] Also in preferred embodiments, the sequence encoding GHRH is
a synthetic GHRH coding sequence. Such a synthetic sequence has a
nucleotide sequence which differs from a natural human GHRH coding
sequence. It is preferred that the sequence utilize optimal codon
usage; preferably at least 50%, 70%, or 90% of the codons are
optimized. Thus, in preferred embodiments the synthetic DNA
sequence has at least 80, 90, 95, or 99% sequence identity to the
sequence of SEQ ID NO. 1. In a particular preferred embodiment, the
synthetic DNA sequence has at least 95% identity, more preferably
at least 99% identity, and most preferably 100% identity to the
sequence of SEQ ID NO. 2.
[0054] In addition, another embodiment of the above vector may
contain a regulatory system for regulating expression of the
nucleic acid cassette. The term "regulatory system" as used herein
refers to cis-acting or trans-acting sequences incorporated into
the above vectors which regulate in some characteristic the
expression of the nucleic acid of interest as well as trans-acting
gene products which are co-expressed in the cell with the above
described vector. Regulatory systems can be used for up-regulation
or down regulation of expression from the normal levels of
expression or existing levels of expression at the time of
regulation. The system contributes to the timing and developmental
expression pattern of the nucleic acid.
[0055] One construction of a regulatory system includes a chimeric
trans-acting regulatory factor incorporating elements of a serum
response factor capable of regulating expression of the vector in a
cell. The chimeric transacting regulatory factor is constructed by
replacing the normal DNA binding domain sequence of the serum
response factor with a DNA binding domain sequence of a receptor.
The serum response factor has a trans-activation domain which is
unchanged. The trans-activation domain is capable of activating
transcription when an agent or ligand specific to the receptor
binding site binds to the receptor. Thus, regulation can be
controlled by controlling the amount of the agent.
[0056] The DNA binding domain sequence of a receptor, incorporated
into the chimeric trans-activating regulatory factor, can be
selected from a variety of receptor groups including but not
limited to vitamin, steroid, thyroid, orphan hormone, retinoic
acid, thyroxine, or GAL4 receptors. The chimeric trans-activating
regulator factor is usually located within the sequence of the
promoter. In one preferred embodiment the promoter used in the
vector is the -actin promoter and the receptor is the vitamin D
receptor.
[0057] "Receptor" as used herein includes natural receptors (i.e.,
as found in a cell in vivo) as well as anything that binds alike
and causes compartmentalization changes in a cell.
[0058] Another embodiment of the regulatory system includes the
construction of a vector with two functional units. One functional
unit expresses a receptor. This functional unit contains elements
required for expression including a promoter, a nucleic acid
sequence coding for the receptor, and a 3' UTR and/or a 3' NCR. The
second functional unit expresses GHRH or a derivative or RNA and
contains, in addition, a response element corresponding to the
receptor, a promoter, a nucleic acid cassette, and a 3' UTR and/or
a 3' NCR. These functional units can be in the same or separate
vectors.
[0059] The first functional unit expresses the receptor. It is
favorable to use a receptor not found in high levels in the target
tissue. The receptor forms an interaction, e.g., ionic, non-ionic,
hydrophobic, H-bonding, with the response element on the second
functional unit prior to, concurrent with, or after the binding of
the agent or ligand to the receptor. This interaction allows the
regulation of the nucleic acid cassette expression. The receptor
can be from the same nonlimiting group as disclosed above.
Furthermore, the vector can be myogenic specific by using myogenic
specific 3' UTR and/or 3' NCR sequences.
[0060] In an exemplary preferred embodiment the plasmid can be
pSK-GHRH or a plasmid comprising a nucleotide sequence which is the
same as the sequence of PSK-GHRH. This is only an example and is
meant to be non-limiting. Thus, sequence changes or variations can
be made to one or more of the sequence elements, such as the 5' and
3' flanking regions.
[0061] In this context, the word "same" means that the sequences
are functionally equivalent and have a high degree of sequence
identity. However, the sequences may have a low level of sequence
differences, such as by substitution, deletion, or addition of one
or more nucleotides. Such sequences will preferably be less than
10%, more preferably less than 5%, and still more preferably less
than 1% of the total sequence.
[0062] In particular embodiments, the vectors of the above aspect
may alternatively comprise, consist essentially of, or consist of
the stated elements or sequences.
[0063] A related aspect of the invention provides a formulation for
delivery and expression of a GHRH gene in a cell, preferably a
human GHRH gene. The formulation includes a vector of the above
aspect together with one or more other components which can, for
example, act to stabilize the vector or to enhance transfection
efficiency, but can also provide other functions. In a preferred
embodiment, the formulation includes the vector in a solution
having between about 0.5% and 50% polyvinyl pyrrolidone (PVP),
preferably about 5% PVP. Preferably, the PVP has a weight average
molecular weight of about 50,000 g/mol. Further information is
disclosed in PCT US95/17038. However, another example of a
formulation includes the vector with a cationic lipid (e.g., as
described in U.S. Pat. No. 4,897,355, issued Jan. 30, 1990), and
can also include a co-lipid, such as a neutral co-lipid, e.g.,
cholesterol.
[0064] In reference to the formulations of this invention, the term
"about" indicates that in preferred embodiments, the actual value
for a particular parameter is in the range of 50%-200% of the
stated value.
[0065] Another related aspect of the invention features a
transgenic animal, at least some cells of which contain vectors of
the first aspect of the present invention. These cells include germ
or somatic cells. The transgenic animals can be used as models for
studying human diseases, for assessing and exploring novel
therapeutic methods, to assess the effects of chemical and physical
carcinogens, and to study the effect of various genes and genetic
regulatory elements. In addition, transgenic animals can be used to
develop commercially important livestock species.
[0066] A fourth related aspect of the present invention features
cells transformed with a vector of the present invention for
expression of a GHRH nucleic acid sequence, preferably a human
hGHRH (hGHRH) nucleic acid sequence.
[0067] As used herein, "transformation" is the change in a cell's
phenotypic characteristics by the action of a gene expressing a
gene product. The gene causing the phenotypic characteristic change
has been transfected into the cell.
[0068] The term "transfection" as used herein refers to a mechanism
of gene transfer which involves the uptake of DNA by a cell or
organism. Following entry into the cell, the transforming DNA may
recombine with that of the host by physically integrating into the
chromosomes of the host cell, may be maintained transiently as an
episomal element without being replicated, or may replicate
independently as a plasmid. Preferably the transforming DNA does
not integrate.
[0069] Transfection can be performed by in vivo techniques as
described below, or by ex vivo techniques in which cells are
co-transfected with a vector containing a selectable marker. This
selectable marker is used to select those cells which have become
transformed. It is well known to those skilled in the art the type
of selectable markers to be used with transfection/transformation
studies. An example of such a marker is a neo gene, providing
neomycin/kanamycin resistance.
[0070] Transfection/transformation can be tissue-specific, i.e.,
involve the use of myogenic specific vectors which cause expression
of the nucleic acid cassette predominantly in the tissue of choice.
In particular, tissue specificity can be directed to myogenic cells
by using a promoter and/or 3' UTR and/or 3' NCR sequences specific
for myogenic tissue expression.
[0071] A fifth related aspect of the present invention features
methods for transfecting a cell with the vectors of the present
invention. These methods comprise the steps of contacting a cell in
situ with a vector of the present invention for sufficient time to
transfect the cell. As discussed above, transfection can be in vivo
or ex vivo.
[0072] A sixth related aspect of the invention provides a method
for delivery and expression of a GHRH gene, preferably a hGHRH
gene. The method comprises transfecting a plurality of cells with a
vector of the first aspect and incubating the cells under
conditions allowing expression of a nucleic acid sequence of the
vector, which codes for GHRH. The "conditions allowing expression"
may be any of a variety of conditions, including in vivo and in
vitro conditions. Under such conditions, the cells will produce.
the gene product from the vector DNA in detectable quantities.
[0073] A seventh related aspect of the present invention features a
method for treating a disease or condition by transfecting cells
with the above-referenced vectors. Such disease or condition may,
for example, be localized or systemic. These vectors contain
nucleic acid sequences coding for growth hormone releasing hormone.
Diseases and conditions can include but are not limited to burn,
sepsis, trauma associated pathology, chronic obstructive pulmonary
disease, aging associated osteoporosis, atherogenesis,
atherosclerotic cardiovascular, cerebrovascular, or peripheral
vascular disease, growth disorders and hemophilia.
[0074] The muscle atrophy to be treated may be due to any of a
variety of different causes. For example, muscle weakness may be
primarily due to disuse atrophy which commonly occurs in situations
such as joint replacement, to muscle wasting during ageing, or to
disease related cachexia. The causes may also include genetic
causes of muscular atrophy, including, for example, muscular
dystrophy. These causes and conditions are only exemplary and are
not limiting to the invention.
[0075] Thus, "localized" disease or condition refers to those in
which there is specific nerve or muscle damage or atrophy to a
defined and limited area of the body. A specific example is disuse
atrophy. A "systemic" disease or condition refers to those which
relate to the entire organism, or is widely distributed at a number
of locations within the body. Examples include growth disorders,
neuropathies, and muscular dystrophy.
[0076] The methods of treating disease of the present invention
feature methods for establishing expression of GHRH in tissue by
administration of a vector. These methods of use of the
above-referenced vectors comprise the steps of administering an
effective amount of the vectors to a human, animal or tissue
culture.
[0077] The term "administering" or "administration" as used herein
refers to the route of introduction of a vector or carrier of DNA
into the body. The vectors of the above methods and the methods
discussed below may be administered by various routes. In
particular a preferred target cell for treatment is the skeletal
muscle cell.
[0078] The term "skeletal muscle" as used herein refers to those
cells which comprise the bulk of the body's musculature, i.e.,
striated muscle.
[0079] Administration can be directly to a target tissue or may
involve targeted delivery after systemic administration. The
preferred embodiments are by direct injection into muscle or
targeted uptake into muscle after intra-venous injection.
[0080] The term "delivery" refers to the process by which the
vector comes into contact with the preferred target cell after
administration. Administration may involve needle injection into
cells, tissues, fluid spaces, or blood vessels, electroporation,
transfection, hypospray, iontophoresis, particle bombardment, or
transplantation of cells genetically modified ex vivo. Examples of
administration include intravenous, intramuscular, aerosol, oral,
topical, systemic, ocular, intraperitoneal and/or intrathecal.
[0081] The preferred means for administration of vectors described
above involves the use of formulations for delivery to the target
cell in which the vector is associated with elements such as
lipids, proteins, carbohydrates, synthetic organic compounds, or
in-organic compounds which enhance the entry of the vector into the
nucleus of the target cell where gene expression may occur. A
particular example is polyvinyl pyrrolidone(PVP).
[0082] The term "formulation" as used herein refers to non-genetic
material combined with the vector in a solution, suspension, or
colloid which enhances the delivery of the vector to a tissue,
uptake by cells within the tissue, intracellular trafficking
through the membrane, endosome or cytoplasm into the nucleus, the
stability of the vector in extracellular or intracellular
compartments, and/or expression of genetic material by the
cell.
[0083] In a preferred embodiment of the present invention the
vector and formulation comprises a nanoparticle which is
administered as a suspension or colloid. The formulation can
include lipids, proteins, carbohydrates, synthetic organic
compounds, or inorganic compounds. Examples of elements which are
included in a formulation are lipids capable of forming liposomes,
cationic lipids, hydrophilic polymers, polycations (e.g. protamine,
polybrine, spermidine, polylysine), peptide or synthetic ligand
recognizing receptors on the surface of the target cells, peptide
or synthetic ligand capable of inducing endosomal-lysis, peptide or
synthetic ligand capable of targeting materials to the nucleus,
gels, slow release matrices, salts, carbohydrates, nutrients, or
soluble or insoluble particles as well as analogues or derivatives
of such elements. This includes formulation elements enhancing the
delivery, uptake, stability, and/or expression of genetic material
into cells. This list is included for illustration only and is not
intended to be limiting in any way.
[0084] Another embodiment of the present invention features the
above vectors with coating elements that enhance expression as well
as uptake by the cell. The term "coating" as used herein refers to
elements, proteins or molecules used to associate with the vector
in order to enhance cellular uptake. In particular, coating
includes a DNA initiation complex and histones. The coating
improves the stability of the vector, its entry into the nucleus,
and the efficiency of transcription.
[0085] The term "DNA initiation complex" as used herein refers to a
complex containing a serum response factor, a transcription
initiation factor and a trans-regulatory factor. The serum response
factor is attached to or interacts with the serum response element
within the promoter region of the vector. The transcription
initiation factor and the trans-regulatory factor then interact
with the serum response factor and the promoter, in particular the
TATA box within the promoter, to form a stable DNA complex. The
term "histone" as used herein refers to nuclear proteins which
associate with and/or bind to DNA, e.g., a vector. The histones can
bind specifically or non-specifically to the DNA.
[0086] The term "effective amount" as used herein refers to
sufficient vector administered to humans, animals or into tissue
culture to produce the adequate levels of protein or RNA. One
skilled in the art recognizes that the adequate level of protein or
RNA will depend on the use of the particular vector. These levels
will be different depending on the type of administration and
treatment or vaccination.
[0087] The methods for treating diseases as disclosed herein
includes treatment with biological products (specifically proteins
as defined above) in which the disease being. treated requires the
protein to circulate through the body from the general circulation.
For example, disorders which might be treated by the present
invention include osteoporosis by expression of GHRH or its binding
proteins. The selection of the appropriate protein to treat various
diseases will be apparent to one skilled in the art.
[0088] In treating disease, the present invention provides a means
for achieving: (1) sufficiently high levels of a particular protein
to obtain a therapeutic effect; (2) controlled expression of
product at levels which are sufficient for therapeutic effect and
lower than the toxic levels; (3) controlled expression in certain
tissues in order to obtain reproducible pharmacokinetics and levels
of gene expression; and (4) delivery using clinically and
pharmaceutically acceptable means of administration and formulation
rather than transplantation of genetically engineered and selected
cells.
[0089] In doing so, the present invention provides significant
advances over the art. First, promoters from viral genomes and
viral vectors which were used to obtain high level expression in
tissue, were not able to provide controlled expression. Second,
promoters from various tissue-specific genes which were used to
obtain controlled expression in transgenic animals and animal
models of gene therapy did not have a sufficiently high level of
expression to obtain therapeutic effect. In addition, in treating
diseases with the present invention, the ability to raise
antibodies against protein products does not reflect the ability to
achieve controlled expression of proteins within the therapeutic
range.
[0090] An eighth related aspect of the present invention features a
method of gene replacement for inherited genetic diseases of
muscle. This method includes the transfection of muscle cells with
the above-referenced vectors.
[0091] The genetic material which is incorporated into the cells
from the above vectors can be any natural or synthetic nucleic
acid. For example, the nucleic acid can be: (1) not normally found
in the tissue of the cells; (2) normally found in a specific tissue
but not expressed at physiological significant levels; (3) normally
found in specific tissue and normally expressed at physiological
desired levels; (4) any other nucleic acid which can be modified
for expression in skeletal muscle cells; and (5) any combination of
the above. In addition to the genetic material which is
incorporated into tissue, the above reference is also applicable to
genetic material which is incorporated into a cell.
[0092] By "comprising" it is meant including, but not limited to,
whatever follows the word "comprising". Thus, use of the term
"comprising" indicates that the listed elements are required or
mandatory, but that other elements are optional and may or may not
be present. By "consisting of" is meant including, and limited to,
whatever follows the phrase "consisting of". Thus, the phrase
"consisting of" indicates that the listed elements are required or
mandatory, and that no other elements may be present. By
"consisting essentially of" is meant including any elements listed
after the phrase, and limited to other elements that do not
interfere with or contribute to the activity or action specified in
the disclosure for the listed elements. Thus, the phrase
"consisting essentially of" indicates that the listed elements are
required or mandatory, but that other elements are optional and may
or may not be present depending upon whether or not they affect the
activity or action of the listed elements.
[0093] The present invention also concerns a gene therapy approach
in which a species-specific GHRH CDNA plasmid based expression
vector or other species-specific GHRH expression vectors are
targeted into peripheral organs and expressed by the transfected
cells. The species-specific GHRH polypeptide is then processed,
secreted and transported to the anterior pituitary, where it
stimulates GH release.
[0094] As used herein, a "plasmid" is an extrachromosomal genetic
element consisting of a circular duplex of DNA which can replicate
independently of chromosomal DNA. Plasmids are used in gene
transfer, as the vehicle by means of which DNA fragments can be
introduced into a host organism, and are associated with the
transfer of antibiotic resistance.
[0095] The present invention concerns a method of expressing growth
hormone releasing hormone (GHRH) in a non-human vertebrate animal
comprising the step of inserting a DNA carrier vehicle containing a
gene sequence encoding a growth hormone releasing hormone
polypeptide sequence operatively linked to a vertebrate gene
promoter into said non-human vertebrate animal tissue under
conditions where said gene (a segment of DNA which codes for a
specific polypeptide or RNA molecule) is expressed and produces
hormone releasing hormone.
[0096] The term "non-human vertebrate animal" encompasses all
animals having a backbone or spinal column, except for human
beings. Vertebrate animals include fishes, amphibians, reptiles,
birds and mammals.
[0097] As used herein, a "DNA carrier vehicle" refers to some means
by which DNA fragments can be introduced into a host organism or
host tissue. The DNA carrier vehicle may be designed to incorporate
the gene of interest and any accessory genetic sequences.
[0098] The "gene sequence" preferably is a nucleic acid
molecule.
[0099] The present invention concerns gene sequences that encode
for a growth hormone releasing hormone having one of the following
sequences; SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ
ID NO.9, or SEQ ID NO.11; or where the non-human vertebrate animal
is one of the following species; porcine, bovine, equine, canine,
feline, caprine, avian (chicken, turkey, duck), ovine or fish.
[0100] The present invention also can involve GHRH gene sequence in
the DNA carrier vehicle that contain no intervening sequences in
the GHRH region.
[0101] A further object of the invention is use of a DNA carrier
vehicle in which the promoter is from a skeletal .alpha.-actin
gene.
[0102] The present invention includes a DNA carrier vehicle which
is injected into said animal muscle.
[0103] The present invention includes a plasmid DNA vector,
adenovirus or adeno-associated virus as DNA carrier vehicles
capable of infecting non-human vertebrate animals in various
tissues.
[0104] The present invention can include a DNA carrier vehicle in
which the promoter-GHRHcDNA-3' UTR is incorporated into an
adeno-associated virus. The present invention can additionally
include an embodiment where the vectors encode for an Arg-Arg
sequence before a tyrosine or a histidine.
[0105] A further object of the invention is incorporation of a gene
switch sequence into the DNA carrier vehicle.
[0106] The present invention also includes a gene sequence which is
a chimeric synthetic cDNA encoding GHRH comprising a mouse specific
fragment and a species specific fragment and wherein the mouse
specific fragment contains the first 45 nucleotides and encodes the
first 15 amino acids of the mouse GHRH, and said mouse specific
fragment is fused in frame with a species-specific fragment
containing 87 nucleotides which encode the 16th to 44th amino acids
of a species-specific GHRH. This chimeric sequence provides
resistance against dipeptidases.
[0107] As used herein, a "chimera" refers to a molecule with
genetic material from genetically different organisms.
[0108] Furthermore, the present invention can include a
species-specific fragment for GHRH encoding a polypeptide from one
of the following animal species; porcine, bovine, equine, canine,
feline, caprine, avian (chicken, turkey, duck), ovine or fish or
encoding for one of the following GHRH polypeptides; SEQ ID NO.5,
SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, or SEQ ID
NO.11.
[0109] The present invention also concerns a method whereby
skeletal muscle can be transfected in vivo by direct plasmid DNA
injection or direct injection of other DNA carrier vehicles.
[0110] The present invention further concerns growth promoting
myogenic expression plasmid vectors, pSK-GHRH, that drive
high-level GHRH expression from animal muscle.
[0111] For example, species-specific GHRH can be secreted in vitro,
in primary chicken and pig myotube cultures, and in vivo, after the
intramuscular injection into regenerating quadriceps muscle of
immunocompetent adult C57/B16 mice, or in vivo in the appropriate
vertebrate species. Intramuscular injection of pSK-GHRH results in
increased serum mGH, several fold over control values, for at least
two weeks, and increased liver IGF-1 mRNA levels and enhances
animal growth as compared to control animals.
[0112] The invention features a plasmid DNA based system which
contains a vertebrate gene promoter that provides constitutive
transcriptional activity. Other suitable vectors may also be used.
The invention may also utilize muscle or other tissue specific
promoters, or viral promoters active in animal cells. Human GHRH
sequence is not desirable for use in other vertebrate species
because it is antigenic and produces antibodies following injection
into lower vertebrate animals. The DNA of the invention contains no
intervening sequences anywhere in the plasmid DNA. The invention
will use the target tissue's transcription, translation and
secretory activities to transcribe the GHRH mRNA, correctly
translate and then process the GHRH precursor protein, which, in
turn, allows for secretion into the systemic blood supply. The
increased levels of secreted GHRH will stimulate secretion of GH
from the target animal's anterior pituitary.
[0113] Several embodiments of the invention involve GHRH expression
for ectopic expression of a truncated GHRH from muscle, liver,
heart, lung and vascular tissues by a plasmid DNA vector. This
vector may contain eukaryotic promoters including various cell or
tissue specific promoters (e.g., muscle, endothelial cell, liver),
various viral promoters and enhancers, and various GHRH cDNAs
isogenically specific for each animal species including porcine,
equine, bovine, canine, feline, caprine, ovine, avian (chicken,
turkey, duck) or fish. The vector may also contain a chimeric GHRH
cDNA composed of the first 15 amino acids of the mouse GHRH
following the processed N-terminal histidine, numbered 1, fused in
frame with a specific animal GHRH species fragment covering amino
acid 16 up to 44 amino acids, a synthetic stop codon, an SV40 or a
growth hormone 3' untranslated region containing polyadenylation
sites. Any and all of these embodiments may utilize suitable
vectors other than a plasmid DNA.
[0114] The plasmid of the invention may be incorporated into
adenoviral and adenoviral-associated viruses and injected into
muscle or into the blood system. DNA taken up into the cellular
nuclei of tissue allows for transcription of a messenger RNA
encoding a truncated GHRH polypeptide which is then translated into
a precursor GHRH protein. The precursor protein requires
metalloprotease or other processing to allow for a biologically
active GHRH to be secreted. The precursor protein is trimmed to
either a N-terminal tyrosine or a N-terminal histidine depending
upon the animal GHRH species. Ectopic secretion from muscle and
other tissues including liver, pancreas, kidney and heart of the
correctly processed GHRH into the blood system, increases the
concentration of GHRH in the blood, which then causes a profound
stimulation of growth hormone (GH) secretion from the anterior
pituitary of the target animal. Skeletal muscle-secreted GHRH is
biologically active, as demonstrated by eliciting robust GH release
following a single intramuscular injection of 100 .mu. plasmid
CMV-GHRH DNA sufficient to elevate GH levels 3 to 4 fold for up to
2 weeks, to enhance liver IFG-1 gene expression and to increase
body weight approximately 10%. Thus, plasmid based-GHRH can serve
as a potent GH secretagogue in animals.
[0115] One embodiment of the invention includes a novel plasmid
vector which is capable of directing high-level gene expression in
a skeletal muscle specific manner. A 228 bp fragment of hGHRH,
which encodes for the 31 amino acid signal peptide and the entire
mature peptide hGHRH(1-44)OH(Tyr1 Leu44) is cloned into a
pBS-derived vector. Gene expression is controlled by a 448 bp
fragment (-424/+24) of the avian skeletal .alpha.-actin gene, which
contains several evolutionarily conserved regulatory elements that
accurately initiate skeletal .alpha.-actin transcripts and drives
transcription of a variety of reporter genes specifically in
differentiated skeletal muscle cells. The GHRH coding region is
followed by the 3' untranslated region of human growth hormone
cDNA.
[0116] In another embodiment the cytomegalovirus promoter and
enhancer is used. In a preferred embodiment the promoter is linked
to a synthetic GHRH CDNA which contains any non-muscle 3'
untranslated region cDNA. In one preferred embodiment a bovine
growth hormone 3' untranslated region cDNA is used.
[0117] In one embodiment of the invention the plasmid DNA is
injected into muscle. In yet another preferred embodiment the
promoter GHRHcDNA-3' UTR can be incorporated into a virus, such as
an adeno-associated virus for viral infection of muscle.
[0118] In another embodiment the invention is incorporated in
adenoviruses and allowed to infect a variety of tissues that will
then express species specific GHRH mRNA in any tissue the
adenovirus infects.
[0119] In another embodiment the GHRH vectors are made with species
specific GHRH that contains a metalloenzyme processing sequence
Arginine-Arginine before a Tyrosine or a Histidine. Each GHRH
polypeptide secreted can be made isogenic so that it is identical
to the actual animals' GHRH.
[0120] Another embodiment of the invention employs a gene switch
element in the DNA carrier vehicle.
[0121] In another embodiment a chimera synthetic cDNA encoding GHRH
is used that contains the first 45 nucleotides to encode the first
15 amino acids of the mouse GHRH fused in frame with the nucleic
acid sequence encoding the 16th to the 44th amino acids of the
species-specific GHRH cDNA sequence. This chimeric sequence is
effective in providing resistance against proteolytic degradation
by dipeptidases.
[0122] In other embodiments of the invention the animal species of
GHRH encoded for may include: porcine, bovine, equine, canine,
feline, caprine, avian (chicken, turkey, duck), ovine and fish.
[0123] Other embodiments of the invention utilize nucleotides
sequences coding for one of the GHRH polypeptides expressed by any
one of SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID
NO.9, and SEQ ID NO.11. A skilled artisan will readily recognize
that these polypeptides can be encoded for by a number of
nucleotide sequences.
[0124] Other features and advantages of the invention will be
apparent from the following detailed description of the invention
in conjunction with the accompanying drawings and from the
claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0125] FIG. 1 is a schematic drawing of the chicken skeletal
.alpha.-actin gene which includes the location of certain unique
restriction sites.
[0126] FIG. 2 is a schematic representation of a myogenic vector
system.
[0127] FIG. 3 is a schematic representation of the exemplary
plasmid pSK-GHRH.
[0128] FIG. 4 is a chart showing the codon usage frequencies for
highly expressed human genes.
[0129] FIG. 5 shows the sequences of wild-type GHRH (SEQ ID NO. 1)
and a synthetic sequence having optimal codon usage and encoding
GHRH (SEQ ID NO. 2).
[0130] FIG. 6 shows the nucleotide sequence of a NotI/SalI fragment
of the pSK-GHRH plasmid which surrounds the GHRH cDNA insert. The
portion coding for GHRH is in bold.
[0131] FIG. 7 shows the level of human GHRH secreted in the culture
media of transfected chicken primary myoblasts as measured by
specific RIA: PSK-GHRH (black, n=8), compared with pSK-LacZ (white,
n=8). The results are presented as means .+-.s.e.m (*, p value is
.ltoreq.0.002).
[0132] FIG. 8 is the experimental design for stimulation of the GH
secretion by hGHRH secreted by primary pig myoblasts (ppm)
transfected with pSK-GHRH.
[0133] FIG. 9 shows pig GH release in primary pig anterior
pituitary culture after 24 h challenge in response to: 10 ng hGHRH
(white, n=4)=long of synthetic hGHRH(1-44)NH.sub.2 have been mixed
in the ppm culture media; pSK-GHRH (black, n=4)=the conditioned
culture media from 1 million ppm transiently transfected with
pSK-GHRH; pSK-LacZ (gray, n=4)=the conditioned culture media from 1
million ppm transiently transfected with pSK-LacZ. The results are
presented as means .+-.s.e.m (*, p value for pSK-GHRH
.ltoreq.0.002).
[0134] FIG. 10 shows expression of pSK-GHRH assessed by RT-PCR at
3-21 days after i.m. injection of 100 .mu.g pSK-GHRH in the
regenerating left quadriceps muscle of adult C57/B16 mice.
[0135] FIG. 11 shows body weight at different time points after a
single injection in the regenerating left quadriceps muscle of
adult mice of pSK-GHRH (black, n=6), compared to that of
age-matched pSK-LacZ injected animals (white, n=6). The results are
presented as means .+-.s.e.m. Significant difference *,
p.ltoreq.0.05 and p.ltoreq.0.03, was observed at day 14 and day 21,
respectively.
[0136] FIG. 12 shows a Northern blot analysis of chicken primary
myoblast culture transiently transfected with pSK-GHRH or pSK-LacZ,
as a control. 10 .mu. of total RNA were separated, transferred onto
a nylon membrane and hybridized with a hGHRH cDNA probe and then
with a mouse GAPDH probe in order to normalize the results.
[0137] FIG. 13 shows expression of pSK-GHRH assessed by RT-PCR at
3-21 days after i.m. injection of 100 .mu. pSK-GHRH into the
regenerating left quadriceps muscle of adult C57/B16 mice. RT-PCR
reaction from 1 .mu. of total RNA upper panel: 254 bp PCR fragment
using SK-GHRH cDNA specific oligonucleotides; lower panel: 497 bp
PCR fragment using mouse cytoskeletal .beta.-actin cDNA specific
oligonucleotides, in pSK-GHRH injected animals or pSK-LacZ injected
animals.
[0138] FIG. 14 shows mouse serum growth hormone was measured y rat
GH heterologous radioimmunoassay after i.m. injection of 100 .mu.
pSK-GHRH in adult C57/B16 mice. Control sera were obtained from
mice injected with pSK-LacZ. The results are presented as means
.+-.s.e.m. Significant differences of *, p.ltoreq.0.03 and
p.ltoreq.0.05 were obtained at day 7 and day 10, respectively.
[0139] FIG. 15 shows Northern blot analysis of mouse liver RNA in
PSK-GHRH (+) or pSK-LacZ (-) injected animals. The animals were
killed and livers harvested at day 3-21, 20 .mu. of total RNA was
separated, transferred onto a nylon membrane and hybridized with an
mIGF-1 cDNA probe and then a mouse 18S probe in order to normalize
the results.
[0140] FIG. 16 shows increased gain in body weight after a single
injection of pSK-GHRH in the regenerating left quadriceps muscle of
adult mice. pSK-GHRH (black, n=6) are compared to that of
age-matched pSK-LacZ injected animals (white, n=6). The results are
presented as means .+-.s.e.m. * p.ltoreq.0.05 and p.ltoreq.0.03,
was observed at day 14 and day 21, respectively.
[0141] FIG. 17 shows generation of mouse anti human GHRH antibodies
following intramuscular injection of pSK-GHRH in C57/B16 mice. 21
(n=3) and 28 (n=3) days after injection of pSK-GHRH and 21 days
after pSK-LacZ (n=3) injections, serial dilutions of sera were
assayed for anti-GHRH antibodies by ELISA. A significant
difference, p.ltoreq.0.05 was observed between PSK-GHRH injected
mice and control curves.
[0142] The drawings are not necessarily to scale, and certain
features of the invention may be exaggerated in scale and shown in
schematic form in the interest of clarity and conciseness.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0143] GHRH administration represents a more physiological
alternative of increasing subnormal GH and IGF-I levels (Corpas et
al., 1993, J. Clin. Endocrin. & Metab. 76:134-138). Even though
in mammalian species GH secretion is pulsatile as a result of a
complex neuroendocrine regulation process, (Betherat et al., 1995,
Eur. J. Endocrin. 132:12-24) numerous studies have shown that
continuous infusion of GHRH augments GH secretion in normal adults
and GH deficient children without evidence of desensitization of
the somatotrophs and promotes growth in short, slowly growing
children (Low, 1993, J. Pediatric Endocrin. 6:15-20). Current
limitations of recombinant GHRH therapy are the high cost of
recombinant proteins, the short half-life of the peptides in vivo
and the requirement for frequent administration (1-3 times/day)
given as subcutaneous or intravenous injections.
[0144] The human GHRH genetic locus, as well as the gene and cDNA
have been characterized (Mayo et al., 1985, Proc. Natl. Acad. Sci.
USA 82:63-87; Mayo et al., 1983, Nature 306:86-88. The gene
includes 5 exons and spans 10 kb on human chromosome 20 (Riddell et
al., 1985, Genetics 11:189-195). Biological activity requires
post-translational processing of the GHRH precursor protein. The
preprohormones are proteolytically clipped to two mature protein
species: (1-40)GHRH with a carboxy terminal group and (1-44)GHRH
with a carboxy terminal amide group. Part of exon 2, all of exon 3
and part of exon 4 encode for the 31 amino acids signal peptide and
the entire mature peptide (Tyr1 Leu44).
[0145] Somatic gene therapy can provide an alternative treatment
for growth disorders, catabolic conditions and for the general
reduction of GH in the elderly. It is well established that
ectopically secreted GHRH, as mature peptide or truncated molecules
(as seen with pancreatic islet cell tumors and various located
carcinoids) are often biologically active and can even produce
acromegaly (Esch et al., 1982), Biochem. & Biophys. Res. Comm.
109:152-158; Thorner et al., 1984, J. Clin. Endocrin. & Metab.
59:846-849. In a gene therapy approach, the human GHRH cDNA can be
targeted into peripheral organs, expressed by the transfected cells
and the peptide processed, secreted, transported to the anterior
pituitary, where it can stimulate GH release.
[0146] Skeletal muscle can be transfected in vivo by direct plasmid
DNA injection and an encoded gene can be expressed at significant
levels for periods of time, up to about 19 months (Wolff et al.,
1992, Human Mol. Genet. 1:363-369; Wolff et al, 1990, Science
247:1465-1468; Davis et al, 1993, Human Gene Therapy 4:151-159;
Walls, 1993, FEBS Lett. 332:170-182). A limitation of this approach
is the relatively low efficiency of gene transfer into
nonregenerating adult muscle, though the transfer efficiency can be
enhanced by treating the target muscle 3-7 days prior to plasmid
DNA injection with 0.75% bupivacaine.
[0147] The vectors and methods of this invention provide for the
delivery and expression of GHRH in mammalian cells, e.g., in human
cells. It has been shown that IGF-I plays an important role in
normal muscle development, muscle growth and hypertrophy, muscle
regeneration and maintenance/regeneration of peripheral nerves.
GHRH increases the levels of GH and IGF-I. Thus, delivery and
expression of GHRH from an expression vector is expected to
modulate these process.
[0148] The following are specific examples of preferred embodiments
of the present invention and are not intended to limit the
invention. These examples demonstrate how the expression vector
systems of the present invention can be used in construction of
various cellular or animal models, and how genes can be regulated
by sequences within such vectors. The description and utility of
such vectors and related vectors is discussed herein and is
amplified upon in Schwartz et al., U.S. Pat. No. 5,298,422,
entitled "Myogenic Vector Systems,", and co-pending application
Schwartz et al., application Ser. No. 08/472,809, entitled
"Expression Vector Systems and Method of Use", which are hereby
specifically incorporated by reference herein, including drawings.
Such vectors can incorporate nucleic acid sequences encoding GHRH
and can be used for delivery and expression of GHRH.
[0149] Below are provided examples of specific regions of 5' UTR
and 3' UTR and/or 3' NCR regions of myogenic genes that can be used
to provide certain functionalities to an expression vector, and
thus within a transformed cell or animal containing such a vector.
Those in the art will recognize that specific portions of these
regions can be identified as that containing the functional nucleic
acid sequence providing the desirable property, and such regions
can be readily defined using routine deletion or mutagenic
techniques or their equivalent. Such regions include the promoter,
enhancer and cis- and trans-acting elements of a regulatable
system. As noted herein, such controlling segments of nucleic acid
may be inserted at any location on the vector, although there may
be preferable sites as described herein.
[0150] Isolation of Chicken Skeletal .alpha.-Actin Gene
[0151] The nucleic acid sequence of the skeletal .alpha.-actin gene
has been characterized in chicken, rat, mouse and human. Formwald
et al, 1982, Nucl. Acids Res. 10:3861-3876; R. Zakut, 1982, Nature
298:857-859; French et al, 1990, Gene(Amst.) 88:173-180; Hu et al,
1986, Mol. Cell. Biol. 6:15-25; Minty et al, 1986, Mol. Cell. Biol.
6:2137-2148. The skeletal .alpha.-actin gene is a member of the
actin multigene family, which, in vertebrates, is made up of three
distinct classes of actin isoforms termed as "cytoplasmic", "smooth
muscle", and "striated" on the basis of their cellular distribution
and pattern of expression in adult tissues. The striated actins,
.alpha.-cardiac and .alpha.-skeletal, are co-expressed specifically
in cardiac myocytes and skeletal myofibers. Expression of the
.alpha.-cardiac and .alpha.-skeletal actin genes is sequentially
up-regulated in developing cardiac and skeletal muscle with the
skeletal isoform predominating in adult skeletal muscle.
(Vandekerckhove & Weber, 1984, J. Mol. Biol. 179:391-413;
McHugh et al., 1991, Dev. Biol. 148:442-458; Hayward &
Schwartz, 1986, J. Cell Biol. 102:1485-1493.) The chicken skeletal
.alpha.-actin gene is the most highly expressed gene in adult
chicken skeletal muscle comprising approximately 8% of the poly(A)
RNA.
[0152] Numerous experiments in vitro and in vivo have established
that the regulatory sequences which confer cell type restricted and
developmentally regulated expression to the skeletal .alpha.-actin
gene are primarily concentrated in the immediate 5' promoter
region. (Bergsma et al., 1986, Mol. Cell. Biol. 6: 2462-2475;
Taylor et al., 1988, Genomics. 3(4): 323-36; Petropoulos et al.,
1989, Mol. Cell. Biol. 9:3785-3792; Carson et al., 1995, Am. J.
Physiol. 268:C918-24.)
[0153] These regulatory sequences are highly conserved in the
promoter regions of all of the known vertebrate skeletal
.alpha.-actin genes from aves to man. Regulatory sequences derived
from the chicken skeletal .alpha.-actin gene were utilized in
construction of the GHRH expression cassette, though other
embodiments can utilize other actin or .alpha.-skeletal actin
genes.
[0154] The primary sequences of the skeletal .alpha.-actin genes of
the various species were deduced from overlapping cDNA clones. To
obtain full genes, the cDNA clones were used to screen genomic DNA.
For example, the 25 Kb EcoRI fragment of chicken genomic DNA
isolated from a lambda Charon 4A vector, contains the 6.2 Kb
skeletal a-actin gene on a single HindIII site of pBR322 is shown
in FIG. 1. Chang et al., Mol. Cell. Biol. 4:2498-2508 (1984).
Nuclear transcription runoffs were used to map the transcriptional
domain of the skeletal .alpha.-actin gene. The chicken skeletal
a-actin control sequences have also been characterized (Bergsma et
al., 1986, Mol. Cell. Biol. 6:2462-2475). DNA probes which
encompassed portions of the 5' noncoding, promoter coding, and the
contiguous 3' noncoding regions were cloned into M13 vectors which
provided sense and antisense probes. Nuclei isolated from
fibroblasts, myoblasts and day 19 embryonic muscle cells were used
in in vitro transcription assays to extend RNA transcripts with
radioactive tagged nucleotides. Labeled RNA hybridized to dotted
DNA probes showed that transcription terminates approximately 1 kb
downstream of the skeletal .alpha.-actin gene's poly A addition
site. This is within a 800 bp PvuII fragment between +2800 and
+3600 nucleotides from the start of transcription.
[0155] The 3' UTR and/or 3' NCR can be isolated by restriction
endonuclease digestion of the 6.2 Kb actin gene with blunt cutter
NaeI, which cuts 30 bp upstream of the translation termination
codon TAA. HindIII releases the 3' most portion of the actin gene
from the vector pBR322 (FIG. 2). The 3' UTR and 3' NCR were used to
prepare DNA constructs. The skeletal .alpha.-actin promoter and DNA
flanking sequences (at least 411 nucleotides from the MRNA cap
site) and DNA sequences extending through the skeletal 5' noncoding
leader, first intron and up to the initiation of translation ATG,
converted to a NcoI cloning site at +196, was liberated from a M13
double stranded DNA by XbaI and NcoI digestion, Klenow filled in
and then linked into the XbaI and blunt SmaI sites of pBluescript
II KS. The NcoI site is regenerated by this cloning step.
[0156] For certain vectors described in Schwartz et al.,
application Ser. No. 08/472,809, the 3' UTR and 3' NCR on the 2.3
kb NaeI/HindIII fragment were directionally cloned into a blunt
EcoRV site and the adjacent HindIII site of the pBluescript II KS
vector cassette. The EcoRV and NaeI sites are destroyed. The
restored NcoI site was used to insert cDNA sequences encoding
polypeptides. Another cloning vector was constructed by inserting
the skeletal .alpha.-actin promoter from -411 to -11 adjacent to
the 3' UTR and 3' NCR. This expression vector eliminates the first
intron and the skeletal actin 5' leader sequence. These two vectors
were used in preparing DNA constructs to test the efficacy of the
3' UTR and 3' NCR.
[0157] Results obtained using vectors having a skeletal
.alpha.-actin/GHRH/GH expression cassette are described below,
illustrating the intracellular expression of GHRH from vector
constructs and certain results of such expression.
[0158] Expression Vector Construction Containing Human GHRH
Gene
[0159] Constructions containing the skeletal a-actin promoter were
linked to the human GHRH cDNA (SEQ ID NO. 1) by standard
recombinant DNA techniques as known in the art. Examples of a
generalized expression vector structure utilizing skeletal a-actin
5' and 3' sequences is shown in FIG. 2.
[0160] The GHRH construction can be made so that a poly A addition
site, e.g., the poly A site of GHRH, was linked to the 3' UTR of
the GH gene. The sequence was added to increase the stability of
nuclear GHRH RNA transcripts.
[0161] The poly A skeletal a-actin 3' UTR can also be used in the
construction. In this way GHRH RNA transcripts containing the
skeletal .alpha.-actin 3' UTR are stabilized and accumulate in
skeletal muscle cells. In addition, by providing contiguous 3' NCR,
GHRH is buffered against outside genomic sequences and is thus more
protected from position effects, when integrated into the genome.
In addition, by providing natural terminating sequences, the
additional regulatory sequences that mark the transcriptional
domain of skeletal .alpha.-actin prevent read through
transcription, improve tissue specificity, developmental timing and
transcriptional activity. Presence of 3' NCR sequence allows for a
single copy of the integrated vector to produce 40-100% of the
transcriptional activity of the endogenous sequences.
[0162] The exemplary plasmid vector, pSK-GHRH was constructed using
pIG0100A and additional constructs (pOGH and pVC0289A). A schematic
representation of pSK-GHRH is shown in FIG. 3. The pSK-GHRH
expression plasmid contains a hGHRH gene expression cassette in a
plasmid backbone containing a kanamycin-resistance (KanR) gene. The
plasmid backbone is as described for pIG0552 in co-pending U.S.
provisional application No. 60/031,539,Coleman et al., entitled
IGF-1 EXPRESSION SYSTEM AND METHODS OF USE, filed Dec. 2, 1996. The
hGHRH gene expression cassette of pSK-GHRH contains: 1) a promoter
derived from the chicken skeletal a-actin promoter and first
intron, 2) the human Growth Hormone Releasing Hormone (hGHRH) CDNA,
and 3) a 3' UTR/poly(A) signal from the human Growth Hormone (hGH)
3' untranslated region (3' UTR). The plasmid backbone is derived
from pBluescript KS+(Stratagene) with 1) the substitution of a
kanamycin-resistance gene (neo) and prokaryotic promoter (PNEO,
Pharmacia) in place of the ampicillin-resistance gene (bla) and 2)
the deletion of the fl origin of replication.
[0163] The actual construction of pSK-GHRH primarily involved three
starting plasmids, pIG0100A, pOGH and pVC0289A.
[0164] The chicken skeletal .alpha.-actin promoter and first intron
were obtained from plasmid pIG0100DA (R. Schwartz, Baylor College
of Medicine). The hGH 3' UTR was obtained from plasmid pOGH
(Nicholas Institute, CA, USA). The hGHRH cDNA 228 bp fragment (part
of exon 2, all exon 3 and part of exon coding for the 31 amino acid
signal peptide and entire mature hGHRH1-44 peptide Tyr1 Leu44) was
utilized. pIG0100A contains the chicken skeletal .alpha.-actin
promoter and first intron, human hIGF-1 cDNA, and chicken skeletal
.alpha.-actin 3' untranslated region and 3' flanking sequence in
pbluescript KS+. As indicated above, the plasmid backbone,
pVC0289A, includes the kanamycin-resistance gene, pUC origin of
replication, and a multicloning site.
[0165] The construction scheme used to produce PSK-GHRH from
pIG0100A, POGH, and pVC0289A incorporated the following steps. In
order to construct hybrid pSK-GHRH, a 448 bp fragment (-424/+24) of
avian skeletal a-actin promoter (SK) was used (Lee et al., 1994, J.
Oncogene 9:1047-1052; Chow et al., 1991, PNAS 88:1301-1305). The
hGHRH cDNA 228 bp fragment (part of exon 2, all exon 3 and part of
exon 4) coding for the 31 aminoacid signal peptide and entire
mature hGHRH1-44 peptide (Tyr1 Leu44) has been cloned into
BamHl/HindIII sites of pVC0289. The 3' untranslated region of hGH
cDNA Smal blunted/EcoRl 622 bp fragment was cut from the commercial
POGH plasmid (Nichols Institute, CA, USA) and cloned into Clal
blunted/EcoRl sites of PVCO 289. The sequence of a NotI/SalI
fragment of the plasmid, which includes the SK promoter, GHRH cDNA,
and hGH 3' region is shown in FIG. 6.
[0166] The GHRH cDNA and plasmid sequences described herein are
believed to be correct, however, the possible presence of a small
percentage of nucleotide sequence errors will not impair the use of
this invention. Those skilled in the art will understand how to
obtain sequences coding for GHRH, e.g., hRHRH, such as by isolating
a GHRH cDNA from a cDNA library using a probe or probes derived
from the published GHRH sequence or from the sequence described
herein. Such a sequence can be sequenced by routine methods to
confirm or obtain the correct GHRH coding sequence. The 5' UTR and
3' UTR sequences reported herein can likewise be obtained by
routine methods. Based on the present disclosure, those skilled in
the art will also understand how to construct a vector containing a
sequence encoding GHRH, which can be used for delivery and
expression of the GHRH in vivo.
[0167] Also, in addition to sequences encoding natural GHRH, e.g.,
the sequence encoding GHRH (1-44), other sequences encoding
functional GHRH derivatives can be used, such as a sequence
encoding hGHRH (1-40), or modified sequences which encode a GHRH
derivative differing in one or a few amino acids but which retains
the GH and IGF-1 related functions of native GHRH. Preferably, the
encoded GHRH derivative will differ from a native GHRH, e.g., hGHRH
(1-44) or hGHRH (1-40), by the addition, delection, substitution,
or a combination of these changes at a small number or amino acid
residues. A small number is preferably 5 or fewer, more 3 or fewer,
still more preferably 2 or fewer, and most preferably is one amino
acid.
[0168] In addition to sequences encoding native length GHRH or a
functional derivative, a coding sequence can also be used which
encodes a preprohormone which can be proteolytically cleaved to
produce an active GHRH molecule or derivative. Such sequences are
exemplified by natural hGHRH coding sequences which encode a
polypeptide sequence which is cleaved to produce both hGHRH (1-44)
and hRHRH (1-40) mature polypeptides.
[0169] In the pSK-LacZ construct, the .beta.-galactosidase gene of
Escherichia coli, with a nuclear localization signal (nls), is
driven by the same SK promoter, but contains the 3' UTR of skeletal
.alpha.-actin gene (French et al., 1990, Gene 88:173-180).
[0170] Instead of the natural sequence coding for GHRH, it is
advantageous to utilize synthetic sequences which encode GHRH. Such
synthetic sequences have alternate codon usage from the natural
sequence, and thus have dramatically different nucleotide sequences
from the natural sequence. In particular, synthetic sequences can
be used which have codon usage at least partially optimized for
expression in a human. The natural sequences do not have such
optimal codon usage. Preferably, substantially all the codons are
optimized.
[0171] Optimal codon usage in humans is indicated by codon usage
frequencies for highly expressed human genes, as shown in FIG. 4.
The codon usage chart is from the program "Human_High.cod" from the
Wisconsin Sequence Analysis Package, Version 8.1, Genetics Computer
Group, Madison, Wis. The codons which are most frequently used in
highly expressed human genes are presumptively the optimal codons
for expression in human host cells, and thus form the basis for
constructing a synthetic coding sequence.
[0172] However, rather than a sequence having fully optimized codon
usage, it may be desirable to utilize an GHRH encoding sequence
which has optimized codon usage except in areas where the same
amino acid is too close together or abundant to make uniform codon
usage optimal.
[0173] In addition, other synthetic or derivative sequences can be
used which have substantial portions of the codon usage optimized,
for example, with at least 50%, 70%, 80% or 90% optimized codons.
Other particular synthetic sequences for GHRH can be selected by
reference to the codon usage chart in FIG. 4. A sequence is
selected by choosing a codon for each of the amino acids of the
polypeptide sequences. DNA molecules corresponding to each of the
polypeptides can then by constructed by routine chemical synthesis
methods. For example, shorter oligonucleotides can be synthesized,
and then ligated in the appropriate relationships to construct the
full-length coding sequences.
[0174] A particular preferred synthetic GHRH coding sequence is
provided in SEQ ID NO. 2.
[0175] Myoqenic Cell Cultures and DNA Transfer
[0176] Minimal Essential Medium (MEM), horse serum, gentamycin,
Hank's Balanced Salt Solution (HBSS), lipofectamine were obtained
from Gibco BRL, NY, USA.
[0177] Primary chicken myoblast culture was obtained as described
(Bergame et al., J. Molec. & Cell. Biol. 6:2462-2475). The
cells were plated 24 h prior to transfection at a density of 1.5
million cells/100 mm plate, in MEM supplemented with 10% horse
serum (HIHS), 5% chicken extract (CE) and gentamycin. Cells were
maintained in a humidified 5% CO.sub.2 95% air atmosphere at 37
C.
[0178] Cells were transfected with 4 .mu.g of pSK-GHRH or pSK-LacZ
per plate using lipofectamine, according to the manufacturer
instructions. After transfection, the cells were changed in MEM, 2%
HIHS, 2% CE for at least 24 h to allow differentiation.
[0179] Primary pig myoblasts culture was obtained as described
(Doumit & Merkel, 1992, Tissue & Cell 24:253-262).
[0180] The cells were plated at a density of 1 million cells/100 mm
plate and maintained in growth media for 2-3 days. The cells were
passed for 2 times prior to transfection. The transfection and
differentiation was made in the same conditions as for the primary
chicken myoblast culture. The media and cells were harvested for
analysis 48, 72 and 96 h postdifferentiation in both cases. The
efficiency of transfection estimated by .beta.-galactosidase
histochemistry on control plates was 10%.
[0181] One day before harvesting, cells were washed twice in HBSS
and changed in MEM, 0.1% BSA. The collected media was conditioned
by adding 1/4 volumes of 1% triflouroacetic acid (TFA) and 0.001%
phenylmethylsulfonylflouride (PMSF), frozen at -80.degree. C.,
lyophilized, purified on C-18 Sep-Columns (Peninsula Laboratories,
CA, USA), relyophilized and used in RIA or resuspended in media
conditioned for primary pig anterior pituitary culture. The pig
anterior pituitary culture was obtained by Dr. Thomas H. Welsh Jr.
in the Department of Animal Sciences at Texas A&M University as
described (Tanner et al., 1990, J. Endocrinol. 125:109-115). Pig GH
was assayed as described (Barb et al., 1991, Domestic Animal
Endocrinology 8:117-127). The samples and controls were assayed as
described in quadruplicate. The cells were homogenized directly
into Ultraspec RNA reagent (Biotecx Laboratories, TX, USA) for the
isolation of total RNA.
[0182] Measurement of Secreted Levels of GHRH from GHRH Gene
Delivery by the Expression Vector
[0183] A. In vitro expression of pSK-GHRH. We characterized a novel
plasmid vector able to express in a skeletal muscle specific manner
a high level of a target protein, hGHRH. A 228 bp fragment of hGHRH
(part of exon 2, all exon 3 and part of exon 4), which encode for
the 31 aminoacid signal peptide and the entire mature peptide
hGHRH(1-44)OH (Tyr1 Leu44) (Mayo et al., 1985, PNAS 82:63-67) was
cloned into a pBS-derived vector. The coding sequence was
controlled by a 448 bp fragment (-424/+24) of the avian skeletal
.alpha.-actin gene, which contain several evolutionarily conserved
regulatory elements that accurately initiate skeletal .alpha.-actin
transcripts and drive transcription of a variety of reporter genes
specifically in differentiated skeletal muscle cells (Bergame et
al, 1986, J. Mol. & Cell. Biol. 6:2462-2475; Chow et al., 1990,
J. Mol. & Cell. Biol. 10:528-538; Lee et al., 1994, J. Oncogene
9:1047-1052). The coding region was followed by the 3' untranslated
region of human growth hormone cDNA.
[0184] In vitro expression of pSK-GHRH was first examined in
transiently transfected chicken primary myoblasts. The pSK-GHRH
transfected cells and the controls, transfected with pSK-LacZ were
placed into differentiation media for 24-72 h to initiate
withdrawal from the cell cycle and induce post-fusion
differentiation, then changed into a minimal serum-free media for a
24 hl pulse. Cells were harvested 48 to 96 h post-differentiation.
Northern blot analysis of cellular extracted RNA treated with
DNase, showed the expected size transcripts of 0.35 kb, in
myoblasts transfected with PSK-GHRH, but not in pSK-LacZ
transfected myoblasts. The expression of pSK-GHRH peaked at 48 h
postdifferentiation and was reduced thereafter in comparison to the
glycolytic enzyme GAPDH. This pattern of activation is
characteristic of the promoter utilized, which induces high levels
of transgene expression in myotubes but not in replicating
myoblasts (Bergame et al, 1986, J. Mol. & Cell. Biol.
6:2462-2475; Chow et al., 1990, J. Mol. & Cell. Biol.
10:528-538; Lee et al., 1994, J. Oncogene 9:1047-1052).
[0185] Conditioned media from PSK-GHRH and pSK-LacZ transfected
myoblasts were harvested and purified on C18 Sep-Columns (which
served two purposes: to separate the peptide to be assayed from
potentially interfering substances and to concentrate the samples)
to determine levels of radioimmunoassayable hGHRH. Chicken primary
myoblasts transfected with pSK-GHRH produced approximately 1.7 ng
hGHRH(1-44)OH/million cells/h. Media from pSK-LacZ control
transfected cells did not contain hGHRH higher than the
untransfected controls (FIG. 7). The decrease in hGHRH secreted
into the media at 96 h correlated with the decrease of MRNA between
the 72 and 96 h time-points. We concluded that the skeletal fibers
transfected with pSK-GHRH are expressing and secreting at a high
level hGHRH (1-44)OH.
[0186] B. In vitro activity of pSK-GHRH. Since anterior pituitary
is the natural target of GHRH stimulation, we determined the
biological activity of secreted GHRH from the media of pSK-GHRH
transfected primary pig myoblasts (FIG. 8). The in vitro potency of
the hGHRH (1-44)OH molecule secreted by primary pig myoblasts (ppm)
transiently transfected with pSK-GHRH was compared to that of the
hGHRH (1-44)NH.sub.2 synthetic molecule for the ability to
stimulate GH release in primary pig anterior pituitary cells after
a 24 h stimulation at 37 C. GH release from the primary pig
anterior pituitary cells rose from values of 7.+-.2 ng/ml to
82.5.+-.3.1 ng/ml (p.ltoreq.0.002) when stimulated with the culture
media from 1 million primary pig myoblasts transiently transfected
with pSK-GHRH. This value equals 72% of that obtained when the
pituitary cells were stimulated with myoblast serum-free media
mixed initially with 10 ng synthetic hGHRH (1-44)NH.sub.2 then
purified and processed as the test media (GH release in this case
was 115.+-.3.2 ng 1 ml) (FIG. 9).
[0187] Thus, hGHRH(1-44)OH secreted by skeletal pig myocytes
transfected with pSK-GHRH retains functional activity in pig
pituitary cell culture and induces secretion of physiologically
significant levels of GH. This is an important finding, because the
pig (1-44)GHRH, as well as the human molecule, is amidated, while
the molecule which is expressed by our construct is non-amidated at
amino acid 44. It has been shown in previous studies using
synthetic molecules that hGHRH(1-44)OH is 30% less effective in
releasing GH than the (1-44) amidated form (Ling et al, 1984,
Biochem. & Biophys. Res. Comm. 123:854-861).
[0188] Insertion of Expression Vectors into Transgenic Mice
[0189] Transgenic mice carrying GHRH containing vectors can be
generated by standard methods, e.g., by standard oocyte injection
(Brinster, et al, Proc. Natl. Acad. Sci. USA 82:4438-4442 (1958))
and bred to demonstrate stable transmission of transgenes to
subsequent generations. Transgenics can be identified by polymerase
chain reaction or Southern genomic DNA blotting analysis from tail
cut DNA. Transgenics can be tested for muscle specific expression
of the transferred GHRH vector by RNA blotting of total RNA
isolated from several tissues.
[0190] Somatic Gene Transfer to Skeletal Muscle in vivo
[0191] In vivo expression and activity of pSK-GHRH. In addition to
the in vitro determinations of GHRH expression from chicken primary
myoblasts and the induction of GH secretion from pig primary
anterior pituitary cells by GHRH expressed in pig primary
myoblasts, we determined whether a single injection of 100 .mu.g
pSK-GHRH in adult immunocompetent C57B16 mice would be sufficient
to elicit enhanced GH systemic levels.
[0192] Five days before the plasmid administration, the mice were
injected with 0.75% bupivacaine into the left quadriceps muscle. On
day 0, animals were anesthetized and injected into the same muscle
either with 100 .mu.g of pSK-GHRH or pSK-LacZ in 100l PBS. Three to
21 days later, the animals were weighted, killed, injected muscle
collected and frozen in liquid nitrogen and the blood collected by
transcardiac puncture.
[0193] The in vivo expression of pSK-GHRH was assessed by RT-PCR on
injected muscle (FIG. 10). Muscle RNA was DNase I treated in order
to eliminate the injected plasmid, reextracted and 1 .mu.g of total
RNA was used in the reverse transcriptase reaction. Only the
pSK-GHRH injected muscles showed a 254 bp PCR fragment when using
GHRH specific primers. The pSK-LacZ injected muscles showed a 497
bp PCR fragment for mouse cytoskeletic -actin, used as a control,
but not for GHRH. The efficiency of DNase treatment to eliminate
plasmid DNA was checked using RNA from pSK-GHRH injected muscle.
When the reverse transcriptase was omitted from the reaction, no
amplification was seen.
[0194] Serum mGH in the pSK-GHRH quadriceps injected animals were
significantly elevated compared with mGH levels in serum from
control mice. Time course analysis of mGH as a response to pSK-GHRH
injections showed stimulation at 3 days post-injection
(21.54.+-.15.29 ng/ml vs. 7.53.+-.0.57 ng/ml, n=6), peaked at 7
days post-injection (36.28.+-.27.28 ng/ml vs. 8.2.+-.1.9 ng/ml,
p.ltoreq.0.05, n=6) and declined gradually to the base-line by 21
days postinjection (9.16.+-.2.54 ng/ml vs. 6.76.+-.0.89 ng/ml,
n=6).
[0195] Another indication of increased systemic levels of GH would
be the linkage with the IGF-I biosynthesis in the liver. Thus,
liver IGF-I expression of injected mice and controls was evaluated
by Northern blot analysis of total RNA. Elevated mIGF-I mRNA
expression was detected in all pSK-GHRH injected animals in
comparison to a relatively stable baseline of IGF-I in RNA with
those animals injected with pSK-LacZ. We observed increased IGF-I
mRNA starting as soon as 3 days post-injection and maintained at
least up to 21 days.
[0196] Finally, hGHRH secreted into the systemic circulation after
intramuscular injection of pSK-GHRH enhanced growth in normal mice
(FIG. 11), as shown by significant differences in their total body
mass at 14 days (21.11.+-.1.47 g vs. 18.62.+-.0.4 hl ,
p.ltoreq.0.043) and 21 days (21.86.+-.1.45 g vs. 18.8.+-.0.42 g,
p.ltoreq.0.028) after a single injection of pSK-GHRH.
[0197] We observed only a transient activity of pSK-GHRH in vivo,
after i.m. injection in adult mice, a fact most probably due to the
humoral immune response targeted against hGHRH, a heterologous
protein in mouse (Yao et al., 1994, Gene Therapy 1:99-107; Tripathy
et al., 1996, PNAS 93:10876-10880; Tripathy et al, 1996, Nature
Med. 2:545-550).
[0198] Our results demonstrate that the i.m. injected pSK-GHRH
could be used to produce physiological levels of GHRH in the
circulation of adult animals. This data suggests that it is
possible to restore endogenous GH secretion to children and adults
with GH deficiencies in a more physiological and less expensive way
compared with the classical therapies.
[0199] Enhanced Vector Expression in Intact Muscle
[0200] Intact plasmid DNA in a sterile 20% sucrose solution
(wt/vol) can be injected into mature avian or mammalian muscle.
Following a single injection the vector DNA is stable for at least
30 days as a non-integrated extrachromosomal circular DNA in muscle
nuclei and, is transcriptionally active. Wolf et al., Science, vol.
247, pp. 1465-1468 (1990). However, greater than 99% of the
injected DNA is degraded in muscle under the Wolff protocol (Wolff,
et al, BioTechniques 11:4374-485 (1991)). This protocol can be
improved by increasing the uptake of plasmid DNA into muscle and
reducing vector degradation. The procedure of the present invention
can use expression vector DNA coated with the relevant
transcriptional regulatory factors, the human serum response factor
and other human associated nuclear proteins, such as histone, and
transcription initiation factors to enhance uptake and stability.
The regulatory proteins protect the DNA against muscle nucleases
and facilitate the uptake of the protein coated DNA into myogenic
nuclei.
[0201] The expression vector forms a protein/DNA complex by the
sequence specific binding of the serum response factor with the
inner core CCXXXXXXGG (where X can be either A or T; SEQ ID NO. 3)
of the serum response element and by the addition of histone. The
interaction with the inner core of the promoter facilitates
myogenic cell type restricted expression of the skeletal
.alpha.-actin gene. The serum response factor, transcription
initiation factor, transregulatory factor and histones are added to
the expression vector by an in vitro binding reaction to form a
reconstituted protein/DNA complex.
[0202] Coating the Expression Vector System
[0203] A specific formulation involves coating the vector with
elements of the transcription initiation complex and histone. This
formulation is used both to enhance delivery of the vector to the
cell and to enhance expression of the vector within the cell.
[0204] The following protocol was used to bacterially express and
purify human serum response factor (SRF). Plasmid pARSRF-Nde is a
T7 polymerase vector (Studier, F.W. and Moffatt, J. Mol. Biol.
189:113-130 (1986)) which produced full-length SRF protein upon
IPTG (isopropyl-B-D-thiogalac- topyranoside) induction. (Manak et
al., Genes and Development 4:955-967 (1990)). E. coli BL21
harboring the plasmid was grown at 37.degree. C. to an OD.sub.600
of 0.4 in TYP medium supplemented with ampicillin (50 .mu.g/ml).
Synthesis of SRF was then induced with 1 mM IPTG for 2.0 hr, after
which cells were spun down, washed once in TE buffer (10 mM
Tris-HC1, 1 mM EDTA, pH 7.0) and resuspended in a 40X packed cell
volume and dialyzed against (10 mM HEPES [N-2
hydroxyethylpiperzine-N-2-ethansul- fonic acid, pH 7.4], 60 mM KCl,
1 mM 2-mercaptoethanol 0.5 mM EDTA, 0.5 mM phenylmethylsulfonyl
fluoride and 10% glycerol). Cells were disrupted on ice by
sonication. The lysate was clarified by centrifugation
(15,000.times. g for 20 min.) and the high speed supernatant
containing overexpressed SRF was stored at -80C. Partial
purification of SRF was done as follows. A 10 ml amount of the
lysate was applied to a 10 ml phosphocellulose column equilibrated
with column buffer (same as dialysis buffer as described above) and
0.05% Nonidet P-40. The flow through fractions were collected and
applied to a 5-ml heparin agarose column. The column was washed
with 0.35 M KC1 and SRF was eluted with 0.5 M KC1. SRF was then
dialyzed and stored at -80.degree. C.
[0205] Approximately, a ratio by weight of 5 to 1 SRF protein to
expression vector DNA was allowed to incubate together in a
solution containing 10 mM. Tris-HCl (pH 8.0, 0.1 mM EDTA, 2 mM
dithiothreitol, 5% glycerol plus 100 mM KC1. The binding of SRF to
the actin promoter has been verified by DNA binding assays and by
nuclease footprint protection assays as shown in the art.
Transcription initiation factors such as the TATA box protein (TBP)
and other initiation factors such as TFIIB, E and F are eluted from
purified HeLa cell nuclei by the protocol of Dignam et al., Mol.
Cell. Biol. 10:582-598 (1983) with 0.42M KCl in the above dialysis
buffer. Nuclear lysates containing transcription initiation factors
are mixed together with the SRF-DNA plasmid at a ratio of 10 parts
protein to one part SRF-DNA to help form a preinitiation complex
which is dialyzed for 24 hours. Finally, a crude histone
preparation which is stripped from HeLa nuclei in 6M urea, 2M NaCl
is dialyzed against low salt dialysis buffer. The full complement
of histone are slowly added to a final ratio of 1 to 1 (histone to
the SRF-protein DNA complex) to form nucleosome particles over
nonprotected DNA. The addition of histone will protect regions of
DNA to a greater extent than naked DNA from cellular nucleases.
[0206] The nucleoprotein complex is then further formulated with a
lipid base, nonaqueous base and/or liposomes for direct injection
into muscle. Because of the abundance of specific transcription
factors, which contain nuclear targeting sequences, expression
vector DNA is readily delivered, and taken up into muscle
nuclei.
[0207] The vector can also be prepared in a formulation with other
DNA binding compounds. For example, the vector can be prepared with
polyvinyl pyrrolidone (PVP). PVP is a synthetic polymer consisting
of linear 1-vinyl-2-pyrrolidone groups. PVP is commercially
available with various degrees of polymerization and molecular
weights. Pharmaceutical grade PVP is marketed under the trade names
Plasdone (International Specialty Products, ISP) and Kollidon
(BASF). ISP describes the typical properties of Plasdone C-30 in
its product literature. Plasdone C-30 has a weight average
molecular weight of 50,000 g/mol.
[0208] PVP is found to interact with DNA by hydrogen bonding. PVP
is also found to protect DNA in vitro from nuclease (DNase 1)
degradation. Reporter genes (CMV-CAT or CMV-.beta.-gal) were
formulated in PVP solutions and injected into rat tibialis muscles
after surgical exposure. The results showed that DNA formulated at
3 mg/mL in 5% PVP in 150 mM NaCl led to the highest enhancement of
gene expression over DNA formulated in saline. The levels of gene
expression using lower molecular weight PVP (Plasdone C-15) were
approximately 2-fold lower than levels of gene expression using
formulations made with Plasdone C-30. When rat tibialis muscles
were injected with DNA formulated in either saline or 5% PVP
(Plasdone C-30), immunochemical staining for .beta.-galactosidase
revealed that the staining was more widely distributed in muscles
treated with the formulated DNA. The staining also showed that the
PVP formulation resulted in an increase in the number of cells
expressing .beta.-gal and that these cells were distributed over a
larger area as compared to DNA injected in saline. It is suggested
that the increased tissue dispersion of DNA using PVP formulations
is due to a hyper-osmotic effect in the muscle. DNA (3 mg/mL) in 5%
PVP (Plasdone C-30) in 150 mM NaCl exerts an osmotic pressure of
341.+-.1 mOsm/kg H.sub.2O.
[0209] An exemplary formulation of the hGHRH plasmid is a
three-vial system, with product components to be mixed just prior
to use. The product components are:
[0210] 1. Human GHRH plasmid in sterile water;
[0211] 2. Lyophilized PVP (polyvinylpyrrolidone; Plasdone C-30,
Povidone U.S.P.); chemical formula
(C.sub.6.sup.H.sub.9NO).sub.n;
[0212] 3. 115 mM sodium citrate buffer (pH 4) in 5% NaCl.
[0213] The expression vector can also be delivered as described
below.
[0214] Administration
[0215] Administration as used herein refers to the route of
introduction of a vector or carrier of DNA into the body.
Administration can be directly to a target tissue or by targeted
delivery to the target tissue after systemic administration. In
particular, the present invention can be used for treating disease
by administration of the vector to the body in order to
establishing controlled expression of any specific nucleic acid
sequence within tissues at certain levels that are useful for gene
therapy.
[0216] The preferred means for administration of vector and use of
formulations for delivery are described above. The preferred
embodiment is by direct injection using needle injection or
hypospray.
[0217] The route of administration of any selected vector construct
will depend on the particular use for the expression vectors. In
general, a specific formulation for each vector construct used will
focus on vector uptake with regard to the particular targeted
tissue, followed by demonstration of efficacy. Uptake studies will
include uptake assays to evaluate cellular uptake of the vectors
and expression of the tissue specific DNA of choice. Such assays
will also determine the localization of the target DNA after
uptake, and establishing the requirements for maintenance of
steady-state concentrations of expressed protein. Efficacy and
cytotoxicity can then be tested. Toxicity will not only include
cell viability but also cell function.
[0218] Muscle cells have the unique ability to take up DNA from the
extracellular space after simple injection of DNA particles as a
solution, suspension, or colloid into the muscle. Expression of DNA
by this method can be sustained for several months.
[0219] Delivery of formulated DNA vectors involves incorporating
DNA into macromolecular complexes that undergo endocytosis by the
target cell. Such complexes may include lipids, proteins,
carbohydrates, synthetic organic compounds, or inorganic compounds.
The characteristics of the complex formed with the vector (size,
charge, surface characteristics, composition) determines the
bioavailability of the vector within the body. Other elements of
the formulation function as ligand which interact with specific
receptors on the surface or interior of the cell. Other elements of
the formulation function to enhance entry into the cell, release
from the endosome, and entry into the nucleus.
[0220] Delivery can also be through use of DNA transporters. DNA
transporters refers to molecules which bind to DNA vectors and are
capable of being taken up by epidermal cells. DNA transporters
contain a molecular complex capable of non-covalently binding to
DNA and efficiently transporting the DNA through the cell membrane.
It is preferable that the transporter also transport the DNA
through the nuclear membrane. See, e.g., the following applications
all of which (including drawings) are hereby incorporated by
reference herein: (1) Woo et al., U.S. Ser. No. 07/855,389,
entitled "A DNA Transporter System and Method of Use", filed Mar.
20, 1992, now abandoned; (2) Woo et al., PCT/US93/02725,
International Publ. WO93/18759, entitled "A DNA Transporter System
and method of Use", (designating the U.S. and other countries)
filed Mar. 19, 1993; (3) a continuation-in-part application by Woo
et al., entitled "Nucleic Acid Transporter Systems and Methods of
Use", filed Dec. 14, 1993, U.S. Ser. No. 08/167,641; (4) Szoka et
al., U.S. Ser. No. 07/913,669, entitled "Self-Assembling
Polynucleotide Delivery System", filed Jul. 14, 1992 and (5) Szoka
et al., PCT/US93/03406, International Publ. WO93/19768 entitled
"Self-Assembling Polynucleotide Delivery System", (designating the
U.S. and other countries) filed Apr. 5, 1993.
[0221] Transfer of genes directly into muscle has been very
effective. Experiments show that administration by direct injection
of DNA into muscle cells results in expression of the gene in the
area of injection. Injection of plasmids containing GHRH results in
expression of the gene for months at relatively constant levels.
The injected DNA appears to persist in an unintegrated
extrachromosomal state. This means of transfer is the preferred
embodiment.
[0222] Another preferred method of delivery involves a DNA
transporter system. The DNA transporter system consists of
particles containing several elements that are independently and
non-covalently bound to DNA. Each element consists of a ligand
which recognizes specific receptors or other functional groups such
as a protein complexed with a cationic group that binds to DNA.
Examples of cations which may be used are spermine, spermine
derivatives, histone, cationic peptides and/or polylysine. One
element is capable of binding both to the DNA vector and to a cell
surface receptor on the target cell. Examples of such elements are
organic compounds which interact with the asialoglycoprotein
receptor, the folate receptor, the mannose-6-phosphate receptor, or
the carnitine receptor. A second element is capable of binding both
to the DNA vector and to a receptor on the nuclear membrane. The
nuclear ligand is capable of recognizing and transporting a
transporter system through a nuclear membrane. An example of such
ligand is the nuclear targeting sequence from SV40 large T antigen
or histone. A third element is capable of binding to both the DNA
vector and to elements which induce episomal lysis. Examples
include inactivated virus particles such as adenovirus, peptides
related to influenza virus hemagglutinin, or the GALA peptide
described in the Skoka patent cited above.
[0223] Administration may also involve lipids. The lipids may form
liposomes which are hollow spherical vesicles composed of lipids
arranged in unilamellar, bilamellar, or multilamellar fashion and
an internal aqueous space for entrapping water soluble compounds,
such as DNA, ranging in size from 0.05 to several microns in
diameter. Lipids may be useful without forming liposomes. Specific
examples include the use of cationic lipids and complexes
containing DOPE which interact with DNA and with the membrane of
the target cell to facilitate entry of DNA into the cell.
[0224] Gene delivery can also be performed by transplanting
genetically engineered cells. For example, immature muscle cells
called myoblasts may be used to carry genes into the muscle fibers.
Myoblasts genetically engineered to express recombinant human
growth hormone can secrete the growth hormone into the animal's
blood. Secretion of the incorporated gene can be sustained over
periods up to 3 months.
[0225] Myoblasts eventually differentiate and fuse to existing
muscle tissue. Because the cell is incorporated into an existing
structure, it is not just tolerated but nurtured. Myoblasts can
easily be obtained by taking muscle tissue from an individual who
needs gene therapy and the genetically engineered cells can also be
easily put back with out causing damage to the patient's muscle.
Similarly, keratinocytes may be used to deliver genes to tissues.
Large numbers of keratinocytes can be generated by cultivation of a
small biopsy. The cultures can be prepared as stratified sheets and
when grafted to humans, generate epidermis which continues to
improve in histotypic quality over many years. The keratinocytes
are genetically engineered while in culture by transfecting the
keratinocytes with the appropriate vector. Although keratinocytes
are separated from the circulation by the basement membrane
dividing the epidermis from the dermis, human keratinocytes secrete
into circulation the protein produced.
[0226] Delivery may also involve the use of viral vectors. For
example, an adenoviral vector may be constructed by replacing the
E1 region of the virus genome with the vector elements described in
this invention including promoter, 5' UTR, 3' UTR and nucleic acid
cassette and introducing this recombinant genome into 293 cells
which will package this gene into an infectious virus particle.
Virus from this cell may then be used to infect tissue ex vivo or
in vivo to introduce the vector into tissues leading to expression
of the gene in the nucleic acid cassette.
[0227] The chosen method of delivery should result in expression of
the gene product encoded within the nucleic acid cassette at levels
which exert an appropriate biological effect. The rate of
expression will depend upon the disease, the pharmacokinetics of
the vector and gene product, and the route of administration, but
should be between 1-1000 mg/kg of body weight/day. This level is
readily determinable by standard methods. It could be more or less
depending on the optimal dosing. The duration of treatment will
extend through the course of the disease symptoms, possibly
continuously. The number of doses will depend upon disease delivery
vehicle and efficacy data from clinical trials.
[0228] Cell Transfection and Transformation
[0229] One aspect of the present invention includes cells
transfected with the vectors described above. Once the cells are
transfected, the transformed cells will express the protein or RNA
encoded for by the nucleic acid cassette. Examples of proteins
include, but are not limited to polypeptide, glycoprotein,
lipoprotein, phosphoprotein, or nucleoprotein.
[0230] The nucleic acid cassette which contains the genetic
material of interest is positionally and sequentially oriented
within the vectors such that the nucleic acid in the cassette can
be transcribed into RNA and, when necessary, be translated into
proteins or polypeptides in the transformed cells.
[0231] A variety of proteins can be expressed by the sequence in
the nucleic acid cassette in the transformed cells. Those proteins
which can be expressed may be located in the cytoplasm, nucleus,
membranes (including the plasmalemma, nuclear membrane, endoplasmic
reticulum or other internal membrane compartments), in organelles
(including the mitochondria, peroxisome, lysosome, endosome or
other organelles), or secreted. Those proteins may function as
intracellular or extracellular structural elements, ligand,
hormones, neurotransmitter, growth regulating factors,
differentiation factors, gene-expression regulating factors,
DNA-associated proteins, enzymes, serum proteins, receptors,
carriers for small molecular weight organic or inorganic compounds,
drugs, immunomodulators, oncogenes, tumor suppressor, toxins, tumor
antigens, or antigens. These proteins may have a natural sequence
or a mutated sequence to enhance, inhibit, regulate, or eliminate
their biological activity. A specific example of a protein to be
expressed is hGHRH.
[0232] In addition, the nucleic acid cassette can code for RNA. The
RNA may function as a template for translation, as an antisense
inhibitor of gene expression, as a triple-strand forming inhibitor
of gene expression, as an enzyme (ribozyme) or as a ligand
recognizing specific structural determinants on cellular structures
for the purpose of modifying their activity. Specific examples
include RNA molecules to inhibit the expression or function of
prostaglandin synthase, lipo-oxenganse, histocompatibilty antigens
(class I or class II), cell adhesion molecules, nitrous oxide
synthase, 2 micro-globulin, oncogenes, and growth factors.
[0233] The compounds which can be incorporated are only limited by
the availability of the nucleic acid sequence for the protein or
polypeptide to be incorporated. One skilled in the art will readily
recognize that as more proteins and polypeptides become identified
they can be integrated into the vector system of the present
invention and expressed in animal or human tissue.
[0234] Transfection can be done either by in vivo or ex vivo
techniques. For example, muscle cells can be propagated in culture,
transfected with the transforming gene, and then transplanted into
muscle tissue. Alternatively, the vectors can be administered to
the cells by the methods discussed above.
[0235] Methods of Use
[0236] A. Treatment with Growth Hormone Releasing Hormone
[0237] Growth hormone is normally produced and secreted from the
anterior pituitary and promotes linear growth in prepuberty
children. Growth hormone acts on the liver and other tissues to
stimulate the production of growth hormone releasing hormone. This
factor is, in turn, responsible for the growth promoting effects of
growth hormone. Further, this factor serves as an indicator of
overall growth hormone secretion. Serum IGF-I concentration
increases in response to endogenous and exogenous administered
growth hormone. These concentrations are low in growth hormone
deficiency.
[0238] Growth hormone releasing hormone is one of the key factors
that potentiates muscle development and muscle growth. Myoblasts
naturally secrete GHRH as well as its cognate binding proteins
during the onset of fusion. This process coincides with the
appearance of muscle specific gene products. In terminally
differentiated muscle, signals propagated from passive stretch
induced hypertrophy induce the expression of IGF genes. Many of the
actions of IGFs on muscle result from interactions with the GHRH
receptor.
[0239] The intramuscular injection of an expression vector
containing the sequence for GHRH (for example, pSK-GHRH) can be
used to treat growth disorders. Vectors are designed to preferably
control the expression of GHRH in a range of 0.1-10 ng/ml. Since
intramuscular expression of vectors leads to expression of the
product encoded by the nucleic acid cassette for several months,
this method provides a long-term inexpensive way to increase
systemic blood concentration of GHRH and consequently GH and IGF-I
in patients with growth hormone deficiency.
[0240] B. Treatment of Muscle Atrophy Due To Age
[0241] Growth hormone levels decline with increasing age. The
levels in healthy men and women above age of 55 are approximately
one third lower than the levels in men and women 18 to 33. This is
associated with a decrease in the concentration of IGF-I. The
decline in growth hormone and IGF-I production correlate with the
decrease in muscle mass, termed senile muscle atrophy, and increase
in adiposity that occur in healthy human subjects. Administering
growth hormone three times a week to healthy 61 to 81 year old men
who had serum levels below those of healthy younger men increased
the serum IGF-I levels to within the range found in young healthy
adults. This increased level led to increased muscle mass and
strength and reduced body fat. The secretion of growth hormone is
regulated by a stimulatory (growth hormone releasing hormone) and
an inhibitory (somatostatin) hypothalamic hormone.
[0242] The convenient cloning sites in the expression vectors of
the present invention are used to construct vectors containing
human growth hormone CDNA sequence, the human growth hormone
releasing hormone (GHRH), or IGF-I. This versatility is important
since the GHRH, GH, and IGF-I, while having similar desired effects
on muscle mass, may have different side effects or kinetics which
will affect their efficacy. The expression of the growth hormone
releasing hormone might be more advantageous than the expression of
either IGF-I or the growth hormone vectors transcripts. Since GHRH
is reduced in the elderly it appears to be responsible for the lack
of GH secretion rather than the anterior pituitary capability of
synthesizing growth hormone, thus the increased expression of GHRH
from muscle would increase GHRH levels in the systemic blood system
and can allow for the natural diurnal secretion pattern of GH from
the anterior pituitary. In this way, GHRH could act as the natural
secretogogue, allowing for elevated secretion or release of GH from
the hypothalamus of the elderly.
[0243] Thus, the application of vector systems described herein to
express growth hormone releasing hormone through the injection of
the pSK-GHRH or related vectors, vectors expressing HG, or IGF-I
into adult muscle of the elderly is a long-term inexpensive way to
increase systemic blood concentration of IGF-I in the elderly.
[0244] Administration of the vectors can be intravenously, through
direct injection into the muscle or by any one of the methods
described above. Dosages will depend on the severity of the disease
and the amount of dosage is readily determinable by standard
methods. The duration of treatment will extend through the course
of the disease symptoms which can be continuously.
[0245] C. Treatment of Osteoporosis
[0246] Osteoporosis is a common accelerated loss of bone mass that
often accompanies aging. The decreased bone density associated with
osteoporosis leads to an increased susceptibility to bone
fractures. Treatment with IGF-I is associated with increased bone
density. Thus, administration of a vector encoding GHRH to muscles
by direct injection or hypospray will induce a higher level of
IGF-I production and will thereby aid in the redeposition of bone
and thereby decrease the risk of fractures.
[0247] Administration of the vectors can be intravenously, through
direct injection or by any one of the methods described above.
Dosages will depend on the severity of the disease and the amount
of dosage is readily determinable by standard methods. The duration
of treatment will extend through the course of the disease symptoms
which can be continuously.
[0248] D. Treatment of Cachexia
[0249] Muscle wasting (cachexia, negative nitrogen balance, loss of
lean body mass) is a common complication of a number of chronic
diseases, such as AIDS, cancer, and rheumatic disease. This process
contributes substantially to a morbid cycle of inactivity,
malnutrition , and opportunistic infections, resulting in prolonged
disability, extended hospitalization, and considerable health care
expense. Muscle wasting is also a common feature of morbid ageing
and it is likely that measures to preserve muscle mass would have a
substantial beneficial impact in the morbidly ageing population.
Reversal of muscle wasting may be an efficient method for treating
osteoporosis as well.
[0250] Current therapies focus on dietary management with the use
of high calorie dietary supplements or parenteral nutrition or use
of appetite stimulants. Dietary approaches are inherently limited
by the poor utilization of caloric intake in these patients.
Androgens are theoretically effective but have profound side
effects which complicate their use. Thus, there is a need for an
effective medicinal approach which directly promotes preservation
of muscle mass. Preferably the approach will involve a therapeutic
composition which does not require frequent administration, thus
providing improved compliance in chronically ill and ageing
populations.
[0251] IGF-1 is the major growth factor promoting the
differentiation of muscle cells and increasing muscle mass. Studies
in animals demonstrate that IGF-1 will effectively reverse
cachexia, though this requires chronic (ideally continuous)
administration. hGH has also been shown to preserve lean body mass
in animal studies and is in use in many clinical trials for this
indication.
[0252] The stimulation of GH and IGF-1 for the treatment of
cachexia can advantageously be provided by the in vivo expression
of GHRH from a vector, e.g., the PSK-GHRH vector, thereby avoiding
the difficulties associated with direct administration of IGF-1 or
GH. This method is expected to be particularly advantageous in
cases of systemic muscle wasting. The vector can be administered by
various methods, such as those indicated above. An example of such
an administration method is the direct injection of a composition
containing the vector encoding GHRH in muscle tissue of the patient
to be treated.
[0253] Improvement of Livestock
[0254] An additional embodiment of the present invention is the
improvement of livestock by injection of GHRH vector constructs, or
similar constructs encoding other growth hormones, such as growth
hormone or growth hormone releasing hormone. It has been shown that
GHRH stimulates milk production (galactopoietic) with no alteration
in milk composition, and sustains growth, mostly on the behalf of
lean body mass, in farm animals (Enright et al., 1993, J. Animal
Science 71:2395-2405; Enright et al., 1986, J. Dairy Science
69:344-351). Thus, muscle injection of vectors encoding GHRH by
hypodermic or hypospray administration will promote increased
muscle mass and reduced body fat in important live-stock species
such as cattle, sheep, swine, rabbits, deer, fish and birds such as
turkeys, chickens, ducks, and geese. Likewise, milk production can
also be stimulated by in vivo expresssion of GHRH from vectors such
as those described above. Administration of the vectors can also be
through any one of the methods described above.
[0255] The following examples are offered by way of illustration
and are not intended to limit the invention in any manner.
EXAMPLE 1
Construction of PSK-GHRH and PSK-LacZ
[0256] The plasmid DNA backbone was pBlueScript KS+ (pBS). In order
to construct hybrid pSK-GHRH, a 448 bp fragment (-424/+24) of avian
skeletal .alpha.-actin promoter (SK) (Lee, T. C. et al., Oncogene
9:1047-1052 (1994); Chow, K. L. et al., Proc. Natl. Acad. Sci. USA,
88:1301-1305 (1991)) was cloned upstream from the hGHRH cDNA 228 bp
fragment (part of exon 2, all exon 3 and part of exon 4) coding for
the 31 amino acid signal peptide and entire mature hGHRHl-44
peptide (Tyr1 Leu44) inserted into the BamHI/HindIII sites of pBS
derived plasmid. The 3' untranslated region of hGH cDNA in a 622 bp
SmaI/EcoRI blunted fragment, was excised from the commercial pOGH
plasmid (Nichols Institute) and cloned into blunted-ended
ClaI/EcoRI sites of pBS derived plasmid. In the pSK-LacZ construct,
the .beta.-galactosidase gene of Escherichia coli, with a nuclear
localization signal (nls), is driven by the same SK promoter, but
contains the 3' UTR of skeletal .alpha.-actin gene.
EXAMPLE 2
In Vitro Expression of pSK-GHRH
[0257] A plasmid vector which is capable of directing high-level
gene expression in a skeletal muscle specific manner is generated
as follows. A 228 bp fragment of hGHRH, which encode for the 31
amino acid signal peptide and the entire mature peptide
hGHRH(1-44)OH (Tyr1 Leu44), was cloned into a pBS-derived vector.
Gene expression was controlled by a 448 bp fragment (-424/+24) of
the avian skeletal .alpha.-actin gene, which contains several
evolutionarily conserved regulatory elements that accurately
initiate skeletal .alpha.-actin transcripts and drives
transcription of a variety of reporter genes specifically in
differentiated skeletal muscle cells. The GHRH coding region was
followed by the 3' untranslated region of human growth hormone
cDNA.
EXAMPLE 3
In Vitro Expression of pSK-GHRH
[0258] In vitro expression of PSK-GHRH was examined in transiently
transfected chicken primary myoblasts. pSK-GHRH and pSK-LacZ
transfected cells were placed into differentiation media for 24-72
h to initiate withdrawal from the cell cycle and to induce
post-fusion differentiation. The media was changed to a minimal
serum-free media for a 24 h pulse. Cells were harvested 48 to 96 h
post-differentiation. Northern blot analysis (FIG. 12) showed the
expected size transcripts of 0.35 kb, in myoblasts transfected with
pSK-GHRH, but not in pSK-LacZ transfected myoblasts. The expression
of pSK-GHRH peaked at 48 h post-differentiation and was reduced
thereafter in comparison to the glycolytic enzyme GAPDH. This
pattern of activation is characteristic for chicken skeletal
.alpha.-actin promoter, which induces high levels of transgene
expression in myotubes but not in replicating myoblasts.
[0259] Conditioned serum-free media from pSK-GHRH and pSK-LacZ
transfected myoblasts were collected and purified on C18
Sep-Columns, which served to separate the peptide to be assayed
from potentially interfering substances and to concentrate the
samples to determine levels of radioimmunoassayable hGHRH. Chicken
primary myoblasts transfected with pSK-GHRH produced approximately
1.7 ng hGHRH(1-44)OH/million cells/h.
EXAMPLE 4
In Vitro Activity of pSK-GHRH
[0260] The in vitro potency of the hGHRH (1-44)OH molecule secreted
by primary pig myoblasts (ppm) transiently transfected with
pSK-GHRH was compared to that of the hGHRH (1-44)NH.sub.2 synthetic
molecule for its ability to stimulate GH release from primary pig
anterior pituitary cells after a 24 h stimulation at 37.degree. C.
GH release from the primary pig anterior pituitary cells rose from
values of 7.+-.2 ng/ml to 82.5.+-.3.1 ng/ml (p.ltoreq.0.002) when
stimulated with 5 ml culture media from 1 million primary pig
myoblasts transiently transfected with pSK-GHRH, containing a
radioimmunoassay equivalent estimated to be long of hGHRH (1-44)OH.
This value equals 72% of that obtained when the pituitary cells
were stimulated with myoblast serum-free media mixed with 10 ng
synthetic hGHRH (1-44)NH.sub.2 then purified and processed as the
test media (GH release in this case was 115.+-.3.2 ng/ml). Thus,
hGHRH(1-44)OH secreted by skeletal pig myocytes transfected with
PSK-GHRH retain functional activity in pig pituitary cell culture
and induces secretion of significant levels of GH. This is an
important finding, and contracts with prior art technique. Pig
(1-44)GHRH, as well as the human molecule, is amidated, while the
molecule which is expressed by the present construct is
non-amidated at amino acid 44.
EXAMPLE 5
In Vivo Expression and Activity of pSK-GHRH
[0261] On day 0, animals were anesthetized and injected with 100
.mu. of pSK-GHRH of pSK-LacZ in 100 .mu. PBS into the regenerating
quadriceps muscle. The animals were killed over the next 3 weeks
and samples of the injected muscles were collected and frozen in
liquid nitrogen and blood collected by transcardiac puncture.
[0262] The in vivo expression of PSK-GHRH was assessed by RT-PCR on
injected muscle (FIG. 13). Muscle RNA was DNase I treated in order
to eliminate the injected plasmid, reextracted and 1 mg of total
RNA was used in the reverse transcriptase reaction. Only the
pSK-GHRH injected muscles showed a 254 bp PCR fragment when
amplified with GHRH specific primers ([+]pSK-GHRH). The pSK-LacZ
injected muscles showed a 497 bp PCR fragment for mouse
cytoskeletal .beta.-actin, used as a control, but not for GHRH. The
efficiency of DNase treatment to eliminate plasmid DNA was screened
by using RNA from pSK-GHRH injected muscle: when the reverse
transcriptase was omitted from the reaction, no amplification was
observed((-) pSK-GHRH).
[0263] Serum mGH in the pSK-GHRH injected animals was significantly
elevated as compared to the mGH levels in serum from control mice
(FIG. 14). Time course analysis of mGH as a response to pSK-GHRH
injections showed stimulation at 3 days post-injection
(21.54.+-.15.29 ng/ml vs. 7.53.+-.0.57 ng/ml, n=6), peaked at 7
days post-injection (36.28.+-.27.28 ng/ml vs. 8.2.+-.1.9 ng/ml,
p.ltoreq.0.05, n=6) and declined gradually to the base-line by 21
days post-injection (9.16.+-.2.54 ng/ml vs. 6.76.+-.0.89 ng/ml,
n=6).
[0264] Another indication of increased systemic levels of GH would
be elevated IGF-1 biosynthesis in the liver. Thus, liver IGF-1
expression of injected mice and controls was evaluated by Northern
blot analysis of total RNA (FIG. 15). Elevated mIGF-1 mRNA
expression was detected in all pSK-GHRH injected animals in
comparison to a relatively stable baseline of IGF-1 RNA in pSK-LacZ
injected mice. IGF-1 MRNA levels increased within 3 days
post-injection and was maintained up to 21 days.
[0265] hGHRH secreted into the systemic circulation after
intramuscular injection of pSK-GHRH enhanced growth in normal mice
(FIG. 16), as shown by significant differences in their total body
mass at 14 days (21.11.+-.1.47 g vs. 18.62.+-.0.4 g,
p.ltoreq.0.043) and 21 days (21.86.ltoreq.1.45 g vs. 18.8.+-.0.42
g, p.ltoreq.0.028) after a single injection of pSK-GHRH. These
results demonstrate that the i.m. injection of pSK-GHRH can be used
to produce physiological levels of GHRH in the circulation of adult
animals.
[0266] However, the hGHRH is unsuitable for use in other animals.
Only a transient increase was observed in mGH in vivo, after i.m.
injection of pSK-GHRH in adult mice. This response is due to a
humoral immune response targeted against hGHRH, which is a
heterologous protein in mouse. The antibody response to hGHRH was
demonstrated using an ELISA assay (FIG. 17). Antibodies to hGHRH
were detected in sera collected 21 days and 28 days after
intramuscular injection of pSK-GHRH but not in sera collected 21
days after intramuscular injection of pSK-LacZ (p.+-.0.05). Also,
the persistence of hGHRH transcripts in the muscle 21 days after
injection demonstrate that expression persists and that the decline
of serum hGHRH concentrations is due to the humoral immune
response.
[0267] Cloning the cDNA coding for the hGHRH(1-40)OH molecule,
which is naturally hydroxylated and has the same potency in vivo as
hGHRH(1-44)NH.sub.2 provides greater GH release in plasmid injected
animals. In addition, mutation of some of the amino acids which are
known to be sites for different peptidases, prolong the half-life
of the hGHRH molecule. In order to regulate the expression level in
vivo and to obtain, if necessary, a discontinuous release of GHRH,
a gene switch (Wang, Y. et al., Nature Biotechnology 15:239-243
(1997)) is an important element to be added.
[0268] The lost cost, the possibility of large scale production of
plasmid DNA, combined with the easy administration procedure and
the 10-20 times higher potency at the same dose as compared to GH,
provides utility for agricultural uses. The intramuscular plasmid
delivery represents a practical way to improve performance of
domestic animals and provide an alternative to classical GH
treatments.
[0269] A GHRH plasmid delivery, which avoids the frequent
administration of recombinant proteins currently used in
agriculture and human clinics and provides a more natural
alternative for the GH-based therapies.
EXAMPLE 6
Cell Culture
[0270] Minimal Essential Medium (MEM), heat inactivated horse serum
(HIHS), gentamicin, Hank's Balanced Salt Solution (HBSS),
lipofectamine were obtained from Gibco BRL. The skilled artisan
recognizes that primary chicken myoblast cultures can be obtained
(Bergsma, D. J. et al., Molecular & Cellular Biology
6:2462-2475 (1986)). Cells were plated 24 h prior to transfection
at a density of 1.5 million cells/100 mm plate, in MEM supplemented
with 10% HIHS, 5% chicken embryo extract (CEE) and gentamicin.
Cells were maintained in a humidified 5% CO.sub.2 95% air
atmosphere at 37.degree. C. Cells were transfected with 4 .mu. of
pSK-GHRH or pSK-LacZ per plate using lipofectamine, according to
the manufacturer instructions. After transfection, the medium was
changed to MEM which contained 2% HIHS, 2% CEE for at least 24 h to
allow the cells to differentiate. Primary pig myoblast cultures
were obtained as described in Doumit, M. E. et al., Tissue &
Cell 24:253-262 (1992). Cells were plated at a density of 1 million
cells/100 mm plate and maintained in growth media for 2-3 days. The
cells were passed for 2 times prior to transfection. Porcine
myoblast cultures were transfected and differentiated under the
same conditions as the primary chicken myoblast cultures. Media and
cells were harvested 48, 72 and 96 h postdifferentiation. The
samples and controls were assayed in quadruplicate. The efficiency
of transfection was estimated by .beta.-galactosidase
histochemistry of control plates to be 10%. One day before
harvesting, cells were washed twice in HBSS and the media changed
to MEM, 0.1% BSA. The cells were homogenized directly into
Ultraspec RNA reagent (Biotecx Laboratories) for the isolation of
total RNA. Conditioned media was treated by adding 0.25 volume of
1% triflouroacetic acid (TFA) and 1 mM phenylmethylsulfonylflouride
(PMSF), frozen at -800, lyophilized, purified on C-18 Sep-Columns,
relyophilized and used in RIA or resuspended in media conditioned
for primary pig anterior pituitary culture. The pit anterior
pituitary culture was obtained as described (Tanner, J. W. et al.,
J. Endocrinol 125:109-115 (1990)). Pig GH was assayed as described
in Barb, C. R. et al., Domestic Animal Endocrinology 8:117-127
(1991).
EXAMPLE 7
Northern Blot Analysis
[0271] 10-20 .mu. of total RNA was DNase I treated (Gibco BRL),
size separated in 1.5% agarose-formaldehyde gel and transferred to
Gene Screen nylon membrane (DuPont Research Products). The
membranes were hybridized with CDNA probes .sup.32P labeled by
random priming (Ready-to-Go DNA labeling kit, Pharmacia Biotech).
Hybridization was carried out at 45.degree. C. in a solution which
contained 50% formamide, 5.times. SSPE, 5.times. Denhardt's, 1%
SDS, 200 mg/ml sheared salmon sperm DNA. Membranes were washed
twice for 10 minutes in 2.times. SSPE/1% SDS at room temperature
and twice for 30 minutes in 0.2.times. SSPE/1% SDS at 68.degree. C.
Blots were subsequently exposed to X-ray film (Kodak X-Omat AR) at
-80.degree. C. with intensifying screens.
EXAMPLE 8
Intramuscular Injection of Plasmid DNA in Adult Mice
[0272] C57/B16 male mice (Taconic Laboratories) were housed under
environmental conditions of 10 h light/14 h darkness. On day -5,
the left quadriceps muscle of mice (17-20 g body weight) was
injected with 50 .mu. of 0.75% bupivacaine hydrochloride in saline
solution. On day 0 the animals were weighed, the regenerating
muscle was exposed and injected with 100 .mu. PBS. The animals were
weighed and killed 3-21 days later. Blood was collected,
centrifuged immediately at 0.degree. C., and stored at -80.degree.
C. prior to analysis. Injected and control organs were removed and
frozen in liquid nitrogen.
EXAMPLE 9
RT-PCR
[0273] Muscle RNA was extracted with Ultraspec RNA reagent. 1 .mu.
of total RNA was treated twice with 10 units of DNase I (Gibco BRL)
and phenol-chloroform extracted. RNA pellets were resuspended in 20
.mu. DEPC-water. Reverse transcriptase reactions were performed
with the SuperScript Preamplification System for First Strand CDNA
Synthesis (Gibco BRL) according to manufacturer instructions. In
(-) pSK-GHRH tubes the reverse transcriptase was omitted. Specific
oligonucleotide primers were used to amplify either a 254 bp
fragment of pSK-GHRH cDNA: 5'TGGTGCTCTGGGTGTTCTT3' (sense) (SEQ ID
NO.12) and 5'GCTTGATATCGAATTCCTGC3' (anti-sense) (SEQ ID NO.13) or
a 497 bp control fragment of mouse cytoskeletal .beta.-actin cDNA:
5'TCAGAAGGACTCCTATGTGG3- ' (sense) (SEQ ID NO.14) and
5'TCTCTTTGATGTCACGCACG3' (anti-sense) (SEQ ID NO.15). The PCR
conditions were, 32 cycles (94.degree. C. for 30s, 60.degree. C.
for 30s, 72.degree. C. for 1 min) in 50 .mu. containing 5 .mu. of
final volume of RT reaction diluted in 1.times. PCR buffer which
contained 1.5 mM MgCl.sub.2, 200 mM each DNTP, 2.5 units AmpliTaq
DNA polymerase (Perkin-Elmer) and 100 ng of each specific
primer.
EXAMPLE 10
Mouse Growth Hormone RIA
[0274] Mouse GH in plasma was measured with a heterologous rat
assay system (Amersham). The sensitivity of the assay was 0.16
ng/tube. The intra- and interassay coefficients of variation were
6.5 and 6.8% respectively.
EXAMPLE 11
Detection of Mouse Anti-hGHRH Antibodies
[0275] Mouse anti-hGHRH antibodies were detected by ELISA.
Ninety-six-well plates (Dynatech Laboratories) were coated with 500
ng of purified of hGHRH (Peninsula Laboratories) per well (in HEPES
buffered saline) at 4.degree. C. overnight. The wells were washed
five times with PBS, blocked with PBS containing 5% (w/v) non fat
dry milk and then incubated 2 hours at room temperature with serial
dilutions of serum (in PBS +2% BSA) from pSK-GHRH or pSK-LacZ
injected mice. The wells were washed five times with PBS and then
incubated with 50 ml of a 1:2000 dilution of HRP-conjugated goat
anti-mouse IgG for 2 hours at room temperatures. 200 .mu. of
peroxidase developing reagent (ABTS substrate) were incubated for 1
hour at room temperature. Plates were read at 410 nm in a Dynatech
MR600 plate reader. In this assay, a rabbit anti-hGHRH antibody
used with a HRP-conjugated goat anti-rabbit secondary antibody was
the positive control for sensitivity.
EXAMPLE 12
Statistics
[0276] Data were analyzed using Microsoft Excel statistics analysis
package. Specific p values were obtained by comparison using
Student's t test. A value of p.ltoreq.0.05 was taken to be
statistically significant. Values shown in the figures are the
mean.+-.s.e.m.
1TABLE 1 Mouse growth hormone values in pSK-GHRH injected mice and
controls (ng/ml) GH LacZ AvGHRH AvLacZ day 3 6.8 7.2 9 8.2 12 6.2
38 8.2 16.45 7.45 day 5 11 7.8 24 10 17.5 8.9 day 7 12 7.2 70 10 28
12 60 7.8 42.5 9.25 day 10 17 12.4 18 8 17.5 10.2 day 14 17 7.5 5.6
7.4 17.6 12 7.4 8.3 11.9 8.8 day 21 9 6.2 6.2 6.3 13 7.8 9.4
6.766667
[0277]
2TABLE II Identification of GHRH Sequences Bovine growth hormone
releasing hormone sequence SEQ ID NO.5 Tyr Ala Asp Ala Ile Phe Thr
Asn Ser Tyr Arg Lys 1 5 10 Val Leu Gly Gln Leu Ser Ala Arg Lys Leu
Leu Gln 15 20 Asp Ile Met Asn Arg Gln Gln Gly Glu Arg Asn Gln 25 30
35 Glu Gln Gly Ala Lys Val Arg Leu 40 Porcine growth hormone
releasing hormone sequence SEQ ID NO.6 Tyr Ala Asp Ala Ile Phe Thr
Asn Ser Tyr Arg Lys 1 5 10 Val Leu Gly Gln Leu Ser Ala Arg Lys Leu
Leu Gln 15 20 Asp Ile Met Ser Arg Gln Gln Gly Glu Arg Asn Gln 25 30
35 Glu Gln Gly Ala Arg Val Arg Leu 40 Ovine growth hormone
releasing hormone sequence SEQ ID NO.7 Tyr Ala Asp Ala Ile Phe Thr
Asn Ser Tyr Arg Lys 1 5 10 Ile Leu Gly Gln Leu Ser Ala Arg Lys Leu
Leu Gln 15 20 Asp Ile Met Asn Arg Gln Gln Gly Glu Arg Asn Gln 25 30
35 Glu Gln Gly Ala Lys Val Arg Leu 40 Mouse growth hormone
releasing hormone sequence SEQ ID NO.8 His Val Asp Ala Ile Phe Thr
Thr Asn Tyr Arg Lys 1 5 10 Leu Leu Ser Gln Leu Try Ala Arg Lys Val
Ile Gln 15 20 Asp Ile Met Asn Lys Gln Gly Glu Arg Ile Gln Glu 25 30
35 Gln Arg Ala Arg Leu Ser 40 Caprine growth hormone releasing
hormone sequence SEQ ID NO.9 Tyr Ala Asp Ala Ile Phe Thr Asn Ser
Tyr Arg Lys 1 5 10 Val Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln
15 20 Asp Ile Met Asn Arg Gln Gln Gly Glu Arg Asn Gln 25 30 35 Glu
Gln Gly Ala Lys Val Arg Leu 40 Human 1-40 OH growth hormone
releasing hormone sequence SEQ ID NO.10 Tyr Ala Asp Ala Ile Phe Thr
Asn Ser Tyr Arg Lys 1 5 10 Val Leu Gly Gln Leu Ser Ala Arg Lys Leu
Leu Gln 15 20 Asp Ile Met Ser Arg Gln Gln Gly Glu Ser Asn Gln 25 30
35 Glu Arg Gly Ala 40 Mouse/porcine chimeric growth hormone
releasing hormone sequence SEQ ID NO.11 His Val Asp Ala Ile Phe Thr
Thr Asn Tyr Arg Lys 1 5 10 Leu Leu Ser Gln Leu Ser Ala Arg Lys Leu
Leu Gln 15 20 Asp Ile Met Ser Arg Gln Gln Gly Glu Arg Asn Gln 25 30
35 Glu Gln Gly Ala Arg Val Arg Leu 40
[0278]
3TABLE III Comparison of GHRH Sequences of Table II SEQ ID NO.5:
Tyr Ala Asp Ala Ile Phe Thr Asn Ser Tyr Arg Lys Val SEQ ID NO.6:
Tyr Ala Asp Ala Ile Phe Thr Asn Ser Tyr Arg Lys Val SEQ ID NO.7:
Tyr Ala Asp Ala Ile Phe Thr Asn Ser Tyr Arg Lys Ile SEQ ID NO.8:
His Val Asp Ala Ile Phe Thr Thr Asn Tyr Arg Lys Leu SEQ ID NO.9:
Tyr Ala Asp Ala Ile Phe Thr Asn Ser Tyr Arg Lys Val SEQ ID NO.10:
Tyr Ala Asp Ala Ile Phe Thr Asn Ser Tyr Arg Lys Val SEQ ID NO.11:
His Val Asp Ala Ile Phe Thr Thr Asn Tyr Arg Lys 5 10 Leu SEQ ID
NO.5: Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp Ile SEQ ID
NO.6: Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp Ile SEQ ID
NO.7: Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp Ile SEQ ID
NO.8: Leu Ser Gln Leu Try Ala Arg Lys Val Ile Gln Asp Ile SEQ ID
NO.9: Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp Ile SEQ ID
NO.10: Leu Gly Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp Ile SEQ ID
NO.11: Leu Ser Gln Leu Ser Ala Arg Lys Leu Leu Gln Asp 15 20 25 Ile
SEQ ID NO.5: Met Asn Arg Gln Gln Gly Glu Arg Asn Gln Glu Gln Gly
SEQ ID NO.6: Met Ser Arg Gln Gln Gly Glu Arg Asn Gln Glu Gln Gly
SEQ ID NO.7: Met Asn Arg Gln Gln Gly Glu Arg Asn Gln Glu Gln Gly
SEQ ID NO.8: Met Asn Lys Gln Gly Glu Arg Ile Gln Glu Gln Arg Ala
SEQ ID NO.9: Met Asn Arg Gln Gln Gly Glu Arg Asn Gln Glu Gln Gly
SEQ ID NO.10: Met Ser Arg Gln Gln Gly Glu Ser Asn Gln Glu Arg Gly
SEQ ID NO.11: Met Ser Arg Gln Gln Gly Glu Arg Asn Gln Glu Gln 30 35
Gly Ala Lys Val Arg Leu SEQ ID NO.5: Ala Arg Val Arg Leu SEQ ID
NO.6: Ala Lys Val Arg Leu SEQ ID NO.7: Arg Leu Ser SEQ ID NO.8: Ala
Lys Val Arg Leu SEQ ID NO.9: Ala SEQ ID NO.10: Ala Arg Val Arg Leu
SEQ ID NO.11: 40
[0279] SEQ ID NO. 6: One skilled in the art will readily appreciate
that SEQ ID NO. 7: the present invention is well adapted to carry
out the objects SEQ ID NO. 8: and obtain the ends and advantages
mentioned as well as those SEQ ID NO. 9: inherent therein. The
vector systems along with the methods, SEQ ID NO. 10: procedures
treatments and vaccinations described herein are SEQ ID NO. 11:
presently representative of preferred embodiments are exemplary and
not intended as limitations on the scope of the invention. Changes
therein and other uses will occur to those skilled in the art which
are encompassed within the spirit of the invention or defined by
this scope with the claims.
[0280] It will be readily apparent to one skilled in the art that
varying substitutions and modifications may be made to the
invention disclosed herein within departing from the scope and
spirit of the invention.
[0281] All patents and publications mentioned in the specification
are indicative of the levels of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
* * * * *