U.S. patent application number 10/081119 was filed with the patent office on 2003-03-06 for ttk in diagnosis and as a therapeutic target in cancer.
Invention is credited to Chan, Vivien W., Jefferson, Anne B., Reinhard, Christoph.
Application Number | 20030045491 10/081119 |
Document ID | / |
Family ID | 26765220 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030045491 |
Kind Code |
A1 |
Reinhard, Christoph ; et
al. |
March 6, 2003 |
TTK in diagnosis and as a therapeutic target in cancer
Abstract
The present invention provides methods for identification of
cancerous cells by detection of expression levels of TTK, as well
as diagnostic, prognostic and therapeutic methods that take
advantage of the differential expression of these genes in
mammalian cancer. Such methods can be useful in determining the
ability of a subject to respond to a particular therapy, e.g., as
the basis of rational therapy. In addition, the invention provides
assays for identifying pharmaceuticals that modulate activity of
these genes in cancers in which these genes are involved, as well
as methods of inhibiting tumor growth by inhibiting activity of
TTK.
Inventors: |
Reinhard, Christoph;
(Alameda, CA) ; Jefferson, Anne B.; (Oakland,
CA) ; Chan, Vivien W.; (San Francisco, CA) |
Correspondence
Address: |
Chiron Corporation
Intellectual Property
P.O. Box 8097
Emeryville
CA
94662-8097
US
|
Family ID: |
26765220 |
Appl. No.: |
10/081119 |
Filed: |
February 21, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60289813 |
Feb 23, 2001 |
|
|
|
Current U.S.
Class: |
514/44A ;
424/146.1; 435/6.18; 435/7.23 |
Current CPC
Class: |
G01N 33/57419 20130101;
C12Q 2600/136 20130101; C12N 9/1205 20130101; A61K 38/00 20130101;
C12Y 207/01037 20130101; C12Q 1/6886 20130101; C12Q 2600/118
20130101; G01N 33/6842 20130101; G01N 2500/00 20130101; G01N
33/57415 20130101; A61K 2039/505 20130101; C12Q 2600/158 20130101;
G01N 33/57496 20130101; G01N 33/68 20130101 |
Class at
Publication: |
514/44 ; 435/6;
435/7.23; 424/146.1 |
International
Class: |
A61K 048/00; C12Q
001/68; G01N 033/574; A61K 039/395 |
Claims
That which is claimed is:
1. A method for reducing growth of a cancerous cell comprising:
contacting a cancerous cell with an amount of an agent effective to
redue tyrosine threonine kinase (TTK) polypeptide activity in the
cell; wherein reduction of TTK polypeptide activity in the
cancerous cell reduces growth of the cell.
2. The method of claim 1 wherein said reduction of TTK activity is
a result of a reduction of TTK polypeptide levels.
3. The method of claim 2 wherein the agent is a TTK antisense
polynucleotide.
4. The method of claim 3 wherein the TTK antisense polynucleotide
is contained in a viral-based vector.
5. The method of claim 1 wherein said reduction of TTK activity is
a result of a reduction of TTK polynucleotide levels.
6. The method of claim 1 wherein the agent is a monoclonal antibody
that specifically binds TTK.
7. The method of claim 1 wherein the TTK polypeptide comprises the
amino acid sequence of SEQ ID NO:14.
8. An assay for identifying a candidate agent that reduces growth
of a cancerous cell, comprising: detecting the activity of a TTK
polypeptide in the presence of a candidate agent; and comparing the
activity of the TTK polypeptide in the presence of the candidate
agent relative to TTK polypeptide activity in the absence of the
candidate agent; wherein a reduction of TTK activity in the
presence of the candidate agent relative to TTK activity in the
absence of the candidate agent indicates the candidate agent
reduces growth of a cancerous cell.
9. The assay of claim 8, wherein said detecting step utilizes the
polypeptide of SEQ ID NO:26 as a substrate.
10. The assay of claim 8, wherein said detecting step uses a
fragment of SEQ ID NO:26 susceptible to TTK phosphorylation as a
substrate.
11. The assay of claim 10, wherein said fragment comprises the
polypeptide of SEQ ID NO:27 or 28.
12. The assay of claim 10 wherein the polypeptide fragment is
biotinylated.
13. The assay of claim 8 wherein the TTK polypeptide is a product
of expression using a system selected from the group of
baculovirus, bacteria, yeast and mammalian systems.
14. The assay of claim 13 wherein the TTK polypeptide is a product
of expression using a baculovirus system.
15. The method of claim 8 wherein the TTK polypeptide comprises the
amino acid sequence of SEQ ID NO:14.
16. A method of identifying an agent that reduces TTK activity, the
method comprising: contacting a cancerous cell displaying elevated
expression of a TTK-encoding polynucleotide with a candidate agent;
and determining the effect of the candidate agent on TTK
polypeptide activity; wherein a decrease in TTK activity indicates
that the agent reduces TTK activity and inhibits growth of the
cancerous cell.
17. The method of claim 16 wherein said reduction of TTK activity
is a result of a reduction of TTK polypeptide levels.
18. The method of claim 16 wherein said reduction of TTK activity
is a result of a reduction of TTK mRNA levels.
19. The method of claim 17 wherein the candidate agent is a TTK
antisense polynucleotide.
20. The method of claim 19, wherein the TTK antisense
polynucleotide is contained in a viral-based vector.
21. The method of claim 16 wherein the cancerous cell is a breast
cancer cell.
22. The method of claim 16 wherein the cancerous cell is a colon
cancer cell.
23. The method of claim 16 wherein TTK polypeptide comprises the
amino acid sequence of SEQ ID NO:14.
24. The method according to claim 18, wherein TTK activity is
detected by detecting expression of a TTK-encoding
polynucleotide.
25. A method of detecting cancer other than ovarian cancer in a
subject, the method comprising: detecting a level of expression of
a TTK polypeptide in a test cell obtained from a subject suspected
of having cancer; and comparing the level of expression of the TTK
polypeptide in the test cell to a level of expression in a normal
non-cancer cell of the same tissue type; wherein detection of an
expression level of TTK polypeptide in the test cell that is
significantly increased relative to the level of expression in the
normal non-cancer cell indicates that the subject has cancer other
than ovarian cancer.
26. The method of claim 25, wherein the test cell is a colon
cell.
27. The method of claim 25, wherein the test cell is a breast
cell.
28. A method of detecting cancer other than ovarian cancer in a
subject, the method comprising: detecting a level of expression of
a TTK polynucleotide in a test cell obtained from a subject
suspected of having cancer; and comparing the level of expression
of the TTK polynucleotide in the test cell to a level of expression
in a normal non-cancer cell of the same tissue type; wherein
detection of an expression level of TTK polynucleotide in the test
cell that is significantly increased relative to the level of
expression in the normal non-cancer cell indicates that the subject
has cancer other than ovarian cancer.
29. The method of claim 29, wherein the test cell is a colon
cell.
30. The method of claim 29, wherein the test cell is a breast
cell.
31. A method for assessing the prognosis of a cancerous disease
other than ovarian cancer in a subject, the method comprising:
detecting expression of a TTK-encoding polynucleotide in a test
cancer cell of a subject; and comparing a level of expression of a
TTK-encoding polynucleotide in the test cancer cell with a level of
expression the polynucleotide in a control non-cancer cell; wherein
the level of expression of TTK in the test cancer cell relative to
the level of expression in the control non-cancer cell is
indicative of the prognosis of the cancerous disease
32. The method of claim 31, wherein said detecting expression is by
detection of a TTK-encoding transcript.
33. The method of claim 31, wherein the test cell is a colon
cell.
34. The method of claim 31, wherein the test cell is a breast cell.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. provisional
application serial No. 60/289,813, filed Feb. 21, 2001, which
application is hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The field of the present invention relates to disease
diagnosis and treatment of cancer and identification of anti-cancer
agents.
BACKGROUND OF THE INVENTION
[0003] Mitotic checkpoint genes have become widely studied for
their roles in development as well as for their potential role in
disease such as cancer. The mitotic checkpoint involves a number of
different mechanisms to ensure proper cellular division. For
example, the spindle assembly checkpoint modulates the timing of
anaphase initiation in response to the improper alignment of
chromosomes at the metaphase plate. If defects are detected, a
signal is transduced to halt further progression of the cell cycle
until correct bipolar attachment to the spindle is achieved.
Initially identified in budding yeast, several mammalian spindle
checkpoint-associated proteins have recently been identified and
partially characterized. These proteins associate with all active
human centromeres, including neocentromeres, in the early stages of
mitosis prior to the commencement of anaphase. The proteins
associated with the checkpoint protein complex (BUB1, BUBR1, BUB3,
MAD2), the anaphase-promoting complex (Tsg24, p55CDC), and other
proteins associated with mitotic checkpoint control (ERK1, 3F3/2
epitope, hZW10), were found to specifically associate with only the
active centromere, suggesting that only active centromeres
participate in the spindle checkpoint. Saffery R et al., Hum Genet.
107:376-84 (2000).
[0004] Tyrosine threonine kinase (TTK), a protein kinase,
phosphorylates serine, threonine, and tyrosine hydroxyamino acids
(Mills et al,. Biol. Chem. 267:16000-6 (1992)). The kinases most
closely related to TTK include SPK1 serine, threonine, and tyrosine
kinase, the Pim1, PBS2, and CDC2 serine/threonine kinases, and the
TIK kinase (Mills et al. J. Biol. Chem. 267:16000-6 (1992)). The
nucleotide and amino acid sequences of human TTK are provided at,
for example, GenBank Accession No. M86699. Expression of TTK is
markedly reduced or absent in resting cells and in tissues with a
low proliferative index (Hogg et al. Oncogene 9:89-96 (1994)). TTK
mRNA is expressed in human testis, thymus, bone marrow, and other
tissues that contain a large number of proliferating cells and is
not detected in tissues that contain few or no dividing cells. TTK
expression was detected in several rapidly proliferating cells
lines, including various cancer cell lines. TTK expression was also
detected and in samples tissue samples from two patients with
malignant ovarian cancer (Mills et al., ibid.; Schmandt et al. J.
Immunol. 152:96-105 (1994)). TTK expression is correlated with cell
proliferation, and plays a role in cell cycle control (Hogg et al.,
ibid.). Very low levels of TTK mRNA and protein are present in
starved cells. When cells are induced to enter the cell cycle,
levels of TTK mRNA, protein, and kinase activity increase at the
G1/S phase of the cell cycle and peak in G2/M. TTK mRNA levels, as
well as kinase activity, drop sharply in early G1, whereas protein
levels are largely maintained. TTK is a human homologue of the S.
cerevesiae kinase mps1 and the S. pombe protein mph1, both of which
are involved in cell cycle spindle assembly checkpoint, thus
indicating that TTK is a spindle checkpoint gene (see, e.g., Cahill
et al. Genomics 58:181-7 (1999).
[0005] Although mitotic checkpoint impairment has been detected in
human cancers (e.g., such impairment is present in about 40% of
human lung cancer cell lines) mutations in the MAD mitotic
checkpoint genes and the BUB gene family are infrequent. Haruki N
et al., Cancer Lett. 162:201-205 (2001); Mimori K et al., Oncol
Rep. 8:39-42 (2001); Cahill et al., ibid.). There is thus a need
for identification of mitotic checkpoint genes that have a role in
human cancers, as they can serve as informative diagnostic and/or
prognostic indicators, and therapeutic targets.
SUMMARY OF THE INVENTION
[0006] The present invention provides methods for identification of
cancerous cells by detection of expression levels of TTK, as well
as diagnostic, prognostic and therapeutic methods that take
advantage of the differential expression of these genes in
mammalian cancer. Such methods can be useful in determining the
ability of a subject to respond to a particular therapy, e.g., as
the basis of rational therapy. In addition, the invention provides
assays for identifying pharmaceuticals that modulate activity of
these genes in cancers in which these genes are involved, as well
as methods of inhibiting tumor growth by inhibiting activity of
TTK.
[0007] In a first embodiment, the present invention provides a
method for identifying TTK levels in a sample of a subject
suspected of having cancer (e.g., a lung, colon, prostrate or
breast tissue biopsy) comprising quantifying the level of TTK in
the sample. The identification of increased levels of TTK in the
sample provides an indication of impairment of the cell cycle
checkpoint in the sampled cells.
[0008] In another embodiment, the invention provides a method for
determining the characteristics of a malignant or pre-malignant
growth comprising determining (either qualitatively or
quantitatively) the level of TTK in the cells of the growth, and
comparing levels with known levels in various stages of cancer
and/or normal tissue. For example, to determine the characteristics
of a particular subject's colon cancer, a sample of the cancer may
be removed, the levels of TTK in the cancer determined, and the
levels compared to normal tissue and/or levels in various stage
colon cancers derived from the same cell type. The levels of TTK
identified in the sample can thus be indicative of various
characteristics of the malignant or pre-malignant growth, as
determined by the characteristics of known tissue and cancers. The
TTK levels can be compared directly to the levels in other single
samples, or may be compared to a standard that is derived from the
data of multiple samples.
[0009] In another embodiment, the TTK levels of a sample can be
used as one index for determining the appropriate therapeutic
intervention for a subject with a malignant or pre-malignant
growth. Highly increased levels of TTK, for example, can be
indicative of the need for more aggressive therapy, as it is
indicative of a later stage cancer. Alternatively, the level of TTK
expression may be indicative of the responsiveness of a subject to
a particular pharmaceutical, and in particular to a therapeutic
intervention that affects the cancer via the mitotic
checkpoint.
[0010] In another embodiment, the invention features a method for
identifying agents for inhibiting growth of a tumor, particular by
a breast or colon tumor, by contacting a cell expressing TTK with a
candidate agent, and assessing the effect of the agent upon TTK
activity.
[0011] Accordingly, in one aspect the invention features a method
of diagnosing cancer in a subject, the method comprising detection
of TTK polynucleotide or polypeptide in a test sample obtained from
a subject so as to determine a level of expression of the gene
product; and comparing the level of expression of the TTK in the
test sample to a level of expression in a normal cell corresponding
to the same tissue; wherein detection of an expression level of TTK
in the test sample that is significantly increased from the level
of expression in a normal cell indicates that the test cell is
cancerous. In specific embodiments, the cancer is other than
ovarian cancer, with colon cancer and breast cancer being of
particular interest.
[0012] In another aspect, the invention features a method for
determining the prognosis of a cancerous disease in a subject, the
method comprising detecting expression of TTK in a test cell from
the subject; and comparing a level of expression of TTK in the test
cell with a level of TTK expression in a control cell; wherein the
level of expression of TTK in the test cell relative to the level
of expression in the control cell is indicative of the prognosis of
the cancerous disease. For example, where the control cell is a
normal cell, an elevated level of TTK expression in the test cell
relative to the normal cell is indicative of the continued presence
of cancerous cells in the subject and thus a relatively poorer
prognosis than where the level of TTK expression in the test cell
is at a level comparable to that found in an normal (non-cancer)
cell. In specific embodiments, progress of a cancer other than
ovarian cancer is of particular interest, especially colon and
breast cancer.
[0013] In another aspect, the invention features a method for
inhibiting growth of a cancerous cell comprising introducing into a
cell an antisense polynucleotide for inhibition of TTK expression,
wherein inhibition of TTK expression inhibits replication of the
cancerous cell.
[0014] In still another aspect, the invention features a method for
assessing the tumor burden of a subject, the method comprising
detecting a level of TTK expression in a test sample from a
subject, the test sample suspected of comprising increased TTK
expression; wherein detection of the level of TTK expression in the
test sample is indicative of the tumor burden in the subject, with
an increased level of TTK expression in the test sample relative to
a control non-cancer cell indicates the presence of a tumor in the
subject.
[0015] In yet another aspect, the invention features a method of
identifying an agent having anti-TTK activity, the method
comprising contacting a cancerous cell displaying elevated
expression of TTK with a candidate agent; and determining the
effect of the candidate agent on TTK activity; wherein a decrease
in TTK activity indicates that the agent has anti-TTK activity. In
specific embodiments, TTK activity is detected by detecting TTK
expression or by detecting a biological activity of TTK
[0016] In yet another aspect, the invention features an assay for
identifying a candidate agent that inhibits growth of a cancerous
cell, comprising contacting a cell expressing TTK polypeptide with
a candidate agent; and detecting activity of the TTK polypeptide,
comparing the activity of the TTK polypeptide in the cell in the
presence of the candidate agent to activity of a TTK polypeptide in
a cell in the absence of the candidate agent; wherein reduction of
TTK activity in the presence of the candidate agent relative to TTK
activity in the absence of the candidate agent indicates that the
candidate agent reduces TTK activity and inhibits growth of a
cancerous cell.
[0017] A primary object of the invention is to exploit TTK as a
therapeutic target, e.g. by identifying candidate agents that
modulate, usually that decrease, TTK activity in a target cell in
order to, for example, inhibit cell growth.
[0018] An object of the present invention is to inhibit tumor
growth by inhibition of activity of a mitotic checkpoint gene
product, particularly though inhibition of TTK activity in the
target tumor cell.
[0019] Another object of the invention is to facilitate rational
cancer therapy. For example, where the cancer in the subject is
associated with increased TTK activity levels, a therapeutic agent
is selected accordingly so as to facilitate reduction of TTK
activity levels.
[0020] Another object of the present invention is to design
clinical trials based on levels of TTK expression in a cancer, and
more particularly to design clinical trials based on TTK expression
in combination with other patient attributes.
[0021] Yet another object of the invention is to identify the
association of TTK expression and intervention attributes that
yield efficacious changes in selected disease progression
measures.
[0022] An advantage of the invention is the ability to project
disease progression based on expression of TTK in a malignant or
pre-malignant growth.
[0023] Another advantage of the present invention is that it allows
a more systematic approach for intervention of a cancerous disease
based upon objective indicia.
[0024] These and other objects, advantages, and features of the
invention will become apparent to those persons skilled in the art
upon reading the details of the methods as more fully described
below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 is a bar graph illustrating expression of TTK in
various normal tissue types as detected by PCR.
[0026] FIG. 2 is a bar graph illustrating expression of TTK in
various tumor cell lines as detected by PCR.
[0027] FIGS. 3-6 are graphs illustrating expression profiles for
IGF2, MAPKAPK2, TTK, and MARCKS in patients with colorectal
carcinoma.
[0028] FIGS. 7 and 8 are graphs illustrating growth suppression of
MDA-MB-231 cells following antisense suppression of TTK
expression.
[0029] FIG. 9 is a graph illustrating growth suppression of SW620
cells following antisense suppression of TTK expression.
[0030] FIG. 10 is a graph illustrating suppression of colony
formation of SW620 cells in soft agar following antisense
suppression of TTK expression.
[0031] FIG. 11 is a graph illustrating that antisense suppression
of TTK has no detectable effect on normal immortal fibroblasts.
[0032] FIG. 12 is a bar graph illustrating induction of cell death
upon depletion of TTK from SW620 cells.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0033] Before the present invention is described, it is to be
understood that this invention is not limited to particular
methodologies described, and as such may, of course, vary. It is
also to be understood that the terminology used herein is for the
purpose of describing particular embodiments only, and is not
intended to be limiting, since the scope of the present invention
will be limited only by the appended claims.
[0034] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0035] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0036] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a cell" includes a plurality of such cells
and reference to "the agent" includes reference to one or more
agents and equivalents thereof known to those skilled in the art,
and so forth.
[0037] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
DEFINITIONS
[0038] The terms "polynucleotide" and "nucleic acid", used
interchangeably herein, refer to a polymeric forms of nucleotides
of any length, either ribonucleotides or deoxynucleotides. Thus,
these terms include, but are not limited to, single-, double-, or
multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a
polymer comprising purine and pyrimidine bases or other natural,
chemically or biochemically modified, non-natural, or derivatized
nucleotide bases. These terms further include, but are not limited
to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa
et al. (1999) Cell 99(7):691-702). The backbone of the
polynucleotide can comprise sugars and phosphate groups (as may
typically be found in RNA or DNA), or modified or substituted sugar
or phosphate groups. Alternatively, the backbone of the
polynucleotide can comprise a polymer of synthetic subunits such as
phosphoramidites and thus can be an oligodeoxynucleoside
phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer.
Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi
et al. (1996) Nucl. Acids Res. 24:2318-2323. A polynucleotide may
comprise modified nucleotides, such as methylated nucleotides and
nucleotide analogs, uracyl, other sugars, and linking groups such
as fluororibose and thioate, and nucleotide branches. The sequence
of nucleotides may be interrupted by non-nucleotide components. A
polynucleotide may be further modified after polymerization, such
as by conjugation with a labeling component. Other types of
modifications included in this definition are caps, substitution of
one or more of the naturally occurring nucleotides with an analog,
and introduction of means for attaching the polynucleotide to
proteins, metal ions, labeling components, other polynucleotides,
or a solid support.
[0039] The terms "polypeptide" and "protein", used interchangeably
herein, refer to a polymeric form of amino acids of any length,
which can include coded and non-coded amino acids, chemically or
biochemically modified or derivatized amino acids, and polypeptides
having modified peptide backbones. The term includes fusion
proteins, including, but not limited to, fusion proteins with a
heterologous amino acid sequence, fusions with heterologous and
homologous leader sequences, with or without N-terminal methionine
residues; immunologically tagged proteins; and the like.
[0040] As used herein "TTK polynucleotide" and "TTK polypeptide"
encompass polynucleotides and polypeptides having sequence
similarity or sequence identity to the human TTK (having GenBank
accession number M86699; SEQ ID NO:13 and 14), or the S. cerevesiae
kinase mps1 gene and gene products (SEQ ID NO:29 and 30), the S.
pombe protein mph1 gene and gene products (SEQ ID NO:31 and 32),
and other genes and gene products related to TTK, such as SPK1 (SEQ
ID NO:15 and 16), Pim1 (SEQ ID NO:17 and 18), PBS2 (SEQ ID NO:19
and 20), CDC2 (SEQ ID NO:21 and 22), and TIK (SEQ ID NO:23 and 24)
of at least about 65%, preferably at least about 80%, more
preferably at least about 85%, and can be about 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or more. Sequence similarity and
sequence identity are calculated based on a reference sequence,
which may be a subset of a larger sequence, such as a conserved
motif, coding region, flanking region, etc. A reference sequence
will usually be at least about 18 nt long, more usually at least
about 30 nt long, and may extend to the complete sequence that is
being compared. In general, percent sequence identity is calculated
by counting the number of residue matches (e.g., nucleotide residue
or amino acid residue) between the query and test sequence and
dividing total number of matches by the number of residues of the
individual sequences found in the region of strongest alignment.
Thus, where 10 residues of an 11 residue query sequence matches a
test sequence, the percent identity above would be 10 divided by
11, or approximately, 90.9%. Algorithms for computer-based sequence
analysis are known in the art, such as BLAST (see, e.g., Altschul
et al., J. Mol. Biol., 215:403-10 (1990)), particularly the
Smith-Waterman homology search algorithm as implemented in MPSRCH
program (Oxford Molecular). For the purposes of this invention, a
preferred method of calculating percent identity is the
Smith-Waterman algorithm, using the following. Global DNA sequence
identity must be greater than 65% as determined by the
Smith-Waterman homology search algorithm as implemented in MPSRCH
program (Oxford Molecular) using an affine gap search with the
following search parameters: gap open penalty, 12; and gap
extension penalty, 1. The human TTK cDNA is represented by the
polynucleotide sequence of SEQ ID NO:13 and the human TTK
polypeptide is represented by the sequence of SEQ ID NO:14.
[0041] "Antisense polynucleotide" or "antisense oligonucleotide"
are used interchangeably herein to mean an unmodified or modified
nucleic acid having a nucleotide sequence complementary to a given
polynucleotide sequence (e.g., a polynucleotide sequence encoding
TTK) including polynucleotide sequences associated with the
transcription or translation of the given polynucleotide sequence
(e.g., a promoter of a polynucleotide encoding TTK), where the
antisense polynucleotide is capable of hybridizing to a
TTK-encoding polynucleotide sequence. Of particular interest are
antisense polynucleotides capable of inhibiting transcription
and/or translation of a TTK-encoding polynucleotide either in vitro
or in vivo.
[0042] The term "cDNA" as used herein is intended to include all
nucleic acids that share the arrangement of sequence elements found
in native mature mRNA species, where sequence elements are exons
(e.g., sequences encoding open reading frames of the encoded
polypeptide) and 3' and 5' non-coding regions. Normally mRNA
species have contiguous exons, with the intervening introns removed
by nuclear RNA splicing to create a continuous open reading frame
encoding TTK.
[0043] A "variant" as used in the context of a "variant
polypeptide" refers to an amino acid sequence that is altered by
one or more amino acids relative to a reference amino acid
sequence. The variant can have "conservative" changes, wherein a
substituted amino acid has similar structural or chemical
properties, e.g., replacement of leucine with isoleucine. More
rarely, a variant can have "nonconservative" changes, e.g.,
replacement of a glycine with a tryptophan. Similar minor
variations can also include amino acid deletions or insertions, or
both. Guidance in determining which and how many amino acid
residues may be substituted, inserted, or deleted without
abolishing biological or immunological activity can be found using
computer programs well known in the art, for example, DNAStar
software.
[0044] A "deletion" is defined as a change in either amino acid or
nucleotide sequence in which one or more amino acid or nucleotide
residues, respectively, are absent as compared to reference amino
acid sequence or nucleotide sequence. Deletions can be of any
length, but are preferably approximately 50, 20, 15, 10, 5 or 3
amino acids or nucleotides in length.
[0045] An "insertion" or "addition" is that change in an amino acid
or nucleotide sequence which has resulted in the addition of one or
more amino acid or nucleotide residues, respectively, as compared
to a reference amino acid sequence or nucleotide sequence.
Insertions or additions can be of any length, but are preferably
approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in
length.
[0046] A "substitution" results from the replacement of one or more
amino acids or nucleotides by different amino acids or nucleotides,
respectively, as compared to a reference amino acid sequence or
nucleotide sequence. Substitutions can be of any length, but are
preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or
nucleotides in length.
[0047] The terms "single nucleotide polymorphism" and "SNP" refer
to polymorphisms of a single base change relative to a reference
sequence.
[0048] The term "biologically active" refers to gene product,
usually a polypeptide, having structural, regulatory, or
biochemical functions of a naturally occurring gene product, e.g.,
protein. "Immunologically active" defines the capability of the
natural, recombinant, or synthetic polypeptide, or any oligopeptide
thereof, to elicit a specific immune response in appropriate
animals or cells and to bind with specific antibodies.
[0049] The term "derivative" as used herein refers to the chemical
modification of a nucleic acid or amino acid sequence relative to a
reference nucleic acid or amino acid sequence. Illustrative of such
modifications would be replacement of hydrogen by an alkyl, acyl,
or amino group. A nucleic acid derivative generally encodes a
polypeptide which retains essential biological characteristics of
the polypeptide encoded by the reference nucleic acid (e.g., the
"parent" molecule).
[0050] As used herein the term "isolated" is meant to describe a
compound of interest (e.g., either a polynucleotide or a
polypeptide) that is in an environment different from that in which
the compound naturally occurs. "Isolated" is meant to include
compounds that are within samples that are substantially enriched
for the compound of interest and/or in which the compound of
interest is partially or substantially purified.
[0051] As used herein, the term "substantially purified" refers to
a compound (e.g., either a polynucleotide or a polypeptide) that is
removed from its natural environment and is at least 60% free,
preferably 75% free, and most preferably 90% free from other
components with which it is naturally associated.
[0052] "Stringency" typically occurs in a range from about Tm
-5.degree. C. (5.degree. C. below the Tm of the probe or antibody)
to about 20.degree. C. to 25.degree. C. below Tm. As will be
understood by those of skill in the art, a stringency hybridization
can be used to identify or detect identical polynucleotide
sequences or to identify or detect similar or related
polynucleotide sequences.
[0053] The term "hybridization" as used herein shall include "any
process by which a strand of nucleic acid joins with a
complementary strand through base pairing" (Coombs, Dictionary of
Biotechnology, Stockton Press, New York N.Y. (1994)). Amplification
as carried out in the polymerase chain reaction technologies is
described in Dieffenbach et al., PCR Primer, a Laboratory Manual,
Cold Spring Harbor Press, Plainview N.Y. (1995).
[0054] The term "transformation" as used herein refers to a
permanent or transient genetic change, induced in a cell following
incorporation of new DNA (i.e., DNA exogenous to the cell). Genetic
change can be accomplished either by incorporation of the new DNA
into the genome of the host cell, or by transient or stable
maintenance of the new DNA as an episomal element. Where the cell
is a mammalian cell, a permanent genetic change is generally
achieved by introduction of the DNA into the genome of the
cell.
[0055] The term "construct" as used herein refers to a recombinant
nucleic acid, generally recombinant DNA, that has been generated
for the purpose of the expression of a specific nucleotide
sequence(s), or is to be used in the construction of other
recombinant nucleotide sequences.
[0056] As used herein, the term "differentially expressed"
generally refers to a polynucleotide that is expressed at levels in
a test cell that differ significantly from levels in a reference
cell, e.g., mRNA is found at levels at least about 25%, at least
about 50% to about 75%, at least about 90% increased or decreased,
generally at least about 1.2-fold, at least about 1.5-fold, at
least about 2-fold, at least about 5-fold, at least about 10-fold,
or at least about 50-fold or more increased or decreased in a
cancerous cell when compared with a cell of the same type that is
not cancerous. The comparison can be made between two tissues, for
example, if one is using in situ hybridization or another assay
method that allows some degree of discrimination among cell types
in the tissue. The comparison may also be made between cells
removed from their tissue source. "Differential expression" refers
to both quantitative, as well as qualitative, differences in the
genes' temporal and/or cellular expression patterns among, for
example, normal and neoplastic tumor cells, and/or among tumor
cells which have undergone different tumor progression events.
[0057] The terms "correspond to" or "represents" as used in, for
example, the phrase "polynucleotide corresponds to a differentially
expressed gene" are used to refer to the relationship between a
given polynucleotide and the gene from which the polynucleotide
sequence is derived (e.g., a polynucleotide that is derived from a
coding region of the gene, a splice variant of the gene, an exon,
and the like) or to which the polynucleotide hybridizes to under
stringer conditions.
[0058] "Differentially expressed polynucleotide" as used herein
refers to a nucleic acid molecule (RNA or DNA) comprising a
sequence that represents or corresponds to a differentially
expressed gene, e.g., the differentially expressed polynucleotide
comprises a sequence (e.g., an open reading frame encoding a gene
product; a non-coding sequence) that uniquely identifies a
differentially expressed gene so that detection of the
differentially expressed polynucleotide in a sample is correlated
with the presence of a differentially expressed gene in a sample.
"Differentially expressed polynucleotides" is also meant to
encompass fragments of the disclosed polynucleotides, e.g.,
fragments retaining biological activity, as well as nucleic acids
homologous, substantially similar, or substantially identical
(e.g., having about 90% sequence identity) to the disclosed
polynucleotides.
[0059] "Diagnosis" as used herein generally includes determination
of a subject's susceptibility to a disease or disorder,
determination as to whether a subject is presently affected by a
disease or disorder, prognosis of a subject affected by a disease
or disorder (e.g., identification of pre-metastatic or metastatic
cancerous states, stages of cancer, or responsiveness of cancer to
therapy), and therametrics (e.g., monitoring a subject's condition
to provide information as to the effect or efficacy of
therapy).
[0060] As used herein, the term "a polypeptide associated with
cancer" (e.g., as in polypeptide associated with colon cancer)
refers to a polypeptide that is present at relatively higher or
lower levels in a cancer cell relative to a normal cell of the same
type.
[0061] The term "biological sample" encompasses a variety of sample
types obtained from an organism and can be used in a diagnostic or
monitoring assay. The term encompasses blood and other liquid
samples of biological origin, solid tissue samples, such as a
biopsy specimen or tissue cultures or cells derived therefrom and
the progeny thereof. The term encompasses samples that have been
manipulated in any way after their procurement, such as by
treatment with reagents, solubilization, or enrichment for certain
components. The term encompasses a clinical sample, and also
includes cells in cell culture, cell supernatants, cell lysates,
serum, plasma, biological fluids, and tissue samples.
[0062] The terms "treatment", "treating", "treat" and the like are
used herein to generally refer to obtaining a desired pharmacologic
and/or physiologic effect. The effect may be prophylactic in terms
of completely or partially preventing a disease or symptom thereof
and/or may be therapeutic in terms of a partial or complete
stabilization or cure for a disease and/or adverse effect
attributable to the disease. "Treatment" as used herein covers any
treatment of a disease in a mammal, particularly a human, and
includes: (a) preventing the disease or symptom from occurring in a
subject which may be predisposed to the disease or symptom but has
not yet been diagnosed as having it; (b) inhibiting the disease
symptom, i.e., arresting its development; or relieving the disease
symptom, i.e., causing regression of the disease or symptom. Thus
"treatment of cancer" thus encompasses one or more of inhibition of
cellular proliferation, inhibition of metastasis, and the like.
[0063] The terms "individual," "subject," "host," and "patient,"
used interchangeably herein and refer to any mammalian subject for
whom diagnosis, treatment, or therapy is desired, particularly
humans. Other subjects may include cattle, dogs, cats, guinea pigs,
rabbits, rats, mice, horses, and so on.
[0064] The phrase "specific binding pair" as used herein comprises
a specific binding member and a binding partner which have a
particular specificity for each other and which bind to each other
in preference to other molecules under stringent conditions.
Examples of specific binding pairs are antigens and antibodies,
molecules and receptors and complementary nucleotide sequences.
Other examples of binding pairs will be apparent to one skilled in
the art upon reading the present disclosure. Further, the term
"specific binding pair" is also applicable where either or both of
the specific binding member and the binding partner comprise a part
of a larger molecule. In embodiments in which the specific binding
pair are nucleic acid sequences, they are preferably between 10 to
200 nucleotides long, more preferably greater than 15 to 100
nucleotides long.
[0065] By "antibody" is meant an immunoglobulin protein which is
capable of binding an antigen. Antibody as used herein is meant to
include the entire antibody as well as any antibody fragments
(e.g., F(ab').sub.2, Fab', Fab, Fv) capable of binding the epitope,
antigen, or antigenic fragment of interest.
[0066] Antibodies of the invention are immunoreactive or
immunospecific for and therefore specifically and selectively bind
to a protein of interest, e.g., human TTK protein. Antibodies which
are immunoreactive and immunospecific for human TTK are preferred.
Antibodies for human TTK are preferably immunospecific--i.e., not
substantially cross-reactive with related materials, although they
may recognize TTK homologs across species. The term "antibody"
encompasses all types of antibodies (e.g., monoclonal and
polyclonal).
[0067] By "binds specifically" is meant high avidity and/or high
affinity binding of an antibody to a specific polypeptide, e.g.,
epitope of a TTK protein. Antibody binding to its epitope on this
specific polypeptide is stronger than binding of the same antibody
to any other epitope, particularly those which may be present in
molecules in association with, or in the same sample, as the
specific polypeptide of interest. Antibodies which bind
specifically to a polypeptide of interest may be capable of binding
other polypeptides at a weak, yet detectable, level (e.g., 10% or
less of the binding shown to the polypeptide of interest). Such
weak binding, or background binding, is readily discernible from
the specific antibody binding to the compound or polypeptide of
interest, e.g., by use of appropriate controls.
[0068] The terms "cancer", "neoplasm", "tumor", and the like are
used interchangeably herein to refer to cells which exhibit
relatively autonomous growth, so that they exhibit an aberrant
growth phenotype characterized by a significant loss of control of
cell proliferation. In general, cells of interest for detection or
treatment in the present application include pre-malignant (e.g.,
benign hyperplasiac), malignant, metastatic, and non-metastatic
cells.
[0069] "TTK activity" as used herein refers to activity of the TTK
polypeptide in phosphorylation of a recipient substrate.
[0070] "Modulation of TTK activity" as used herein refers to an
increase or decrease in TTK activity that can be a result of, for
example, interaction of an agent with a TTK polypeptide (e.g.,
reversible or irreversible binding of an inhibitory agent so as to
interfere with TTK polypeptide interaction with a donor molecule or
a recipient (acceptor) molecule in the phosphorylation activity of
TTK), inhibition of TTK transcription and/or translation (e.g.,
through antisense interaction with the TTK gene or TTK transcript,
through modulation of transcription factors that facilitate TTK
expression), and the like. Modulation of TTK activity that results
in a decrease of TTK activity is of particular interest in the
invention. In this context, TTK activity can be decreased by an
inhibitory agent at least 10%, 25%, 50%, 75%, 85%, 90%, up to 100%
relative to TTK activity in the absence of an agent. TTK activity
can be assessed by assaying enzymatic activity, by assessing TTK
polypeptide levels, or by assessing TTK transcription levels.
Comparisons of TTK activity can also be accomplished by comparing
TTK activity assessed (either qualitatively or quantitatively) in a
test sample to a standard TTK activity (e.g., a level of TTK
activity in the absence of an inhibitory agent or agonist, that is
associated with a normal cell, a level of TTK activity of a
cancerous cell of a selected tissue type, and the like).
[0071] Overview
[0072] Human TTK is a mitotic checkpoint gene which encodes an 857
amino acid protein that exhibits activity of a mixed specificity
(tyr/thr) kinase. TTK is expressed in rapidly proliferating tissues
such as testis and thymus. See, e.g., Mills G B et al., J Biol
Chem. 267:16000-6 (1992). The present invention is based upon the
finding that TTK is differentially expressed in colon tumor cells
relative to normal colon cells as detected by microarray analysis.
Differential expression was confirmed in cell lines derived from
various forms of cancer, indicating that the involvement of TTK in
cancer as a more general mechanism. In addition, disruption of TTK
function using antisense oligonucleotides to "knock-out" TTK
message decreased proliferation, inhibited anchorage independent
growth, and induced apoptosis of cancer cell lines, including a
metastatic breast cancer cell line (MDA-MB-213) and a colorectal
carcinoma cell line (SW620). These data indicate that TTK can be a
therapeutic target for chemotherapy in cancers in which TTK is
overexpressed.
[0073] The identification of the association of TTK with cancer,
and the confirmation that inhibition of TTK activity (e.g., by
reducing TTK expression) serves as the basis for the materials and
methods of the invention, such as are disclosed and discussed
herein, for use in, for example, diagnosing cancer of a patient,
particularly a cancer that is susceptible to treatment by
decreasing activity of TTK. The invention also provides for
planning and selection of appropriate therapeutic and/or
prophylactic treatment, permitting streamlining of treatment by
targeting those most likely to benefit. The invention also provides
for treatment of a cancer associated with aberrant TTK levels
(e.g., associated with overexpression or overproduction of TTK),
e.g. by inhibition of gene product production (e.g., decreasing
levels of transcription and/or translation), by decreasing TTK
activity (e.g., by decreasing TTK gene product production (e.g., at
the level of transcription or translation) and/or by reducing one
or more of TTK's kinase activities).
[0074] Various aspects of the invention will now be described in
more detail.
[0075] Diagnostic Methods
[0076] In one aspect the invention is based on the discovery that
TTK activity is present at higher levels in cancerous cells
(particularly in colon cancer and breast cancer) than in normal
cells of the same cell type. This discovery serves as the basis for
identification of cancerous cells, as well as identification of
tumors that are susceptible to therapy by inhibiting activity of
TTK, e.g., by inhibiting TTK expression at the level of
transcription or translation or both, by inhibiting TTK activity,
and the like.
[0077] TTK gene products e.g. TTK encoding mRNA or TTK polypeptides
are of particular interest as markers (e.g., in bodily fluids (such
as blood) or in tissues) to detect the earliest changes along the
carcinogenesis pathway (e.g., to differentiate cancerous tissue
from non-cancerous tissue) and/or to monitor the efficacy of
various therapies and preventive interventions. For example, a
relatively increased level of expression of TTK compared to normal
cells or tissues of the same type can be indicative of a poorer
prognosis, and therefore warrant more aggressive therapy (e.g.,
chemo- or radio-therapy) for a patient or vice versa. The
correlation of surrogate tumor specific features with response to
treatment and outcome in patients can define prognostic indicators
that allow the design of tailored therapy based on the molecular
profile of the tumor. These therapies include antibody targeting,
antagonists (e.g., small molecules), and gene therapy. Determining
TTK expression and comparison of a patient's profile with known
expression in normal tissue and variants of the disease allows a
determination of the best possible treatment for a patient, both in
terms of specificity of treatment and in terms of comfort level of
the patient. Surrogate tumor markers, such as polynucleotide
expression, can also be used to better classify, and thus diagnose
and treat, different forms and disease states of cancer. Two
classifications widely used in oncology that can benefit from
identification of TTK expression levels are staging of the
cancerous disorder, and grading the nature of the cancerous
tissue.
[0078] TTK polynucleotides, as well as their encoded gene products,
can be useful to monitor patients having or susceptible to cancer
to detect potentially malignant events at a molecular level before
they are detectable at a gross morphological level. In addition,
detection of TTK gene products can be useful as therametrics, e.g.,
to assess the effectiveness of therapy by using the polynucleotides
or their encoded gene products, to assess, for example, tumor
burden in the patient before, during, and after therapy.
[0079] Furthermore, a polynucleotide identified as corresponding to
a gene that is differentially expressed in, and thus is important
for, one type of cancer can also have implications for development
or risk of development of other types of cancer, e.g., where a
polynucleotide represents a gene differentially expressed across
various cancer types. Thus, for example, expression of a
polynucleotide corresponding to a gene that has clinical
implications for metastatic colon cancer can also have clinical
implications for stomach cancer or endometrial cancer.
[0080] In making a diagnosis, prognosis, risk assessment, or
measurement of tumor burden based on the enzymatic activity of TTK
or the expression levels of TTK polypeptide or TTK encoding
polynucleotides, activity or expression levels may be compared to
those of suitable cancerous or non-cancerous control samples. For
example, a diagnosis of cancer can be made if TTK activity is
increased at by 25%, 50%, 75%, 90%, up to 100%, or, alternatively
by 5-fold, 10-fold, 50-fold, or more than 100-fold relative to a
normal non-cancerous cell of the same tissue type.
[0081] Other gene products that are differentially expressed in
cancerous cells relative to, for example, non-cancer cells of
between cancer cells of differing malignant potential (e.g.,
non-malignant tumor cells versus cells of high potential
malignancy) can also be assayed in addition to TTK for differential
expression in a test cell. Such exemplary gene products include,
but are not necessarily limited to MAPKAP kinase 2 (SEQ ID. No. 33
and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and
38).
[0082] Staging. Staging is a process used by physicians to describe
how advanced the cancerous state is in a patient. Staging assists
the physician in determining a prognosis, planning treatment and
evaluating the results of such treatment. Staging systems vary with
the types of cancer, but generally involve the following "TNM"
system: the type of tumor, indicated by T; whether the cancer has
metastasized to nearby lymph nodes, indicated by N; and whether the
cancer has metastasized to more distant parts of the body,
indicated by M. Generally, if a cancer is only detectable in the
area of the primary lesion without having spread to any lymph nodes
it is called Stage I. If it has spread only to the closest lymph
nodes, it is called Stage II. In Stage II, the cancer has generally
spread to the lymph nodes in near proximity to the site of the
primary lesion. Cancers that have spread to a distant part of the
body, such as the liver, bone, brain or other site, are Stage IV,
the most advanced stage.
[0083] The differential expression level of TTK can facilitate
fine-tuning of the staging process by identifying markers for the
aggressiveness of a cancer, e.g. the metastatic potential, as well
as the presence in different areas of the body. Thus, a Stage II
cancer with a large differential level of expression of TTK can
signify a cancer with a high metastatic potential and can be used
to change a borderline Stage II tumor to a Stage III tumor,
justifying more aggressive therapy.
[0084] Grading of cancers. Grade is a term used to describe how
closely a tumor resembles normal tissue of its same type. The
microscopic appearance of a tumor is used to identify tumor grade
based on parameters such as cell morphology, cellular organization,
and other markers of differentiation. As a general rule, the grade
of a tumor corresponds to its rate of growth or aggressiveness,
with undifferentiated or high-grade tumors generally being more
aggressive than well differentiated or low-grade tumors. The
following guidelines are generally used for grading tumors: 1) GX
Grade cannot be assessed; 2) G1 Well differentiated; G2 Moderately
well differentiated; 3) G3 Poorly differentiated; 4) G4
Undifferentiated. TTK activity levels (e.g., expression levels) can
be especially valuable in determining the grade of the tumor, as
they not only can aid in determining the differentiation status of
the cells of a tumor, they can also identify factors other than
differentiation that are valuable in determining the aggressiveness
of a tumor, such as metastatic potential.
[0085] Detection of colon cancer. Polynucleotides and polypeptides
corresponding to TTK can be used to detect colon cancer in a
subject. Colorectal cancer is one of the most common neoplasms in
humans and perhaps the most frequent form of hereditary neoplasia.
Prevention and early detection are key factors in controlling and
curing colorectal cancer. Colorectal cancer begins as polyps, which
are small, benign growths of cells that form on the inner lining of
the colon. Over a period of several years, some of these polyps
accumulate additional mutations and become cancerous. Multiple
familial colorectal cancer disorders have been identified, which
are summarized as follows: 1) Familial adenomatous polyposis (FAP);
2) Gardner's syndrome; 3) Hereditary nonpolyposis colon cancer
(HNPCC); and 4) Familial colorectal cancer in Ashkenazi Jews. The
expression of appropriate polypeptide andpolynucleotides can be
used in the diagnosis, prognosis and management of colorectal
cancer. Detection of colon cancer can be determined using
expression levels of TTK alone or in combination with the levels of
expression of other genes differentially expressed in colon cancer.
Determination of the aggressive nature and/or the metastatic
potential of a colon cancer can be determined by comparing levels
of TTK with a level associated with a normal cell, and comparing
total levels of another sequence known to be differentially
expressed, or otherwise be a marker of, cancerous tissue, e.g.,
expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al.,
Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957;
Bodmer W, et al., Nat Genet. (1994) 4(3):217; Fearon E R, Ann N Y
Acad Sci. (1995) 768:101)or MAPKAP kinase 2 (SEQ ID. No. 33 and
34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and
38). For example, development of colon cancer can be detected by
examining the level of expression of a gene corresponding to a
polynucleotides described herein to the levels of oncogenes (e.g.
ras) or tumor suppressor genes (e.g. FAP or p53). Thus expression
of specific marker polynucleotides can be used to discriminate
between normal and cancerous colon tissue, to discriminate between
colon cancers with different cells of origin, to discriminate
between colon cancers with different potential metastatic rates,
etc. For a review of markers of cancer, see, e.g., Hanahan et al.
(2000) Cell 100:57-70.
[0086] Detection of breast cancer. The majority of breast cancers
are adenocarcinomas subtypes, which can be summarized as follows:
1) ductal carcinoma in situ (DCIS), including comedocarcinoma; 2)
infiltrating (or invasive) ductal carcinoma (IDC); 3) lobular
carcinoma in situ (LCIS); 4) infiltrating (or invasive) lobular
carcinoma (ILC); 5) inflammatory breast cancer; 6) medullary
carcinoma; 7) mucinous carcinoma; 8) Paget's disease of the nipple;
9) Phyllodes tumor; and 10) tubular carcinoma.
[0087] The expression levels of TTK can be used in the diagnosis
and management of breast cancer, as well as to distinguish between
types of breast cancer. Detection of breast cancer can be
determined using expression levels of TTK, either alone or in
combination with expression of other gene known to be
differentially expressed in breast cancer. Determination of the
aggressive nature and/or the metastatic potential of a breast
cancer can also be determined by comparing levels of TTK and
comparing levels of another sequence known to vary in cancerous
tissue, e.g. ER expression. In addition, development of breast
cancer can be detected by examining the ratio of expression of TTK
to the levels of steroid hormones (e.g., testosterone or estrogen)
or to other hormones (e.g., growth hormone, insulin). Thus
expression of specific marker polynucleotides and polypeptides can
be used to discriminate between normal and cancerous breast tissue,
to discriminate between breast cancers with different cells of
origin, to discriminate between breast cancers with different
potential metastatic rates, etc.
[0088] Detection Methods
[0089] A number of methods are known in the art for analyzing
biological samples from individuals to determine whether the
individual has increased expression of a TTK gene product (e.g.,
RNA or protein) by detecting the TTK gene product in a biological
sample from that subject. As discussed above, the purpose of such
analysis may be used for diagnosis, to detect the presence of an
existing cancer, to help identify the type of cancer, to assist a
physician in determining the severity or likely course of the
cancer, and/or to optimize treatment of it. In specific
non-limiting embodiments, the methods are useful for detecting
cancer cells, facilitating diagnosis of cancer and the severity of
a cancer (e.g., tumor grade, tumor burden, and the like) in a
subject, facilitating a determination of the prognosis of a
subject, and assessing the responsiveness of the subject to therapy
(e.g., by providing a measure of therapeutic effect through, for
example, assessing tumor burden during or following a
chemotherapeutic regimen). In additional embodiments, the methods
are useful for classification or stratification of cancer cells,
e.g., for the purpose of selecting patients to be included in a
clinical trial population, for selecting an appropriate therapy
(e.g., selecting therapy according to an expression profile of the
cancerous cells), and the like.
[0090] Kits
[0091] The detection methods can be provided as part of a kit.
Thus, the invention further provides kits for detecting the
presence and/or a level of TTK activity e.g., by detection of a
TTK-encoding mRNA and/or a polypeptide encoded thereby or by
measuring TTK activity, in a biological sample. Procedures using
these kits can be performed by clinical laboratories, experimental
laboratories, medical practitioners, or private individuals. The
kits of the invention for detecting TTK polypeptide that is
differentially expressed in cancer cells comprise a moiety that
specifically binds the polypeptide, which may be a specific
antibody. The kits of the invention for detecting a TTK-encoding
polynucleotide that is differentially expressed in cancer cells
comprise a moiety that specifically hybridizes to such a
polynucleotide such as a primer. The kits of the invention for
detecting TTK activity comprise a recipient substrate capable of
being phosphorylated by TTK, and a labeled donor substrate. The
kits may optionally provide additional components that are useful
in the procedure, including, but not limited to, buffers,
developing reagents, labels, reacting surfaces, means for
detection, control samples, standards, instructions, and
interpretive information.
[0092] Screening for TTK Nucleic Acid or Polypeptide
[0093] Methods for detection of TTK activity include screening for
the presence of TTK nucleic acid sequences representing an
expressed TTK gene or alleles or variants thereof, and detecting
the TTK polypeptide. The methods make use of biological samples
from individuals that are suspected of contain the nucleic acid
sequences or polypeptide. Examples of biological samples include
blood, plasma, serum, tissue samples, tumor samples, saliva and
urine.
[0094] Exemplary approaches for detecting TTK nucleic acid or
polypeptides include: (a) determining the presence of the
polypeptide encoded by the TTK gene; (b) using a specific binding
member capable of binding to a TTK nucleic acid sequence (e.g., a
known complementary sequence), the specific binding member
comprising a nucleic acid that hybridizes with the TTK sequence
under stringent conditions (c) using a substance comprising an
antibody domain with specificity for a TTK nucleic acid sequence or
the polypeptide encoded by it, the specific binding member being
labeled to allow detection of the specific binding member to its
binding partner is detectable; (d) using PCR involving one or more
primers to determine relative levels of TTK in a sample from a
patient; and (e) using an assay for TTK activity, e.g.,
phosphorylation of a TTK substrate.
[0095] The determination of TTK levels can include both levels of
normal TTK and/or variant forms of TTK. A variant form of the gene
may contain one or more insertions, deletions, substitutions and/or
additions of one or more nucleotides compared with the wild-type
sequence which may or may not alter the gene function. Differences
at the nucleic acid level are not necessarily reflected by a
difference in the amino acid sequence of the encoded polypeptide
due to the degeneracy of the genetic code. However, a mutation or
other difference in a gene may result in a frame-shift or stop
codon, which could seriously affect the nature of the polypeptide
produced (if any), or a point mutation or gross mutational change
to the encoded polypeptide, including insertion, deletion,
substitution and/or addition of one or more amino acids or regions
in the polypeptide.
[0096] A mutation in a promoter sequence or other regulatory region
may alter (e.g., reduce or enhance) expression from the gene or
affect the processing or stability of the mRNA transcript.
[0097] There are various methods for detecting a particular nucleic
acid sequence in a test sample. Tests may be carried out on
preparations containing mRNA or cDNA generated from isolated mRNA
in a manner that reflects the relative levels of mRNA transcripts
in the sample. Levels of RNA can be determined specific
amplification reaction such as PCR using one or more pairs of
primers may be employed to amplify a region of the nucleic acid,
and preferably a region with less homology to other genes. Nucleic
acid for testing may be prepared from nucleic acid removed from
cells or in a library using a variety of other techniques such as
restriction enzyme digest and electrophoresis.
[0098] Nucleic acid may be screened using a TTK-specific probe.
Such a probe corresponds in sequence to a region of the TTK gene,
or its complement. Under stringent conditions, specific
hybridization of such a probe to test nucleic acid is indicative of
the presence of the TTK nucleic acid in a sample. For efficient
screening purposes, more than one probe may be used on the same
test sample. The probe may contain as few as 15, 20, 50 or 100
nucleotides of the TTK gene of SEQ ID. No. 13 or may be as long as
or 500, 1 kb or as much as 3.8 kb or longer in length.
[0099] Allele- or variant-specific oligonucleotides may similarly
be used in PCR to specifically amplify particular sequences if
present in a test sample. Assessment of whether a PCR band contains
a gene variant may be carried out in a number of ways familiar to
those skilled in the art. The PCR product may for instance be
treated in a way that enables one to display the mutation or
polymorphism on a denaturing polyacrylamide DNA sequencing gel,
with specific bands that are linked to the gene variants being
selected. This can be done simultaneous to or sequentially to
determining the level of a normal TTK sequence, e.g., to determine
the combinatory levels of total TTK.
[0100] The presence of absence of a lesion in a promoter or other
regulatory sequence may also be assessed by determining the level
of mRNA production by transcription or the level of polypeptide
production by translation from the mRNA. The presence of
differences in sequence of nucleic acid molecules may be detected
by means of restriction enzyme digestion, such as in a method of
DNA fingerprinting where the restriction pattern produced when one
or more restriction enzymes are used to cut a sample of nucleic
acid is compared with the pattern obtained when a sample containing
the normal gene or a variant or allele is digested with the same
enzyme or enzymes.
[0101] A test sample of nucleic acid may be provided for example by
extracting nucleic acid from cells, e.g., cells from a tumor
biopsy.
[0102] Detection of TTK Polypeptides
[0103] There are various methods for determining the presence or
absence in a test sample of a TTK polypeptide. A sample may be
tested for the presence of a binding partner for a specific binding
member such as an antibody (or mixture of antibodies), specific for
wild-type TTK and/or one or more particular variants (e.g., allelic
variants) of the TTK polypeptide. In such cases, the sample may be
tested by being contacted with a specific binding member such as an
antibody under appropriate conditions for specific binding. Where a
panel of antibodies is used, different reporting labels may be
employed for each antibody so that binding of each can be
determined. In addition to detection of TTK polypeptides using
anti-TTK antibodies, TTK polypeptide can also be identified using
TTK-specific activity assays.
[0104] Arrays
[0105] Binding agents (such as antibodies or nucleic acid
sequences) can also be immobilized in small, discrete locations
and/or as arrays on solid supports or on diagnostic chips. These
approaches can be particularly valuable as they can provide great
sensitivity, particularly through the use of fluorescently labeled
reagents, require only very small amounts of biological sample from
individuals being tested and allow a variety of separate assays can
be carried out simultaneously. This latter advantage can be useful
as it provides an assay for different proteins (e.g., an oncogene
or tumor suppressor) in tandem with the assay for TTK. Thus, in a
further aspect, the present invention provides a support or
diagnostic chip having immobilized thereon one or more binding
agents capable of specifically binding TTK nucleic acid or
polypeptides, optionally in combination with other reagents needed
to carrying out an assay.
[0106] Methods for Expression of TTK Polypeptide
[0107] The full-length or partial polypeptides encoded by TTK may
be expressed in any expression system, including, for example,
bacterial, yeast, insect, amphibian and mammalian systems. Suitable
vectors and host cells for which are described in U.S. Pat. No.
5,654,173. Appropriate polynucleotide constructs are purified using
standard recombinant DNA techniques as described in, for example,
Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd
ed. (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and under
current regulations described in United States Dept. of HHS,
National Institute of Health (NIH) Guidelines for Recombinant DNA
Research.
[0108] Bacteria. Expression systems in bacteria include those
described in Chang et al., Nature (1978) 275:615, Goeddel et al.,
Nature (1979) 281:544, Goeddel et al., Nucleic Acids Res. (1980)
8:4057; EP 0 036,776, U.S. Pat. No. 4,551,433, DeBoer et al., Proc.
Natl. Acad. Sci. (USA) (1983) 80:21-25, and Siebenlist et al., Cell
(1980) 20:269.
[0109] Yeast. Expression systems in yeast include those described
in Hinnen et al., Proc. Natl. Acad. Sci. (USA) (1978) 75:1929; Ito
et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell.
Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985)
25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459,
Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302) Das et al., J.
Bacteriol. (1984) 158:1165; De Louvencourt et al., J. Bacteriol.
(1983) 154:737, Van den Berg et al., Bio/Technology (1990) 8:135;
Kunze et al., J. Basic Microbiol. (1985) 25:141; Cregg et al., Mol.
Cell. Biol. (1985) 5:3376, U.S. Pat. Nos. 4,837,148 and 4,929,555;
Beach and Nurse, Nature (1981) 300:706; Davidow et al., Curr.
Genet. (1985) 10:380, Gaillardin et al., Curr. Genet. (1985) 10:49,
Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:284-289;
Tilburn et al., Gene (1983) 26:205-221, Yelton et al., Proc. Natl.
Acad. Sci. (USA) (1984) 81:1470-1474, Kelly and Hynes, EMBO J.
(1985) 4:475479; EP 0 244,234, and WO 91/00357.
[0110] Insect Cells. Expression of heterologous genes in insects is
accomplished as described in U.S. Pat. No. 4,745,051, Friesen et
al. (1986) "The Regulation of Baculovirus Gene Expression" in: The
Molecular Biology Of Baculoviruses (W. Doerfler, ed.), EP 0
127,839, EP 0 155,476, and Vlak et al., J. Gen. Virol. (1988)
69:765-776, Miller et al., Ann. Rev. Microbiol. (1988) 42:177,
Carbonell et al., Gene (1988) 73:409, Maeda et al., Nature (1985)
315:592-594, Lebacq-Verheyden et al., Mol. Cell Biol. (1988)
8:3129; Smith et al., Proc. Natl. Acad. Sci. (USA) (1985) 82:8404,
Miyajima et al., Gene (1987) 58:273; and Martin et al., DNA (1988)
7:99. Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts are described in Luckow et
al., Bio/Technology (1988) 6:47-55, Miller et al., Generic
Engineering (Setlow, J. K. et al. eds.), Vol. 8 (Plenum Publishing,
1986), pp. 277-279, and Maeda et al., Nature, (1985)
315:592-594.
[0111] Mammalian Cells. Mammalian expression is accomplished as
described in Dijkema et al., EMBO J. (1985) 4:761, Gorman et al.,
Proc. Natl. Acad. Sci. (USA) (1982) 79:6777, Boshart et al., Cell
(1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of
mammalian expression are facilitated as described in Ham and
Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem.
(1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762,
4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.
[0112] Screening Assays to Identify Chemotherapeutic Agents
[0113] The invention also encompasses screening assays to identify
agents that modulate TTK activity, specifically that decrease
aberrant TTK activity in an affected cell, e.g., a cancerous or
pre-cancerous cell in which TTK is differentially expressed. Such
assays may be performed either in vitro or in vivo.
[0114] Candidate Agents
[0115] The term "agent" as used herein describes any molecule with
the capability of altering the expression or physiological function
of a gene product of a differentially expressed gene. Generally a
plurality of assay mixtures are run in parallel with different
agent concentrations to obtain a differential response to the
various concentrations. Typically, one of these concentrations
serves as a negative control, i.e., at zero concentration or below
the level of detection.
[0116] Candidate agents encompass numerous chemical classes,
including, but not limited to, organic molecules (e.g., small
organic compounds having a molecular weight of more than 50 and
less than about 2,500 daltons), peptides, monoclonal antibodies,
antisense polynucleotides, and ribozymes, and the like. Candidate
agents can comprise functional groups necessary for structural
interaction with proteins, particularly hydrogen bonding, and
typically include at least an amine, carbonyl, hydroxyl or carboxyl
group, preferably at least two of the functional chemical groups.
The candidate agents often comprise cyclical carbon or heterocyclic
structures and/or aromatic or polyaromatic structures substituted
with one or more of the above functional groups. Candidate agents
are also found among biomolecules including, but not limited to:
polynucleotides, peptides, saccharides, fatty acids, steroids,
purines, pyrimidines, derivatives, structural analogs or
combinations thereof.
[0117] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs. Candidate agents can be assessed for
modulation of TTK activity either singly or in pools.
[0118] Screening of Candidate Agents In Vitro
[0119] A wide variety of in vitro assays may be used to screen
candidate agents for the desired biological activity, including,
but not limited to, labeled in vitro protein-protein binding
assays, protein-DNA binding assays (e.g., to identify agents that
affect expression), electrophoretic mobility shift assays,
immunoassays for protein binding, and the like. For example, by
providing for the production of large amounts of a differentially
expressed polypeptide, one can identify ligands or substrates that
bind to, modulate or mimic the action of the polypeptide. Further
methods for identifying these ligands and substrates are provided
below. The purified polypeptide may also be used for determination
of three-dimensional crystal structure, which can be used for
modeling intermolecular interactions, transcriptional regulation,
etc.
[0120] The screening assay can be a binding assay, wherein one or
more of the molecules may be joined to a label, and the label
directly or indirectly provide a detectable signal. Various labels
include radioisotopes, fluorescers, chemiluminescers, enzymes,
specific binding molecules, particles, e.g.,magnetic particles, and
the like. Specific binding molecules include pairs, such as biotin
and streptavidin, digoxin and antidigoxin etc. For the specific
binding members, the complementary member would normally be labeled
with a molecule that provides for detection, in accordance with
known procedures.
[0121] A variety of other reagents may be included in the screening
assays described herein. Where the assay is a binding assay, these
include reagents like salts, neutral proteins, e.g.,albumin,
detergents, etc that are used to facilitate optimal protein-protein
binding, protein-DNA binding, and/or reduce non-specific or
background interactions. Reagents that improve the efficiency of
the assay, such as protease inhibitors, nuclease inhibitors,
anti-microbial agents, etc. may be used. The mixture of components
are added in any order that provides for the requisite binding.
Incubations are performed at any suitable temperature, typically
between 4 and 40.degree. C. Incubation periods are selected for
optimum activity, but may also be optimized to facilitate rapid
high-throughput screening. Typically between 0.1 and 1 hours will
be sufficient.
[0122] Many mammalian genes have homologs in yeast and lower
animals. The study of such homologs physiological role and
interactions with other proteins in vivo or in vitro can facilitate
understanding of biological function. In addition to model systems
based on genetic complementation, yeast has been shown to be a
powerful tool for studying protein-protein interactions through the
two hybrid system described in Chien et al. 1991 Proc. Natl. Acad.
Sci. USA 88:9578-9582.
[0123] Screening of Candidate Agents In Vivo
[0124] Candidate agents can be screened in a non-human animal model
of cancer (e.g., in animals into which have been injected cancerous
cells; in animals that are transgenic for an alteration in
expression of a differentially expressed gene as described herein,
e.g., a transgenic "knock-out," or a transgenic "knock-in," a
polynucleotide encoding all or a portion of a differentially
expressed gene product and comprising an operably linked reporter
gene, and the like).
[0125] In general, the candidate agent is administered to the
animal, and the effects of the candidate agent determined. The
candidate agent can be administered in any manner desired and/or
appropriate for delivery of the agent in order to effect a desired
result. For example, the candidate agent can be administered by
injection (e.g., by injection intravenously, intramuscularly,
subcutaneously, or directly into the tissue in which the desired
affect is to be achieved), orally, or by any other desirable means.
Normally, the in vivo screen will involve a number of animals
receiving varying amounts and concentrations of the candidate agent
(from no agent to an amount of agent hat approaches an upper limit
of the amount that can be delivered successfully to the animal),
and may include delivery of the agent in different formulation. The
agents can be administered singly or can be combined in
combinations of two or more, especially where administration of a
combination of agents may result in a synergistic effect.
[0126] The effect of agent administration upon the transgenic
animal can be monitored by assessing expression of the gene
product, growth of the injected tumor cells, and the like.
[0127] Identified Candidate Agents
[0128] Compounds having the desired pharmacological activity may be
administered in a physiologically acceptable carrier to a host for
treatment of a condition that is amenable to treatment by
modulation of expression of a differentially expressed gene
product. The therapeutic agents may be administered in a variety of
ways, orally, topically, parenterally e.g., subcutaneously,
intraperitoneally, by viral infection, intravascularly, etc. Oral
and inhaled treatments are of particular interest. Depending upon
the manner of introduction, the compounds may be formulated in a
variety of ways. The concentration of therapeutically active
compound in the formulation may vary from about 0.1-100 wt. %. The
therapeutic agents can be administered in a single dose, or as
multiple doses over a course of treatment.
[0129] The pharmaceutical compositions can be prepared in various
forms, such as granules, tablets, pills, suppositories, capsules,
suspensions, salves, lotions and the like. Pharmaceutical grade
organic or inorganic carriers and/or diluents suitable for oral and
topical use can be used to make up compositions containing the
therapeutically-active compounds. Diluents known to the art include
aqueous media, vegetable and animal oils and fats. Stabilizing
agents, wetting and emulsifying agents, salts for varying the
osmotic pressure or buffers for securing an adequate pH value, and
skin penetration enhancers can be used as auxiliary agents.
[0130] Methods of Screening for Drugs that Modulate TTK
Activity
[0131] A TTK polypeptide or TTK-encoding nucleic acid according to
the present invention may be used in screening for molecules which
affect or modulate TTK activity or function. Such molecules may be
useful in a therapeutic and/or prophylactic context. Means for
screening for substances potentially useful in treating or
preventing cancer is provided by the present invention. In general,
the methods of the invention are to facilitate identification of
modulators of TTK activity (e.g., by modulating activity of TTK
polypeptide or other TTK gene product, or by affecting TTK activity
by targeting activity of gene products that act either upstream or
downstream of TTK in a cascade that leads to TTK activity), with
agents that decrease TTK activity generally being of particular
interest. Substances identified as modulators of the TTK activity
represent an advance in the fight against cancer since they provide
basis for design and investigation of pharmaceuticals for in vivo
use.
[0132] A method of screening for a substance which modulates
activity of a polypeptide may include contacting one or more test
substances with the polypeptide in a suitable reaction medium,
testing the activity of the treated polypeptide (e.g., the ability
to phosphorylate its substrate) and comparing that activity with
the activity of the polypeptide in comparable reaction medium
untreated with the test substance or substances. A difference in
activity between the treated and untreated polypeptides is
indicative of a modulating effect of the relevant test substance or
substances.
[0133] Combinatorial library technology provides an efficient way
of testing a potentially vast number of different substances for
ability to modulate activity of a polypeptide. Such libraries and
their use are known in the art. The use of peptide libraries is
preferred. Test substances may also be screened for ability to
interact with the polypeptide, e.g., in a yeast two-hybrid system.
This may be used as a coarse screen prior to testing a substance
for actual ability to modulate activity of the polypeptide.
Alternatively, the screen could be used to screen test substances
for binding to a TTK specific binding partner.
[0134] A substance identified using as a modulator of TTK
polypeptide function may be peptide or non-peptide in nature.
Non-peptide "small molecules" are often preferred for many in vivo
pharmaceutical uses. Accordingly, a mimetic or mimic of the
substance (particularly if a peptide) may be designed for
pharmaceutical use.
[0135] TTK activity assays
[0136] The activity of the TTK may be measured using any suitable
kinase assay known in the art. For example, and not by way of
limitation, the methods described in Hogg et al (Oncogene 1994
9:98-96), Mills et al (J. Biol. Chem. 1992 267:16000-006) and
Tomizawa et al 2001 (FEBS Lett. 2001 492: 221-7), Schmandt et al,
(J. Immunol. 1994, 152:96-105) may be used. Further serine,
threonine and tyrosine kinase assays are described in Ausubel et
al. (Short Protocols in Molecular Biology, 1999, unit 17.6).
[0137] TTK assays generally use TTK polypeptide, a labeled donor
substrate, and a receptor substrate that is either specific or
non-specific for TTK. In such assays TTK transfers a labeled moiety
from the donor substrate to the receptor substrate, and kinase
activity is measured by the amount of labeled moiety transferred
from the donor substrate to the receptor substrate.
[0138] TTK polypeptide may be produced using various expression
systems as detailed above, may be purified from cells, may be in
the form of a cleaved or uncleaved recombinant fusion protein and
may have non-TTK polypeptide sequences, for example a His tag or
.beta.-galactosidase at its N- or C-terminus. TTK activity may be
assayed in cancerous cells lines if the cancerous cell lines are
used as a source of the TTK to be assayed. Suitable donor
substrates for TTK assays include any molecule that is susceptible
to dephosphorylation by TTK include .gamma.-labeled ATP and ATP
analogs, wherein the label is .sup.33P, .sup.32P, .sup.35S or any
other radioactive isotope or a suitable fluorescent marker.
Suitable recipient substrates for TTK assays include any
polypeptide or other molecule that is susceptible to
phosphorylation by TTK. Recipient substrates are usually derived
from fragments of in vivo targets of TTK. Recipient substrates
fragments may be 8 to 50 amino acids in length, usually 10 to 30
amino acids and preferably of about 10, 12, 15, 18, 20 and 25 amino
acids in length Further recipient substrates can be determined
empirically using a set of different polypeptides or other
molecules. Targets of TTK suitable for TTK assays include tau and
cdc25. Recipient substrates for TTK are typically capable of being
purified from other components of the reaction once the reaction
has been performed. This purification is usually done through a
molecular interaction, where the recipient substrates is
biotinylated and purified through its interaction with
streptavidin, or a specific antibody is available that can
specifically recognize the recipient substrates. The reaction can
be performed in a variety of conditions, such as on a solid
support, in a gel, in solution or in living cells.
[0139] One exemplary recipient substrate for TTK phosphorylation is
the human protein cdc25, SEQ ID NO:26, which is phosphorylated by
TTK at the serine residues of amino acid position 214 and 216. Two
fragments of cdc25 are used as substrates in the kinase assay
described below. These fragments comprise peptides A (SEQ ID
NO:27), corresponding to amino acids 209 to 225 of the cdc25
polypeptide sequence or peptide B (SEQ ID NO:28), corresponds to
amino acids 210 to 223 of the cdc25 polypeptide. In this assay, two
biotinylated polypeptides of comprising either SEQ ID NO:27
(Biotin-SGSGSGLYRSPSMPENLNRPR-NH2) or SEQ ID NO:28
(Biotin-GGGGLYRSPSMPENLNRK-OH) are used.
[0140] The choice of detection methods depends on type of label
used for the donor molecule and may include, for example,
measurement of incorporated radiation or fluorescence by
autoradiography, scintillation, scanning or fluorography.
[0141] Methods of Inhibiting Tumor Growth and Other Treatment
Goals
[0142] The invention further provides methods for reducing growth
of cancer cells, particular breast or colon cancer cells. In
general, the methods comprise contacting a cancer cell that
expresses TTK at an aberrant level relative to normal cells with a
substance that (1) modulates, generally decreases, expression of
TTK (e.g., a antisense polynucleotide corresponding to TTK); or (2)
otherwise modulates, generally decreases, TTK polypeptide levels
and/or TTK activity in a cancerous cell having aberrant TTK
activity.
[0143] "Reducing growth of a cancer cell" includes, but is not
limited to, reducing proliferation of cancer cells, and reducing
the incidence of a normal cell from developing a cancerous
phenotype or morphology. Whether a reduction in cancer cell growth
has been achieved can be readily determined using any known assay,
including, but not limited to, [.sup.3H]-thymidine incorporation;
counting cell number over a period of time; detecting, measuring a
marker associated with colon cancer (e.g., CEA, CA19-9, and LASA),
and/or methods well known in the art for assessing tumor
burden.
[0144] The present invention provides methods for treating cancer
(particularly breast and colon cancer or other cancer that is
associated with aberrantly high TTK activity) which methods
generally comprise administering to an individual an agent that
reduces TTK activity in an amount sufficient to reduce cancer cell
growth to treat the cancer. Whether a substance, or a specific
amount of the substance, is effective in treating cancer can be
assessed using any of a variety of known diagnostic assays, e.g. in
the case of colon cancer, sigmoidoscopy, proctoscopy, rectal
examination, colonoscopy with biopsy, contrast radiographic
studies, CAT scans, angiography, and detection of a tumor marker
associated with colon cancer in the blood of the individual. The
substance can be administered systemically or locally. Thus, in
some embodiments, the substance is administered locally, and colon
cancer growth is decreased at the site of administration. Local
administration may be useful in treating, e.g., a solid tumor.
[0145] In one embodiment, the invention features polynucleotides
that act as antisense polynucleotides and decrease TTK activity.
Antisense TTK polynucleotides generally comprise a polynucleotide
of at least about 20 to 3000 nucleotides, usually at least about 20
to 1000 nucleotides and more usually at least about 8 to 50
nucleotides, and preferably about 26, 20, 18, 17, 15, 10 and 8
nucleotides. Exemplary TTK polynucleotides are provided in the
Examples and in SEQ ID NO:1-12, although any antisense fragment of
SEQ ID NO:13 will suffice.
[0146] The therapeutic regimen is selected according to the
expression profile. For example, if a patient's tumor indicates
that the tumor produces aberrantly high level of TTK relative to
normal cells, then a drug having efficacy in the treatment of such
TTK-expressing tumors is selected for therapy of that patient.
[0147] Pharmaceutical Compositions
[0148] Pharmaceutical compositions of the invention can comprise a
therapeutically effective amount of a polypeptide, antibody,
polynucleotide (including antisense nucleotides and ribozymes), or
small molecule or other compound identified as modulating activity
of TTK, preferably decreasing TTK activity. The term
"therapeutically effective amount" as used herein refers to an
amount of a therapeutic agent to treat, ameliorate, or prevent a
desired disease or condition, or to exhibit a detectable
therapeutic or preventative effect. The effect can be detected by,
for example, chemical markers or antigen levels. Therapeutic
effects also include reduction in physical symptoms, such as
decreased body temperature, and/or in the effect upon tumor load in
the subject (e.g., decrease in tumor size or inhibition in tumor
growth). The precise effective amount for a subject will depend
upon the subject's size and health, the nature and extent of the
condition, and the therapeutics or combination of therapeutics
selected for administration. Thus, it is not useful to specify an
exact effective amount in advance. However, the effective amount
for a given situation is determined by routine experimentation and
is within the judgment of the clinician. For purposes of the
present invention, an effective dose will generally be from about
0.01 mg/ kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA
constructs in the individual to which it is administered.
[0149] A pharmaceutical composition can also contain a
pharmaceutically acceptable carrier. The term "pharmaceutically
acceptable carrier" refers to a carrier for administration of a
therapeutic agent, such as antibodies or a polypeptide, genes, and
other therapeutic agents. The term refers to any pharmaceutical
carrier that does not itself induce the production of antibodies
harmful to the individual receiving the composition, and which can
be administered without undue toxicity. Suitable carriers can be
large, slowly metabolized macromolecules such as proteins,
polysaccharides, polylactic acids, polyglycolic acids, polymeric
amino acids, amino acid copolymers, and inactive virus particles.
Such carriers are well known to those of ordinary skill in the art.
Pharmaceutically acceptable carriers in therapeutic compositions
can include liquids such as water, saline, glycerol and ethanol.
Auxiliary substances, such as wetting or emulsifying agents, pH
buffering substances, and the like, can also be present in such
vehicles. Typically, the therapeutic compositions are prepared as
injectables, either as liquid solutions or suspensions; solid forms
suitable for solution in, or suspension in, liquid vehicles prior
to injection can also be prepared. Liposomes are included within
the definition of a pharmaceutically acceptable carrier.
Pharmaceutically acceptable salts can also be present in the
pharmaceutical composition, e.g., mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. A thorough discussion of
pharmaceutically acceptable excipients is available in Remington 's
Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991). The precise
nature of the carrier or other material may depend on the route of
administration, e.g., oral, intravenous, cutaneous or subcutaneous,
nasal, intramuscular, intraperitoneal routes.
[0150] Pharmaceutical compositions for oral administration may be
in tablet, capsule, powder or liquid form. A tablet may include a
solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical
compositions generally include a liquid carrier such as water,
petroleum, animal or vegetable oils, mineral oil or synthetic oil.
Physiological saline solution, dextrose or other saccharide
solution or glycols such as ethylene glycol, propylene glycol or
polyethylene glycol may be included.
[0151] For intravenous, cutaneous or subcutaneous injection, or
injection at the site of affliction, the active ingredient will be
in the form of a parenterally acceptable aqueous solution which is
has suitable pH, isotonicity and stability. Suitable solutions, for
example, optionally include but are not limited to isotonic
vehicles such as sodium chloride, preservatives, stabilizers,
buffers, antioxidants and/or other additives as required.
[0152] Administration of the pharmaceutical is administered in a
prophylactically effective amount or a therapeutically effective
amount. The actual amount administered, and rate and time-course of
administration, will depend on the nature and severity of what is
being treated. Decisions on dosage etc, can be determined by one
skilled in the art based upon the disclosed methods, and typically
takes account of the disorder to be treated, the condition of the
individual patient, the site of delivery, the method of
administration and other factors known to practitioners. Examples
of the techniques and protocols mentioned above can be found in
Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed),
1980.
[0153] Alternatively, targeting therapies may be used to deliver
the active agent more specifically to certain types of cell, by the
use of targeting systems such as antibody or cell specific ligands.
Targeting may be desirable for a variety of reasons; for example if
the agent is unacceptably toxic, or if it would otherwise require
too high a dosage, or if it would not otherwise be able to enter
the target cells. Targeting can be accomplished by, for example,
administering a drug-antibody complex to a subject, wherein the
antibody is specific for a cancer-associated antigen, and the drug
is one that reduces cancer cell growth. Targeting can be
accomplished by coupling (e.g., linking, directly or via a linker
molecule, either covalently or non-covalently, so as to form a
drug-antibody complex) a drug to an antibody specific for a
cancer-associated antigen. Methods of coupling a drug to an
antibody are well known in the art and need not be elaborated upon
herein.
[0154] Pharmaceutical agents can also be produced in the target
cells by expression from an encoding gene introduced into the
cells, e.g., in a viral or liposomal vector. The vector could be
targeted to the specific cells to be treated, or it could contain
regulatory elements which are switched on more or less selectively
by the target cells.
[0155] Alternatively, the agent could be administered in a
precursor form, for conversion to the active form by an activating
agent produced in, or targeted to, the cells to be treated. A
composition may be administered alone or in combination with other
treatments, either simultaneously or sequentially dependent upon
the condition to be treated.
[0156] Delivery Methods for Therapy
[0157] Once formulated, the compositions of the invention or
identified using the methods of the invention can be administered
directly to the subject (e.g., as polynucleotide or polypeptides).
Direct delivery of the compositions will generally be accomplished
by parenteral injection, e.g., subcutaneously, intraperitoneally,
intravenously or intramuscularly, intratumoral or to the
interstitial space of a tissue. Other modes of administration
include oral and pulmonary administration, suppositories, and
transdermal applications, needles, and gene guns or hyposprays.
Dosage treatment can be a single dose schedule or a multiple dose
schedule.
[0158] Once a gene corresponding to a polynucleotide of the
invention has been found to correlate with a proliferative
disorder, such as neoplasia, dysplasia, and hyperplasia, the
disorder can be amenable to treatment by administration of a
therapeutic agent based on the provided polynucleotide,
corresponding polypeptide or other corresponding molecule (e.g.,
antisense, ribozyme, etc.).
[0159] The dose and the means of administration are determined
based on the specific qualities of the therapeutic composition, the
condition, age, and weight of the patient, the progression of the
disease, and other relevant factors. For example, administration of
polynucleotide therapeutic compositions agents of the invention
includes local or systemic administration, including injection,
oral administration, particle gun or catheterized administration,
and topical administration. Preferably, the therapeutic
polynucleotide composition contains an expression construct
comprising a promoter operably linked to a polynucleotide of at
least 12, 15, 17, 18, 22, 25, 30, or 35 contiguous-nucleotides of
the polynucleotide disclosed herein. Various methods can be used to
administer the therapeutic composition directly to a specific site
in the body. For example, a small metastatic lesion is located and
the therapeutic composition injected several times in several
different locations within the body of tumor. Alternatively,
arteries which serve a tumor are identified, and the therapeutic
composition injected into such an artery, in order to deliver the
composition directly into the tumor. A tumor that has a necrotic
center is aspirated and the composition injected directly into the
now empty center of the tumor. The antisense composition is
directly administered to the surface of the tumor, for example, by
topical application of the composition. X-ray imaging is used to
assist in certain of the above delivery methods.
[0160] Receptor-mediated targeted delivery of therapeutic
compositions containing an antisense polynucleotide, subgenomic
polynucleotides, or antibodies to specific tissues can also be
used. Receptor-mediated DNA delivery techniques are described in,
for example, Findeis et al., Trends Biotechnol. (1993) 11:202;
Chiou et al., Gene Therapeutics: Methods And Applications Of Direct
Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem.
(1988) 263:621; Wu et al., J. Biol Chem. (1994) 269:542; Zenke et
al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655; Wu et al., J.
Biol. Chem. (1991) 266:338. Therapeutic compositions containing a
polynucleotide are administered in a range of about 100 ng to about
200 mg of DNA for local administration in a gene therapy protocol.
Concentration ranges of about 500 ng to about 50 mg, about 1 .mu.g
to about 2 mg, about 5 .mu.g to about 500 .mu.g, and about 20 .mu.g
to about 100 .mu.g of DNA can also be used during a gene therapy
protocol. Factors such as method of action (e.g., for enhancing or
inhibiting levels of the encoded gene product) and efficacy of
transformation and expression are considerations which will affect
the dosage required for ultimate efficacy of the antisense
subgenomic polynucleotides. Where greater expression is desired
over a larger area of tissue, larger amounts of antisense
subgenomic polynucleotides or the same amounts readministered in a
successive protocol of administrations, or several administrations
to different adjacent or close tissue portions of, for example, a
tumor site, may be required to effect a positive therapeutic
outcome. In all cases, routine experimentation in clinical trials
will determine specific ranges for optimal therapeutic effect. For
polynucleotide related genes encoding polypeptides or proteins with
anti-inflammatory activity, suitable use, doses, and administration
are described in U.S. Pat. No. 5,654,173.
[0161] The therapeutic polynucleotides and polypeptides of the
present invention can be delivered using gene delivery vehicles.
The gene delivery vehicle can be of viral or non-viral origin (see
generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human
Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995)
1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of
such coding sequences can be induced using endogenous mammalian or
heterologous promoters. Expression of the coding sequence can be
either constitutive or regulated.
[0162] Viral-based vectors for delivery of a desired polynucleotide
and expression in a desired cell are well known in the art.
Exemplary viral-based vehicles include, but are not limited to,
recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO
93/25698; WO 93/25234; U.S. Pat. No. 5, 219,740; WO 93/11230; WO
93/10218; U.S. Pat. No. 4,777,127; GB Patent No. 2,200,651; EP 0
345 242; and WO 91/02805), alphavirus-based vectors (e.g., Sindbis
virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247),
Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine
encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC
VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO
94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO
95/00655). Administration of DNA linked to killed adenovirus as
described in Curiel, Hum. Gene Ther. (1992) 3:147 can also be
employed.
[0163] Non-viral delivery vehicles and methods can also be
employed, including, but not limited to, polycationic condensed DNA
linked or unlinked to killed adenovirus alone (see, e.g., Curiel,
Hum. Gene Ther. (1992) 3:147); ligand-linked DNA(see, e.g., Wu, J.
Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles
cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO
96/17072; WO 95/30763; and WO 97/42338) and nucleic charge
neutralization or fusion with cell membranes. Naked DNA can also be
employed. Exemplary naked DNA introduction methods are described in
WO 90/11092 and U.S. Pat. No. 5,580,859. Liposomes that can act as
gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO
95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional
approaches are described in Philip, Mol. Cell Biol. (1994) 14:2411,
and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
[0164] Further non-viral delivery suitable for use includes
mechanical delivery systems such as the approach described in
Woffendin et al., Proc. Natl. Acad. Sci. USA (1994) 91(24): 11581.
Moreover, the coding sequence and the product of expression of such
can be delivered through deposition of photopolymerized hydrogel
materials or use of ionizing radiation (see, e.g., U.S. Pat. No.
5,206,152 and WO 92/11033). Other conventional methods for gene
delivery that can be used for delivery of the coding sequence
include, for example, use of hand-held gene transfer particle gun
(see, e.g., U.S. Pat. No. 5,149,655); use of ionizing radiation for
activating transferred gene (see, e.g., U.S. Pat. No. 5,206,152 and
WO 92/11033).
[0165] As an alternative to the use of viral vectors other known
methods of introducing nucleic acid into cells includes
electroporation, calcium phosphate co-precipitation, mechanical
techniques such as microinjection, transfer mediated by liposomes
and direct DNA uptake and receptor-mediated DNA transfer. Gene
transfer techniques which selectively target the TTK nucleic acid
to the affected cell type are preferred. Examples of this included
receptor-mediated gene transfer, in which the nucleic acid is
linked to a protein ligand via polylysine, with the ligand being
specific for a receptor present on the surface of the target
cells.
[0166] Screening for Substances Affecting TTK Expression
[0167] The present invention also provides the use of all or part
of the nucleic acid sequence of the TTK promoter and/or enhancer
regions in methods of screening for substances which modulate the
activity of the promoter and increase or decrease the level of TTK
expression. This assay can be performed to identify anti-cancer
agents for therapeutic and/or prophylactic purposes. The level of
promoter activity, i.e., the ability to initiate transcription, is
quantifiable for instance by assessment of the amount of mRNA
produced by transcription from the promoter or by assessment of the
amount of protein product produced by translation of mRNA produced
by transcription from the promoter. The amount of a specific mRNA
present in an expression system may be determined for example using
specific oligonucleotides which are able to hybridize with the mRNA
and which are labeled or may be used in a specific amplification
reaction such as PCR. Use of a reporter gene facilitates
determination of promoter activity by reference to protein
production.
[0168] Generally, a reporter gene under control of the TTK promoter
and/or enhancers may be transcribed into mRNA which may be
translated into a peptide or polypeptide product which may be
detected and preferably quantitated following expression. The
reporter gene preferably encodes an enzyme which catalyses a
reaction which produces a detectable signal, preferably a visually
detectable signal, such as a coloured product. Many examples are
known, including .beta.-galactosidase and luciferase.
.beta.-galactosidase activity may be assayed by production of blue
color on substrate, the assay being by eye or by use of a
spectrophotometer to measure absorbance. Fluorescence, for example
that produced as a result of luciferase activity, may be
quantitated using a spectrophotometer. Radioactive assays may be
used, for instance using choloramphenicol acetyltransferase, which
may also be used in non-radioactive assays. The presence and/or
amount of gene product resulting from expression from the reporter
gene may be determined using a molecule able to bind the product,
such as an antibody or fragment thereof. The binding molecule may
be labeled directly or indirectly using any standard technique.
[0169] Those skilled in the art are well aware of a multitude of
possible reporter genes and assay techniques which may be used to
determine gene activity according to the presently disclosed
methods. Any suitable reporter/assay may be used and the present
invention is intended to encompass such systems.
[0170] Following identification of a substance which modulates or
affects promoter activity, the substance may be investigated
further. Furthermore, it may be manufactured and/or used in
preparation, i.e. manufacture or formulation, of a composition such
as a medicament, pharmaceutical composition or drug.
[0171] Integrated Disease Information System
[0172] The levels of TTK in a sample can be used in an integrated
disease information system to aid in analysis such as proposed
patient interventions, designing clinical trials, performing
pharmacoeconomic analysis, and illustrating disease progression for
various patients over time. For example, TTK information determined
according to the methods of the invention can be used in a system
such as that described in U.S. Pat. No. 6,108,635 issued to Herren,
et al. on Aug. 22, 2000. Such a system can be for collecting the
results of medical treatments given to patients in a plurality of
locations. See, e.g., U.S. Pat. No. 5,713,350 issued to Yokota, et
al. on Feb. 3, 1998.
EXAMPLES
[0173] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g., amounts, temperature, etc.) but some experimental
errors and deviations should be accounted for. Unless indicated
otherwise, parts are parts by weight, molecular weight is weight
average molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
Example 1
Source of Patient Tissue Samples
[0174] Normal and cancerous tissues were collected from patients
using laser capture microdissection (LCM) techniques, which
techniques are well known in the art (see, e.g., Ohyama et al.
(2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol.
53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone
et al (1998) Trends Genet 14:272-6; Conia et al. (1997) J. Clin.
Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science
274:998-1001). Table 1 (inserted following the last page of the
Examples ) provides information about each patient from which the
samples were isolated, including: the Patient ID and Path ReportID,
numbers assigned to the patient and the pathology reports for
identification purposes; the anatomical location of the tumor
(AnatomicalLoc); The Primary Tumor Size; the Primary Tumor Grade;
the Histopathologic Grade; a description of local sites to which
the tumor had invaded (Local Invasion); the presence of lymph node
metastases (Lymph Node Metastasis); incidence of lymph node
metastases (provided as number of lymph nodes positive for
metastasis over the number of lymph nodes examined) (Incidence
Lymphnode Metastasis); the Regional Lymphnode Grade; the
identification or detection of metastases to sites distant to the
tumor and their location (Distant Met & Loc);a description of
the distant metastases (Description Distant Met); the grade of
distant metastasis (Distant Met Grade); and general comments about
the patient or the tumor (Comments). Adenoma was not described in
any of the patients; adenoma dysplasia (described as hyperplasia by
the pathologist) was described in Patient ID No. 695. Extranodal
extensions were described in two patients, Patient ID Nos. 784 and
791. Lymphovascular invasion was described in seven patients,
Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like
infiltrates were described in seven patients, Patient ID Nos. 52,
264, 268, 392, 393, 784, and 791.
Example 2
Differential Expression of TTK
[0175] cDNA probes were prepared from total RNA isolated from the
patient cells described in Example 1. Since LCM provides for the
isolation of specific cell types to provide a substantially
homogenous cell sample, this provided for a similarly pure RNA
sample.
[0176] Total RNA was first reverse transcribed into cDNA using a
primer containing a T7 RNA polymerase promoter, followed by second
strand DNA synthesis. cDNA was then transcribed in vitro to produce
antisense RNA using the T7 promoter-mediated expression (see, e.g.,
Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was
then converted into cDNA. The second set of cDNAs were again
transcribed in vitro, using the T7 promoter, to provide antisense
RNA. Optionally, the RNA was again converted into cDNA, allowing
for up to a third round of T7-mediated amplification to produce
more antisense RNA. Thus the procedure provided for two or three
rounds of in vitro transcription to produce the final RNA used for
fluorescent labeling. Fluorescent probes were generated by first
adding control RNA to the antisense RNA mix, and producing
fluorescently labeled cDNA from the RNA starting material.
Fluorescently labeled cDNAs prepared from the tumor RNA sample were
compared to fluorescently labeled cDNAs prepared from normal cell
RNA sample. For example, the cDNA probes from the normal cells were
labeled with Cy3 fluorescent dye (green) and the cDNA probes
prepared from the tumor cells were labeled with Cy5 fluorescent dye
(red).
[0177] Each array used had an identical spatial layout and control
spot set. Each microarray was divided into two areas, each area
having an array with, on each half, twelve groupings of 32.times.12
spots for a total of about 9,216 spots on each array. The two areas
are spotted identically which provide for at least two duplicates
of each clone per array. Spotting was accomplished using PCR
amplified products from 0.5 kb to 2.0 kb and spotted using a
Molecular Dynamics Gen III spotter according to the manufacturer's
recommendations. The first row of each of the 24 regions on the
array had about 32 control spots, including 4 negative control
spots and 8 test polynucleotides. The test polynucleotides were
spiked into each sample before the labeling reaction with a range
of concentrations from 2-600 pg/slide and ratios of 1:1 . For each
array design, two slides were hybridized with the test samples
reverse-labeled in the labeling reaction. This provided for about 4
duplicate measurements for each clone, two of one color and two of
the other, for each sample.
[0178] The differential expression assay was performed by mixing
equal amounts of probes from tumor cells and normal cells of the
same patient. The arrays were prehybridized by incubation for about
2 hrs at 60.degree. C. in 5.times.SSC/0.2% SDS/1 mM EDTA, and then
washed three times in water and twice in isopropanol. Following
prehybridization of the array, the probe mixture was then
hybridized to the array under conditions of high stringency
(overnight at 42.degree. C. in 50% formamide, 5.times.SSC, and 0.2%
SDS. After hybridization, the array was washed at 55.degree. C.
three times as follows: 1) first wash in 1.times.SSC/0.2% SDS; 2)
second wash in 0.1.times.SSC/0.2% SDS; and 3) third wash in
0.1.times.SSC.
[0179] The arrays were then scanned for green and red fluorescence
using a Molecular Dynamics Generation III dual color
laser-scanner/detector. The images were processed using
BioDiscovery Autogene software, and the data from each scan set
normalized to provide for a ratio of expression relative to normal.
Data from the microarray experiments was analyzed according to the
algorithms described in U.S. application Ser. No. 60/252,358, filed
Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and
entitled "Precision and accuracy in cDNA microarray data," which
application is specifically incorporated herein by reference.
[0180] The experiment was repeated, this time labeling the two
probes with the opposite color in order to perform the assay in
both "color directions." Each experiment was sometimes repeated
with two more slides (one in each color direction). The level
fluorescence for each sequence on the array expressed as a ratio of
the geometric mean of 8 replicate spots/genes from the four arrays
or 4 replicate spots/gene from 2 arrays or some other permutation.
The data were normalized using the spiked positive controls present
in each duplicated area, and the precision of this normalization
was included in the final determination of the significance of each
differential. The fluorescent intensity of each spot was also
compared to the negative controls in each duplicated area to
determine which spots have detected significant expression levels
in each sample.
[0181] A statistical analysis of the fluorescent intensities was
applied to each set of duplicate spots to assess the precision and
significance of each differential measurement, resulting in a
p-value testing the null hypothesis that there is no differential
in the expression level between the tumor and normal samples of
each patient. During initial analysis of the microarrays, the
hypothesis was accepted if p>10.sup.-3, and the differential
ratio was set to 1.000 for those spots. All other spots have a
significant difference in expression between the tumor and normal
sample. If the tumor sample has detectable expression and the
normal does not, the ratio is truncated at 1000 since the value for
expression in the normal sample would be zero, and the ratio would
not be a mathematically useful value (e.g., infinity). If the
normal sample has detectable expression and the tumor does not, the
ratio is truncated to 0.001, since the value for expression in the
tumor sample would be zero and the ratio would not be a
mathematically useful value. These latter two situations are
referred to herein as "on/off." Database tables were populated
using a 95% confidence level (p>0.05).
[0182] The difference in the expression level of TTK in the colon
tumor cells relative to the matched normal colon cells was greater
than or equal to 2 fold (">=2.times.") in 39% of the patients,
greater than or equal to 2.5 fold in 36% of the patients, and
greater than or equal to 5 fold in 27% of the patients
examined.
[0183] Quantitative PCR of a number of normal tissues and tumor
cell lines, particularly colorectal carcinoma cell lines was used
to analyze expression of TTK. Quantitative real-time PCR was
performed by first isolating RNA from cells using a Roche RNA
Isolation kit according to manufacturer's directions. One microgram
of RNA was used to synthesize a first-strand cDNA using MMLV
reverse transcriptase (Ambion) using the manufacturers buffer and
recommended concentrations of oligo dT, nucleotides, and Rnasin.
This first-strand cDNA served as a template for quantitative
real-time PCR using the Roche light-cycler as recommended in the
machine manual. TTK was amplified with the forward primer
CGGAATCAAGTCTTCTAGCT (SEQ ID NO: 1) and reverse primer
GGTTGCTCAAAAGTTGGTATG (SEQ ID NO:2) PCR product was quantified
based on the cycle at which the amplification entered the linear
phase of amplification in comparison to an internal standard and
using the software supplied by the manufacturer. Small differences
in amounts or total template in the first-strand cDNA reaction were
eliminated by normalizing to amount of actin amplified in a
separate quantitative PCR reaction using the forward primer
5'-CGGGAAATCGTGCGTGACATTAAG-3' (SEQ ID NO:3) and the reverse
primer: 5'-TGATCTCCTTCTGCATCCTGTCGG-3' (SEQ ID NO:4). The results
for TTK mRNA levels in normal tissues are shown in FIG. 1; the
results for TTK mRNA levels in tumor cell lines are shown in FIG.
2. A brief description of the cell lines analyzed is provided in
the table below.
1 Cell Line Tissue Source Cell Line Tissue Source MDA-MB-231 Human
breast; high Caco-2 Human colorectal metastatic potential
adenocarcinoma (micromets in lung; adenocarcinoma; pleural effusion
MDA-MB-435 Human breast, high SW620 Human colorectal metastatic
potential adenocarcinoma; (macrometastases in from metastatic lung)
site (lymph node) MCF-7 Human breast; non- LS174T High metastatic
metastatic potential human colorectal adenocarcinoma MDA-MB-468
Human breast; LOVO Human colorectal adenocarcinoma adenocarcinoma;
colon; from metastatic site (colon) Alab Human breast, HT29 Human
colorectal metastatic adenocarcinoma; colon SKOV3 Human ovarian
SW480 Human colorectal adenocarcinoma adenocarcinoma; colon OVCAR3
Human ovarian HCT116 Human colorectal adenocarcinoma carcinoma;
colon KM12C Human colon; low Colo 320DN Human colorectal metastatic
potential adenocarcinoma; colon KM12L4 Human colon; high T84 Human
colorectal metastatic potential carcinoma; colon; (derived from
from metastatic site Km12C) (lung) DU 145 Human prostate; HCT15
Human colorectal carcinoma; from adenocarcinoma; metastatic site:
brain colon HT1080 Human sarcoma cell CCD112 Human colorectal line;
adenocarcinoma, low metastatic potential HMVEC Primary human DLD1
Human colon; microvascular colorectal endothelial cells
adenocarcinoma 184B5 normal breast 293 kidney epithelial epithelial
cells; cells chemically trans- formed LNCAP prostate carcinoma;
GRDP2 primary prostate metastasis to left epithelium
supraclavicular lymph U373MG glioblastoma cell IMR90 primary lung
fibroblast WOCA primary prostate PC3 prostate cancer; epithelium
androgen receptor negative
[0184] TTK was expressed in normal cells (FIG. 1), with thymus and
testis identified as the normal tissues that most highly expressed
the gene for TTK. Numerous cancer cells, however, displayed a
significantly elevated level of TTK expression (FIG. 2) as compared
to most wild-type tissues.
Example 3
Hierarchical Clustering and Stratification of Colon Cancers Using
Differential Expression Data
[0185] Differential expression patterns from Example 2 were
analyzed by applying hierarchical clustering methods to the data
sets (see Eisen et al. (1998) PNAS 95:14863-14868). In short,
hierarchical clustering algorithms are based on the average-linkage
method of Sokal and Michener (Sokal, R R & Michener, C D (1958)
Univ. Kans. Sci. Bull. 38, 1409-1438), which was developed for
clustering correlation matrixes. The object of this algorithm is to
compute a dendrogram that assembles all elements into a single
tree. For any set of n genes, an upper-diagonal similarity matrix
is computed which contains similarity scores for all pairs of
genes. The matrix is scanned to identify the highest value
(representing a similar pair of genes). Using this technique, four
groups of differential expression patterns were identified and
assigned to clusters.
[0186] Application of hierarchical clustering to the data from
Example 2 revealed that IGF2 (insulin-like growth factor 2), TTK
(serine, threonine, tyrosine kinase implicated in the cell cycle),
MAPKAPK2 (mitogen-activated protein (MAP) kinase-activated protein
kinase), and MARCKS (myristoylated alanine-rich C kinase substrate,
which is a substrate of protein kinase C) are concurrently
upregulated as detected in 9 out of the 33 colon cancer patient
samples examined. The data for these experiments is presented in
graphical form in FIGS. 3-6. The concurrent upregulation suggests
that these genes are co-regulated and that patients with an
elevated serum level of IGF2 may be candidates for treatment with
inhibitors to TTK, MAPKAP kinase 2, MARCKS and/or IGF2.
Example 4
Antisense Regulation of TTK Expression
[0187] Additional functional information on TTK was generated using
antisense knockout technology. TTK expression in cancerous cells
was further analyzed to confirm the role and function of the gene
product in tumorgenesis, e.g., in promoting a metastatic
phenotype.
[0188] A number of different oligonucleotides complementary to TTK
mRNA were designed as potential antisense oligonucleotides, and
tested for their ability to suppress expression of TTK. The ability
of each designed antisense oligonucleotide to inhibit gene
expression was tested through transfection into SW620 colon
colorectal carcinoma cells. For each transfection mixture, a
carrier molecule, preferably a lipitoid or cholesteroid, was
prepared to a working concentration of 0.5 mM in water, sonicated
to yield a uniform solution, and filtered through a 0.45 .mu.m PVDF
membrane. The antisense or control oligonucleotide was then
prepared to a working concentration of 100 .mu.M in sterile
Millipore water. The oligonucleotide was further diluted in
OptiMEM.TM. (Gibco/BRL), in a microfuge tube, to 2 .mu.M, or
approximately 20 .mu.g oligo/ml of OptiMEM.TM.. In a separate
microfuge tube, lipitoid or cholesteroid, typically in the amount
of about 1.5-2 nmol lipitoid/pg antisense oligonucleotide, was
diluted into the same volume of OptiMEM.TM. used to dilute the
oligonucleotide. The diluted antisense oligonucleotide was
immediately added to the diluted lipitoid and mixed by pipetting up
and down. Oligonucleotide was added to the cells to a final
concentration of 30 nM.
[0189] The level of target mRNA (TTK) in the transfected cells was
quantitated in the cancer cell lines using the Roche
LightCycler.TM. real-time PCR machine. Values for the target mRNA
were normalized versus an internal control (e.g., beta-actin). For
each 20 .mu.l reaction, extracted RNA (generally 0.2-1 .mu.g total)
was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and
water was added to a total volume of 12.5 .mu.l. To each tube was
added 7.5 .mu.l of a buffer/enzyme mixture, prepared by mixing (in
the order listed) 2.5 .mu.l H.sub.2O, 2.0 .mu.l 10.times.reaction
buffer, 10 .mu.l oligo dT (20 pmol), 1.0 .mu.l dNTP mix (10 mM
each), 0.5 .mu.l RNAsin.RTM. (20 u) (Ambion, Inc., Hialeah, Fla.),
and 0.5 .mu.l MMLV reverse transcriptase (50 u) (Ambion, Inc.). The
contents were mixed by pipetting up and down, and the reaction
mixture was incubated at 42.degree. C. for 1 hour. The contents of
each tube were centrifuged prior to amplification.
[0190] An amplification mixture was prepared by mixing in the
following order: 1.times.PCR buffer II, 3 mM MgCl.sub.2, 140 .mu.M
each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR.RTM. Green,
0.25 mg/ml BSA, 1 unit Taq polymerase, and H.sub.2O to 20 .mu.l.
(PCR buffer II is available in 10.times.concentration from
Perkin-Elmer, Norwalk, Conn.). In 1.times.concentration it contains
10 mM Tris pH 8.3 and 50 mM KCl. SYBR.RTM. Green (Molecular Probes,
Eugene, Oreg.) is a dye which fluoresces when bound to double
stranded DNA. As double stranded PCR product is produced during
amplification, the fluorescence from SYBR.RTM. Green increases. To
each 20 .mu.l aliquot of amplification mixture, 2 .mu.l of template
RT was added, and amplification was carried out according to
standard protocols.
[0191] The following antisense oligonucleotides were shown to
effectively deplete TTK RNA in the transfection assays:
[0192] Oligo 79-5AS: GGGACTCTTCCAAATGGGCATGACT (SEQ ID NO:5)
[0193] Oligo 79-9AS: TCCAGTAACTCTTGCGTTCCCATGG (SEQ ID NO:6)
[0194] The reverse control of each of these antisense
oligonucleotides were synthesized, as were oligonucleotides with
the identical sequence of the antisense oligonucleotides in reverse
orientation (Reverse Control):
[0195] Oligo 79-5RC: TCAGTACGGGTAAACCTTCTCAGGG (SEQ ID NO:7)
[0196] Oligo 79-9RC: GGTACCCTTGCGTTCTCAATGACCT (SEQ ID NO:8)
[0197] The antisense oligonucleotides were introduced into a test
cell and the effect upon TTK expression of the corresponding gene,
as well as the effect induction of the cancerous phenotype, was
examined as described below.
Example 5
Effect of TTK Expression on Proliferation
[0198] The effect of TTK on proliferation was assessed in
metastatic breast cancer cell lines (MDA-MB-231 ("231")), SW620
colon colorectal carcinoma cells, or 847 human immortal fibroblast
cells. Transfection was carried out as described above in Example
4.
[0199] Cells were plated to approximately 60-80% confluency in
96-well dishes. Antisense or reverse control oligonucleotide was
diluted to 2 .mu.M in OptiMEM.TM. and added to OptiMEM.TM. into
which the delivery vehicle, lipitoid 116-6 in the case of SW620
cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231
cells, had been diluted. The oligo/ delivery vehicle mixture was
then further diluted into medium with serum on the cells. The final
concentration of oligonucleotide for all experiments was 300 nM,
and the final ratio of oligo to delivery vehicle for all
experiments was 1.5 nmol lipitoid/.mu.g oligonucleotide. Cells were
transfected overnight at 37.degree. C. and the transfection mixture
was replaced with fresh medium the next morning.
[0200] Transfection of the antisense oligonucleotides into both
SW620 colorectal carcinoma cells (FIG. 7) and 231 cells (FIG. 8)
resulted in a decreased rate of proliferation compared to matched
reverse control (RC) and oligonucleotides, but no inhibition of
growth of 847 human immortal fibroblast cells (FIG. 11), suggesting
possible tissue or transformation specificity in the functional
role for the TTK protein.
Example 6
Effect of TTK Expression on Colony Formation
[0201] The effect of TTK expression upon colony formation was
tested in a soft agar assay. Soft agar assays were conducted by
first establishing a bottom layer of 2 ml of 0.6% agar in media
plated fresh within a few hours of layering on the cells. The cell
layer was formed on the bottom layer by removing cells transfected
as described above from plates using 0.05% trypsin and washing
twice in media. The cells were counted in a Coulter counter, and
resuspended to 106 per ml in media. 10 .mu.l aliquots are placed
with media in 96-well plates (to check counting with WST1), or
diluted further for soft agar assay. 2000 cells are plated in 800
.mu.l 0.4% agar in duplicate wells above 0.6% agar bottom layer.
After the cell layer agar solidifies, 2 ml of media is dribbled on
top and antisense or reverse control oligo is added without
delivery vehicles. Fresh media and oligos are added every 3-4 days.
Colonies are formed in 10 days to 3 weeks. Fields of colonies were
counted by eye. Wst-1 metabolism values can be used to compensate
for small differences in starting cell number. Larger fields can be
scanned for visual record of differences.
[0202] As shown in FIG. 9, antisense oligonucleotides to TTK
(79-9AS) led to decreased colony size and number compared to
control reverse control oligonucleotides (79-9RC) or to control
oligonucleotides (52-3AS: TAGGTCTTTGGCCGGTGATGGGTCG (SEQ ID NO:9)
and 52-3RC: GCTGGGTAGTGGCCGGTTTCTGGAT (SEQ ID NO:10)). The 52-3
antisense oligonucleotide is directed to the hD53 mRNA, and serves
as a negative control in the experiment.
Example 7
Induction of Cell Death Upon Depletion of TTK ("Antisense
Knockout")
[0203] SW620 cells were transfected as described for proliferation
assays. For cytotoxic effect in the presence of cisplatin (cis),
the same protocol was followed but cells were left in the presence
of 2 .mu.M drug. Each day, cytotoxicity was monitored by measuring
the amount of LDH enzyme released in the medium due to membrane
damage. The activity of LDH was measured using the Cytotoxicity
Detection Kit from Roche Molecular Biochemicals. The data is
provided as a ratio of LDH released in the medium vs. the total LDH
present in the well at the same time point and treatment
(rLDH/tLDH). A positive control using antisense and reverse control
oligonucleotides for BCL2 (a known anti-apoptotic gene) shows that
loss of message for BCL2 leads to an increase in cell death
compared with treatment with the control oligonucleotide
(background cytotoxicity due to transfection).
[0204] The following antisense oligonucleotides were tested for the
ability to deplete the message levels of the gene corresponding to
the indicated cluster. Oligo Name: AS or RC provides the name of
the target gene or name of the oligo, and whether the oligo is
antisense (AS) or a reverse control (RC).
2 Oligo Name: Antisense (AS) or Reverse Control (RC) Oligo Sequence
SEQ ID NO: Chir39-5:AS ACTCATCTGGCTGGGCTATGGTGGT SEQ ID NO:11
Chir39-5:RC TGGTGGTATCGGGTCGGTCTACTCA SEQ ID NO:12 Chir79-9:AS
TCCAGTAACTCTTGCGTTCCCATGG SEQ ID NO:6 Chir79-9:RC
GGTACCCTTGCGTTCTCAATGACCT SEQ ID NO:8
[0205] As shown in FIG. 12, Chiron 79-9 (TTK) antisense does not
sensitize the cells to treatment by cisplatin at a detectable
level, but leads to increased death compared to control oligo at
day 3.
Example 8
Sample Assay for Agents that Modulate TTK Activity
[0206] This assay may be performed in microtitre plates. TTK was
purified as a 6.times.IIis tagged fusion protein using a
baculovirus expression system. Essentially 20 ul of 20 nM TTK (100
k Da) in TTK kinase buffer comprising 50 mM Hepes pH 7.4, 2mM
MgCl.sub.2, 10 mM MnCl.sub.2, 1 mM NaF, 50 mM NaCl, 1 mM DTT and 1
mg/ml BSA was added to 5 ul of a candidate agent diluted in 20%
DMSO, 10 ul of a 2.8 uM solution of a biotinylated substrate
peptide derived from cdc25, such as
Biotin-SGSGSGLYRSPSMPENLNRPR-NH2 (SEQ ID NO:27) or
Biotin-GGGGLYRSPSMPENLNRK-OH (SEQ ID NO:28) and 5 ul of 80 nM
.sup.33P-.gamma.ATP in a well of a microtitre plate. Samples were
mixed, incubated for 2 hours and each reaction is terminated using
20 ul of 0.5 M EDTA pH 8.0. 50 ul of the sample is transferred to a
96 well flat bottom Streptavidin coated flash plate, and the sample
is incubated with the plate for 1 hr at room temperature. The wells
of the plate are washed four times with 250 ul of calcium and
magnesium-free phosphate buffered saline, and scintillation fluid
is added to the sample. Activity of TTK was measured by calculating
the emission of .sup.33P, transferred by TTK from
.sup.33P-.gamma.ATP to a substrate peptide, by scintillation.
[0207] Agents modulating TTK activity can be identified by
comparing the activity of TTK in the presence of a candidate agent
to the activity of TTK in the absence of a candidate agent.
[0208] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the invention.
Sequence CWU 0
0
* * * * *