U.S. patent application number 10/194594 was filed with the patent office on 2003-03-06 for recombinant vsv for the treatment of tumor cells.
Invention is credited to Barber, Glen N..
Application Number | 20030044386 10/194594 |
Document ID | / |
Family ID | 23175155 |
Filed Date | 2003-03-06 |
United States Patent
Application |
20030044386 |
Kind Code |
A1 |
Barber, Glen N. |
March 6, 2003 |
Recombinant VSV for the treatment of tumor cells
Abstract
The present invention relates to compositions and methods for
the treatment of tumor and/or malignant and/or cancerous cells. The
present invention provides VSV vectors comprising nucleic acid
encoding a cytokine, such as interleukin or interferon, or a
suicide gene, such as thymidine kinase, or other biological
protein, such as heat shock protein gp96, or endostatin or
angiostatin, wherein said VSV vectors exhibit greater oncolytic
activity against the tumor and/or malignant and/or cancerous cell
than a wild-type VSV vector. The present invention also provides
methods of making such vectors, host cells, expression systems, and
compositions comprising such VSV vectors, and viral particles
comprising such VSV vectors. The present invention also provides
methods for producing oncolytic activity in a tumor and/or
malignant and/or cancerous cell comprising contacting said cell
with a VSV vector of the present invention. The present invention
also provides methods for suppressing tumor growth comprising
contacting said tumor with a VSV vector of the present invention.
The present invention also provides methods for eliciting an immune
response to a tumor cell in an individual.
Inventors: |
Barber, Glen N.; (Miami,
FL) |
Correspondence
Address: |
Catherine M. Polizzi
Morrison & Foerster LLP
755 Page Mill Road
Palo Alto
CA
94304-1018
US
|
Family ID: |
23175155 |
Appl. No.: |
10/194594 |
Filed: |
July 11, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60304125 |
Jul 11, 2001 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
424/85.2; 424/85.5; 435/235.1 |
Current CPC
Class: |
A61K 38/208 20130101;
A61K 35/766 20130101; A61K 48/00 20130101; A61P 35/00 20180101;
A61K 38/215 20130101; A61K 38/217 20130101; A61P 35/04 20180101;
C12N 2760/20232 20130101; A61P 13/08 20180101; A61K 38/2026
20130101; C12N 15/86 20130101; A61P 1/02 20180101; A61K 38/45
20130101; C12N 2760/20243 20130101; A61P 35/02 20180101; A61K
48/0058 20130101; C07K 14/5406 20130101 |
Class at
Publication: |
424/93.2 ;
435/235.1; 424/85.2; 424/85.5 |
International
Class: |
A61K 048/00; A61K
038/21; A61K 038/20; C12N 007/00 |
Claims
1. A recombinant vesicular stomatitis virus (VSV) vector comprising
nucleic acid encoding a cytokine, wherein said recombinant VSV
vector exhibits greater oncolytic activity against a tumor cell
than a wild-type VSV vector when contacted with the tumor cell.
2. The recombinant VSV vector claim 1 wherein said cytokine is
interferon.
3. The recombinant VSV vector of claim 2 wherein said interferon is
interferon-beta.
4. The recombinant VSV vector of claim 2 wherein said interferon is
interferon-gamma.
5. The recombinant VSV vector of claim 1 wherein said cytokine is
IL-4.
6. The recombinant VSV vector of claim 1 wherein said cytokine is
IL-12.
7. The recombinant VSV vector of claim 1 wherein said VSV vector is
replication-defective.
8. The recombinant VSV vector of claim 7 wherein said VSV vector
lacks G-protein function.
9. The recombinant VSV vector of claim 1 wherein the tumor cell
includes a melanoma tumor cell, mammary tumor cell, prostate tumor
cell, cervical tumor cell, hematological-associated tumor cell or a
cell harboring a defect in a tumor suppressor pathway.
10. The recombinant VSV vector of claim 1 wherein a mammal
comprises the tumor cell.
11. The recombinant VSV vector of claim 1 further comprising
nucleic acid encoding a second cytokine.
12. A replication-defective VSV vector comprising nucleic acid
encoding interferon, wherein said recombinant VSV vector exhibits
greater oncolytic activity against a tumor cell than a wild-type
VSV vector when contacted with the tumor cell.
13. The replication-defective VSV vector of claim 12 wherein said
interferon is interferon-beta or interferon-gamma.
14. The replication-defective VSV vector of claim 12 wherein said
VSV lacks G-protein.
15. The replication-defective VSV vector of claim 12 wherein the
tumor cell includes a melanoma tumor cell, mammary tumor cell,
prostate tumor cell, cervical tumor cell, hematological-associated
tumor cell or a cell harboring a defect in a tumor suppressor
pathway.
16. The recombinant VSV vector of claim 12 wherein a mammal
comprises the tumor cell.
17. The recombinant VSV vector of claim 13 further comprising
nucleic acid encoding an interleukin.
18. An isolated nucleic acid encoding the recombinant VSV vector of
claim 1.
19. An isolated nucleic acid encoding the recombinant VSV vector of
claim 12.
20. A cell comprising the VSV vector of claim 1, and progeny
thereof.
21. A cell comprising the VSV vector of claim 12, and progeny
thereof.
22. A method of producing a VSV comprising nucleic acid encoding a
cytokine comprising, growing a cell according to claim 20 under
conditions whereby VSV is produced; and optionally isolating said
VSV.
23. A method of producing a VSV comprising nucleic acid encoding a
interferon comprising, growing a cell according to claim 21 under
conditions whereby VSV is produced; and optionally isolating said
VSV.
24. The method of claim 23 wherein said VSV lacks G-protein
function and said cell expresses VSV G-protein function.
25. A recombinant vesicular stomatitis viral particle comprising
the VSV vector of claim 1.
26. A recombinant vesicular stomatitis viral particle comprising
the VSV vector of claim 12.
27. A composition comprising the VSV vector of claim 1.
28. The composition of claim 27 wherein said VSV vector is present
in the composition in an amount effective to produce oncolytic
activity of a tumor cell when said composition is contacted with
the tumor cell.
29. The composition of claim 27 wherein said cytokine is an
interferon.
30. The composition of claim 27 wherein said cytokine is an
interleukin.
31. The composition of claim 27 wherein said VSV vector is
replication-defective.
32. The composition of claim 31 wherein said VSV vector lacks
G-protein function.
33. The composition of claim 27 wherein said composition further
comprises a pharmaceutically acceptable excipient.
34. The composition of claim 28 wherein said composition comprises
a pharmaceutically acceptable excipient.
35. A method for producing oncolytic activity in a tumor cell,
comprising the step of contacting the cell with a recombinant VSV
vector comprising nucleic acid encoding a cytokine, wherein said
VSV vector exhibits greater oncolytic activity against the tumor
cell than a wild-type VSV vector.
36. The method of claim 35 wherein said VSV vector is
replication-defective.
37. The method of claim 36 wherein said VSV vector lacks G-protein
function.
38. The method of claim 35 wherein said cytokine is interferon-beta
or interferon-gamma.
39. The method of claim 35 wherein said cytokine is an
interleukin.
40. The method of claim 35 wherein the tumor cell includes a
melanoma tumor cell, mammary tumor cell, prostate tumor cell,
cervical tumor cell, hematological-associated tumor cell or cell
harboring defects in a tumor suppressor pathway.
41. The method of claim 35 wherein said contacting is by
intravenous injection to an individual comprising said tumor
cell.
42. The method of claim 35 wherein said contacting is by
intratumoral injection to an individual comprising said tumor
cell.
43. A method for producing oncolytic activity in a tumor cell,
comprising the step of contacting the tumor cell with a recombinant
VSV vector comprising nucleic acid encoding a suicide gene wherein
said VSV vector exhibits greater oncolytic activity against the
tumor cell when administered along with a prodrug than a wild-type
VSV vector.
44. The method of claim 43 wherein said suicide gene encodes
thymidine kinase (TK).
45. The method of claim 44 wherein said prodrug is
ganclyclovir.
46. The method of claim 43 wherein said prodrug is acyclovir.
47. The method of claim 43 wherein said VSV vector is
replication-defective.
48. The method of claim 47 wherein said VSV vector lacks
G-protein.
49. The method of claim 43 wherein the tumor cell includes melanoma
tumor cell, mammary tumor cell, prostate tumor cell, cervical tumor
cell, hematological-associated tumor cell or cell harboring a
defect in a tumor suppressor pathway.
50. The method of claim 43 wherein said contacting is by
intravenous injection to an individual comprising said tumor
cell.
51. The method of claim 43 wherein said contacting is by
intratumoral injection to an individual comprising said tumor
cell.
52. A method for suppressing tumor growth, comprising the step of
contacting the tumor with a recombinant VSV vector comprising
nucleic acid encoding a cytokine, wherein said VSV vector exhibits
greater tumor suppression than a wild-type VSV vector.
53. A method for suppressing tumor growth, comprising the step of
contacting the tumor with a recombinant VSV vector comprising
nucleic acid encoding a suicide gene wherein said VSV vector
exhibits greater tumor suppression when administered along with a
prodrug than a wild-type VSV vector.
54. A method for eliciting an immune response to a tumor cell in an
individual comprising, administering a composition comprising tumor
cells infected with or lysed by a VSV vector comprising nucleic
acid encoding a cytokine, chemokine or heat shock protein to said
individual.
55. The method of claim 54 wherein the cytokine is an interferon or
interleukin.
56. A composition capable of inducing an immune response in an
individual comprising, tumor cells infected with or lysed by a VSV
vector comprising nucleic acid encoding a cytokine, chemokine or
heat shock protein.
57. A method for protecting an individual against a tumor
comprising, contacting a tumor cell obtained from an individual
with a VSV vector comprising nucleic acid encoding a cytokine,
chemokine or heat shock protein under conditions suitable for
lysing said tumor cells; and returning said lysed tumor cells to
said individual.
58. A kit comprising a VSV vector comprising nucleic acid encoding
a cytokine and instructions for use of the VSV vector.
59. A kit comprising a VSV vector comprising nucleic acid encoding
a thymidine kinase and instructions for use of the VSV vector.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of priority to
U.S. provisional application No. 60/304,125 filed Jul. 11, 2001
which is hereby incorporated herein in its entirety by
reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not Applicable
FIELD OF THE INVENTION
[0003] The present invention generally relates to vesicular
stomatitis virus (VSV), methods of producing heterologous proteins
in recombinant VSV and the use of recombinant VSV comprising
cytokines or suicide genes for the treatment of malignant
cells.
BACKGROUND OF THE INVENTION
[0004] Vesicular stomatitis virus (VSV), of the genus,
Vesiculovirus, is the prototypic member of the family
Rhabdoviridae, and is an enveloped virus with a negative stranded
RNA genome that causes a self-limiting disease in live-stock and is
essentially non-pathogenic in humans. Balachandran and Barber
(2000, IUBMB Life 50: 135-8). Rhabdoviruses have single,
negative-strand RNA genomes of 11,000 to 12,000 nucleotides (Rose
and Schubert, 1987, Rhabdovirus genomes and their products, in The
Viruses: The Rhabdoviruses, Plenum Publishing Corp., NY, pp.
129-166). The virus particles contain a helical, nucleocapsid core
composed of the genomic RNA and protein. Generally, three proteins,
termed N (nucleocapsid, which encases the genome tightly), P
(formerly termed NS, originally indicating nonstructural), and L
(large) are found to be associated with the nucleocapsid. An
additional matrix (M) protein lies within the membrane envelope,
perhaps interacting both with the membrane and the nucleocapsid
core. A single glycoprotein (G) species spans the membrane and
forms the spikes on the surface of the virus particle. Glycoprotein
G is responsible for binding to cells and membrane fusion. The VSV
genome is the negative sense (i.e., complementary to the RNA
sequence (positive sense) that functions as mRNA to directly
produce encoded protein), and rhabdoviruses must encode and package
an RNA-dependent RNA polymerase in the virion (Baltimore et al.,
1970, Proc. Natl. Acad. Sci. USA 66: 572-576), composed of the P
and L proteins. This enzyme transcribes genomic RNA to make
subgenomic mRNAs encoding the 5-6 viral proteins and also
replicates full-length positive and negative sense RNAs. The genes
are transcribed sequentially, starting at the 3' end of the
genomes.
[0005] The sequences of the VSV mRNAs and genome is described in
Gallione et al. 1981, J. Virol. 39:529-535; Rose and Gallione,
1981, J. Virol. 39:519-528; Rose and Schubert, 1987, Rhabdovirus
genomes and their products, p. 129-166, in R. R. Wagner (ed.), The
Rhabdoviruses. Plenum Publishing Corp., NY; Schubert et al., 1985,
Proc. Natl. Acad. Sci. USA 82:7984-7988. WO 96/34625 published Nov.
7, 1996, disclose methods for the production and recovery of
replicable vesiculovirus. U.S. Pat. No. 6,168,943, issued Jan. 2,
2001, describes methods for making recombinant vesiculoviruses.
[0006] Although most immortilized tissue culture cell lines are
permissive to VSV, the virus is sensitive to the antiviral actions
of the interferons (IFN). Balachandran and Barber, supra. Primary
cells containing PKR and a functional INF system are not strongly
permissive to VSV replication. Balachandran et al. (2000, Immunity
13, 129-141) disclose that mice lacking the IFN-inducible double
stranded RNA-dependent protein kinase (PKR), are susceptible to VSV
infection. That VSV is capable of replicating in a majority of
mammalian cell lines, but not well in primary cells unless PKR
function or INF signaling is defective, implies that host defense
mechanisms required to prevent VSV replication are impaired in
cells permissive to the virus, including immortilized and malignant
cells. Balachandran and Barber, supra.
[0007] VSV oncolytic activity is disclosed in WO 00/62735,
published Oct. 26, 2000; Balachandran and Barber, supra; Stojdl et
al. (2000, Nature Medicine, vol 6, pages 821-825); Balachandran et
al. (2001, J. of Virol. p.3473-3479); WO 01/19380, published Mar.
22, 2001; WO 99/18799 published Apr. 22, 1999; and WO 00/62735
published Oct. 26, 2000.
[0008] There remains a need for the development of compositions and
methods for the treatment of tumor cells.
[0009] All references and patent publications are hereby
incorporated herein by reference in their entirety.
BRIEF SUMMARY OF THE INVENTION
[0010] The present invention relates to recombinant vesicular
stomatitis virus (VSV) expression constructs (vectors) based on VSV
which confer infectivity, replication, transcription, or any
combination thereof when the construct is introduced into cells
either in vitro or in vivo, with or without a viral particle. The
VSV construct is engineered to express one or more heterologous
nucleotide sequence(s), especially genes encoding a cytokine, such
as for example, interferon or interleukin, or other biologically
active molecules, such as for example, heat shock protein gp96, or
suicide cassette such as thymidine kinase (TK) or cytosine
deaminase. The VSV vector may comprise nucleic acid encoding two or
more biologically active proteins, for example, two cytokines, such
as an interferon and an interleukin, or two interferons or two
interleukins. The two or more cytokines maybe identical or
different. The recombinant VSV can be replication-competent or
replication-defective. The present invention also relates to
methods for producing oncolytic activity in tumor and/or malignant
cells comprising administering recombinant VSV vectors comprising
nucleic acid encoding a cytokine, including for example,
interferon, such as, interferon-beta or interferon-gamma, and
interleukin, such as, interleukin 4 or interleukin 12 to the tumor
and/or malignant cells.
[0011] The present invention provides recombinant vesicular
stomatitis virus (VSV) vectors comprising nucleic acid encoding a
cytokine(s), wherein said recombinant VSV vector exhibits greater
oncolytic activity against a tumor cell than a wild-type VSV vector
when contacted with the tumor cell. In some examples, the cytokine
is an interferon, such as interferon-beta or interferon-gamma. In
other examples, the cytokine is an interleukin such as for example,
IL-4 or IL-12. In some examples, the VSV vector comprises nucleic
acid encoding two or more cytokines, such as two interferons or two
interleukins or an interferon, such as interferon-beta and an
interleukin, such as interleukin-12. The two or more cytokines
maybe identical or different. In additional examples, the VSV
vector is replication-defective. In yet other examples, the VSV
vector lacks G-protein function and may also lack M and/or N
protein function(s). In other examples, the tumor cell is a
melanoma tumor cell, mammary tumor cell, prostate tumor cell,
cervical tumor cell, hematological-associated tumor cell or a cell
harboring a defect in a tumor suppressor pathway. The present
invention also provides a replication-defective VSV vector
comprising nucleic acid encoding interferon, wherein said
recombinant VSV vector exhibits greater oncolytic activity against
a tumor cell than a wild-type VSV vector when contacted with the
tumor cell. In some examples, the interferon is interferon-beta or
interferon-gamma. In other examples, the VSV vector lacks G-protein
function. In further examples, the tumor cell includes a melanoma
tumor cell, mammary tumor cell, prostate tumor cell, cervical tumor
cell, hematological-associated tumor cell or a cell harboring a
defect in a tumor suppressor pathway. In further examples, an
animal comprises the tumor cell and in other examples, the animal
is a mammal, such as a human. The present invention also provides
viral particles comprising a VSV vector of the present invention,
such as a VSV vector comprising nucleic acid encoding a cytokine or
suicide gene.
[0012] The present invention also comprises isolated nucleic acid
encoding a recombinant VSV vector of the present invention as well
as host cells comprising a recombinant VSV vector of the present
invention. The present invention also provides methods for making a
recombinant VSV vector of the present invention comprising growing
a cell comprising said VSV vector under conditions whereby VSV is
produced; and optionally isolating said VSV. In some examples, the
VSV vector is replication defective and the host cells comprise the
VSV protein function essential for VSV replication such that said
VSV vector is capable of replication in said host cell. In some
examples, the VSV vector comprises nucleic acid encoding a
cytokine, such as an interferon or interleukin; a suicide gene,
such as thymidine kinase or cytosine deaminase or other biological
protein, such as a heat shock protein, such as for example,
gp96.
[0013] The present invention also provides compositions comprising
a VSV vector or viral particle of the present invention. In some
examples, the VSV vector is present in the composition in an amount
effective to produce oncolytic activity in a tumor cell when said
composition is contacted with the tumor cell. In other examples,
the composition comprises a pharmaceutically acceptable
excipient.
[0014] The present invention also provides methods for producing
oncolytic activity in a tumor cell, comprising the step of
contacting the cell with a recombinant VSV vector comprising
nucleic acid encoding a cytokine, wherein said VSV vector exhibits
greater oncolytic activity against the tumor cell than a wild-type
VSV vector. In some examples of the methods, the VSV vector is
replication-defective. In other examples, the VSV vector lacks
G-protein function. In yet further examples, the cytokine is an
interferon, such as for example, interferon-beta or
interferon-gamma; or a cytokine, such as for example, an
interleukin, such as interleukin-4 or interleukin-12. In additional
examples, the tumor cell includes a melanoma tumor cell, mammary
tumor cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or cell harboring defects in a
tumor suppressor pathway. In yet further examples, said contacting
is by intravenous injection to an individual comprising said tumor
cell or by intratumoral injection to an individual comprising said
tumor cell.
[0015] The present invention also provides methods for producing
oncolytic activity in a tumor cell, comprising the step of
contacting the tumor cell with a recombinant VSV vector comprising
nucleic acid encoding a suicide gene wherein said VSV vector
exhibits greater oncolytic activity against the tumor cell when
administered along with a prodrug than a wild-type VSV vector. In
some examples of the methods, the suicide gene encodes thymidine
kinase (TK) and the prodrug is ganclyclovir or acyclovir. In other
examples, the suicide gene encodes a cytosine deaminase and the
prodrug is 5-fluorocytosine. In some examples of the methods, the
VSV vector is replication-defective. In other examples, the VSV
vector lacks G-protein function. In yet other examples of the
methods, the tumor cell includes melanoma tumor cell, mammary tumor
cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or cell harboring a defect in a
tumor suppressor pathway. In other examples, the contacting is by
intravenous injection to an individual comprising said tumor cell
or by intratumoral injection to an individual comprising said tumor
cell.
[0016] The present invention also provide methods for suppressing
tumor growth, comprising the step of contacting the tumor with a
recombinant VSV vector comprising nucleic acid encoding a cytokine,
wherein said VSV vector exhibits greater tumor suppression than a
wild-type VSV vector. In some examples of the methods, the VSV
vector is replication-defective. In other examples, the VSV vector
lacks G-protein function. In yet further examples, the cytokine is
an interferon, such as for example, interferon-beta or
interferon-gamma; or a cytokine, such as for example, an
interleukin, such as interleukin-4 or interleukin-12. The present
invention also provides methods for suppressing tumor growth,
comprising the step of contacting the tumor with a recombinant VSV
vector comprising nucleic acid encoding a suicide gene wherein said
VSV vector exhibits greater tumor suppression when administered
along with a prodrug than a wild-type VSV vector. In some examples
of the methods, the VSV vector is replication-defective. In other
examples, the VSV vector lacks G-protein function. In yet further
examples, the suicide gene encodes thymidine kinase and the prodrug
is ganclyclovir or acyclovir. In other examples, the suicide gene
encodes a cytosine deaminase and the prodrug is 5-fluorocytosine.
In yet other examples of the methods, the tumor cell includes
melanoma tumor cell, mammary tumor cell, prostate tumor cell,
cervical tumor cell, hematological-associated tumor cell or cell
harboring a defect in a tumor suppressor pathway.
[0017] The present invention also provides methods for eliciting an
immune response to a tumor cell in an individual comprising,
administering a composition comprising tumor cells infected with or
lysed by a VSV vector to said individual. In some examples, the VSV
vector comprises nucleic acid encoding a cytokine, a heat shock
protein or an immunomodulatory protein. In some examples, the
cytokine is an interferon, such as interferon-beta or
interferon-gamma, or interleukin, such as interleukin-4 or
interleukin-12. The present invention also provides a composition
capable of inducing an immune response in an individual comprising,
tumor cells infected with or lysed by a VSV vector. In some
examples, the VSV vector comprises nucleic acid encoding a
cytokine, a heat shock protein or an immunomodulatory protein. The
present invention also provides methods for protecting an
individual against a tumor comprising, contacting a tumor cell
obtained from an individual with a VSV vector under conditions
suitable for lysing said tumor cells; and returning said lysed
tumor cells to said individual. In some examples, the VSV vector
comprises nucleic acid encoding a cytokine, a heat shock protein or
an immunomodulatory protein.
[0018] The present invention also provides kits comprising a VSV
vector comprising nucleic acid encoding a cytokine or a suicide
gene and instructions for use of the VSV vector.
[0019] Also disclosed are methods of making and using VSV
constructs to express a cytokine or other biologically active
molecule, such as thymidine kinase or cytosine deaminase, as well
as viruses or mammalian cells comprising the VSV expression
construct. The present invention also provides methods of producing
difficult to make, toxic or rare proteins. The present invention
also provides methods for producing eucaryotic proteins using VSV
expression systems which provide authentic (i.e., eucaryotic)
processing.
BRIEF DESCRIPTION OF THE DRAWING(S)
[0020] FIGS. 1A-1B illustrate the generation of recombinant VSV
expressing TK, IL-4, IFN, or green fluorescent protein (GFP).
[0021] FIG. 1A. cDNA representing the VSV genome (pVSV-XN2),
flanked by the T7 RNA polymerase leader and T7 terminator as well
as hepatitis virus delta ribozyme (RBZ) was used to create
recombinant viruses. IL-4, TK or GFP were inserted between the G
and L genes of VSV.
[0022] FIG. 1B. Growth curves of recombinant viruses. BHK cells
were infected with wild type (WT) VSV, VSV-IL-4 and VSV-TK at an
m.o.i. of 10. Supernatants from infected cells were harvested at
the indicated times post-infection and viral titers determined by
plaque assay.
[0023] FIGS. 2A-2D illustrate expression of IL-4 or TK from
rVSV.
[0024] FIG. 2A. GCV is phosphorylated in cells infected with
VSV-TK. BHK cells were mock infected or infected with VSV-TK or WT
VSV (m.o.i.=1) for 8 h and cell lysates were assayed for GCV
phosphorylation, in vitro. BHK cells transiently transfected with
CMV promoter driven HSV-TK [BHK(+)] or empty vector (BHK) were used
as controls
[0025] FIG. 2B. Expression of HSV-TK in VSV-TK infected cells. BHK
cells were mock infected (lane 1) or infected with WT VSV (lane 2)
or VSV-TK (lane 3), at an m.o.i. of 1, for 24 h and cell extracts
analyzed for TK expression using an anti-TK monoclonal antibody.
293T cells transiently transfected with an empty vector (lane 4) or
CMV promoter driven HSV-TK (lane 5) were used as a positive
control.
[0026] FIG. 2C. High level expression of IL-4 in cells infected
with VSV-IL-4. Culture medium from BHK cells infected with WT VSV
or VSV-IL-4 was measured for functional IL-4 using capture ELISA.
As further controls, IL-4 was measured in culture medium from BHK
cells transiently transfected with an empty vector or CMV-promoter
driven IL-4 cDNA.
[0027] FIG. 2D. Immunoprecipitation of IL-4 from supernatants of
VSV-IL-4 infected cells. Extracts from [.sup.35S]methionine-labeled
cells mock infected (lane 1) or infected with VSV-IL-4 (lane 2) or
WT VSV (lane 3) were immunoprecipitated with an IL-4 antibody.
[0028] FIGS. 3A-3F illustrate the in vitro effects of wild type and
recombinant VSVs on primary or transformed cells.
[0029] FIGS. 3A-3C illustrate efficient replication of VSV-GFP in
transformed cells. HMVEC, B16(F10) or DA-3 cells were infected with
VSV-GFP with or without prior treatment of IFN.alpha. (500 u/ml).
Top panels show cells under brightfield microscopy (magnification,
20.times.) and lower panels shows the same field by
immunofluorescence.
[0030] FIGS. 3D-3F illustrate that rVSVs efficiently kill
transformed cells. HMVEC, B16(F10) or DA-3 cells were infected with
WT VSV, VSV-TK or VSV-IL-4 with (solid columns) or without (clear
columns) prior treatment with IFN.alpha.. Cell viability was
assayed by Trypan Blue exclusion 18 h after infection.
[0031] FIGS. 4A-4C illustrate that rVSV expressing TK and IL-4
inhibit the growth of syngeneic breast and melanoma tumors in
immunocompetent mice.
[0032] FIG. 4A. C57B1/6 mice were implanted subcutaneously with
5.times.10.sup.5 B16(F10) melanoma cells. After palpable tumors had
formed, animals were treated intratumorally with 2.times.10.sup.7
p.f.u. WT VSV, VSV-IL-4 or VSV-TK. Injections of virus were
repeated after 3 days. Tumor volumes were calculated and are shown
as a mean.+-.S.E.M. (n=5). Two mice that received heat inactivated
virus were sacrificed at day 4 due to the large size of tumors.
[0033] FIG. 4B. BALB/c mice were implanted subcutaneously with
1.5.times.10.sup.6 D1 DMBA3 tumor cells. After palpable tumors had
formed animals were intratumorally injected with 2.times.10.sup.7
p.f.u. heat inactivated virus, WT VSV, VSV-IL-4 or VSV-TK. Virus
treatment was repeated after 3 days. Tumor volumes at day 21
post-implantation (7 days after the last virus treatment) are
shown. Results are presented as a mean.+-.S.E.M. (n=5). Comparable
results were obtained in three independent sets of experiments.
[0034] FIG. 4C. Induction of CTL response against B16(F10) tumor in
animals receiving VSV-TK/GCV treatment. C57B1/6 tumor bearing mice
were injected intratumorally with wild type or recombinant VSVs. A
second injection was administered 3 days later. Ten days after the
first virus injection, spleen cells were isolated and cocultured
with B16(F10) cells. Spleen cells were incubated at the indicated
effector to target ratios with .sup.51Cr labeled B16(F10) target
cells. CTL activity was determined by .sup.51Cr release.
[0035] FIGS. 5A-5D illustrate the histopathological analysis of
tumors. Tumors from C57B1/6 and Balb/c mice were removed 7 days
after receiving intratumoral injections of either FIG. 5A heat
inactivated (HI)-VSV, FIG. 5B WT VSV, FIG. 5C VSV-IL-4, or FIG. 5D
VSV-TK. The left panel indicates large areas of cell death in
B16(F10) tumors from WT VSV treated tumors, which are more
pronounced in tumors treated with VSV-TK and VSV-IL-4. The right
panel emphasizes increased infiltration of eosinophils in D1 DMBA3
tumors injected with VSV-IL-4.
[0036] FIG. 6 illustrates the genomic organization of the VSV
genome.
[0037] FIGS. 7A-7B demonstrate that several human cancer cell lines
are permissive to VSV replication and lysis. FIG. 7A demonstrates
that MCF-7, BC-1, Jurkat, HL60, K562, PC-3 and HeLa cells were
treated with or without 1000 U/ml hIFN-.beta. for 18 hours and
subsequently infected with VSV. 48 hours post infection, viability
was assessed by Trypan blue exclusion analysis. FIG. 7B.
Supernatants from cells treated as in FIG. 7A were analyzed for
viral yield by standard plaque assay.
[0038] FIG. 8 shows the growth curve of recombinant viruses
expressing interferon in BHK-21 cells.
[0039] FIG. 9 shows the in vitro effects of VSV-INF on DA-3 cells
at 24 hours after infection.
[0040] FIG. 10 shows the production of INF-beta in recombinant
virus-infected BHK-21 cells.
[0041] FIGS. 11A-11B show the effects of viral inoculation on
weights and survivals. FIG. 11A shows the average weight of mice
following virus inoculation. BALB/c mice (n=5 per group) were
inoculated intravenously with VSV-IFN.beta., VSV-GFP, or rVSV at
5.times.10.sup.6 or 2.times.10.sup.7 p.f.u. per mouse, and weights
of mice were measured every week. Error bars show 0.5 .times.
standard deviation. FIG. 11B shows the survival rate of mice
following virus inoculation. BALB/c mice (n=5 per group) were
inoculated intravenously with 1.times.10.sup.8 p.f.u. of
VSV-IFN.beta., VSV-GFP, or wild-type VSV, and the mortality of mice
was monitored daily.
[0042] FIG. 12 shows IL-12 expression by BHK cells infected with
VSV-IL-12.
[0043] FIG. 13 shows expression of gp96 in BHK cells that are not
infected or infected with VSV-gp96 or VSV GFP (m.o.i. 10).
[0044] FIG. 14 shows expression of endostatin in cell lysates and
supernatants of BHK cells infected with VSV-endostatin:angiostatin
or VSV-GFP at an m.o.i. of 10. As a positive control, cells were
transfected with a plasmid expressing endostatin:angiostatin
(pBlast:mEndo:Angio).
DETAILED DESCRIPTION OF THE INVENTION
[0045] Vesicular stomatitis virus (VSV) is a negative-stranded
virus, comprising only 5 genes, that preferentially replicates in
immortalized and malignant cells, eventually inducing apoptosis. A
schematic illustration of the VSV viral genome is shown in FIG. 6.
The ability of VSV to reproduce in tumor or malignant cells has
been reported to occur, in part, to a defective interferon (IFN)
system. Since the IFN system is functional in normal cells,
efficient replication of VSV, which is an IFN-sensitive virus, is
prevented. Based on in vitro and in vivo observations, it has been
demonstrated that VSV effectively replicates in and lyses infected
cancer cells, while leaving normal cells relatively unaffected.
Stodj et al., supra; Fernandez et al. (2002, J. Virol. 76:895-904);
Balachandran et al. (2001, J. Virol, 75:3474-9; Balachandran and
Barber supra.
[0046] The use of VSV as an oncolytic agent has several advantages
over other virus delivery systems presently used in tumor therapy
such as adenoviruses and retroviruses. Foremost, VSV has no known
transforming abilities. VSV is not gene-attenuated, which affects
replication and therefore oncolytic anti-tumor activity. The
envelope glycoprotein (G) of VSV is highly tropic for a number of
cell-types and should be effective at targeting a variety of
tissues in vivo. VSV appears to be able to replicate in a wide
variety of tumorigenic cells and not, for example, only in cells
defective in selective tumor suppressor genes such as p53. VSV is
able to potently exert its oncolytic activity in tumors harboring
defects in the Ras, Myc and p53 pathways, cellular aberrations that
occur in over 90% of all tumors. VSV can be modified through
genetic engineering to comprise immunomodulatory and/or suicide
cassettes designed to increase the anti-tumor activity of the
VSV.
[0047] Results of experiments disclosed herein demonstrate that a
VSV vector comprising nucleic acid encoding a cytokine or suicide
cassette exhibits greater oncolytic activity against tumor cells
than a wild-type VSV vector alone. Results from experiments
disclosed herein demonstrate that a VSV vector comprising nucleic
acid encoding TK exhibits oncolytic activity against systemic and
sub-cutaneous tumors and stimulates anti-tumor T-cell response.
Data also demonstrate that VSV-IL4 or VSV-TK induce apoptosis, in
vivo, of highly aggressive melanoma cells when an animal is
infected at an m.o.i. of 1 or less. The data also demonstrate that
VSV-TK and VSV-IL4 exhibit oncolytic activity superior to VSV alone
in examples disclosed herein.
[0048] VSV has also been successfully used to express IFN-beta
(FIG. 10) or IFN-gamma. VSV-IFN can be grown in tumor cells since
the IFN response is defective in these cells. Therefore, VSV-IFN
still replicates in tumor cells to destroy them. During replication
in the tumor cells, VSV makes high levels of IFN, which is secreted
to surrounding cells. IFN is a powerful immunostimulatory molecule
(these cytokines can activate dendritic cells and NK cells) and
they also have tumor suppressive properties. Thus, the synthesis of
IFN from VSV-IFN infected cells may induce additional anti-tumor
affects and enhance the oncolytic activity of VSV. Normal cells
surrounding the tumor should be activated (have their anti-viral
state induced) by the VSV-synthesized IFN and become additionally
protected against inadvertent VSV infection. In effect VSV-IFN
should exert more potent anti-tumor activity than VSV alone and
should be safer for normal, that is, non-tumor cells. The data
disclosed herein indicate that VSV-IFN kills cancerous cells very
efficiently, and normal cells are considerable more protected.
Thus, VSV expressing IFN-beta is specific against cancer cells,
more attenuated in normal cells, and therefore, safer. Results from
experiments described herein demonstrate that a VSV vector
comprising nucleic acid encoding IFN-beta or IFN-gamma replicates
in cancerous cells and kills them. The data also demonstrate that
VSV-IFN-beta and VSV-IFN-gamma exhibit oncolytic activity superior
to VSV alone.
[0049] Data disclosed herein indicate that VSV vectors can be
utilized to express high levels of biologically active recombinant
proteins. Essentially, following virus infection, cellular
transcription and translation is prevented, and cytoplasmic
resources are focused on unbridled expression of the virus genes
and any accompanying heterologous nucleic acid, even potentially
toxic cellular or viral genes. Data disclosed herein demonstrate
that VSV can be modified to deliver genes such as suicide and
immunomodulatory cassettes that can greatly increase oncolytic
activity, such as for example, killing of tumor cells. In addition,
VSV possesses high target specificity and proficient transfection
efficacy.
[0050] General Techniques
[0051] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are within the scope of those of
skill in the art. Such techniques are explained fully in the
literature, such as, "Molecular Cloning: A Laboratory Manual",
second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis"
(M. J. Gait, ed., 1984); "Animal Cell Culture" (R. I. Freshney,
ed., 1987); "Methods in Enzymology" (Academic Press, Inc.);
"Handbook of Experimental Immunology" (D. M. Weir & C. C.
Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (J.
M. Miller & M. P. Calos, eds., 1987); "Current Protocols in
Molecular Biology" (F. M. Ausubel et al., eds., 1987); "PCR: The
Polymerase Chain Reaction", (Mullis et al., eds., 1994); and
"Current Protocols in Immunology" (J. E. Coligan et al., eds.,
1991).
[0052] For general information related to vesicular stomatitis
virus, see, "Fundamental Virology", second edition, 1991, ed. B. N.
Fields, Raven Press, New York, pages 489-503; and "Fields
Virology", third edition, 1995, ed. B. N. Fields, vol. 1, pages
1121-1159.
[0053] "VSV" as used herein refers to any strain of VSV or mutant
forms of VSV, such as those described in WO 01/19380. A VSV
construct of this invention may be in any of several forms,
including, but not limited to, genomic RNA, mRNA, cDNA, part or all
of the VSV RNA encapsulated in the nucleocapsid core, VSV complexed
with compounds such as PEG and VSV conjugated to a nonviral
protein. VSV vectors of the invention encompasses
replication-competent and replication-defective VSV vectors, such
as, VSV vectors lacking G glycoprotein.
[0054] As used herein, the terms "malignant", "malignant cells",
"tumor", "tumor cells", "cancer" and "cancer cells", (used
interchangeably) refer to cells which exhibit relatively autonomous
growth, so that they exhibit an aberrant growth phenotype
characterized by a significant loss of control of cell
proliferation. The term "tumors" includes metastatic as well as
non-metastatic tumors.
[0055] As used herein "oncolytic activity" refers to inhibition or
suppression of tumor and/or malignant and/or cancerous cell growth;
regression of tumor and/or malignant and/or cancerous cell growth;
cell death of tumor and/or malignant and/or cancerous cells or
prevention of the occurrence of additional tumor and/or malignant
and/or cancerous cells. As used herein, "inhibiting or suppressing
tumor growth" refers to reducing the rate of growth of a tumor,
halting tumor growth completely, causing a regression in the size
of an existing tumor, eradicating an existing tumor and/or
preventing the occurrence of additional tumors upon administration
of the VSV comprising compositions, or methods of the present
invention. "Suppressing" tumor growth indicates a growth state that
is curtailed when compared to growth without contact with a VSV of
the present invention. Tumor cell growth can be assessed by any
means known in the art, including, but not limited to, measuring
tumor size, determining whether tumor cells are proliferating using
a .sup.3H-thymidine incorporation assay, or counting tumor cells.
"Suppressing" tumor and/or malignant and/or cancerous cell growth
means any or all of the following states: slowing, delaying, and
stopping tumor growth, as well as tumor shrinkage. "Delaying
development" of tumor and/or malignant and/or cancerous cells means
to defer, hinder, slow, retard, stabilize, and/or postpone
development of the disease. This delay can be of varying lengths of
time, depending on the history of the disease and/or individual
being treated.
[0056] The term "cytokine" as used herein includes any cytokine
capable of stimulating an immune response in an individual. Such
cytokines include, but are not limited to, interleukins, including
but not limited to interleukin-2, interleukin-4, interleukin-6,
interleukin- 12; interferons, including but not limited to,
interferon-alpha, interferon-beta, interferon-gamma,
interferon-omega and interferon-epsilon; granulocyte-macrophage
colony stimulating factors, and tumor necrosis factor. An
"immunomodulatory" protein is one that can stimulate the immune
system and includes, but is not limited to cytokines and
chemokines.
[0057] The term "suicide cassette" or "suicide gene"
(interchangeable herein) refer to genes that assist in killing
tumor cells and include but are not limited to thymidine kinase and
cytosine deaminase.
[0058] As used herein, the term "vector" refers to a polynucleotide
construct designed for transduction/transfection of one or more
cell types. VSV vectors may be, for example, "cloning vectors"
which are designed for isolation, propagation and replication of
inserted nucleotides, "expression vectors" which are designed for
expression of a nucleotide sequence in a host cell, or a "viral
vector" which is designed to result in the production of a
recombinant virus or virus-like particle, or "shuttle vectors",
which comprise the attributes of more than one type of vector. The
present invention encompasses VSV vectors that comprise nucleic
acid encoding cytokines, including but not limited to those
cytokines described herein; chemokines, such as for example, Mip;
co-stimulatory proteins, such as for example, B7-1 and B7-2;
angiostatin; endostatin; and heat shock proteins, such as for
example gp96.
[0059] The terms "polynucleotide" and "nucleic acid", used
interchangeably herein, refer to a polymeric form of nucleotides of
any length, either ribonucleotides or deoxyribonucleotides. These
terms include a single-, double- or triple-stranded DNA, genomic
DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrid, or a polymer
comprising purine and pyrimidine bases, or other natural,
chemically, biochemically modified, non-natural or derivatized
nucleotide bases. The backbone of the polynucleotide can comprise
sugars and phosphate groups (as may typically be found in RNA or
DNA), or modified or substituted sugar or phosphate groups.
Alternatively, the backbone of the polynucleotide can comprise a
polymer of synthetic subunits such as phosphoramidates and thus can
be a oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed
phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996)
Nucleic Acids Res. 24: 1841-8; Chaturvedi et al. (1996) Nucleic
Acids Res. 24: 2318-23; Schultz et al. (1996) Nucleic Acids Res.
24: 2966-73. A phosphorothioate linkage can be used in place of a
phosphodiester linkage. Braun et al. (1988) J. Immunol. 141:
2084-9; Latimer et al. (1995) Molec. Immunol. 32: 1057-1064. In
addition, a double-stranded polynucleotide can be obtained from the
single stranded polynucleotide product of chemical synthesis either
by synthesizing the complementary strand and annealing the strands
under appropriate conditions, or by synthesizing the complementary
strand de novo using a DNA polymerase with an appropriate primer.
Reference to a polynucleotide sequence (such as referring to a SEQ
ID NO) also includes the complement sequence.
[0060] The following are non-limiting examples of polynucleotides:
a gene or gene fragment, exons, introns, genomic RNA, mRNA, tRNA,
rRNA, ribozymes, cDNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of any sequence, nucleic acid probes, and primers. A
polynucleotide may comprise modified nucleotides, such as
methylated nucleotides and nucleotide analogs, uracyl, other sugars
and linking groups such as fluororibose and thioate, and nucleotide
branches. The sequence of nucleotides may be interrupted by
non-nucleotide components. A polynucleotide may be further modified
after polymerization, such as by conjugation with a labeling
component. Other types of modifications included in this definition
are caps, substitution of one or more of the naturally occurring
nucleotides with an analog, and introduction of means for attaching
the polynucleotide to proteins, metal ions, labeling components,
other polynucleotides, or a solid support.
[0061] "Under transcriptional control" is a term well understood in
the art and indicates that transcription of a polynucleotide
sequence depends on its being operably (operatively) linked to an
element which contributes to the initiation of, or promotes,
transcription. "Operably linked" refers to a juxtaposition wherein
the elements are in an arrangement allowing them to function.
[0062] In the context of VSV, a "heterologous polynucleotide" or
"heterologous gene" or "transgene" is any polynucleotide or gene
that is not present in wild-type VSV.
[0063] In the context of VSV, a "heterologous" promoter is one
which is not associated with or derived from VSV.
[0064] A "host cell" includes an individual cell or cell culture
which can be or has been a recipient of a VSV vector(s) of this
invention. Host cells include progeny of a single host cell, and
the progeny may not necessarily be completely identical (in
morphology or in total DNA complement) to the original parent cell
due to natural, accidental, or deliberate mutation and/or change. A
host cell includes cells transfected, transformed or infected in
vivo or in vitro with a VSV vector of this invention.
[0065] "Replication" and "propagation" are used interchangeably and
refer to the ability of an VSV vector of the invention to reproduce
or proliferate. These terms are well understood in the art. For
purposes of this invention, replication involves production of VSV
proteins and is generally directed to reproduction of VSV.
Replication can be measured using assays standard in the art.
"Replication" and "propagation" include any activity directly or
indirectly involved in the process of virus manufacture, including,
but not limited to, viral gene expression; production of viral
proteins, nucleic acids or other components; packaging of viral
components into complete viruses; and cell lysis.
[0066] An "individual" is a vertebrate, preferably a mammal, more
preferably a human. Mammals include, but are not limited to, farm
animals, sport animals, rodents, primates, e.g. humans, and
pets.
[0067] An "effective amount" is an amount sufficient to effect
beneficial or desired results, including clinical results. An
effective amount can be administered in one or more
administrations. For purposes of this invention, an effective
amount of a VSV vector is an amount that is sufficient to palliate,
ameliorate, stabilize, reverse, slow or delay the progression of
the disease state.
[0068] "Expression" includes transcription and/or translation.
[0069] As used herein, the term "comprising" and its cognates are
used in their inclusive sense; that is, equivalent to the term
"including" and its corresponding cognates.
[0070] "A," "an" and "the" include plural references unless the
context clearly dictates otherwise.
[0071] VSV
[0072] VSV sequences and constructs
[0073] VSV, a member of the Rhabdoviridae family, is a
negative-stranded virus that replicates in the cytoplasm of
infected cells, does not undergo genetic recombination or
reassortment, has no known transforming potential and does not
integrate any part of it genome into the host. VSV comprises an
about 11 kilobase genome that encodes for five proteins referred to
as the nucleocapsid (N), polymerase proteins (L) and (P), surface
glycoprotein (G) and a peripheral matrix protein (M). The genome is
tightly encased in nucleocapsid (N) protein and also comprises the
polymerase proteins (L) and (P). Following infection of the cell,
the polymerase proteins initiate the transcription of five
subgenomic viral mRNAs, from the negative-sense genome, that encode
the viral proteins. The polymerase proteins are also responsible
for the replication of the full-length viral genomes that are
packaged into progeny virions. The matrix (M) protein binds to the
RNA genome/nucleocapsid core (RNP) and also to the glycosylated (G)
protein, which extends from the outer surface in an array of spike
like projections and is responsible for binding to cell surface
receptors and initiating the infectious process.
[0074] Following attachment of VSV through the (G) protein to
receptor(s) on the host surface, the virus penetrates the host and
uncoats to release the RNP particles. The polymerase proteins,
which are carried in with the virus, bind to the 3' end of the
genome and sequentially synthesize the individual mRNAs encoding N,
P, M, G, and L, followed by negative-sense progeny genomes. Newly
synthesized N, P and L proteins associate in the cytoplasm and form
RNP cores which bind to regions of the plasma membrane rich in both
M and G proteins. Viral particles form and budding or release of
progeny virus ensues.
[0075] A schematic illustration of the VSV genome is shown in FIG.
6. A table of various VSV strains is shown in "Fundamental
Virology", second edition, supra, at page 490. WO 01/19380 and U.S.
Pat. No. 6,168,943 disclose that strains of VSV include Indiana,
New Jersey, Piry, Colorado, Coccal, Chandipura and San Juan. The
complete nucleotide and deduced protein sequence of a VSV genome is
known and is available as Genbank VSVCG, accession number JO2428;
NCBI Seq ID 335873; and is published in Rose and Schubert, 1987, in
The Viruses: The Rhabdoviruses, Plenum Press, NY. pp. 129-166. A
complete sequence of a VSV strain is shown in U.S. Pat. No.
6,168,943. VSV New Jersey strain is available from the American
Type Culture Collection (ATCC) and has ATCC accession number
VR-159. VSV Indiana strain is available from the ATCC and has ATCC
accession number VR-1421.
[0076] The present invention encompasses the use of any strain of
VSV, including mutants of VSV disclosed in WO 01/19380. The present
invention encompasses any form of VSV, including, but not limited
to genomic RNA, mRNA, cDNA, and part or all of VSV RNA encapsulated
in the nucleocapsid core. The present invention encompasses VSV in
the form of a VSV vector construct as well as VSV in the form of
viral particles. The present invention also encompasses nucleic
acid encoding specific VSV vectors disclosed herein. As discussed
herein, VSV vectors of the present invention encompass
replication-competent as well as replication-defective VSV
vectors.
[0077] Accordingly, the present invention provides recombinant
vesicular stomatitis virus (VSV) vectors comprising nucleic acid
encoding a cytokine, wherein said recombinant VSV vector exhibits
greater oncolytic activity against a tumor cell than a wild-type
VSV vector when contacted with the tumor cell. In some examples,
the cytokine is an interferon, such as interferon-beta or
interferon-gamma. In other examples, the cytokine is an interleukin
such as for example, IL-4 or IL-12. The present invention
encompasses VSV vectors comprising nucleic acid encoding more than
one biologically active protein, such as for example, a VSV vector
comprising nucleic acid encoding two cytokines, such as for
example, an interferon and an interleukin; two interferons; or two
interleukins. In one example, a VSV vector comprises nucleic acid
encoding interferon-beta and interleukin-12. A VSV vector may
comprise nucleic acid encoding a heat shock protein, such as gp96
and a cytokine, such as an interferon. In other examples, the VSV
vector is replication-competent. In additional examples, the VSV
vector is replication-defective. In yet other examples, the VSV
vector lacks a protein function essential for replication, such as
G-protein function or M and/or N protein function. The VSV vector
may lack several protein functions essential for replication. In
other examples, the tumor cell is a melanoma tumor cell, mammary
tumor cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or a cell harboring a defect in
a tumor suppressor pathway. The present invention also provides a
replication-defective VSV vector comprising nucleic acid encoding
interferon, wherein said recombinant VSV vector exhibits greater
oncolytic activity against a tumor cell than a wild-type VSV vector
when contacted with the tumor cell. In some examples, the
interferon is interferon-beta or interferon-gamma. In other
examples, the VSV vector lacks G-protein. In further examples, the
tumor cell includes a melanoma tumor cell, mammary tumor cell,
prostate tumor cell, cervical tumor cell, hematological-associated
tumor cell or a cell harboring a defect in a tumor suppressor
pathway. In further examples, an animal comprises the tumor cell
and in other examples, the animal is a mammal, such as a human. The
present invention also provides viral particles comprising a VSV
vector of the present invention, such as a VSV vector comprising
nucleic acid encoding a cytokine or suicide gene. The present
invention also comprises isolated nucleic acid encoding a
recombinant VSV vector of the present invention as well as host
cells comprising a recombinant VSV vector of the present
invention.
[0078] VSV is sensitive to the antiviral actions of the interferons
(IFN). In studies with mice rendered defective in type I IFN
signaling, the animals become susceptible to lethal infection by
VSV. Data indicate that a functional IFN system is required to
induce antiviral genes responsible for inhibiting the viral
replication. One key anti-viral gene that is induced by IFN is
referred to as the RNA-dependent protein kinase. (PKR), a 68 kDa
serine/threonine protein kinase, that has been shown to be critical
for protection against VSV infection. Down regulation of PKR
protein or activity occurs in a broad spectrum of human
malignancies. Therefore, tumor cells with reduced PKR activity are
predicted to be more susceptible to VSV infection than their normal
counterparts. WO 01/19380. Methods for measuring the activity of
PKR in cells/cell lines are known in the art. Table 1 shows that
interferon protects primary but not transformed cells from
infection with rVSV. B16(F10) (murine melanoma), DA-3 (murine
breast cancer) and HMVEC (human microvascular endothelial cells;
normal cells) pretreated with IFN for 24 h were infected with WT
VSV, VSV-IL-4, VSV-TK or VSV-GFP at an m.o.i. of 0.1 pfu for 18 h.
Supernatants from infected cells were used to determine viral
titers in plaque assays.
1TABLE 1 Viral titers in interferon treated transformed and primary
cells Cell line Virus PFU/ml B16 (F10) WT VSV 7.0 .times. 10.sup.5
VSV-TK 1.0 .times. 10.sup.5 VSV-IL-4 6.2 .times. 10.sup.4 VSV-GFP
4.0 .times. 10.sup.5 DA-3 WT VSV 2.9 .times. 10.sup.7 VSV-TK 3.1
.times. 10.sup.7 VSV-IL-4 2.7 .times. 10.sup.7 VSV-GFP 3.0 .times.
10.sup.7 HMVEC WT VSV <100 VSV-TK <100 VSV-IL-4 <100
VSV-GFP <100
[0079] VSV replicates preferentially in malignant cells. This is
primarily due to host defense mechanisms that normally contain VSV
infection being damaged in cancerous cells, thus allowing the virus
to propagate. The virus will destroy the malignant cells by
mechanisms involving virus-induced apoptosis. Tumors grown in mice
can be destroyed following intratumoral or intravenous inoculation
of VSV. Table 2 provides a list of cell lines and VSV ability to
replicate in these cell lines.
2 TABLE 2 Cell line Cell or tissue type VSU infection BHK hamster
kidney + HMVEC human normal - B16 (F10) melanoma + DA-3 breast +
MCF-7 transformed hu breast + BC-1 hu hematological malignancy +
Jurkat hu hematological malignancy + HL60 hu hematological
malignancy + K562 hu hematological malignancy + PC-3 hu transformed
prostate + Hela hu cervical tumor + wherein "hu" refers to of human
origin
[0080] Recombinant VSV vectors that contain suicide cassettes
and/or immunomodulatory genes are shown to enhance apoptotic or
antitumor immune activity. Recombinant VSV vectors have been
produced that contain nucleic acid encoding the IL-4 or IL-12 gene
and that express large quantities of the IL-4 or IL-12 cytokine
following infection of a cell. IL-4 and IL-12 are responsible for
regulating T and B-cell responses. Without being bound by theory,
rVSV-IL4 or VSV-IL-12 expressing constructs should target cancer
cells in the body and replicate while producing amounts of
localized IL-4 or IL-12, which may stimulate cytotoxic T-cell
and/or antibody responses to the tumor. This may have an amplified
antitumor effect and help eradicate the malignancy. Other
immunomodulatory proteins that have been inserted into VSV
constructs include the interferons, chemokines, endostatin,
angiostatin and heat shock protein gp96.
[0081] Recombinant VSV that contains the suicide cassette TK gene
has been constructed that expresses large quantities of thymidine
kinase following VSV infection of the cell. Expression of the
herpes simplex virus thymidine kinase (HSV-TK) in tumor cells
allows the conversion of prodrugs such as gancyclovir (GCV) and
acyclovir (ACV) into their monophosphate forms which are further
phosphorylated by cellular kinases into their di- and triphosphate
forms. The triphosphate metabolites then get incorporated into DNA
and cause cell death by inhibiting mammalian DNA polymerases.
Neighboring tumor cells that do not express this gene are also
killed in the presence of GCV, the phenomenon known as "bystander
killing". This effect is mediated by cellular connexins and gap
junctions that allow the transfer of toxic metabolites into
neighboring cells. As demonstrated herein VSV vectors comprising
nucleic acid encoding TK demonstrates greater killing potential to
a VSV vector alone. Additional VSV constructs that comprises
nucleic acid encoding other suicide genes, such as cytosine
deaminase, which renders cells capable of metabolizing
5-fluorocytosine (5-FC) to the chemotherapeutic agent
5-fluorouracil (5-FU), increases cell killing and bystander effect
have been produced. As will be appreciated by the skilled artisan,
other suicide genes may be employed. The addition of a suicide gene
to a VSV vector may improve the safety of VSV therapy for
immunocompromised individuals. A VSV vector comprising nucleic acid
encoding cytosine deaminase fused to uracil
phosphoribosyltransferase was constructed. This VSV vector
exhibited functional expression of the cytosine deaminase
activity.
[0082] VSV vector constructs comprising nucleic acid encoding
interferon, and in particular interferon-beta and interferon-gamma,
have been produced. As shown in FIG. 10, high levels of functional
INF-beta are produced by cells comprising a VSV vector construct
comprising nucleic acid encoding INF-beta. As shown in FIG. 9,
VSV-IFN-beta and VSV-IFN-gamma increase cell death of DA-3 cells at
24 hours after VSV infection.
[0083] Additionally, recombinant VSVs efficiently produces large
amounts of difficult to make/toxic/rare proteins. Thus, such
viruses could be useful in making large amounts of I1-4, IL-12,
IL-2 and other cytokines or other toxic or hard to make proteins.
Accordingly, the invention includes VSV vectors encoding nucleic
acid encoding angio and endostatin, heat shock and immune
co-stimulatory molecules have been prepared. VSV vectors and VSV
viral particles can be generated to make any protein of choice, in
large amounts and constitutes a eukaryotic version of the
successful baculovirus/insect cell expression system. Advantages of
the VSV system include high level of expression and authentic
(eukaryotic) processing, unlike in insect cells.
[0084] Accordingly, the present invention provides methods for
making a recombinant VSV vector of the present invention comprising
growing a cell comprising said VSV vector under conditions whereby
VSV is produced; and optionally isolating said VSV. In some
examples, the VSV vector is replication defective and the host
cells comprising the VSV protein function essential for VSV
replication such that said VSV vector is capable of replication in
said host cell. In some examples, the VSV vector comprises nucleic
acid encoding a cytokine, such as an interferon or interleukin; a
suicide gene, such as thymidine kinase or cytosine deaminase or
other biological protein, such as a heat shock protein, such as for
example, gp96, and endostatin and angiostatin .
[0085] Host cells, compositions and kits comprising VSV
[0086] The present invention also provides host cells comprising
(i.e., transformed, transfected or infected with) the VSV vectors
or particles described herein. Both prokaryotic and eukaryotic host
cells, including insect cells, can be used as long as sequences
requisite for maintenance in that host, such as appropriate
replication origin(s), are present. For convenience, selectable
markers are also provided. Host systems are known in the art and
need not be described in detail herein. Prokaryotic host cells
include bacterial cells, for example, E. coli, B. subtilis, and
mycobacteria. Among eukaryotic host cells are yeast, insect, avian,
plant, C. elegans (or nematode) and mammalian host cells. Examples
of fungi (including yeast) host cells are S. cerevisiae,
Kluyveromyces lactis (K. lactis), species of Candida including C.
albicans and C. glabrata, Aspergillus nidulans, Schizosaccharomyces
pombe (S. pombe), Pichia pastoris, and Yarrowia lipolytica.
Examples of mammalian cells are COS cells, mouse L cells, LNCaP
cells, Chinese hamster ovary (CHO) cells, human embryonic kidney
(HEK) cells, and African green monkey cells. Xenopus laevis
oocytes, or other cells of amphibian origin, may also be used.
[0087] The present invention also includes compositions, including
pharmaceutical compositions, containing the VSV vectors described
herein. Such compositions are useful for administration in vivo,
for example, when measuring the degree of transduction and/or
effectiveness of oncolytic activity toward a malignant cell.
Compositions can comprise a VSV vector(s) of the invention and a
suitable solvent, such as a physiologically acceptable buffer.
These are well known in the art. In other embodiments, these
compositions further comprise a pharmaceutically acceptable
excipient. These compositions, which can comprise an effective
amount of a VSV vector of the invention in a pharmaceutically
acceptable excipient, are suitable for systemic or local
administration to individuals in unit dosage forms, sterile
parenteral solutions or suspensions, sterile non-parenteral
solutions or oral solutions or suspensions, oil in water or water
in oil emulsions and the like. Formulations for parenteral and
nonparenteral drug delivery are known in the art and are set forth
in Remington's Pharmaceutical Sciences, 19th Edition, Mack
Publishing (1995). Compositions also include lyophilized and/or
reconstituted forms of the VSV vectors (including those packaged as
a virus) of the invention.
[0088] The present invention also encompasses kits containing VSV
vector(s) of this invention. These kits can be used for example for
producing proteins for screening, assays and biological uses, such
as treating a tumor. Procedures using these kits can be performed
by clinical laboratories, experimental laboratories, medical
practitioners, or private individuals.
[0089] The kits of the invention comprise a VSV vector described
herein in suitable packaging. The kit may optionally provide
additional components that are useful in the procedure, including,
but not limited to, buffers, developing reagents, labels, reacting
surfaces, means for detection, control samples, instructions, and
interpretive information. The kit may include instructions for
administration of a VSV vector.
[0090] Methods of producing recombinant VSV
[0091] The study of VSV and related negative strand viruses has
been limited by the inability to perform direct genetic
manipulation of the virus using recombinant DNA technology. The
difficulty in generating VSV from DNA is that neither the
full-length genomic nor antigenomic RNAs are infectious. The
minimal infectious unit is the genomic RNA tightly bound to 1,250
subunits of the nucleocapsid (N) protein (Thomas et al., 1985, J.
Virol. 54:598-607) and smaller amounts of the two virally encoded
polymerase subunits, L and P. To reconstitute infectious virus from
the viral RNA, it is necessary first to assemble the N protein-RNA
complex that serves as the template for transcription and
replication by the VSV polymerase. Although smaller negative-strand
RNA segments of the influenza virus genome can be packaged into
nucleocapsids in vitro, and then rescued in influenza infected
cells (Enami et al., 1990, Proc. Natl. Acad. Sci. USA 87:3802-3805;
Luytjes et al., 1989, Cell 59:1107-1113), systems for packaging the
much larger eukaryotic genomic RNAs in vitro are not yet
available.
[0092] Systems for replication and transcription of DNA-derived
minigenomes or small defective RNAs from Rhabdoviruses (Conzelmann
and Schnell, 1994, J. Virol. 68:713-719; Pattnaik et al., 1992,
Cell 69:1011-1120) have been described. In these systems, RNAs are
assembled into nucleocapsids within cells that express the viral N
protein and polymerase proteins. These systems do not allow genetic
manipulation of the full-length genome of infectious viruses. U.S.
Pat. No. 6,168,943 discloses methods for the preparation of
infectious recombinant vesiculovirus capable of replication in an
animal into which the recombinant vesiculovirus is introduced. For
example, U.S. Pat. No. 6,168,943 describes that vesiculoviruses are
produced by providing in an appropriate host cell: (a) DNA that can
be transcribed to yield (encode) vesiculovirus antigenomic (+) RNA
(complementary to the vesiculovirus genome), (b) a recombinant
source of vesiculovirus N protein, (c) a recombinant source of
vesiculovirus P protein, and (d) a recombinant source of
vesiculovirus L protein; under conditions such that the DNA is
transcribed to produce the antigenomic RNA, and a vesiculovirus is
produced that contains genomic RNA complementary to the antigenomic
RNA produced from the DNA.
[0093] Alternatively, after purification of genomic RNA, VSV mRNA
can be synthesized in vitro, and cDNA prepared by standard methods,
followed by insertion into cloning vectors (see, e.g., Rose and
Gallione, 1981, J. Virol. 39(2):519-528). VSV or portions of VSV
can be prepared using oligonucleotide synthesis (if the sequence is
known) or recombinant methods (such as PCR and/or restriction
enzymes). Polynucleotides used for making VSV vectors of this
invention may be obtained using standard methods in the art, such
as chemical synthesis, recombinant methods and/or obtained from
biological sources. Individual cDNA clones of VSV RNA can be joined
by use of small DNA fragments covering the gene junctions,
generated by use of reverse transcription and polymerase chain
reaction (RT-PCR) (Mullis and Faloona, 1987, Meth. Enzymol.
155:335-350) from VSV genomic RNA (see Section 6, infra). The
ability to recover fully infectious virus from a plasmid cDNA copy
of the VSV genome has allowed genetic manipulation of this virus to
become feasible.
[0094] In an example disclosed herein, a cDNA clone representing
the entire 11,161 nucleotides of VSV has been generated and unique
Xho I/Nhe I sites were added to facilitate entry of a heterologous
gene, e.g. for example, HSV-TK. Transcription of the cDNA is
dependent on T7 RNA polymerase. Vaccinia vTF7-3 was used to infect
baby hamster kidney cells (BHK-21), to provide a source of
polymerase. Subsequently, VSV cDNA was transfected into the same
cells together with three other plasmids that express the VSV N, P
and L proteins. These latter three proteins facilitate the assembly
of nascent VSV antigenomic RNA into nucleocapsids and initiate the
VSV infectious cycle. After 24 hours, host cells were lysed,
clarified and residual vaccinia removed by filtration through a 0.2
um filter onto fresh BHK cells. Only recombinant VSVs are produced
by this method since no wild-type VSV can be generated (Rose et
al., 1995, P.N.A.S. USA).
[0095] VSV may be genetically modified in order to alter it
properties for use in vivo. Methods for the genetic modification of
VSV are well established within the art. For example, a reverse
genetic system has been established for VSV (Roberts et al.,
Virology, 1998, 247:1-6) allowing for modifications of the genetic
properties of the VSV. Standard techniques well known to one of
skill in the art may be used to genetically modify VSV and
introduce desired genes within the VSV genome to produce
recombinant VSVs (see for example, Sambrooke et al., 1989, A
Laboratory Manual, New York: Cold Spring Harbor Laboratory Press.
For insertion of nucleotide sequences into VSV vectors, for example
nucleotide sequences encoding a cytokine, or for VSV gene sequences
inserted into vectors, such as for the production helper cell
lines, specific initiation signals are required for efficient
translation of inserted protein coding sequences. These signals
include the ATG initiation codon and adjacent sequences. In cases
where an entire VSV gene, such as G-protein including its own
initiation codon and adjacent sequences are inserted into the
appropriate vectors, no additional translational control signals
may be needed. However, in cases where only a portion of the gene
sequence is inserted, exogenous translational control signals,
including the ATG initiation codon, must be provided. The
initiation codon must furthermore be in phase with the reading
frame of the protein coding sequences to ensure translation of the
entire insert. These exogenous translational control signals and
initiation codons can be of a variety of origins, both natural and
synthetic.
[0096] Following infection of a host cell, recombinant VSV shuts
down host cell protein synthesis and expresses not only its own
five gene products, but also heterologous proteins encoded within
its genome. Successful expression of heterologous nucleic acid from
VSV recombinants requires only the addition of the heterologous
nucleic acid sequence into the full-length cDNA along with the
minimal conserved sequence found at each VSV gene junction. This
sequence consists of the polyadenylation/transcri- ption stop
signal (3' AUACU.sub.7) followed by an intergenic dinucleotide (GA
or CA) and a transcription start sequence (3' UUGUCNNUAG)
complementary to the 5' ends of all VSV mRNAs. Ball et al. 1999, J.
Virol. 73:4705-4712; Lawson et al. 1995, P.N.A.S. USA 92:4477-4481;
Whelan et al. 1995, P.N.A.S. USA 92:8388-8392. Additionally,
restriction sites, preferably unique, (e.g., in a polylinker) are
introduced into the VSV cDNA, for example in intergenic regions, to
facilitate insertion of heterologous nucleic acid, such as nucleic
acid encoding an interleukin or interferon. In other examples, the
VSV cDNA is constructed so as to have a promoter operatively linked
thereto. The promoter should be capable of initiating transcription
of the cDNA in an animal or insect cell in which it is desired to
produce the recombinant VSV vector. Promoters which may be used
include, but are not limited to, the SV40 early promoter region
(Bernoist and Chambon, 1981, Nature 290:304-310), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine
kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:1441-1445), the regulatory sequences of the metallothionein gene
(Brinster et al., 1982, Nature 296:39-42); heat shock promoters
(e.g., hsp70 for use in Drosophila S2 cells); the ADC (alcohol
dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter,
alkaline phosphatase promoter, and the following animal
transcriptional control regions, which exhibit tissue specificity
and have been utilized in transgenic animals: elastase I gene
control region which is active in pancreatic acinar cells (Swift et
al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor
Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology
7:425-515); insulin gene control region which is active in
pancreatic beta cells (Hanahan, 1985, Nature 315:115-122),
immunoglobulin gene control region which is active in lymphoid
cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al.,
1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol.
7:1436-1444), mouse mammary tumor virus control region which is
active in testicular, breast, lymphoid and mast cells (Leder et
al., 1986, Cell 45:485-495), albumin gene control region which is
active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276),
alpha-fetoprotein gene control region which is active in liver
(Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et
al., 1987, Science 235:53-58; alpha 1-antitrypsin gene control
region which is active in the liver (Kelsey et al., 1987, Genes and
Devel. 1:161-171), beta-globin gene control region which is active
in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias
et al., 1986, Cell 46:89-94; myclin basic protein gene control
region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell 48:703-712); and myosin light chain-2
gene control region which is active in skeletal muscle (Sani, 1985,
Nature 314:283-286). Preferably, the promoter is an RNA polymerase
promoter, preferably a bacteriophage or viral or insect RNA
polymerase promoter, including but not limited to the promoters for
T7 RNA polymerase, SP6 RNA polymerase, and T3 RNA polymerase. If an
RNA polymerase promoter is used in which the RNA polymerase is not
endogenously produced by the host cell in which it is desired to
produce the recombinant VSV, a recombinant source of the RNA
polymerase must also be provided in the host cell. Such RNA
polymerase are known in the art.
[0097] The VSV cDNA can be operably linked to a promoter before or
after insertion of nucleic acid encoding a heterologous protein,
such as a mammalian protein including a cytokine or a suicide gene.
In some examples, a transcriptional terminator is situated
downstream of the VSV cDNA. In other examples, a DNA sequence that
can be transcribed to produce a ribozyme sequence is situated at
the immediate 3' end of the VSV cDNA, prior to the transcriptional
termination signal, so that upon transcription a self-cleaving
ribozyme sequence is produced at the 3' end of the antigenomic RNA,
which ribozyme sequence will autolytically cleave (after a U) this
fusion transcript to release the exact 3' end of the VSV
antigenomic (+) RNA. Any ribozyme sequence known in the art may be
used, as long as the correct sequence is recognized and cleaved.
(It is noted that hammerhead ribozyme is probably not suitable for
use.)
[0098] VSV vectors of the present invention comprise one or more
heterologous nucleic acid sequence(s) encoding a mammalian protein,
such as for example, a cytokine, suicide gene or heat shock protein
gp96, or a reporter gene, such as for example, green fluorescent
protein. Examples of cytokines include, but are not limited to
interferons (IFN), including IFN-beta, IFN-gamma, INF-alpha,
INF-omega, and INF-epsilon; tumor necrosis factor (TNF),
lymphotoxin, interleukins (IL), including but not limited to IL-2,
IL-4, and IL-12 and granulocyte-macrophage colony-stimulating
factor (GM-CSF). A VSV vector may comprise nucleic acid encoding
two cytokines, such as for example, two interleukins, two
interferons or an interleukin and an interferon.
[0099] The sequences for most of the genes encoding IFN as they
occur in nature are published and many have been deposited with the
American Type Culture Collection (ATCC) (Rockville, Md.). A VSV
vector of the present invention can encode any form of IFN. In some
examples, the nucleic acid encodes a human form of IFN. This
includes human IFN, IFN-alpha, IFN-beta, IFN-gamma, IFN-omega, and
INF-epsilon. Human INF-alpha sequences are described in Weber et
al. (1987, EMBO, J. 6:591-598); human INF-beta sequences are
described in U.S. Pat. No. 5,908,626 and Fiers et al. (1982)
Philos. Trans. R. Soc. Lond., B, Biol. Sci. 299:29-38) and has been
deposited with GenBank under Accession No. M25460; human INF-gamma
is available from the ATCC and has ATCC accession numbers 39047 and
39046 and a particular form of recombinant human IFN-gamma is
commercially available (rhIFN-gamma-lb, Actimmune.RTM., Genentech,
Inc. South San Francisco, Calif.); and human IFN-epsilon sequence
are disclosed in U.S. Pat. No. 6,329,175. The human IL-2 gene has
been cloned and sequenced and can be obtained as, for example, a
0.68 kB BamHI-HinDIII fragment from pBC12/HIV/IL-2 (available from
the American Type Culture Collection ("ATCC") under Accession No.
67618). U.S. Pat. No. 5,951,973 discloses the sequence for mouse
and human IL-4. Interleukin-12 (IL-12), originally called natural
killer cell stimulatory factor, is a heterodimeric cytokine
described, for example, in M. Kobayashi et al, J. Exp. Med.,
170:827 (1989). The expression and isolation of IL-12 protein in
recombinant host cells is described in detail in International
Patent Application W090/05147, published May 17, 1990 (also
European patent application No. 441,900). The DNA and amino acid
sequences of the 30 kd and 40 kd subunits of the heterodimeric
human IL-12 are provided in the above recited international
application. Research quantities of recombinant human and murine
IL-12 are also available from Genetics Institute, Inc., Cambridge,
Mass. Further, the sequences of human GM-CSF, human TNF and human
lymphotoxin are known and are available. The sequence of human
GM-CSF is known (Wong et al. (1985) Science 228:810-815) and has
been deposited with GenBank under Accession No. M10663. The
sequence of human TNF has been described (Wang et al. (1985)
Science 228:149-154) and is deposited with GenBank under Accession
No. M10988. The sequence of human lymphotoxin (TNF-b) has also been
published (Iris et al. (1993) Nature Genet. 3:137-145) and is
deposited with GenBank under Accession No. Z15026.
[0100] A VSV vector or viral particle of the present invention can
comprise nucleic acid encoding a suicide gene, such as thymidine
kinase (TK), such as herpes simplex TK or cytosine deaminase (CD),
such as for example E.coli CD. The HSV-TK gene has been previously
mapped, cloned and sequenced, and is readily available (EMBL
HEHSVLTK, Accession X03764, EMBL HEHS07, Accession V00466). The
HSV-tk gene can be obtained from natural sources, such as from the
viral genome of Herpes simplex virus type I (HSV-1) or from the
Herpes simplex virus type II (HSV-2) genome. The varicella zoster
virus (VZV) genome also includes a specific thymidine kinase gene
(VZV-tk) which has been cloned, sequenced and characterized (Mori
et al. (1988) Intervirology 29:301-310, (1986) J. Gen. Virol.
67:1759-1816). Thus, the VZV-tk gene can be obtained from the VZV
genome. The E. coli cytosine deaminase gene has also been cloned
and sequenced (Danielson et al. (1992) Mol. Microbiol. 6:1335-1344,
Austin et al. (1993) Mol. Pharmacol. 43:380-387, Dong et al. (1996)
Human Gene Therapy 7:713-720), and the gene sequence has been
deposited with GenBank under Accession No. S56903. The E. coli
cytosine deaminase gene can therefore also be obtained from a
number of natural or synthetic sources known to those skilled in
the art. Alternatively, cytokine or suicide gene oligonucleotides
can be synthetically derived, using a combination of solid phase
direct oligonucleotide synthesis chemistry and enzymatic ligation
methods which are conventional in the art. Synthetic sequences can
be prepared using commercially available oligonucleotide synthesis
devices such as those devices available from Applied Biosystems,
Inc. (Foster City, Calif.).
[0101] The present invention encompasses expression systems
comprising a VSV vector comprising one or more heterologous
nucleotide sequence(s), such as, a nucleotide sequence encoding a
cytokine, such as for example, interferon, or two cytokines, or a
suicide gene, such as for example, TK, inserted within a region of
the VSV essential for replication, such as the G glycoprotein
region, or other region essential for replication, such that the
VSV lacks the essential function and is replication-defective. The
VSV vector may have a mutation, such as a a point mutation or
deletion of part or all, of any region of the VSV genome, including
the G, M, N, L or P region. If the mutation is in a region
essential for replication, the VSV will be grown in a helper cell
line that provides the essential region function. The VSV may also
comprise a mutation, such as for example, a point mutation or
deletion of part or all of a nucleotide sequence essential for
replication, and optionally, with the heterologous nucleotide
sequence inserted in the site of the deleted nucleotide sequence.
The heterologous nucleotide sequence may be operably linked to a
transcriptional regulatory sequence. Following infection of a
target malignant or tumor cell, progeny viruses will lack essential
protein function and cannot disseminate to infect surrounding
tissue. In additional embodiments, the VSV vector is mutated in
nucleic acid, such as by point mutation, substitution or addtion of
nucleic acid, or deletion of part or all, of nucleic acid encoding
other VSV protein function such as, M protein and/or N protein
function. VSV may be targeted to a desired site in vitro to
increase viral efficiency. For example, modification of VSV G
protein (or other VSV proteins) to produce fusion proteins that
target specific sites may be used to enhance VSV efficiency in
vivo. Such fusion proteins may comprise, for example, but not
limited to single chain Fv fragments that have specificity for
tumor antigens. (Lorimer et al., P.N.A.S. U.S.A., 1996.
93:14815-20).
[0102] A VSV vector lacking a gene(s) essential for viral
replication can be grown in an appropriate complementary cell line.
Accordingly, the present invention provides recombinant helper cell
lines or helper cells that provide a VSV protein function essential
for replication of a replication-deficient VSV construct. In some
examples, the protein function is G-protein function. For example,
a VSV vector comprising nucleic acid encoding a cytokine and
lacking G-protein function can be grown in a cell line, i.e., a
helper cell line, for example, a mammalian cells line such as CHO
cell line, permissive for VSV replication, wherein said cell line
expresses an appropriate G-protein function, such that said VSV is
capable of replicating in the cell line. These complementing or
helper cell lines are capable of allowing a replication-defective
VSV to replicate and express one or more foreign genes or fragments
thereof encoded by the heterologous nucleotide sequence. In some
embodiments, the VSV vector lacks a protein function essential for
replication, such as for example, G-protein function and the host
cell line comprises nucleic acid encoding the protein function
essential for replication, such as for example, VSV G-protein
function. Complementing cell lines can provide VSV viral function
through, for example, co-infection with a helper virus, or by
integration or otherwise maintaining in stable form part or all of
a viral genome encoding a particular viral function. In other
examples, additional VSV non-essential proteins can be deleted or
heterologous nucleotide sequences inserted into nucleotide regions
encoding non-essential VSV, such as for example, the M and N
proteins. The heterologous nucleotide sequence can be inserted into
a region non-essential for replication wherein the VSV is
replication-competent. Heterologous nucleotide sequences can be
inserted in non-essential regions of the VSV genome, without
necessitating the use of a helper cell line for growth of the VSV
vector.
[0103] The recombinant VSV of the invention are produced for
example, by providing in an appropriate host cell VSV cDNA wherein
said cDNA comprises nucleotide sequence encoding a heterologous
protein, such as for example, a cytokine, including interleukin or
interferon, or a suicide gene. The nucleic acid encoding a
heterologous protein can be inserted in a region non-essential for
replication, or a region essential for replication, in which case
the VSV is grown in the presence of an appropriate helper cell
line. In some examples, the production of recombinant VSV vector is
in vitro, in cell culture, in cells permissive for growth of the
VSV. Standard recombinant techniques can be used to construct
expression vectors containing DNA encoding VSV proteins. Expression
of such proteins may be controlled by any promoter/enhancer element
known in the art. Promoters which may be used to control expression
of VSV proteins can be constitutive or inducible.
[0104] The host cell used for recombinant VSV production can be any
cell in which VSV grows, e.g., mammalian cells and some insect
(e.g., Drosophila) cells. Primary cells lacking a functional INF
system, or in other examples, immortilized or tumor cell lines can
be used. A vast number of cell lines commonly known in the art are
available for use. By way of example, such cell lines include but
are not limited to BHK (baby hamster kidney) cells, CHO (Chinese
hamster ovary) cells, HeLA (human) cells, mouse L cells, Vero
(monkey) cells, ESK-4, PK-15, EMSK cells, MDCK (Madin-Darby canine
kidney) cells, MDBK (Madin-Darby bovine kidney) cells, 293 (human)
cells, and Hep-2 cells. Such cell lines are publicly available for
example, from the ATCC and other culture depositories.
[0105] In examples disclosed herein, the plasmid, pVSV-XN2 was
constructed as shown in FIG. 1A. The genes encoding HSV-TK, mouse
IL-4, INF-beta or INF-gamma or GFP were cloned into the pVSV-XN2,
between the VSV G and L genes. Recombinant VSV (rVSV) produced by
cell lines can be isolated using for example, an affinity matrix.
Method of isolating VSV by affinity matrix are described in for
example, WO 01/19380. Briefly, methods for isolating a rVSV from
comprising adding the VSV to an affinity matrix, to produce bound
VSV, washing the bound VSV, and eluting the VSV from the affinity
matrix. The present invention encompasses a modified VSV that
comprises a non-naturally occurring fusion protein on the outer
surface of the virus. The non-native protein may be a fusion
protein comprising an affinity tag and a viral envelope protein or
it may be derived from a producer cell. Producer cell lines may be
engineered to express one or more affinity tags on their plasma
membranes which would be acquired by the virus as it buds through
the membrane. One example of an affinity tag is the use of
Histidine residues which bind to immobilized nickel columns.
Affinity tags also include antibodies. Other protocols for affinity
purification may be used as known within the art, for example, but
not limited to, batch processing, a solution of virus and affinity
matrix, pelleting the VSV-bound matrix by centrifugation, and
isolating the virus. Alternatively, VSV can be collected and
purified as described in U.S. Pat. No. 6,168,943. Briefly, VSV is
collected from culture supernatants, and the supernatants clarified
to remove cellular debris. One method of isolating and
concentrating the virus is by passage of the supernatant through a
tangential flow membrane concentration. The harvest can be further
reduced in volume by pelleting through a glycerol cushion and by
concentration on a sucrose step gradient.
[0106] Methods of using recombinant VSV vectors of the
invention
[0107] The subject VSV vectors and viral particles can be used for
a wide variety of purposes, which will vary with the desired or
intended result. Accordingly, the present invention includes
methods using the VSV vectors described herein.
[0108] The invention provides methods for producing oncolytic
activity in a tumor cell and/or malignant cell and/or cancerous
cell comprising contacting the cell, including, for example, a
tumor cell or a malignant cell in metastatic disease, with a VSV
vector of the invention, wherein said VSV vector exhibits greater
oncolytic activity against the cell than a wild-type VSV vector. In
some examples, the contacting is effected by administration, such
as for example, intravenous injection to an individual comprising
said cell. In other examples, the contacting is effected by
administration, such as by intratumoral injection to an individual
comprising said cell. For these methods, the VSV vector may or may
not be used in conjunction with other treatment modalities for
producing oncolytic activity, such as, for example, tumor
suppression, including but not limited to chemotherapeutic agents
known in the art, radiation and/or antibodies. The invention also
provides compositions comprising a VSV vector comprising nucleic
acid encoding a cytokine or a suicide gene wherein said VSV vector
is present in the composition in an amount effective to produce
oncolytic activity when said composition is administered to the
tumor and/or malignant cells. In some examples, the composition
further comprises a pharmaceutical excipient. In other examples,
the composition is administered intratumorally or intravenously to
an individual comprising the tumor cells.
[0109] Accordingly, the present invention provides methods for
producing oncolytic activity in a tumor cell, comprising the step
of contacting the cell with a recombinant VSV vector comprising
nucleic acid encoding a cytokine, wherein said VSV vector exhibits
greater oncolytic activity against the tumor cell than a wild-type
VSV vector. In some examples of the methods, the VSV vector is
replication-defective. In other examples, the VSV vector lacks
G-protein function. In yet further examples, the cytokine is an
interferon, such as for example, interferon-beta or
interferon-gamma; or a cytokine, such as for example, an
interleukin, such as interleukin-4 or interleukin-12. In additional
examples, the tumor cell includes a melanoma tumor cell, mammary
tumor cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or cell harboring defects in a
tumor suppressor pathway. In yet further examples, said contacting
is by intravenous injection to an individual comprising said tumor
cell or by intratumoral injection to an individual comprising said
tumor cell.
[0110] The present invention also provides methods for producing
oncolytic activity in a tumor cell, comprising the step of
contacting the tumor cell with a recombinant VSV vector comprising
nucleic acid encoding a suicide gene wherein said VSV vector
exhibits greater oncolytic activity against the tumor cell when
administered along with a prodrug than a wild-type VSV vector. In
some examples of the methods, the suicide gene encodes thymidine
kinase (TK) and the prodrug is ganclyclovir or acyclovir. In other
examples, the suicide gene encodes a cytosine deaminase and the
prodrug is 5-fluorocytosine. In some examples of the methods, the
VSV vector is replication-defective. In other examples, the VSV
vector lacks G-protein function. In yet other examples of the
methods, the tumor cell includes melanoma tumor cell, mammary tumor
cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or cell harboring a defect in a
tumor suppressor pathway. In other examples, the contacting is by
intravenous injection to an individual comprising said tumor cell
or by intratumoral injection to an individual comprising said tumor
cell.
[0111] The invention also provides methods of treatment, in which
an effective amount of a VSV vector(s) described herein, or a
composition comprising a VSV vector of the present invention
described herein, is administered to an individual comprising,
having or suspected of having a malignant cell and/or tumor cell
and/or cancerous cell. VSV was shown to induce cell death in
transformed human cell lines including those derived from breast
(MCF7), prostate (PC-3), or cervical tumors (HeLa), as well as a
variety of cells derived from hematological-associated malignancies
(HL 60, K562, Jurkat, BC-1). BC-1 is positive for human
herpesvirus-8 (HHV-8), overexpresses Bcl-2 and is largely resistant
to a wide variety of apoptotic stimuli and chemotherapeutic
strategies. The results of additional studies indicated that VSV
could induce apoptosis of cells specifically transformed with
either Myc or activated Ras and transformed cells carrying Myc or
activated Ras or lacking p53 or overexpressing Bcl-2 are
susceptible to VSV replication and viral-induced apoptosis. FIGS.
7A-7B illustrate that several human cancer cell lines are
permissive to VSV replication and lysis. Therefore, it is predicted
that administration of a VSV vector of the present invention or a
composition comprising a VSV vector of the present invention would
produce oncolytic activity in a variety of malignant cells or tumor
cells. Methods for screening cells or cell lines, including
malignant cells lines, for susceptibility to infection with a VSV
vector of the present invention, can be performed by methods
disclosed in WO 01/19380. Briefly a method for identifying a tumor
susceptible to treatment with a virus, comprises: (a) dividing a
sample containing cells of the tumor into a first portion and a
second portion; (b) treating portion with the VSV virus; and (c)
determining whether the percentage of dead cells in the first
portion is higher than in the second portion, wherein the tumor is
susceptible to treatment with the VSV virus if the percentage of
dead cells in the first portion is higher than in the second
portion.
[0112] The present invention encompasses treatment using a VSV
vector(s) in individuals with malignant cells and/or tumor cells
susceptible to VSV infection, as described above. Also indicated
are individuals who are considered to be at risk for developing
tumor or malignant cells, such as those who have had previous
disease comprising malignant cells or tumor cells or those who have
had a family history of such tumor cells or malignant cells.
Determination of suitability of administering VSV vector(s) of the
invention will depend on assessable clinical parameters such as
serological indications and histological examination of cell,
tissue or tumor biopsies. Generally, a composition comprising a VSV
vector(s) in a pharmaceutically acceptable excipient is
administered.
[0113] Accordingly, the present invention provides methods for
suppressing tumor growth, comprising the step of contacting the
tumor with a recombinant VSV vector comprising nucleic acid
encoding a cytokine, wherein said VSV vector exhibits greater tumor
suppression than a wild-type VSV vector. In some examples of the
methods, the VSV vector is replication-defective. In other
examples, the VSV vector lacks G-protein function. In yet further
examples, the cytokine is an interferon, such as for example,
interferon-beta or interferon-gamma; or a cytokine, such as for
example, an interleukin, such as interleukin-4 or interleukin-12.
The present invention also provides methods for suppressing tumor
growth, comprising the step of contacting the tumor with a
recombinant VSV vector comprising nucleic acid encoding a suicides
gene wherein said VSV vector exhibits greater tumor suppression
when administered along with a prodrug than a wild-type VSV vector.
In some examples of the methods, the VSV vector is
replication-defective. In other examples, the VSV vector lacks
G-protein function. In yet further examples, the suicide gene is
thymidine kinase and the prodrug is ganclyclovir or acyclovir. In
other examples, the suicide gene encodes a cytosine deaminase and
the prodrug is 5-fluorocytosine. In yet other examples of the
methods, the tumor cell includes melanoma tumor cell, mammary tumor
cell, prostate tumor cell, cervical tumor cell,
hematological-associated tumor cell or cell harboring a defect in a
tumor suppressor pathway.
[0114] The present invention encompasses ex vivo treatment of cells
or tissues using a VSV vector(s) in individuals with malignant
cells and/or tumor cells and/or cancerous cells susceptible to VSV
infection, as described above. Ex vivo treatment of cells can be
undertaken in an attempt to reduce or eliminate undesirable
malignant or cancerous cells from a mixture of cells. Such cells
include for example, bone marrow cells or peripheral blood stem
cells. Accordingly, the present invention provides a method for the
ex-vivo treatment of cells whereby a cell population from an
individual comprising undesirable cells or suspected of comprising
undesirable cells is contacted with a VSV vector of the present
invention, such as a VSV vector comprising nucleic acid encoding a
cytokine or a suicide gene. After the contacting, the cell
population maybe transplanted back into the individual. Ex vivo
purging of cells using viruses is described in for example, WO
02/00233.
[0115] The present invention also encompasses the use of VSV
vectors, including VSV vectors comprising nucleic acid encoding one
or more cytokine(s) such as for example, an IFN, including IFN-beta
and IFN-gamma, to infect tumor and/or malignant and/or cancerous
cells, in vitro. The present invention encompasses any tumor and/or
malignant and/or cancerous cell that is sensitive to VSV infection.
The VSV vector replicates in the tumor cells, expressing the
cytokine (immunomodulatory gene) to high levels. The cells are
inoculated into an animal, (in some examples, back into the animal
from which they were obtained) which makes an immune response to
the infected, lysed tumor cells. The VSV expressed cytokines
stimulate the host's immune response. Thus, an individual, such as
a mammal, including a human, could be protected from subsequent
tumor challenge, if exposed to the tumor and/or malignant and/or
cancerous cells that have been contacted with a VSV vector of the
present invention and subsequently lysed, thereby creating a
"cancer vaccine" effect. The use of VSV vectors of the present
invention as "cancer vaccines" can be tested in an animal model by
obtaining tumors grown in a mouse; contacting the tumors with a VSV
vector of the present invention, such as a VSV vector comprising
nucleic acid encoding a cytokine, such as for example, an IFN,
IL-12 and/or heat shock protein, in vitro. Then different mice
(same strain) that have the same tumor type growing in them are
inoculated with the VSV-infected tumor cells. The VSV infected
tumor cells lyse in the animal, attract the host's immune system
and eradicate the established tumor (post-vaccine). In contrast,
lysed tumor cells not exposed to virus are poor immunogens. The use
of VSV virus infection attracts an immune response in the animal.
In some examples, the VSV vector is replication-defective. In other
examples, the VSV vector is replication-competent. Accordingly, the
present invention provides compositions capable of eliciting an
immune response in an individual comprising tumor cells infected
with or lysed by a VSV vector of the present invention. The present
invention also provides methods for eliciting an immune response to
tumor cells in an individual comprising administering a composition
comprising tumor cells infected with or lysed by a VSV vector of
the present invention to said individual. In some examples, the VSV
vector comprises nucleic acid encoding one or more cytokines, such
as an interferon or interleukin. In other examples, the VSV vector
comprises nucleic acid encoding a immunomodulatory protein, such as
a chemokine; or a heat shock protein, such as for example, gp96.
The present invention also provides methods for protecting an
individual against tumor challenge comprising, contacting tumor
cells derived from an individual with a VSV vector comprising
nucleic acid encoding a cytokine, an immunomodulatory protein or a
heat shock protein, such as gp96, under conditions suitable for
lysing said tumor cells; and returning said lysed tumor cells to
said individual.
[0116] Once a VSV vector comprising a nucleotide sequence encoding
a cytokine or suicide gene has been obtained, the VSV vector, or
VSV particles comprising the vector, can be administered to an
individual in need. Such an individual can comprise malignant cells
or tumor cells or can be at risk for developing malignant cells or
tumor cells or development of metastatic disease. The VSV
constructs of the present invention comprising a cytokine or
suicide cassette can be used to treat local tumors or metastatic
disease. A variety of cells and cells lines, including ovarian
carcinoma cells, fibrosarcoma, lung carcinoma, melanoma, prostate
carcinoma, lung carcinoma and leukaemia cells are sensitive to VSV
infection. Therefore, such tumor cells and/or malignant cells
derived therefrom may be particularly amenable to treatment with a
VSV expressing a cytokine or a suicide gene. As disclosed herein,
VSV expressing cytokines or suicide genes have been shown to
exhibit greater oncolytic activity than wt VSV. It is expected that
VSV will have oncolytic activity when administered locally to the
tumor cells or malignant cells, that is intratumorally, as well as
when administered distal to the tumor or malignant cell, such as
via intravenous administration or by other routes.
[0117] To evaluate whether genetically engineered VSV carrying
immunomodulatory or suicide genes, such as thymidine kinase, can be
created and whether such viruses are more efficacious in tumor
therapy than the wild type VSV, VSV vectors carrying the herpes
virus thymidine kinase suicide cassette (TK) or the cytokine gene
interleukin-4 (IL-4) were developed. It is known that the mechanism
of TK action involves the TK protein phosphorylating the non-toxic
pro-drug ganciclovir (GCV), which becomes incorporated into
cellular DNA during replication leading to chain termination and
cell death. The TK/GCV suicide approach has been reported to have
additional benefits in that modified TK can be directly passed from
the transduced cell to adjacent cells thereby increasing tumor
killing, a phenomenon known as the "bystander effect". The
activities of IL-4, in contrast, involve influencing the
development of effector cells such as eosinophils and antigen
presenting cells. IL-4 is also known to regulate T helper (Th) cell
development into Th2 cells and assist in the stimulation of a
humoral response (Asnagli et al. 2001, Curr. Opin. Immunol. 13:
242-7). High levels of IL-4 have been reported to be critical for
the rejection of tumors in the initial phases of tumor development
and implanted engineered IL-4 secreting cells as well as viral
vectors transducing IL-4 have been shown to mediate the regression
of a number of malignancies including melanoma, glioma and colon
carcinoma (Benedetti et al. 2000, Nat. Med. 6:447-50;
Giezeman-Smits, 2000, Cancer Res 60:2449-50; Nagai, et al. 2000,
Breast Cancer 7: 181-6; Tepper et al. 1992, Science
257:548-51).
[0118] Results from experiments disclosed herein demonstrate that a
VSV vector comprising nucleic acid encoding TK exhibits oncolytic
activity against systemic and sub-cutaneous tumors and stimulates
anti-tumor T-cell response. Data also demonstrate that VSV-IL4 or
VSV-TK induce apoptosis, in vivo, of highly aggressive melanoma
cells when an animal is infected at an m.o.i. of 1 or less. The
data also demonstrate that VSV-TK and VSV-IL4 exhibit oncolytic
activity superior to VSV alone in examples disclosed herein.
[0119] VSV vectors comprising nucleic acid encoding interferon, in
particular, interferon-beta and interferon-gamma, were developed.
Results from experiments described herein demonstrate that a VSV
vector comprising nucleic acid encoding INF-beta or INF-gamma
replicates in malignant cells and kills them. The data also
demonstrate that VSV-INF-beta and INF-gamma exhibit oncolytic
activity superior to VSV alone.
[0120] Methods of administration
[0121] Many methods may be used to administer or introduce the VSV
vectors or viral particles into individuals, including but not
limited to, oral, intradermal, intramuscular, intraperitoneal,
intravenous, intratumor, subcutaneous, and intranasal routes. The
individual to which a VSV vector or viral particle is administered
is a primate, or in other examples, a mammal, or in other examples,
a human, but can also be a non-human mammal including but not
limited to cows, horses, sheep, pigs, fowl, cats, dogs, hamsters,
mice and rats. In the use of a VSV vector or viral particles, the
individual can be any animal in which a VSV vector or virus is
capable of growing and/or replicating. The present invention
encompasses compositions comprising VSV vector or viral particles
wherein said compositions can further comprise a pharmaceutically
acceptable carrier. The amount of VSV vector(s) to be administered
will depend on several factors, such as route of administration,
the condition of the individual, the degree of aggressiveness of
the malignancy, and the particular VSV vector employed,. Also, the
VSV vector may be used in conjunction with other treatment
modalities.
[0122] If administered as a VSV virus, from about 10.sup.2 up to
about 10.sup.7 p.f.u., in other examples, from about 10.sup.3 up to
about 10.sup.6 p.f.u., and in other examples, from about 10.sup.4
up to about 10.sup.5 p.f.u. can be administered. If administered as
a polynucleotide construct (i.e., not packaged as a virus), about
0.01 .mu.g to about 100 .mu.g of a VSV construct of the present
invention can be administered, in other examples, 0.1 .mu.g to
about 500 .mu.g, and in other examples, about 0.5 .mu.g to about
200 .mu.g can be administered. More than one VSV vector can be
administered, either simultaneously or sequentially.
Administrations are typically given periodically, while monitoring
any response. Administration can be given, for example,
intratumorally, intravenously or intraperitoneally.
[0123] Pharmaceutically acceptable carriers are well known in the
art and include but are not limited to saline, buffered saline,
dextrose, water, glycerol, sterile isotonic aqueous buffer, and
combinations thereof. One example of such an acceptable carrier is
a physiologically balanced culture medium containing one or more
stabilizing agents such as stabilized, hydrolyzed proteins,
lactose, etc. The carrier is preferably sterile. The formulation
should suit the mode of administration.
[0124] The composition, if desired, can also contain minor amounts
of wetting or emulsifying agents, or pH buffering agents. The
composition can be a liquid solution, suspension, emulsion, tablet,
pill, capsule, sustained release formulation, or powder. Oral
formulation can include standard carriers such as pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, etc.
[0125] Generally, the ingredients are supplied either separately or
mixed together in unit dosage form, for example, as a dry
lyophilized powder or water free concentrate in a hermetically
sealed container such as an ampoule or sachette indicating the
quantity of active agent. Where the composition is administered by
injection, an ampoule of sterile diluent can be provided so that
the ingredients may be mixed prior to administration.
[0126] In a specific embodiment, a lyophilized recombinant VSV of
the invention is provided in a first container; a second container
comprises diluent consisting of an aqueous solution of 50%
glycerin, 0.25% phenol, and an antiseptic (e.g., 0.005% brilliant
green).
[0127] The precise dose of VSV vector or viral particles to be
employed in the formulation will also depend on the route of
administration, and the nature of the patient, and should be
decided according to the judgment of the practitioner and each
patient's circumstances according to standard clinical techniques.
The exact amount of VSV vector or virus utilized in a given
preparation is not critical, provided that the minimum amount of
virus necessary to produce oncolytic activity is given. A dosage
range of as little as about 10 mg, up to amount a milligram or
more, is contemplated.
[0128] Effective doses of the VSV vector or viral particle of the
invention may also be extrapolated from dose-response curves
derived from animal model test systems. A table of safety of
recombinant viruses on BALB/c mice is shown below.
3TABLE 3 Table Safety of recombinant viruses on BALB/c mice Amount
of virus N. of dead Mortality Inoculation Virus (PFU) mouse (%)
I.V. VSV-GFP 1 .times. 10{circumflex over ( )}6 0/5 0 5 .times.
10{circumflex over ( )}6 0/5 0 2 .times. 10{circumflex over ( )}7
0/5 0 5 .times. 10{circumflex over ( )}7 0/5 0 1 .times.
10{circumflex over ( )}8 5/5 100 VSV-IFN.beta. 1 .times.
10{circumflex over ( )}6 0/6 0 5 .times. 10{circumflex over ( )}6
0/6 0 2 .times. 10{circumflex over ( )}7 0/6 0 5 .times.
10{circumflex over ( )}7 0/5 0 1 .times. 10{circumflex over ( )}8
2/5 40 VSV-IFN.gamma. 1 .times. 10{circumflex over ( )}6 0/6 0 5
.times. 10{circumflex over ( )}6 0/6 0 2 .times. 10{circumflex over
( )}7 0/6 0 5 .times. 10{circumflex over ( )}7 4/5 80 rVSV 1
.times. 10{circumflex over ( )}6 0/5 0 5 .times. 10{circumflex over
( )}6 0/5 0 VSV-IL12 2 .times. 10{circumflex over ( )}7 0/2 0 5
.times. 10{circumflex over ( )}7 2/2 100 1 .times. 10{circumflex
over ( )}8 4/4 100
[0129] The data show that the growth of VSV-IFN-beta is attenuated
compared to VSV-GFP. The following examples are offered by way of
illustration and should not be considered as limiting the scope of
the invention.
EXAMPLES
Example 1
Materials and Methods
[0130] Experimental Protocol
[0131] Cell lines. BHK-21 and B 16(F10) melanoma cells were
obtained from American Type Culture Condition (ATCC, Manassas,
Va.). BHK cells were grown in Dulbecco's Modified Essential Medium
(DMEM) containing 10% fetal bovine serum (FBS, Hyclone Laboratories
Inc, Logan, Utah). B16(F10) cells were propagated in similar medium
except that it contained low sodium bicarbonate (1.5 g/L). D1-DMBA3
breast tumor and DA-3 cells derived from the tumor were a gift from
Dr. Diana Lopez (University of Miami, Miami, Fla.). Human primary
cells (microvascular endothelial-HMVEC) were obtained from
Clonetics Corp (San Diego, Calif.) and grown according to the
manufacturer's specifications.
[0132] Construction of recombinant viruses. The IL-4, TK and GFP
inserts were amplified from pGexp, pKO-TK and pLEGFP-C1 (Clontech
Laboratories, Palo Alto, Calif.) plasmids respectively by PCR. For
IL-4, the primers 5' GGCACTCGAGATGGGTCTCAACCCCCAGCTAGTTG and 5'
GCCGTCTAGACTACGAGTAATCCATTTGCA- TGATGC were used.
[0133] For the GFP gene, the primers used were 5'
GGCACTCGAGATGGTGAGCAAGGG- CGAGGAG and 5'
GCTTGAGCTCTAGATCTGAGTCCCTACTTGTACAGC.
[0134] The TK gene was amplified using the following primers 5'
CTTGTAGACTCGAGTATGGCTTCGTACCCCGGCCATCAG 5'
GTATTGTCTGCTAGCGTGTTTCAGTTAGCC- TCCCCCATC.
[0135] The IL-4 and GFP PCR products were digested with XhoI and
XbaI while the TK PCR product was digested with XhoI and NheI and
ligated to pVSV-XN2 (a gift from Dr. John Rose, Yale University)
that had been digested with XhoI and NheI (compatible with XbaI).
The plasmid pVSV-XN2 contains the entire VSV genome and has unique
XhoI and NheI sites flanked by VSV transcription start and stop
signals. The procedure for recovering infectious recombinant VSV
viruses was similar to that described previously (Lawson et al.
1995, P.N.A.S. USA 92:4477-81; Whelan et al., 1995, P.N.A.S. USA
92:8388-92).
[0136] In vitro cell killing assay. Murine B16, DA-3 and human
HMVECs cells were seeded in 12 well plates at approximately
2.times.10.sup.5 cells/well. Cells were pretreated with interferon
(human interferon-.alpha.-2a [Hoffman-La Roche, Nutley N.J.] for
HMVECs, mouse interferon-.alpha..beta. [Sigma, St Louis, Mich.] for
B16 and DA-3) at 1000 u/ml for 24 hours. The cells were then
infected with wt VSV, VSV-TK, VSV-IL-4 or VSV-GFP at an m.o.i. of
0.1 for 18 hours, trypsinized and counted by Trypan Blue exclusion
analysis.
[0137] Enzyme-linked immunosorbent assay for IL-4 production.
Levels of IL-4 in the rVSV-IL-4 supernatants obtained 24 hours
following infection of BHK cells with rVSV-IL-4 were determined by
using an IL-4 ELISA kit obtained from Pharmingen (San Diego,
Calif.) following the manufacturer's protocol.
[0138] Thymidine kinase enzyme assay. Phosphorylation of
ganciclovir was used to measure functional levels of HSV-TK in
extracts of VSV-TK infected cells as follows (Yamamoto et al. 1997,
Cancer Gene Ther 4:91-6). After a 24 hour infection with wild type
or recombinant viruses, BHK cells were washed twice with PBS and
resuspended in a buffer containing 0.5% NP-40, 50 mM Tris HCl (pH
7.5), 20% glycerol, 5mM benzamidine, 2 mM dithiothreotol and 0.5 mM
PMSF. They were subjected to four cycles of freeze thawing followed
by centrifugation of the lysates at 13,000 rpm for 5 min. at
4.degree. C. The enzyme assay was carried out using 60 .mu.g
protein in a reaction mix containing 50 mM Tris HCl, 5 mM magnesium
chloride, 5 mM ATP, 10 mM sodium fluoride and 2 mM dithiothreotol
in a 37.degree. C. water bath. 20 .mu.l aliquots were taken at 0,
30 and 60 minutes following addition of [.sup.3H] GCV (45 .mu.M)
and spotted on DE-81 (Whatman) paper. The filter papers were washed
twice in 1 mM ammonium formate and extracted with 0.1M KCl/0.1N HCl
and counted in a scintillation counter.
[0139] Tumor inoculation in mice. Female C57B1/6 or Balb/c mice (8
week old) from Jackson laboratories were inoculated subcutaneously
with 5.times.10.sup.5 B16(F10) melanoma cells (left flank) or
1.5.times.10.sup.6 D1-DMBA3 breast tumor cells (mammary pad). Mice
were divided into four groups of five each according to the type of
virus administered--heat inactivated VSV, wild type VSV virus,
VSV-TK or VSV-IL-4. After the development of palpable tumors the
mice received 2.times.10.sup.7 pfu of the wild type or recombinant
VSV viruses intratumorally followed by a second injection three
days later. Mice that received VSV-TK were also administered GCV
(100 mg/kg body weight) one day following the initial injection,
followed by daily injections for 10 days thereafter. Tumors were
measured three times weekly. Mice were sacrificed once tumors
reached greater than 1.8 cm in any diameter. Mean tumor volumes in
the four groups were compared using one way ANOVA analysis.
Histopathology was carried out as described previously
(Balachandran et al. 2001, J. Virol. 75:3474-9).
[0140] Cytotoxic assays. Single cell spleen suspensions were
cultured in 25 mm upright flasks at a 20:1 ratio with mitomycin C
treated B16F10 cells for 3 days in the presence of 400 pg/ml IL-2
(Calbiochem, San Diego, Calif.) at 37.degree. C. in a humidified 5%
CO.sub.2 atmosphere. The cytotoxic activity of spleen cells was
determined by performing a standard chromium release assay using
0.1 mCi of Na.sub.2.sup.51CrO4 (Amersham, Arlington Heights, Ill.)
at 37.degree. C., 2 h. After 4 h incubation of effector and target
cells, the supernatants were harvested using a SKATRON cell
harvester and the amount of .sup.51Cr release determined in a gamma
counter (Beckman, Palo Alto, Calif.). The percent specific lysis
was calculated by the following equation: experimental release
CPM-spontaneous release CPM/maximum release CPM-spontaneous release
CPM.times.100. Maximum release was the cpm obtained by incubating
target cells with 2%SDS (Fisher), and spontaneous release was
determined by incubation with growth medium alone. Spontaneous
release of .sup.51Cr was always less than 15% of the total release
in these assays.
Example 2
[0141] Generation of rVSV expressing TK or IL-4. To evaluate
whether VSV could be generated to express potential anticancer
genes, the HSV-TK, mouse IL-4 or, control green fluorescent protein
(GFP) were cloned into the plasmid pVSV-XN2, as additional
transcription units between the VSV G and L genes (FIG. 1a).
Recombinant VSVs expressing either TK, IL-4 or GFP from the
modified transcription unit were recovered in cells expressing the
full-length antigenomic VSV RNA containing the additional gene as
well as the VSV nucleocapsid (N), phosphoprotein (P) and polymerase
(L) proteins. Preliminary analysis indicated that viable
recombinant viruses could be obtained in all cases and examination
of virus production per cell, by one-step growth curve studies,
indicated no aberrant variation in replication abilities compared
to the wild-type VSV (FIG. 1b). Indeed, all viruses grew to
exceptionally high titers of approximately 10.sup.9 plaque forming
units (pfu) per ml. We next determined whether the recovered VSVs
expressed TK, IL-4, or GFP. Accordingly, BHK cells were infected
with VSV-TK for 24 hours at a multiplicity of infection (m.o.i.) of
1 and infected cells were examined for TK protein expression by
immunoblot analysis using an anti-TK monoclonal antibody. Results
indicated that the TK protein was being synthesized to extremely
high levels in cells infected with VSV-TK, while in contrast we
were unable to detect any TK being expressed in cells infected with
other types of VSV (FIG. 2b lanes 1-3). Confirmation of TK
expression was demonstrated using immunofluorescent microscopy of
VSV-TK infected cells while BHK cells infected with VSV- green
fluorescent protein (GFP) also expressed high levels of GFP as
determined by fluorescent microscopy. To ascertain whether the TK
was functional, GCV phosphorylation levels were measured in cells
infected at an m.o.i. of 1 with VSV-TK or wild-type virus, 8 hours
post-infection. The results indicated that TK phosphorylated GCV at
high levels, on average approaching 200 pmoles/mg/min, which we
estimated to be nearly 60-fold greater than in wild-type VSV
infected cells (FIG. 2a). The data disclosed herein thus indicate
that VSV can be generated to express high levels of functional TK,
without any adverse effects upon virus replication.
[0142] We next analyzed whether VSV could express functional IL-4.
Since IL-4 is rapidly secreted from the cell following translation,
preliminary immunoblot analysis of VSV-IL-4 infected cell extracts
using an anti-murine IL-4 monoclonal antibody indicated very little
IL-4 present in the cytoplasm of infected cells, as expected.
However, capture enzyme-linked immunoabsorbant assay (ELISA) using
a monoclonal antibody that binds functional IL-4 indicated that the
cytokine was being secreted into the culture medium at very high
levels from VSV-IL-4 infected cells (FIG. 2c). Indeed, VSV-IL-4
generated about 150 ng/ml of IL-4 per 10.sup.6 cells, over a
hundred fold greater than in the same number of BHK cells
transfected with IL-4 cDNA under control of the CMV promoter.
Confirmation of IL-4 expression, was obtained by
immunoprecipitating secreted IL-4 from the culture medium of
.sup.35S labeled VSV-IL-4 infected cells using an anti-IL-4
monoclonal antibody (FIG. 2d). Thus, similar to our observations
characterizing VSV-TK, we demonstrate that VSV can also be
engineered to express high levels of the cytokine IL-4, which is
biologically active.
Example 3
[0143] rVSV expressing TK or IL-4 retain oncolytic activity. To
evaluate whether the recombinant viruses expressing IL-4 or TK
retained their ability to preferentially replicate in malignant
cells, to eventually induce cell death, a number of transformed
cells were examined in infection assays. An important objective was
also to compare the effects of VSV and recombinant VSVs on normal
cells. To start to appraise this, we selected human microvascular
endothelial cells (HMVECs) since they would be most likely to be
exposed to VSV infection after subcutaneous (s.c.) or intravenous
(i.v.) administration in tumor therapy. HMVECs (106) were therefore
infected at an m.o.i of 0.1 for 18 hours with wild-type VSV or
VSV-IL-4, VSV-TK or VSV-GFP. Cell viability was measured using
Trypan Blue exclusion analysis and revealed that approximately
20-30% of the HMVECs underwent cell death, an effect that could be
essentially eliminated following pre-treatment with interferon
(IFN-.alpha.) [FIGS. 3a and d]. In contrast, a similarly infected
murine breast tumor cell-line (Sotomayor, et al. 1991, J. Immunol.
147:2816-23) (DA-3, derived from D1 DMBA-3 tumor) as well as a
melanoma cell-line B16(F10) (Fidler et al., 1975, Cancer Res. 35,
218-24) underwent dramatic cytolysis (80-90%) following infection
with either the wild-type virus, VSV-TK, VSV-IL-4 or VSV-GFP.
VSV-TK induced potent cytolysis of cells even in the absence of
GCV. Pretreatment of B16(F10) cells with IFN (1000 u/ml for 24
hours) reduced the amount of virus-mediated cell death observed
following infection, regardless of the virus used. It remained
plausible that the mechanisms of IFN production may be
predominantly defective in B16(F10) cells in view of the fact that
IFN-signaling to induce antiviral protection appears partially
intact. However, subsequent analysis of viral production in IFN
pre-treated B16(F10) cells revealed relatively high virus
replication (10.sup.5/ml), suggesting incomplete protection and
anti-viral activity (Table 1). In contrast, Trypan Blue exclusion
analysis indicated that IFN did not afford any significant
protection of breast tumor derived DA-3 cells, suggesting that IFN
function may be defective at multiple levels in these cells (FIGS.
3c and f). These data were confirmed by determining that virus
replication in IFN-treated DA-3 cells was exceedingly high
(10.sup.7/ml) compared to control HMVECs in which virus production
was almost completed ablated (Table 1). To evaluate the mechanisms
of virus-mediated cell lysis, infected B16(F10) and DA-3 cells were
evaluated for apoptotic activity 18 hours post-infection. The
mechanisms of cytolysis invoked by recombinant VSV-IL-4 or TK as
well as the wild-type virus involved the induction of apoptosis
since levels of active caspase-8 and 9 was three-fold higher than
in untreated cells. Thus, recombinant VSV expressing IL-4 or TK do
not appear to lose their effectiveness at inducing programmed cell
death in infected cells compared to wild-type VSV.
Example 4
[0144] rVSV expressing TK or IL-4 kill tumors in vivo.
[0145] To evaluate the oncolytic activity of the recombinant
viruses, immunocompetent mice were sub-cutaneously (s.c.) implanted
with 1.times.10.sup.6 cells of the syngeneic B16 melanoma (C57B1/6)
or poorly immunogenic mammary tumor derived D1 DMBA (Balb/c), both
aggressive tumors. Following the formation of palpable tumors,
2.times.10.sup.7 wild-type VSV or VSV-IL-4 or VSV-TK were
introduced intratumorally (i.t.). As controls, an equivalent amount
of heat-inactivated (HI) VSV was used. Ganciclovir was administered
(100 mg/kg body weight), intraperitoneally (i.p.), daily in animals
receiving VSV-TK. Virus therapy was repeated once more, three days
after the first injection and tumor growth monitored three times
weekly. Resultant data demonstrated that wild-type VSV inhibited
the growth of both the melanoma and breast tumors compared to
tumors treated with control HI virus (FIGS. 4a and b). However, in
independent sets of experiments, more potent inhibition of tumor
growth (both B16 and D-1 DMBA) was observed in animals treated with
either VSV-IL-4 or VSV-TK (FIGS. 4a and b). In some instances,
complete regression of tumors was observed in animals implanted
with either B16(F10) (3/5 mice) or D1 DMBA (2/5 mice), following
treatment with VSV-TK. In contrast, a number of mice implanted with
either tumor and infected with HI-VSV had to be sacrificed 4 days
post-treatment because of the excessive tumor size. The differences
in the tumor volume between the control group (HI-VSV) and animals
treated with either VSV-TK or VSV-IL-4 was observed to be
statistically significant, at (p<0.01) and (p<0.001) for
animals implanted with B16(F10 ) or D1 DMBA, respectively. These
data indicate that VSV expressing either IL-4 or TK exhibit potent
oncolytic activity, superior to that of VSV alone.
[0146] To examine the effects of virus therapy, in vivo, tumors
inoculated with the various viruses were excised and sections
examined histologically following hematoxylin and eosin (H&E)
staining. As expected, tumors infected with control HI-VSV
exhibited very little morphological abnormalities that could be
associated with virus induced oncolytic activity (<30% necrosis
[FIG. 5a]). However, a greater proportion of cell death, as
exhibited by pyknotic nuclei, was observed in B16(F10) tumors
treated with wild-type VSV (.about.50%) or with VSV-IL-4 (75%) or
VSV-TK (.about.95%), indicative of an increase in oncolytic
activity (FIGS. 5b-d). Significant inflammatory infiltration was
also evident in tumors treated with the recombinant viruses,
especially in tumors treated with VSV-IL-4, which showed major
infiltration of polymorphonuclear cells including neutrophils and
eosinophils (FIG. 5 compare e to g). Analysis of viral replication
in the brain, liver and tumors retrieved from mice implanted with
B16(F10) or D1 DMBA cells and treated with wild-type or recombinant
viruses (two were analyzed from each virus treated group) did not
reveal evidence of infectious virus 7 days after the last virus
treatment (one week after the primary inoculation). Thus, following
i.t. inoculation, all VSV types appear to be rapidly cleared from
the animals.
[0147] Although CD8+ T-lymphocytes have been reported to be
important for the antitumor activity of IL-4, cellular immune
responses have also been reported to play a role in the local and
systemic antitumor activity of TK/GCV (Yamamoto et al. 1997, Cancer
Gene Ther 4:91-6). Since IL-4 and TK/GCV treated tumors exhibited
pronounced host cell infiltration, we examined whether lymphocytes
generated by the animals exhibited specific cytotoxic activity to
tumor associated antigens in the implanted syngeneic transformed
cells. Accordingly, animals harboring B16(F10) derived tumors were
intratumorally inoculated twice with wild-type VSV, HI VSV,
VSV-IL-4 or VSV-TK. Seven days after inoculation, spleens were
removed, mononuclear cells isolated and chromium release assays
carried out using B16(F10) target cells. The results indicated that
animals generated a robust CTL-response only against tumors
receiving VSV-TK, and not with VSV-IL-4, the wild-type virus or
controls. The data are consistent with previous findings that
TK/GCV-mediated destruction of tumor cells can facilitate antigen
uptake by professional antigen presenting cells. Possibly, the
process of cellular destruction involves apoptosis through
accumulation of p53 and the upregulation of Fas (CD-95), which then
through aggregation stimulates FADD-dependent cell death in a Fas
ligand independent manner (Beltinger et al. 1999, P.N.A.S. USA
96:8699-704). It is therefore plausible that VSV expressing TK
exerts a greater oncolytic effect through TK/GCV mediated apoptosis
and enhanced bystander effect, as well as through the generation of
specific antitumor CTL responses. While IL-4 can influence the
development of Th cells, IL-4 in this tumor model did not strongly
influence the development of tumor specific cytotoxic T cells, as
judged by CTL assays. Nevertheless, VSV-expressing IL-4 did exert a
greater oncolytic effect that was statistically significant
compared to wild-type VSV.
[0148] Although IL-4 has been incorporated into a number of live
virus vectors for either gene therapy, anticancer strategies or to
increase an immune response to candidate viral-vaccines, the
overall positive effects of the cytokines contribution vary
(Bebedetti et al. 2000, Nat. Med. 6:447-50). The data shown herein
indicate that tumors treated with VSV expressing IL-4 may exert a
more potent oncolytic effect than VSV alone possibly due to the
increased presence of infiltrating eosinophils and neutrophils,
which have been reported to directly have antitumor activity
(Tepper et al., 1992, Science 257:548-51). However, the full
mechanisms of IL-4 mediated antitumor activity undoubtedly remain
to be clarified.
[0149] A recent report indicated that expression of IL-4 by
ectromelia virus suppressed antiviral cell-mediated immune
responses and was associated with high mortality in mice usually
resistant to the wild-type virus (Jackson et al., 2001, J. Virol.
75:1205). While these data raise concerns about developing novel
viruses that contain immunomodulatory genes, the data would be
consistent with studies where retroviruses or adenovirus expressing
IL-4 produced no adverse effects in vivo (Steele et al. 2000, Proc.
Soc. Exp. Biol. Med. 223:118-27). In safety trials we did not note
any increase in toxicity in animals inoculated, by various routes,
with VSV-IL-4 compared to the wild-type VSV. Aside from not being
able to detect infectious VSV in organs or tumors from mice
receiving VSV treatment, 7 days after the last tumor inoculation,
animals receiving VSV-IL-4 or VSV-TK at 2.times.10.sup.7 (i.p.) or
2.times.10.sup.6 (i.v.), presently remain healthy 8 weeks after
infection.
Example 5
Materials and Methods
Cells
[0150] BHK-21 cells, primary and transformed mouse embryonic
fibroblasts derived from C57BL/6 mice were maintained in Dulbecco's
modified essential medium (DMEM) supplemented with 10% fetal bovine
serum (HyClone Laboratories Inc., Logan, Utah), 100 units of
penicillin G/ml, 100 units of streptomycin/ml and 0.25 .mu.g of
amphotericin B. B16(F10) melanoma cells and DA-3 cells derived from
D1-DMBA3 breast tumor were maintained in same medium except that it
contained 1.5 g of sodium bicarbonate per liter and OPI media
supplement (Sigma, St. Louis, Mo.), respectively. TS/A mammary
adenocarcinoma cells were maintained RPMI 1640 medium supplemented
with 10% fetal bovine serum.
[0151] Construction of recombinant virus
[0152] Mouse IFN-.beta. cDNA was amplified by polymerase chain
reaction (PCR) from plasmid pMK-M.beta., a gift from Dr. Yoichiro
Iwakura, Institute of Medical Science, University of Tokyo, using
oligonucleotides 5'-TCCATCCTCGAGCACTATGAACAACAGGTGGATCCTC-3'
(sense) and 5'-AGGTCTGCTAGCCTAGTTTTGGAAGTTTCTGGT-3' (anti-sense).
The amplified fragment was then inserted into the Xho I-Nhe I site
of pVSV-XN2 (Fernandez et al. 2002, J. Virol.; 76(2): 895-904). The
procedure for recovering recombinant VSV was similar to that
described previously (Lawson et al., 1995, P.N.A.S. USA,
92:4477-81; Whelan et al., 1995, P.N.A.S. USA, 92:8388-92). The
seed virus was propagated in BHK-21 cells and stored at -80 C.
until use. VSV-GFP and rVSV were prepared as previously described
(Fernandez et al., 2002).
[0153] Virus growth in vitro
[0154] The growth of the recombinant viruses in BHK-21 cells were
examined as previously described (Fernandez et al., 2002). Cells
were seeded in 6-well culture plate at 1.times.10.sup.6 cells per
well and infected with each virus at a multiplicity of infection
(m.o.i.) of 10 PFU per cell. The culture supernatants were
harvested at the indicated times and subjected to titer
determination by a standard plaque assay on BHK-21 cells.
[0155] For in vitro cell-killing assay, murine embryonic
fibroblasts, B16(F10), DA-3, and TS/A cells were seeded in 12- or
24-well culture plate at approximately 2.times.10.sup.5 cells per
well and infected with viruses at the indicated m.o.i. for 24 h,
and then trypsinized and counted by trypanblue exclusion
analysis.
[0156] ELISA for IFN-.beta. production
[0157] Expression levels of IFN-.beta. on VSV-IFN.beta.-infected
cells was examined by an enzyme-linked immunosorbent assay (ELISA).
BHK-21 cells were seeded in a 35-mm-diameter culture dish at
1.times.10.sup.6 cells and infected with viruses at an m.o.i of 10
p.f.u. per cell for 24 h. The supernatant was then subjected to
ELISA. ELISA was performed as previously published procedure
(Coligan et al., 1991). Briefly, 96-well microcroplate (Nalge Nunc
International, Rochester, N.Y.) was coated with 5 .mu.g/ml of
monoclonal rat antibody to mouse IFN-.beta. (Seikagaku America,
Falmouth, Mass.) and incubated overnight at 4 C. Serial dilutions
of the supernatants were then added and incubated overnight at 4 C.
Polyclonal sheep antibody to mouse IFN-.alpha./.beta. (United
States Biological, Swampscott, Mass.) diluted to 1:2000 was used as
secondary antibody, and bound antibodies were detected with
peroxidase-labeled polyclonal rabbit antibody to sheep IgG (H+L)
(KPL, Gaithersburs, Md.) diluted to 1:2500. The peroxidase was
revealed by incubation with the substrate 2, 2+-azino-bis
(3-ethylbenzothiazoline-6-sulfonate) for 30 min, and a
spectrophotometric reading was obtained at 414 nm.
[0158] Biological activity assay for IFN-.beta.
[0159] BHK-21 cells were seeded in a 35-mm-diameter culture dish at
1.times.10.sup.6 cells and infected with viruses at an m.o.i of 10
p.f.u. per cell for 24 h. The supernatants were harvested and
treated at 56 C. for 30 min to inactivate the viral infectivity.
B16(F10) cells were seeded in a 24-well culture plate at
2.times.10.sup.6 cells per well and incubated with the supernatant
diluted to 1:50 or 500 units/ml of mouse IFN-.alpha./.beta. (Sigma)
for 24 h. Cells were then infected with VSV at an m.o.i. of 0.1 for
24 h, and CPE was assessed under microscopy.
[0160] Animal studies
[0161] Six to 8-week-old female BALB/c mice were obtained from
Jackson Laboratories and maintained under specific pathogen-free
conditions. Mice were injected intravenously (i.v.) with
5.times.10.sup.4 TS/A cells and then infected i.v. with
5.times.10.sup.7 p.f.u. of recombinant VSV 2 days later. The
survival of mice was monitored daily after virus infection. For
vaccination of VSV-IFN.beta.-infected TS/A cells, the cells were
infected with the virus at an m.o.i. of 10 per cell for 2h. Mice
were injected subcutaneously (s.c.) with 1.times.10.sup.6 infected
TS/A cells and challenged sub-cutaneously with 1.times.10.sup.5
TS/A cells 10 days later. The tumor sizes were measured at 2 days
intervals, and the volume was calculated according to the formula
0.5.times.length.times.(width.sup- .2).
[0162] Statistical significance of inter-group differences was
evaluated using the Mann-Whitney test. For histopathological
analysis, mice were killed at indicated time point, and tumors were
excised, fixed with 10% neutralized buffered formalin and stained
with hematoxylin and eosin.
[0163] Cytotoxic assay
[0164] Cytotoxity of T-lymphocytes was performed as described as
previously (Fernandez et al., 2002). Briefly, spleen cells prepared
from VSV-infected tumor-bearing mice were incubated with
.sup.51Cr-labeled TS/A cells at indicated effecter cells to target
cells ratios, and release of .sup.51Cr was quantified on a gamma
counter. The percentage of lysis was calculated according to the
formula [(experimental release cpm-spontaneous release
cpm)/(maximum release-spontaneous release)]33 100.
[0165] Table 4 shows the virus titers in primary and transformed
C57BL/6 mouse fibroblast. Table 5 shows the virus titers in TS/A
cells.
4TABLE 4 Virus titers in primary and transformed C57BL/6 mouse
fibroblasts Virus titers (PFU/1 .times. 10{circumflex over ( )}5
cells).sup.b) Virus.sup.a) Primary Cell Transformed Cell VSV-GFP
1.3 .times. 10{circumflex over ( )}7 3.6 .times. 10{circumflex over
( )}6 VSV-IFN.beta. 6.2 .times. 10{circumflex over ( )}4 2.9
.times. 10{circumflex over ( )}5 VSV-IFN.gamma. 3.5 .times.
10{circumflex over ( )}6 1.5 .times. 10{circumflex over ( )}6
.sup.a)MOI 0.01 .sup.b)Data shows a mean of twice of independent
experiment
[0166]
5TABLE 5 Virus titers in TS/A cells Virus titers (PFU/1 .times.
10{circumflex over ( )}6 cells).sup.a) Virus M.O.I. 0.1 M.O.I. 0.01
VSV-GFP 4.3 .times. 10{circumflex over ( )}8 1.4 .times.
10{circumflex over ( )}8 VSV-IFN.beta. 3.5 .times. 10{circumflex
over ( )}8 1.4 .times. 10{circumflex over ( )}7 VSV-IFN.gamma. 3.4
.times. 10{circumflex over ( )}8 1.3 .times. 10{circumflex over (
)}8 .sup.a)Data shows a mean of twice of independent experiment
[0167] The data show that VSV-IFN-beta or IFN-gamma retain the
ability to kill tumor cells. The inclusion of the IFN-beta or
IFN-gamma in the VSV vector construct does not impede the VSV
oncolytic activity or replicative abilities.
Example 6
[0168] VSV Inhibits Growth of p53-Deficient, Myc-Transformed, or
Ras-Transformed In Vivo.
[0169] To start to evaluate the use of VSV in antitumor therapy,
athymic nude mice were subcutaneously implanted with
2.times.10.sup.6 C6 glioma cells, or with Balb-3T3 cells
transformed with the Myc or the activated K-Ras gene. When palpable
tumors had formed (approximately 7-14 days when the tumors had
reached an approximate size of 0.25 cm.sup.2) mice were infected
intratumorally with VSV (2.5.times.10.sup.7 pfu/ml) and monitored
daily. The injection, with same amount of virus was repeated after
four days. All mice that received VSV showed markedly-inhibited
tumor growth, irrespective of the genetic backgrounds of the
tumors, or the oncogenic events contributing to their
transformation. In fact, the administration of VSV resulted in
marked repression of tumor growth in all animals tested within 17
days, when tumors in the control animals exceeded that acceptable
tumor burden. These data highlight the potent efficacy of VSV
against tumors both in vitro and in vivo.
[0170] To examine whether VSV spread beyond the implanted,
virus-inoculated tumor, a variety of tissue from the VSV treated
animals, as well as the tumors themselves were analyzed for the
presence of residual, replicating VSV. Examination of VSV infected
mice for the presence of VSV 21 days after infection revealed the
existence of residual virus (2.times.10.sup.4-3.5.times.10.sup.5
pfu/g) in tumor tissue derived from C6 cells. However, no virus was
detectable in the lung, brain, kidney, spleen, or liver of mice
receiving VSV therapy after this period of time. These data show
that VSV replication is restricted to tumor-lineage.
Example 7
[0171] VSV Exerts Anti-Tumor Activity Intravenously and on Distal
Tumors.
[0172] To examine whether VSV was capable of exerting its antitumor
effects following inoculation at sites distant from the tumor, VSV
was introduced intravenously (i.v; three injections of
1.times.10.sup.7 pfu each/mouse two days apart) and monitored
growth of implanted C6 glioblastoma tumors every day for up to 8
days.
[0173] Nude mice were implanted with 1.times.10.sup.6 C6 cells
bilaterally into both rear flanks of the mouse and the right tumor
was inoculated with 1.times.10.sup.7 pfu VSV, or with
heat-inactivated control virus. Nude mice bearing single C6 tumors
were injected intravenously with 1.times.10.sup.8 pfu VSV at days
1, 3, 5, 7, 9, 11 and 13. i.v.-inoculated VSV was able to cause the
regression of C6 tumors in vivo.
[0174] Next, experiments were designed to determine whether
intratumoral inoculation of VSV can cause the regression of distal
tumors at other sites on the mouse. For these experiments, nude
mice were implanted with C6 glioblastoma cells bilaterally on both
the left and right flanks of the mouse, and inoculated only one of
the implanted tumors with VSV after both had reaches a size of
approximately 0.25 cm.sup.2. VSV, but not heat-inactivated virus
control, was able to cause the partial regression of distal tumors
when introduced into one tumor. These studies demonstrate the
potential of VSV to eradicate tumors and metastases at sites distal
from the site of inoculation.
Example 8
[0175] VSV from cDNA
[0176] A cDNA clone representing the entire 11,161 nucleotides of
VSV was generated and unique Xho I/Nhe I sites were added to
facilitate entry of a heterologous gene, in our case, HSV-TK.
Transcription of the cDNA is dependent on T7 RNA polymerase.
Vaccinia vTF7-3 is used to infect baby-hamster kidney cells
(BHK-21), to provide a source of polymerase. Subsequently, VSV cDNA
is transfected into the same cells together with three other
plasmids that express the VSV N, P and L proteins. These latter
three proteins facilitate the assembly of nascent VSV antigenomic
RNA into nucleocapsids and initiate the VSV infectious cycle. After
24 hours, host cells are lysed, clarified and residual vaccinia
removed by filtration through a 0.2 um filter onto fresh BHK cells.
Only recombinant VSVs are produced by this method since no
wild-type VSV can be generated.
Example 9
[0177] Characterization of recombinant VSVs (rVSVs).
[0178] Cells infected with rVSV or wild-type VSV are metabolically
labeled with [.sup.35S]methionine. Cells are lysed and aliquots
analyzed by SDS-PAGE. Since VSV inhibits host proteins synthesis,
only viral proteins are made, including heterologous genes inserted
into its genome. Cells infected with rVSVs will have an extra
protein (i.e. HSV-TK, .about.26 kDa) being synthesized compared to
control cells infected with VSV alone. VSV mRNAs are detected by a
similar manner using radiolabeled dUTP. In many cases, antibody to
the heterologous protein exists. Therefore, ELISAs are used to
detect the expression of heterologous proteins, such as, IL-4,
IL-12 and IFNs. High levels of heterologous protein expression have
been obtained in all recombinant systems examined.
Example 10
[0179] Growth of VSV
[0180] Large amounts of VSV (Indiana strain) and recombinant VSV
are purified by sucrose gradients. Essentially, BHK cells are
infected at 0.01 m.o.i and after 24 hours, where >80% of cells
usually exhibit CPE/apoptosis, supernatants are collected and
clarified by centrifugation. Clarified supernatants are purified by
centrifugation through 10% sucrose and the viral pellets
resuspended and layered onto continuous 35-55% sucrose gradients.
The gradients are centrifuged at 110,000 g for 18 hours at
4.degree. C. and virus retrieved and pelleted by further
centrifugation and 15,000 rpm at 4.degree. C. for 1 hour. Viruses
are resuspended in PBS, concentrations determined by standard
plaque assays and stored in aliquots at -80.degree. C. (30).
Example 11
[0181] Generation of replication-defective recombinant VSV.
[0182]
[0183] VSV that lacks the G protein function and which express
IL-12 or IFN-.beta. and .gamma. are constructed. Such viruses are
generated in helper cells (CHO) that have been constructed to
inducibly express the VSV G protein. Following infection of target
cells, resultant viruses infect cells because they contain the VSV
G from the helper cell. However, following infection and
replication, progeny viruses will lack the receptor G and cannot
disseminate to infect surrounding tissue. It is likely that these
viruses are able to infect tumor cells and preferentially replicate
to express immunomodulatory or suicide protein.
Replication-defective VSV viruses expressing selected heterologous
genes are produced and compared regarding their anti-tumor efficacy
in vitro and in vivo against wt VSV counterparts. rVSV lacking M
and N protein function are produced. Additionally, VSV having a
replacement of the G protein with other receptors, such as tumor
specific receptors are produced and analyzed to determine if the
presence of the tumor specific receptor in the rVSV is more tumor
cell specific.
[0184] The present invention is not to be limited in scope by the
specific embodiments described herein. Various modifications of the
invention in addition to those described herein will become
apparent to those skilled in the art from the foregoing description
and accompanying figures. Such modifications are intended to fall
within the scope of the appended claims.
* * * * *