U.S. patent application number 09/974546 was filed with the patent office on 2003-03-13 for biomarkers and targets for diagnosis, prognosis and management of prostate disease, bladder and breast cancer.
This patent application is currently assigned to UroCor, Inc.. Invention is credited to An, Gang, O'Hara, S. Mark, Ralph, David, Veltri, Robert.
Application Number | 20030050470 09/974546 |
Document ID | / |
Family ID | 22261997 |
Filed Date | 2003-03-13 |
United States Patent
Application |
20030050470 |
Kind Code |
A1 |
An, Gang ; et al. |
March 13, 2003 |
Biomarkers and targets for diagnosis, prognosis and management of
prostate disease, bladder and breast cancer
Abstract
Disclosed are diagnostic techniques for the detection of human
prostate, bladder and breast cancer. Genetic probes and methods
useful in monitoring the progression and diagnosis of prostate,
bladder and breast cancer are described. The invention relates
particularly to probes and methods for evaluating the presence of
RNA species that are differentially expressed in prostate, bladder
and breast cancer compared to normal human prostate, benign
prostatic hyperplasia, or normal bladder or breast tissue.
Inventors: |
An, Gang; (Oklahoma City,
OK) ; O'Hara, S. Mark; (Oklahoma City, OK) ;
Ralph, David; (Edmund, OK) ; Veltri, Robert;
(Oklahoma City, OK) |
Correspondence
Address: |
Gina N. Shishima
FULBRIGHT & JAWORSKI, L.L.P.
Ste. 1900
600 Congress Ave.
Austin
TX
78701
US
|
Assignee: |
UroCor, Inc.
800 Research Pkwy, #200
Oklahoma City
OK
73104-3699
|
Family ID: |
22261997 |
Appl. No.: |
09/974546 |
Filed: |
October 10, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09974546 |
Oct 10, 2001 |
|
|
|
09662270 |
Sep 14, 2000 |
|
|
|
09662270 |
Sep 14, 2000 |
|
|
|
09097199 |
Jun 12, 1998 |
|
|
|
6218529 |
|
|
|
|
09097199 |
Jun 12, 1998 |
|
|
|
08692787 |
Jul 31, 1996 |
|
|
|
5882864 |
|
|
|
|
Current U.S.
Class: |
536/24.3 ;
435/6.14 |
Current CPC
Class: |
C12Q 2600/112 20130101;
A61K 48/00 20130101; C07K 14/82 20130101; C12Q 1/6886 20130101;
C07K 14/47 20130101; C12Q 2600/158 20130101; C07H 21/00
20130101 |
Class at
Publication: |
536/24.3 ;
435/6 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
1. An isolated nucleic acid segment comprising a full length
sequence or the fill length complement of a sequence selected from
the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ
ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID NO:85.
2. An isolated nucleic acid molecule, of a size between about 14
and 100 bases in length, identical in sequence to a contiguous
portion of at least 14 bases of a nucleic acid or its complement
selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ
ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17,
SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID
NO:85.
3. The isolated nucleic acid molecule of claim 2, of a size of
between about 17 and 100 bases in length.
4. The isolated nucleic acid molecule of claim 2, of a size of
between about 20 and 100 bases in length.
5. The isolated nucleic acid molecule of claim 2, of a size of
between about 25 and 100 bases in length.
6. The isolated nucleic acid molecule of claim 2, of a size of
between about 30 and 100 bases in length.
7. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:1.
8. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:2.
9. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:3.
10. The isolated nucleic acid according to claim 1 wherein the
sequence is SEQ ID NO:4.
11. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:5.
12. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:10.
13. The isolated nucleic acid according to claim 1 wherein the
sequence is SEQ ID NO:11.
14. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO: 12.
15. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:13.
16. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:15.
17. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:16.
18. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:17.
19. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO: 19.
20. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:20.
21. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:21.
22. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:22.
23. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:23.
24. The isolated nucleic acid according to claim 1 wherein the
sequence is SEQ ID NO:45.
25. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:46.
26. The isolated nucleic acid according to claim 1 wherein the
sequence is SEQ ID NO:83.
27. The isolated nucleic acid according to claim 1, wherein the
sequence is SEQ ID NO:85.
28. An isolated polypeptide with an amino acid sequence encoded by
a polynucleotide having a sequence selected from a group consisting
of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5,
SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45 and SEQ ID
NO:46.
29. An isolated peptide, of a size between 10 and 50 amino acids in
length, with an amino acid sequence encoded within a polynucleotide
having a sequence selected from a group consisting of SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10,
SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ ID NO:23, SEQ ID NO:45 and SEQ ID NO:46.
30. A method for identifying markers for human prostate cancer,
comprising the following steps: a) providing human prostate RNAs;
b) amplifying said RNAs to provide nucleic acid amplification
products; c) separating said nucleic acid amplification products;
and d) identifying those RNAs that are differentially expressed
between human prostate cancers versus normal or benign human
prostate.
31. The method according to claim 30, further comprising converting
said RNAs into cDNAs using reverse transcriptase prior to
amplification.
32. The method according to claim 31, further comprising amplifying
the cDNAs by polymerase chain reaction (PCR) using arbitrarily
chosen oligonucleotide primers under initially reduced stringency
conditions.
33. The method according to claim 31, further comprising: a) using
one oligo dT anchoring primer and an arbitrarily chosen
oligonucleotide primer for the reverse transcription step; and b)
using an oligo dT anchoring primer and an arbitrarily chosen
oligonucleotide primer for the amplification step.
34. A method for detecting prostate cancer cells in a biological
sample comprising the step of detecting a prostate cancer marker in
said sample, wherein said prostate cancer marker is a nucleic acid
having a sequence selected from a group consisting of SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7,
SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12,
SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID
NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ
ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID NO: 85.
35. The method of claim 34, further comprising the steps of a)
providing nucleic acids from said sample; b) amplifying said
nucleic acids to form nucleic acid amplification products; c)
contacting said nucleic acid amplification products with an
oligonucleotide probe that will hybridize under stringent
conditions with said prostate cancer marker; d) detecting the
nucleic acid amplification products which hybridize with said
probe; and e) measuring the amount of said nucleic acid
amplification products that hybridize with said probe.
36. The method of claim 35, in which said oligonucleotide probe is
selected to bind specifically an isolated nucleic acid having a
sequence selected from a group consisting of SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22,
SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID
NO:85.
37. The method of claim 35, in which the sequence of said
oligonucleotide probe is selected to bind specifically to a nucleic
acid product of a known gene, said nucleic acid product selected
from a group consisting of cyclin A (SEQ ID NO:8), fibronectin (SEQ
ID NO:7), and a truncated form of Her2/neu (SEQ ID NO:9).
38. The method of claim 35, in which the sequence of said
oligonucleotide probe is selected to bind specifically to a
truncated nucleic acid product of the Her2/neu gene.
39. The method of claim 35, in which the sequence of said
oligonucleotide probe is selected to bind specifically to a nucleic
acid product of the cyclin A gene.
40. The method of claim 35, in which the sequence of said
oligonucleotide probe is selected to bind specifically to a nucleic
acid product of the fibronectin gene.
41. The method of claim 34, further comprising the steps of a)
providing nucleic acids from said sample; b) providing primers that
will selectively amplify said prostate cancer marker; c) amplifying
said nucleic acids with said primers to form nucleic acid
amplification products; d) detecting said nucleic acid
amplification products; and e) quantifying said nucleic acid
amplification products.
42. The method of claim 41, wherein said primers are selected to
amplify a nucleic acid having a sequence selected from a group
consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID
NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ
ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45,
SEQ ID NO:46, SEQ ID NO:83 and SEQ ID NO:85.
43. The method of claim 41, wherein said primers are selected to
amplify a nucleic acid product of a known gene, said nucleic acid
product selected from a group consisting of cyclin A, fibronectin,
and a truncated form of Her2/neu.
44. The method of claim 41, wherein said primers are selected to
amplify a truncated nucleic acid product of the Her2/neu gene.
45. The method of claim 41, wherein said primers are selected to
amplify a nucleic acid product of the cyclin A gene.
46. The method of claim 41, wherein said primers are selected to
amplify a nucleic acid product of the fibronectin gene.
47. The method of claim 41, further comprising determining the
prognosis of prostate cancer patients by quantifying the nucleic
acid amplification product binding to a probe specific for said
prostate cancer marker.
48. The method of claim 41, further comprising determining the
diagnosis of human prostate cancer by quantifying the nucleic acid
amplification product binding to a probe specific for said prostate
cancer marker.
49. The method of claim 41, further comprising determining the
prognosis of prostate cancer patients by quantifying the nucleic
acid amplification product.
50. The method of claim 41, further comprising determining the
diagnosis of human prostate cancer by quantifying the nucleic acid
amplification product.
51. A method of treating individuals with prostate cancer,
comprising the steps of: a) obtaining a sample of tissue from an
individual with prostate cancer; b) screening said sample for the
expression of a polypeptide encoded by a polynucleotide having a
sequence selected from a group consisting of SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22,
SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID
NO:85; c) providing an antibody that reacts immunologically against
said polypeptide; and d) administering an effective amount of said
antibody to an individual with prostate cancer.
52. A method of treating individuals with prostate cancer,
comprising the steps of: a) obtaining a sample of tissue from an
individual with prostate cancer; b) screening said sample for the
expression of a polynucleotide having a sequence selected from a
group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5,, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:83 and SEQ ID NO:85; c) providing an antisense DNA molecule that
encodes an RNA molecule that binds to said polynucleotide; d)
providing said antisense DNA molecule in the form of a human vector
containing appropriate regulatory elements for the production of
said RNA molecule; and e) administering an effective amount of said
vector to an individual with prostate cancer.
53. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) a primer pair for amplifying a
nucleic acid having a sequence selected from a group consisting of
SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5,
SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID
NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ
ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46,
SEQ ID NO:83 and SEQ ID NO:85; and (b) containers for each of said
primers.
54. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) a primer pair for amplifying a
nucleic acid product of a human gene, said nucleic acid product
selected from a group consisting of cyclin A, fibronectin, and a
truncated form of Her2/neu; and (b) containers for each of said
primers.
55. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) an oligonucleotide probe which
binds under high stringency conditions to an isolated nucleic acid
having a sequence selected from a group consisting of SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10,
SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83
and SEQ ID NO:85; and (b) a container for said probe.
56. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) an oligonucleotide probe which
binds under high stringency conditions to a nucleic acid product of
a human gene, said nucleic acid product selected from a group
consisting of cyclin A, fibronectin gene, and a truncated form of
Her2/neu; and (b) a container for said probe.
57. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) an antibody which binds
immunologically to a protein having an amino acid sequence encoded
by a nucleic acid sequence selected from a group consisting of SEQ
ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:83 and SEQ ID NO:85; and (b) a container for said antibody.
58. A method for detecting prostate cancer cells in biological
samples, comprising the following steps: (a) providing an antibody
that binds immunologically to a peptide, said peptide encoded by an
isolated nucleic acid selected from a group consisting of SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:83 and SEQ ID NO:85, cyclin A, fibronectin, and a truncated form
of Her2/neu; (b) contacting a human tissue sample with said
antibody; (c) separating antibody bound to said tissue sample from
unbound antibody; and (d) detecting the bound antibody.
59. A kit for use in detecting prostate cancer cells in a
biological sample, comprising: (a) an antibody which binds
immunologically to a polypeptide having an amino acid sequence
encoded by a nucleic acid selected from a group consisting of SEQ
ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:83 and SEQ ID NO:85, cyclin A, fibronectin, and a truncated form
of Her2/neu; and (b) a container for said antibody.
60. A method for treating individuals with prostate cancer,
comprising the following steps: (a) selecting a prostate cancer
marker from a group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ
ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23,
SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83, SEQ ID NO:85, cyclin A,
fibronectin, and a truncated form of Her2/neu; (b) providing an
inhibitor designed to bind specifically to the protein product of
said prostate cancer marker; and (c) administering an effective
dosage of said inhibitor to a prostate cancer patient.
61. An isolated nucleic acid segment useful as a marker of bladder
cancer or breast cancer and having a sequence or the full length
complement of a sequence selected from the group consisting of SEQ
ID NO:3, SEQ ID NO:83 and SEQ ID NO:85.
62. An isolated nucleic acid molecule, of a size between about 14
and 100 bases in length, identical in sequence to a contiguous
portion of at least 14 bases of a nucleic acid or its complement
selected from the group consisting of SEQ ID NO:3, SEQ ID NO:83 and
SEQ ID NO:85.
63. An isolated polypeptide with an amino acid sequence encoded by
a nucleic acid having a sequence selected from a group consisting
of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85.
64. An isolated peptide, of a size between 10 and 50 amino acids in
length, with an amino acid sequence encoded within a polynucleotide
having a sequence selected from a group consisting of SEQ ID NO:3,
SEQ ID NO:83 and SEQ ID NO:85.
65. A method for detecting bladder cancer or breast cancer cells in
a biological sample comprising the step of detecting a bladder
cancer or breast cancer marker in said sample, wherein said bladder
cancer or breast cancer marker is a nucleic acid having a sequence
selected from a group consisting of SEQ ID NO:3, SEQ ID NO:83 and
SEQ ID NO:85.
66. The method of claim 65, further comprising the steps of a)
providing nucleic acids from said sample; b) amplifying said
nucleic acids to form nucleic acid amplification products; c)
contacting said nucleic acid amplification products with an
oligonucleotide probe that will hybridize under stringent
conditions with said bladder cancer or breast cancer marker; d)
detecting the nucleic acid amplification products which hybridize
with said probe; and e) quantifying the nucleic acid amplification
products that hybridize with said probe.
67. The method of claim 65, further comprising the steps of a)
providing nucleic acids from said sample; b) providing primers that
will selectively amplify said bladder cancer or breast cancer
marker; c) amplifying said nucleic acids with said primers to form
nucleic acid amplification products; d) detecting said nucleic acid
amplification products; and e) quantifying said nucleic acid
amplification products.
68. The method of claim 65, further comprising determining the
prognosis of bladder cancer or breast cancer patients by
quantifying the nucleic acid amplification product binding to a
probe specific for said bladder cancer or breast cancer marker.
69. The method of claim 65, further comprising determining the
diagnosis of human bladder cancer or breast cancer by quantifying
the nucleic acid amplification product binding to a probe specific
for said bladder cancer or breast cancer marker.
70. The method of claim 65, further comprising determining the
prognosis of bladder cancer or breast cancer patients by
quantifying the nucleic acid amplification product.
71. The method of claim 65, further comprising determining the
diagnosis of human bladder cancer or breast cancer by quantifying
the nucleic acid amplification product.
72. A method of treating individuals with bladder cancer or breast
cancer, comprising the steps of: a) obtaining a sample of tissue
from an individual with bladder cancer or breast cancer; b)
screening said sample for the expression of a polypeptide encoded
by a polynucleotide having a sequence selected from a group
consisting of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85; c)
providing an antibody that reacts immunologically against said
polypeptide; and d) administering an effective amount of said
antibody to an individual with bladder cancer or breast cancer.
73. A method of treating a subject with bladder cancer or breast
cancer, comprising the steps of: a) obtaining a sample of tissue
from an individual with bladder cancer or breast cancer; b)
screening said sample for the expression of a polynucleotide having
a sequence selected from a group consisting SEQ ID NO:3, SEQ ID
NO:83 and SEQ ID NO:85; c) providing an antisense DNA molecule that
encodes an RNA molecule that binds to said polynucleotide; d)
providing said antisense DNA molecule in the form of a human vector
containing appropriate regulatory elements for the production of
said RNA molecule; and e) administering an effective amount of said
vector to an individual with bladder cancer or breast cancer.
74. A kit for use in detecting bladder cancer cells or breast
cancer cells in a biological sample, comprising: a) a primer pair
for amplifying a nucleic acid having a sequence selected from a
group consisting of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85; and
b) containers for each of said primers.
75. A kit for use in detecting bladder cancer cells or breast
cancer cells in a biological sample, comprising: a) an
oligonucleotide probe which binds under high stringency conditions
to an isolated nucleic acid having a sequence selected from a group
consisting of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85; and b) a
container for said probe.
76. A kit for use in detecting bladder cancer cells or breast
cancer cells in a biological sample, comprising: a) an antibody
which binds immunologically to a protein having an amino acid
sequence encoded by a polynucleotide having a sequence selected
from a group consisting of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID
NO:85; and b) a container for said antibody.
77. A method for detecting bladder cancer cells or breast cancer
cells in biological samples, comprising the following steps: a)
providing an antibody that binds immunologically to a polypeptide
encoded by an isolated nucleic acid selected from a group
consisting of SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85; b)
contacting a human tissue sample with said antibody; c) separating
antibody bound to said tissue sample from unbound antibody; and d)
detecting the bound antibody.
Description
[0001] The present application is a continuation-in-part of
co-pending U.S. patent application Ser. No. 08/692,787 filed Jul.
31, 1996. The entire text of the above-referenced disclosure is
specifically incorporated by reference herein without
disclaimer.
BACKGROUND OF THE INVENTION
[0002] A. Field of the Invention
[0003] The present invention relates generally to nucleic acid
sequences useful as probes for the diagnosis of cancer and methods
relating thereto. More particularly, the present invention concerns
probes and methods useful in diagnosing, identifying and monitoring
the progression of prostate cancer, benign prostatic hyperplasia,
bladder cancer or breast cancer through measurements of gene
products.
[0004] B. Description of the Related Art
[0005] Genetic detection of human disease states is a rapidly
developing field (Taparowsky et al., 1982; Slamon et al., 1989;
Sidransky et al., 1992; Miki et al., 1994; Dong et al., 1995;
Morahan et al., 1996; Lifton, 1996; Barinaga, 1996). However, some
problems exist with this approach. A number of known genetic
lesions merely predispose to development of specific disease
states. Individuals carrying the genetic lesion may not develop the
disease state, while other individuals may develop the disease
state without possessing a particular genetic lesion. In human
cancers, genetic defects may potentially occur in a large number of
known tumor suppresser genes and proto-oncogenes.
[0006] The genetic detection of cancer has a long history. One of
the earliest genetic lesions shown to predispose to cancer was
transforming point mutations in the ras oncogenes (Taparowsky et
al., 1982). Transforming ras point mutations may be detected in the
stool of individuals with benign and malignant colorectal tumors
(Sidransky et al., 1992). However, only 50% of such tumors
contained a ras mutation (Sidransky et al., 1992). Similar results
have been obtained with amplification of HER-2/neu in breast and
ovarian cancer (Slamon et al., 1989), deletion and mutation of p53
in bladder cancer (Sidransky et al., 1991), deletion of DCC in
colorectal cancer (Fearon et al., 1990) and mutation of BRCA1 in
breast and ovarian cancer (Miki et al., 1994).
[0007] None of these genetic lesions are capable of predicting a
majority of individuals with cancer and most require direct
sampling of a suspected tumor, making screening difficult.
[0008] Further, none of the markers described above are capable of
distinguishing between metastatic and non-metastatic forms of
cancer. In effective management of cancer patients, identification
of those individuals whose tumors have already metastasized or are
likely to metastasize is critical. Because metastatic cancer kills
560,000 people in the US each year (ACS home page), identification
of markers for metastatic cancer, such as metastatic prostate and
breast cancer, would be an important advance.
[0009] A particular problem in cancer detection and diagnosis
occurs with prostate cancer. Carcinoma of the prostate (PCA) is the
most frequently diagnosed cancer among men in the United States
(Veltri et al., 1996). Prostate cancer was diagnosed in
approximately 210,000 men in 1997 and about 39,000 men succumbed to
the malignancy (Parker et al., 1996; Wingo et al., 1997). The
American Cancer Society expects that more than 340,000 new cases of
prostate cancer will be diagnosed in 1998 (Orozco et al., 1998).
Although relatively few prostate tumors progress to clinical
significance during the lifetime of the patient, those which are
progressive in nature are likely to have metastasized by the time
of detection. Survival rates for individuals with metastatic
prostate cancer are quite low. Between these extremes are patients
with prostate tumors that will metastasize but have not yet done
so, for whom surgical prostate removal is curative. Determination
of which group a patient falls within is critical in determining
optimal treatment and patient survival.
[0010] The FDA approval of the serum prostate specific antigen
(PSA) test in 1984 has subsequently changed the way prostate
disease was managed (Allhoff et al., 1989; Cooner et al., 1990;
Jacobson et al., 1995; Orozco et al., 1998). PSA is widely used as
a serum biomarker to detect and monitor therapeutic response in
prostate cancer patients (Badalament et al., 1996; O'Dowd et al.,
1997). Several modifications in PSA assays (Partin and Oesterling,
1994; Babian et al., 1996; Zlotta et al., 1997) have resulted in
earlier diagnoses and improved treatment.
[0011] While an effective indicator of prostate cancer when serum
levels are relatively high, PSA serum levels are more ambiguous
indicators of prostate cancer when only modestly elevated, for
example when levels are between 2-10 ng/ml. At these modest
elevations, serum PSA may have originated from non-cancerous
disease states such as BPH (benign prostatic hyperplasia),
prostatitis or physical trauma (McCormack et al., 1995). Although
application of the lower 2.0 ng/ml cancer detection cutoff
concentration of serum PSA has increased the diagnosis of prostate
cancer, especially in younger men with non-palpable early stage
tumors (Stage Tlc) (Soh et al., 1997; Carter et al., 1997; Harris
et al., 1997; Orozco et al., 1998), the specificity of the PSA
assay for prostate cancer detection at low serum PSA levels remains
a problem.
[0012] In current clinical practice, the serum PSA assay and
digital rectal exam (DRE) is used to indicate which patients should
have a prostate biopsy (Lithrup et al., 1994; Orozco et al., 1998).
Histological examination of the biopsied tissue is used to make the
diagnosis of prostate cancer. Based upon the American Cancer
Society estimate of 340,000 cases of diagnosed prostate cancer in
1998 and a known cancer detection rate of about 35% (Parker et al.,
1996), it is estimated that in 1998 over one million prostate
biopsies will be performed in the United States (Orozco et al.,
1998). Clearly, there would be much benefit derived from a
serological test that was sensitive enough to detect small and
early stage prostate tumors that also had sufficient specificity to
exclude a greater portion of patients with noncancerous or
clinically insignificant conditions.
[0013] Several investigators have sought to improve upon the
specificity of serologic detection of prostate cancer by examining
a variety of other biomarkers besides serum PSA concentration
(Ralph and Veltri, 1997). One of the most heavily investigated of
these other biomarkers is the ratio of free versus total PSA (f/t
PSA) in a patient's blood. Most PSA in serum is in a molecular form
that is bound to other proteins such as .alpha.1-antichymotrypsin
(ACT) or .alpha.2-macroglobulin (Christensson et al., 1993; Stenman
et al., 1991; Lilja et al., 1991). Free PSA is not bound to other
proteins. The ratio of free to total PSA (f/tPSA) is usually
significantly higher in patients with BPH compared to those with
organ confined prostate cancer (Marley et al., 1996; Oesterling et
al., 1995; Pettersson et al., 1995). When an appropriate cutoff is
determined for the f/tPSA assay, the f/tPSA assay can help
distinguish patients with BPH from those with prostate cancer in
cases in which serum PSA levels are only modestly elevated (Marley
et al., 1996; Partin and Oesterling, 1996). Unfortunately, while
f/tPSA may improve on the detection of prostate cancer, information
in the f/tPSA ratio is insufficient to improve the sensitivity and
specificity of serologic detection of prostate cancer to desirable
levels.
[0014] Genetic changes reported to be associated with prostate
cancer include: allelic loss (Bova, et al., 1993; Macoska et al.,
1994; Carter et al., 1990); DNA hypermethylation (Isaacs et al.,
1994); point mutations or deletions of the retinoblastoma (Rb) and
p53 genes (Bookstein et al., 1990a; Bookstein et al., 1990b; Isaacs
et al., 1991); and aneuploidy and aneusomy of chromosomes detected
by fluorescence in situ hybridization (FISH) (Macoska et al., 1994;
Visakorpi et al., 1994; Takahashi et al., 1994; Alcaraz et al.,
1994).
[0015] A recent development in this field was the identification of
a prostate metastasis suppresser gene, KAI1 (Dong et al., 1995).
Insertion of wild-type KAI1 gene into a rat prostate cancer line
caused a significant decrease in metastatic tumor formation (Dong
et al., 1995). However, detection of KAI1 mutations is dependent
upon direct sampling of mutant prostate cells. Thus, either a
primary prostate tumor must be sampled or else sufficient
transformed cells must be present in blood, lymph nodes or other
tissues to detect the missing or abnormal gene. Further, the
presence of a deleted gene may frequently be masked by large
numbers of untransformed cells that may be present in a given
tissue sample.
[0016] The most commonly utilized current tests for prostate cancer
are digital rectal examination (DRE) and analysis of serum prostate
specific antigen (PSA). Although PSA has been widely used as a
clinical marker of prostate cancer since 1988 (Partin &
Oesterling, 1994), screening programs utilizing PSA alone or in
combination with digital rectal examination have not been
successful in improving the survival rate for men with prostate
cancer (Partin & Oesterling, 1994). While PSA is specific to
prostate tissue, it is produced by normal and benign as well as
malignant prostatic epithelium, resulting in a high false-positive
rate for prostate cancer detection (Partin & Oesterling,
1994).
[0017] Other markers that have been used for prostate cancer
detection include prostatic acid phosphatase (PAP) and prostate
secreted protein (PSP). PAP is secreted by prostate cells under
hormonal control (Brawn et al., 1996). It has less specificity and
sensitivity than does PSA. As a result, it is used much less now,
although PAP may still have some applications for monitoring
metastatic patients that have failed primary treatments. In
general, PSP is a more sensitive biomarker than PAP, but is not as
sensitive as PSA (Huang et al., 1993). Like PSA, PSP levels are
frequently elevated in patients with BPH as well as those with
prostate cancer.
[0018] Another serum marker associated with prostate disease is
prostate specific membrane antigen (PSMA) (Horoszewicz et al.,
1987; Carter et al., 1996; Murphy et al., 1996). PSMA is a Type II
cell membrane protein and has been identified as Folic Acid
Hydrolase (FAH) (Carter et al., 1996). Antibodies against PSMA
react with both normal prostate tissue and prostate cancer tissue
(Horoszewicz et al., 1987). Murphy et al. (1995) used ELISA to
detect serum PSMA in advanced prostate cancer. As a serum test,
PSMA levels are a relatively poor indicator of prostate cancer.
However, PSMA may have utility in certain circumstances. PSMA is
expressed in metastatic prostate tumor capillary beds (Silver et
al., 1997) and is reported to be more abundant in the blood of
metastatic cancer patients (Murphy et al., 1996). PSMA messenger
RNA (mRNA) is down-regulated 8-10 fold in the LNCAP prostate cancer
cell line after exposure to 5-.alpha.-dihydroxytestosterone (DHT)
(Israeli et al., 1994).
[0019] A relatively new potential biomarker for prostate cancer is
human kallekrein 2 (HK2) (Piironen et al., 1996). HK2 is a member
of the kallekrein family that is secreted by the prostate gland. In
theory, serum concentrations of HK2 may be of utility in prostate
cancer detection or diagnosis, but the usefulness of this marker is
still being evaluated.
[0020] As prostate cancer is one of the most prevalent forms of
cancer in men, breast cancer is one of the most prevalent forms of
cancer in women. Breast cancer is the leading cause of death for
women between 30-50 years of age in the United States. Pathological
breast cancer staging (tumor size, nodal status) is still the most
reliable method for predicting outcome. In contrast to other forms
of cancer, only a few tumor markers have been identified for breast
cancer (e.g., estrogen receptor, progesterone receptor, S-phase,
P53, Erb-2, cathepsin D) (see, e.g. Slamon et al., 1987).
[0021] Mutational analysis of important tumor suppressor genes such
as p53 (Elledge, 1994) and BRCA1 (Miki et al., 1994) has recently
been introduced as a diagnostic and prognostic test for breast
cancer. However, many of those markers are not reliable enough to
be used for routine purposes in the clinic. Two tumor suppressor
genes that are mutated in a number of other cancers (Rb and p53)
show a frequency of mutation of only about 30% in breast cancer
(Cox et al., 1994). Mutations in the recently identified breast
cancer susceptibility genes BRCA1 (chromosome 17q21) and BRCA2
(chromosome 13q13) are associated with familial breast cancer,
accounting for about 5% of total breast cancer cases, but have not
been found in sporadic breast cancer (Stratton and Wooster, 1996).
There has yet to be found a single genetic change that accounts for
the majority of sporadic breast cancers. Therefore, there is an
urgent need for better prognostic markers in breast cancer
diagnosis.
[0022] It is known that the processes of transformation and tumor
progression are associated with changes in the levels of messenger
RNA species (Slamonet al., 1984; Sager et al., 1993; Mok et al.,
1994; Watson et al., 1994). Recently, a variation on PCR analysis
known as RNA fingerprinting has been used to identify messages
differentially expressed in ovarian or breast carcinomas (Liang et
al., 1992; Sager et al., 1993; Mok et al., 1994; Watson et al.,
1994). By using arbitrary primers to generate "fingerprints" from
total cell RNA, followed by separation of the amplified fragments
by high resolution gel electrophoresis, it is possible to identify
RNA species that are either up-regulated or down-regulated in
cancer cells. Results of these studies indicated the presence of
several markers of potential utility for diagnosis of breast or
ovarian cancer, including a6-integrin (Sager et al., 1993), DEST001
and DEST002 (Watson et al., 1994), and LF4.0 (Mok et al.,
1994).
[0023] There remain, however, deficiencies in the prior art with
respect to the identification of the genes linked with the
progression of prostate, bladder or breast cancer and the
development of diagnostic methods to monitor disease progression.
Likewise, the identification of genes which are differentially
expressed in prostate, bladder, breast and other forms of cancer
would be of considerable importance in the development of a rapid,
inexpensive method to diagnose cancer.
SUMMARY OF THE INVENTION
[0024] The present invention addresses deficiencies in the prior
art by identifying and characterizing RNA species that are
differentially expressed in human prostate disease, bladder cancer
or breast cancer, along with providing methods for identifying such
RNA species. These RNA species and the corresponding encoded
protein species have utility, for example, as markers of prostate
cancer, benign prostatic hyperplasia (BPH), bladder cancer or
breast cancer, and as targets for therapeutic intervention in
prostate cancer, BPH, bladder cancer or breast cancer. The
disclosed methods may also be applied to other tissues in order to
identify differentially expressed genes that are markers of
different physiological states of that tissue.
[0025] The identified markers of prostate cancer, BPH, bladder
cancer or breast cancer can in turn be used to design specific
oligonucleotide probes and primers. When used in combination with
nucleic acid hybridization and amplification procedures, these
probes and primers permit the rapid analysis of prostate, bladder
or breast biopsy core specimens, serum samples, etc. This will
assist physicians in diagnosing prostate disease, bladder cancer or
breast cancer, and in determining optimal treatment courses for
individuals with bladder cancer, breast cancer or with prostate
tumors of varying malignancy. The same probes and primers may also
be used for in situ hybridization or in situ PCR detection and
diagnosis of prostate cancer, BPH, bladder cancer or breast
cancer.
[0026] The identified markers of prostate cancer, BPH, bladder
cancer or breast cancer may also be used to identify and isolate
full length gene sequences, including regulatory elements for gene
expression, from genomic human DNA libraries. The cDNA sequences
identified in the present invention are first used as hybridization
probes to screen genomic human DNA libraries by standard
techniques. Once partial genomic clones have been identified,
full-length genes are isolated by "chromosomal walking" (also
called "overlap hybridization"). See, Chinault & Carbon
"Overlap Hybridization Screening: Isolation and Characterization of
Overlapping DNA Fragments Surrounding the LEU2 Gene on Yeast
Chromosome III." Gene 5: 111-126, 1979. Nonrepetitive sequences at
or near the ends of the partial genomic clones are then used as
hybridization probes in further genomic library screening,
ultimately allowing the isolation of entire gene sequences for the
cancer markers of interest. Those experienced in the art will
realize that full length genes may be obtained using the small
expressed sequence tags (ESTs) described herein using technology
currently available (Sambrook et al., 1989; Chinault & Carbon,
1979), as illustrated in Example 5 of the instant application.
[0027] The identified markers may also be used to identify and
isolate cDNA sequences. In the practice of this method, the EST
sequences identified in the present disclosure are used as
hybridization probes to screen human cDNA libraries by standard
techniques. In a preferred practice, a high quality human cDNA
library is obtained from commercial or other sources. The library
is plated on, for example, agarose plates containing nutrients,
antibiotics and other standard ingredients. Individual colonies are
transferred to nylon or nitrocellulose membranes and the EST probes
are hybridized to complementary sequences on the membranes.
Hybridization is detected by radioactive or enzyme-linked tags
associated with the hybridized probes. Positive colonies are grown
up and sequenced by, for example, dideoxy nucleotide sequencing or
similar methods well known in the art. Comparison of cloned cDNA
sequences with known human or animal cDNA or genomic sequences is
performed using computer programs and databases well known to the
skilled practitioner.
[0028] In one embodiment of the present invention, the isolated
nucleic acids of the present invention are incorporated into
expression vectors and expressed as the encoded proteins or
peptides. Such proteins or peptides may in certain embodiments be
used as antigens for induction of monoclonal or polyclonal antibody
production.
[0029] One aspect of the present invention is thus, oligonucleotide
hybridization probes and primers that hybridize selectively to
specific markers of prostate cancer, BPH, bladder cancer or breast
cancer. These probes and primers are selected from those sequences
designated herein as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ
ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20,
SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID
NO:46, SEQ ID NO:47, SEQ ID NO:83 and SEQ ID NO:85. Probes and
primers selected from those sequences designated herein as SEQ ID
NO:3, SEQ ID NO:83 and SEQ ID NO:85 are preferred in hybridization
to markers of prostate disease, bladder cancer or breast cancer.
The availability of probes and primers specific for such unique
markers provides the basis for diagnostic kits useful for
distinguishing between BPH, prostate organ confined cancer and
prostate tumors with potential for metastatic progression.
Alternatively, the availability of probes and primers that
hybridize to one or more markers of breast cancer, bladder cancer
or prostate disease provide the basis for diagnostic kits useful in
the detection of breast cancer, bladder cancer or prostate
disease.
[0030] In one broad aspect, the present invention encompasses kits
for use in detecting prostate cancer, BPH, bladder cancer or breast
cancer cells in a biological sample. Such a kit may comprise one or
more pairs of primers for amplifying nucleic acids corresponding to
one or more prostate cancer, BPH, bladder cancer or breast cancer
marker genes. The kit may further comprise samples of total mRNA
derived from tissue of various physiological states, such as
normal, BPH, confined tumor and metastatically progressive tumor,
for example, to be used as controls. The kit may also comprise
buffers, nucleotide bases, and other compositions to be used in
hybridization and/or amplification reactions. Each solution or
composition may be contained in a vial or bottle and all vials held
in close confinement in a box for commercial sale. Another
embodiment of the present invention encompasses a kit for use in
detecting prostate, bladder or breast cancer cells in a biological
sample comprising oligonucleotide probes effective to bind with
high affinity to markers of prostate disease, bladder cancer or
breast cancer, in a Northern blot assay and containers for each of
these probes. In a further embodiment, the invention encompasses a
kit for use in detecting prostate cancer, BPH, bladder cancer or
breast cancer cells in a biological sample comprising antibodies
specific for proteins encoded by the nucleic acid markers of
prostate cancer, BPH, bladder cancer or breast cancer, identified
in the present invention.
[0031] In one broad aspect, the present invention encompasses
methods for treating prostate cancer patients by administration of
effective amounts of antibodies specific for the peptide products
of prostate cancer markers identified herein, or by administration
of effective amounts of vectors producing anti-sense messenger RNAs
that bind to the nucleic acid products of prostate cancer markers,
thereby inhibiting expression of the protein products of prostate
cancer marker genes. In another broad aspect, the present invention
encompasses methods for treating breast or bladder cancer patients
by administration of effective amounts of antibodies specific for
the peptide products of breast or bladder cancer markers identified
herein, or by administration of effective amounts of vectors
producing anti-sense messenger RNAs that bind to the nucleic acid
products of breast or bladder cancer markers, thereby inhibiting
expression of the protein products of breast or bladder cancer
marker genes. Antisense nucleic acid molecules may also be provided
as RNAs, as some stable forms of RNA with a long half-life that may
be administered directly without the use of a vector are now known
in the art. In addition, DNA constructs may be delivered to cells
by liposomes, receptor mediated transfection and other methods
known in the art. The method of delivery does not, in and of
itself, constitute the present invention, but it is the delivery of
an agent that will inhibit or disrupt expression of the targeted
mRNAs as defined herein that constitute a critical step of this
embodiment of the invention. Therefore, delivery of those agents,
by any means known in the art would be encompassed by the present
claims.
[0032] One aspect of the present invention is novel isolated
nucleic acid segments that are useful as described herein as
hybridization probes and primers that specifically hybridize to
prostate cancer, BPH, bladder cancer or breast cancer markers.
These disease markers, including both known genes and previously
undescribed genes, are described herein as those mRNA species shown
to be differentially expressed (either up- or down-regulated) in a
prostate cancer, BPH, bladder cancer or breast cancer state as
compared to a normal prostate, bladder or breast tissue. The novel
isolated segments are designated herein as SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:17, SEQ ID NO:19,SEQ ID NO:20,SEQ ID NO:21,SEQ ID NO:22,SEQ
ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID
NO:85. The invention further comprises an isolated nucleic acid of
between about 14 and about 100 bases in length, either identical to
or complementary to a portion of the same length occurring within
the disclosed sequences.
[0033] The present invention comprises proteins and peptides with
amino acid sequences encoded by the aforementioned isolated nucleic
acid segments. The invention also comprises methods for identifying
biomarkers for prognostic or diagnostic assays of human prostate
cancer, BPH, bladder cancer or breast cancer, using the techniques
of RNA fingerprinting to identify RNAs that are differentially
expressed between prostate, bladder or breast cancers versus normal
or benign tissues of the same origin. Such fngerprinting techniques
may utilize an oligo dT primer and an arbitrary primer, an oligo dT
primer alone or random hexamers or any other method known in the
art.
[0034] The invention further comprises methods for detecting
prostate, bladder or breast cancer cells in biological samples,
using hybridization primers and probes designed to specifically
hybridize to prostate, bladder or breast cancer markers. The
hybridization probes are identified and designated herein as SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ
ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22,
SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID
NO:85. This method further comprises measuring the amounts of
nucleic acid amplification products formed when primers selected
from the designated sequences are used.
[0035] The invention further comprises the prognosis and/or
diagnosis of prostate, bladder or breast cancer by measuring the
amounts of nucleic acid amplification products formed as above. The
invention comprises methods of treating individuals with prostate,
bladder or breast cancer by providing effective amounts of
antibodies and/or antisense DNA molecules which bind to the
products of the above mentioned isolated nucleic acids. Preferred
methods of prognosis and/or diagnosis of breast cancer utilize
nucleic acid amplification products formed from the sequences
designated as SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85 and
methods of treating individuals with breast cancer comprise
providing effective amounts of antibodies and/or antisense DNA
molecules which bind to the products of SEQ ID NO:3, SEQ ID NO:83
and SEQ ID NO:85. The invention further comprises kits for
performing the above-mentioned procedures, containing antibodies,
amplification primers and/or hybridization probes.
[0036] The present invention further comprises production of
antibodies specific for proteins or peptides encoded by SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID
NO:83 and SEQ ID NO:85, and the use of those antibodies for
diagnostic applications in detecting prostate, bladder or breast
cancer. The production of antibodies specific for proteins or
peptides encoded by SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85 is
preferred in the use of those antibodies for diagnostic
applications in detecting bladder cancer or breast cancer. The
invention further comprises therapeutic treatment of prostate,
bladder or breast cancer by administration of effective doses of
inhibitors specific for the aforementioned encoded proteins.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1. Normalized quantitative RT-PCR of UC Band #25 (SEQ
ID NO:1) shows that it is overexpressed in prostate cancers and
benign prostate compared with normal prostate tissues. The levels
are particularly high in metastatic prostate cancer. N=normal
prostate, B=benign prostatic hyperplasia (BPH), NB=needle core
biopsy of prostate cancer, T=primary prostate cancer, LM=metastatic
lymph node prostate cancer, NC=negative control.
[0038] FIG. 2. Normalized quantitative RT-PCR of UC Band #27 (SEQ
ID NO:2) shows that it is elevated in prostate cancers compared
with normal or benign prostates. N=normal prostate, B=benign
prostatic hyperplasia (BPH), NB=needle core biopsy of prostate
cancer, T=primary prostate cancer, LM=metastatic lymph node
prostate cancer, NC=negative control.
[0039] FIG. 3. Normalized quantitative RT-PCR of UC Band #28 (SEQ
ID NO:3) shows that it is elevated in prostate cancers,
particularly in metastatic prostate cancer, compared with normal or
benign prostates. N=normal prostate, B=benign prostatic hyperplasia
(BPH), NB=needle core biopsy of prostate cancer, T=primary prostate
cancer, LM=metastatic lymph node prostate cancer, NC=negative
control.
[0040] FIG. 4. Normalized quantitative RT-PCR of UC Band #31 (SEQ
ID NO:4) shows that it is overexpressed in benign and malignant
prostate compared with normal prostate. N=normal prostate, B=benign
prostatic hyperplasia (BPH), NB=needle core biopsy of prostate
cancer, T=primary prostate cancer, LM=metastatic lymph node
prostate cancer, NC=negative control.
[0041] FIG. 5. Normalized quantitative RT-PCR of a sequence from
the human fibronectin gene (SEQ ID NO:7) shows that it is down
regulated in BPH and prostate cancer compared with normal prostate.
N=normal prostate, B=benign prostatic hyperplasia (BPH), NB=needle
core biopsy of prostate cancer, T=primary prostate cancer,
LM=metastatic lymph node prostate cancer, NC=negative control.
[0042] FIG. 6. Normalized quantitative RT-PCR of UC Band #33 (SEQ
ID NO:5) shows that it is overexpressed in prostate cancers
compared with normal or benign prostate. N=normal prostate,
B=benign prostatic hyperplasia (BPH), NB=needle core biopsy of
prostate cancer, T primary prostate cancer, LM=metastatic lymph
node prostate cancer, NC=negative control.
[0043] FIG. 7. Quantitative RT-PCR of TGF-.beta.1 shows that it is
overexpressed in prostate cancer compared to benign prostatic
hyperplasia. N=normal prostate, B=benign prostatic hyperplasia
(BPH), NB=needle core biopsy of prostate cancer, T=primary prostate
cancer, LM=metastatic lymph node prostate cancer, NC=negative
control.
[0044] FIG. 8. Quantitative RT-PCR of Cyclin A (SEQ ID NO:8) shows
that it is overexpressed in prostate cancer compared to normal
prostate and benign prostatic hyperplasia. N=normal prostate,
B=benign prostatic hyperplasia (BPH), NB=needle core biopsy of
prostate cancer, T=primary prostate cancer, LM=metastatic lymph
node prostate cancer, NC=negative control.
[0045] FIG. 9. Oligonucleotides used in RT-PCR investigations of
Her2/neu and a truncated form of Her2/neu. The binding sites for
PCR primers are marked as P1 (Neu5'), P2 (Neu3') and P5 (Neu3').
The truncated form of Her2/neu also contains the P1 binding site.
The regions within the Her2/neu coding sequence are: ECD
(extracellular domain), MD (membrane domain), and ICD
(intracellular domain).
[0046] FIG. 10. Normalized quantitative RT-PCR for the full length
Her2/neu transcript shows that it is overexpressed in prostate
cancers compared to normal prostate and benign prostatic
hyperplasia. N=normal prostate, B=benign prostatic hyperplasia
(BPH), NB=needle core biopsy of prostate cancer, T=primary prostate
cancer, LM=metastatic lymph node prostate cancer, NC=negative
control.
[0047] FIG. 11. Normalized quantitative RT-PCR for the truncated
form of the Her2/neu transcript (SEQ ID NO:9) shows that it is
overexpressed in prostate cancers compared to normal prostate and
benign prostatic hyperplasia. N=normal prostate, B=benign prostatic
hyperplasia (BPH), NB=needle core biopsy of prostate cancer,
T=primary prostate cancer, LM=metastatic lymph node prostate
cancer, NC=negative control.
[0048] FIG. 12. Amplification of .beta.-actin cDNA from 25 cDNAs
synthesized from various prostate tissues. The physiological states
of these tissues, being either normal prostates, glands with BPH or
prostate tumors are given in Table 2. Also shown are molecular
weight markers displayed as "ladders" and three isolated bands
representing the PCR products from pools of (left to right) normal,
BPH and prostate cancers.
[0049] FIG. 13 Amplification of a cDNA fragment derived from the
Hek (UC205) mRNA in the individual prostate cancers described in
Table 2. Many, but not all, prostate glands with BPH are seen to
have higher levels of expression of Hek than seen in a pool of
normal glands. Examination of a gel also indicated that some of the
PCRs are not in the linear phase of their amplification curves.
Data was captured on the IS1000 and normalized as described in
Table 2.
[0050] FIG. 14. Amplification of Hek Using Pooled cDNAs normalized
by .beta.-actin. Pools of cDNAs synthesized from either normal
prostates (N), prostate glands with BPH (B) or prostate tumors (C)
were used as templates for .beta.-actin cDNA amplification. Four
identical sets of PCRs were set up. These were stopped and examined
after differing numbers of PCR cycles. The data for the 22 cycles
were numerically captured by the IS1000 and used to derive
normalizing statistics. The normalizing statistics are obtained by
dividing the average intensity of the three captured bands by the
value of the three bands separately. These normalizing statistics
were then used to normalize the data obtained from the mRNA of Hek
(UC205). Hek mRNA is more abundant in the BPH and prostate cancer
pools than in the pool of normal prostates. At 34 and 37 cycles,
the PCRs for the BPH and cancer pools are observed in the linear
phase of their amplification curves. The data was normalized to the
.beta.-actin data.
[0051] FIG. 15. Normalized quantitative RT-PCR of UC 28 in breast,
colon, and lung cancers. UC 28 (SEQ ID NO:3) is overexpressed in
breast cancer compared to normal tissue, but not overexpressed in
colon and lung cancer.
[0052] FIG. 16. Differential expression of UC 28 in bladder cancer.
Expression of UC 28 was examined in four normal bladder tissues and
five bladder cancer tissues by relative quantitative RT-PCR using
.beta.-actin as a control for normalization.
[0053] FIG. 17. Stimulation of UC 28 gene expression by
Dihydrotestosterone (DHT). LnCaP cells were cultured in RPMI-1640
with 10% charcoal stripped serum for 48 hours prior to treatment.
The cells were incubated in DHT for 24 hours. RT-PCR of the UC 28
gene message showed increasing UC 28 message level in LnCaP cells
incubated in increasing concentrations (0, 0.1, 1, 10, and 100 nM)
of DHT. RT-PCR message was normalized to .beta.-actin.
[0054] FIG. 18. Differential expression of UC 28 in prostate cancer
by relative quantitative RT-PCR. Expression of UC 28 was examined
in pooled samples of normal prostate tissues compared to individual
BPH and prostate cancer samples.
[0055] FIG. 19. Determination of copy number of UC 28 by human
genomic DNA Southern analyses. Genomic human DNA was digested with
either Eco RI or Hind III and labeled with a UC 28 specific probe.
A single band was observed with each restriction endonuclease.
[0056] FIG. 20. Localization of the UC 28 gene to human chromosome
6q23-24 by FISH chromosome mapping.
DETAILED DESCRIPTION OF THE INVENTION
[0057] The present invention concerns the early detection,
diagnosis, prognosis and treatment of bladder or breast cancer or
prostate diseases, such as prostate cancer or benign prostatic
hyperplasia (BPH). Markers of prostate disease, bladder cancer or
breast cancer, in the form of nucleic acid sequences isolated from
human prostate tumors or prostate cancer cell lines are disclosed.
These markers are indicators of malignant transformation of
prostate, bladder or breast tissues and are diagnostic of the
potential for metastatic spread of malignant prostate tumors.
[0058] Those skilled in the art will realize that the nucleic acid
sequences disclosed herein will find utility in a variety of
applications in prostate, bladder or breast cancer detection,
diagnosis, prognosis and treatment. Examples of such applications
within the scope of the present invention comprise amplification of
one or more markers of prostate disease, bladder cancer or breast
cancer, using specific primers; detection of markers of prostate
disease, bladder cancer or breast cancer, by hybridization with
oligonucleotide probes; incorporation of isolated nucleic acids
into vectors; expression of RNA, peptides or polypeptides from the
vectors; development of immunologic reagents corresponding to
marker encoded products; and therapeutic treatments of prostate,
bladder or breast cancer using antibodies, anti-sense nucleic
acids, or other inhibitors specific for the identified prostate,
bladder or breast cancer markers.
[0059] A. Nucleic Acids
[0060] As described herein, an aspect of the present disclosure is
26 markers of prostate disease, including one gene marker for
prostate disease, bladder cancer and breast cancer, identified by
RNA fingerprinting or quantitative RT-PCR. These include 20
previously unknown gene products, including the gene marker for
prostate, bladder and breast cancer, as well as nucleic acid
products of the PAP, fibronectin and cyclin A genes and a truncated
nucleic acid product of the Her2/neu gene. The latter three gene
products have been identified in other forms of cancer, but the
present invention is the first report of overexpressionin prostate
cancer.
[0061] The SEQ ID NOs corresponding to the identified markers are
listed below.
1 UC 25 SEQ ID NO:1 UC 27 SEQ ID NO:2 UC 28 SEQ ID NO:3, SEQ ID
NO:83, SEQ ID NO:85 UC 31 SEQ ID NO:4 UC 32 SEQ ID NO:7
(fibronectin) UC 33 SEQ ID NO:5 Cyclin A SEQ ID NO:8 truncated neu
SEQ ID NO:9 UC 38 SEQ ID NO:10 UC 40 SEQ ID NO:11 UC 41 SEQ ID
NO:12 UC 43 SEQ ID NO:19 UC 47 SEQ ID NO:47 (prostatic acid
phosphatase) UC 201 SEQ ID NO:13 UC 204 SEQ ID NO:20 UC 205 SEQ ID
NO:14 (Hek) UC 207 SEQ ID NO:15 UC 209 SEQ ID NO:16 UC 210 SEQ ID
NO:17 UC 211 SEQ ID NO:21 UC 212 SEQ ID NO:22 UC 213 SEQ ID NO:23
UC 214 SEQ ID NO:45 UC 215 SEQ ID NO:46
[0062] The biomarkers, primers and amino acid sequences
corresponding to each SEQ ID NO are identified below (first number
of each column is SEQ ID NO).
2 1. UC 25 30. UC 27 primer 60 55. UC 28 ISH probe 2. UC 27 31. UC
27 primer 56. UC 28 3. UC 28 32. UC 28 primer antigenic peptide 4.
UC 31 33. UC 28 primer 57. UC 43 primer 5. UC 33 35 34. UC 31
primer 58. UC 43 primer 6. UC 214 primer 35. UC 31 primer 65 59. UC
47 primer 7. UC 32 36. UC 32 primer 60. UC 47 primer fibronectin 8.
Cyclin A 37. UC 32 primer 61. UC 201 primer 9. Truncated NEU 38. UC
33 primer 62. UC 201 primer 10. UC 38 40 39. UC 33 primer 63. UC
204 primer 11. UC 40 40. .beta.-Actin primer 70 64. UC 204 primer
12. UC 41 41. .beta.-Actin primer 65. UC 205 primer 13. UC 201 42.
5' primer 66. UC 205 primer 14. UC 205 UC 28 mRNA 67. UC 207 primer
(human HEK) 45 43. 3' primer 68. UC 207 primer 15. UC 207 UC 28 2.1
75 69. UC 209 primer kb mRNA 16. UC 209 44. NEU T3' 70. UC 209
primer primer 17. UC 210 45. UC 214 71. UC 210 primer 18. UC 214
primer 46. UC 215 72. UC 210 primer 19. UC 43 50 47. UC 47 73. UC
211 primer (prostatic 20. UC 204 acid 80 74. UC 211 primer
phosphatase) 21. UC 211 48. Amino acid 75. UC 212 primer 22. UC 212
sequence of 76. UC 212 primer UC 47 23. UC 213 49. UC 38 primer 77.
UC 213 primer 24. UC 215 primer 55 50. UC 38 primer 78. UC 213
primer 25. UC 215 primer 51. UC 40 primer 85 79. PSA primer 26.
cyclin A primer 52. UC 40 primer 80. PSA primer 27. cyclin A primer
53. UC 41 primer 81. .beta.-Actin primer 28. UC 25 primer 54. UC 41
primer 82. .beta.-Actin primer 29. UC 25 primer 83. UC 28 85. UC 28
87. primer UC 28 2.5 kb 84. UC 28 amino 5 86. UC 28 amino mRNA acid
sequence acid sequence
[0063] In one embodiment, the nucleic acid sequences disclosed
herein will find utility as hybridization probes or amplification
primers. These nucleic acids may be used, for example, in
diagnostic evaluation of tissue samples or employed to clone full
length cDNAs or genomic clones corresponding thereto. In certain
embodiments, these probes and primers consist of oligonucleotide
fragments. Such fragments should be of sufficient length to provide
specific hybridization to a RNA or DNA tissue sample. The sequences
typically will be 10-20 nucleotides, but may be longer. Longer
sequences, e.g., 40, 50, 100,500 and even up to full length, are
preferred for certain embodiments.
[0064] Nucleic acid molecules having contiguous stretches of about
10, 15, 17, 20, 30, 40, 50, 60, 75 or 100 or 500 nucleotides from a
sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ
ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:45, SEQ ID NO:46, SEQ ID NO:83 and SEQ ID NO:85 are
contemplated. Molecules that are complementary to the above
mentioned sequences and that bind to these sequences under high
stringency conditions also are contemplated. These probes will be
useful in a variety of hybridization embodiments, such as Southern
and Northern blotting. In some cases, it is contemplated that
probes may be used that hybridize to multiple target sequences
without compromising their ability to effectively diagnose
cancer.
[0065] Various probes and primers can be designed around the
disclosed nucleotide sequences. Primers may be of any length but,
typically, are 10-20 bases in length. By assigning numeric values
to a sequence, for example, the first residue is 1, the second
residue is 2, etc., an algorithm defining all primers can be
proposed:
[0066] n to n+y
[0067] where n is an integer from 1 to the last number of the
sequence and y is the length of the primer minus one (9 to 19),
where n+y does not exceed the last number of the sequence. Thus,
for a 10-mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to
12 . . . and so on. For a 15-mer, the probes correspond to bases 1
to 15, 2 to 16, 3 to 17 . . . and so on. For a 20-mer, the probes
correspond to bases 1 to 20, 2 to 21, 3 to 22 . . . and so on.
[0068] The values of n in the algorithm above for each of the
nucleic acid sequences is: SEQ ID NO:1, n=391; SEQ ID NO:2, n=614;
SEQ ID NO:3, n=757; SEQ ID NO:4, n=673; SEQ ID NO:5, n--358; SEQ ID
NO:10, n=166; SEQ ID NO:11, n=107; SEQ ID NO:12, n=183; SEQ ID
NO:13, n=92; SEQ ID NO:15, n--174; SEQ ID NO:16, n=132; SEQ ID
NO:17, n--135; SEQ ID NO:19, n=471; SEQ ID NO:20, n=209, SEQ ID
NO:21, n=407, SEQ ID NO:22, n=267, SEQ ID NO:23, n=333, SEQ ID
NO:45, n=369, SEQ ID NO:46, n=301, SEQ ID NO:83, n=2087, SEQ ID
NO:85, n=2505.
[0069] In certain embodiments, it is contemplated that multiple
probes may be used for hybridization to a single sample. For
example, a truncated form of Her2/neu could be detected by probing
human tissue samples with oligonucleotides specific for the 5' and
3' ends of the full-length Her2/neu transcript. A full-length
Her2/neu transcript would bind both probes, while a truncated form
of the Her2/neu transcript, indicative of transformed cells, would
bind to the 5' probe but not to the 3' probe.
[0070] The use of a hybridization probe of between 14 and 100
nucleotides in length allows the formation of a duplex molecule
that is both stable and selective. Molecules having complementary
sequences over stretches greater than 20 bases in length are
generally preferred, in order to increase stability and selectivity
of the hybrid, and thereby improve the quality and degree of
particular hybrid molecules obtained. One will generally prefer to
design nucleic acid molecules having stretches of 20 to 30
nucleotides, or even longer where desired. Such fragments may be
readily prepared by, for example, directly synthesizing the
fragment by chemical means or by introducing selected sequences
into recombinant vectors for recombinant production.
[0071] Accordingly, the nucleotide sequences of the invention may
be used for their ability to selectively form duplex molecules with
complementary stretches of genes or RNAs or to provide primers for
amplification of DNA or RNA from tissues. Depending on the
application envisioned, one will desire to employ varying
conditions of hybridization to achieve varying degrees of
selectivity of probe towards target sequence.
[0072] For applications requiring high selectivity, one will
typically desire to employ relatively stringent conditions to form
the hybrids, e.g., one will select relatively low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.10 M NaCl at temperatures of about 50.degree. C. to about
70.degree. C. Such high stringency conditions tolerate little, if
any, mismatch between the probe and the template or target strand,
and would be particularly suitable for isolating specific genes or
detecting specific mRNA transcripts. It is generally appreciated
that conditions can be rendered more stringent by the addition of
increasing amounts of formamide.
[0073] For certain applications, for example, substitution of amino
acids by site-directed mutagenesis, it is appreciated that lower
stringency conditions are required. Under these conditions,
hybridization may occur even though the sequences of probe and
target strand are not perfectly complementary, but are mismatched
at one or more positions. Conditions may be rendered less stringent
by increasing salt concentration and decreasing temperature. For
example, a medium stringency condition could be provided by about
0.1 to 0.25 M NaCl at temperatures of about 37.degree. C. to about
55.degree. C., while a low stringency condition could be provided
by about 0.15 M to about 0.9 M salt, at temperatures ranging from
about 20.degree. C. to about 55.degree. C. Thus, hybridization
conditions can be readily manipulated, and thus will generally be a
method of choice depending on the desired results.
[0074] The following codon chart may be used, in a site-directed
mutagenic scheme, to produce nucleic acids encoding the same or
slightly different amino acid sequences of a given nucleic
acid:
3TABLE 1 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine
Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA
GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K
AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG
Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine
Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S
AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val
V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
[0075] In other embodiments, hybridization may be achieved under
conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3
mM MgCl.sub.2, 10 mM dithiothreitol, at temperatures between
approximately 20.degree. C. to about 37.degree. C. Other
hybridization conditions utilized could include approximately 10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 1.5 .mu.M MgCl.sub.2, at temperatures
ranging from approximately 40.degree. C. to about 72.degree. C.
[0076] In certain embodiments, it will be advantageous to employ
nucleic acid sequences of the present invention in combination with
an appropriate means, such as a label, for determining
hybridization. A wide variety of appropriate indicator means are
known in the art, including fluorescent, radioactive, enzymatic or
other ligands, such as avidin/biotin, which are capable of being
detected. In preferred embodiments, one may desire to employ a
fluorescent label or an enzyme tag such as urease, alkaline
phosphatase or peroxidase, instead of radioactive or other
environmentally undesirable reagents. In the case of enzyme tags,
colorimetric indicator substrates are known which can be employed
to provide a detection means visible to the human eye or
spectrophotometrically, to identify specific hybridization with
complementary nucleic acid-containing samples.
[0077] In general, it is envisioned that the hybridization probes
described herein will be useful both as reagents in solution
hybridization, as in PCR, for detection of expression of
corresponding genes, as well as in embodiments employing a solid
phase. In embodiments involving a solid phase, the test DNA (or
RNA) is adsorbed or otherwise affixed to a selected matrix or
surface. This fixed, single-stranded nucleic acid is then subjected
to hybridization with selected probes under desired conditions. The
selected conditions will depend on the particular circumstances
based on the particular criteria required (depending, for example,
on the G+C content, type of target nucleic acid, source of nucleic
acid, size of hybridization probe, etc.). Following washing of the
hybridized surface to remove non-specifically bound probe
molecules, hybridization is detected, or even quantified, by means
of the label.
[0078] It will be understood that this invention is not limited to
the particular probes disclosed herein and particularly is intended
to encompass at least nucleic acid sequences that are hybridizable
to the disclosed sequences or are functional sequence analogs of
these sequences. For example, a partial sequence may be used to
identify a structurally-related gene or the fill length genomic or
cDNA clone from which it is derived. Those of skill in the art are
well aware of the methods for generating cDNA and genomic libraries
which can be used as a target for the above-described probes
(Sambrook et al., 1989).
[0079] For applications in which the nucleic acid segments of the
present invention are incorporated into vectors, such as plasmids,
cosmids or viruses, these segments may be combined with other DNA
sequences, such as promoters, polyadenylation signals, restriction
enzyme sites, multiple cloning sites, other coding segments, and
the like, such that their overall length may vary considerably. It
is contemplated that a nucleic acid fragment of almost any length
may be employed, with the total length preferably being limited by
the ease of preparation and use in the intended recombinant DNA
protocol.
[0080] DNA segments encoding a specific gene may be introduced into
recombinant host cells and employed for expressing a specific
structural or regulatory protein. Alternatively, through the
application of genetic engineering techniques, subportions or
derivatives of selected genes may be employed. Upstream regions
containing regulatory regions such as promoter regions may be
isolated and subsequently employed for expression of the selected
gene.
[0081] Where an expression product is to be generated, it is
possible for the nucleic acid sequence to be varied while retaining
the ability to encode the same product. Reference to the codon
chart, provided above, will permit those of skill in the art to
design any nucleic acid encoding for the product of a given nucleic
acid.
[0082] B. Encoded Proteins
[0083] Once the entire coding sequence of a marker-associated gene
has been determined, the gene can be inserted into an appropriate
expression system. The gene can be expressed in any number of
different recombinant DNA expression systems to generate large
amounts of the polypeptide product, which can then be purified and
used to vaccinate animals to generate antisera with which further
studies may be conducted.
[0084] Examples of expression systems known to the skilled
practitioner in the art include bacteria such as E. coli, yeast
such as Pichia pastoris, baculovirus, and mammalian expression
systems such as in Cos or CHO cells. A complete gene can be
expressed or, alternatively, fragments of the gene encoding
portions of polypeptide can be produced.
[0085] In certain broad applications of the invention, the gene
sequence encoding the polypeptide is analyzed to detect putative
transmembrane sequences. Such sequences are typically very
hydrophobic and are readily detected by the use of standard
sequence analysis software, such as MacVector (IBI, New Haven, CT).
The presence of transmembrane sequences is often deleterious when a
recombinant protein is synthesized in many expression systems,
especially E. coli, as it leads to the production of insoluble
aggregates which are difficult to renature into the native
conformation of the protein. Deletion of transmembrane sequences
typically does not significantly alter the conformation of the
remaining protein structure.
[0086] Moreover, transmembrane sequences, being by definition
embedded within a membrane, are inaccessible. Antibodies to these
sequences may not, therefore, prove useful in in vivo or in situ
studies. Deletion of transmembrane-encoding sequences from the
genes used for expression can be achieved by standard techniques.
For example, fortuitously-placed restriction enzyme sites can be
used to excise the desired gene fragment, or PCR-type amplification
can be used to amplify only the desired part of the gene.
[0087] Computer sequence analysis may be used to determine the
location of the predicted major antigenic determinant epitopes of
the polypeptide. Software capable of carrying out this analysis is
readily available commercially, for example MacVector (IBI, New
Haven, Conn.). The software typically uses standard algorithms such
as the Kyte/Doolittle or Hopp/Woods methods for locating
hydrophilic sequences may be found on the surface of proteins and
are, therefore, likely to act as antigenic determinants.
[0088] Once this analysis is made, polypeptides may be prepared
which contain at least the essential features of the antigenic
determinant and which may be employed in the generation of antisera
against the polypeptide. Minigenes or gene fusions encoding these
determinants may be constructed and inserted into expression
vectors by standard methods, for example, using PCR cloning
methodology.
[0089] The gene or gene fragment encoding a polypeptide may be
inserted into an expression vector by standard subcloning
techniques. An E. coli expression vector may be used which produces
the recombinant polypeptide as a fusion protein, allowing rapid
affinity purification of the protein. Examples of such fusion
protein expression systems are the glutathione S-transferase system
(Pharmacia, Piscataway, N.J.), the maltose binding protein system
(NEB, Beverley, Mass.), the FLAG system (IBI, New Haven, Conn.),
and the 6xHis system (Qiagen, Chatsworth, Calif.).
[0090] Some of these systems produce recombinant polypeptides
bearing only a small number of additional amino acids, which are
unlikely to affect the antigenic ability of the recombinant
polypeptide. For example, both the FLAG system and the 6xHis system
add only short sequences, both of which are known to be poorly
antigenic and which do not adversely affect folding of the
polypeptide to its native conformation. Other fusion systems are
designed to produce fusions wherein the fusion partner is easily
excised from the desired polypeptide. In one embodiment, the fusion
partner is linked to the recombinant polypeptide by a peptide
sequence containing a specific recognition sequence for a protease.
Examples of suitable sequences are those recognized by the Tobacco
Etch Virus protease (Life Technologies, Gaithersburg, Md.) or
Factor Xa (New England Biolabs, Beverley, Mass.).
[0091] The expression system used may also be one driven by the
baculovirus polyhedron promoter. The gene encoding the polypeptide
may be manipulated by standard techniques in order to facilitate
cloning into the baculovirus vector. One baculovirus vector is the
pBlueBac vector (Invitrogen, Sorrento, Calif.). The vector carrying
the gene for the polypeptide is transfected into Spodoptera
frugiperda (Sf9) cells by standard protocols, and the cells are
cultured and processed to produce the recombinant antigen. See
Summers et al., A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures, Texas Agricultural Experimental
Station; U.S. Pat. No. 4,215,051 (incorporated by reference).
[0092] As an alternative to recombinant polypeptides, synthetic
peptides corresponding to the antigenic determinants may be
prepared. Such peptides are at least six amino acid residues long,
and may contain up to approximately 35 residues, which is the
approximate upper length limit of automated peptide synthesis
machines, such as those available from Applied Biosystems (Foster
City, Calif.). Use of such small peptides for vaccination typically
requires conjugation of the peptide to an immunogenic carrier
protein such as hepatitis B surface antigen, keyhole limpet
hemocyanin or bovine serum albumin. Methods for performing this
conjugation are well known in the art.
[0093] Amino acid sequence variants of the polypeptide may also be
prepared. These may, for instance, be minor sequence variants of
the polypeptide which arise due to natural variation within the
population or they may be homologues found in other species. They
also may be sequences which do not occur naturally but which are
sufficiently similar that they function similarly and/or elicit an
immune response that cross-reacts with natural forms of the
polypeptide. Sequence variants may be prepared by standard methods
of site-directed mutagenesis such as those described herein for
removing the transmembrane sequence.
[0094] Amino acid sequence variants of the polypeptide may be
substitutional, insertional or deletion variants. Deletion variants
lack one or more residues of the native protein which are not
essential for function or immunogenic activity, and are exemplified
by the variants lacking a transmembrane sequence. Another common
type of deletion variant is one lacking secretory signal sequences
or signal sequences directing a protein to bind to a particular
part of a cell. An example of the latter sequence is the SH2
domain, which induces protein binding to phosphotyrosine
residues.
[0095] Substitutional variants typically contain an alternative
amino acid at one or more sites within the protein, and may be
designed to modulate one or more properties of the polypeptide such
as stability against proteolytic cleavage. Substitutions preferably
are conservative, that is, one amino acid is replaced with one of
similar size and charge. Conservative substitutions are well known
in the art and include, for example, the changes of: alanine to
serine; arginine to lysine; asparagine to glutamine or histidine;
aspartate to glutamate; cysteine to serine; glutamine to
asparagine; glutamate to aspartate; glycine to proline; histidine
to asparagine or glutamine; isoleucine to leucine or valine;
leucine to valine or isoleucine; lysine to arginine, glutamine, or
glutamate; methionine to leucine or isoleucine; phenylalanine to
tyrosine, leucine or methionine; serine to threonine; threonine to
serine; tryptophan to tyrosine; tyrosine to tryptophan or
phenylalanine; and valine to isoleucine or leucine.
[0096] Insertional variants include fusion proteins such as those
used to allow rapid purification of the polypeptide and also may
include hybrid proteins containing sequences from other proteins
and polypeptides which are homologues of the polypeptide. For
example, an insertional variant may include portions of the amino
acid sequence of the polypeptide from one species, together with
portions of the homologous polypeptide from another species. Other
insertional variants may include those in which additional amino
acids are introduced within the coding sequence of the polypeptide.
These typically are smaller insertions than the fusion proteins
described above and are introduced, for example, to disrupt a
protease cleavage site.
[0097] Major antigenic determinants of the polypeptide may be
identified by an empirical approach in which portions of the gene
encoding the polypeptide are expressed in a recombinant host, and
the resulting proteins tested for their ability to elicit an immune
response. For example, PCR may be used to prepare a range of
peptides lacking successively longer fragments of the C-terminus of
the protein. The immunoprotective activity of each of these
peptides then identifies those fragments or domains of the
polypeptide which are essential for this activity. Further studies
in which only a small number of amino acids are removed at each
iteration then allows the location of the antigenic determinants of
the polypeptide.
[0098] Another method for the preparation of the polypeptides
according to the invention is the use of peptide mimetics. Mimetics
are peptide-containing molecules which mimic elements of protein
secondary structure. See, for example, Johnson et al., "Peptide
Turn Mimetics" in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds.,
Chapman and Hall, New York (1993). The underlying rationale behind
the use of peptide mimetics is that the peptide backbone of
proteins exists chiefly to orient amino acid side chains in such a
way as to facilitate molecular interactions, such as those of
antibody and antigen. A peptide mimetic is expected to permit
molecular interactions similar to the natural molecule.
[0099] Successful applications of the peptide mimetic concept have
thus far focused on mimetics of .beta.-turns within proteins, which
are known to be highly antigenic. Likely .beta.-turn structure
within a polypeptide may be predicted by computer-based algorithms
as discussed herein. Once the component amino acids of the turn are
determined, peptide mimetics may be constructed to achieve a
similar spatial orientation of the essential elements of the amino
acid side chains.
[0100] C. Preparation of Antibodies Specific for Encoded
Proteins
[0101] 1. Expression of Proteins from Cloned cDNAs
[0102] The cDNA species specified in SEQ ID NO:1, SEQ ID NO:2, SEQ
ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:83 and SEQ ID NO:85
may be expressed as encoded peptides or proteins. The engineering
of DNA segment(s) for expression in a prokaryotic or eukaryotic
system may be performed by techniques generally known to those of
skill in recombinant expression. It is believed that virtually any
expression system may be employed in the expression of the claimed
nucleic acid sequences.
[0103] Both cDNA and genomic sequences are suitable for eukaryotic
expression, as the host cell will generally process the genomic
transcripts to yield functional mRNA for translation into protein.
In addition, it is possible to use partial sequences for generation
of antibodies against discrete portions of a gene product, even
when the entire sequence of that gene product remains unknown.
Computer programs are available to aid in the selection of regions
which have potential immunologic significance. For example,
software capable of carrying out this analysis is readily available
commercially from MacVector (IBI, New Haven, Conn.). The software
typically uses standard algorithms such as the Kyte/Doolittle or
Hopp/Woods methods for locating hydrophilic sequences which are
characteristically found on the surface of proteins and are,
therefore, likely to act as antigenic determinants.
[0104] As used herein, the terms "engineered" and "recombinant"
cells are intended to refer to a cell into which an exogenous DNA
segment or gene, such as a cDNA or gene has been introduced through
the hand of man. Therefore, engineered cells are distinguishable
from naturally occurring cells which do not contain a recombinantly
introduced exogenous DNA segment or gene. Recombinant cells include
those having an introduced cDNA or genomic gene, and also include
genes positioned adjacent to a heterologous promoter not naturally
associated with the particular introduced gene.
[0105] To express a recombinant encoded protein or peptide, whether
mutant or wild-type, in accordance with the present invention one
would prepare an expression vector that comprises one of the
claimed isolated nucleic acids under the control of, or operatively
linked to, one or more promoters. To bring a coding sequence "under
the control of" a promoter, one positions the 5' end of the
transcription initiation site of the transcriptional reading frame
generally between about 1 and about 50 nucleotides "downstream"
(i.e., 3') of the chosen promoter. The "upstream" promoter
stimulates transcription of the DNA and promotes expression of the
encoded recombinant protein. This is the meaning of "recombinant
expression" in this context.
[0106] Many standard techniques are available to construct
expression vectors containing the appropriate nucleic acids and
transcriptional/translational control sequences in order to achieve
protein or peptide expression in a variety of host-expression
systems. Cell types available for expression include, but are not
limited to, bacteria, such as E. coli and B. subtilis transformed
with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors.
[0107] Certain examples of prokaryotic hosts are E. coli strain
RR1, E. coli LE392, E. coli B, E. coli X 1776 (ATCC No. 31537) as
well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325);
bacilli such as Bacillus subtilis; and other enterobacteriaceae
such as Salmonella typhimurium, Serratia marcescens, and various
Pseudomonas species.
[0108] In general, plasmid vectors containing replicon and control
sequences which are derived from species compatible with the host
cell are used in connection with these hosts. The vector ordinarily
carries a replication site, as well as marking sequences which are
capable of providing phenotypic selection in transformed cells. For
example, E. coli is often transformed using pBR322, a plasmid
derived from an E. coli species. pBR322 contains genes for
ampicillin and tetracycline resistance and thus provides easy means
for identifying transformed cells. The pBR plasmid, or other
microbial plasmid or phage must also contain, or be modified to
contain, promoters which may be used by the microbial organism for
expression of its own proteins.
[0109] In addition, phage vectors containing replicon and control
sequences that are compatible with the host microorganism may be
used as transforming vectors in connection with these hosts. For
example, the phage lambda GEM.TM.-11 may be utilized in making a
recombinant phage vector which may be used to transform host cells,
such as E. coli LE392.
[0110] Further useful vectors include pIN vectors (Inouye et al.,
1985); and pGEX vectors, for use in generating glutathione
S-transferase (GST) soluble fusion proteins for later purification
and separation or cleavage. Other suitable fusion proteins are
those with .beta.-galactosidase, ubiquitin, or the like.
[0111] Promoters that are most commonly used in recombinant DNA
construction include the .beta.-lactamase (penicillinase), lactose
and tryptophan (trp) promoter systems. While these are the most
commonly used, other microbial promoters have been discovered and
utilized, and details concerning their nucleotide sequences have
been published, enabling those of skill in the art to ligate them
functionally with plasmid vectors.
[0112] For expression in Saccharomyces, the plasmid YRp7, for
example, is commonly used (Stinchcomb et al., 1979; Kingsman et
al., 1979; Tschemper et al., 1980). This plasmid already contains
the trp1 gene which provides a selection marker for a mutant strain
of yeast lacking the ability to grow in tryptophan, for example
ATCC No. 44076 or PEP4-1 (Jones, 1977). The presence of the trp1
lesion as a characteristic of the yeast host cell genome then
provides an effective environment for detecting transformation by
growth in the absence of tryptophan.
[0113] Suitable promoting sequences in yeast vectors include the
promoters for 3-phosphoglycerate kinase (Hitzeman et al., 1980) or
other glycolytic enzymes (Hess et al., 1968; Holland et al., 1978),
such as enolase, glyceraldehyde-3-phosphated ehydrogenase,
hexokinase, pyruvate decarboxylase, phosphofructokinase,
glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate
kinase, triosephosphate isomerase, phosphoglucose isomerase, and
glucokinase. In constructing suitable expression plasmids, the
termination sequences associated with these genes are also ligated
into the expression vector 3' of the sequence desired to be
expressed to provide polyadenylation of the mRNA and
termination.
[0114] Other suitable promoters, which have the additional
advantage of transcription controlled by growth conditions, include
the promoter region for alcohol dehydrogenase 2, isocytochrome C,
acid phosphatase, degradative enzymes associated with nitrogen
metabolism, and the aforementioned glyceraldehyde-3-phosphate
dehydrogenase, and enzymes responsible for maltose and galactose
utilization.
[0115] In addition to micro-organisms, cultures of cells derived
from multicellular organisms may also be used as hosts. In
principle, any such cell culture is workable, whether from
vertebrate or invertebrate culture. In addition to mammalian cells,
these include insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus); and plant cell systems
infected with recombinant virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors (e.g., Ti
plasmid) containing one or more coding sequences.
[0116] In a useful insect system, Autographa califormica nuclear
polyhidrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The isolated
nucleic acid coding sequences are cloned into non-essential regions
(for example the polyhedrin gene) of the virus and placed under
control of an AcNPV promoter (for example the polyhedrin promoter).
Successful insertion of the coding sequences results in the
inactivation of the polyhedrin gene and production of non-occluded
recombinant virus (i.e., virus lacking the proteinaceous coat coded
for by the polyhedrin gene). These recombinant viruses are then
used to infect Spodoptera frugiperda cells in which the inserted
gene is expressed (e.g., U.S. Pat. No. 4,215,051 (Smith)).
[0117] Examples of useful mammalian host cell lines are VERO and
HeLa cells, Chinese hamster ovary (CHO) cell lines, WI 38, BHK,
COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines. In addition, a
host cell strain may be chosen that modulates the expression of the
inserted sequences, or modifies and processes the gene product in
the specific fashion desired. Such modifications (e.g.,
glycosylation) and processing (e.g., cleavage) of protein products
may be important for the function of the encoded protein.
[0118] Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins. Appropriate cells lines or host systems may be chosen
to ensure the correct modification and processing of the foreign
protein expressed. Expression vectors for use in mammalian cells
ordinarily include an origin of replication (as necessary), a
promoter located in front of the gene to be expressed, along with
any necessary ribosome binding sites, RNA splice sites,
polyadenylation site, and transcriptional terminator sequences. The
origin of replication may be provided either by construction of the
vector to include an exogenous origin, such as may be derived from
SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may
be provided by the host cell chromosomal replication mechanism. If
the vector is integrated into the host cell chromosome, the latter
is often sufficient.
[0119] The promoters may be derived from the genome of mammalian
cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the adenovirus late promoter; the vaccinia virus 7.5K
promoter). Further, it is also possible, and may be desirable, to
utilize promoter or control sequences normally associated with the
desired gene sequence, provided such control sequences are
compatible with the host cell systems.
[0120] A number of viral based expression systems may be utilized,
for example, commonly used promoters are derived from polyoma,
Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early
and late promoters of SV40 virus are particularly useful because
both are obtained easily from the virus as a fragment which also
contains the SV40 viral origin of replication. Smaller or larger
SV40 fragments may also be used, provided there is included the
approximately 250 bp sequence extending from the Hind III site
toward the Bgl I site located in the viral origin of
replication.
[0121] In cases where an adenovirus is used as an expression
vector, the coding sequences may be ligated to an adenovirus
transcription/translatio- n control complex, e.g., the late
promoter and tripartite leader sequence. This chimeric gene may
then be inserted in the adenovirus genome by in vitro or in vivo
recombination. Insertion in a non-essential region of the viral
genome (e.g., region E1 or E3) will result in a recombinant virus
that is viable and capable of expressing proteins in infected
hosts.
[0122] Specific initiation signals may also be required for
efficient translation of the claimed isolated nucleic acid coding
sequences. These signals include the ATG initiation codon and
adjacent sequences. Exogenous translational control signals,
including the ATG initiation codon, may additionally need to be
provided. One of ordinary skill in the art would readily be capable
of determining this and providing the necessary signals. It is well
known that the initiation codon must be in-frame (or in-phase) with
the reading frame of the desired coding sequence to ensure
translation of the entire insert. These exogenous translational
control signals and initiation codons may be of a variety of
origins, both natural and synthetic. The efficiency of expression
may be enhanced by the inclusion of appropriate transcription
enhancer elements or transcription terminators (Bittner et al.,
1987).
[0123] In eukaryotic expression, one will also typically desire to
incorporate into the transcriptional unit an appropriate
polyadenylation site (e.g., 5'-AATAAA-3') if one was not contained
within the original cloned segment. Typically, the poly A addition
site is placed about 30 to 2000 nucleotides "downstream" of the
termination site of the protein at a position prior to
transcription termination.
[0124] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
that stably express constructs encoding proteins may be engineered.
Rather than using expression vectors that contain viral origins of
replication, host cells may be transformed with vectors controlled
by appropriate expression control elements (e.g., promoter,
enhancer, sequences, transcription terminators, polyadenylation
sites, etc.), and a selectable marker. Following the introduction
of foreign DNA, engineered cells may be allowed to grow for 1-2
days in an enriched media, and then are switched to a selective
media. The selectable marker in the recombinant plasmid confers
resistance to the selection and allows cells to stably integrate
the plasmid into their chromosomes and grow to form foci which in
turn may be cloned and expanded into cell lines.
[0125] A number of selection systems may be used, including but not
limited to, the herpes simplex virus thymidine kinase (Wigler et
al., 1977), hypoxanthine-guanine phosphoribosyltransferase
(Szybalska et al., 1962) and adenine phosphoribosyltransferase
genes (Lowy et al., 1980), in tk-, hgprt- or aprt-cells,
respectively. Also, antimetabolite resistance may be used as the
basis of selection for dhfr, that confers resistance to
methotrexate (Wigler et al., 1980; O'Hare et al., 1981); gpt, that
confers resistance to mycophenolic acid (Mulligan et al., 1981);
neo, that confers resistance to the aminoglycoside G-418
(Colberre-Garapinet al., 1981); and hygro, that confers resistance
to hygromycin (Santerre et al., 1984).
[0126] It is contemplated that the isolated nucleic acids of the
invention may be "overexpressed", i.e., expressed in increased
levels relative to its natural expression in human prostate,
bladder or breast cells, or even relative to the expression of
other proteins in the recombinant host cell. Such overexpression
may be assessed by a variety of methods, including radio-labeling
and/or protein purification. However, simple and direct methods are
preferred, for example, those involving SDS/PAGE and protein
staining or Western blotting, followed by quantitative analyses,
such as densitometric scanning of the resultant gel or blot. A
specific increase in the level of the recombinant protein or
peptide in comparison to the level in natural human prostate,
bladder or breast cells is indicative of overexpression, as is a
relative abundance of the specific protein in relation to the other
proteins produced by the host cell and, e.g., visible on a gel.
[0127] 2. Purification of Expressed Proteins
[0128] Further aspects of the present invention concern the
purification, and in particular embodiments, the substantial
purification, of an encoded protein or peptide. The term "purified
protein or peptide" as used herein, is intended to refer to a
composition, isolatable from other components, wherein the protein
or peptide is purified to any degree relative to its
naturally-obtainable state, i.e., in this case, relative to its
purity within a prostate, bladder or breast cell extract. A
purified protein or peptide therefore also refers to a protein or
peptide, free from the environment in which it may naturally
occur.
[0129] Generally, "purified" will refer to a protein or peptide
composition which has been subjected to fractionation to remove
various other components, and which composition substantially
retains its expressed biological activity. Where the term
"substantially purified" is used, this will refer to a composition
in which the protein or peptide forms the major component of the
composition, such as constituting about 50% or more of the proteins
in the composition.
[0130] Various methods for quantifying the degree of purification
of the protein or peptide will be known to those of skill in the
art in light of the present disclosure. These include, for example,
determining the specific activity of an active fraction, or
assessing the number of polypeptides within a fraction by SDS/PAGE
analysis. A preferred method for assessing the purity of a fraction
is to calculate the specific activity of the fraction, to compare
it to the specific activity of the initial extract, and to thus
calculate the degree of purity, herein assessed by a "-fold
purification number". The actual units used to represent the amount
of activity will, of course, be dependent upon the particular assay
technique chosen to follow the purification and whether or not the
expressed protein or peptide exhibits a detectable activity.
[0131] Various techniques suitable for use in protein purification
will be well known to those of skill in the art. These include, for
example, precipitation with ammonium sulfate, PEG, antibodies and
the like or by heat denaturation, followed by centrifugation;
chromatography steps such as ion exchange, gel filtration, reverse
phase, hydroxylapatite and affinity chromatography; isoelectric
focusing; gel electrophoresis; and combinations of such and other
techniques. As is generally known in the art, it is believed that
the order of conducting the various purification steps may be
changed, or that certain steps may be omitted, and still result in
a suitable method for the preparation of a substantially purified
protein or peptide.
[0132] There is no general requirement that the protein or peptide
always be provided in the most purified state. Indeed, it is
contemplated that less substantially purified products will have
utility in certain embodiments. Partial purification may be
accomplished by using fewer purification steps in combination, or
by utilizing different forms of the same general purification
scheme. For example, it is appreciated that a cation-exchange
column chromatography performed utilizing an HPLC apparatus will
generally result in a greater--fold purification than the same
technique utilizing a low pressure chromatography system. Methods
exhibiting a lower degree of relative purification may have
advantages in total recovery of protein product, or in maintaining
the activity of an expressed protein.
[0133] It is known that the migration of a polypeptide may vary,
sometimes significantly, with different conditions of SDS/PAGE
(Capaldi et al., Biochem. Biophys. Res. Comm., 76:425, 1977). It
will therefore be appreciated that under differing electrophoresis
conditions, the apparent molecular weights of purified or partially
purified expression products may vary.
[0134] 3. Antibody Generation
[0135] For some embodiments, it will be desirable to produce
antibodies that bind with high specificity to the polypeptide
product(s) of an isolated nucleic acid selected from SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:10,
SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:15, SEQ ID
NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:83
and SEQ ID NO:85. Means for preparing and characterizing antibodies
are well known in the art (See, e.g., Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by
reference).
[0136] Methods for generating polyclonal antibodies are well known
in the art. Briefly, a polyclonal antibody is prepared by
immunizing an animal with an immunogenic composition and collecting
antisera from that immunized animal. A wide range of animal species
may be used for the production of antisera. Typically the animal
used for production of anti-antisera is a rabbit, a mouse, a rat, a
hamster, a guinea pig or a goat. Because of the relatively large
blood volume of rabbits, a rabbit is a preferred choice for
production of polyclonal antibodies.
[0137] As is well known in the art, a given composition may vary in
its immunogenicity. It is often necessary therefore to boost the
host immune system, as may be achieved by coupling a peptide or
polypeptide immunogen to a carrier. Exemplary and preferred
carriers are keyhole limpet hemocyanin (KLH) and bovine serum
albumin (BSA). Other albumins such as ovalbumin, mouse serum
albumin or rabbit serum albumin may also be used as carriers. Means
for conjugating a polypeptide to a carrier protein are well known
in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hy-
droxysuccinimide ester, carbodiimide and bis-biazotized
benzidine.
[0138] As is also well known in the art, the immunogenicity of a
particular immunogen composition may be enhanced by the use of
non-specific stimulators of the immune response, known as
adjuvants. Exemplary and preferred adjuvants include complete
Freund's adjuvant (a non-specific stimulator of the immune response
containing killed Mycobacterium tuberculosis), incomplete Freund's
adjuvants and aluminum hydroxide adjuvant.
[0139] The amount of immunogen composition used in the production
of polyclonal antibodies varies upon the nature of the immunogen as
well as the animal used for immunization. A variety of routes may
be used to administer the immunogen (subcutaneous, intramuscular,
intradermal, intravenous and intraperitoneal). The production of
polyclonal antibodies may be monitored by sampling blood of the
immunized animal at various points following immunization. A
second, booster injection, may also be given. The process of
boosting and titering is repeated until a suitable titer is
achieved. When a desired level of immunogenicity is obtained, the
immunized animal may be bled and the serum isolated and stored,
and/or the animal may be used to generate MAbs. For production of
rabbit polyclonal antibodies, the animal may be bled through an ear
vein or alternatively by cardiac puncture. The removed blood is
allowed to coagulate and then centrifuged to separate serum
components from whole cells and blood clots. The serum may be used
as is for various applications or else the desired antibody
fraction may be purified by well-known methods, such as affinity
chromatography using another antibody or a peptide bound to a solid
matrix.
[0140] Monoclonal antibodies (MAbs) may be readily prepared through
use of well-known techniques, such as those exemplified in U.S.
Pat. No. 4,196,265, incorporated herein by reference. Typically,
this technique involves immunizing a suitable animal with a
selected immunogen composition, e.g., a purified or partially
purified expressed protein, polypeptide or peptide. The immunizing
composition is administered in a manner effective to stimulate
antibody producing cells.
[0141] The methods for generating monoclonal antibodies (MAbs)
generally begin along the same lines as those for preparing
polyclonal antibodies. Rodents such as mice and rats are preferred
animals, however, the use of rabbit, sheep or frog cells is also
possible. The use of rats may provide certain advantages (Goding,
1986, pp. 60-61), but mice are preferred, with the BALB/c mouse
being most preferred as this is most routinely used and generally
gives a higher percentage of stable fusions.
[0142] The animals are injected with antigen as described above.
The antigen may be coupled to carrier molecules such as keyhole
limpet hemocyanin if necessary. The antigen would typically be
mixed with adjuvant, such as Freund's complete or incomplete
adjuvant. Booster injections with the same antigen would occur at
approximately two-week intervals.
[0143] Following immunization, somatic cells with the potential for
producing antibodies, specifically B lymphocytes (B cells), are
selected for use in the MAb generating protocol. These cells may be
obtained from biopsied spleens, tonsils or lymph nodes, or from a
peripheral blood sample. Spleen cells and peripheral blood cells
are preferred, the former because they are a rich source of
antibody-producing cells that are in the dividing plasmablast
stage, and the latter because peripheral blood is easily
accessible. Often, a panel of animals will have been immunized and
the spleen of the animal with the highest antibody titer will be
removed and the spleen lymphocytes obtained by homogenizing the
spleen with a syringe. Typically, a spleen from an immunized mouse
contains approximately 5.times.10.sup.7 to 2.times.10.sup.8
lymphocytes.
[0144] The antibody-producing B lymphocytes from the immunized
animal are then fused with cells of an immortal myeloma cell,
generally one of the same species as the animal that was immunized.
Myeloma cell lines suited for use in hybridoma-producing fusion
procedures preferably are non-antibody-producing, have high fusion
efficiency, and enzyme deficiencies that render then incapable of
growing in certain selective media which support the growth of only
the desired fused cells (hybridomas).
[0145] Any one of a number of myeloma cells may be used, as are
known to those of skill in the art (Goding, pp. 65-66, 1986;
Campbell, pp. 75-83, 1984). For example, where the immunized animal
is a mouse, one may use P3-X63/Ag8,.times.63-Ag8.653, NS1/1.Ag 41,
Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S194/5XXO Bul;
for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and
U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in
connection with human cell fusions.
[0146] One preferred murine myeloma cell is the NS-1 myeloma cell
line (also termed P3-NS-1-Ag4-1), which is readily available from
the NIGMS Human Genetic Mutant Cell Repository by requesting cell
line repository number GM3573. Another mouse myeloma cell line that
may be used is the 8-azaguanine-resistant mouse murine myeloma
SP2/0 non-producer cell line.
[0147] Methods for generating hybrids of antibody-producing spleen
or lymph node cells and myeloma cells usually comprise mixing
somatic cells with myeloma cells in a 2:1 proportion, though the
proportion may vary from about 20:1 to about 1:1, respectively, in
the presence of an agent or agents (chemical or electrical) that
promote the fusion of cell membranes. Fusion methods using Sendai
virus have been described by Kohler and Milstein (1975; 1976), and
those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by
Gefter et al. (1977). The use of electrically induced fusion
methods is also appropriate (Godingpp. 71-74, 1986).
[0148] Fusion procedures usually produce viable hybrids at low
frequencies, about 1.times.10.sup.-6 to 1.times.10.sup.-8. However,
this does not pose a problem, as the viable, fused hybrids are
differentiated from the parental, unfused cells (particularly the
unfused myeloma cells that would normally continue to divide
indefinitely) by culturing in a selective medium. The selective
medium is generally one that contains an agent that blocks the de
novo synthesis of nucleotides in the tissue culture media.
Exemplary and preferred agents are aminopterin, methotrexate, and
azaserine. Aminopterin and methotrexate block de novo synthesis of
both purines and pyrimidines, whereas azaserine blocks only purine
synthesis. Where aminopterin or methotrexate is used, the media is
supplemented with hypoxanthine and thymidine as a source of
nucleotides (HAT medium). Where azaserine is used, the media is
supplemented with hypoxanthine.
[0149] The preferred selection medium is HAT. Only cells capable of
operating nucleotide salvage pathways are able to survive in HAT
medium. The myeloma cells are defective in key enzymes of the
salvage pathway, e.g., hypoxanthine phosphoribosyl transferase
(HPRT), and they cannot survive. The B cells may operate this
pathway, but they have a limited life span in culture and generally
die within about two weeks. Therefore, the only cells that can
survive in the selective media are those hybrids formed from
myeloma and B cells.
[0150] This culturing provides a population of hybridomas from
which specific hybridomas are selected. Typically, selection of
hybridomas is performed by culturing the cells by single-clone
dilution in microtiter plates, followed by testing the individual
clonal supernatants (after about two to three weeks) for the
desired reactivity. The assay should be sensitive, simple and
rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity
assays, plaque assays, dot immunobinding assays, and the like.
[0151] The selected hybridomas would then be serially diluted and
cloned into individual antibody-producing cell lines, which clones
may then be propagated indefinitely to provide MAbs. The cell lines
may be exploited for MAb production in two basic ways. A sample of
the hybridoma may be injected (often into the peritoneal cavity)
into a histocompatible animal of the type that was used to provide
the somatic and myeloma cells for the original fusion. The injected
animal develops tumors secreting the specific monoclonal antibody
produced by the fused cell hybrid. The body fluids of the animal,
such as serum or ascites fluid, may then be tapped to provide MAbs
in high concentration. The individual cell lines may also be
cultured in vitro, where the MAbs are naturally secreted into the
culture medium from which they may be readily obtained in high
concentrations. MAbs produced by either means may be further
purified, if desired, using filtration, centrifugation and various
chromatographic methods such as HPLC or affinity
chromatography.
[0152] Large amounts of the monoclonal antibodies of the present
invention may also be obtained by multiplying hybridoma cells in
vivo. Cell clones are injected into mammals which are
histocompatible with the parent cells, e.g., syngeneic mice, to
cause growth of antibody-producing tumors. Optionally, the animals
are primed with a hydrocarbon, especially oils such as pristane
(tetramethylpentadecane) prior to injection.
[0153] In accordance with the present invention, fragments of the
monoclonal antibody of the invention may be obtained from the
monoclonal antibody produced as described above, by methods which
include digestion with enzymes such as pepsin or papain and/or
cleavage of disulfide bonds by chemical reduction. Alternatively,
monoclonal antibody fragments encompassed by the present invention
may be synthesized using an automated peptide synthesizer.
[0154] The monoclonal conjugates of the present invention are
prepared by methods known in the art, e.g., by reacting a
monoclonal antibody prepared as described above with, for instance,
an enzyme in the presence of a coupling agent such as
glutaraldehyde or periodate. Conjugates with fluorescein markers
are prepared in the presence of these coupling agents or by
reaction with an isothiocyanate. Conjugates with metal chelates are
similarly produced. Other moieties to which antibodies may be
conjugated include radionuclides such as .sup.3H, .sup.125I ,
.sup.131I, .sup.32P, .sup.35S, .sup.14C, .sup.51Cr, .sup.36Cl,
.sup.57Co, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu, and
.sup.99mTc. Radioactively labeled monoclonal antibodies of the
present invention are produced according to well-known methods in
the art. For instance, monoclonal antibodies may be iodinated by
contact with sodium or potassium iodide and a chemical oxidizing
agent such as sodium hypochlorite, or an enzymatic oxidizing agent,
such as lactoperoxidase. Monoclonal antibodies according to the
invention may be labeled with technetium-.sup.99 by ligand exchange
process, for example, by reducing pertechnate with stannous
solution, chelating the reduced technetium onto a Sephadex column
and applying the antibody to this column or by direct labeling
techniques, e.g., by incubating pertechnate, a reducing agent such
as SNCl.sub.2, a buffer solution such as sodium-potassium phthalate
solution, and the antibody.
[0155] It will be appreciated by those of skill in the art that
monoclonal or polyclonal antibodies specific for proteins that are
preferentially expressed in metastatic or nonmetastatic human
prostate, bladder or breast cancer will have utilities in several
types of applications. These may include the production of
diagnostic kits for use in detecting or diagnosing human prostate,
bladder or breast cancer. An alternative use would be to link such
antibodies to therapeutic agents, such as chemotherapeutic agents,
followed by administration to individuals with prostate, bladder or
breast cancer, thereby selectively targeting the prostate, bladder
or breast cancer cells for destruction. The skilled practitioner
will realize that such uses are within the scope of the present
invention.
[0156] D. Immunodetection Assays
[0157] 1. Immunodetection Methods
[0158] In still further embodiments, the present invention concerns
immunodetection methods for binding, purifying, removing,
quantifying or otherwise generally detecting biological components.
The encoded proteins or peptides of the present invention may be
employed to detect antibodies having reactivity therewith, or,
alternatively, antibodies prepared in accordance with the present
invention, may be employed to detect the encoded proteins or
peptides. The steps of various useful immunodetection methods have
been described in the scientific literature, such as, e.g.,
Nakamura et al. (1987).
[0159] In general, the immunobinding methods include obtaining a
sample suspected of containing a protein, peptide or antibody, and
contacting the sample with an antibody or protein or peptide in
accordance with the present invention, as the case may be, under
conditions effective to allow the formation of immunocomplexes.
[0160] The immunobinding methods include methods for detecting or
quantifying the amount of a reactive component in a sample, which
methods require the detection or quantitation of any immune
complexes formed during the binding process. Here, one would obtain
a sample suspected of containing a prostate disease, bladder cancer
or breast cancer marker encoded protein, peptide or a corresponding
antibody, and contact the sample with an antibody or encoded
protein or peptide, as the case may be, and then detect or quantify
the amount of immune complexes formed under the specific
conditions.
[0161] In terms of antigen detection, the biological sample
analyzed may be any sample that is suspected of containing a
prostate, bladder or breast cancer-specificantigen, such as a
prostate, bladder, breast, or lymph node tissue section or
specimen, a homogenized tissue extract, an isolated cell, a cell
membrane preparation, separated or purified forms of any of the
above protein-containing compositions, or even any biological fluid
that comes into contact with prostate, bladder or breast tissues,
including blood, lymphatic fluid, and even seminal or lactary
fluids.
[0162] Contacting the chosen biological sample with the protein,
peptide or antibody under conditions effective and for a period of
time sufficient to allow the formation of immune complexes (primary
immune complexes) is generally a matter of simply adding the
composition to the sample and incubating the mixture for a period
of time long enough for the antibodies to form immune complexes
with, i.e., to bind to, any antigens present. After this time, the
sample-antibody composition, such as a tissue section, ELISA plate,
dot blot or Western blot, will generally be washed to remove any
non-specifically bound antibody species, allowing only those
antibodies specifically bound within the primary immune complexes
to be detected.
[0163] In general, the detection of immunocomplex formation is well
known in the art and may be achieved through the application of
numerous approaches. These methods are generally based upon the
detection of a label or marker, such as any radioactive,
fluorescent, biological or enzymatic tags or labels of standard use
in the art. U.S. Patents concerning the use of such labels include
U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149 and 4,366,241, each incorporated herein by
reference. Of course, one may find additional advantages through
the use of a secondary binding ligand such as a second antibody or
a biotin/avidin ligand binding arrangement, as is known in the
art.
[0164] The encoded protein, peptide or corresponding antibody
employed in the detection may itself be linked to a detectable
label, wherein one would then simply detect this label, thereby
allowing the amount of the primary immune complexes in the
composition to be determined.
[0165] Alternatively, the first added component that becomes bound
within the primary immune complexes may be detected by means of a
second binding ligand that has binding affinity for the encoded
protein, peptide or corresponding antibody. In these cases, the
second binding ligand may be linked to a detectable label. The
second binding ligand is itself often an antibody, which may thus
be termed a "secondary" antibody. The primary immune complexes are
contacted with the labeled, secondary binding ligand, or antibody,
under conditions effective and for a period of time sufficient to
allow the formation of secondary immune complexes. The secondary
immune complexes are then generally washed to remove any
non-specifically bound labeled secondary antibodies or ligands, and
the remaining label in the secondary immune complexes is then
detected.
[0166] Further methods include the detection of primary immune
complexes by a two step approach. A second binding ligand, such as
an antibody, that has binding affinity for the encoded protein,
peptide or corresponding antibody is used to form secondary immune
complexes, as described above. After washing, the secondary immune
complexes are contacted with a third binding ligand or antibody
that has binding affinity for the second antibody, again under
conditions effective and for a period of time sufficient to allow
the formation of immune complexes (tertiary immune complexes). The
third ligand or antibody is linked to a detectable label, allowing
detection of the tertiary immune complexes thus formed. This system
may provide for signal amplification if this is desired.
[0167] The immunodetection methods of the present invention have
evident utility in the diagnosis of conditions such as prostate
cancer, benign prostate hyperplasia, bladder cancer and breast
cancer. Here, a biological or clinical sample suspected of
containing either the encoded protein or peptide or corresponding
antibody is used. However, these embodiments also have applications
to non-clinical samples, such as in the titering of antigen or
antibody samples, in the selection of hybridomas, and the like.
[0168] In the clinical diagnosis or monitoring of patients with
prostate cancer, the detection of an antigen encoded by a prostate
cancer marker nucleic acid, or an increase in the levels of such an
antigen, in comparison to the levels in a corresponding biological
sample from a normal subject is indicative of a patient with
prostate cancer. The basis for such diagnostic methods lies, in
part, with the finding that the nucleic acid prostate cancer
markers identified in the present invention are overexpressed in
prostate cancer tissue samples (see Examples below). By extension,
it may be inferred that at least some of these markers produce
elevated levels of encoded proteins, that may also be used as
prostate cancer markers.
[0169] In the clinical diagnosis or monitoring of patients with
breast cancer, the detection of an antigen encoded by a breast
cancer marker nucleic acid, or an increase in the levels of such an
antigen, in comparison to the levels in a corresponding biological
sample from a normal subject is indicative of a patient with breast
cancer. The basis for such diagnostic methods lies, in part, with
the finding that the nucleic acid breast cancer marker identified
in the present invention are overexpressed in breast cancer tissue
samples (see Examples below). By extension, it may be inferred that
this marker produces elevated levels of encoded protein, that may
also be used as a breast cancer marker.
[0170] In the clinical diagnosis or monitoring of patients with
bladder cancer, the detection of an antigen encoded by a bladder
cancer marker nucleic acid, or an increase in the levels of such an
antigen, in comparison to the levels in a corresponding biological
sample from a normal subject is indicative of a patient with
bladder cancer. The basis for such diagnostic methods lies, in
part, with the finding that the nucleic acid bladder cancer marker
identified in the present invention are overexpressed in bladder
cancer tissue samples (see Examples below). By extension, it may be
inferred that this marker produces elevated levels of encoded
protein, that may also be used as a bladder cancer marker.
[0171] Those of skill in the art are very familiar with
differentiating between significant expression of a biomarker,
which represents a positive identification, and low level or
background expression of a biomarker. Indeed, background expression
levels are often used to form a "cut-off" above which increased
staining will be scored as significant or positive. Significant
expression may be represented by high levels of antigens in tissues
or within body fluids, or alternatively, by a high proportion of
cells from within a tissue that each give a positive signal.
[0172] 2. Immunohistochemistry
[0173] The antibodies of the present invention may be used in
conjunction with both fresh-frozen and formalin-fixed,
paraffin-embedded tissue blocks prepared by
immunohistochemistry(IHC). Any IHC method well known in the art may
be used such as those described in Diagnostic Immunopathology, 2nd
edition. edited by, Robert B. Colvin, Atul K. Bhan and Robert T.
McCluskey. Raven Press, New York., 1995, (incorporated herein by
reference) and in particular, Chapter 31 of that reference entitled
Gynecological and Genitourinary Tumors (pages 579-597), by Debra A.
Bell, Robert H. Young and Robert E. Scully and references
therein.
[0174] 3. ELISA
[0175] As noted, it is contemplated that the encoded proteins or
peptides of the invention will find utility as immunogens, e.g., in
connection with vaccine development, in immunohistochemistry and in
ELISA assays. One evident utility of the encoded antigens and
corresponding antibodies is in immunoassays for the detection of
prostate disease, bladder cancer or breast cancer marker proteins,
as needed in diagnosis and prognostic monitoring.
[0176] Immunoassays, in their most simple and direct sense, are
binding assays. Certain preferred immunoassays are the various
types of enzyme linked immunosorbent assays (ELISAs) and
radioimmunoassays (RIA) known in the art. Immunohistochemical
detection using tissue sections is also particularly useful.
However, it will be readily appreciated that detection is not
limited to such techniques, and Western blotting, dot blotting,
FACS analyses, and the like may also be used.
[0177] In one exemplary ELISA, antibodies binding to the encoded
proteins of the invention are immobilized onto a selected surface
exhibiting protein affinity, such as a well in a polystyrene
microtiter plate. Then, a test composition suspected of containing
the prostate disease, bladder cancer or breast cancer marker
antigen, such as a clinical sample, is added to the wells. After
binding and washing to remove non-specifically bound
immunecomplexes, the bound antigen may be detected. Detection is
generally achieved by the addition of a second antibody specific
for the target protein, that is linked to a detectable label. This
type of ELISA is a simple "sandwich ELISA". Detection may also be
achieved by the addition of a second antibody, followed by the
addition of a third antibody that has binding affinity for the
second antibody, with the third antibody being linked to a
detectable label.
[0178] In another exemplary ELISA, the samples suspected of
containing the prostate disease, bladder cancer or breast cancer
marker antigen are immobilized onto the well surface and then
contacted with the antibodies of the invention. After binding and
washing to remove non-specifically bound immunecomplexes, the bound
antigen is detected. Where the initial antibodies are linked to a
detectable label, the immunecomplexes may be detected directly.
Again, the immunecomplexes may be detected using a second antibody
that has binding affinity for the first antibody, with the second
antibody being linked to a detectable label.
[0179] Another ELISA in which the proteins or peptides are
immobilized, involves the use of antibody competition in the
detection. In this ELISA, labeled antibodies are added to the
wells, allowed to bind to the prostate disease, bladder cancer or
breast cancer marker protein, and detected by means of their label.
The amount of marker antigen in an unknown sample is then
determined by mixing the sample with the labeled antibodies before
or during incubation with coated wells. The presence of marker
antigen in the sample acts to reduce the amount of antibody
available for binding to the well and thus reduces the ultimate
signal. This is appropriate for detecting antibodies in an unknown
sample, where the unlabeled antibodies bind to the antigen-coated
wells and also reduces the amount of antigen available to bind the
labeled antibodies.
[0180] Irrespective of the format employed, ELISAs have certain
features in common, such as coating, incubating or binding, washing
to remove non-specifically bound species, and detecting the bound
immunecomplexes. These are described as follows:
[0181] In coating a plate with either antigen or antibody, one will
generally incubate the wells of the plate with a solution of the
antigen or antibody, either overnight or for a specified period of
hours. The wells of the plate will then be washed to remove
incompletely adsorbed material. Any remaining available surfaces of
the wells are then "coated" with a nonspecific protein that is
antigenically neutral with regard to the test antisera. These
include bovine serum albumin (BSA), casein and solutions of milk
powder. The coating allows for blocking of nonspecific adsorption
sites on the immobilizing surface and thus reduces the background
caused by nonspecific binding of antisera onto the surface.
[0182] In ELISAs, it is probably more customary to use a secondary
or tertiary detection means rather than a direct procedure. Thus,
after binding of a protein or antibody to the well, coating with a
non-reactive material to reduce background, and washing to remove
unbound material, the immobilizing surface is contacted with the
control human prostate, bladder or breast cancer and/or clinical or
biological sample to be tested under conditions effective to allow
immunecomplex (antigen/antibody) formation. Detection of the
immunecomplex then requires a labeled secondary binding ligand or
antibody, or a secondary binding ligand or antibody in conjunction
with a labeled tertiary antibody or third binding ligand.
[0183] "Under conditions effective to allow immunecomplex
(antigen/antibody) formation" means that the conditions preferably
include diluting the antigens and antibodies with solutions such as
BSA, bovine gamma globulin (BGG) and phosphate buffered saline
(PBS)/Tween. These added agents also tend to assist in the
reduction of nonspecific background.
[0184] The "suitable" conditions also mean that the incubation is
at a temperature and for a period of time sufficient to allow
effective binding. Incubation steps are typically from about 1 to 2
to 4 hours, at temperatures preferably on the order of 25.degree.
to 27.degree. C., or may be overnight at about 4.degree. C. or
so.
[0185] Following all incubation steps in an ELISA, the contacted
surface is washed so as to remove non-complexed material. A
preferred washing procedure includes washing with a solution such
as PBS/Tween, or borate buffer. Following the formation of specific
immunecomplexes between the test sample and the originally bound
material, and subsequent washing, the occurrence of even minute
amounts of immunecomplexes may be determined.
[0186] To provide a detecting means, the second or third antibody
will have an associated label to allow detection. Preferably, this
will be an enzyme that will generate color development upon
incubating with an appropriate chromogenic substrate. Thus, for
example, one will desire to contact and incubate the first or
second immunecomplex with a urease, glucose oxidase, alkaline
phosphatase or hydrogen peroxidase-conjugated antibody for a period
of time and under conditions that favor the development of further
immunecomplex formation (e.g., incubation for 2 hours at room
temperature in a PBS-containing solution such as PBS-Tween).
[0187] After incubation with the labeled antibody, and subsequent
to washing to remove unbound material, the amount of label is
quantified, e.g., by incubation with a chromogenic substrate such
as urea and bromocresol purple or
2,2'-azido-di-(3-ethyl-benzthiazoline-6-sulfonic acid [ABTS] and
H.sub.2O.sub.2, in the case of peroxidase as the enzyme label.
Quantitation is then achieved by measuring the degree of color
generation, e.g., using a visible spectra spectrophotometer.
[0188] 4 Use of Antibodies for Radioimaging
[0189] The antibodies of this invention will be used to quantify
and localize the expression of the encoded marker proteins. The
antibody, for example, will be labeled by any one of a variety of
methods and used to visualize the localized concentration of the
cells producing the encoded protein.
[0190] The invention also relates to an in vivo method of imaging a
pathological prostate, bladder or breast cancer condition using the
above described monoclonal antibodies. Specifically, this method
involves administering to a subject an imaging-effective amount of
a detectably-labeled prostate, bladder or breast cancer-specific
monoclonal antibody or fragment thereof and a pharmaceutically
effective carrier and detecting the binding of the labeled
monoclonal antibody to the diseased tissue. The term "in vivo
imaging" refers to any method which permits the detection of a
labeled monoclonal antibody of the present invention or fragment
thereof that specifically binds to a diseased tissue located in the
subject's body. A "subject" is a mammal, preferably a human. An
"imaging effective amount" means that the amount of the
detectably-labeled monoclonal antibody, or fragment thereof,
administered is sufficient to enable detection of binding of the
monoclonal antibody or fragment thereof to the diseased tissue.
[0191] A factor to consider in selecting a radionuclide for in vivo
diagnosis is that the half-life of a nuclide be long enough so that
it is still detectable at the time of maximum uptake by the target,
but short enough so that deleterious radiation upon the host, as
well as background, is minimized. Ideally, a radionuclide used for
in vivo imaging will lack a particulate emission, but produce a
large number of photons in a 140-2000 keV range, which may be
readily detected by conventional gamma cameras.
[0192] A radionuclide may be bound to an antibody either directly
or indirectly by using an intermediary functional group.
Intermediary functional groups which are often used to bind
radioisotopes which exist as metallic ions to antibody are
diethylenetriaminepentaacetic acid (DTPA) and ethylene
diaminetetracetic acid (EDTA). Examples of metallic ions suitable
for use in this invention are .sup.99mTc, .sup.123I, .sup.131I,
.sup.111In, .sup.131I, .sup.97Ru, .sup.67Cu, .sup.67Ga, .sup.125I,
.sup.68Ga, .sup.72As, .sup.89Zr, and .sup.201Tl.
[0193] In accordance with this invention, the monoclonal antibody
or fragment thereof may be labeled by any of several techniques
known to the art. The methods of the present invention may also use
paramagnetic isotopes for purposes of in vivo detection. Elements
particularly useful in Magnetic Resonance Imaging ("MRI") include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Cr, and .sup.56Fe.
[0194] Administration of the labeled antibody may be local or
systemic and accomplished intravenously, intraarterially, via the
spinal fluid or the like. Administration may also be intradermal or
intracavitary, depending upon the body site under examination.
After a sufficient time has lapsed for the monoclonal antibody or
fragment thereof to bind with the diseased tissue, for example 30
minutes to 48 hours, the area of the subject under investigation is
examined by routine imaging techniques such as MRI, SPECT, planar
scintillation imaging and emerging imaging techniques, as well. The
exact protocol will necessarily vary depending upon factors
specific to the patient, as noted above, and depending upon the
body site under examination, method of administration and type of
label used; the determination of specific procedures would be
routine to the skilled artisan. The distribution of the bound
radioactive isotope and its increase or decrease with time is then
monitored and recorded. By comparing the results with data obtained
from studies of clinically normal individuals, the presence and
extent of the diseased tissue may be determined.
[0195] It will be apparent to those of skill in the art that a
similar approach may be used to radio-image the production of the
encoded prostate disease, bladder cancer or breast cancer marker
proteins in human patients. The present invention provides methods
for the in vivo diagnosis of prostate, bladder or breast cancer in
a patient. Such methods generally comprise administering to a
patient an effective amount of a prostate, bladder or breast cancer
specific antibody, which antibody is conjugated to a marker, such
as a radioactive isotope or a spin-labeled molecule, that is
detectable by non-invasive methods. The antibody-marker conjugate
is allowed sufficient time to come into contact with reactive
antigens that be present within the tissues of the patient, and the
patient is then exposed to a detection device to identify the
detectable marker.
[0196] 5. Kits
[0197] In still further embodiments, the present invention concerns
immunodetection kits for use with the immunodetection methods
described above. As the encoded proteins or peptides may be
employed to detect antibodies and the corresponding antibodies may
be employed to detect encoded proteins or peptides, either or both
of such components may be provided in the kit. The immunodetection
kits will thus comprise, in suitable container means, an encoded
protein or peptide, or a first antibody that binds to an encoded
protein or peptide, and an immunodetection reagent.
[0198] In certain embodiments, the encoded protein or peptide, or
the first antibody that binds to the encoded protein or peptide,
may be bound to a solid support, such as a column matrix or well of
a microtiter plate.
[0199] The immunodetection reagents of the kit may take any one of
a variety of forms, including those detectable labels that are
associated with or linked to the given antibody or antigen, and
detectable labels that are associated with or attached to a
secondary binding ligand. Exemplary secondary ligands are those
secondary antibodies that have binding affinity for the first
antibody or antigen, and secondary antibodies that have binding
affinity for a human antibody.
[0200] Further suitable immunodetection reagents for use in the
present kits include the two-component reagent that comprises a
secondary antibody that has binding affinity for the first antibody
or antigen, along with a third antibody that has binding affinity
for the second antibody, the third antibody being linked to a
detectable label.
[0201] The kits may further comprise a suitably aliquoted
composition of the encoded protein or polypeptide antigen, whether
labeled or unlabeled, as may be used to prepare a standard curve
for a detection assay.
[0202] The kits may contain antibody-label conjugates either in
fully conjugated form, in the form of intermediates, or as separate
moieties to be conjugated by the user of the kit. The components of
the kits may be packaged either in aqueous media or in lyophilized
form.
[0203] The container means of the kits will generally include at
least one vial, test tube, flask, bottle, syringe or other
container means, into which the antibody or antigen may be placed,
and preferably, suitably aliquoted. Where a second or third binding
ligand or additional component is provided, the kit will also
generally contain a second, third or other additional container
into which this ligand or component may be placed. The kits of the
present invention will also typically include a means for
containing the antibody, antigen, and any other reagent containers
in close confinement for commercial sale. Such containers may
include injection or blow-molded plastic containers into which the
desired vials are retained.
[0204] E. Detection and Quantitation of RNA Species
[0205] One embodiment of the instant invention comprises a method
for identification of prostate, bladder or breast cancer cells in a
biological sample by amplifying and detecting nucleic acids
corresponding to prostate, bladder or breast cancer cell markers.
The biological sample may be any tissue or fluid in which prostate,
bladder or breast cancer cells might be present. Various
embodiments include bone marrow aspirate, bone marrow biopsy, lymph
node aspirate, lymph node biopsy, spleen tissue, fine needle
aspirate, skin biopsy or organ tissue biopsy. Other embodiments
include samples where the body fluid is peripheral blood, lymph
fluid, ascites, serous fluid, pleural effusion, sputum,
cerebrospinal fluid, lacrimal fluid, stool or urine.
[0206] Nucleic acid used as a template for amplification is
isolated from cells contained in the biological sample, according
to standard methodologies. (Sambrook et al., 1989) The nucleic acid
may be genomic DNA or fractionated or whole cell RNA. Where RNA is
used, it may be desired to convert the RNA to a complementary cDNA.
In one embodiment, the RNA is whole cell RNA and is used directly
as the template for amplification.
[0207] Pairs of primers that selectively hybridize to nucleic acids
corresponding to prostate, bladder or breast cancer specific
markers are contacted with the isolated nucleic acid under
conditions that permit selective hybridization. Once hybridized,
the nucleic acid:primer complex is contacted with one or more
enzymes that facilitate template-dependent nucleic acid synthesis.
Multiple rounds of amplification, also referred to as "cycles," are
conducted until a sufficient amount of amplification product is
produced.
[0208] Next, the amplification product is detected. In certain
applications, the detection may be performed by visual means.
Alternatively, the detection may involve indirect identification of
the product via chemiluminescence, radioactive scintigraphy of
incorporated radiolabel or fluorescent label or even via a system
using electrical or thermal impulse signals (Affymax technology;
Bellus, 1994).
[0209] Following detection, one may compare the results seen in a
given patient with a statistically significant reference group of
normal patients and prostate, bladder or breast cancer patients. In
this way, it is possible to correlate the amount of marker detected
with various clinical states.
[0210] 1. Primers
[0211] The term primer, as defined herein, is meant to encompass
any nucleic acid that is capable of priming the synthesis of a
nascent nucleic acid in a template-dependent process. Typically,
primers are oligonucleotides from ten to twenty base pairs in
length, but longer sequences may be employed. Primers may be
provided in double-stranded or single-stranded form, although the
single-stranded form is preferred.
[0212] 2. Template Dependent Amplification Methods
[0213] A number of template dependent processes are available to
amplify the marker sequences present in a given template sample.
One of the best known amplification methods is the polymerase chain
reaction (referred to as PCR) which is described in detail in U.S.
Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al.,
1990, each of which is incorporated herein by reference in its
entirety.
[0214] Briefly, in PCR, two primer sequences are prepared which are
complementary to regions on opposite complementary strands of the
marker sequence. An excess of deoxynucleoside triphosphates are
added to a reaction mixture along with a DNA polymerase, e.g., Taq
polymerase. If the marker sequence is present in a sample, the
primers will bind to the marker and the polymerase will cause the
primers to be extended along the marker sequence by adding on
nucleotides. By raising and lowering the temperature of the
reaction mixture, the extended primers will dissociate from the
marker to form reaction products, excess primers will bind to the
marker and to the reaction products and the process is
repeated.
[0215] A reverse transcriptase PCR amplification procedure may be
performed in order to quantify the amount of mRNA amplified.
Methods of reverse transcribing RNA into cDNA are well known and
described in Sambrook et al., 1989. Alternative methods for reverse
transcription utilize thermostable DNA polymerases. These methods
are described in WO 90/07641 filed Dec. 21, 1990. Polymerase chain
reaction methodologies are well known in the art. The most
preferred methods of RT-PCR are as described herein in Example
1.
[0216] Another method for amplification is the ligase chain
reaction ("LCR"), disclosed in European Application No. 320 308,
incorporated herein by reference in its entirely. In LCR, two
complementary probe pairs are prepared, and in the presence of the
target sequence, each pair will bind to opposite complementary
strands of the target such that they abut. In the presence of a
ligase, the two probe pairs will link to form a single unit. By
temperature cycling, as in PCR, bound ligated units dissociate from
the target and then serve as "target sequences" for ligation of
excess probe pairs. U.S. Pat. No. 4,883,750 describes a method
similar to LCR for binding probe pairs to a target sequence.
[0217] Qbeta Replicase, described in PCT Application No.
PCT/US87/00880, may also be used as still another amplification
method in the present invention. In this method, a replicative
sequence of RNA which has a region complementary to that of a
target is added to a sample in the presence of an RNA polymerase.
The polymerase will copy the replicative sequence which may then be
detected.
[0218] An isothermal amplification method, in which restriction
endonucleases and ligases are used to achieve the amplification of
target molecules that contain nucleotide
5'-[alpha-thio]-triphosphatesin one strand of a restriction site
may also be useful in the amplification of nucleic acids in the
present invention. Walker et al., Proc. Nat'l Acad. Sci. USA
89:392-396 (1992), incorporated herein by reference in its
entirety.
[0219] Strand Displacement Amplification (SDA) is another method of
carrying out isothermal amplification of nucleic acids which
involves multiple rounds of strand displacement and synthesis,
i.e., nick translation. A similar method, called Repair Chain
Reaction (RCR), involves annealing several probes throughout a
region targeted for amplification, followed by a repair reaction in
which only two of the four bases are present. The other two bases
may be added as biotinylated derivatives for easy detection. A
similar approach is used in SDA. Target specific sequences may also
be detected using a cyclic probe reaction (CPR). In CPR, a probe
having 3' and 5' sequences of non-specific DNA and a middle
sequence of specific RNA is hybridized to DNA which is present in a
sample. Upon hybridization, the reaction is treated with RNase H,
and the products of the probe identified as distinctive products
which are released after digestion. The original template is
annealed to another cycling probe and the reaction is repeated.
[0220] Still other amplification methods described in GB
Application No. 2 202 328, and in PCT Application No.
PCT/US89/01025, each of which is incorporated herein by reference
in its entirety, may be used in accordance with the present
invention. In the former application, "modified" primers are used
in a PCR like, template and enzyme dependent synthesis. The primers
may be modified by labeling with a capture moiety (e.g., biotin)
and/or a detector moiety (e.g., enzyme). In the latter application,
an excess of labeled probes are added to a sample. In the presence
of the target sequence, the probe binds and is cleaved
catalytically. After cleavage, the target sequence is released
intact to be bound by excess probe. Cleavage of the labeled probe
signals the presence of the target sequence.
[0221] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR. Kwoh et al.,
Proc. Nat'l Acad. Sci. USA 86:1173 (1989); Gingeras et al., PCT
Application WO 88/10315, incorporated herein by reference in their
entirety. In NASBA, the nucleic acids may be prepared for
amplification by standard phenol/chloroform extraction, heat
denaturation of a clinical sample, treatment with lysis buffer and
minispin columns for isolation of DNA and RNA or guanidinium
chloride extraction of RNA. These amplification techniques involve
annealing a primer which has target specific sequences. Following
polymerization, DNA/RNA hybrids are digested with RNase H while
double stranded DNA molecules are heat denatured again. In either
case the single stranded DNA is made fully double stranded by
addition of second target specific primer, followed by
polymerization. The double-stranded DNA molecules are then multiply
transcribed by a polymerase such as T7 or SP6. In an isothermal
cyclic reaction, the RNA's are reverse transcribed into double
stranded DNA, and transcribed once against with a polymerase such
as T7 or SP6. The resulting products, whether truncated or
complete, indicate target specific sequences.
[0222] Davey et al., European Application No. 329 822 (incorporated
herein by reference in its entirely) disclose a nucleic acid
amplification process involving cyclically synthesizing
single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA
(dsDNA), which may be used in accordance with the present
invention. The ssRNA is a first template for a first primer
oligonucleotide, which is elongated by reverse transcriptase
(RNA-dependent DNA polymerase). The RNA is then removed from the
resulting DNA:RNA duplex by the action of ribonuclease H (RNase H,
an RNase specific for RNA in duplex with either DNA or RNA). The
resultant ssDNA is a second template for a second primer, which
also includes the sequences of an RNA polymerase promoter
(exemplified by T7 RNA polymerase) 5' to its homology to the
template. This primer is then extended by DNA polymerase
(exemplified by the large "Klenow" fragment of E. coli DNA
polymerase I), resulting in a double-stranded DNA ("dsDNA")
molecule, having a sequence identical to that of the original RNA
between the primers and having additionally, at one end, a promoter
sequence. This promoter sequence may be used by the appropriate RNA
polymerase to make many RNA copies of the DNA. These copies may
then re-enter the cycle leading to very swift amplification. With
proper choice of enzymes, this amplification may be done
isothermally without addition of enzymes at each cycle. Because of
the cyclical nature of this process, the starting sequence may be
chosen to be in the form of either DNA or RNA.
[0223] Miller et al., PCT Application WO 89/06700 (incorporated
herein by reference in its entirety) disclose a nucleic acid
sequence amplification scheme based on the hybridization of a
promoter/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts. Other amplification methods include
"race" and "one-sided PCR." Frohman, M. A., In: PCR PROTOCOLS: A
GUIDE TO METHODS AND APPLICATIONS, Academic Press, N.Y. (1990) and
Ohara et al., Proc. Nat'l Acad. Sci. USA, 86:5673-5677 (1989), each
herein incorporated by reference in their entirety.
[0224] Methods based on ligation of two (or more) oligonucleotides
in the presence of nucleic acid having the sequence of the
resulting "di-oligonucleotide", thereby amplifying the
di-oligonucleotide, may also be used in the amplification step of
the present invention. Wu et al., Genomics 4:560 (1989),
incorporated herein by reference in its entirety.
[0225] 3. Separation Methods
[0226] Following amplification, it may be desirable to separate the
amplification product from the template and the excess primer for
the purpose of determining whether specific amplification has
occurred. In one embodiment, amplification products are separated
by agarose, agarose-acrylamide or polyacrylamide gel
electrophoresis using standard methods. See Sambrook et al.,
1989.
[0227] Alternatively, chromatographic techniques may be employed to
effect separation. There are many kinds of chromatography which may
be used in the present invention: adsorption, partition,
ion-exchange and molecular sieve, and many specialized techniques
for using them including column, paper, thin-layer and gas
chromatography (Freifelder, 1982).
[0228] 4. Identification Methods
[0229] Amplification products must be visualized in order to
confirm amplification of the marker sequences. One typical
visualization method involves staining of a gel with ethidium
bromide and visualization under UV light. Alternatively, if the
amplification products are integrally labeled with radio- or
fluorometrically-labeled nucleotides, the amplification products
may then be exposed to x-ray film or visualized under the
appropriate stimulating spectra, following separation.
[0230] In one embodiment, visualization is achieved indirectly.
Following separation of amplification products, a labeled, nucleic
acid probe is brought into contact with the amplified marker
sequence. The probe preferably is conjugated to a chromophore but
may be radiolabeled. In another embodiment, the probe is conjugated
to a binding partner, such as an antibody or biotin, where the
other member of the binding pair carries a detectable moiety.
[0231] In one embodiment, detection is by Southern blotting and
hybridization with a labeled probe. The techniques involved in
Southern blotting are well known to those of skill in the art and
may be found in many standard books on molecular protocols. See
Sambrook et al., 1989. Briefly, amplification products are
separated by gel electrophoresis. The gel is then contacted with a
membrane, such as nitrocellulose, permitting transfer of the
nucleic acid and non-covalent binding. Subsequently, the membrane
is incubated with a chromophore-conjugated probe that is capable of
hybridizing with a target amplification product. Detection is by
exposure of the membrane to x-ray film or ion-emitting detection
devices.
[0232] One example of the foregoing is described in U.S. Pat. No.
5,279,721, incorporated by reference herein, which discloses an
apparatus and method for the automated electrophoresis and transfer
of nucleic acids. The apparatus permits electrophoresis and
blotting without external manipulation of the gel and is ideally
suited to carrying out methods according to the present
invention.
[0233] 5. Kit Components
[0234] All the essential materials and reagents required for
detecting prostate disease, bladder cancer or breast cancer markers
in a biological sample may be assembled together in a kit. The kit
generally will comprise preselected primer pairs for one or more
specific markers. For example a kit may include primers to detect
RNA markers of normal tissue, BPH tissue, confined tumor tissue or
metastically progressive tumor tissue, or any combination of these.
Also included may be enzymes suitable for amplifying nucleic acids
including various polymerases (RT, Taq, etc.), deoxynucleotides and
buffers to provide the necessary reaction mixture for
amplification. Preferred kits may also comprise primers for the
detection of a control, non-differentially expressed RNA such as
.beta.-actin, for example.
[0235] The kits generally will comprise, in suitable means,
distinct containers for each individual reagent and enzyme as well
as for each marker primer pair. Preferred pairs of primers for
amplifying nucleic acids are selected to amplify the sequences
designated herein as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ
ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20,
SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45, SEQ ID
NO:46, SEQ ID NO:47, SEQ ID NO:83 or SEQ ID NO:85.
[0236] In certain embodiments, kits will comprise hybridization
probes specific for differentially expressed markers. The probes
are designed to hybridize to a sequence or a complement of a
sequence designated herein as SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:83 or SEQ ID NO:85.
Such kits generally will comprise, in suitable means for close
confinement, distinct containers for each individual reagent and
enzyme as well as for each marker hybridization probe.
[0237] F. Use of RNA Fingerprinting to Identify Markers of Prostate
Disease, Bladder Cancer or Breast Cancer
[0238] RNA fingerprinting is a means by which RNAs isolated from
many different tissues, cell types or treatment groups may be
sampled simultaneously to identify RNAs whose relative abundances
vary. Two forms of this technology were developed simultaneously
and reported in 1992 as RNA fingerprinting by differential display
(Liang and Pardee, 1992; Welsh et al., 1992). (See also Liang and
Pardee, U.S. Pat. No. 5,262,311, incorporated herein by reference
in its entirety.) Both techniques were utilized in the studies
described below. Some of the studies described herein were
performed similarly to Donahue et al., J. Biol. Chem. 269:
8604-8609,1994.
[0239] All forms of RNA fingerprinting by PCR are theoretically
similar but differ in their primer design and application. The most
striking difference between differential display and other methods
of RNA fingerprinting is that differential display utilizes
anchoring primers that hybridize to the poly A tails of mRNAs. As a
consequence, the PCR products amplified in differential display are
biased towards the 3' untranslated regions of mRNAs.
[0240] The basic technique of differential display has been
described in detail (Liang and Pardee, 1992). Total cell RNA is
primed for first strand reverse transcription with an anchoring
primer composed of oligo dT. The oligo dT primer is extended using
a reverse transcriptase, for example, Moloney Murine Leukemia Virus
(MMLV) reverse transcriptase. The synthesis of the second strand is
primed with an arbitrarily chosen oligonucleotide, using reduced
stringency conditions. Once the double-stranded cDNA has been
synthesized, amplification proceeds by standard PCR techniques,
utilizing the same primers. The resulting DNA fingerprint is
analyzed by gel electrophoresis and ethidium bromide staining or
autoradiography. A side by side comparison of fingerprints obtained
from different cell derived RNAs using the same oligonucleotide
primers identifies mRNAs that are differentially expressed.
[0241] RNA fingerprinting technology has been demonstrated as being
effective in identifying genes that are differentially expressed in
cancer (Liang et al., 1992; Wong et al., 1993; Sager et al., 1993;
Mok et al., 1994; Watson et al., 1994; Chen et al., 1995; An et
al., 1995). The present invention utilizes the RNA fingerprinting
technique to identify genes that are differentially expressed in
prostate, bladder or breast cancer. These studies utilized RNAs
isolated from tumor tissues and tumor-derived cell lines that
behave as tumors cells with different metastatic potential.
[0242] The underlying concept of these studies was that genes that
are differentially expressed in cells with different metastatic
potentials may be used as indicators of metastatic potential. Since
metastasis is a prerequisite for prostate, bladder or breast cancer
progression to life threatening pathologies, indicators of
metastatic potential are likely to be indicators of pathological
potential.
[0243] G. Design and Theoretical Considerations for Relative
Quantitative RT-PCR
[0244] Reverse transcription (RT) of RNA to cDNA followed by
relative quantitative PCR (RT-PCR) may be used to determine the
relative concentrations of specific mRNA species in a series of
total cell RNAs isolated from normal, benign and cancerous
prostate, bladder or breast tissues. By determining that the
concentration of a specific mRNA species varies, it is shown that
the gene encoding the specific mRNA species is differentially
expressed. This technique may be used to confirm that mRNA
transcripts shown to be differentially regulated by RNA
fingerprinting are differentially expressed in prostate, bladder or
breast cancer progression.
[0245] In PCR, the number of molecules of the amplified target DNA
increase by a factor approaching two with every cycle of the
reaction until some reagent becomes limiting. Thereafter, the rate
of amplification becomes increasingly diminished until there is not
an increase in the amplified target between cycles. If one plots a
graph on which the cycle number is on the X axis and the log of the
concentration of the amplified target DNA is on the Y axis, one
observes that a curved line of characteristic shape is formed by
connecting the plotted points. Beginning with the first cycle, the
slope of the line is positive and constant. This is said to be the
linear portion of the curve. After some reagent becomes limiting,
the slope of the line begins to decrease and eventually becomes
zero. At this point the concentration of the amplified target DNA
becomes asymptotic to some fixed value. This is said to be the
plateau portion of the curve.
[0246] The concentration of the target DNA in the linear portion of
the PCR is directly proportional to the starting concentration of
the target before the PCR was begun. By determining the
concentration of the PCR products of the target DNA in PCR
reactions that have completed the same number of cycles and are in
their linear ranges, it is possible to determine the relative
concentrations of the specific target sequence in the original DNA
mixture. If the DNA mixtures are cDNAs synthesized from RNAs
isolated from different tissues or cells, the relative abundances
of the specific mRNA from which the target sequence was derived may
be determined for the respective tissues or cells. This direct
proportionality between the concentration of the PCR products and
the relative mRNA abundances is only true in the linear range
portion of the PCR reaction.
[0247] The final concentration of the target DNA in the plateau
portion of the curve is determined by the availability of reagents
in the reaction mix and is independent of the original
concentration of target DNA. Therefore, the one condition that must
be met before the relative abundances of an mRNA species may be
determined by RT-PCR for a collection of RNA populations is that
the concentrations of the amplified PCR products must be sampled
when the PCR reactions are in the linear portion of their
curves.
[0248] A second condition that must be met for an RT-PCR study to
successfully determine the relative abundances of a particular mRNA
species is that relative concentrations of the amplifiable cDNAs
must be normalized to some independent standard. The goal of an
RT-PCR study is to determine the abundance of a particular mRNA
species relative to the average abundance of all mRNA species in
the sample. In the studies described below, mRNAs for B-actin,
asparagine synthetase and lipocortin II were used as external and
internal standards to which the relative abundance of other mRNAs
are compared.
[0249] Most protocols for competitive PCR utilize internal PCR
standards that are approximately as abundant as the target. These
strategies are effective if the products of the PCR amplifications
are sampled during their linear phases. If the products are sampled
when the reactions are approaching the plateau phase, then the less
abundant product becomes relatively over represented. Comparisons
of relative abundances made for many different RNA samples, such as
when examining RNA samples for differential expression, become
distorted in such a way as to make differences in relative
abundances of RNAs appear less than they actually are. This is not
a significant problem if the internal standard is much more
abundant than the target. If the internal standard is more abundant
than the target, then direct linear comparisons may be made between
RNA samples.
[0250] The discussion above describes the theoretical
considerations for an RT-PCR assay for clinically derived
materials. The problems inherent in clinical samples are that they
are of variable quantity (making normalization problematic), and
that they are of variable quality (necessitating the
co-amplification of a reliable internal control, preferably of
larger size than the target). Both of these problems are overcome
if the RT-PCR is performed as a relative quantitative RT-PCR with
an internal standard in which the internal standard is an
amplifiable cDNA fragment that is larger than the target cDNA
fragment and in which the abundance of the mRNA encoding the
internal standard is roughly 5-100 fold higher than the mRNA
encoding the target. This assay measures relative abundance, not
absolute abundance of the respective mRNA species.
[0251] Other studies described below were performed using a more
conventional relative quantitative RT-PCR with an external standard
protocol. These assays sample the PCR products in the linear
portion of their amplification curves. The number of PCR cycles
that are optimal for sampling must be empirically determined for
each target cDNA fragment. In addition, the reverse transcriptase
products of each RNA population isolated from the various tissue
samples must be carefully normalized for equal concentrations of
amplifiable cDNAs. This is very important since this assay measures
absolute mRNA abundance. Absolute mRNA abundance may be used as a
measure of differential gene expression only in normalized samples.
While empirical determination of the linear range of the
amplification curve and normalization of cDNA preparations are
tedious and time consuming processes, the resulting RT-PCR assays
may be superior to those derived from the relative quantitative
RT-PCR with an internal standard.
[0252] One reason for this is that without the internal
standard/competitor, all of the reagents may be converted into a
single PCR product in the linear range of the amplification curve,
increasing the sensitivity of the assay. Another reason is that
with only one PCR product, display of the product on an
electrophoretic gel or some other display method becomes less
complex, has less background and is easier to interpret.
[0253] H. Diagnosis and Prognosis of Human Cancer
[0254] In certain embodiments, the present invention allows the
diagnosis and prognosis of human prostate, bladder or breast cancer
by screening for marker nucleic acids. The field of cancer
diagnosis and prognosis is still uncertain. Various markers have
been proposed to be correlated with metastasis and malignancy. They
may be classified generally as cytologic, protein or nucleic acid
markers.
[0255] Cytologic markers include such things as "nuclear
roundedness" (Diamond et al., 1982) and cell ploidy. Protein
markers include prostate specific antigen (PSA) and CA125. Nucleic
acid markers have included amplification of Her2/neu, point
mutations in the p53 or ras genes, and changes in the sizes of
triplet repeat segments of particular chromosomes.
[0256] All of these markers exhibit certain drawbacks, associated
with false positives and false negatives. A false positive result
occurs when an individual without malignant cancer exhibits the
presence of a "cancer marker". For example, elevated serum PSA has
been associated with prostate carcinoma. However, it also occurs in
some individuals with non-malignant, benign hyperplasia of the
prostate. A false negative result occurs when an individual
actually has cancer, but the test fails to show the presence of a
specific marker. The incidence of false negatives varies for each
marker, and frequently also by tissue type. For example, ras point
mutations have been reported to range from a high of 95 percent in
pancreatic cancer to a low of zero percent in some gynecologic
cancers.
[0257] Additional problems arise when a marker is present only
within the transformed cell itself. Ras point mutations may only be
detected within the mutant cell, and are apparently not present in,
for example, the blood serum or urine of individuals with
ras-activated carcinomas. This means that, in order to detect a
malignant tumor, one must take a sample of the tumor itself, or its
metastatic cells. Since the object of cancer detection is to
identify and treat tumors before they metastasize, essentially one
must first identify and sample a tumor before the presence of the
cancer marker can be detected.
[0258] Finally, specific problems occur with markers that are
present in normal cells but absent in cancer cells. Most tumor
samples will contain mixed populations of both normal and
transformed cells. If one is searching for a marker that is present
in normal cells, but occurs at reduced levels in transformed cells,
the "background" signal from the normal cells in the sample may
mask the presence of transformed cells.
[0259] The ideal cancer marker would be one that is present in
malignant cancers, and either missing or else expressed at
significantly lower levels in benign tumors and normal cells.
Further, since any single marker would typically be present only in
some proportion of malignant cancers, it is better to have a number
of such markers for each cancer type. The present invention
addresses this need for prostate, bladder and breast cancer markers
by identifying several new nucleic acid markers that are expressed
at much higher levels in malignant prostate carcinoma than in
benign or normal prostate, as well as identifying a novel gene, UC
Band #28 (SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85) whose mRNA
transcripts are expressed at much higher levels in breast and
bladder cancer than in their normal tissues of origin. In
particular, the results for markers UC Band #28 (SEQ ID NO:3, SEQ
ID NO:83 and SEQ ID NO:85) and UC Band #33 (SEQ ID NO:5), discussed
in Examples 2 and 4 below, are quite promising in that these
markers are apparently only overexpressed in malignant tumors and
are present at very low levels in benign or normal prostate.
Further, these markers are significantly elevated in a high
percentage of human prostate cancers examined to date.
[0260] It is anticipated that in clinical applications, human
tissue samples will be screened for the presence of the markers of
prostate disease, bladder cancer or breast cancer identified
herein. Such samples could consist of needle biopsy cores, surgical
resection samples, lymph node tissue, or serum. In certain
embodiments, nucleic acids would be extracted from these samples
and amplified as described above. Some embodiments would utilize
kits containing pre-selected primer pairs or hybridization probes.
The amplified nucleic acids would be tested for the markers by, for
example, gel electrophoresis and ethidium bromide staining, or
Southern blotting, or a solid-phase detection means as described
above. These methods are well known within the art. The levels of
selected markers detected would be compared with statistically
valid groups of metastatic, non-metastatic malignant, benign or
normal prostate, bladder or breast samples. The diagnosis and
prognosis of the individual patient would be determined by
comparison with such groups.
[0261] Another embodiment of the present invention involves
application of RT-PCR techniques to detect circulating prostate,
bladder or breast cancer cells (ie., those that have already
metastasized), using probes and primers selected from sequences or
their complements designated herein as SEQ ID NO:1, SEQ ID NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8,
SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ
ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23,
SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:83 or SEQ ID
NO:85. Similar techniques have been described in PCT Patent
Application No. WO 94/10343, incorporated herein by reference.
[0262] In this embodiment, metastatic prostate, bladder or breast
cancer cells are detected in hematopoietic samples by amplification
of prostate, bladder or breast cancer-specific nucleic acid
sequences. Samples taken from blood or lymph nodes are treated as
described below to purify total cell RNA. The isolated RNA is
reverse transcribed using a reverse transcriptase and primers
selected to bind under high stringency conditions to a nucleic acid
sequence to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3,
SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9,
SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19, SEQ
ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:45,
SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:83 or SEQ ID NO:85. Following
reverse transcription, the resulting cDNAs are amplified using
standard PCR techniques (described below) and a thermostable DNA
polymerase.
[0263] The presence of amplification products corresponding to
prostate, bladder or breast cancer-marker nucleic acids may be
detected by several alternative means. In one embodiment, the
amplification product may be detected by gel electrophoresis and
ethidium bromide staining. Alternatively, following the gel
electrophoresis step the amplification product may be detected by
standard Southern blotting techniques, using an hybridization probe
selected to bind specifically to a prostate, bladder or breast
cancer-marker nucleic acid sequence. Probe hybridization may in
turn be detected by a standard labeling means, for example, by
incorporation of [.sup.32P]-nucleotides followed by
autoradiography. The amplification products may alternatively be
detected using a solid phase detection system as described above,
utilizing a prostate, bladder or breast cancer-marker specific
hybridization probe and an appropriate labeling means. The presence
of prostate, bladder or breast cancer-marker nucleic acids in blood
or lymph node samples may be taken as indicative of a patient with
metastatic prostate, bladder or breast cancer.
[0264] I. Targeted Inhibition of Prostate, Bladder and Breast
Cancer Markers
[0265] In principal, the prostate, bladder or breast cancer-markers
identified in the present invention may serve as targets for
therapeutic intervention in prostate, bladder or breast cancer. One
of the identified genes, cyclin A, has been described as a target
for a number of agents that inhibit tumor cell growth by promoting
differentiation or inhibiting cell division. For example,
L-tyrosine has been reported to promote increased melanogenesis and
replicative senescence in the B 16 melanoma cell line, correlated
with a decrease in cyclin A activity. (Rieber & Rieber, 1994)
Suramin is an antitumor agent that reduces the expression of cyclin
A in the DU-145 prostate carcinoma cell line. (Qiao et al., 1994)
Rapamycin inhibits cell proliferation in the YAC-1 T cell lymphoma
and also inhibits cyclin A mRNA production. (Dumont et al., 1994)
It is not clear if these inhibitors are acting directly on cyclin
A, or somewhere upstream in a signal transduction/phosphorylation
cascade pathway. However, inhibitors of cyclin A should inhibit
cell proliferation and decrease tumor growth. Such inhibitors may
have utility as therapeutic agents for the treatment of prostate
cancer.
[0266] Inhibitors could also potentially be designed for the
previously unreported prostate, bladder or breast cancer-markers
identified in the present invention. This is complicated by the
fact that no specific function has been identified for most of
these gene products, and no data is available on their
three-dimensional structures.
[0267] Identification of protein function may be extrapolated, in
some cases, from the primary sequence data, provided that sequence
homology exists between the unknown protein and a protein of
similar sequence and known function. Proteins tend to occur in
large families of relatively similar sequence and function. For
example, a number of the serine proteases, like trypsin and
chymotrypsin, have extensive sequence homologies and relatively
similar three-dimensional structures. Other general categories of
homologous proteins include different classes of transcriptional
factors, membrane receptor proteins, tyrosine kinases, GTP-binding
proteins, etc. The putative amino acid sequences encoded by the
prostate, bladder or breast cancer-marker nucleic acids of the
present invention may be cross-checked for sequence homologies
versus the protein sequence database of the National Biomedical
Research Fund. Homology searches are standard techniques for the
skilled practitioner.
[0268] Even three-dimensional structure may be inferred from the
primary sequence data of the encoded proteins. Again, if homologies
exist between the encoded amino acid sequences and other proteins
of known structure, then a model for the structure of the encoded
protein may be designed, based upon the structure of the known
protein. An example of this type of approach was reported by Ribas
de Pouplana and Fothergill-Gilmore (Biochemistry 33: 7047-7055,
1994). These authors developed a detailed three-dimensional model
for the structure of Drosophila alcohol dehydrogenase, based in
part upon sequence homology with the known structure of 3-a,
20-.beta.-hydroxysteroid dehydrogenase. Once a three-dimensional
model is available, inhibitors may be designed by standard computer
modeling techniques. This area has been recently reviewed by Sun
and Cohen (Gene 137: 127-132,1993), herein incorporated by
reference.
[0269] 1. Antisense Constructs
[0270] The term "antisense" is intended to refer to polynucleotide
molecules complementary to a portion of a RNA marker of prostate
disease, or a marker of bladder or breast cancer as defined herein.
"Complementary" polynucleotides are those which are capable of
base-pairing according to the standard Watson-Crick complementarity
rules. That is, the larger purines will base pair with the smaller
pyrimidines to form combinations of guanine paired with cytosine
(G:C) and adenine paired with either thymine (A:T) in the case of
DNA, or adenine paired with uracil (A:U) in the case of RNA.
Inclusion of less common bases such as inosine, 5-methylcytosine,
6-methyladenine, hypoxanthine and others in hybridizing sequences
does not interfere with pairing.
[0271] Antisense polynucleotides, when introduced into a target
cell, specifically bind to their target polynucleotide and
interfere with transcription, RNA processing, transport,
translation and/or stability. Antisense RNA constructs, or DNA
encoding such antisense RNA's, may be employed to inhibit gene
transcription or translation or both within a host cell, either in
vitro or in vivo, such as within a host animal, including a human
subject.
[0272] The intracellular concentration of monovalent cation is
approximately 160 mM (10 mM Na.sup.+; 150 mM K.sup.+). The
intracellular concentration of divalent cation is approximately 20
mM (18 mM Mg.sup.+; 2 mM Ca.sup.++). The intracellular protein
concentration, which would serve to decrease the volume of
hybridization and, therefore, increase the effective concentration
of nucleic acid species, is 150 mg/ml. Constructs can be tested in
vitro under conditions that mimic these in vivo conditions.
[0273] Antisense constructs may be designed to bind to the promoter
and other control regions, exons, introns or even exon-intron
boundaries of a gene. It is contemplated that the most effective
antisense constructs for the present invention will include regions
complementary to the mRNA start site, or to those sequences
identified herein as prostate disease or bladder or breast cancer
markers. One can readily test such constructs simply by testing the
constructs in vitro to determine whether levels of the target
protein are affected. Similarly, detrimental non-specific
inhibition of protein synthesis also can be measured by determining
target cell viability in vitro.
[0274] As used herein, the terms "complementary" or "antisense"
mean polynucleotides that are substantially complementary over
their entire length and have very few base mismatches. For example,
sequences of fifteen bases in length may be termed complementary
when they have a complementary nucleotide at thirteen or fourteen
nucleotides out of fifteen. Naturally, sequences which are
"completely complementary" will be sequences which are entirely
complementary throughout their entire length and have no base
mismatches.
[0275] Other sequences with lower degrees of homology also are
contemplated. For example, an antisense construct which has limited
regions of high homology, but also contains a non-homologous region
(e.g., a ribozyme) could be designed. These molecules, though
having less than 50% homology, would bind to target sequences under
appropriate conditions.
[0276] As stated above, although the antisense sequences may be
full length cDNA copies, or large fragments thereof, they also may
be shorter fragments, or "oligonucleotides," defined herein as
polynucleotides of 50 or less bases. Although shorter oligomers
(8-20) are easier to make and increase in vivo accessibility,
numerous other factors are involved in determining the specificity
of base-pairing. For example, both binding affinity and sequence
specificity of an oligonucleotide to its complementary target
increase with increasing length. It is contemplated that
oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19,20,25, 30, 35, 40,45, 50 or 100 base pairs will be used. While
all or part of the gene sequence may be employed in the context of
antisense construction, statistically, any sequence of 14 bases
long should occur only once in the human genome and, therefore,
suffice to specify a unique target sequence.
[0277] In certain embodiments, one may wish to employ antisense
constructs which include other elements, for example, those which
include C-5 propyne pyrimidines. Oligonucleotides which contain C-5
propyne analogues of uridine and cytidine have been shown to bind
RNA with high affinity and to be potent antisense inhibitors of
gene expression (Wagner et al., 1993).
[0278] As an alternative to targeted antisense delivery, targeted
ribozymes may be used. The term "ribozyme" is refers to an
RNA-based enzyme capable of targeting and cleaving particular base
sequences in both DNA and RNA. Ribozymes can either be targeted
directly to cells, in the form of RNA oligonucleotides
incorporating ribozyme sequences, or introduced into the cell as an
expression vector encoding the desired ribozymal RNA. Ribozymes may
be used and applied in much the same way as described for antisense
polynucleotide. Ribozyme sequences also may be modified in much the
same way as described for antisense polynucleotide. For example,
one could incorporate non-Watson-Crick bases, or make mixed RNA/DNA
oligonucleotides, or modify the phosphodiester backbone, or modify
the 2'-hydroxy in the ribose sugar group of the RNA.
[0279] Alternatively, the antisense oligo- and polynucleotides
according to the present invention may be provided as RNA via
transcription from expression constructs that carry nucleic acids
encoding the oligo- or polynucleotides. Throughout this
application, the term "expression construct" is meant to include
any type of genetic construct containing a nucleic acid encoding an
antisense product in which part or all of the nucleic acid sequence
is capable of being transcribed. Typical expression vectors include
bacterial plasmids or phage, such as any of the pUC or
Bluescript.TM. plasmid series or, as discussed further below, viral
vectors adapted for use in eukaryotic cells.
[0280] In preferred embodiments, the nucleic acid encodes an
antisense oligo- or polynucleotide under transcriptional control of
a promoter. A "promoter" refers to a DNA sequence recognized by the
synthetic machinery of the cell, or introduced synthetic machinery,
required to initiate the specific transcription of a gene. The
phrase "under transcriptional control" means that the promoter is
in the correct location and orientation in relation to the nucleic
acid to control RNA polymerase initiation.
[0281] The term promoter will be used here to refer to a group of
transcriptional control modules that are clustered around the
initiation site for RNA polymerase II. Much of the thinking about
how promoters are organized derives from analyses of several viral
promoters, including those for the HSV thymidine kinase (tk) and
SV40 early transcription units. These studies, augmented by more
recent work, have shown that promoters are composed of discrete
functional modules, each consisting of approximately 7-20 bp of
DNA, and containing one or more recognition sites for
transcriptional activator or repressor proteins.
[0282] At least one module in each promoter functions to position
the start site for RNA synthesis. The best known example of this is
the TATA box, but in some promoters lacking a TATA box, such as the
promoter for the mammalian terminal deoxynucleotidyl transferase
gene and the promoter for the SV40 late genes, a discrete element
overlying the start site itself helps to fix the place of
initiation.
[0283] Additional promoter elements regulate the frequency of
transcriptional initiation. Typically, these are located in the
region 30-110 bp upstream of the start site, although a number of
promoters have recently been shown to contain functional elements
downstream of the start site as well. The spacing between promoter
elements frequently is flexible, so that promoter function is
preserved when elements are inverted or moved relative to one
another. In the tk promoter, the spacing between promoter elements
can be increased to 50 bp apart before activity begins to decline.
Depending on the promoter, it appears that individual elements can
function either co-operatively or independently to activate
transcription.
[0284] The particular promoter that is employed to control the
expression of a nucleic acid encoding the inhibitory peptide is not
believed to be important, so long as it is capable of expressing
the peptide in the targeted cell. Thus, where a human cell is
targeted, it is preferable to position the nucleic acid coding the
inhibitory peptide adjacent to and under the control of a promoter
that is active in the human cell. Generally speaking, such a
promoter might include either a human or viral promoter.
[0285] In various embodiments, the human cytomegalovirus (CMV)
immediate early gene promoter, the SV40 early promoter and the Rous
sarcoma virus long terminal repeat can be used to obtain high-level
expression of various proteins. The use of other viral or mammalian
cellular or bacterial phage promoters which are well-known in the
art to achieve expression of peptides according to the present
invention is contemplated as well, provided that the levels of
expression are sufficient for a given purpose.
[0286] By employing a promoter with well-known properties, the
level and pattern of expression of an antisense oligo- or
polynucleotide can be optimized. Further, selection of a promoter
that is regulated in response to specific physiologic signals can
permit inducible expression of an inhibitory protein. For example,
a nucleic acid under control of the human PAI-1 promoter results in
expression inducible by tumor necrosis factor. Additionally any
promoter/enhancer combination (as per the Eukaryotic Promoter Data
Base EPDB) also could be used to drive expression of a nucleic acid
according to the present invention. Use of a T3, T7 or SP6
cytoplasmic expression system is another possible embodiment.
Eukaryotic cells can support cytoplasmic transcription from certain
bacterial promoters if the appropriate bacterial polymerase is
provided, either as part of the delivery complex or as an
additional genetic expression construct.
[0287] In certain embodiments of the invention, the delivery of a
nucleic acid in a cell may be identified in vitro or in vivo by
including a marker in the expression construct. The marker would
result in an identifiable change to the transfected cell permitting
easy identification of expression. Enzymes such as herpes simplex
virus thymidine kinase (tk) (eukaryotic) or chloramphenicol
acetyltransferase(CAT) (prokaryotic) may be employed.
[0288] One also may include a polyadenylation signal to effect
proper polyadenylation of the transcript. The nature of the
polyadenylation signal is not believed to be crucial to the
successful practice of the invention, and any such sequence may be
employed. For example, the SV40, .beta.-globin or adenovirus
polyadenylation signal may be employed. Also contemplated as an
element of the expression cassette is a terminator. These elements
can serve to enhance message levels and to minimize read through
from the cassette into other sequences.
[0289] 2. Liposomal Formulations
[0290] In certain broad embodiments of the invention, the antisense
oligo- or polynucleotides and/or expression vectors may be
entrapped in a liposome. Liposomes are vesicular structures
characterized by a phospholipid bilayer membrane and an inner
aqueous medium. Multilamellar liposomes have multiple lipid layers
separated by aqueous medium. They form spontaneously when
phospholipids are suspended in an excess of aqueous solution. The
lipid components undergo self-rearrangement before the formation of
closed structures and entrap water and dissolved solutes between
the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated
are cationic lipid-nucleic acid complexes, such as
lipofectamine-nucleic acid complexes.
[0291] In certain embodiments of the invention, the liposome may be
complexed with a hemagglutinating virus (HVJ). This has been shown
to facilitate fusion with the cell membrane and promote cell entry
of liposome-encapsulated DNA (Kaneda et al., 1989). In other
embodiments, the liposome may be complexed or employed in
conjunction with nuclear non-histone chromosomal proteins (HMG-1)
(Kato et al., 1991). In yet further embodiments, the liposome may
be complexed or employed in conjunction with both HVJ and HMG-1. In
that such expression vectors have been successfully employed in
transfer and expression of a polynucleotide in vitro and in vivo,
then they are applicable for the present invention. Where a
bacterial promoter is employed in the DNA construct, it also will
be desirable to include within the liposome an appropriate
bacterial polymerase.
[0292] "Liposome" is a generic term encompassing a variety of
single and multilamellar lipid vehicles formed by the generation of
enclosed lipid bilayers. Phospholipids are used for preparing the
liposomes according to the present invention and can carry a net
positive charge, a net negative charge or are neutral. Dicetyl
phosphate can be employed to confer a negative charge on the
liposomes, and stearylamine can be used to confer a positive charge
on the liposomes.
[0293] Lipids suitable for use according to the present invention
can be obtained from commercial sources. For example, dimyristyl
phosphatidylcholine ("DMPC") can be obtained from Sigma Chemical
Co., dicetyl phosphate ("DCP") is obtained from K & K
Laboratories (Plainview, N.Y.); cholesterol ("Chol") is obtained
from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG")
and other lipids may be obtained from Avanti Polar Lipids, Inc.
(Birmingham, Ala.). Stock solutions of lipids in chloroform,
chlorofom/methanol or t-butanol can be stored at about -20.degree.
C. Preferably, chloroform is used as the only solvent since it is
more readily evaporated than methanol.
[0294] Phospholipids from natural sources, such as egg or soybean
phosphatidylcholine, brain phosphatidic acid, brain or plant
phosphatidylinositol, heart cardiolipin and plant or bacterial
phosphatidylethanolamineare preferably not used as the primary
phosphatide, i.e., constituting 50% or more of the total
phosphatide composition, because of the instability and leakiness
of the resulting liposomes.
[0295] Liposomes used according to the present invention can be
made by different methods. The size of the liposomes varies
depending on the method of synthesis. A liposome suspended in an
aqueous solution is generally in the shape of a spherical vesicle,
having one or more concentric layers of lipid bilayer molecules.
Each layer consists of a parallel array of molecules represented by
the formula XY, wherein X is a hydrophilic moiety and Y is a
hydrophobic moiety. In aqueous suspension, the concentric layers
are arranged such that the hydrophilic moieties tend to remain in
contact with an aqueous phase and the hydrophobic regions tend to
self-associate. For example, when aqueous phases are present both
within and without the liposome, the lipid molecules will form a
bilayer, known as a lamella, of the arrangement XY-YX.
[0296] Liposomes within the scope of the present invention can be
prepared in accordance with known laboratory techniques. In one
preferred embodiment, liposomes are prepared by mixing liposomal
lipids, in a solvent in a container, e.g., a glass, pear-shaped
flask. The container should have a volume ten-times greater than
the volume of the expected suspension of liposomes. Using a rotary
evaporator, the solvent is removed at approximately 40.degree. C.
under negative pressure. The solvent normally is removed within
about 5 min to 2 hours, depending on the desired volume of the
liposomes. The composition can be dried further in a desiccator
under vacuum. The dried lipids generally are discarded after about
1 week because of a tendency to deteriorate with time.
[0297] Dried lipids can be hydrated at approximately 25-50 mM
phospholipid in sterile, pyrogen-free water by shaking until all
the lipid film is resuspended. The aqueous liposomes can be then
separated into aliquots, each placed in a vial, lyophilized and
sealed under vacuum.
[0298] In the alternative, liposomes can be prepared in accordance
with other known laboratory procedures: the method of Bangham et
al. (1965), the contents of which are incorporated herein by
reference; the method of Gregoriadis, as described in DRUG CARRIERS
IN BIOLOGY AND MEDICINE, G. Gregoriadis ed. (1979) pp. 287-341, the
contents of which are incorporated herein by reference; the method
of Deamer and Uster (1983), the contents of which are incorporated
by reference; and the reverse-phase evaporation method as described
by Szoka and Papahadjopoulos (1978). The aforementioned methods
differ in their respective abilities to entrap aqueous material and
their respective aqueous space-to-lipid ratios.
[0299] The dried lipids or lyophilized liposomes prepared as
described above may be reconstituted in a solution of nucleic acid
and diluted to an appropriate concentration with an suitable
solvent, e.g, DPBS. The mixture is then vigorously shaken in a
vortex mixer. Unencapsulated nucleic acid is removed by
centrifugation at 29,000.times. g and the liposomal pellets washed.
The washed liposomes are resuspended at an appropriate total
phospholipid concentration, e.g., about 50-200 mM. The amount of
nucleic acid encapsulated can be determined in accordance with
standard methods. After determination of the amount of nucleic acid
encapsulated in the liposome preparation, the liposomes may be
diluted to appropriate concentration and stored at 4.degree. C.
until use.
[0300] In a preferred embodiment, the lipid
dioleoylphosphatidylcholine is employed. Nuclease-resistant
oligonucleotides were mixed with lipids in the presence of excess
t-butanol. The mixture was vortexed before being frozen in an
acetone/dry ice bath. The frozen mixture was lyophilized and
hydrated with Hepes-buffered saline (1 mM Hepes, 10 mM NaCl, pH
7.5) overnight, and then the liposomes were sonicated in a bath
type sonicator for 10 to 15 min. The size of the
liposomal-oligonucleotides typically ranged between 200-300 nm in
diameter as determined by the submicron particle sizer autodilute
model 370 (Nicomp, Santa Barbara, CA).
[0301] 3. Alternative Delivery Systems
[0302] Adenoviruses: Human adenoviruses are double-stranded DNA
tumor viruses with genome sizes of approximate 36 kB (Tooze, 1981).
As a model system for eukaryotic gene expression, adenoviruses have
been widely studied and well characterized, which makes them an
attractive system for development of adenovirus as a gene transfer
system. This group of viruses is easy to grow and manipulate, and
they exhibit a broad host range in vitro and in vivo. In lytically
infected cells, adenoviruses are capable of shutting off host
protein synthesis, directing cellular machineries to synthesize
large quantities of viral proteins, and producing copious amounts
of virus.
[0303] The El region of the genome includes E1A and E1B which
encode proteins responsible for transcription regulation of the
viral genome, as well as a few cellular genes. E2 expression,
including E2A and E2B, allows synthesis of viral replicative
functions, e.g. DNA-binding protein, DNA polymerase, and a terminal
protein that primes replication. E3 gene products prevent cytolysis
by cytotoxic T cells and tumor necrosis factor and appear to be
important for viral propagation. Functions associated with the E4
proteins include DNA replication, late gene expression, and host
cell shutoff. The late gene products include most of the virion
capsid proteins, and these are expressed only after most of the
processing of a single primary transcript from the major late
promoter has occurred. The major late promoter (MLP) exhibits high
efficiency during the late phase of the infection
(Stratford-Perricaudet and Perricaudet, 1991).
[0304] As only a small portion of the viral genome appears to be
required in cis (Tooze, 1981), adenovirus-derived vectors offer
excellent potential for the substitution of large DNA fragments
when used in connection with cell lines such as 293 cells.
Ad5-transformed human embryonic kidney cell lines (Graham, et al.,
1977) have been developed to provide the essential viral proteins
in trans.
[0305] Particular advantages of an adenovirus system for delivering
foreign proteins to a cell include (i) the ability to substitute
relatively large pieces of viral DNA by foreign DNA; (ii) the
structural stability of recombinant adenoviruses; (iii) the safety
of adenoviral administration to humans; and (iv) lack of any known
association of adenoviral infection with cancer or malignancies;
(v) the ability to obtain high titers of the recombinant virus; and
(vi) the high infectivity of adenovirus.
[0306] Further advantages of adenovirus vectors over retroviruses
include the higher levels of gene expression. Additionally,
adenovirus replication is independent of host gene replication,
unlike retroviral sequences. Because adenovirus transforming genes
in the E1 region can be readily deleted and still provide efficient
expression vectors, oncogenic risk from adenovirus vectors is
thought to be negligible (Grunhaus & Horwitz, 1992).
[0307] In general, adenovirus gene transfer systems are based upon
recombinant, engineered adenovirus which is rendered
replication-incompetent by deletion of a portion of its genome,
such as El, and yet still retains its competency for infection.
Sequences encoding relatively large foreign proteins can be
expressed when additional deletions are made in the adenovirus
genome. For example, adenoviruses deleted in both E1 and E3 regions
are capable of carrying up to 10 kB of foreign DNA and can be grown
to high titers in 293 cells (Stratford-Perricaudet and Perricaudet,
1991). Surprisingly persistent expression of transgenes following
adenoviral infection has also been reported.
[0308] Other Viral Vectors as Expression Constructs. Other viral
vectors may be employed as expression constructs in the present
invention. Vectors derived from viruses such as vaccinia virus
(Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988)
adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden,
1986; Hermonat and Muzycska, 1984) and herpes viruses may be
employed. They offer several attractive features for various
mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and
Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).
[0309] With the recent recognition of defective hepatitis B
viruses, new insight was gained into the structure-function
relationship of different viral sequences. In vitro studies showed
that the virus could retain the ability for helper-dependent
packaging and reverse transcription despite the deletion of up to
80% of its genome (Horwich et al., 1990). This suggested that large
portions of the genome could be replaced with foreign genetic
material. The hepatotropism and persistence (integration) were
particularly attractive properties for liver-directed gene
transfer. Chang et al. recently introduced the chloramphenicol
acetyltransferase (CAT) gene into duck hepatitis B virus genome in
the place of the polymerase, surface, and pre-surface coding
sequences. It was cotransfected with wild-type virus into an avian
hepatoma cell line. Culture media containing high titers of the
recombinant virus were used to infect primary duckling hepatocytes.
Stable CAT gene expression was detected for at least 24 days after
transfection (Chang et al., 1991).
[0310] Non-viral Methods. Several non-viral methods for the
transfer of expression vectors into cultured mammalian cells also
are contemplated by the present invention. These include calcium
phosphate precipitation (Graham and Van Der Eb, 1973; Chen and
Okayama, 1987; Rippe et al., 1990) DEAE-dextran (Gopal, 1985),
lipofectamine-DNA complexes, and receptor-mediated transfection (Wu
and Wu, 1987; Wu and Wu, 1988). Some of these techniquesmay be
successfully adapted for in vivo or ex vivo use.
[0311] In one embodiment of the invention, the expression construct
may simply consist of naked recombinant vector. Transfer of the
construct may be performed by any of the methods mentioned above
which physically or chemically permeabilize the cell membrane. For
example, Dubensky et al. (1984) successfully injected polyomavirus
DNA in the form of CaPO.sub.4 precipitates into liver and spleen of
adult and newborn mice demonstrating active viral replication and
acute infection. Benvenisty and Neshif (1986) also demonstrated
that direct intraperitoneal injection of CaPO.sub.4 precipitated
plasmids results in expression of the transfected genes. It is
envisioned that DNA encoding an antisense prostate, bladder or
breast disease marker construct may also be transferred in a
similar manner in vivo.
[0312] Pharmaceutical Compositions and Routes of Administration
[0313] Where clinical application of liposomes containing antisense
oligo- or polynucleotides or expression vectors is undertaken, it
will be necessary to prepare the liposome complex as a
pharmaceutical composition appropriate for the intended
application. Generally, this will entail preparing a pharmaceutical
composition that is essentially free of pyrogens, as well as any
other impurities that could be harmful to humans or animals. One
also will generally desire to employ appropriate buffers to render
the complex stable and allow for uptake by target cells.
[0314] Aqueous compositions of the present invention comprise an
effective amount of the antisense expression vector encapsulated in
a liposome as discussed above, further dispersed in
pharmaceutically acceptable carrier or aqueous medium. Such
compositions also are referred to as inocula. The phrases
"pharmaceutically or pharmacologically acceptable" refer to
compositions that do not produce an adverse, allergic or other
untoward reaction when administered to an animal, or a human, as
appropriate.
[0315] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents and the like. The use of such media and agents for
pharmaceutical active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active ingredient, its use in the therapeutic compositions is
contemplated. Supplementary active ingredients also can be
incorporated into the compositions.
[0316] Solutions of therapeutic compositions can be prepared in
water suitably mixed with a surfactant, such as
hydroxypropylcellulose. Dispersions also can be prepared in
glycerol, liquid polyethylene glycols, mixtures thereof and in
oils. Under ordinary conditions of storage and use, these
preparations contain a preservative to prevent the growth of
microorganisms.
[0317] The therapeutic compositions of the present invention are
advantageously administered in the form of injectable compositions
either as liquid solutions or suspensions; solid forms suitable for
solution in, or suspension in, liquid prior to injection may also
be prepared. These preparations also may be emulsified. A typical
composition for such purpose comprises a pharmaceutically
acceptable carrier. For instance, the composition may contain 10
mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per
milliliter of phosphate buffered saline. Other pharmaceutically
acceptable carriers include aqueous solutions, non-toxic
excipients, including salts, preservatives, buffers and the
like.
[0318] Examples of non-aqueous solvents are propylene glycol,
polyethylene glycol, vegetable oil and injectable organic esters
such as ethyloleate. Aqueous carriers include water,
alcoholic/aqueous solutions, saline solutions, parenteral vehicles
such as sodium chloride, Ringer's dextrose, etc. Intravenous
vehicles include fluid and nutrient replenishers. Preservatives
include antimicrobial agents, anti-oxidants, chelating agents and
inert gases. The pH and exact concentration of the various
components the pharmaceutical composition are adjusted according to
well known parameters.
[0319] An effective amount of the therapeutic composition is
determined based on the intended goal. The term "unit dose" or
"dosage" refers to physically discrete units suitable for use in a
subject, each unit containing a predetermined-quantity of the
therapeutic composition calculated to produce the desired
responses, discussed above, in association with its administration,
i.e., the appropriate route and treatment regimen. The quantity to
be administered, both according to number of treatments and unit
dose, depends on the protection desired.
[0320] Precise amounts of the therapeutic composition also depend
on the judgment of the practitioner and are peculiar to each
individual. Factors affecting dose include physical and clinical
state of the patient, the route of administration and the potency,
stability and toxicity of the particular therapeutic substance. For
the instant application, it is envisioned that the amount of
therapeutic composition comprising a unit dose will range from
about 5-30 mg of polynucleotide.
[0321] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventors to
function well in the practice of the invention, and thus may be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes may be made in the
particular embodiments which are disclosed and still obtain a like
or similar result without departing from the spirit and scope of
the invention.
[0322] J. Materials and Methods
[0323] 1. Application of RNA Fingerprinting to Discover Biomarkers
for Prostate Cancers
[0324] RNA fingerprinting (according to Liang and Pardee, 1992;
Welsh et al., 1992; Liang and Pardee, 1993) was applied to nucleic
acids isolated from primary human prostate tumors or from prostate
tumor derived cell lines that behave as tumor cells with different
metastatic potential. The human prostate cancer cell lines examined
in these studies were LnCaP, PC-3(pf), PC-3(mf), and DU-145. These
cell lines vary in their metastatic potentials. LnCaP is only
slightly metastatic while the other three cell lines are very
aggressive and highly metastatic. The primary human prostate tumors
used were of varying degrees of malignancy.
[0325] The cell lines were propagated in RPMI-1640 (GIBCO-BRL,
Inc.) supplemented with 10% fetal bovine serum, 5 units/ml
penicillin G, 5 pg/ml streptomycin, and Fungizone according to the
supplier's directions. All antibiotics were purchased from
GIBCO-BRL, Inc. Cells were harvested in late log phase of growth.
RNA was isolated by the guanidinium thiocyanate method (Chomczynski
and Sacchi, 1987). RNA was also isolated from solid prostate tumors
by guanidinium thiocyanate extraction (Chomczynski and Sacchi,
1987), after the tumors were frozen and ground to a powder in
liquid nitrogen.
[0326] After RNA isolation, the nucleic acids were precipitated
with ethanol. The precipitates were pelleted by centrifugation and
redissolved in water. The redissolved nucleic acids were then
digested with RNase-free DNase I (Boehringer Mannheim, Inc.)
following the manufacturer's instructions, followed by organic
extraction with phenol:chloroform:isoamylalcohol (25:24:1) and
reprecipitation with ethanol.
[0327] The DNase I treated RNA was then pelleted by centrifugation
and redissolved in water. The purity and concentration of the RNA
in solution was estimated by determining optical density at wave
lengths of 260 nm and 280 nm (Sambrook et al., 1989). A small
aliquot of the RNA was also separated by gel electrophoresis in a
3% formaldehyde gel with MOPS buffer (Sambrook et al., 1989) to
confirm the estimation of concentration and to determine if the
ribosomal RNAs were intact. This RNA, hereafter referred to as
total cell RNA, was used in the studies described below.
[0328] 2. Methods Utilized in the Differential Display
Technique
[0329] There were two kinds of RNA fingerprinting studies performed
with the total cell RNA. The first of these kinds of studies
followed the differential display protocol of Liang and Pardee
(1992) except that it was modified by using 5' biotinylated primers
for nonisotopic PCR product detection.
[0330] In these studies, 0.2 .mu.g of total cell RNA was primed for
reverse transcription with an anchoring primer composed of oligo
dT, then two arbitrarily chosen nucleotides. The anchoring primers
used in these studies were further modified to be biotinylated at
the 5' end.
[0331] Reverse transcription was performed with 200 units of MMLV
(Moloney Murine Leukemia Virus) reverse transcriptase (GIBCO/BRL)
in the presence of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl.sub.2, 10 mM DTT, 500 pM dNTP, 1 .mu.M biotinylated anchored
primer and 1 U/.mu.l RNase inhibitor. The reaction mixture was
incubated at room temperature for 10 minutes, then at 37.degree. C.
for 50 minutes. After reverse transcription the enzyme was
denatured by heating to 65.degree. C. for 10 minutes.
[0332] One tenth of the resulting reverse transcription reactions
were then amplified by PCR using the same anchoring primer as was
used in the reverse transcription step and a second oligonucleotide
of arbitrarily chosen sequences. The PCR reaction contained 10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 20 .mu.M dNTP, 1.5 .mu.M MgCl.sub.2,
200 nM arbitrary decamer, 1 .mu.M biotinylated anchored primer, and
1 unit of Taq DNA polymerase (Boehringer Mannheim) in a 40 .mu.l
volume. The amplification was performed in a thermal cycler (MJ
Research) for 30 cycles with denaturing at 94.degree. C. for 30
sec, annealing at 40.degree. C. for 2 min, and extending at
72.degree. C. for 30 sec.
[0333] The PCR products were then separated on a 6% TBE-urea
sequencing gel (Sambrook et al., 1989) and detected by
chemiluminescent reaction using the Seq-Light.TM. detection system
(Tropix, Inc). Differentially appearing PCR products were excised
from the gels, reamplified using the same primers used in the
original amplification, and cloned using the TA cloning strategy
(Invitrogen, Inc. and Promega, Inc.).
[0334] 3. Methods Utilized in the RNA Fingerprinting Technique
[0335] The second type of RNA fingerprinting studies performed more
closely resembled the protocol of Welsh et al. (1992). This
approach used a variation of the above as modified by the use of
agarose gels and non-isotopic detection of bands by ethidium
bromide staining (An et al., 1995). Total RNAs were isolated from
the frozen prostate tissues or cultured cells as described
(Chomczynski & Sacchi, 1987). Ten micrograms of total cellular
RNAs were treated with 5 units of RNAse-free DNAse I (GIBCO/BRL) in
20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2 mM MgCl.sub.2, and 20 units
of RNAse inhibitor (Boehringer Mannheim). After extraction with
phenol/chloroform and ethanol precipitation, the RNAs were
redissolved in DEPC-treated water.
[0336] Two .mu.g of each total cell RNA sample was reverse
transcribed into cDNA using randomly selected hexamer primers and
MMLV reverse transcriptase (GIBCO/BRL). PCR was performed using one
or two arbitrarily chosen oligonucleotide primers (10-12mers). PCR
conditions were: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM
MgCl.sub.2, 50 .mu.M dNTPs, 0.2 .mu.M of primer(s), 1 unit of Taq
DNA polymerase (GIBCO/BRL) in a final volume of 20 .mu.l. The
amplification parameters included 35 cycles of reaction with 30 sec
denaturing at 94.degree. C., 90 sec annealing at 40.degree. C., and
60 sec extension at 72.degree. C. A final extension at 72.degree.
C. was performed for 15 min. The resulting PCR products were
resolved into a fingerprint by size separation by electrophoresis
through 2% agarose gels in TBE buffer (Sambrook et al., 1989). The
fingerprints were visualized by staining with ethidium bromide. No
reamplification was performed.
[0337] Differentially appearing PCR products, that might represent
differentially expressed genes, were excised from the gel with a
razor blade, purified from the agarose using the Geneclean kit (Bio
101, Inc.), eluted in water and cloned directly into plasmid
vectors using the TA cloning strategy (Invitrogen, Inc., and
Promega, Inc.). These products were not reamplified after the
initial PCR fingerprinting protocol.
[0338] 4. Confirmation of Differential Expression by Relative
Quantitative RT-PCR: Protocols for RT-PCR
[0339] a. Reverse Transcription
[0340] Five .mu.g of total cell RNA from each tissue sample was
reverse transcribed into cDNA. Reverse transcription was performed
with 400 units of MMLV reverse transcriptase (GIBCO/BRL) in the
presence of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl.sub.2, 10
mM DTT, 500 .mu.M dNTP, 50 ng random hexamers per microgram of RNA,
and 1 U/.mu.l RNase inhibitor. The reaction volume was 60 .mu.l.
The reaction mixture was incubated at room temperature for 10
minutes, then at 37.degree. C. for 50 minutes. After reverse
transcription the enzyme was denatured by heating to 65.degree. C.
for 10 minutes. After heat denaturation the samples were diluted
with water to a final volume of 300 .mu.l.
[0341] RT-PCR was utilized to examine mRNAs for differential
expression. The sequences of oligonucleotides used as primers to
direct the amplification of the various cDNA fragments are
presented in Table 4.
[0342] b. Relative Quantitative RT-PCR With an Internal
Standard
[0343] The concentrations of the original total cell RNAs were
determined by measurement of OD.sub.260/280 (Sambrook et al., 1989)
and confirmed by examination of ribosomal RNAs on ethidium bromide
stained agarose gels. It is required that all quantitative PCR
reactions be normalized for equal amounts of amplifiable cDNA after
the reverse transcription is completed. One solution to this is to
terminate the reactions by driving the PCR reactions into plateau
phase. This approach was utilized in some studies because it is
quick and efficient. Lipocortin II was used as the internal
standard or competitor. These PCRs were set up as:
[0344] Reagents: 200 .mu.M each dNTP, 200 nM each oligonucleotide
primer, 1.times. PCR buffer (Boehringer Mannheim including 1.5 mM
MgCl.sub.2), 3 .mu.l diluted cDNA, and 2.5 units of Taq DNA
polymerase/100 .mu.l of reaction volume.
[0345] Cycling parameters: 30 cycles of 94.degree. C. for 1 min;
55.degree. C. for 1 min; and 72.degree. C. for two min.
Thermocyclers were either the MJ research thermocycler or the
Stratagene Robocycler.
[0346] c. Relative Quantitative RT-PCR with an External
Standard
[0347] There are three potential difficulties with the relative
quantitative RT-PCR strategy described above. First, the internal
standard must be roughly 4-10 times more abundant that the target
for this strategy to normalize the samples. Second, because most of
the PCR products are templated from the more abundant internal
standard, the assay is less than optimally sensitive. Third, the
internal standard must be truly unvarying. The result is that while
the strategy described above is fast, convenient and applicable to
samples of varying quality, it lacks sensitivity to modest changes
in abundances.
[0348] To address these issues, a normalization was performed using
both the 3-actin and asparagine synthetase mRNAs as external
standards. These PCR reactions were performed with sufficient
cycles to observe the products in the linear range of their
amplification curves. Photographic negatives of gels of ethidium
bromide stained PCR products were produced for each study. These
negatives were scanned and quantified using a BioRad densitometer.
The quantified data was then normalized for variations in the
starting concentrations of amplifiable cDNA by comparing the
quantified data from each study with that derived from a similar
study which amplified a cDNA fragment copied from the 3-actin mRNA.
Quantified data that had been normalized to beta actin were
converted into bar graph representations.
K. EXAMPLES
Example 1
Relative Quantitative Reverse Transcriptase-polymerase Chain
Reaction-A Method to Evaluate Novel Genes (ESTs) as Diagnostic
Biomarkers
[0349] The reverse transcription-polymerase chain reaction (RT-PCR)
protocols described in the following example were developed as a
means to determine the relative abundances of mRNA species that are
expressed in various tissues, organs and cells. The protocols used
to meet this need must be robust, reproducible, relatively
quantitative, sensitive, conservative in its use of resources,
rapid and have a high throughput rate. Relative quantitative RT-PCR
has the technical features that, in theory, meet all of these
criteria. In practice there are six important barriers to
implementing an RT-PCR based assay that compares the relative
abundances of mRNA species. The protocol described herein addresses
each of these six barriers and has permitted the realization of the
potential of RT-PCR for this application. Although the present
example is drawn to the identification and confirmation of
differential expression in various physiological states in prostate
tissue, the methods described herein may be applied to any type of
tissue to provide a sensitive method of identifying differential
expression.
[0350] The large majority of the candidate genes examined by this
method are partial cDNA fragments that have been identified by RNA
fingerprinting methodologies. This necessitated development of a
relatively quantitative approach to independently confirm the
differential expression of the mRNAs from which these partial cDNA
fragments were derived. The key objective of the described
screening protocol is the assessment of changes in the relative
abundances of mRNA.
[0351] The gene discovery program described in the present
disclosure is focused on analysis of human tissue and confirmation
must be performed on the same biological material. Access to human
tissue for isolation of RNA is limited. This limitation is
especially problematic in Northern blots, the traditional means to
determine differential gene expression. Northern blots typically
consume roughly 20 .mu.g of RNA per examined tissue per gene
identified. This means that for the average size of tissue sample
available, only 1-5 Northern blots can be performed before all of
the RNA from a tissue sample is completely consumed. Clearly
Northern blots are seriously limited for primary confirmation of
discovered genes and consume extremely valuable biological
resources required for gene discovery and characterization.
[0352] Because of such limitations on the amount of available
tissue, and because of the need for high throughput and rapid
turnaround of results, a two tiered assay protocol has been
developed that is technologically grounded on reverse transcription
(RT) of RNA into cDNA followed by amplification of specific cDNA
sequences by polymerase chain reaction (PCR). This coupling of
techniques is frequently referred to as RT-PCR.
[0353] One advantage of RT-PCR is that it consumes relatively small
quantities of RNA. With 20 .mu.g of RNA per examined sample, the
amount of RNA required to perform a single Northern blot
experiment, 50-200 RT-PCR assays can be performed with up to four
data points per assay. Another advantage is a high throughput,
eight independent experiments which examine eight different mRNA
species for differential expression can be performed simultaneously
in a single PCR machine with 96 wells. A single individual skilled
in this technique can thereby examine and evaluate eight genes per
day without significant time constraints. By comparison, even if
RNA of sufficient quality and quantity were available to do this
number of Northern blots, a similarly skilled individual performing
Northern blots would be hard pressed to examine and evaluate eight
genes per week. In addition to the lower throughput rate of
Northern blots, eight Northern blots per week would require the
consumption of about 400 .mu.Ci of .sup.32P per week. While not
dangerous to use in the hands of a skilled individual, .sup.32P is
certainly inconvenient to use. RT-PCR avoids the use of radioactive
materials.
[0354] An additional advantage of RT-PCR over Northern blots as a
technological platform for evaluating the relative expression of
mRNA species is that RT-PCR is much less sensitive to differences
in quality of the RNA being examined. The human tissues described
herein were removed from patients for treatment purposes and were
only incidentally saved for further studies. Hence the RNA, an
extremely labile molecule, is expected to be at least partially
degraded. Because the RNA is separated by size on a gel in the
Northern blot assay, partially degraded RNA appears as a smear,
rather than discrete bands. By contrast, RT-PCR amplifies only a
section or domain of an RNA molecule, and as long as that portion
is intact, the size or degradation state of the entire molecule is
irrelevant. As a result, RNAs that are identical except that they
vary by degree of partial degradation will give much more variable
signals in a Northern blot than they will in an RT-PCR. When
samples are of variable quality, as is often the case in human
studies, the relative sensitivities of the techniques to variation
in sample quality is an important consideration.
[0355] In the practice of this method, total cell RNA is first
converted into cDNA using reverse transcriptase primed with random
hexamers. This protocol results in a cDNA population in which each
RNA has contributed according to its relative proportion in
original total cell RNA. If two RNA species differ by ten fold in
their original relative abundances in the total cell RNA, then the
cDNA derived from these two RNAs will also differ by ten fold in
their relative abundances in the resulting population of cDNA. This
is a conservation of relative proportionality in the conversion of
RNA to cDNA.
[0356] Another consideration is the relative rates of amplification
of a targeted cDNA by PCR. In theory, the amount of an amplified
product synthesized by PCR will be equal to M(EC). Where M is the
mass of the targeted cDNA molecules before the beginning of PCR and
C is the number of PCR cycle performed. E is an efficiency of
amplification factor. This factor is complex and varies between 1
and 2. The important consideration in this assay is that over most
of a PCR amplification, E will be nearly constant and nearly equal
to 2. In PCR reactions that are identical in every way except the
cDNAs being used as templates are derived from different total cell
RNAs, then E will have the same value in each reaction. If a cDNA
target has an initial mass of Ml in one PCR reaction and a mass of
M.sub.2 in another PCR reaction and if E has the same value in each
reaction, then after C cycles of PCR there will be a mass of
M.sub.1(E.sup.C) of the amplified target in the first reaction and
a mass of M.sub.2(E.sup.C) of the amplified target in the second
reaction. The ratios of these masses is unaltered by PCR
amplification. That is M1/M2=[M.sub.1(E.sup.C)]/M.sub.2(E.sup.C).
Hence, there is a conservation of relative proportionality of
amplified products during PCR.
[0357] Since both reverse transcription and PCR can be performed in
such a way as to conserve proportionality, it is possible to
compare the relative abundance of an mRNA species in two or more
total cell RNA populations by first converting the RNA to cDNA and
then amplifying a fragment of the cDNA derived from the specific
mRNA by PCR. The ratio of the amplified masses of the targeted cDNA
is very close to or identical to the ratios of the mRNAs in the
original total cell RNA populations.
[0358] Six major challenges or barriers to be overcome in order to
best use RT-PCR to quantitate the relative abundances of RNA are as
follows:
[0359] 1.) Degradation of RNA must be minimized during RNA
preparation.
[0360] 2.) Genomic DNA must be eliminated.
[0361] 3.) RNA must be free of contaminants that might interfere
with reverse transcription.
[0362] 4.) The efficiency of RT is variable. cDNAs, not RNA, must
be normalized for equal concentrations of amplifiable cDNA.
[0363] 5.) Limited linear range requires multiple sampling points
in any amplification curve.
[0364] 6.) Tube to tube variability in PCR
[0365] It is the development of techniques to overcome these
barriers and to provide a sensitive and accurate method of
quantitative RT-PCR that is applicable to any tissue type or
physiological state that is a part of the present invention.
[0366] The first three barriers to successful RT-PCR are all
related to the quality of the RNA used in this assay. The protocols
described in this section address the first two barriers as
described in the last section. These are the requirements that
degradation of RNA must be minimized during RNA preparation and
that genomic DNA must be eliminated from the RNA.
[0367] Two preferred methods for RNA isolation are the guanididium
thiocyanate method, which is well known in the art, and kits for
RNA isolation manufactured by Qiagen, Inc. (Chatworth, Calif.),
with the kits being the most preferred for convenience. Four
protocols are performed on the RNA isolated by either method (or
any method) before the RNA is be used in RT-PCR.
[0368] The first of these four protocols is digestion of the RNAs
with DNaseI to remove all genomic DNA that was co-isolated with the
total cell RNA. Prior to DNaseI digestion, the RNA is in a
particulate suspension in 70% ethanol. Approximately 50 .mu.g of
RNA (as determined by OD260/280) is removed from the suspension and
precipitated. This RNA is resuspended in DEPC treated sterile
water. To this is added 10.times. DNaseI buffer (200 mM Tris-HCl;
pH 8.4, 20 mM MgCl.sub.2, 500 mM KCl), 10 units of RNase Inhibitor
(GIBCO-BRL Cat#15518-012) and 20 units of DNaseI (GIBCO-BRL Cat#
18068-015). The volume is adjusted to 50 .mu.l with additional DEPC
treated water. The reaction is incubated at 37.degree. C. for 30
minutes. After DNaseI digestion the RNAs are organic
solvent-extracted with phenol and chloroform followed by ethanol
precipitation. This represents the second ethanol precipitation of
the isolated RNA. Empirical observations suggest that this repeated
precipitation improves RNA performance in the RT reaction to
follow.
[0369] Following DNaseI digestion, an aliquot of the RNA suspension
in ethanol is removed and divided into thirds. A different
procedure is performed on each one of the aliquot thirds. These
three procedures are: (1). An OD.sub.260/280 is obtained using a
standard protocol and is used to estimate the amount of RNA present
and its likely quality. (2). An aliquot is run out on an agarose
gel, and the RNA is stained with ethidium bromide. Observation that
both the 28S and 18S RNAs are visible as discreet bands and that
there is little staining above the point at which the 28S rRNA
migrates indicate that the RNA is relatively intact. While it is
not critical to assay performance that the examined RNAs be
completely free of partial degradation, it is important to
determine that the RNA is not so degraded as to significantly
effect the appearance of the 28S rRNA. (3). The total cell RNAs are
run using a PCR-based test that confirms that the DNaseI treatment
actually digested the contaminating genomic DNA to completion. It
is very important to confirm complete digestion of genomic DNA
because genomic DNA may act as a template in PCR reactions
resulting in false positive signals in the relative quantitative
RT-PCR assay described below. The assay for contaminating genomic
DNA utilizes gene specific oligonucleotides that flank a 145
nucleotide long intron (intron #3) in the gene encoding Prostate
Specific Antigen (PSA). This is a single copy gene with no
pseudogenes. It is a member of the kallikrien gene family of serine
proteases, but the oligonucleotides used in this assay are specific
to PSA. The sequences of these oligonucleotides are:
4 5'CGCCTCAGGCTGGGGCAGCATT 3' (SEQ ID NO:79) and
5'ACAGTGGAAGAGTCTCATTCGAGAT 3' (SEQ ID NO:80).
[0370] In the assay for contaminating genomic DNA, 500 ng to 1.0
.mu.g of each of the DNaseI treated RNAs are used as templates in a
standard PCR (3540 cycles under conditions describe below) in which
the oligonucleotides described above are used as primers. Human
genomic DNA is used as the appropriate positive control. This DNA
may be purchased from a commercial vender. A positive signal in
this assay is the amplification of a 242 nucleotide genomic DNA
specific PCR product from the RNA sample being tested as visualized
on an ethidium bromide stained electrophoretic gel. There should be
no evidence of genomic DNA as indicated by this assay in the RNAs
used in the RT-PCR assay described below. Evidence of contaminating
genomic DNA results in redigestion of the RNA with DNaseI and
reevaluation of the DNase treated RNA by determining its
OD.sub.260/280 ratio, examination on electrophoretic gel and
retesting for genomic DNA contamination using the described PCR
assay.
[0371] The standard conditions used for PCR (as mentioned in the
last paragraph) are:
[0372] 1.times. GIBCO-BRL PCR reaction buffer [20 mM Tris-Cl (pH
8.4), 50 mM KCl]
[0373] 1.5 mM MgCl.sub.2
[0374] 200 .mu.M each of the four dNTPs
[0375] 200 nM each oligonucleotide primer
[0376] concentration of template as appropriate
[0377] 2.5 units of Taq polymerase per 100 .mu.l of reaction
volume.
[0378] Using these conditions, PCR is performed with 35-40 cycles
of:
[0379] 94.degree. C. for 45 sec
[0380] 55.degree.-60.degree. C. for 45 sec
[0381] 72.degree. C. for 1:00 minute.
[0382] The protocols described in the above section permit
isolation of total cellular RNA that overcomes two of the six
barriers to successful RT-PCR, ie. the RNA is acceptably intact and
is free from contaminating genomic DNA.
[0383] Reverse transcriptases, also called RNA dependent DNA
polymerases, as applied in currently used molecular biology
protocols, are known to be less processive than other commonly used
nucleic acid polymerases. It has been observed that not only is the
efficiency of conversion of RNA to cDNA relatively inefficient,
there is also several fold variation in the efficiency of cDNA
synthesis between reactions that use RNAs as templates that
otherwise appear indistinguishable. The sources of this variation
are not well characterized, but empirically, it has been observed
that the efficiencies of some reverse transcription (RT) reactions
may be improved by repeated organic extractions and ethanol
precipitations. This implies that some of the variation in RT is
due to contaminates in the RNA templates. In this case, the DNaseI
treatment described above may be aiding the efficiency of RT by
subjecting the RNA to an additional cycle of extraction with phenol
and chloroform and ethanol precipitation. Contamination of the
template RNA with inhibitors of RT is an important barrier to
successful RT that is partially overcome by careful RNA preparation
and repeated organic extractions and ethanol precipitations.
[0384] Reverse transcription reactions are performed using the
Superscript.TM. Preamplification System for First Strand cDNA
Synthesis kit which is manufactured by GIBCO-BRL Life Technologies
(Gaithersburg, Md.). Superscript.TM. is a cloned form of M-MLV
reverse transcriptase that has been deleted for its endogenous
RNaseH activity in order to enhance its processivity. In the
present example, the published protocols of the manufacturer are
used for cDNA synthesis primed with random hexamers. cDNA synthesis
may also be primed with a mixture of random hexamers (or other
small oligonucleotides of random sequence) and oligo dT. The
addition of oligo dT increases the efficiency of conversion of RNA
to cDNA proximal to the polyA tail. As template, either 5 or 10
micrograms of RNA is used (depending on availability). After the RT
reaction has been completed according to the protocol provided by
GIBCO-BRL, the RT reaction is diluted with water to a final volume
of 100 .mu.l.
[0385] Even with the best prepared RNA and the most processive
enzyme, there may be significant variation in the efficiency of RT.
This variation would be sufficiently great that cDNA made in
different RTs could not be reliably compared. To overcome this
possible variation, cDNA populations made from different RT
reactions may be normalized to contain equal concentrations of
amplifiable cDNA synthesized from mRNAs that are known not to vary
between the physiological states being examined. In the present
examples, cDNAs made from total cell RNAs are normalized to contain
equal concentrations of amplifiable .beta.-actin cDNA.
[0386] One .mu.l of each diluted RT reaction is subjected to PCR
using oligonucleotides specific to .beta.-actin as primers. These
primers are designed to cross introns, permitting the
differentiation of cDNA and genomic DNA. These .beta.-actin
specific oligonucleotides have the sequences:
5 5'CGAGCTGCCTGACGGCCAGGTCATC 3' (SEQ ID NO:81) and
5'GAAGCATTTGCGGTGGACGATGGAG 3' (SEQ ID NO:82)
[0387] PCR is performed under standard conditions as described
previously for either 19 or 20 cycles. The resulting PCR product is
415 nucleotides in length. The product is examined by PCR using
agarose gel electrophoresis followed by staining with ethidium
bromide. The amplified cDNA fragment is then visualized by
irradiation with ultra violet light using a transilluminator. A
white light image of the illuminated gel is captured by an IS-1000
Digital Imaging System manufactured by Alpha Innotech Corporation.
The captured image is analyzed using either version 2.0 or 2.01 of
the software package supplied by the manufacturer to determine the
relative amounts of amplified .beta.-actin cDNA in each RT
reaction.
[0388] To normalize the various cDNAs, water is added to the most
concentrated cDNAs as determined by the assay described in the last
paragraph. PCR using 1 .mu.l of the newly rediluted and adjusted
cDNA is repeated using the .beta.-actin oligonucleotides as
primers. The number of cycles of PCR must be increased to 21 or 22
cycles in order to compensate for the decreased concentrations of
the newly diluted cDNAs. With this empirical method the cDNAs can
be adjusted by dilution to contain roughly equal concentrations of
amplifiable cDNA. Sometimes this process must be repeated to give
acceptable final normalization. By dividing the average optical
density of all observed bands by that of a particular band, a
normalization statistic can be created that will permit more
accurate comparisons of the relative abundances of RNAs examined in
the normalized panel of cDNAs. A representative gel is shown if
FIG. 12. An analysis of the data is shown in Table 2.
[0389] Once the normalization statistics are derived, PCR may be
performed using different gene specific oligonucleotides as primers
to determine the relative abundances of other mRNAs as represented
as cDNAs in the normalized panel of diluted RT reaction
products.
[0390] Most mRNA species are not differentially expressed. An
example of a differentially expressed message is the mRNA encoding
the transmembrane tyrosine kinase receptor, Hek, that is
significantly up regulated in BPH as compared to normal
prostates.
[0391] In an examination of the relative abundance levels of Hek
mRNA, the normal and tumor specimens were examined as pools. Low
level expression was observed in the pool of normal prostate
tissues relative to that observed in BPH. By normalizing these
values to the .beta.-actin standard using the normalization
statistics, it is possible to quantify this difference in the
relative abundances of Hek mRNA. These normalized data are
displayed graphically in the bar graph shown in FIG. 13. Most but
not all of the BPH specimens showed elevated abundances of Hek mRNA
relative to a pool of normal prostates. On average, the abundance
of Hek mRNA was observed to be 2.9 fold higher in the BPH specimens
than in an average normal prostate gland as represented by the pool
of normal glands.
[0392] While these observations are consistent with many similar
studies that examined Hek expression using other tissue samples and
cDNAs, they vary from observations described in the next section in
which an RT-PCR assay is discussed that uses pooled cDNAs and is
more likely to capture data from PCRs while in the linear portions
of their amplification curves. It was fairly obvious from the data
obtained in the Hek study that at least some of the RT-PCR
reactions were not in the linear portions of their amplification
curves when the data was captured. This was concluded from
observation that the intensity of the bands from BPH9 slightly
decreased from a sample taken at 35 to a sample taken at 40 cycles.
To a lesser extent this was true for other samples as well. This is
a strong indication that the PCRs had left the linear portions of
their amplification curves. While this observation limits the
qualitative value of this experiment, it does not necessarily limit
the ability of the assay to determine qualitative differences in
mRNA abundances. The error caused by observing PCRs after the
linear portion of PCR is in the direction of quantitatively
underestimating mRNA abundance differences. It is still valid to
conclude that Hek is up regulated in many prostate glands with BPH
even if the absolute fold increase in abundance can not be
determined. By looking at individuals, it is possible to examine
questions as to what portion of individuals of a particular
physiologic class, i.e. individuals with BPH, similarly regulate
the mRNA being examined. To determine quantitative differences in
mRNA expression, it is necessary that the data is collected in the
linear portion of the respective PCR amplification curves. This
requirement is met in the assay described in following
paragraphs.
[0393] The last two barriers to RT-PCR are addressed in the
sections that follow involving the use of pooled cDNAs as templates
in RT-PCR. In practice, the protocols using pooled templates are
usually performed before the protocol described above.
[0394] There are two additional barriers to relative mRNA
quantitation with RT-PCR that frequently compromise interpretations
of results obtained by this method. The first of these involves the
need to quantify the amplification products while the PCR is still
in the linear portion of the process where "E" behaves as a
constant and is nearly equal to two. In the "linear" portion of the
amplification curve, the log of the mass of the amplified product
is directly proportional to the cycle number. At the end of the PCR
process, "E" is not constant. Late in PCR, "E" declines with each
additional cycle until there is no increase in PCR product mass
with additional cycles. The most important reason why the
efficiency of amplification decreases at high PCR cycle number, may
be that the concentration of the PCR products becomes high enough
that the two strands of the product begin to anneal to each other
with a greater efficiency than that at which the oligonucleotide
primers anneal to the individual product strands. This competition
between the PCR product strands and the oligonucleotide primers
creates a decrease in PCR efficiency. This part of the PCR where
the efficiency of amplification is decreased is called the
"plateau" phase of the amplification curve. When "E" ceases to
behave as a constant and the PCR begins to move towards the plateau
phase, the conservation of relative proportionality of amplified
products during PCR is lost. This creates an error in estimating
the differences in relative abundance of an mRNA species occurring
in different total cell RNA populations. This error is always in
the same direction, in that it causes differences in relative mRNA
abundances to appear less than they actually are. In the extreme
case, where all PCRs have entered the plateau phase, this effect
will cause differentially expressed mRNAs to appear as if they are
not differentially expressed at all.
[0395] To control for this type of error, it is important that the
PCR products be quantified in the linear portion of the
amplification curve. This is technically difficult because
currently used means of DNA quantitation are only sensitive enough
to quantify the PCR products when they are approaching
concentrations at which the product strands begin to compete with
the primers for annealing. This means that the PCR products can
only be detected at the very end of the linear range of the
amplification curve. Predicting in advance at what cycle number the
PCR products should be quantified is technically difficult.
[0396] Practically speaking, it is necessary to sample the PCR
products at a variety of cycle numbers that are believed to span
the optimum detection range in which the products are abundant
enough to detect, but still in the linear range of the
amplification curve. It is impractical to do this in a study that
involves large numbers of samples because the number of different
PCR reactions and/or number of different electrophoretic gels that
must be run becomes prohibitively large.
[0397] To overcome these limitations, a two tiered approach has
been designed to relatively quantitate mRNA abundance levels using
RT-PCR. In the first tier, pools of cDNAs produced by combining
equal amounts of normalized cDNA are examined to determine how mRNA
abundances vary in the average individual with a particular
physiological state. This reduces the number of compared samples to
a very small number such as two to four. In the studies described
herein, three pools are examined. These are pools of normal
prostates, those with BPH and a variety of prostate tumors. Each
pool may contain a large number of individuals. While this approach
does not discriminate differences between individuals, it can
easily discern broad patterns of differential expression. The great
advantage of examining pooled cDNAs is that it permits many
duplicate PCR reactions to be simultaneously set up.
[0398] The individual duplicates can be harvested and examined at
different cycle numbers of PCR. In studies described below, four
duplicate PCR reactions were set up. One duplicate was terminated
at 31, 34, 37, and 40 PCR cycles. Occasionally, PCR reactions were
also terminated at 28 cycles. Examining the PCRs at different cycle
numbers yielded the following benefits. It is very likely that at
least one of the RT-PCRs will be in the optimum portion of the
amplification curves to reliably compare relative mRNA abundances.
In addition, the optimum cycle number will be known, so that
studies with much larger sample sizes, such as the studies Hek
described above, are much more likely to succeed. This is the
second tier of a two tiered approach that has been taken to
relatively quantitate mRNA abundance levels using RT-PCR. Doing the
RT-PCR with the pooled samples permits much more efficient
application of RT-PCR to the samples derived from individuals. A
further benefit, also as discussed below, tube to tube variability
in PCR can be discounted and controlled because most studies yield
multiple data points due to duplication.
[0399] Like the previously described protocol involving
individuals, the first step in this protocol is to normalize the
pooled samples to contain equal amounts of amplifiable cDNA. This
is done using oligonucleotides that direct the amplification of
.beta.-actin. In this example, a PCR amplification of a cDNA
fragment derived from the .beta.-actin mRNA from pools of normal
prostates, glands with BPH and prostate tumors was performed. This
study was set up as four identical PCR reactions. The products of
these PCRs were collected and electrophoresed after 22, 25, 28 and
31 PCR cycles. Quantitation of these bands using the IS 1000 system
shows that the PCRs are still in the linear ranges of their
amplification curves at 22, 25 and 28 cycles but that they have
left linearity at 31 cycles. This is known because the ratios of
the band intensities remain constant and internally consistent for
the data obtained from 22, 25 and 28 cycles, but these ratios
become distorted at 31 cycles. This quantitation will also permit
the derivation of normalizing statistics for the three pools
relative to each other in exactly the same manner as was done
previously for individuals (Table 2).
[0400] This study is then repeated using gene specific primers for
a gene other than .beta.-actin. For purposes of comparison, the
mRNAs examined were the same as were previously shown, Hek. As was
done previously for the samples derived from individuals, the
intensities of the relevant bands were quantitated using the IS
1000 and normalized to the .beta.-actin signals.
[0401] For Hek, the data deserves more interpretation. While the
Hek derived PCR product was observable at 34 cycles of PCR, at 40
cycles, the Hek derived PCR product was present as a bold band in
the PCRs using either the pooled BPH samples or pooled prostate
tumor samples as templates. The Hek band obtained when a pool of
normal prostates is examined is barely visible. It is clear that
Hek is more abundantly expressed in BPH and prostate tumors than it
is in normal glands. Quantitation and normalization of this data as
described previously was performed and shown in the bar graph in
FIG. 14.
[0402] The central question to be answered in analyzing this data
is whether the PCRs have been examined in the linear portions of
their amplification curves. A test for this can be devised by
determining if the proportionality of the PCR products has been
conserved as PCR cycle number has increased. At 34 cycles, the Hek
product is observed at 5.77 and 4.375 relative abundance units
respectively for the pooled BPH and cancer samples as shown in FIG.
14. The ratio of these values is 1.32. Similarly, at 37 cycles the
values for BPH and cancer are 23.1 and 17.5. The ratio of these
values is also 1.32. This is strong evidence that the PCRs were in
the linear portions of their amplification curves when these
observations were made. This is a better conservation of
proportionality than is frequently observed. In some studies, data
was excepted when the rations were similar but not identical. This
conservation of proportionality is lost at 40 cycles. The ratio of
the BPH and cancer values has increased to 1.85. This indicates
that these PCRs are nearing the plateau phases of their
amplification curves. Further evidence that the plateau phase is
nearing can be directly observed in the relative increases in the
numerical data observed in this study. From 34 to 37 cycles of PCR
the mass of the observed PCR products increased 4.0 fold in both
the BPH and cancer reactions. Similar calculations of the increase
in signals between 37 and 40 cycles indicate a 3.1 fold increase in
the BPH reactions and only a 2.2 fold increase for the cancer
reactions. In both cases, "E" is declining, and the reactions are
nearing their plateau phases.
[0403] For the reactions that attempted to amplify Hek cDNA from a
pool of normal prostates, a band was only observed at 40 cycles.
Since the BPH and cancer reactions had left their linear phases,
direct numerical quantitation of the fold increase in abundance
between normal, BPH and cancer is not possible. It is, however,
valid to conclude that Hek mRNA is more abundant in samples derived
from BPH or prostate tumors than it is in normal prostate glands.
It may also be true that Hek is more abundant in the average BPH
specimen than it is in the average prostate tumor. This has been
observed in many studies including the one shown here, but the
difference in relative expression of Hek between BPH and prostate
cancers is always small, as it is here. It is possible that the
higher levels of expression in the tumor pool relative to normal
prostates may be due to BPH tissue contaminating the tumor
specimens. Alternatively, it may be due to higher Hek expression in
the tumors themselves. Examination of tissue by in situ
hybridization or by immunohistochemical methods may be required to
distinguish between these possibilities.
[0404] The final major barrier to quantifying relative mRNA
abundances with RT-PCR is tube to tube variability in PCR. This can
result from many factors, including unequal heating and cooling in
the thermocycler, imperfections in the PCR tubes and operator
error. To control for this source of variation, the Cole-Parmer
digital thermocouple Model # 8402-00 was used to calibrate the
thermocyclers used in these studies. Only slight variations in
temperature were observed. To rigorously demonstrate that PCR tube
to tube variability was not a factor in the studies described
above, 24 duplicate PCRs for .beta.-actin using the same cDNA as
template were performed. These PCR tubes were scattered over the
surface of a 96 well thermocycler, including the corners of the
block where it might be suspected the temperature might deviate
from other areas. Tubes were collected at various cycle numbers.
Nine tubes were collected at 21 cycles. Nine tubes were collected
at 24 cycles, and six tubes were collected at 27 cycles.
Quantitation of the intensities of the resulting bands with the IS
1000 system determined that the standard error of the mean of the
PCR product abundances was .+-.13%. This is an acceptably small
number to be discounted as a major source of variability in an
RT-PCR assay.
[0405] The RT-PCR protocol examining pooled cDNAs is internally
controlled for tube to tube variability that might arise from any
source. By examining the abundance of the PCR products at several
different cycle numbers, it can be determined that the mass of the
expected PCR product is increasing appropriately with increasing
PCR cycle number. Not only does this demonstrate that the PCRs are
being examined in the linear phase of the PCR, where the data is
most reliable, it demonstrates that each reaction with the same
template is consistent with the data from the surrounding cycle
numbers. If there was an unexplained source of variation, the
expectation that PCR product mass would increase appropriately with
increasing cycle number would not be met. This would indicate
artifactual variation in results. Internal duplication and
consistency of the data derived from different cycle numbers
controls for system derived variation in tube to tube results.
[0406] As described in the preceding paragraphs, the RT-PCR
protocol using pooled cDNA templates overcomes the last two
barriers to effective relative quantitative RT-PCR. These barriers
are the need examine the PCR products while the reactions are in
the linear portions of their amplification curves and the need to
control tube to tube variation in PCR. The described protocol
examines PCR products at three to four different cycle numbers.
This insures that the PCRs are quantitated in their linear ranges
and, as discussed in the last paragraph, controls for possible tube
to tube variation.
[0407] One final question is whether .beta.-actin is an appropriate
internal standard for mRNA quantitation. p-actin has been used by
many investigators to normalize mRNA levels. Others have argued
that .beta.-actin is itself differentially regulated and therefore
unsuitable as an internal normalization standard. In the protocols
described herein differential regulation of .beta.-actin is not a
concern. More than fifty genes have been examined for differential
expression using these protocols. Fewer than half were actually
differentially expressed. The other half were regulated similarly
to .beta.-actin within the standard error of 13%. Either all of
these genes are coordinately differentially regulated with
.beta.-actin, or none of them are differentially regulated. The
possibility that all of these genes could be similarly and
coordinately differentially regulated with .beta.-actin seems
highly unlikely. This possibility has been discounted.
[0408] .beta.-actin has also been criticized by some as an internal
standard in PCRs because of the large number of pseudogenes of
.beta.-actin that occur in mammalian genomes. This is not a
consideration in the described assays because all of the RNAs used
herein are demonstrated to be free of contaminating genomic DNA by
a very sensitive PCR based assay. In addition, the cycle number of
PCR needed to detect .beta.-actin cDNA from the diluted RT
reactions, usually between 19 and 22 cycles, is sufficiently low to
discount any contribution that genomic DNA might make to the
abundance of amplifiable .beta.-actin templates.
6TABLE 2 Raw Numerical Data Captured on the IS1000 and
Normalization by Comparison to B-Actin Raw Data Normal- Raw Data
Normalized Type of Raw Data corrected for izing for Hek Data for
Hek Tissue B-Actin background Statistic (UC205) (UC205) Normal 16
11 1.42 Pool 1 Normal 35 30 0.52 Pool 2 Total 25.5 20.5 0.76 22
16.72 normal Pool BPH1 13 8 1.96 37 72.52 BPH2 27 22 0.71 10 17.1
BPH3 36 31 0.5 44 22 BPH4 1 31 31 BPH5 18 13 1.2 24 28.8 BPH6 15 10
1.56 41 63.96 BPH7 17 12 1.3 51 66.3 BPH8 21 16 0.975 39 38 BPH9 11
6 2.6 50 130 BPH10 17 12 1.3 14 18.2 BPH Pool 19.4 14.4 1.08
Cancer1 13 8 1.96 Cancer2 18 13 1.2 Cancer3 22 17 0.92 Cancer4 25
20 0.78 Cancer5 29 24 0.65 Cancer6 1 Cancer7 22 17 0.92 Cancer8 22
17 0.92 Cancer9 15 10 1.56 Cancer10 16 11 1.42 Cancer11 11 6 2.6
Cancer 34 29 0.54 (Met)12 Cancer 20.6 15.7 1 41 41 Pool No 5 0
template Back- 5 0 ground Total 497.9 377.9 Average 20.6 15.6
Example 2
Identification of Markers of Prostate Disease by RNA
Fingerprinting
[0409] The technique of RNA fingerprinting was used to identify
differentially expressed RNA species isolated from primary human
prostate tumors or human prostate cancer cell lines grown in
culture as described above. About 400 bands were observed in these
studies. A number of these appeared to be differentially expressed,
and were cloned as described above.
[0410] Slot blots of total cell RNA probed with riboprobes
indicated that six of the clones were differentially expressed.
These six cloned PCR products chosen for further analysis were
named UC Band #25 (SEQ ID NO:1), UC Band #27 (SEQ ID NO:2), UC Band
#28 (SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85), UC Band #31 (SEQ
ID NO:4), UC Band #32 (SEQ ID NO:7) and UC Band #33 (SEQ ID
NO:5).
[0411] Studies were performed using total cell RNA isolated from
human prostate glands and primary human prostate tumor samples. The
prostate disease markers observed to be differentially expressed in
this series of studies include UC Band #25 (SEQ ID NO:1), UC Band
#28 (SEQ ID NO:3, SEQ ID NO:83 and SEQ ID NO:85), UC Band #31 (SEQ
ID NO:4), UC Band #32 (SEQ ID NO:7) and UC Band #33 (SEQ ID NO:5).
Differential expression of these gene products in human prostate
tumors compared with benign and normal prostate tissues was
confirmed by quantitative RT-PCR, as described below.
[0412] DNA sequence determination indicated that UC Band #25 (SEQ
ID NO:1), UC Band #27 (SEQ ID NO:2), UC Band #28 (SEQ ID NO:3, SEQ
ID NO:83 and SEQ ID NO:85), UC Band #31 (SEQ ID NO:4) and UC Band
#33 (SEQ ID NO:5) were previously unknown genes. UC Band #32 (SEQ
ID NO:7) was derived from the mRNA of fibronectin. The result with
the latter gene product is interesting because urinary fibronectin
has been proposed as a potential biomarker for prostatic cancer
(Webb & Lin, 1980.) The levels of expression for UC Band #25,
UC Band #27, UC Band #28, UC Band #31, UC Band #33, fibronectin and
lipocortin II were analyzed by the quantitative RT-PCR protocol in
samples of normal, benign and malignant prostate glands. The
results for UC Band #25 (SEQ ID NO:1), (FIG. 1), UC Band #27 (SEQ
ID NO:2), (FIG. 2), UC Band #28 (SEQ ID NO:3, SEQ ID NO:83 and SEQ
ID NO:85), (FIG. 3), UC Band #31 (SEQ ID NO:4), (FIG. 4), and UC
Band #33 (SEQ ID NO:5), (FIG. 6), all show an increased level of
expression in prostate carcinomas (NB, T and LM) compared with
benign (B) and normal (N) prostate samples.
[0413] The results for UC Band #28 (FIG. 3) and UC Band #33 (FIG.
6) are particularly striking. These clones are expressed at very
low levels in normal or benign prostate, and at significantly
higher levels in metastatic and nonmetastatic prostate cancers. As
such, they would provide excellent markers for the detection of
malignant prostate tumors in biopsy samples containing a mixture of
normal, benign and malignant prostate. The skilled practitioner
will realize that all of these clones, particularly UC Band #28 and
UC Band #33, have utility for the detection and diagnosis of
prostate cancer, and such uses are included within the scope of the
present invention.
[0414] The RT-PCR analysis for fibronectin (UC Band #32, FIG. 5) is
also interesting. This marker appears to only be expressed in
normal prostate samples, and is present at very low levels in
either benign or malignant prostate (FIG. 5). The down regulation
of fibronectin expression in BPH is a novel result. This
observation is surprising in light of the previous report that
fibronectin is a potential marker for prostate cancer. (Webb and
Lin, 1980.) Those experienced in the art will realize that loss of
fibronectin expression in BPH is of utility in diagnosing and
detecting this condition in patients. The mRNA for lipocortin II,
while differentially expressed in the cell lines was not
differentially expressed in tumors.
[0415] Further RNA fingerprinting studies were done to identify
genes that are differentially regulated at the level of mRNA
transcription in normal prostate glands, glands with BPH, prostate
tumors and metastases of prostate tumors. Differential expression
was confirmed by relative quantitative RT-PCR. The oligonucleotides
used are listed in Table 4. These studies resulted in the discovery
of additional sequences that were differentially regulated. These
sequences are designated herein as UC38, SEQ ID NO:10; UC40, SEQ ID
NO: 1; UC41, SEQ ID NO:12; UC43, SEQ ID NO:19; UC45, UC46, UC47,
matches GenBank Accession #M34840, prostatic acid phosphatase Nt
901-2095; UC201, SEQ ID NO: 13; UC202, UC203, UC204 (matches
GB#Z28521 and GB# D42055), SEQ ID NO:20; UC205 (Humhek, GB# H8394,
sense strand), SEQ ID NO:14; UC206 (antisense strand), UC207 (sense
strand), SEQ ID NO:15; UC208 (sense strand), UC209, SEQ ID NO:16;
UC210 (sense strand), SEQ ID NO:17; UC211 (antisense strand), SEQ
ID NO:21; UC212 (sense strand), SEQ ID NO:22; and UC213 (sense
strand, matches GB# T07736), SEQ ID NO:23. Of these UC38, UC41,
UC47 and UC211 are more abundant in tumors and are potential tumor
markers. UC40, UC205 and UC207 are more abundant in BPH. UC43 is
more abundant in normal and BPH glands and is a potential tumor
suppressor. UC201 and UC210 are more abundant in some tumors and
are potential progression markers. UC212 is more abundant in BPH
and perhaps in some tumors. UC209 is down regulated in some tumors
and is a possible suppressor of progression, and UC213 is down
regulated in tumors.
[0416] Those experienced in the art will recognize that the genes
and gene products (RNAs and proteins) for the above described
markers of prostate disease and normal prostate marker are included
within the scope of the invention herein described. Those
experienced in the art will also recognize that the diagnosis and
prognosis of prostatic cancer by detection of the nucleic acid
products of these genes are included within the scope of the
present invention.
[0417] 3. Detection of Differentially Expressed RNA Species Using
Primers Specific for TGF-.beta. and Cyclin A
[0418] Relative quantitative RT-PCR with an external standard
proved to be a powerful means to examine mRNAs for differential
expression in prostate cancer. Other genes were examined for
differential expression by these means. These were selected because
they were either known to be up regulated as a consequence of
transformation or could be hypothesized to be up regulated as a
consequence of transformation.
[0419] The results of two of these assays are included here. They
show that TGF-.beta.1 (FIG. 7) and cyclin A (FIG. 8) are both up
regulated in prostate cancer relative to normal and benign glands.
The cyclin A result is particularly interesting because this
protein is known to be a positive regulator of cell cycle
progression. It has occasionally been shown to be up regulated in
some cancers, but this is the first observation of cyclin A being
up regulated in most or all tumors derived from a single organ
source (prostate). The sequence of cyclin A is identified as SEQ ID
NO:8. Those skilled in the art will recognize that the genes and
gene products (RNAs and proteins), including the diagnosis and
prognosis of prostatic cancer by detection of the RNA products for
these two genes, are included within the scope of the invention
herein described.
Example 4
Identification of Markers of Prostate Disease Using Probes Specific
for a Truncated Form of Her2/neu
[0420] In the studies described below, a relative quantitative
version of RT-PCR was performed. The oligonucleotides used as
primers to direct the amplification by PCR of the various cDNA
fragments are given in Table 5. Briefly, three oligonucleotide
primers were designed, which are identified in Table 5 as Neu5',
SEQ ID NO:44; Neu3', SEQ ID NO:71; and NeuT3', SEQ ID NO:72. Neu5'
anneals to antisense sequence for both the full length and
truncated form of the Her2/neu mRNAs at a position 5' of an
alternate RNA processing site (see FIG. 9). Neu3' anneals to the
sense strand of the full length Her2/neu mRNA at a position just 3'
of the transmembrane domain (FIG. 9).
[0421] In an RT-PCR assay using Neu5' and Neu3' as primers, a 350
base pair long amplification product was generated using the full
length mRNA as a template. Using these primers, a cDNA fragment can
not be generated from the truncated mRNA because Neu3' will not
anneal to this mRNA or its cDNA. The third oligonucleotide primer,
NeuT3', anneals to the sense strand of the 3' untranslated region
of the truncated form of the Her2/neu mRNA and cDNA (FIG. 9). In an
RT-PCR assay using Neu5' and NeuT3' as primers, a 180 base pair
long cDNA fragment was amplified using the truncated mRNA as a
template. This primer pair can not direct the amplification of a
fragment of the full length Her2/neu mRNA because NeuT3' will not
anneal to the full length transcript.
[0422] The results of relative quantitative RT-PCR clearly showed
that the relative abundance of the Her2/neu mRNA is increased in
prostate cancers as compared to either normal prostate or benign
prostatic hyperplasia (FIG. 10). These data were generated from a
densitometry scan of a photographic negative of a photograph of an
ethidium bromide stained gel. The raw densitometry scan data were
then normalized to a similar scan of a PCR amplification from the
same template of .beta.-actin, a gene whose expression is not
expected to vary as a function of transformation or tumor
progression. The results are completely consistent with the
increased abundance of Her2/neu protein in prostate tumors that was
previously described in the literature reviewed above.
[0423] A relative quantitative RT-PCR assay examining the relative
abundance of the truncated form of the Her2/neu mRNA (SEQ ID NO:9)
in various prostate tissues was also performed. This assay was
similar to that shown above for the full length Her2/neu
transcript. The data from this study was quantified and normalized
to 13-actin and is displayed in FIG. 11.
[0424] As shown in FIG. 11, the relative abundance of this
truncated transcript was significantly increased in prostate
cancers as compared to normal and benign prostate. As discussed in
a previous section, this truncated form of the Her2/neu mRNA has
been previously described in breast, ovarian and gastric tumors.
This is the first report of differential expression of a truncated
form of Her2/neu as a biomarker for prostate cancer.
[0425] As indicated in Scott et al. (1993), expression of this
truncated Her2/neu mRNA may alter the cellular behavior of cancer
cells to the detriment of patients. Those skilled in the art will
recognize that therapeutic treatment of prostate cancer targeted
towards the gene products (including mRNAs and proteins) of the
truncated form of Her2/neu is included within the scope of this
invention.
7TABLE 3 Genes Whose mRNAs have Abundances that Vary in Prostate
Cancer Relative to Normal and Benign Glands Name of cDNA Sequence
Confirmed Previously Fragment Determined by RT-PCR Known SEQ ID NO:
UC Band #25 Yes Yes No 1 UC Band #27 Yes Yes No 2 UC Band #28 Yes
Yes No 3, 83, 84 UC Band #31 Yes Yes No 4 UC Band #32 Yes Yes
fibronectin 7 US Band #33 Yes Yes No 5 Cyclin A Yes Yes Cyclin A 8
Trunc. Yes Yes Tru. HER2/ 9 HER2/neu neu UC Band #38 Yes Yes No 10
UC Band #40 Yes Yes No 11 UC Band #41 Yes Yes No 12 UC Band #43 Yes
Yes No 19 UC Band #47 Yes Yes Prostatic 47 Acid Phosphatase UC Band
#201 Yes Yes No 13 UC Band #204 Yes Yes GB #Z28521 20 and GB
#D42055 UC Band #205 Yes Yes Humhek 14 UC Band #207 Yes Yes No 15
UC Band #209 Yes Yes No 16 UC Band #210 Yes Yes No 17 UC Band #211
Yes Yes No 21 UC Band #212 Yes Yes No 22 UC Band #213 Yes Yes GB
#T07736 23 UC Band #214 Yes Yes No 45 UC Band #215 Yes Yes No
46
[0426] Table 4. Oligonucleotides used in the relative quantitative
RT-PCR portion of these studies.
[0427] Oligonucleotides used to examine the expression of
genes:
[0428] Cyclin A (SEQ ID NO:8)
8 5'TGCGTTCACCATTCATGTGGATGAAGCAG3', SEQ ID NO:26
5'CTCCTACTTCAACTAACCAGTCCACGAG3', SEQ ID NO:27
[0429] UC Band #25 (SEQ ID NO:1)
9 5'GATGCTTTGAAGTTATCTCTCTTGG3', SEQ ID NO:28
5'ATCAGTGTGGCAGATATAATGGACC3', SEQ ID NO:29
[0430] UC Band #27 (SEQ ID NO:2)
10 5'GCCCCAAATGCCAGGCTGCACTGAT3', SEQ ID NO:30
5'GCCAGAAGACAAGAGTGTGAGCTT3', SEQ ID NO:31
[0431] UC Band #28 (SEQ ID NO:3)
11 5'GCTTCAGGGTGGTCCAATTAGAGTT3', SEQ ID NO:32
5'TCCAACAACGACACATTCAGGAGTT3', SEQ ID NO:33
[0432] UC Band #31 (SEQ ID NO:4)
12 5'GGACACAGAGTAAGATACCCACTGA3', SEQ ID NO:34
5'CCTCGGTCTTTGGTCTTTGCATATC3', SEQ ID NO:35
[0433] UC Band #32 (SEQ ID NO:7)
13 5'ACAAGGAAAGTGTCCCTATCTCTGA3', SEQ ID NO:36
5'CTCGAGGTCTCCCACTGAAGTGCTC3', SEQ ID NO:37
[0434] UC Band #33 (SEQ ID NO:5)
14 5'CACTGCACATTAAGATGGAGCCCGA3', SEQ ID NO:38
5'CCTGTAGAAGTTCTGCTGCGTGTGG3', SEQ ID NO:39
[0435] UC Band #38 (SEQ ID NO:10)
15 5' TCGCTCCACATTCATCCTTTCT3', SEQ ID NO:49 5'
TGATCCCTGGGTGATATAGAGCATA3', SEQ ID NO:50
[0436] UCBand#40 (SEQ ID NO:11)
16 5' GCCCCACATCTGAACAAGCTAATAA3', SEQ ID NO:51 5'
TGCGCCCTTCATACAGGCAGAGTTG3', SEQ ID NO:52
[0437] UC Band #41 (SEQ ID NO:12) j
17 5' CACGATGCCATTCTGCCATTTCTGT3', SEQ ID NO:53 5'
GGAAGAGATGGAATAGAAACTGTAA3', SEQ ID NO:54
[0438] UC Band #43 (SEQ ID NO:19)
18 5' CACTGGAACCAACAGGCCTGCCTCAAC3', SEQ ID NO:57 5'
CCGAGCCAATTGGTACAGGTCTGTTCTCCC3', SEQ ID NO:58
[0439] UC Band #47 (SEQ ID NO:47)
19 5' CCTCAAGACTGGTCCACGGAGTGTATGA3', SEQ ID NO:59 5'
GGGTAATGGCCAAAGTATGTTCTCAAAGCA3', SEQ ID NO:60
[0440] UC Band #201 (SEQ ID NO:13)
20 5' AAACAAACGTCTTTGGGTAAA3', SEQ ID NO:61 5'
CTGGACAAAGAGGAATATGA3', SEQ ID NO:62
[0441] UC Band #204 (SEQ ID NO:20)
21 5' GCCCTTTATAAATACGATTAGTATGGAG3', SEQ ID NO:63 5'
TGTAGTTAGTGCAGCAAAAGGAAGA3', SEQ ID NO:64
[0442] UC Band #205 (Humhek) (SEQ ID NO:14)
22 5' GATGTAATTAAAGCTGTAGATGAGGG3', SEQ ID NO:65 5'
GAATACTAACAATCTGCTCAAACTTGGG3', SEQ ID NO:66
[0443] UC Band #207 (SEQ ID NO:15)
23 5' GCCAAATGGGTAGCATTGTTGCTCGG3', SEQ ID NO:67 5'
CAGAGTGGGGCAAGATACCCTTGAG3', SEQ ID NO:68
[0444] UC Band #209 (SEQ ID NO:16)
24 5' AATGGAATTTCTTATGCCCTC3', SEQ ID NO:69 5'
CAATGCCAAGCACCCACTGATTC3', SEQ ID NO:70
[0445] UC Band #210 (SEQ ID NO:17)
25 5' ACACAGACACACACATGCACACCA3', SEQ ID NO:71 5'
CCTACCTGTGCAGAAATCAA3', SEQ ID NO:72
[0446] UC Band #211 (SEQ ID NO:21)
26 5' AGCAGCATAGCCTCTCTGAAACTC3', SEQ ID NO:73 5'
CCTTCTCATGTAGCCTGCAACCTGCTC3', SEQ ID NO:74
[0447] UC Band #212 (SEQ ID NO:22)
27 5' CATTGGTGCAGCAGGTTTAGATGG3', SEQ ID NO:75 5'
GAGATATCAATTTATAAGCACCAAG3', SEQ ID NO:76
[0448] UC Band #213 (SEQ ID NO:23) j
28 5' ATCTCAATCATTGAGCCTGAAGG3', SEQ ID NO:77 5'
CAGCAGGTTGAGTGAGGGATTTGG3', SEQ ID NO:78
[0449] UC Band #214 (SEQ ID NO:45)
29 5' CACAGATGTAGCTTCCTCACTGG3', SEQ ID NO:6 5'
CTTCATGGCAGGACTCGGTTTGGG3', SEQ ID NO:18
[0450] UC Band #215 (SEQ ID NO:46)
30 5' CCTGTGGCGTAAGGCATCCCA3', SEQ ID NO:24 5'
GCAAGCACTCCTTTGTAAAATGTCC3', SEQ ID NO:25
[0451] Controls used to normalize relative quantitative RT-PCR
[0452] .beta.-actin
31 5' CGAGCTGCCTGACGGCCAGGTCATC3', SEQ ID NO:40 5'
GAAGCATTTGCGGTGGACGATGGAG3', SEQ ID NO:41
[0453]
32TABLE 5 Oligonucleotide for detection of the truncated Her2/new
mRNA. NEU T3' 5' CCCCTTTTATAGTAAGAGCCCCAGA3', SEQ ID NO:44
Example 5
Identification of a Marker of Prostate, Bladder and Breast
Cancer
[0454] The prostate disease marker UC Band #28 (SEQ ID NO:3), which
was previously identified by RNA fingerprinting in the examples
above, was chosen for further analysis. Using the original UC 28
EST as a probe, the full-length cDNA for UC 28 gene has been cloned
by a combination of cDNA library screening and RACE (Rapid Cloning
of cDNA Ends) methods (Frohman, In: PCR PROTOCOLS: A GUIDE TO
METHODS AND APPLICATIONS, Academic Press, N.Y., 1990 incorporated
by reference). Two alternative cDNA sequences for this gene
corresponding to mRNA splice variants were isolated and sequenced,
and are included as SEQ ID NO:83 and SEQ ID NO:85. Each sequence
has the same open reading flame, and encodes a protein with 135
amino acids (SEQ ID NO:84 and SEQ ID NO:86).
[0455] Northern analysis using the UC 28 EST as the probe,
confirmed there are two alternative splicing mRNA variants, with
sizes 2.1 and 2.5 kb. The message for this gene was highly
expressed in colon, small intestine, and prostate. The message was
also seen in testes, spleen, thymus, and a modest amount of
expression was seen in peripheral blood leukocytes. The two mRNA
variants share an identical 5' untranslated region, an open reading
frame and part of the 3' untranslated region; and they differ only
at the end of the 3' untranslated region. Both mRNAs have poly A
tails and predicted polyadenylation sites. Both mRNAs, with the 2.5
kb mRNA being more abundant than the 2.1 kb mRNA, were confirmed to
be expressed in the prostate tissues by PCRTM using one common 5'
primer and two different 3' primers.
[0456] The 5' end sense primer used for amplification of both mRNAs
was:
33 5' TAGAAGACCAAATGCCCCGAGT3', SEQ ID NO:42
[0457] The 3' end anti-sense primer for the 2.1 kb mRNA was:
34 5' TGTATTTCTGTGGGATCGGTGG3', SEQ ID NO:43
[0458] The 3' end anti-sense primer for the 2.5 kb mRNA was:
35 5' CCCACCTCCCAAAGTGCTGGGA3', SEQ ID NO:87
[0459] The medium for PCRTM amplification contained 2 .mu.l of
prostate tissue cDNA, 10 mM Tris-HCl (pH 9.3), 50 mM KCl, 3 mM
MgCl.sub.2, 0.5 mM dNTP's, 1.25 U of Taq DNA polymerase (GIBCO/BRL)
and 200 nM of sense and anti-sense primers in a total reaction
volume of 30 .mu.l. Amplification was performed in a thermal cycler
(MJ Research), for 36 cycles of 1 min at 94.degree. C., 1 min at
55.degree. C. and 1 min at 72.degree. C.
[0460] The expression of UC 28 has been reconfirmed to be up
regulated more than five fold in organ-confined and metastatic
prostate cancers using relative quantitative RT-PCRTM in an
expanded panel of tissue samples (FIG. 18). Pools of mRNA from
normal individuals and mRNA from a normal individual were compared
to mRNA samples from BPH and prostate tumor bearing individuals
(n>10). The expression of UC 28 has also been investigated by
RT-PCR in breast, bladder lung, and colon cancers. UC 28 is
significantly up regulated in breast cancer, but not in lung or
colon cancers (FIG. 15). UC 28 expression was increased between
two- and eight-fold in four out of five bladder cancer samples
examined, compared with four normal bladder tissue controls. (FIG.
16).
[0461] Since hormones regulate both prostate and mammary glands,
the possibility that expression of this gene is modified by
androgen was examined. Results from the studies in LnCaP cells
indicated that indeed, gene expression is stimulated by
dihydrotestosterone (DHT) in a time and dosage-dependent manner
(FIG. 17). Considering the fact that both prostate and mammary
glands are hormonally regulated, and the gene is up regulated in
prostate and breast cancers, this gene may be involved in the
hormone-regulated cell growth or proliferation pathways in these
glands.
[0462] In situ hybridization (ISH) studies were performed to
investigate the expression of the gene and to localize UC 28 mRNA
in formalin-fixed paraffin-embedded radical prostatectomy
specimens. For ISH, a 25-mer antisense oligonucleotide, of the
sequence listed below, was biotinylated at the 3' end and used as
the probe with alkaline phosphatase or horseradish peroxidase used
as the detection enzyme.
36 5' CTTAACTCGGGCATTTGGTCTTC 3' SEQ ID NO:55
[0463] Minimal levels of UC 28 mRNA were detected in the adjacent
benign prostatic epithelial cells of prostate cancer tissue. A
significantly higher level of UC 28 mRNA was localized in prostate
adenocarcinoma tissue. The results further confirm the
up-regulation of the gene in prostate cancer and localize the
expression of the gene to the prostatic epithelia.
[0464] A first generation polyclonal antibody has been produced in
rabbits using a KLH conjugated synthetic peptide (21 amino acids).
The peptide, of sequence listed below, was chosen for antigenicity
by a computer software program (DNASTAR, Madison, Wis.).
[0465] RKKEKVKRSQKATEFIDYSIE SEQ ID NO:56
[0466] The synthetic peptide was conjugated to KLH by standard
techniques and injected into two rabbits, with bleeding started at
ten weeks. The antibody was peptide affinity purified and then
tested in prostate cancer cell lines, and breast and prostate
cancer tissue, confirming the localization of the UC 28 protein to
epithelial cells, mainly on the cell membrane.
[0467] EcoRI or HindIII digested human genomic DNA was also probed
in a Southern analysis to demonstrate that UC 28 is encoded by a
single copy of the gene in the human genome (FIG. 19). The gene has
been mapped to chromosome 6q23-24 by FISH chromosome mapping (FIG.
20).
[0468] Computer analyses using bioinfomatics from public databases
(MotifFinder program in the GenomeNet database, Japan,
motif@genome.adjp) indicate that the UC 28 peptide has a possible
26 amino acid transmembrane domain from amino acid 34 to amino acid
50, and also contains three PKC phosphorylation sites beginning at
amino acids 62 (SQK), 89 (TMK), and 94 (SMK) and one myristylation
site beginning at amino acid 118 (GLECCL). In vitro translation
studies using rabbit reticulocyte lysate methods were performed to
evaluate the size of the translated product from the open reading
frame. A single 17 kDa protein product was obtained, which is the
correct predicted size from the open reading frame.
[0469] Those experienced in the art will recognize that the genes
and gene products (RNAs and proteins) for the above described
markers of prostate disease, normal prostate, bladder cancer and
breast cancer are included within the scope of the invention herein
described. Those experienced in the art will also recognize that
the diagnosis and prognosis of prostatic, bladder or breast cancer
by detection of the nucleic acid products of these genes are
included within the scope of the present invention.
[0470] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the composition, methods and in the
steps or in the sequence of steps of the method described herein
without departing from the concept, spirit and scope of the
invention.
[0471] More specifically, it will be apparent that certain agents
which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0472] The following literature citations as well as those cited
above are incorporated in pertinent part by reference herein for
the reasons cited in the above text.
[0473] Alcaraz et al., Cancer Res., 55:3998-4002, 1994.
[0474] Allhoff et al., World J. Urol., 7:12-16, 1989.
[0475] American Cancer Society-Facts and Figures-1998,
http://www.cancer.org/ statistics198cff/98prosta.html.
[0476] An et al., Proc. Amer. Assn. Canc. Res., 36:82, 1995.
[0477] Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.,
1988.
[0478] Babian et al., J. Urol., 156:432-437, 1996.
[0479] Badalament et al., J. Urol., 156:1375-1380,1996.
[0480] Baichwal and Sugden, In: Gene Transfer, Kucherlapati R, ed.,
New York, Plenum Press, pp. 117-148, 1986.
[0481] Bangham et al., J. Mol. Biol. 13: 238-252, 1965.
[0482] Barinaga, Science, 271: 1233, 1996.
[0483] Bellus, J. Macromol. Sci. Pure Appl. Chem.,
A31(1):1355-1376, 1994.
[0484] Benvenisty and Neshif, Proc. Nat. Acad. Sci. USA,
83:9551-9555, 1986.
[0485] Bittner et al., Methods in Enzymol., 153:516-544, 1987.
[0486] Bookstein et al., Science, 247:712-715, 1990a.
[0487] Bookstein et al., Proc. Nat'l Acad. Sci. USA, 87:7762-7767,
1990b.
[0488] Bova et al., Cancer Res., 53:3869-3873, 1993.
[0489] Brawn et al., The Prostate, 28: 295-299, 1996.
[0490] Campbell, In: Monoclonal Antibody Technology, Laboratory
Techniques in Biochemistry and Molecular Biology, Burden and Von
Knippenberg, Eds., Vol. 13:75-83, Elsevier, Amsterdam, 1984.
[0491] Capaldi et al., Biochem. Biophys. Res. Comm., 76:425,
1977.
[0492] Carter et al., Proc. Nat'l Acad. Sci. USA, 87:8751-8755,
1990.
[0493] Carter and Coffey, In: Prostate Cancer: The Second Tokyo
Symposium, J. P. Karr and H. Yamanak (eds.), pp. 19-27, New York:
Elsevier, 1989.
[0494] Carter and Coffey, Prostate, 16:39-48, 1990.
[0495] Carter et al., Proc. Nat'l Acad. Sci. USA, 87:8751-8755,
1990.
[0496] Carter et al., Proc. Nat'l Acad. Sci. USA 93: 749-753,
1996.
[0497] Carter et al., J. Urol., 157:2206-2209, 1997.
[0498] Chang et al., Hepatology, 14:124A, 1991.
[0499] Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987.
[0500] Chen et al., Clin. Chem., 41:273-282, 1995.
[0501] Chen et al., Proc. Am. Urol. Assn., 153:267A, 1995.
[0502] Chinault and Carbon, Gene, 5:111-126, 1979.
[0503] Chomczynski and Sacchi, Anal. Biochem.,
162:156-159,1987.
[0504] Christensson et al., J. Urol., 150:100-105, 1993.
[0505] Colberre-Garapinet al., J. Mol. Biol., 150:1, 1981.
[0506] Cooner et al., J. Urol., 143:1146-1154, 1990.
[0507] Coupar et al., Gene, 68:1-10, 1988.
[0508] Cox et al., Breast Canc. Res. Treat. 32: 19-38, 1994.
[0509] Davey et al., EPO No.329 822.
[0510] Deamer and Uster, "Liposome Preparation: Methods and
Mechanisms," In: Liposomes M. Ostro, ed., 1983.
[0511] Diamond et al., J. Urol., 128:729-734, 1982.
[0512] Diamond et al., J Urol., 128: 729-734, 1982.
[0513] Donahue et al., J. Biol. Chem., 269:8604-8609, 1994.
[0514] Dong et al., Science, 268: 884-886, 1995.
[0515] Dubensky et al., Proc. Nat. Acad. Sci. USA, 81:7529-7533,
1984.
[0516] Dumont et al., J. Immunol., 152:992-1003, 1994.
[0517] Elledge et al., Cancer Res. 54: 3752-3757, 1994
[0518] Fearon et al., Science 247: 47-56, 1990.
[0519] Friedmann, Science, 244:1275-1281, 1989.
[0520] Freifelder, Physical Biochemistry Applications to
Biochemistry and Molecular Biology, 2nd ed., Wm. Freeman and Co.,
New York, N.Y., 1982.
[0521] Frohman, PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS,
Academic Press, N.Y., 1990.
[0522] Gefter et al., Somatic Cell Genet., 3:231-236, 1977.
[0523] Ghosh-Choudhury et al., EMBO J, 6:1733-1739, 1987.
[0524] Gingeras et al., PCT Application WO 88/10315.
[0525] Goding, In: Monoclonal Antibodies: Principles and Practice,
2d ed., Orlando, Fla., Academic Press, pp. 60-61, 65-66, 71-74,
1986.
[0526] Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
[0527] Graham et al., J. Gen. Virol., 36:59-72, 1977.
[0528] Graham and van der Eb, Virology, 52:456-467, 1973.
[0529] Graham and Prevec, In: Methods in Molecular Biology: Gene
Transfer and Expression Protocols 7, E. J. Murray (ed.), Clifton,
N.J., Humana Press, pp. 205-225. 1991.
[0530] G. Gregoriadis (ed.) DRUG CARRIERS IN BIOLOGY AND MEDICINE,
pp. 287-341, 1979.
[0531] Grunhaus and Horwitz, Seminar in Virology, 3:237-252,
1992.
[0532] Harris et al., J. Urol., 157:1740-1743, 1997.
[0533] Hermonat and Muzycska, Proc. Nat. Acad. Sci. USA,
81:6466-6470, 1984.
[0534] Hess et al., J. Adv. Enzyme Reg., 7:149, 1968.
[0535] Hitzeman et al., J. Biol. Chem., 255:2073, 1980.
[0536] Holland et al., Biochemistry, 17:4900, 1978.
[0537] Horoszewicz, Kawinski and Murphy, Anticancer Res.,
7:927-936, 1987.
[0538] Horwich, et al., J. Virol., 64:642-650, 1990.
[0539] Huang et al., Prostate, 23: 201-212, 1993.
[0540] Innis et al., PCR Protocols, Academic Press, Inc., San Diego
Calif., 1990.
[0541] Inouye et al., Nucleic Acids Res., 13:3101-3109, 1985.
[0542] Isaacs et al., Cancer Res., 51:4716-4720, 1991.
[0543] Isaacs et al., Seminars in Oncology, 21: 1-18, 1994.
[0544] Israeli et al., Cancer Research, 54:1807-1811, 1994.
[0545] Israeli et al., J. Urol., 153:573-577, 1995.
[0546] Jaakkola et al., Clin. Chem., 41:182-186, 1995.
[0547] Jacobson et al., JAMA, 274:1445-1449, 1995.
[0548] Johnson et al., In: BIOTECHNOLOGY AND PHARMACY, Pezzuto et
al., Eds., Chapman and Hall, New York, 1993.
[0549] Jones, Genetics, 85:12, 1977.
[0550] Kaneda et al., Science, 243:375-378, 1989.
[0551] Kato et al., J. Biol. Chem., 266:3361-3364, 1991.
[0552] Kingsman et al., Gene, 7: 141, 1979.
[0553] Klein et al., Nature, 327:70-73, 1987.
[0554] Kohler and Milstein, Nature, 256:495-497, 1975.
[0555] Kohler and Milstein, Eur. J. Immunol., 6:511-519, 1976.
[0556] Kwoh et al., Proc. Nat. Acad. Sci. USA, 86:1173, 1989.
[0557] Liang and Pardee, Science, 257:967-971, 1992.
[0558] Liang and Pardee, U.S. Pat. No. 5,262,311, 1993.
[0559] Liang et al., Cancer Res., 52:6966-6968, 1992.
[0560] Lifton, Science, 272: 676, 1996.
[0561] Lilja et al., Clin. Chem., 37:1618-1625, 1991.
[0562] Lithrup et al., Cancer, 74:3146-3150, 1994.
[0563] Lowy et al., Cell, 22:817, 1980.
[0564] Macoska et al., Cancer Res., 54:3824-3830, 1994.
[0565] Marley et al., Urology, 48(6A):16-22, 1996.
[0566] McCormack et al., Urology, 45:729-744, 1995.
[0567] Miki et al., Science 266: 66-71, 1994.
[0568] Miller et al., PCT Application WO 89/06700.
[0569] Mok et al., Gynecol. Oncol., 52:247-252, 1994.
[0570] Morahan et al., Science 272: 1811, 1996.
[0571] Mulligan et al., Proc. Nat'l Acad Sci. USA, 78:2072,
1981.
[0572] Mulligan, Science, 260:926-932, 1993.
[0573] Murphy et al., Cancer, 78: 809-818, 1996.
[0574] Murphy et al., Prostate, 26:164-168, 1995.
[0575] Myers, EP 0273085
[0576] Nagase et al., DNA Res., 3(5):321-329, 1996.
[0577] Nakamura et al., In: Handbook of Experimental Immunology
(4th Ed.), Weir, E., Herzenberg, L. A., Blackwell, C., Herzenberg,
L. (eds), Vol. 1, Chapter 27, Blackwell Scientific Publ., Oxford,
1987.
[0578] O'Dowd et al., J. Urol., 158: 687-698, 1997.
[0579] O'Hare et al., Proc. Nat'l Acad. Sci. USA, 78:1527,
1981.
[0580] Oesterling, Contemporary Urology, 8:76-92, 1996.
[0581] Oesterling et al., J. Urol., 154:1090-1095, 1995.
[0582] Ohara et al., Proc. Nat'l Acad. Sci. USA, 86:5673-5677,
1989.
[0583] Orozco et al., Urology, 51: 186-195, 1998.
[0584] Parker et al., CA Cancer J. Clin., 65:5-27, 1996.
[0585] Partin and Oesterling, Urology, 48 (6A):1-3, 1996.
[0586] Partin and Oesterling, J. Urol., 152:1358-1368, 1994.
[0587] Partin and Oesterling, (Eds.) Urology, 48(6A) supplement:
1-87, 1996.
[0588] Partin et al., Cancer Res., 53:744-746, 1993.
[0589] Pettersson et al., Clin. Chem., 41(10):1480-1488, 1995.
[0590] Piironen et al., Clin. Chem. 42: 1034-1041, 1996.
[0591] Qiao et al., Biochem. Biophys. Res. Comm., 201:581-588,
1994.
[0592] Ralph and Veltri, Advance/Laboratory, 6:51-56, 1997.
[0593] Ralph et al., Proc. Natl. Acad. Sci. USA,
90(22):10710-10714, 1993.
[0594] Ribas de Pouplana and Fothergill-Gilmore, Biochemistry,
33:7047-7055, 1994.
[0595] Ridgeway, In: Vectors: A survey of molecular cloning vectors
and their uses, Rodriguez R L, Denhardt D T, ed.,
Stoneham:Butterworth, pp. 467-492, 1988.
[0596] Rieber, M. and Rieber, M. S., Cell Growth Diff.,
5:1339-1346, 1994.
[0597] Rippe et al., Mol. Cell Biol., 10:689-695, 1990.
[0598] Sager et al., FASEB J., 7:964-970, 1993.
[0599] Sambrook et al., (ed.), MOLECULAR CLONING, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
[0600] Santerre et al., Gene, 30: 147-156, 1984.
[0601] Scott et al., Molec. Cell. Biol., 13:2247-2257, 1993.
[0602] Sidransky et al., Science, 252: 706-709, 1991.
[0603] Silver et al., Clin. Cancer Res., 3: 81-85, 1997.
[0604] Slamon et al., Science, 224:256-262, 1984.
[0605] Slamon et al., Science 235; 177-182, 1987.
[0606] Slamon et al., Science, 244: 707-712, 1989.
[0607] Smith, U.S. Pat. No. 4,215,051.
[0608] Soh et al., J. Urol., 157:2212-2218, 1997.
[0609] Stenman et al., Cancer Research, 51:222-226, 1991.
[0610] Stinchcomb et al., Nature, 282:39, 1979.
[0611] Stratford-Perricaudet and Perricaudet, In: Human Gene
Transfer, O. Cohen-Haguenauer et al., eds., John Libbey Eurotext,
France, pp. 51-61, 1991.
[0612] Stratford-Perricaudet et al., Hum. Gene. Ther., 1:241-256,
1990.
[0613] Stratton and Wooster, Curr. Opin. Genet. Devel. 6: 93-97,
1996.
[0614] Sun and Cohen, Gene, 137:127-132, 1993.
[0615] Szoka et al., Proc. Natl. Acad. Sci. USA, 75: 4194-4198,
1978.
[0616] Szybalska et al., Proc. Nat'l Acad. Sci. USA, 48:2026,
1962.
[0617] Takahashi et al., Cancer Res., 54:3574-3579, 1994.
[0618] Takahashi et al., Mol. Cell. Biol., 8:1853-1856, 1988.
[0619] Taparowsky et al., Nature, 300: 762-764, 1982.
[0620] Tooze, Molecular Biology of DNA Tumor Viruses, 2nd ed., Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1991.
[0621] Tschemper et al., Gene, 10:157, 1980.
[0622] VanArsdale et al., Proc. Natl. Acad. Sci. USA, 94:2460-2465,
1997.
[0623] Veltri et al., J. Cell Biochem. 19(suppl): 249-258,
1994.
[0624] Veltri et al., Urology, 48: 685-691, 1996.
[0625] Visakorpi et al., Am. J. Pathol., 145:1-7, 1994.
[0626] Wagner et al., Science, 260:1510-1513, 1990.
[0627] Walker et al., Proc. Nat'l Acad. Sci. USA, 89:392-396,
1992.
[0628] Watson et al., Cancer Res., 54:4598-4602, 1994.
[0629] Webb and Lin, Invest Urol., 17:401-404, 1980.
[0630] Welsh et al., Nucleic Acids Res., 20:4965-4970, 1992.
[0631] Welsh and McClelland, Nucl. Acids. Res., 18:7213-7218,
1990.
[0632] Wigler et al., Cell, 11:223, 1977.
[0633] Wigler et al., Proc. Nat'l Acad. Sci. USA, 77:3567,
1980.
[0634] Wingo et al., CA Cancer J. Clin., 47: 239-242,1997.
[0635] Wong et al., Gene, 10: 87-94,1980.
[0636] Wong et al., Int. J. Oncol., 3:13-17, 1993.
[0637] Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987.
[0638] Wu and Wu, Biochemistry, 27: 887-892, 1988.
[0639] Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.
[0640] Wu et al., Genomics, 4:560, 1989.
[0641] Zlotta, et al., J. Urol., 157:1315-1321, 1997.
Sequence CWU 1
1
* * * * *
References