U.S. patent application number 09/817513 was filed with the patent office on 2003-03-06 for cytoplasmic modulators of integrin regulation/signaling.
This patent application is currently assigned to ICOS Corporation. Invention is credited to Lispky, Brian P., Staunton, Donald E..
Application Number | 20030044958 09/817513 |
Document ID | / |
Family ID | 24534733 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030044958 |
Kind Code |
A1 |
Staunton, Donald E. ; et
al. |
March 6, 2003 |
Cytoplasmic modulators of integrin regulation/signaling
Abstract
The present invention provides purified and isolated
polynucleotides encoding IRP polypeptides which regulate
.beta..sub.2 and .beta..sub.7 integrins and which are contemplated
to participate in integrin signaling and/or recycling pathways.
Also provided are methods for identifying modulators of IRP
activities and methods for identifying other proteins which
interact with IRP polypeptides in signaling pathways. Modulators of
IRP interactions are contemplated to be useful, for example, in
monitoring and treating inflammatory processes involving
leukocytes.
Inventors: |
Staunton, Donald E.;
(Kirkland, WA) ; Lispky, Brian P.; (Seattle,
WA) |
Correspondence
Address: |
MARSHALL, O'TOOLE, GERSTEIN, MURRAY & BORUN
6300 SEARS TOWER
233 SOUTH WACKER DRIVE
CHICAGO
IL
60606-6402
US
|
Assignee: |
ICOS Corporation
|
Family ID: |
24534733 |
Appl. No.: |
09/817513 |
Filed: |
March 26, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09817513 |
Mar 26, 2001 |
|
|
|
09023591 |
Feb 13, 1998 |
|
|
|
09023591 |
Feb 13, 1998 |
|
|
|
08839581 |
Apr 15, 1997 |
|
|
|
08839581 |
Apr 15, 1997 |
|
|
|
08632247 |
Apr 15, 1996 |
|
|
|
Current U.S.
Class: |
435/226 ;
435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12N 5/16 20130101; C07K
2319/00 20130101; C07K 14/4702 20130101 |
Class at
Publication: |
435/226 ;
435/69.1; 435/325; 435/320.1; 536/23.2 |
International
Class: |
C07H 021/04; C12N
009/64; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. A purified and isolated polynucleotide encoding the human IRP-1
amino acid sequence set out in SEQ ID NO: 2.
2. A purified and isolated polynucleotide encoding the human IRP-2
amino acid sequence set out in SEQ ID NO: 4.
3. The polynucleotide of claim 1 or 2 which is a DNA molecule.
4. The DNA of claim 3 which is selected from the groups consisting
of cDNA, genomic DNA, partially synthesized DNA, and wholly
synthesized DNA.
5. A DNA molecule comprising the human IRP-1 Polypeptide coding
region sequence set out in SEQ ED NO: 1.
6. A DNA molecule comprising the human IRP-2 polypeptide coding
region sequence set out in SEQ ID NO: 3.
7. A DNA molecule encoding an IRP polypeptide selected from the
group consisting of: a) the human IRP-1 DNA set out in SEQ ID NO:
1; b) the human IRP-2 DNA set out in SEQ ID NO: 3; c) a DNA
molecule which hybridizes under stringent conditions to the
noncoding strand of the protein coding portion of (a); and d) a DNA
molecule which hybridizes under stringent conditions to the
noncoding strand of the protein coding portion of (b).
8. A DNA expression construct comprising the DNA of claim 1, 2 or
7.
9. A host cell transformed or transfected with the DNA of claim 1,
2 or 7.
10. A method for producing an IRP polypeptide comprising growing
the host cell of claim 9 in a suitable medium and isolating the IRP
polypeptide from the host cell or the medium of its growth.
11. A purified and isolated polypeptide comprising the IRP-1 amino
acid sequence set out in SEQ ID NO: 2.
12. A purified and isolated polypeptide comprising the IRP-2 amino
acid sequence set out in SEQ ID NO: 4.
13. An antibody which specifically binds to IRP-1.
14. An antibody which specifically binds to IRP-2.
15. The antibody of claim 13 or 14 which is a monoclonal
antibody.
16. An anti-idiotype antibody which specifically binds to the
monoclonal antibody of claim 13 or 14.
17. A hybridoma cell line producing the monoclonal antibody of
claim 13 or 14.
18. Hybridoma cell line 200A (ATCC HB-12331).
19. A monoclonal antibody produced by the hybridoma cell line of
claim 18.
20. Hybridoma cell line 200B (ATCC HB-12332).
21. A monoclonal antibody produced by the hybridoma cell line of
claim 20.
22. Hybridoma cell line 233G (ATCC HB-12333)
23. A monoclonal antibody produced by the hybridoma cell line of
claim 22.
24. A method for identifying a compound that modulates binding
between IRP-1 and a .beta. integrin subunit comprising the steps
of: a) contacting IRP-1 or a fragment thereof, with a .beta.
integrin subunit or a fragment thereof; b) measuring binding
between IRP-1 or a fragment thereof, and .beta. integrin subunit or
a fragment thereof; c) measuring binding between IRP-1 or a
fragment thereof, and a .beta. integrin subunit or a fragment
thereof in the presence of a test compound, and d) comparing the
measurement in step (b) and the measurement in step (c) wherein a
decrease in binding in step (c) indicates the test compound in an
inhibitor of binding, and an increase in binding in step (c)
indicates the test compound is an activator of binding.
25. A method for identifying a compound that modulates binding
between IRP-2 and a .beta. integrin subunit comprising the steps
of: a) contacting IRP-2 or a fragment thereof, with a .beta.
integrin subunit or a fragment thereof; b) measuring binding
between IRP-2 or a fragment thereof, and a .beta. integrin subunit
or a fragment thereof; c) measuring binding between IRP-2 or a
fragment thereof, and a .beta. integrin subunit or a fragment
thereof in the presence of a test compound, and d) comparing the
measurement in step (b) and the measurement in step (c) wherein a
decrease in binding in step (c) indicates the test compound in an
inhibitor of binding, and an increase in binding in step (c)
indicates the test compound is an activator of binding.
26. A method for identifying a compound that modulates binding
between IRP-1 and ADP ribosylation factor (ARF) comprising the
steps of: a) contacting IRP-1 or a fragment thereof, with ARF or a
fragment thereof; b) measuring binding between IRP-1 or a fragment
thereof, and ARF or a fragment thereof; c) measuring binding
between IRP-1 or a fragment thereof, and ARF or a fragment thereof
in the presence of a test compound, and d) comparing the
measurement in step (b) and the measurement in step (c) wherein a
decrease in binding in step (c) indicates the test compound is an
inhibitor of binding, and an increase in binding in step (c)
indicates the test compound is an activator of binding.
27. A method for identifying a compound that modulates binding
between IRP-2 and ADP ribosylation factor (ARF) comprising the
steps of: a) contacting IRP-2 or a fragment thereof, with ARF or a
fragment thereof; b) measuring binding between IRP-2 or a fragment
thereof, and ARF or a fragment thereof; c) measuring binding
between IRP-2 or a fragment thereof, and ARF or a fragment thereof
in the presence of a test compound, and d) comparing the
measurement in step (b) and the measurement in step (c) wherein a
decrease in binding in step (c) indicates the test compound is an
inhibitor of binding, and an increase in binding in step (c)
indicates the test compound is an activator of binding.
28. A method for identifying a compound that modulates binding
between IRP-1 and phosphatidyl inositol (PI) comprising the steps
of: a) contacting IRP-1 or a fragment thereof, with PI; b)
measuring binding between IRP-1 or a fragment thereof, and PI; c)
measuring binding between IRP-1 or a fragment thereof, and PI in
the presence of a test compound, and d) comparing the measurement
in step (b) and the measurement in step (c) wherein a decrease in
binding in step (c) indicates the test compound is an inhibitor of
binding, and an increase in binding in step (c) indicates the test
compound is an activator of binding.
29. A method for identifying a compound that modulates binding
between IRP-2 and phosphatidyl inositol (PI) comprising the steps
of: a) contacting IRP-2 or a fragment thereof, with PI; b)
measuring binding between IRP-2 or a fragment thereof, and PI; c)
measuring binding between IRP-2 or a fragment thereof, and PI in
the presence of a test compound, and d) comparing the measurement
in step (b) and the measurement in step (c) wherein a decrease in
binding in step (c) indicates the test compound is an inhibitor of
binding, and an increase in binding in step (c) indicates the test
compound is an activator of binding.
30. A method for isolating a polynucleotide encoding a protein that
binds to IRP-1 comprising the steps of: a) transforming or
transfecting appropriate host cells with a DNA construct comprising
a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA-binding domain and an activating
domain; b) expressing in said host cells a first hybrid DNA
sequence encoding a first fusion of part or all of IRP-1 and either
the DNA binding domain or the activating domain of said
transcription factor; c) expressing in said host cells a library of
second hybrid DNA sequences encoding second fusions of part or all
of putative IRP-1 binding proteins and the DNA binding domain or
activating domain of said transcription factor which is not
incorporated in said first fusion; d) detecting binding of an IRP-1
binding protein to IRP-1 in a particular host cell by detecting the
production of reporter gene product in said host cell; and e)
isolating second hybrid DNA sequences encoding IRP-1 binding
protein from said particular host cell.
31. A method for isolating a polynucleotide encoding a protein that
binds to IRP-2 comprising the steps of: a) transforming or
transfecting appropriate host cells with a DNA construct comprising
a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA-binding domain and an activating
domain; b) expressing in said host cells a first hybrid DNA
sequence encoding a first fusion of part or all of IRP-2 and either
the DNA binding domain or the activating domain of said
transcription factor; c) expressing in said host cells a library of
second hybrid DNA sequences encoding second fusions of part or all
of putative IRP-2 binding proteins and the DNA binding domain or
activating domain of said transcription factor which is not
incorporated in said first fusion; d) detecting binding of an IRP-2
binding protein to IRP-2 in a particular host cell by detecting the
production of reporter gene product in said host cell; and e)
isolating second hybrid DNA sequences encoding IRP-2 binding
protein from said particular host cell.
Description
[0001] This application is a continuation-in-part application of
co-pending U.S. patent application Ser. No. 08/632,247 filed Apr.
15, 1996.
FIELD OF THE INVENTION
[0002] The present invention generally relates to proteins involved
in integrin signaling pathways. More specifically, the invention
relates to a family of proteins, named integrin regulatory proteins
(IRPs) herein, which regulate integrin activities and to two
members of that protein family designated IRP-1 and IRP-2.
BACKGROUND
[0003] The integrins are heterodimeric surface molecules comprised
of an .alpha. and .beta. subunit in non-covalent association. All
integrins are transmembrane proteins with counter-receptor binding
activity localized in the extracellular domain. Integrins also
possess relatively short cytoplasmic regions which participate in
transmembrane signaling events. Integrins are capable of
interacting with other cell-bound counter-receptors and components
of the extracellular matrix, as well as soluble factors. Binding of
extracellular ligands leads to crosslinking and localized
clustering of integrins [Miyamoto, et al., Science, 267: 833
(1995)] and formation of focal adhesions wherein the clustered
integrin cytoplasmic domains associate with cytoskeletal components
including, for example, actin filaments [Pavalko and Otey, Proc.
Soc. Exp. Biol. Med., 205: 32767 (1994) and Gumbiner, Neuron, 11:
551 (1993)]. While most investigations into integrin physiological
activity have focused on identifying specific extracellular
counter-receptors, less is known about the specific interactions of
integrins with cytoplasmic components. Mutation studies, however,
have indicated that the cytoplasmic sequences are required for
integrin association with focal contacts [LaFlamme, et al., J.
Cell. BioL, 117: 437 (1992)].
[0004] While numerous integrins have been identified, certain
subsets are unique to leukocytes, with each member of the subset
having characteristic cell-specific expression and counter-receptor
binding properties. Of leukocyte-specific integrins, at least three
.beta..sub.2 integrins are known, each comprised of a unique
.alpha. subunit in association with a .beta..sub.2 subunit
(designated CD18) [Kishimoto, et al., Cell, 48: 681-690 (1987)].
For a review of the state of the art with regard to .beta..sub.2
integrins, see Springer, Cell, 76: 301-314 (1994). CD11a/CD18, also
known as .alpha..sub.L.beta..sub.2 or LFA-1, is expressed on all
leukocytes and has been shown to bind to ICAM-1, ICAM-2, and
ICAM-3. CD11b/CD18, also know as .alpha..sub.M.beta..sub.2 or
Mac-1, is expressed on polymorphonu-clear neutrophils, monocytes
and eosinophils and has been shown to bind to ICAM-1, complement
factor iC3b, factor X, and fibrinogen. CD11c/CD18, also known as
.alpha..sub.x.beta..sub.2 or p150/95, is expressed on monocytes,
polymorphonu-clear neutrophils and eosinophils and has been shown
to bind to complement factor iC3b and fibrinogen. In addition, a
fourth human .beta..sub.2 integrin, designated
.alpha..sub.d.beta..sub.2, has recently been identified [Van der
Vieren, et al., Immunity, 3: 683-690 (1995)].
[0005] The .beta..sub.7 integrin subunit, in association with an
.alpha..sub.4 subunit is expressed predominately on leukocytes. The
cell surface heterodimer recognizes a gut homing counterreceptor
designated the mucosa addressin cell adhesion molecule (MadCAM) and
appears to play a pivotal role in lymphocyte binding to intestinal
tissue [Berlin, et al., Cell 74:185-195 (1993)].
.alpha..sub.4.beta..sub.7 has also been shown to bind to VCAM [Chan
et al., J. Biol. Chem. 267:8366-8370 (1992)]. In a manner similar
to action previously associated only with selectin surface
molecules, .alpha..sub.4.beta..sub.7 has been shown to participate
in selectin-independent lymphocyte attachment to inflamed venules
under flow conditions [Berlin, et al, Cell 80:413-422 (1995).
Animal models using antibodies immunospecific for the .alpha..sub.4
subunit have suggested that .alpha..sub.4.beta..sub.7, or
.alpha..sub.4 in associated with the .beta..sub.1 integrin subunit,
may play a role in numerous disease states, including, for example,
experimental allergic encephalomyelitis [Yednock, et al., Nature
356:63-66 (1992); Baron, et al., J. Exp. Med. 177:57-68 (1993)];
contact hypersensitivity [Ferguson and Kupper, J. Immunol.
150:1172-1182 (1993); Chisholm, et al., Eur. J. Immunol. 23:682-688
(1993)]; and non-obese diabetes [Yang, et al., Proc. Natl. Acad.
Sci. (USA) 90:10494-10498 (1993); Burkly, et al., Diabetes
43:529-534 (1994); Baron, et al., J. Clin. Invest. 93:1700-1708
(1994)].
[0006] The integrins have been shown to be one of the major types
of proteins involved in trafficking of leukocytes throughout the
body. Leukocytes constantly recirculate between lymphoid organs and
other tissues by passing from lymph and blood through the
endothelial cell layer of the vasculature and penetrating the
underlying tissue. One component of inflammatory and autoimmune
diseases is the influx of leukocytes to inflammatory sites.
Resolution of inflammation at such sites can be accomplished with
monoclonal antibodies immunospecific for integrins which block or
inhibit leukocyte function. For review, see Lobb and Hemler, J.
Clin.Invest. 94:1722-1728 (1994). Modulation of integrin function
is one way in which resolution of inflammation may be effected, but
little is known about the specific cytoplasmic components of
integrin regulation and signaling.
[0007] Liu and Pohajdak, Biochimica et Biophysica Acta, 1132: 75-58
(1992) describes a human cDNA clone named B2-1 which encodes a
protein having domains homologous to the yeast SEC7 protein, squid
kinesin, pleckstrin, and dynamin. The article states that since
B2-1 is homologous to only a small portion of the yeast SEC7
protein it has not been unequivocally proven that B2-1 is the human
homologue of the yeast protein, which is unlikely given
dissimilarities outside the SEC7 motif. The article postulates that
B2-1 may be involved in the re-orientation of the golgi/secretory
granules of NK cells toward target cells during cytolysis. Schiller
and Kolanus ["A dominant negative effect of the human Sec7 PH
domain on .beta..sub.2 integrin mediated binding to ICAM-1," 3rd
Adhesion Meeting of the German Immunology Association, Regensburg,
Germany, Mar. 14-15, 1995] describe a human protein having similar
motifs which interacts with the cytoplasmic domain of .beta..sub.2
integrins and report that overexpression of the PH domain of the
protein results in a strong dominant negative effect on the
activation dependent avidity Of .beta..sub.2 integrins in Jurkat
cells. However, Schiller and Kolanus do not show: (i) the existence
of integrin regulatory proteins (IRPs) which preferentially
interact with and/or modulate integrins activity, (ii) IRPs which,
when co-transfected with integrin-encoding DNA in COS cells,
regulate de novo expression of the co-transfected integrin, or
(iii) IRPs which modulate attachment and rolling of JY cells under
flow conditions
[0008] Thus there exists a need in the art to identify molecules
which bind to and/or modulate the binding and/or signaling
activities of the integrins and to develop methods by which these
molecules can be identified. The methods, and the molecules thereby
identified, will provide practical means for therapeutic
intervention in integrin-mediated immune and inflammatory
responses.
BRIEF DESCRIPTION OF THE INVENTION
[0009] The present invention provides novel human IRPs that are
cytoplasmic components of .beta..sub.2 and/or .beta..sub.7 integrin
regulatory and/or signaling pathways.
[0010] In one of its aspects, the present invention provides
purified and isolated polynucleotides (e.g., DNAs and RNAs, both
coding and non-coding strands thereof) encoding IRP-1 and IRP-2.
Polynucleotides contemplated by the invention include genomic DNAs,
RNAs, cDNAs and wholly or partially chemically synthesized DNAs.
Preferred polynucleotides of the invention comprise the IRP-1 DNA
sequence set out in SEQ ID NO: 1, the IRP-2 DNA sequence set out in
SEQ ID NO: 2, and DNA sequences which hybridize to the noncoding
strands thereof under stringent conditions or which would hybridize
but for the redundancy of the genetic code. Exemplary stringent
hybridization conditions are as follows: hybridization at
42.degree. C. in 5X SSPE, 45% formamide and washing at 65.degree.
C. in 0.2X SSC or at 50.degree. C. in 1X SSC. It is understood by
those of skill in the art that variation in these conditions occurs
based on the length and GC nucleotide base content of the sequences
to be hybridized. Formulas standard in the art are appropriate for
determining exact hybridization conditions. See Sambrook et al.,
9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York (1989).
[0011] The DNA sequence information provided by the present
invention makes possible the identification and isolation of DNAs
encoding related molecules by well-known techniques such as DNA/DNA
hybridization as described above and polymerase chain reaction
(PCR) cloning. As one series of examples, knowledge of the sequence
of cDNAs encoding IRPs makes possible the isolation by DNA/DNA
hybridization of genomic DNA sequences encoding the IRPs and
expression control regulatory sequences such as promoters,
operators and the like. DNA/DNA hybridization procedures carried
out with DNA sequences of the invention under stringent conditions
are likewise expected to allow the isolation of DNAs encoding
allelic variants of the IRPs; non-human species proteins homologous
to the IRPS; and other structurally related proteins sharing one or
more of the abilities to interact with members or regulators of the
.beta..sub.2 and/or .beta..sub.7 integrin regulation pathway(s) in
which IRPs participate. Polynucleotides of the invention when
detectably labelled are also useful in hybridization assays to
detect the capacity of cells to synthesize IRPs. The DNA sequence
information provided by the present invention also makes possible
the development, by homologous recombination or "knockout"
strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of
rodents that fail to express functional IRPs or that express
variant IRPs. Such rodents are useful as models for studying the
activities of IRPs and IRP modulators in vivo. Polynucleotides of
the invention may also be the basis for diagnostic methods useful
for identifying a genetic alteration(s) in an IRP locus that
underlies a disease state or states. Also made available by the
invention are anti-sense polynucleotides relevant to regulating
expression of IRPs by those cells which ordinarily express the
same.
[0012] The invention also provides autonomously replicating
recombinant constructions such as plasmid and viral DNA vectors
incorporating polynucleotides of the invention, especially vectors
in which the polynucleotides are functionally linked to an
endogenous or heterologous expression control DNA sequence and a
transcription terminator.
[0013] According to another aspect of the invention, host cells,
especially unicellular host cells such as prokaryotic and
eukaryotic cells, are stably transformed or transfected with DNAs
of the invention in a manner allowing expression of IRPs therein.
Host cells of the invention are conspicuously useful in methods for
the large scale production of IRPs wherein the cells are grown in a
suitable culture medium and the desired proteins are isolated from
the cells or from the medium in which the cells are grown.
[0014] IRP polypeptide products having part or all of the amino
acid sequence set out in SEQ ID NO: 2 (IRP-1) and SEQ ID NO: 4
(IRP-2) are contemplated. Use of mammalian host cells is expected
to provide for such post-translational modifications (e.g.,
myristoylation, glycosylation, truncation, lapidation and tyrosine,
serine or threonine phosphorylation) as may be needed to confer
optimal biological activity on recombinant expression products of
the invention. Fusion polypeptides are also provided wherein IRP
amino acid sequences are expressed contiguously with amino acid
sequences derived from other polypeptides. Fusion polypeptides of
the invention include those with modified biological, biochemical,
and/or immunological properties in comparison to the naturally
occurring polypeptide. Multimeric forms of the IRPs are also
contemplated. The polypeptide products of the invention may be full
length polypeptides, fragments or variants. Variants comprise IRP
products wherein one or more of the specified (i.e., naturally
encoded) amino acids is deleted or replaced or wherein one or more
nonspecified amino acids are added: (1) without loss of the ability
to interact with members or regulators of the .beta..sub.2 and/or
.beta..sub.7 signaling pathway or (2) with disablement of the
ability to interact with members or regulators of the .beta..sub.2
and/or .beta..sub.7 signaling pathway. Proteins which interact with
IRPs may be identified by various assays.
[0015] A first assay contemplated by the invention is a two-hybrid
screen. The two-hybrid system was developed in yeast [Chien et al.,
Proc. NatL. Acad. Sci. (USA), 88: 9578-9582 (1991)] and is based on
functional in vivo reconstitution of a transcription factor which
activates a reporter gene. Specifically, a polynucleotide encoding
a protein that interacts with IRPs is isolated by: transforming or
transfecting appropriate host cells with a DNA construct comprising
a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA binding domain and an activating
domain; expressing in the host cells a first hybrid DNA sequence
encoding a first fusion of part or all of an IRP and either the DNA
binding domain or the activating domain of the transcription
factor; expressing in the host cells a library of second hybrid DNA
sequences encoding second fusions of part or all of putative IRP
binding proteins and the DNA binding domain or activating domain of
the transcription factor which is not incorporated in the first
fusion; detecting binding of an IRP interacting protein to IRPs in
a particular host cell by detecting the production of reporter gene
product in the host cell; and isolating second hybrid DNA sequences
encoding the interacting protein from the particular host cell.
Presently preferred for use in the assay are a GAL4 upstream
activation sequence to drive expression of the lacZ reporter gene,
a transcription factor comprising the GAL4 DNA binding domain and
the GAL4 transactivation domain, and yeast host cells.
[0016] Other assays for identifying proteins that interact with
IRPs may involve immobilizing IRPs or a test protein, detectably
labelling the non-immobilized binding partner, incubating the
binding partners together and determining the amount of label
bound. Bound label indicates that the test protein interacts with
IRPs.
[0017] Another type of assay for identifying IRP interacting
proteins involves immobilizing IRPs or fragments thereof on a solid
support coated (or impregnated with) a fluorescent agent, labelling
a test protein with a compound capable of exciting the fluorescent
agent, contacting the immobilized IRPs with the labelled test
protein, detecting light emission by the fluorescent agent, and
identifying interacting proteins as test proteins which result in
the emission of light by the fluorescent agent. Alternatively, the
putative interacting protein may be immobilized and IRPs may be
labelled in the assay.
[0018] Also comprehended by the present invention are antibody
products and other binding proteins (such as those identified in
the assays above) which are specific for the IRPs of the invention.
Antibody products of the invention include monoclonal, polyclonal,
anti-idiotypic, and recombinant (i.e., humanized, chimeric, etc.)
antibodies and fragments thereof. Cell lines (e.g., hybridoma cell
lines) producing antibody products of the invention are
contemplated. Binding proteins can be developed using isolated
natural or recombinant IRP polypeptide products. The binding
proteins are useful, in turn, for purifying recombinant and
naturally occurring IRP polypeptide products and identifying cells
producing such products. Assays for the detection and
quantification of proteins in cells and in fluids may involve a
single antibody substance or multiple antibody substances in a
"sandwich" assay format. The binding proteins are also manifestly
useful in modulating (i.e., blocking, inhibiting, or stimulating)
IRP interactions with .beta..sub.2 and/or .beta..sub.7 integrin
signaling pathway components.
[0019] Specifically illustrating the monoclonal antibodies of the
present invention are monoclonal antibodies produced by hybridoma
cell lines 200A, 200B and 233G. These cell lines were deposited
with the American Type Culture Collection (ATCC), 12301 Parklawn
Drive, Rockville, Md. 20852 on Apr. 2, 1997. The deposit number for
200A is HB-12331, 200B is HB-12332 , and 233G is HB-12333.
[0020] Assays for identifying compounds that modulate interaction
of IRPs with other proteins or lipids may involve: transforming or
transfecting appropriate host cells with a DNA construct comprising
a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA-binding domain and an activating
domain; expressing in the host cells a first hybrid DNA sequence
encoding a first fusion of part or all of an IRP and the DNA
binding domain or the activating domain of the transcription
factor; expressing in the host cells a second hybrid DNA sequence
encoding part or all of a protein that interacts with IRPs and the
DNA binding domain or activating domain of the transcription factor
which is not incorporated in the first fusion; evaluating the
effect of a test compound on the interaction between the IRP and
the interacting protein by detecting binding of the interacting
protein to IRPs in a particular host cell by measuring the
production of reporter gene product in the host cell in the
presence or absence of the test compound; and identifying
modulating compounds as those test compounds altering production of
the reported gene product in comparison to production of the
reporter gene product in the absence of the modulating compound.
Presently preferred for use in the assay are a GAL4 upstream
activation sequence to drive expression of the reporter gene, the
lacZ reporter gene, a transcription factor comprising the GAL4 DNA
binding domain and the GAL4 transactivation domain, and yeast host
cells.
[0021] Another type of assay for identifying compounds that
modulate the interaction between IRPs and an interacting protein or
lipid involves immobilizing IRPs or a natural IRP interacting
protein, detectably labelling the nonimmobilized binding partner,
incubating the binding partners together and determining the effect
of a test compound on the amount of label bound wherein a reduction
in the label bound in the presence of the test compound compared to
the amount of label bound in the absence of the test compound
indicates that the test agent is an inhibitor of IRP interaction
with the protein. Conversely, an increase in the label bound in the
presence of the test compound compared to the amount of label bound
in the absence of the compound indicates that the putative
modulator is an activator of IRP interaction with the protein.
[0022] Yet another method contemplated by the invention for
identifying compounds that modulate the binding between IRPs and an
interacting protein or lipid involves immobilizing IRPs or
fragments thereof on a solid support coated (or impregnated with) a
fluorescent agent, labelling the interacting protein with a
compound capable of exciting the fluorescent agent, contacting the
immobilized IRPs with the labelled interacting protein in the
presence and absence of a test compound, detecting light emission
by the fluorescent agent, and identifying modulating compounds as
those test compounds that affect the emission of light by the
fluorescent agent in comparison to the emission of light by the
fluorescent agent in the absence of the test compound.
Alternatively, the IRP interacting protein may be immobilized and
IRPs may be labelled in the assay.
[0023] Modulators of IRPs may affect ARF, PI, .beta..sub.1,
.beta..sub.2, .beta..sub.3 and/or .beta..sub.7 integrin regulation
and signaling activities, IRP localization in the cell, and/or IRP
interaction with members of the ARF, PI, .beta..sub.1,
.beta..sub.2, .beta..sub.3 and/or .beta..sub.7 integrin signaling
pathways. Combinatorial libraries, peptide and peptide mimetics,
defined chemical entities, oligonucleotides, and natural product
libraries may be screened for activity as modulators in assays such
as those described above. Selective modulators may include, for
example, polypeptides or peptides which specifically bind to IRPs
or IRP nucleic acid, oligonucleotides which specifically bind to
IRPs or IRP nucleic acid, and/or other non-peptide compounds (e.g.,
isolated or synthetic organic molecules) which specifically react
with IRPs or IRP nucleic acid. Mutant forms of IRPs which affect
the binding activity or cellular localization of wild-type IRPs are
also contemplated by the invention. Modulators of ARF, PI,
.beta..sub.1, .beta..sub.2, .beta..sub.3 or .beta..sub.7/IRP
interaction identified by the methods of the invention are utilized
in vitro or in vivo to affect inflammatory processes involving
leukocytes. In addition, modulating compounds which bind to ARF,
PI, .beta..sub.1, .beta..sub.2, .beta..sub.3 and/or .beta..sub.7
integrins or IRPs are useful in monitoring the levels of ARF, PI,
.beta..sub.1, .beta..sub.2, .beta..sub.3 and/or .beta..sub.7 in
biological samples including body fluids or biopsies tissue.
[0024] IRP modulators may be formulated in compositions comprising
pharmaceutically acceptable carriers. Dosage amounts indicated
would be sufficient to result in modulation of IRP/.beta..sub.1,
.beta..sub.2, .beta..sub.3 or .beta..sub.7 integrin signaling or
regulation in vivo.
[0025] Numerous other aspects and advantages of the present
invention will be apparent upon consideration of the following
detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 presents a graph showing the ability of JY cells,
expressing the indicated polypeptides, to bind to VCAM-1.
[0027] FIG. 2 presents a graph showing the ability of JY cells,
expressing the indicated polypeptides, to bind to ICAM-1.
[0028] FIG. 3 shows an alignment of the amino acid sequences of
IRP-1, IRP-2, B2-1 and a C. elegans homolog of B2-1.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention is illustrated by the following
examples wherein Example 1 describes the isolation of cDNAs
encoding IRP-1 and IRP-2 and Example 2 provides an analysis of the
domain structure of the IRP-1 and IRP-2 proteins encoded by the
cDNAs. Recombinant expression constructs containing the full length
IRP cDNAs and cDNAs encoding IRP domains and IRP mutations are
described in Example 3. Presented in Example 4 are the results of
assays in which the effects of recombinant expression of the IRPs
on host cell adhesion are analyzed, including the role of IRPs on
cell adhesion to ICAM-1 and VCAM-1, the role of IRPs in cell
surface expression of integrins, and subcellular localization of
IRPs. Example 5 describes the preparation of a stably transformed
JY cell line (JY-8) that stably expresses IL-8 receptor and its use
in determining the role of IRPs on IL-8-dependent and
PMA-stimulated cell adhesion to ICAM-1 and VCAM-1. Example 5 also
describes the preparation of expression vectors encoding green
fluorescent protein (GFP) IRP fusion proteins. Example 6 describes
adhesion of JY cells transfected with IRPs under flow conditions.
The preparation and characterization of monoclonal antibodies to
IRPs is described in Example 7. The role of IRPs in chemotaxis is
characterized in Example 8. Example 9 describes experiments showing
the distribution of IRPs in various human tissues. Assays to
identify proteins which interact with IRPs are described in Example
10 while assays to identify modulators of IRP interactions are
described in Examples 11 and 12.
Example 1
[0030] Two human IRP cDNA clones were isolated using the polymerase
chain reaction (PCR) and DNA/DNA hybridization.
[0031] A BLAST search identified various partial cDNAs exhibiting
similarity to the B2-l protein. Consensus sequence oligonucleotide
primers corresponding to the 5' and 3' ends of regions representing
pleckstrin homology domains were designed based on the ESTs H02055,
R82669, R43994, H39073, R45477, T07442, and T32215. The sequences
of the primers designed to the 5' end (TS3.5) and 3' end (TS3.3)
were:
1 TS3.5 ATATACGCGTACCTTCTTCAACCCGGACC (SEQ ID NO:5) TS3.3
ATATGTCGACTCAGGGCTGCTCCTGCTTC (SEQ ID NO:6)
[0032] The primers were used in a 100 .mu.l PCR reaction using
human spleen cDNA as template 2 mg of plasmid cDNA in pcDNA-1 Amp
(Invitrogen, San Diego, Calif.)]. Samples held at 94.degree. C. for
five minutes and then run through 30 cycles of: 94.degree. C., one
minute; 50.degree. C., one minute; 72.degree. C., two minutes. The
resulting PCR product of about 450 bp was digested with MluI and
SalI. The purified digested fragment was cloned into the vector
pCl-neo (Promega, Madison, Wis.) which had sequences encoding a
hemagglutinin tag immediately 5' to the site of insertion of the
digested PCR fragment. The sequence of the resulting insert was
verified and the vector was named 5'HA TS53/pCl #3.
[0033] The MluI/SalI digested PCR product was labeled and used to
probe a human spleen cDNA library size selected for greater than 3
kb inserts. The spleen library was prepared by cloning an oligo-dT
primed cDNA library into pcDNA-1 Amp and size selecting
vector/insert DNA greater than about 7.8 kb. The library vectors
were transformed into XL1 Blue Ultracompetent Cells (Stratagene, La
Jolla, Calif.) and plated on 15 master 150 mm.sup.2 plates with
Hybond N.sup.+filters at a density of about 20,000 colonies/plate.
Two replicas made from each master were used in hybridizations. The
digested PCR fragment (400 ng) was labeled with 120 .mu.Ci .sup.32P
dCTP and dTTP using the Boehringer Mannheim Random Primed Labeling
Kit according to the manufacturers' suggested protocol.
Unincorporated nucleotides were removed via Centri-sep columns
(Princeton Separations, Adelphia, N.J.). The probe was hybridized
in a solution containing (5X SSPE, 45% formamide, 5X Denhardts, 1%
SDS) at 42.degree. C. overnight. Filters were washed to a final
stringency of 0.2X SSC at 65.degree. C. and exposed to film.
Positives on duplicate filters were picked, diluted, and replated
on Hybond N.sup.+filters on LBM plates. Two duplicates were made
from each of these masters which were rehybridized with the
hybridization solution saved from the primary screen. Secondary
positives were picked, grown, and the plasmids were isolated and
both ends of the insert were sequenced.
[0034] One clone identified contained a full length gene which was
named clone S3 and the protein encoded thereby is designated IRP-1
herein. The nucleotide and deduced amino acid sequences of the
clone are set out in SEQ ID NOs: 1 and 2. The clone has an optimal
Kozak consensus sequence surrounding its initiating methionine and
a stop codon in frame 5' of the methionine. The clone is
approximately 1.6 kb in length and has an open reading frame of 399
amino acids. Clone S3 is most similar to EST R82724, showing
homology of greater than 93% over 469 nucleotides.
[0035] Another clone was recovered which is approximately 3.4 kb in
length. This clone, named S12 which encodes a protein designated
herein as IRP-2, exhibits homology to IRP-1 but is clearly a novel
gene. The IRP-2 clone was not full length since alignment of its 5'
end with IRP-1 sequence placed it approximately fifty amino acids
into the coding region of the IRP-1 clone.
[0036] In order to obtain a full length IRP-2 clone, the same
spleen cDNA library (described above) was rescreened using two
IRP-2 probes as follows. The truncated IRP-2 clone was digested
separately with XbaI and XhoI. A 2 kb XbaI fragment and 1 kb XhoI
fragment were then labeled as described above using the Boehringer
Mannheim Random Primed Labeling Kit. Unincorporated nucleotides
were removed using a Centri-sep column and the probe was added to
the filters in hybridization solution as described above and
hybridized overnight at 42.degree. C. The filters were washed to a
final stringency of 1X SSC/0. 1% SDS at 50.degree. C. Primary
positives were picked, diluted and repeated on Hybond
N.sup.+filters on LBM plates. Two duplicate filters were made from
each of these masters which were rehybridized with the saved
hybridization buffer from above. Positives on duplicate filters
were picked, grown, and their plasmids were isolated and inserts
sequenced. Two clones, S12-41 and S12-47, extended the IRP-2 coding
region about 50 amino acids in the 5' direction. There is a
methionine at the 5' end of the clones which maintains about the
same amino acid organization seen in the IRP-1 clone and a good
match to the Kozak consensus sequence surrounding the methionine.
The S12-47 clone was fully sequenced and the IRP-2 DNA and deduced
amino acid sequences are set out in SEQ ID NOs: 3 and 4.
Example 2
[0037] Three common domains or motifs were identified by comparison
of the IRP-1, IRP-2, B2-1 (Liu et al., supra) genes and deduced
amino acid sequences: an amino terminal kinesin/myosin domain, a
SEC7 domain, and a carboxyl terminal pleckstrin homology (PH)
domain. Kinesin and myosin are transport proteins associated with
microtubules [Navone, et al., J. Biol. Chem. 117: 1263-1275
(1992)]. The yeast protein SEC7, described in Altschul et al., J.
Mol. Biol., 215: 403-410 (1990), is a 2008 amino acid protein which
appears to regulate glycoprotein secretion from the Golgi
apparatus. While a more precise function of SEC7 in yeast has not
been determined, a SEC7 gene mutation in Arabidopsis results in
modulation of development-related cell division and cell adhesion
[Shevell, et al., Cell, 77:1051-1062 (1994)]. PH domains are found
in a large number of proteins involved in signal transduction. In
some proteins the domain confers the ability to bind to G protein
.beta..gamma. subunits, inositol triphosphate (IP.sub.3), or
phosphatidyl inositol diphosphate (PIP.sub.2). See Ingley and
Hemmings, J. Cell. Biochem., 56: 436-443 (1994). In the amino acid
sequences of IRP-1 and IRP-2, the kinesin/myosin domain extends
from approximately residue 9 to approximately residue 60, the SEC7
domain from approximately residue 71 to approximately residue 245,
and the PH domain from approximately residue 260 to the carboxy
terminus. In B2-1, the kinesin/myosin, SEC7, and PH domains are
approximately defined from approximately residue 10 to
approximately residue 61, approximately residue 72 to residue 245,
and approximately residue 246 to the carboxy terminus,
respectively. The amino acid identity between the various domains
in IRP and B2-1 is shown in Table 1 below.
2TABLE 1 B2-1 Kinesin/Myosin SEC7 domain PH domain IRP-1 59% 88%
90% IRP-2 34% 79% 72%
[0038] Based on the conservation of the kinesin/myosin, SEC7, and
PH domains in the three proteins, the IRP-1 and IRP-2 proteins
appear to represent members of a family of human proteins related
to B2-1. FIG. 3 shows an alignment of the IRP-1, IRP-2, and B2-1
clones with an apparent C. elegans homolog [Wilson et al., Nature,
368: 32-38 (1994)]. While the percent identity of the C. elegans
protein to the other three human proteins is not very high, it is
clear that overall domain structure is conserved among the four
proteins.
[0039] Most residues conserved between the three human proteins and
the C. elegans protein are also conserved in an Arabidopsis protein
[Shevell et al., supra] which contains homologous SEC7 region and
are additionally conserved in the yeast SEC7 protein. This suggests
the importance of these residues in the function of the SEC7
domain. In fact, Shevell et al., supra, reported that in the
Arabidopsis clone (EMB30), a mutation changing one of these
residues (corresponding to position 157 in the alignment in FIG. 3)
affected cell division, elongation, and adhesion.
[0040] Conserved residues in IRP PH domains may also be
functionally important. Tsukada et al., Proc. Natl. Acad. Sci.
(USA), 91: 11256-11260 (1994) reports that the mutation of an
arginine (corresponding to position 289 in FIG. 3) conserved in
many PH domains to a cysteine, when present in the PH domain of the
btk tyrosine kinase in mice, led to a X-linked immunodeficient
phenotype despite the enzyme maintaining full btk kinase activity.
The authors speculated since this residue is predicted to be on the
surface of the molecule, it is unlikely this substitution has a
structural effect, but more likely disrupt a specific interaction
with another protein. This residue is also conserved among the
human IRP proteins and the C. elegans protein.
[0041] Finally, all three human proteins as well as the C. elegans
protein have an additional sixteen to eighteen residues between
subdomains 5 and 6 in their PH domains when compared to other PH
domains. If evaluated in view of the proposed three-dimensional
structure of the PH domain described in Macias et al., Nature, 369:
675 (1994), this domain would create a loop extending from the core
of the domain and might therefore be important for an interaction
with another protein or proteins. These sixteen to eighteen
residues exhibit 73% identity between the four proteins.
Example 3
[0042] In order to study the role of the IRP proteins in integrin
function, the IRP-1, IRP-2, and B2-1 proteins or PH domains thereof
were expressed in COS and JY cells along with the .beta..sub.2
integrin subunits CD11a and CD18. IRP and B2-1 expression vectors
were constructed as follows. Expression of the proteins using the
vectors is described in Example 4.
[0043] Complementary DNA encoding the human B2-1 protein was cloned
by PCR amplification of a size-selected 2.5-4 kb Ramos library.
Primers to the 5' and 3' ends of the coding region were designed
based on the previously published sequence (Liu et al., supra).
Primer pairs were designed to facilitate insertion of amplified
sequences into appropriate vectors. The B2-l cDNA was first
amplified and cloned into the vector pET 15b (Novagen, Madison,
Wis.) using the 5' Sc7.Nde and 3' Sc7.Xho primers:
3 Sc7.Nde ATATCATATGGAGGAGGACGACAGCTAC (SEQ ID NO:7) Sc7.Xho
ATATCTCGAGTCAGTGTCGCTTCGTGGAG (SEQ ID NO:8)
[0044] The primers were used in a 100 .mu.l PCR reaction. Samples
were held at 94.degree. C. for 5 minutes and then run through 30
cycles of the sequence: 94.degree. C., 30 seconds; 55.degree. C.,
30 seconds; and 72.degree. C., 1 minute. The resulting PCR product
was gel purified, digested with NdeI and XhoI and cloned into pET
15b. Clones were sequenced and clones Sc7/pET #5 and Sc7/pET #6
contained an insert having a sequence identical to the published
B2-1 sequence.
[0045] An HA tag was added to the 5' end of the B2-1 cDNA by PCR
and then the tagged gene was cloned into pCl-neo. The 3' Sc7.Xho
primer described above was utilized with the 5' Sc7.HAS primer:
4 Sc7.HAS
ATATGCTAGCCACCATGGGGTACCCATACGATGTTCCTGACTATGCGACGCGTATGG-
AGGAGGACGACAGC (SEQ ID NO:9)
[0046] The underlined nucleotides in the primer encode the HA tag.
The primers were used in a 100 .mu.l PCR reaction with Sc7/pET #6
DNA as template under the following conditions. Samples held at
94.degree. for 5 minutes and then run through 30 cycles of:
94.degree. C., 1 minute; 55.degree. C., 1 minute; and 72.degree. C.
2 minutes. The resulting PCR product was gel purified, digested
with NdeI and XhoI and cloned into a pCl-neo vector digested with
NdeI/XhoI. The resulting clone was named 5' HASc7/pCl #29. Its
insert encoded a HA fusion protein named 5'HA B2-1 herein.
[0047] An HA tag was added to the 3' end of the B2-1 cDNA by PCR
and the tagged cDNA was then cloned into pCl-neo. The primers used
were Sc7.HA3 and T7:
5 Sc7.HA3
ATATGTCGACTCACGCATAGTACAGGAACATCGTATGGGTACATACGCGTGTGTCGC-
TTCGTGGAGGA (SEQ ID NO:10) T7 TAATACGACTCACTATAGGG (SEQ ID
NO:11)
[0048] These primers were used in a 100 .mu.l PCR reaction with
SEC7/pCl #9 DNA as template under the following conditions. Samples
were held at 94.degree. C. for 5 minutes and then run through 30
cycles of sequence: 94.degree. C. for 1 minute; 55.degree. C. for 1
minute; and 72.degree. for 2 minutes. The resulting PCR product was
gel purified, digested with XhoI and SalI and ligated into pCl-neo
previously cut with XhoI and SalI. The construct was named 3'HA
B2-1/pCl #29 and its encoded protein was named 3'HA B2-1.
[0049] The B2-1 PH domain was subcloned by PCR using 5' Tsc7.S and
3' Sc7.Xba primers:
6 Tsc7.5 ATATACGCGTACTTTCTTCAATCCAGACCG (SEQ ID NO:12) Sc7.Xba
ATATTCTAGATCAGTGTCGCTTCGTGGAG (SEQ ID NO:13)
[0050] The primers were used in a 100.lambda. PCR reaction with
SEC7/pET #5 DNA as template under the following conditions. Samples
held at 94.degree. C. for 5 minutes followed by 30 cycles of:
94.degree. C., one minute; 50.degree. C., one minute; and
72.degree. C., two minutes. The resulting PCR product was gel
purified, digested with Mlu1 and Xba1 and cloned into 5'HA pCl-neo
previously cut with MluI/XbaI (prepared by cutting 5'HA B2-1/pCl
#29 clone with MluI and XbaI). The insert of the resulting clone
encoded an HA fusion protein named 5'HA B2-1 PH herein.
[0051] The IRP-1 cDNA was subcloned into the 5'HA pCl vector by
first using PCR to add an Mlu site to the 5' end of the cDNA and a
Sall site to the 3' end of the clone. The primers used were:
7 S3.5' HA ATATACGCGTATGGAGGACGGCGTCTATG (SEQ ID NO:14) TS3.3 (SEQ
ID NO:6)
[0052] The primers were used in a 100 .mu.l PCR reaction with S3.3
DNA as template under the following conditions. Samples were held
at 94.degree. C. for 5 minutes followed by 30 cycles of: 94.degree.
C., 45 seconds, 50.degree., 45 seconds; and 72.degree., 1 minute.
The PCR product was gel purified, digested with Mlu and Sal1 and
ligated into 5'HA pCl previously digested with Mlu and Sal1. The
resulting clone was named 5'HA IRP-1/pCl #15 and the protein
encoded thereby was named 5'HA IRP-1.
[0053] Clone 5'HA TS3/pcl #3 (Example 1) was used to express the
IRP-1 PH domain.
[0054] IRP-2 was first cloned into pCl-neo using PCR without an HA
tag. The primers used were:
8 S12/SR1 ATATGAATTCCACCATGGACCTGTGCCACCCAG (SEQ ID NO:15) TS12.3
ATATGTCGACTCACTGCTTGCTGGCAATC (SEQ ID NO:16)
[0055] These primers were used in a 100 .mu.l PCR for 30 cycles
with clone 5 'HAS12/pCl as template under the following conditions:
94.degree. C., one minute; 50.degree. C., one minute; and
72.degree. C., one minute. The resulting amplification product was
purified, digested with EcoRI and SalI, and ligated into a pCl-neo
vector previously digested with the same two enzymes. The resulting
clone #11 was fully sequenced and found to be identical to the
original clone.
[0056] In addition, IRP-2 and the IRP-2 PH domain were separately
cloned into pCl-neo with a 5'HA tag using PCR and the primers
TS12.5 (SEQ ID NO: 17), TS12.3 (SEQ ID NO: 18) and S12.5 (SEQ ID
NO: 19).
9 TS12.5 ATATACGCGTACCTTCTTCAATCCAGAC (SEQ ID NO:17) ST12.3
ATATGTCGACTCACTGCTTGCTGGCAATC (SEQ ID NO:18) S12.5
ATATACGCGTATGGACCTGTGCCACCCAG (SEQ ID NO:19)
[0057] Template DNA for the amplification reactions was clone S12.
Samples were held at 94.degree. C. for four minutes, and followed
by t30 cycles of: 94.degree. C. for one minute; 52.degree. C. for
two minutes, and 72.degree. C. for two minutes. Each of the two
resulting amplification products was digested with MluI and SalI,
purified and separately ligated into a pCl-neo HA vector previously
digested with MluI and SalI. Clones pCl-neo HA IRP-2 #8 and pCl-neo
IRP-2 PH #5 were sequenced and found to be identical to
corresponding sequences in the template clone.
Example 4
[0058] The effects of overexpressing IRPs on .beta..sub.2 dependent
cell adhesion (measured by binding of transfected COS or JY cells
to ICAM-1) and on .beta..sub.7 dependent cell adhesion (measured by
binding of transfected JY cells to VCAM-1) were determined.
[0059] COS cells were co-transfected with vectors encoding
CD11a/CD18 and vectors (Example 3) having inserts encoding one of
5'HA B2-1, 3'HA B2-1, 5'HA B2-1 PH, 5'HA IRP-1, 5'HA IRP-1 PH, 5'
HA IRP-2, 5'HA IRP-2 PH, or a pCl-neo vector control. COS cells
were split 1.2.times.10.sup.6 cells per 10 cm.sup.2 plate 24 hours
prior to transfection, The next day a transfection mix was prepared
for each plate containing 5 ml DMEM, 2 .mu.l of chloroquine (0.25
M), 30 .mu.l of DEAE Dextran (50 mg/ml in CMF-PBS) and 10 .mu.g of
each vector DNA being transfected into the cells. The growth media
was removed from approximately 80% confluent plates of COS cells,
and the transfection mix was added. The plates were incubated for
2.5 hours at 37.degree. C. The transfection mix was removed by
aspiration and a 10% solution of DMSO in DMEM was added for one
minute (room temperature). After one minute, the DMSO was removed
by aspiration and 10 ml of complete media was added.
[0060] Expression of LFA-1 and IRPs by the transfected COS cells
was confirmed using various antibodies. All transfectants stained
positive for CD18. IRP transfectants all stained positive for the
HA epitope using an HA tag specific monoclonal antibody 150B OR
12CA5.
[0061] The transfected cells were tested for their ability to bind
ICAM-1 at 48 and 72 hours after transfection. To prepare cells for
an adhesion assay, the growth media was removed by aspiration, 5 ml
versene was added to the plate for three minutes and then the cells
were recovered. Five ml of complete DMEM was added and then the
cell suspension was spun down at 1,000 rpm for five minutes. The
cells were resuspended in complete DMEM and counted. Adhesion
assays with the variously transfected cells were carried out as
described below.
[0062] Individual 96 well plates (Corning, Cambridge, Mass.) were
initially coated with either ICAM-1/Fc or VCAM-1/Fc in carbonate
buffer, pH 9.6, at 50 .mu.l/well of 5 .mu.g/ml protein and
incubated overnight at 4.degree. C. The plates were washed two
times with 150 .mu.l/well PBS and blocked with 150 .mu.l/well 1%
BSA in PBS for one hour at room temperature. Following blocker, 100
.mu.l adhesion buffer (RPMI media with 10% fetal bovine serum) was
added to each well along with 100 .mu.l transfected JY cells
suspended in adhesion buffer at room temperature. The transfected
cells were prepared as follows.
[0063] The day prior to assay, transfected cells were split to a
density of 3.times.10.sup.5 cells/ml in RPMI media supplemented
with penicillin/streptomycin, L-glutamine, sodium pyruvate and 10%
fetal calf serum. Cells were allowed to double, generally after 24
hour incubation. After doubling, cells were harvested and
resuspended at a density of 1.times.10.sup.6 cells/ml in adhesion
buffer. Approximately 1.times.10.sup.5 cells in 100 .mu.l were
added to each well, and the plates incubated for 30 minutes at room
temperature while covered.
[0064] Following incubation, cells were fixed by addition of 50
.mu.l/well 14% glutaraldehyde in CMF-PBS and incubation for 30
minutes at room temperature. After incubation, the wells were
washed three times with deionized water. Following the last wash,
the water was removed by aspiration, 50 .mu.l stain containing
0.125% Crystal Violet (prepared as a stock solution of 1% in 10%
ethanol and 90% deionized water, diluted to 0.125% with deionized
water and filtered through a 0.22 micron filter), and the plates
incubated for two minutes. After incubation, the plates were washed
three times with deionized water as described above, and 200
.mu.l/well ethanol solution (two parts 95% ethanol and one part
deionized water) was added. After one hour incubation, the plates
were read on an ESISA reader at a wavelength between 570 and 590
nm.
[0065] At 48 hours post-transection, B2-1 PH domain transfectants
demonstrated a moderate decrease in LFA-1 dependent adhesion
relative to vector control transfectants. There was a marked
decrease in binding of IRP-2 PH domain transfectants whereas full
length IRP clones showed no significant change in adhesion relative
to the pCl-neo vector control. At 72 hours post-transection, four
transfectants (3'HA B2-1, 5'HA B2-1, B2-1 PH, IRP-1 PH)
demonstrated a 50% decrease in ICAM-1 adhesion compared with the
vector control.
[0066] JY cells, which express endogenous .alpha..sub.4.beta..sub.7
and LFA-1, were individually transfected with vectors encoding
either IRP-1, IRP-2, B2-1, IRP-1 PH, IRP-2 PH, or B2-1 PH. Cells
were transfected by electroporation using a standard protocol.
Briefly, for each transformation 10.sup.7 JY cells were spun down
and kept on ice. The cells were rinsed with DPBS and respun. The
cells were then resuspended in 0.5 ml DPBS and transferred to an
electroporation cuvette. Thirty .mu.g of DNA (1 mg/ml in DPBS) was
added to each transformation mix. The transformation mix was mixed
gently and incubated on ice for 10 minutes. The cells were
electroporated using a BioRad Gene Pulser using the following
parameters: capacitance extender on, voltage at 250 V, and
capacitance at 960 .mu.f. After electroporation, the transfection
mix was incubated on ice for ten minutes. The cells were then
placed in a T25 flask with 5 ml complete RPMI media. Three days
post-transection, hygromycin was added to the media at a
concentration of 0.5 mg/ml. Adhesion assays were performed 14 days
post-transection.
[0067] JY cells transfected with IRPs also demonstrated a decrease
in LFA-1 dependent adhesion to ICAM-1 and .alpha..sub.4.beta..sub.7
adhesion to VCAM-1. LFA-1 and .alpha..sub.4 levels were not
significantly different between transfectants, and therefore do not
explain decreases in adhesion.
[0068] IRPs thus appear to demonstrate some specificity for
modulating .beta..sub.2 or .beta..sub.7 integrin dependent
adhesion. IRP-1 expressed in JY cels appears to preferentially
decrease .beta..sub.2 dependent adhesion whereas IRP-2 appeared to
down regulate .beta..sub.7 dependent adhesion. B2-1 transfectants
demonstrate both decreased .beta..sub.2 and .beta..sub.7 adhesion.
The expression of truncates consisting of the PH domain of IRP-1,
IRP-2, or B2-1 appeared to generally decrease both .beta..sub.2 and
.beta..sub.7 dependent adhesion. See Table 2 below where a "+"
represents an increase in adhesion, an "-" indicates a decrease in
adhesion, and "NS" represents no significant change in
adhesion.
10 TABLE 2 Host Cell JY Cos Expressed Protein .beta..sub.2
.beta..sub.7 .beta..sub.2 5'HA IRP-1 -- NS/+ -- 5'HA IRP-2 NS -- NS
5'HA B2-1 -- NS/+ -- 5'HA IRP-1 PH -- NS/- -- 5'HA IRP-2 PH -- NS/-
NS
[0069] These results would be consistent with the amino terminal
portion of IRPs interacting directly or indirectly with
.beta..sub.2 or .beta..sub.7 integrins with differing affinities
resulting in preferential regulation of one or the other type of
integrin. The functions and interaction of the PH domains, in
contrast, may be a common signaling element in pathways regulating
different integrins. This element may be heterotrimeric GTP binding
proteins (e.g. G.sub..alpha..beta..gamma.) PIP.sub.n, protein
kinase C (PKC) or some as yet unidentified ligand of PH domains. An
antagonist that disrupts IRP PH domain binding to this common
signaling element would be predicted to broadly regulate adhesion
of .beta..sub.2, .beta..sub.7, and perhaps other integrins such as
.beta..sub.1 and .beta..sub.3 integrins. In contrast, an antagonist
that disrupts the amino terminal interaction of IRPs with integrin
may be predicted to regulate integrin dependent adhesion in a more
specific manner.
[0070] Leukocytes and leukocyte cell lines that are not maximally
activated for integrin dependent cell adhesion can be activated by
PKC agonists such as the phorbol ester PMA. The mechanism by which
PKC activity induces cell adhesion is not well defined; PKC may
have some effect on affinity or avidity upregulation, as well as
cytoskeletal reorganization required for cell spreading. However,
the effect of PKC activation on IRP down regulation of integrin
dependent adhesion may indicate if PKC functions downstream or
upstream of IRP. Phorbol stimulation of JY transfectants described
above often does not restore LFA-1 or .alpha..sub.4.beta..sub.7
dependent adhesion to vector control levels. Thus either the
regulatory PKC substrate may be upstream in the pathway regulated
by IRPs, or PKC regulates a different pathway or aspect of integrin
dependent adhesion. Alternatively, IRPs may regulate multiple
aspects of integrin dependent adhesion and PKC stimulation may only
affect one of these. IRPs may regulate integrin dependent adhesion
by affecting integrin affinity, avidity (clustering) (Example 4),
or membrane recycling. A role in integrin recycling is suggested by
decreased LFA-1 levels on COS cells expressing IRPs but not in COS
cells expressing IRP PH domains.
[0071] In order to determine if IRPs exert an effect on cell
surface expression of integrins, COS cells were co-transfected with
DNAs encoding either full length IRP-1, IRP-2, or B2-1 (or with a
control DNA vector pCl-neo or DNA encoding 14-3-3.theta.) along
with DNA encoding either .alpha..sub.1.beta..sub.2,
.alpha..sub.4.beta..sub.7, or ICAM-2. Cells were stained for
surface expression (fluorescence intensity and percent positive
cells) using monoclonal antibodies ICA4.1 (immuno-specific for
.alpha..sub.4), TS1/22 (immunospecific for .alpha..sub.1), 3S3
(immunospecific for .beta..sub.1), or 92C12F (immunospecific for
ICAM-2). .beta..sub.1 is endogenously expressed in COS cells and
.beta..sub.1 encoding DNA was required for transfection.
[0072] The results, presented in Table 3 below, suggest that IRP-1
decreases cell surface expression of .alpha..sub.1.beta..sub.2
integrin, possibly through down regulation of de novo biosynthesis
or a recycling process which removes and replaces the integrin on
the cell surface.
11TABLE 3 IRP Effect on Cell Surface Integrin Expression
.alpha..sub.L .beta..sub.1 .alpha..sub.4 .beta..sub.1 ICAM-2
.beta..sub.1 pCI-neo 760.dagger. 396 317 309 509 363 59%* 62% 30%
74% 59% 72% IRP-1 533 364 266 405 469 361 51% 66% 32% 74% 59% 77%
IRP-2 711 367 294 384 522 359 60% 69% 38% 75% 55% 76% B2-1 666 375
304 418 489 329 59% 70% 36% 72% 54% 73% 14-3-3.theta. 690 361 336
368 543 386 60% 72% 43% 74% 60% 75% .dagger.Mean Fluorescence
Intensity *Percent Positive
[0073] As discussed above, different family members can have
opposing effects on integrin dependent adhesion. Such opposing
effects are consistent with IRPs interacting with different
effectors or signaling pathways that regulate integrin binding
(discussed below). Redundancy in these pathways may in part explain
why overexpression of IRPs results in only a partial block of IL-8
inducible adhesion. In addition, the decrease in adhesion with
IRP-1 overexpression may be due to IRP-1 antagonizing a proadhesive
activity of another IRP. The proadhesive activity of B2-1
(cytohesin-1) is not unique to JY-8 (Example 5) and has also been
observed with overexpression in Jurkat T-lymphoid cells [Kolanus et
al, Cell, 86:233-242 (1996)]. However in contrast to JY-8 cells,
expression in Jurkat cells induced .alpha..sub.1.beta..sub.2
binding. Thus B2-1 may induce binding of either
.alpha..sub.4.beta..sub.7 or .alpha..sub.1.beta..sub.2 in a cell
type specific manner. This is not surprising in that binding
properties of a specific integrin can vary with cell type [Chan et
al, J. Cell. Biol., 120:537-543 (1993), Kassner et al., J. Exp.
Med., 178:649-660 (1993)].
[0074] Next, subcellular localization of IRP/GFP fusion proteins
was determined in JY-8 (Example 5) transfectants adherent to
ICAM-1. Glass slides were coated with ICAM-1/Fc (10 .mu.g/ml) in 50
mM bicarbonate buffer, pH 9.6, for 18 hours at 4.degree. C. and
subsequently rinsed with RPMI medium containing 10% FBS. JY-8
transfectants expressing GFP/IRP fusion proteins were allowed to
adhere on the ICAM-1 coated glass slides.
[0075] To determine the subcellular distribution of IRP/GFP fusion
proteins and to identify what regions IRP-1 may be found in
intracellular localization, JY-8 transfectants were examined by
fluorescence confocal microscopy. IRP-1, IRP-2 and B2-1 localized
predominantly to the leading edge cortical cytoskeletal region of
cells crawling on ICAM-1 (See Example 8). The PH domain of IRP-1
localized to the plasma membrane region, whereas the Sec7 domain
demonstrated a more diffuse cytoplasmic localization. Transfectants
expressing GFP demonstrated diffuse cytoplasmic fluorescence. These
results indicate that the PH domain, which supports localization to
the plasma membrane, functions with other domains to localize wild
type IRPs to the leading edge.
[0076] To examine the distribution of IRPs during lamelli
formation, time-lapse images of JY-8 IRP-2/GFP transfectants
crawling on ICAM-1 were analyzed. JY-8 cells overexpressing IRP-2
was chosen to determine localization in cells capable of migrating
in response to IL-8 because IRP-2 fusion transfectants demonstrate
greater levels of chemotactic migration relative to IRP-1 or B2-1
transfectants. IRP-2 was found concentrated along one edge of JY-8
cells at the site of and prior to lamelli formation. Time lapse
images demonstrate that concomitant with its development, IRP-2
relocalized into lamelli. Thus IRP-2 is present very early and
throughout lamellipodia extension.
[0077] IRPs likely play a role in supporting integrin function in
the leading edge of migrating cells. This localization appears to
be dependent on both Sec7 and PH domain interactions since the Sec7
domain is diffusely located and the PH domain is uniformly
localized to the membrane when expressed independently. PH domain
interactions may support a functional membrane localization of a
complex containing IRP and ADP ribosylation factor (ARF). At this
site ARF can become activated since ARNO (a protein described after
filing of the priority application hereto which may be IRP-1) GTP
exchange factor (GEF) activity is stimulated by
phosphatidylinositol binding to the PH domain [Chardin et al.,
Nature, 384:481-484 (1996)]. The role of ARFs in membrane transport
suggests that they could mediate integrin localization to and from
the leading edge of migrating cells. This would be consistent with
the notion that polarized exocytosis in the leading edge may play a
critical role in cell locomotion [Bretscher, Cell, 87:601-606
(1996)].
[0078] In addition, an inhibitor of ARF GTP exchange, Brefeldin A,
inhibits lamellipodia formation and migration of fibroblasts in a
wound healing model [Bershadsky et al., Proc. Natl. Acad. Sci.
U.S.A., 91:5686-5689 (1994)]. B2-1 has been reported to bind
directly to the cytoplasmic domain of .beta..sub.2 [Kolanus et al.,
Cell, 86:233-242 (1996)]. Thus IRPs may link integrins to and
activate members of the ras superfamily which might function in one
or more steps in chemotaxis.
[0079] A role in integrin avidity is also suggested. ARF and
another member of the ras superfamily RhoA, act synergistically to
activate phospholipase D (PLD) [Kuribara et al., J. Biol. Chem.,
270:25667-25671 (1995)]. PLD is activated by various agonists in
different cell types and cleaves phophatidylcholine to produce
choline and phosphatidic acid [Boman et al., Trends Bio. Chem.
Sci., 20147-150 (1995)]. Phosphatidic acid, and not various other
negatively changed lipids, has been demonstrated to increase
binding of purified integrin GPllbllla to fibrinogen [Smyth et al.,
J. Biol. Chem., 267:15568-15577 (1992)]. IRPs may function as
regulators in signaling pathways that alter integrin membrane
localization or avidity. Recently, ARNO has been reported to induce
GDP/GTP exchange in, and hence activate a member of the ras
superfamily, ARF-1 [Chardin et al., Nature, 384:481-484 (1996)].
There are six known ARFs and an additional four ARF-like proteins
that share 45-60% amino acid identity [Boman et al., Trends in Bio.
Chem. Sci., 20:147-150 (1995)]. ARFs localize to golgi, vesicles
and plasma membrane and have been implicated in membrane transport,
endocytosis and exocytosis [D'Souza-Schorey et al., Science,
267:1175-1178 (1995), Peters et al., J. Cell Biol., 128:1003-1017
(1995), Boman et al., Trends in Biol. Sci., 20:147-150 (1995)].
IRPs therefore may regulate localized increases in phosphatidic
acid that in turn up-regulate integrin binding directly or
indirectly through conversion to a PKC agonist diacylglycerol
(DAG).
Example 5
[0080] A JY cell line that stably expresses a functional receptor
for IL-8 possessing an N-terminal mAb epitope tag was developed.
This cell line is identified herein as "JY-8". To demonstrate a
role in .alpha..sub.1.beta..sub.2 dependent adhesion, IRPs were
overexpressed in the JY-8 cell line. JY-8 cells normally express
one .beta..sub.2 integrin, .alpha..sub.1.beta..sub.2, and one
.alpha..sub.4 integrin, .alpha..sub.4.beta..sub.7 [Chan et al., J.
Biol. Chem., 267:8366-8370 (1992)]. IRP expression constructs were
generated with green fluorescence protein (GFP) fused to the amino
terminus of IRP-1, IRP-2 and B2-1 wild type sequences as described
in the following paragraph.
[0081] Expression constructs for green fluorescent protein (GFP)
IRP fusion proteins were prepared as follows. The expression vector
pCEP4 (Invitrogen, San Diego, Calif.) was digested with Nhel and
BamHI. A Nhel and BamHI digested DNA fragment encoding GFP from
pEGFP (Clontech, Palo Alto, Calif.), was ligated to the NHel/Bam HI
digested pCEP4. The resulting plasmid, pCEP4/GFP, was used to make
IRP fusion constructs.
[0082] To subclone IRP DNA fragments into pCEP4/GFP, PCR reactions
were performed to add Xho I and Hind III restriction sites to the
ends of the fragments for subsequent in frame ligation.
[0083] The following primer pairs were used for PCR:
12 S3.GFP.Xho.5, ATATCTCGAGCTATGGAGGACGGCGTCTAT, (SEQ ID NO:20) and
S3.GFP.H3.3, ATATAAGCTTGCGGCCGCTCAGGGCTGCTCCTGCTTC (SEQ ID
NO:23)
[0084] ID NO: 21) for IRP-1 GFP fusion; S7.GFP.Xho.5,
13 S7.GFP.Xho.5, ATATCTCGAGCTATGGAGGAGGACGACAGCTAC, (SEQ ID NO:22)
and S7.GFP.H3.3, ATATAAGCTTGCGGCCGCTCAGTGTCGCTTCGTGGAGG (SEQ ID
NO:23)
[0085] NO: 23) for B2-1 GFP fusion; S12.GFP.Xho.5,
14 ATATCTCGAGCTATGGACCTGTGCCACCCAG, (SEQ ID NO: 24) and
S12.GFP.H3.3, ATATAAGCTTGCGGCCGCTCACTGCTTGCTGGCAATCTTC, (SEQ ID NO:
25)
[0086] ID NO: 25) for IRP-2 GFP fusion; S12.GFP.5.X,
15 ATATCTCGAGCTATGAGCGAGGTGGAGGGGCTG, (SEQ ID NO: 26) S3.GFP.5.H3,
ATATAAGCTTGCGGCCGCTCAGAAGGTGTGGGTCAGGTC, (SEQ ID NO: 27)
[0087] ID NO: 27) for IRP-2 GFP fusion; Sec7 domain GFP fusion;
S3.GFP.P.X. ATATCTCGAGCTATGACCTFCTFCAACCCGG, (SEQ ID NO: 28) and
S3.GFP.H3.3 for IRP-1 PH domain GFP fusion.
[0088] In addition, amino acid substitution mutants were generated
using the Muta-Gene Phagemid in vitro mutagenesis kit (Version 2,
BioRad, Hercules, Calif.) with the oligonucleotides: S3.E156A,
GTCAATITrCTGGGCCGCTCCGGGTAGGCGAAA, (SEQ ID NO: 29) for preparing
E156A and S3.R279A, TGTGAGGATAAACCAGGCCCGCTTCCACGTCTTC (SEQ ID NO:
30) for preparing R279A. PCR amplification of the mutant cDNA using
the primers S3.GFP.Xho5 and S3.GFP.H3.3, was performed to generate
appropriate restriction sites for GFP fusion.
[0089] The resulting PCR products were ligated to the Xho I and
Hind III sites of PCEP4/GFP. Clones isolated from E. coli XL1 Blue
transformants were confirmed by sequencing. All expression vectors
were designed to encode IRP/GFP fusion proteins with GFP at the
amino terminus of the fusion protein. JY-8 cells were transfected
by electroporation with the expression constructs and the
transfectants were selected using hygromycin B (0.5 mg/ml,
Calbiochem, San Diego, Calif.).
[0090] In addition, IRP-1 GFP fusion proteins having amino acid
substitutions in the Sec7 or PH domains were generated. A
substitution of alanine for glutamate at position 156, E156/A, was
chosen based on the effects of this mutation on cellular adhesion
in the Sec7 domain of an Arabidopsis protein, EMB30 [Shevell et
al., Cell, 77:1051-1062 (1994)]. Similarly, a substitution in the
PH domain, R279/A, was chosen based on a mutation identified in the
PH domain of BTK which results in an X-linked agammaglobulinemia
(XLA) [Yao et al., Proc. Natl. Acad. Sci. U.S.A., 91:9175-9179
(1994)] and may be important in PKC (Yao, et al., Proc. Nat. Acad.
Sci, USA, 91:9175-9179 (1994) and Inositol
1,3,4,5-Tetrakisphosphat- e (IP.sub.4) [Fukuda et al., J. Biol.
Chem., 271:30303-30306 (1996)] binding. Truncates containing either
the Sec7 domain or the PH domain of IRP-1 fused to GFP were also
generated.
[0091] Imunoblotting showed that the IRP/GFP fusion proteins were
expressed in all JY-8 transfectants at similar levels. To confirm
expression of fusion proteins, detergent lysates of JY-8
transfectants were immunoblotted with antibodies specific for
IRP-1, B2-1, IRP PH domains and GFP. The migration of all GFP
fusion proteins, in SDS-PAGE, was consistent with their predicted
sizes. In addition, fusion proteins bound appropriate IRP-1, B2-1
or PH domain specific mAb as well as GFP antibodies. Endogenous
IRP-1 and B2-1 was also detected in JY lysates. Estimates from
several blots indicated that all seven fusion proteins were
expressed at levels at least ten-fold greater than that of
endogenous IRP-1 and B2-1.
[0092] Integrin dependent cellular adhesion is inducible by various
stimuli [Diamond and Springer, Curr. Opin. Biol., 4:506-517,
(1994)]. Known stimuli for inducing adhesion include agonists for
G-protein coupled chemokine receptors such as IL-8 or agonists for
PKC such as PMA. These stimuli activate signalling pathways that
may regulate cytoskeletal organization and integrin clustering in a
manner that increases or stabilizes integrin-dependent adhesion.
Chemokines and agonists such as PMA are utilized routinely to
increase adhesion or determine maximal levels of adhesion in in
vitro assays.
[0093] Adhesion assays measuring IRP/GFP fusion proteins binding to
ICAM-1 or VCAM-1 were performed in 96-well Easy Wash plates
(Corning) using a modified procedure of Morla et al., Nature,
367:193-196 (1994). Each well was coated with 50 .mu.l of ICAM-1/Fc
(5 .mu.g/ml) or VCAM-1/Fc (2 .mu./ml) in 50 mM bicarbonate buffer
(pH 9.6). Some wells were coated with a CD18 mAb (22F12C, ICOS
Corporation) to quantitate 100% of input cell binding or BSA block
to determine background binding. Plates were blocked with 1% BSA in
PBS for one hour at room temperature. Wells were then rinsed and
200 .mu.l of adhesion buffer (5% FBS, 5 mM KCI, 150 mM NaCl, 1 mM
MgCl.sub.2, 1 mM CaCl.sub.2, 20 mM HEPES, 10 mM D-Glucose) was
added with or without PMA (20 ng/ml) or IL-8 (25 ng/ml). JY-8 cells
(100 .mu.l of 5.times.10.sup.6/ml) were then added to each well and
plates were incubated at 37.degree. C., in 5% CO.sub.2 for 5 or 30
minutes. Adherent cells were fixed with the addition of 50 .mu.l of
10% glutaraldehyde solution and stained with 0.5% crystal violet
(SIGMA) solution. After washing and the addition of 70% ethanol,
adherent cells were quantitated by determining absorbance at 570 nm
using a SPECTRAmax.TM. 250 Microplate Spectrophotometer System
(Molecular Devices). Percent adherent cells was determined using
the formula: 1 A 570 ( binding to ICAM - 1 or VCAM - 1 ) - A 570 (
binding to BSA ) A 570 ( binding to CD18 m Ab ) .times. 100
[0094] Adhesion of JY-8 transfectants to immobilized ICAM-1 or
VCAM-1 was determined under static conditions with no stimulation
(basal level binding) as well as under IL-8 or PMA stimulation. In
comparison to basal level binding, JY-8 cells expressing only GFP
(control) demonstrated a 3-4 fold increase in binding to ICAM-1 and
a 2-fold increase in binding to VCAM-1 in the presence of IL-8.
IL-8 inducible adhesion to VCAM-1 was apparent at five minutes,
however, an increase in basal level binding between five and thirty
minutes decreased the difference between stimulated and
unstimulated binding. Subsequent assays were performed for thirty
minutes. PMA treatment resulted in a 4-fold or greater increase in
adhesion to ICAM-1 and VCAM-1. JY-8 transfectants overexpressing
IRP-1 demonstrated a 40-50% decrease in binding to ICAM-1 relative
to control transfectants expressing equivalent or greater levels of
GFP. This decrease was apparent for basal and IL-8 stimulated
adhesion, but not for PMA induced adhesion. The binding of the
IRP-1 overexpressing JY-8 transfectants to VCAM-1 was also
decreased by approximately 40% under conditions of IL-8
stimulation, but not basal or PMA stimulated conditions. These
results indicate that IRP-1 preferentially effects chemokine but
not PMA stimulated adhesion and that IRP-1 overexpression does not
render cells generally adhesion incompetent.
[0095] To determine the contribution of different IRP-1 domains to
the inhibition of adhesion, JY-8 cells expressing the amino acid
substitution and deletion mutants were tested. Substitution of
amino acids in the Sec7 and PH domains abrogated the effects of
IRP-1 overexpression on adhesion. Transfectants expressing the
IRP-1 Sec7 domain mutation E156/A, and the PH domain mutation
R279/A, demonstrate levels of binding to ICAM-1 and VCAM-1
equivalent to that of GFP expressing JY-8. In addition, expression
of IRP-1 Sec7 or PH domains independently did not decrease binding
to either ICAM-1 or VCAM-1 as effectively as wild type IRP-1. Thus,
both Sec7 and PH domains function together to regulate IL-8
stimulated adhesion to ICAM-1 and VCAM-1.
[0096] In addition to IRP-1, the effects of IRP-2 and B2-1
overexpression on JY-8 adhesion was determined. JY-8 transfectants
overexpressing IRP-2 demonstrated a weak decrease, approximately
20%, in basal level binding to ICAM-1 or IL-8 induced binding to
ICAM-1 and VCAM-1 relative to GFP transfectants. In contrast,
transfectants overexpressing B2-1 demonstrated control levels of
IL-8 stimulated binding to ICAM-1 but consistently increased
binding to VCAM-1 by approximately 50%. Thus, the effects on B2-1
overexpression in IL-8 stimulated adhesion to VCAM-1 is opposite to
that of IRP-1 and IRP-2 and selective for
.alpha..sub.4.beta..sub.7VCAM-1 interaction.
[0097] The modulation of JY-8 adhesion to ICAM-1 and VCAM-1 with
overexpression of IRPs cannot be attributed to changes in cell
surface levels of .alpha..sub.1.beta..sub.2 or
.alpha..sub.4.beta..sub.7. There was relatively little difference
in the amount of expression of .alpha..sub.1.beta..sub.2 or
.alpha..sub.4.beta..sub.7 on different JY-8 transfectants
overexpressing IRPs relative to the transfectant expressing GFP.
JY-8 cells overexpressing IRP-1 Sec7 displayed a moderately
decreased expression of .alpha..sub.4.beta..sub.7, nevertheless,
these cells did not show decreased adhesion to VCAM-1.
Example 6
[0098] The integrin .alpha..sub.4.beta..sub.7 can mediate
attachment and rolling adhesion of lymphocytes to the endothelial
cell ligands VCAM-1 and MadCAM-1 under flow conditions [Berlin, et
al., supra (1995)]. In order to determine if IRP expression effects
.alpha..sub.4.beta..sub.7 mediated cell attachment and rolling,
binding of JY transfectants under flow conditions was quantitated
[Berlin, et al, supra (1995)]. In addition, cell binding under flow
conditions was examined following static adhesion to determine
possible changes in .alpha..sub.4.beta..sub.- 7 avidity resulting
from IRP expression.
[0099] JY cells, which express endogenous
.alpha..sub.4.beta..sub.7, were transfected with either full length
IRP-1 (JY.sub.IRP-1), IRP-2 (JY.sub.IRP-2), or B2-1 (JY.sub.B2-1)
encoding sequences or vector control DNA (JY.sub.VEC) and
introduced into a flow system loop containing an immobilized
VCAM-1/immunoglobulin (VCAM-1/Ig) chimeric protein [Vonderheide, et
al., J. Cell. Biol 125:215-222 (1994)]. The initial flow rate was 3
dynes/cm.sup.2 which was maintained for one minute. For the next
five minutes, the flow rate was reduced to 1.5 dynes/cm.sup.2,
during which time JY.sub.VEC transfectants and to a lesser extent,
JY.sub.B2-1 transfectants demonstrated the ability to attach and
roll (FIG. 2). Cells transfected with either IRP-1 or IRP-2,
JY.sub.IRP-1 and JY.sub.IRP-2, did not or very rarely attached.
[0100] For the next minute, transfected cells were incubated in the
presence of the immobilized ligand in the absence of flow, and this
time was insufficient to permit JY.sub.IRP-1/VCAM-1 or
JY.sub.IRP-2/VCAM-1 binding. After the period of static binding,
the flow rate was incrementally increased from 1.5 to 9
dynes/cm.sup.2 over the next four and a half minutes. Binding of
JY.sub.B2-1 and JY.sub.VEC both decreased as the flow rate reached
3 dynes/cm.sup.2 (FIG. 2). The similar decreasing rates of binding
for the two proteins suggest similar binding avidities for IRP-3
and VEC.
[0101] The results of the assay indicate that IRP-1 and IRP-2
expression abrogate the ability of .alpha..sub.4.beta..sub.7 to
bind to VCAM-1 under both flow and short term static conditions.
Expression of B2-1, however, appears to only decrease the
efficiency of attachment and rolling.
[0102] In order to determine the effect of IRP-1 and IRP-2
expression on the binding of endogenous LFA-1 to ICAM-1, JY cells
transfected as described above were utilized in a similar assay
except that ICAM-1 was the immobilized counterreceptor. All of the
transfected JY cells except JY.sub.B2-1 cells attached and rolled
on ICAM-1 at 1.5 dynes/cm.sup.2. The efficiency of attachment,
however, was reduced relative to .alpha..sub.4.beta..sub.7/VCAM-1
binding (FIG. 3). Adhesion to ICAM-1 increased markedly following
one minute of static binding for all transfectants except
JY.sub.IRP-1 cells, for which binding increased but to a lower
maximum. As the flow rate was increased following static binding,
ICAM-1 binding of JY.sub.IRP-1, JY.sub.B2-1 and JY.sub.VEC cells
decreased. JY.sub.IRP-2 cell binding, however, appeared to be most
resistant to increasing flow rates as binding was detected at a
flow rate up to 7.5 dynes/cm.sup.2. These results suggest that B2-1
expression abrogates LFA-1 attachment to ICAM-1 under flow
conditions; IRP-1 expression decreases LFA-1/ICAM-1 binding under
static conditions; and IRP-2 expression supports higher avidity
binding between LFA-1 and ICAM-1.
Example 7
[0103] To generate IRP-1 and B2-1 specific monoclonal antibodies,
mice were immunized with His-tagged IRP-1 and B2-1 expressed and
purified from E. coli. The coding regions of IRP-1 and B2-1 were
ligated in frame into pET15b (Novagen, Madison, Wis.) C-terminal to
sequences encoding the histidine tag so that the IRP-1 and B2-1
proteins were expressed as N-terminal histidine tagged proteins in
E. coli strain BL21lysS. Recombinant proteins were purified by
standard procedures (Qiagen, Chatsworth, Calif.).
[0104] Hybridomas were generated as described generally in Tjoelker
et al., J. Biol. Chem., 270:25481-25487 (1995). For hybridoma
series 200, each of five 6 to 12 week old Balb/c mice was pre-bled
on day 0 and then immunized subcutaneously with 67 .mu.g E. coli
produced HisB2-1, emulsified in complete Freunds adjuvant. On day
21, each mouse was boosted with 25 .mu.g HisB2-1 in incomplete
Freunds adjuvant. Test bleeds were taken on day 34 and tested by
western blot. 100 ng HisB2-1 protein from a 10% reducing SDS-PAGE
was transferred onto PVDF, which was then cut into strips. The blot
was blocked for one hour at ambient temperature with 3% BSA, 0.2%
Tween 20 in CMF-PBS. Pre-immune and immune sera were diluted 1:500
in blocking buffer and incubated with the strips for two hours at
ambient temperature. Strips were washed three times with 2% Tween
20 in CMF-PBS and then incubated with goat anti-mouse (Fc)-HRP for
one hour. After washing four times, strips were developed with
Renaissance chemiluminescent reagents (NEN). Mouse #2413 was given
a final intraperitoneal boost of 25 .mu.g HisB2-1 protein in
CMF-PBS on day 45 and the spleen was removed four days later.
[0105] For hybridoma series 233, each of five 6 to 12 week old
Balb/c mice was pre-bled on day 0 and the immunized subcutaneously
with 30 .mu.g E. coli produced HisIRP-1, emulsified in complete
Freunds adjuvant. On day 22, each mouse was boosted with 10 .mu.g
HisIRP-1, and on Day 45 with 5 .mu.g HisIRP-1, in incomplete
Freunds adjuvant. On day 55, test bleeds were taken and tested by
western blot against HisIRP-1 and HisIRP-2. Mouse #2520 was boosted
intraperitoneally with 50 .mu.g HisIRP-1 in CMF-PBS each day on
days 133 and 134, and the spleen was sterilely removed on day
137.
[0106] Fusions were performed as described below. Briefly, a
single-cell suspension was formed by grinding the spleen between
the frosted ends of two glass microscope slides submerged in serum
free RPMI 1640, supplemented with 2 mM L-glutamine, 1 mM sodium
pyruvate, 100 units/ml penicillin, and 100 .mu.g/ml streptomycin
(RPMI) (Gibco, Canada). The cell suspension was filtered through
sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany,
N.J.) and washed twice by centrifuging at 200 g for five minutes
and resuspending the pellet in 20 ml serum free RPMI. Thymocytes
taken from three naive Balb/c mice were prepared in a similar
manner.
[0107] NS-1 myeloma cells, kept in log phase in RPMI with 11%
FetalClone serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah)
for three days prior to fusion, were centrifuged at 200 g for five
minutes, and the pellet was washed twice as described in the
foregoing paragraph. After washing, each cell suspension was
brought to a final volume of 10 ml in serum free RPMI and
counted.
[0108] Spleen cells were combined with NS-1 cells in a ratio of
5:1, centrifuged and the supernatant was aspirated. The cell pellet
was dislodged and 2 ml of 37.degree. C. PEG 1500 (50% in 75 mM
Hepes, pH 8.0) (Boehringer Mannheim) was added while stirring over
the course of one minute, followed by addition of 14 ml of serum
free RPMI over seven minutes. An additional 16 ml RPMI was added
and the cells were centrifuged at 200 g for ten minutes. After
discarding the supernatant, the pellet was resuspended in 200 ml
RPMI containing 15% FBS, 100 .mu.M sodium hypoxanthine, 0.4 .mu.M
aminopterin, 16 .mu.M thymidine (HAT) (Gibco), 25 units/ml IL-6
(Boehringer Mannheim) and 1.5.times.10.sup.6 thymocytes/ml. The
suspension was dispensed into ten 96-well flat bottom tissue
culture plates (Corning, United Kingdom) at 200 .mu.l/well. Cells
in plates were fed three to five times before screening by
aspirating approximately 100 .mu.l from each well with an 18 G
needle (Becton Dickinson), and adding 100 .mu.l/well plating medium
described above except containing 10 units/ml IL-6 and lacking
thymocytes.
[0109] Supernatants from fusion 200 were screened initially by
ELISA on the immunogen and detected with goat anti-mouse IgG (fc)
horse radish peroxidase conjugate. Supernatants from thirty wells
that gave the highest signal were retested by Western analysis on
the immunogen. Based on assay results, nine fusion wells were
selected for further cloning. The nine wells were designated 200A
through 200I.
[0110] Supernatants from fusion 233 were initially tested by ELISA
on HisIRP-1 and HisB2-1 coated plates. Fusions from wells reacting
with HisIRP-1 and not HisB2-1 were selected for further
cloning.
[0111] These fusion cells were subcloned successively using RPMI,
15% FBS, 100 .mu.M sodium hypoxanthine, 16 uM thymidine, and 10
units/ml IL-6. Subcloning was performed either by doubling dilution
or by limiting dilution, by seeding 96 well plates at 0.5-1.0
cells/well. Wells of subclone plates were scored visually and the
numbers of colonies in the least dense wells were recorded.
Selected wells of each cloning were tested, by ELISA or Western
blot as described, for reactivity observed in the original fusion
well. Cloning was completed for cell lines 200A, 200B, 200F, 200H,
200G, 233E, 233G, and 233K. Western blots were performed by
reacting antibodies from the eight hybridoma lines with IRP-1,
IRP-2, and B2-1. Isotypes were determined for the monoclonal
antibodies from the eight hybridoma cell lines using either the
Isostrip kit (Boehringer Mannheim) or an ELISA using isotype
specific reagents (Zymed Laboratories, South San Francisco,
Calif.). All antibodies are IgG1 except 200G which is IgG2a
isotope.
[0112] Hybridoma cell lines 200A, 200B, and 233G were deposited
with the American Type Culture Collection.
[0113] The 233 series of mAbs were further tested by using
hybridoma supernatants to screen in Western blots. Briefly, JY-8
cells transfected with either GFP/IRP-1, GFP/IRP-2 or GFP/B2-1 (see
Example 5) were lysed in 1% CHAPS buffer. Cells were lysed on ice
for thirty minutes and then centrifuged at 12,000 rpm for ten
minutes. Sample buffer was added to the supernatants and the
samples were boiled for four minutes. Samples were run on an 8%
Novex gel and transferred to PVDF membrane. The membrane was
blocked in TST (25 mM Tris pH 8.0, 150 mM NaCl, 0.2% Tween-20)
containing 3% BSA for one hour. Blocking solution was removed and
replaced with a 1:20 dilution of hybridoma supernatant in binding
buffer (3% BSA in TST) and incubated at room temperature for one
hour. The membrane was washed extensively with TST and then
incubated with an HRP conjugated goat anti-mouse IgG Fc fragment
(Jackson ImmunoResearch) for thirty minutes at room temperature.
After washing with TST, a Renaissance kit (NEN) was used for ECL
detection and the membrane was exposed to Hyperfilm (Kodak).
Supernatants from 233A, 233D, 233G, 233K, and 233L all specifically
recognized an appropriately sized 77 kDa band in the GFP-Irp-1
lysate and not in the GFP-IRP-2 or GFB-B2-1 lysates. The signal
using 233G was strongest.
[0114] Using the same procedures as above, purified 200A and 200B
mAbs were tested for their ability to detect GFP-IRP fusion
proteins from lysates of JY-8 transfectants using Western blotting.
Both mAbs were used at 1 .mu.g/ml in Western blotting. mAb 200A
recognized GFP-Irp1, GFP-IRP-2 and GFP-B2-1 equally well, whereas
200B preferentially recognized GFP-B2-1 and showed weak recognition
(less than 10% of the level seen with B2-1) of GFP-Irp-1. On
another Western containing lysate of a JY-8 transfectant expressing
a GFP tagged PH domain of an IRP-1 truncation, 200A detected a band
of an appropriate size for a GFP-IRP-1 PH domain truncate
suggesting that 200A recognizes a common epitope in the homologous
PH domains of IRP-1, IRP-2 and B2-1.
[0115] Hybridoma supernatants were screened for specific reactivity
to recombinant proteins by ELISA. In addition, specificity was
determined by reactivity to Western blots containing IRP-1, IRP-2
and B2-1 E. Coli expressed proteins. mAb 200A (reactive to IRP-1,
IRP-2 and B2-1 PH domains), 233G (reactive to IRP-1) and 200B
(reactive to B2-1) were used to determine expression levels and
sizes of GFP-IRP fusion proteins in JY-8 IRP transfectants.
[0116] To determine integrin expression levels on JY-8
transfectants, cells were stained with mAb specific for
.alpha..sub.1.beta..sub.2, TS1/22 (ATCC), and .alpha..sub.4,
IC/A4.1 (ICOS Corporation) by standard indirect immunofluorescence.
Fluorescence was quantitated by flow cytofluoremetry using a FACS
scan.
Example 8
[0117] Chemotaxis requires not only initial adhesion to substrate
and cycling of integrin through phases of binding and release in
polarized cells but also requires recycling of integrin from the
trailing to the leading edge. To determine if IRPs effect other
integrin functions in addition to static adhesion, the role of IRP
on chemotaxis was determined by a chemotactic cell migration assay.
In this assay, JY-8 cells migrate toward a source of IL-8 in an
integrin and CAM dependent manner.
[0118] The assay was a modification of a procedure for cell
migration under agarose as described by Schreiner et al, Immunol.,
88:89-96 (1980). Briefly, 6-well plates (Falcon) were coated with
either ICAM-1/Fc (25 .mu.g/ml) or VCAM-1/Fc (10 .mu.g/ml) (ICOS
Corporation) in bicarbonate buffer (pH 9.6). After overlaying 1%
agarose in RPMI containing 0.5% BSA (Intergen) plates were
incubated at 4.degree. C. for 30 minutes. Cells were washed with
RPMI and resuspended at 5.times.10.sup.7/ml in RPMI with 0.5% BSA.
Wells were formed in the agarose by using a 2.5 mm gel puncher
(Pharmacia), and filled immediately with 10 .mu.l of either IL-8
(2.5 .mu.g/ml) (PeproTech) or cell suspension. Plates were
incubated at 37.degree. C. in 5% CO.sub.2 for 8 hours. Cells were
then fixed by the addition of 2% glutaraldehyde solution. After
removing the agarose, wells were rinsed with dH.sub.2O and dried.
Quantitation of cell migration was performed using a video
microscopy work station consisting of a Diaphot microscope (Nikon,
Tokyo, Japan), a CCD-72 video camera and DSP2000 digital processor
(Dage, Michigan City, Ind.), and a Macintosh.RTM. NIH Image program
(developed at the U.S. National Institutes of Health and available
from the Internet by anonymous FTP from zippy.nimh.nih.gov or on
floppy disk from the National Technical Information Service,
Springfield, Va., part number PB95-500195GEI).
[0119] Cheomotaxis of JY-8 cells expressing GFP/IRP fusion proteins
was determined as described above. IRP-1, IRP-2 and B2-1
overexpression in JY-8 cells decreased chemotaxis on ICAM-1 or
VCAM-1 relative to GFP expressing transfectants. Expression of the
IRP-1 PH domain substitution mutant R279/A also decreased
chemotaxis. However, expression of R279/A decreased chemotaxis much
less effectively then expression of wild type IRP-1. Expression of
the IRP-1 PH domain also decreased chemotaxis on ICAM-1 and VCAM-1.
These results indicate that IRP-1 PH domain plays a major role in
the IRP-1 mediated decrease in chemotaxis. The substitution E156/A
in IRP-1 Sec7 domain also resulted in a decrease in chemotaxis but
less than that observed with wild type IRP-1 overexpression.
Overexpression of IRP-1 Sec7 domain resulted in increased
chemotaxis on ICAM-1, but no change in chemotaxis was observed on
VCAM-1. These results indicate that the Sec7 domain can also
contribute to chemotaxis. Thus both IRP-1 Sec7 and PH domains
function in .alpha..sub.4.beta..sub.7 and .alpha..sub.1.beta..sub.2
dependent chemotactic migration.
[0120] As discussed above, the inhibitory effect of IRP-1
overexpression on chemotaxis was decreased by substitutions in the
Sec7 (E156/A) and PH (R279/A) domains, indicating that as with
adhesion both domains contribute to IRP-1 regulation of chemotaxis.
The increased chemotactic migration of JY-8 transfectants
expressing IRP-1 R279/A relative to wild type, and the near
complete blocking with expression of the IRP-1 PH domain, indicates
that the PH domain plays a major role in chemotaxis. Therefore
interactions between IRP-1 PH domain and phosphatidylinositols
[Harlan et al., Biochemistry, 34:9859-9864 (1995), Pitcher et al.,
J. Biol. Chem., 270:11707-11710 (1995)] or heterotrimeric G protein
.beta..gamma. subunits [Mahadeven et al., Biochemistry,
34:9111-9117 (1995), Touhara et al., J. Biol. Chem.,
269:10217-10220 (1994), Pitcher et al., J. Biol. Chem.,
270:11707-11710 (1995)] appear to be critical to the role of IRPs
in chemotaxis.
Example 9
[0121] Tissue distribution of IRPs was determined using monoclonal
antibodies 200B and 233G. Antibody 200B preferentially recognizes
B2-1 and antibody 233G specifically recognizes IRP-1.
[0122] Both monoclonal antibodies were used at 10 .mu.g/ml for
immunocytochemical analysis of frozen human tonsil, spleen, and
lymph node sections. Sections of 6 micron thickness were layered
onto Superfrost Plus Slides (VWR) and stored at -70.degree. C.
Prior to use, slides were removed from -70.degree. C. and placed at
55.degree. C. for five minuets. Sections were then fixed in cold 4%
paraformaldehyde for two minutes, then in cold acetone for 5
minutes and air dried. Sections were blocked in a solution
containing 1% BSA, 30% normal human sera and 5% normal rat sera for
thirty minutes at room temperature. Antibodies 200B or 233G was
applied to each section for one hour at room temperature. Unbound
antibody was removed by washing the slides three times in TBS
buffer for five minutes per wash. Next, rat anti-mouse-biotin
conjugated antibody was applied to each section in the same TBS
buffer and incubated for thirty minutes at room temperature. An
ABC-elite kit (Vector Labs) was used to detect the secondary
antibody and was applied to each section for thirty minutes at room
temperature. DAB substrate (Vector Labs) was applied and color
development stopped by immersion in water. The color was enhanced
by the application of 1% Osmic Acid for approximately five to ten
seconds. The enhancement was stopped by placing slides in water.
Sections were counter stained in Hematoxylin Gill's No. 2 and
rinsed in water, acid alcohol, lithium carbonate before dehydration
and mounting with Pennount (VWR). 200B and 233G staining was
detected in tonsil, spleen, and lymph node, but not with a control
IgG1 antibody.
[0123] Both antibodies displayed very strong labeling on the
mucosal epithelium on tonsil. Both antibodies appear to be labeling
a subset of stratified squamous epithelium. A difference between
200B and 233G binding in the tonsil is the labeling seen within the
secondary follicles with 233G. This labeling was not seen with
200B. In the spleen, both antibodies looked very similar in their
binding, labeling individual cells in the red pulp areas. In the
lymph node, binding was observed on individual cells in the deep
cortex with 200B and in the deep cortex and medullary cortex with
233G. The labeling pattern seen with 200B was very punctate. This
was also seen with 233G but it was much more subtle.
Example 10
[0124] PH domains are present in over seventy functionally diverse
proteins including kinases and linker proteins. PH domains have
been reported to confer the ability to bind to G protein
.beta..gamma. subunits, PIP.sub.2, and PKC. The SEC7 motif in IRPs
also occurs in other proteins not sharing homology beyond this
motif and is likely to support intramolecular interactions. In
addition, the kinesin/myosin amino terminal homology of IRPs might
similarly be predicted to support interaction with other proteins.
Proteins which interact with IRPs may be identified by various
assays as described below.
[0125] A first assay contemplated by the invention is a two-hybrid
screen. The two-hybrid system was developed in yeast [Chien et al.,
Proc. Natl. Acad. Sci. (USA), 88: 9578-9582 (1991)] and is based on
functional in vivo reconstitution of a transcription factor which
activates a reporter gene. Specifically, a polynucleotide encoding
a protein that interacts with IRPs is isolated by: transforming or
transfecting appropriate host cells with a DNA construct comprising
a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA binding domain and an activating
domain; expressing in the host cells a first hybrid DNA sequence
encoding a first fusion of part or all of IRPs and either the DNA
binding domain or the activating domain of the transcription
factor; expressing in the host cells a library of second hybrid DNA
sequences encoding second fusions of part or all of putative IRPs
binding proteins and the DNA binding domain or activating domain of
the transcription factor which is not incorporated in the first
fusion; detecting binding of an IRPs interacting protein to IRPs in
a particular host cell by detecting the production of reporter gene
product in the host cell; and isolating second hybrid DNA sequences
encoding the interacting protein from the particular host cell.
Presently preferred for use in the assay are a lexA promoter to
drive expression of the reporter gene, the lacZ reporter gene, a
transcription factor comprising the lexA DNA binding domain and the
GAL4 transactivation domain, and yeast host cells.
[0126] Other assays for identifying proteins that interact with
IRPs may involve immobilizing IRPs or a test protein, detectably
labelling the nonimmobilized binding partner, incubating the
binding partners together and determining the amount of label
bound. Bound label indicates that the test protein interacts with
IRPs.
[0127] Another type of assay for identifying IRPs interacting
proteins involves immobilizing IRPs or a fragment thereof on a
solid support coated (or impregnated with) a fluorescent agent,
labelling a test protein with a compound capable of exciting the
fluorescent agent, contacting the immobilized IRPs with the
labelled test protein, detecting light emission by the fluorescent
agent, and identifying interacting proteins as test proteins which
result in the emission of light by the fluorescent agent.
Alternatively, the putative interacting protein may be immobilized
and IRPs may be labelled in the assay.
Example 11
[0128] Modulators of IRP interactions are contemplated by the
invention as useful in decreasing integrin, especially .beta..sub.2
and/or .beta..sub.7 integrin, adhesion to cellular or extracellular
matrix ligands resulting in down regulation of functions supported
by integrin engagement, especially cell growth, stimulation, and
localization in inflammatory processes. Specifically, it is
contemplated that the modulators have therapeutic value in
treatment of inflammatory or autoimmune diseases by decreasing the
influx of cells, for example neutrophils, eosinophils, lymphocytes,
monocytes or NK cells, to an inflammatory site and diminishing the
cytotoxic activity of cells already localized to such a site.
Modulators may be able to both down regulate integrin dependent
adhesion and antagonize stimulatory and costimulatory activities of
integrins. Modulators of IRPs may have an advantage over compounds
that interfere with integrin binding to extracellular ligands
(i.e., blocking antibodies or extracellular ligand antagonists)
because engagement of integrins can have activating effects and be
proinflammatory. Modulators of IRP binding may directly or
indirectly disrupt integrin signaling pathways. Because
overexpression of the carboxy terminal PH domain of IRPs does not
appear to result in an integrin specific decrease in cell adhesion,
specificity may be a function of amino terminal sequences that
possess kinesin or SEC7 homologies. Thus, modulators that bind to
these amino terminal sequences may effect cellular adhesion in an
integrin specific manner. Examples of assays for identifying
compounds that modulate interaction of IRPs with other proteins are
set out below.
[0129] A first assay involves transforming or transfecting
appropriate host cells with a DNA construct comprising a reporter
gene under the control of a promoter regulated by a transcription
factor having a DNA-binding domain and an activating domain;
expressing in the host cells a first hybrid DNA sequence encoding a
first fusion of part or all of IRPs and the DNA binding domain or
the activating domain of the transcription factor; expressing in
the host cells a second hybrid DNA sequence encoding part or all of
a protein that interacts with IRPs and the DNA binding domain or
activating domain of the transcription factor which is not
incorporated in the first fusion; evaluating the effect of a test
compound on the interaction between IRPs and the interacting
protein by detecting binding of the interacting protein to IRPs in
a particular host cell by measuring the production of reporter gene
product in the host cell in the presence or absence of the test
compound; and identifying modulating compounds as those test
compounds altering production of the reported gene product in
comparison to production of the reporter gene product in the
absence of the modulating compound. Presently preferred for use in
the assay are a lexA promoter to drive expression of the reporter
gene, the lacZ reporter gene, a transcription factor comprising the
lexA DNA binding domain and the GAL4 transactivation domain, and
yeast host cells.
[0130] Another type of assay for identifying compounds that
modulate the interaction between IRPs and an interacting protein
involves immobilizing IRPs or a natural IRPs interacting protein,
detectably labelling the nonimmobilized binding partner, incubating
the binding partners together and determining the effect of a test
compound on the amount of label bound wherein a reduction in the
label bound in the present of the test compound compared to the
amount of label bound in the absence of the test compound indicates
that the test agent is an inhibitor of IRPs interaction with
protein. Conversely, an increase in the label bound in the presence
of the test compound compared to the amount label bound in the
absence of the compound indicates that the putative modulator is an
activator of IRP interaction with the protein.
[0131] Specifically, IRP proteins were expressed as His-tagged or
His-kemptide-tagged recombinant proteins and were purified over
metal chelating chromatography resins from pET15b-transformed E.
coli lysates.
[0132] A well known means for radiolabeling recombinant proteins is
to tag the peptide with a kemptide tag. The kemptide tag is a seven
amino acid polypeptide fragment which contains a protein kinase A
(PKA) phosphorylation site. The kemptide tagged recombinant protein
may be radiolabeled at the kemptide tag by the action of PKA
[Mohanraj, et al., Protein Expr Purif 8(2): 175-182 (1996)].
[0133] IRPs (non-kemptide-tagged) were radiolabeled with free
.sup.125I either by the Iodobead.RTM. method (Pierce) or using the
lactoperoxidase/hydrogen peroxide method modified from Antibodies,
A Laboratory Manual, Cold Spring Harbor Laboratory, Harlow and
Lane, Editors, Chapter 9, pages 319-358 (1988). The radiolabeled
proteins were desalted and stored in binding assay buffer was
either 20 mM HEPES or 20 mM sodium phosphate pH 7.5 buffers with
either 150 mM or 300 mM NaCl, with or without 0.05% detergent
(NP-40 or Triton-X-100), and 2 mM azide as preservative. Final
specific radioactivity was between 3-10 .mu.Ci [.sup.125]/nmol
IRP.
[0134] .beta..sub.2 integrin cytoplasmic tail proteins (C-tails)
were expressed and purified as recombinant His3E9-tagged proteins
from either pET15b-transformed E. coli or from transformed
Saccharomyces sp., or were obtained as untagged, synthetic peptide
preparations (Anaspec, Inc. San Jose, Calif., Macromolecular
Resources, Fort Collins, Colo.).
[0135] The integrin C-tails were immobilized onto 96-well
microtiter Scintistrip.TM. (Wallac) plates at concentrations
between 1-100 .mu./ml in volumes of 50-100 .mu.l bicarbonate, pH
9.6, per well and were incubated at 4.degree. C. overnight. Plates
were dried and blocked in 350 .mu.l/well sterile-filtered 1-2%
Bovine Serum Albumin (BSA) dissolved in binding assay buffer and
were incubated at room temperature for 1-2 hours. The wells were
washed 3 times in binding assay buffer and dried just prior to
addition of IRPs.
[0136] The binding assay format was either a competition/inhibition
binding assay or a saturation binding assay. In the competition
binding assay, radiolabeled IRPs were diluted to 25-100 nM in
binding assay buffer with one potential modulator of binding
(unlabelled IRPs, soluble C-tails or non-specific control
polypeptides such as BSA). The assay was initiated with addition of
100 .mu.l labeled IRPs/potential modulator solution to the blocked
Scintistrip.RTM. wells (50,000-200,000 cpm/well), then incubated
one hour at room temperature (22-24.degree. C.) and stopped by
rapidly washing in binding assay buffer three to five times. The
saturation binding assays were performed similarly, except that a
constant 1:20 ratio of radiolabeled:unlabeled IRPs were tested over
a total concentration range of 0.01-30 .mu.M. The plates were dried
and scintillation was measured on a Wallac Model 1450 liquid
scintillation counter after the detectors were normalized.
Interwell crosstalk was corrected for with a test Scintistrip.TM.
plate, containing in the G11, 100 .mu.l of 25-100 nM radiolabeled
IRP captured by anti-IRP monoclonal antibody 200A coated in the
well at 20 .mu.g/ml in bicarbonate buffer. The incubation times and
conditions for the test plate were identical to the binding assay
above.
[0137] Binding was measured as counts of radiolabeled IRPs found in
C-tail-coated wells above counts found in BSA-coated wells.
Specific binding was assessed as counts found in C-tail-coated
wells which were reduced with added unlabelled IRPs or soluble
C-tails.
[0138] The competition binding assay utilizing iodinated IRP-1
showed that the potential modulators IRP-1, IRP-1 Sec7 domain,
B2-1, inhibited binding between iodinated IRP-1 and immobilized
His3E9-tagged .beta..sub.2 C-tails. IRP-1, IRP-1 Sec7 domain, B2-1,
when present in concentrations ranging from 0.001 to 4 .mu.M
decreased the binding of iodinated IRP-1 to the .beta..sub.2 C-tail
by about 75%. The addition of control peptide (BSA) did not
decrease IRP-1 binding to the immobilized .beta..sub.2 C-tail.
Additionally, a second control in which no .beta..sub.2 C-tail was
immobilized on a BSA blocked microtiter plate showed only
background levels of radiolabeled IRP-1 binding.
[0139] The binding assays may be modified by utilizing IRPs and the
C-tails of other integrins, including but not limited to
.beta..sub.1, .beta..sub.3 and .beta..sub.7. The IRPs or the
C-tails can be labeled with [.sup.3H]-sodium borohydride,
[.sup.125I]-bolton-hunter reagent, [.sup.35S]-metabolic labelling,
protein kinase [.sup.32P]-labelling, or other suitable radiolabel
crosslinking methods. Proteins and peptides may be immobilized on
to microtiter plates (Nunc Covalink, Pierce Reactibind, Costar
Labcoat, etc . . . ) or to beads (SPA or otherwise). The binding
assays may be modified by a skilled artisan to adjust incubation
times and modify buffer conditions. In addition, the polypeptides
utilized in the assay may include different synthetic peptide
fragments and may be prepared by various means understood by the
skilled worker, including expression of cDNA constructs, isolation
from natural sources and chemical synthesis. The determination that
a test compound is a modulator is accomplished by the addition of
the test compound to the binding assay. As discussed above, an
increase or decrease in binding indicates that the test compound is
a modulator of IRps.
[0140] Other binding assays contemplated to be useful in
identifying modulators of IRP activity include assays which
determine the binding of IRPs to a binding partner (ARFs,
phosphatidyl inositols or other related compounds). In these
assays, IRP or its binding partner is immobilzzed to microtiter
plates of beads. The amount of binding of detectably labeled IRP or
the binding partner is determined in the presence and absence of a
test compound under appropriate conditions. A modulator of IRP
activity is a compound that decreases or increases the binding of
IRP to the binding partner.
[0141] To determine the binding of IRP to a phosphatidyl inositol,
His-tagged IRP-1 PH domain (5'HA IRP-1 PH) was immobilized on a
microtiter plate by incubating 100 .mu.l of 20 .mu.g/ml 5'HA IRP-1
PH in bicarbonate buffer, pH 9.6 for approximately sixteen hours at
4.degree. C. The microtiter plate was then decanted and blocked
with 1-2% human IgG for one hour at approximately 22.degree. C. The
plates were washed three times in assay buffer (25 mM Tris pH 7.4,
100 .mu.M NaCl, 0.25% NP-40, 0.1% sodium deoxycholate, 1mM
MgCl.sub.2, 0.5% DTT). Ten nanomoles of .sup.3H-inositol phosphates
(IPn) (Du Pont, NEN) was added in 100 .mu.l assay buffer with
between 0-100 .mu.moles cold IPn for two hours at 22.degree. C. The
microtiter plates were washed four times and scintillant was added.
The binding was determined by measuring the bound radioactivity in
a scintillation counter. The results indicated that His-tagged
IRP-1 PH domain bound to inositol (1,3,4,5)P.sub.4 and IP.sub.6 by
a factor of ten over controls. A modulator of binding between IRP
and inositol phosphates may be determined by the addition of a test
compound to this assay and determining the differences in binding
in the presence and absence of the test compound.
[0142] Yet another method contemplated by the invention for
identifying compounds that modulate the binding between IRPs and an
interacting protein involves immobilizing IRPs or a fragment
thereof on a solid support coated (or impregnated with) a
fluorescent agent, labelling the interacting protein with a
compound capable of exciting the fluorescent agent, contacting the
immobilized IRPs with the labelled interacting protein in the
presence and absence of a test compound, detecting light emission
by the fluorescent agent, and identifying modulating compounds as
those test compounds that affect the emission of light by the
fluorescent agent in comparison to the emission of light by the
fluorescent agent in the absence of the test compound.
Alternatively, the IRPs interacting protein may be immobilized and
IRPs may be labelled in the assay.
[0143] Combinatorial libraries, peptide and peptide mimetics,
defined chemical entities, oligonucleotides, and natural product
libraries may be screened for activity as modulators in assays such
as those described above.
Example 12
[0144] Identification of modulators of IRPs interactions is
facilitated by clearly defining the portions of the proteins which
are necessary for binding. Amino acid substitution, through
standard mutagenesis techniques, is contemplated for use in
identifying binding regions of the proteins. Deletion analysis,
wherein truncated forms of the proteins are generated, for example
by PCR, is also useful for identification of binding regions if the
deletion does not disrupt the tertiary or quaternary structure of
the protein to the point that it is no longer recognized buy its
counter-receptor.
[0145] Identification of the significant protein regions involved
in binding permits more accurate and efficient screening of
putative modulators of binding activity. The invention contemplates
of a high throughput screening assay to analyze large libraries of
small molecules or peptides, as well as antibodies immunospecific
for either or both binding partners, for the ability to modulate
interactions of .beta..sub.2, .beta..sub.7, .beta..sub.1, and/or
.beta..sub.3 integrins with IRPs as well as for the ability to
modulate interactions of IRPs with other interacting proteins.
While two hybrid screening, scintillation proximity assays (SPA)
and immunological methodologies [for example, enzyme-linked
immunosorbent assays (ELISA)] disclosed herein are not HTS methods,
per se, they are amenable to test many of the compounds listed for
an ability to modulate binding. SPA and ELISA are particularly
useful in this identification process and can be modified to permit
high throughput screening of the test compounds described.
[0146] While the present invention has been described in terms of
specific embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Accordingly,
only such limitations as appear in the claims should be placed on
the invention.
Sequence CWU 1
1
* * * * *