U.S. patent application number 09/258133 was filed with the patent office on 2003-03-06 for nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures.
Invention is credited to ANDERSON, STEPHEN, GOELET, PHILIP, KNAPP, MICHAEL R..
Application Number | 20030044779 09/258133 |
Document ID | / |
Family ID | 27099072 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030044779 |
Kind Code |
A1 |
GOELET, PHILIP ; et
al. |
March 6, 2003 |
NUCLEIC ACID TYPING BY POLYMERASE EXTENSION OF OLIGONUCLEOTIDES
USING TERMINATOR MIXTURES
Abstract
This invention concerns a reagent composition comprising at
least two different terminators of a nucleic acid
template-dependent, primer extension reaction. This invention also
concerns a method for determining the identity of a nucleotide base
at a specific position in a nucleic acid of interest. This
invention further concerns a method for determining the presence or
absence of a particular nucleotide sequence in a sample of nucleic
acids. This invention further concerns a method for identifying
different alleles in a sample containing nucleic acids. This
invention further concerns a method for determining the genotype of
an organism at one or more particular genetic loci.
Inventors: |
GOELET, PHILIP;
(COCKEYSVILLE, MD) ; KNAPP, MICHAEL R.;
(BALTIMORE, MD) ; ANDERSON, STEPHEN; (PRINCETON,
NJ) |
Correspondence
Address: |
DAVID A. KALOW, ESQ.
KALOW, SPRINGUT & BRESSLER, LLP
488 MADISON AVENUE
19TH FLOOR
NEW YORK
NY
10022
US
|
Family ID: |
27099072 |
Appl. No.: |
09/258133 |
Filed: |
February 26, 1999 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09258133 |
Feb 26, 1999 |
|
|
|
07775786 |
Oct 11, 1991 |
|
|
|
6004744 |
|
|
|
|
09258133 |
Feb 26, 1999 |
|
|
|
07664837 |
Mar 5, 1991 |
|
|
|
5888819 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6858 20130101;
C12Q 1/6827 20130101; C12Q 1/6827 20130101; C12Q 1/6869 20130101;
C12Q 2525/121 20130101; C12Q 2535/101 20130101; C12Q 2537/143
20130101; C12Q 2563/107 20130101; C12Q 2535/125 20130101; C12Q
1/6881 20130101; C12Q 2600/156 20130101; C12Q 1/6869 20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34; C12Q 001/70 |
Claims
What is claimed is:
1. A reagent composition which comprises an aqueous carrier and an
admixture of at least two different terminators of a nucleic acid
template-dependent, primer extension reaction, each of the
terminators being capable of specifically terminating the extension
reaction in a manner strictly dependent on the identity of the
unpaired nucleotide base in the template immediately adjacent to,
and downstream of, the 3' end of the primer, and at least one of
the terminators being labeled with a detectable marker.
2. A reagent of claim 1, wherein the reagent comprises four
different terminators.
3. A reagent of claim 2, wherein two of the terminators are
labeled, each with a different detectable marker.
4. A reagent of claim 2, wherein three of the terminators are
labeled, each with a different detectable marker.
5. A reagent of claim 2, wherein the four terminators are labeled,
each with a different detectable marker.
6. A reagent of any of claims 1-5, wherein the terminator(s)
comprise(s) a nucleotide or nucleotide analog.
7. A reagent of claim 6, wherein the terminator(s) comprise(s)
dideoxynucleotides.
8. A reagent of claim 6, wherein the terminator(s) comprise(s)
arabinoside triphosphates.
9. A reagent of claim 7, wherein the terminator(s) comprise(s) one
or more of ddATP, ddCTP, ddGTP or ddTTP.
10. A reagent of any of claims 1-5, wherein each of the different
detectable markers is an isotopically labeled moiety, a
chromophore, a fluorophore, a protein moiety, or a moiety to which
an isotopically labeled moiety, a chromophore, a fluorophore, or a
protein moiety can be attached.
11. A reagent of claim 10, wherein each of the different detectable
markers is a different fluorophore.
12. A reagent of any of claims 1-5, wherein the reagent further
comprises pyrophosphatase.
13. A method of determining the identity of a nucleotide base at a
specific position in a nucleic acid of interest which comprises:
(a) treating a sample containing the nucleic acid of interest, if
such nucleic acid is double-stranded, so as to obtain unpaired
nucleotide bases spanning the specific position, or directly
employing step (b) if the nucleic acid of interest is
single-stranded; (b) contacting the sample from step (a), under
hybridizing conditions, with an oligonucleotide primer which is
capable of hybridizing with a stretch of nucleotide bases present
in the nucleic acid of interest, immediately adjacent to the
nucleotide base to be identified, so as to form a duplex between
the primer and the nucleic acid of interest such that the
nucleotide base to be identified is the first unpaired base in the
template immediately downstream of the 3' end of the primer in said
duplex; (c) contacting the duplex from step (b) with a reagent of
claim 5, under conditions permitting base pairing of a
complementary terminator present in the reagent with the nucleotide
base to be identified and occurrence of a template-dependent,
primer extension reaction so as to incorporate the terminator at
the 3' end of the primer, the net result being that the primer has
been extended by one terminator; and, (d) determining the identity
of the detectable marker present at the 3' end of the extended
primer from step (c) and thereby determining the identity of the
nucleotide base at the specific position in the nucleic acid of
interest.
14. A method of determining the identity of a nucleotide base at a
specific position in a nucleic acid of interest which comprises:
(a) treating a sample containing the nucleic acid of interest, if
such nucleic acid is double-stranded, so as to obtain unpaired
nucleotide bases spanning the specific position, or directly
employing step (b) if the nucleic acid of interest is
single-stranded; (b) contacting the sample from step (a), under
hybridizing conditions, with an oligonucleotide primer which is
capable of hybridizing with a stretch of nucleotide bases present
in the nucleic acid of interest, immediately adjacent to the
nucleotide base to be identified, so as to form a duplex between
the primer and the nucleic acid of interest such that the
nucleotide base to be identified is the first unpaired base in the
template immediately downstream of the 3' end of the primer in said
duplex; (c) contacting the duplex from step (b) with a reagent of
claim 2, wherein only one of the terminators has a detectable
marker, under conditions permitting base pairing of a complementary
terminator present in the reagent with the nucleotide base to be
identified and occurrence of a template-dependent primer extension
reaction so as to incorporate the terminator at the 3' end of the
primer, the net result being that the primer has been extended by
one terminator; (d) repeating step (c) three additional times, with
a different one of each of the four terminators being labeled in
each of the four parallel reaction steps; and, (e) determining
which of the products of the four parallel template-dependent,
primer extension reactions has a detectable marker present at the
3' end of the primer and thereby determining the identity of the
nucleotide base at the specific position in the nucleic acid of
interest.
15. A method of determining the presence or absence of a particular
nucleotide sequence in a sample of nucleic acids which comprises:
(a) treating the sample of nucleic acids, if such sample of nucleic
acids contains double-stranded nucleic acids, so as to obtain
single-stranded nucleic acids, or directly employing step (b) if
the sample of nucleic acids contains only single-stranded nucleic
acids; (b) contacting the sample from step (a), under hybridizing
conditions, with an oligonucleotide primer which is capable of
hybridizing with the particular nucleotide sequence, if the
particular nucleotide sequence is present, so as to form a duplex
between the primer and the particular nucleotide sequence; (c)
contacting the duplex, if any, from step (b) with a reagent of
claim 5, under conditions permitting base pairing of a
complementary terminator present in the reagent with the unpaired
template nucleotide base immediately downstream of the 3' end of
the primer, the primer being hybridized with the particular
nucleotide sequence in the template, and occurrence of a
template-dependent, primer extension reaction so as to incorporate
the terminator at the 3' end of the primer; and, (d) determining
the absence or presence and identity of a detectable marker at the
3' end of the primer from step (c) and thereby determining the
presence or absence of the particular nucleotide sequence in the
sample of nucleic acids.
16. A method of determining the presence or absence of a particular
nucleotide sequence in a sample of nucleic acids which comprises:
(a) treating the sample of nucleic acids, if such sample of nucleic
acids contains double-stranded nucleic acids, so as to obtain
single-stranded nucleic acids, or directly employing step (b) if
the sample of nucleic acids contains only single-stranded nucleic
acids; (b) contacting the sample from step (a), under hybridizing
conditions, with an oligonucleotide primer which is capable of
hybridizing with the particular nucleotide sequence, if the
particular nucleotide sequence is present, so as to form a duplex
between the primer and the particular nucleotide sequence; (c)
contacting the duplex, if any, from step (b) with a reagent of
claim 2, wherein only one of the terminators has a detectable
marker, under conditions permitting base pairing of a complementary
terminator present in the reagent with the unpaired template
nucleotide base immediately downstream of the 3' end of the primer,
the primer being hybridized with the particular nucleotide sequence
in the template, and occurrence of a template-dependent, primer
extension reaction so as to incorporate the terminator at the 3'
end of the primer; (d) repeating step (c) three additional times,
with a different one of each of the four terminators being labeled
in each of the four parallel reaction steps; and, (e) determining
the absence or presence and identity of a detectable marker at the
3' end of the primer in the products of each of the four parallel
template-dependent, primer extension reactions and thereby
determining the presence or absence of the particular nucleotide
sequence in the sample of nucleic acids.
17. A method of typing a sample containing nucleic acids which
comprises identifying the nucleotide base or bases present at each
of one or more specific positions, each such nucleotide base being
identified using the method of claim 13 or 14, and each such
specific position being determined using a different primer.
18. A method of claim 17, wherein the identity of each nucleotide
base or bases at each position is determined individually or
wherein the identities of the nucleotide bases at different
positions are determined simultaneously.
19. A method of typing a sample containing nucleic acids which
comprises determining the presence or absence of one or more
particular nucleotide sequences, the presence or absence of each
such nucleotide sequence being determined by the method of claim 15
or 16.
20. A method of typing a sample containing nucleic acids which
comprises: (a) determining the presence or absence of one or more
particular nucleotide sequences, the presence or absence of each
such nucleotide sequence being determined by the method of claim 15
or 16; and, (b) identifying the nucleotide base or bases present at
each of one or more specific positions, each such nucleotide base
being identified using the method of claim 13 or 14, and each such
specific position being determined using a different primer.
21. A method for identifying different alleles in a sample
containing nucleic acids which comprises identifying the nucleotide
base or bases present at each of one or more specific positions,
each such nucleotide base being identified by the method of claim
13 or 14.
22. A method for determining the genotype of an organism at one or
more particular genetic loci which comprises: (a) obtaining from
the organism a sample containing genomic DNA; and (b) identifying
the nucleotide base or bases present at each of one or more
specific positions in nucleic acids of interest, each such base or
bases being identified using the method of claim 13 or 14, and
thereby identifying different alleles and thereby, in turn,
determining the genotype of the organism at one or more particular
genetic loci.
23. A method of claim 13 or 14, wherein the conditions for the
occurrence of the template-dependent, primer extension reaction in
step (c) are created, in part, by the presence of a suitable
template-dependent enzyme.
24. A method of claim 23, wherein the template-dependent enzyme is
E. coli DNA polymerase I or the "Klenow fragment" thereof, T4 DNA
polymerase, T7 DNA polymerase ("Sequenase"), T. aqtuaticus DNA
polymerase, a retroviral reverse transcriptase, or combinations
thereof.
25. A method of claim 13 or 14, wherein the nucleic acid of
interest is a deoxyribonucleic acid, a ribonucleic acid, or a
copolymer of deoxyribonucleic acid and ribonucleic acid.
26. A method of claim 13 or 14, wherein the primer is an
oligodeoxyribonucleotide, an oligoribonucleotide, or a copolymer of
deoxyribonucleic acid and ribonucleic acid.
27. A method of claim 13 or 14, wherein the template is a
deoxyribonucleic acid, the primer is an oligodeoxyribonucleotide,
oligoribonucleotide, or a copolymer of deoxyribonucleotides and
ribonucleotides, and the template-dependent enzyme is a DNA
polymerase.
28. A method of claim 13 or 14, wherein the template is a
ribonucleic acid, the primer is an oligodeoxyribonucleotide,
oligoribonucleotide, or a copolymer of deoxyribonucleotides and
ribonucleotides, and the template-dependent enzyme is a reverse
transcriptase.
29. A method of claim 13 or 14, wherein the template is a
deoxyribonucleic acid, the primer is an oligoribonucleotide, and
the enzyme is an RNA polymerase.
30. A method of claim 13 or 14, wherein the template is a
ribonucleic acid, the primer is an oligoribonucleotide, and the
template-dependent enzyme is an RNA replicase.
31. A method of claim 13 or 14, wherein, prior to the primer
extension reaction in step (c), the template has been capped at its
3' end by the addition of a terminator to the 3' end of the
template, said terminator being capable of terminating a
template-dependent, primer extension reaction.
32. A method of claim 31, wherein the terminator is a
dideoxynucleotide.
33. A method of claim 13 or 14, wherein the nucleic acid of
interest has been synthesized enzymatically in vivo, synthesized
enzymatically in vitro, or synthesized non-enzymatically.
34. A method of claim 13 or 14, wherein the oligonucleotide primer
has been synthesized enzymatically in vivo, synthesized
enzymatically in vitro, or synthesized non-enzymatically.
35. A method of claim 13 or 14, wherein the oligonucleotide primer
comprises one or more moieties that permit affinity separation of
the primer from the unincorporated reagent and/or the nucleic acid
of interest.
36. A method of claim 35, wherein the oligonucleotide primer
comprises biotin which permits affinity separation of the primer
from the unincorporated reagent and/or nucleic acid of interest via
binding of the biotin to streptavidin which is attached to a solid
support.
37. A method of claim 13 or 14, wherein the sequence of the
oligonucleotide primer comprises a DNA sequence that permits
affinity separation of the primer from the unincorporated reagent
and/or the nucleic acid of interest via base pairing to a
complementary sequence present in a nucleic acid attached to a
solid support.
38. A method of claim 13 or 14, wherein the nucleic acid of
interest comprises one or more moieties that permit affinity
separation of the nucleic acid of interest from the unincorporated
reagent and/or the primer.
39. A method of claim 38, wherein the nucleic acid of interest
comprises biotin which permits affinity separation of the nucleic
acid of interest from the unincorporated reagent and/or the primer
via binding of the biotin to streptavidin which is attached to a
solid support.
40. A method of claim 13 or 14, wherein the sequence of the nucleic
acid of interest comprises a DNA sequence that permits affinity
separation of the nucleic acid of interest from the unincorporated
reagent and/or the primer via base pairing to a complementary
sequence present in a nucleic acid attached to a solid support.
41. A method of claim 13 or 14, wherein the oligonucleotide primer
is labeled with a detectable marker.
42. A method of claim 41, wherein the oligonucleotide primer is
labeled with a detectable marker that is different from any
detectable marker present in the reagent or attached to the nucleic
acid of interest.
43. A method of claim 13 or 14, wherein the nucleic acid of
interest is labeled with a detectable marker.
44. A method of claim 43, wherein the nucleic acid of interest is
labeled with a detectable marker that is different from any
detectable marker present in the reagent or attached to the
primer.
45. A method of claim 13 or 14, wherein the nucleic acid of
interest comprises non-natural nucleotide analogs.
46. A method of claim 45, wherein the non-natural nucleotide
analogs comprise deoxyinosine or 7-deaza-2'-deoxyguanosine.
47. A method of claim 13 or 14, wherein the nucleic acid of
interest has been synthesized by the polymerase chain reaction.
48. A method of claim 13 or 14, wherein the sample comprises
genomic DNA from an organism, RNA transcripts thereof, or cDNA
prepared from RNA transcripts thereof.
49. A method of claim 13 or 14, wherein the sample comprises
extragenomic DNA from an organism, RNA transcripts thereof, or cDNA
prepared from RNA transcripts thereof.
50. A method of claim 13 or 14, wherein the primer is substantially
complementary to the known base sequence immediately adjacent to
the base to be identified.
51. A method of claim 13 or 14, wherein the primer is fully
complementary to the known base sequence immediately adjacent to
the base to be identified.
52. A method of claim 13 or 14, wherein the primer is separated
from the nucleic acid of interest after the primer extension
reaction in step (c) by using appropriate denaturing
conditions.
53. A method of claim 52, wherein the denaturing conditions
comprise heat, alkali, formamide, urea, glyoxal, enzymes, and
combinations thereof.
54. A method of claim 53, wherein the denaturing conditions
comprise treatment with 0.2 N NaOH.
55. A method of claim 48, wherein the organism is a plant,
microorganism, virus, or bird.
56. A method of claim 48, wherein the organism is a vertebrate or
invertebrate.
57. A method of claim 48, wherein the organism is a mammal.
58. A method of claim 57, wherein the mammal is a human being.
59. A method of claim 57, wherein the mammal is a horse, dog, cow,
cat, pig, or sheep.
Description
[0001] This application is a continuation-in-part of U.S. Ser. No.
664,837 filed Mar. 5, 1991, the contents of which are hereby
incorporated by reference into the present disclosure.
BACKGROUND OF THE INVENTION
[0002] This invention relates to the field of nucleic acid sequence
detection. The detection of nucleic acid sequences can be used in
two general contexts. First, the detection of nucleic acid
sequences can be used to determine the presence or absence of a
particular genetic element. Second, the detection of nucleic acid
sequences can be used to determine the specific type of a
particular genetic element that is present. Variant genetic
elements usually exist. Many techniques have been developed (1) to
determine the presence of specific nucleic acid sequences, and (2)
to compare homologous segments of nucleic acid sequence to
determine if the segments are identical or if they differ at one or
more nucleotides. Practical applications of these techniques
include genetic disease diagnoses, infectious disease diagnoses,
forensic techniques, paternity determinations, and genome
mapping.
[0003] In general, the detection of nucleic acids in a sample and
the subtypes thereof depends on the technique of specific nucleic
acid hybridization in which the oligonucleotide probe is annealed
under conditions of high stringency to nucleic acids in the sample,
and the successfully annealed probes are subsequently detected (see
Spiegelman, S., Scientific American, Vol. 210, p. 48 (1964)).
[0004] The most definitive method for comparing DNA segments is to
determine the complete nucleotide sequence of each segment.
Examples of how sequencing has been used to study mutations in
human genes are included in the publications of Engelke, et al.,
Proc. Natl. Acad. Sci. U.S.A., 85:544-548 (1988) and Wong, et al.,
Nature, 330:384-386 (1987). At the present time, it is not
practical to use extensive sequencing to compare more than just a
few DNA segments because the effort required to determine,
interpret, and compare sequence information is time-consuming.
[0005] A commonly used screen for DNA polymorphisms arising from
DNA sequence variation consists of digesting DNA with restriction
endonucleases and analyzing the resulting fragments by means of
Southern blots, as described by Botstein, et al., Am. J. Hum.
Genet., 32:314-331 (1980) and White, et al., Sci. Am., 258:40-48
(1988). Mutations that affect the recognition sequence of the
endonuclease will preclude enzymatic cleavage at that site, thereby
altering the cleavage pattern of that DNA. DNAs are compared by
looking for differences in restriction fragment lengths. A major
problem with this method (known as restriction fragment length
polymorphism mapping or RFLP mapping) is its inability to detect
mutations that do not affect cleavage with a restriction
endonuclease. Thus, many mutations are missed with this method. One
study, by Jeffreys, Cell, 18:1-18 (1979), was able to detect only
0.7% of the mutational variants estimated to be present in a 40,000
base pair region of human DNA. Another problem is that the methods
used to detect restriction fragment length polymorphisms are very
labor intensive, in particular, the techniques involved with
Southern blot analysis.
[0006] A technique for detecting specific mutations in any segment
of DNA is described in Wallace, et al., Nucl. Acids Res., 9:879-894
(1981). It involves hybridizing the DNA to be analyzed (target DNA)
with a complementary, labeled oligonucleotide probe. Due to the
thermal instability of DNA duplexes containing even a single base
pair mismatch, differential melting temperature can be used to
distinguish target DNAs that are perfectly complementary to the
probe from target DNAs that differ by as little as a single
nucleotide. In a related technique, described in Landegren, et al.,
Science, 41:1077-1080 (1988), oligonucleotide probes are
constructed in pairs such that their junction corresponds to the
site on the DNA being analyzed for mutation. These oligonucleotides
are then hybridized to the DNA being analyzed. Base pair mismatch
between either oligonucleotide and the target DNA at the junction
location prevents the efficient joining of the two oligonucleotide
probes by DNA ligase.
[0007] A. Nucleic Acid Hybridization
[0008] The base pairing of nucleic acids in a hybridization
reaction forms the basis of most nucleic acid analytical and
diagnostic techniques. In practice, tests based only on parameters
of nucleic acid hybridization function poorly in cases where the
sequence complexity of the test sample is high. This is partly due
to the small thermodynamic differences in hybrid stability,
generated by single nucleotide changes, and the fact that
increasing specificity by lengthening the probe has the effect of
further diminishing this differential stability. Nucleic acid
hybridization is, therefore, generally combined with some other
selection or enrichment procedure for analytical and diagnostic
purposes.
[0009] Combining hybridization with size fractionation of
hybridized molecules as a selection technique has been one general
diagnostic approach. Size selection can be carried out prior to
hybridization. The best known prior size selection technique is
Southern Blotting (see Southern, E., Methods in Enzymology, 69:152
(1980). In this technique, a DNA sample is subjected to digestion
with restriction enzymes which introduce double stranded breaks in
the phosphodiester backbone at or near the site of a short sequence
of nucleotides which is characteristic for each enzyme. The
resulting heterogeneous mixture of DNA fragments is then separated
by gel electrophoresis, denatured, and transferred to a solid phase
where it is subjected to hybridization analysis in situ using a
labeled nucleic acid probe. Fragments which contain sequences
complementary to the labeled probe are revealed visually or
densitometrically as bands of hybridized label. A variation of this
method is Northern Blotting for RNA molecules. Size selection has
also been used after hybridization in a number of techniques, in
particular by hybrid protection techniques, by subjecting
probe/nucleic acid hybrids to enzymatic digestion before size
analysis.
[0010] B. Polymerase Extension of Duplex Primer:Template
Complexes
[0011] Hybrids between primers and DNA targets can be analyzed by
polymerase extension of the hybrids. A modification of this
methodology is the polymerase chain reaction in which the
purification is produced by sequential hybridization reactions of
anti-parallel primers, followed by enzymatic amplification with DNA
polymerase (see Saiki, et al., Science 239:487-491 (1988)). By
selecting for two hybridization reactions, this methodology
provides the specificity lacking in techniques that depend only
upon a single hybridization reaction.
[0012] It has long been known that primer-dependent DNA polymerases
have, in general, a low error rate for the addition of nucleotides
complementary to a template. This feature is essential in biology
for the prevention of genetic mistakes which would have detrimental
effects on progeny. The specificity inherent in this enzymological
reaction has been widely exploited as the basis of the "Sanger" or
dideoxy chain termination sequencing methodology which is the
ultimate nucleic acid typing experiment. One type of Sanger DNA
sequencing method makes use of mixtures of the four deoxynucleoside
triphosphates, which are normal DNA precursors, and one of the four
possible dideoxynucleoside triphosphates, which have a hydrogen
atom instead of a hydroxyl group attached to the 3' carbon atom of
the ribose sugar component of the nucleotide. DNA chain elongation
in the 5' to 3' direction ("downstream") requires this hydroxyl
group. As such, when a dideoxynucleotide is incorporated into the
growing DNA chain, no further elongation can occur. With one
dideoxynucleotide in the mixture, DNA polymerases can, from a
primer:template combination, produce a population of molecules of
varying length, all of which terminate after the addition of one
out of the four possible nucleotides. The series of four
independent reactions, each with a different dideoxynucleotide,
generates a nested set of fragments, all starting at the same 5'
terminus of the priming DNA molecule and terminating at all
possible 3' nucleotide positions.
[0013] Another utilization of dideoxynucleoside triphosphates and a
polymerase in the analysis of DNA involves labeling the 3' end of a
molecule. One prominent manifestation of this technique provides
the means for sequencing a DNA molecule from its 3' end using the
Maxam-Gilbert method. In this technique, a molecule with a
protruding 3' end is treated with terminal transferase in the
presence of radioactive dideoxy-ATP. One radioactive nucleotide is
added, rendering the molecule suitable for sequencing. Both methods
of DNA sequencing using labeled dideoxynucleotides require
electrophoretic separation of reaction products in order to derive
the typing information. Most methods require four separate gel
tracks for each typing determination.
[0014] The following two patents describe other methods of typing
nucleic acids which employ primer extension and labeled
nucleotides. Mundy (U.S. Pat. No. 4,656,127) describes a method
whereby a primer is constructed complementary to a region of a
target nucleic acid of interest such that its 3' end is close to a
nucleotide in which variation can occur. This hybrid is subject to
primer extension in the presence of a DNA polymerase and four
deoxynucleoside triphosphates, one of which is an
.alpha.-thionucleotide. The hybrid is then digested using an
exonuclease enzyme which cannot use thio-derivatized DNA as a
substrate for its nucleolytic action (for example Exonuclease III
of E. coli). If the variant nucleotide in the template is
complementary to one of the thionucleotides in the reaction
mixture, the resulting extended primer molecule will be of a
characteristic size and resistant to the exonuclease; hybrids
without thio-derivatized DNA will be digested. After an appropriate
enzyme digest to remove underivatized molecules, the
thio-derivatized molecule can be detected by gel electrophoresis or
other separation technology.
[0015] Vary and Diamond (U.S. Pat. No. 4,851,331) describes a
method similar to that of Mundy wherein the last nucleotide of the
primer corresponds to the variant nucleotide of interest. Since
mismatching of the primer and the template at the 3' terminal
nucleotide of the primer is counterproductive to elongation,
significant differences in the amount of incorporation of a tracer
nucleotide will result under normal primer extension conditions.
This method depends on the use of a DNA polymerase, e.g., AMV
reverse transcriptase, that does not have an associated 3' to 5'
exonuclease activity. The methods of Mundy and of Vary and Diamond
have drawbacks. The method of Mundy is useful but cumbersome due to
the requirements of the second, different enzymological system
where the non-derivatized hybrids are digested. The method of Vary
is complicated by the fact that it does not generate discrete
reaction products. Any "false" priming will generate significant
noise in such a system which would be difficult to distinguish from
a genuine signal.
[0016] The present invention circumvents the problems associated
with the methods of Mundy and of Vary and Diamond for typing
nucleic acid with respect to particular nucleotides. With methods
employing primer extension and a DNA polymerase, the current
invention will generate a discrete molecular species one base
longer than the primer itself. In many methods, particularly those
employing the polymerase chain reaction, the type of reaction used
to purify the nucleic acid of interest in the first step can also
be used in the subsequent detection step. Finally, with terminators
which are labeled with different detector moieties (for example
different fluorophors having different spectral properties), it
will be possible to use only one reagent for all sequence detection
experiments. Furthermore, if techniques are used to separate the
terminated primers post-reaction, sequence detection experiments at
more than one locus can be carried out in the same tube.
[0017] A recent article by Mullis (Scientific American, April 1990,
pp. 56-65) suggests an experiment, which apparently was not
performed, to determine the identity of a targeted base pair in a
piece of double-stranded DNA. Mullis suggests using four types of
dideoxynucleosides triphosphate, with one type of dideoxynucleoside
triphosphate being radioactively labeled.
[0018] The present invention permits analyses of nucleic acid
sequences that can be useful in the diagnosis of infectious
diseases, the diagnosis of genetic disorders, and in the
identification of individuals and their parentage.
[0019] A number of methods have been developed for these purposes.
Although powerful, such methodologies have been cumbersome and
expensive, generally involving a combination of techniques such as
gel electrophoresis, blotting, hybridization, and autoradiography
or non-isotopic revelation. Simpler technologies are needed to
allow the more widespread use of nucleic acid analysis. In
addition, tests based on nucleic acids are currently among the most
expensive of laboratory procedures and for this reason cannot be
used on a routine basis. Finally, current techniques are not
adapted to automated procedures which would be necessary to allow
the analysis of large numbers of samples and would further reduce
the cost.
[0020] The current invention provides a method that can be used to
diagnose or characterize nucleic acids in biological samples
without recourse to gel electrophoretic size separation of the
nucleic acid species. This feature renders this process easily
adaptable to automation and thus will permit the analysis of large
numbers of samples at relatively low cost. Because nucleic acids
are the essential blueprint of life, each organism or individual
can be uniquely characterized by identifiable sequences of nucleic
acids. It is, therefore, possible to identify the presence of
particular organisms or demonstrate the biological origin of
certain samples by detecting these specific nucleic acid
sequences.
SUMMARY OF THE INVENTION
[0021] The subject invention provides a reagent composition
comprising an aqueous carrier and an admixture of at least two
different terminators of a nucleic acid template-dependent, primer
extension reaction. Each of the terminators is capable of
specifically terminating the extension reaction in a manner
strictly dependent on the identity of the unpaired nucleotide base
in the template immediately adjacent to, and downstream of, the 3'
end of the primer. In addition, at least one of the terminators is
labeled with a detectable marker.
[0022] The subject invention further provides a reagent composition
comprising an aqueous carrier and an admixture of four different
terminators of a nucleic acid template-dependent, primer extension
reaction. Each of the terminators is capable of specifically
terminating the extension reaction as above and one, two, three, or
four of the terminators is labeled with a detectable marker.
[0023] The subject invention further provides a reagent as
described above wherein the terminators comprise nucleotides,
nucleotide analogs, dideoxynucleotides, or arabinoside
triphosphates. The subject invention also provides a reagent
wherein the terminators comprise one or more of dideoxyadenosine
triphosphate (ddATP), dideoxycytosine triphosphate (ddCTP),
dideoxyguanosine triphosphate (ddGTP), dideoxythymidine
triphosphate (ddTTP), or dideoxyuridine triphosphate (ddUTP).
[0024] The subject invention also provides a method for determining
the identity of a nucleotide base at a specific position in a
nucleic acid of interest. First, a sample containing the nucleic
acid of interest is treated, if such nucleic acid is
double-stranded, so as to obtain unpaired nucleotide bases spanning
the specific position. If the nucleic acid of interest is
single-stranded, this step is not necessary. Second, the sample
containing the nucleic acid of interest is contacted with an
oligonucleotide primer under hybridizing conditions. The
oligonucleotide primer is capable of hybridizing with a stretch of
nucleotide bases present in the nucleic acid of interest,
immediately adjacent to the nucleotide base to be identified, so as
to form a duplex between the primer and the nucleic acid of
interest such that the nucleotide base to be identified is the
first unpaired base in the template immediately downstream of the
3' end of the primer in the duplex of primer and the nucleic acid
of interest. Enzymatic extension of the oligonucleotide primer in
the resultant duplex by one nucleotide, catalyzed, for example, by
a DNA polymerase, thus depends on correct base pairing of the added
nucleotide to the nucleotide base to be identified.
[0025] The duplex of primer and the nucleic acid of interest is
then contacted with a reagent containing four labeled terminators,
each terminator being labeled with a different detectable marker.
The duplex of primer and the nucleic acid of interest is contacted
with the reagent under conditions permitting base pairing of a
complementary terminator present in the reagent with the nucleotide
base to be identified and the occurrence of a template-dependent,
primer extension reaction so as to incorporate the terminator at
the 3' end of the primer. The net result is that the
oligonucleotide primer has been extended by one terminator. Next,
the identity of the detectable marker present at the 3' end of the
extended primer is determined. The identity of the detectable
marker indicates which terminator has base paired to the next base
in the nucleic acid of interest. Since the terminator is
complementary to the next base in the nucleic acid of interest, the
identity of the next base in the nucleic acid of interest is
thereby determined.
[0026] The subject invention also provides another method for
determining the identity of a nucleotide base at a specific
position in a nucleic acid of interest. This additional method uses
a reagent containing four terminators, only one of the terminators
having a detectable marker.
[0027] The subject invention also provides a method of typing a
sample of nucleic acids which comprises identifying the base or
bases present at each of one or more specific positions, each such
nucleotide base being identified using one of the methods for
determining the identity of a nucleotide base at a specific
position in a nucleic acid of interest as outlined above. Each
specific position in the nucleic acid of interest is determined
using a different primer. The identity of each nucleotide base or
bases at each position can be determined individually or the
identities of the nucleotide bases at different positions can be
determined simultaneously.
[0028] The subject invention further provides a method for
identifying different alleles in a sample containing nucleic acids
which comprises identifying the base or bases present at each of
one or more specific positions. The identity of each nucleotide
base is determined by the method for determining the identity of a
nucleotide base at a specific position in a nucleic acid of
interest as outlined above.
[0029] The subject invention also provides a method for determining
the genotype of an organism at one or more particular genetic loci
which comprises obtaining from the organism a sample containing
genomic DNA and identifying the nucleotide base or bases present at
each of one or more specific positions in nucleic acids of
interest. The identity of each such base is determined by using one
of the methods for determining the identity of a nucleotide base at
a specific position in a nucleic acid of interest as outlined
above. The identities of the nucleotide bases determine the
different alleles and, thereby, determine the genotype of the
organism at one or more particular genetic loci.
BRIEF DESCRIPTION OF THE FIGURES
[0030] FIG. 1. Autoradiography of labeled DNA products after
fractionation on a polyacrylamide/urea gel. Panel A shows products
of the "A" extension reaction on oligonucleotide primer 182
directed by template oligonucleotides 180 or 181. Panel B shows
products of the "B" termination reaction on oligonucleotide primer
182 annealed to template oligonucleotides 180 or 181. Panel C shows
the same products as in panel B after purification on magnetic
beads. Note: oligodeoxynucleotide 182 was used as supplied by
Midland Certified Reagents with no further purification. The minor
bands above and below the main band are presumably contaminants due
to incomplete reactions or side reactions that occurred during the
step-wise synthesis of the oligonucleotide. For a definition of the
"A" extension reaction and the "B" termination reaction, see "A.
GENERAL METHODS" in the Detailed Description of the Invention.
[0031] FIG. 2. Detection of Sequence Polymorphisms in PCR Products.
Target polymorphic DNA sequence showing amplification primers,
detection primers, and molecular clone (plasmid) designations. For
each primer, sites of binding to one or the other strand of the
target DNA sequence are indicated by underlining, and the direction
of DNA synthesis is indicated by an arrow. Numbering for the target
sequence is shown in the righthand margin. Polymorphic sites at
positions 114 and 190 are indicated by bold lettering and a slash
between the two polymorphic possibilities.
[0032] FIG. 3. Autoradiogram of gel-analyzed polymorphism test on
PCR products. Templates from PCR products of p183, p624, or p814
were analyzed with the detection primers, TGL182 and TGL166, in a
template-directed chain extension experiment, as described in the
specification. Reaction products were fractionated by size on a
polyacrylamide/urea DNA sequencing gel, and incorporation of
[.sup.35S]-.alpha.-thio-dideoxy adenosine monophosphate was assayed
by autoradiography.
[0033] FIG. 4. Gel electrophoretic analysis of the labelled
extension products of primers TGL346 and TGL391. Productive
primer-template complexes of TGL346 or TGL391 with the bead-bound
oligonucleotide template, TGL382, were subjected to primer
extension labelling reactions with the four different
[.alpha.-thio-.sup.35S]dideoxynucleoside triphosphate mixes.
Labelled primer DNA was released from the washed beads and
electrophoresed on an 8% polyacrylamide/8 M urea DNA sequencing gel
(2.5 pmoles of primer/lane), then analyzed by autoradiography. The
four lanes shown for the primer TGL346 indicate that labelling
occurred predominantly with the ddC mix, indicating that the next
unpaired base in the TGL382 template adjacent to the 3' end of
TGL346 was a G (see sequence given in Example 4). The four lanes
shown for the primer TGL391 indicate that the labelling occurred
predominantly with the ddT mix, indicating that the next unpaired
base in the TGL382 template adjacent to the 3' end of TGL391 was an
A.
[0034] FIG. 5. Autoradiographic analyses of total radioactivity
bound to beads. The bead suspensions, containing the products of
the extension reactions described in FIG. 5, were spotted onto
filter paper (1 pmole of primer per spot) and exposed to X-ray film
to assay total bead-bound radioactivity. As shown, TGL346
predominantly incorporated label from the ddC mix and TGL391
predominantly from the ddT mix.
[0035] FIG. 6. PCR-amplified polymorphic locus of mammalian DNA.
Shown is a 327 basepair segment of mammalian DNA that was amplified
from samples of genomic DNA using the PCR primers TGL240
(biotinylated) and TGL239 (unbiotinylated). Samples of DNA from two
homozygous individuals, ESB164 (genotype AA) and EA2014 (genotype
BB), were subjected to the analyses described in Example 5. The
complete DNA sequence of the A allele at this locus is shown, with
the polymorphic sites where the B allele sequence differs from the
A allele sequence indicated by the bases underneath the A sequence.
The detection primer, TGL308, is shown base-paired with the
template strand extending from the biotinylated primer. For the A
allele, the first unpaired template base immediately downstream of
the 3' end of TGL308 is a C, and for the B allele this base is an
A. Thus, the A allele should result in labelling of TGL308 by the
ddG mix only, and the B allele should result in labelling by the
ddT mix only.
[0036] FIG. 7. Gel electrophoretic analysis of PCR products from
two different homozygous individuals. Primers TGL240 and TGL239
were used to amplify genomic DNA (obtained from blood) from two
individuals, ESB164 and EA2014. The products of the extension
reactions for primer TGL308, annealled to the bead-bound,
PCR-generated template as outlined in FIG. 7, were analyzed by
electrophoresis on an 8% polyacrylamide/8 M urea DNA sequencing gel
as outlined in FIG. 5. Shown for individual ESB164 (genotype AA:
labelling expected from the ddG mix) are 250 fmoles of extended
primer from the four different ddNTP labelling reactions. Shown for
individual EA2014 (genotype BB: labelling expected from the ddT
mix) are loadings of 25, 75, and 250 fmoles of extended primer from
the four different ddNTP labelling reactions.
[0037] FIG. 8. Autoradiographic analyses of total and NaOH-eluted
radioactivity from TGL308 primer extension reactions. Primer TGL308
was used to analyze the genotypes of individuals ESB164 and EA2014
as outlined in Example 5 and FIGS. 7 and 8. Total bead-associated
radioactivity was determined by directly spotting a suspension of
beads containing 75 fmoles of primer onto filter paper followed by
autoradiographic detection of the label in the spot. Radioactivity
specifically associated with the TGL308 primer was determined by
magnetically immobilizing the beads, eluting the primer with NaOH
as described in Examples 4 and 5, and spotting on filter paper an
amount corresponding to 75 fmoles. Label in these spots was also
detected by autoradiography.
[0038] FIG. 9. Data is shown from GBA on single stranded nucleic
acid produced by asymmetric PCR from human DNA samples of different
genotypes. The DNA sequence being interrogated is from the HLA DPA1
locus at the polymorphic sequence coding for amino acid 31 of the
DP alpha chain (Marsh, S. G. E. and Bodmer, J. G., HLA Class II
Nucleotide Sequences, 1991. Human Immunol. 31, 207-227 [1991]) and
is shown in the middle of the figure. Identification of the
nucleotide immediately downstream of the pjrimer is accomplished by
enzyme-linked detection and is visualized as an orange color change
in the well corresponding to the nucleotide which is inserted by
the T7 DNA polymerase. Homozygotes only have one positive well,
heterozygotes have two. The sequence of the GBA primer is indicated
by an arrow whose tail is the 5' and head is the 3' end of the
oligonucleotide.
[0039] FIG. 10. Data is shown from GBA on single stranded nucleic
acid produced by asymmetric PCR from equine DNA samples of
different genotypes. The DNA sequence being interrogated is from
the HLA DPA1 locus at the polymorphic sequence coding for amino
acid 50 of the DP alpha chain (Marsh, S. G. E. and Bodmer, J. G.,
HLA Class II Nucleotide Sequences, 1991. Human Immunol. 31, 207-227
[1991]) and is shown in the middle of the Figure.
[0040] FIG. 11. Data is shown from GBA on single stranded nucleic
acid produced by asymmetric PCR from equine DNA samples of
different genotypes. The DNA sequence being interrogated is from
the anonymous locus JH85 at the polymorphic sequence at nucleotide
number 122 with respect to the original ccloned genomic peice
(unpublished results) and is shown in the middle of the figure. At
this position, the "B" allele contains one extra base. For this
reason, a different nucleotide position is interrogated by primer
#307 as compared to #308. Nevertheless, the results of both strand
interrogations allow for unambiguous typing.
[0041] FIG. 12. Data shown are the results of a quantitative GBA of
equine locus JH85. Following addition of substrate, the microplate
was read kinetically, in a "Vmax" model 96-well spectrophotometer
(Molecular Devices, Inc., Menlo Park, Calif.). Values are expressed
as a Vmax in milli OD units per minute. The GBA results for the AA
homozygote (solid bars), the AB heterozygote (open bars), and BB
homozygote (stippled bars) single stranded templates is indicated
for the four biotinylated ddNTPs analyzed in separate wells.
Numerical values obtained are indicated at the top of each bar.
DETAILED DESCRIPTION OF THE INVENTION
[0042] The subject invention provides a reagent composition
comprising an aqueous carrier and an admixture of at least two
different terminators of a nucleic acid template-dependent, primer
extension reaction. Each of the terminators is capable of
specifically terminating the extension reaction in a manner
strictly dependent on the identity of the unpaired nucleotide base
in the template immediately adjacent to, and downstream of, the 3'
end of the primer. In addition, at least one of the terminators is
labeled with a detectable marker.
[0043] The subject invention further provides a reagent composition
comprising an aqueous carrier and an admixture of four different
terminators of a nucleic acid template-dependent, primer extension
reaction. Each of the terminators is capable of specifically
terminating the extension reaction as above and at least one of the
terminators is labeled with a detectable marker.
[0044] The subject invention further provides a reagent composition
comprising an aqueous carrier and an admixture of four different
terminators of a nucleic acid template-dependent, primer extension
reaction. Each of the terminators is capable of specifically
terminating the extension reaction as above and two, three, or four
of the terminators are labeled with a different detectable
marker.
[0045] The subject invention further provides a reagent as
described above wherein the terminators comprise nucleotides,
nucleotide analogs, dideoxynucleotides, or arabinoside
triphosphates. The subject invention also provides a reagent
wherein the terminators comprise one or more of dideoxyadenosine
triphosphate (ddATP), dideoxycytosine triphosphate (ddCTP),
dideoxyguanosine triphosphate (ddGTP), dideoxythymidine
triphosphate (ddTTP), or dideoxyuridine triphosphate (ddUTP).
[0046] The subject invention further provides a reagent as
described above wherein each of the detectable markers attached to
the terminators is an isotopically labeled moiety, a chromophore, a
fluorophore, a protein moiety, or a moiety to which an isotopically
labeled moiety, a chromophore, a fluorophore, or a protein moiety
can be attached. The subject invention also provides a reagent
wherein each of the different detectable markers is a different
fluorophore.
[0047] The subject invention also provides a reagent as described
above wherein the reagent further comprises pyrophosphatase.
[0048] The invented reagent consists of two or more chain
terminators with one or more of the chain terminators being
identifiably tagged. This reagent can be used in a DNA polymerase
primer extension reaction to type nucleic acid sequences of
interest that are complementary to one or more oligonucleotide
primers by chemically or physically separating the polymerase
extended primers from the chain terminator reagent and analyzing
the terminal additions. Any kind of terminator that inhibits
further elongation can be used, for example, a dideoxynucleoside
triphosphate. Several approaches can be used for the labeling and
detection of terminators: (1) radioactivity and its detection by
either autoradiography or scintillation counting, (2) fluorescence
or absorption spectroscopy, (3) mass spectrometry, or (4) enzyme
activity, using a protein moiety. The identity of each terminator
can be determined individually, i.e., one at a time. In addition,
methods which permit independent analyses of each of the
terminators permit analysis of incorporation of up to four
terminators simultaneously.
[0049] The subject invention also provides a method for determining
the identity of a nucleotide base at a specific position in a
nucleic acid of interest. First, a sample containing the nucleic
acid of interest is treated, if such nucleic acid is
double-stranded, so as to obtain unpaired nucleotide bases spanning
the specific position. If the nucleic acid of interest is
single-stranded, this step is not necessary. Second, the sample
containing the nucleic acid of interest is contacted with an
oligonucleotide primer under hybridizing conditions. The
oligonucleotide primer is capable of hybridizing with a stretch of
nucleotide bases present in the nucleic acid of interest,
immediately adjacent to the nucleotide base to be identified, so as
to form a duplex between the primer and the nucleic acid of
interest such that the nucleotide base to be identified is the
first unpaired base in the template immediately downstream of the
3' end of the primer in the duplex of primer and the nucleic acid
of interest. Enzymatic extension of the oligonucleotide primer in
the resultant duplex by one nucleotide, catalyzed, for example, by
a DNA polymerase, thus depends on correct base pairing of the added
nucleotide to the nucleotide base to be identified.
[0050] The duplex of primer and the nucleic acid of interest is
then contacted with a reagent containing four labeled terminators,
each terminator being labeled with a different detectable marker.
The duplex of primer and the nucleic acid of interest is contacted
with the reagent under conditions permitting base pairing of a
complementary terminator present in the reagent with the nucleotide
base to be identified and the occurrence of a template-dependent,
primer extension reaction so as to incorporate the terminator at
the 3' end of the primer.
[0051] The net result is that the oligonucleotide primer has been
extended by one terminator. Next, the identity of the detectable
marker present at the 3' end of the extended primer is determined.
The identity of the detectable marker indicates which terminator
has base paired to the next base in the nucleic acid of interest.
Since the terminator is complementary to the next base in the
nucleic acid of interest, the identity of the next base in the
nucleic acid of interest is thereby determined.
[0052] The subject invention also provides another method for
determining the identity of a nucleotide base at a specific
position in a nucleic acid of interest. First, a sample containing
the nucleic acid of interest is treated, if such nucleic acid is
double-stranded, so as to obtain unpaired nucleotide bases spanning
the specific position. If the nucleic acid of interest is
single-stranded, this step is not necessary. Second, the sample
containing the nucleic acid of interest is contacted with an
oligonucleotide primer under hybridizing conditions. The
oligonucleotide primer is capable of hybridizing with nucleotide
bases in the nucleic acid of interest, immediately adjacent to the
nucleotide base to be identified, so a to form a duplex between the
primer and the nucleic acid of interest such that the nucleotide
base to be identified is the first unpaired base in the template
immediately downstream of the 3' end of the primer in the duplex of
primer and the nucleic acid of interest.
[0053] The duplex of primer and the nucleic acid of interest is
then contacted with a reagent containing four terminators, only one
of the terminators having a detectable marker. The duplex of primer
and the nucleic acid of interest is contacted with the reagent
under conditions permitting base pairing of a complementary
terminator present in the reagent with the nucleotide base to be
identified and the occurrence of a template-dependent, primer
extension reaction so as to incorporate the terminator at the 3'
end of the primer. The net result is that the oligonucleotide
primer has been extended by one terminator.
[0054] The original duplex of primer and the nucleic acid of
interest is then contacted with three different reagents, with a
different one of each of the four terminators being labeled in each
of the four parallel reaction steps. Next, the products of the four
parallel template-dependent, primer extension reactions are
examined to determine which of the products has a detectable
marker. The product with a detectable marker indicates which
terminator has base paired to the next base in the nucleic acid of
interest. Since the terminator is complementary to the next base in
the nucleic acid of interest, the identity of the next base in the
nucleic acid of interest is thereby determined.
[0055] Both of the methods for determining the identity of a
nucleotide base at a specific position in a nucleic acid of
interest label the primer after hybridization between the primer
and the template. If the template-dependent enzyme has no
exonuclease function, the 3' end of the primer must be base paired
for the labeling by a terminator to occur.
[0056] The subject invention also provides a method for determining
the presence or absence of a particular nucleotide sequence in a
sample of nucleic acids. First, the sample of nucleic acids is
treated, if such sample of nucleic acids contains double-stranded
nucleic acids, so as to obtain single-stranded nucleic acids. If
the nucleic acids in the sample are single-stranded, this step is
not necessary. Second, the sample of nucleic acids is contacted
with an oligonucleotide primer under hybridizing conditions. The
oligonucleotide primer is capable of hybridizing with the
particular nucleotide sequence, if the particular nucleotide
sequence is present, so as to form a duplex between the primer and
the particular nucleotide sequence.
[0057] The duplex of primer and the particular nucleotide sequence,
if any, is then contacted with a reagent containing four labeled
terminators, each terminator being labeled with a different
detectable marker. The duplex of primer and the particular
nucleotide sequence, if any, is contacted with the reagent under
conditions permitting base pairing of a complementary terminator
present in the reagent with the unpaired template nucleotide base
downstream of the 3' end of the primer, the primer being hybridized
with the particular nucleotide sequence in the template, and the
occurrence of a template-dependent, primer extension reaction so as
to incorporate the terminator at the 3' end of the primer. Next,
the absence or presence and identity of a detectable marker at the
3' end of the primer are determined. The presence or absence of the
detectable marker indicates whether the primer has hybridized to
the template. If a detectable marker is absent, the primer did not
hybridize to the template, and, therefore, the particular
nucleotide sequence is not present in the sample of nucleic acids.
If a detectable marker is present, the primer did hybridize to the
template, and, therefore, the particular nucleotide sequence is
present in the sample of nucleic acids.
[0058] The subject invention also provides another method for
determining the presence or absence of a particular nucleotide
sequence in a sample of nucleic acids. First, the sample of nucleic
acids is treated, if such sample of nucleic acids contains
double-stranded nucleic acids, so as to obtain single-stranded
nucleic acids. Second, the sample of nucleic acids is contacted
with an oligonucleotide primer under hybridizing conditions. The
oligonucleotide primer is capable of hybridizing with the
particular nucleotide sequence, if the particular nucleotide
sequence is present, so as to form a duplex between the primer and
the particular nucleotide sequence.
[0059] The duplex of primer and the particular nucleotide sequence,
if any, is then contacted with a reagent containing four
terminators, only one of the terminators having a detectable
marker. The duplex of primer and the particular nucleotide
sequence, if any, is contacted with the reagent under conditions
permitting base pairing of a complementary terminator present in
the reagent with the unpaired template nucleotide base downstream
of the 3' end of the primer, the primer being hybridized with the
particular nucleotide sequence in the template, and the occurrence
of a template-dependent, primer extension reaction. The net result
is the incorporation of the terminator at the 3' end of the
primer.
[0060] The original duplex of primer and the particular nucleotide
sequence, if any, is then contacted with three different reagents,
with a different one of each of the four terminators being labeled
in each of the four parallel reaction steps. Next, the products of
the four parallel, template-dependent, primer extension reactions
are examined to determine which, if any, of the products have
detectable markers. The absence or presence and identity of the
detectable marker indicates whether the primer has hybridized to
the template. If no detectable marker is present in any of the
products, the primer did not hybridize to the template, and,
therefore, the particular nucleotide sequence was not present in
the sample of nucleic acids. If a detectable marker is present in
any of the products, the primer did hybridize to the template, and,
therefore, the particular nucleotide sequence was present in the
sample of nucleic acids.
[0061] Different versions of the method for determining the
identity of a nucleotide base at a specific position in a nucleic
acid of interest and the method for determining the presence or
absence of a particular nucleotide sequence in a sample of nucleic
acids are possible. In the first version, the template is a
deoxyribonucleic acid, the primer is an oligodeoxyribonucleotide,
oligoribonucleotide, or a copolymer of deoxyribonucleotides and
ribonucleotides, and the template-dependent enzyme is a DNA
polymerase. This version gives a DNA product. In a second version,
the template is a ribonucleic acid, the primer is an
oligodeoxyribonucleotide, oligoribonucleotide, or a copolymer of
deoxyribonucleotides and ribonucleotides, and the
template-dependent enzyme is a reverse transcriptase. This version
gives a DNA product. In a third version, the template is a
deoxyribonucleic acid, the primer is an oligoribonucleotide, and
the enzyme is an RNA polymerase. This version gives an RNA product.
In a fourth version, the template is a ribonucleic acid, the primer
is an oligoribonucleotide, and the template-dependent enzyme is an
RNA replicase. This version gives an RNA product.
[0062] Preferably, before the primer extension reaction is
performed, the template is capped by the addition of a terminator
to the 3' end of the template. The terminator is capable of
terminating a template-dependent, primer extension reaction. The
template is capped so that no additional labeled terminator will
attach at the 3' end of the template. The extension reaction should
occur on the primer, not on the template. A dideoxynucleotide can
be used as a terminator for capping the template.
[0063] Another modification of the method for determining the
identity of a nucleotide base at a specific position in a nucleic
acid of interest is to separate the primer from the nucleic acid of
interest after the extension reaction by using appropriate
denaturing conditions. The denaturing conditions can comprise heat,
alkali, formamide, urea, glyoxal, enzymes, and combinations
thereof. The denaturing conditions can also comprise treatment with
2.0 N NaOH.
[0064] The nucleic acid of interest can comprise non-natural
nucleotide analogs such as deoxyinosine or
7-deaza-2'-deoxyguanosine. These analogues destabilize DNA duplexes
and could allow a primer annealing and extension reaction to occur
in a double-stranded sample without completely separating the
strands.
[0065] The sample of nucleic acids can be from any source. The
sample of nucleic acids can be natural or synthetic (i.e.,
synthesized enzymatically in vitro). The sample of nucleic acids
can comprise deoxyribonucleic acids, ribonucleic acids, or
copolymers of deoxyribonucleic acid and ribonucleic acid. The
nucleic acid of interest can be a deoxyribonucleic acid, a
ribonucleic acid, or a copolymer of deoxyribonucleic acid and
ribonucleic acid. The nucleic acid of interest can be synthesized
enzymatically in vivo, synthesized enzymatically in vitro, or
synthesized non-enzymatically. The sample containing the nucleic
acid or acids of interest can comprise genomic DNA from an
organism, RNA transcripts thereof, or cDNA prepared from RNA
transcripts thereof. The sample containing the nucleic acid or
acids of interest can also comprise extragenomic DNA from an
organism, RNA transcripts thereof, or cDNA prepared from RNA
transcripts thereof. Also, the nucleic acid or acids of interest
can be synthesized by the polymerase chain reaction.
[0066] The sample can be taken from any organism. Some examples of
organisms to which the method of the subject invention is
applicable include plants, microorganisms, viruses, birds,
vertebrates, invertebrates, mammals, human beings, horses, dogs,
cows, cats, pigs, or sheep.
[0067] The nucleic acid of interest can comprise one or more
moieties that permit affinity separation of the nucleic acid of
interest from the unincorporated reagent and/or the primer. The
nucleic acid of interest can comprise biotin which permits affinity
separation of the nucleic acid of interest from the unincorporated
reagent and/or the primer via binding of the biotin to streptavidin
which is attached to a solid support. The sequence of the nucleic
acid of interest can comprise a DNA sequence that permits affinity
separation of the nucleic acid of interest from the unincorporated
reagent and/or the primer via base pairing to a complementary
sequence present in a nucleic acid attached to a solid support. The
nucleic acid of interest can be labeled with a detectable marker,
this detectable marker can be different from any detectable marker
present in the reagent or attached to the primer.
[0068] The oligonucleotide primer can be an
oligodeoxyribonucleotide, an oligoribonucleotide, or a copolymer of
deoxyribonucleotides and ribonucleotides. The oligonucleotide
primer can be either natural or synthetic. The oligonucleotide
primer can be synthesized either enzymatically in vivo,
enzymatically in vitro, or non-enzymatically in vitro. The
oligonucleotide primer can be labeled with a detectable marker;
this detectable marker can be different from any detectable marker
present in the reagent or attached to the nucleic acid of interest.
In addition, the oligonucleotide primer must be capable of
hybridizing or annealing with nucleotides present in the nucleic
acid of interest, immediately adjacent to, and upstream of, the
nucleotide base to be identified. One way to accomplish the desired
hybridization is to have the template-dependent primer be
substantially complementary or fully complementary to the known
base sequence immediately adjacent to the base to be
identified.
[0069] The oligonucleotide primer can comprise one or more moieties
that permit affinity separation of the primer from the
unincorporated reagent and/or the nucleic acid of interest. The
oligonucleotide primer can comprise biotin which permits affinity
separation of the primer from the unincorporated reagent and/or
nucleic acid of interest via binding of the biotin to streptavidin
which is attached to a solid support. The sequence of the
oligonucleotide primer can comprise a DNA sequence that permits
affinity separation of the primer from the unincorporated reagent
and/or the nucleic acid of interest via base pairing to a
complementary sequence present in a nucleic acid attached to a
solid support.
[0070] The subject invention also provides a method of typing a
sample of nucleic acids which comprises identifying the base or
bases present at each of one or more specific positions, each such
nucleotide base being identified using one of the methods for
determining the identity of a nucleotide base at a specific
position in a nucleic acid of interest as outlined above. Each
specific position in the nucleic acid of interest is determined
using a different primer. The identity of each nucleotide base or
bases at each position can be determined individually or the
identities of the. nucleotide bases at different positions can be
determined simultaneously.
[0071] The subject invention also provides another method of typing
a sample of nucleic acids which comprises determining the presence
or absence of one or more particular nucleotide sequences, the
presence or absence of each such nucleotide sequence being
determined using one of the methods for determining the presence or
absence of a particular nucleotide sequence in a sample of nucleic
acids as outlined above.
[0072] The subject invention also provides an additional method of
typing a sample containing nucleic acids. First, the presence or
absence of one or more particular nucleotide sequences is
determined; the presence or absence of each such nucleotide
sequence is determined using one of the methods for determining the
presence or absence of a particular nucleotide sequence in a sample
of nucleic acids as outlined above. Second, the nucleotide base or
bases present at each of one or more specific positions is
identified; each such base is identified using one of the methods
for determining the identity of a nucleotide base at a specific
position in a nucleic acid of interest as outlined above.
[0073] The subject invention further provides a method for
identifying different alleles in a sample containing nucleic acids
which comprises identifying the base or bases present at each of
one or more specific positions. The identity of each nucleotide
base is determined by the method for determining the identity of a
nucleotide base at a specific position in a nucleic acid of
interest as outlined above.
[0074] The subject invention also provides a method for determining
the genotype of an organism at one or more particular genetic loci
which comprises obtaining from the organism a sample containing
genomic DNA and identifying the nucleotide base or bases present at
each of one or more specific positions in nucleic acids of
interest. The identity of each such base is determined by using one
of the methods for determining the identity of a nucleotide base at
a specific position in a nucleic acid of interest as outlined
above. The identity of the nucleotide bases determine the different
alleles and, thereby, determine the genotype of the organism at one
or more particular genetic loci.
[0075] The chain termination reagent in combination with an
appropriate oligonucleotide primer, and a DNA polymerase with or
without an associated 3' to 5' exonuclease function, and an
appropriate salt and cofactor mixture, can be used under
appropriate hybridization conditions as a kit for diagnosing or
typing nucleic acids, if appropriate primer separation techniques
are used. To simplify the primer separation and the terminal
nucleotide addition analysis this invention makes use of
oligonucleotides that are modified in such ways that permit
affinity separation as well as polymerase extension. The 5' termini
and internal nucleotides of synthetic oligonucleotides can be
modified in a number of different ways to permit different affinity
separation approaches, e.g., biotinylation. These affinity reagents
can be used with the terminator mixture to facilitate the analysis
of extended oligonucleotide(s) in two ways:
[0076] (1) If a single affinity group is used on the
oligonucleotide(s), the oligonucleotide(s) can be separated from
the unincorporated terminator reagent. This eliminates the need of
physical or size separation.
[0077] (2) More than one oligonucleotide can be separated from the
terminator reagent and analyzed simultaneously if more than one
affinity group is used. This permits the analysis of several
nucleic acid species or more nucleic acid sequence information per
extension reaction.
[0078] The affinity group(s) need not be on the priming
oligonucleotide but coula, alternatively, be present on the
template. As long as the primer remains hydrogen bonded to the
template during the affinity separation step, this will allow
efficient separation of the primer from unincorporated terminator
reagent. This also has the additional benefit of leaving sites free
on the primer for the convenient attachment of additional moieties.
For example, the 5'-terminus of the primer could be modified by
coupling it to a suitable fluorescent group such as rhodamine,
allowing the amount of primer in the primer:template complex to be
easily quantified after the affinity separation step. The amounts
of 3'-terminating terminators could then be normalized to the total
amount of annealed primer.
[0079] The oligonucleotide primers and template can be any length
or sequence, can be DNA or RNA, or any modification thereof. It is
necessary, however, that conditions are chosen to optimize
stringent hybridization of the primers to the target sequences of
interest.
[0080] The conditions for the occurence of the template-dependent,
primer extension reaction can be created, in part, by the presence
of a suitable template-dependent enzyme. Some of the suitable
template-dependent enzymes are DNA polymerases. The DNA polymerase
can be of several types. The DNA polymerase must, however, be
primer and template dependent. For example, E. coli DNA polymerase
I or the "Klenow fragment" thereof, T4 DNA polymerase, T7 DNA
polymerase ("Sequenase"), T. aquaticus DNA polymerase, or a
retroviral reverse transcriptase can be used. RNA polymerases such
as T3 or T7 RNA polymerase could also be used in some protocols.
Depending upon the polymerase, different conditions must be used,
and different temperatures ranges may be required for the
hybridization and extension reactions.
[0081] The reagents of the subject invention permit the typing of
nucleic acids of interest by facilitating the analysis of the 3'
terminal addition of terminators to a specific primer or primers
under specific hybridization and polymerase chain extension
conditions. Using only the terminator mixture as the nucleoside
triphosphate substrate ensures addition of only one nucleotide
residue to the 3' terminus of the primer in the polymerase
reaction. Using all four terminators simultaneously ensures
fidelity, i.e., suppression of misreading.
[0082] By specifically labeling one or more of the terminators, the
sequence of the extended primer can be deduced. In principle, more
than one reaction product can be analyzed per reaction if more than
one terminator is specifically labeled.
[0083] By specifically tagging the oligonucleotide primer(s), or
template(s) with a moiety that does not affect the 3' extension
reaction yet permits affinity separation, the extension product(s)
can be separated post-reaction from the unincorporated terminators,
other components of the reagents, and/or the template strand.
Several oligonucleotides can be analyzed per extension reaction if
more than one affinity agent is used.
[0084] In principle, the combination of four differently labeled
terminators and many primers or templates tagged with different
groups permits the typing of many different nucleic acid sequences
simultaneously.
[0085] Specificity in this diagnostic reaction is determined by (1)
the stringency of oligonucleotide hybridization and (2) the
sequence information gained by the single residue extension.
[0086] A. General Methods
[0087] 1. Biotinylation of Oligodeoxynucleotides.
[0088] Oligodeoxynucleotides, terminated at their 5'-ends with a
primary amino group, were ordered from Midland Certified Reagents,
Midland, Tex. These were biotinylated using biotin-XX-NHS ester
(Clontech Laboratories, Inc., Palo Alto, Calif.), a derivative of
biotin-N-hydroxysuccinimide. Reagents used were from the Clontech
biotinylation kit. Typically, the oligonucleotide (9 nanomoles) was
dissolved in 100 .mu.l of 0.1M NaHCO.sub.3/Na.sub.2CO.sub.3 (pH 9),
and 25 .mu.l of N,N-dimethylformamide containing 2.5 mg
biotin-XX-NHS-ester was added. The mixture was incubated overnight
at room temperature. It was then passed over a 6 ml Sephadex G-25
column ("DNA grade"--Pharmacia) equilibrated with H.sub.2O. Eluate
fractions containing DNA were identified by mixing 4 .mu.l aliquots
with an equal volume of ethidium bromide (2 .mu.g/ml) and the
DNA-induced fluorescence was monitored with a UV transilluminator.
Unreacted ester was detected by UV absorption at 220 nm. The tubes
containing DNA were pooled, concentrated in a Centricon-3
microconcentrator (Amicon), and passed over Sephadex again.
[0089] Inhibition of the binding of [.sup.3H]-biotin to magnetic
M-280 streptavidin Dynabeads (Dynal) was used to assay
quantitatively the extent of biotinylation of the oligonucleotides.
Eppendorf tubes and pipet tips were siliconized. A known amount
(5-10 pmoles) of biotin-labeled oligonucleotide in 10 .mu.l 0.1M
NaCl was added to tubes containing 25 .mu.l of 1:4 suspension of
beads in 0.1M NaCl. The tubes were rotated for one hour on a
Labquake shaker (Labindustries, Inc.). Increasing amounts of
[.sup.3H]-biotin (5-35 pmoles) in 20 .mu.l of 0.1M NaCl were added
to the tubes and these were rotated again for one hour. Tubes were
put on a Dynal MPC-E magnet to remove the beads from suspension, 10
.mu.l aliquots of the supernatant were withdrawn, and the amount of
radioactivity in these was measured using a Beckman LS 5000 TD
liquid scintillation counter. Counts were compared to those from
tubes to which no oligonucleotide had been added. Alternatively,
for some primers, biotinylation was monitored by size fractionation
of the reaction products using analytical polyacrylamide gel
electrophoresis in the presence of 8 M urea.
[0090] 2. Template-Dependent Primer Extension/Termination
Reactions.
[0091] Approximately five pmoles of 5'-biotinylated
oligodeoxynucleotide template (see above) were mixed with
approximately three pmoles of primer in 1.times. sequencing buffer
(from Sequenase Version 2.0 kit, US Biochemical Corp.) (10 .mu.l
final volume), the mixture was incubated at 65.degree. C. for 2
min, then allowed to cool to room temperature in order to anneal
the primer and template. The solution containing the annealed
template-primer was separated into two 5 .mu.l portions, A and B,
to which were added the following: Reactions A (for normalizing
template concentrations) -0.5 .mu.l of 100 mM dithiothreitol, 1
.mu.l each of 10 .mu.M dATP, dGTP, ddCTP, 0.5 .mu.l of "Mn buffer"
(from Sequenase Version 2.0 kit, US Biochemical Corp.), 0.5 .mu.l
of [.sup.35S]-.alpha.-thio-dTTP (10 mCi/ml, 1180 Ci/mmole)
(Dupont-NEN), 1 .mu.l of Sequenase (1:8 dilution, US Biochemical
Corp.); Reactions B (for template-specific labeling of primer
3'-ends)--same additions as in Reactions A except the nucleotides
used were ddCTP, ddGTP, ddTTP, and
[.sup.35S]-.alpha.-thio-ddATP.
[0092] Reactions were for 5 min at 37.degree. C. Control reactions
omitting the primer or the Sequenase were also performed. Aliquots
were removed and analyzed by electrophoresis on a 15%
polyacrylamide, 8 M urea, DNA sequencing gel (see Maniatis, T., et
al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor
Laboratory (1982)). The gel was fixed in 10% methanol, 10% acetic
acid, dried down onto Whatman's 3MM paper, and exposed to Kodak
X-Omat AR film. Alternatively, for purposes of analyzing the
products by liquid scintillation counting, the biotinylated
template or template-primer was bound to an excess of M-280
streptavidin Dynabeads (Dynal) before or after the Sequenase
reaction (see above, "1. Biotinylation of oligodeoxynucleotides",
for binding conditions). Beads were washed three times with 0.1 M
NaCl to remove unincorporated label, then scintillation fluid was
added and the radioactivity measured by liquid scintillation
counting.
[0093] 3. Generation of Templates from Polymerase Chain Reaction
Products.
[0094] Polymerase chain reaction (PCR) reactions were carried out
where one or the other of the amplification primers flanking the
target stretch of DNA were biotinylated as described above. These
primers (2 .mu.mol final concentration) and the target DNA (up to 1
.mu.g) were incubated with 2.5 units of Taq polymerase (Perkin
Elmer/Cetus), 200 AM each of dATP, dCTP, dGTP, and dTTP, 10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, and 0.01% gelatin
(sigma). Reaction mixtures were overlayed with paraffin oil and
incubated for 30 cycles in Perkin Elmer/Cetus thermocycler. Each
cycle consisted of 1 min at 94.degree. C., 2 min at 60.degree. C.,
and 3 min at 72.degree. C. Reaction products were purified by
phenol/chloroform extraction and ethanol precipitation, then
analyzed by ethidium bromide staining after electrophoresis on a
polyacrylamide gel. The yield of duplex PCR product was typically
about 10 .mu.g.
[0095] Approximately 5 .mu.g of this PCR product was incubated with
gentle agitation for 60 min with 50 .mu.L of a suspension of
prewashed M-280 Dynabeads in 0.1 M NaCl. The beads with the bound
DNA (approximately 15 pmoles) were then incubated for 5 min at
25.degree. C. with 0.15 M NaOH. Beads were washed once With 0.15 M
NaOH to remove the unbiotinylated DNA strand, then washed three
times with H.sub.2O. The beads were resuspended in H.sub.2O and the
strand bound to the beads via the biotin-streptavidin link was used
as template for further primer extension reactions.
B. EXAMPLES
Example 1
[0096]
1 Primer oligo 182: .sup.5' GCCTTGGCGTTGTAGAA.sup.3' Template
oligos 180(C)/181(T): .sup.3'
TCGGGTCGGAACCGCAACATCTTC/TATAGACTA.sup.5'
[0097] Oligonucleotides 180 and 181 were synthesized with primary
amino groups attached to their 5' termini. These were coupled with
biotin as described above. Oligonucleotide 182 was annealed as a
primer and extension reactions "A" and "B" (see above) were carried
out. The expected template-dependent 3'-terminal extensions to
oligonucleotide 182 were as follows ("*" preceding a nucleotide
signifies a radioactive label):
2 Template Reaction A Reaction B 180 -dG-*dT-dA-*dT-ddC -ddG 181
-dA-*dT-dA-*dT-ddC -*ddA
[0098] Thus, in the "A" reactions, both template oligonucleotides
will direct a radioactively-labelled five nucleotide extension of
the primer; the amount of labeling should be proportional to the
amount of productively primed template present in the reactions. In
the "B" reactions, both templates will direct a one nucleotide
extension of the primer, but only for template 181 should this
result in labeling of the primer. The "B" reaction, therefore, is
an example of template-directed, sequence-specific labeling of an
oligonucleotide via DNA polymerase-catalyzed extension of a
productive primer-template complex.
[0099] The reaction products were fractionated by size on a 15%
polyacrylamide/8M urea sequencing gel and visualized by
autoradiography. The results (FIG. 1) show that, as expected, the
"A" reactions yield labeling and extension of both primers whereas
the "B" reaction results in labeling that is strongly biased in
favor of template 181. Panel C in FIG. 1 shows a gel analysis of
the same reaction products as in Panel B, except the reaction
products were first purified as described above using M-280
streptavidin Dynabeads.
Example 2
[0100] The experiment described in Example 1 shows
template-directed labeling of oligonucleotide primer 182 in which
the labeling is specific with respect to oligonucleotides or other
species that migrate similarly on a polyacrylamide gel. In order to
assess more generally the template-directed specific labeling of
oligonucleotide 182 with respect to all other labeled species,
regardless of gel mobility, a direct measurement of incorporated
radioactivity was performed. In this experiment, both reactions "A"
and "B" were performed, reaction products were purified using
Dynabeads, and total radioactivity in the aliquots was measured by
liquid scintillation counting. This procedure assesses both
misincorporation of label into other species and, in addition, the
efficiency of the Dynabead washing procedure with respect to
unincorporated nucleotides. As a practical matter, it would be of
interest to minimize both sources of non-specific label in order to
have a simple, non-gel-based, procedure for assessing specific,
template-directed labeling of the primer. The results of directly
counting the reaction products after washing on the magnetic beads
are as follows (all results expressed as cpm of .sup.35S):
3 Reaction Template 180 Template 181 A, complete 325,782 441,823 A,
no polymerase 5,187 5,416 A, no primer 4,351 12,386 B, complete
5,674 176,291 B, no polymerase 2,988 1,419 B, no primer 1,889
1,266
[0101] As can be seen from these results, specific
template-directed labeling of primer 182 can also be determined by
measuring the total radioactivity of the reaction products after
washing with magnetic beads to remove unreacted nucleotides. The
background in this experiment due to nonspecific label from all
other sources was approximately 3-4% (compare templates 180 and 181
in the "B, complete" reaction). Control experiments ("no
polymerase" and "no primer") showed that the bulk of the background
label was probably contributed by unincorporated nucleotides that
were not completely removed by the washing step. The "A, complete"
reactions showed that, for both templates, productive
template:primer complexes were present.
Example 3
[0102] Two amplification primers, TGL 105 and TGL 106 (FIG. 2),
were used to amplify a cloned stretch of bovine DNA containing two
DNA sequence polymorphisms: a C or T at position 114 and an A or G
at position 190 (FIG. 2). DNAs containing these polymorphisms were
molecularly cloned and available on plasmids, as follows: plasmid
p183, C114 and A190; plasmid p624, T114 and A190; plasmid p814,
C114 and G190. Four PCR reactions with biotinylated primers were
performed to amplify and purify specific strands of these plasmids
for use as templates:
4 Primers Plasmids Detection Primers 105 biotinylated, p183 and
p624 TGL 182 106 unbiotinylated 105 unbiotinylated, p183 and p814
TGL 166 106 biotinylated
[0103] The duplex PCR products were bound to magnetic microspheres,
denatured with NaOH, and the biotinylated strand purified as
described above. Templates prepared with biotinylated TGL 105 were
subjected to analysis by DNA sequencing with unbiotinylated primer
TGL 106 in order to measure the amount of template present.
Similarly, template prepared using biotinylated TGL 106 was
analyzed by sequencing with unbiotinylated TGL 105.
[0104] Approximately equal amounts of template (2 pmoles) were
annealed for 5 min at 65.degree. C. to the polymorphism detection
primers, TGL 182 and TGL 166 (see above and FIG. 2). These primers
hydrogen-bond to the templates in a sequence-specific fashion such
that their 3'-termini are adjacent to nucleotide positions 114 and
190, respectively (FIG. 2). Template-directed primer extension
reactions (reaction "B" conditions) were carried out on these
primer:template complexes in the presence of the four ddNTPs, one
of which (ddATP) was labeled. The products of these extension
reactions were analyzed by electrophoresis on a 15%
polyacrylamide/8M urea gel followed by autoradiography (FIG.
3).
Example 4
[0105]
5 Primer oligo TGL391: .sup.5'TGTTTTGCACAAAAGCA.sup.3' Primer oligo
TGL346: .sup.5'GTTTTGCACAAAAGCAT.sup.3' Template oligo TGL382:
.sup.3'CACAAAACGTGTTTTCGTAGGA.sup.5'- biotin:
(streptavidin-bead)
[0106] Oligonucleotide TGL382 was purchased from the Midland
Certified Reagent Company, Midland, Tex. It was biotinylated using
Midland Certified Reagent Company's "Biotin dX" reagent (a biotin
derivative phosphoramidite) which is suitable for use in automated
DNA synthesis in the 5' terminal nucleotide position. The
biotinylated oligonucleotide was then purified by anion exchange
HPLC. Streptavidin-conjugated M-280 Dynabeads were washed in TNET
buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.1% Triton
X-100) and resuspended in the same buffer at a concentration of
7.times.10.sup.8 beads/ml. 10-100 pmoles of biotinylated
oligonucleotide TGL382 was incubated with 100 .mu.l of the Dynabead
suspension in TNET for 30 minutes at 20.degree. C. in order to
allow the biotin moiety to bind to the streptavidin. The beads were
then washed (using a magnet to immobilize them) three times with
200 .mu.l of TNET and resuspended in 100 .mu.l of TNET. For
annealing, 25 .mu.l of this suspension of the Dynabeads with the
attached template oligonucleotide was immobilized with the magnet,
the TNET withdrawn, and 25 .mu.l of 40 mM Tris-HCL, pH 7.5, 20 mM
MgCl.sub.2, 50 mM NaCl, containing 2 .mu.M of oligonucleotide
primers 346 or 391, was added. The template and each primer were
annealled by incubating them for 5 minutes at 65.degree. C.,
followed by slow cooling over a period of 20 minutes to room
temperature. Beads containing the bound template-primer complexes
were washed twice with 200 .mu.l TNET, followed by resuspension in
25 .mu.l of 40 mM Tris-HCl, pH 7.5, 20 .mu.M MgCl.sub.2, 50 .mu.M
NaCl.
[0107] The following ddNTP mixes were used:
[0108] .sup.35S-labelled dideoxynucleoside triphosphate mixes
(labelled nucleotide indicated in the form ddN*TP):
6 ddG Mix: 5 .mu.M ddG*TP 10 .mu.M ddATP 10 .mu.M ddTTP 10 .mu.M
ddCTP ddA Mix: 10 .mu.M ddGTP 5 .mu.M ddA*TP 10 .mu.M ddTTP 10
.mu.M ddCTP ddT Mix: 10 .mu.M ddGTP 10 .mu.M ddATP 5 .mu.M ddT*TP
10 .mu.M ddCTP ddC Mix: 10 .mu.M ddGTP 10 .mu.M ddATP 10 .mu.M
ddTTP 5 .mu.M ddC*TP
[0109] The ddN*TPs were the four respective
[.alpha.-thio-.sup.35S]dideoxy- nucleoside triphosphates (purchased
from New England Nuclear).
[0110] For each bead-bound, template-primer complex, four extension
reactions were carried out, one reaction for each of the four ddNTP
mixes. Extension reactions contained the following components: 5.0
.mu.l bead suspension containing the annealled template-primer
complex, 0.5 .mu.l of 100 mM dithiothreitol, 0.5 .mu.l of
"Mn.sup.++ solution" (100 mM MnCl.sub.2, 150 mM DL-isocitrate, pH
7.0; purchased from U.S. Biochemicals, Cleveland, Ohio), 1.0 .mu.l
of ddG, ddA, ddT, or ddC mix, 2.0 .mu.l of H.sub.2O, and 1.0 .mu.l
of T7 DNA polymerase ("Sequenase", version 2.0, US Biochemicals,
1625 units/ml in 50 mM Tris-HCl, pH 7.5, 10 mM 2-mercaptoethanol, 1
mg/ml bovine serum albumin).
[0111] Reactions were allowed to proceed for 15 minutes at
20.degree. C., then stopped by washing the magnetically immobilized
beads three times with 500 .mu.l TNET. Beads were resuspended in
final volume of 25 .mu.l TNET prior to the detection assays.
[0112] Incorporation of labelled dideoxynucleotides by the primer
extension reaction was assayed two different ways: gel
electrophoresis followed by autoradiography, and direct
autoradiographic analysis of labelled DNA.
[0113] 1. Gel electrophoresis followed by autoradiography
(.sup.35S-labelled material only). Samples of washed, bead-bound
DNA were heated at 94.degree. C. for 5 minutes in 10 .mu.l of
formamide loading buffer (80% formamide, 10 mM Tris-HCl, pH 8, 1 mM
EDTA, 0.02% bromphenol blue) to denature the DNA and release the
labelled primer from the primer:template complex. Samples were
analyzed by electrophoresis on 8 or 12.5% polyacrylamide/8 M urea
sequencing gels (19:1 acrylamide:bis-acrylamide ratio; 100 mM
Tris-HCl, 100 mM borate, 2 mM EDTA, pH 8.3, running buffer; 60
watts constant power). After electrophoresis, gels were either
dried down onto filter paper or frozen at -80.degree. C. to prevent
diffusion, covered with plastic wrap, and exposed to X-ray film to
visualize the labelled DNA by autoradiography (FIG. 4).
[0114] 2. Direct autoradiographic analysis of labelled DNA. For the
analysis of total radioactivity bound to the beads, 10 .mu.l
aliquots of the bead suspensions in TNET were spotted directly onto
filter paper or nylon membranes. Filters or membranes were dried
under an incandescent lamp, covered with plastic wrap, and exposed
to X-ray film (FIG. 5).
Example 5
[0115]
7 TGL240: .sup.5'AGATGATGCTTTTGTGCAAAACAC.sup.3' TGL239:
.sup.5'TCAATACCTGAGTCCCGACACCCTG.sup.3' TGL308:
.sup.5'AGCCTCAGACCGCGTGGTGCCTGGT.sup.3'
[0116] Oligonucleotide TGL240 was synthesized with a primary amino
group attached to its 5' terminus and coupled with biotin as
described above. TGL240 (biotinylated) and TGL239 (unbiotinylated)
were used to amplify, via the polymerase chain reaction procedure
(see "A. General Methods"), a region of DNA comprising a particular
genetic locus in samples of mammalian genomic DNA. DNAs from two
different individuals, each homozygous for a particular set of
linked sequence polymorphisms (the "A" allele and the "B"
allele--see FIG. 6), were examined. After the PCR reaction, 2-20
pmoles of duplex PCR DNA was incubated with 100 ul of
streptavidin-conjugated M-280 Dynabeads (7.times.10.sup.8 beads/ml)
in TNET buffer in order to bind the biotinylated strand to the
beads. After binding, the beads were magnetically immobilized and
washed three times with 200 .mu.l of TNET, then resuspended in 100
.mu.l of TNET. To remove the non-biotinylated strand, 500 .mu.l of
0.15 N NaOH was added and the suspension incubated for 30 minutes
at 20.degree. C. The beads were then magnetically immobilized and
washed once with 250 .mu.l of 0.15 N NaOH, three times with 500 Ml
TNET, and resuspended in 100 .mu.l of TNET.
[0117] The detection primer, oligonucleotide TGL308 (FIG. 6), was
annealled to the bead-bound PCR-generated template as described
above in Example 4. Further washes, extension reactions, and
detection assays were also carried out as described in Example 4. A
gel autoradiographic analysis of the labelled primer extension
products for the two homozygous individuals, ESB164 ("AA" genotype)
and EA2014 ("BB" genotype), is shown in FIG. 7. Autoradiographic
analyses of total bead-bound radioactivity, or primer-associated
radioactivity after NaOH elution, are shown for these same
individuals using the filter spotting assay (FIG. 8). For the
analysis of primer only, 10 .mu.l of 0.4 N NaOH was added to 10
.mu.l of the bead suspension. After incubation for 10 minutes at
room temperature, the beads were immobilized magnetically and the
supernatant withdrawn and spotted onto nylon blotting membrane.
Example 6
Genetic Bit Analysis
[0118] DNA Samples.
[0119] Genomic DNA was isolated using the SDS/Proteinase K
procedure (Maniatis, T. Molecular Cloning, A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989) from
peripheral blood nucleated cells of humans or horses enriched from
red blood cells by selective lysis accomplished by diluting blood
with a three fold volume excess of ACK lysing buffer (0.15 M
ammonium chloride, 1 mm potassium bicarbonate, 0.1 mM EDTA).
Oligonucleotides were prepared by solid-phase phosphoramidite
chemistry using an Applied Biosystems, Inc. (Foster City, Calif.)
Model 391 automated DNA synthesizer. In the case of primers used in
Genetic Bit Analysis (GBA) reactions, de-tritylation was not
performed following the final cycle of synthesis and the
full-length oligonucleotide was purified using the Applied
Biosystems oligonucleotide purification cartridge (OPC) as
recommended by the manufacturer. For most PCR reactions, primers
were used directly by drying down the de-protection reaction.
Oligonucleotides derivatized with 5'-amino groups were prepared
using Aminolink 2 purchased from Applied Biosystems and used
according the manufacturer's recommendations.
[0120] Oligonucleotide Sequences.
[0121] Primers for first round amplification of equine locus JH85
were #91: 5' CGTCTGCAGAATCCACTGGCTTCTTGAG 3' and #92: 5'
GCAGGATCCTGGAACTACTCATTTGCCT 3'. Second round amplification of
equine locus was achieved using nested primers #239: 5'
TCAATACCTGAGTCCCGACACCCT- G 3' and #240: 5'
AGGATGATGCTTTTGTGCAAAACAC 3'. Amplification of human HLA DPA1
sequences (Marsh, S. G. E., Bodmer, J. G. HLA Class II Nucleotide
Sequences, 1991. Human Immunol. 31:207-227) was accomplished with
primers #467: 5' GCGGACCATGTGTCAACTTAT 3' and #445: 5'
GCCTGAGTGTGGTTGGAACTG 3'.
[0122] Template Preparation.
[0123] Amplification of genomic sequences was performed using the
polymerase chain reaction (PCR) (Saiki, R. K., Gelfand, D. H.,
Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K.
B., Erlich, H. A., Primer Directed Enzymatic Amplification of DNA
with a Thermostable DNA Polymerase. Science 239:487-491). In a
first step, one hundred nanograms of genomic DNA was used in a
reaction mixture containing each first round primer at a
concentration of 2 .mu.M/10 mM Tris pH 8.3/50 mM KC1/1.5 mM
MgCl.sub.2/0.1% gelatin/0.05 units per Al Taq DNA Polymerase
(AmpliTaq, Perkin Elmer Cetus, Norwalk, Conn.). Reactions were
assembled and incubated at 94.degree. C. for 1.5 minutes, followed
by 30 cycles of 94.degree. C./1 minute, 60.degree. C./2 minutes,
72.degree. C./3 minutes. Single stranded DNA was prepared in a
second "asymmetric" PCR in which the products of the first reaction
were diluted 1/1000. One of the primers was used at the standard
concentration of 2 .mu.M while the other was used at 0.08 .mu.M.
Under these conditions, both single stranded and double stranded
molecules were synthesized during the reaction.
[0124] Solid Phase Immobilization of Nucleic Acids.
[0125] GBA reactions were performed in 96-well plates (Nunc Nunclon
plates, Roskilde, Denmark). The GBA primer was covalently coupled
to the plate by incubating 10 pmoles of primer having a 5' amino
group per well in 50 .mu.l of 3 mM sodium phosphate buffer, pH 6,
20 mM 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)
overnight at room temperature. After coupling, the plate was washed
three times with 10 mM Tris pH 7.5/150 mM NaCl/0.05% Tween-20
(TNTw).
[0126] Biotinylated ddNTPs.
[0127] Biotinylated ddNTPs were synthesized according to U.S. Pat.
No. 5,047,519.
[0128] GBA in Microwell Plates.
[0129] Hybridization of single-stranded DNA to primers covalently
coupled to 96-well plates was accomplished by adding an equal
volume of 3M NaCl/50 mM EDTA to the second round asymmetric PCR and
incubating each well with 20 .mu.l of this mixture at 55.degree. C.
for 30 minutes. The plate was subsequently washed three times with
TNTw. Twenty (20) Al of polymerase extension mix containing ddNTPs
(3 .mu.M each, one of which was biotinylated/5 mM DTT/7.5 mM sodium
isocitrate/5 mM MnCl.sub.2/0.04 units per .mu.l of modified T7 DNA
polymerase and incubated for 5 minutes at room temperature.
Following the extension reaction, the plate was washed once with
TNTw. Template strands were removed by incubating wells with 50
.mu.l 0.2N NaOH for 5 minutes at room temperature, then washing the
wells with another 50 .mu.l 0.2N NaOH. The plate was then washed
three times with TNTw. Incorporation of biotinylated ddNTPs was
measured by an enzyme-linked assay. Each well was incubated with 20
.mu.l f streptavidin-conjugated horseradish peroxidase (1/1000
dilution in TNTw of product purchased from BRL, Gaithersburg, Md.)
with agitation for 30 minutes at room temperature. After washing 5
times with TNTw, 100 .mu.l of o-phenylenediamine (OPD, 1 mg/ml in
0.1 M Citric acid, pH 4.5) (BRL) containing 0.012% H.sub.2O.sub.2
was added to each well. The amount of bound enzyme was determined
by photographing the plate after stopping the reaction or
quantitatively using a Molecular Devices model "Vmax" 96-well
spectrophotometer.
[0130] In order to demonstrate the generality of the procedure, the
ability to type three different sites located on two different
template molecules is shown. In the middle of FIGS. 9 through 11 is
shown the polymorphic region of these loci together with the
sequence of the GBA primers used to genotype the DNA samples. The
genotype of the test DNA samples was previously determined by
restriction analysis and gel electrophoresis (equine samples) or by
allele specific hybridization (human samples).
[0131] At the top and bottom of FIGS. 9 through 11 are photographs
of the non-radioactive GBA analysis of these sites. Analysis of the
"plus" strand (which corresponds to the mRNA for the HLA DPA1 but
is arbitrarily chosen for the equine locus JH85) is shown at the
top of the figure, analysis of the "minus" strand is shown in the
lower photograph. Using horseradish peroxidase activity genotyping
data was observed visually. Because both strands were suitable
templates for GBA, it was possible to get genotypic confirmation by
using two different primers. For the HLA DPA1 locus, two sites of
variation were typed (FIGS. 9 and 10). Identical results were
achieved. Spectrophotometric quantitation of a separate experiment
involving the equine locus JH85 is shown in FIG. 12. The average
ratio of signals obtained with expected vs. inappropriate base
incorporation was 62.2.
[0132] C. Embodiments
[0133] An example of one method to practice the present invention
involves obtaining from a convenient source, such as blood,
epithelium, hair, or other tissue, samples of DNA or RNA, then
amplifying in vitro specific regions of the nucleic acid using the
polymerase chain reaction, transcription-based amplification (see
Kwoh, et al., Proc. Natl. Acad. Sci. 80:1173 (1989)), etc.
Amplification is accomplished using specific primers flanking the
region of interest, with one or more of the primers being modified
by having an attached affinity group (although in any given
reaction only one such primer is modified at a time). A preferred
modification is attachment of biotin moieties to the 5'-termini of
the primers. A sample (typically, 0.5-5 pmoles) of the amplified
DNA is then bound to streptavidin-conjugated magnetic microspheres
(e.g., Dynal M-280 "Dynabeads") via the attached biotin moiety on
the amplification primer. The DNA is denatured by adjusting the
aqueous suspension containing the microspheres to a sufficiently
alkaline pH, and the strand bound to the microspheres via the
biotin-streptavidin link is separated from the complementary strand
by washing under similar alkaline conditions. To accomplish this,
the microspheres are centrifuged or immobilized by the application
of a magnetic field. The microsphere-bound strand is then used as a
template in the remaining manipulations.
[0134] To the template strand, generated as described above, a
specific primer oligonucleotide is bound under high stringency
annealing conditions, the sequence of the primer being consistent
with unique binding to a site on the template strand immediately
adjacent to a known DNA sequence polymorphism. A preferred sequence
and mode of binding for the primer ensures that the primer forms a
duplex with the template such that the 3'-terminal nucleotide of
the primer forms a Watson-Crick basepair with the template
nucleotide immediately adjacent to the site of the first nucleotide
in the sequence polymorphism, without the duplex overlapping any of
the polymorphic sequence to be analyzed. This arrangement causes
the nucleotides added via template-directed, DNA
polymerase-catalyzed, extension of the primer to be determined
unambiguously by the polymorphic nucleotide sequence in the
template.
[0135] The above-described primer:template complex is contacted,
under conditions of salt, pH, and temperature compatible with
template-directed DNA synthesis, with a suitable DNA polymerase and
four different chain-terminating nucleotide analogues known to form
specific base pairs with the bases in the template. Most likely,
but not necessarily, the bases in the template as well as the
chain-terminating analogues are based on the common nucleosides:
adenosine, cytosine, guanine or inosine, thymidine or uridine. A
preferred set of chain-terminating analogues are the four
dideoxynucleoside triphosphates, ddATP, ddCTP, ddGTP, and ddTTP,
where each of the four ddNTPs has been modified by attachment of a
different fluorescent reporter group. These fluorescent tags would
have the property of having spectroscopically distinguishable
emission spectra, and in no case would the dideoxynucleoside
triphosphate modification render the chain-terminating analogue
unsuitable for DNA polymerase-catalyzed incorporation onto primer
3'-termini. The result of DNA polymerase-catalyzed chain extension
in such a mixture with such a primer:template complex is the
quantitative, specific and unambiguous incorporation of a
fluorescent chain-terminating analogue onto the 3'-terminus of the
primer, the particular fluorescent nucleotide added being solely
dictated by the sequence of the polymorphic nucleotides in the
template.
[0136] The fluorescently-tagged primer:template complex, still
attached to the magnetic microspheres, is then separated from the
reaction mix containing the unincorporated nucleotides by, for
example, washing the magnetically immobilized beads in a suitable
buffer. Additionally, it is desirable in some circumstances to then
elute the primer from the immobilized template strand with NaOH,
transfer the eluted primer to a separate medium or container, and
subsequently determine the identity of the incorporated terminator.
The identity of the attached fluorescent group is then assessed by
illuminating the modified DNA strand with light, preferably
provided by a laser, of a suitable wavelength and intensity and
spectrophotometrically analyzing the emission spectrum produced. In
general, for a two allele (diploid) system at any given site in the
DNA sequence, there are ten possible canonical emission spectra
produced, corresponding to the sixteen possible homozygotic and
heterozygotic pairings. By suitable matching of the measured
spectra to this library of canonical spectra it is possible to
identify which chain-terminating nucleotide(s) have been added to
the 3'-terminus of the primer and thereby identify the nature of
the sequence polymorphism in the template. Spectra produced by
multiple allele systems or by alleles present in a ratio other than
1:1 can also be deconvolved by suitable mathematical treatments to
identify and estimate the relative ratios of each contributing
nucleotide.
[0137] All of the above steps involve chemistries, manipulations,
and protocols that have been, or are amenable to being, automated.
Thereby, incorporation of the preferred mode of practice of this
invention into the operation of a suitably programmed robotic
workstation should result in significant cost savings and increases
in productivity for virtually any diagnostic procedure that depends
on the detection of specific nucleotide sequences or sequence
differences in nucleic acids derived from biological samples.
[0138] Several features of the above-described method have been
improved and constitute a preferred embodiment of subject
invention. Specifically, the preferred embodiment, Genetic Bit
Analysis (GBA), presents a more convenient solid phase. Magnetic
microspheres must be manipulated with care in order to effectively
wash and resuspend them. It is therefore difficult to envisage high
volume, automated assays using these beads. Furthermore, they are
deeply colored and are not adapted to calorimetric or fluorescent
assays.
[0139] The GBA methodology has been adapted to allow the
utilization of standard, polystyrene, 96-well microplates. These
have the advantage of being widely used in clinical and research
laboratories. There are a large number of liquid handling systems,
including automated systems, adapted to this format. They are
suited to optical signal detection methods and automated plate
readers for different types of light detection are available.
[0140] The template for GBA will always come from the nucleic acid
sample of interest. These nucleic acids may be from a sample
suspected of containing an infectious agent, one from an individual
whose genotype is being determined, a sample from a patient
suspected of having cancer, etc. If the immobilized partner of the
hybrid complex to be extended is the template, each nucleic acid
sample would have to be treated in such a way as to make
immobilization possible. On the other hand, the primer for a given
nucleic acid position to be interrogated will always be the same.
Therefore, methods have been devised which allow the binding of the
primer to the microplates and hybridization of single stranded
template molecules to the plate-bound primer. This provides the
additional feature of being able to make use of single-stranded
templates produced in many different ways, including direct
analysis of RNA.
[0141] Radioactive methods are inconvenient and produce waste which
is difficult to dispose of. For this reason, most commercial
biochemistry detection systems have been converted to
non-radioactive methods. By using ddNTPs which are labeled with
biotin, GBA can be performed non-radioactively using a variety of
detection systems including enzyme linked calorimetric assays.
[0142] Quality control is an important issue for tests designed to
be used in clinical settings. Because GBA interrogates the nucleic
acid sequence itself, on double stranded molecules, there is an
opportunity to derive complementary genetic information by
independently interrogating both strands. Applicants have shown
that this approach is feasible using both equine and human genetic
variants.
[0143] In the previously described method, the template was
prepared by PCR using derivatized primers to permit immobilization
of the template on the solid phase. Derivitization of the template
is no longer necessary when the primer is immobilized. Rather,
using unequal concentrations of PCR primers in an otherwise
standard PCR, it is possible to generate an excess of one
single-stranded molecule or the other, depending on which primer is
in excess. These serve as convenient templates for hybridization to
plate-bound GBA primer molecules.
* * * * *