U.S. patent application number 10/045631 was filed with the patent office on 2003-03-06 for human kinesins and methods of producing and purifying human kinesins.
This patent application is currently assigned to Cytokinetics. Invention is credited to Beraud, Christophe, Ohashi, Cara, Sakowicz, Roman, Vaisberg, Eugeni, Wood, Ken, Yu, Ming.
Application Number | 20030044900 10/045631 |
Document ID | / |
Family ID | 23138473 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030044900 |
Kind Code |
A1 |
Beraud, Christophe ; et
al. |
March 6, 2003 |
Human kinesins and methods of producing and purifying human
kinesins
Abstract
Described herein are methods of producing kinesins. In a
preferred embodiment, the kinesins are produced from a prokaryote,
most preferably, a bacterial cell. Bacterial expression offers
several advantages over systems previously utilized, such as, for
example, Bacculovirus. The yield of protein is higher, the cost of
the expression setup is lower, and creation of alternative
expression vectors is easier. The concern of copurifying a
contaminating activity from the expression host is also eliminated
since bacteria, in contrast to the bacculovirus expresion system,
do not have kinesin like proteins. Also described herein are
purified kinesins, preferably unglycosylated and methods of
use.
Inventors: |
Beraud, Christophe; (San
Francisco, CA) ; Ohashi, Cara; (San Francisco,
CA) ; Sakowicz, Roman; (Foster City, CA) ;
Vaisberg, Eugeni; (Foster City, CA) ; Wood, Ken;
(Foster City, CA) ; Yu, Ming; (Foster City,
CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Cytokinetics
280 East Grand Avenue
South San Francisco
CA
94080
|
Family ID: |
23138473 |
Appl. No.: |
10/045631 |
Filed: |
October 19, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10045631 |
Oct 19, 2001 |
|
|
|
PCT/US00/10870 |
Apr 20, 2000 |
|
|
|
PCT/US00/10870 |
Apr 20, 2000 |
|
|
|
09295612 |
Apr 20, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/183; 435/194; 435/252.3; 435/320.1; 435/325 |
Current CPC
Class: |
C12N 9/14 20130101; Y10S
977/914 20130101 |
Class at
Publication: |
435/69.1 ;
435/183; 435/194; 435/320.1; 435/325; 435/252.3 |
International
Class: |
C12P 021/02; C12N
005/06; C12N 009/00; C12N 009/12 |
Claims
We claim:
1. A method of producing a human mitotic kinesin protein excluding
Kid comprising a motor domain comprising: expressing a nucleic acid
comprising a nucleic acid encoding a human mitotic kinesin protein
comprising a motor domain in a bacterial cell and substantially
purifying said human mitotic kinesin protein.
2. A method of producing a human kinesin protein comprising a motor
domain comprising: expressing a nucleic acid comprising a nucleic
acid encoding a human kinesin protein comprising a motor domain in
a bacterial cell and substantially purifying said human kinesin
protein, wherein said kinesin protein is selected from the group
consisting of chromokinesin, KSP, CENP-E, MKLP1, HSET, Kif15, Kin2,
Kif1A and MCAK.
3. A method of producing a human kinesin protein comprising a motor
domain and at least three epitope tags comprising: expressing a
nucleic acid encoding a human kinesin protein comprising a motor
domain in a bacterial cell and substantially purifying said human
kinesin protein.
4. The method of claim 3 wherein KHC is excluded.
5. A method of producing a kinesin protein comprising a motor
domain comprising: expressing a nucleic acid encoding a kinesin
protein comprising a motor domain in a bacterial cell and
substantially purifying said kinesin protein, wherein said kinesin
is selected from the group consisting of Kin2, chromokinesin, HSET,
Kif15, Kif1A, BimC and MKLP1.
6. A substantially pure unglycosylated human mitotic kinesin
protein excluding kid comprising a motor domain.
7. A substantially pure unglycosylated human mitotic kinesin
protein, wherein said kinesin protein is selected from the group
consisting of chromokinesin, KSP, CENP-E, MKLP1, HSET, Kif15, Kin2,
Kif1A and MCAK.
8. A substantially pure unglycosylated human kinesin protein
comprising a motor domain and at least three epitope tags.
9. A substantially pure unglycosylated kinesin protein comprising a
motor domain, wherein said kinesin is selected from the group
consisting of Kin2, chromokinesin, BimC, HSET, Kif15, Kif1A and
MKLP1.
10. A bacterial cell comprising a nucleic acid comprising a nucleic
acid encoding a kinesin selected from the group consisting of
chromokinesin, BimC, HSET, Kif15, Kin2, and Kif1A.
11. A bacterial cell comprising a nucleic acid comprising a nucleic
acid encoding a human kinesin selected from the group consisting of
chromokinesin, Kin2, BimC, Kif1A, KSP, CENP-E, MCAK, HSET and
Kif15.
12. An assay to identify a candidate agent which binds to a kinesin
protein of claim 6, 7, 8, or 9 comprising: combining a candidate
agent with a kinesin protein of claim 6, 7, 8, or 9 and determining
whether binding occurs.
13. An assay to identify a modulator of a kinesin protein of claim
6, 7, 8, or 9 comprising: detecting activity of a kinesin protein
of claim 6, 7, 8, or 9 in the presence and absence of a candidate
agent wherein a change in activity indicates a modulator.
14. The assay of claim 13 wherein said activity is ATPase activity
and/or microtubule binding or gliding.
15. A substantially purified unglycosylated peptide selected from
the group consisting of K335, Q475, D679, FL1, P166, H195, FL2,
E433, R494, E658, L360, K491, S553, M329, T340, S405, V465, T488,
M1, M2, M3, M4, M5, M6, FL3, A2N370, A2M511, K519, E152.2, Q151.2,
Q353 and M472.
Description
FIELD OF THE INVENTION
[0001] This invention relates to the production and purification of
human kinesins, preferably functional, using prokaryotic systems
and to human kinesins isolated from bacterial systems.
BACKGROUND OF THE INVENTION
[0002] Cancer is the second-leading cause of death in
industrialized nations. Effective therapeutics include the taxanes
and vinca alkyloids, agents which act on microtubules. Microtubules
are the primary structural element of the mitotic spindle. The
mitotic spindle is responsible for distribution of replicate copies
of the genome to each of the two daughter cells that result from
cell division. It is presumed that it is the disruption of the
mitotic spindle by these drugs that results in inhibition of cancer
cell division, and also induction of cancer cell death. However,
microtubules also form other types of cellular structures,
including tracks for intracellular transport in nerve processes.
Therefore, the taxanes have side effects that limit their
usefulness.
[0003] Mitotic kinesins are enzymes essential for assembly and
function of the mitotic spindle, but are not generally part of
other microtubule structures, such as nerve processes. Mitotic
kinesins play essential roles during all phases of mitosis. These
enzymes are "molecular motors" that translate energy released by
hydrolysis of ATP into mechanical force which drives the
directional movement of cellular cargoes along microtubules. The
catalytic domain sufficient for this task is a compact structure of
approximately 340 amino acids. During mitosis, kinesins organize
microtubules into the bipolar structure that is the mitotic
spindle. Kinesins mediate movement of chromosomes along spindle
microtubules, as well as structural changes in the mitotic spindle
associated with specific phases of mitosis. Experimental
perturbation of mitotic kinesin function causes malformation or
dysfunction of the mitotic spindle, frequently resulting in cell
cycle arrest. From both the biological and enzymatic perspectives,
these enzymes are attractive targets for the discovery and
development of novel anti-mitotic chemotherapeutics.
[0004] A number of kinesins have been described in the art.
However, there still exists a need for kinesins which can be easily
produced in large quantities. In particular, human mitotic kinesins
isolated and purified from a bacterial source are desirable.
[0005] Among the kinesins which have been identified is
chromokinesin. Chromokinesin is a kinesin localized to mitotic
chromatin and contributes to prometaphase chromosome alignment; it
is expressed primarily in proliferating tissues and is enriched in
mitotic compared to interphase cells. Perturbation of a Xenopus
chromokinesin causes gross defects in mitotic spindle formation,
including dissociation of chromosomes from spindle microtubules,
multipolar spindles, misaligned chromosomes and failure of
cytokinesis. Cloning of chicken (Wang and Adler, J. Cell Biol.,
128:761-8 (1995)) and human (Oh, et al., direct GenBank submission
without corresponding publication, submitted Jun. 11, 1998 by
Molecular Biology, Institute for Medical Sciences, San5 Wonchon
Paldal, Suwon, Kyongki 442-749, Korea) chromokinesin homologs have
been reported. The mouse homolog of chromokinesin, Kif4, has been
expressed in Sf9 cells (bacculovirus vector) and has been reported
to have motility and ATPase activity (Sekine, et al., J. Cell
Biol., 127-187-201 (1994)). This same study speculated that Kif4
may participate in the transport of membraneous organelles in
neuronal and other cell types.
[0006] Another kinesin reported to be associated with chromosomes
is Kid. Kid is reported as unrelated to other known kinesins. The
C-terminal 260 amino acids of Kid expressed in bacteria and
purified reportedly binds directly to DNA in vitro. The same study
reported that when fused to a transcriptional activation domain and
co-transfected into mammalian cells with a reporter construct this
domain can stimulate expression from the promoter on the
co-transfected construct in living cells. Tokai, et al., EMBO J.,
15(3):457-467 (1996). This study further reports that the
amino-terminal 470 amino acids of Kid, which includes the motor
domain, has been expressed in bacteria fused to
glutathione-S-transferase, binds to microtubues and exhibits
microtubule-stimulated ATPase activity. Kid is expressed in all
human cell lines that have been examined, and is most abundant in
adult human speen, thymus and testis as well as fetal liver and
kidney. In cultured human cells, Kid is reportedly found associated
with chromatin throughout mitosis, showing some enrichment at
kinetochores.
[0007] Another mitotic kinesin of interest is MKLP1 which localizes
to microtubules of the spindle midzone throughout mitosis. In vitro
MKLP1 can slide antiparallel microtubules relative to each other.
Microinjection of antibody directed against MKLP1 into mammalian
cells induces mitotic arrest with subtle defects in microtubule
organization. Genetic data from both Drosophila and C. elegans
clearly show that MKLP1 homologues are required for organization of
the interzonal microtubules of the anaphase spindle and for
formation of a functional contractile ring. MKLP1 associates with a
kinase of the polo family in both Drosophila and mammals. Cloning
of human (Nislow, et al., Nature, 359:543-7 (1992)), hamster
(Kuriyama, et al., J. Cell Sci., 107(Pt 12):3485-99 (1994)),
Drosophila (Adams, et al., Gene Dev., 12:1483-94 (1998)), and C.
elegans (Raich, et al., Mol. Biol. Cell, 9:2037-49 (1998)) homologs
of MKLP1 have been reported. Nislow, et al., supra, reported on
expressed full-length human MKLP1 in bacteria, however there was
relatively poor expression, and the polypeptide was not purified.
Using this crude bacterial lysate, microtubule bundling and sliding
activity were reported on. Kuriyama, et al., supra, reported on
expressed hamster MKLP1 in Sf9 cells (baculovirus vector), but the
protein was not purified.
[0008] KSP is also of interest. KSP belongs to an evolutionarily
conserved kinesin subfamily of plus end-directed microtubule motors
that assemble into bipolar homotetramers consisting of antiparallel
homodimers. During mitosis KSP associates with microtubules of the
mitotic spindle. Microinjection of antibody directed against KSP
into human cells prevents spindle pole separation during
prometaphase, giving rise to monopolar spindles and causing mitotic
arrest. KSP and related kinesins bundle antiparallel microtubules
and slide them relative to one another, thus forcing the two
spindle poles apart. KSP may also mediate in anaphase B spindle
elongation and focussing of microtubules at the spindle pole.
Cloning of human (Blangy, et al., Cell, 83:1159-69 (1995);
Whitehead, et al., direct GenBank submission without corresponding
publication, submitted Sep. 29, 1995 by Medical Biochemistry,
University of Calgary, 3330 Hospital Dr. NW, Calgary, Alberta TN
4N1, Canada), Drosophila (Heck, et al., J Cell Biol, 123:665-79
(1993)) and Xenopus (Le Guellec, et al., Mol. Cell Biol., 11
(6):3395-8 (1991)) homologs of KSP have been reported. Drosophila
KLP61 F/KRP130 has reportedly been purified in native form (Cole,
et al., J. Biol. Chem., 269(37):22913-6 (1994)), expressed in E.
coli, (Barton, et al., Mol. Biol. Cell, 6:1563-74 (1995)) and
reported to have motility and ATPase activities (Cole, et al.,
supra; Barton, et al., supra). Xenopus Eg5 was expressed in E. coli
and reported to possess motility activity (Sawin, et al., Nature,
359:540-3 (1992); Lockhart and Cross, Biochemistry, 35(7):2365-73
(1996); Crevel, et al, J. Mol. Biol., 273:160-170 (1997) and ATPase
activity (Lockhart and Cross, supra; Crevel et al., supra).
[0009] CENP-E, also of interest, is a plus end-directed microtubule
motor essential for achieving metaphase chromosome alignment.
CENP-E accumulates during interphase and is degraded following
completion of mitosis. Microinjection of antibody directed against
CENP-E or overexpression of a dominant negative mutant of CENP-E
causes mitotic arrest with prometaphase chromosomes scattered on a
bipolar spindle. The tail domain of CENP-E mediates localization to
kinetochores and also interacts with the mitotic checkpoint kinase
hBubR1. CENP-E also associates with active forms of MAP kinase.
Cloning of human (Yen, et al., Nature, 359(6395):536-9 (1992))
CENP-E has been reported. In Thrower, et al., EMBO J., 14:918-26
(1995) partially purified native human CENP-E was reported on.
Moreover, the study reported that CENP-E was a minus end-directed
microtubule motor. Wood, et al., Cell, 91:357-66 (1997)) discloses
expressed Xenopus CENP-E in E. coli and that XCENP-E has motility
as a plus end directed motor in vitro.
[0010] The kinesin MCAK has also been identified. During anaphase A
disjoined sister chromatids migrate poleward. This poleward
movement is driven by kinetochores and is accompanied by the
depolymerization of microtubules attached to the migrating
chromatids. The kinesin MCAK plays an important role in this
motility and may promote disassembly of microtubules attached to
kinetochores. MCAK localizes to kinetochores of mitotic
chromosomes. MCAK belongs to small and unique subfamily of kinesins
(Kin I) that destabilize microtubule ends. Overexpression of a
dominant negative MCAK mutant or antisense inhibition of MCAK
expression causes chromosomes to lag during anaphase. Genes for the
Xenopus (Walczak, et al., Cell, 84:37-47 (1996), hamster (Wordeman
and Mitchison, J. Cell Biol., 128:95-104 (1995) and human (Kim, et
al., Biochim. Biophys. Acta., 1359:181-6 (1997)) homologs of MCAK
have been cloned and characterized. Kim, et al., supra, also
described mRNA expression patterns of the endogenous gene in human
cells and tissues, but did not describe exogenous expression.
[0011] Other mitotic kinesins of interest include HSET and Kif15.
However, it is understood, as described above, all kinesins are of
interest.
[0012] The kinesin superfamily further encompasses a number of
families that exhibit non-mitotic motor functions, e.g., vesicle
and organelle transport. These proteins are ATP dependent, and have
plus end-directed microtubule motor activity involved in fast
anterograde organelle transport in neurons. Anterograde transport
is a directional transport, typically of mitochondria, other
organelles and vesicles, from the cell body to the tip of the axon.
Moreover, some non-mitotic kinesins are involved in "slow"
transport.
[0013] Among the kinesins associated with neurons is the Kif2
family of kinesins. Cloning of mouse (Aizawa, et al., Genes Dev.,
12:1483-94 (1992)), Xenopus (Walczak, et al., supra), and human
(Debemardi, et al., Genomics, 42:67-73 (1997)) Kin2 homologs have
been reported. Mouse Kif2 (Noda, et al., J. Cell iol., 129:157-67
(1995)) was reportedly expressed in Sf9 cells (bacculovirus vector)
and was reported to have motility activity. Xenopus Kif2 (Desai, et
al., Cell, 96:69-78 (1999)) was expressed in Sf9 cells
(bacculovirus vector) and microtubule depolymerization activity was
reported.
[0014] Cloning of human Kif1A (ATSV) has been reported (Furlong, et
al., Genomics, 33(3):421-29 (1996)). The mouse homolog was
expressed in bacculovirus and characterized biochemically (Okada,
et al., Cell, 81:769-80 (1995)), and a mouse Kif1/KHC hybrid
(formed for stability) was also expressed in E. coli and reportedly
had activity in a motility assay (Okada and Hirokawa, Science,
283:1152-7 (1999)).
[0015] The human form of KHC (Kinesin Heavy Chain) has been cloned
(Navone, et al., J. Cell Biol, 117:1263-75 (1992)). Fujiwara, et
al., Biophys J., 69:1563-8 (1995) reportedly expressed human KHC
fragment 1-349 in E. coli and conducted structural studies on the
purified protein. Vale, et al., Nature, 380:451-3 (1996) reportedly
expressed human KHC fragment 1-560 in E. coli and purified it by
phosphocellulose and Mono-Q chromatography. KHC additionally
reportedly had motility activity.
[0016] Functional studies of enzymes, including but not limited to
high-throughput screening for small molecule inhibitors, require
significant amounts of active protein. Therefore, it is an object
of this invention to provide systems to express kinesins in high
quantities. It is further an object of this invention to provide
methods for expression and purification of kinesins. It is further
an object to provide kinesins which are unglycosylated.
SUMMARY OF THE INVENTION
[0017] Accordingly, the present invention provides kinesins which
are produced from prokaryotes. In a preferred embodiment, bacterial
systems are utilized. Bacterial expression provides the most
economical means of obtaining substantial quantities of kinesins
without a concern for copurifying a contaminating activity from the
expression host since bacteria do not harbor kinesin like
proteins.
[0018] In one aspect, the invention provides a method of producing
a human mitotic kinesin protein comprising a motor domain. The
method comprises expressing a nucleic acid comprising a nucleic
acid encoding a human mitotic kinesin protein comprising a motor
domain in a bacterial cell and substantially purifying said human
mitotic kinesin protein.
[0019] In another aspect, a method is provided for producing a
human kinesin protein comprising a motor domain and at least two
epitope tags. The method comprises expressing a nucleic acid
encoding a human kinesin protein comprising a motor domain and at
least two epitope tags in a prokaryote and substantially purifying
said human kinesin protein.
[0020] In a further aspect, a method is provided for producing a
kinesin protein comprising a motor domain. The method comprises
expressing a nucleic acid encoding a kinesin protein comprising a
motor domain in a prokaryote and substantially purifying said
kinesin protein, wherein said kinesin is selected from the group
consisting of Kin2, chromokinesin, Kif1 A and MKLP1. It is
understood that unless a particular species is named, the term
"kinesin" includes homologs thereof which may have different
nomenclature among species. For example, the human homolog of Kif1A
is termed ATSV, the human homologue of Xenopus Eg5 is termed KSP,
and human HSET corresponds to Chinese hamster CHO2.
[0021] Also provided herein is a substantially pure unglycosylated
human mitotic kinesin protein comprising a motor domain. A
substantially pure unglycosylated human kinesin protein comprising
a motor domain and at least two epitope tags is also provided.
Additionally, a substantially pure unglycosylated kinesin protein
comprising a motor domain, wherein said kinesin is selected from
the group consisting of Kin2, chromokinesin, Kif1A and MKLP1 is
provided.
[0022] In one embodiment a prokaryote comprising a nucleic acid
comprising a nucleic acid encoding a kinesin selected from the
group consisting of chromokinesin, Kin2, and Kif1A is provided. In
a further embodiment, a prokaryote comprising a nucleic acid
comprising a nucleic acid encoding a human kinesin selected from
the group consisting of chromokinesin, Kin2, Kif1A, KSP, CENP-E,
MCAK, HSET and Kif15 is provided.
[0023] The proteins provided herein can be used in assays provided
herein to determine binding properties and modulators of biological
activity.
[0024] In a further embodiment, provided herein is a substantially
purified unglycosylated peptide selected from the group consisting
of K335, Q475, D679, FL1, P166, H195, FL2, E433, R494, E658, L360,
K491, S553, M329, T340, S405, V465, T488, M1, M2, M3, M4, M5, M6,
FL3, A2N370, A2M511, K519, E152.2, Q151.2, Q353 and M472.
DETAILED DESCRIPTION OF THE INVENTION
[0025] In accordance with the objects of this invention, methods of
producing kinesins are provided herein. In a preferred embodiment,
the kinesins are produced from a prokaryote. In a preferred
embodiment, the prokaryote is a bacterial cell. Bacterial
expression offers several advantages over systems previously
utilized, such as, for example, Bacculovirus. The yield of protein
is higher, the cost of the expression setup is lower, and creation
of alternative expression vectors is easier. The concern of
copurifying a contaminating activity from the expression host is
also eliminated since bacteria, in contrast to the bacculovirus
expression system, do not have kinesin like proteins.
[0026] Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5772 (ATCC 53,635). Preferred bacterial strains
include E. coli BL21 (DE3), BL21 (DE3), pLysS, BL21 (DE3)
pLysE.
[0027] The kinesins that are produced by the methods herein each
comprise a molecular motor domain. Therefore, in one embodiment the
kinesin is a full length protein. In another embodiment the kinesin
is a kinesin protein comprising a molecular motor domain. A
molecular motor protein is a cytoskeletal molecule that utilizes
chemical energy to produce mechanical force, and drives the motile
properties of the cytoskeleton. The molecular motor domain is
usually about 35-45% identical among all kinesin superfamily
members, and is approximately 340 amino acids. Vale and Kreis,
1993, GUIDEBOOK TO THE CYTOSKELETAL AND MOTOR PROTEINS New York:
Oxford University Press; Goldstein, 1993, Ann. Rev. Genetics 27:
319-351; Mooseker and Cheney, 1995, Annu. Rev. Cell Biol. 11:
633-675; Burridge et al., 1996, Ann. Rev. Cell Dev. Biol. 12:
463-519.
[0028] In one embodiment, the kinesin can be from any species.
Thus, unless otherwise specified, kinesin includes homologs
thereof. The kinesins therefore include those from Xenopus,
Drosophila and other insects, plants, fungi and mammalian cells,
with rodents (mice, rats, hamsters, guinea pigs and gerbils being
preferred), primates and humans being preferred. In a preferred
embodiment, the kinesin is selected from the group consisting of
chromokinesin, Kin2, Kif1A, and MKLP1. Preferably Kif1A is
expressed as an individual kinesin, i.e., it excludes fusion forms
to other kinesins.
[0029] In another embodiment, the kinesin is a human kinesin. In a
preferred embodiment, the human kinesin is selected from the group
consisting of chromokinesin, Kin2, Kif1A, MKLP1, KSP, CENP-E, MCAK,
KHC, HSET and Kif15.
[0030] In one embodiment, the kinesin protein is a mitotic kinesin
protein. In one embodiment, the mitotic kinesin protein is selected
from the group consisting of chromokinesin, MKLP1, KSP, CENP-E and
MCAK. In a preferred embodiment, the mitotic kinesin protein is a
human mitotic kinesin protein.
[0031] In another embodiment, the kinesin protein is a non-mitotic
kinesin protein. In a preferred embodiment, the non-mitotic kinesin
protein is selected from the group consisting of KHC, Kin2 and
Kif1A. In a preferred embodiment, the non-mitotic kinesin protein
is a human non-mitotic kinesin protein.
[0032] In a particularly preferred embodiment, the human kinesin
protein is selected from the group consisting of chromokinesin,
KSP, CENP-E, MCAK, Kin2 and Kif1A. In another particularly
preferred embodiment, the kinesin protein is selected from the
group consisting of chromokinesin, Kif1A, MKLP1 and Kin2, with
chromokinesin and Kin2 being most preferred. It is understood that
the groups provided herein necessarily describe groups or
individuals within them. For example, the group consisting of KSP,
CENP-E, MCAK, Kin2 and Kif1A describes a group consisting of KSP,
CENP-E, MCAK and Kin2, or CENP-E as an individual kinesin protein,
etc.
[0033] In another embodiment, the kinesin protein is a peptide
selected from the group consisting of K335, Q475, D679, FL1, P166,
H195, FL2, E433, R494, E658, L360, K491, S553, M329, T340, S405,
V465, T488, M1, M2, M3, M4, M5, M6, FL3, A2N370, A2M511, K519,
E152.2, Q151.2, Q353 and M472. Similarly, it is understood that
this group explicitly includes the group of M1, M2, and M6 or K335
and K491, etc.
[0034] In one embodiment, the kinesin proteins provided herein have
glycosylation patterns which differs from their native form. In a
preferred embodiment, the kinesin proteins provided herein are
unglycosylated. In a preferred embodiment, the kinesin proteins are
expressed in prokaryotes, preferably bacteria, and most preferably
E. coli, and are thus unglycosylated. However, it is understood
that at least in one embodiment an altered native glycosylation
pattern can be obtained by a variety of techniques. Removal of
carbohydrate moieties present on the kinesin protein may further be
accomplished chemically or enzymatically or by mutational
substitution of codons encoding for amino acid residues that serve
as targets for glycosylation. Chemical deglycosylation techniques
are known in the art and described, for instance, by Hakimuddin, et
al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al.,
Anal. Biochem., 118:131 (1981). Enzymatic cleavage of carbohydrate
moieties on polypeptides can be achieved by the use of a variety of
endo-and exo-glycosidases as described by Thotakura et al., Meth.
Enzymol., 138:350 (1987).
[0035] In another aspect, the kinesins provided herein may have
phosphorylation or farnesylation patterns which differ from their
native form. In one embodiment, a kinesin is provided which
substantially lacks phosphorylation, farneslation and
glycosylation.
[0036] In one embodiment provided herein, the kinesin protein has
at least one and preferably at least two epitope tags. An example
of such a chimeric molecule comprises a kinesin protein fused to an
epitope tag sequence or a Fc region of an immunoglobulin. The term
"epitope tagged" when used herein refers to a chimeric polypeptide
comprising a kinesin protein fused to a "tag polypeptide". The tag
polypeptide has enough residues to provide an epitope against which
an antibody can be made, yet is short enough such that it does not
interfere with activity of the polypeptide to which it is fused.
The tag polypeptide preferably also is fairly unique so that the
antibody does not substantially cross-react with other epitopes.
Suitable tag polypeptides generally have at least five amino acid
residues and usually between about 8 and 50 amino acid residues
(preferably, between about 6 and 20 amino acid residues). In one
embodiment, such a chimeric molecule comprises a fusion of the
kinesin protein with a tag polypeptide which provides an epitope to
which an anti-tag antibody can selectively bind. The epitope tag is
generally placed at the amino- or carboxyl-terminus of the kinesin
protein. The presence of such epitope-tagged forms of the kinesin
protein can be detected using an antibody against the tag
polypeptide. Also, provision of the epitope tag enables the kinesin
protein to be readily purified by affinity purification using an
anti-tag antibody or another type of affinity matrix that binds to
the epitope tag.
[0037] Various tag polypeptides and their respective antibodies are
well known in the art. Examples include poly-histidine (poly-his)
or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag
polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol.,
8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7
and 9E10 antibodies thereto (Evan et al., Molecular and Cellular
Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus
glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include
the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)];
the KT3 epitope peptide [Martin et al., Science, 255:192-194
(1992)]; an .alpha.-tubulin epitope peptide [Skinner et al., J.
Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein
peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA,
87:6393-6397 (1990)].
[0038] In a preferred embodiment, the kinesin protein comprises an
N-terminal T7 epitope tag and a C-terminus myc-epitope and 6-His
tag.
[0039] In an alternative embodiment, the chimeric molecule may
comprise a fusion of the kinesin protein with an immunoglobulin or
a particular region of an immunoglobulin. For a bivalent form of
the chimeric molecule (also referred to as an "immunoadhesin"),
such a fusion could be to the Fc region of an IgG molecule. The Ig
fusions preferably include the substitution of a soluble
(transmembrane domain deleted or inactivated) form of a Kinesin
protein in place of at least one variable region within an Ig
molecule. In a particularly preferred embodiment, the
immunoglobulin fusion includes the hinge, CH2 and CH3, or the
hinge, CH1, CH2 and CH3 regions of an IgG-1 molecule. For the
production of immunoglobulin fusions see also U.S. Pat. No.
5,428,130 issued Jun. 27, 1995.
[0040] Additionally, as recognized by the skilled artisan and as
will be further apparent below, labels of various sorts may be
utilized in the invention. A "label" is a composition detectable by
spectroscopic, photochemical, biochemical, immunochemical, or
chemical means. For example, useful labels include .sup.32P,
fluorescent dyes, electron-dense reagents, enzymes, biotin,
dioxigenin, or haptens and proteins for which antisera or
monoclonal antibodies are available. Labels are also described
further below.
[0041] In a preferred embodiment, a method provided herein includes
purifying said kinesin protein. The terms "isolated" "purified" or
"biologically pure" refer to material that is substantially or
essentially free from components which normally accompany it as
found in its native state. Purity and homogeneity are typically
determined using analytical chemistry techniques such as
polyacrylamide gel electrophoresis or high performance liquid
chromatography. A protein that is the predominant species present
in a preparation is substantially purified. The term "purified"
denotes that a nucleic acid or protein gives rise to essentially
one band in an electrophoretic gel. Particularly, it means that the
nucleic acid or protein is at least 85% pure, more preferably at
least 95% pure, and most preferably at least 99% pure. In a
preferred embodiment, a protein is considered pure wherein it is
determined that there is no contaminating activity.
[0042] The nucleic acid (e.g., cDNA or genomic DNA) encoding the
kinesin protein may be inserted into a replicable vector for
cloning (amplification of the DNA) or for expression.
[0043] The term "nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form. Unless specifically limited, the term
encompasses nucleic acids containing known analogues of natural
nucleotides which have similar binding properties as the reference
nucleic acid and are metabolized in a manner similar to naturally
occurring nucleotides. Unless otherwise indicated, a particular
nucleic acid sequence also implicitly encompasses conservatively
modified variants thereof (e.g., degenerate codon substitutions)
and complementary sequences and as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608
(1985); Cassol et al., 1992; Rossolini et al., Mol. Cell. Probes
8:91-98 (1994)). The term nucleic acid is used interchangeably with
gene, cDNA, and mRNA encoded by a gene.
[0044] Various vectors are publicly available. The vector may, for
example, be in the form of a plasmid, cosmid, viral particle, or
phage. The appropriate nucleic acid sequence may be inserted into
the vector by a variety of procedures. In general, DNA is inserted
into an appropriate restriction endonuclease site(s) using
techniques known in the art. Vector components generally include,
but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker genes, an enhancer element, a
promoter, and a transcription termination sequence. Construction of
suitable vectors containing one or more of these components employs
standard ligation techniques which are known to the skilled
artisan.
[0045] The kinesin protein may be produced recombinantly not only
directly, but also as a fusion polypeptide with a heterologous
polypeptide, which may be a signal sequence or other polypeptide
having a specific cleavage site at the N-terminus of the mature
protein or polypeptide. In general, the signal sequence may be a
component of the vector, or it may be a part of the
kinesin-encoding DNA that is inserted into the vector. The signal
sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase, penicillinase,
lpp, or heat-stable enterotoxin II leaders.
[0046] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria. The origin of replication from the plasmid pBR322 is
suitable for most Gram-negative bacteria.
[0047] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0048] Expression and cloning vectors usually contain a promoter
operably linked to the kinesin-encoding nucleic acid sequence to
direct mRNA synthesis. Promoters recognized by a variety of
potential host cells are well known. Promoters suitable for use
with prokaryotic hosts include the .beta.-lactamase and lactose
promoter systems [Chang et al., Nature, 275:615 (1978); Goeddel et
al., Nature, 281:544 (1979)], alkaline phosphatase, a tryptophan
(trp) promoter system (Goeddel, Nucleic Acids Res., 8:4057 (1980);
EP 36,776], and hybrid promoters such as the tac promoter [deboer
et al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for
use in bacterial systems also will contain a Shine-Dalgamo (S.D.)
sequence operably linked to the DNA encoding kinesin protein.
[0049] The host cells are transformed with the nucleic acids as
described herein for kinesin protein production and cultured in
nutrient media modified as appropriate for inducing promoters,
selecting transformants, or amplifying the genes encoding the
desired sequences. The preferred embodiments are demonstrated in
the examples below.
[0050] Recombinant proteins are expressed by transformed bacteria
in large amounts, typically after promoter induction; but
expression can be constitutive. Bacteria are grown according to
standard procedures in the art. Preferably fresh bacteria cells are
used for isolation of protein.
[0051] The preferred embodiments for each of the steps of
production and purification are further described below in the
examples. In particular, preferred lysis, wash and elution buffers
are provided. In a preferred embodiment, purification over a Ni-NTA
resin leads to a high degree of purification in a single step.
[0052] Preferably, the kinesins provided herein as compositions or
produced from the methods provided herein have at least one
activity of a kinesin protein as further defined below. Preferably
the activity is the ability to hydrolyze ATP in a manner stimulated
by microtubules.
[0053] While it is preferable to produce the kinesins herein in
prokaryotic systems, in one aspect, the kinesins herein are
produced in eukaryotic systems. In each case, the kinesin is
expressed recombinantly. Previous work provided a limited number of
kinesin homologs recombinantly, however, herein, each homolog,
preferably the human homolog, is expressed recombinantly. For
example, methods for expressing human Kin2 in a recombinant system
are provided herein. In a preferred embodiment, a vector comprising
a human Kin2 sequence is expressed in a eukaryotic cell, and the
Kin2 is purified. Similarly, in one embodiment, human
chromokinesin, HSET, Kif15, MCAK, Kif1A, MKLP1, CENP-E, KHC or KSP
is expressed in a eukaryotic cell. In a preferred embodiment, the
eukaryotic cell works in conjunction with a baculovirus system,
such as Sf9 cell. The kinesins provided produced by such systems
are also provided herein.
[0054] In one aspect the specific coding sequences as published and
known in the art which encode the kinesin proteins are utilized.
However, in an alternative embodiment, a substantially identical
sequence encoding a kinesin protein is utilized. The term
"substantially identical" in the context of two nucleic acids or
polypeptides refers to the residues in the two sequences that have
at least 80% identity when aligned for maximum correspondence as
measured using one of the following algorithms. Optimal alignment
of sequences for comparison can be conducted, e.g., by the local
homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482
(1981), by the homology alignment algorithm of Needleman &
Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity
method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:
2444 (1988), by computerized implementations of these algorithms
(GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software
Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.),
or by inspection.
[0055] One example of a useful algorithm is PILEUP. PILEUP creates
a multiple sequence alignment from a group of related sequences
using progressive, pairwise alignments. It can also plot a tree
showing the clustering relationships used to create the alignment.
PILEUP uses a simplification of the progressive alignment method of
Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method
used is similar to the method described by Higgins & Sharp,
CABIOS 5: 151-153 (1989). The program can align up to 300 sequences
of a maximum length of 5,000. The multiple alignment procedure
begins with the pairwise alignment of the two most similar
sequences, producing a cluster of two aligned sequences. This
cluster can then be aligned to the next most related sequence or
cluster of aligned sequences. Two clusters of sequences can be
aligned by a simple extension of the pairwise alignment of two
individual sequences. The final alignment is achieved by a series
of progressive, pairwise alignments. The program can also be used
to plot a dendogram or tree representation of clustering
relationships. The program is run by designating specific sequences
and their amino acid or nucleotide coordinates for regions of
sequence comparison, e.g., the motor domain. In one example,
kinesin proteins were compared to other kinesin protein superfamily
sequences using the following parameters: default gap weight
(3.00), default gap length weight (0.10), and weighted end
gaps.
[0056] Another example of algorithm that is suitable for
determining sequence similarity is the BLAST algorithm, which is
described in Altschul et at, J. Mol. Biol. 215: 403-410 (1990).
Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence that either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold (Altschul et al, supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
extended in both directions along each sequence for as far as the
cumulative alignment score can be increased. Extension of the word
hits in each direction are halted when: the cumulative alignment
score falls off by the quantity X from its maximum achieved value;
the cumulative score goes to zero or below, due to the accumulation
of one or more negative-scoring residue alignments; or the end of
either sequence is reached. The BLAST algorithm parameters W, T,
and X determine the sensitivity and speed of the alignment. The
BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62
scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10,
M=5, N=-4, and a comparison of both strands.
[0057] The BLAST algorithm performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul,
Proc. Nat'l. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. For example, a nucleic acid is considered
similar to a nucleic acid if the smallest sum probability in a
comparison of the test nucleic acid to the nucleic acid is less
than about 0.1, more preferably less than about 0.01, and most
preferably less than about 0.001. Where the test nucleic acid
encodes a kinesin protein, it is considered similar to a specified
kinesin nucleic acid if the comparison results in a smallest sum
probability of less than about 0.5, and more preferably less than
about 0.2.
[0058] An indication that two polypeptide sequences are
substantially identical is that one peptide is immunologically
reactive with antibodies raised against the second peptide. Thus, a
polypeptide is substantially identical to a second polypeptide, for
example, where the two peptides differ only by a conservative
substitution. An indication that two nucleic acid sequences are
substantially identical is that the polypeptide which the first
nucleic acid encodes is immunologically cross reactive with the
polypeptide encoded by the second nucleic acid. Another indication
that two nucleic acid sequences are substantially identical is that
the two molecules hybridize to each other under stringent
conditions.
[0059] The phrase "hybridizing specifically to" refers to the
binding, duplexing, or hybridizing of a molecule only to a
particular nucleotide sequence under stringent conditions when that
sequence is present in a complex mixture (e.g., total cellular) DNA
or RNA. The term "stringent conditions" refers to conditions under
which a probe will hybridize to its target subsequence, but to no
other sequences. Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength and pH. The T.sub.m is the temperature
(under defined ionic strength, pH, and nucleic acid concentration)
at which 50% of the probes complementary to the target sequence
hybridize to the target sequence at equilibrium (as the target
sequences are generally present in excess, at T.sub.m, 50% of the
probes are occupied at equilibrium). Typically, stringent
conditions will be those in which the salt concentration is less
than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium
ion concentration (or other salts) at pH 7.0 to 8.3 and the
temperature is at least about 30.degree. C. for short probes (e.g.,
10 to 50 nucleotides) and at least about 60.degree. C. for long
probes (e.g., greater than 50 nucleotides). Stringent conditions
may also be achieved with the addition of destabilizing agents such
as formamide.
[0060] Once expressed and purified if necessary, the kinesin
proteins and nucleic acids are useful in a number of
applications.
[0061] In a preferred embodiment, the kinesin proteins or cells
containing the native or modified kinesin proteins are used in
screening assays. Production of these important motor proteins in
large quantities permits the design of drug screening assays for
compounds that modulate kinesin activity.
[0062] Screens may be designed to first find candidate agents that
can bind to kinesin proteins, and then these agents may be used in
assays that evaluate the ability of the candidate agent to modulate
kinesin activity. Thus, as will be appreciated by those in the art,
there are a number of different assays which may be run; binding
assays and activity assays.
[0063] Thus, in a preferred embodiment, the methods comprise
combining a kinesin protein and a candidate bioactive agent, and
determining the binding of the candidate agent to the kinesin
protein. Preferred embodiments utilize a human kinesin protein,
although other homologs may be used. In a preferred embodiment, the
kinesin is unglycosylated or has at least two epitope tags as
described herein.
[0064] The term "candidate bioactive agent" as used herein
describes any molecule, e.g., protein, oligopeptide, small organic
molecule, polysaccharide, polynucleotide, etc., with the capability
of directly or indirectly altering the bioactivity of kinesin.
Generally a plurality of assay mixtures are run in parallel with
different agent concentrations to obtain a differential response to
the various concentrations. Typically, one of these concentrations
serves as a negative control, i.e., at zero concentration or below
the level of detection.
[0065] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 100 and less than
about 2,500 daltons. Candidate agents comprise functional groups
necessary for structural interaction with proteins, particularly
hydrogen bonding, and typically include at least an amine,
carbonyl, hydroxyl or carboxyl group, preferably at least two of
the functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including peptides, saccharides, fatty acids,
steroids, purines, pyrimidines, derivatives, structural analogs or
combinations thereof. Particularly preferred are peptides.
[0066] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides. Alternatively, libraries
of natural compounds in the form of bacterial, fungal, plant and
animal extracts are available or readily produced. Additionally,
natural or synthetically produced libraries and compounds are
readily modified through conventional chemical, physical and
biochemical means. Known pharmacological agents may be subjected to
directed or random chemical modifications, such as acylation,
alkylation, esterification, amidification to produce structural
analogs.
[0067] In a preferred embodiment, the candidate bioactive agents
are proteins. By "protein" herein is meant at least two covalently
attached amino acids, which includes proteins, polypeptides,
oligopeptides and peptides. The protein may be made up of naturally
occurring amino acids and peptide bonds, or synthetic
peptidomimetic structures. Thus "amino acid", or "peptide residue",
as used herein means both naturally occurring and synthetic amino
acids. For example, homo-phenylalanine, citrulline and noreleucine
are considered amino acids for the purposes of the invention.
"Amino acid" also includes imino acid residues such as proline and
hydroxyproline. The side chains may be in either the (R) or the (S)
configuration. In the preferred embodiment, the amino acids are in
the (S) or L-configuration. If non-naturally occurring side chains
are used, non-amino acid substituents may be used, for example to
prevent or retard in vivo degradations.
[0068] In a preferred embodiment, the candidate bioactive agents
are naturally occurring proteins or fragments of naturally
occurring proteins. Thus, for example, cellular extracts containing
proteins, or random or directed digests of proteinaceous cellular
extracts, may be used. In this way libraries of procaryotic and
eucaryotic proteins may be made for screening against kinesin.
Particularly preferred in this embodiment are libraries of
bacterial, fungal, viral, and mammalian proteins, with the latter
being preferred, and human proteins being especially preferred.
[0069] In a preferred embodiment, the candidate bioactive agents
are peptides of from about 5 to about 30 amino acids, with from
about 5 to about 20 amino acids being preferred, and from about 7
to about 15 being particularly preferred. The peptides may be
digests of naturally occurring proteins as is outlined above,
random peptides, or "biased" random peptides. By "randomized" or
grammatical equivalents herein is meant that each nucleic acid and
peptide consists of essentially random nucleotides and amino acids,
respectively. Since generally these random peptides (or nucleic
acids, discussed below) are chemically synthesized, they may
incorporate any nucleotide or amino acid at any position. The
synthetic process can be designed to generate randomized proteins
or nucleic acids, to allow the formation of all or most of the
possible combinations over the length of the sequence, thus forming
a library of randomized candidate bioactive proteinaceous
agents.
[0070] In one embodiment, the library is fully randomized, with no
sequence preferences or constants at any position. In a preferred
embodiment, the library is biased. That is, some positions within
the sequence are either held constant, or are selected from a
limited number of possibilities. For example, in a preferred
embodiment, the nucleotides or amino acid residues are randomized
within a defined class, for example, of hydrophobic amino acids,
hydrophilic residues, sterically biased (either small or large)
residues, towards the creation of cysteines, for cross-linking,
prolines for SH-3 domains, serines, threonines, tyrosines or
histidines for phosphorylation sites, etc., or to purines, etc.
[0071] In a preferred embodiment, the candidate bioactive agents
are nucleic acids. By "nucleic acid" or"oligonucleotide" or
grammatical equivalents herein means at least two nucleotides
covalently linked together. A nucleic acid of the present invention
will generally contain phosphodiester bonds, although in some
cases, as outlined below, nucleic acid analogs are included that
may have alternate backbones, comprising, for example,
phosphoramide (Beaucage et al., Tetrahedron 49(10):1925 (1993) and
references therein; Letsinger, J. Org. Chem. 35:3800 (1970);
Sprinzl et al., Eur. J. Biochem. 81:579 (1977); Letsinger et al.,
Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett. 805
(1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and
Pauwels et al., Chemica Scripta 26:141 91986)), phosphorothioate
(Mag et al., Nucleic Acids Res. 19:1437 (1991); and U.S. Patent No.
5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc.
111:2321 (1989), O-methylphophoroamidite linkages (see Eckstein,
Oligonucleotides and Analogues: A Practical Approach, Oxford
University Press), and peptide nucleic acid backbones and linkages
(see Egholm; J. Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem.
Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature, 365:566 (1993);
Carlsson et al., Nature 380:207 (1996), all of which are
incorporated by reference). Other analog nucleic acids include
those with positive backbones (Denpcy et al., Proc. Natl. Acad.
Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Pat. Nos.
5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863;
Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991);
Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et
al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3,
ASC Symposium Series 580, "Carbohydrate Modifications in Antisense
Research", Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al.,
Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al.,
J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996))
and non-ribose backbones, including those described in U.S. Pat.
Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium
Series 580, "Carbohydrate Modifications in Antisense Research", Ed.
Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more
carbocyclic sugars are also included within the definition of
nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995)
pp169-176). Several nucleic acid analogs are described in Rawls, C
& E News Jun. 2, 1997 page 35. All of these references are
hereby expressly incorporated by reference. These modifications of
the ribose-phosphate backbone may be done to facilitate the
addition of additional moieties such as labels, or to increase the
stability and half-life of such molecules in physiological
environments. In addition, mixtures of naturally occurring nucleic
acids and analogs can be made. Alternatively, mixtures of different
nucleic acid analogs, and mixtures of naturally occurring nucleic
acids and analogs may be made. The nucleic acids may be single
stranded or double stranded, as specified, or contain portions of
both double stranded or single stranded sequence. The nucleic acid
may be DNA, both genomic and cDNA, RNA or a hybrid, where the
nucleic acid contains any combination of deoxyribo- and
ribo-nucleotides, and any combination of bases, including uracil,
adenine, thymine, cytosine, guanine, inosine, xathanine
hypoxathanine, isocytosine, isoguanine, etc.
[0072] As described above generally for proteins, nucleic acid
candidate bioactive agents may be naturally occurring nucleic
acids, random nucleic acids, or "biased" random nucleic acids.
[0073] For example, digests of procaryotic or eucaryotic genomes
may be used as is outlined above for proteins.
[0074] In a preferred embodiment, the candidate bioactive agents
are organic chemical moieties, a wide variety of which are
available in the literature.
[0075] The assays described utilize kinesin proteins as defined
herein. In one embodiment, portions of kinesin proteins are
utilized, in a preferred embodiment, portions having kinesin
activity are used. In addition, the assays described herein may
utilize either isolated kinesin proteins or cells comprising the
kinesin proteins.
[0076] In one of the embodiments of the methods provided herein,
the kinesin protein or the candidate agent is non-diffusably bound
to an insoluble support having isolated sample receiving areas
(e.g. a microtiter plate, an array, etc.). The insoluble supports
may be made of any composition to which the compositions can be
bound, is readily separated from soluble material, and is otherwise
compatible with the overall method of screening. The surface of
such supports may be solid or porous and of any convenient shape.
Examples of suitable insoluble supports include microtiter plates,
arrays, membranes and beads. These are typically made of glass,
plastic (e.g., polystyrene), polysaccharides, nylon or
nitrocellulose, teflon.TM., etc. Microtiter plates and arrays are
especially convenient because a large number of assays can be
carried out simultaneously, using small amounts of reagents and
samples. In some cases magnetic beads and the like are included.
The particular manner of binding of the composition is not crucial
so long as it is compatible with the reagents and overall methods
of the invention, maintains the activity of the composition and is
nondiffusable. Preferred methods of binding include the use of
antibodies (which do not sterically block either the ligand binding
site or activation sequence when the protein is bound to the
support), direct binding to "sticky" or ionic supports, chemical
crosslinking, the synthesis of the protein or agent on the surface,
etc. Following binding of the protein or agent, excess unbound
material is removed by washing. The sample receiving areas may then
be blocked through incubation with bovine serum albumin (BSA),
casein or other innocuous protein or other moiety. Also included in
this invention are screening assays wherein solid supports are not
used. Solution based assays are further described below.
[0077] In a preferred embodiment, the kinesin protein is bound to
the support, and a candidate bioactive agent is added to the assay.
Alternatively, the candidate agent is bound to the support and the
kinesin protein is added. Novel binding agents include specific
antibodies, non-natural binding agents identified in screens of
chemical libraries, peptide analogs, etc. Of particular interest
are screening assays for agents that have a low toxicity for human
cells. A wide variety of assays may be used for this purpose,
including labeled in vitro protein-protein binding assays,
electrophoretic mobility shift assays, immunoassays for protein
binding, functional assays (phosphorylation assays, etc.) and the
like.
[0078] The determination of the binding of the candidate bioactive
agent to a kinesin protein may be done in a number of ways. In a
preferred embodiment, the candidate bioactive agent is labelled,
and binding determined directly. For example, this may be done by
attaching all or a portion of a kinesin protein to a solid support,
adding a labelled candidate agent (for example a fluorescent
label), washing off excess reagent, and determining whether the
label is present on the solid support. Various blocking and washing
steps may be utilized as is known in the art.
[0079] By "labeled" herein is meant that the compound is either
directly or indirectly labeled with a label which provides a
detectable signal, e.g. radioisotope, fluorescers, enzyme,
antibodies, particles such as magnetic particles, chemiluminescers,
or specific binding molecules, etc. Specific binding molecules
include pairs, such as biotin and streptavidin, digoxin and
antidigoxin etc. For the specific binding members, the
complementary member would normally be labeled with a molecule
which provides for detection, in accordance with known procedures,
as outlined above. The label can directly or indirectly provide a
detectable signal.
[0080] In some embodiments, only one of the components is labeled.
For example, the proteins (or proteinaceous candidate agents) may
be labeled at tyrosine positions using .sup.125I, or with
fluorophores. Alternatively, more than one component may be labeled
with different labels; using .sup.125I for the proteins, for
example, and a fluorophor for the candidate agents.
[0081] In a preferred embodiment, the binding of the candidate
bioactive agent is determined through the use of competitive
binding assays. In this embodiment, the competitor is a binding
moiety known to bind to the target molecule (i.e. kinesin), such as
an antibody, peptide, binding partner, ligand, etc. Under certain
circumstances, there may be competitive binding as between the
bioactive agent and the binding moiety, with the binding moiety
displacing the bioactive agent. This assay can be used to determine
candidate agents which interfere with binding between kinesin
proteins and, for example, a microtubule.
[0082] In one embodiment, the candidate bioactive agent is labeled.
Either the candidate bioactive agent, or the competitor, or both,
is added first to the protein for a time sufficient to allow
binding, if present. Incubations may be performed at any
temperature which facilitates optimal activity, typically between 4
and 40.degree. C. Incubation periods are selected for optimum
activity, but may also be optimized to facilitate rapid high
through put screening. Typically between 0.1 and 1 hour will be
sufficient. Excess reagent is generally removed or washed away. The
second component is then added, and the presence or absence of the
labeled component is followed, to indicate binding.
[0083] In a preferred embodiment, the competitor is added first,
followed by the candidate bioactive agent. Displacement of the
competitor is an indication that the candidate bioactive agent is
binding to the kinesin protein and thus is capable of binding to,
and potentially modulating, the activity of the kinesin protein. In
this embodiment, either component can be labeled. Thus, for
example, if the competitor is labeled, the presence of label in the
wash solution indicates displacement by the agent. Alternatively,
if the candidate bioactive agent is labeled, the presence of the
label on the support indicates displacement.
[0084] In an alternative embodiment, the candidate bioactive agent
is added first, with incubation and washing, followed by the
competitor. The absence of binding by the competitor may indicate
that the bioactive agent is bound to the kinesin protein with a
higher affinity. Thus, if the candidate bioactive agent is labeled,
the presence of the label on the support, coupled with a lack of
competitor binding, may indicate that the candidate agent is
capable of binding to the kinesin protein.
[0085] In a preferred embodiment, the methods comprise differential
screening to identity bioactive agents that are capable of
modulating the activity of the kinesin proteins. In this
embodiment, the methods comprise combining a kinesin protein and a
competitor in a first sample. A second sample comprises a candidate
bioactive agent, a kinesin protein and a competitor. The binding of
the competitor is determined for both samples, and a change, or
difference in binding between the two samples indicates the
presence of an agent capable of binding to the kinesin protein and
potentially modulating its activity. That is, if the binding of the
competitor is different in the second sample relative to the first
sample, the agent is capable-of binding to the kinesin protein.
[0086] Alternatively, a preferred embodiment utilizes differential
screening to identify drug candidates that bind to the native
kinesin protein, but cannot bind to modified kinesin proteins. The
structure of the kinesin protein may be modeled, and used in
rational drug design to synthesize agents that interact with that
site. Drug candidates that affect kinesin bioactivity are also
identified by screening drugs for the ability to either enhance or
reduce the activity of the protein.
[0087] Positive controls and negative controls may be used in the
assays. Preferably all control and test samples are performed in at
least triplicate to obtain statistically significant results.
Incubation of all samples is for a time sufficient for the binding
of the agent to the protein. Following incubation, all samples are
washed free of non-specifically bound material and the amount of
bound, generally labeled agent determined. For example, where a
radiolabel is employed, the samples may be counted in a
scintillation counter to determine the amount of bound
compound.
[0088] A variety of other reagents may be included in the screening
assays. These include reagents like salts, neutral proteins, e.g.
albumin, detergents, etc which may be used to facilitate optimal
protein-protein binding and/or reduce non-specific or background
interactions. Also reagents that otherwise improve the efficiency
of the assay, such as protease inhibitors, nuclease inhibitors,
anti-microbial agents, etc., may be used. The mixture of components
may be added in any order that provides for the requisite
binding.
[0089] Screening for agents that modulate the activity of kinesin
protein may also be done. In a preferred embodiment, methods for
screening for a bioactive agent capable of modulating the activity
of kinesin protein comprise the steps of adding a candidate
bioactive agent to a sample of kinesin protein, as above, and
determining an alteration in the biological activity of kinesin
protein. "Modulating the activity of kinesin protein" includes an
increase in activity, a decrease in activity, or a change in the
type or kind of activity present. Thus, in this embodiment, the
candidate agent should both bind to kinesin protein (although this
may not be necessary), and alter its biological or biochemical
activity as defined herein. The methods include both in vitro
screening methods, as are generally outlined above, and in vivo
screening of cells for alterations in the presence, distribution,
activity or amount of kinesin protein.
[0090] Thus, in this embodiment, the methods comprise combining a
kinesin protein sample and a candidate bioactive agent, and
evaluating the effect on motor activity. By "kinesin protein
activity" or grammatical equivalents herein is meant one of kinesin
protein's biological activities, including, but not limited to, its
ability to affect ATP hydrolyzation. Other activities include
microtubule binding, gliding, polymerazation/depolymerazation
(effects on microtubule dynamics), binding to other proteins of the
spindle, binding to proteins involved in cell-cycle control, or
serving as a substrate to other enzymes, such as kinases or
proteases and specific kinesin cellular activities such as
chromosome congregation, axonal transport, etc.
[0091] Methods of performing motility assays are well known to
those of skill in the art (see, e.g., Hall, et al (1996), Biophys.
J., 71: 3467-3476, Turner et al, 1996, Anal. Biochem. 242 (1):20-5;
Gittes et al., 1996, Biophys. J. 70(1): 418-29; Shirakawa et al.,
1995, J. Exp. Biol. 198: 1809-15; Winkelmann et at., 1995, Biophys.
J. 68: 2444-53; Winkelmann et al, 1995, Biophys. J. 68: 72S, and
the like).
[0092] In addition to the assays described above, methods known in
the art for determining ATPase activity can be used. Preferably,
solution based assays are utilized. Alternatively, conventional
methods are used. For example, P.sub.1 release from kinesin can be
quantified. In one preferred embodiment, the ATPase activity assay
utilizes 0.3 M PCA (perchloric acid) and malachite green reagent
(8.27 mM sodium molybdate 11, 0.33 mM malachite green oxalate, and
0.8 mM Triton X-100). To perform the assay, 10 .mu.L of reaction is
quenched in 90 .mu.L of cold 0.3 M PCA. Phosphate standards are
used so data can be converted to mM inorganic phosphate released.
When all reactions and standards have been quenched in PCA, 100
.mu.L of malachite green reagent is added to the to relevant wells
in e.g., a microtiter plate. The mixture is developed for 10-15
minutes and the plate is read at an absorbance of 650 nm. If
phosphate standards were used, absorbance readings can be converted
to mM P.sub.1 and plotted over time. Additionally, ATPase assays
known in the art include the luciferase assay.
[0093] In a preferred embodiment, the activity of the kinesin
protein is decreased or increased, with a decrease being preferred.
Modulation also includes changes such as the binding
characteristics etc. Thus, bioactive agents that are antagonists
are preferred in some embodiments, and bioactive agents that are
agonists may be preferred in other embodiments.
[0094] The components provided herein for the assays provided
herein may also be combined to form kits. The kits can be based on
the use of the protein and/or the nucleic acid encoding the kinesin
proteins.
[0095] In this way, bioactive agents are identified. Compounds with
pharmacological activity are able to enhance or interfere with the
activity of the kinesin protein. The compounds having the desired
pharmacological activity may be administered in a physiologically
acceptable carrier to a host, as previously described. The agents
may be administered in a variety of ways, orally, parenterally
e.g., subcutaneously, intraperitoneally, intravascularly, etc.
Depending upon the manner of introduction, the compounds may be
formulated in a variety of ways. The concentration of
therapeutically active compound in the formulation may vary from
about 0.1-100 wt. %.
[0096] The pharmaceutical compositions can be prepared in various
forms, such as granules. tablets, pills, suppositories, capsules,
suspensions, salves, lotions and the like. Pharmaceutical grade
organic or inorganic carriers and/or diluents suitable for oral and
topical use can be used to make up compositions containing the
therapeutically-active compounds. Diluents known to the art include
aqueous media, vegetable and animal oils and fats. Stabilizing
agents, wetting and emulsifying agents, salts for varying the
osmotic pressure or buffers for securing an adequate pH value, and
skin penetration enhancers can be used as auxiliary agents.
[0097] It is also understood that bioactive compounds may be used
in the agricultural arena. For example, inhibitors of kinesins may
eliminate fungi which adversely effect agricultural crops.
Alternatively, inhibitors of kinesins may be useful in eliminating
unwanted plants, i.e., weeds.
[0098] Thus, in one embodiment, methods of modulating motor
activity in cells or organisms are provided. In one embodiment, the
methods comprise administering to a cell an anti-kinesin antibody
or other agent identified herein or by the methods provided herein,
that reduces or eliminates. the biological activity of the
endogenous kinesin protein. Alternatively, the methods comprise
administering to a cell or organism a recombinant nucleic acid
encoding a kinesin protein or modulator including anti-sense
nucleic acids.
[0099] In one embodiment, the kinesin proteins of the present
invention may be used to generate polyclonal and monoclonal
antibodies to kinesin proteins, which are useful as described
herein. Similarly, the kinesin proteins can be coupled, using
standard technology, to affinity chromatography columns. These
columns may then be used to purify kinesin antibodies. In a
preferred embodiment, the antibodies are generated to epitopes
unique to the kinesin protein; that is, the antibodies show little
or no cross-reactivity to other proteins. These antibodies find use
in a number of applications. For example, the kinesin antibodies
may be coupled to standard affinity chromatography columns and used
to purify kinesin proteins as further described below. The
antibodies may also be used as blocking polypeptides, as outlined
above, since they will specifically bind to the kinesin
protein.
[0100] The anti-kinesin protein antibodies may comprise polyclonal
antibodies. Methods of preparing polyclonal antibodies are known to
the skilled artisan. Polyclonal antibodies can be raised in a
mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant. Typically, the immunizing agent
and/or adjuvant will be injected in the mammal by multiple
subcutaneous or intraperitoneal injections. The immunizing agent
may include the kinesin protein polypeptide or a fusion protein
thereof. It may be useful to conjugate the immunizing agent to a
protein known to be immunogenic in the mammal being immunized.
Examples of such immunogenic proteins include but are not limited
to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin,
and soybean trypsin inhibitor. Examples of adjuvants which may be
employed include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The
immunization protocol may be selected by one skilled in the art
without undue experimentation.
[0101] The anti-kinesin protein antibodies may, alternatively, be
monoclonal antibodies. Monoclonal antibodies may be prepared using
hybridoma methods, such as those described by Kohler and Milstein,
Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or
other appropriate host animal, is typically immunized with an
immunizing agent to elicit lymphocytes that produce or are capable
of producing antibodies that will specifically bind to the
immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
[0102] The immunizing agent will typically include the kinesin
protein polypeptide or a fusion protein thereof. Generally, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell [Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986) pp. 59-103]. Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine and
human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells may be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
[0103] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0104] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against kinesin protein. Preferably, the binding
specificity of monoclonal antibodies produced by the hybridoma
cells is determined by immunoprecipitation or by an in vitro
binding assay, such as radioimmunoassay (RIA) or enzyme-linked
immunosorbent assay (ELISA). Such techniques and assays are known
in the art. The binding affinity of the monoclonal antibody can,
for example, be determined by the Scatchard analysis of Munson and
Pollard, Anal. Biochem., 107:220 (1980).
[0105] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0106] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0107] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences (U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0108] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0109] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art.
[0110] The anti-kinesin protein antibodies of the invention may
further comprise humanized antibodies or human antibodies.
Humanized forms of non-human (e.g., murine) antibodies are chimeric
immunoglobulins, immunoglobulin chains or fragments thereof (such
as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. Humanized antibodies include human
immunoglobulins (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In some instances, Fv framework
residues of the human immunoglobulin are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues
which are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann
et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)].
[0111] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0112] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
[Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol., 147(1):86-95 (1991)]. Similarly, human antibodies can be
made by introducing of human immunoglobulin loci into transgenic
animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge,
human antibody production is observed, which closely resembles that
seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire. This approach is described, for
example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825;
5,625,126; 5,633,425; 5,661,016, and in the following scientific
publications: Marks et al., Bio/Technology 10, 779-783 (1992);
Lonberg et al, Nature 368 856-859 (1994); Morrison, Nature 368,
812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51
(1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and
Huszar, Intern. Rev. Immunol. 13 65-93 (1995).
[0113] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for the kinesin protein, the other one is for any
other antigen, and preferably for a cell-surface protein or
receptor or receptor subunit.
[0114] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities [Milstein and Cuello, Nature, 305:537-539
(1983)]. Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published May 13,
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0115] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0116] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0117] The anti-kinesin protein antibodies of the invention have
various utilities. For example, anti-kinesin protein antibodies may
be used in diagnostic assays for a kinesin protein, e.g., detecting
its expression in specific cells, tissues, or serum. Various
diagnostic assay techniques known in the art may be used, such as
competitive binding assays, direct or indirect sandwich assays and
immunoprecipitation assays conducted in either heterogeneous or
homogeneous phases [Zola, Monoclonal Antibodies: A Manual of
Techniques, CRC Press, Inc. (1987) pp. 147-158]. The antibodies
used in the diagnostic assays can be labeled with a detectable
moiety. The detectable moiety should be capable of producing,
either directly or indirectly, a detectable signal. For example,
the detectable moiety may be a radioisotope, such as .sup.3H,
.sup.14C, .sup.32P, .sup.35S, or .sup.125I, a fluorescent or
chemiluminescent compound, such as fluorescein isothiocyanate,
rhodamine, or luciferin, or an enzyme, such as alkaline
phosphatase, beta-galactosidase or horseradish peroxidase. Any
method known in the art for conjugating the antibody to the
detectable moiety may be employed, including those methods
described by Hunter et al., Nature, 144:945 (1962); David et al.,
Biochemistry, 13:1014-(1974); Pain et al., J. Immunol. Meth.,
40:219 (1981); and Nygren, J. Histochem. and Cytochem., 30:407
(1982).
[0118] Anti-kinesin protein antibodies also are useful for the
affinity purification of kinesin protein from recombinant cell
culture or natural sources. In this process, the antibodies against
kinesin protein are immobilized on a suitable support, such a
Sephadex resin or filter paper, using methods well known in the
art. The immobilized antibody then is contacted with a sample
containing the kinesin protein to be purified, and thereafter the
support is washed with a suitable solvent that will remove
substantially all the material in the sample except the kinesin
protein, which is bound to the immobilized antibody. Finally, the
support is washed with another suitable solvent that will release
the kinesin protein from the antibody.
[0119] The anti-kinesin protein antibodies may also be used in
treatment. In one embodiment, the genes encoding the antibodies are
provided, such that the antibodies bind to and modulate the kinesin
protein within the cell.
[0120] All publications, sequences (those of known kinesins, those
disclosed or referenced in publications cited herein, or those
referenced herein by accession number) and patent applications
cited in this specification are herein incorporated by reference as
if each individual publication, sequence or patent application were
specifically and individually indicated to be incorporated by
reference in their entirety. Additionally, wherein accession
numbers are provided for sequences herein, the related text in that
database entry is also incorporated herein in its entirety.
[0121] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to one of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
EXAMPLES
Example 1
[0122] Bacterial Expression Constructs:
[0123] cDNA Cloning.
[0124] For all of the kinesin-related proteins provided herein as
examples, the full-length human cDNA has been previously described
(see Table I). We have cloned cDNAs for all examples by PCR using
the primers and cDNA sources indicated on Table I, except for
CENP-E which was obtained from Don Cleveland at the Ludwig
Institute for Cancer Research, UCSD; see, Yen et al., Nature,
359(6395):536-9 (1992). The nucleotide numbering on Table I
corresponds to the Genbank submission numbering scheme. The clones
were all sequenced to confirm they were the same as the published
genes, although some polymorphisms were present.
1TABLE I Cloning of Human kinesins Published Seq: Primers for cDNA
cloning: Human Accession #s & 5' primer Nucleotides kinesin
Publication Ref. 3' primer Included cDNA Source Chromokinesin
AF071592 RACE AP1 primer (Clontech) <1-193 Marathon- 1165722
(GSDB- CCAAACAGGAAACAGTATCCAAGGCAACC Ready HeLa partial) (Clontech)
TGCCCATCTCGTGAGAAAGC 76-1178 HeLa GCTTGACGGAGAGCATGCTG (Our prep)
ATTGATTACCCAGTTATCGG 1032-3326 HeLa TGATGACTCCAACTTCAGTG (Our prep)
Kin-2 Y08319 GCCGAATACATCAAGCAATGGTAAC 2-2088 Breast tumor
TCTGGGTATCCTTTAGCAGCAAATG (Invitrogen) MKLP1 X67155
AGCCATGTTGTCAGCGAGAGCTAAG 73-2078 human Nislow, et al.
AGGGTCTCTCTGGCTTCTCAGTTTTAGG placenta 1992 (Invitrogen) KSP U37426
CCTTGATTTTTTGGCGGGGACCGTC 66-3259 breast tumor
AAAGGTTGATCTGGGCTCGCAGAGG (Invitrogen) CENP-E Z15005 Yen, et al.
1992 MCAK U63743 GCGTTTCTCTTCCTTGCTGACTCTC 22-2274 breast tumor
Kim, et al. AGAGGCTGGGTGTCAAACCAAACAG (Invitrogen) 1997 Kid
AB017430 GTCGCTGTCGGCTAAGCAAG 101-1596 breast tumor
CTTTGCCCCTGTGACTGTGC (Invitrogen) CTGGATCCCAGCCGCGGGCGGCTCGACG
28-248 HeLa CAG (our prep) CTCTAGAGAGCAGCTGTCCATGCCCC HSET D14678
(partial) GGGCTTGGTGCAAGAGCTTC 213-1624 HeLa
CACCCCTCACCCGATACATAGAC (our prep) ATSV X90840 GGGCTCCCACTACTGCGAGG
21-2311 WERI CTCCTCCTCGTTCACCTCCG (our prep)
[0125] The sequences from the GenBank accession numbers from Table
I and anywhere provided herein, are expressly and explicitly
incorporated herein. Other preferred sequences include the
following: HsATSV, GenBank accession number X90840; HsHSET/CHO2
partial, GenBank accession number D14678; HsKHC, GenBank accession
number X65873; HsKid, GenBank accession number AB017430; and
AnBimC, GenBank accession number M32075.
[0126] Expression Plasmid Vector Backbones:
[0127] pET23d (Novagen 69748-3) encodes a T7 epitope tag 5' of the
polylinker cloning site and a 6-His tag 3' of the polylinker
cloning site. We constructed pET23dmyc by inserting the annealed
oligonucleotides described below into the Xhol site of pET23d. This
creates coding sequence for the myc epitope tag in-frame with the
6-His tag.
2 Annealed oligonucleotides for pET23dmyc: sense:
TCGAGGGTACCGAGCAGAAGCTGATCAGCGAGGAGGACCTGA antisense:
TCGATCAGGTCCTCCTCGCTGATCAGCTTCTGCTCGGTACCC
[0128] Subcloning of Genes into Expression Vectors:
[0129] Using the human kinesin clones obtained by the methods
described above as a template, PCR was used to amplify portions of
the coding sequence, and the PCR product was inserted into the
bacterial expression plasmids described above by restriction enzyme
digest and ligation. Several constructs of different lengths were
developed for each kinesin (see Table II, the column "Residues
Included" describes the starting and ending amino add in one-letter
code and amino acid number). All of the resulting constructs encode
the motor domain, and vary in the amount of flanking sequence. The
PCR primers detailed on Table II are designed such that resulting
constructs encode a protein with a C-terminal 6-His tag (for those
constructs built into pET23d) or the combination myc-epitope/6-His
tag (for those constructs built into pET23dmyc), or an N-temrinal
6-His tag (for those constructs built into pET15b). All constructs
made using the pET23d or the pET23dmyc vector, except those cloned
into the Ncol site, also encode a protein with an N-terminal T7
epitope tag.
3TABLE II Subcloning of Human kinesins into Bacterial Expression
Plasmids: Construct 5' primer Residues Cloning Host Kinesin Name 3'
primer Included sites Vector Chromokinesin K335
TAGCCATGGAAGAGGTGAAGGGAATTC E2-K335 5': NcoI pET23dmyc
CCGCTCGAGTTTTCTTGCTCTGTC 3': XhoI Chromokinesin Q475
TAGAAGCTTGGAAGAGGTGAAGGG E2-Q475 5' HindIII pET23dmyc
TAGAAGCTTCTGGGTAATCAATTG 3': HindIII Chromokinesin D679
TAGAAGCTTGGAAGAGGTGAAGGG E2-D679 5' HindIII pET23dmyc
TAGAAGCTTGTCTCGTTCTTTTAAC 3': HindIII Chromokinesin FL1
TAGAAGCTTGGAAGAGGTGAAGGG E2-H1229 5' HindIII pET23dmyc
TAGAAGCTTGTGGGCCTCTTCTTCG 3': HindIII Kin2 P166
TACGGATCCCAAATTATGAAATTATG P166-A532 5': BamHI pET23dmyc
TACAAGCTTAGCAGTTGGATCTACAGTC 3': HindIII Kin2 H195
TACGGATCCATAGGATATGTGTGTGTG H195-A532 5': BamHI pET23dmyc
TACAAGCTTAGCAGTTGGATCTACAGTC 3': HindIII Kin2 FL2
CTCCATGGTAACATCTTTAAATGAAGATAATG M1-L679 5': NcoI pET23dmyc
CTAAGCTTAAGGGCACGGGGTCTCTTCGGGTTG 3': HindIII MKLP1 E433
ATCCATGGCGAGAGCTAAGACACCCCGGAAACC A4-E433 5': NcoI pET23dmyc
ATGCGGCCGCTTCTTGAGTCACTTCCGCAAATCTC 3': NotI MKLP1 R494
ATCCATGGCGAGAGCTAAGACACCCCGGAAACC A4-R494 5': NcoI pET23dmyc
ATGCGGCCGCCCTTGGAAGTGTCTGCTCATCGTTG 3': NotI MKLP1 E658
ATCCATGGCGAGAGCTAAGACACCCCGGAAACC A4-E658 5': NcoI pET23dmyc
ATGCGGCCGCTTCAGTAACAATAGCCTTCAGTTG 3': NotI KSP L360
ATCCATGGCGTGCCAGCCAAATTCGTCTGCG M1-L360 5': NcoI pET23dmyc
ATCTCGAGCAATATGTTCTTTGCTCTATGAGC 3': XhoI KSP K491
ATCCATGGCGTGCCAGCCAAATTCGTCTGCG M1-K491 5': NcoI pET23dmyc
ATCTCGAGTTTCTCCTCAGTACTTTCCAAAGC 3': XhoI KSP S553
ATCCATGGCGTGCCAGCCAAATTCGTCTGCG M1-S553 5': NcoI pET23dmyc
ATCTCGAGGCTGCCATCCTTAATTAATTCTTCC 3': XhoI CENP-E M329
CTGGATCCCGGCGGAGGAAGGAGCCGTGGCC A2-M329 5': BamHI pET23d
CACTCGAGCATATATTTAGCAGTACTGGC 3': XhoI CENP-E T340
CTGGATCCCGGCGGAGGAAGGAGCCGTGGCC A2-T340 5': BamHI pET23d
CACTCGAGAGTTGATACCTCATTAACATAAGGAG 3': XhoI CENP-E S405
CTGGATCCCGGCGGAGGAAGGAGCCGTGGCC A2-S405 5': BamHI pET23d
CACTCGAGAGAAGAGGTCACCAGCATCCG 3': XhoI CENP-E V465
CTGGATCCCGGCGGAGGAAGGAGCCGTGGCC A2-V465 5': BamHI pET23d
CACTCGAGGACAGATTCATCAATTTCTCG 3': XhoI CENP-E T488
CTGGATCCCGGCGGAGGAAGGAGCCGTGGCC A2-T488 5': BamHI pET23d
CACTCGAGTGTTGCTGGATTCCATTCTATC 3': XhoI MCAK M1
CTGGATCCGGAGGAAATCATGTCTTGTGAAG R189-P617 5': BamHI pET23dmyc
CACTCGAGTGGAATCAGCGCCCCGTTAGAG 3': XhoI MCAK M2
CTGGATCCCAAACTGGGAATTTGCCCGAATG P228-P617 5': BamHI pET23dmyc
CACTCGAGTGGAATCAGCGCCCCGTTAGAG 3': XhoI MCAK M3
CTGGATCCACAGAATATGTGTCTGTGTTAGG H257-P617 5': BamHI pET23dmyc
CACTCGAGTGGAATCAGCGCCCCGTTAGAG 3': XhoI MCAK M4
CTGGATCCGGAGGAAATCATGTCTTGTGAAG R189-P660 5': BamHI pET23dmyc
CACTCGAGTGGTCCTTGCTGTATGATCTC 3': XhoI MCAK M5
CTGGATCCCAAACTGGGAATTTGCCCGAATG P228-P660 5': BamHI pET23dmyc
CACTCGAGTGGTCCTTGCTGTATGATCTC 3': XhoI MCAK M6
CTGGATCCACAGAATATGTGTCTGTGTTAGG H257-P660 5': BamHI pET23dmyc
CACTCGAGTGGTCCTTGCTGTATGATCTC 3': XhoI MCAK FL3
CTCCATGGACTCGTCGCTTCAGGCCCGC M3-Q725 5': NcoI pET23dmyc
CTCTCGAGCTGGGGCCGTTTTCTTGCTGCTTATTTG 3': XhoI Kid A2N370
CTGGATCCCAGCCGCGGGCGGCTCGACGCAG A2-N370 5': BamHI pET23dmyc
CACTCGAGATTGATCACCTCCTTGGACCTG 3': XhoI Kid A2M511
CTGGATCCCAGCCGCGGGCGGCTCGACGCAG A2-M511 5': BamHI pET23dmyc
CACTCGAGCATTGTGGGACAATGGTTCTC 3': XhoI HSET K519
TCGGATCCTTGGTGCAAGAGCTTCAG L72-K519 5': BamHI pET23dmyc
CACTCGAGCTTCCTGTTGGCCTGAGC 3' XhoI HSET E152.2
CATGCCATGGAACTCAAGGGCAAC E152-K519 5': NcoI pET23d
CACTCGAGCTTCCTGTTGGCCTGAGC 3': XhoI HSET Q151.3
GGATATCCATATGCAGGAACTCAAGGGCAAC Q151-K519 5': NdeI pET15b
GCAGGATCCTCACTTCCTGTTGGCCTGAG 3': BamHI ATSV Q353
CTGGATCCCCGGGGCTTCGGTGAAGGTGGCG G3-Q353 5': BamHI pET23dmyc
CACTCGAGCTGCTTGGCCCGGTCAGCATAC 3': XhoI ATSV M472
CTGGATCCCCGGGGCTTCGGTGAAGGTGGCG G3-M472 5': BamHI pET23dmyc
CACTCGAGCATCTCGGCCAGCAGGGCTTC 3': XhoI
[0130] The construct name, such as "Q475", is used herein to
identify the construct initially identified by the "residues
included" and the GenBank accession number provided herein. As
noted in the procedures provided herein, the vector also supplies
an initiation methionine and epitope tags. It is understood that
when the construct is named in the context of a peptide, such as a
peptide selected from the group consisting of Q475 and D679, the
peptide has a sequence encoded by the construct using the universal
code as is known in the art.
[0131] Protein Production & Purification:
[0132] This section details a protocol that we have used to produce
the kinesin protein fragments detailed in Table II. Variations for
particular kinesins are noted in the protocol. For many of the
examples (Chromokinesin, Kin2), the protocols are quite similar.
However, we have found that modifications to the protocol are
preferred in certain cases. For example, for MCAK, the PIPES-based
buffers were not suitable for production of active proteins, and
therefore the success of Tris-based buffers were discovered.
[0133] Expression Protocol:
[0134] Typical culture volume for a preparation is 1-2 liters, with
each 500 ml of culture being contained in a 2 liter flask to
promote aeration. Typical culture media is LB medium with 10 ppm
antifoam. Alternatively, TB medium is also suitable. Media is
inoculated in the morning with a single fresh colony of bacterial
cells (for example, E. Coli strain BL21(DE3)plysS) harboring an
expression plasmid (for example, those plasmids described above).
For all kinesins, cultures are grown at 37.degree. C. with shaking
until OD.sub.800 reaches about 0.8 at which point cultures continue
to shake at room temperature for about 30-45 minutes. To provide a
pre-induction sample, 500 .mu.l of culture is spun down and frozen
at -20.degree. C. at this point. To induce protein production, IPTG
is added to 0.2 mM (or 0.5 mM for CENP-E and MCAK), and shaking is
continued overnight. On the following morning (after 12-16 hours),
another 500 .mu.l sample is collected, spun down, and frozen at
-20.degree. C. The remainder of cells are harvested by
centrifugation at 4.degree. C. for 30 minutes (for example, using a
Beckman Allegra 6R Centrifuge at 3000 rpm or using a JLA 10 rotor
in a Beckman Avanti J-25 centrifuge at 5000 rpm).
[0135] Purification Protocol:
[0136] The preferred buffers for each kinesin are described at the
end of this section. From this point, all solutions are kept on ice
and/or in a 4.degree. C. environment Cell pellets are resuspended
in lysis buffer supplemented with protease inhibitors (for example
1.times.concentrations of Complete EDTA-free protease inhibitors
(Boehringer 1836 170)). 20 ml of lysis buffer is used for every 1
liter of culture. Dounce homogenization is conducted to ensure
complete resuspension. At this point it is possible to freeze the
cell suspension in liquid nitrogen and store it at -80.degree. C.
If cell suspension is frozen at this point, fresh DTT (and ATP for
MCAK) are added upon thawing. Cells are lysed with a microfluidizer
by running 2 passes, 7-8 cycles each at 80 psi. If cell suspension
had been frozen, only 1 pass of 3 cycles is used. About 10 mis of
extra lysis buffer is passed through the microfluidizer chamber to
rinse it. Lysate is clarified by centrifugation (for example, for
45 minutes at 22,000 rpm in a JA25.50 rotor in a Beckman Avanti
J-25 Centrifuge, or for 30-45 minutes at 30,000 rpm in a 45 Ti
Rotor in a Beckman Optima LE-80K Ultracetnrifuge).
[0137] For MCAK, 0.5 ml of Ni-NTA resin (Qiagen 31014) is used for
every 1 liter of culture. For all others, 1.5 ml of Ni-NTA resin is
used for every 1 liter of culture. Resin is equilibrated with lysis
buffer by washing 2 times with 15 ml of buffer without DTT and
protease inhibitors. During these washes, resin is collected by
spinning at 600-700 rpm for about 2 minutes in a bench-top
centrifuge. 100 .mu.l of lysate is reserved before addition to the
resin. Remainder of clarified lysate is added to the resin and
incubated at 4.degree. C. for hour (20 minutes for MCAK) with
rocking.
[0138] For Chromokinesin, Kin2, MKLP1, KSP and CENP-E, resin is
collected by spinning at 600-700 rpm for about 2 minutes in a
bench-top centrifuge. Supernatant is removed and a 100 .mu.l sample
is saved. Resin is resuspended in 5-10 ml lysis buffer with
0.1.times.protease inhibitors, and slurry is poured into a column
For MCAK, lysate/resin slurry is directly poured into a column (for
example, BioRad 1 cm ID EconoColumn), and flowthrough is collected
and a 100 .mu.l sample of flowthrough is reserved.
[0139] Column is then washed (using either gravity flow or a
peristaltic pump at 1 ml/min) with 50 ml of lysate buffer. Column
is then washed with 10 ml of wash buffer. Protein is eluted from
column with 8 ml of elution buffer containing 0.1.times.protease
inhibitors, and 1 ml fractions are collected. Fractions containing
protein peak as measured by Bradford assay are pooled, and protein
is diluted to 2 mg/ml with wash buffer with 0.1.times.protease
inhibitors (for KSP, do not include Imidazole in wash buffer used
for dilution). Aliquots are quick-frozen in liquid nitrogen and
stored at -80.degree. C.
[0140] Buffers Used in Purification Procedure
[0141] Chromokinesin, Kin2, MKLP-1, HSET, ATSV Buffers:
[0142] Lysis Buffer: 50 mM tris/HCl; 250 mM NaCl; 10 mM Imidazole;
2 mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 7.4.
[0143] Wash Buffer: 50 mM PIPES; 10% Sucrose; 100 mM NaCl; 2 mM
MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 6.8 with NaOH.
[0144] Elution Buffer: 50 mM PIPES; 10% Sucrose; 300 mM Imidazole;
100 mM NaCl; 2 mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 6.8 with
NaOH.
[0145] KSP Buffers:
[0146] Lysis Buffer 50 mM tris/HCl; 250 mM NaCl; 10 mM Imidazole; 2
mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 7.4.
[0147] Wash Buffer: 50 mM PIPES; 10% Sucrose; 40 mM Imidazole, 100
mM NaCl; 2 mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 6.8 with
NaOH.
[0148] Elution Buffer: 50 mM PIPES; 10% Sucrose; 200 or 250 mM
Imidazole; 100 mM NaCl; 2 mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH
6.8 with NaOH.
[0149] CENP-E Buffers:
[0150] Lysis Buffer 50 mM tris/HCl; 250 mM NaCl; 10 mM Imidazole; 2
mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; 0.1mM ATP, pH 7.4.
[0151] Wash Buffer: 50 mM PIPES; 10% Sucrose; 100 mM NaCl; 2 mM
MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 6.8 with NaOH.
[0152] Elution Buffer 50 mM PIPES; 10% Sucrose; 300 mM Imidazole;
100 mM NaCl; 2 mM MgCl.sub.2; 1 mM EGTA; 1 mM DTT; pH 6.8 with
NaOH.
[0153] MCAK Buffers:
[0154] Lysis Buffer: 50 mM tris/HCl; 50 mM NaCl; 10 mM Imidazole; 5
mM MgCl2; 1 mM EGTA; 1 mM DTT; 1mM ATP pH 6.8.
[0155] Wash Buffer: 50 mM tris/HCl; 50 mM NaCl; 50 mM Imidazole;
5mM MgCl2 1 mM EGTA; 1 mM DTT; 1 mM ATP, 20%sucrose; pH 6.8.
[0156] Elution Buffer: 50 mM tris/HCl; 50 mM NaCl; 100 mM
Imidazole; 5mM MgCl2 1 mM EGTA; 1 mM DTT;1mM ATP; 20%sucrose; pH
6.8.
[0157] Results of Purification:
[0158] Successful application of this protocol is measured by the
yield, purity and activity of the desired protein. Table III
describes results using the protocol detailed above. We have
assessed "activity" by the ability of the protein to hydrolyze ATP
in a manner stimulated by microtubules. The motor domain of the
kinesins is responsible for this enzymatic process. All of the
constructs contain the motor domain, and differ in the amount of
flanking sequence. We find that the character of the fragment can
affect yield and purity (see Table III). We find that the
purification conditions used can affect yield, purity and activity.
The protocol above describes the most successful conditions, and
Table III describes the outcome resulting from the preferred
protocol. There were also conditions tested that were not
successful. For example, for KSP, elution buffer containing varying
amounts of imidazole were tested. 50 mM and 100 mM
imidazole-containing elution buffers failed to elute most protein,
so yields were low. However, 200 mM and 250 mM imidazole-containing
elution buffers resulted in high yields of active protein. As
another example, for MCAK, the PIPES-based buffers were not
suitable for production of active proteins as discussed above,
therefore successful results were discovered with Tris-based
buffers.
4TABLE III Production and Purification Results: Construct Residues
Kinesin Name Included Production Activity Chromokinesin K335
E2-K335 Expresses well Low Chromokinesin Q475 E2-Q475 Expresses
well High Chromokinesin D679 E2-D679 Expresses well High
Chromokinesin FL1 E2-H1229 Does not express well n/a Kin2 P166
P166-A532 Expresses well Yes Kin2 H195 H195-A532 Expresses well Yes
Kin2 FL2 M1-L679 Does not express well n/a MKLP1 E433 A4-E433
Expresses well Yes MKLP1 R494 A4-R494 Expresses well Yes MKLP1 E658
A4-E658 Does not express well n/a KSP L360 M1-L360 Expresses well
Yes KSP K491 M1-K491 Expresses well Yes KSP S553 M1-S553 Not as
well as L360 and K491 n/a CENP-E M329 A2-M329 Expresses well, but
relatively Yes impure CENP-E T340 A2-T340 Expresses well Yes CENP-E
S405 A2-S405 Expresses well Yes CENP-E V465 A2-V465 Expresses well,
but relatively Yes impure CENP-E T488 A2-T488 Expresses well, but
relatively Yes impure MCAK M1 R189-P617 Expresses well, low
solubility Low MCAK M2 P228-P617 Expresses well, low solubility Low
MCAK M3 H257-P617 Expresses well, low solubility Moderate MCAK M4
R189-P660 Expresses well, low solubility Low MCAK M5 P228-P660
Expresses well, low solubility Low MCAK M5 H257-P660 Expresses
well, low solubility Moderate MCAK FL3 M3-Q725 Expresses well, low
solubility Low Kid A2N370 A2-N370 Expresses well Not tested Kid
A2M511 A2-M511 Expresses well Not tested HSET K519 L72-K519 Low
expression Low HSET E152.2 E152-K519 Expresses well Yes HSET Q151.3
Q151-K519 Expresses well Yes ATSV Q353 G3-Q353 Expresses well High
ATSV M472 G3-M472 Expresses well Low
* * * * *
References