U.S. patent application number 09/880729 was filed with the patent office on 2003-03-06 for enzymes having carboxymethyl cellulase activity and methods of use thereof.
Invention is credited to Lam, David E., Mathur, Eric J., Short, Jay M..
Application Number | 20030044956 09/880729 |
Document ID | / |
Family ID | 25376953 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030044956 |
Kind Code |
A1 |
Short, Jay M. ; et
al. |
March 6, 2003 |
Enzymes having carboxymethyl cellulase activity and methods of use
thereof
Abstract
The invention relates to carboxymethyl cellulases and to
polynucleotides encoding the carboxymethyl cellulases. In addition
methods of designing new carboxymethyl cellulases and method of use
thereof are also provided. The carboxymethyl cellulases have
increased activity and stability at increased pH and
temperature.
Inventors: |
Short, Jay M.; (Rancho Santa
Fe, CA) ; Mathur, Eric J.; (Carlsbad, CA) ;
Lam, David E.; (Carlsbad, CA) |
Correspondence
Address: |
FISH & RICHARDSON, PC
4350 LA JOLLA VILLAGE DRIVE
SUITE 500
SAN DIEGO
CA
92122
US
|
Family ID: |
25376953 |
Appl. No.: |
09/880729 |
Filed: |
June 12, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09880729 |
Jun 12, 2001 |
|
|
|
09472857 |
Dec 27, 1999 |
|
|
|
6245547 |
|
|
|
|
09472857 |
Dec 27, 1999 |
|
|
|
08951889 |
Oct 16, 1997 |
|
|
|
6008032 |
|
|
|
|
08951889 |
Oct 16, 1997 |
|
|
|
08518615 |
Aug 23, 1995 |
|
|
|
5962258 |
|
|
|
|
Current U.S.
Class: |
435/209 ;
435/101; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12Y 302/01004 20130101;
C12N 15/1027 20130101; C07H 21/00 20130101; C12N 9/2437 20130101;
G16B 30/00 20190201; G16B 30/20 20190201; G16B 30/10 20190201 |
Class at
Publication: |
435/209 ;
435/69.1; 435/325; 435/320.1; 536/23.2; 435/101 |
International
Class: |
C12P 019/04; C07H
021/04; C12N 009/42; C12P 021/02; C12N 005/06 |
Claims
What is claimed is:
1. An isolated nucleic acid comprising a sequence as set forth in
SEQ ID NO:1 and variants thereof having at least about 50% identity
to SEQ ID NO:1 and encoding a polypeptide having carboxymethyl
cellulase activity.
2. The isolated nucleic acid of claim 1, comprising a sequence as
set forth in SEQ ID NO: 1, sequences substantially identical
thereto, and sequences complementary thereto.
3. An isolated nucleic acid that hybridizes to a nucleic acid of
claim 1 under conditions of high stringency.
4. An isolated nucleic acid that hybridizes to a nucleic acid of
claim 1 under conditions of moderate stringency.
5. An isolated nucleic acid that hybridizes to a nucleic acid of
claim 1 under conditions of low stringency.
6. An isolated nucleic acid having at least about 55% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
7. An isolated nucleic acid having at least about 60% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
8. An isolated nucleic acid having at least about 65% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
9. An isolated nucleic acid having at least 70% homology to the
nucleic acid of claim 1 as determined by analysis with a sequence
comparison algorithm.
10. An isolated nucleic acid having at least about 75% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
11. An isolated nucleic acid having at least 80% homology to the
nucleic acid of claim 1 as determined by analysis with a sequence
comparison algorithm.
12. An isolated nucleic acid having at least about 85% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
13. An isolated nucleic acid having at least 90% homology to the
nucleic acid of claim 1 as determined by analysis with a sequence
comparison algorithm.
14. An isolated nucleic acid having at least about 95% homology to
the nucleic acid of claim 1 as determined by analysis with a
sequence comparison algorithm.
15. The isolated nucleic acid of claim 1, 2, 6, 7, 8, 9, 10, 11, or
12, wherein the sequence comparison algorithm is FASTA version
3.0t78 with the default parameters.
16. An isolated nucleic acid comprising at least 10 consecutive
bases of SEQ ID NO:1, sequences substantially identical thereto,
and sequences complementary thereto.
17. An isolated nucleic acid having at least about 50% homology to
the nucleic acid of claim 10 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
18. An isolated nucleic acid having at least about 55% homology to
the nucleic acid of claim 10 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
19. An isolated nucleic acid having at least about 60% homology to
the nucleic acid of claim 10 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
20. An isolated nucleic acid having at least about 65% homology to
the nucleic acid of claim 10 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
21. An isolated nucleic acid having at least 70% homology to the
nucleic acid of claim 10 as determined by analysis with a sequence
comparison algorithm or FASTA version 3.0t78 with the default
parameters.
22. An isolated nucleic acid encoding a polypeptide having a
sequence as set forth in SEQ ID NO: 2, and sequences substantially
identical thereto.
23. An isolated nucleic acid encoding a polypeptide comprising at
least 10 consecutive amino acids of a polypeptide having a sequence
as set forth in of SEQ ID NO: 2, and sequences substantially
identical thereto.
24. A purified polypeptide substantially identical to the
polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
25. A purified polypeptide having at least about 50% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
26. A purified polypeptide having at least about 55% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
27. A purified polypeptide having at least about 60% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
28. A purified polypeptide having at least about 65% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
29. A purified polypeptide having at least 70% homology to the
polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
30. A purified polypeptide having at least about 75% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
31. A purified polypeptide having at least 80% homology to the
polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
32. A purified polypeptide having at least about 85% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
33. A purified polypeptide having at least about 90% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
34. A purified polypeptide having at least about 95% homology to
the polypeptide of claim 22 or 23 as determined by analysis with a
sequence comparison algorithm or FASTA version 3.0t78 with the
default parameters.
35. A purified polypeptide having a sequence as set forth in SEQ ID
NO: 2 and sequences substantially identical thereto.
36. A purified antibody that specifically binds to a polypeptide
comprising a sequence as set forth in SEQ ID NO: 2, and sequences
substantially identical thereto.
37. A purified antibody that specifically binds to a polypeptide
having at least 10 consecutive amino acids of the polypeptides as
set forth in SEQ ID NO: 2, and sequences substantially identical
thereto.
38. The antibody of claim 36 or 37, wherein the antibodies are
polyclonal.
39. The antibody of claim 36 or 37, wherein the antibodies are
monoclonal.
40. A method of producing a polypeptide having a sequence as set
forth in SEQ ID NO: 2, and sequences substantially identical
thereto comprising introducing a nucleic acid encoding the
polypeptide into a host cell under conditions that allow expression
of the polypeptide and recovering the polypeptide.
41. A method of producing a polypeptide comprising at least 10
amino acids of a sequence as set forth in SEQ ID NO: 2, and
sequences substantially identical thereto comprising introducing a
nucleic acid encoding the polypeptide, operably linked to a
promoter, into a host cell under conditions that allow expression
of the polypeptide and recovering the polypeptide.
42. A method of generating a variant comprising: obtaining a
nucleic acid comprising a sequence as set forth in SEQ ID NO: 1,
sequences substantially identical thereto, sequences complementary
thereto, fragments comprising at least 30 consecutive nucleotides
thereof, and fragments comprising at least 30 consecutive
nucleotides of the sequences complementary to SEQ ID NO: 1; and
modifying one or more nucleotides in said sequence to another
nucleotide, deleting one or more nucleotides in said sequence, or
adding one or more nucleotides to said sequence.
43. The method of claim 42, wherein the modifications are
introduced by a method selected from the group consisting of
error-prone PCR, shuffling, oligonucleotide-directed mutagenesis,
assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette
mutagenesis, recursive ensemble mutagenesis, exponential ensemble
mutagenesis, site-specific mutagenesis, gene reassembly, gene site
saturated mutagenesis and any combination thereof.
44. The method of claim 42, wherein the modifications are
introduced by error-prone PCR.
45. The method of claim 42, wherein the modifications are
introduced by shuffling.
46. The method of claim 42, wherein the modifications are
introduced by oligonucleotide-directed mutagenesis.
47. The method of claim 42, wherein the modifications are
introduced by assembly PCR.
48. The method of claim 42, wherein the modifications are
introduced by sexual PCR mutagenesis.
49. The method of claim 42, wherein the modifications are
introduced by in vivo mutagenesis.
50. The method of claim 42, wherein the modifications are
introduced by cassette mutagenesis.
51. The method of claim 42, wherein the modifications are
introduced by recursive ensemble mutagenesis.
52. The method of claim 42, wherein the modifications are
introduced by exponential ensemble mutagenesis.
53. The method of claim 42, wherein the modifications are
introduced by site-specific mutagenesis.
54. The method of claim 42, wherein the modifications are
introduced by gene reassembly.
55. The method of claim 42, wherein the modifications are
introduced by gene site saturated mutagenesis.
56. A computer readable medium having stored thereon a nucleic acid
sequence as set forth in SEQ ID NO: 1, and sequences substantially
identical thereto, or a polypeptide sequence as set forth in SEQ ID
NO: 2, and sequences substantially identical thereto.
57. A computer system comprising a processor and a data storage
device wherein said data storage device has stored thereon a
nucleic acid sequence as set forth in SEQ ID NO: 1, and sequences
substantially identical thereto, or a polypeptide sequence as set
forth in SEQ ID NO: 2, and sequences substantially identical
thereto.
58. The computer system of claim 45, further comprising a sequence
comparison algorithm and a data storage device having at least one
reference sequence stored thereon.
59. The computer system of claim 58, wherein the sequence
comparison algorithm comprises a computer program which indicates
polymorphisms.
60. The computer system of claim 57, further comprising an
identifier which identifies features in said sequence.
61. A method for comparing a first sequence to a reference sequence
wherein said first sequence is a nucleic acid sequence as set forth
in SEQ ID NO: 1, and sequences substantially identical thereto, or
a polypeptide sequence as set forth in SEQ ID NO: 2, and sequences
substantially identical thereto comprising: reading the first
sequence and the reference sequence through use of a computer
program which compares sequences; and determining differences
between the first sequence and the reference sequence with the
computer program.
62. The method of claim 61, wherein determining differences between
the first sequence and the reference sequence comprises identifying
polymorphisms.
63. A method for identifying a feature in a sequence wherein the
sequence is as set forth in SEQ ID NO: 1, sequences substantially
identical thereto, or a polypeptide sequence as set forth in SEQ ID
NO: 2, and sequences substantially identical thereto comprising:
reading the sequence through the use of a computer program which
identifies features in sequences; and identifying features in the
sequences with the computer program.
64. A purified polypeptide of claim 1, wherein the polypeptide is a
thermostable enzyme which is stable to heat, is heat resistant and
catalyzes the enzymatic hydrolysis of cellulose, and wherein the
enzyme is able to renature and regain activity after exposure to
temperatures of from about 60 degrees C. to 105 degrees C.
65. A method of catalyzing the hydrolysis of cellulose comprising
contacting a sample containing cellulose with a polypeptide
selected from the group consisting of SEQ ID NO: 2 and sequences
having at least 50% homology and having carboxymethyl cellulase
enzyme activity under conditions with facilitate the hydrolysis of
the cellulose.
66. An assay for identifying functional polypeptide fragments or
variants encoded by fragments of SEQ ID NO: 1, and sequences
substantially identical thereto, which retain the enzymatic
function of the polypeptides of SEQ ID NO: 2, and sequences
substantially identical thereto, said assay comprising: contacting
the polypeptide of SEQ ID NO: 2, and sequences substantially
identical thereto, or polypeptide fragment or variant encoded by
SEQ ID NO: 1, with a substrate molecule under conditions which
allow said polypeptide or fragment or variant to function, and
detecting either a decrease in the level of substrate or an
increase in the level of the specific reaction product of the
reaction between said polypeptide and substrate, wherein a decrease
in the level of substrate or an increase in the level of the
reaction product is indicative of a functional polypeptide or
fragment or variant.
67. A nucleic acid probe comprising an oligonucleotide from about
10 to 50 nucleotides in length and having an area of at least 10
contiguous nucleotides that is at least 50% complementary to a
nucleic acid target region of the nucleic acid sequence set forth
in SEQ ID NO:1 and which hybridizes to the nucleic acid target
region under moderate to highly stringent conditions to form a
detectable target:probe duplex.
68. The probe of claim 67, wherein the oligonucleotide is DNA.
69. The probe of claim 67, which is at least 55% complementary to
the nucleic acid target region.
70. The probe of claim 67, which is at least 60% complementary to
the nucleic acid target region.
71. The probe of claim 67, which is at least 65% complementary to
the nucleic acid target region.
72. The probe of claim 67, which is at least 70% complementary to
the nucleic acid target region.
73. The probe of claim 67, which is at least 75% complementary to
the nucleic acid target region.
74. The probe of claim 67, wherein the oligonucleotide comprises a
sequence which is 80% complementary to the nucleic acid target
region.
75. The probe of claim 67, which is at least 85% complementary to
the nucleic acid target region.
76. The probe of claim 67, wherein the oligonucleotide comprises a
sequence which is 90% complementary to the nucleic acid target
region.
77. The probe of claim 67, which is at least 95% complementary to
the nucleic acid target region.
78. The probe of claim 67, which is fully complementary to the
nucleic acid target region.
79. The probe of claim 67, wherein the oligonucleotide is 15-50
bases in length.
80. The probe of claim 67, wherein the probe further comprises a
detectable isotopic label.
81. The probe of claim 67, wherein the probe further comprises a
detectable non-isotopic label selected from the group consisting of
a fluorescent molecule, a chemiluminescent molecule, an enzyme, a
cofactor, an enzyme substrate, and a hapten.
82. A nucleic acid probe comprising an oligonucleotide from about
15 to 50 nucleotides in length and having an area of at least 15
contiguous nucleotides that is at least 90% complementary to a
nucleic acid target region of the nucleic acid sequence set forth
in SEQ ID NO:1 and which hybridizes to the nucleic acid target
region under moderate to highly stringent conditions to form a
detectable target:probe duplex.
83. A nucleic acid probe comprising an oligonucleotide from about
15 to 50 nucleotides in length and having an area of at least 15
contiguous nucleotides that is at least 95% complementary to a
nucleic acid target region of the nucleic acid sequence set forth
in SEQ ID NO:1 and which hybridizes to the nucleic acid target
region under moderate to highly stringent conditions to form a
detectable target:probe duplex.
84. A nucleic acid probe comprising an oligonucleotide from about
15 to 50 nucleotides in length and having an area of at least 15
contiguous nucleotides that is at least 97% complementary to a
nucleic acid target region of the nucleic acid sequence set forth
in SEQ ID NO:1 and which hybridizes to the nucleic acid target
region under moderate to highly stringent conditions to form a
detectable target:probe duplex.
85. A polynucleotide probe for isolation or identification of
carboxymethyl cellulase genes having a sequence which is the same
as or fully complementary to at least a portion of SEQ ID NO:1.
86. An enzyme preparation comprising a polypeptide of any one of
claim 17 or 25 which is liquid.
87. An enzyme preparation comprising the polypeptide of any one of
claim 17 or 25 which is dry.
88. A method for modifying small molecules, comprising mixing a
polypeptide encoded by a polynucleotide of claim 1 or fragments
thereof with a small molecule to produce a modified small
molecule.
89. The method of claim 88 wherein a library of modified small
molecules is tested to determine if a modified small molecule is
present within the library which exhibits a desired activity.
90. The method of claim 89 wherein a specific biocatalytic reaction
which produces the modified small molecule of desired activity is
identified by systematically eliminating each of the biocatalytic
reactions used to produce a portion of the library, and then
testing the small molecules produced in the portion of the library
for the presence or absence of the modified small molecule with the
desired activity.
91. The method of claim 90 wherein the specific biocatalytic
reactions which produce the modified small molecule of desired
activity is optionally repeated.
92. The method of claim 90 or 91 wherein (a) the biocatalytic
reactions are conducted with a group of biocatalysts that react
with distinct structural moieties found within the structure of a
small molecule, (b) each biocatalyst is specific for one structural
moiety or a group of related structural moieties; and (c) each
biocatalyst reacts with many different small molecules which
contain the distinct structural moiety.
Description
RELATED APPLICATION DATA
[0001] This application is a continuation-in-part of U.S. Ser. No.
09/472, 857, filed Dec. 27, 1999, now issued as U.S. Pat. No.
6,245,547, the contents of which are hereby incorporated by
reference in their entirety.
FIELD OF THE INVENTION
[0002] This invention relates generally to enzymes, polynucleotides
encoding the enzymes, the use of such polynucleotides and
polypeptides, and more specifically to enzymes having carboxymethyl
cellulase activity.
BACKGROUND
[0003] Cellulose, a fibrous, tough, water-insoluble substance is
found in the cell walls of plants, particularly, in stalks, stems,
trunks and all the woody portions of plant tissues. Cellulose
constitutes much of the mass of wood, and cotton is almost pure
cellulose. Because cellulose is a linear, unbranched
homopolysaccharide of 10,000 to 15,000 D-glucose units, it
resembles amylose and the main chains of glycogen. But there is a
very important difference; in cellulose, the glucose residues have
the beta configuration, whereas in amylose, amylopectin and
glycogen the glucose is in the alpha configuration. The glucose
residues in cellulose are linked by (beta 1.fwdarw.4)glycosidic
bonds. This difference gives cellulose and amylose very different
3-dimensional structures and physical properties.
[0004] Cellulose cannot be used by most animals as a source of
stored fuel, because the (beta 1.fwdarw.4) linkages of cellulose
are not hydrolyzed by alpha-amylases. Termites readily digest
cellulose but only because their intestinal tract harbors a
symbiotic microorganism, trichonympha, which secretes cellulase, an
enzyme that hydrolyzes (beta 1.fwdarw.4) linkages between glucose
units. The only vertebrates able to use cellulose as food are
cattle and other ruminant animals (sheep, goats, camels and
giraffes). The extra stomachs "rumens" of these animals teem with
bacteria and protists that secrete cellulase.
[0005] The enzymatic hydrolysis of cellulose is considered to
require the action of both endoglucanases (1,4-beta-D-glucan
glucanohydrolase) and exoglucanases (1,4-beta-D-glucan
cellobiohydrolase). A synergistic interaction of these enzymes is
necessary for the complete hydrolysis of crystalline cellulose,
(Caughlin, M. P., Genet. Eng. Rev., 3:39-109 (1985). For the
complete degradation of cellulose (cellulose to glucose),
.beta.-glucosidase might be required if the "exo" enzyme does not
release glucose, 1,4-.beta.-d-Glucan glucohydrolase is another type
of "exo" cellulase.
[0006] Thermophilic bacteria have received considerable attention
as sources of highly active and thermostable cellulolytic and
xylanolytic enzymes (Bronneomeier, K. and Staudenbauer, W. L., D.
R. Woods (Ed.), The Clostridia and Biotechnology, Butterworth
Publishers, Stoneham, Mass. (1993)). Recently, the most extremely
thermophilic organotrophic eubacteria presently known have been
isolated and characterized. These bacteria, which belong to the
genus Thermotoga, are fermentative microorganisms metabolizing a
variety of carbohydrates (Huber, R. and Stetter, K. O., in Ballows,
et al., (Ed.), The Prokaryotes, 2nd Ed., Springer-Velag, N.Y., pgs.
3809-3819 (1992)).
[0007] In Huber et al., 1986, Arch. Microbial. 144:324-333, the
isolation of the bacterium Thermotoga maritima is described. T.
maritima is a eubacterium that is strictly anaerobic, rod-shaped,
fermentative, hyperthermophilic, and grows between 55.degree. C.
and 90.degree. C., with an optimum growth temperature of about
80.degree. C. This eubacterium has been isolated from geothermally
heated sea floors in Italy arid the Azores. T. maritima cells have
a sheath-like structure and monotrichous flagellation. T. maritima
is classified in the eubacterium kingdom by virtue of having murein
and fatty acid-containing lipids, diphtheria-toxin-resistant
elongation factor 2, an RNA polymerase subunit pattern, and
sensitivity to antibiotics.
[0008] Enzymes are highly selective catalysts. Their hallmark is
the ability to catalyze reactions with exquisite stereo-, regio-,
and chemo-selectivities that are unparalleled in conventional
synthetic chemistry. Moreover, enzymes are remarkably versatile.
They can be tailored to function in organic solvents, operate at
extreme pH's and temperatures, and catalyze reactions with
compounds that are structurally unrelated to their natural,
physiological substrates.
[0009] Enzymes are reactive toward a wide range of natural and
unnatural substrates, thus enabling the modification of virtually
any organic lead compound. Moreover, unlike traditional chemical
catalysts, enzymes are highly enantio- and regio-selective. The
high degree of functional group specificity exhibited by enzymes
enables one to keep track of each reaction in a synthetic sequence
leading to a new active compound. Enzymes are also capable of
catalyzing many diverse reactions unrelated to their physiological
function in nature. For example, peroxidases catalyze the oxidation
of phenols by hydrogen peroxide. Peroxidases can also catalyze
hydroxylation reactions that are not related to the native function
of the enzyme. Other examples are proteases which catalyze the
breakdown of polypeptides. In organic solution some proteases can
also acylate sugars, a function unrelated to the native function of
these enzymes.
[0010] The present invention exploits the unique catalytic
properties of enzymes. Whereas the use of biocatalysts (i.e.,
purified or crude enzymes, non-living or living cells) in chemical
transformations normally requires the identification of a
particular biocatalyst that reacts with a specific starting
compound, the present invention uses selected biocatalysts and
reaction conditions that are specific for functional groups that
are present in many starting compounds.
[0011] Each biocatalyst is specific for one functional group, or
several related functional groups, and can react with many starting
compounds containing this functional group.
[0012] The biocatalytic reactions produce a population of
derivatives from a single starting compound. These derivatives can
be subjected to another round of biocatalytic reactions to produce
a second population of derivative compounds. Thousands of
variations of the original compound can be produced with each
iteration of biocatalytic derivatization.
[0013] Enzymes react at specific sites of a starting compound
without affecting the rest of the molecule, a process which is very
difficult to achieve using traditional chemical methods. This high
degree of biocatalytic specificity provides the means to identify a
single active compound within the library. The library is
characterized by the series of biocatalytic reactions used to
produce it, a so-called "biosynthetic history". Screening the
library for biological activities and tracing the biosynthetic
history identifies the specific reaction sequence producing the
active compound. The reaction sequence is repeated and the
structure of the synthesized compound determined. This mode of
identification, unlike other synthesis and screening approaches,
does not require immobilization technologies, and compounds can be
synthesized and tested free in solution using virtually any type of
screening assay. It is important to note, that the high degree of
specificity of enzyme reactions on functional groups allows for the
"tracking" of specific enzymatic reactions that make up the
biocatalytically produced library.
[0014] Many of the procedural steps are performed using robotic
automation enabling the execution of many thousands of biocatalytic
reactions and screening assays per day as well as ensuring a high
level of accuracy and reproducibility. As a result, a library of
derivative compounds can be produced in a matter of weeks which
would take years to produce using current chemical methods. (For
further teachings on modification of molecules, including small
molecules, see PCT/US94/09174, herein incorporated by reference in
its entirety).
[0015] The polynucleotide sequence and polypeptide of the present
invention have been putatively identified as an endoglucanase
having carboxymethyl cellulose activity.
[0016] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the invention is not entitled to antedate such disclosure by virtue
of prior invention.
SUMMARY OF THE INVENTION
[0017] The invention provides an isolated nucleic acid having a
sequence as set forth in SEQ ID NO:1 and variants thereof having at
least 50% sequence identity to SEQ ID NO:1 and encoding
polypeptides having cellulase activity.
[0018] One aspect of the invention is an isolated nucleic acid
having a sequence as set forth in SEQ ID NO:1, sequences
substantially identical thereto, and sequences complementary
thereto.
[0019] Another aspect of the invention is an isolated nucleic acid
including at least 10 consecutive bases of SEQ ID NO:1, sequences
substantially identical thereto, and the sequences complementary
thereto.
[0020] In yet another aspect, the invention provides an isolated
nucleic acid encoding a polypeptide having a sequence as set forth
in SEQ ID NO:2 and variants thereof encoding a polypeptide having
cellulase activity and having at least 50% sequence identity to
such sequence.
[0021] Another aspect of the invention is an isolated nucleic acid
encoding a polypeptide or a functional fragment thereof having a
sequence as set forth in SEQ ID NO: 2, and sequences substantially
identical thereto.
[0022] Another aspect of the invention is an isolated nucleic acid
encoding a polypeptide having at least 10 consecutive amino acids
of a sequence as set forth in SEQ ID NO:2, and sequences
substantially identical thereto.
[0023] In yet another aspect, the invention provides a purified
polypeptide having a sequence as set forth in SEQ ID NO:2, and
sequences substantially identical thereto.
[0024] Another aspect of the invention is an isolated or purified
antibody that specifically binds to a polypeptide having a sequence
as set forth in SEQ ID NO:2, and sequences substantially identical
thereto.
[0025] Another aspect of the invention is an isolated or purified
antibody or binding fragment thereof, which specifically binds to a
polypeptide having at least 10 consecutive amino acids of SEQ ID
NO:2, and sequences substantially identical thereto.
[0026] Another aspect of the invention is a method of making a
polypeptide having a sequence as set forth in SEQ ID NO:2, and
sequences substantially identical thereto. The method includes
introducing a nucleic acid encoding the polypeptide into a host
cell, wherein the nucleic acid is operably linked to a promoter,
and culturing the host cell under conditions that allow expression
of the nucleic acid.
[0027] Another aspect of the invention is a method of making a
polypeptide having at least 10 amino acids of a sequence as set
forth in SEQ ID NO:2, and sequences substantially identical
thereto. The method includes introducing a nucleic acid encoding
the polypeptide into a host cell, wherein the nucleic acid is
operably linked to a promoter, and culturing the host cell under
conditions that allow expression of the nucleic acid, thereby
producing the polypeptide.
[0028] Another aspect of the invention is a method of generating a
variant including obtaining a nucleic acid having a sequence as set
forth in SEQ ID NO:1, sequences substantially identical thereto,
sequences complementary to SEQ ID NO:1, fragments comprising at
least 30 consecutive nucleotides of SEQ ID NO:1, and changing one
or more nucleotides in the sequence to another nucleotide, deleting
one or more nucleotides in the sequence, or adding one or more
nucleotides to the sequence.
[0029] Another aspect of the invention is a computer readable
medium having stored thereon a sequence as set forth in SEQ ID
NO:1, and sequences substantially identical thereto, or a
polypeptide sequence as set forth in SEQ ID NO:2, and sequences
substantially identical thereto.
[0030] Another aspect of the invention is a computer system
including a processor and a data storage device wherein the data
storage device has stored thereon a sequence as set forth in SEQ ID
NO:1, and sequences substantially identical thereto, or a
polypeptide having a sequence as set forth in SEQ ID NO:2, and
sequences substantially identical thereto.
[0031] Another aspect of the invention is a method for comparing a
first sequence to a reference sequence wherein the first sequence
is a nucleic acid having a sequence as set forth SEQ ID NO:1, and
sequences substantially identical thereto, or a polypeptide code of
SEQ ID NO:2, and sequences substantially identical thereto. The
method includes reading the first sequence and the reference
sequence through use of a computer program which compares
sequences; and determining differences between the first sequence
and the reference sequence with the computer program.
[0032] Another aspect of the invention is a method for identifying
a feature in SEQ ID NO:1, and sequences substantially identical
thereto, or a polypeptide having a sequence as set forth in SEQ ID
NO:2, and sequences substantially identical thereto, including
reading the sequence through the use of a computer program which
identifies features in sequences; and identifying features in the
sequence with the computer program.
[0033] Another aspect of the invention is an assay for identifying
fragments or variants of SEQ ID NO:2, and sequences substantially
identical thereto, which retain the enzymatic function of SEQ ID
NO:2, and sequences substantially identical thereto. The assay
includes contacting SEQ ID NO:2, sequences substantially identical
thereto, or polypeptide fragment or variant with a substrate
molecule under conditions which allow the polypeptide fragment or
variant to function, and detecting either a decrease in the level
of substrate or an increase in the level of the specific reaction
product of the reaction between the polypeptide and substrate
thereby identifying a fragment or variant of such sequences.
[0034] Another aspect of the invention is a method for modifying
small molecules, including contacting a polypeptide encoded by a
polynucleotide described herein or enzymatically active fragments
thereof with a small molecule to produce a modified small
molecule.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0036] FIG. 1 is a block diagram of a computer system.
[0037] FIG. 2 is a flow diagram illustrating one embodiment of a
process for comparing a new nucleotide or protein sequence with a
database of sequences in order to determine the homology levels
between the new sequence and the sequences in the database.
[0038] FIG. 3 is a flow diagram illustrating one embodiment of a
process in a computer for determining whether two sequences are
homologous.
[0039] FIG. 4 is a flow diagram illustrating one embodiment of an
identifier process 300 for detecting the presence of a feature in a
sequence.
[0040] FIG. 5A-C shows an illustration of the full-length DNA and
corresponding deduced amino acid sequence of the enzyme of the
present invention
DETAILED DESCRIPTION OF THE INVENTION
[0041] The present invention relates to carboxymethyl cellulase and
the polynucleotide encoding it. As used herein, the term
"cellulase" encompasses enzymes that catalyze the hydrolysis of the
beta 1,4 glycosidic bonds in cellulose.
[0042] The polynucleotides of the invention have been identified as
encoding polypeptides having cellulase activity.
[0043] The phrases "nucleic acid" or "nucleic acid sequence" as
used herein refer to an oligonucleotide, nucleotide,
polynucleotide, or to a fragment of any of these, to DNA or RNA of
genomic or synthetic origin which may be single-stranded or
double-stranded and may represent a sense or antisense strand, to
peptide nucleic acid (PNA), or to any DNA-like or RNA-like
material, natural or synthetic in origin.
[0044] A "coding sequence of" or a "nucleotide sequence encoding" a
particular polypeptide or protein, is a nucleic acid sequence which
is transcribed and translated into a polypeptide or protein when
placed under the control of appropriate regulatory sequences.
[0045] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as, where
applicable, intervening sequences (introns) between individual
coding segments (exons).
[0046] "Amino acid" or "amino acid sequence" as used herein refer
to an oligopeptide, peptide, polypeptide, or protein sequence, or
to a fragment, portion, or subunit of any of these, and to
naturally occurring or synthetic molecules.
[0047] The term "polypeptide" as used herein, refers to amino acids
joined to each other by peptide bonds or modified peptide bonds,
i.e., peptide isosteres, and may contain modified amino acids other
than the 20 gene-encoded amino acids. The polypeptides may be
modified by either natural processes, such as post-translational
processing, or by chemical modification techniques which are well
known in the art. Modifications can occur anywhere in the
polypeptide, including the peptide backbone, the amino acid
side-chains and the amino or carboxyl termini. It will be
appreciated that the same type of modification may be present in
the same or varying degrees at several sites in a given
polypeptide. Also a given polypeptide may have many types of
modifications. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of a phosphytidylinositol,
cross-linking cyclization, disulfide bond formation, demethylation,
formation of covalent cross-links, formation of cysteine, formation
of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI anchor formation, hydroxylation, iodination, methylation,
myristolyation, oxidation, pergylation, proteolytic processing,
phosphorylation, prenylation, racemization, selenoylation,
sulfation, and transfer-RNA mediated addition of amino acids to
protein such as arginylation. (See Creighton, T. E.,
Proteins--Structure and Molecular Properties 2nd Ed., W. H. Freeman
and Company, New York (1993); Posttranslational Covalent
Modification of Proteins, B. C. Johnson, Ed., Academic Press, New
York, pp. 1-12 (1983)).
[0048] As used herein, the term "isolated" means that the material
is removed from its original environment (e.g., the natural
environment if it is naturally occurring). For example, a
naturally-occurring polynucleotide or polypeptide present in a
living animal is not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting materials
in the natural system, is isolated. Such polynucleotides could be
part of a vector and/or such polynucleotides or polypeptides could
be part of a composition, and still be isolated in that such vector
or composition is not part of its natural environment.
[0049] As used herein, the term "purified" does not require
absolute purity; rather, it is intended as a relative definition.
Individual nucleic acids obtained from a library have been
conventionally purified to electrophoretic homogeneity. The
sequences obtained from these clones could not be obtained directly
either from the library or from total human DNA. The purified
nucleic acids of the invention have been purified from the
remainder of the genomic DNA in the organism by at least
10.sup.4-10.sup.6 fold. However, the term "purified" also includes
nucleic acids which have been purified from the remainder of the
genomic DNA or from other sequences in a library or other
environment by at least one order of magnitude, typically two or
three orders, and more typically four or five orders of
magnitude.
[0050] As used herein, the term "recombinant" means that the
nucleic acid is adjacent to a "backbone" nucleic acid to which it
is not adjacent in its natural environment. Additionally, to be
"enriched" the nucleic acids will represent 5% or more of the
number of nucleic acid inserts in a population of nucleic acid
backbone molecules. Backbone molecules according to the invention
include nucleic acids such as expression vectors, self-replicating
nucleic acids, viruses, integrating nucleic acids, and other
vectors or nucleic acids used to maintain or manipulate a nucleic
acid insert of interest. Typically, the enriched nucleic acids
represent 15% or more of the number of nucleic acid inserts in the
population of recombinant backbone molecules. More typically, the
enriched nucleic acids represent 50% or more of the number of
nucleic acid inserts in the population of recombinant backbone
molecules. In a one embodiment, the enriched nucleic acids
represent 90% or more of the number of nucleic acid inserts in the
population of recombinant backbone molecules.
[0051] "Recombinant" polypeptides or proteins refer to polypeptides
or proteins produced by recombinant DNA techniques; i.e., produced
from cells transformed by an exogenous DNA construct encoding the
desired polypeptide or protein. "Synthetic" polypeptides or protein
are those prepared by chemical synthesis. Solid-phase chemical
peptide synthesis methods can also be used to synthesize the
polypeptide or fragments of the invention. Such method have been
known in the art since the early 1960's (Merrifield, R. B., J. Am.
Chem. Soc., 85:2149-2154, 1963) (See also Stewart, J. M. and Young,
J. D., Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co.,
Rockford, Ill., pp. 11-12)) and have recently been employed in
commercially available laboratory peptide design and synthesis kits
(Cambridge Research Biochemicals). Such commercially available
laboratory kits have generally utilized the teachings of H. M.
Geysen et al, Proc. Natl. Acad. Sci., USA, 81:3998 (1984) and
provide for synthesizing peptides upon the tips of a multitude of
"rods" or "pins" all of which are connected to a single plate. When
such a system is utilized, a plate of rods or pins is inverted and
inserted into a second plate of corresponding wells or reservoirs,
which contain solutions for attaching or anchoring an appropriate
amino acid to the pin's or rod's tips. By repeating such a process
step, i.e., inverting and inserting the rod's and pin's tips into
appropriate solutions, amino acids are built into desired peptides.
In addition, a number of available FMOC peptide synthesis systems
are available. For example, assembly of a polypeptide or fragment
can be carried out on a solid support using an Applied Biosystems,
Inc. Model 431A automated peptide synthesizer. Such equipment
provides ready access to the peptides of the invention, either by
direct synthesis or by synthesis of a series of fragments that can
be coupled using other known techniques.
[0052] A promoter sequence is "operably linked to" a coding
sequence when RNA polymerase which initiates transcription at the
promoter will transcribe the coding sequence into mRNA.
[0053] "Plasmids" are designated by a lower case "p" preceded
and/or followed by capital letters and/or numbers. The starting
plasmids herein are either commercially available, publicly
available on an unrestricted basis, or can be constructed from
available plasmids in accord with published procedures. In
addition, equivalent plasmids to those described herein are known
in the art and will be apparent to the ordinarily skilled
artisan.
[0054] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion, gel electrophoresis may be performed to isolate the
desired fragment.
[0055] "Oligonucleotide" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0056] The phrase "substantially identical" in the context of two
nucleic acids or polypeptides, refers to two or more sequences that
have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% and in some
aspects 90-95% nucleotide or amino acid residue identity, when
compared and aligned for maximum correspondence, as measured using
one of the known sequence comparison algorithms or by visual
inspection. Typically, the substantial identity exists over a
region of at least about 100 residues, and most commonly the
sequences are substantially identical over at least about 150-200
residues. In some embodiments, the sequences are substantially
identical over the entire length of the coding regions.
[0057] Additionally a "substantially identical" amino acid sequence
is a sequence that differs from a reference sequence by one or more
conservative or non-conservative amino acid substitutions,
deletions, or insertions, particularly when such a substitution
occurs at a site that is not the active site of the molecule, and
provided that the polypeptide essentially retains its functional
properties. A conservative amino acid substitution, for example,
substitutes one amino acid for another of the same class (e.g.,
substitution of one hydrophobic amino acid, such as isoleucine,
valine, leucine, or methionine, for another, or substitution of one
polar amino acid for another, such as substitution of arginine for
lysine, glutamic acid for aspartic acid or glutamine for
asparagine). One or more amino acids can be deleted, for example,
from an carboxymethyl cellulase polypeptide, resulting in
modification of the structure of the polypeptide, without
significantly altering its biological activity. For example, amino-
or carboxyl-tenninal amino acids that are not required for
carboxymethyl cellulase biological activity can be removed.
Modified polypeptide sequences of the invention can be assayed for
carboxymethyl cellulase biological activity by any number of
methods, including contacting the modified polypeptide sequence
with a carboxymethyl cellulase substrate and determining whether
the modified polypeptide decreases the amount of specific substrate
in the assay or increases the bioproducts of the enzymatic reaction
of a functional carboxymethyl cellulase polypeptide with the
substrate.
[0058] "Fragments" as used herein are a portion of a naturally
occurring protein which can exist in at least two different
conformations. Fragments can have the same or substantially the
same amino acid sequence as the naturally occurring protein.
"Substantially the same" means that an amino acid sequence is
largely, but not entirely, the same, but retains at least one
functional activity of the sequence to which it is related. In
general two amino acid sequences are "substantially the same" or
"substantially homologous" if they are at least about 85%
identical. Fragments which have different three dimensional
structures as the naturally occurring protein are also included. An
example of this, is a "pro-form" molecule, such as a low activity
proprotein that can be modified by cleavage to produce a mature
enzyme with significantly higher activity.
[0059] "Hybridization" refers to the process by which a nucleic
acid strand joins with a complementary strand through base pairing.
Hybridization reactions can be sensitive and selective so that a
particular sequence of interest can be identified even in samples
in which it is present at low concentrations. Suitably stringent
conditions can be defined by, for example, the concentrations of
salt or formamide in the prehybridization and hybridization
solutions, or by the hybridization temperature, and are well known
in the art. In particular, stringency can be increased by reducing
the concentration of salt, increasing the concentration of
formamide, or raising the hybridization temperature.
[0060] For example, hybridization under high stringency conditions
could occur in about 50% formamide at about 37.degree. C. to
42.degree. C. Hybridization could occur under reduced stringency
conditions in about 35% to 25% formamide at about 30.degree. C. to
35.degree. C. In particular, hybridization could occur under high
stringency conditions at 42.degree. C. in 50% formamide, 5.times.
SSPE, 0.3% SDS, and 200 n/ml sheared and denatured salmon sperm
DNA. Hybridization could occur under reduced stringency conditions
as described above, but in 35% formamide at a reduced temperature
of 35.degree. C. The temperature range corresponding to a
particular level of stringency can be further narrowed by
calculating the purine to pyrimidine ratio of the nucleic acid of
interest and adjusting the temperature accordingly. Variations on
the above ranges and conditions are well known in the art.
[0061] The term "variant" refers to polynucleotides or polypeptides
of the invention modified at one or more base pairs, codons,
introns, exons, or amino acid residues (respectively) yet still
retain the biological activity of a carboxymethyl cellulase of the
invention. Variants can be produced by any number of means included
methods such as, for example, error-prone PCR, shuffling,
oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR
mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive
ensemble mutagenesis, exponential ensemble mutagenesis,
site-specific mutagenesis, gene reassembly, GSSM and any
combination thereof.
[0062] In one aspect, the present invention provides a
non-stochastic method termed synthetic gene reassembly, that is
somewhat related to stochastic shuffling, save that the nucleic
acid building blocks are not shuffled or concatenated or chimerized
randomly, but rather are assembled non-stochastically.
[0063] The SLR method does not depend on the presence of a high
level of homology between polynucleotides to be shuffled. The
invention can be used to non-stochastically generate libraries (or
sets) of progeny molecules comprised of over 10.sup.100 different
chimeras. Conceivably, SLR can even be used to generate libraries
comprised of over 10.sup.1000 different progeny chimeras.
[0064] Thus, in one aspect, the invention provides a non-stochastic
method of producing a set of finalized chimeric nucleic acid
molecules having an overall assembly order that is chosen by
design, which method is comprised of the steps of generating by
design a plurality of specific nucleic acid building blocks having
serviceable mutually compatible ligatable ends, and assembling
these nucleic acid building blocks, such that a designed overall
assembly order is achieved.
[0065] The mutually compatible ligatable ends of the nucleic acid
building blocks to be assembled are considered to be "serviceable"
for this type of ordered assembly if they enable the building
blocks to be coupled in predetermined orders. Thus, in one aspect,
the overall assembly order in which the nucleic acid building
blocks can be coupled is specified by the design of the ligatable
ends and, if more than one assembly step is to be used, then the
overall assembly order in which the nucleic acid building blocks
can be coupled is also specified by the sequential order of the
assembly step(s). In a one embodiment of the invention, the
annealed building pieces are treated with an enzyme, such as a
ligase (e.g., T4 DNA ligase) to achieve covalent bonding of the
building pieces.
[0066] In a another embodiment, the design of nucleic acid building
blocks is obtained upon analysis of the sequences of a set of
progenitor nucleic acid templates that serve as a basis for
producing a progeny set of finalized chimeric nucleic acid
molecules. These progenitor nucleic acid templates thus serve as a
source of sequence information that aids in the design of the
nucleic acid building blocks that are to be mutagenized, i.e.
chimerized or shuffled.
[0067] In one exemplification, the invention provides for the
chimerization of a family of related genes and their encoded family
of related products. In a particular exemplification, the encoded
products are enzymes. The cellulase of the present invention can be
mutagenized in accordance with the methods described herein.
[0068] Thus according to one aspect of the invention, the sequences
of a plurality of progenitor nucleic acid templates are aligned in
order to select one or more demarcation points, which demarcation
points can be located at an area of homology. The demarcation
points can be used to delineate the boundaries of nucleic acid
building blocks to be generated. Thus, the demarcation points
identified and selected in the progenitor molecules serve as
potential chimerization points in the assembly of the progeny
molecules.
[0069] Typically a serviceable demarcation point is an area of
homology (comprised of at least one homologous nucleotide base)
shared by at least two progenitor templates, but the demarcation
point can be an area of homology that is shared by at least half of
the progenitor templates, at least two thirds of the progenitor
templates, at least three fourths of the progenitor templates, and
preferably at almost all of the progenitor templates. Even more
preferably still a serviceable demarcation point is an area of
homology that is shared by all of the progenitor templates.
[0070] In a one embodiment, the gene reassembly process is
performed exhaustively in order to generate an exhaustive library.
In other words, all possible ordered combinations of the nucleic
acid building blocks are represented in the set of finalized
chimeric nucleic acid molecules. At the same time, the assembly
order (i.e. the order of assembly of each building block in the 5'
to 3 sequence of each finalized chimeric nucleic acid) in each
combination is by design (or non-stochastic). Because of the
non-stochastic nature of the method, the possibility of unwanted
side products is greatly reduced.
[0071] In another embodiment, the method provides that the gene
reassembly process is performed systematically, for example to
generate a systematically compartmentalized library, with
compartments that can be screened systematically, e.g., one by one.
In other words the invention provides that, through the selective
and judicious use of specific nucleic acid building blocks, coupled
with the selective and judicious use of sequentially stepped
assembly reactions, an experimental design can be achieved where
specific sets of progeny products are made in each of several
reaction vessels. This allows a systematic examination and
screening procedure to be performed. Thus, it allows a potentially
very large number of progeny molecules to be examined
systematically in smaller groups.
[0072] Because of its ability to perform chimerizations in a manner
that is highly flexible yet exhaustive and systematic as well,
particularly when there is a low level of homology among the
progenitor molecules, the instant invention provides for the
generation of a library (or set) comprised of a large number of
progeny molecules. Because of the non-stochastic nature of the
instant gene reassembly invention, the progeny molecules generated
preferably comprise a library of finalized chimeric nucleic acid
molecules having an overall assembly order that is chosen by
design. In a particularly embodiment, such a generated library is
comprised of greater than 10.sup.3 to greater than 10.sup.1000
different progeny molecular species.
[0073] In one aspect, a set of finalized chimeric nucleic acid
molecules, produced as described is comprised of a polynucleotide
encoding a polypeptide. According to one embodiment, this
polynucleotide is a gene, which may be a man-made gene. According
to another embodiment, this polynucleotide is a gene pathway, which
may be a man-made gene pathway. The invention provides that one or
more man-made genes generated by the invention may be incorporated
into a man-made gene pathway, such as pathway operable in a
eukaryotic organism (including a plant).
[0074] In another exemplification, the synthetic nature of the step
in which the building blocks are generated allows the design and
introduction of nucleotides (e.g., one or more nucleotides, which
may be, for example, codons or introns or regulatory sequences)
that can later be optionally removed in an in vitro process (e.g.,
by mutagenesis) or in an in vivo process (e.g., by utilizing the
gene splicing ability of a host organism). It is appreciated that
in many instances the introduction of these nucleotides may also be
desirable for many other reasons in addition to the potential
benefit of creating a serviceable demarcation point.
[0075] Thus, according to another embodiment, the invention
provides that a nucleic acid building block can be used to
introduce an intron. Thus, the invention provides that functional
introns may be introduced into a man-made gene of the invention.
The invention also provides that functional introns may be
introduced into a man-made gene pathway of the invention.
Accordingly, the invention provides for the generation of a
chimeric polynucleotide that is a man-made gene containing one (or
more) artificially introduced intron(s).
[0076] Accordingly, the invention also provides for the generation
of a chimeric polynucleotide that is a man-made gene pathway
containing one (or more) artificially introduced intron(s).
Preferably, the artificially introduced intron(s) are functional in
one or more host cells for gene splicing much in the way that
naturally-occurring introns serve functionally in gene splicing.
The invention provides a process of producing man-made
intron-containing polynucleotides to be introduced into host
organisms for recombination and/or splicing.
[0077] A man-made gene produced using the invention can also serve
as a substrate for recombination with another nucleic acid.
Likewise, a man-made gene pathway produced using the invention can
also serve as a substrate for recombination with another nucleic
acid. In a preferred instance, the recombination is facilitated by,
or occurs at, areas of homology between the man-made,
intron-containing gene and a nucleic acid, which serves as a
recombination partner. In a particularly preferred instance, the
recombination partner may also be a nucleic acid generated by the
invention, including a man-made gene or a man-made gene pathway.
Recombination may be facilitated by or may occur at areas of
homology that exist at the one (or more) artificially introduced
intron(s) in the man-made gene.
[0078] The synthetic gene reassembly method of the invention
utilizes a plurality of nucleic acid building blocks, each of which
preferably has two ligatable ends. The two ligatable ends on each
nucleic acid building block may be two blunt ends (i.e. each having
an overhang of zero nucleotides), or preferably one blunt end and
one overhang, or more preferably still two overhangs.
[0079] A useful overhang for this purpose may be a 3' overhang or a
5' overhang. Thus, a nucleic acid building block may have a 3'
overhang or alternatively a 5' overhang or alternatively two 3'
overhangs or alternatively two 5' overhangs. The overall order in
which the nucleic acid building blocks are assembled to form a
finalized chimeric nucleic acid molecule is determined by
purposeful experimental design and is not random.
[0080] According to one preferred embodiment, a nucleic acid
building block is generated by chemical synthesis of two
single-stranded nucleic acids (also referred to as single-stranded
oligos) and contacting them so as to allow them to anneal to form a
double-stranded nucleic acid building block.
[0081] A double-stranded nucleic acid building block can be of
variable size. The sizes of these building blocks can be small or
large. Preferred sizes for building block range from 1 base pair
(not including any overhangs) to 100,000 base pairs (not including
any overhangs). Other preferred size ranges are also provided,
which have lower limits of from 1 bp to 10,000 bp (including every
integer value in between), and upper limits of from 2 bp to 100,000
bp (including every integer value in between).
[0082] Many methods exist by which a double-stranded nucleic acid
building block can be generated that is serviceable for the
invention; and these are known in the art and can be readily
performed by the skilled artisan.
[0083] According to one embodiment, a double-stranded nucleic acid
building block is generated by first generating two single stranded
nucleic acids and allowing them to anneal to form a double-stranded
nucleic acid building block. The two strands of a double-stranded
nucleic acid building block may be complementary at every
nucleotide apart from any that form an overhang; thus containing no
mismatches, apart from any overhang(s). According to another
embodiment, the two strands of a double-stranded nucleic acid
building block are complementary at fewer than every nucleotide
apart from any that form an overhang. Thus, according to this
embodiment, a double-stranded nucleic acid building block can be
used to introduce codon degeneracy. Preferably the codon degeneracy
is introduced using the site-saturation mutagenesis described
herein, using one or more N,N,G/T cassettes or alternatively using
one or more N,N,N cassettes.
[0084] The in vivo recombination method of the invention can be
performed blindly on a pool of unknown hybrids or alleles of a
specific polynucleotide or sequence. However, it is not necessary
to know the actual DNA or RNA sequence of the specific
polynucleotide.
[0085] The approach of using recombination within a mixed
population of genes can be useful for the generation of any useful
proteins, for example, interleukin I, antibodies, tPA and growth
hormone. This approach may be used to generate proteins having
altered specificity or activity. The approach may also be useful
for the generation of hybrid nucleic acid sequences, for example,
promoter regions, introns, exons, enhancer sequences, 31
untranslated regions or 51 untranslated regions of genes. Thus this
approach may be used to generate genes having increased rates of
expression. This approach may also be useful in the study of
repetitive DNA sequences. Finally, this approach may be useful to
mutate ribozymes or aptamers.
[0086] In one aspect the invention described herein is directed to
the use of repeated cycles of reductive reassortment, recombination
and selection which allow for the directed molecular evolution of
highly complex linear sequences, such as DNA, RNA or proteins
thorough recombination.
[0087] In vivo shuffling of molecules is useful in providing
variants and can be performed utilizing the natural property of
cells to recombine multimers. While recombination in vivo has
provided the major natural route to molecular diversity, genetic
recombination remains a relatively complex process that involves 1)
the recognition of homologies; 2) strand cleavage, strand invasion,
and metabolic steps leading to the production of recombinant
chiasma; and finally 3) the resolution of chiasma into discrete
recombined molecules. The formation of the chiasma requires the
recognition of homologous sequences.
[0088] In another embodiment, the invention includes a method for
producing a hybrid polynucleotide from at least a first
polynucleotide and a second polynucleotide. The invention can be
used to produce a hybrid polynucleotide by introducing at least a
first polynucleotide and a second polynucleotide which share at
least one region of partial sequence homology into a suitable host
cell. The regions of partial sequence homology promote processes
which result in sequence reorganization producing a hybrid
polynucleotide. The term "hybrid polynucleotide", as used herein,
is any nucleotide sequence which results from the method of the
present invention and contains sequence from at least two original
polynucleotide sequences. Such hybrid polynucleotides can result
from intermolecular recombination events which promote sequence
integration between DNA molecules. In addition, such hybrid
polynucleotides can result from intramolecular reductive
reassortment processes which utilize repeated sequences to alter a
nucleotide sequence within a DNA molecule.
[0089] The invention provides a means for generating hybrid
polynucleotides which may encode biologically active hybrid
polypeptides (e.g., hybrid carboxymethyl cellulase). In one aspect,
the original polynucleotides encode biologically active
polypeptides. The method of the invention produces new hybrid
polypeptides by utilizing cellular processes which integrate the
sequence of the original polynucleotides such that the resulting
hybrid polynucleotide encodes a polypeptide demonstrating
activities derived from the original biologically active
polypeptides. For example, the original polynucleotides may encode
a particular enzyme from different microorganisms. An enzyme
encoded by a first polynucleotide from one organism or variant may,
for example, function effectively under a particular environmental
condition, e.g. high salinity. An enzyme encoded by a second
polynucleotide from a different organism or variant may function
effectively under a different environmental condition, such as
extremely high temperatures. A hybrid polynucleotide containing
sequences from the first and second original polynucleotides may
encode an enzyme which exhibits characteristics of both enzymes
encoded by the original polynucleotides. Thus, the enzyme encoded
by the hybrid polynucleotide may function effectively under
environmental conditions shared by each of the enzymes encoded by
the first and second polynucleotides, e.g., high salinity and
extreme temperatures.
[0090] Enzymes encoded by the polynucleotides of the invention
include, but are not limited to, hydrolases, such as carboxymethyl
cellulases. A hybrid polypeptide resulting from the method of the
invention may exhibit specialized enzyme activity not displayed in
the original enzymes. For example, following recombination and/or
reductive reassortment of polynucleotides encoding hydrolase
activities, the resulting hybrid polypeptide encoded by a hybrid
polynucleotide can be screened for specialized hydrolase activities
obtained from each of the original enzymes, i.e. the type of bond
on which the hydrolase acts and the temperature at which the
hydrolase functions. Thus, for example, the hydrolase may be
screened to ascertain those chemical functionalities which
distinguish the hybrid hydrolase from the original hydrolases, such
as: (a) amide (peptide bonds), i.e., proteases; (b) ester bonds,
ie., esterases and lipases; (c) acetals, i.e., glycosidases and,
for example, the temperature, pH or salt concentration at which the
hybrid polypeptide functions.
[0091] Sources of the original polynucleotides may be isolated from
individual organisms ("isolates"), collections of organisms that
have been grown in defined media ("enrichment cultures"), or,
uncultivated organisms ("environmental samples"). The use of a
culture-independent approach to derive polynucleotides encoding
novel bioactivities from environmental samples is most preferable
since it allows one to access untapped resources of
biodiversity.
[0092] "Environmental libraries" are generated from environmental
samples and represent the collective genomes of naturally occurring
organisms archived in cloning vectors that can be propagated in
suitable prokaryotic hosts. Because the cloned DNA is initially
extracted directly from environmental samples, the libraries are
not limited to the small fraction of prokaryotes that can be grown
in pure culture. Additionally, a normalization of the environmental
DNA present in these samples could allow more equal representation
of the DNA from all of the species present in the original sample.
This can dramatically increase the efficiency of finding
interesting genes from minor constituents of the sample which may
be under-represented by several orders of magnitude compared to the
dominant species.
[0093] For example, gene libraries generated from one or more
uncultivated microorganisms are screened for an activity of
interest. Potential pathways encoding bioactive molecules of
interest are first captured in prokaryotic cells in the form of
gene expression libraries. Polynucleotides encoding activities of
interest are isolated from such libraries and introduced into a
host cell. The host cell is grown under conditions which promote
recombination and/or reductive reassortment creating potentially
active biomolecules with novel or enhanced activities.
[0094] The microorganisms from which the polynucleotide may be
prepared include prokaryotic microorganisms, such as Eubacteria and
Archaebacteria, and lower eukaryotic microorganisms such as fungi,
some algae and protozoa. Polynucleotides may be isolated from
environmental samples in which case the nucleic acid may be
recovered without culturing of an organism or recovered from one or
more cultured organisms. In one aspect, such microorganisms may be
extremophiles, such as hyperthermophiles, psychrophiles,
psychrotrophs, halophiles, barophiles and acidophiles.
Polynucleotides encoding enzymes isolated from extremophilic
microorganisms are particularly preferred. Such enzymes may
function at temperatures above 100.degree. C. in terrestrial hot
springs and deep sea thermal vents, at temperatures below 0.degree.
C. in arctic waters, in the saturated salt environment of the Dead
Sea, at pH values around 0 in coal deposits and geothermal
sulfur-rich springs, or at pH values greater than 11 in sewage
sludge. For example, several esterases and lipases cloned and
expressed from extremophilic organisms show high activity
throughout a wide range of temperatures and pHs.
[0095] Polynucleotides selected and isolated as hereinabove
described are introduced into a suitable host cell. A suitable host
cell is any cell which is capable of promoting recombination and/or
reductive reassortment. The selected polynucleotides are preferably
already in a vector which includes appropriate control sequences.
The host cell can be a higher eukaryotic cell, such as a mammalian
cell, or a lower eukaryotic cell, such as a yeast cell, or
preferably, the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host cell
can be effected by calcium phosphate transfection, DEAE-Dextran
mediated transfection, or electroporation (Davis et al., 1986).
[0096] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; and plant cells. The selection
of an appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
[0097] With particular references to various mammalian cell culture
systems that can be employed to express recombinant protein,
examples of mammalian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described in "SV40-transformed simian
cells support the replication of early SV40 mutants" (Gluzman,
1981), and other cell lines capable of expressing a compatible
vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
Mammalian expression vectors will comprise an origin of
replication, a suitable promoter and enhancer, and also any
necessary ribosome binding sites, polyadenylation site, splice
donor and acceptor sites, transcriptional termination sequences,
and 5' flanking nontranscribed sequences. DNA sequences derived
from the SV40 splice, and polyadenylation sites may be used to
provide the required nontranscribed genetic elements.
[0098] Host cells containing the polynucleotides of interest can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying genes.
The culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan. The clones
which are identified as having the specified enzyme activity may
then be sequenced to identify the polynucleotide sequence encoding
an enzyme having the enhanced activity.
[0099] In another aspect, it is envisioned the method of the
present invention can be used to generate novel polynucleotides
encoding biochemical pathways from one or more operons or gene
clusters or portions thereof. For example, bacteria and many
eukaryotes have a coordinated mechanism for regulating genes whose
products are involved in related processes. The genes are
clustered, in structures referred to as "gene clusters," on a
single chromosome and are transcribed together under the control of
a single regulatory sequence, including a single promoter which
initiates transcription of the entire cluster. Thus, a gene cluster
is a group of adjacent genes that are either identical or related,
usually as to their function. An example of a biochemical pathway
encoded by gene clusters are polyketides. Polyketides are molecules
which are an extremely rich source of bioactivities, including
antibiotics (such as tetracyclines and erythromycin), anti-cancer
agents (daunomycin), immunosuppressants (FK506 and rapamycin), and
veterinary products (monensin). Many polyketides (produced by
polyketide synthases) are valuable as therapeutic agents.
Polyketide synthases are multifunctional enzymes that catalyze the
biosynthesis of an enormous variety of carbon chains differing in
length and patterns of functionality and cyclization. Polyketide
synthase genes fall into gene clusters and at least one type
(designated type I) of polyketide synthases have large size genes
and enzymes, complicating genetic manipulation and in vitro studies
of these genes/proteins.
[0100] Gene cluster DNA can be isolated from different organisms
and ligated into vectors, particularly vectors containing
expression regulatory sequences which can control and regulate the
production of a detectable protein or protein-related array
activity from the ligated gene clusters. Use of vectors which have
an exceptionally large capacity for exogenous DNA introduction are
particularly appropriate for use with such gene clusters and are
described by way of example herein to include the f-factor (or
fertility factor) of E. coli. This f-factor of E. coli is a plasmid
which affect high-frequency transfer of itself during conjugation
and is ideal to achieve and stably propagate large DNA fragments,
such as gene clusters from mixed microbial samples. A particularly
preferred embodiment is to use cloning vectors, referred to as
"fosmids" or bacterial artificial chromosome (BAC) vectors. These
are derived from E. coli f-factor which is able to stably integrate
large segments of genomic DNA. When integrated with DNA from a
mixed uncultured environmental sample, this makes it possible to
achieve large genomic fragments in the form of a stable
"environmental DNA library." Another type of vector for use in the
present invention is a cosmid vector. Cosmid vectors were
originally designed to clone and propagate large segments of
genomic DNA. Cloning into cosmid vectors is described in detail in
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed.,
Cold Spring Harbor Laboratory Press (1989). Once ligated into an
appropriate vector, two or more vectors containing different
polyketide synthase gene clusters can be introduced into a suitable
host cell. Regions of partial sequence homology shared by the gene
clusters will promote processes which result in sequence
reorganization resulting in a hybrid gene cluster. The novel hybrid
gene cluster can then be screened for enhanced activities not found
in the original gene clusters.
[0101] Therefore, in a one embodiment, the invention relates to a
method for producing a biologically active hybrid polypeptide and
screening such a polypeptide for enhanced activity by:
[0102] 1) introducing at least a first polynucleotide in operable
linkage and a second polynucleotide in operable linkage, said at
least first polynucleotide and second polynucleotide sharing at
least one region of partial sequence homology, into a suitable host
cell;
[0103] 2) growing the host cell under conditions which promote
sequence reorganization resulting in a hybrid polynucleotide in
operable linkage;
[0104] 3) expressing a hybrid polypeptide encoded by the hybrid
polynucleotide;
[0105] 4) screening the hybrid polypeptide under conditions which
promote identification of enhanced biological activity; and
[0106] 5) isolating the a polynucleotide encoding the hybrid
polypeptide.
[0107] Methods for screening for various enzyme activities are
known to those of skill in the art and are discussed throughout the
present specification. Such methods may be employed when isolating
the polypeptides and polynucleotides of the invention.
[0108] As representative examples of expression vectors which may
be used, there may be mentioned viral particles, baculovirus,
phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial
chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus,
pseudorabies and derivatives of SV40), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as
bacillus, aspergillus and yeast). Thus, for example, the DNA may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences. Large numbers of
suitable vectors are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids,
pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3,
pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene),
pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid
or other vector may be used so long as they are replicable and
viable in the host. Low copy number or high copy number vectors may
be employed with the present invention.
[0109] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct RNA synthesis. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L and trp.
Eukaryotic promoters include CMV immediate early, HSV thymidine
kinase, early and late SV40, LTRs from retrovirus, and mouse
metallothionein-I. Selection of the appropriate vector and promoter
is well within the level of ordinary skill in the art. The
expression vector also contains a ribosome binding site for
translation initiation and a transcription terminator. The vector
may also include appropriate sequences for amplifying expression.
Promoter regions can be selected from any desired gene using
chloramphenicol transferase (CAT) vectors or other vectors with
selectable markers. In addition, the expression vectors preferably
contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells such as dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture, or
such as tetracycline or ampicillin resistance in E. coli.
[0110] In vivo reassortment is focused on "inter-molecular"
processes collectively referred to as "recombination" which in
bacteria, is generally viewed as a "RecA-dependent" phenomenon. The
invention can rely on recombination processes of a host cell to
recombine and re-assort sequences, or the cells' ability to mediate
reductive processes to decrease the complexity of quasi-repeated
sequences in the cell by deletion. This process of "reductive
reassortment" occurs by an "intra-molecular", RecA-independent
process.
[0111] Therefore, in another aspect of the invention, novel
polynucleotides can be generated by the process of reductive
reassortment. The method involves the generation of constructs
containing consecutive sequences (original encoding sequences),
their insertion into an appropriate vector, and their subsequent
introduction into an appropriate host cell. The reassortment of the
individual molecular identities occurs by combinatorial processes
between the consecutive sequences in the construct possessing
regions of homology, or between quasi-repeated units. The
reassortment process recombines and/or reduces the complexity and
extent of the repeated sequences, and results in the production of
novel molecular species. Various treatments may be applied to
enhance the rate of reassortment. These could include treatment
with ultra-violet light, or DNA damaging chemicals, and/or the use
of host cell lines displaying enhanced levels of "genetic
instability". Thus the reassortment process may involve homologous
recombination or the natural property of quasi-repeated sequences
to direct their own evolution.
[0112] Repeated or "quasi-repeated" sequences play a role in
genetic instability. In the present invention, "quasi-repeats" are
repeats that are not restricted to their original unit structure.
Quasi-repeated units can be presented as an array of sequences in a
construct; consecutive units of similar sequences. Once ligated,
the junctions between the consecutive sequences become essentially
invisible and the quasi-repetitive nature of the resulting
construct is now continuous at the molecular level. The deletion
process the cell performs to reduce the complexity of the resulting
construct operates between the quasi-repeated sequences. The
quasi-repeated units provide a practically limitless repertoire of
templates upon which slippage events can occur. The constructs
containing the quasi-repeats thus effectively provide sufficient
molecular elasticity that deletion (and potentially insertion)
events can occur virtually anywhere within the quasi-repetitive
units.
[0113] When the quasi-repeated sequences are all ligated in the
same orientation, for instance head to tail or vice versa, the cell
cannot distinguish individual units. Consequently, the reductive
process can occur throughout the sequences. In contrast, when for
example, the units are presented head to head, rather than head to
tail, the inversion delineates the endpoints of the adjacent unit
so that deletion formation will favor the loss of discrete units.
Thus, it is preferable with the present method that the sequences
are in the same orientation. Random orientation of quasi-repeated
sequences will result in the loss of reassortment efficiency, while
consistent orientation of the sequences will offer the highest
efficiency. However, while having fewer of the contiguous sequences
in the same orientation decreases the efficiency, it may still
provide sufficient elasticity for the effective recovery of novel
molecules. Constructs can be made with the quasi-repeated sequences
in the same orientation to allow higher efficiency.
[0114] Sequences can be assembled in a head to tail orientation
using any of a variety of methods, including the following:
[0115] a) Primers that include a poly-A head and poly-T tail which
when made single-stranded would provide orientation can be
utilized. This is accomplished by having the first few bases of the
primers made from RNA and hence easily removed RNAseH.
[0116] b) Primers that include unique restriction cleavage sites
can be utilized. Multiple sites, a battery of unique sequences, and
repeated synthesis and ligation steps would be required.
[0117] c) The inner few bases of the primer could be thiolated and
an exonuclease used to produce properly tailed molecules.
[0118] The recovery of the re-assorted sequences relies on the
identification of cloning vectors with a reduced repetitive index
(RI). The re-assorted encoding sequences can then be recovered by
amplification. The products are re-cloned and expressed. The
recovery of cloning vectors with reduced RI can be affected by:
[0119] 1) The use of vectors only stably maintained when the
construct is reduced in complexity.
[0120] 2) The physical recovery of shortened vectors by physical
procedures. In this case, the cloning vector would be recovered
using standard plasmid isolation procedures and size fractionated
on either an agarose gel, or column with a low molecular weight cut
off utilizing standard procedures.
[0121] 3) The recovery of vectors containing interrupted genes
which can be selected when insert size decreases.
[0122] 4) The use of direct selection techniques with an expression
vector and the appropriate selection.
[0123] Encoding sequences (for example, genes) from related
organisms may demonstrate a high degree of homology and encode
quite diverse protein products. These types of sequences are
particularly useful in the present invention as quasi-repeats.
However, while the examples illustrated below demonstrate the
reassortment of nearly identical original encoding sequences
(quasi-repeats), this process is not limited to such nearly
identical repeats.
[0124] The following example demonstrates a method of the
invention. Encoding nucleic acid sequences (quasi-repeats) derived
from three (3) unique species are described. Each sequence encodes
a protein with a distinct set of properties. Each of the sequences
differs by a single or a few base pairs at a unique position in the
sequence. The quasi-repeated sequences are separately or
collectively amplified and ligated into random assemblies such that
all possible permutations and combinations are available in the
population of ligated molecules. The number of quasi-repeat units
can be controlled by the assembly conditions. The average number of
quasi-repeated units in a construct is defined as the repetitive
index (R1).
[0125] Once formed, the constructs may, or may not be size
fractionated on an agarose gel according to published protocols,
inserted into a cloning vector, and transfected into an appropriate
host cell. The cells are then propagated and "reductive
reassortment" is effected. The rate of the reductive reassortment
process may be stimulated by the introduction of DNA damage if
desired. Whether the reduction in RI is mediated by deletion
formation between repeated sequences by an "intra-molecular"
mechanism, or mediated by recombination-like events through
"inter-molecular" mechanisms is immaterial. The end result is a
reassortment of the molecules into all possible combinations.
[0126] Optionally, the method comprises the additional step of
screening the library members of the shuffled pool to identify
individual shuffled library members having the ability to bind or
otherwise interact, or catalyze a particular reaction (e.g., such
as catalytic domain of an enzyme) with a predetermined
macromolecule, such as for example a proteinaceous receptor, an
oligosaccharide, viron, or other predetermined compound or
structure.
[0127] The polypeptides that are identified from such libraries can
be used for therapeutic, diagnostic, research and related purposes
(e.g., catalysts, solutes for increasing osmolarity of an aqueous
solution, and the like), and/or can be subjected to one or more
additional cycles of shuffling and/or selection.
[0128] In another aspect, it is envisioned that prior to or during
recombination or reassortment, polynucleotides generated by the
method of the invention can be subjected to agents or processes
which promote the introduction of mutations into the original
polynucleotides. The introduction of such mutations would increase
the diversity of resulting hybrid polynucleotides and polypeptides
encoded therefrom. The agents or processes which promote
mutagenesis can include, but are not limited to: (+)-CC-1065, or a
synthetic analog such as (+)-CC-1065-(N-3-Adenine (See Sun and
Hurley, (1992); an N-acelylated or deacetylated
4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis
(See, for example, van de Poll et al. (1992)); or a N-acetylated or
deacetylated 4-aminobiphenyl adduct capable of inhibiting DNA
synthesis (See also, van de Poll et al. (1992), pp. 751-758);
trivalent chromium, a trivalent chromium salt, a polycyclic
aromatic hydrocarbon (PAH) DNA adduct capable of inhibiting DNA
replication, such as 7-bromomethyl-benz[a]anthracene ("BMA"),
tris(2,3-dibromopropyl)phosphate ("Tris-BP"),
1,2-dibromo-3-chloropropane ("DBCP"), 2-bromoacrolein (2BA),
benzo[a]pyrene-7,8-dihydrodiol-9-10-epoxide ("BPDE"), a
platinum(II) halogen salt,
N-hydroxy-2-amino-3-methylimidazo[4,5-f]-quinoline
("N-hydroxy-IQ"), and
N-hydroxy-2-amino-1-methyl-6-phenylimidazo[4,5-f]-p- yridine
("N-hydroxy-PhIP"). Especially preferred means for slowing or
halting PCR amplification consist of UV light (+)-CC-1065 and
(+)-CC-1065-(N-3-Adenine). Particularly encompassed means are DNA
adducts or polynucleotides comprising the DNA adducts from the
polynucleotides or polynucleotides pool, which can be released or
removed by a process including heating the solution comprising the
polynucleotides prior to further processing.
[0129] In another aspect the invention is directed to a method of
producing recombinant proteins having biological activity by
treating a sample comprising double-stranded template
polynucleotides encoding a wild-type protein under conditions
according to the invention which provide for the production of
hybrid or re-assorted polynucleotides.
[0130] The invention also provides for the use of proprietary codon
primers (containing a degenerate N,N,N sequence) to introduce point
mutations into a polynucleotide, so as to generate a set of progeny
polypeptides in which a full range of single amino acid
substitutions is represented at each amino acid position (gene site
saturated mutagenesis (GSSM)). The oligos used are comprised
contiguously of a first homologous sequence, a degenerate N,N,N
sequence, and preferably but not necessarily a second homologous
sequence. The downstream progeny translational products from the
use of such oligos include all possible amino acid changes at each
amino acid site along the polypeptide, because the degeneracy of
the N,N,N sequence includes codons for all 20 amino acids.
[0131] In one aspect, one such degenerate oligo (comprised of one
degenerate N,N,N cassette) is used for subjecting each original
codon in a parental polynucleotide template to a full range of
codon substitutions. In another aspect, at least two degenerate
N,N,N cassettes are used--either in the same oligo or not, for
subjecting at least two original codons in a parental
polynucleotide template to a full range of codon substitutions.
Thus, more than one N,N,N sequence can be contained in one oligo to
introduce amino acid mutations at more than one site. This
plurality of N,N,N sequences can be directly contiguous, or
separated by one or more additional nucleotide sequence(s). In
another aspect, oligos serviceable for introducing additions and
deletions can be used either alone or in combination with the
codons containing an N,N,N sequence, to introduce any combination
or permutation of amino acid additions, deletions, and/or
substitutions.
[0132] In a particular exemplification, it is possible to
simultaneously mutagenize two or more contiguous amino acid
positions using an oligo that contains contiguous N,N,N triplets,
i.e. a degenerate (N,N,N).sub.n sequence.
[0133] In another aspect, the present invention provides for the
use of degenerate cassettes having less degeneracy than the N,N,N
sequence. For example, it may be desirable in some instances to use
(e.g. in an oligo) a degenerate triplet sequence comprised of only
one N, where said N can be in the first second or third position of
the triplet. Any other bases including any combinations and
permutations thereof can be used in the remaining two positions of
the triplet. Alternatively, it may be desirable in some instances
to use (e.g., in an oligo) a degenerate N,N,N triplet sequence,
N,N,G/T, or an N,N, G/C triplet sequence.
[0134] It is appreciated, however, that the use of a degenerate
triplet (such as N,N,G/T or an N,N, G/C triplet sequence) as
disclosed in the instant invention is advantageous for several
reasons. In one aspect, this invention provides a means to
systematically and fairly easily generate the substitution of the
full range of possible amino acids (for a total of 20 amino acids)
into each and every amino acid position in a polypeptide. Thus, for
a 100 amino acid polypeptide, the invention provides a way to
systematically and fairly easily generate 2000 distinct species
(i.e., 20 possible amino acids per position times 100 amino acid
positions). It is appreciated that there is provided, through the
use of an oligo containing a degenerate N,N,G/T or an N,N, G/C
triplet sequence, 32 individual sequences that code for 20 possible
amino acids. Thus, in a reaction vessel in which a parental
polynucleotide sequence is subjected to saturation mutagenesis
using one such oligo, there are generated 32 distinct progeny
polynucleotides encoding 20 distinct polypeptides. In contrast, the
use of a non-degenerate oligo in site-directed mutagenesis leads to
only one progeny polypeptide product per reaction vessel.
[0135] This invention also provides for the use of nondegenerate
oligos, which can optionally be used in combination with degenerate
primers disclosed. It is appreciated that in some situations, it is
advantageous to use nondegenerate oligos to generate specific point
mutations in a working polynucleotide. This provides a means to
generate specific silent point mutations, point mutations leading
to corresponding amino acid changes, and point mutations that cause
the generation of stop codons and the corresponding expression of
polypeptide fragments.
[0136] Thus, in a preferred embodiment of this invention, each
saturation mutagenesis reaction vessel contains polynucleotides
encoding at least 20 progeny polypeptide molecules such that all 20
amino acids are represented at the one specific amino acid position
corresponding to the codon position mutagenized in the parental
polynucleotide. The 32-fold degenerate progeny polypeptides
generated from each saturation mutagenesis reaction vessel can be
subjected to clonal amplification (e.g., cloned into a suitable E.
coli host using an expression vector) and subjected to expression
screening. When an individual progeny polypeptide is identified by
screening to display a favorable change in property (when compared
to the parental polypeptide), it can be sequenced to identify the
correspondingly favorable amino acid substitution contained
therein.
[0137] It is appreciated that upon mutagenizing each and every
amino acid position in a parental polypeptide using saturation
mutagenesis as disclosed herein, favorable amino acid changes may
be identified at more than one amino acid position. One or more new
progeny molecules can be generated that contain a combination of
all or part of these favorable amino acid substitutions. For
example, if 2 specific favorable amino acid changes are identified
in each of 3 amino acid positions in a polypeptide, the
permutations include 3 possibilities at each position (no change
from the original amino acid, and each of two favorable changes)
and 3 positions. Thus, there are 3.times.3.times.3 or 27 total
possibilities, including 7 that were previously examined -6 single
point mutations (i.e., 2 at each of three positions) and no change
at any position.
[0138] In yet another aspect, site-saturation mutagenesis can be
used together with shuffling, chimerization, recombination and
other mutagenizing processes, along with screening. This invention
provides for the use of any mutagenizing process(es), including
saturation mutagenesis, in an iterative manner. In one
exemplification, the iterative use of any mutagenizing process(es)
is used in combination with screening.
[0139] Thus, in a non-limiting exemplification, this invention
provides for the use of saturation mutagenesis in combination with
additional mutagenization processes, such as process where two or
more related polynucleotides are introduced into a suitable host
cell such that a hybrid polynucleotide is generated by
recombination and reductive reassortment.
[0140] In addition to performing mutagenesis along the entire
sequence of a gene, the instant invention provides that mutagenesis
can be use to replace each of any number of bases in a
polynucleotide sequence, wherein the number of bases to be
mutagenized is preferably every integer from 15 to 100,000. Thus,
instead of mutagenizing every position along a molecule, one can
subject every or a discrete number of bases (preferably a subset
totaling from 15 to 100,000) to mutagenesis. Preferably, a separate
nucleotide is used for mutagenizing each position or group of
positions along a polynucleotide sequence. A group of 3 positions
to be mutagenized may be a codon. The mutations are preferably
introduced using a mutagenic primer, containing a heterologous
cassette, also referred to as a mutagenic cassette. Preferred
cassettes can have from 1 to 500 bases. Each nucleotide position in
such heterologous cassettes be N, A, C, G, T, A/C, AIG, A/T, C/G,
C/T, G/T, C/G/T, A/G/T, A/C/T, A/C/G, or E, where E is any base
that is not A, C, G, or T (E can be referred to as a designer
oligo).
[0141] In a general sense, saturation mutagenesis is comprised of
mutagenizing a complete set of mutagenic cassettes (wherein each
cassette is preferably about 1-500 bases in length) in defined
polynucleotide sequence to be mutagenized (wherein the sequence to
be mutagenized is preferably from about 15 to 100,000 bases in
length). Thus, a group of mutations (ranging from 1 to 100
mutations) is introduced into each cassette to be mutagenized. A
grouping of mutations to be introduced into one cassette can be
different or the same from a second grouping of mutations to be
introduced into a second cassette during the application of one
round of saturation mutagenesis. Such groupings are exemplified by
deletions, additions, groupings of particular codons, and groupings
of particular nucleotide cassettes.
[0142] Defined sequences to be mutagenized include a whole gene,
pathway, cDNA, an entire open reading frame (ORF), and entire
promoter, enhancer, repressor/transactivator, origin of
replication, intron, operator, or any polynucleotide functional
group. Generally, a "defined sequences" for this purpose may be any
polynucleotide that a 15 base-polynucleotide sequence, and
polynucleotide sequences of lengths between 15 bases and 15,000
bases (this invention specifically names every integer in between).
Considerations in choosing groupings of codons include types of
amino acids encoded by a degenerate mutagenic cassette.
[0143] In a particularly preferred exemplification a grouping of
mutations that can be introduced into a mutagenic cassette, this
invention specifically provides for degenerate codon substitutions
(using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each
position, and a library of polypeptides encoded thereby.
[0144] One aspect of the invention is an isolated nucleic acid
comprising the sequence SEQ ID NO.: 1, and sequences substantially
identical thereto, the sequences complementary thereto, or a
fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:1
(or the sequences complementary thereto). The isolated, nucleic
acids may comprise DNA, including cDNA, genomic DNA, and synthetic
DNA. The DNA may be double-stranded or single-stranded, and if
single stranded may be the coding strand or non-coding (anti-sense)
strand. Alternatively, the isolated nucleic acids may comprise
RNA.
[0145] As discussed in more detail below, the isolated nucleic
acids SEQ ID NO:1, and sequences substantially identical thereto,
may be used to prepare one of the polypeptides of SEQ ID NO:2, and
sequences substantially identical thereto, or fragments comprising
at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150
consecutive amino acids of SEQ ID NO:2, and sequences substantially
identical thereto.
[0146] Accordingly, another aspect of the invention is an isolated
nucleic acid which encodes SEQ ID NO:2, and sequences substantially
identical thereto, or fragments comprising at least 5, 10, 15, 20,
25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ
ID NO:2. The coding sequences of these nucleic acids may be
identical to SEQ ID NO:1, or a fragment thereof or may be different
coding sequences which encode SEQ ID NO:2, sequences substantially
identical thereto, and fragments having at least 5, 10, 15, 20, 25,
30, 35, 40, 50, 75, 100, or 150 consecutive amino acids SEQ ID
NO:2, as a result of the redundancy or degeneracy of the genetic
code. The genetic code is well known to those of skill in the art
and can be obtained, for example, on page 214 of B. Lewin, Genes
VI, Oxford University Press, 1997, the disclosure of which is
incorporated herein by reference.
[0147] The isolated nucleic acid which encodes SEQ ID NO:2, and
sequences substantially identical thereto, may include, but is not
limited to: only the coding sequence of SEQ ID NO:1, and sequences
substantially identical thereto, and additional coding sequences,
such as leader sequences or proprotein sequences and non-coding
sequences, such as introns or non-coding sequences 5' and/or 3' of
the coding sequence. Thus, as used herein, the term "polynucleotide
encoding a polypeptide" encompasses a polynucleotide which includes
only the coding sequence for the polypeptide as well as a
polynucleotide which includes additional coding and/or non-coding
sequence.
[0148] Alternatively, SEQ ID NO:1, and sequences substantially
identical thereto, may be mutagenized using conventional
techniques, such as site directed mutagenesis, or other techniques
familiar to those skilled in the art, to introduce silent changes
SEQ ID NO:1, and sequences substantially identical thereto. As used
herein, "silent changes" include, for example, changes which do not
alter the amino acid sequence encoded by the polynucleotide. Such
changes may be desirable in order to increase the level of the
polypeptide produced by host cells containing a vector encoding the
polypeptide by introducing codons or codon pairs which occur
frequently in the host organism.
[0149] The invention also relates to polynucleotides which have
nucleotide changes which result in amino acid substitutions,
additions, deletions, fusions and truncations in SEQ ID NO:2, and
sequences substantially identical thereto. Such nucleotide changes
may be introduced using techniques such as site directed
mutagenesis, random chemical mutagenesis, exonuclease III deletion,
and other recombinant DNA techniques. Alternatively, such
nucleotide changes may be naturally occurring allelic variants
which are isolated by identifying nucleic acids which specifically
hybridize to probes comprising at least 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID
NO:1, and sequences substantially identical thereto (or the
sequences complementary thereto) under conditions of high,
moderate, or low stringency as provided herein.
[0150] The isolated SEQ ID NO:1, and sequences substantially
identical thereto, the sequences complementary thereto, or a
fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:1,
and sequences substantially identical thereto, or the sequences
complementary thereto may also be used as probes to determine
whether a biological sample, such as a soil sample, contains an
organism having a nucleic acid sequence of the invention or an
organism from which the nucleic acid was obtained. In such
procedures, a biological sample potentially harboring the organism
from which the nucleic acid was isolated is obtained and nucleic
acids are obtained from the sample. The nucleic acids are contacted
with the probe under conditions which permit the probe to
specifically hybridize to any complementary sequences from which
are present therein.
[0151] Where necessary, conditions which permit the probe to
specifically hybridize to complementary sequences may be determined
by placing the probe in contact with complementary sequences from
samples known to contain the complementary sequence as well as
control sequences which do not contain the complementary sequence.
Hybridization conditions, such as the salt concentration of the
hybridization buffer, the formamide concentration of the
hybridization buffer, or the hybridization temperature, may be
varied to identify conditions which allow the probe to hybridize
specifically to complementary nucleic acids.
[0152] If the sample contains the organism from which the nucleic
acid was isolated, specific hybridization of the probe is then
detected. Hybridization may be detected by labeling the probe with
a detectable agent such as a radioactive isotope, a fluorescent dye
or an enzyme capable of catalyzing the formation of a detectable
product.
[0153] Many methods for using the labeled probes to detect the
presence of complementary nucleic acids in a sample are familiar to
those skilled in the art. These include Southern Blots, Northern
Blots, colony hybridization procedures, and dot blots. Protocols
for each of these procedures are provided in Ausubel et al. Current
Protocols in Molecular Biology, John Wiley 503 Sons, Inc. (1997)
and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed.,
Cold Spring Harbor Laboratory Press (1989), the entire disclosures
of which are incorporated herein by reference.
[0154] Alternatively, more than one probe (at least one of which is
capable of specifically hybridizing to any complementary sequences
which are present in the nucleic acid sample), may be used in an
amplification reaction to determine whether the sample contains an
organism containing a nucleic acid sequence of the invention (e.g.,
an organism from which the nucleic acid was isolated). Typically,
the probes comprise oligonucleotides. In one embodiment, the
amplification reaction may comprise a PCR reaction. PCR protocols
are described in Ausubel and Sambrook, supra. Alternatively, the
amplification may comprise a ligase chain reaction, 3SR, or strand
displacement reaction. (See Barany, F., "The Ligase Chain Reaction
in a PCR World", PCR Methods and Applications 1:5-16, 1991; E. Fahy
et al., "Self-sustained Sequence Replication (3SR): An Isothermal
Transcription-based Amplification System Alternative to PCR", PCR
Methods and Applications 1:25-33, 1991; and Walker G. T. et al.,
"Strand Displacement Amplification-an Isothermal in vitro DNA
Amplification Technique", Nucleic Acid Research 20:1691-1696, 1992,
the disclosures of which are incorporated herein by reference in
their entireties). In such procedures, the nucleic acids in the
sample are contacted with the probes, the amplification reaction is
performed, and any resulting amplification product is detected. The
amplification product may be detected by performing gel
electrophoresis on the reaction products and staining the gel with
an interculator such as ethidium bromide. Alternatively, one or
more of the probes may be labeled with a radioactive isotope and
the presence of a radioactive amplification product may be detected
by autoradiography after gel electrophoresis.
[0155] Probes derived from sequences near the ends of the sequence
of SEQ ID NO:1, and sequences substantially identical thereto, may
also be used in chromosome walking procedures to identify clones
containing genomic sequences located adjacent to the sequence of
SEQ ID NO:1, and sequences substantially identical thereto. Such
methods allow the isolation of genes which encode additional
proteins from the host organism.
[0156] The isolated nucleic acid of SEQ ID NO:1, and sequences
substantially identical thereto, the sequences complementary
thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35,
40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of
SEQ ID NO:1, and sequences substantially identical thereto, or the
sequences complementary thereto may be used as probes to identify
and isolate related nucleic acids. In some embodiments, the related
nucleic acids may be cDNAs or genomic DNAs from organisms other
than the one from which the nucleic acid was isolated. For example,
the other organisms may be related organisms. In such procedures, a
nucleic acid sample is contacted with the probe under conditions
which permit the probe to specifically hybridize to related
sequences. Hybridization of the probe to nucleic acids from the
related organism is then detected using any of the methods
described above.
[0157] In nucleic acid hybridization reactions, the conditions used
to achieve a particular level of stringency will vary, depending on
the nature of the nucleic acids being hybridized. For example, the
length, degree of complementarity, nucleotide sequence composition
(e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA)
of the hybridizing regions of the nucleic acids can be considered
in selecting hybridization conditions. An additional consideration
is whether one of the nucleic acids is immobilized, for example, on
a filter.
[0158] Hybridization may be carried out under conditions of low
stringency, moderate stringency or high stringency. As an example
of nucleic acid hybridization, a polymer membrane containing
immobilized denatured nucleic acids is first prehybridized for 30
minutes at 45.degree. C. in a solution consisting of 0.9 M NaCl, 50
mM NaH.sub.2PO.sub.4, pH 7.0, 5.0 mM Na.sub.2EDTA, 0.5% SDS,
10.times. Denhardt's, and 0.5 mg/ml polyriboadenylic acid.
Approximately 2.times.10.sup.7 cpm (specific activity
4-9.times.10.sup.8 cpm/ug) of .sup.32P end-labeled oligonucleotide
probe are then added to the solution. After 12-16 hours of
incubation, the membrane is washed for 30 minutes at room
temperature in 1.times. SET (150 mM NaCl, 20 mM Tris hydrochloride,
pH 7.8, 1 mM Na.sub.2EDTA) containing 0.5% SDS, followed by a 30
minute wash in fresh 1.times. SET at T.sub.m-10.degree. C. for the
oligonucleotide probe. The membrane is then exposed to
auto-radiographic film for detection of hybridization signals.
[0159] By varying the stringency of the hybridization conditions
used to identify nucleic acids, such as cDNAs or genomic DNAs,
which hybridize to the detectable probe, nucleic acids having
different levels of homology to the probe can be identified and
isolated. Stringency may be varied by conducting the hybridization
at varying temperatures below the melting temperatures of the
probes. The melting temperature, T.sub.m, is the temperature (under
defined ionic strength and pH) at which 50% of the target sequence
hybridizes to a perfectly complementary probe. Very stringent
conditions are selected to be equal to or about 5.degree. C. lower
than the T.sub.m for a particular probe. The melting temperature of
the probe may be calculated using the following formulas:
[0160] For probes between 14 and 70 nucleotides in length the
melting temperature (Tm) is calculated using the formula:
T.sub.m=81.5+16.6(log [Na+])+0.41(fraction G+C)-(600/N) where N is
the length of the probe.
[0161] If the hybridization is carried out in a solution containing
formamide, the melting temperature may be calculated using the
equation: T.sub.m=81.5+16.6(log [Na+])+0.41(fraction G+C)-(0.63%
formamide)-(600/N) where N is the length of the probe.
[0162] Prehybridization maybe carried out in 6.times. SSC, 5.times.
Denhardt's reagent, 0.5% SDS, 100 .mu.g denatured fragmented salmon
sperm DNA or 6.times. SSC, 5.times. Denhardt's reagent, 0.5% SDS,
100 .mu.g denatured fragmented salmon sperm DNA, 50% formamide. The
formulas for SSC and Denhardt's solutions are listed in Sambrook et
al., supra.
[0163] Hybridization is conducted by adding the detectable probe to
the prehybridization solutions listed above. Where the probe
comprises double stranded DNA, it is denatured before addition to
the hybridization solution. The filter is contacted with the
hybridization solution for a sufficient period of time to allow the
probe to hybridize to cDNAs or genomic DNAs containing sequences
complementary thereto or homologous thereto. For probes over 200
nucleotides in length, the hybridization may be carried out at
15-25.degree. C. below the T.sub.m. For shorter probes, such as
oligonucleotide probes, the hybridization may be conducted at
5-10.degree. C. below the T.sub.m. Typically, for hybridizations in
6.times. SSC, the hybridization is conducted at approximately
68.degree. C. Usually, for hybridizations in 50% formamide
containing solutions, the hybridization is conducted at
approximately 42.degree. C.
[0164] All of the foregoing hybridizations would be considered to
be under conditions of high stringency.
[0165] Following hybridization, the filter is washed to remove any
non-specifically bound detectable probe. The stringency used to
wash the filters can also be varied depending on the nature of the
nucleic acids being hybridized, the length of the nucleic acids
being hybridized, the degree of complementarity, the nucleotide
sequence composition (e.g., GC v. AT content), and the nucleic acid
type (e.g., RNA v. DNA). Examples of progressively higher
stringency condition washes are as follows: 2.times. SSC, 0.1% SDS
at room temperature for 15 minutes (low stringency); 0.1.times.
SSC, 0.5% SDS at room temperature for 30 minutes to 1 hour
(moderate stringency); 0.1.times. SSC, 0.5% SDS for 15 to 30
minutes at between the hybridization temperature and 68.degree. C.
(high stringency); and 0.15M NaCl for 15 minutes at 72.degree. C.
(very high stringency). A final low stringency wash can be
conducted in 0.1.times. SSC at room temperature. The examples above
are merely illustrative of one set of conditions that can be used
to wash filters. One of skill in the art would know that there are
numerous recipes for different stringency washes. Some other
examples are given below.
[0166] Nucleic acids which have hybridized to the probe are
identified by autoradiography or other conventional techniques.
[0167] The above procedure may be modified to identify nucleic
acids having decreasing levels of homology to the probe sequence.
For example, to obtain nucleic acids of decreasing homology to the
detectable probe, less stringent conditions may be used. For
example, the hybridization temperature may be decreased in
increments of 5.degree. C. from 68.degree. C. to 42.degree. C. in a
hybridization buffer having a Na+ concentration of approximately 1
M. Following hybridization, the filter may be washed with 2.times.
SSC, 0.5% SDS at the temperature of hybridization. These conditions
are considered to be "moderate" conditions above 50.degree. C. and
"low" conditions below 50.degree. C. A specific example of
"moderate" hybridization conditions is when the above hybridization
is conducted at 55.degree. C. A specific example of "low
stringency" hybridization conditions is when the above
hybridization is conducted at 45.degree. C.
[0168] Alternatively, the hybridization may be carried out in
buffers, such as 6.times. SSC, containing formamide at a
temperature of 42.degree. C. In this case, the concentration of
formamide in the hybridization buffer may be reduced in 5%
increments from 50% to 0% to identify clones having decreasing
levels of homology to the probe. Following hybridization, the
filter may be washed with 6.times. SSC, 0.5% SDS at 50.degree. C.
These conditions are considered to be "moderate" conditions above
25% formamide and "low" conditions below 25% formamide. A specific
example of "moderate" hybridization conditions is when the above
hybridization is conducted at 30% formamide. A specific example of
"low stringency" hybridization conditions is when the above
hybridization is conducted at 10% formamide.
[0169] For example, the preceding methods may be used to isolate
nucleic acids having a sequence with at least about 97%, at least
95%, at least 90%, at least 85%, at least 80%, at least 75%, at
least 70%, at least 65%, at least 60%, at least 55%, or at least
50%, homology to the nucleic acid sequence of SEQ ID NO:1, and
sequences substantially identical thereto, or fragments comprising
at least about 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200,
300, 400, or 500 consecutive bases thereof, and the sequences
complementary thereto. Homology may be measured using the alignment
algorithm. For example, the homologous polynucleotides may have a
coding sequence which is a naturally occurring allelic variant of
one of the coding sequences described herein. Such allelic variants
may have a substitution, deletion or addition of one or more
nucleotides when compared to the nucleic acids of SEQ ID NO:1 or
the sequences complementary thereto.
[0170] Additionally, the above procedures may be used to isolate
nucleic acids which encode polypeptides having at least about 99%,
at least 95%, at least 90%, at least 85%, at least 80%, at least
75%, at least 70%, at least 65%, at least 60%, at least 55%, or at
least 50% homology to a polypeptide having the sequence of SEQ ID
NO:2, and sequences substantially identical thereto, or fragments
comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or
150 consecutive amino acids thereof as determined using a sequence
alignment algorithm (e.g., such as the FASTA version 3.0t78
algorithm with the default parameters).
[0171] Another aspect of the invention is an isolated or purified
polypeptide comprising the sequence of SEQ ID NO:1, and sequences
substantially identical thereto, or fragments comprising at least
about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150
consecutive amino acids thereof. As discussed above, such
polypeptides may be obtained by inserting a nucleic acid encoding
the polypeptide into a vector such that the coding sequence is
operably linked to a sequence capable of driving the expression of
the encoded polypeptide in a suitable host cell. For example, the
expression vector may comprise a promoter, a ribosome binding site
for translation initiation and a transcription terminator. The
vector may also include appropriate sequences for amplifying
expression.
[0172] Promoters suitable for expressing the polypeptide or
fragment thereof in bacteria include the E. coli lac or trp
promoters, the lacI promoter, the lacZ promoter, the T3 promoter,
the T7 promoter, the gpt promoter, the lambda PR promoter, the
lambda PL promoter, promoters from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), and the acid
phosphatase promoter. Fungal promoters include the V factor
promoter. Eukaryotic promoters include the CMV immediate early
promoter, the HSV thymidine kinase promoter, heat shock promoters,
the early and late SV40 promoter, LTRs from retroviruses, and the
mouse metallothionein-I promoter. Other promoters known to control
expression of genes in prokaryotic or eukaryotic cells or their
viruses may also be used.
[0173] Mammalian expression vectors may also comprise an origin of
replication, any necessary ribosome binding sites, a
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. In some embodiments, DNA sequences
derived from the SV40 splice and polyadenylation sites may be used
to provide the required nontranscribed genetic elements.
[0174] Vectors for expressing the polypeptide or fragment thereof
in eukaryotic cells may also contain enhancers to increase
expression levels. Enhancers are cis-acting elements of DNA,
usually from about 10 to about 300 bp in length that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin bp 100 to 270,
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and the adenovirus
enhancers.
[0175] In addition, the expression vectors typically contain one or
more selectable marker genes to permit selection of host cells
containing the vector. Such selectable markers include genes
encoding dihydrofolate reductase or genes conferring neomycin
resistance for eukaryotic cell culture, genes conferring
tetracycline or ampicillin resistance in E. coli, and the S.
cerevisiae TRP1 gene.
[0176] In some embodiments, the nucleic acid encoding SEQ ID NO:2,
and sequences substantially identical thereto, or fragments
comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, or 150 consecutive amino acids thereof is assembled in
appropriate phase with a leader sequence capable of directing
secretion of the translated polypeptide or fragment thereof.
Optionally, the nucleic acid can encode a fusion polypeptide in
which one of the polypeptides of SEQ ID NO:2, and sequences
substantially identical thereto, or fragments comprising at least
5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive
amino acids thereof is fused to heterologous peptides or
polypeptides, such as N-terminal identification peptides which
impart desired characteristics, such as increased stability or
simplified purification.
[0177] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is ligated
to the desired position in the vector following digestion of the
insert and the vector with appropriate restriction endonucleases.
Alternatively, blunt ends in both the insert and the vector may be
ligated. A variety of cloning techniques are disclosed in Ausubel
et al. Current Protocols in Molecular Biology, John Wiley 503 Sons,
Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory
Manual 2d Ed., Cold Spring Harbor Laboratory Press (1989), the
entire disclosures of which are incorporated herein by reference.
Such procedures and others are deemed to be within the scope of
those skilled in the art.
[0178] The vector may be, for example, in the form of a plasmid, a
viral particle, or a phage. Other vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, derivatives of SV40;
bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors
derived from combinations of plasmids and phage DNA, viral DNA such
as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A
variety of cloning and expression vectors for use with prokaryotic
and eukaryotic hosts are described by Sambrook, et al., Molecular
Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, N.Y.,
(1989), the disclosure of which is hereby incorporated by
reference.
[0179] Particular bacterial vectors which may be used include the
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia
Fine Chemicals, Uppsala, Sweden), GEMI (Promega Biotec, Madison,
Wis., USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript
II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7.
Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any
other vector may be used as long as it is replicable and viable in
the host cell.
[0180] The host cell may be any of the host cells familiar to those
skilled in the art, including prokaryotic cells, eukaryotic cells,
mammalian cells, insect cells, or plant cells. As representative
examples of appropriate hosts, there may be mentioned: bacterial
cells, such as E. coli, Streptomyces, Bacillus subtilis ,
Salmonella typhimurium and various species within the genera
Pseudomonas, Streptomyces, and Staphylococcus, fungal cells, such
as yeast, insect cells such as Drosophila S2 and Spodoptera Sf9,
animal cells such as CHO, COS or Bowes melanoma, and adenoviruses.
The selection of an appropriate host is within the abilities of
those skilled in the art.
[0181] The vector may be introduced into the host cells using any
of a variety of techniques, including transformation, transfection,
transduction, viral infection, gene guns, or Ti-mediated gene
transfer. Particular methods include calcium phosphate
transfection, DEAE-Dextran mediated transfection, lipofection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0182] Where appropriate, the engineered host cells can be cultured
in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the invention. Following transformation of a suitable host
strain and growth of the host strain to an appropriate cell
density, the selected promoter may be induced by appropriate means
(e.g., temperature shift or chemical induction) and the cells may
be cultured for an additional period to allow them to produce the
desired polypeptide or fragment thereof.
[0183] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract is
retained for further purification. Microbial cells employed for
expression of proteins can be disrupted by any convenient method,
including freeze-thaw cycling, sonication, mechanical disruption,
or use of cell lysing agents. Such methods are well known to those
skilled in the art. The expressed polypeptide or fragment thereof
can be recovered and purified from recombinant cell cultures by
methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0184] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts
(described by Gluzman, Cell, 23:175, 1981), and other cell lines
capable of expressing proteins from a compatible vector, such as
the C127, 3T3, CHO, HeLa and BHK cell lines.
[0185] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Depending upon the host employed in a recombinant
production procedure, the polypeptides produced by host cells
containing the vector may be glycosylated or may be
non-glycosylated. Polypeptides of the invention may or may not also
include an initial methionine amino acid residue.
[0186] Alternatively, SEQ ID NO:2, and sequences substantially
identical thereto, or fragments comprising at least 5, 10, 15, 20,
25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof
can be synthetically produced by conventional peptide synthesizers.
In other embodiments, fragments or portions of the polypeptides may
be employed for producing the corresponding full-length polypeptide
by peptide synthesis; therefore, the fragments may be employed as
intermediates for producing the full-length polypeptides.
[0187] Cell-free translation systems can also be employed to
produce SEQ ID NO:2, and sequences substantially identical thereto,
or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50,
75, 100, or 150 consecutive amino acids thereof using mRNAs
transcribed from a DNA construct comprising a promoter operably
linked to a nucleic acid encoding the polypeptide or fragment
thereof. In some embodiments, the DNA construct may be linearized
prior to conducting an in vitro transcription reaction. The
transcribed mRNA is then incubated with an appropriate cell-free
translation extract, such as a rabbit reticulocyte extract, to
produce the desired polypeptide or fragment thereof.
[0188] The invention also relates to variants of SEQ ID NO:2, and
sequences substantially identical thereto, or fragments comprising
at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150
consecutive amino acids thereof. The term "variant" includes
derivatives or analogs of these polypeptides. In particular, the
variants may differ in amino acid sequence from SEQ ID NO:2, and
sequences substantially identical thereto, by one or more
substitutions, additions, deletions, fusions and truncations, which
may be present in any combination.
[0189] The variants may be naturally occurring or created in vitro.
In particular, such variants may be created using genetic
engineering techniques such as site directed mutagenesis, random
chemical mutagenesis, Exonuclease III deletion procedures, and
standard cloning techniques. Alternatively, such variants,
fragments, analogs, or derivatives may be created using chemical
synthesis or modification procedures.
[0190] Other methods of making variants are also familiar to those
skilled in the art. These include procedures in which nucleic acid
sequences obtained from natural isolates are modified to generate
nucleic acids which encode polypeptides having characteristics
which enhance their value in industrial or laboratory applications.
In such procedures, a large number of variant sequences having one
or more nucleotide differences with respect to the sequence
obtained from the natural isolate are generated and characterized.
Typically, these nucleotide differences result in amino acid
changes with respect to the polypeptides encoded by the nucleic
acids from the natural isolates.
[0191] For example, variants may be created using error prone PCR.
In error prone PCR, PCR is performed under conditions where the
copying fidelity of the DNA polymerase is low, such that a high
rate of point mutations is obtained along the entire length of the
PCR product. Error prone PCR is described in Leung, D. W., et al.,
Technique, 1:11-15, 1989) and Caldwell, R. C. & Joyce G. F.,
PCR Methods Applic., 2:28-33, 1992, the disclosure of which is
incorporated herein by reference in its entirety. Briefly, in such
procedures, nucleic acids to be mutagenized are mixed with PCR
primers, reaction buffer, MgCl.sub.2, MnCl.sub.2, Taq polymerase
and an appropriate concentration of dNTPs for achieving a high rate
of point mutation along the entire length of the PCR product. For
example, the reaction may be performed using 20 fmoles of nucleic
acid to be mutagenized, 30 pmole of each PCR primer, a reaction
buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3) and 0.01%
gelatin, 7 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 5 units of Taq
polymerase, 0.2 mM dGTP, 0.2 mM DATP, 1 mM dCTP, and 1 mM dTTP. PCR
may be performed for 30 cycles of 94.degree. C. for 1 min,
45.degree. C. for 1 min, and 72.degree. C. for 1 min. However, it
will be appreciated that these parameters may be varied as
appropriate. The mutagenized nucleic acids are cloned into an
appropriate vector and the activities of the polypeptides encoded
by the mutagenized nucleic acids is evaluated.
[0192] Variants may also be created using oligonucleotide directed
mutagenesis to generate site-specific mutations in any cloned DNA
of interest. Oligonucleotide mutagenesis is described in
Reidhaar-Olson, J. F. & Sauer, R. T., et al., Science,
241:53-57, 1988, the disclosure of which is incorporated herein by
reference in its entirety. Briefly, in such procedures a plurality
of double stranded oligonucleotides bearing one or more mutations
to be introduced into the cloned DNA are synthesized and inserted
into the cloned DNA to be mutagenized. Clones containing the
mutagenized DNA are recovered and the activities of the
polypeptides they encode are assessed.
[0193] Another method for generating variants is assembly PCR.
Assembly PCR involves the assembly of a PCR product from a mixture
of small DNA fragments. A large number of different PCR reactions
occur in parallel in the same vial, with the products of one
reaction priming the products of another reaction. Assembly PCR is
described in U.S. Pat. No. 5,965,408, filed Jul. 9, 1996, entitled,
"Method of DNA Reassembly by Interrupting Synthesis", the
disclosure of which is incorporated herein by reference in its
entirety.
[0194] Still another method of generating variants is sexual PCR
mutagenesis. In sexual PCR mutagenesis, forced homologous
recombination occurs between DNA molecules of different but highly
related DNA sequence in vitro, as a result of random fragmentation
of the DNA molecule based on sequence homology, followed by
fixation of the crossover by primer extension in a PCR reaction.
Sexual PCR mutagenesis is described in Stemmer, W. P., PNAS, USA,
91:10747-10751, 1994, the disclosure of which is incorporated
herein by reference. Briefly, in such procedures a plurality of
nucleic acids to be recombined are digested with DNAse to generate
fragments having an average size of 50-200 nucleotides. Fragments
of the desired average size are purified and resuspended in a PCR
mixture. PCR is conducted under conditions which facilitate
recombination between the nucleic acid fragments. For example, PCR
may be performed by resuspending the purified fragments at a
concentration of 10-30 ng/:1 in a solution of 0.2 mM of each dNTP,
2.2 mM MgCl.sub.2, 50 mM KCl, 10 mM Tris HCl, pH 9.0, and 0.1%
Triton X-100. 2.5 units of Taq polymerase per 100:1 of reaction
mixture is added and PCR is performed using the following regime:
94.degree. C. for 60 seconds, 94.degree. C. for 30 seconds,
50-55.degree. C. for 30 seconds, 72.degree. C. for 30 seconds
(30-45 times) and 72.degree. C. for 5 minutes. However, it will be
appreciated that these parameters may be varied as appropriate. In
some embodiments, oligonucleotides may be included in the PCR
reactions. In other embodiments, the Klenow fragment of DNA
polymerase I may be used in a first set of PCR reactions and Taq
polymerase may be used in a subsequent set of PCR reactions.
Recombinant sequences are isolated and the activities of the
polypeptides they encode are assessed.
[0195] Variants may also be created by in vivo mutagenesis. In some
embodiments, random mutations in a sequence of interest are
generated by propagating the sequence of interest in a bacterial
strain, such as an E. coli strain, which carries mutations in one
or more of the DNA repair pathways. Such "mutator" strains have a
higher random mutation rate than that of a wild-type parent.
Propagating the DNA in one of these strains will eventually
generate random mutations within the DNA. Mutator strains suitable
for use for in vivo mutagenesis are described in PCT Publication
No. WO 91/16427, published Oct. 31, 1991, entitled "Methods for
Phenotype Creation from Multiple Gene Populations" the disclosure
of which is incorporated herein by reference in its entirety.
[0196] Variants may also be generated using cassette mutagenesis.
In cassette mutagenesis a small region of a double stranded DNA
molecule is replaced with a synthetic oligonucleotide "cassette"
that differs from the native sequence. The oligonucleotide often
contains completely and/or partially randomized native
sequence.
[0197] Recursive ensemble mutagenesis may also be used to generate
variants. Recursive ensemble mutagenesis is an algorithm for
protein engineering (protein mutagenesis) developed to produce
diverse populations of phenotypically related mutants whose members
differ in amino acid sequence. This method uses a feedback
mechanism to control successive rounds of combinatorial cassette
mutagenesis. Recursive ensemble mutagenesis is described in Arkin,
A. P. and Youvan, D. C., PNAS, USA, 89:7811-7815, 1992, the
disclosure of which is incorporated herein by reference in its
entirety.
[0198] In some embodiments, variants are created using exponential
ensemble mutagenesis. Exponential ensemble mutagenesis is a process
for generating combinatorial libraries with a high percentage of
unique and functional mutants, wherein small groups of residues are
randomized in parallel to identify, at each altered position, amino
acids which lead to functional proteins. Exponential ensemble
mutagenesis is described in Delegrave, S. and Youvan, D. C.,
Biotechnology Research, 11 1548-1552, 1993, the disclosure of which
incorporated herein by reference in its entirety. Random and
site-directed mutagenesis are described in Arnold, F. H., Current
Opinion in Biotechnology, 4:450-455, 1993, the disclosure of which
is incorporated herein by reference in its entirety.
[0199] In some embodiments, the variants are created using
shuffling procedures wherein portions of a plurality of nucleic
acids which encode distinct polypeptides are fused together to
create chimeric nucleic acid sequences which encode chimeric
polypeptides as described in U.S. Pat. No. 5,965,408, filed Jul. 9,
1996, entitled, "Method of DNA Reassembly by Interrupting
Synthesis", and U.S. Pat. No. 5,939,250, filed May 22, 1996,
entitled, "Production of Enzymes Having Desired Activities by
Mutagenesis", both of which are incorporated herein by
reference.
[0200] The variants of SEQ ID NO:2 may be variants in which one or
more of the amino acid residues of SEQ ID NO:2 are substituted with
a conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code.
[0201] Conservative substitutions are those that substitute a given
amino acid in a polypeptide by another amino acid of like
characteristics. Typically seen as conservative substitutions are
the following replacements: replacements of an aliphatic amino acid
such as Alanine, Valine, Leucine and Isoleucine with another
aliphatic amino acid; replacement of a Serine with a Threonine or
vice versa; replacement of an acidic residue such as Aspartic acid
and Glutamic acid with another acidic residue; replacement of a
residue bearing an amide group, such as Asparagine and Glutamine,
with another residue bearing an amide group; exchange of a basic
residue such as Lysine and Arginine with another basic residue; and
replacement of an aromatic residue such as Phenylalanine, Tyrosine
with another aromatic residue.
[0202] Other variants are those in which one or more of the amino
acid residues of SEQ ID NO:2 includes a substituent group.
[0203] Still other variants are those in which the polypeptide is
associated with another compound, such as a compound to increase
the half-life of the polypeptide (for example, polyethylene
glycol).
[0204] Additional variants are those in which additional amino
acids are fused to the polypeptide, such as a leader sequence, a
secretory sequence, a proprotein sequence or a sequence which
facilitates purification, enrichment, or stabilization of the
polypeptide.
[0205] In some embodiments, the fragments, derivatives and analogs
retain the same biological function or activity as SEQ ID NO:2, and
sequences substantially identical thereto. In other embodiments,
the fragment, derivative, or analog includes a proprotein, such
that the fragment, derivative, or analog can be activated by
cleavage of the proprotein portion to produce an active
polypeptide.
[0206] Another aspect of the invention is polypeptides or fragments
thereof which have at least about 50%, at least about 55%, at least
about 60%, at least about 65%, at least about 70%, at least about
75%, at least about 80%, at least about 85%, at least about 90%, at
least about 95%, or more than about 95% homology to SEQ ID NO:2,
and sequences substantially identical thereto, or a fragment
comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or
150 consecutive amino acids thereof. Homology may be determined
using any of the programs described above which aligns the
polypeptides or fragments being compared and determines the extent
of amino acid identity or similarity between them. It will be
appreciated that amino acid "homology" includes conservative amino
acid substitutions such as those described above.
[0207] The polypeptides or fragments having homology to SEQ ID
NO:2, and sequences substantially identical thereto, or a fragment
comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, or 150 consecutive amino acids thereof may be obtained by
isolating the nucleic acids encoding them using the techniques
described above.
[0208] Alternatively, the homologous polypeptides or fragments may
be obtained through biochemical enrichment or purification
procedures. The sequence of potentially homologous polypeptides or
fragments may be determined by proteolytic digestion, gel
electrophoresis and/or microsequencing. The sequence of the
prospective homologous polypeptide or fragment can be compared to
SEQ ID NO:2, and sequences substantially identical thereto, or a
fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, or 150 consecutive amino acids thereof using any of
the programs described above.
[0209] Another aspect of the invention is an assay for identifying
fragments or variants of SEQ ID NO:2, and sequences substantially
identical thereto, which retain the enzymatic function of SEQ ID
NO:2, and sequences substantially identical thereto. For example
the fragments or variants of said polypeptides, may be used to
catalyze biochemical reactions, which indicate that the fragment or
variant retains the enzymatic activity of SEQ ID NO:2.
[0210] The assay for determining if fragments of variants retain
the enzymatic activity of SEQ ID NO:2, and sequences substantially
identical thereto includes the steps of; contacting the polypeptide
fragment or variant with a substrate molecule under conditions
which allow the polypeptide fragment or variant to function, and
detecting either a decrease in the level of substrate or an
increase in the level of the specific reaction product of the
reaction between the polypeptide and substrate.
[0211] SEQ ID NO:2, and sequences substantially identical thereto
or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50,
75, 100, or 150 consecutive amino acids thereof may be used in a
variety of applications. For example, the polypeptides or fragments
thereof may be used to catalyze biochemical reactions. In
accordance with one aspect of the invention, there is provided a
process for utilizing SEQ ID NO:2, and sequences substantially
identical thereto or polynucleotides encoding such polypeptides for
hydrolyzing glycosidic linkages. In such procedures, a substance
containing a glycosidic linkage (e.g., a starch) is contacted with
SEQ ID NO:2, or sequences substantially identical thereto under
conditions which facilitate the hydrolysis of the glycosidic
linkage.
[0212] SEQ ID NO:2, and sequences substantially identical thereto
or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50,
75, 100, or 150 consecutive amino acids thereof, may also be used
to generate antibodies which bind specifically to the polypeptides
or fragments. The resulting antibodies may be used in
immunoaffinity chromatography procedures to isolate or purify the
polypeptide or to determine whether the polypeptide is present in a
biological sample. In such procedures, a protein preparation, such
as an extract, or a biological sample is contacted with an antibody
capable of specifically binding to SEQ ID NO:2, and sequences
substantially identical thereto, or fragments comprising at least
5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive
amino acids thereof.
[0213] In immunoaffinity procedures, the antibody is attached to a
solid support, such as a bead or other column matrix. The protein
preparation is placed in contact with the antibody under conditions
in which the antibody specifically binds to SEQ ID NO:2, and
sequences substantially identical thereto, or fragment thereof.
After a wash to remove non-specifically bound proteins, the
specifically bound polypeptides are eluted.
[0214] The ability of proteins in a biological sample to bind to
the antibody may be determined using any of a variety of procedures
familiar to those skilled in the art. For example, binding may be
determined by labeling the antibody with a detectable label such as
a fluorescent agent, an enzymatic label, or a radioisotope.
Alternatively, binding of the antibody to the sample may be
detected using a secondary antibody having such a detectable label
thereon. Particular assays include ELISA assays, sandwich assays,
radioimmunoassays, and Western Blots.
[0215] Polyclonal antibodies generated against SEQ ID NO:2, and
sequences substantially identical thereto, or fragments comprising
at least 5, 10, 15, 20, 25, 30, 35,40, 50, 75, 100, or 150
consecutive amino acids thereof can be obtained by direct injection
of the polypeptides into an animal or by administering the
polypeptides to an animal, for example, a nonhuman. The antibody so
obtained will then bind the polypeptide itself. In this manner,
even a sequence encoding only a fragment of the polypeptide can be
used to generate antibodies which may bind to the whole native
polypeptide. Such antibodies can then be used to isolate the
polypeptide from cells expressing that polypeptide.
[0216] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, Nature, 256:495-497, 1975, the disclosure of which is
incorporated herein by reference), the trioma technique, the human
B-cell hybridoma technique (Kozbor et al., Immunology Today 4:72,
1983, the disclosure of which is incorporated herein by reference),
and the EBV-hybridoma technique (Cole, et al., 1985, in Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, the
disclosure of which is incorporated herein by reference).
[0217] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778, the disclosure of which is
incorporated herein by reference) can be adapted to produce single
chain antibodies to SEQ ID NO:2, and sequences substantially
identical thereto, or fragments comprising at least 5, 10, 15, 20,
25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids
thereof. Alternatively, transgenic mice may be used to express
humanized antibodies to these polypeptides or fragments
thereof.
[0218] Antibodies generated against SEQ ID NO:2, and sequences
substantially identical thereto, or fragments comprising at least
5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive
amino acids thereof may be used in screening for similar
polypeptides from other organisms and samples. In such techniques,
polypeptides from the organism are contacted with the antibody and
those polypeptides which specifically bind the antibody are
detected. Any of the procedures described above may be used to
detect antibody binding. One such screening assay is described in
"Methods for Measuring Cellulase Activities", Methods in
Enzymology, Vol 160, pp. 87-116, which is hereby incorporated by
reference in its entirety.
[0219] As used herein the term "SEQ ID NO:1 " encompasses the
nucleotide sequence of SEQ ID NO:1, and sequences substantially
identical thereto, as well as sequences homologous to SEQ ID NO:1,
and fragments thereof and sequences complementary to all of the
preceding sequences. The fragments include portions of SEQ ID NO:1,
comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150,
200, 300, 400, or 500 consecutive nucleotides of SEQ ID NO:1, and
sequences substantially identical thereto. Homologous sequences and
fragments of SEQ ID NO:1, and sequences substantially identical
thereto, refer to a sequence having at least 99%, 98%, 97%, 96%,
95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55% or 50% homology to
these sequences. Homology may be determined using any of the
computer programs and parameters described herein, including FASTA
version 3.0t78 with the default parameters. Homologous sequences
also include RNA sequences in which uridines replace the thymines
in the nucleic acid sequences as set forth in SEQ ID NO:1. The
homologous sequences may be obtained using any of the procedures
described herein or may result from the correction of a sequencing
error. It will be appreciated that the nucleic acid sequences as
set forth in SEQ ID NO:1, and sequences substantially identical
thereto, can be represented in the traditional single character
format (See the inside back cover of Stryer, Lubert. Biochemistry,
3rd Ed., W. H Freeman & Co., New York.) or in any other format
which records the identity of the nucleotides in a sequence.
[0220] As used herein the term "a polypeptide sequence as set forth
in SEQ ID NO:2" encompasses the polypeptide sequence of SEQ ID
NO:2, and sequences substantially identical thereto, which are
encoded by a sequence as set forth in SEQ ID NO:1, polypeptide
sequences homologous to SEQ ID NO:2, and sequences substantially
identical thereto, or fragments of any of the preceding sequences.
Homologous polypeptide sequences refer to a polypeptide sequence
having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%,
65%, 60%, 55% or 50% homology to SEQ ID NO:2. Homology may be
determined using any of the computer programs and parameters
described herein, including FASTA version 3.0t78 with the default
parameters or with any modified parameters. The homologous
sequences may be obtained using any of the procedures described
herein or may result from the correction of a sequencing error. The
polypeptide fragments comprise at least 5, 10, 15, 20, 25, 30, 35,
40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2, and
sequences substantially identical thereto. It will be appreciated
that the polypeptide codes as set forth in SEQ ID NO:2, and
sequences substantially identical thereto, can be represented in
the traditional single character format or three letter format (See
the inside back cover of Stryer, Lubert. Biochemistry, 3rd Ed., W.
H Freeman & Co., New York.) or in any other format which
relates the identity of the polypeptides in a sequence.
[0221] It will be appreciated by those skilled in the art that a
nucleic acid sequence as set forth in SEQ ID NO:1 and a polypeptide
sequence as set forth in SEQ ID NO:2 can be stored, recorded, and
manipulated on any medium which can be read and accessed by a
computer. As used herein, the words "recorded" and "stored" refer
to a process for storing information on a computer medium. A
skilled artisan can readily adopt any of the presently known
methods for recording information on a computer readable medium to
generate manufactures comprising one or more of the nucleic acid
sequences as set forth in SEQ ID NO:1, and sequences substantially
identical thereto, one or more of the polypeptide sequences as set
forth in SEQ ID NO:2, and sequences substantially identical
thereto. Another aspect of the invention is a computer readable
medium having recorded thereon at least 2, 5, 10, 15, or 20 nucleic
acid sequences as set forth in SEQ ID NO:1, and sequences
substantially identical thereto.
[0222] Another aspect of the invention is a computer readable
medium having recorded thereon one or more of the nucleic acid
sequences as set forth SEQ ID NO:1, and sequences substantially
identical thereto. Another aspect of the invention is a computer
readable medium having recorded thereon one or more of the
polypeptide sequences as set forth in SEQ ID NO:2, and sequences
substantially identical thereto. Another aspect of the invention is
a computer readable medium having recorded thereon at least 2, 5,
10, 15, or 20 of the sequences as set forth above.
[0223] Computer readable media include magnetically readable media,
optically readable media, electronically readable media and
magnetic/optical media. For example, the computer readable media
may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital
Versatile Disk (DVD), Random Access Memory (RAM), or Read Only
Memory (ROM) as well as other types of other media known to those
skilled in the art.
[0224] Embodiments of the invention include systems (e.g., internet
based systems), particularly computer systems which store and
manipulate the sequence information described herein. One example
of a computer system 100 is illustrated in block diagram form in
FIG. 1. As used herein, "a computer system" refers to the hardware
components, software components, and data storage components used
to analyze a nucleotide sequence of a nucleic acid sequence as set
forth in SEQ ID NO:1, and sequences substantially identical
thereto, or a polypeptide sequence as set forth in SEQ ID NO:2. The
computer system 100 typically includes a processor for processing,
accessing and manipulating the sequence data. The processor 105 can
be any well-known type of central processing unit, such as, for
example, the Pentium III from Intel Corporation, or similar
processor from Sun, Motorola, Compaq, AMD or International Business
Machines.
[0225] Typically the computer system 100 is a general purpose
system that comprises the processor 105 and one or more internal
data storage components 110 for storing data, and one or more data
retrieving devices for retrieving the data stored on the data
storage components. A skilled artisan can readily appreciate that
any one of the currently available computer systems are
suitable.
[0226] In one particular embodiment, the computer system 100
includes a processor 105 connected to a bus which is connected to a
main memory 115 (preferably implemented as RAM) and one or more
internal data storage devices 110, such as a hard drive and/or
other computer readable media having data recorded thereon. In some
embodiments, the computer system 100 further includes one or more
data retrieving device 118 for reading the data stored on the
internal data storage devices 110.
[0227] The data retrieving device 118 may represent, for example, a
floppy disk drive, a compact disk drive, a magnetic tape drive, or
a modem capable of connection to a remote data storage system
(e.g., via the internet) etc. In some embodiments, the internal
data storage device 110 is a removable computer readable medium
such as a floppy disk, a compact disk, a magnetic tape, etc.
containing control logic and/or data recorded thereon. The computer
system 100 may advantageously include or be programmed by
appropriate software for reading the control logic and/or the data
from the data storage component once inserted in the data
retrieving device.
[0228] The computer system 100 includes a display 120 which is used
to display output to a computer user. It should also be noted that
the computer system 100 can be linked to other computer systems
125a-c in a network or wide area network to provide centralized
access to the computer system 100.
[0229] Software for accessing and processing the nucleotide
sequences of a nucleic acid sequence as set forth in SEQ ID NO:1,
and sequences substantially identical thereto, or a polypeptide
sequence as set forth in SEQ ID NO:2, and sequences substantially
identical thereto, (such as search tools, compare tools, and
modeling tools etc.) may reside in main memory 115 during
execution.
[0230] In some embodiments, the computer system 100 may further
comprise a sequence comparison algorithm for comparing a nucleic
acid sequence as set forth in SEQ ID NO:1, and sequences
substantially identical thereto, or a polypeptide sequence as set
forth in SEQ ID NO:2, and sequences substantially identical
thereto, stored on a computer readable medium to a reference
nucleotide or polypeptide sequence(s) stored on a computer readable
medium. A "sequence comparison algorithm" refers to one or more
programs which are implemented (locally or remotely) on the
computer system 100 to compare a nucleotide sequence with other
nucleotide sequences and/or compounds stored within a data storage
means. For example, the sequence comparison algorithm may compare
the nucleotide sequences of a nucleic acid sequence as set forth in
SEQ ID NO:1, and sequences substantially identical thereto, or a
polypeptide sequence as set forth in SEQ ID NO:2, and sequences
substantially identical thereto, stored on a computer readable
medium to reference sequences stored on a computer readable medium
to identify homologies or structural motifs. Various sequence
comparison programs identified elsewhere in this patent
specification are particularly contemplated for use in this aspect
of the invention. Protein and/or nucleic acid sequence homologies
may be evaluated using any of the variety of sequence comparison
algorithms and programs known in the art. Such algorithms and
programs include, but are by no means limited to, TBLASTN, BLASTP,
FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad.
Sci. USA 85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol.
215(3):403-410, 1990; Thompson et al., Nucleic Acids Res.
22(2):4673-4680, 1994; Higgins et al., Methods Enzymol.
266:383-402, 1996; Altschul et al., J. Mol. Biol. 215(3):403-410,
1990; Altschul et al., Nature Genetics 3:266-272, 1993).
[0231] Homology or identity is often measured using sequence
analysis software (e.g., Sequence Analysis Software Package of the
Genetics Computer Group, University of Wisconsin Biotechnology
Center, 1710 University Avenue, Madison, Wis. 53705). Such software
matches similar sequences by assigning degrees of homology to
various deletions, substitutions and other modifications. The terms
"homology" and "identity" in the context of two or more nucleic
acids or polypeptide sequences, refer to two or more sequences or
subsequences that are the same or have a specified percentage of
amino acid residues or nucleotides that are the same when compared
and aligned for maximum correspondence over a comparison window or
designated region as measured using any number of sequence
comparison algorithms or by manual alignment and visual
inspection.
[0232] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identities for the
test sequences relative to the reference sequence, based on the
program parameters.
[0233] A "comparison window", as used herein, includes reference to
a segment of any one of the number of contiguous positions selected
from the group consisting of from 20 to 600, usually about 50 to
about 200, more usually about 100 to about 150 in which a sequence
may be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally aligned.
Methods of alignment of sequence for comparison are well-known in
the art. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol 48:443, 1970, by
the search for similarity method of person & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444, 1988, by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection. Other algorithms for determining
homology or identity include, for example, in addition to a BLAST
program (Basic Local Alignment Search Tool at the National Center
for Biological Information), ALIGN, AMAS (Analysis of Multiply
Aligned Sequences), AMPS (Protein Multiple Sequence Alignment),
ASSET (Aligned Segment Statistical Evaluation Tool), BANDS,
BESTSCOR, BIOSCAN (Biological Sequence Comparative Analysis Node),
BLIMPS (BLocks IMProved Searcher), FASTA, Intervals & Points,
BMB, CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS,
Smith-Waterman algorithm, DARWIN, Las Vegas algorithm, FNAT (Forced
Nucleotide Alignment Tool), Framealign, Framesearch, DYNAMIC,
FILTER, FSAP (Fristensky Sequence Analysis Package), GAP (Global
Alignment Program), GENAL, GIBBS, GenQuest, ISSC (Sensitive
Sequence Comparison), LALIGN (Local Sequence Alignment), LCP (Local
Content Program), MACAW (Multiple Alignment Construction &
Analysis Workbench), MAP (Multiple Alignment Program), MBLKP,
MBLKN, PIMA (Pattern-Induced Multi-sequence Alignment), SAGA
(Sequence Alignment by Genetic Algorithm) and WHAT-IF. Such
alignment programs can also be used to screen genome databases to
identify polynucleotide sequences having substantially identical
sequences. A number of genome databases are available, for example,
a substantial portion of the human genome is available as part of
the Human Genome Sequencing Project (J. Roach,
http://weber.u.Washingt- on.edu/.about.roach/human_genome_progress
2.html) (Gibbs, 1995). At least twenty-one other genomes have
already been sequenced, including, for example, M. genitalium
(Fraser et al., 1995), M. jannaschii (Bult et al., 1996), H.
influenzae (Fleischmann et al., 1995), E. coli (Blattner et al.,
1997), and yeast (S. cerevisiae) (Mewes et al., 1997), and D.
melanogaster (Adams et al., 2000). Significant progress has also
been made in sequencing the genomes of model organism, such as
mouse, C. elegans, and Arabadopsis sp. Several databases containing
genomic information annotated with some functional information are
maintained by different organization, and are accessible via the
internet, for example, http://wwwtigr.org/tdb;
http://www.genetics.wisc.edu;
http://genome-www.stanford.edu/.about.ball;
http://hiv-web.lanl.gov; http://www.ncbi.nlm.nih.gov;
http://www.ebi.ac.uk; http://Pasteur.fr/other/biology; and
http://www.genome.wi.mit.edu.
[0234] One example of a useful algorithm is BLAST and BLAST 2.0
algorithms, which are described in Altschul et al., Nuc. Acids Res.
25:3389-3402, 1977, and Altschul et al., J. Mol. Biol. 215:403-410,
1990, respectively. Software for performing BLAST analyses is
publicly available through the National Center for Biotechnology
Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves
first identifying high scoring sequence pairs (HSPs) by identifying
short words of length W in the query sequence, which either match
or satisfy some positive-valued threshold score T when aligned with
a word of the same length in a database sequence. T is referred to
as the neighborhood word score threshold (Altschul et al., supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
extended in both directions along each sequence for as far as the
cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always >0). For
amino acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, M=5, N=-4 and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a
wordlength of 3, and expectations (E) of 10, and the BLOSUM62
scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915, 1989) alignments (B) of 50, expectation (E) of 10,
M=5, N=-4, and a comparison of both strands.
[0235] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin &
Altschul, Proc. Natl. Acad. Sci. USA 90:5873, 1993). One measure of
similarity provided by BLAST algorithm is the smallest sum
probability (P(N) which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. For example, a nucleic acid is considered
similar to a references sequence if the smallest sum probability in
a comparison of the test nucleic acid to the reference nucleic acid
is less than about 0.2, more preferably less than about 0.01, and
most preferably less than about 0.001.
[0236] In one embodiment, protein and nucleic acid sequence
homologies are evaluated using the Basic Local Alignment Search
Tool ("BLAST") In particular, five specific BLAST programs are used
to perform the following task:
[0237] (1) BLASTP and BLAST3 compare an amino acid query sequence
against a protein sequence database;
[0238] (2) BLASTN compares a nucleotide query sequence against a
nucleotide sequence database;
[0239] (3) BLASTX compares the six-frame conceptual translation
products of a query nucleotide sequence (both strands) against a
protein sequence database;
[0240] (4) TBLASTN compares a query protein sequence against a
nucleotide sequence database translated in all six reading frames
(both strands); and
[0241] (5) TBLASTX compares the six-frame translations of a
nucleotide query sequence against the six-frame translations of a
nucleotide sequence database.
[0242] The BLAST programs identify homologous sequences by
identifying similar segments, which are referred to herein as
"high-scoring segment pairs," between a query amino or nucleic acid
sequence and a test sequence which is preferably obtained from a
protein or nucleic acid sequence database. High-scoring segment
pairs are preferably identified (i.e., aligned) by means of a
scoring matrix, many of which are known in the art. Preferably, the
scoring matrix used is the BLOSUM62 matrix (Gonnet et al., Science
25 6:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61,
1993). Less preferably, the PAM or PAM250 matrices may also be used
(see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for
Detecting Distance Relationships: Atlas of Protein Sequence and
Structure, Washington: National Biomedical Research Foundation).
BLAST programs are accessible through the U.S. National Library of
Medicine, e.g., at www.ncbi.nlm.nih.gov.
[0243] The parameters used with the above algorithms may be adapted
depending on the sequence length and degree of homology studied. In
some embodiments, the parameters may be the default parameters used
by the algorithms in the absence of instructions from the user.
[0244] FIG. 2 is a flow diagram illustrating one embodiment of a
process 200 for comparing a new nucleotide or protein sequence with
a database of sequences in order to determine the homology levels
between the new sequence and the sequences in the database. The
database of sequences can be a private database stored within the
computer system 100, or a public database such as GENBANK that is
available through the Internet.
[0245] The process 200 begins at a start state 201 and then moves
to a state 202 wherein the new sequence to be compared is stored to
a memory in a computer system 100. As discussed above, the memory
could be any type of memory, including RAM or an internal storage
device.
[0246] The process 200 then moves to a state 204 wherein a database
of sequences is opened for analysis and comparison. The process 200
then moves to a state 206 wherein the first sequence stored in the
database is read into a memory on the computer. A comparison is
then performed at a state 210 to determine if the first sequence is
the same as the second sequence. It is important to note that this
step is not limited to performing an exact comparison between the
new sequence and the first sequence in the database. Well-known
methods are known to those of skill in the art for comparing two
nucleotide or protein sequences, even if they are not identical.
For example, gaps can be introduced into one sequence in order to
raise the homology level between the two tested sequences. The
parameters that control whether gaps or other features are
introduced into a sequence during comparison are normally entered
by the user of the computer system.
[0247] Once a comparison of the two sequences has been performed at
the state 210, a determination is made at a decision state 210
whether the two sequences are the same. Of course, the term "same"
is not limited to sequences that are absolutely identical.
Sequences that are within the homology parameters entered by the
user will be marked as "same" in the process 200.
[0248] If a determination is made that the two sequences are the
same, the process 200 moves to a state 214 wherein the name of the
sequence from the database is displayed to the user. This state
notifies the user that the sequence with the displayed name
fulfills the homology constraints that were entered. Once the name
of the stored sequence is displayed to the user, the process 200
moves to a decision state 218 wherein a determination is made
whether more sequences exist in the database. If no more sequences
exist in the database, then the process 200 terminates at an end
state 220. However, if more sequences do exist in the database,
then the process 200 moves to a state 224 wherein a pointer is
moved to the next sequence in the database so that it can be
compared to the new sequence. In this manner, the new sequence is
aligned and compared with every sequence in the database.
[0249] It should be noted that if a determination had been made at
the decision state 212 that the sequences were not homologous, then
the process 200 would move immediately to the decision state 218 in
order to determine if any other sequences were available in the
database for comparison.
[0250] Accordingly, one aspect of the invention is a computer
system comprising a processor, a data storage device having stored
thereon a nucleic acid sequence as set forth in SEQ ID NO:1, and
sequences substantially identical thereto, or a polypeptide
sequence as set forth in SEQ ID NO:2, and sequences substantially
identical thereto, a data storage device having retrievably stored
thereon reference nucleotide sequences or polypeptide sequences to
be compared to a nucleic acid sequence as set forth in SEQ ID NO:,
and sequences substantially identical thereto, or a polypeptide
sequence as set forth in SEQ ID NO:2, and sequences substantially
identical thereto, and a sequence comparer for conducting the
comparison. The sequence comparer may indicate a homology level
between the sequences compared or identify structural motifs in the
above described nucleic acid code of SEQ ID NO:1, and sequences
substantially identical thereto, or a polypeptide sequence as set
forth in SEQ ID NO:2, and sequences substantially identical
thereto, or it may identify structural motifs in sequences which
are compared to these nucleic acid codes and polypeptide codes. In
some embodiments, the data storage device may have stored thereon
the sequences of at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of
the nucleic acid sequences as set forth in SEQ ID NO:1, and
sequences substantially identical thereto, or the polypeptide
sequences as set forth in SEQ ID NO:2, and sequences substantially
identical thereto.
[0251] Another aspect of the invention is a method for determining
the level of homology between a nucleic acid sequence as set forth
in SEQ ID NO:1, and sequences substantially identical thereto, or a
polypeptide sequence as set forth in SEQ ID NO:2, and sequences
substantially identical thereto, and a reference nucleotide
sequence. The method including reading the nucleic acid code or the
polypeptide code and the reference nucleotide or polypeptide
sequence through the use of a computer program which determines
homology levels and determining homology between the nucleic acid
code or polypeptide code and the reference nucleotide or
polypeptide sequence with the computer program. The computer
program may be any of a number of computer programs for determining
homology levels, including those specifically enumerated herein,
(e.g. BLAST2N with the default parameters or with any modified
parameters). The method may be implemented using the computer
systems described above. The method may also be performed by
reading at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of the
above described nucleic acid sequences as set forth in SEQ ID NO:1,
or the polypeptide sequences as set forth in SEQ ID NO:2 through
use of the computer program and determining homology between the
nucleic acid codes or polypeptide codes and reference nucleotide
sequences or polypeptide sequences.
[0252] FIG. 3 is a flow diagram illustrating one embodiment of a
process 250 in a computer for determining whether two sequences are
homologous. The process 250 begins at a start state 252 and then
moves to a state 254 wherein a first sequence to be compared is
stored to a memory. The second sequence to be compared is then
stored to a memory at a state 256. The process 250 then moves to a
state 260 wherein the first character in the first sequence is read
and then to a state 262 wherein the first character of the second
sequence is read. It should be understood that if the sequence is a
nucleotide sequence, then the character would normally be either A,
T, C, G or U. If the sequence is a protein sequence, then it is
preferably in the single letter amino acid code so that the first
and sequence sequences can be easily compared.
[0253] A determination is then made at a decision state 264 whether
the two characters are the same. If they are the same, then the
process 250 moves to a state 268 wherein the next characters in the
first and second sequences are read. A determination is then made
whether the next characters are the same. If they are, then the
process 250 continues this loop until two characters are not the
same. If a determination is made that the next two characters are
not the same, the process 250 moves to a decision state 274 to
determine whether there are any more characters either sequence to
read.
[0254] If there are not any more characters to read, then the
process 250 moves to a state 276 wherein the level of homology
between the first and second sequences is displayed to the user.
The level of homology is determined by calculating the proportion
of characters between the sequences that were the same out of the
total number of sequences in the first sequence. Thus, if every
character in a first 100 nucleotide sequence aligned with a every
character in a second sequence, the homology level would be
100%.
[0255] Alternatively, the computer program may be a computer
program which compares the nucleotide sequences of a nucleic acid
sequence as set forth in the invention, to one or more reference
nucleotide sequences in order to determine whether the nucleic acid
code of SEQ ID NO:1, and sequences substantially identical thereto,
differs from a reference nucleic acid sequence at one or more
positions. Optionally such a program records the length and
identity of inserted, deleted or substituted nucleotides with
respect to the sequence of either the reference polynucleotide or a
nucleic acid sequence as set forth in SEQ ID NO:1, and sequences
substantially identical thereto. In one embodiment, the computer
program may be a program which determines whether a nucleic acid
sequence as set forth in SEQ ID NO:1, and sequences substantially
identical thereto, contains a single nucleotide polymorphism (SNP)
with respect to a reference nucleotide sequence.
[0256] Accordingly, another aspect of the invention is a method for
determining whether a nucleic acid sequence as set forth in SEQ ID
NO:1, and sequences substantially identical thereto, differs at one
or more nucleotides from a reference nucleotide sequence comprising
the steps of reading the nucleic acid code and the reference
nucleotide sequence through use of a computer program which
identifies differences between nucleic acid sequences and
identifying differences between the nucleic acid code and the
reference nucleotide sequence with the computer program. In some
embodiments, the computer program is a program which identifies
single nucleotide polymorphisms. The method may be implemented by
the computer systems described above and the method illustrated in
FIG. 3. The method may also be performed by reading at least 2, 5,
10, 15, 20, 25, 30, or 40 or more of the nucleic acid sequences as
set forth in SEQ ID NO:1, and sequences substantially identical
thereto, and the reference nucleotide sequences through the use of
the computer program and identifying differences between the
nucleic acid codes and the reference nucleotide sequences with the
computer program.
[0257] In other embodiments the computer based system may further
comprise an identifier for identifying features within a nucleic
acid sequence as set forth in SEQ ID NO:1 or a polypeptide sequence
as set forth in SEQ ID NO:2, and sequences substantially identical
thereto.
[0258] An "identifier" refers to one or more programs which
identifies certain features within a nucleic acid sequence as set
forth in SEQ ID NO:1, and sequences substantially identical
thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and
sequences substantially identical thereto. In one embodiment, the
identifier may comprise a program which identifies an open reading
frame in a nucleic acid sequence as set forth in SEQ ID NO:1, and
sequences substantially identical thereto.
[0259] FIG. 5 is a flow diagram illustrating one embodiment of an
identifier process 300 for detecting the presence of a feature in a
sequence. The process 300 begins at a start state 302 and then
moves to a state 304 wherein a first sequence that is to be checked
for features is stored to a memory 115 in the computer system 100.
The process 300 then moves to a state 306 wherein a database of
sequence features is opened. Such a database would include a list
of each feature's attributes along with the name of the feature.
For example, a feature name could be "Initiation Codon" and the
attribute would be "ATG". Another example would be the feature name
"TAATAA Box" and the feature attribute would be "TAATAA". An
example of such a database is produced by the University of
Wisconsin Genetics Computer Group (www.gcg.com). Alternatively, the
features may be structural polypeptide motifs such as alpha
helices, beta sheets, or functional polypeptide motifs such as
enzymatic active sites, helix-turn-helix motifs or other motifs
known to those skilled in the art.
[0260] Once the database of features is opened at the state 306,
the process 300 moves to a state 308 wherein the first feature is
read from the database. A comparison of the attribute of the first
feature with the first sequence is then made at a state 310. A
determination is then made at a decision state 316 whether the
attribute of the feature was found in the first sequence. If the
attribute was found, then the process 300 moves to a state 318
wherein the name of the found feature is displayed to the user.
[0261] The process 300 then moves to a decision state 320 wherein a
determination is made whether move features exist in the database.
If no more features do exist, then the process 300 terminates at an
end state 324. However, if more features do exist in the database,
then the process 300 reads the next sequence feature at a state 326
and loops back to the state 310 wherein the attribute of the next
feature is compared against the first sequence.
[0262] It should be noted, that if the feature attribute is not
found in the first sequence at the decision state 316, the process
300 moves directly to the decision state 320 in order to determine
if any more features exist in the database.
[0263] Accordingly, another aspect of the invention is a method of
identifying a feature within a nucleic acid sequence as set forth
in SEQ ID NO:1, and sequences substantially identical thereto, or a
polypeptide sequence as set forth in SEQ ID NO:2, and sequences
substantially identical thereto, comprising reading the nucleic
acid code(s) or polypeptide code(s) through the use of a computer
program which identifies features therein and identifying features
within the nucleic acid code(s) with the computer program. In one
embodiment, computer program comprises a computer program which
identifies open reading frames. The method may be performed by
reading a single sequence or at least 2, 5, 10, 15, 20, 25, 30, or
40 of the nucleic acid sequences as set forth in SEQ ID NO:1, and
sequences substantially identical thereto, or the polypeptide
sequences as set forth in SEQ ID NO:2, and sequences substantially
identical thereto, through the use of the computer program and
identifying features within the nucleic acid codes or polypeptide
codes with the computer program.
[0264] A nucleic acid sequence as set forth in SEQ ID NO:1, and
sequences substantially identical thereto, or a polypeptide
sequence as set forth in SEQ ID NO:2, and sequences substantially
identical thereto, may be stored and manipulated in a variety of
data processor programs in a variety of formats. For example, a
nucleic acid sequence as set forth in SEQ ID NO:1, and sequences
substantially identical thereto, or a polypeptide sequence as set
forth in SEQ ID NO:2, and sequences substantially identical
thereto, may be stored as text in a word processing file, such as
MicrosoftWORD or WORDPERFECT or as an ASCII file in a variety of
database programs familiar to those of skill in the art, such as
DB2, SYBASE, or ORACLE. In addition, many computer programs and
databases may be used as sequence comparison algorithms,
identifiers, or sources of reference nucleotide sequences or
polypeptide sequences to be compared to a nucleic acid sequence as
set forth in SEQ ID NO:1, and sequences substantially identical
thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and
sequences substantially identical thereto. The following list is
intended not to limit the invention but to provide guidance to
programs and databases which are useful with the nucleic acid
sequences as set forth in SEQ ID NO:1, and sequences substantially
identical thereto, or the polypeptide sequences as set forth in SEQ
ID NO:2, and sequences substantially identical thereto.
[0265] The programs and databases which may be used include, but
are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular
Applications Group), GeneMine (Molecular Applications Group), Look
(Molecular Applications Group), MacLook (Molecular Applications
Group), BLAST and BLAST2 (NCBI), BLASTN and BLASTX (Altschul et al,
J. Mol. Biol. 215: 403, 1990), FASTA (Pearson and Lipman, Proc.
Natl. Acad. Sci. USA, 85: 2444, 1988), FASTDB (Brutlag et al. Comp.
App. Biosci. 6:237-245, 1990), Catalyst (Molecular Simulations
Inc.), Catalyst/SHAPE (Molecular Simulations Inc.),
Cerius.sup.2.DBAccess (Molecular Simulations Inc.), HypoGen
(Molecular Simulations Inc.), Insight II, (Molecular Simulations
Inc.), Discover (Molecular Simulations Inc.), CHARMm (Molecular
Simulations Inc.), Felix (Molecular Simulations Inc.), DelPhi,
(Molecular Simulations Inc.), QuanteMM, (Molecular Simulations
Inc.), Homology (Molecular Simulations Inc.), Modeler (Molecular
Simulations Inc.), ISIS (Molecular Simulations Inc.),
Quanta/Protein Design (Molecular Simulations Inc.), WebLab
(Molecular Simulations Inc.), WebLab Diversity Explorer (Molecular
Simulations Inc.), Gene Explorer (Molecular Simulations Inc.),
SeqFold (Molecular Simulations Inc.), the MDL Available Chemicals
Directory database, the MDL Drug Data Report data base, the
Comprehensive Medicinal Chemistry database, Derwent's World Drug
Index database, the BioByteMasterFile database, the Genbank
database, and the Genseqn database. Many other programs and data
bases would be apparent to one of skill in the art given the
present disclosure.
[0266] Motifs which may be detected using the above programs
include sequences encoding leucine zippers, helix-turn-helix
motifs, glycosylation sites, ubiquitination sites, alpha helices,
and beta sheets, signal sequences encoding signal peptides which
direct the secretion of the encoded proteins, sequences implicated
in transcription regulation such as homeoboxes, acidic stretches,
enzymatic active sites, substrate binding sites, and enzymatic
cleavage sites.
[0267] The present invention exploits the unique catalytic
properties of enzymes. Whereas the use of biocatalysts (i.e.,
purified or crude enzymes, non-living or living cells) in chemical
transformations normally requires the identification of a
particular biocatalyst that reacts with a specific starting
compound, the present invention uses selected biocatalysts and
reaction conditions that are specific for functional groups that
are present in many starting compounds, such as small molecules.
Each biocatalyst is specific for one functional group, or several
related functional groups, and can react with many starting
compounds containing this functional group.
[0268] The biocatalytic reactions produce a population of
derivatives from a single starting compound. These derivatives can
be subjected to another round of biocatalytic reactions to produce
a second population of derivative compounds. Thousands of
variations of the original small molecule or compound can be
produced with each iteration of biocatalytic derivatization.
[0269] Enzymes react at specific sites of a starting compound
without affecting the rest of the molecule, a process which is very
difficult to achieve using traditional chemical methods. This high
degree of biocatalytic specificity provides the means to identify a
single active compound within the library. The library is
characterized by the series of biocatalytic reactions used to
produce it, a so called "biosynthetic history". Screening the
library for biological activities and tracing the biosynthetic
history identifies the specific reaction sequence producing the
active compound. The reaction sequence is repeated and the
structure of the synthesized compound determined. This mode of
identification, unlike other synthesis and screening approaches,
does not require immobilization technologies, and compounds can be
synthesized and tested free in solution using virtually any type of
screening assay. It is important to note, that the high degree of
specificity of enzyme reactions on functional groups allows for the
"tracking" of specific enzymatic reactions that make up the
biocatalytically produced library.
[0270] Many of the procedural steps are performed using robotic
automation enabling the execution of many thousands of biocatalytic
reactions and screening assays per day as well as ensuring a high
level of accuracy and reproducibility. As a result, a library of
derivative compounds can be produced in a matter of weeks which
would take years to produce using current chemical methods.
[0271] In a particular embodiment, the invention provides a method
for modifying small molecules, comprising contacting a polypeptide
encoded by a polynucleotide described herein or enzymatically
active fragments thereof with a small molecule to produce a
modified small molecule. A library of modified small molecules is
tested to determine if a modified small molecule is present within
the library which exhibits a desired activity. A specific
biocatalytic reaction which produces the modified small molecule of
desired activity is identified by systematically eliminating each
of the biocatalytic reactions used to produce a portion of the
library, and then testing the small molecules produced in the
portion of the library for the presence or absence of the modified
small molecule with the desired activity. The specific biocatalytic
reactions which produce the modified small molecule of desired
activity is optionally repeated. The biocatalytic reactions are
conducted with a group of biocatalysts that react with distinct
structural moieties found within the structure of a small molecule,
each biocatalyst is specific for one structural moiety or a group
of related structural moieties; and each biocatalyst reacts with
many different small molecules which contain the distinct
structural moiety.
[0272] The invention will be further described with reference to
the following examples; however, it is to be understood that the
invention is not limited to such examples.
EXAMPLES
Example 1
[0273] Bacterial Expression and Purification of CMCase
[0274] A T. maritima genomic library was constructed in the Lambda
ZapII.RTM. cloning vector (Stratagene Cloning Systems), and mass
excision was performed according to the manufacturers protocol to
yield a gene library in the pBluescript cloning vector. The
pBluescript library was screened in SOLR E. Coli cells (Stratagene)
for CMCase activity and a positive clone was identified and
isolated. This clone was used to inoculate an overnight culture of
Luria Broth liquid medium as per Ausubel, F. M., et al., Short
Protocols in Molecular Biology 2d Ed., Harvard Medical School
(1992). The plasmid DNA was isolated from the overnight culture
using an alkaline lysis mini-prep protocol as per Maniatis, T., et
al., Molecular Cloning, Cold Spring Harbor Press, New York (1982).
Mini-prep DNA was then used to transform competent E. coli cells,
XL1 blue (Stratagene) according to the manufacturer's protocol. A
single clone was then used to innoculate a 100 ml overnight culture
of Luria Broth liquid medium and plasmid DNA was isolated from this
overnight using midi-prep procedure according to the manufacturer's
protocol (Qiagen). The midi-prep plasmid DNA was partially
sequenced with an ABI 377 and a putative open reading frame was
idnetified within the sequenced region. The sequence information
was used in the generation of primer sequences which were
subsequently used to PCR amplify the target gene encoding the
CMCase activity. The primer sequences used were as follows:
1 5' TTATTGCGGCCGCTTAAGGAGGAAAAATTATGGGTGTTGATCCTTTTGAA 3' (SEQ. ID
NO: 3) and 5' TTATTGGATCCGAAGGTTGAAACCAC- GCCATCT 3'. (SEQ. ID NO:
4)
[0275] The amplification product was subcloned into the pBluescript
II cloning vector (Stratagene). The plasmid clone was transformed
in to XL1 Blue cells again for verification. The plasmid clone
contains the DNA encoding the CMCase enzyme of the present
invention as shown in FIG. 1 and deposited as ATCC No. 97245.
[0276] A pBluescript II clone containing the DNA encoding the
enzyme of the present invention may be obtained from the ATCC, ATCC
Deposit No.97245. This pBluescript II clone containing the DNA of
the present invention is used to transform E. coli XL1 Blue cells
and the E. coli XL1 Blue cells are used to inoculate a 5 ml
overnight culture of Luria Broth liquid medium. The 5 ml culture
was aliquoted into 1 ml aliquots, and each aliquot was used to
innoculate 1 liter of 5.times. LB culture media. Cells were grown
overnight in five 2-liter shake flasks at 37.degree. C. Each one
liter cell culture pellet was resuspended in 150 ml of 25 mM Tris,
pH 8.0 and then spun at 4K rpm for 10 minutes at 4.degree. C. The
resulting pellet was resuspended in 5 ml of 25 mM Tris, pH 8.0, and
sonicated with a microsonicator tip 10 times at 30 second
intervals. The cell debris was spun out in a SS-34 rotor at 12K
rpms for 10 minutes at 4.degree. C. The resulting supernatant was
then brought up to 10% ethanol and incubated at 75.degree. C. for
20 minutes. The flocculated proteins were spun out in an SS-34
rotor at 10K rpms for 10 minutes at 4.degree. C. The resultant
supernatant was then filtered through a 0.22 micron filter and
applied to a weak anion exchange column (Poros, PI). The column was
eluted with a 250, 500, 800 mM NaCl step in a 10 mM Tris Base/10 mM
Bis Tris Propane buffer at pH 8.0 (anion buffer). The active CMCase
fraction came off at the 250 mM step. This fraction was then
diluted with the anion buffer to a concentration of 50 mM. It was
then applied to a strong anion exchange column (Poros, HQ) and the
column was eluted with a 10 column volume gradient from 50 to 250
mM NaCl using anion buffer. A one band fraction of a 35 kD
cellulose comes off in this gradient at approximately 150 mM
NaCl.
[0277] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described. On Aug.
29,1995, a deposit of biologically samples identified above were
made with the American Type Culture Collection (ATCC), having an
address at 10801 University Boulevard, Manassa, Va. 20110-2209,
U.S.A. The deposits were made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of viable cultures for a period of thirty (30) years from the date
of deposit and at least five (5) years after the most recent
request for the furnishing of a sample of the deposit by the
depository. The organisms will be made available by the ATCC under
the terms of the Budapest Treaty, which assures permanent and
unrestricted availability of the cultures to one determined by the
U.S. Commissioner of Patents and Trademarks to be entitled thereto
according to 35 USC .sctn.122 and the Commissioner's rules pursuant
thereto (including 37 CFR .sctn.1.12).
[0278] These deposits are provided merely as convenience to those
of skill in the art, and are not an admission that a deposit is
required under 35 USC .sctn.112. A license may be required to make,
use, or sell the deposited materials, and no such license is hereby
granted.
* * * * *
References