U.S. patent application number 09/773670 was filed with the patent office on 2003-03-13 for programmed cell death and ich-3.
Invention is credited to Fishman, Jay A., Miura, Masayuki, Wang, Suyue, Yuan, Junying.
Application Number | 20030049709 09/773670 |
Document ID | / |
Family ID | 21818023 |
Filed Date | 2003-03-13 |
United States Patent
Application |
20030049709 |
Kind Code |
A1 |
Yuan, Junying ; et
al. |
March 13, 2003 |
Programmed cell death and Ich-3
Abstract
This invention relates to modulation of programmed cell death.
It also relates to transgenic non-human animals comprising a
disrupted Ich-3 gene and methods of making these animals. The Ich-3
mutant animals exhibit resistance to septic shock and defects in
folliculogenesis. This invention also relates to methods of using
the transgenic animals to screen for compounds to treat septic
shock and defective folliculogenesis. Moreover, this invention also
relates to methods of treating septic shock in normal individuals
by inhibiting ICH-3.
Inventors: |
Yuan, Junying; (Newton,
MA) ; Wang, Suyue; (Brookline, MA) ; Miura,
Masayuki; (Osaka, JP) ; Fishman, Jay A.;
(Wellesley, MA) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W., SUITE 600
WASHINGTON
DC
20005-3934
US
|
Family ID: |
21818023 |
Appl. No.: |
09/773670 |
Filed: |
February 2, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09773670 |
Feb 2, 2001 |
|
|
|
08908436 |
Aug 7, 1997 |
|
|
|
60023937 |
Aug 9, 1996 |
|
|
|
Current U.S.
Class: |
435/23 ; 514/1.4;
514/16.6; 514/18.9; 514/54; 514/9.8; 800/18; 800/9 |
Current CPC
Class: |
A01K 2217/05 20130101;
A01K 2267/0337 20130101; A01K 2267/02 20130101; C12N 15/8509
20130101; C07K 14/545 20130101; A01K 67/0276 20130101; A01K
2227/105 20130101; C12N 9/6475 20130101; A01K 2267/03 20130101;
A01K 2217/075 20130101 |
Class at
Publication: |
435/23 ; 800/9;
800/18; 514/12; 514/54 |
International
Class: |
A01K 067/027; C12Q
001/37; A61K 038/17; A61K 031/739 |
Goverment Interests
[0002] Part of the work performed during the development of this
invention was supported by U.S. Government funds. The U.S.
Government may have certain rights in this invention.
Claims
What is claimed is:
1. A method for modulating programmed cell death in a cell
comprising contacting said cell with modulating amounts of
ICH-3.
2. The method of claim 1 comprising using ICH-3 in the presence of
ICE.
3. A method of promoting proIL1-.beta. processing by a cell in the
presence of ICE comprising contacting said cell with ICH-3
expressed under the control of a CMV promoter.
4. A method for stimulating synthesis of Ich-3 gene products in a
cell comprising contacting said cell with stimulatory amounts of
using lipopolysaccharide (LPS).
5. A monoclonal or polyclonal antibody that specifically binds
ICH-3.
6. The antibody of claim 5, wherein said antibody binds to a 43 kDa
or a 38 kDA fragment of the ICH-3 protein.
7. The antibody of claim 5, wherein said antibody binds to the p20
region of ICH-3.
8. The antibody of claim 7, wherein said antibody is made against
the antigen having the amino acid peptide
(H-TEFKHLSLRYGAKFD)8-MAP-LINKED.
9. A transgenic non-human animal comprising a disrupted Ich-3
gene.
10. The transgenic non-human animal as claimed in claim 9, wherein
said animal is a mouse.
11. The transgenic non-human animal as claimed in claim 9, wherein
said transgenic animal is resistant to septic shock.
12. The transgenic non-human animal as claimed in claim 9, wherein
said transgenic animal is resistant to LPS treatment.
13. The transgenic non-human animal as claimed in claim 9, wherein
said transgenic animal has severely reduced plasma levels of
IL-1.beta. and IL-1.alpha. after LPS injection.
14. The transgenic non-human animal as claimed in claim 9, wherein
a 43 kDa and a 38 kDa protein reactive with an ICH-3 antibody, is
absent or severely reduced in spleen, thymus, kidney, lung, brain
and intestine, said antibody being made against the amino acid
peptide TEFKHLSLRYGAKFD.
15. The transgenic non-human animal as claimed in claim 9, wherein
said transgenic animal is a female mouse and said mouse contains
significantly reduced numbers of oocyte-containing primordial
follicles during neonatal development.
16. A transgenic non-human animal model for the study of septic
shock wherein said animal comprises an animal with a disrupted
Ich-3 gene.
17. Atransgenic non-human animal model for the study of infection
wherein said animal comprises an animal with a disrupted Ich-3
gene.
18. The transgenic non-human animal as claimed in claim 9, wherein
nucleotides encoding amino acids of ICH-3 are replaced with a
sequence from an Ich-3 targeting vector.
19. The progeny of the transgenic non-human animal as claimed in
claim 9.
20. A method of screening folliculogenic compounds, comprising: (a)
providing a transgenic non-human animal having a disrupted Ich-3
gene and exhibiting reduced endowment of primordial follicles; (b)
administering a compound to be tested to said transgenic animal;
(c) determining the effect of said compound on folliculogenesis of
said animal; and (d) correlating the effect of said compound on
folliculogenesis of said animal with an effect of said compound on
folliculogenesis of a non-treated animal having a disrupted Ich-3
gene.
21. A method of screening compounds for treating sepsis or septic
shock comprising: (d) providing a transgenic non-human animal
having a disrupted Ich-3 gene and exhibiting resistance to septic
shock; (b) applying a sepsis or septic shock stimulus to said
animal; (e) administering a compound to be tested to said
transgenic animal; (f) determining the effect of said compound on
the susceptibility to manifestatiation of sepsis or septic shock of
said animal; and (d) correlating the effect of said compound on
septic shock or sepsis of said animal with an effect of said
compound on the sequelae of sepsis or septic shock in a non-treated
animal having a disrupted Ich-3 gene or in a wild type animal.
22. A method of screening compounds for alteration in
susceptibility to infection, or the sequelae of thermal injury,
major trauma, or combinations thereof, comprising: (g) providing a
transgenic non-human animal having a disrupted Ich-3 gene and
exhibiting resistance to septic shock; (b) applying a burn, trauma,
infection, bacteremia or other infection to said animal; (h)
administering a compound to be tested to said transgenic animal;
(i) determining the effect of said compound on the susceptibility
to manifestatiation of sepsis or septic shock of said animal; and
(d) correlating the effect of said compound on the injury received
by said animal with an effect of said compound on the sequelae of
sepsis or septic shock in a non-treated animal having a disrupted
Ich-3 gene or on a wild type animal.
23. A method of making a transgenic non-human animal having a
disrupted Ich-3 gene, comprising: (a) providing a DNA molecule
comprising an intact Ich-3gene; (b) providing a targeting vector
capable of disrupting said Ich-3 gene upon homologous recombination
with said DNA molecule; (c) placing said DNA molecule comprising
the intact Ich-3 gene and said targeting vector in contact under
conditions where said DNA molecule and said targeting vector will
undergo homologous recombination to produce a second DNA molecule
comprising a disrupted Ich-3 gene; (d) introducing said second DNA
molecule into ES cells; (e) injecting ES cells into blastocytes;
(f) implanting said blastocytes containing the ES cells with the
disrupted Ich-3 gene into the uterus of a pseudopregnant female;
and (g) delivering a transgenic animal comprising a disrupted Ich-3
gene from said pseudopregnant female.
24. The method of making a transgenic non-human animal as claimed
in claim 23, wherein said pseudopregnant female and said transgenic
animal is a mouse.
25. A method for reducing mortality of sepsis in a wild-type animal
comprising treating said animal with inhibitors of ICH-3.
26. A method for reducing mortality of burns and trauma in a
wild-type animal comprising treating said animal with inhibitors of
ICH-3.
27. A method of protecting against lung injury in common medical
conditions comprising utilizing inhibitors of the pathways of
apoptosis.
Description
[0001] This application claims the benefit of the filing date of
U.S. Provisional Application 60/023,937, filed Aug. 9, 1996 and is
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The invention is generally in the field of molecular biology
as related to the control of programmed cell death. The invention
also relates to transgenic non-human animals comprising a disrupted
Ich-3 gene. This invention further relates to methods of making and
using the transgenic animals.
[0005] 2. Related Art
[0006] Programmed Cell Death
[0007] Apoptosis, also referred to as programmed cell death or
regulated cell death, is a process by which organisms eliminate
unwanted cells. Such cell death occurs as a normal aspect of animal
development as well as in tissue homeostasis and during aging
(Glucksmann, A., Biol. Rev. Cambridge Philos. Soc. 26:59-86 (1950);
Ellis et al., Dev. 112:591-603 (1991); Vaux et al., Cell 76:777-779
(1994)). Programmed cell death can also act to regulate cell
number, to facilitate morphogenesis, to remove harmful or otherwise
abnormal cells and to eliminate cells that have already performed
their function. Additionally, programmed cell death is believed to
occur in response to various physiological stresses such as hypoxia
or ischemia. The morphological characteristics of apoptosis include
plasma membrane blebbing, condensation of nucleoplasm and cytoplasm
and degradation of chromosomal DNA at inter-nucleosomal intervals.
(Wyllie, A. H., in Cell Death in Biology and Pathology, Bowen and
Lockshin, eds., Chapman and Hall (1981), pp. 9-34).
[0008] Apoptosis is achieved through an endogenous mechanism of
cellular suicide (Wyllie, A. H., in Cell Death in Biology and
Pathology, Bowen and Lockshin, eds., Chapman and Hall (1981), pp.
9-34) and occurs when a cell activates its internally encoded
suicide program as a result of either interaal or external signals.
The suicide program is executed through the activation of a
carefully regulated genetic program (Wylie, A. H., et al., Int.
Rev. Cyt. 68: 251 (1980); Ellis, R. E., et al., Ann. Rev. Cell Bio.
7. 663 (1991); Yuan, Y. Curr. Op. Cell. Biol. 7:211-214(1995)).
[0009] In many cases, gene expression appears to be required, since
cell death can be prevented by inhibitors of RNA or protein
synthesis (Cohen et al., J. Immunol. 32:38-42 (1984); Stanisic et
al., Invest. Urol. 16:19-22 (1978); Martin et al., J. Cell Biol.
106:829-844 (1988). A genetic pathway of programmed cell death was
first identified in the nematode C. elegans (Ellis, R. E., et al.,
Annu. Rev. Cell Biol. 7:663-698 (1991)). In this pathway, the
fuinction of two genes, ced-3 and ced-4, are required for cells to
undergo programmed cell death. Genetic mosaic analysis indicated
that both ced-3 and ced-4 most likely act in dying cells to induce
cell death; thus, they are essential parts of intracellular
machinery involved in execution of cell death (Yuan & Horvitz,
Dev. Biol. 138:33-41(1990)). Furthermore, in C. elegans, the
products of ced-3 and ced-4 genes carry out the program of cellular
suicide (Yuan & Horvitz, Dev. Bio. 138: 33 (1990)).
[0010] Amino acid sequence of CED-3 protein is homologous to
mammalian interleukin-1.beta., converting enzyme (ICE) with 28%
amino acid identity (Yuan et al., Cell 75:641-652 (1993)). The C
terminal half of the CED-3 is more homologous to ICE (43%
identity), which includes the active pentapeptide QACRG present in
all members of the ICE/CED-3 family.
[0011] Interleukin-1-.beta. Converting Enzyme (ICE) Family
[0012] The interleukin-1.beta. converting enzyme (ICE) family is a
growing family of cysteine proteases involved in cytokine
maturation and apoptosis (Yuan, J., Curr. Opin. in Cell Biology
7:211-214 (1995)). ICE is a cytoplasmic cysteine protease
responsible for proteolytically processing pro-interleukin-1.beta.
(31 kDa) into active form (17 kDa) (homberry, N. A., Nature
356:768-774 (1992), Cerretti, D. P., et al., Science 256:97-100
(1992)). ICE is synthesized as a precursor of 45 kDa which is
proteolytically cleaved during activation to generate two subunits
of 22 kDa (p20) and 10 kDa (p10) (Thornberry, N. A., et al., Nature
356:768-774 (1992)). X-ray crystallography analysis of three
dimensional structure of ICE showed that ICE is a homodimer of
activated ICE p20 and p10 subunits (Wilson, K. P., et al., Nature
370:270-275 (1994); Walker, N. P. C., et al., Cell 78:343-352
(1994)). Activated ICE can cleave the inactive ICE precursor;
however, in vitro synthesized ICE precursor cannot cleave itself
(Thornberry, N. A., et al., Nature 356:768-774 (1992)), suggesting
that ICE may need to be activated by another protease in vivo.
[0013] The amino acid sequence of ICE shares 29% identity with C.
elegans cell death gene product Ced-3 (Yuan et al., Cell 75:641-752
(1993)) which suggests that ICE may play a role in controlling
mammalian apoptosis. Expression of Ice in a number of mammalian
cell lines induces apoptosis (Miura et al., Cell 75:653-660 (1993);
Wang et al., Cell 87:739-750 (1994)). Microinjection of an
expression vector of crmA, a cowpox virus gene encoding a serpin
that is a specific inhibitor of ICE, prevents not only death of
neurons from dorsal root ganglia induced by trophic factor
deprivation but also the death of ciliary ganglia (Gagliardini et
al., Science 263:826-828 (1994); Li et al., Cell 80:401-411 (1995);
Allsopp et al., Cell 73:295-307, (1993)). Expression of crmA can
also suppress apoptosis induced by TNF-.alpha. and Fas (Enari et
al., Nature 375:78-81 (1995); Los et al., Nature 375:81-83 (1995);
Kuide et al., Science 267:2000-2002 (1995); Miura et al., Proc.
Natl. Acad. Sci. USA 92:8318-8322 (1995)). These experiments
suggest that the members of the ICE family play important roles in
controlling mammalian apoptosis. These results did not indicate,
however, which member of the ICE family is critical for cell death
since CrmA may cross-inhibit other members of the ICE family.
[0014] The mammalian ICE/CED-3 family now includes eight members:
ICE, TX/ICE.sub.relII/ICH-2, ICE.sub.relIII, ICH-1/NEDD2,
CPP32/Yama/Apopain, MCH2, MCH-3/ICE-LAP3/MCH-2 and ICH-3 (Kumar et
al., Genes Dev. 8:1613-1626 (1994); Femandes-Alnemri, et al., J.
Biol. Chem. 269:30761-30764 (1994); Femandez-Alnemri et al., Cancer
Res. 55:2737-2742 (1995); Fernandes-Alnemri et al., Cancer Res.
55:6045-6052 (1996); Wang et al., Cell 78:739-750 (1994); Faucheu,
et al., EMBO J. 14:1914-1922(1995); Tewari & Dixit, J. Biol.
Chem. 270:3255-3260 (1995); Kamens etal., J. Biol. Chem.
270:15250-15256 (1995); Munday, N. A., et al., J. Biol. Chem.
270:15870-15876 (1995); Duan, H. J., et al., J. Biol. Chem.
271:1621-1625 (1996); Lippke, J. A., et al., J. Biol. Chem.
271:1825-1828 (1996)). Since ICH-3 is most homologous to TX, it may
be the mouse version of human TX. This cannot be concluded at the
moment, however, because TX has been shown to cleave pro-ICE
(Faucheu, et al., EMBO J. 14:1914-1922 (1995)) whereas ICH-3 has
not been shown to cleave pro-ICE in a similar assay (data not
shown).
[0015] Overexpression of Nedd-2/Ich-1.sub.L induces cell death very
effectively (Kumar et al., Genes Dev. 8:1613-1626 (1994); Wang et
al., Cell 87:739-750 (1994)). Expression of CPP32/Yama in full
length cDNA induces apoptosis of insect Sf9 cells but not that of
mammalian cells (Femandes-Alnemri et al., J. Biol. Chem
269:30761-30764 (1994); E. S. Alnemri, personal communication).
Recombinant CPP32/Yama is inactive and cleavage of CPP32/Yama by
ICE in vitro activates the precursor (Tewari et al., Cell
81:801-809 (1995b)), suggesting that in vivo CPP32/Yama may be
activated by another protease to induce apoptosis. Expression of
MCH2.alpha. also induces apoptosis of insect Sf9 cells but not that
of mammalian cells (Femandes-Alnemri et al., Cancer Res.
55:2737-2742 (1995)). Thus, the members of the ICE family can be
classified into 2 classes: those that when overexpressed in
mammalian cells can induces apoptosis (e.g. Ice and Ich-1) and
those that when overexpressed in mammalian cells cannot induce
apoptosis (e.g. CPP32 and Mch-2). These experimental evidence
suggest that in vivo members of the ICE family may be arranged in
proteases cascades and certain members of the ICE family may
activate other members of the ICE family.
[0016] The control of apoptosis in ammanls is much more complex
than that in C. elegans where function of one ced-3 gene controls
all programmed cell death (Ellis & Horvitz, Cell 44:817-829
(1986)). In contras to C. elegans, multiple proteases may be
involved in regulation of programmed cell death (apoptosis) in
mammals. This hypothesis is supported by many in vitro studies. For
instance, peptide inhibitors of ICE such as YVAD-cmk inhibit Fas
induced apoptosis but requires much higher doses than that for
inhibiting ICE (Enari et al., Nature 375:78-81 (1995)), suggesting
that inhibition of additional ICE-like protease(s) is required for
complete inhibition of Fas induced apoptosis. Similarly,
Ac-DEVD-CHO, a peptide inhibitor of CPP32/Yama/Apopain, inhibits
poly(ADP-ribose) polymerase (PARP) cleavage at a dose of 1 nM but
requires 1 .mu.M to cause 50% inhibition of apoptosis in an
cell-free system (Nicholson, D. W., et al., Nature 376:37-43
(1995)), suggesting that inhibition of protease(s) other than
CPP32/Yama/Apopain is required for complete inhibition of apoptosis
in this system. Furthermore, inhibitors that are known not to have
effects or have little effects on ICE like cysteine proteases such
as cysteine protease inhibitors trans-epoxysuccininyl-L-le-
ucylamido-(4-guanidino) butane (E64) and leupeptin, calpain
inhibitors I and II, and serine protease inhibitors diisopropyl
fluorophosphate and phenylmethylsulfonyl fluroride, were found to
inhibit apoptosis induced by T cell receptor binding-triggered
apoptosis (Sarin et al., J. Exp. Med. 178:1693-1700 (1993)),
suggesting that not only cysteine proteases but also serine
proteases may play important roles in mammalian cell apoptosis.
[0017] Cytotoxic T lymphocytes (CTL) are important players in host
cell-mediated immunity (reviewed by Henkart & Sitkovsky, Curr.
Opin. in Immun. 5:404410 (1994)). Granzyme B(GraB) is a serine
protease Granzyme B is a serine protease required for the cytotoxic
activity of lymphocytes (Shi et al., J. Exp. Med 176:1521-1529
(1992)). It also plays a major role in apoptosis induced by CTLs
since mice that are deficient for GraB generated by gene targeting
technique are severely defective in CTL induced apoptosis (Heusel,
J. W., et al., Cell 76:977-987 (1994)). GraB can induce apoptosis
of many if not all cell types in the presence of pore forming
protein perforin (Shi et al., J. Exp. Med. 175:553-566 (1992) &
Shi etal., J. Exp. Med. 176:1521-1529 (1992)).
[0018] Recent work showed that apoptosis of embryonic fibroblasts
induced by granzyme B is mediated through ICE (Shi et al., Proc.
Natl. Acad. Sci. , In Press (1996)) Apoptosis induced by granzyme B
and perforin can be inhibited by inhibitors of the ICE family,
including CrmA, ICH-1.sub.S and a mutant ICE (Shi et al., Submitted
(1996)). Most significantly, embryonic fibroblasts from Ice
deficient mice are resistant to granzyme B/perforin induced
apoptosis, suggesting that ICE itself is required for cytoxicity of
grnzyme B/perforin in at least certain cell types (Shi et al.,
Submitted (1996)). Granzyme B does not, however, cleave and
activate ICE precursor directly (Darmon, A. J., et al., J. Biol.
Chem. 269:32043-32046 (1994)), suggesting that there are
intermediate steps of regulation between granzyme B and ICE.
[0019] A recent report showed that CPP32, a member of the ICE
family, is activated by cytotoxic T-cell-derived GraB, suggesting
that CPP32 is important for CTL killing (Darmon, A. J., et al.,
Nature 377:446-448 (1995)). CPP32, however, cannot be the only ICE
family activated by CTL since CrmA is a very poor inhibitor of
CPP32 (Nicholson, D. W., et al., Nature 376:37-43 (1995)). Tewari
et al., Chem. 270:22605-22708 (1995) showed that expression of crmA
completely blocks the Ca.sup.2+-independent component of
CTL-killing (i.e. Fas-mediated); if CPP32 were the only ICE family
member responsible for CTL cytotoxicity, expression of crmA should
not suppress CTL killing. It is predicted that there are additional
members of the ICE family which play an important role in CTL
induced apoptosis. The amino acid sequence of GraB is not
homologous with ICE; however, GraB and ICE share many enzymatic
similarities. Like ICE, GraB requires Asp at P1 position for
cleavage. Inhibitors of ICE or the ICE family, CrmA, ICH-1. and a
mutant ICE are effective inhibitors of GraB/perforin induced
apoptosis (Shi et al., Submitted (1996)). Embryonic fibroblasts
that are deficient in ICE from Ice-/- mice are resistant to
GraB/perforin induced apoptosis (Shi et al., Submitted (1996)),
suggesting that ICE is critical for GraB/perforin induced apoptosis
in at least certain cell types. ICE itself cannot be directly
cleaved by GraB (Darmon, A. J., et al., J. Biol. Chem.
269:32043-32046 (1994)) and thus, although ICE is required for
GraB/perforin induced apoptosis in certain cells, GraB does not
activate ICE directly. One possibility is that GraB activates
another ICE family member which may then directly or indirectly
activate ICE and the activator of ICE can be inhibited by CrmA.
[0020] Transgenic Animals
[0021] With so many members in the ICE/CED-3 family, it is
important to determine the ICE/CED-3 family member's finctions
individually. Transgenic mice are an ideal model for accomplishing
this by generating mutations in the genes of interest, resulting in
"knock-out" mice. Using such models, it has already been shown that
mice deficient in Ice develop normally but are resistant to
endotoxic shock induced by lipopolysaccharide (LPS). This can be
attributed to their defect in production of mature IL-1.beta. (Li
et al., Cell 80:401-411 (1995); Kuida et al., Science 267:2000-2003
(1995)). Furthermore, Ice deficient thymocytes undergo apoptosis
normally when stimulated with dexamethasone and .gamma.-irradiation
but are resistant to Fas induced apoptosis (Kuida et al., Science
267:2000-2003 (1995)), suggesting that ICE is required for Fas but
not dexamethasone and .gamma.-irradiation induced apoptosis in
thymocytes. Ice may be involved, however, in .gamma.-irradiation
induced cell death in concanavalin A (conA)-stimulated splenocytes
(Tamura et al., Nature 376:596-599 (1995)). Expression of Ice is
induced in splenocytes stimulated by cona and induction of Ice
expression enhances the susceptibility of mitogen activated T cells
to cell death induced by .gamma.-irradiation and DNA damaging
chemotherapeutic agents such as adriamycin or etoposide induced
cell death.
[0022] Generation of mutant mice by gene targeting technique and
ultimately, making crosses all of potential candidate genes, should
provide vital information about the genetic and biochemical
pathways of apoptosis. Over the last several years, transgenic
animals containing specific genetic defects, e.g., resulting in the
development of, or predisposition to, various disease states, have
been made. These transgenic animals can be useful in characterizing
the effect of such a defect on the organism as a whole, and
developing pharmacological treatments for these defects.
[0023] The relevant techniques whereby foreign DNA sequences can be
introduced into the mammalian germ line have been developed in
mice. See Manipulating the Mouse Embryo (Hogan et al.,eds., 2d ed.,
Cold Spring Harbor Press, 1994) (ISBN 0-87969-384-3). At present,
one route of introducing foreign DNA into a germ line entails the
direct microinjection of a few hundred linear DNA molecules into a
pronucleus of a fertiize one-cell egg. Microinjected eggs may then
subsequently be transferred into the oviducts of pseudo-pregnant
foster mothers and allowed to develop. It has been reported by
Brinster et al. (1985), that about 25% of the mice that develop
inherit one or more copies of the micro-injected DNA.
[0024] More specifically, "knock-out" mice, a specific type of
transgenic animal, are obtained by first making mutant ES cells.
Chiineric mice are then made by injecting ES cells into blastocytes
and the chimera are bred to obtain the germline transmitted
mutation.
[0025] In addition to transgenic mice, other transgenic animals
have been made. For example, transgenic domestic livestock have
also been made, such as pigs, sheep, and cattle. Once integrated
into the germ line, the foreign DNA may be expressed in the tissue
of choice at high levels to produce a functional protein. The
resulting animal exhibits the desired phenotypic property resulting
from the production of the functional protein.
[0026] In light of the various biological roles of apoptosis, there
exists a need in the art to develop trrmsgenic animals, e.g.,
transgenic mice, wherein genes involved in apoptosis have been
modified. There also exists a need in the art to develop methods to
test compounds directed to moding the apoptotic condition using
these transgenic animals. A further need in the art is to develop
treatments for various pathological states in which apoptosis has
been found to occur.
SUMMARY OF THE INVENTION
[0027] It has now been found that overexpression of Ich-3 in rat-1
and HeLa cells induces apoptosis which can be inhibited by CrmA and
Bcl-2. These results indicate that ICH-3 acting as an upstream
regulator of ICE may play an important role in apoptosis and
inflammatory responses. It has further been found that inactivation
of the Ich-3 gene by gene targeting produces a transgenic animal
(mutant mouse) which is resistant to endotoxic shock (septic
shock)induced by lipopolysaccharide (LPS).
[0028] This invention satisfies a need in the art for a means to
study the modulation of apoptosis regulated by the Ich-3 gene by
providing a method for modulating programmed cell death and by
providing a transgenic non-human animal comprising a disrupted
Ich-3 gene. Surprisingly, such an animal is resistant to septic
shock.
[0029] The invention is first directed to a method for modulating
programmed cell death comprising the use of ICH-3. The method is
further directed to promoting proIL-.beta. processing by using
ICH-3. More preferably the processing occurs in the presence of
interleukin converting enzyme (ICE).
[0030] The invention is also directed to an antibody (monoclomal or
polyclonal) which specifically binds to ICH-3. Preferably the
antibody binds to a 38 kDa or a 43 kDa portion of the ICH-3 protein
or to the amino acid peptide TEFKHLSLRYGAKFD.
[0031] The invention is further directed to a transgenic non-human
animal in which the Ich-3 gene is disrupted. Preferably the
non-human animal is a mouse. Such ICH-3 deficient mice exhibit
resistance to septic shock. Furthermore, neonatal ICH-3 deficient
female mice show delayed follicle activation, a reduced endowment
of primordial oocytes and abnormal follicles.
[0032] In a specific embodiment of the invention, the transgenic
non-human animal is a mouse. Moreover, in an additional specific
embodiment of this invention, the Ich-3 gene comprises an
insertion/substitution resulting in deletion of 16 amino acids from
the coding region of Ich-3 in exon 5 which includes the QACRG
active site.
[0033] In an additional embodiment, this invention provides a
method of making the transgenic non-human animal of the invention
comprising providing a first DNA molecule with an intact Ich-3
gene; providing a targeting vector capable of disrupting said Ich-3
gene upon homologous recombination with said DNA molecule; placing
said first DNA molecule and said targeting vector in contact under
conditions where the DNA molecules undergo homologous recombination
to produce a second DNA molecule comprising a disrupted Ich-3 gene;
introducing said second DNA molecule into blastocytes; implanting
the blastocytes into the uterus of a pseudopregnant female; and
delivering trausgenic animals of the invention from said
pseudopregnant female.
[0034] In an additional embodiments, this invention provides a
method of testing compounds affecting sepsis by providing a
transgenic non-human animal having a disrupted Ich-3 gene, wherein
the animal exhibits an increased resistance to sepsis. One
administers a compound to be tested to the transgenic animal, and
determines the effect of the compound on the resistance to
sepsis.
[0035] In another embodiment, the invention provides for increasing
the resistance to sepsis or septic shock by inhibiting ICH-3 in
normal animals.
[0036] In additional embodiments, this invention provides a method
of testing compounds affecting follicular development by providing
a transgenic non-human animal having a disrupted Ich-3 gene,
wherein the animal exhibits delayed follicle activation as
characterized by a reduced endowment of primordial oocytes and
abnormal follicles. One administers a compound to be tested to the
transgenic animal, and determines the effect of the compound on the
delayed follicular development of the animal.
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIGS. 1A-1B. The nucleotide sequence of Ich-3 cDNA and
predicted amino acid sequence of ICH-3 protein. The initiation
codon and stop codon are indicated in bold. The sequence coding for
QACRG active site and polyadenylation signal are underlined.
Potential cleavage sites are indicated by arrows below the
residue.
[0038] FIG. 2A. Sequence and structural comparison of the mouse
ICH-3 with other closely related members of cysteine protease
family. TX, ICE.sub.rel-II and ICH-2 are the same protein. Dotted
lines are spaces in the sequence to allow optimal alignment. The
catalytic Gly.sub.238, Cys.sub.285 and His.sub.237 residues are
marked by an asterisk above the residues as indicated by x-ray
crystallography analysis (Wilson et al., 1994; Walker et al.,
1994). The residues whose amino acid side chains form the P1 pocket
are indicated by a " " above the residue. And those for binding
P2-P4 residues are indicated by a ".diamond-solid.". Known and
predicted Asp-X cleavage sites which result in the p20/p10 subunits
are indicated by arrows below the residue. The potential processing
residues are underlined. Residues conserved in more than three ICE
members are in bold. The numbers at the end of each lane are the
numbers of amino acid of the protein.
[0039] FIG. 2B. The structure motifs of hICE, mICE, ICH-3 and
hICH-2. The predicted Asp residues of ICH-3 cleavage sites are
indicated. The position of the absolutely conserved pentapeptide
sequence QACRG, which includes the catalytic Cysteine residue, is
indicated above the bars. The black bar and hatched bar represent
p20 and p10 domains, respectively.
[0040] FIG. 3A. Induction of Ich-3 mRNA expression by LPS. Total
RNAs were isolated from tissues of 7-10 weeks old mice with or
without LPS injection (40 mg/kg). The "+" and "-" sign represent
with or without LPS injection. 5 .mu.g total RNA from each tissue
was loaded per lane. Lane 1, 2, 3 , 4, and 5 are total RNAs
isolated from thymus, spleen, kidney, lung and brain, respectively.
The amount of RNA was adjusted by .beta.-actin blotting.
[0041] FIG. 3B. Expression pattern of Ich-3 in different tissues
from wild type mice. 1 .mu.ug of total RNA was used for RT-PCR. The
amount of PCR product was adjusted by .beta.-actin.
[0042] FIG. 3C Induction of ICH-3 protein expression by LPS.
Proteins were isolated from tissues of 7-10 weeks old mice before
and after LPS injection. The numbers (0, 4, 20) represent the hours
after LPS injection. The amount of protein loaded from each sample
was 60 .mu.g per lane except thymus, which was 20 .mu.g. The
western blot was probed with a rat anti-ICH-3 monoclonal
antibody.
[0043] FIGS. 4A-4D. ICH-3 induces apoptosis in Rat-1 cells. Rat-1
cells were transiently transfected with pactGal control
(p.beta.actGal vector alone)--FIG. 4A, mutant Ich-3-lacZ fuision
under the control of p -actin promoter (p.beta.actS6Z)-FIG. 4B,
mouse Ice-lacZ fusion under the control of .beta. actin promoter
(p.beta.actM10Z)-FIG. 4C and Ich-3-lacZ fuision under the control
of CMV promoter (pCMVM26Z)-FIG. 4D. 24 hours after transfection,
the cells were fixed and stained with X-Gal solution for 3
hours.
[0044] FIG. 5. Cleavage of ICH-3 protein by granzyme B. 10 .mu.g
His-tagged ICH-3 protein purified from E. coli was incubated with
20 ng of GraB in the presence of 10 mM DTT at 30.degree. C. for 1
hour. The result was detected by Western blotting with a peptide
antibody against p20 portion of ICH-3.
[0045] FIG. 6. ICH-3 does not process proIL-1.beta. directly but
promotes processing of proL-1.beta. by ICE. COS cells were
cotransfected with mouse proIL-1.beta. (pCMVS11) and with either
Ice (p.beta.actM10Z) or Ich-3 (pCMVM26Z) or both. Vector DNA was
added to each transfection to equalize the total amount of
transfected DNA so that total amount of DNA is the same in each
group of transfection. Each set of data was from at least three
independent transfection results. 24 hours after transfection,
supernatant was collected and subjected for ELISA test. The height
of the bars represent the concentration of detected mature
IL-1.beta. in pg/ml.
[0046] FIGS. 7A-7C. Targeted disruption of the Ich-3 Gene.
[0047] FIG. 7A. Structure of the mouse Ich-3 gene. Exons are
depicted as open boxes and are numbered from the exon encoding ATG
translation initiation codon. Amino acids residues of each exon are
indicated in the parenthesis. The locations and transcription
orientation of PGKneo and HSVtk selection cassettes are indicated.
Restriction enzyme sites used for construction and Southern
blotting are shown. Diagnostic probes used for Southern blot
analysis are shown on the top of the figure.
[0048] FIG. 7B. Southern blot analysis of ES cell DNA. DNA was
digested with BamHI and blot was hybridized to probe A. The
wild-type allele contains a 10 kb BamHI fragment and the mutant
allele contains a 8.7 kb BamHI fragment because of an additional
BamHI site in the neo cassette. Random integration of the targeting
vector gives a 2.7 kb BamHI fragment because the vector has an
additional BamHI site next to the insert Homologous recombinant ES
clones were successfully screened using an internal probe. Two
criteria to recognize the homologous recombination event were used:
the disappearance of 2.7 kb BamHI fragment and appearance of 8.7 kb
BamHI fragment.
[0049] FIG. 7C. Southern blot analysis of tail DNA from wild type,
heterozygous and mutant. DNA was digested with BamHI and blot was
hybridized to probe A. The wild-type allele is a 10 kb BamHI
fragment and the mutant allele is a 8.7 kb BamHI fragment.
[0050] FIGS. 8A-8D. Expression of Ich-3 in Mutant Mice.
[0051] FIG. 8A. Expression of Ich-3 in Endotoxic Shock. Total RNA
was isolated from the tissues 5 hr after administration of LPS.
Expression was analyzed by Northern blotting with Ich-3 EDNA (0.8
kb PstI fragment of BSNO12) as a probe. Genotypes were indicated as
+/+ (wild-type) and -/- (mutant).
[0052] FIG. 8B. Absence of ICH-3 protein in Ich-3 mutant mice.
Proteins were isolated from different tissues of both wild type
(+/+) and homozygous mutant Ich-3 (-/-) mice 4 hours after LPS
injection (40 mg/kg). 20 .mu.g proteins were loaded in each lane
for western blot analysis using a rat-anti-Ich-3 monoclonal
antibody.
[0053] FIG. 8C Northern blot analysis of Ice and Ich-3 expression.
Poly (A).sup.+RNA was isolated from thymus of wild-type and Ich-3
mutant. 2 (g of poly(A).sup.+RNA was loaded in each lane, and the
blot was hybridized with Ich-3 cDNA (0.8 kb PstI fragment of
BSNO12), Ice cDNA (PCR fragment of primer set MICE3 and MICE4) or
chicken .beta.-actin. A 1.4 kb Ich-3 transcipt was detected in wild
type but not in Ich-3 mutant. A 1.4 kb Ice transcript was detected
in both wild type and Ich-3 mutant in comparable amount.
[0054] FIG. 8D. Reverse-transcription PCR analysis of Ice and Ich-3
expression. The cDNA templates were reverse transcribed from mRNA
isolated from thymus (Lanes 1, 3, 6, and 8) and kidney (lanes 2, 4,
7, and 9). Lanes 5 and 10 are negative control (no cDNA template).
Lanes 1, 2, 6, and 7 are results by using cDNA templates from
wild-type mice. Lanes 3, 4, 8, and 9 are results by using cDNA
templates from mutant mice. Lanes 1-5 are using primer set for
Ich-3 exon 4 and 6 (NOV2 and mnNOp20R primer set), lanes 6-10 are
using primer set for Ice exon 6 (MICE3 and MICE4 primer set).
[0055] FIGS. 9A-9B. Ich-3 deficient EF cells are resistant to
Granzyme B and Granzyme 3 induced apoptosis. Embryonic fibroblasts
from Ich-3-/- and wild type controls were treated with varying
concentrations of granzyme B (FIG. 9A) or granzyme 3 (FIG. 9B) in
the presence of a constant amount of perforin (50 ng/ml) for a
period of 2 and 8 hrs, respectively. The percentage of apoptosis
cells was determined from cell counts after staining with Hoechst
dye (Chen et al., 1995). Control wells contained cells alone
incubated with or without perforin. Data points represent the
percentage of apoptotic cells for a particular dilution of granzyme
minus the percentage of apoptotic cells observed in medium
alone.
[0056] FIG. 10. Partial Resistance to Fas-Induced Thymocytes Cell
Death in Ich-3-deficient mice. Freshly isolated thymocytes were
incubated for 20 hr with antibody at the concentrations indicated.
Cell viability was determined by trypan blue dye exclusion. Values
represent the percentage dead cell from three independent wells
(.+-.S.D). Two independent experiments were performed and showed
similar results.
[0057] FIG. 11. Survival of Ich-3-Deficient Mice After
Administration with Lethal Dose of LPS. Survival of Ich-3-deficient
(-/-), heterozygous (+/-) and wild-type (+/+) mice after injection
of lethal dose of LPS (40 mg LPS/kg body weight) were tested. A
total of 10 Ich-3 mutant (5 males, 5 females), 9 heterozygous (8
males, 1 females), and 9 wild-type (3 males and 6 females) were
tested in at least three independent experiments.
[0058] FIGS. 12A-12B. Normal Secretion of ILS by Macrophages from
Ich-3-Deficient Mice.
[0059] FIG. 12A. Northern blot analysis of Ice and Ich-3 expression
in PECs and splenocytes. Northern blots were probed with Ice or
Ich-3 cDNA probes as indicated. Lane 1: 2.5 (g of total RNA from
splenocytes stimulated with conA (5 (g/ml) and murine IL-2 (100
uhnl) for 3 days. Lane 2: 2.5 (g of total RNA from splenocytes
stimulated with conA (5 (g/ml) for 3 days. Lane 3: 2.5 (g of total
RNA from freshly isolated splenocytes. Lane 4 and 5: total RNA from
PECs (lane 4, 2.5 (g RNA., lane 5, 10 (g total RNA).
[0060] FIG. 12B. IL-1 production by macrophages from
Ich-3-deficient and wild-type mice. Peritoneal macrophages (PECs)
were isolated and stimulated with LPS, and then ATP was added to
induce apoptosis. [.sup.35S]-methionine labeled cytokines in the
supernatants were collected and then processed for
immunoprecipitation. Antibodies used for immunoprecipitations were
indicated in the figure. Genotypes were indicated as in +/+
(wild-type) and -/- (mutant).
[0061] FIGS. 13A-13C The function of Ich-3 in ovary.
[0062] FIG. 13A. Morphometric analysis of the numbers of follicles
at the primordial, primary or small preantral stages of development
in ovaries of wild-type (open bars) and Ich-3 deficient (hatched
bars) female mice at 4 days of age postpartum (N. D.=none
detected). Due to the large scale differences in the numbers of
follicles at different stages of development, the insert depicts an
enlarged frame specifically corresponding to the primary and small
preantral follicle numbers.
[0063] FIG. 13B. Representative photomicrograph granulosa cells
(GC) without an oocyte (arrows), and granulosa cells with multiple
oocyte-like cells (arrow heads), found only in ovaries of Ich-3
mutant mice.
[0064] FIG. 13C Comparative photograph of ovary from a wild type
mouse at day 4 postpartum. Arrows point to normal granulosa cells
with an oocyte.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0065] In the description that follows, a variety of technical
terms are used. Unless the context indicates otherwise, these terms
shall have their ordinary well-recognized meaning in the art. In
order to provide a clearer and more consistent understanding of the
specification and claims, the following definitions are
provided.
[0066] Italicized words such as Ice or Ich refer to the gene or the
corresponding RNA, while non-italicized words such as "ICE or ICH"
refers to the protein product encoded by the corresponding
gene.
[0067] Apoptosis. As used herein, "apoptosis" refers to the process
by which organisms eliminate unwanted cells. The process is
regulated by a cellular program. Apoptosis may eliminate cells
during normal development, aging, tissue homeostasis or following
imposition of an external stress such as hypoxia or trophic factor
deprivation.
[0068] Disrupted gene. As used herein, "disrupted gene" refers to a
gene containing an insertion, substitution, or deletion resulting
in the loss of substantially all of the biological activity
associated with the gene. For example, a disrupted Ich-3 gene would
be unable to express a protein a substantial amount of ICH-3
protein.
[0069] Endotoxic or septic shock. As used herein, "endotoxic or
septic shock" means shock produced by bacterial endotoxins,
particularly E. coli; particularly with septicemia or infection
with gram negative bacilli. (Stedman's Medical Dictionary, 22nd
ed., Williams & Wilkins Co., Baltimore, 1972). Septic shock may
be produced by administration of lipopolysaccharide (LPS).
[0070] Septic shock is a systemic response to infection with high
mortality in human (Morrison & Ryan, Anna Rev. Med 38:417-432
(1987)). LPS and other endotoxin products of gram-positive or
gram-negative bacteria induce massive systemic release of
TNF-.alpha. and IL-1, which are the major mediators of pathology in
sepsis. The release of these endogenous mediators leads to several
characteristic pathophysiological reactions, such as fever,
leukopenia, thrombo-cytopenia, disseminated intravascular
coagulation, leukocyte infiltration in various organs, hemodynamic
changes and eventual death. Some of these responses may be due to
the effects of TNF-.alpha. or IL-.beta. on vascular endothelial
cells which result in cell adhesion, vascular leakage and shock.
Neutralization of either TNF-.alpha. or IL-.beta. has been shown to
prevent lethality in animal models of sepsis (Dinarello, et al., J.
Am. Med. Assoc. 269:106-113 (1993)).
[0071] Expression vector. As used herein, an "expression vector" is
a vector comprising a structural gene operably linked to an
expression control sequence so that the structural gene can be
expressed when the expression vector is transformed into an
appropriate host cell. Two DNA sequences are said to be "operably
linked" if the nature of the linkage between the two DNA sequences
does not (1) result in the introduction of a frame-shift mutation,
(2) interfere with the ability of the promoter region sequence to
direct the transcription of the desired sequence, or (3) interfere
with the ability of the desired sequence to be transcribed by the
promoter region sequence. Thus, a promoter region would be operably
linked to a desired DNA sequence if the promoter were capable of
effecting transcription of that DNA sequence.
[0072] ICE pathway. As used herein, "ICE pathway" refers to the
pathway by which interleukin converting enzyme converts the
pro-IL.beta. to IL-.beta. eventually resulting in programmed cell
death.
[0073] Modulating programmed cell death. As used herein,
"modulating programmed cell death" should be understood to mean
that one either increases or decreases cell death depending upon
the desired end result.
[0074] Resistant to. As used herein "resistant to" means that an
animal exposed to a certain treatment shows a greater degree of
survivability than the corresponding control (i.e. the treatment is
less lethal than to the corresponding control). This does not
necessarily mean that all animals will survive the treatment.
[0075] Sepsis. As used herein, "sepsis" means the presence of
various pus-forming and other pathogenic organisms, or their
toxins, in the blood or tissues; septicemia is a common form of
sepsis. Septicemia is a systemic disease caused by the presence of
microorganisms or their toxins inthe circulating blood. (Stedman's
Medical Dictionary, 22nd ed., Williams & Wilkins Co.,
Baltimore, 1972).
[0076] Targeting vector. As used herein "a targeting vector" is a
vector comprising sequences that can be inserted into a gene to be
disrupted, e.g., by homologous recombination. Therefore, a
targeting vector may contain sequences homologous to the gene to be
disrupted. This invention relates to non-human transgenic animals
comprising a disrupted Ich-3 gene.
[0077] Transgenic. As used herein, a "transgenic organism" is an
organism containing a defined change to its germ line, wherein the
change is not ordinarily found in wild-type organisms. This change
can be passed on to the organism's progeny. The change to the
organism's germ line can be an insertion, a substitution, or a
deletion. Thus, the term "transgenic" encompasses organisms where a
gene has been eliminated or disrupted so as to result in the
elimination of a phenotype associated with the disrupted gene
("knock-out animals"). The term "transgenic" also encompasses
organisms containing modifications to their existing genes and
organisms modified to contain exogenous genes introduced into their
germ line.
[0078] Vector. As used herein, a "vector" is a plasmid, phage, or
other DNA sequence, which provides an appropriate nucleic acid
environment for a transfer of a gene of interest into a host cell.
The cloning vectors of this invention will ordinarily replicate
autonomously in eukaryotic hosts. The cloning vector may be further
characterized in terms of endonuclease restriction sites where the
vector may be cut in a determinable fashion. The vector may also
comprise a marker suitable for use in identifying cells transformed
with the cloning vector. For example, markers can be antibiotic
resistance genes.
[0079] Naturally occurring cell death acts to regulate cell number,
to facilitate morphogenesis, to remove harmful or otherwise
abnormal cells and to eliminate cells that have already performed
their function. Additionally, programmed cell death is believed to
occur in response to physiological stresses such as hypoxia or
ischemia.
[0080] Acute and chronic disregulation of cell death is believed to
lead to a number of major human diseases (Barr et al. Biotech.
12:487-493, 1995). These diseases include but are not limited to
malignant and pre-malignant conditions, neurological disorder,
heart disease, immune system disorders, intestinal disorders,
kidney disease and aging
[0081] Malignant and pre-malignant conditions may include solid
tumors, B cell lymphomas, chronic lymphocytic leukemia, prostate
hypertrophy, preneoplastic liver foci and resistance to
chemotherapy. Neurological disorders may include stroke,
Alzheimer's disease, prion-associated disorder and ataxia
telangiectasia. Heart disease may include ischemic cardiac damage
and chemotherapy-induced myocardial suppression. Immune system
disorder may include AIDS, type I diabetes, lupus erythematosus,
Sjogren's syndrome and glomerulonephritis. Intestinal disorder may
include dysentery, inflammatory bowel disease and radiation- and
mV-induced diarrhea. Kidney disease may include polycystic kidney
disease and anemia/erythropoiesis. Specific references to these
pathophysiological conditions as involving disregulated apoptosis
can be found in Barret al. Id.-Table I.
[0082] Knowing the genes and substrates involved in the ICE pathway
and effects of altering or eliminating expression of apoptotic
proteins such as ICE or ICH-3 leads to means for modulating (i.e.
increasing or decreasing) cell death thereby altering apoptosis. A
better understanding of the apoptosis pathways and specific gene
products such as ICE or ICH-3 can also lead to development of
assays for agents which may affect the apoptotic process.
Interventions may include, inter alia, agents which affect the
activities of the gene products (e.g. agents which block receptors,
inhibit or stimulate enzymatic activity), modulation of the gene
product using geneirected approaches such as anti-sense
oligodeoxynucleotide strategies, transcriptional regulation and
gene therapy (Karp et al., Cancer Res. 54:653-665 (1994)).
Therefore, apoptosis should be amenable to therapeutic
intervention. In this regard, one may either stimulate or inhibit
the process depending upon whether wants to increase or decrease
the rate of programmed cell death.
[0083] Proteolytic cleavage by the ICE family may lead to apoptosis
in several ways. One possibility is that cleavage of a large number
of proteins destroys the entire cellular machinery. This, however,
is unlikely because most proteins appear to remain intact when
cells undergo apoptosis (Lazebnik et al., Nature 371:346-347
(1994)). The second possibility is that proteolytic cleavage of one
critically important substrate leads to cell death. This also is
unlikely because a number of proteins, including pro-IL-1.beta.
ribose polymerase (PARP), U1-70 kD ribonuclear protein, and nuclear
lamin are cleaved during apoptosis (Miura, et al., Proc. Natl.
Acad. Sci. 92:8318-8322 (1995); Lazebnik et al., Nature 371:346-347
(1994); Casciola-Rosen et al., J. Biol. Chem. 269:30757-30760
(1994); Lazebnik, Y. A., et al., Proc. Natl. Acad. Sci.
92:9042-9046 (1995)). It is not clear (with perhaps the exception
of pro-IL-1.beta.), whether products of proteins cleaved by the
ICE-family mediate downstream events of cell death pathways or
whether they are merely the end result of apoptosis. In contrast to
pro-IL-1.beta., however, are the examples in the specification
using ICH-3 which suggest that the Ich-3 gene encodes an
upstream-regulator of ICE in vivo.
[0084] The third possibility for how proteolytic cleavage may lead
to apoptosis is that activation of the ICE pathway and therefore
the ICE family may result in cleavage of several substrates, some
being activated (mediating cell death) and others being destroyed
(required for cell survival). Activation of the pathway may occur
due to events such as trophic factor deprivation, hypoxia,
G.sub.1/S arrest or TNF-.alpha. treatment. Results previously
obtained lead to favoring this last hypothesis, at least as related
to the Ice gene because the data indicate that
endogenously-produced mature IL-1.beta. is directly involved in
cell death and is the first identified substrate of an
apoptosis-inducing gene whose product plays a direct role in
mediating the apoptotic cascade. While these are proposed
mechanisms for how the ICE-family may modulate apoptosis, they
should in no way be construed as limiting the claims of the
invention to operation by such a mechanism.
[0085] Additionally, a number of signal transduction mechanisms
mediate the biological effect of IL-1.beta.. Several of these
second messengers have been implicated in apoptosis and, following
ICE activation, likely mediate cell death following endogenous
mature IL-1.beta. receptor binding. Therefore, blocking receptor
binding will modulate apoptosis. IL-1.beta. induces ceramide
production in EL4 thymoma cells (Mathias, S., et al., Science
259:519-522 (1993)). IL-1.beta. also induces apoptosis in
pancreatic Rlm5F cells via a pathway which is dependent on its
ability to induce nitric oxide production (Ankarcrona et al., Cell
Res. 213:172-177 (1994)). Both ceramide and nitric oxide are strong
candidates for direct mediators of apoptosis (Ankarcrona et al.,
Cell Res. 213:172-177 (1994); Haimovitz-Friedman, A., et al., J.
Exp. Med. 180:525-535 (1994)). A recent report showed that NGF
deprivation of PC12 cells, which induces apoptosis, led to a
substantial activation of the JNK and p38 MAP kinases (Xia et al.,
Science 270:1326-1331 (1995)). IL-1.beta. has been shown to
activate the JNK-p38 signaling pathway and NGF withdrawal may
induce secretion of IL-1.beta. which then activates the JNK-p38
pathway and cell death (Raingeaud, J., et al., J. Biol. Chem.
270:7420-7426 (1995)).
[0086] By obtaining trrnsgenic animals in which specific genes and
proteins of the apoptotic pathway are altered or eliminated (i.e.
knock-out mice) a better understanding ofthe regulation of
programmed cell death will be gained. In order to obtain a
transgenic animal comprising a disrupted Ich-3 gene, a targeting
vector is used. The targeting vector will generally have a 5'
flanking region and a 3' flanking region homologous to segments of
the gene surrounding an unrelated DNA sequence to be inserted into
the Ich-3 gene. For example, the unrelated DNA sequence can encode
a selectable marker, such as an antibiotic resistance gene.
Specific examples of a suitable selectable marker include the
neomycin resistance gene (NEO) and the hygromycin
.beta.-phosphotrsferase. The 5' flanking region and the 3' flanking
region are homologous to regions within the Ich-3 gene surrounding
the portion of the gene to be replaced with the unrelated DNA
sequence. DNA comprising the targeting vector and the native Ich-3
gene are brought together under conditions where homologous
recombination is favored. For example, the targeting vector and
native Ich-3 gene sequence can be used to transform embryonic stem
(ES) cells, where they can subsequently undergo homologous
recombination. The targeting vector pJ476, has been deposited with
the A.T.C.C. (Rockville, Md.) under the terms of the Budapest
Treaty under AT.C.C. accession number 98118 on Aug. 1, 1996.
[0087] Proper homologous recombination can be tested by Southern
blot analysis of restriction endonuclease digested DNA using a
probe to a non-disrupted region of the Ich-3 gene. For example,
Probe A, identified in FIG. 7A, can be used. Since the native Ich-3
gene will exhibit a different restriction pattern from the
disrupted Ich-3gene, the presence of a disrupted Ich-3 gene can be
determined from the size of the restriction fragments tat hybridize
to the probe.
[0088] In one method of producing the transgenic animals,
transformed ES cells containing a disrupted Ich-3 gene having
undergone homologous recombination, are introduced into a normal
blastocyst The blastocyst is then transferred into the uterus of a
pseudo-pregnant foster mother. Pseudo-pregnant foster mothers have
been mated with vasectomized males, so that they are in the proper
stage of their estrus cycle and their uterus is hormonally primed
to accept an embryo.
[0089] The extent of the contribution of the ES cells, containing
the disrupted Ich-3 gene, to the somatic tissues of the transgenic
mouse can be determined visually by choosing strans of mice for the
source of the ES cells and blastocyst that have different coat
colors.
[0090] The resulting homozygous Ich-3 mutant animals generated by
homologous recombination are viable, fertile, and indistinguishable
from wild-type and heterozygous littermates in overall appearance.
These mutant animals contains essentially no full length Ich-3
transcripts and no immunoreactive ICH-protein as measured by
western blot analysis.
[0091] The Ich-3 mutant animals of the invention can be any
non-human mammal. In embodiments of this invention, the animals are
mice, rats, guinea pigs, rabbits, and dogs. In an especially
preferred embodiment of the invention, the Ich-3 mutant animal is a
mouse.
[0092] The mutant mouse of the invention provides, inter alla, a
model and/or test system for investigators to manipulate and better
understand the mechanisms of apoptosis, sepsis and
folliculogenesis. In particular, a better understanding is gained
concerning the role of the Ich-3 gene, its protein product and
possibly the ICE pathway. Such a model, allows the investigator to
test various drugs where physiological responses are altered in the
mouse, e.g. resistance to sepsis (increased) and thereby determine
more effective therapy to address the underlying mechanism of the
problem.
[0093] Therefore, invention also provides, a method of screening
compounds, comprising: providing the compound to a transgenic
non-human animal having a disrupted Ich-3 gene; determining the
effect of the compound on apoptosis of said animal; and correlating
the effect of the compound with increases or decreases in
apoptosis.
[0094] The compounds to be tested can be administered to the
transgenic non-human animal having a disrupted Ich-3gene in a
variety of ways well known to one of ordinary skill in the art. For
example, the compound can be administered by parenteral injection,
such as subcutaneous, intramuscular, or intra-abdominal injection,
infusion, ingestion, suppository administration, and skin-patch
application. Moreover, the compound can be provided in a
pharmaceutically acceptable carrier. See "Remington's
Pharmaceutical Sciences" (1990). The effect of the compound on
apoptosis, septic shock or folliculogenesis can be determined using
methods well known to one of ordinary skill in the art.
[0095] In addition, the Ich-3 mutant animals of this invention
unexpectedly exhibit an increased resistance to septic shock
resulting from LPS administration The Ich-3mutant animals of this
invention, therefore, are useful as an animal model to study septic
shock. For example, various compounds could be tested to determine
whether they further increase or decrease the resistance of Ich-3
mutant mice to septic shock.
[0096] This invention relates to Ich-3 mutant animals with defects
in early folliculogenesis and germ cell endowment. Therefore, the
invention provides methods for screening compounds using the
Ich-3mutant animals as an animal model to identify compounds useful
in treating problems related to folliculogenesis or germ cell
endowment.
[0097] These aspects of the invention (i.e. those relating to the
testing of compounds affecting apoptosis, septic shock,
folliculogenesis and germ cell endowment) are useful to screen
compounds from a variety of sources. Examples of compounds that can
be screened using the method of the invention include but are not
limited to rationally designed and synthetic molecules, plant
extracts, animal extracts, inorganic compounds, mixtures, and
solutions, as well as homogeneous molecular or elemental samples.
Establishing that a compound has an effect in the Ich-3 mutant
animals has predictive value relating to that compound's effect in
other animals, including humans. Such predictive values provides
for initial screening of therapeutically valuable drugs.
[0098] The invention, therefore, provides a method of screening
compounds, comprising: providing a transgenic non-human animal
having a disrupted Ich-3 gene and exhibiting the properties
described in this specification, administering a compound to be
tested to the transgenic animal; determining the effect of the
compound on the properties of interest in said animal; and
correlating the effect of the compound on the Ich-3 mutant mouse
with the effect of said compound in a control animal.
[0099] Thus, the mutant animals of this invention are also useful
as animal models to study apoptosis, septic shock and
folliculogensis.
[0100] Having now generally described the invention, the same will
be more readily understood through reference to the following
examples which are provided by way of illustration, and are not
intended to be limiting of the present invention.
EXAMPLES
Example 1
ICH-3 is a Member of the ICE Family
[0101] To identify additional members of the ICE family, a mouse
thymus cDNA library (Strategene) was screened under low stringency
conditions using human Ice cDNA as a probe. Two positive clones
were identified. One of them was murine Ice cDNA and the other,
named Ich-3 subsequently, encodes a protein similar but not
identical to murine ICE.
[0102] Cloning and Construction of Plasmids
[0103] A mouse thymus cDNA library containing 10.sub.6
plaque-forming units was screened by human Ice cDNA as a probe.
Hybridization was performed under low stringency at 40.degree. C.
overnight in 5.times.SSPE, 20% formamide, 10.times.Denhardt's
solution, 1% SDS. Filters were washed in 1.times.SSPE, 0.5% SDS
twice at room temperature, and then twice at 42.degree. C. Two
Ich-3 cDNA clones were originally obtained and subdloned into
pBluescript II (named m29 and mNO). Additional Ich-3 clones were
also obtained from the same cDNA library by direct screening with a
Ich-3 probe and were subdloned in pBluescript II (named BSNO1,
BSNO3, BSNO9 and BSNO12). These clones contain inserts with
overlapping segments of the Ich-3 gene. mNO contained the longest
insert (2 kb) including ATG initiation codon, however, this insert
was longer than the size of Ich-3 mRNA determined by Northern blot.
mNO contained an unexpected duplication of Ich-3 3' cDNA sequence
at its 5' end. To confirm that the 35 bp upstream sequence from the
ATG codon was derived from Ich-3 mRNA, reverse transcriptase PCR
analysis was performed by using the primer set mNOF
(5'-CTTCACAGTGCGAAAGAAC) and m29P2 (5'-GGTCCACACTGAAGAAT
GTCTGGAGAAGCATTTCA). An amplified fragment of expected size was
obtained, indicating that the entire coding region of Ich-3 had
been cloned (data not shown).
[0104] To construct the Ich-3-lacZ fusion gene, full-length Ich-3
cDNA was made by PCR using M34 (CCCTCGAGCGGCCGCCATGGCTGAA
AACAAACACCC) and mNOR (AAGTCGACTTGCCAGGAAAGAGG TAGAAATATC). LacZ
SalI/BamHI ragment was isolated from p.beta.actGal' and cloned into
pBluescript (BSZ). BSZ was digested with XhoI and SalI and then
ligated with Ich-3 PCR fragment which was digested with XbaI and
SalI (pM23Z). NotI fragment (Ich-3-lacZ) of pM23Z was cloned into
p.beta.actSTneoB (p.beta.actM24Z) or pcDNA3 (pCMVM26Z).
[0105] To construct mutant Ich-3 gene in which the coding region
for the active cysteine residue is changed into a glycine residue,
two primers containing the mutation were synthesized: NO2GA
(GTGCAGGCCGGCAGAGGTGGG) and NO2GB (CCCACCTCTGCCGGCCTGCAC). The
mutant construct p.beta.actS6Z was made from two rounds of PCR
using two pairs of primers. The first round of PCR was to generate
the mutant cDNA as two half cDNA fragments. The 5' fragment from
N-terminus to the mutation site was made using Ich-3 cDNA as a
template and M34 (CCCTCGAGCGGCCGCCATGGCTG AAAACAAACACCC) and NO2GB
as primers. The 3' fragment from mutated site to C-terminus was
generated using Ich-3 cDNA as template and NO2GA and mNOR
(AAGTCGACTTGCCAGGAAAGAGGT- AGAAATATC) as primers. The PCR was
performed under the following conditions: 1.times.Vent DNA
polymerase buffer (Biolabs), 0.3 mM dNTPs, 0.5 .mu.M each primers
and 1 unit of Vent DNA polymerase (BioLabs) in a total volume of 25
.mu.l. DNA was denatured at 94.degree. C. for 1 min, annealed at
60.degree. C. for 1 min and elongated at 72.degree. C. for 1 min
with 28 cycles. In the second round PCR, the mixture of 5'-fragment
and 3'-fragment was used as template and M34 and mNR Fusion as
primers. The product of second PCR was a complete Ich-3 cDNA with a
mutation which changed the active cysteine to a glycine. The
conditions of the PCR were the same as in the first round. The PCR
product was inserted into EcoRV site of pBluescript II and
sequenced to insure that no additional mutation was introduced
during the PCR reactions. The expression construct of the mutant
Ich-3 (p.beta.actS6Z) was constructed similar to the original wild
type construct.
[0106] The cDNA sequence of Ich-3 (FIG. 1) contains an open reading
frame of 373 amino acids. The first ATG translational start codon
is at the nucleotide 35-37. An opal stop codon is at the
nucleotides 1154-1156. There is a canonical poly(A) signal (AATAAA)
at its 3' non-coding region. The predicted molecular weight of
ICH-3 is 42 kDa. The amino acid sequence of ICH-3 is most
homologous to human IX (60% identity), which is also named as
ICErelII and ICH2 (Munday, N. A., et al., J. Biol. Chem.
270:15870-15876 (1995); Kamens et al., J. Biol. Chem.
270:15250-15256 (1995)). ICH-3 shares 46%, 45% and 54% of
identities with murine ICE, human ICE and human ICErelIII,
respectively (Table 1). ICH-3 is less homologous to C. elegans
Ced-3, human ICH-1.sub.L, human CPP32 and human MCH2 with
26%,30%,32% and 24% identities, respectively. Like all the other
members of the ICE family, ICH-3 also lacks an extended serine rich
region that is present in Ced-3 (Yuan et al., Cell 75:641-752
(1993)). The majority of sequence heterogeneity occurs in the
prepeptide region, whereas those areas within and around the
conserved pentapeptide QACRG, the active site for the ICE family,
is highly homologous. These results indicate that ICH-3 protein is
a member of the ICE family.
1TABLE 1 Summary of amino acid sequence identities among all the
ICE/Ced-3 family members reported to date. The numbers in the table
represent % of identity of the sequences compared. The human
protein TX, ICE.sub.relII and ICH-2 are the same protein.
Percentage of amino acid sequence identity: TX mICE hICE relIII
CED3 hICH1 CPP32 MCH2 ICH-3 60 46 45 54 26 30 32 24 TX/ 49 53 73 27
28 32 23 ICErelII /ICH2 mICE 62 49 28 26 32 28 hICE 50 29 27 30 27
ICErel- 25 25 30 23 III CED-3 28 34 33 hICH-1 28 28 CPP32/ 46
YAMA
[0107] ICE is synthesized as a p45 precursor form which is cleaved
during activation into the p20 and p10 subunits (Thomberry, N. A.,
Nature 356:768-774 (1992)). The cleavage is dependent on aspartic
acid residue in the P1 position. Examining the residues involved in
the maturation of the ICE precursor (Thornberry, N. A., Nature
356:768-774 (1992); Walker, N. P. C., et al., Cell 78:3434-352
(1994); Wilson, K. P., et al., Nature 370:270-275 (1994)), the
residue of ICH-3 corresponding to the ICE residue involved in
processing p10 N-terminal is conserved, whereas the residues
corresponding to the processing site for the N-terminus and
C-terminus of p20 are not conserved in ICH-3 (FIG. 2). Two nearby
Asp residues (Asp.sub.59 and Asp.sub.80) in the ICH-3 sequence may
serve as potential processing sites for the N-terminus of p20,
which would produce a subunit of 20 kDa.
[0108] According to the X-ray crystal structural analysis of ICE
(Wilson, K. P., et al., Nature 370:270-275 (1994); Walker, N. P.
C., et al., Cell 78:3434-352 (1994)), His.sub.237, Gly.sub.238 and
Cys.sub.285 of ICE are involved in catalysis and all three are
conserved in ICH-3 (His.sub.206, Gly.sub.207 and Cys.sub.254) (FIG.
2A). The residues that are-part of the P1 Asp binding pocket in ICE
(Arg.sub.179, Gln.sub.283, Arg.sub.341 and Ser.sub.347) are also
conserved in ICH-3 (Arg.sub.148, Gln.sub.252, Arg.sub.310 and
Ser.sub.316) (FIG. 2A). However, the residues in ICE that make up
the groove for binding P2-P4 residues of the substrate (ICE
Val.sub.338, Trp.sub.340, His.sub.342, Pro.sub.343, Arg.sub.383,
and Gln.sub.385) are quite different in ICH-3 and the corresponding
amino acids are Leu.sub.307, Tyr.sub.309, Asp.sub.311, Lys.sub.312
and His.sub.352 with only one Gln.sub.352 conserved. These
comparisons predict that ICH-3 is also a cysteine protease with
preference for Asp at P1 position but it may recognize a slightly
different set of substrates than those cleaved by ICE.
[0109] The molecular cloning and characterization of murine Ich-3,
a new member of the Ice/ced-3 family is described. The predicted
ICH-3 protein is 373 amino acids long and contains the 100%
conserved ICE family signature peptide QACRG. Five additional
members of the ICE family have been identified (Wang et al., Cell
87:739-750 (1994); Munday, N. A., et al., J. Biol. Chem.
270:15870-15876 (1995); Kamens et al., J. Biol. Chem.
270:15250-15256 (1995)). These ICE homologs can be classified into
two different groups by their sequence homology: one group (ICE) is
more homologous to ICE than to Ced-3 (TX/ICErelII/ICH2 and
ICErelIII) and the other (Ced-3) is more homologous to Ced-3 than
to ICE or equslly homologous to ICE and Ced-3 (ICH-1, CPP32/Yama
and MCH-2). Murine ICH-3 is more homologous to ICE than to Ced-3
and therefore belongs to the ICE group. The amino acid sequence of
ICH-3 is 60% identical to TX, which is close to the identity shared
by murine and human ICE (62% identity). The expression pattern of
Ich-3 is also similar to TX: both are expressed in many tissues,
but are expressed at very low levels in the brain. It is possible
that ICH-3 is the murine equivalent of human TX. It cannot be
concluded at the moment, however, that Ich-3 is in fact murine
version of human TX because TX has been shown to be able to cleave
pro-ICE (Faucheu et al., EMBO J. 14:1914-1922 (1995)) whereas the
same thing has not been observed for ICH-3 in a similar assay.
Example 2
Ich-3 is Expressed in Many Tissues and is Induced by LPS
[0110] To study the expression pattern of Ich-3, total RNA was
isolated from different tissues of mice.
[0111] Northern Blot Analysis and RT-PCR
[0112] Total RNA from different tissues of mouse was isolated by
TRIzol total RNA Isolation (GIBCO BRL). For isolation of total RNA
from mice stimulated by LPS, 7-10 weeks old mice were injected with
LPS at dose of 40 mg/kg body weight and 5 hrs after LPS injection,
tissues were isolated for RNA preparation. The .sup.32P-labeled
probe was the 3'-fragment of Ich-3 generated by PCR using two
primers NO2GA and mNoR. Hybridization was performed overnight at
62.degree. C. in 1% BSA, 1 mM EDTA, 0.5 M Sodium phosphate pH 7.2,
and 17.5% SDS. The blots were washed in 40 mM Sodium phosphate (pH
7.2), 1 mM EDTA, 1% SDS and 70 mM NaCl at 65.degree. C. and
autoradiographed. For RT-PCR, first strand cDNA was synthesized by
use of total RNA and random priming with Moloney murine leukemia
virus reverse transcriptase (Gibco BRL) as described previously
(Wang et al., 1994). The primers used for PCR to amplify Ich-3 were
mNOF (5'-CTTCACAGTGCGAAAGAACT-3') and m29P2
(5'-GGTCCACACTGAAGAATGTCTGGAGAAGCA- TTTCA-3'). The PCR was
performed under the following conditions: 1.times. Taq polymerase
buffer (Promega), 0.3 mM dNTPs, 2.5 mM MgCl.sub.2, 0.5 .mu.M each
primer, 1 unit of Taq DNA polymerase (Promega) in a total volume of
25 .mu.l. DNA was denatured at 94.degree. C. for 1 min, annealed at
5.degree. C. for 1 min and elongated at 72.degree. C. for 1 min
with 30 cycles. The PCR of .beta. actin was performed under the
same conditions.
[0113] Expression and Purification of ICH-3from E. coli.
[0114] An EcoRI fragment from the cDNA clone BSNO12 encoding the
full length Ich-3 was subdloned into EcoRI site of pTrcHis
(Invitrogen). The construct was named as pTrcHisS9. In this
construct, the N-terminal of Ich-3 was fused to a polyhistidine
(six histidines) coding region and the fusion gene was placed under
the control of the inducible trpB and lacUV5 hybrid promoter. The
production of the fusion protein was induced by 0.3 mM IPTG and the
protein was purified by His.Bind.TM. Buffer Kit from Novagen
according to the protocol. The protein was stored at -20.degree. C.
in 10% glycerol.
[0115] Generation of ICH-3 p20 Peptide Antibody and Western
Blotting Analysis
[0116] A 15 amino acid peptide (H-TEFKHLSLRYGAKFD)8-MAP-linked
withtin the p20 region of ICH-3 was used for the generation of
polyclonal antibodies. Standard protocols in the art were used
(Liddell, et al., Antibody Technology, 1995; Drenckhahn et al,
Methods in Cell Biology, Vol 37, 1993; Catty, D., Practical
Approach Series, Vol. 1A, 1988; E. Herlow et al. The specificity of
these antibodies was verified by Western blot analysis. In
addition, an anti-ICH-3 monoclonal antibody was isolated from rats
immunized with bacterially expressed ICH-3 protein using
conventional protocols (Harlow et al.,).
[0117] The peptide and rabbit polycolonal antibodies against p20
region of ICH-3 were made by Research Genetics (Huntsville, Ala.)
and purified using 4% N-hydroxy-succinimidyl
chloro-formate-activated cross-linked beaded agarose from Sigma
(H8635) according to manufacture's protocol. For Western blotting,
10 .mu.g of purified bacterial ICH-3 fusion protein was subjected
to SDS-PAGE on a 15% polyacrylamide gel. Proteins were then
transferred onto Immobilon-P membrane (Millipore, Bedford, Mass.)
and incubated with 1 .mu.g/ml rabbit anti-ICH-3 p20 polycolonal
antibody for 2 hours at room temperature. After three washes with
TBST (10 mM Tris pH 8.0, 0.15 M NaCl, 0.05% Tween 20), the membrane
was incubated with horseradish peroxidase linked anti-rabbit Ig
antibody for 45 min at room temperature (Amersham, Buckinghamshire,
England). After washing three times, antibodies bound to the
membrane were revealed with the ECL Western blotting reagent
(Amersham, Buckinghamshire, England).
[0118] To determine induction of ICH-3 by LPS, proteins were
isolated from tissues of 7-10 week old mice before injection or 4
and 20 hours after LPS injection (40 mg/kg). 60 .mu.g of proteins
were loaded in each lane on a 12% polyacrylamide gel for SDS-PAGE.
After transferring the proteins onto Immobilon-P membrane, Western
blotting was carried out as described above by using rat-anti mouse
ICH-3 monoclonal antibodies.
[0119] Northern blots were probed with an Ich-3 cDNA probe (from
the active site to 3'-end) in high stringency conditions where the
hybridization mixture contained 17.5% SDS. Under the conditions
only sequences with more than 95% identity would hybridize. (see
above--"Northern blot analysis"). The Ich-3 probe hybridizes to a
single band of 1.4 kb mRNA which is very similar to the sizes of
Ice mRNA and the reported size of TX/ICErelII/CH2 (FIGS. 3A-3B).
The expression pattern of Ich-3 is very similar to that of Ice,
except that of brain where Ice expression can be detected but Ich-3
is not. Ich-3 expression can be detected in adult heart, lung,
thymus, spleen, kidney. Higher levels of Ich-3 is found in adult
thymus and spleen, which is similar to the distribution of
TX/ICH-2/ICE.sub.relII mRNA (Faucheu et al., EMBO J.
14:1914-1922(1995); Kamens et al., J. Biol. Chem. 270:15250-15256
(1995); Munday, N. A., et al., J. Biol. Chem. 270:15870-15876
(1995)). Only RT-PCR can detect low levels of expression in brain
(FIG. 3B).
[0120] The expression levels of Ich-3 in wild type mice in control
conditions are very low. Endotoxins (lipopolysaccharide, LPS) are
strong inducers of proIL-1.beta. synthesis and mature IL-1.beta.
secretion. To examine if the expression of Ich-3 can be induced by
LPS, RNA was prepared from mice either before injection or 5 hrs
after injection of lethal dose LPS (40 mg/kg of body weight).
Northern blot analysis showed that Ich-3 RNA expression was
dramatically induced at least 30 fold after LPS stimulation in
thymus, lung, spleen and kidney but not brain where Ich-3
expression is low in control mice (FIG. 3A). Ice transcription was
not induced in spleen, kidney, lung, heart and brain after LPS
stimulation. Ice mRNA was only induced significantly in thymus
(FIG. 3A).
[0121] The levels of ICH-3 protein before and after LPS stimulation
were also investigated. Proteins were isolated from tissues of 7-10
weeks old mice before injection and 4 hrs or 20 hrs after LPS
stimulation (40 mg/kg) and then analyzed on western blot using a
monoclonal antibody which recognizes ICH-3 specifically. ICH-3
protein was undetectable in western blot of tissues isolated from
control mice. In LPS stimulated mice, ICH-3 was detected as two
proteins of 43 kDa and 38kDa. 43 kDa is very close to the predicted
protein size from the full length Ich-3 cDNA. It is known that
these proteins are from the Ich-3 locus because the Ich-3-/-
knockout mice that have been generated using gene targeting
techniques are specifically missing these two proteins. LPS
stimulation resulted in at least 20-30 fold increase in levels of
ICH-3 proteins. In the spleen, two additional bands of 30 kDa and
26 kDa were detected which may be cleavage products of 43 kDa or 38
kiDa Elevated levels of ICH-3 proteins were found at both 4 hrs and
20 hrs after LPS stimulation, suggesting that LPS induced an
immediate and sustained increase in levels of ICH-3 proteins. In
contrast, western blot analysis of the same tissue samples using a
polyclonal anti-ICE antibody detected no difference in expression
before and after LPS stimulation (data not shown). These results
suggest that Ich-3 may be an important regulator of endotoxic shock
in mice.
Example 3
Overexpression of Ich-3 Induces Apoptosis
[0122] To examine whether expression of Ich-3 may be able to induce
apoptosis, the same transient expression system used for Ice and
Ich-1 (Miura et al., Cell 75:653-660 (1993); Wang et al., Cell
87:739-750 (1994)) was used. The mouse Ich-3 cDNA was fused with
the E. coli lacZ gene and the fused gene was placed under the
control of either a chicken .beta.-actin promoter (p.beta.actM24Z)
or CMV promoter (pCMVM26Z). A mutant Ich-3 was generated by
site-directed mutagenesis in which the Cys residue in the conserved
pentapeptide QACRG domain was converted to a Gly residue. This
mutant was also fused to the lacZ gene and placed under the control
of chicken .beta.-actin promoter and named p.beta.actS6Z. These
expression constructs were transfected into different culture cells
and their ability to induce apoptosis was tested by determining the
ratio of round dead blue cells to flat live blue cells.
[0123] Cell Culture and Transfection Studies
[0124] Rat-1 cells, HeLa cells and COS cells were maintained in
Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10%
fetal calf serum (FCS). For transfection, cells were seeded at a
density of about 2.5.times.10.sup.5 in each of the 6-well dishes. 1
.mu.g of expression construct and 3 .mu.l of lipofectamine reagent
were used according to the protocol from GIBCO BRL. The expression
of lacZ fusion genes in cell cultures was detected by X-gal
staining as previously described (Miura et al., 1993). For
cotransfections using more than one construct, a CaCl.sub.2
transfection method was used.
[0125] Briefly, for each 6 well dish, 1-5 .mu.g of DNA was mixed
with 108 .mu.l of water and 15.5 .mu.l of 2M CaCl.sub.2. Then the
DNA-CaCl.sub.2 mixture was added slowly into 125 .mu.l of
2.times.HBS(280 mM Nalco, 10 mM KCl, 1.5 mM
Na.sub.2HPO.sub.4.2H.sub.2O, 12 mM dextrose and 50 mM HEPES,
pH7.2). After incubation at room temperature for 20-30 min, the
DNA-CaCl.sub.2 mixture was added into the dish and incubated at
37.degree. C. for 3-5 hours. The cells were shocked by 15% Glycerol
in 1.times.HBS for 1 min and then grown in complete medium until
harvesting.
[0126] As shown in FIGS. 4A-4D and Table 2, induction of Rat-1 cell
apoptosis by Ich-3 is as efficient as Ice (both at about 97%).
Thus, Ich-3 clearly modulates programmed cell death. The percentage
of cell death induced by Ich-3-lacZ under control of the chicken
.beta. actin promoter (p.beta.actM24Z) is similar to that of the
CMV promoter (pCMV26Z). Ich-3 is less effective in inducing HeLa
cell apoptosis (43%) than that of Ice (94%). Since Rat-1 cells are
not transforned whereas HeLa cells are of tumor origin, this result
suggests that Ich-3 induced apoptosis may be more sensitive to
apoptosis Jo suppressors than that of Ice. Consistent with this
hypothesis, bcl-2 is somewhat more effective in suppressing Ich-3
induced cell death than that of Ice (Table 2).
[0127] Table 2. Overexpression of Ich-3 in tissue culture cells
induces apoptosis. The constructs .beta.-gal control
(=p.beta.actGal vector), Ice-lacZ (Ice-lacZ fusion under
.beta.-actin promoter controlppactMlOZ), Ich-3-lacZ (Ich-3-lacZ
fusion under CMV promoter control=pCMVM6Z), and mutant Ich-3
(=p.beta.actS6Z , mutant Ich-3 under .beta.-actin promoter control)
were transiently transfected in to different cell lines. 24 hours
(40 hours in COS cells) after transfection, the cells were fixed
and stained for X-Gal. The data (mean.+-.SEM) are the percentage of
round blue cells among total number of blue cells counted. The
numbers in the parentheses are the number of blue cells counted.
The data were from at least three independent experiments. ND, not
determined.
2 % of Cell Death Constructs Rat-1 Hela COS Rat-1/bcl-2 Rat-1/crmA
Vector alone 3.6 .+-. 0.5 (946) 9.0 .+-. 2.6 (768) 4.3 .+-. 1.9
(428) 3.0 .+-. 0.6 (987) 7.33 .+-. 2.3 (870) Ice-lacZ 97.7 .+-. 3.4
(746) 93.9 .+-. 0.3 (982) 11 .+-. 0.2 (1084) 69 .+-. 19 (81) 56.5
.+-. 3.4 (272) Ich-3-lacZ 97.2 .+-. 4.2 (751) 43.5 .+-. 5.5 (220)
12.1 .+-. 2.1 (548) 53.7 .+-. 11 (446) 55 .+-. 14 (618) mut.
Ich-3-lacZ 10.2 .+-. 2.8 (654) ND 5.2 .+-. 2.8 (492) ND ND
[0128] The cowpox virusgene crma encodes a serpin that is a
specific inhibitor of ICE (Ray, C. A, et al., Cell 69:597-604
(1992)). CrnA is much more effective in inhibiting ICE induced
apoptosis than ICH-1.sub.L induced apoptosis (Wang et al., Cell
87:739-750 (1994)). CrinA is 10.sup.4 fold more potent in
inhibiting ICE than CPP32 (Nicholson, D. W., et al., Nature
376:3743 (1995)). These results suggest that CrmA can discriminate
among different members of the ICE family. Since expression of crmA
can suppress trophic factor deprivation induced neuronal cell death
(Gagliardini et al., Science 263:826-828 (1994)), CTL, Fas and
TNF.alpha. induced apoptosis (Tewari et al., Chem. 270:22605-22708
(1995a); Talley, A. K, et al., Mol. Cell. Biol. 15:2359-2366
(1995); Enari et al., Nature 375:78-81 (1995); Los et al., Nature
375:81-83 (1995); Miura et al., Proc. Natl. Acad Sci. USA
92:8318-8322 (1995)), it became important to examine whether cell
death induced by a particular ICE family member can be suppressed
by CrmA. Expression constructs of Ice and Ich-3 were transiently
transfected into Rat-1 cells stably expressing crmA (Miura et al.,
Cell 75:653-660 (1993)) and percentage of round dead blue cells
among total blue cells were counted. As shown in Table 2, Ich-3
induced only 55% cell death in rat-1/cnmA cells compared with 97%
cell death in Rat-1 cells. Similar inhibition of cell death was
observed in Ice induced cell death which is reduced from 97% to
57%. These experiments showed that CrmA is as effective in
suppressing Ich-3 induced cell death as that of Ice.
Example 4
ICH-3 Can Be Cleaved by Granzyme B In Vitro
[0129] Recent studies suggest that Ice may be involved in
GraB/perforin mediated Cytotoxic T lymphocytes (CTL) induced
apoptosis. CTLs induce apoptosis via granzymes in the presence of
the pore forming protein perforin (Shi et al., J. Exp. Med.
175:553-566 (1992a); Shi et al., J. Exp. Med. 176:1521-1529
(1992b)). It has been shown that ICE cannot be cleaved directly by
GraB; nevertheless, ICE is important for GraB induced apoptosis in
at least certain cell types (Shi et al., Proc. Natl. Acad. Sci. (In
press, 1996) Other ICE family members may be processed by GraB,
which in turn may directly or indirectly activate ICE. ICH-3
cleavage by GraB was examined.
[0130] In Vitro Cleavage Assay
[0131] For in vitro cleavage of ICH-3 by GraB, 10 mg purified
His-tagged ICH-3 protein was incubated with 20 ng of GraB in the
presence of 50 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 0.5 mM Sucrose and
10 mM DTT in a total volume of 10 .mu.l. The mixture was incubated
at 30.degree. C. for 1 hour and the cleavage was detected by
Western blotting with a peptide antibody against the p20 portion of
ICH-3.
[0132] To examine whether GraB can cleave ICH-3, a His-tagged ICH-3
protein was expressed in E. coli. His-tagged ICH-3 protein purified
from bacteria was mixed with or without active GraB and incubated
at 30.degree. C. for 1 hour. The cleavage products were identified
by Western blot with a peptide antibodies against the p20 or a
monoclonal antibody against p10 portion of ICH-3. As show in FIG.
5, the fulll length ICH-3 band disappeared after incubation with
GraB: a new 20 kDa band appeared which is detected by an anti-ICH-3
p20 antibody and a new 10 kDa band which is recognized by a
monoclonal antibody against p10 of ICH-3. The ICH-3 protein
purified from bacteria is processed into p30 (perhaps by
autocleavage) but not p20 and p10, whereas GraB can cleave ICH-3
into p20 and p10. Fragments around 30 kDa are the predicted sizes
of the cleavages at Asp 59 and Asp 80. An additional cleavage at
Asp281 will generate a 20 kDa and a 10 kDa subunit. To confirm that
p10 and p20 are generated from predicted p30 region, a T7-tagged
p30 Ich-3 was expressed in E. coli. Cleavage of this T7-tagged p30
generated predicted p20 and p10 subunits recognized by p20 and p10
specific antibody. The cleavage of ICH-3 by GraB suggests a
possible role for ICH-3 in granzyme B/perforin induced
apoptosis.
Example 5
ICH-3 Does Not Process proIL-1.beta. Directly But Can Potentiate
ICE For Cleavage of proIL-1.beta.
[0133] Mice with a homozygously disrupted Ice genes are severely
defective in generating mature IL-1.beta. (Li et al., Cell
80:401-411 (1995)); hence, ICE plays a critical role in processing
pro-IL-1.beta. to mature IL-1.beta.. Since both mature IL-1.beta.
and Ich-3 mRNA can be dramatically induced by LPS in vivo, it is
hypothesized that ICH-3 may directly or indirectly contribute to
proIL-1.beta. processing. A transient transfection assay combined
with enzyme-linked immunoabsorbent assay (ELISA) was used to test
the ability of ICH-3 in cleaving proIL-1.beta..
[0134] Assay of proI-L1.beta. secretion
[0135] An EcoRI fragment of mouse proIL-1.beta. cDNA was cloned
into pcDNA3 and placed under control of CMV promoter. The construct
was named pCMVS11. To test whether ICH-3 can process proIL-1.beta.,
pCMVS11 was cotransfected with Ich-3-LacZ fusion construct pCMVM26Z
into COS cells. proIL-1.beta. (PCMVS11) was also cotransfected with
Ice-lacZ fusion construct and with vector (p.beta.actGal). Vector
DNA was added to each transfection to equalize the total amount of
transfected DNA. 24 hours after transfection, supernatant was
collected and stored at -80.degree. C. or used immediately for
ELISA according to the manufacture's protocol (Genzyme, Cambridge,
Mass.). In some experiments the cells were stained by X-Gal as
previously described (Miura et al., 1993) to test the efficiency of
the transfection.
[0136] A mouse proIL-1.beta. expression construct pCMVS11 was
cotransfected into COS cells together with either Ice
(p.beta.ctM10Z) or Ich-3 (pCMVM26Z) expression constructs. 24 hours
after transfection, secretion of mature IL-1.beta. into the culture
medium was quantified by an ELISA assay (Genzyme, Cambridge,
Mass.). As shown in FIG. 6, cotransfection of Ice with
proIL-1.beta. resulted in a significant amount of secretion of
mature IL-1.beta.. The amount of mature IL-1.beta. generated by ICE
whlich ranges from 70 pg/ml to 600 pg/ml is proportional to the
amount of proIL-1.beta. and Ice used in the transfection. In
contrast, when Ich-3 was cotransfected with proIL-1.beta., no
significant secretion of mature IL-1.beta. was observed, indicating
that ICH-3 could not process pro-IL-1.beta. by itself.
Cotransfection of expression vectors of both Ice and Ich-3 with
that of mouse proIL-1.beta. into COS cells resulted in a 50%
increase in the amount of mature IL-1.beta. secretion compared to
Ice alone. Thus, ICH-3 can promote processing of proIL-1.beta. by
ICE. There was no increase of mature IL-1.beta. production when Ice
was cotransfected with vector (p.beta.actGal) or mutant Ich-3
(p.beta.actS6Z) (FIG. 6), suggesting that ICH-3 enzyme activity is
required for promoting ICE function in generating mature IL-1.beta.
in vivo.
[0137] Expression of Ich-3 mRNA is low in normal healthy tissues.
The levels of ICH-3 proteins are generally undetectable on western
blots of tissues from healthy mice. LPS stimulation dramatically
induces Ich-3 mRNA and proteins, which persists at least 20 hrs
post LPS stimulation. In contrast, expression of Ice is not
elevated in most tissues after LPS stimulation with the exception
of thymus where its level is moderately elevated. ICH-3 protein is
undetectable in normal condition in mice. Upon stimulation by LPS,
two proteins of 43 kDa and 38 kDa are detected. Both proteins are
products of Ich-3 gene because a null mutation in Ich-3 locus
eliminates both proteins (Miura et al., Submitted (1996)). 43 kDa
is very close to the predicted protein size (42 kDa) which would be
generated from full length Ich-3 cDNA. The 38 klDa protein may be
an alternatively spliced product of Ich-3. These results suggest
that ICH-3 may play a very important role in inflammatory
responses.
[0138] Consistent with its role in inflammatory responses, mice
with a homozygous null mutation in Ich-3 gene are resistant to LPS
induced septic shock (See Example 10 and FIG. 11). ICH-3 proteins,
however, are not likely to be directly involved in processing of
pro-IL-1.beta. for the following two reasons. First, there is no in
vivo evidence of existence of another protease playing a
significant role in pro-IL1.beta. processing since ICE knock-out
mice are at least 90% defective in processing pro-IL-1.beta. (Li et
al., Cell 80:401-411 (1995); Kuide et al., Science 267:2000-2002
(1995)). Second, expression of Ich-3 in COS cells does not lead to
pro-IL-1.beta. processing directly; rather it promotes processing
of pro-IL-1.beta. by ICE. This result suggests that ICH-3 is an
upstream regulator of ICE.
[0139] It is not clear, however, how ICH-3 activates ICE. The
simplest possibility that ICH-3 directly cleaves ICE to activate it
may not be true since the cleavage of pro-ICE by ICH-3 either in
enzymatic assay using GraB activated ICH-3 or in cells by double
transfection has consistently failed to be observed. It is
hypothesized that there may be one or more intermediate steps
between ICH-3 and ICE. Expression of Ich-3 in COS cells may
activate this intermediate step(s) which in turn activates ICE.
This may also explain only a 50% increase in mature IL-1.beta.
production is observed when both Ice and Ich-3 was
coexpressed--because there is an intermediate step(s) involving a
protein which is present in limited quantities in COS cells. This
intermediate step may be controlled by another member of the ICE
family. Alternatively, ICH-3 may activate ICE indirectly by
inactivating an ICE inhibitor.
[0140] A question was also raised whether the role of ICE is
primarily in inflammation or apoptosis (Li et al., Cell 80:401411
(1995)). It is clear now that ICE has functions in both processes
since Ice-/- cells are defective in both production of mature
IL-1.beta., and Fas and GraB induced apoptosis (Li et al., Cell
80:401-411 (1995); Kuida et al., Science 267:2000-2002 (1995); Shi
et al., Submitted (1996)). The same question can be asked for
Ich-3: expressing Ich-3 can induce apoptosis which indicates that
Ich-3 has the ability to induce apoptosis which does not prove that
it has a role in inducing cell death in vivo. Ich-3-/- thymocytes
are partially resistant to Fas induced apoptosis and Ich-3-/- EF
cells are resistant to GraB induced apoptosis. These in vivo data
are consistent with the in vitro data present here, that all
suggest ICH-3 is an upstream regulator of ICE.
[0141] Like Ice-/- mice, a lethal dose of LPS fails to induce
production of IL1 in the sera of Ich-3-/- mice. The critical
difference, however, is that Ich-3 deficient macrophages and
monocytes in vitro can produce mature IL-1.beta. as well as wild
type cells when stimulated with LPS and ATP (for macrophages) or
LPS alone (for monocytes); thus, Ich-3 mutant cells still have the
normal ICE function, whereas Ice deficient macrophages and
monocytes do not produce mature IL-1 when stimulated in vitro (Li
et al., Cell 80:401-411 (1995)). These results suggest that ICH-3
may also be an upstream regulator of ICE in vivo. When mice are
stimulated with LPS, ICH-3 may be induced first and activated which
in turn indirectly activates ICE. This hypothesis is entirely
consistent with the data presented here: ICH-3 does not process
proIL-1.beta. directly but does promote proIL-1.beta. processing
when ICE is present The requirement for ICH-3 is bypassed in vitro,
however, when cells are stimulated with a strong signal.
[0142] Summary of Examples 1-5
[0143] The predicted amino acid sequence of ICH-3 exhibits 46%
identity with murine ICE, 45% identity with human ICE, 60% and 54%
identities with human ICE-like proteases TX (IX, ICE.sub.rel-II and
ICH-2 are the same protein) and ICE.sub.rel-III, respectively. It
shares 26-32% sequence identity with CED-3, human ICH-1L and
CPP32/YAMA. Overexpression of Ich-3 in Rat-1 and HeLa cells induces
apoptosis which can be inhibited by CrmA and Bcl-2. Expression of
Ich-3 is dramatically elevated in vivo after stimulation of
lipopolysaccharide CLPS), an endotoxin secreted by gram-negative
bacteria which induces sepsis. In addition, ICH-3 can be cleaved by
granule serine protease granzyme B in vitro. ICH-3 does not process
proIL-1.beta. directly but promotes processing of proIL-1.beta. by
ICE. These results suggest that Ich-3 may play an important role in
apoptosis and inflammatory responses and may be an upstream
regulator of ICE.
Example 6
[0144] Generation of a Null Mutation in the Ich-3 Gene in Mice
[0145] To obtain the genomic clone of the Ich-3 locus, a mouse
129/Sv genomic library using Ich-3 cDNA as a probe (See Example 1
and FIG. 1) was screened as follows.
[0146] Construction of the Ich-3 Targeting Vector
[0147] A full length Ich-3 cDNA was used to screen a lambda dash
mouse genomic library of 129/Sv strain (Stratagene). To confirm the
identities of genomic clones, phage DNA was digested with SalI and
the genomic fragment was subdloned into pBluescript and analyzed by
Southern blots and DNA sequencing. One of the subdlones named BSMNO
which contains all the coding exons of Ich-3 was used to construct
the targeting vector.
[0148] A genomic 3.5 kb EcoRI fragment which contains the exon
encoding the QACRG active site, was subcloned into pBluescript
(pJ453). A 8 kb EcoRi fragment near 3' of Ich-3 gene was subeloned
into pbluescript (pJ451). A poly-adenylated neomycin resistance
gene under the control of phosphoglycerokinase gene promoter
(pGKneo) was inserted between a 2.2 kb EcoRFAccI fragment of pJ453
and a 8 kb EcoRI fragment of pJ451, and thymidine kinase (tk) gene
was ligated with 3' end of the 8 kb EcoRI fragment. The resulting
targeting vector contained 2 kb of genomic DNA from the Ich-3 to
gene before the PGKneo insertion and 8 kb of genomic DNA downstream
from PGKneo and was named pJ476.
[0149] A 1.5 kb piece of Ich-3 genomic sequence including the
region coding for the active site QACRG was replaced with PGKneo in
this targeting vector. To clone the 5' portion of the Ich-3 genome,
the .lambda.FIX 129/Sv strain genomic library (Stratagene) was
screened using an EcoRI/HindIII 0.3 kb fragment of Ich-3 cDNA
(BSNO12) which contains exon 2 and 3 of Ich-3 as a probe. Four
different genomic phage DNAs were subcloned into pBluescript (named
BSNO3G, BSNO6G, BSNOl lG, BSNO22G). From BSNO3G, a 3 kb EcoRI
fragment which contains exon 2 and introns surrounding exon 2 was
subcloned. A 1.9 kb fragment of exon 2 and the 5' intron was
obtained by PCR using the primer set of T3 and m29P2
(5'-GGTCCACACTGAAGAATGTCTGG AGAAGCATTTCA) and was used as a probe
for genomic Southern blot. This probe detects a 10 kb and 8.7 kb
BamHI fragment in wild type and mutant mice, respectively. The same
BammH fragment could be detected by using an internal probe (3.5 kb
EcoRI fragment of pJ451, described as probe A in FIG. 7A).
[0150] Determination of Intron/Exon Boundary
[0151] Various primers were used for sequencing the genomic clone
(BSMNO) to determine the position of intron/exon boundary. PCR was
performed to determine the length of intron. Primers used for this
study were as follows: for exon 2: m29P2
(5'-GGTCCACACTGAAGAATGTCTGGAGAAGCATTTCA); for exon 3: NO3
(5'-CCAGAAGAATCATTGAACAC), mNO15 (5'-GAGAGTGTTCAATGA); for exon 4:
NOV1 (5'-GCTGTAAGCTCCTCTTTCAC), NOV2 (5'- AAACATCTCTC
ACTGAGGTATGGGGCTAAATM;l), for exon 5: NO1 (5'-ACTCTCAGAA
CACCAGACATC), NO2 (5'-CCCACCTCTGCAGGCCTGCAC); for exon 6: NOp10
(5'-GCTGTCAAGCTGAGCC), mNOp20R (5'-TCAGCTTCCATATTCCATGG); for exon
7: M38 (5'-ATCACTTGTCCTACCGA); for exon 8: M50 (5'-GGCAAGTAT
TCATTCCC), NO4 (5'-GATCAATGGTGGGCATCTGGGAA) and mnNORFusion
(5'-TTGCCAGGAAAGAGGTAGAAAT).
[0152] Screening of ES Cells
[0153] J1-ES cells were maintained on feeder layers of mouse
embryonic fibroblasts in the presence of 500 U/ml of leukemia
inhibitory factor (GibcoBRL, Grand Island, N.Y.). ES cells were
transfected with 15 .mu.g linearized pJ476 by electroporation
(400V, 25 .mu.F, Gene Pulser, Bio-Rad, Hercules, Calif.).
Thirty-six hrs after transfection, G418 (200 .mu.g/ml of active
form) was added to the medium and then 1 day later, 0.2 ,.mu.M of
FIAU (1-[2-deoxy, 2-fluoro-.beta.-D-arabinofuranosyl]-5-iod-
ouracil. Bristol-Myers Squibb Pharmaceutical Res., Seattle, Wash.)
was added to the medium. Resistant colonies were picked from day
10-12 after transfection, and expanded. DNA from each resistant
colony was isolated and subjected to Southern blot analysis to
identify clones that underwent homologous recombination. DNA was
extracted according the method by Laird (1991), and digested with
BamHI, and analyzed by Southern blot analysis probed with 3.5 kb
EcoRI fragment of pJ453 (probe A in FIG. 7A).
[0154] Production of Chimeric and Mutant Mice
[0155] C57BL/6J blastocytes were microinjected with 10-12 J1 cells
from a single targeted clone and implanted into pseudopregnant
foster females. Techniques for microinjection are readily known to
those of skill in the art and descriptions of the same can be
readily found in Hogan et al., (Manipulatimg the Mouse Embryo, 2d
ed., cold Spring Harbor Press, 1994). Chimeric male progeny with
>60% agouti coat color were mated with C57BL/6J.times.DBA2 F1
female, and their progeny were screened by Southern blot analysis
with the probe described above for transmission of the targeted
allele.
[0156] Ich-3 is a single-copy gene with at least 8 exons (FIG. 7A).
Exon 1 only encodes 3 amino acids including the initiation codon
ATG for Met The active site pentapeptide QACRG is encoded in the
exon 5. A replacement-type targeting vector was constructed for
selecting homologous recombination events in Ich-3 locus (FIG. 7A).
In this construct, a 1.5 kb Ich-3 genomic DNA fragment containing
the coding region for the active site QACRG pentapeptide was
replaced with the neomycin phosphotransferase (neo) gene. This
insertion/substitution resulted in deletion of 16 amino acids from
the coding region of Ich-3 in exon 5 including the QACRG active
site.
[0157] The Ich-3 targeting vector was transfected into J3 ES cells
by electroporation and ES cells were enriched for homologous
recombinants by selecting in G418 and FIAU. Correctly targeted
Ich-3 mutant alleles were screened among G418/FIAU resistant ES
cell clones by Southern blot analysis using an internal probe
(probe A) (FIG. 7B). Probe A detected a 10 kb endogenous BamHI
fragment in wild type cells whereas in cells with a homologous
recombination event in one Ich-3 locus it detects a 8.7 kb and a 10
kb Bamli fragments. If the targeting vector is randomly inserted in
the ES cell genome, a 2.7 kb band is detected, in addition to the
endogenous 10 kb Bamli band. An external probe which encompassed a
2 kb genomic DNA frggment including exon 2 was also used to confirm
the homologous recombinants on additional Southern blots (data not
shown). All confirmed clones were also probed with neo gene to
ensure that there is only a single integration event (data not
shown). The frequency of correctly targeted clones was 16 out of
719 G418/FIAU doubly-resistant colonies. Three clones (clones 282,
444, 531) were expanded for injection of C57BL/6J blastocysts.
[0158] All three clones gave rise to highly chimeric males that
were then mated with C57BL/6J.times.DBA2 Fl females to obtain
germline transmission of the mutant alleles. Chimera of clone 444
produced germline transmitted mutant mice and the offsprings from
clone 444 chimera were used for fuirther studies. About 50% of the
offspring with agouti coat color derived from mating chimeras with
C57BL/6J mice were heterozygous as determined by Southern blot
analysis. Heterozygous mice were crossed and genotypes were
determined by Southern blot (FIG. 7C). Of the progeny from such
crosses, 30% of the mice were homozygous for the mutant allele, 23%
were wild-type, and 47% were heterozygous as determined by Southern
blot analysis of tail DNA (total number of mice tested: 661). Thus,
segregation of the mutant Ich-3 allele was close to Mendelian
ratio.
[0159] The litter size from homozygous Ich-3 deficient male and
female mice mating was the same as heterozygous crosses with a 1:1
male and female ratio (Data not shown). These results suggested
that mutation of the Ich-3 locus did not cause any gross
abnormalities of general health and reproduction of mice.
Example 7
Ich-3 Mutant Mice Do Not Express Wild Type Ich-3 mRNA or Protein
but Express Normal Amount of Ice Transcripts
[0160] To examine whether the Ich-3 mutant mice express Ich-3,
total RNA was isolated from wild type and mutant mice.
[0161] Northern Blotting and RT-PCR
[0162] Total RNA was extracted from various organs of the mice by
using TRIZOL reagent (GibcoBRL, Gaithersburg, Md.) according to the
manufacture's protocol. The Northern blots were probed using murine
Ice or Ich-3 using conditions of 1% BSA, 1 mM EDTA, 0.5 M sodium
phosphate pH 7.2 and 7% SDS at 62.degree. C. overnight The blots
were washed twice in 40 mM sodium phosphate pH 7.2, 1 mM EDTA, 1%
SDS and 70 mM NaCl at 62.degree. C. for 20 min each. Poly(A)+RNA
was isolated from total RNA using standard oligo(dT) column
chromatography (Sambrook et al. Molecular Cloning: A Laboratory
Manual, Second Edition Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press, (1989)). For reverse transcription PCR, first
strand cDNA was synthesized through the use of random priming with
Moloney murine leukemia virus reverse transcriptase (GibcoBRL,
Gaithersburg, Md.). The primers used for PCR to amplify Ich-3 were
NOV2, mNOp20R, MNOF (5'-CTTCACAGTGCGAAAGAACT), and m29P2. The
primers used to amplify Ice were MICE3 (5'-GAGATGGT GAAAGAGGTG) and
MICE4 (5'-TTGTTTCTCTCCACGGCA). The PCR was performed with the
following conditions: 1.times. Taq polymerase buffer (Promega), 0.3
mM dNTPs, 2.5 mM MgCl.sub.2, 0.5 .mu.M each primer and IU of Taq
DNA polymerase (Promega) in a total volume of 25 .mu.l. DNA was
denatured at 94.degree. C. for 2 min prior to 30 cycles of
94.degree. C. for 1 min, 55.degree. C. for 2 min, 72.degree. C. for
2 min.
[0163] Northern blots were probed with Ich-3 cDNA (from the Pst I
site within the active site to the 5'-end of the cDNA). Since Ich-3
transcription is dramatically induced after LPS stimulation, the
transcription of the mutant Ich-3 can be induced by LPS (FIG. 2A)
was tested. Tissue samples were isolated from both wild type and
mutant mice before and 5 hrs after LPS injection at 40 mg/kg of
body weight intraperitoneally. As shown in FIG. 8A, even when the
Ich-3 transcript level is dramatically induced in wild type mice,
intact Ich-3 transcript in mutant mice could not be detected. Wild
type mice express a 1.4 kb Ich-3 mRNA which is highly induced upon
LPS stimulation whereas no wild type Ich-3 mRNA can be detected in
the mutant mice even after LPS stimulation (FIG. 8A). A faint band
of approximately 1.3 kb only in mutant mice in some of the tissues
tested could be seen. This may be the result of aberrant
transcription or splicing of the mutant allele.
[0164] A monoclonal antibody was generated against ICH-3 (See
Example 2). This ICH-3 antibody recognized two proteins of 43 kDa
and 38 kDa in LPS stimulated tissue. To determine if these two
proteins are encoded by the Ich-3 locus, proteins were isolated
from various tissues of wild type and Ich-3 mutant mice. Western
blots probed with this antibody showed that these two proteins are
specifically missing in Ich-3 mutant mice (FIG. 8B). Thus, the
Ich-3 locus encoded two proteins of 43 kDa and 38 kDa and the
targeted mutation in Ich-3 has eliminated expression of both
proteins.
[0165] To determine if a deficiency in Ich-3 affects the expression
of Ice, the expression of Ice by Northern blotting and RT-PCR using
MRNA isolated from wild type and Ich-3 mutant thymus and kidney was
also analyzed. A comparable amount of Ice transcript in both
wild-type and mutant mice (FIGS. 8C-8D) could be seen. Thus, the
absence of the Ich-3 gene product did not have any obvious adverse
effect on the level of Ice mRNA.
Example 8
Ich-3 Mice Develop Normally
[0166] The Ich-3 deficient mice developed normally and their growth
rate was the same as the wild type in postnatal development (not
shown). Histological analysis of kidney, thymus, heart, and lung,
in which Ich-3 expression was higher than other tissues, from 7-10
weeks old mice showed no gross abnormalities (data not shown). The
percentages of different subsets of T cells from freshly isolated
thymocytes was examined by flow cytometry. There was no significant
differences in the distribution of CD4.sup.+CD8.sup.+,
CD4.sup.+CD8.sup.-, CD4.sup.-CD8.sup.+, or CD4.sup.-CD8.sup.-
populations as compared with those of wild-type mice (data not
shown).
Example 9
Apoptosis in Ich-3 Deficient Mice
[0167] Granule serine protease (GraB) derived from cytotoxic T
lymphocytes (CTL) can induce apoptosis in the presence of the pore
forming protein perforin (Shi et al., J. Exp. Med. 176:1521-1529
(1992)). To determine the role of ICH-3 in apoptosis induced by
GraB, the ability of Ich-3-/- embryonic fibroblasts (EF) to undergo
apoptosis following treatment with GraB or Granzyme 3 (Gra3) and
perforin was examined. Embryonic fibroblasts from Ich-3-/- mice and
wild type littermate controls were treated with varying
concentrations of GraB or Gra3 in the presence of a constant amount
of perforin (50 ng/ml) for a period of 2 and 8 hrs, respectively.
More than 40% of wild type EF cells died in 0.8 .mu.g/ml of GraB or
Gra3 in the presence of 50 ng/ml of perforin, whereas only baseline
levels of apoptosis were detected in Ich-3-/- EF cells (FIG.
9).
[0168] Thus, Ich-3-/- EF cells were completely resistant to the
dose of GraB and Gra3 tested (up to 0.8 .mu.g/ml). This result
suggested that ICH-3 plays an important role in GraB mediated
apoptosis in EF cells.
[0169] Thymocytes are sensitive to several apoptotic stimuli such
as irradiation and dexamethasone (Cohen, J. J., et al., Annu. Rev.
Immunol. 10:267-293 (1992)). To determine if apoptosis of
thymocytes is affected by a mutation in the Ich-3 locus, Ich-3-/-
thymocytes were examined for defects in apoptosis using a variety
of apoptotic induction signals. Thymocytes isolated from 6-7 week
old, wild-type and Ich-3 mutant mice were treated with 500 rads of
y-irtadiation, or dexamethasone (1(IM, or 10 nM phorbol myristate
acetate (PMA) and 500 nM Ca.sup.2+ ionophore, and cell viability
was examined 10 hr or 24 hr after treatment by using FCAS analysis
after staining with propidine iodine. (Schwartz, et al., "Cell
Death--Methods in Cell Biology." vol. 46, Academic Press).
[0170] No significant difference in apoptosis between mutant and
wild type thymocytes was found under these stimuli, suggesting that
the mutant Ich-3 thymocytes die as readily as wild type thymocytes
(data not shown).
[0171] Fas antigen belongs to the TNF-.alpha. receptor superfamily.
This family is characterized by its cytoplasmic death domain which
is homologous to the Drosophila Reaper protein (Goldstein et al.,
1995). Activation of Fas by either Fas ligand or agonistic anti-Fas
antibody binding induces apoptosis (Yonehara et al., J. Exp. Med.
169:1747-1756 (1989); Suda et al., Cell 75:1169-1178 (1993)).
Fas-mediated apoptosis can be prevented by crmA, suggesting that
crm,4 inhibitable ICE/CED-3 proteases are crucial for Fas-mediated
apoptosis (Tewari & Dixit, J. Biol. Chem. 270:3255-3260 (1995);
Enari et al., Nature 375:78-81 (1995); Los et al., Nature 375:81-83
(1995)). Ich-3 induced cell death can be inhibited by crmA and
Ich-3 expression can be detected in thymus and spleen (See Example
3). Thus, it is possible that Ich-3 may play a role in Fas-mediated
apoptosis and Ich-3 mutant mice may have different sensitivity to
Fas mediated cell death. Therefore, sensitivity for anti-Fas
induced apoptosis in Ich-3 mutant thymocytes was also examined.
[0172] Anti-Fas Induced Thymocytes Apoptosis
[0173] Thymocytes were dissociated from thymus of 5-7 week old male
mice and incubated in RPMI media with 10% fetal bovine serum at a
concentration of 2.times.10.sup.6 cells/ml in 24 well tissue
culture plates. They were incubated with anti-Fas antibody (JO-2,
Phamiingen) for 20 hr with various concentrations of the antibody.
Cell viability was determined by trypan-blue dye exclusion.
[0174] Thymocytes were isolated from Ich-3 mutant as well as
wild-type mice of 5-7 weeks of age and incubated with different
concentration of anti-Fas antibody. As shown in FIG. 10, thymocytes
from Ich-3 deficient mice were partially resistant to anti-Fas
induced apoptosis. Thus, the product of Ich-3 gene may be a
downstream component of the Fas pathway.
[0175] The phenotypes oflch-3 deficient mice are similar to that of
the Ice deficient mice in many ways. The Ich-3 mutant thymocytes
are partially resistant to Fas induced apoptosis, but they die
normally when stimulated with dexamethasone, .gamma.-irradiation,
or PMA and calcium ionophore. Ich-3-/- embryonic fibroblasts are
resistant to granzyme B induced apoptosis. Mutations in the C.
elegans cell death gene ced-3 eliminates essentially all the
programmed cell death during C. elegans development (Ellis &
Horvitz, Cell 44:817-829 (1986)). In contst, both Ice and Ich-3
deficient mice are only partially defective in apoptosis induced by
Fas.
Example 10
Ich-3-Deficient Mice are Resistant to Septic Shock
[0176] Administration of LPS to mice induces production and
secretion, largely by macrophages and monocytes, of proinflammatory
cytokines which are subsequently released into the circulation
(Dinarello, C. A., et al., J. Am. Assoc. 269:1829-1835 (1993)).
Lethal endotoxic shock can be induced by intraperitoneal injection
of a high dose of LPS in mice. Wild-type mice show a series
ofresponses such as shivering, fever, lethargy, watery eyes and
ultimately death. Ice-deficient mice are resistant to a lethal dose
of endotoxin because of a dramatic reduction in release of
proinflammatory cytokines such as IL-1.alpha. and IL-1.beta. (Li et
al., Cell Death & Diff. 3:105-112(1995); Kuida et al., Science
267:2000-2003 (1995)).
[0177] Induction of Septic Shock
[0178] To examine if Ich-3 deficient mice are also resistant to
LPS, 8 week old wild-type and Ich-3-deficient mice were injected
with LPS. The mice were injected intraperitoneally with LPS from
Escherichia coli 0127:B7 (Sigma, St. Louis, Mo.) at a dose of 40
mg/kg body weight. The injected mice were monitored for signs of
endotoxemia and lethality at least twice daily. The systemic
release of cytokines after toxin challenge was determined by ELISA
kits for murine IL-.alpha. and .beta. (Genzyme, Cambridge, Mass.).
Blood was taken 5 hr after LPS injection.
[0179] Only 11% of the wild type mice survived 4 days after
receiving LPS (FIG. 11). Symptoms of endotoxic shock similar to
those observed in wild-type mice were also observed in Ich-3
deficient mice except that the Ich-3 deficient mice were less
lethargic and most of them recovered within 48 hours. Most of the
Ich-3 -deficient mice (80%) survived 4 days after LPS treatment.
Survival rate of heterozygous mice was about the half of the Ich-3
-deficient mice (44%).
[0180] To investigate whether Ich-3 mutant mice have a defect in
production of proinflammatory cytokines in vivo which may explain
why they are resistant to LPS, the plasma levels of IL-1.alpha. and
IL-1.beta. which are dramatically reduced in Ice deficient mice (Li
et al., Cell 80:401-411 (1995); Kuida et al., Science 267:2000-2003
(1995)) were tested. LPS at a dose of 40 mg/kg body weight was
administrated to Ich-3 mutant and wild-type control mice, and
plasma levels of IL-1.alpha. and IL-1.beta. were measured by ELISA
before and 5 hrs after LPS injection.
[0181] IL-1.alpha. and IL-1.beta. were undetectable in both mutant
and wild-type mice under control conditions. Plasma IL-1.beta.
levels were significantly increased in wild type mice 5 hrs after
LPS injection. Surprisingly, plasma IL-1.beta. levels in Ich-3
mutant were undetectable 5 hrs after LPS injection (Table 3),
suggesting that Ich-3 has a regulatory role in mature IL-1.beta.
production in vivo. Plasma levels of IL-1.alpha. were also
significantly lower in Ice-deficient mice than wild type mice after
LPS stimulation (Li et al., Cell 80:401-411 (1995); Kuida et al.,
Science 267:2000-2003 (1995)), suggesting that IL-1.beta. may have
a role in regulating IL-1.alpha. production and secretion.
[0182] Thus, Ich-3 mutant mice were further examined to determine
if they had a defect in IL-1.alpha. production. Plasma of Ich-3
mutant and wild-type control mice were assayed for IL-1.alpha.
levels 5 hrs after LPS injection by ELISA. These experiments showed
that, like Ice -deficient mice, Ich-3deficient mice also have
severely reduced plasma level of IL-1.alpha. after LPS stimulation
(Table 3), which is consistent with the hypothesis that IL-1.beta.
may have a role in regulating IL-1.alpha. levels in vivo.
3TABLE 3 Plasma Cytokine Levels in Endotoxic Shock. Cytokine
Concentration (pg/ml) Cytokine Stimulus Ich-3 +/+ Ich-3 -/-
IL-1.alpha. LPS 850 .+-. 150 40 .+-. 24 IL-1.beta. None 0* 0* LPS
195 .+-. 60 0* Ich-3 mutant (-/-) and wild type (+/+) mice were
bled from the retro-orbital plexus 4 hr after LPS stimulation. The
plasma was used for ELISA. The data are mean .+-. SEM. of at least
three individual mice. *lower than detection level.
[0183] An ICE Pathway
[0184] The critical role of IL-1 in sepsis has been highlighted by
the ke-deficient mice which are defective in secretion of both
IL-1.alpha. and IL-1.beta. and are resistant to LPS challenge (Li
et al., Cell 80:401411 (1995); Kuida et al., Science 267:2000-2003
(1995)). IL-1.beta. is an important mediator of chronic and acute
inflammatory diseases (Dinarello, C. A., Blood 77:1627-1652
(1991)). Although IL-1.beta. is a part of primary host defense to
infections, over-stimulation of the system results in excessive or
continued production of IL-1 which leads to debilitation of normal
host functions with disastrous consequences. Reduction of IL-1
production and secretion is a target of therapy for many diseases.
Pro-IL-1.beta. does not contain a signal peptide and mature
IL-1.beta. is not usually detected inside the cell, suggesting that
processing occurs concurrent with release (Hazuda, D. J., et al.,
J. Biol. Chem. 266:7081-7086 (1991)). Thus, understanding the
regulation of pro-IL-1.beta. processing may be critical for design
of drugs which may inhibit so the release of mature IL-1.beta..
Since the results from the Ice-deficient mice indicated that ICE is
responsible for processing at least 90% of mature IL-1.beta. (Li et
al., Cell Death & Diff. 3:105-112 (1995); Kuida et al., Science
267:2000-2003 (1995)), it is a surprising that Ich-3-deficient mice
are also resistant to LPS and also have defects in processing
pro-IL-1.beta..
[0185] There are three possible hypotheses which may explain why
Ich-3-deficient mice are also defective in processing pro-IL-1 in
vivo. The first hypothesis is that Ich-3 controls or processes
IL-1.beta. in cells other than macrophages and monocytes. This
would explain why Ich-3-deficient macrophages and monocytes process
pro-IL-1.beta. at the same level as that observed in the
corresponding wild type cells in vitro; however, this hypothesis
cannot explain why Ich-3 deficient mice are defective in processing
IL-1.beta. in vivo when stimulated with LPS since monocytes and
macrophages are the major producers of IL-1.beta. in vivo
(Dinarello, C. A., et al., J. Am. Assoc. 269:1829-1835 (1993)).
[0186] The second hypothesis is that ICH-3 protein may form a
complex with ICE which is essential for ICE to process IL-1.beta..
This would explain why Ich-3-deficient mice are defective in
processing IL-1.beta. in vivo when stimulated with LPS. This
hypothesis, however, is inconsistent with several in vitro studies.
First, it does not explain why Ich-3-deficient macrophages and
monocytes can process and secrete IL-1.beta. in vitro when
stimulated with LPS and ATP or LPS alone. Second, ICE alone is
sufficient for the processing IL-1.beta. in vitro (Thornberry, N.
A., et al., Nature 356:768-774 (1992)). Thus, the preferable
hypothesis is that ICH-3 is an upstream regulator of ICE activity
in vivo. It can therefore be hypothesized that in wild-type mice,
LPS challenge leads to the activation of ICH-3 expression and
proteolytic activity which in turn may indirectly activate ICE
either by activating another member of the ICE family or by
inactivating an inhibitor of ICE. This hypothesis, however, is
consistent with in vitro studies which found that expression of
Ich-3 does not result in processing of pro-IL1.beta. in COS cells
but potentiates processing of pro-IL1.beta. when cotransfected with
an Ice expression construct.
[0187] This sequential pathway can be bypassed in vitro, where much
stronger signals can be delivered than what would be possible in
vivo under physiological conditions. It is predicted that in vivo,
this sequential pathway is arranged in such a way so that the
ICE/CED-3 members in the beginning of this pathway are more easily
activated. When a physiological stimulus is delivered, the
ICE/CED-3 family member in the beginning of the pathway is
activated, which in turn activates the next ICE/CED-3 family member
in line and so on. An in vivo signal would activate ICH-3 first
which then indirectly activates ICE. In vitro, however, more than
one member of the ICEICED-3 family can be activated simultaneously
by a strong signal and activation of any of these proteases may be
sufficient by itself to cause cell death. Consistent with this
hypothesis, although Ich-3-deficient mice have defects in
production of mature IL-1 in vivo after LPS stimulation,
Ich-3-deficient macrophages can process and secrete IL-1.beta.
normally when stimulated with LPS and ATT. These results suggest
that although ICE is under the control of ICH-3 in vivo, the
requirement can be bypassed in vitro when stimulated with a
stronger signal. This hypothesis may also explain why macrophages
that are defective for either Ice or Ich-3 can still undergo
apoptosis when stimulated with ATP because multiple proteases may
be activated directly by ATP bypassing the requirement for ICE or
ICH-3. This hypothesis is also consistent with the fact that in
vitro, high doses of ICE inhibitors are required to inhibit
apoptosis because multiple proteases with different specificities
may be activated by a single strong inducer of apoptosis.
[0188] In general, the control of apoptosis in mammals appears to
be very complex and delicate. First, different apoptotic signals
may activate different effectors. While Ich-3 and Ice mutant
thymocytes are partially resistant to Fas induced apoptosis, they
are not resistant to 500 Rads of .gamma.-irradiation, dexamethasone
(1 .mu.M), or 10 nM PMA and 500 nM Ca.sup.2+ ionophore. Thus, Fas
may activate the ICE pathway more specifically than some of the
other signals. Secondly, even the same signal at different doses
may activate different components of the ICE pathway. For example,
LPS is incapable of inducing IL-1.beta. secretion in Ich-3 mutant
mice and thus, cannot activate ICE in vivo; however, LPS in high
dose can induce IL-1.beta. secretion in vitro and thus, can
activate ICE directly in vitro even in the absence of ICH-3.
Therefore, such complexity requires caution when interpreting in
vitro data on apoptosis in mice relative to mutations in the ICE
family.
[0189] Inflammation and Apoptosis
[0190] Consistent with its proinflammatory role, Ich-3
transcription is highly inducible after LPS stimulation. When wild
type mice are challenged with a high dose of LPS, the Ich-3
transcript levels increase dramatically in spleen, thymus, heart,
liver and lung where Ich-3 expression is very low in all of these
tissues under normal condition (See Example 2). In contrast, Ice
transcript levels are increased only in thymus after LPS
stimulation. These characteristics of Ich-3 action are consistent
with its regulatory role in other ICE/CED-3 family members.
Homozygous Ich-3 mutant mice are highly resistant to the lethality
of LPS whereas an approximately 50% survival rate is observed in
heterozygous mice, suggesting that Ich-3 confers a gene
dose-sensitive resistance to LPS.
[0191] Ich-3 mutant mice are resistant to septic shock induced by
LPS, suggesting that Ich-3 plays an important role in inflammation.
Ich-3 mutant mice are normal, however, in clearing pseudomonas
bacterial infection (unpublished results), suggesting that Ich-3
and, hence IL-1 as well are not essential for inflammatory response
inthis case. IL-1.beta. is undetectable in normal healthy
individuals or animals.
[0192] There is a dramatic induction of IL1 production by a variety
of cells in response to infection, microbial toxins, inflammatory
agents, and complement and clotting components (Dinarello, C. A.,
Blood 77:1627-1652 (1991)). IL1 has been postulated to be part of
the body's primary defense responses to invasions (Dinarello, C.
A., Blood 77:1627-1652 (1991)). Both Ice (Li et al., Cell 80:401411
(1995)) and Ich-3 mutant mice, however, are apparently not any more
prone to infections than wild type mice, at least in controlled
animal facilities.
[0193] Ich-3 mutant mice also clear pseudomonas infection normally,
although both mutants are highly resistant to LPS induced
lethality. In addition, the initial symptoms of sepsis, such as
fever, lethargy and watery eyes, which may be induced by other
cytokines such as TNF-.alpha., are present in Ich-3 mutant mice
after LPS injection, suggesting that these mice are indeed in
septic shock. Absence of Ich-3 selectively reduces the mortality of
sepsis. These results suggest that a super-induction of IL-1.beta.
together with IL-1.alpha. may be necessary and sufficient for
mortality of sepsis. Since without Ich-3 and with significantly
reduced levels of IL-1, these mice can clear a septic dose of
pseudomonas (unpublished observation), Ich-3 and thus, IL-1.beta.
appear to be dispensable for fighting bacterial infection.
[0194] Although without a systematic study of cell numbers in these
organs in the mutants, it cannot be ruled out that Ich-3-deficient
mice have defects in developmental and homeostatic cell death and
therefore, have excess cells in these organs, it is suggested that
a major function of Ich-3 is not in development or homeostasis but
rather in host defense responses under severe stress or viral
infection conditions. These findings suggest that inhibitors to
ICH-3 may be able to significantly reduce mortality of sepsis
without compromise to host defense mechanisms. Furthermore, such
inhibitors may also be useful in treating other inflammatory
diseases in which IL-1.beta. plays a significant role such as
rheumatoid arthritis (Li et al., Cell 80:404-411, 1995).
[0195] Since ICE shares sequence homology with the C. elegans
programmed cell death gene ced-3 product, it is interesting to
speculate that perhaps inflammatory responses are evolved from
primitive mechanism of programmed cell death. Although the most
recognized role of IL-1.beta. has been in inflammation, there is
indication that IL-1.beta. may play an active role in promoting
apoptosis as well. Inhibition of IL-1.beta. by a naturally existing
antagonist, IL-1Ra, or by a neutralizng antibody to IL-1.beta. or
IL-1.beta. receptor, can reduce cell death in a number of systems
and conditions (Friedlander, R. M., et al., J. Exp. Med. 184:August
1996, In Press). It is speculated that perhaps the lethality of
sepsis may be partly due to the ability of IL-1.beta. to induce
apoptosis which may contribute to organ failure, a major cause of
death in sepsis. Results presented here suggest that there may be
not only evolutionary links but also mechanistic connections
between apoptosis and inflammation.
Example 11
IL1 Production in Cultured Ich-3 Mutant Macrophages and
Monocytes
[0196] The phenotypes of Ich-3-deficient mice as described to this
point are very similar to that of Ice-deficient mice except that
unlike Ice-3-deficient mice, the transcription of Ice is at
wild-type levels in the Ich-3 mutant. Thus, it was determined
whether Ich-3-1-125 mice have normal ICE function. Since mice with
a mutation in the Ice locus are severely defective in processing
pro-IL-1.beta. ((Li et al., Cell 80:401-411 (1995); Kuida et al.,
Science 267:2000-2003 (1995)), the ability to process
pro-IL-1.beta. is a specific indication of ICE function.
[0197] Thioglycollate-elicited peritoneal macrophages (PECs) can be
stimulated with LPS to induce the expression of pro-IL1.beta. and
with ATP to induce apoptosis which causes the release of mature
IL-1.beta. (Hogquist et al., 1991). Monocytes can be stimulated by
LPS to induce the expression and secretion of IL-1.beta. (Perregaux
& Gabel, J. Biol. Chem. 269:15195-15203 (1994)). Both Ice-/-
macrophages and Ice-/- monocytes are defective in processing
pro-IL-1.beta. in vitro (Li et al., Cell 80:401-411 (1995); Kuida
et al., Science 267:2000-2003 (1995)). Macrophages and monocytes
are major producers of IL-1 in vivo (Dinarello, C. A., Blood
77:1627-1652 (1991)). These results suggest that ICE is responsible
for processing 90% or more of mature IL-1.beta. in vivo. Thus, if
Ich-3 mutant cells can produce normal levels of IL-1.beta. in
vitro, it will be strong evidence that normal ICE function is
present in Ich-3 mutant mice.
[0198] To examine if Ich-3 is expressed in macrophage and
monocytes, the expression of Ice and Ich-3 in wild type PECs and
splenocytes by Northern blot (FIG. 12A) was investigated.
[0199] In Vitro Assays of IL-1 Releasefrom Monocytes and
Macrophages
[0200] Peritoneal macrophages were prelabeled by incubating in
[3.sup.5S]-methionine (120 .mu.Ci/ml) for 20 hr, and thereafter
incubated in LPS (1 .mu.g/ml) for an additional 4 hrs. The cells
were then treated with ATP (5 mM) for 30 min, then washed and
chased in fresh media for 20 hr. The media samples (500 .mu.l) were
collected, and two volumes of RIPA buffer (150 mM NaCl, 1.0% NP-40,
0.5% DOC, 0.1% SDS, 50 mM Tris-HCl pH8.0) containing protein A (50
.mu.l) and 5 .mu.g of anti-murine IL-1.alpha. and IL-1.beta. (kind
gift of Dr. D. Chaplin) were added. Samples were incubated
overnight at 4.degree. C. with gentle rotation and then washed four
times with RIPA and two times with TBS (150 mM MaCl, 25 mM Tris-HCl
pH7.5). Samples were then analyzed on 15% SDS-polyacrylamide
gels.
[0201] Spleen cells were dissociated and the cells attached to
tissue culture dishes within two hours were used as monocytes.
Monocytes were treated with LPS (1 .mu.g/ml) with or without
nigericin (10 .mu.M) for 20 hr. For ELISA, supernatant of
LPS-treated monocytes was assayed for mature IL-1.beta. using a kit
from Genzyme (Cambridge, Mass.).
[0202] Similar amounts of Ice and Ich-3 transcripts in both PECs
and splenocytes were seen. To examine if Ich-3-/- macrophages and
monocytes can process pro-IL-1.beta. in culture, PECs from both
wild type and Ich-3 mutant mice were isolated. Isolated macrophages
labeled with [.sup.35S] methionine were stimulated with LPS to
induce expression of pro-IL-1.beta. and then treated with ATP to
induce apoptosis. There was no difference in apoptosis of
macrophages stimulated with ATP in both wild type and Ich-3 mutants
(data not shown), which is similar to the Ice mutant mice (Li et
al., Cell Death & Diff. 3:105-112 (1995)). The release of
mature IL-1.beta. in the culture medium after induction of
apoptosis by ATP was examined by immunoprecipitation using
antibodies specific to IL-1.alpha. or IL-1.beta.. The stimulated
macrophages from Ich-3 deficient mice released mature IL-1.alpha.
and IL-1.beta. at the same level as that of wild type macrophages
(FIG. 12B).
[0203] It was also determined whether Ich-3 mutant monocytes could
be stimulated to produce mature IL-1.beta. in vitro. Monocytes were
isolated from spleens of both wild type and Ich-3 mutant mice and
cultured in the presence of a high dose of LPS or LPS plus
nigericin. Secretion of mature IL-1.beta. by monocytes into tissue
culture media after LPS or LPS and nigericin stimulation was
examined by ELISA. Nigericin is a K.sup.+-H.sup.+ ionophore that
can activate a plasma membrane adenosine triphosphatase (ATPase)
and enhances release of mature IL-1.beta. (Perregaux & Gabel,
J. Biol. Chem. 269:15195-15203 (1994)). As shown in Table 4, the
ability of Ich-3-/- monocytes to secrete mature IL-1.beta. was
similar to that of wild type. Thus, wild type and Ich-3 mutant
monocytes demonstrated no difference in their ability to secrete
mature IL-1.beta. in vitro when stimulated with LPS. These results
show that IL-1.beta. release in culture was not reduced by the loss
of Ich-3 function, and thus Ich-3 mutant monocytes and macrophages
have normal IL-1.beta. converting enzyme activity.
4TABLE 4 Secretion of mature IL-1.beta. by monocytes. IL-1.beta.
Concentration (pg/ml) Stimulus Ich-3 +/+ Ich-3 -/- None 0 0 LPS (1
.mu.g/ml) 188 .+-. 57 183 .+-. 35 LPS (1 .mu.g/ml) + nigericin (10
.mu.M) 460 .+-. 87 580 .+-. 190 Monocytes isolated from Ich-3
mutant (-/-) and wild type (+/+) mice were treated either with LPS
(1 .mu.g/ml) or LPS (1 .mu.g/ml) + nigericin (10 .mu.M) for 20 hrs.
The supernatant was used for ELISA. The data are mean .+-. SEM. of
monocytes from three individual mice for each genotype.
Example 12
Reduced Germ Cell Endowment and Delayed Follicle Activation in
Ich-3Mutant Female Mice
[0204] Expression of Ich-3 in the ovary was detectable by Northern
blot analysis (data not shown). Although Ich-3-/- female mice were
fertile and had normal litter sizes, in depth morphometric and
histological evaluations of the ovaries revealed three striking
phenotypes.
[0205] Histological and Morphometric Examination of Mouse Ovary
[0206] Ovaries were isolated from wild-type or Ich-3 mutant female
mice at either 4 days or 6-7 weeks of age postpartum, fixed in
neutral-buffered 4% paraformaldehyde, and embedded in paffim for
morphometric and histological evaluations. For all tissues, serial
sections (7 .mu.m) were mounted on glass slides, stained with
Weigert's hematoxylin pycric acid methyl blue dye, and visualized
by light microscopy. The numbers of oocyte-contaming primordial,
primary and small preantral follicles were estimated using the
fractionator and nucleator principles for stereological analysis as
described previously described in the art (Gundersen et al., 1988;
Ratts et al., 1995). Differences in follicle numbers were analyzed
by a one-way analysis of variance followed by Scheffe's test, with
significance assigned at P<0.05.
[0207] At postpartum day 4 of age, estimates of the numbers of
oocyte-containing follicles at the primordial, primary and small
preantral stages of development demonstrated significantly less
oocyte-containing primordial follicles (FIG. 13A). The
oocyte-containing follicles represent the stockpile of germ cells
available for ovulation throughout reproductive life, in Ich-3
mutant mice. The reduced endowment of primordial follicles in
female Ich-3 mutant mice may be the result of the subsequent
degeneration of oocytes in follicles formed during the perinatal
period, as remnants of primordial follicle-like structures
containing a single layer of fusiform granulosa cells without an
oocyte were scattered throughout the ovaries of Ich-3 mutant mice
(FIG. 12B). Some of the follicle-like structures contained multiple
oocyte-like cells instead of one oocyte as found in wild type
primordial follicles (FIG. 12B).
[0208] The abnormal structures were never observed in ovaries of
wild-type mice (FIG. 12C). Furthermore, not one actively growing
immature follicle (either primary or small preantral) could be
detected in serial sections of ovaries collected from mice lacling
functional Ich-3 (FIG. 12A, insert), indicative of an early defect
in the timing of activation and recruitment of quiescent follicles
into the growing pool. In contrast to the clear differences in the
ovaries of mutant versus wild-type mice early in life, a similar
series of morphometric and histological evaluations conducted at
6-7 weeks of age postpartum revealed no discernible differences in
follicle numbers or ovarian histology (data not shown).
[0209] The Role of ICH-3 in Female Germ Cell Endowment and Ovarian
Follicular Dynamics
[0210] The progeny ratio of homozygous Ich-3 mutants to wild-type
offspring from heterozygous female and male breedings deviates
slightly from the expected Mendelian ratio (30% Ich-3 mutant and
23% wild type vs. expected 25% mutant and 25% wild-type). This
finding prompted investigation into the development of the ovary in
Ich-3 mutant mice. Initial histological and morphometric
examination of ovaries collected from adult mice at 6-7 weeks of
age did not reveal any discernible differences in the Ich-3 mutant
and wild-type mice.
[0211] Further examination of neonatal ovaries, however, revealed
striking phenotypic abnormalities in Ich-3 mutant mice. At
postpartum day 4, not one actively growing follicle primary or
small preantral) was observed in six mutant ovaries analyzed. In
contrast to this, on average there were 600 primary follicles and
100 small preantral follicles per ovary of wild-type littermates.
Thus, activation of early follicle growth, as measured by
transition of a quiescent primordial follicle to an actively
growing stage, is significantly delayed in Ich-3 mutant mice.
[0212] It is interesting to draw a comparison with the nematode C.
elegans. In C. elegans, ced-3 mutants develop normally despite of
20% excess cells (Ellis & Horvitz, Cell 44:817-829 (1986)).
However, one of the most significant defects of ced-3 mutant is a
30% delay in onset of egg-laying (unpublished observation). It
takes about 2.5 days for a wild type C. elegans to reach egg-laying
stage whereas it takes about 3.5 days for a ced-3 mutant to lay
eggs. This defect is fully suppressible by a ced-3 transgene,
indicating that this defect is due to a mutation in ced-3 rather
than a linked mutation. Moreover, this defect is not caused by
problems with the neuronal control of egg-laying system since ced-3
mutants do not exhibit Egl (egg-laying) defect (Ellis &
Horvitz, Cell 44:817-829 (1986)). It is therefore possible that
ced-3 and programmed cell death plays a significant role in the
timing of normal egg growth and maturation in C. elegans, analogous
to the apparent requirement for ICH-3 in early follicle growth
activation in the mouse.
[0213] Endowment of a normal complement of primordial follicles,
the source of the eggs for ovulation throughout life, in the
neonatal Ich-3 mutant mouse ovary is also severely affected: at
postpartum day 4, wild type female mice have approximately 20,000
oocyte-containing primordial follicles whereas Ich-3 mutant
littermates have only 7,000. Cell death plays a predominant role in
the establishment and subsequent depletion of the female gonadal
germ cell pool in mammalian and avian species (Tilly, J. L.,
Frontiers Biosci. 1:d1-10 (1996)). Of the estimated two million
germ cells present in the embryonic human ovary, only 300-350 of
these oocytes are released from the ovary through ovulation for
potential fertilization. The remaining, and overwhelming majority,
of female germ cells are naturally lost directly through attrition
during the perinatal period or as a consequence of somatic cell
death and follicular atresia during pre- and postpubertal life.
Although the regulation of cellular depletion from the ovary
remains to be fully elucidated, recent studies have provided
evidence that members of the Ice/ced-3 gene family may in fact be
involved in ovarian cell death (Flaws, J. A., Edocri. 136:5042-5053
(1995)).
[0214] In summary, it was found that postpartum day 4 Ich-3 mutant
female mice have significantly less primordial follicles in the
starting "stockpile", suggesting that these mice: 1) began with a
smaller embryonic pool of germ cells to undergo elonal expansion in
the developing ovary; or 2) display a defect in clonal expansion of
the germ cell pool in the fetal ovary; or 3) exhibit greater losses
of oogonia and oocytes during the perinatal waves of attrition. If
the latter possibility is true, Ich-3 would play a role opposite of
that expected since this gene is a member of the CED-3/ICE family
of death-inducing proteases, yet its ablation yields a reduced
oocyte survival rate.
[0215] Interestingly, by 6-7 weeks of age, differences in numbers
of follicles at the primordial, primary or small preantral stage of
development in adult Ich-3 mutant versus wild-type female mice were
not observed. Since the Ich-3 mutants start off with only one-third
the number of primordial follicles per ovary as compared with their
wild-type littermates, these findings further support the role of
ICH-3 in the timing of early follicle activation and recruitment.
For instance, wild-type females, from the time of birth until
reproductive senescence, almost continuously "activate" primordial
follicles to become a part of the growing follicle pool which will
serve as a potential source of the egg for ovulation. The rates of
follicle recruitment are such that a delay in only one week in the
timing of follicle activation (such as that potentially occurring
in Ich-3 mutants) would be sufficient for the wild-type mice to
"deplete" their primordial pool to levels observed in the
Ich-3-deficient females. Consequently, these findings suggest that
although the time in life at which complete follicular exhaustion
occurs (reproductive senescence, the menopause in humans) would not
be affected by the absence of Ich-3, the timing of puberty may be
delayed due to an initially reduced pool of actively growing
follicles in Ich-3 mutant ovaries.
[0216] In addition to the reduced endowment of primordial follicles
in the Ich-3 mutants, neonatal ovaries collected from these mice
also appear grossly abnormal in morphology. Reminiscent of the
ovarian morphology of Bcl-2-deficient mice (Ratts, V. S., et al.,
Endocrinology 136:3665-3668 (1995)). In contrast to the wild-type
ovaries, many primordial follicle-like structures containing a
single layer of fusiform granulosa cells surrounding an empty space
(presumably where an oocyte once existed), or a complex of multiple
oocyte4ike cells instead of the normal single oocyte were observed.
The empty follicle-like structures suggest that the oocytes
previously occupying these spaces have degenerated, which may
partially account for the reduced numbers of endowed follicles in
the mutants. However, the presence of follicles containing multiple
oocyte-like cells in a large complex suggests another possibility:
Ich-3 mutants exhibit a defect in early folliculogenesis such that
steps leading to the proper formation of a follicle are disrupted
and hence granulosa cells surround either too many oocytes, or
conversely no oocyte at all. In any case, these findings
collectively indicate that Ich-3 is very important for
establishment of the female gonadal germ cell pool, early
folliculogenesis, and activation of quiescent primordial follicles
for recruitment into the growing pool of follicles required for
ovulation.
[0217] Summary of Results Concerning the Ich-3 Mutant Mouse
[0218] Observations are presented describing the inactivation by
gene-targeting, of a new member of the Ice/ced-3 family of cell
death genes, Ich-3. Thymocytes from Ich-3 deficient mice are
partially resistant to apoptosis induced by Fas antibody. Ich-3-/-
embryonic fibroblasts are resistant to granzyme B induced
apoptosis. Neonatal Ich-3-/- female mice show delayed follicle
activation, a reduced endowment of primordial oocytes and abnormal
follicles. Like Ice deficient mice, Ich-3 mutant mice are resistant
to endotoxic shock induced by lipopolysaccharide (LPS). Production
of both IL-1.alpha. and IL-1.beta., a crucial event during septic
shock, is severely reduced in Ich-3 mutant mice after LPS
stimulation. In contrast to Ice deficient mice, whose macrophages
and monocytes cannot process pro-IL-1.beta. in culture after
stimulation with LPS and ATP or LPS alone, Ich-3 mutant monocytes
and macrophages process and secrete mature IL-1.beta. normally
under these conditions.
[0219] Similar to Ice, overexpression of Ich-3 induces apoptosis in
Rat-1 fibroblasts and Ich-3-induced cell death could be prevented
by bcl-2 and crmA. Differing from Ice, however, expression of Ich-3
is highly inducible by LPS, suggesting that Ich-3 may have a
regulatory role in both apoptosis and inflammatory responses. ICH-3
does not process proIL-1.beta. directly but overexpression of Ich-3
does stimulate processing of pro-IL-1.beta. by ICE. Stimulation of
wild type mice by LPS dramatically induces the production and
secretion of mature IL-1.beta.. This response is absent in mice
that are deficient for Ice suggesting that ICE is responsible for
processing at least 90% of IL-1.beta. (Li et al., Cell Death &
Diff. 3:105-112 (1995); Kuida et al., Science 267:2000-2003
(1995)). Interestingly, it was found that, although ICH-3 does not
process pro-IL-1.beta. directly, Ich-3 deficient mice are also
resistant to lethal dose of LPS which can be attributed to a lack
of IL-1 production. An important difference between Ich-3 and Ice
deficient mice is that Ich-3 deficient macrophages and monocytes
can process pro-IL-1.beta. normally in to vitro when stimulated
with LPS and ATP or LPS alone. These results suggest that Ich-3
encodes an upstream regulator of ICE.
Example 13
Reduction of Mortality Due to Endotoxin (Bacterial
Lipopolysaccharide) in Normal Animals
[0220] Control non-mutant mice are treated with a compound that
inhibits ICH-3 prior to induction or during shock due to LPS. These
compounds may be chosen from the group including but limited to,
peptide inhibitors such as YVAD-cmk, Ac-DEVD-CHO, cysteine protease
inhibitors or serine protease inhibitors such as
trans-epoxysuccininyl-L-leucylamido-(4-guanid- ino) butane (E64)
and leupeptin, calpain inhibitors I and II.
[0221] The treated mice and non-treated control mice are injected
intraperitoneally with LPS from Escherichia coli 0127:B7 (Sigma, St
Louis, Mo.) at a dose of 40 mg/kg body weight. The injected mice
are monitored for signs of endotoxemia and lethality at least twice
daily. The systemic release of cytokines after toxin challenge is
determined by ELISA kits for murine IL1-.alpha. and IL1-.beta.
(Genyyme, Cambridge, Mass.). Blood samples are taken 1-8 hrs after
LPS injection.
[0222] This treatment should be applicable to any medical condition
in which pathways induced by endotoxemia, including ICH-3 and
apoptosis are involved.
Example 14
Screening of Compounds that Affect Septic Shock using Ich-3 Mutant
Mice
[0223] The Ich-3 mutant mice exhibit resistance to endotoxic shock
following injection of LPS. This is related to the lack of
expression of ICH-3. Using the Ich-3 mouse to screen compounds
allows the pre-clinical determination of combinations of compounds
which would be be beneficial in treating sepsis in normal
individuals, i.e. if one can eliminate the effects of ICH-3 with a
drug (i.e. thereby simulating the knock-out mouse), a second drug
may potentiate the resistance to sepsis. Alternatively, if a drug
decreases the resistance to septic shock, its use may be
contra-indicated for therapy. Additionally, the mutant mice may be
used for screening compounds for treating infection, the sequelae
of thermal injury, major trauma, or combinations thereof, by
correlating the effect of the compound in question on protecting
the animal from the sequelae of sepsis or septic shock.
[0224] Compounds to be screened for activity can be administered to
the Ich-3 mutant mice using pharmaceutically acceptable methods.
See Remington's Pharmaceutical Sciences (1990). Shock is induced as
in Example 12 or by any means known to those of skill in the art.
Alternatively, other injuries such as thermal injury (see Example
16) may be induced. For example, the compound to be screened can be
administered at various concentrations by parenteral injection,
infusion, ingestion, and other suitable methods in admixture with a
pharmaceutically acceptable carrier. The effect of various
concentrations of the screened compound on increasing or decreasing
the resistance to sepsis is measured relative to control Ich-3
mutant animals that have not been administered the compound to
wild-type animals.
[0225] A significant increase in resistance to septic shock of the
Ich-3 mutant mice by a screened compound is indicative that the
compound would exhibit beneficial effects in the treatment of
sepsis, either alone or in combination with a compound that
inhibits ICH-3.
[0226] Particularly preferred compounds for screening are compounds
known to inhibit activities of ICH-3 and ICE in vitro or any other
candidate for treating sepsis or septic shock.
Example 15
Screening of Compounds for Affect on Follicle Activation Using
Ich-3 Mutant Mice
[0227] The female neonatal Ich-3 mutant mouse exhibits
significantly fewer primordial follicles as well as other defects
related to folliculogensis. Compounds to be screened for
folliculogenic activity can be administered to the Ich-3 mutant
mice in a pharmaceutically acceptable excipient For example, the
compound can be administered at various concentrations to mice as
an ointment or salve. Alternatively, other pharmaceutically
acceptable modes of administration can be used. For example, a
pharmaceutical composition comprising the compound can be
administered by parenteral injection, infusion, ingestion,
skin-patch application, and other suitable methods. The effect of
the compound is measured relative to control Ich-3 mutant animals
that have not been administered the compound.
[0228] A significant enhancement of folliculogenesis in mutant mice
by a screened compound would indicate that this compound exhibits
beneficial effects.
[0229] Particularly preferred compounds for screening are compounds
known to inhibit activities of ICH-3 and ICE in vitro.
Example 16
Resistance of Ich-3 Mutant Mice to The Effect of Burns, Bacterial
Infection and Sepsis
[0230] A quantifiable bum and sepsis animal model was established
in a variety of mouse strains, B10, C3H, AKR, BALB/c and C57B16
using a clinical isolate of Pseudomonas aeruginosa administered
intravenously and intratracheally in varying dosages in the
presence and absence of a 10% body surface area (BSA) third degree
burn. In this model, viable bacteria were administered
intraperitoneally (up to 106) in the presence or absence of a 10%
BSA burn to the shaved back of anaesthetized mice using a heated
brass probe. Burned animals received saline resuscitation (3-5 ml.)
while recovering from anesthesia The time course of infection was
followed. At various timepoints following infection, tissues
(blood, lungs, liver, spleen) were harvested and immediately ground
and plated on blood agar media for quantitative cultures, fixed for
histology, frozen for cytokine mRNA assays and myeloperoxidase
assays (a quantitative measure of infiltrating neutrophils).
[0231] Initial studies focused on the 72 hours following infection
based on the observation that survival and bacterial clearance are
completed in mice by three days following exposure. In control
wild-type mice, bacteria rapidly entered the bloodstream by one
hour following ip injection. This bacteremia was cleared by 24
hours. In the burned wild type mice, the same time course of
infection was observed with three exceptions:
[0232] 1) While the Pseudomonas bacteremia was cleared, bacteremia
due to organisms endogenous to the gastrointestinal tract was
observed in the blood for up to 8 hours following thermal injury.
These organisms were also found in the liver and lungs at periods
up to 25 hours following thermal injury and after clearance of the
bloodstream. Organisms isolated included Proteus spp, micrococci,
enterococci, and anaerobic gram positive rods. These organisms were
present in both lung and liver at 4 hours (75% of all animals in
the lung, 100% in the liver), 7 hours (75% lung, 75% liver), and 25
hours (50% liver, 0% lung) following burns. The same pattern of
bacteremia due to non-Pseudomonal organisms is observed if
Pseudomonas is introduced via the airway (intratracheally up to 105
bacteria).
[0233] 2) Cultures taken aseptically from the subcutaneous area
underneath the burned skin demonstrated no infection with
Pseudomonas introduced either ip or intratracheally (it) but
{fraction (10/12)} of these sites were infected with the same
endogenous organisms found systemically.
[0234] 3) Pseudomonas introduced intratracheally was cleared from
the lungs more rapidly (i.e., fewer organisms cultured at 2, 4 and
6 hrs) in the burned animals than in the control for the first 7
hours following the burn. However, infection persists at 24 hours
only in burned animals (50%). Further, when the number of
Pseudomonas organisms introduced intratracheally is increased
(500,000 per animal), the number of organisms per gram of lung
tissue (wet weight) was increased almost 3.7 fold in burned animals
(mean 108,158 colonies per gram in burned animals (sd 13,711) vs
mean 29,286 (sd 14,798) p<0.01). Thus, this model is capable of
demonstrating both delayed clearance of exogenous (e.g.,
nosocomial) infection and significant levels of endogenous (i.e.,
gastrointestinal translocation) infection following a 10% BSA
thermal injury.
[0235] Bacterial translocation from the gut following burns has
been described extensively and is related to activation of
cytokines, prostaglandins, neutrophils, with microvascular
permeability and edema A number of studies have demonstrated that
thermal injury causes activation of neutrophils and transient
sequestration of neutrophils in the lungs (and other tissues)
largely in the vascular tree.
[0236] The suggestion that ICH-3 was involved in the systemic
response to injury was based on the initial observations that the
ICH-3 knockout mouse was resistant to LPS (See Example 10). This
was investigated in more detail.
[0237] When 10 mg of E. coli LPS was injected intraperitoneally
into 10 Ich-3 mutant mice and 10 genetically identical wild-type
mice, all of the wild-type animals died within 24 hours while all
of the Ich-3 mutant mice survived. It was assumed that the defect
was somehow protective against the LPS injury. However, when the
degree of inflammation was scored, the Ich-3 mutant mice had
greater levels of pulmonary neutrophilic infiltration than did wild
type mice despite resistance to LPS. There was, however, a marked
reduction in the level of anatomic lung injury in the knockout mice
(by a score of 2.7 to 0.8 on a scale of 0-4 for edema, hemorrhage,
alveolar proteinosis).
[0238] The Ich-3 mutant mice lacked serum IL-1.beta. in response to
LPS as measured by ELISA assay, while normal animals had high
levels of IL-1.beta.. However, it was already known based on the
reports of three laboratories (L. Shornick, M. Tocci, and Immunex,
in the Newsletter of the International Cytokine Society, 1994, p.
5) that the IL-1.beta. knockout was completely normal in response
to LPS and to injection. Thus, the defect in these animals may not
only be that of isolated IL-1.beta. deficiency but there may be
additional components which also limit susceptibility to
LPS-induced lung injury.
[0239] The Ich-3 mutant mice were further studied in groups of
15-20 tail-blot-confirmed ICH-3 knockouts, heterozygotes, and wild
types each (depending on the litter size) in the presence and
absence of Pseudomonas infection and burn injuries. The clearance
of bacteria from the bloodstream was equivalent in wild type and
Ich-3 mutant animals. The circulating white blood cell counts were
slightly higher in the knockouts than those seen in wild-type
animals with normal differential counts.
[0240] The histology of the lungs and livers from burned Ich-3
mutant mice and burned wild-type control animals was similar to
that of the LPS injected mice: a greater intensity of neutrophilic
infiltrate in the knockout mice with a marked reduction in edema
and hemorrhage and greater adhesion of neutrophils to the vascular
endothelium in the mutant mice. Burned skin in mutant mice also
showed a much greater depth of neutrophil infiltration (from the
dermis through the subcutaneous fat) than did wild-type animals
which showed virtually no neutrophils above the level of the fatty
subcutaneous tissue.
[0241] Quantitative microbiologic culture data from multiple organs
were obtained 24 hours after infection in one group of knockout and
of control mice. No statistically significant difference in the
clearance of bacteria was detected (p>0.05) between the Ich-3
mutant mice and the wild types. Thus, lung injury was reduced in
the presence of increased numbers of neutrophils, while the
clearance of bacteria was unaltered.
[0242] These observations suggested that: 1) the failure of
infiltrating neutrophils to degranulate and, possibly, to die was
related to the absence of lung injury and 2) that the profile of
cytokines and other mediators in the lungs might be informative
with regard to manipulations potentially protective to the lungs in
the setting of burns, major trauma, infection and sepsis. Data
supports the hypothesis that the lack of lung injury is due to the
avoidance of degranulation of infiltrating neutrophils in the
burn/sepsis model. Apoptosis of neutrophils appears to be, however,
roughly equivalent in knockout and wild-type mice following thermal
injury or bacterial infection.
Example 17
Reduction of Mortality Due to Burn Injury and Sepsis in Normal
Animals
[0243] Under conditions of bacteremia, sepsis and following thermal
injury (10% body surface area burn) Ich-3 mutant mice are
relatively resistant to development of pulmonary injury. Wild-type
animals routinely (100%) develop pulnonary hemorrhage, pulmonary
edema, and pulmonary inflammation following Pseudomonas bacteremia
The defect in the Ich-3 mutant mouse appears to block this
result.
[0244] Control wild-type mice are treated with a compound that
inhibits a pathway of apoptosis to mimic the genetic defect of the
knockout mice. In this way one protects the lung against injury in
common medical conditions. These injuries include but are not
limited to sepsis due to bacteria and fingi, burn, major trauma,
drug toxicity and other forms of systemic injury including viral
infection, parasitermia, endocarditis, brain injury, pulmonary
emboli all of which are associated with a syndrome knows as Adult
Respiratory Distress Syndrome (ARDS). This is a debilitating and
potentially fatal disorder of pulmonary inflammation and injury
with fibrosis and results in prolonged hospitalation for mechanical
ventilation, frequent superinfection and is often associated with
patient death.
[0245] The apoptotic pathway involving ICH-3 is inhibited either
prior to induction or during injury. The compounds to inhibit ICH-3
may be chosen from the group including but not limited to, peptide
inhibitors such as YVAD-cmk, Ac-DEVD-CHO, cysteihe protease
inhibitors or serine protease inhibitors such as trans-epoxy
succininyl-L-leucylamido-(4-guanidino) butane (E64) and leupeptin,
calpain inhibitors I and II.
[0246] The treated mice and non-treated control mice are then
injured as above (See Example 16). Alternatively the mice are
injured by routine methods known in the art for proucing major
trauma. The injured mice are then monitored for the sequelae of
injury, which includes but is not limited to signs of bacterial
infection, endotoxernia and lethality at least twice daily.
Additional sequelae of injury or infection can be readily found in
the art, such as for example in Robbins S. L. et al., (Basic
Pathology, 1987, W. B. Saunder Co.). Changes in the sequelae as
recognized by those of skill in the art reflect an altered
susceptibility to the injury being examined.
[0247] The systemic release of cytokines after toxin challenge is
determined by ELISA kits for murine IL-.alpha., IL1-.beta., IL6,
IL10, IL8 (Endogen, Cambridge, Mass.). Animals ar sacrificed amd/or
blood samples obtained at time point up to 7 days following the
injury. Tissues are analyzed as described in Example 16.
[0248] All references mentioned herein are incorporated by
reference in the disclosure. Having now fullly described the
invention by way of illustration and example for purposes of
clarity and understanding, it will be apparent to those of ordinary
skill in the art that certain changes and modification may be made
in the disclosed embodiments and such modifications are intended to
be within the scope of the present invention. As examples, the
preferred embodiments constitute only one form of carrying out the
claimed invention.
Sequence CWU 1
1
* * * * *