U.S. patent application number 10/060795 was filed with the patent office on 2003-02-27 for dopamine receptors and genes.
This patent application is currently assigned to Oregon Health and Sciences University. Invention is credited to Bunzow, James R., Civelli, Olivier, Grandy, David K., Machida, Curtis A..
Application Number | 20030040022 10/060795 |
Document ID | / |
Family ID | 46252928 |
Filed Date | 2003-02-27 |
United States Patent
Application |
20030040022 |
Kind Code |
A1 |
Civelli, Olivier ; et
al. |
February 27, 2003 |
Dopamine receptors and genes
Abstract
A mammalian D.sub.2 dopamine receptor gene has been cloned.
Thus, DNA sequences encoding all or a part of the dopamine receptor
are provided, as well as the corresponding polypeptide sequences
and methods for producing the same both synthetically and via
expression of a corresponding sequence from a host transformed with
a suitable vector carrying the corresponding DNA sequence. The
various structural information provided by this invention enables
the preparation of labeled or unlabeled immunospecific species,
particularly antibodies, as well as nucleic acid probes labeled in
conventional fashion. Pharmaceutical compositions and methods of
using various products of this invention are also provided.
Inventors: |
Civelli, Olivier; (Portland,
OR) ; Bunzow, James R.; (Portland, OR) ;
Grandy, David K.; (Portland, OR) ; Machida, Curtis
A.; (Portland, OR) |
Correspondence
Address: |
MCDONNELL BOEHNEN HULBERT & BERGHOFF
300 SOUTH WACKER DRIVE
SUITE 3200
CHICAGO
IL
60606
US
|
Assignee: |
Oregon Health and Sciences
University
|
Family ID: |
46252928 |
Appl. No.: |
10/060795 |
Filed: |
January 29, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10060795 |
Jan 29, 2002 |
|
|
|
09238977 |
Jan 27, 1999 |
|
|
|
6342360 |
|
|
|
|
09238977 |
Jan 27, 1999 |
|
|
|
08474892 |
Jun 7, 1995 |
|
|
|
5880260 |
|
|
|
|
08474892 |
Jun 7, 1995 |
|
|
|
07973588 |
Nov 9, 1992 |
|
|
|
07973588 |
Nov 9, 1992 |
|
|
|
07438544 |
Nov 20, 1989 |
|
|
|
07438544 |
Nov 20, 1989 |
|
|
|
07273373 |
Nov 18, 1988 |
|
|
|
Current U.S.
Class: |
435/7.21 ;
530/388.22 |
Current CPC
Class: |
C12N 15/00 20130101;
C12Q 2600/158 20130101; C12Q 1/6876 20130101; A61K 38/00 20130101;
A01K 2217/05 20130101; C07K 16/286 20130101; C07K 14/70571
20130101 |
Class at
Publication: |
435/7.21 ;
530/388.22 |
International
Class: |
G01N 033/567; C07K
016/28 |
Claims
What is claimed is:
1. An antibody capable of specifically binding to a mammalian D2
dopamine receptor having an amino acid sequence identified as the
amino acid sequence of FIGS. 7A-C, FIGS. 18A-H or FIGS. 18A-H
wherein amino acids 242-270 are deleted therefrom.
2. An antibody according to claim 1 that is a monoclonal
antibody.
3. An antigen-binding fragment of an antibody according to claim 1,
wherein said fragment can be produced by chemical or enzymatic
cleavage of said antibody.
4. An antigen-binding fragment according to claim 3, wherein the
fragment is an Fab fragment, an F(ab)' fragment, an F(ab).sub.2
fragment or an Fv fragment.
5. An antibody according to claim 1 wherein the mammalian D2
dopamine receptor is a human D2 dopamine receptor.
6. An antibody according to claim 5 wherein the mammalian D2
dopamine receptor has an amino acid sequence identified as the
amino acid sequence of FIGS. 18A-H or FIGS. 18A-H wherein amino
acids 242-270 are deleted therefrom.
7. An antibody according to claim 1 wherein the mammalian D2
dopamine receptor is a rat D2 dopamine receptor.
8. An antibody according to claim 5 wherein the mammalian D2
dopamine receptor has an amino acid sequence identified as the
amino acid sequence of FIGS. 7A-C.
9. An antibody according to claim 1 wherein the antibody is
detectably-labeled.
10. An antibody according to claim 1 where the antibody has
immunological binding specificity for an epitope comprising amino
acids 2-13, 182-192, 264-277, 289-298 or 404-414 in FIG. 1.
Description
[0001] This application is a continuation of U.S. Ser. No.
07/438,544, filed Nov. 20, 1989, now abandoned, which was a
continuation-in-part of U.S. Ser. No. 07/273,373, filed Nov. 18,
1988, now abandoned.
BACKGROUND OF THE INVENTION
[0002] This invention relates to dopamine receptors from mammalian
species and the corresponding genes. In particular, it relates to
the isolation, sequencing and/or cloning of D.sub.2 dopamine
receptor genes, the synthesis of D.sub.2 dopamine receptors by
transformed cells, and the manufacture and use of a variety of
novel products enabled by the identification and cloning of DNA
encoding dopamine receptors.
[0003] Dopamine receptors in general have been implicated in a
large number of neurological and other disorders, including, for
example, movement disorders, schizophrenia, drug addiction,
Parkinson's disease, Tourette syndrome, Tardive Dyskinesia, and
many others. As a result, the dopamine receptor has been the
subject of numerous pharmacological and biochemical studies.
[0004] In general, dopamine receptors can be classified into
D.sub.1 and D.sub.2 subtypes based on pharmacological and
biochemical characteristics (1, 2). The D.sub.2 dopamine receptor
has been implicated in the pathophysiology and treatment of the
mentioned disorders. In addition, it is known that the D.sub.2
dopamine receptor interacts with guanine nucleotide binding
proteins to modulate second messenger systems (6, 7).
[0005] Despite the heavy emphasis placed on elucidation of the
existence and properties of the dopamine receptor and its gene,
identification, isolation and cloning have been inaccessible
heretofore. This is true despite the knowledge that other members
of the family of receptors that are coupled to G proteins share a
significant similarity in primary amino acid sequence and exhibit
an archetypical topology predicted to consist of seven putative
transmembrane domains (8). Regarding the serotonin receptor, e.g.,
see Julius et al., Science, Vol. 241, 558 (1988).
SUMMARY OF THE INVENTION
[0006] This invention has successfully identified, isolated and
cloned mammalian, including human, D.sub.2 dopamine receptor gene
sequences and produced the encoded dopamine receptor. The
corresponding polypeptide has been synthesized. Sequences of both
the gene and the polypeptide have been determined. The invention
also provides a variety of new and useful nucleic acid, cell line,
vector, and polypeptide and medicinal products, inter alia, as well
as methods of using these.
[0007] Thus, this invention relates to an isolated DNA sequence, an
identified portion of which is a structural gene which encodes a
polypeptide having the biological activity of a mammalian D.sub.2
dopamine receptor. In particular, it relates to an isolated DNA
sequence which will hybridize to a DNA sequence encoding a
mammalian D.sub.2 dopamine receptor. It also relates to fragments,
variants and mutants of such sequences, particularly those which
also encode a polypeptide having biological activity of a mammalian
dopamine receptor, most particularly a mammalian D.sub.2 dopamine
receptor. In a preferred aspect, the dopamine receptor is human. In
another preferred aspect, the sequence is that of rat D.sub.2
dopamine receptor as shown in FIG. 1. Of course, the nucleic acids
of this invention also include complementary strands of the
foregoing, as well as sequences differing therefrom by codon
degeneracy and sequences which hybridize with the aforementioned
sequences. In other preferred aspects, this invention includes
nucleic acid sequences and fragments useful as oligonucleotide
probes, preferably labelled with a detectable moiety such as a
radioactive or biotin label. For example, such probes can hybridize
with DNA encoding a polypeptide having the biological activity of a
D.sub.2 dopamine receptor or with DNA associated therewith, e.g.,
DNA providing control of a D.sub.2 dopamine receptor gene or
introns thereof, etc. DNA of this invention can also be part of a
vector.
[0008] The invention also involves cells transformed with vectors
of this invention as well as methods of culturing these cells to
manufacture polypeptides, e.g., having the biological activity of a
D.sub.2 dopamine receptor. Preferably, the cells are of mammalian
origin when used in such methods.
[0009] The invention also relates to polypeptides encoded by the
foregoing nucleic acid sequences, especially to isolated mammalian
dopamine receptors, preferably of human origin. The invention
further relates to polypeptides which are mutants or variants of
such receptors, preferably those wherein one or more amino acids
are substituted for, inserted into and/or deleted from the
receptor, especially those mutants which retain the biological
activity of a dopamine receptor. This invention also relates to
antibodies, preferably labelled, and most preferably monoclonal,
capable of binding a dopamine receptor amino acid sequence,
preferably wherein the latter is human, or a fragment of such an
antibody.
[0010] The invention further relates to compositions comprising one
of the various products mentioned above and, typically, a
pharmaceutically acceptable carrier as well as to methods of
employing these products to achieve a wide variety of utilitarian
results.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Various other objects, features and attendant advantages of
the present invention will be more fully appreciated as the same
becomes better understood when considered in conjunction with the
accompanying drawings, and wherein:
[0012] FIG. 1 shows the nucleotide sequence for the RGB-2 cDNA and
deduced amino acid sequence of the rat D.sub.2 dopamine receptor.
The nucleotide sequence is numbered beginning with the first
methionine of the long open reading frame. Nucleotide numbering
appears beneath the nucleotide sequence at the right-hand end of
each line. The deduced amino acid sequence is shown above the
nucleotide sequence. The double underline denotes the small open
reading frame in the 5' untranslated region. Postulated N-linked
glycosylation sites are indicated by asterisks. Putative protein
kinase A phosphorylation sites have a line above them. The intron
splice junction is designated by an arrow. The poly A adenylation
site is underlined.
[0013] FIG. 2 shows the alignment of the amino acid sequences of
the rat D.sub.2 dopamine receptor, the hamster
.beta..sub.2-adrenergic receptor, the human
.alpha..sub.2-adrenergic receptor, the human G-21 (serotonin 1a)
receptor, the porcine muscarinic M receptor and the bovine
substance K receptor. Amino acids enclosed in solid lines and
shaded represent residues that are identical in at least two other
sequences when compared to the D.sub.2 dopamine receptor. The
putative transmembrane domains are indicated by brackets labeled by
Roman numerals. The numbers of residues in the variable third
cytoplasmic loop and at the C-terminus are in parentheses.
[0014] FIG. 3 shows a Northern blot analysis of RGB-2 transcripts
in rat brain and pituitary. Each lane contained 20 .mu.g of total
RNA. Numbers on the right indicate molecular weight as determined
from RNA size markers (BRL). A: olfactory bulb; B: hippocampus; C:
cerebellum; D: posterior cortex; E: anterior cortex; F: thalamus;
G: hypothalamus; H: medulla; I: amygdala; J: mesencephalon; K:
septum; L: posterior basal ganglia; M: anterior basal ganglia; N:
neurointermediate lobe of pituitary; O: anterior lobe of the
pituitary.
[0015] FIG. 4 illustrates the binding of .sup.3H-spiperone to
membranes from L-RGB2Zem-1 cells.
[0016] a) 1: Saturation isotherms of the specific binding of
.sup.3H-spiperone to membranes prepared from L-RGB2Zem-1 cells and
rat striatum. Results are shown from one of four independent
experiments.
[0017] 2: Scatchard transformation of the data.
[0018] b) Competitions curves using L-RGB2Zem-1 membranes.
Representative curves are shown for inhibition of specifically
bound .sup.3H-spiperone by drugs in membranes from L-RGB2Zem-1
cells. Each drug was tested 3 times.
[0019] c) Table of K.sub.i values for L-RGB2Zem-1 and rat striatum.
Results are geometric means of 3 experiments in which 0.5 nM
.sup.3H-spiperone was inhibited by various concentrations of
unlabeled drug. For some drugs, inhibition curves in rat striatal
tissue were fit best by assuming the presence of two classes of
binding sites. The proportions of binding sites with high or low
affinity for inhibitor are shown in parentheses. K.sub.i values for
the class of binding sites representing 10-25% of specific binding
were calculated by assuming that the radioligand was binding to
serotonin receptors with a Kd value of 1 nM.
[0020] FIG. 5 shows (a) a hydrophobicity plot of the amino acid
sequence shown in FIG. 1; and (b) a hydophobicity plot of the amino
acid sequence of the .beta..sub.2-adrenergic receptor. The
transmembrane regions are marked by the Roman numerals.
[0021] FIG. 6 shows a calculated restriction map of a 2477 base
EcoRI fragment of the nucleic acid sequence shown in FIG. 1.
[0022] FIG. 7 shows a partial sequence of a human D.sub.2 dopamine
receptor, the middle amino acid sequence shown being the correct
one.
[0023] FIG. 8 shows a saturation analysis of specific
[.sup.3H]spiroperidol binding to LZR1 and LZR2 cells. Results shown
are from representative experiments in which LZR1 and LZR2 cells
were grown in control growth medium or medium to which zinc sulfate
had been added, as indicated. Data are plotted as specifically
bound radioligand divided by the corrected free concentration of
radioligand (total added minus total bound), versus specifically
bound radioligand. For zinc treatments, 100 .mu.M zinc sulfate was
added to growth medium for 16 hours. Both control and zinc-treated
cells were then washed and grown in control medium for one day
before harvesting. In the experiments shown, B.sub.max values
determined by nonlinear regressions analysis were 876 and 914
fmol/mg of protein for control LZR1 cells or LZR1 cells treated
with zinc, respectively. B.sub.max values for control or
zinc-treated LZR2 cells were 385 and 593 fmol/gm of protein,
respectively.
[0024] FIG. 9 shows the inhibition of radioligand binding by
agonists. Results are plotted as specific binding, expressed as a
percentage of specific binding in the absence of competing drug,
versus the log of the concentration of competiting drug. Membranes
were prepared from LZR1 cells as described in the text.
[0025] A. Curves from a single experiment are shown for inhibition
of the binding of [.sup.3H]spiroperidol by agonists. Each drug was
tested twice. In this experiment, the free concentration of
[.sup.3H]spiroperidol was 230 pM, and the K.sub.0 value for
[.sup.3H]spiroperidol was 60 pM. K.sub.1 values and Hill
coefficients in this experiment were 5 nM and 1.05 for
bromocriptine, respectively, 790 nM and 0.89 for (-)3-PPP, 8 .mu.M
and 1.0 for quinpirole, 31 .mu.M and 1.05 for (+)3-PPP, and 0.3 mM
and 0.72 for LY181990.
[0026] B. Results are shown from one of four independent
experiments in which the effect of GTP and NaCl on the inhibition
of [.sup.3H]spiroperidol binding by DA was determined.
Concentrations of [.sup.3H]spiroperidol ranged from 323 to 498 pM.
In this experiment, the concentration of radioligand was 323 pM.
Open circles represent inhibition by DA in the presence of 0.1 mM
GTP and 120 mM NaCl, whereas closed circles represent inhibition in
the absence of added GTP and NaCl. IC.sub.50 values and Hill
coefficients in this experiment were 29 .mu.M and 0.65,
respectively, in the absence and 115 .mu.M and 1.03 in the presence
of GTP and NaCl.
[0027] FIG. 10 shows the inhibition of adenylate cyclase activity
in LZR1 cells. Agonists were tested for inhibition of adenylate
cyclase activity in membranes prepared from LZR1 cells.
Approximately 50 to 100 .mu.g of protein was used in each assay.
Results are shown as [.sup.3P]cAMP/mg of protein/min., expressed as
a percentage of total activity in the presence of 10 .mu.M
forskolin. Representative dose-response curves are shown for six
drugs, each tested at least three times. Data are plotted as enzyme
activity versus the log of the concentration of drug. No curve is
plotted for the data for (-)3-PPP, since no inhibition was
observed. In the experiments shown in this figure, basal and
forskolin-stimulated activity ranged from approximately 0.8 to 1.5
and 8.5 to 15.8 pmol/mg of protein/min., respectively.
[0028] FIG. 11 shows the blockade of DA-sensitive adenylate
cyclase. Results shown are means of three experiments .+-.SE,
plotted as the percentage of total activity in the presence of 10
.mu.M forskolin. Forskolin (FSK) was present in all the experiments
shown, together with 10 .mu.M dopamine (DA) or DA and 10 .mu.M
(+)-butaclamol (BUT) as indicated. Some cells were treated with
pertussins toxin (PT) before harvesting for determination of enzyme
activity. Basal activity in control and PT-treated cells was
1.2.+-.0.07 and 1.6.+-.0.15 pmol/mg of protein/min., respectively.
Total forskolin-stimulated activity in control cells (FSK) was
11.9.+-.1.0 pmol/mg of protein/min. *p<0.05 compared to FSK in
control cells, as determined by a t test for paired means.
[0029] FIG. 12 shows the reversal of dopamine inhibition by
pertussis toxin pretreatment. Data presented for membrane adenylate
cyclase activity represent means (x) with standard error (S.E.) and
% inhibition (% Inh.) below. % Inhibition was calculated from the
equation 100.times.[1-(S-B/I-B.sub.1)] where B, S, and I are values
of basal activity, activity in the presence of stimulator (S) or
inhibitor (I), respectively and B.sub.1 is basal activity in the
presence of inhibitor. Results were obtained from parallel assays
in controls and cells pretreated (16 h, 50 ng/ml) with pertussis
toxin (indicated as +P.T.).
[0030] (A) Adenylate Cyclase. Membranes for cyclase assay were
exposed acutely to 10 .mu.M forskolin (FSK) or 100 .mu.M dopamine
(DA), and adenylate cyclase activity expressed as pmol/mg
protein/min.
[0031] (B) Intracellular cAMP. Cells were treated acutely with VIP
(200 nM) and dopamine (1 .mu.M) and cAMP accumulation (expressed as
pmol/dish) was measured in cell extracts.
[0032] (C) Extracellular cAMP. Media samples from the same dishes
of cells were assayed for cAMP accumulation expressed as
pmol/dish.
[0033] FIG. 13 shows the expression of specific dopamine-D.sub.2
receptor mRNA and specific binding in GH.sub.4ZR.sub.7 transfectant
cells.
[0034] (A) Northern blot analysis of GH.sub.4C.sub.1 cell total
RNA' (20 .mu.g/lane). Y-axis indicate the migration of RNA
molecular weight standards (kb).
[0035] (B) (1) Specific binding of .sup.3H-spiperone to membranes
prepared from GH.sub.4ZR.sub.7 cells was characterized by
saturation analysis (see "Experimental Procedures", Example 2).
Data from one of four independent experiments are plotted as
specifically bound radioligand (ordinate) versus corrected free
radioligand concentration (total added minus total bound).
Calculated K.sub.0 and B.sub.max values for this experiment were 60
pM and 1165 fmol/mg protein.
[0036] (B)(2) Transformation of the data by the method of Scatchard
which are plotted as specific bound/free (Y-axis) vs. specific
bound concentrations of .sup.3H-spiperone (X-axis).
[0037] (C) Displacement of specific .sup.3H-spiperone binding by
dopamine: effect of GTP/NaCl. GH.sub.4ZR.sub.7 cell membranes were
incubated with .sup.3H-spiperone (0.47 nM) and indicated
concentrations of dopamine (X-axis) in the absence (o) or presence
(.cndot.) of 100 .mu.M GTP/120 mM NaCl. Results are shown for one
of four experiments. Calculated IC.sub.50 and Hill coefficient
values for dopamine in the experiment shown were 16 .mu.M and 0.61
in the absence of GTP/NaCl, and 56 .mu.M and 0.85 in the presence
of GTP/NaCl.
[0038] FIG. 14 shows the inhibition of cAMP accumulation and PRL
release by dopamine in GH.sub.4ZR.sub.7 cells. Incubations were
performed in triplicate as described in "Experimental Procedures",
Example 2.
[0039] (A) Inhibition of extracellular cAMP accumulation by
dopamine. Parallel dishes of GH.sub.4C.sub.1 and GH.sub.4ZR.sub.7
cells were incubated with concentrations of VIP, dopamine (D), and
(-)-sulpiride (-S) of 250 nM, 10 .mu.M and 5 .mu.M, respectively.
Untreated controls are denoted as "C". Media were collected and
assayed for cAMP (ordinate) expressed as pmol/dish.
[0040] (B) Inhibition of intracellular cAMP accumulation by
dopamine in GH.sub.4ZR.sub.7 cells. Cell extracts were assayed for
cAMP, expressed on the ordinate. Drug concentrations were as in
(A), except (+)-sulpiride (+S), 5 .mu.M.
[0041] (C) Inhibition of stimulated PRL release by dopamine in
GH.sub.4ZR.sub.7 cells. Media samples were assayed for PRL
(ordinate) after the indicated treatments. The concentrations of
VIP, TRH, dopamine (D), and (-)-sulpiride (-S) were 200 nM, 200 nM,
100 nM, and 2 .mu.M, respectively.
[0042] FIG. 15 shows dose-response relations for dopamine
inhibition of basal and VIP-enhanced cAMP accumulation in
GH.sub.4ZR.sub.7 cells.
[0043] (A) Basal intra-(.cndot.) and extracellular (o) cAMP
accumulation in the presence of indicated concentrations of
dopamine. Basal cAMP levels in the absence of dopamine were 22.+-.6
pmol/dish (intracellular) and 12.4.+-.0.6 pmol/dish
(extracellular). EC.sub.50 values for dopamine actions were 4.9 nM
(intracellular) and 8.5 nM (extracellular).
[0044] (B) VIP-enhanced intra-(.cndot.) and extracellular (o) cAMP
accumulation in the presence of indicated dopamine concentrations.
VIP (250 nM)-enhanced levels of intra- and extracellular cAMP (in
the absence of dopamine) were 145.+-.1.2 pmol/dish and 146.+-.2.8
pmol/dish, and basal cAMP levels were 35.+-.1.6 pmol/dish and
15.+-.0.2 pmol/dish, respectively. EC.sub.50 values for dopamine
inhibition were 5.5 nM (intracellular) and 5.8 nM
(extracellular).
[0045] FIG. 16 shows the specific blockade of dopamine-induced
inhibition of VIP-enhanced cAMP accumulation. GH.sub.4ZR.sub.7
cells were incubated in FAT medium (see "Methods", Example 2) in
the presence of 250 nM VIP and 100 nM dopamine, and indicated
concentrations of various dopamine antagonists, and extracellular
levels of cAMP measured. Data are plotted as percent of maximal
cAMP levels versus the logarithm of indicated concentrations of
dopamine antagonists. The standard error of triplicate
determinations was less than 8%. Basal and VIP-enhanced cAMP levels
(in the absence of dopamine and antagonists) were 25.8.+-.1.6
pmol/dish and 214.+-.14 pmol/dish. IC.sub.50 and estimated K.sub.i
values for antagonism of dopamine actions were: spiperone, 0.56 nM
and 30 pM; (+)-butaclamol, 4.5 nM and 0.2 nM; (-)-sulpiride 38 nM
and 1.8 nM; SCH23390, >1 .mu.M; (-)-butaclamol, >10 .mu.M.
Estimated K.sub.I were calculated from the equation
K.sub.I-IC.sub.50/(1+([DA]/EC.sub.50)), where [DA] is 100 nM and
the EC.sub.50 for dopamine is 6 nM. Spiperone, (+)-butaclamol and
(-)-sulpiride alone did not alter basal cAMP levels.
[0046] FIG. 17 shows the inhibition of adenylate cyclase by
dopamine-D.sub.2 agonists. Inhibition of adenylate cyclase activity
was assessed in the presence of 10 .mu.M forskolin. Data are
plotted as the mean of triplicate assays, with enzyme activity
expressed as a percentage of total activity versus the logarithm of
drug concentration. Average basal adenylate cyclase activity was
4.6.+-.0.2 pmol/mg protein/min and total forskolin-stimulated
activity was 63.8.+-.0.2 pmol/mg protein/min. EC.sub.50 values and
maximal inhibition for the experiments shown were 79 nM and 57%,
respectively, for dopamine, 200 nM and 49% for quinpirole, 5 nM and
23% for bromocryptine, and 600 .mu.M and 40% for (+)-3-PPP.
[0047] FIG. 18 shows the nucleotide sequence of the human pituitary
dopamine D.sub.2 receptor cDNA. The deduced amino acid sequence is
indicated above the human cDNA. Below is the nucleotide sequence of
the cloned rat cDNA (see Reference 9, Example 3) and the amino
acids which differ between the two clones. Boxed regions, numbered
I-VII, represent the putative transmembrane domains. Triangles
indicate the exon/intron splice junctions; a period is one missing
base pair; asterisks identify potential N-linked glycosylation
sites and targets of protein kinase A phosphorylation are
underlined. The polyadenylation signal is double underlined.
[0048] FIG. 19 shows competition curves of [3H]-domperidone binding
to L-hPitD.sub.2Zem membranes. The radioligand was used at a
concentration of 1 nM, and specific binding was defined using 1
.mu.M (+) butaclamol. Data are shown for one of three
experiments.
[0049] FIG. 20 shows Southern blot of human genomic DNA. The
genomic BamHI 1.6-kb fragment containing exon 7 was prepared from
.lambda.HD2G1 and used as probe (specific activity,
2.times.10.sup.8 cpm). DNA was digested with BamHI (lane 1), Bg1II
(lane 2), BamHI/Bg1II (lane 3), and HindIII (lane 4).
[0050] FIG. 21 is a schematic representation of the human dopamine
D.sub.2 receptor gene and pituitary cDNA.
[0051] (a) Restriction map of the two overlapping genomic phase,
.lambda.hD2G1 and .lambda.hD2G2; A, ApaLI; B, BamHI; Bg, Bg1II; H,
HindIII.
[0052] (b) Diagram of the human gene locus DRD2. Exons, indicated
by the boxes, are numbered. The solid boxes indicate regions of
coding sequence and open boxes, non-translated sequence. The
genomic sequencing strategy is expanded above the gene. These
regions are not drawn to scale. DNA sequences (+ indicates sense
and -, antisense sequence) were read from the bottom to the top of
each ladder in the directions indicated by the arrows (pointing to
the right, 5' to 3' and to the left, 3' to 5'). The 87-bp exon is
No. 5. Intron sizes were determined by Southern blotting and
restriction mapping and are accurate to within 10 percent, with one
exception: intron 1 is accurate to within 20 percent.
[0053] (c) The structure of the human pituitary cDNA. Exon/intron
splice junctions are indicated by triangles. Regions encoding
transmembrane domains I-VII are enclosed by boxes containing wavy
lines. The 87-bp sequence is striped. The sites for translation
initiation (ATG) and termination (TAG) are indicated, as is the
polyadenylation signal sequence (AATAAAA).
[0054] FIG. 22 shows a comparison of IC.sub.50 values (nM) for
L-hPitD2Zem, L-RGB2Zem1 and rat striatum.
[0055] FIG. 23 shows the exon/intron junctions in the human
dopamine D.sub.2 receptor gene.
DISCUSSION
[0056] This invention takes advantage in a unique way of nucleotide
sequence similarities among members of a gene family coding for
receptors that are coupled to G proteins. By using a unique hamster
.beta..sub.2-adrenergic receptor (.beta..sub.2AR) gene as a
hybridization probe, a cDNA encoding the rat D.sub.2 dopamine
receptor was identified and isolated. The receptor has been
characterized on the basis of three criteria: 1) the deduced amino
acid sequence which reveals that it is a member of the family of G
protein-coupled receptors, 2) the tissue distribution of the
corresponding mRNA which parallels that known for the D.sub.2
dopamine receptor, and 3) the pharmacological profile of Ltk-cells
transformed with the cDNA.
[0057] A rat genomic library was screened under low-stringency
hybridization conditions with a nick-translated 1.3 kb HindIII
fragment containing most of the coding region of the hamster
.beta..sub.2AR gene. The hamster .beta..sub.2AR receptor gene was
cloned from a partial hamster lung .lambda.gt10 genomic DNA library
(constructed from size fractionated (5-7 kb) EcoRI digested DNA)
with two oligonucleotide probes (30-mer,
TCTGCTTTCAATCCCCTCATCTACTGTCGG; 40-mer, CTATCTTCTGGAGCTGCCTTTTGG-
CCACCTGGAAGACCCT) designed from the sequence of Dixon et al. (9).
The 1.3 kb HindIII fragment of the hamster .beta..sub.2AR gene
which contains most of the coding sequence of that gene was labeled
by nick translation and used to probe a rat genomic DNA library in
the commercially available phage EMBL3. The library was transferred
to Colony Plaque Screen filters (NEN) and screened with the
.sup.32P labeled probe using the following hybridization
conditions: 25% formamide, 5.times.SSC, 5.times. Dehardts, 0.1%
sodium pyrophosphate, 1% SDS and salmon sperm DNA (100 .mu.g/ml) at
37.degree. C. Filters were washed in 2.times. $SC and 0.1% SDS at
55.degree. C.
[0058] Several clones were found to hybridize to the hamster probe
using these conditions. One clone, called RGB-2, was found to have
a 0.8 kb EcoRI-PstI fragment that hybridized to the hamster
.beta..sub.2AR probe in Southern blot analysis. This fragment was
sequenced and shown to have a stretch of nucleotides with a high
degree of identity (32 out of 40 bases) to the nucleotide sequence
of transmembrane domain VII of the hamster .beta..sub.2AR. One of
the possible reading frames demonstrated a significant similarity
to the amino acid sequence of transmembrane domains VI and VII of
the hamster .beta..sub.2AR. Within this genomic fragment there is
also a 3'intron splice site (10) and 400 bp of putative intronic
sequence.
[0059] The 0.8 kb EcoRI-PstI fragment (nick translated) was used to
probe a rat brain cDNA library in .lambda.gt10 with the same
hybridization conditions as above except that 50% formamide was
used. Washing of the filters was performed in 0.2.times.SSC and
0.1% SDS at 65.degree. C. Under these high stringency hybridization
conditions, two positive clones of about 2.5 kb in size were
identified from a library of 500,000 clones. DNA sequence was
obtained from both strands by the Sanger dideoxy chain
determination method using Sequenase (U.S. Biochemical) (26).
Sequence and restriction analysis indicated that the two clones
were replicas of a single clone and contained the sequence of the
genomic fragment that had been used as a probe. When the RGB-2 cDNA
was used as a hybridization probe in Northern blot analysis of mRNA
isolated from rat brain, a band of approximately 2.5 kb was
detected. This finding indicated that the RGB-2 clone was nearly
full length.
[0060] FIG. 1 shows the nucleotide sequence of 2455 bases for the
RGB-2 cDNA. The longest open reading frame in this cDNA codes for a
415 amino acid protein (relative molecular weight (Mr=47,064)) also
shown in the figure. This molecular weight is similar to that
reported for the deglycosylated form of the D.sub.2 dopamine
receptor as determined by SDS polyacrylamide gel electrophoresis
(11). An in-frame dipeptide which is 36 bases upstream from the
putative initiation site is found in the 5' untranslated region of
the RGB-2 cDNA. A small open reading frame has been observed in the
5' untranslated sequence of the .beta..sub.2AR mRNA (9).
[0061] Several structural features of the protein deduced from the
RGB-2 cDNA demonstrate that it belongs to the family of G
protein-coupled receptors. The hydrophobicity plot of the protein
sequence (FIG. 5) shows the existence of seven stretches of
hydrophobic amino acids which could represent seven transmembrane
domains (8). Moreover, the primary amino acid sequence of RGB-2
shows a high degree of similarity with other G protein-coupled
receptors (FIG. 2). The regions of greatest amino acid identity are
clustered within the putative transmembrane domains. Within these
domains the RGB-2 protein has a sequence identity of 50% with the
human .alpha..sub.2-adrenergic receptor (12), 42% with the human
G-21 receptor (13), 38% with the hamster .beta..sub.2AR-adrenergic
receptor (9), 27% with the porcine M.sub.1 receptor (14), and 25%
with the bovine substance K-receptor (15).
[0062] Thirdly, RGB-2 has several structural characteristics common
to the members of the family of G protein-coupled receptors. There
are three consensus sequences for N-linked glycosylation in the
N-terminus with no signal sequence. The Asp 80 found in
transmembrane domain II is conserved in all known G protein-coupled
receptors. In transmembrane domain III there is Asp 114 for which a
corresponding Asp residue is found only in receptors that bind
cationic amines (16). Phosphorylation has been proposed as a means
of regulating receptor function (17). A potential site for
phosphorylation by protein kinase A exists at Ser 228 in the third
cytoplasmic loop. In the C-terminal portion of the rhodopsins and
.beta.-adrenergic receptors are found many Ser and Thr residues
which are potential substrates for receptor kinases (18). In
contrast, the short C-terminus of RGB-2 has no Ser and Thr
residues. However, as is the case for the .alpha..sub.2-adrenergic
receptor, RGB-2 has many Ser and Thr residues (22 residues) in the
third cytoplasmic loop which could serve as phosphorylation
substrates.
[0063] RGB-2 contains a large cytoplasmic loop (135 amino acids)
between transmembrane domains V and VI with a short C-terminus (14
amino acids). This structural organization is similar to other
receptors which are coupled by G.sub.i (inhibitory G protein) such
as the .sub.2-adrenergic receptor and the M.sub.2 muscarinic
receptor. Unlike the members of the adrenergic and muscarinic
receptor families, the RGB-2 gene has at least one intron in its
coding sequence which is located in transmembrane domain VI.
[0064] As a first step towards determining the identity of RGB-2,
the tissue distribution of the RGB-2 mRNA was examined by Northern
blot analysis (FIG. 3).
[0065] Brain tissue was dissected from male Sprague Dawley rats and
RNA isolated according to Chirgwin et al. (27) and Ullrich et al.
(28). For Northern blotting, RNA was denatured using glyoxal and
DMSO and run on 1.2% agarose gels. After electrophoresis, RNA was
blotted onto a nylon membrane (N-Bond, Amersham) and baked for 2
hours at 80.degree. C. The membranes were prehybridized in 50%
formamide, 0.2% PVP (M.W. 40,000), 0.2% ficoll (M.W. 400,000), 0.05
M Tris pH 7.5, 1M NaCl, 0.1% PPi, 1% SDS and denatured salmon sperm
DNA (100 .mu.g/ml) for 16 hrs at 42.degree. C. A random primed
.sup.32P-labeled fragment (1-2 10.sup.8 dpm/.mu.g) from the 1.6 kb
BamHI-BglII fragment of RGB-2 which contains the coding region of
this clone was used at 10.sup.7 dpm/ml in the hybridization
solution from above to probe the filters overnight at 42.degree. C.
The blots were washed twice in 2.times.SSC and 0.1% SDS at
65.degree. C. for 10 min., twice in 0.5.times.SSC and 0.1% SDS at
RT for 15 min. and once in 10.1.times.SSC and 0.1% SDS at
65.degree. C. for 15 min. Blots were exposed overnight at
-70.degree. C. to X-ray film with an intensifying screen.
[0066] The RGB-2 mRNA is expressed at different levels in various
regions of the rat brain with the basal ganglia showing the highest
concentration. Furthermore, the RGB-2 mRNA was found in high
amounts in the neurointermediate lobe of the pituitary gland of the
rat and to a lesser degree in the anterior lobe of this gland. The
expression pattern of the RGB-2 mRNA is strikingly similar to the
distribution of the D.sub.2 dopamine receptor as determined by
receptor autoradiography and binding studies of tissue preparations
(19).
[0067] In order to study the pharmacological characteristics of the
receptor encoded by RGB-2, the cDNA was expressed in eucaryotic
cells. The full RGB-2 cDNA was cloned into the eucaryotic
expression vector pZem3 (20) which initiates transcription from the
mouse metallothionein promoter (21). This plasmid was cotransfected
with the selectable neomycin phosphotransferase gene (pRSVneo) into
the Ltk-mouse fibroblast cell line by the standard CaP.sub.4
precipitation technique (21). Cells were selected in 350 .mu.g/ml
of G418. Transfectants were isolated and checked for expression of
RGB-2 mRNA by Northern blot analysis. A cell line expressing RGB-2
designated L-RGB2Zem-1 was isolated. The RGB-2 mRNA was not
detectable in the parent Ltk-cell line.
[0068] Since the RGB-2 mRNA displayed the tissue distribution
expected of the D.sub.2 dopamine receptor, a pharmacological study
was performed of the L-RGB2Zem-1 cell line, native Ltk-cells and
rat striatum using the D.sub.2 ligand .sup.3H-spiperone.
[0069] Membranes were prepared by homogenizing cells with a Dounce
homogenizer at 4.degree. C. in 0.25 M sucrose, 25 mM Tris pH 7.4, 6
mM MgCl.sub.2, 1 mM EDTA. The homogenizing solution was centrifuged
at 800.times.g for 10 min. and the pellet was subjected to a second
homogenization and centrifugation as before. The supernatants were
pooled and centrifuged at 200,000.times.g for 1 hour. The pellet of
this centrifugation was resuspended in 25 mM Tris pH 7.4, 6 mM
MgCl.sub.2, 1 mM EDTA at approximately 250 .mu.g protein/ml and
stored in small aliquots at -70.degree. C. Radioligand binding
assays were carried out in duplicate in a volume of 2 ml
(saturation analyses) or 1 ml (inhibition curves) containing (final
concentration): 50 mM Tris, pH 7.4, 0.9% NaCl, 0.025% ascorbic
acid, 0.001% bovine serum albumin, .sup.3H-spiperone (Amersham, 95
Ci/mmol) and appropriate drugs. In some experiments 100 uM
guanosine 5'-triphosphate was included. (+)-Butaclamol (2 uM) was
used to define nonspecific binding. Incubations were initiated by
the addition of 15-40 .mu.g of protein, carried out at 37.degree.
C. for 50 minutes, and stopped by the addition of 10 ml of ice-cold
wash buffer (10 mM Tris, pH=7.4, and 0.9% NaCl) to each assay. The
samples were filtered through glass-fiber filters (Schleicher and
Schuell No. 30) and washed with an additional 10 ml of wash
buffer.
[0070] The radioactivity retained on the filter was counted using a
Beckman LS 1701 scintillation counter. Data were analyzed as
previously described (29) except that curves were drawn using the
data analysis program Enzfitter. The resulting IC.sub.50 values
were converted to K.sub.i values by the method of Cheng and Prusoff
(30).
[0071] Membranes prepared from control Ltk-cells showed no
(+)-butaclamol- or sulpiride-displaceable binding of
.sup.3H-spiperone. Binding of .sup.3H-spiperone to membranes
prepared from L-RGB2Zem-1 cells was saturable with a Kd value of 48
pM (FIG. 4a). This value agrees with that observed for binding of
.sup.3H-spiperone to rat striatal membranes in parallel experiments
(52 pM). In the experiment shown in FIG. 4a, Kd and Bmax values for
membranes prepared from L-RGB2Zem-1 were 40 pm and 876 fmol/mg of
protein, whereas the corresponding values in striatal membranes
were 37 pm and 547 fmol/mg of protein. The density of binding sites
as determined in four experiments was 945 fmol/mg of protein in
L-RGB2Zem-1 membranes and 454 fmol/mg of protein in rat striatal
membranes.
[0072] The binding of .sup.3H-spiperone to membranes from
L-RGB2Zem-1 cells was inhibited by a number of drugs and the
resulting K.sub.i values closely matched those obtained using
striatal membranes (FIGS. 4b, 4c). The D.sub.2 antagonists
(+)-butaclamol and haloperidol were the most potent inhibitors,
followed by sulpiride. The D.sub.1 dopamine antagonist SCH 23390
and the serotonin 5HT.sub.2 antagonist ketanserin were much less
potent at blocking .sup.3H-spiperone binding. The binding appeared
to be stereoselective as (+)-butaclamol was much more potent than
(-)-butaclamol at inhibiting binding. In these experiments the
absolute affinities of dopaminergic antagonists and the rank order
of potency of the drugs
(spiperone>(+)-butaclamol>haloperidol>sulpiride>>-
;(-)-butaclamol) agree closely with previously published values for
the D.sub.2 dopamine receptor (2).
[0073] All binding data for L-RGB2Zem-1 membranes were fit best by
assuming the presence of only one class of binding sites. On the
other hand, inhibition by several drugs of .sup.3H-spiperone
binding to rat striatal membranes was fit best by assuming the
presence of two classes of binding sites. Thus, SCH 23390 and
ketanserin inhibited 10-20% of .sup.3H-spiperone binding to rat
striatal membranes with high affinity (FIG. 4c). In rat striatal
membranes, inhibition of radioligand binding by sulpiride was fit
best by one class of binding sites, but 10-15% of the
(+)-butaclamol-displaceable binding was not inhibited by sulpiride
at the concentrations used. It seems likely that the binding sites
with high affinity for ketanserin and SCH 23390 and which are not
displaced by sulpiride represent binding of .sup.3H-spiperone to
5HT.sub.2 serotonin receptors in rat striatal membranes. Binding of
SCH 23390 to 5HT.sub.2 receptors has been described previously
(22). In rat striatal membranes, the apparent affinity of drugs for
D.sub.2 dopamine receptors, the class of binding sites comprising
80-90% of .sup.3H-spiperone binding, was indistinguishable from the
apparent affinity of drugs to membranes prepared from L-RGB2Zem-1
cells (FIG. 4c).
[0074] The physiological effects of stimulation of D.sub.2 dopamine
receptors appear to be mediated by G.sub.i (6). Inhibition of
agonist binding to D.sub.2 dopamine receptors by GTP is thought to
be due to GTP-induced dissociation of a receptor-G.sub.i complex
which has a high affinity for agonist (23, 24). Although
.sup.3H-spiperone binding was inhibited by the agonist dopamine
with a K.sub.i of 17 um in the L-RGB2Zem-1 membranes, this dopamine
binding was not responsive to the addition of GTP. However, this
finding is consistent with the reported lack of G.sub.i in L cells
(25). The pharmacological data presented here proves that the
binding profile of the D.sub.2 dopamine receptor is found in
Ltk-cells expressing the RGB-2 cDNA.
[0075] The foregoing data show that, when transfected into
eucaryotic cells, the RGB-2 cDNA directs the expression of a
D.sub.2 dopamine binding protein. Since the mRNA corresponding to
this cDNA is localized in tissues where the D.sub.2 dopamine
receptor is known to be present and since this mRNA codes for a
protein which has all the expected characteristics of a G
protein-coupled receptor, inter alia, RGB-2 is a clone for the rat
D.sub.2 dopamine receptor.
[0076] The nucleic acid sequence shown in FIG. 1 can be inserted
into a wide variety of conventional and preferably commercially
available plasmids, e.g., using EcoRI sites or other appropriate
sites. See, e.g., FIG. 6 for a restriction map of the sequence of
FIG. 1.
[0077] Dopamine receptor genes of this invention, particularly
mammalian D.sub.2 dopamine receptor genes, based on this
disclosure, can now be routinely made, isolated and/or cloned,
using many conventional techniques. For example, the procedure
disclosed herein can be substantially reproduced for libraries
containing dopamine receptor DNA sequences. Alternatively,
oligonucleotide probes can be routinely designed, e.g., from the
sequences of FIG. 1 and/or the omitted introns, which are selective
for dopamine receptor genes, especially for mammalian dopamine
D.sub.2 receptor genes. These can be used to screen nucleic acid
libraries containing dopamine receptor nucleic acid sequences.
Sequences in these libraries hybridizing to the probes, especially
to all of a plurality of such probes (e.g. 2 or 3), will be DNA
sequences of this invention with high probability. Of course, it is
also possible to synthesize the sequence of FIG. 1 or any fragment
thereof using conventional methods.
[0078] This invention also enables the production of a wide variety
of useful products and the employment of a wide variety of useful
methods, as well as providing basic tools for the study of the
regulation and function of dopamine receptors.
[0079] These products and methods can be produced and carried out,
respectively, using the well known recombinant DNA, immunochemical
and other methodologies of the biotech industry. See, e.g., U.S.
Pat. No. 4,237,224; U.S. Pat. No. 4,264,731; U.S. Pat. No.
4,273,875; U.S. Pat. No. 4,293,652; EP 093,619;
[0080] Davis et al "A Manual for Genetic Engineering, Advanced
Bacterial Genetics," Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y. (1980); Maniatis et al., Molecular Cloning, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Davis et al.,
Basic Methods in Molecular Biology, Elsevier, N.Y. (1986); Methods
in Enzymology, Berger & Kimmel (Eds.), (1987).
[0081] This invention provides, for the first time, purified and
isolated polypeptide products having all or part of the primary
amino acid sequence of the dopamine D.sub.2 receptor as well as its
biological properties, including: all sites for covalent
modification, such as phosphorylation and glycosylation; all
primary sequence that determines the secondary, tertiary and
quaternary structure of the functional protein; all parts of the
molecule that provide antigenicity and antibody binding sites; all
parts of the protein that provide for noncovalent interactions with
other biological molecules, such as lipids, carbohydrates, and
proteins, such as guanine nucleotide-binding regulatory proteins;
all parts of the protein that make up the binding sites for
ligands, including agonists, partial agonists and antagonists; all
parts of the protein that are required for functional
conformational changes involved in normal biological activities,
such as desensitization; and all proteins that might arise as a
result of alternative splicing of the gene for this receptor.
[0082] These polypeptides can be expressed from the nucleic acids
of this invention by procaryotic or eucaryotic hosts, e.g.,
bacterial, yeast or mammalian cells in culture, using fully
conventional transformation or transfection (e.g., via calcium
phosphate for mammalian cells) techniques. The products of such
expression in vertebrate (e.g., mammalian and avian) cells are
especially advantageous in that they are produced free from
association with other human proteins or contaminants with which
they may be associated in natural form. Preferred hosts for
expression are mammalian and include for example mouse
Ltk.sup.-cells, hamster CHO cells, mouse GH.sub.4 cells, mouse
C.sub.6 cells, mouse/rat NG108-15 cells and mouse AtT20 cells. For
example, when the gene of FIG. 1 is transfected into the
commercially available growth hormone GH.sub.4 cells, modulation of
the cAMP second messenger system has been observed. Preferred
vectors include pZem or pRSV or viral vectors such as vaccinia
virus and retroviruses.
[0083] The polypeptides of this invention include all possible
variants, e.g., both the glycosylated and non-glycosylated forms.
The particular carbohydrates involved will depend on the mammalian
or other eucaryotic cells used for the expression. The polypeptides
of the invention can also include an initial methionine amino acid
residue.
[0084] Also included in this invention are polypeptides, synthetic
or otherwise, duplicating the amino acid sequence of FIG. 1 and/or
of the dopamine receptors per se of this invention, or only
partially duplicating the same. These wholly or partially
duplicative polypeptides will preferably also retain the biological
and/or immunological activity of the dopamine receptor per se. Also
included within the scope of this invention are the monoclonal and
polyclonal antibodies (generatable by conventional techniques and
preferably labelled) which are immunoreactive with such
polypeptides.
[0085] Preferred partial polypeptides (fragments) are those
including at least a portion of the sequences located in the
hydrophobic transmembrane domains V, VI and VII, shown in FIG. 2.
These are the likely locations of the ligand binding site(s),
particularly domain VII. The third cytoplasmic loop is also an
important fragment area; e.g., G-protein binding requires this
location as well as domains V and VI. Where it is desired to have
an antibody highly specific to a particular dopamine receptor, a
fragment generating such an antibody will be selected from the
highly unique region between transmembrane regions V and VI, i.e.,
the third cytoplasmic loop, or the C-terminal domain, both of which
have low homology with other receptors, and/or the antibodies will
be selected to be specific to an epitope in these regions. Another
receptor/gene specific region is that of the intron sequences,
e.g., those for RGB-2, mentioned above. Particularly preferred
peptides which have been synthesized are (referring to the amino
acid numbers of FIG. 1): (A) 2-13; (B) 182-192; (C) 264-277; (D)
287-298; and (E) 404-414. These are selected based on the following
principles: the known antigenicity of peptides containing a large
number of Pro residues (B/C/D); coverage of the N and C termini (A)
and (E); the ability to direct antibodies towards an extracellular
domain (receptor reaction region) which will be effective to block
the receptor reaction (A/C/D). Antibodies to these fragments are
raised conventionally, e.g., monoclonals by fully conventional
hybridoma techniques.
[0086] This invention also relates to DNA sequences encoding the
full dopamine receptor or fragments thereof, as well as expression
vectors (e.g., viral and circular plasmid vectors) containing such
whole or partial sequences. Similarly, hosts (e.g., bacterial,
yeast and mammalian) or cells transformed or transfected with such
vectors are also included. The corresponding methods of expressing
the polypeptides corresponding to the sequences in such vectors are
also included, e.g., comprising culturing the transformed or
transfected cells under appropriate conditions for large scale
expression of the exogenous sequences and for the isolation of the
polypeptides as usual, e.g., from the growth medium, cellular
lysates or cellular membrane fractions.
[0087] DNA sequences of this invention also include those coding
for polypeptide variants, mutants or analogues which differ from
the natural sequence described herein. Such differences can be
derived from deletion of one or more amino acid residues from the
natural sequence, by substitution of a given such residue by
another residue and/or by additions wherein one or more amino acid
residues are added to the natural sequence. Preferably, the
resultant modified polypeptide will retain at least one of the
biological or immunological activities of the dopamine
receptor.
[0088] Mutations likely to affect dopamine affinity activity will
be those in transmembrane domains V, VI or VII or in the third
cytoplasmic loop. In addition, the DNA sequences also include
sequences complementary to any of the other DNA strands mentioned
herein and, most notably, those shown in the Figures; DNA sequences
which hybridize to the DNA sequences described herein, typically
under the hybridization conditions mentioned herein or under more
stringent conditions, or which hybridize to fragments of such DNA
sequences; and DNA sequences which differ from those shown herein
by the degeneracy of the genetic code. Thus, this invention
includes all DNA sequences which encode a dopamine receptor and
hybridize to one or more of the sequences shown herein. These
include allelic variants as well as dopamine receptors from
mammalian species other than the species mentioned in the
experimental descriptions herein.
[0089] Modifications of the cDNA or genomic dopamine receptor DNA
may be readily accomplished by any of the well known techniques,
including site-directed mutagenesis techniques. Such modified DNA
sequences can include deletions, additions and/or substitutions
made in selected regions, e.g., not in transmembrane domains V, VI
or VII or in the third cytoplasmic loop, where retention of the
underlying biological activity of the dopamine receptor is
desired.
[0090] Modified proteins which do not retain the mentioned
biological activity and/or the corresponding DNA sequences will
also be useful, e.g., in various assays of this invention. In a
particularly preferred such modification, the transmembrane domain
V, VI, or VII or the third cytoplasmic loop will be deleted or
rendered inactive, e.g., by sequence modification. Deletion of the
glycosylation sites shown in FIG. 1 is also a useful variant for
expression of the polypeptide, e.g., in yeast cells.
[0091] As mentioned above, it is well established that significant
portions of the DNA sequence encoding a dopamine receptor are
conserved in various mammalian species. Consequently, using only
routine experimentation, a skilled worker can readily screen a DNA
genomic library or, preferably, a cDNA library, e.g., from the
brain of a given mammal, for the presence of other dopamine
receptor genes, especially D.sub.2 dopamine receptor genes, using
probes manufactured in accordance with the details of the sequences
shown herein, including the 5' flanking, the intronic and the
structural gene sequences shown in FIG. 1 and the human sequence of
FIG. 7. Probes will preferably be selected from the seven highly
conserved transmembrane domains shown in FIG. 2, preferably domains
VI and VII. Such a routine screening will identify clones which
hybridize with the probes. From these, dopamine receptors can
routinely be selected, e.g., using the techniques described herein.
With respect to human D.sub.2 dopamine receptors, particularly
useful sources include, for cDNA, striatum, pituitary,
neuroblastoma, kidney, placenta cells, etc., and, for genomic DNA,
liver, placenta cells, etc. For primates, e.g., rhesus monkeys,
particularly useful genomic DNA or cDNA libraries include brain,
kidney and placenta cells.
[0092] With respect to human D.sub.2 dopamine receptor genes, the
partial sequence shown in FIG. 7 has been identified by
conventionally screening, under the stringent hybridization
conditions described above for the probing by the 0.8 kb EcoRI-PstI
fragment of rat brain cDNA in .lambda.gt10, a pituitary cDNA
library using a probe which is the full length rat cDNA, RGB-2. The
cDNA libraries mentioned herein were prepared by fully conventional
methods, e.g., as described in the references cited above, e.g.,
Davis et al. This sequence or fragments thereof can also be useful
as a probe, for example, to screen conventional libraries as
mentioned above for human dopamine receptor genes in accordance
with the foregoing and other fully conventional procedures. As can
be seen by comparing the sequence of FIG. 7 with the sequences
shown in FIGS. 1 and 2 above, the partial human sequence of FIG. 7
has high homology with RGB-2 beginning at amino acid no. 259 of
FIG. 1. similarly, this invention more generally includes mammalian
D.sub.2 dopamine receptor genes in the broadest sense, e.g., both
regulatory and structural such genes, alone or in combination,
e.g., in reading frame. For example, using the routine methods
discussed herein, such genes have been and can be cloned from
mammalian DNA libraries. As well, this invention includes
biologically active fragments of such genes, e.g., fragments
encoding polypeptides having the biological activity of a mammalian
D.sub.2 dopamine receptor, or fragments useful in controlling
expression of such encoding fragments, or fragments useful as
probes for any such gene or fragment, e.g., by hybridizing
therewith.
[0093] The various polypeptides and sequences of this invention may
be conventionally labeled with detectable marker substances,
typically by covalent association, and further typically by
radiolabeling, or in the case of DNA, with non-isotopic labels such
as biotin. The polypeptide products (e.g., labelled antibodies) can
be used conventionally to detect and quantitate the presence of
dopamine receptors in various samples; the DNA-labeled products can
be conventionally employed in the usual hybridization methods
(e.g., Northern blots, Southern blots, spot assays, etc.) to detect
and quantitate the presence of associated nucleic acids (DNA, RNA)
in samples, e.g., to locate the dopamine gene positions in various
mammalian chromosomal maps, to determine whether mRNA or receptor
concentrations are abnormally high or low in comparison to standard
levels, etc. They will also be useful, again using fully
conventional procedures, to identify dopamine receptor gene
disorders (defective or aberrant genes) in in vitro diagnostic
procedures on DNA samples from given patients, e.g., to detect
chromosomal defects, e.g., using RFLP analyses (see, e.g., Genes
III, Levin, John Wiley and Sons (1987). For example, since dopamine
receptors have been implicated in schizophrenia, products and
methods of this invention can be used to characterize nucleic
acids, e.g., in size fractionated form, from schizophrenia patients
and, inter alia, classify patients according to schizophrenia
subgroups, make diagnoses based on comparisons to standard DNA
fractionation arrays, etc. Of course, they can also be used, e.g.,
in the mapping of the human or other mammalian genome, as gene
markers to identify accompanying genes, e.g., in RFLP analyses,
and, where applicable, other disorders. The gene-unique regions
discussed above, e.g., the intron regions, the third cytoplasmic
loop, etc., will be especially useful in this regard.
[0094] Typical assays in which the polypeptides of this invention
can be utilized include any of the well known immunoassay
techniques such as RIA, ELISA, etc., both of in vitro and in vivo
nature. Various fragments of the polypeptide sequence of the
dopamine receptor can also be utilized conventionally for producing
corresponding polyclonal antibodies or preferably monoclonal
antibodies (e.g., by conventional preparation and expression of
corresponding hybridomas) for epitopes within the given fragment.
The antibodies will often be conventionally labelled, e.g., radio-
or enzymatically labelled. In a preferred aspect, the resultant
polyclonal or monoclonal antibodies will also be immunospecific
with respect to not only the mentioned fragment, but also the full
protein. Such antibodies will be conventionally employable, for
example, in the detection and affinity purification or
chromatography of dopamine receptor and related products.
[0095] Of course, the polypeptides of this invention include those
expressed in accordance with conventional procedures from cells as
mentioned above, as well as those which are synthetically prepared
also using conventional procedures. This invention enables for the
first time non-natural preparation of mammalian dopamine receptors
substantially free of constituents of their natural environment. It
is in this sense the term "substantially pure" is used herein,
i.e., substantially free of these natural constituents. The
invention also includes DNA sequences which can be isolated from
the various sources mentioned above or synthetically prepared using
fully conventional methods.
[0096] Also included within the scope of this invention are
pharmaceutical compositions comprising effective amounts of one or
more of the polypeptide products of this invention or one or more
of the nucleic acid sequences of this invention, in admixture with
suitable conventional diluents, adjuvants and/or carriers well
known in the pharmaceutical industry. These can be utilized for in
vitro uses, e.g., for detection of the presence of a dopamine
receptor in a sample or of the presence of a gene or an abnormal
gene in a sample or for increasing the concentration of receptor or
its gene in a sample, or for in vivo uses such as gene therapy
(e.g., to render a defective gene or gene product inactive, e.g.,
block it by an appropriate monoclonal antibody) and/or to provide
new functional genes (e.g., using retroviral vectors)), or to
provide an increased concentration of dopamine receptor in a given
location, or to modulate receptor expression and/or activity, e.g.,
by administration of antisense oligosequences, all in mammals
including humans. Thus, these compositions will be useful to treat
disease conditions, inter alia, those associated with abnormalities
in the structure, expression or concentration of the dopamine
receptor or its gene, such as those mentioned in the foregoing.
Specific effective dosages for a given condition in a given patient
will vary, as is well known, with the usual conditions, including
the overall condition of the patient, body weight, the identity and
severity of the particular dopamine-deficiency disease state,
etc.
[0097] The polypeptides of this invention can also be used in,
e.g., competitive binding assays, to test for the affinity thereto
of candidate chemical substances such as drugs, e.g., affinity
(e.g., agonistic or antagonistic) to D.sub.2 dopamine receptors.
Such procedures can be carried out, e.g., as pharmaceutical
screening tests, using fully conventional procedures, analogous to
those described herein and/or to known protocols based on natural
sources of dopamine receptors, e.g., analogous to known tests for
inhibition of the binding of tritiated dopamine agonists and
antagonists to striatal receptors per the methods of Schwarcz et
al., J. Neurochemistry, 34 (1980), 772-778 and Creese et al.,
European J. Pharmacol., 46 (1977), 377-381, and to those for other
receptors. It is also possible to screen substances for ability to
modify or initiate a response which is triggered by ligand bonding
to a dopamine receptor, e.g., cellular responses such as modulation
of second messenger systems. Such analyses can utilize cells of
this invention transformed with nucleic acid sequences of this
invention.
[0098] Antibodies of this invention to the dopamine receptors or
other regions of dopamine receptor genes, especially the D.sub.2
receptor, can also be used in diagnostic imaging techniques, e.g.,
by radiodiagnostic, MRI or positron imaging. Radio-, paramagnetic-
or positron-labels can be conventionally attached to the antibodies
(preferably monoclonal in nature), e.g., via covalent bonding to
chelating groups for a positron emitting, radionucleotide or
paramagnetic metal. MRI, radiosensitive or positron imaging can
then be effected with these agents using conventional methods. See,
e.g., Maziere et al., Life Sci., 35, 1349 (1984).
[0099] Suitable pharmaceutical carriers include water, saline,
human serum albumin, etc. The compositions can also include other
active ingredients suitable for amelioration of the particular
disease state involved, e.g., conventional dopamine agonists,
dopamine antagonists, etc. The components of this invention can be
provided in conventional kit form containing, e.g., an antibody or
a DNA probe (e.g., able to detect gene homologies or anomalies)
along with detection method-specific reagents such as enzymes,
substrates, materials for analyzing DNA restriction fragments,
etc.
[0100] The DNA sequences of this invention are also useful to
prepare the corresponding transgenic animals, in particular
nonhuman mammals, e.g., rats, monkeys, etc., using known methods,
e.g., analogous to those described in U.S. Pat. No. 4,736,866. Such
animals, e.g., are particularly useful for commercial research
purposes. The DNA sequences or the corresponding mRNA can also be
used conventionally to inject oocytes, e.g., from frogs, which can
then be conventionally used in binding or second messenger
analyses. Moreover, the availability of the primary amino acid
sequence itself enables experimental and computational modeling and
understanding of the secondary and tertiary structures of the
dopamine receptor. This three-dimensional information provides a
basis for modeling and understanding the details of the receptor
function, e.g., interaction with the cell membrane, its ligand
(binding pocket), associated proteins, messenger systems, etc. Such
analyses enable rational drug design whereby, e.g., new dopamine
receptor affecting chemical agents can be designed in accordance
with the details of this interaction.
NUMBERED REFERENCES FOR BACKGROUND, SUMMARY, FIGS. 1-7, AND
DISCUSSION (EXCLUDING EXAMPLES)
[0101] 1. Creese, I., Sibley, D. R., Hamblin, M.W. & Leff, S.
E. Ann. Rev. Neurosci. 6, 43-71 (1983).
[0102] 2. Seeman, P. Pharmacol. Rev. 32, 229-313 (1980).
[0103] 3. Lee, T. et al. Nature 273, 59-61 (1984).
[0104] 4. Seeman, P. et al. Science 225, 728-731 (1984).
[0105] 5. Barnes, D. M. Science 241, 415=417 (1988).
[0106] 6. Cote, T. E., Frey, E. A., Grewe, C. W., & Kebabian,
J. W. J. Neural. Trans. Suppl. 18, 139-147 (1983).
[0107] 7. Senogles, S. E. et al. J. Biol. Chem. 262, 4860-4867
(1987).
[0108] 8. Dohlman, H. G., Caron, M. G. & Lefkowitz, R. J.
Biochemistry 26, 2657-2664 (1987).
[0109] 9. Dixon, R. A. F., et al. Nature 321, 75-79 (1986).
[0110] 10. Mount, S. M. Nucleic Acids Res. 10, 459-472 (1982).
[0111] 11. Grigoriadis, D. E., Niznik, H. B., Jarvie, K. R. &
Seeman, P. FEBS Let. 227, 220-224 (1988).
[0112] 12. Kobilka, B. K., et al. Science 238, 650-656 (1987).
[0113] 13. Kobilka, B. K., et al. Nature 329, 75-79 (1987).
[0114] 14. Kubo, T., et al. Nature 323, 411-416 (1986).
[0115] 15. Kubo, Y., et al. Nature 329, 836-838 (1986).
[0116] 16. Strader, C. D., et al. J. Biol. Chem. 263, 10267-10271
(1988).
[0117] 17. Sibley, D. R., Benovic, J. L., Caron, M. G. &
Lefkowitz, R. J. Cell 48, 913-922 (1987).
[0118] 18. Bouvier, M., et al. Nature 333, 370-373 (1988).
[0119] 19. Boyson, S. J., McGonigle, P. & Molinoff, P. B. J.
Neurosci. 6, 3177-3188 (1986).
[0120] 20. Uhler, M. & McKnight, G. S. J. Biol. Chem. 262,
15202-15207 (1987).
[0121] 21. Gorman, C., Padmanabhan, R. & Howard, B. H. Science
221, 551-553 (1983).
[0122] 22. Hyttel, J. Eur. J. Pharmacol. 91, 153-154 (1983).
[0123] 23. Hamblin, M. W., Leff, S. E. & Creese, I. Biochem.
Pharmacol. 33, 872-877 (1984).
[0124] 24. Dolphin, A. C. Trends in Neurosci. 10, 53-57 (1987).
[0125] 25. Jones, S. V. P., et al. Proc. Nat. Acad. Sci. U.S.A. 85,
4056-4060 (1988).
[0126] 26. Sanger, F., Nicklen, S. & Coulson, A. R. Proc. Nat.
Acad. Sci. U.S.A. 74, 5463-5467 (1977).
[0127] 27. Chirgwin, J. M., Przybyla, A. E., McDonald, R. J. &
Rutter, W. J. Biochemistry 18, 5294-5299 (1979).
[0128] 28. Ullrich, A., et al. Science 196, 1313-1319 (1977).
[0129] 29. Neve, K. A. & Molinoff, P. B. Mol. Pharmacol. 30,
104-111 (1986).
[0130] 30. Cheng, Y. C. & Prusoff, W. H. Biochem. Pharmacol.
22, 3099-3108 (1973).
[0131] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, utilize the
present invention to its fullest extent. The mentioned embodiments
are, therefore, to be construed as merely illustrative and not
limitative of the remainder of the disclosure in any way
whatsoever.
[0132] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention
and, without departing from the spirit and scope thereof, can make
various changes and modifications of the invention to adapt it to
various usages and conditions.
[0133] The entire texts of all applications, patents and
publications cited above are hereby incorporated by reference.
EXAMPLES
Example 1
[0134] Summary
[0135] We recently cloned a complementary DNA for the rat dopamine
D-2 receptor, making it possible to create cell lines expressing
this receptor. A cell line (LZR1) was created by transfecting the
D-2 cDNA (RGB-2) into mouse fibroblast Ltk.sup.- cells. LZR1 cells,
previously described as L-RGB2Zem-1 cells (1), expressed a high
density of D-2 receptors, whereas the wild-type cells did not.
Although transcription of the RGB-2 cDNA is regulated by the
zinc-inducible mouse metallothionein promoter, the density of D-2
receptors on membranes prepared from LZR1 cells was not increased
after the cells were treated with zinc. A second cell line derived
from Ltk cells, designated LZR2, had a lower density of D-2
receptors in the uninduced state, and treatment with zinc induced a
50% increase in the receptor density. A number of agonists
competitively and stereoselectively inhibited the binding of
[.sup.3H]spiroperidol to the expressed D-2 receptors. In LZR1
cells, dopamine was a more potent inhibitor of radioligand binding
in the absence than in the presence of GTP and NaCl. Dopamine
reduced forskolin-stimulated adenylate cyclase activity by 27% in
membranes prepared from LZR1 cells. Inhibition by dopamine was
blocked by (+)-butaclamol or prior treatment of intact cells with
pertussis toxin. These data indicate that the RGB-2 cDNA directs
the expression of a dopamine D-2 receptor capable of interacting
with guanine nucleotide-binding proteins and inhibiting adenylate
cyclase activity. Furthermore, the RGB-2 cDNA provides a means of
creating many cell lines that will be useful tools for the
biochemical and pharmacological characterization of dopamine D-2
receptors.
[0136] Introduction
[0137] Dopamine (DA) receptors have been classified into two
subtypes based on functional and pharmacological profiles (2). DA
D-2 receptors are characterized functionally by their ability to
inhibit adenylate cyclase activity (3). Activation of D-2 receptors
also inhibits calcium channels (4, 5), increases potassium
conductance (6), and may inhibit accumulation of inositol
phosphates (7, 8). One factor that has impeded research on the
regulation and functional characteristics of DA receptors has been
the lack of cell lines that express the receptors. One cell line,
derived from a prolactin-secreting tumor, has recently been
described in which DA inhibits adenylate cyclase activity and
prolactin secretion (9).
[0138] We recently cloned a rat brain complementary DNA (cDNA),
designated RGB-2, that has significant homology with
.beta..sub.2-adrenergic receptors and other receptors that interact
with guanine nucleotide-binding proteins. Three lines of evidence
indicate that the RGB-2 cDNA encodes the DA D-2 receptor: (1) The
deduced amino acid-sequence of the protein suggests the existence
of the seven membrane-spanning domains typical of receptors coupled
to guanine nucleotide-binding proteins (10); (2) the distribution
of messenger RNA that hybridizes with the cDNA parallels the
distribution of the D-2 receptor; and (3) when the RGB-2 cDNA is
transfected into cells that lack high affinity binding of the D-2
selective ligand [.sup.3H]spiroperidol, the cells express binding
sites for the radioligand with a pharmacological profile
characteristic of D-2 receptors (1).
[0139] The cloning of a D-2 receptor cDNA makes it possible to
express DA receptors in cell lines in which the effects of receptor
activation can readily be determined. We previously described the
binding of [.sup.3H]spiroperidol and other D-2 antagonists to a
line of cells derived by transfection of mouse L cells with the
RGB-2 cDNA under the control of a zinc-inducible mouse
metallothionein promoter (1). We also reported that, under the
assay conditions used previously, the binding of DA to LZR1
membranes was not responsive to GTP. We now demonstrate that the
D-2 receptor encoded by the RGB-2 cDNA is functional with respect
to the guanine nucleotide sensitivity of the binding of agonists
and the ability of agonists to inhibit adenylate cyclase
activity.
[0140] Methods
[0141] Materials: [.alpha.-.sup.32P]Adenosine 5'-triphosphate (ATP,
10-50 Ci/mmol) and [.sup.3H]cyclic AMP (31.9 Ci/mmol) were
purchased from New England Nuclear (Boston, Mass.), and
[.sup.3H]spiroperidol (95 Ci/mmol) was purchased from Amersham
(Arlington Heights, Ill.). Guanosine 5'-triphosphate (GTP), DA,
cyclic AMP, 3-isobutyl-1-methyl-xanthine, ATP, and forskolin were
purchased from Sigma Chemical Company (St. Louis, Mo.). Quinpirole,
LY181990 (Lilly Laboratories), bromocriptine (Sandoz Research
Institute), and (+) and (-)3-PPP (Astra) were generous
donations.
[0142] Transfection: The full RGB-2 cDNA was cloned into the
plasmid pZem3 (11). The cDNA and the vector were made compatible by
partially filling in the Bg1 II site on the vector and a Sal I site
on the cDNA adaptor. This plasmid was co-transfected with the
plasmid pRSVneo into mouse Ltk.sup.- cells by a CaPO.sub.4
precipitation technique (12). Transfectants were selected in 350
.mu.g/ml of G418, isolated, and screened for expression of RGB-2
mRNA by Northern blot analysis. The subclone LZR1, selected on the
basis of high expression of RGB-2 mRNA, was partially characterized
previously as L-RGB2Zem-1 (1). A second cell line, LZR2, was
isolated in the same way.
[0143] Tissue culture: Cells were plated at a density of 20,000
cells/cm.sup.2 in 150 mm diameter Falcon tissue culture plates
(Beckton Dickinson, Lincoln Park, N.J.), subcultured by replacing
the growth medium with trypsin-EDTA (0.1% trypsin, 0.02% EDTA in
phosphate-buffered saline) or fed on day 3, and harvested on day 5
or 6. Cells were grown in Dulbecco's modified Eagles.sup.1 medium
(Sigma), supplemented with 5% fetal bovine serum and 5%
iron-supplemented calf bovine serum (Hyclone, Logan, Utah), in an
atmosphere of 10% CO.sub.2/90% air at 37.degree.. Cells were lysed
by replacing the growth medium with ice-cold hypotonic buffer (1 mM
Na.sup.+-HEPES, pH 7.4, 2 mM EDTA). After swelling for 10-15 min,
the cells were scraped from the plate and centrifuged at
24.000.times.g for 20 min. The resulting crude membrane fraction
was resuspended with a Brinkmann Polytron homogenizer at setting 6
for 10 sec in Tris-isosaline (50 mM Tris-HCl, pH 7.4, and 0.9%
NaCl) and stored at -70.degree. for receptor binding experiments or
resuspended in Tris-isosaline, centrifuged again at 24,000.times.g
for 20 min., and resuspended in Tris-isosaline for immediate use in
adenylate cyclase experiments.
[0144] Receptor binding assay: The membrane preparation was thawed,
centrifuged at 24,000.times.g for 20 min., and resuspended in
Tris-isosaline except where indicated. Aliquots of the membrane
preparation were added to assay tubes containing (final
concentrations) 50 mM Tris-HCl, pH 7.4, 0.9% NaCl, 0.025% ascorbic
acid, 0.001% bovine serum albumin, [.sup.3H]spiroperidol, and
appropriate drugs. (+)-Butaclamol (2 .mu.M) was used to define
nonspecific binding, which was typically less than 10% of total
binding at concentrations of radioligand near the K.sub.D value.
Assays were carried out in duplicate in a volume of 2 ml for
saturation analyses or 1 ml for inhibition analyses. Incubations
were initiated by the addition of 15-50 .mu.g of protein, carried
out at 37.degree. for 50 min., and stopped by the addition of 10 ml
of ice-cold wash buffer (10 mM Tris, pH 7.4, and 0.9% NaCl) to each
assay. The samples were filtered through glass-fibre filters
(Schleicher & Schuell No. 30) and washed with an additional 10
ml of wash buffer. The radioactivity retained on the filters was
counted using a Beckman LS 1701 scintillation counter. Data were
analyzed by nonlinear regression using the data analysis program
Enzfitter (Elsevier-Biosoft). In competition experiments, K.sub.I
values were calculated from experimentally determined IC.sub.50
values by the method of Cheng and Prusoff (13). Averages for
K.sub.I and K.sub.D values are the geometric means. In experiments
designed to assess the effect of GTP and NaCl on the binding of DA,
fresh tissue was used. Cells were harvested, centrifuged, and
Mg.sup.2+ resuspended in Tris-Mg.sup.2+ (50 mM Tris, pH 7.4, and 4
mM MgCl.sub.2). Tissue was incubated for 15 min. at 37.degree. in
this buffer before re-centrifugation. The resuspended protein was
added to assays containing Tris-Mg.sup.2+ with no added NaCl or
GTP, or Tris-Mg.sup.2+ with 120 mM NaCl and 100 .mu.M GTP.
[0145] Adenylate cyclase assay: The conversion of
[.alpha..sup.32P]ATP to [.sup.32P]cAMP was determined essentially
as described by Salomon et al. (14). Membranes (50-100 .mu.g of
protein) resuspended in Tris-isosaline were added in a volume of
0.1 ml to an assay of 0.2 ml containing 50 mM Tris-HCl, pH 7.4, 5
mM cAMP, 1 mM 3-isobutyl-1-methylxanthine 1 mM MgCl.sub.2, 0.5 mM
EGTA, 0.25 mM ATP, 30 .mu.M GTP, approximately 2.times.10.sup.6 cpm
of [.alpha.-.sup.32P]ATP, and various drugs. Assays were initiated
by warming to 25.degree. and terminated after 20 minutes by cooling
to 0.degree., then adding trichloroacetic acid (100 .mu.l of a 30%
solution) to each assay. [.sup.3H]Cyclic AMP (approximately 30,000
cpm) was added to each assay as an internal standard. The assay
volume was brought up to 1 ml with water, and tubes were
centrifuged for 10 min. at 2000.times.g. Cyclic AMP in the
supernatant was isolated by sequential chromatography on columns
containing Dowex AG50W-X4 resin and neutral alumina. The 2-ml
eluate from each column of alumina was dissolved in 10 ml of
Bio-Safe II (RPI, Mount Prospect, Ill.) for liquid scintillation
counting. Dose-response curves for inhibition of adenylate cyclase
activity by agonists were analyzed by nonlinear regression using
the program Enzfitter. The data were fit to the equation:
E=(100-E.sub.max)/(1+(A/EC.sub.50).sup.N)+E.sub.max
[0146] where E is the amount of enzyme activity, expressed as
percentage of total stimulated activity, A is the concentration of
agonists, EC.sub.50 is the concentration of agonist causing
half-maximal inhibition of enzyme activity, E.sub.max is the enzyme
activity observed in the presence of maximally inhibiting
concentrations of agonist, expressed as the percentage of total
stimulated activity, and N is a slope factor. Averages of
EC.sub.50. values are the geometric means. Protein concentration
was determined by the method of Peterson (15).
[0147] Results
[0148] Saturation analysis of the binding of [.sup.3H]spiroperidol:
The density of D-2 receptors on membranes prepared from LZR1 cells
was determined by saturation analysis of the binding of
[.sup.3H]spiroperidol (FIG. 8). Since the RGB-2 cDNA is under the
control of the zinc-inducible mouse metallothionein promoter, the
effect of prior treatment of cells with 100 .mu.M zinc sulfate on
the binding of [.sup.3H]spiroperidol was also determined. The
density of binding sites was 736.+-.140 fmol/mg of protein in
control LZR1 cells, and 759.+-.155 fmol/mg of protein in LZR1 cells
treated with zinc (n=2). A second cell line, designated LZR2, had a
lower density of D-2 receptors (mean B.sub.max.+-.SE, 435.+-.71
fmol/mg of protein). In contrast to LZR1 cells, the density of
binding sites on LZR2 cells was increased 50% by zinc treatment to
630.+-.52 fmol/mg of protein. The mean K.sub.D value of 42 pM for
control LZR1 and LZR2 cells (pK.sub.D.+-.SE, 10.37.+-.0.15, n=4)
did not differ significantly from the mean K.sub.D value of 47 pM
for zinc-treated cells (10.33.+-.0.17). Scatchard transformation of
saturation analyses from all experiments yielded straight lines.
Wild-type Ltk.sup.- cells had no detectable displaceable binding of
[.sup.3H]spiroperidol (data not shown). Since LZR1 cells had the
higher density of D-2 receptors, these cells were used in all
subsequent experiments.
[0149] Inhibition of radioligand binding by agonists: The apparent
affinity of D-2 receptors for several agonists and related
compounds was determined in two experiments (FIG. 9A, Table 1). Of
the six compounds tested, bromocriptine was the most potent with a
mean K.sub.I value of 2 nM, whereas LY181990, the inactive
enantiomer of the D-2-selective agonist quinpirole, was the least
potent. All assays were carried out in the presence of 0.1 mM GTP
and 120 mM NaCl, using membranes prepared from LZR1 cells.
[0150] In other experiments, the effect of GTP and NaCl on
inhibition of radioligand binding by DA was determined (FIG. 9B).
Freshly prepared membranes were used for these experiments, and 4
mM MgCl.sub.2 was added to the homogenization and assay buffers. In
the absence of GTP and NaCl, the mean IC.sub.50 was 25 .mu.M
[mean-log(IC.sub.50).+-.SE=4.6.+-.0.3]. Addition of GTP and NaCl to
the assay buffer increased the mean IC.sub.50 value to 167 .mu.M
(3.8.+-.0.3, n=0.4), without altering the binding of
[3H]spiroperidol. Hill coefficients in the absence of GTP and NaCl
ranged from 0.56 to 0.68 (mean=0.64) whereas in the presence of GTP
and NaCl values ranged from 0.77 to 1.1 (mean=0.94). In the absence
of GTP and NaCl, inhibition curves for DA could be fit best by
assuming the presence of two classes of binding sites. One class of
high affinity sites, representing 48.+-.14% of the total number of
receptors, had a mean K.sub.I for DA of 0.3 .mu.M. The second
class, representing 52.+-.13% of the total number of receptors had
a mean K.sub.I value of 24 .mu.M.
[0151] Inhibition of adenylate cyclase activity by agonists: In
freshly prepared membranes from LZR1 cells, but not in membranes
from wild-type Ltk.sup.- cells, DA caused a concentration-dependent
attenuation of forskolin-stimulated adenylate cyclase activity.
Maximal inhibition was 27% of total activity, with an EC.sub.50
value of 624 nM (FIG. 10A; Table 1). Quinpirole was approximately
as efficacious as dopamine; that is, the maximal inhibition induced
by quinpirole was similar to that induced by DA. LY181990 was less
potent and less efficacious than its active isomer (FIG. 10B; Table
1), indicating that D-2 receptor-mediated inhibition of adenylate
cyclase activity was stereoselective. The finding that LY181990
caused measurable inhibition of enzyme activity in only 2 out of 3
experiments (Table 1) suggests that the compound has little or no
agonist activity. Similarly, (-)3-PPP did not have detectable
agonist activity. Bromocriptine, with an EC.sub.50 value of 45 nM,
was the most potent agonist. Bromocriptine and (+)3-PPP were less
efficacious than DA; thus, the drugs appeared to be partial
agonists.
[0152] Inhibition of adenylate cyclase activity in LZR1 cells by 10
.mu.M DA was prevented by including 10 .mu.M (+)-butaclamol in the
assay (FIG. 11), indicating that inhibition of DA is
receptor-mediated. Also, treatment of LZR1 cells with pertussis
toxin (50 ng/ml of growth medium for 16 hours) blocked DA-inhibited
enzyme activity in membranes prepared from the cells (FIG. 10C),
suggesting that G.sub.i mediates inhibition of enzyme activity by
DA. Interestingly, forskolin-stimulated adenylate cyclase activity
in membranes from pertussis toxin-treated cells was approximately
2.5-fold greater than activity in control membranes.
1TABLE 1 Inhibition of radioligand binding and adenylate cyclase
activity by agonists The apparent affinity (K.sub.1) of 6 drugs for
D-2 receptors on membranes prepared from LZR1 cells, determined by
inhibition of the binding of [.sup.3H]spiroperidol (0.2 nM), is
shown, as well as the concentration of each drug that caused
half-maximal inhibition of forskolin-stimulated adenylate cyclase
activity (EC.sub.50). Values for drug concentrations, expressed as
.mu.M, are the geometric means of results from 3 experiments
(EC.sub.50, quinpirole and (+) 3-PPP), 4 experiments (EC.sub.50-DA)
or 2 (K.sub.1, all drugs; EC.sub.50, bromocriptine) experiments.
The maximal inhibition of adenylate cyclase activity observed (Max)
is expressed as the mean .+-. SEM of the percent inhibition of
total activity in the presence of 10 .mu.M forskolin. For LY181990,
the results shown are from two experiments in which inhibition of
enzyme was observed. There was no inhibition in a third experiment.
Drug K.sub.1 EC.sub.50 Max Dopamine 17 0.6 27 .+-. 3% Quinpirole 9
0.7 28 .+-. 2% LY181990 277 5.0 10 .+-. 2% Bromocriptine 0.0024
0.04 17 .+-. 1% (+) 3-PPP 33 4.0 16 .+-. 3% (-) 3-PPP 0.87 --
--
[0153] Discussion
[0154] As reported previously, Ltk.sup.- cells transfected with a
rat D-2 receptor cDNA express a high density of DA D-2 receptors
(1). We have characterized one subclone of these cells, designated
LZR1, that stably expresses D-2 receptors at a density of 750 to
1000 fmol/mg of protein (present results; ref. 1).
[0155] As the D-2 cDNA is contained in the plasmid pZem3, under the
regulation of a zinc-inducible promoter, the effect of zinc
treatment on the properties of radioligand binding was determined.
D-2 receptors on LZR1 cells appear to be maximally expressed in the
absence of zinc, so that zinc treatment caused no increase in the
density of receptors. The lack of responsiveness to zinc is not a
characteristic of the LtK.sup.- cell line, since we have isolated a
second transfected line of Ltk.sup.- cells, LZR2, in which the
density of D-2 receptors is elevated approximately 50% by treatment
with zinc, from 435 to 630 fmol/mg of protein. The affinity of D-2
receptors for [.sup.3H]spiroperidol was not significantly altered
by zinc treatment.
[0156] The apparent affinity of D-2 receptors on LZR1 cells for
several agonists and related drugs was determined by inhibiting the
specific binding of [3H]spiroperidol with the drugs in the presence
of GTP. Bromocriptine was an extremely potent agonist, with a
K.sub.I value of 2 nM. The potency of quinpirole, like that of DA,
was approximately 10 .mu.M. The binding of agonists was
stereoselective, since LY181990 was much less potent than its
active enantiomer, quinpirole, and (-)3-PPP was more potent than
(+)3-PPP. These data extend our previous investigation of the
binding of antagonists to D-2 receptors on LZR1 cells (1).
[0157] Physiological effects of stimulation of D-2 receptors appear
to be mediated by a guanine nucleotide-binding protein, G.sub.i,
that inhibits adenylate cyclase activity (16). High affinity
binding of agonists is thought to represent a ternary complex
composed of agonist, receptor, and the .alpha.-subunit of G.sub.i
(G.sub.i.alpha.), and inhibition of agonist binding to D-2
receptors by GTP represents GTP-induced uncoupling of D-2 receptors
from G.sub.i.alpha.. To evaluate the ability of D-2 receptors
encoded by the RGB-2 cDNA to couple to G proteins, the effect of
GTP on the potency of DA for inhibition of radioligand binding was
determined. In preliminary studies using LZR1 cells, we found that
in our standard assay buffer containing 120 mM NaCl and no added
Mg.sup.2+, the binding of DA was not sensitive to GTP (1), although
under the same conditions the binding of DA to rat striatal
membranes is inhibited by GTP (data not shown). There were three
possible explanations for the lack of sensitivity to GTP in LZR1
membranes: (1) LZR1 cells, derived from Ltk.sup.- cells, could lack
the appropriate G-protein. (2) The RGB-2 cDNA could encode only a
binding subunit of the D-2 receptor. This possibility seemed
unlikely because of the similarity between the predicted primary
structure of the protein encoded by RGB-2 and other receptors
coupled to guanine nucleotide-binding proteins. (3) It could be
that the ionic conditions of the binding assay were not appropriate
for formation or destabilization of the ternary complex. In the
studies described here, ionic conditions were varied to increase
the likelihood of observing GTP-sensitive binding. To maximize
high-affinity agonist binding, tissue was preincubated with
MgCl.sub.2, and MgCl.sub.2 was included in the assay buffer (17).
To maximize GTP-induced destabilization of the ternary complex,
NaCl was added together with GTP (17). Under these conditions,
addition of GTP and NaCl decreased the potency of DA for D-2
receptors and increased the slope of the inhibition curve in
membranes from LZR1 cells. It is interesting that the ionic
requirements for formation and destabilization of the ternary
complex seem-to be more stringent in membranes from LZR cells than
in membranes from rat striatum.
[0158] Inhibition of adenylate cyclase activity by DA D-2 receptors
is a well-characterized phenomenon (3, 18, 19). Inhibition of
adenylate cyclase activity by several drugs was assessed in
membranes from LZR1 cells. Maximally effective concentrations of DA
and the D-2-selective agonist quinpirole decreased
forskolin-stimulated enzyme activity by almost 30%. Inhibition of
enzyme activity by DA was blocked by the D-2 antagonist
(+)-butaclamol. The most potent agonist tested, bromocriptine,
appeared to be a partial agonist, as reported by others (19, 20).
Inhibition of adenylate cyclase by agonists was stereoselective,
since LY181990, the dextrorotatory enantiomer of quinpirole, had
little or no efficacy. As has been reported previously, the partial
agonist (+)3-PPP is a stronger agonist than (-)3-PPP, although
(-)3-PPP binds to D-2 receptors with higher affinity (21, 22). We
observed no inhibition of adenylate cyclase activity by (-)3-PPP in
membranes from LZR1 cells. The EC.sub.50 values determined for
inhibition of adenylate cyclase activity by agonists were generally
lower than the K.sub.I values determined in assays of ligand
binding (Table 1). This could be due to the presence of a receptor
reserve on these cells, although the observation that drugs
differed in maximal inhibition of enzyme activity suggests that
there is not a large receptor reserve even for the most efficacious
agonists, DA and quinpirole. Also, there would be no receptor
reserve for a partial agonist such as (+)3-PPP. An alternative
explanation is that inhibition of adenylate cyclase activity could
be related to the binding of agonists to D-2 receptors in a
high-affinity state induced-by formation of the ternary complex, as
had been proposed for inhibition of enzyme activity by DA in the
anterior pituitary (23). On the other hand, K.sub.I values in the
present report, determined in the presence of GTP and NaCl, reflect
the binding of agonists to receptors in a state of low affinity.
Direct comparisons are difficult, since adenylate cyclase and
radioligand binding assays were carried out at different
temperatures, but the K.sub.I value for DA binding to the
high-affinity class of sites (0.3 .mu.M) is close to the EC.sub.50
value for DA-inhibited adenylate cyclase (0.6 .mu.M), whereas the
K.sub.I values for the binding of DA to the low-affinity class of
sites (24 .mu.M) and binding in the presence of GTP (17 .mu.M) are
considerably higher.
[0159] DA did not inhibit adenylate cyclase activity in membranes
from LZR1 cells that had been treated with pertussis toxin. Since
pertussis toxin-catalyzed ADP-ribosylation of G.sub.i prevents
G.sub.i-mediated inhibition of adenylate cyclase, this finding is
consistent with the hypothesis that D-2 receptors interact with
G.sub.i.alpha. in the transfected LZR1 cells. As has been observed
for stimulation of adenylate cyclase activity by isoproterenol
after pertussis toxin-treatment of other cell types (24), treatment
of intact LZR1 cells with pertussis toxin potentiated the ability
of forskolin to stimulate adenylate cyclase activity, suggesting
that in some cell lines G.sub.i normally acts to attenuate
forskolin-and hormone-stimulated adenylate cyclase activity.
[0160] We have characterized a cell line, transfected with the
RGB-2 cDNA, that stably expresses a high density of D-2 receptors.
With this cell line, it was determined the cDNA encodes a DA D-2
receptor that interacts productively with a guanine
nucleotide-binding protein to inhibit adenylate cyclase activity.
It seems likely that the RGB-2 cDNA would direct the expression of
a functional D-2 receptor in almost any type of cell. For example,
GH.sub.4C.sub.1 cells, derived from a rat pituitary tumor (25), are
prolactin-secreting cells that lack DA receptors, even though
lactrotrophs in the rat anterior pituitary express D-2 receptors.
Transfection of the RGB-2 cDNA into GH.sub.4C.sub.1 cells results
in the expression of a D-2 receptor with functional characteristics
similar to those described here (26). Cell lines created by
transfection with a D-2 receptor cDNA will be useful in the study
of mechanisms of action and regulation of D-2 receptors.
REFERENCES FOR EXAMPLE 1
[0161] 1. Bunzow, J. R., H. H. M. Van Tol, D. K. Grandy, P. Albert,
J. Salon, M. Christie, C. A. Machida, K. A. Neve, and O. Civelli.
Cloning and expressing of a rat D.sub.2 dopamine receptor cDNA.
Nature (Lond.) 336:783-787 (1988). 2. Kebabian, J. W., and D. B.
Calne. Multiple receptors for dopamine. Nature (Lond.) 277:93-96
(1979).
[0162] 3. De Camilli, P., D. Macconi, and A. Spada. Dopamine
inhibits adenylate cyclase in human prolactin-secreting pituitary
adenomas. Nature (Lond.) 278:252-254 (179).
[0163] 4. Malgaroli, A., L. Vallar, F. R. Elahi, T. Pozzan, A.
Spada, and J. Meldoiesi. Dopamine inhibits cytosolic
Ca.sup.2-increases in rat lactotroph cells: Evidence of a dual
mechanism of action. J. Biol. Chem. 262:13920-13927 (1987).
[0164] 5. Drouva, S. V., E. Rerat, C. Bihoreau, E. Laplante, R.
Rasolonjanahary, H. Clauser, and C. Kordon.
Dihydropyridine-sensitive calcium channel activity related to
prolactin, growth hormone, and luteinizing hormone release from
anterior pituitary cells in culture. Interactions with
somatostatin, dopamine, and estrogens. Endocrinology 123:2762-2773
(1988).
[0165] 6. Lacey, M. G., N. B. Mercuri, and R. A. North. Dopamine
acts on D2 receptors to increase potassium conductance in neurones
of the rab substantia nigra zona compacta. J. Physiol. (Lond.)
392:397-416 (1987).
[0166] 7. Simmonds, S. H., and P. G. Strange. Inhibition of
inositol phospholipid breakdown by D.sub.2 dopamine receptors in
dissociated bovine anterior pituitary cells. Neurosci. Lett.
60:267-272 (1985).
[0167] 8. Enjalbert, A., F. Sladaczek, G. Guillon, P. Bertrand, C.
Shu, J. Epelbaum, A. Garcia-Sainz, S. Jard, C. Lombard, C. Kordon,
and J. Bockaert. Angiotensin II and dopamine modulate both cAMP and
inositol phosphate productions in anterior pituitary cells:
Involvement in prolactin secretion. J. Biol Chem. 261:4071-4075
(1986).
[0168] 9. Judd, A. M., I. S. Login, K. Kovacs, P. C. Ross, B. L.
Spangelo, W. D. Jarvis, and R. M. MacLeod. Characterization of the
MMQ cell, a prolactin-secreting cloned cell line that is responsive
to dopamine. Endocrinology 123:2341-2350 (1988).
[0169] 10. Lefkowitz, R. J. and M. G. Caron. Adrenergic receptors:
Models for the study of receptors coupled to guanine nucleotide
regulatory proteins. J. Biol. Chem. 263:4993-4996 (1988).
[0170] 11. Uhler, M. D., and G. S. McKnight. Expression of cDNAs
for two isoforms of the catalytic subunit of cAMP-dependent protein
kinase. J. Biol. Chem. 262:15202-15207, 1987.
[0171] 12. Gorman, C., R. Padmanabhan, and B. H. Howard. High
efficiency DNA-mediated transformation of primate cells. Science
231:551-553 (1983).
[0172] 13. Cheng, Y. -C. and W. H. Prusoff. Relationship between
the inhibition constant (K.sub.I) and the concentration of
inhibitor which causes 50 percent inhibition (I.sub.50) of an
enzymatic reaction. Biochem. Pharmacol. 22:3099-3108 (1973).
[0173] 14. Salomon, Y., C. Londos, and M. Rodbell. A highly
sensitive adenylate cyclase assay. Analyt. Biochem. 58:541-548
(1974).
[0174] 15. Peterson, G. L. A simplification of the protein assay
method of Lowry et al. which is more generally applicable. Analyt.
Biochem. 83:346-356 (1977).
[0175] 16. Cote, T. E., E. A. Frey, C. W. Grewe, and J. W.
Kebabian. Evidence that the dopamine receptor in the intermediate
lobe of the rat pituitary gland is associated with an inhibitory
guanyl nucleotide component. J. Neural. Trans. Suppl. 18:139-147
(1983).
[0176] 17. Hamblin, M. W., and I. Creese. .sup.3H-Dopamine binding
to rat seriatal D-2 and D-3 sites: Enhancement by magnesium and
inhibition by guanine nucleotides and sodium. Life Sci.
30:1587-1595 (1982).
[0177] 18. Weiss, S., M. Sebben, J. A. Garcia-Sainz, and J.
Bockaert. D.sub.2-Dopamine receptor-mediated inhibition of cyclic
AMP formation in striatal neurons in primary culture. Mol.
Pharmacol. 27:595-599 (1985).
[0178] 19. Onali, P., M. C. Olianas, and G. L. Gessa.
Characterization of dopamine receptors mediating inhibition of
adenylate cyclase activity in rat striatum. Mol. Pharmacol.
28:138-145 (1985).
[0179] 20. Agui, T., N. Amlaiky, M. G. Caron, and J. W. Kebabian.
Binding of [.sup.125I]-N-(p-aminophenethyl)spiroperidol to the D-2
dopamine receptor in the neurointermediate lob of the rat pituitary
gland: A thermodynamic study. Mol. Pharmacol. 32:163-169
(1988).
[0180] 21. Koch, S. W., B. K. Koe, and N. G. Bacopoulos.
Differential effects of the enantiomers of
3-(3-hydroxyphenyl)-N-n-propylpiperidine (3-PPP) at dopamine
receptor sites. Eur. J. Pharmacol. 92:279-283 (1983).
[0181] 22. Meller, E., K. Bohmaker, Y. Namba, A. J. Friedhoff, and
M. Goldstein. Relationship between receptor occupancy and response
at striatal dopamine autoreceptors. Mol. Pharmacol. 31:592-598
(1987).
[0182] 23. Borgundvaag, V., and S. R. George. Dopamine inhibition
of anterior pituitary adenylate cyclase is mediated through the
high-affinity state of the D.sub.2 receptor. Life Sci. 37:379-386
(1985).
[0183] 24. Abramson, S. N., M. W. Martin, A. R. Hughes, T. K.
Harden, K. A. Neve, D. A. Barrett, and P. B. Molinoff. Interaction
of .beta.-adrenergic receptors with the inhibitory guanine
nucleotide-binding protein of adenylate cyclase in membranes
prepared from cyc-S49 lymphoma cells. Biochem. Pharmacol.
37:4289-4297 (1988).
[0184] 25. Tashjian, A. H. Clonal strains of hormone-producing
pituitary cells. Meth. Enzymol. 58:527-535 (1979).
[0185] 26. Albert, P. R., K. Neve, J. Bunzow, and O. Civelli.
Biological functions of the rat dopamine D.sub.2 receptor cDNA
expressed in GH.sub.4C.sub.1 rat pituitary cells. Proc. Endocrine
Soc. 71:(in press).
Example 2
[0186] Summary
[0187] We have previously described a cDNA which encodes a binding
site with the pharmacology of the D.sub.2-dopamine receptor
(Bunzow, J. R., et al. (19868) Nature 336, 783-787). We demonstrate
here that this protein is a functional receptor, i.e., it couples
to G-proteins to inhibit cAMP generation and hormone secretion. The
cDNA was expressed in GH.sub.4C.sub.1 cells, a rat
somatomammotrophic cell strain which lacks dopamine receptors.
Stable transfectants were isolated and one clone, GH.sub.4ZR.sub.7,
which had the highest levels of D.sub.2-dopamine receptor mRNA on
Northern blot, was studied in detail. Binding of D2-dopamine
antagonist .sup.3H-spiperone to membranes isolated from
GH.sub.4ZR.sub.7 cells was saturable, with K.sub.D=96 pM, and
B.sub.max=2300 fmol/mg protein. Addition of GTP/NaCl increased the
IC.sub.50 value for dopamine competition for .sup.3H-spiperone
binding by two-fold, indicating that the D.sub.2-dopamine receptor
interacts with one or more G proteins. To assess the function of
the dopamine binding site, acute biological actions of dopamine
were characterized in GH.sub.4ZR.sub.7 cells. Dopamine decreased
resting intra- and extracellular cAMP levels by 50-70%
(EC.sub.50=8.+-.2 nM), and blocked completely VIP-induced
enhancement of cAMP levels (EC.sub.50=6.+-.1 nM), which ranged from
8-12 times basal levels. Antagonism of dopamine-induced inhibition
of VIP-enhanced cAMP levels by spiperone, (+)-butaclamol,
(-)-sulpiride and SCH23390 occurred at concentrations expected from
K.sub.I values for these antagonists at the D.sub.2-receptor and
was stereo-selective. Dopamine (as well as several
D.sub.2-selective agonists) inhibited forskolin-stimulated
adenylate cyclase activity by 45.+-.6%, with EC.sub.50 of 500-800
nM in GH.sub.4ZR.sub.7 membranes. Dopaminergic inhibition of
cellular cAMP levels and of adenylate cyclase activity in membrane
preparations was abolished by pretreatment with pertussis toxin (50
ng/ml, 16h). Dopamine (200 nM) abolished VIP and TRH-induced acute
prolactin release. These data show conclusively that the cDNA clone
encodes a functional dopamine-D2 receptor which couples to G
proteins to inhibit adenylate cyclase, and both cAMP-dependent and
cAMP-independent hormone secretion. The GH.sub.4ZR.sub.7 cells will
prove useful in elucidating further the biochemistry of the
dopamine D.sub.2 receptor.
[0188] Introduction
[0189] The major element controlling PRL.sup.1 secretion from the
pituitary is the concentration of dopamine in the hypophyseal
portal bloodstream (1) Dopamine acts via dopamine-D.sub.2 receptors
on pituitary lactotrophs to inhibit basal and hormone-stimulated
secretion of PRL (1-5). The dopamine-D.sub.2 receptor interacts
with pertussis toxin-sensitive, inhibitory G proteins (6-9) to
reduce adenylate cyclase activity, and to block enhancement of cAMP
levels by other agents (6, 10-12). Dopamine also decreases
[Ca.sup.++].sub.i in lactotrophs, and partially inhibits elevation
of [Ca.sup.++].sub.i by other agents, such as TRH (13-15). Both
dopaminergic inhibition of cAMP and of [Ca.sup.++].sub.i are
mediated through coupling to one or more pertussis toxin-sensitive
G proteins, and appear to contribute to dopamine inhibition of PRL
secretion (15). The precise relation between these components of
dopamine action has been difficult to study (15, 16) due to the
presence of heterogeneous cell types, limitations of cell number,
and variations in responsiveness of divers lactotroph
preparations.
[0190] The recent cloning of the dopamine-D.sub.2 receptor cDNA
(17) provides a useful tool to examine the intracellular actions
and regulation of the receptor. To examine whether the
D.sub.2-receptor clone directs synthesis of a functional receptor,
and to define the pathway between dopamine-D.sub.2 receptor
activation and biological effect, we have transfected the
dopamine-D.sub.2 receptor cDNA into a pituitary-derived cell
strain, GH.sub.4C.sub.1 cells. GH.sub.4C.sub.1 cells are rat
pituitary cells which synthesize and secrete PRL and GH, and
possess a variety of hormone, growth factor, and neurotransmitter
receptors, second messenger systems, and ion channels and have
provided an accessible model of lactotroph function (18, 19).
However, these cells lack dopamine-D.sub.2 receptors, which are
present on normal lactotrophs, and thus provide an ideal host for
studying the function of the dopamine-D.sub.2 receptor. This report
demonstrates that the gene product of the cDNA clone functions as a
dopamine-D.sub.2 receptor and couples to inhibitory G proteins to
decrease cAMP accumulation.sup.2 and PRL release. The
GH.sub.4C.sub.1 transfectants characterized herein should provide a
useful cell system in which the mechanisms of dopamine action at
D.sub.2 receptors may be studied further.
[0191] Experimental Procedures
[0192] Materials: Dopamine agonists and antagonists were from
Research Biochemicals Incorporated (Waltham, Mass.), except
quinpirole (Lilly), bromocryptine (Sandoz Research Institute), and
(+) and (-)3-PPP (Astra). Rabbit antibody (lot CA-3) to
2-O-succinyl-cAMP-bovine serum albumin conjugate was obtained from
ICN (Irvine, Calif.), rPRL standard and anti-rPRL antibody were
from Dr. Salvatore Raiti, NIDDK, Bethesda, Md. Peptides were from
Peninsula (, CA) or Sigma (St. Louis, Mo). .alpha..sup.32P-dCTP
(2,200 Ci/mmol), .sup.125I-2-O-(iodotyrosyl methyl ester)-succinyl
cAMP (2,200 Ci/mmol), .sup.125I-rPRL (2,200 Ci/mmol),
.alpha..sup.32 P-ATP (10-50 Ci/mmol), .sup.3H-cAMP (31.9 Ci/mmol)
were from New England Nuclear (Boston, Mass.). All other chemicals
were reagent grade, obtained primarily from Sigma.
[0193] Methods:
[0194] Construction of pZEM-D.sub.2-cDNA: The pZEM-3 plasmid (20)
was cut at the Bgl II site between the metallothionein promotor and
hGH 3'-flanking sequence. Full-length dopamine-D.sub.2 cDNA (17)
was excised from .lambda.GT10 with Sal I and was ligated to the cut
pZEM-3 plasmid in the presence of dATP and dGTP (250 .mu.M) and
transformed into E. coli strain XL-1 (Stratagene). Recombinants
were characterized by their hybridization to .sup.32P-labelled
D.sub.2-cDNA, followed by restriction analysis and DNA sequencing.
Recombinants with cDNA inserts in the sense orientation were
prepared and purified by CsCl gradient centrifugation for
transfection into eucaryotic cells.
[0195] Cell Culture: GH.sub.4C.sub.1 cells, obtained from Dr. A. H.
Tashjian, Jr. (Harvard University, Boston, Mass.) and subclones
were grown in Ham's F10 medium, supplemented with 10% fetal bovine
serum, at 37.degree. C. in 5% CO.sub.2. For studies of
.sup.3H-spiperone binding or adenylate cyclase activity, cells were
grown in Dulbecco's modified Eagle's medium supplemented with 10t
fetal bovine serum at 37.degree. C. in 10% Co.sub.2. Media were
changed 12-24 h prior to transfection or experimentation. For
transfection, GH.sub.4C.sub.1 cells were grown to
2-4.times.10.sup.6 cells/10 cm dish. 20 .mu.g of pZEM-D.sub.2cDNA
and 1 .mu.g pRSV-neo were co-precipitated with calcium phosphate in
2 ml of Hepes-buffered saline, and placed over cells for 10-20 min.
8 ml of warm F10+10% fetal calf serum (pH 7.0) was added, and the
cells incubated for 4-5 h, 37.degree. C. The medium was removed and
15% glycerol in Hepes-buffered saline was added, and incubated for
3 min., 37.degree. C. The plates were rinsed and fresh F10+10%
fetal calf serum added, and the cells placed in the incubator for
16-20 h. Fresh medium supplemented with 700 .mu.g/ml G418
(Geneticin, GIBCO, N.Y.) was added over the next 3-4 weeks, to
select for stable transfectants expressing neo-resistance. Single
colonies were isolated using sterile micropipette tips to take up
individual colonies in 3-5 .mu.l. Once stocks of the transfectant
cell lines were stored frozen in liquid nitrogen, G418 was omitted
from growth media.
[0196] RNA Isolation and Northern Blot Analysis: Cells were rinsed
in calcium-free Hepes-buffered saline+0.02% EDTA and extracted with
Tris-buffered guanidinium hydrochloride, centrifuged (33,000 rpm,
16 h) through a 1.7 g/ml CsCl pad, and the pellets extracted with
phenol/chloroform and ethanol precipitated (21). RNA was
resuspended and quantitated by UV absorbance at OD=260 nm. For
Northern blots, RNA was denatured in glyoxal/dimethylsulfoxide (1
h, 50.degree. C.), and run on a 1% agarose gel in 10 mM sodium
phosphate. RNA was blotted overnight onto nylon membrane (N-bond,
Amersham), baked at 80.degree. C. for 2h. Prehybridization was as
described, for 6 h at 42.degree. C. Random-primed .sup.32P-labelled
1.6 kb BamHI-BglII fragment of the D.sub.2-cDNA (1-2.times.10.sup.6
dpm/.mu.g) was used for hybridization, 16-20h at 42.degree. C. in
50% formamide. Blots were washed in 2.times.SSC for 10 min, room
temperature, followed by 3.times.15 min. wash in 0.2.times.SSC,
0.5% SDS, 70.degree. C., and exposed to X-ray film overnight at
-80.degree. C., with intensifying screen.
[0197] Ligand Binding: Cell membranes were prepared by first
replacing growth medium with ice-cold hypotonic buffer (1 mM Hepes,
pH 7.4, 2 mM EDTA). After swelling for 10-15 min, the cells were
scraped from the plate and centrifuged at 24,000 g for 20 min,
lysed with a Brinkman Polytron homogenizer at setting 6 for 10 sec
in Tris-isosaline (50 mM Tris, pH 7.4, 0.9% NaCl) and stored at
-70.degree. C. for receptor binding experiments, or resuspended in
50 mM Tris, pH 7.4, centrifuged as above, and resuspended in 50 mM
Tris for immediate use in adenylate cyclase assay (below). For
binding assays, the membrane preparation was thawed, centrifuged
(24,000 g.times.20 min) and resuspended in Tris-isosaline except
where indicated. Aliquots of membrane preparation were added to
tubes containing 50 mM Tris, pH 7.4, 0.9% NaCl, 0.025% ascorbic
acid, 0.001% bovine serum albumin, .sup.3H-spiperone and indicated
drugs. (+)-Butaclamol (2 .mu.M) was used to define nonspecific
binding, which was less than 10% of total binding at concentrations
of radioligand near the K.sub.D value. Assays were carried out in
duplicate, in a volume of 2 ml for saturation analyses or 1 ml for
inhibition analyses. Incubations were initiated by addition of
10-50 .mu.g of membrane protein, carried out at 37.degree. C. for
50 min, and stopped by addition of 10 ml of ice-cold buffer (10 mM
Tris, pH 7.4, 0.9% NaCl) to each tube. The samples were immediately
filtered through glass-fibre filters (Schleicher and Schuell No.
30) and washed with 10 ml of ice-cold buffer. Radioactivity
retained on the filter was counted using a Beckman LS 1701
scintillation counter. In experiments to examine the effect of GTP
on dopamine binding, cells were harvested, centrifuged, resuspended
in Tris-Mg.sup.++ (50 mM Tris, pH 7.4, 4 mM MgCl.sub.2) and
incubated for 15 min, 37.degree. C. After centrifugation, the
resuspended protein was added to assays containing Tris-Mg.sup.++
with no added GTP or NaCl, or Tris-Mg.sup.++ with 120 .sup.2Q mM
NaCl and 100 .mu.m GTP.
[0198] cAMP and PRL Assay: Cells were plated in 6-well, 35 mm
dishes, 3-7 days prior to experimentation. Cells were pre-incubated
in 2 ml/well warm F10+0.1% (-)-ascorbic acid +20 mM Tris (pH 7.2)
(FAT) for 5-10 min, followed by addition of 1 ml/well of FAT+100
.mu.m IBMX+experimental compounds, and incubated for 30 min. at
37.degree. C. Experimental compounds were diluted 200- to 1000-fold
from stock solutions made immediately prior to assay. The final
ethanol concentration never exceeded 0.1%, a concentration without
effect on basal or VIP-enhanced cAMP or PRL levels in
GH.sub.4ZR.sub.7 cells. Media were collected, and the cells were
lysed immediately in 1 ml of boiling water. Cell lysates and media
were centrifuged (2000.times.g, 10 min., 4.degree. C.), and the
supernatants collected for assay as cell extracts. Cell extracts
and media samples were frozen at -20.degree. C. until assay, if not
assayed immediately. cAMP was assayed by a specific
radioimmunoassay as described (22), with antibody used at 1:500
dilution. After 16 h incubation at 4.degree. C., 20 .mu.l of 10%
BSA and 1 ml of 95% ethanol were added consecutively to precipitate
the antibody-antigen complex. Standard curves showed IC.sub.50 of
0.5.+-.0.2 pmol using cAMP as standard. PRL was assayed in the
media samples obtained as described above, except that IBMX was
omitted during the 30 min incubation in FAT medium. PRL levels were
determined by specific radioimmunoassay using Staphyloccus A lysate
(Igsorb, The Enzyme Center, Malden, Mass.) to precipitate
antigen-antibody complexes (23). Standard curves gave IC.sub.50 of
36.+-.6 ng using rPRL standard.
[0199] Adenylate Cyclase Assay: The conversion of
.alpha..sup.32P-ATP to .sup.32P-cAMP was determined essentially as
described by Salomon et al. (24). Membranes (10-50 .mu.g) were
added in a volume of 100 .mu.l to an assay of 200 .mu.l containing
50 mM Tris, pH 7.4, 5 mM cAMP, 1 mM IBMX, 1 mM MgCl.sub.2, 0.5 mM
EGTA, 0.25 mM ATP, 30 .mu.m GTP, and about 2.times.10.sup.6 cpm of
.alpha..sup.32P-ATP, and various drugs. Assays carried out in
triplicate were initiated by warming to 25.degree. C. and
terminated by cooling to 0.degree. C. Trichloroacetic acid (100
.mu.l of 30% solution) was added to each assay, and .sup.3H-cAMP
(30,000 cpm) was added to each tube as an internal standard. The
assay volume was increased to 1 ml by addition of water, and tubes
were centrifuged (2000g.times.10 min). cAMP in the supernatant was
isolated by sequential chromatography on columns containing Dowex
AG50W-X4 resin and neutral alumina. The 2-ml eluate from each
alumina column was dissolved in 10 ml of Bio-Safe II (RPI, Mount
Prospect, Ill.) for liquid scintillation counting.
[0200] Calculations: Data from cAMP and PRL assays are expressed as
means.+-.standard error for triplicate determinations.
Curve-fitting parameters were obtained by nonlinear regression
analysis using the Enzfitter program (Elsevier Biosoft). Average
affinity, EC.sub.50 and IC.sub.50 values are geometric means of the
indicated number of experiments. In competition experiments,
K.sub.I values were calculated from experimentally determined
IC.sub.50 values by the method of Cheng and Prusoff (25). All
experiments were representative of 3-5 independent trials, with the
exception of that presented in FIG. 16 (2 trials).
[0201] Results
[0202] Characterization of Stable Transfectants: GH.sub.4C.sub.1
cells were cotransfected with pZEM-D.sub.2-cDNA and pRSV-neo, and
colonies resistant to the antibiotic G418 were isolated and
initially characterized by Northern blot analysis. One clone,
GH.sub.4ZR.sub.7, had higher levels of 2.5 kb D.sub.2 mRNA than
other clones (FIG. 13A). Wild-type (untransfected) GH.sub.4C.sub.1
cells, as well as a GH.sub.4C.sub.1 cell transfectant
(GH.sub.4ZD.sub.10) expressing the rat 5-HT.sub.1A receptor gene in
the pZEM-3 vector.sup.3 showed no hybridization to the
D.sub.2-receptor probe. Pretreatment of GH.sub.4ZR.sub.7 cells with
100 .mu.M ZnSO.sub.4 for 36 h induced a marked enhancement of
D.sub.2 receptor mRNA, indicating that the transcribed mRNA is
regulated by the zinc-sensitive metallothionein promotor (20). The
GH.sub.4ZR.sub.7 clone was used for further analysis (below)
because of the high levels of dopamine-D.sub.2 receptor expression
in this clone.
[0203] Specific binding of the selective dopamine-D2 receptor
antagonist, .sup.3H-spiperone, was assayed in crude membranes
prepared from GH.sub.4ZR.sub.7 cells (FIG. 13B). The
GH.sub.4ZR.sub.7 membranes showed a saturable component of
.sup.3H-spiperone binding which was displaced by 2 .mu.M
(+)-butaclamol, whereas membranes from wild-type GH.sub.4C.sub.1
cells showed no specific .sup.3H-spiperone binding (data not
shown). In 5 experiments, the GH.sub.4ZR.sub.7 cell membranes
showed maximal specific .sup.3H-spiperone binding of 2046.+-.315
fmol/mg of protein, and a mean K.sub.D value of 96.+-.1 pM. These
values demonstrate robust expression of dopamine-D.sub.2 binding
sites receptors in these cells with affinity for .sup.3H-spiperone
comparable to that obtained in rat striatal membranes, and in
Ltk.sup.- cells transfected with pZEM-D.sub.2-cDNA (17).
[0204] To ascertain whether the expressed dopamine binding site
interacted with a G protein, inhibition of .sup.3H-spiperone
binding by dopamine was assayed in GH.sub.4ZR.sub.7 cell membranes,
in the absence or presence of 100 .mu.M GTP and 120 m!M NaCl (FIG.
13C). Assays were carried out in the presence of 4 mM MgCl.sub.2 to
promote high affinity binding of dopamine. In the absence of added
GTP and NaCl, dopamine inhibited .sup.3H-spiperone binding with
IC.sub.50=49.+-.15 .mu.M, and Hill coefficient of 0.69, suggesting
the presence of high and low affinity sites for dopamine. Analyzing
the data according to a model assuming the presence of two classes
of binding sites indicated that 46.+-.15% of the receptors had a
high affinity (K.sub.D=0.5 .mu.M) for dopamine and the remaining
receptors had lower affinity (30 .mu.M) for the agonist. In the
presence of GTP and NaCl, the IC.sub.50 for dopamine was shifted
two-fold to 109.+-.20 .mu.M (K.sub.I=17 AM) with Hill coefficient
closer to unity (0.93). Thus, the presence of GTP/NaCl converts the
dopamine receptors from a heterogeneous population of high and low
affinity receptors to a nearly homogeneous population of receptors
in a low-affinity agonist state, as observed in striatal membrane
preparations (6, 7). These data suggest that the cloned dopamine
binding site interacts with G proteins when expressed in GH.sub.4
cells.
[0205] Dopamine Actions on cAMP and PRL Levels: To test directly
the function of the expressed dopamine-D.sub.2 receptor clone, the
actions of dopamine on cellular cAMP levels were measured. These
assays were conducted in the presence of 100 .mu.M IBMX, to inhibit
phosphodiesterase activity in these cells (22). Thus, the observed
changes in cAMP levels reflect changes in the rate of synthesis of
cAMP rather than changes in its degradation. Dopamine actions on
basal cAMP levels were measured, as well as dopamine inhibition of
VIP-enhanced levels of cAMP. GH.sub.4C.sub.1 cells respond to VIP
with an enhancement of cAMP accumulation (FIG. 14A) as described by
others (22, 26). Dopamine had no effect on extracellular cAMP
levels in wild-type GH.sub.4C.sub.1 cells, whether VIP was omitted
or present during the incubation. This result is consistent with
the lack of D.sub.2-dopamine receptor mRNA and binding in
GH.sub.4C.sub.1 cells (FIG. 13), and indicates that these cells
also lack a detectable D.sub.2-dopamine response since dopamine
does not elevate cAMP concentrations. In media from
GH.sub.4ZR.sub.7 cells, dopamine inhibited both basal cAMP levels
(by 50-70%), and reduced VIP-enhanced cAMP to basal levels. These
actions of dopamine to reduce cAMP levels were consistently
observed in all experiments and dopamine was equally effective in
lowering intracellular cAMP levels (FIG. 14B). As observed
previously in GH.sub.4C.sub.1 cells (22), both intra- and
extracellular cAMP levels change in parallel, although changes in
extracellular cAMP may be more pronounced due to lower recovery of
extracted intracellular cAMP. Dopamine actions on cAMP accumulation
were blocked by (-)-sulpiride, a highly selective dopamine-D.sub.2
antagonist, whereas the inactive stereoisomer, (+)-sulpiride, did
not block dopaminergic inhibition of cAMP accumulation.
Stereo-selective blockade by sulpiride suggested that inhibition of
cAMP levels in GH.sub.4ZR.sub.7 by dopamine was mediated by
activation of a dopamine-D.sub.2 receptor not present in wild-type
GH.sub.4C.sub.1 cells.
[0206] The physiological outcome of dopamine action is inhibition
of secretion, which was assayed by measuring acute (30 min) PRL
release in GH.sub.4ZR.sub.7 cells (FIG. 14D). VIP and TRH enhanced
PRL secretion 1.5- and 3-fold, respectively. VIP is thought to
enhance PRL release by a cAMP-dependent mechanism (22, 23, 26),
while TRH acts by a cAMP-independent mechanism linked to calcium
mobilization (19, 27). Dopamine did not inhibit basal PRL release,
but both VIP- and TRH-induced enhancement of PRL secretion were
blocked by dopamine. Thus, dopamine blocked both cAMP-dependent and
cAMP-independent secretion in GH.sub.4ZR.sub.7 cells. These actions
of dopamine were reversed by (-)-sulpiride, but not by
(+)-sulpiride. In GH.sub.4C.sub.1 cells, dopamine had no effect on
basal, VIP-stimulated, or TRH-stimulated secretion of PRL (data not
shown).
[0207] To examine whether concentrations required for biological
response correlated with affinity for the dopamine-D.sub.2
receptor, dose-response relations were examined for dopamine
actions on cAMP levels (FIG. 15). Dopamine potently inhibited
intra- and extracellular levels of cAMP with similar EC.sub.50
values. Furthermore, dopamine inhibited both basal and VIP-enhanced
cAMP accumulation with EC.sub.50 values of 8.+-.2 nM and 6.+-.1 nM,
respectively. These data demonstrate that dopamine inhibits both
basal and stimulated cAMP accumulation with approximately equal
potency. The high potency of these inhibitory actions of dopamine
supports the assertion that GH.sub.4ZR.sub.7 cells express a
functional dopamine-D.sub.2 receptor.
[0208] The pharmacological specificity of dopaminergic inhibition
of VIP-enhanced levels of cAMP in GH.sub.4ZR.sub.7 was examined
further using specific receptor antagonists (FIG. 16). The data
show that certain receptor antagonists reverse dopamine-induced
inhibition of VIP-enhanced levels of extracellular cAMP. Maximal
cAMP (100%) corresponded to cAMP levels in the presence of VIP
alone. Low concentrations of dopamine-D.sub.2 antagonists
(spiperone, (+)-butaclamol, (-)-sulpiride) blocked dopamine action,
whereas SCH23390, a specific dopamine-D.sub.1 antagonist, was
active only at very high concentrations. Inactive stereoisomers of
D.sub.2-antagonists ((-)-butaclamol, (+)-sulpiride (FIG. 14C)) had
little or no effect on dopamine action. Antagonists added in the
absence of dopamine did not alter cAMP concentrations. Estimated
K.sub.I values obtained from IC.sub.50 values for the antagonists
(see description of FIG. 16) were similar to values determined from
binding competition studies of the dopamine D.sub.2 receptor (17),
showing that inhibition of cAMP levels by dopamine in
GH.sub.4ZR.sub.7 cells is mediated by a receptor which is
pharmacologically indistinguishable from the dopamine-D.sub.2
receptor.
[0209] Inhibition of Adenylate Cyclase: To assess directly
inhibition of adenylate cyclase activity by dopamine receptor
agonists, the conversion of .sup.32P-ATP to .sup.32P-cAMP was
measured in membranes prepared from GH.sub.4ZR.sub.7 cells (FIG.
17). Dopamine inhibited total forskolin (10 .mu.M)-stimulated
activity by 45% with an average EC.sub.50 value of 0.36 .mu.M
(n-5). As observed in pituitary (11) and striatal (28) membranes,
bromocryptine behaved as partial agonist, maximally inhibiting
enzyme activity by 23% (EC.sub.50=6 nM). Inhibition of adenylate
cyclase activity by selective D.sub.2-agonists was
stereo-selective. For example, quinpirole inhibited
forskolin-stimulated cyclase activity by 41% (EC.sub.50=0.32 nM),
whereas LY181990, the inactive (+)-enantiomer of quinpirole, cause
no consistent reduction in enzyme activity. Similarly, (+)-3-PPP
(EC.sub.50=0.86 nM) was as efficacious as dopamine, whereas the
enantiomer (-)-3-PPP did not consistently educe adenylate cyclase
activity. VIP also stimulated adenylate cyclase activity in
GH.sub.4ZR.sub.7 cell membranes, as reported for wild-type
GH.sub.4C.sub.1 cell membranes (29). Total activity stimulated by
200 nM VIP was 22.+-.7 pmol/mg protein/min (n=3), and VIP-enhanced
activity was inhibited 41% by dopamine (100 .mu.M), compared to
50-55% inhibition in rat anterior pituitary membranes (11). No
effect of dopamine on basal adenylate cyclase activity was observed
in these preparations. Nevertheless, inhibition by dopamine of
forskolin- or VIP-stimulated adenylate cyclase activity provides a
likely mechanism for inhibition of cAMP accumulation by dopamine in
GH.sub.4ZR.sub.7 cells.
[0210] Pertussis Toxin Sensitivity: Sensitivity to pertussis toxin
is a hallmark of receptors, such as the dopamine-D.sub.2 receptor
(6-12, 15), which couple to inhibitor G proteins (e.g., G.sub.i or
G.sub.o) to induce responses. Pretreatment of GH.sub.4ZR.sub.7
cells with pertussis toxin for 16 h (FIG. 12) uncoupled
dopamine-mediated inhibition of forskolin-stimulated membrane
adenylate cyclase activity, and abolished inhibition of basal and
VIP-stimulated cAMP accumulation by dopamine. The concentration of
pertussis toxin and incubation time used produce maximal blockage
of somatostatin responses in wild-type cells (30), and the dopamine
responses were almost completely inhibited under these conditions.
By contrast, basal and VIP-stimulated cAMP accumulation, as well as
basal and forskolin-stimulated cyclase activity, were not
significantly altered by pertussis toxin pretreatment. These data
support the assertion that the expressed cDNA clone codes for a
dopamine-D.sub.2 binding site which is functionally coupled to
inhibitory G proteins present in GH.sub.4 cells, and thus
represents a bona fide receptor.
[0211] Discussion
[0212] The cDNA clone coding for a dopamine-D.sub.2 binding site
(17) was expressed in GH.sub.4C.sub.1 cells to determine whether
the lone expresses a functional D.sub.2 receptor, which is coupled
by pertussis toxin-sensitive inhibitory G proteins to inhibition of
adenylate cyclase, cAMP accumulation, and inhibition of PRL
secretion (6-12, 15). Dopamine-D2 receptors were expressed
specifically from a D.sub.2-cDNA construct under the regulation of
the mouse metallothionein promotor (20), as evidenced by the
presence of D.sub.2 receptor mRNA in the GH.sub.4ZR.sub.7
transfectant. Dopamine-D.sub.2 receptor mRNA levels were
undetectable in untransfected GH.sub.4C.sub.1 cells, or in cells
transfected with the rat 5-HT.sub.1A receptor subtype (FIG. 13A).
The mRNA species found in GH.sub.4ZR.sub.7 cells was approximately
the same molecular weight as D.sub.2 receptor mRNA found in rat
brain (17). Levels of dopamine-D.sub.2 mRNA increased by addition
of 100 .mu.M Zn.sup.++ in GH.sub.4ZR.sub.7 cells, indicating that
expression of the mRNA is controlled by the Zn.sup.++-sensitive
mouse metallothionein promotor, and does not represent
transcription of the endogenous gene. Specific binding of
.sup.3H-spiperone binding was present only in GH.sub.4ZR.sub.7
cells, and was increased by 100 .mu.M Zn.sup.++, and thus
correlated with the expression of dopamine-D.sub.2 receptor mRNA in
these cells. The D.sub.2-receptor mRNA was transcribed to yield
robust expression of high affinity dopamine-D.sub.2 binding sites
in GH.sub.4ZR.sub.7 cells.
[0213] The presence of dopamine-D.sub.2 binding in the
GH.sub.4ZR.sub.7 transfectant correlated with potent and powerful
inhibition of cAMP accumulation and PRL release, as well as
inhibition of forskolin-stimulated adenylate cyclase activity,
actions of dopamine not observed in untransfected GH.sub.4C.sub.1
cells. These inhibitory actions of dopamine match exactly the known
physiological actions of dopamine in pituitary lactotrophs (1, 2).
In particular, dopamine controls PRL secretion and cAMP
accumulation in lactotrophs such that stimulation of these
processes does not occur unless dopamine concentrations decrease to
low levels (1, 3-5). Similarly, in the present of maximal
concentrations of dopamine, VIP does not enhance cAMP levels or PRL
secretion in GH.sub.4ZR.sub.7 cells (FIG. 14). The potency of
dopamine inhibition of basal and VIP-enhanced cAMP accumulation in
GH.sub.4ZR.sub.7 cells (FIG. 15) was in the range of concentration
expected for lactotrophs, given that dopamine concentrations in
hypophyseal portal blood vary from 7 nM in female rates during
proestrous, to 20 nM during estrous, and are 3 nM in male rats
(31). Detailed analysis of the pharmacology of dopamine-induced
inhibition of adenylate cyclase and cAMP accumulation using
specific agonists and antagonists are fully consistent with the
conclusion that dopaminergic actions in GH.sub.4ZR.sub.7 cells are
mediated by a receptor indistinguishable from the dopamine-D.sub.2
receptor.
[0214] The discrepancy between the measured affinity of dopamine
(FIG. 13C), and the potency of dopamine to inhibit cAMP
accumulation (FIG. 13) raises the possibility that GH.sub.4ZR.sub.7
cells have "spare" receptors, i.e., a sufficient excess of binding
sites to shift the EC.sub.50 for biological action to values lower
than the K.sub.D value. An alternative explanation is that the
receptor in membrane preparations has a lower affinity for agonists
(but unchanged affinity for antagonists since measured IC.sub.50
values correlated with K.sub.1 values) than in intact cells. Since
cytosolic or membrane-associated components present in intact cells
are not entirely replaced in membrane binding and adenylate cyclase
assay conditions, it is possible that components which allow for
optimal function of the dopamine receptor in membrane preparations
are lacking. This assertion is supported by the EC.sub.50 value for
inhibition of particulate adenylate cyclase by dopamine (360 nM),
which is close to K.sub.I values obtained for dopamine from binding
competition experiments (500 nM), but 100-fold higher EC.sub.50
values (6-8 nM) obtained for inhibition of cAMP levels by dopamine
in intact cells. This difference in conditions may explain the
observed differences between assays in intact versus particulate
preparations. However, affinities of antagonists correlated well
with estimated K.sub.I values obtained from cAMP accumulation
experiments (FIG. 16), indicating that antagonist binding is
similar in membranes and whole cells.
[0215] Further evidence of coupling of the expressed
dopamine-D.sub.2 binding site to G proteins is the shift of
dopamine binding affinity to lower affinity in the presence of GTP.
Such GTP-induced shifts in affinity have been reported for dopamine
binding in membranes from rat brain (6, 7), and are due to
interaction of the receptor with G proteins (8, 9). In the presence
of GTP, the G protein dissociates from the receptor leaving the
receptor in a low affinity agonist state (6, 7). In the case of
dopamine, the difference between the affinities of the two states
is small, hence the GTP-induced shift to the low-affinity state is
small (two-fold) and requires the presence of Na.sup.+ ion to
maximize dissociation of the G protein (28). The observation of a
GTP-induced shift in dopamine affinity suggests that the expressed
dopamine receptor is associated with one or more G proteins in
GH.sub.4ZR.sub.7 cell membranes.
[0216] Although the inhibitory actions of dopamine indicate that
the receptor couples to inhibitory G proteins, this was tested more
directly by pretreating GH.sub.4ZR.sub.7 cells with pertussis toxin
to inactivate inhibitory G proteins (30). Pertussis toxin
pretreatment completely blocked dopamine actions, without altering
basal or VIP-stimulated cAMP accumulation. Thus, pertussis toxin
prevented the dopamine-enhanced transduction of biological
responses, presumably by uncoupling the dopamine-D.sub.2 receptor
from inhibitory G proteins. Unlike other systems (32), but as seen
in wild-type GH.sub.4C.sub.1 cells (30), enhancement of cAMP levels
by stimulators (e.g., VIP) was not augmented in pertussis
toxin-treated GH.sub.4ZR.sub.7 cells, nor were basal cAMP levels
altered by pertussis toxin. This suggests that inhibitory G
proteins present in GH.sub.4ZR.sub.7 cells do not inhibit cAMP
generation tonically.
[0217] The presence of somatostatin receptors on GH.sub.4C.sub.1
cells (33) allows for direct comparison of the inhibitory actions
of somatostatin and dopamine. Like dopamine, somatostatin does not
inhibit basal adenylate cyclase activity (29) or basal PRL
secretion (30). Somatostatin-induced inhibition of VIP-stimulated
cyclase activity (29), VIP-enhanced cAMP accumulation (22), and PRL
secretion (23, 30) in GH.sub.4C.sub.1 cells were all-about half the
maximal inhibition induced by dopamine in GH.sub.4ZR.sub.7 cells.
Indeed, in GH.sub.4ZR.sub.7 cells, somatostatin was half as
effective as dopamine at inhibiting VIP-enhanced cAMP accumulation
(data not shown). The larger effects of dopamine were not due to
the presence of an excessive number of D.sub.2 receptors since the
receptor number under conditions of cAMP accumulation and PRL
secretion experiments was less than 10,000 sites/cell, smaller than
somatostatin receptor number (13,000 sites/cell) in GH.sub.4C.sub.1
cells (33). It is apparent that the dopamine receptors expressed in
these cells are more effective at transducing inhibitory actions
than somatostatin receptors, suggesting a more effective coupling
of the dopamine receptor to the G proteins present in GH cells.
[0218] A second reason for expressing the dopamine-D.sub.2 receptor
cDNA in GH.sub.4C, cells was to establish a new model system in
which to study dopamine actions and D.sub.2 receptor mechanisms.
Current studies on dopamine action in rat lactotrophs, the most
accessible cell system expressing dopamine-D.sub.2 receptors until
recently (16), have come to divergent conclusions on mechanisms of
dopamine inhibition. In neurons, dopamine hyperpolarizes membrane
potential (34) by opening potassium channels (35), actions mediated
by coupling of the D2 receptor to inhibitory G proteins (15).
Membrane hyperpolarization induced by dopamine in lactotrophs (36)
would close calcium channels, decreasing basal calcium influx and
explaining observed decreases in basal [Ca.sup.++].sub.i induced by
dopamine (13-15, 37, 38). However, dopamine has been observed to
increase [Ca.sup.++].sub.i in certain pituitary cells (37). By
examining dopamine-induced changes in [Ca.sup.++].sub.i in
GH.sub.4ZR.sub.7 cells it will be possible to specifically
associate the D.sub.2 receptor with changes in [Ca.sup.++].sub.i,
and to ascertain the role of [Ca.sup.++].sub.i in mediating
dopamine inhibition of hormone secretion. Another unresolved issue
is the mechanism by which dopamine inhibits enhancement of
secretion and by calcium-mobilizing hormones such as TRH. While
some report inhibition by dopamine of TRH-induced enhancement of
phosphatidyl inositol turnover (39, 40) and [Ca.sup.++].sub.i (13,
14), others find no change (38, 41). The observed inhibition by
dopamine of TRH-induced PRL release in GH.sub.4ZR.sub.7 cells (FIG.
14C) suggests that dopamine may be coupled by G proteins to
processes (e.g., opening of potassium channels) which alter
TRH-induced calcium-mobilization or phosphatidyl inositol turnover.
GH.sub.4ZR.sub.7 cells will provide a homogeneous, abundant, and
highly-responsive preparation in which to study these and other
questions regarding mechanisms of the dopamine-D.sub.2
receptor.
[0219] The data presented in this report indicate that the
expressed clone (17) possesses the pharmacology of the dopamine-D2
receptor in all actions investigated including inhibition of PRL
secretion, cAMP generation, and adenylate cyclase activity. The
D.sub.2 clone meets five basic criteria for classification as a
functional G protein-coupled receptor: 1) the cDNA clone for the
dopamine-D.sub.2 binding site possesses the archetypical structure
of G protein-coupled receptors; 2) the clone expresses a protein
with saturable and specific binding properties; 3) agonist binding
affinity to the expressed binding site is decreased in the presence
of GTP; 4) the expressed receptor is coupled to functions (e.g.,
inhibition of adenylate cyclase) known to be regulated by G
proteins; 5) agents (e.g., pertussis toxin) which uncouple G
protein function uncouple activation of the expressed receptor from
generation of the appropriate response. In conclusion, the
interaction of the cloned dopamine-D.sub.2 receptor with G proteins
is productive, leading to activation of .alpha..sub.i or
.alpha..sub.o subunits and consequent inhibition of cAMP and PRL
levels by both cAMP-dependent and cAMP-independent mechanisms.
REFERENCES FOR EXAMPLE 2
[0220] 1. Ben-Jonathan, N. (1985), Endocr. Rev. 6, 564-589.
[0221] 2. Memo, M., Missale, C., Carruba, M. O., and Spane, P. F.
(1986), J. Neural Transm. (Suppl.) 22, 19-32.
[0222] 3. Martinez de la Escalera, G., and Weiner, R. I. (1986),
Endocrinology 123, 1682-1687.
[0223] 4. Lopez, F. J., Dominguez, J. R., Sanchez-Criado, J. E.,
and Negro-Vilar, A. (1988), Endocrinology 124, 527-535.
[0224] 5. Ibid, pp. 536-542.
[0225] 6. Sibley, D. R., DeLean, A., and Creese, I. (1982), J.
Biol. Chem. 257, 6351-6361.
[0226] 7. DeLean, A., Kilpatrick, B. F., and Caron, M. G. (1982),
Mol. Pharmacol. 22, 290-297.
[0227] 8. Senogles, S. E., Benovic, J. L., Amlaiky, N., Unson, C.,
Milligan, G., Vinitsky, R., Spiegel, A. M., Caron, M. G. (1987), J.
Biol. Chem. 262, 4860-4867.
[0228] 9. Ohara, K., Haga, K., Berstein, G., Haga, T., Ichiyama,
A., and Ohara, K. (1988), Mol. Pharmacol. 33, 290-296.
[0229] 10. DeCamilli, P., Macconi, D., and Spada, A. (1979), Nature
278, 252-254.
[0230] 11. Onali, P., Schwartz, J. P., and Costa, E. (1981),
P.N.A.S. 78, 6531-6534.
[0231] 12. Cronin, M. J., Myer, G. A., MacLeod, R. M., and Hewlett,
E. (1983), Am. J. Physiol. 244, E499-E504.
[0232] 13. Schofield, J. G. (1983), F.E.B.S. Lett. 159, 79-82.
[0233] 14. Margaroli, A., Vallar, L., Elahi, F. R., Pozzan, T.,
Spada, A., and Meldolesi, J. (1987), J. Biol. Chem. 261,
13920-13927.
[0234] 15. Vallar, L. and Meldolesi, J. (1989), TIPS 10, 74-77.
[0235] 16. Judd, A. M., Login, I. S., Kovacs, K., Ross, P. C.,
Spangelo, B. L., Jarvis, W. D., and MacLeod, R. M. (1988),
Endocrinology 123, 2341-2350.
[0236] 17. Bunzow, J. R., VanTol, H. H. M., Grandy, D. K., Albert,
P., Salon, J., Christie, M., Machida, C., Neva, K. A., and Civelli,
O. (1988), Nature 336, 783-787.
[0237] 18. Tashjian, A. H., Jr. (1979), Meth. Enzymol. 58,
526-535.
[0238] 19. Ozawa, S., and Sand, 0. (1986), Physiol. Rev. 66,
887-952.
[0239] 20. Uhler, M., and McKnight, G. S. (1987), J. Biol. Chem.
262, 15202-15207.
[0240] 21. Chirgwin, J. M., Prybyla, A. E., MacDonald, R. J., and
Rutter, W. J. (1979).
[0241] 22. Dorflinger, L. J., and Schonbrunn, A. (1983),
Endocrinology 113, 1541-1550.
[0242] 23. Dorflinger, L. J., and Schonbrunn, A. (1983),
Endocrinology 113, 1551-1558.
[0243] 24. Salomon, Y., Londos, C., and Rodbell, M. (1974), Analyt.
Biochem. 58, 541-548.
[0244] 25. Cheng, Y. -C., and Prusoff, W. H. (1973), Biochem.
Pharmacol. 22, 3099-3108.
[0245] 26. Gourdji, D., Bataille, D., Vauclin, N., Grouselle, D.,
Rosselin, G., and Tixier-Vidal, A. (1979), FEBS Lett. 104,
165-168.
[0246] 27. Albert, P. R., and Tashjian, A. H., Jr. (1984), J. Biol.
Chem. 259, 15350-15363.
[0247] 28. Onali, P., Olianas, M. C., and Gessa, G. L. (1985), Mol.
Pharmacol. 28, 138-145.
[0248] 29. Koch, B. D., and Schonbrunn, A. (1984), Endocrinology
114, 1784-1790.
[0249] 30. Koch, B. D., Dorflinger, L. D., and Schonbrunn, A.
(1985), J. Biol. Chem. 260, 13138-13145.
[0250] 31. Ben-Jonathan, N., Oliver, C., Weiner, H.J., Mical, R.
S., and Porter, J. C. (1977), Endocrinology 100, 452-458.
[0251] 32. Kurose, H., Katada, T., Amano, T., and Ui, M. (1983), J.
Biol. Chem. 258, 4870-4875.
[0252] 33., Schonbrunn, A., and Tashjian, A. H., Jr. (1978), J.
Biol. Chem. 253, 6473-6483.
[0253] 34. Bunney, B. S., Aghajanian, G. K., and Roth, R. H.
(1973), Nature (New Biol.) 245, 123-125.
[0254] 35. Lacey, M. G., Mercuri, N. B., and North, R. A. (1987),
J. Physiol. 392, 397-416.
[0255] 36. Taraskevich, P. S., and Douglas, W. W. (1978), Nature
276, 832-834.
[0256] 37. Winiger, B. P., Wuarin, F., Zahan, G. R., Wollheim, C.
B., and Schlegel, W. (1987), Endocrinology 121, 2222-2228.
[0257] 38. Law, G. J., Pachter, J. A., and Dannies, P. (1988), Mol.
Endocrinol. 2, 966-972.
[0258] 39. Journot, L., Homburger, V., Pantaloni, C., Priam, M.,
Bockaert, J., and Enjalbert, A. (1987), J. Biol. Chem. 262,
15106-15110.
[0259] 40. Vallar, L., Vicentini, L. M., and Meldolesi, J. (1988),
J. Biol. Chem. 263, 10127-10134.
[0260] 41. Canonico, P. L., Jarvis, W. D., Judd, A. M., and
MacLeod, R. M. (1986), J. Endocrinol. 110, 389-393.
FOOTNOTES
[0261] .sup.1 The abbreviations used are: PRL, prolactin; GH,
growth hormone; [Ca.sup.++].sub.i, cytosolic free calcium
concentration; VIP, vasoactive intestinal peptide; TRH,
thyrotropin-releasing hormone; IBMX, 3-isobutyl-1-methyl xanthine;
K.sub.D, equilibrium dissociation constant; EC.sub.50 (IC.sub.50),
concentration required to elicit a half-maximal effect
(inhibition).
[0262] .sup.2 These results have been presented in part at the
71.sup.st Annual Endocrine Meetings, Seattle, Wash., Abstract
#1278.
[0263] .sup.3 Albert, P. R., et al., manuscript in preparation.
Example 3
[0264] Abstract
[0265] A clone encoding a human dopamine D.sub.2 receptor was
isolated from a pituitary cDNA library and sequenced. The deduced
protein sequence is 96% identical with that of the cloned rat
receptor [Bunzow et al. (1988) Nature 336, 783-787] with one major
difference: The human receptor contains an additional 29 amino
acids in its putative third cytoplasmic loop. Southern blotting
demonstrated the presence of only one human dopamine D.sub.2
receptor gene. Two overlapping phage containing the gene were
isolated and characterized. DNA sequence analysis of these clones
showed that the coding sequence is interrupted by six introns and
that the additional amino acids present in the human pituitary
receptor are encoded by a single exon of 87-basepairs. The
involvement of this sequence in alternative splicing and its
biological significance are discussed.
[0266] Introduction
[0267] Dopamine neurons in the vertebrate central nervous system
are involved in the initiation and execution of movement, the
maintenance of emotional stability, and the regulation of pituitary
function. Several human neurological diseases, including
Parkinson's Disease (1) and schizophrenia (2), are thought to be
manifestations of imbalances between dopamine receptors and
dopamine. The receptors which mediate dopamine's effects have been
divided into D.sub.1 and D.sub.2 subtypes, which are distinguished
by their G-protein coupling (3, 4), ligand specificities,
anatomical distribution and physiological effects (5). The dopamine
D.sub.2 receptors have been of particular clinical interest due to
their regulation of prolactin secretion (6) and their affinity for
antipsychotic drugs (7, 8).
[0268] The dopamine D.sub.2 receptors belong to the family of
G-protein coupled receptors. The sequence similarity shared by
members of this family enabled us to clone a rat brain dopamine
D.sub.2 receptor cDNA (9). We have used that clone to isolate the
human pituitary dopamine D.sub.2 receptor cDNA described here. We
have found that the deduced amino acid sequences of these two
receptors are very similar, with one notable difference. The human
receptor contains an additional 29 amino acids in its putative
third cytoplasmic loop which are encoded by one of the gene's
exons. This genomic organization suggests that the existence of two
dopamine D.sub.2 receptor mRNAs is the result of an alternative
splicing event.
[0269] Materials and Methods
[0270] Cloning of the Human Pituitary cDNA
[0271] Human pituitary tissue was a generous gift from Drs. N.
Seidah and M. Chretien, Clinical Research Institute of Montreal,
Canada. Poly(A).sup.+ mRNA and cDNA were prepared as previously
described (9). The cDNA was size-selected (1-6 kb) on agarose gels,
isolated using Geneclean (Bio 101), ligated to EcoRI adaptors,
cloned into .lambda.GT10 arms (Stratagene), and packaged (Gigapak
Gold). Recombinants (1.5.times.10.sup.6) were screened on replica
nylon filters (DuPont Plaque/Colony Hybridization filters) with
[.sup.32P]-labelled hybridization probes. Prehybridization and
hybridization were performed in 50% formamide, 1% SDS, 2.times.SSC
(1.times.SSC=0.15 M NaCl/0.015 M sodium citrate, pH 7) at
37.degree. C. The complete sequence of both strands of DNA were
determined in M13 mp19 using Sequenase (U.S. Biochemical) primed
with synthetic oligonucleotides.
[0272] Expression and Pharmacology
[0273] The 2.5-kb human pituitary cDNA (hPitD.sub.2) was cloned
into pZem3 (a gift from Dr. E. Mulvihill, Zymogenetics) and
co-transfected with the pRSVneo gene into mouse Ltk.sup.- cells by
CaPO.sub.4 precipitation (10). A stable transfectant
(L-hPitD.sub.2Zem) was selected and maintained in 750 .mu.g/ml of
G418 (Geneticin sulphate, Gibco). Twenty hours prior to the
harvesting of membranes, these cells were incubated with 70 .mu.M
zinc sulphate. Membranes were prepared from L-HPitD.sub.2Zem, from
the Ltk.sup.- cell line expressing the cloned rat dopamine D.sub.2
receptor (L-RGB2Zem-1) and from freshly dissected rat striata
(Taconic Farm, Germantown, N.Y.), as previously described (11, 12).
For the binding assays, membrane protein was used at 10-15 .mu.g
from L-hPitD.sub.2Zem, 50-75 .mu.g from L-RGB2Zem-l, and 220-250
.mu.g from rat striatum. The binding assays were incubated at
37.degree. C. for 60 minutes in 50 mM Tris-HCl, 120 mM NaCl, 5 mM
KCl, 2 mM CaCl.sub.2, 1 mM MgCl.sub.2, pH 7.4, and then stopped by
rapid filtration over glass fiber filters (Schleicher and Schuell,
No. 32) which had been presoaked in 0.5% polyethyleneimine. The
filters were washed twice in ice cold 50 mM Tris-HCl, pH 7.4.
Saturation curves were generated using increasing concentrations of
the highly D.sub.2-specific antagonist [.sup.3H]-domperidone (13).
Antagonist drugs were evaluated for their ability to inhibit
specifically bound [.sup.3H]-domperidone (1 nM). The B.sub.max,
K.sub.d, and IC.sub.50 values were determined as previously
described (14).
[0274] Southern Blotting
[0275] Human genomic DNA prepared from a normal male donor was a
gift from M. Litt. Three micrograms of DNA were digested with
restriction enzymes and the fragments were electrophoresed in 0.7%
agarose and blotted onto nitrocellulose filters (Schleicher and
Schuell). Prehybridization and hybridization were performed at
37.degree. C. in 50% formamide as previously described (15).
[0276] Genomic Sequencing
[0277] Genomic bacteriophage lambda libraries, prepared from normal
human male DNA, were purchased from Stratagene and Clontech
Laboratories, Inc. and screened with portions of the cloned rat
dopamine D.sub.2 receptor cDNA. DNA sequence was determined by a
genomic sequencing approach (16, 17). Briefly, for each restriction
enzyme used, cloned genomic phage DNA (50 .mu.g) was digested,
subjected to chemical cleavage, and the resulting fragments
resolved in a denaturing polyacrylamide gel. The DNA was then
transferred from the gel and immobilized onto nylon filters (Plasco
Genetran). Using [.sup.32P] end-labelled synthetic oligomers,
ladders of sequence were visualized within exons and read into
neighboring introns. The filters were then either reprobed with a
different oligomer, or a new filter was made in order to read the
complementary sequence back across the exon. Both strands of the
coding region were sequenced.
[0278] Results
[0279] Cloning and Sequence Analysis of the Human Pituitary
cDNA
[0280] Using the rat brain D.sub.2 receptor cDNA as probe, three
partial cDNAs were isolated from a human pituitary library and
sequenced. Two oligonucleotide probes based on these sequences were
used to isolate a fourth cDNA, hPitD.sub.2, which encoded a
full-length receptor protein (FIG. 18). The human pituitary
receptor contains seven putative transmembrane domains and lacks a
signal sequence. Overall, the human and rat nucleotide sequences
are 90% similar and show 96% identity at the amino acid level.
Several consensus sequences for N-linked glycosylation, protein
kinase A phosphorylation and palmitoylation (18) are conserved
between the human and rat receptors. There are also 18 amino acid
differences (including one deletion) between these proteins, and,
strikingly, the human pituitary receptor contains an additional 29
amino acids in its putative third cytoplasmic loop.
[0281] Expression and Pharmacological Evaluation of hPit D.sub.2
cDNA
[0282] In order to evaluate the pharmacological characteristics of
the human pituitary receptor, its cDNA was subcloned into pZem3 and
expressed in mouse Ltk.sup.- cells (L-hPitD.sub.2Zem). Membranes
prepared from these cells showed specific binding of
[.sup.3H]-domperidone, a D.sub.2-selective antagonist (12, 13),
with a B.sub.max of 4.05+/-0.3 pmol per mg (n=2) protein and a
K.sub.d of 0.74+/-0.11 nM (n=2). This K.sub.d value is in excellent
agreement with the published value of 0.74 nM in mouse brain
membranes (13). A Scatchard plot of the data was linear. There was
no detectable [.sup.3H]-domperidone binding in membranes prepared
from cells transfected with pZem3 alone (data not shown).
[.sup.3H]-domperidone binding to L-hPitD.sub.2Zem membranes was
inhibited by a number of dopamine D.sub.2-specific drugs (FIG. 19).
Their rank order of potency was: spiperone, (+)-butaclamol,
haloperidol, and sulpiride. The serotonin-selective antagonist
mianserin and the D.sub.1-selective antagonist SCH-23390 inhibited
domperidone binding only at very high concentrations, as did the
inactive isomer (-)-butaclamol. These values are essentially
identical to those obtained with membranes from Ltk.sup.- cells
transfected with the cloned rat dopamine D.sub.2 receptor cDNA
(L-RGB2Zem-1) and from rat striatum (FIG. 22).
[0283] Human Dopamine D.sub.2 Receptor Gene
[0284] Using portions of the rat cDNA as probe, a clone was
isolated from a human genomic library. This genomic clone,
.lambda.HD2G1, contained a 1.6-kb BamHI fragment which encoded the
last 64 amino acids of the human D.sub.2 receptor and 1.2-kb of 3'
non-coding sequence. The 1.6-kb fragment was used to probe a
Southern blot of human genomic DNA digested with three restriction
enzymes. Each enzyme generated a single fragment that hybridized to
the probe (FIG. 20), indicating that there is probably only one
human dopamine D.sub.2 receptor gene.
[0285] In order to isolate a genomic clone that encoded the
N-terminus of the human receptor protein, a 118-bp restriction
fragment from the cloned rat dopamine D.sub.2 receptor cDNA
(corresponding to amino acid residues 1-39) was used to screen a
second genomic library. .lambda.HD2G2 was isolated and found to
overlap with .lambda.HD2G1 by 400 nucleotides (FIG. 21a). Together,
these phage span 34-kb of the human dopamine D.sub.2 receptor gene
locus, DRD2 (19), and contain the sequence found in the hPitD.sub.2
cDNA plus sequences that extend 15-kb downstream of the
polyadenylation signal and 3.7-kb upstream of the translation
initiation site. To characterize the intron/exon structure of the
gene, a genomic sequencing approach employing oligonucleotide
probes and chemical cleavage was used (FIG. 21b). Since the
divergence of nucleotide sequences between human and rat members of
this receptor family is approximately 10% (unpublished
observations), we were able to initiate the genomic sequencing
relying on hybridization probes and restriction sites that are
present in the cloned rat dopamine D.sub.2 receptor cDNA. our
results demonstrate that the coding portion of the human dopamine
D2 receptor gene is divided into seven exons (FIG. 21b).
Interestingly, we found that exon five is 87-bp long and encodes
the entire 29 amino acid sequence present in the cloned human
pituitary receptor (FIGS. 18 and 21c). Analysis of the six introns
revealed that each contains acceptor and donor sequences that
conform to the GT/AG rule (20), as summarized in FIG. 23. The
approximate sizes of the introns were based on the results of
Southern blotting experiments (data not shown). When compared, the
genomic and cDNA sequences were found to differ by only two silent
transitions, one at 939 (T to C in the gene) and the other at 957
(C to T in the gene).
[0286] Discussion
[0287] Several alternative hypotheses might account for the extra
sequence present in our human pituitary D.sub.2 receptor cDNA
clone. One possibility is that the human gene contains the extra 87
bases and that the rat gene does not. Another is that both human
and rat have two distinct genes which code for two different
dopamine D.sub.2 receptors. Finally, alternative splicing of a
single transcript could result in one mRNA and the other without
the 87 bases. In support of the latter hypothesis, we have shown
that there is probably only one human dopamine D.sub.2 receptor
gene, DRD2, and that the 87-bp sequence is contained on a distinct
exon of that gene. Furthermore, we have cloned a rat brain cDNA
that contains the 87-bp sequence (unpublished results). This
sequence is highly similar to that of the human cDNA and
established that dopamine D.sub.2 receptors containing the 29
residues are not unique to the human pituitary.
[0288] The human dopamine D.sub.2 receptor expressed in
L-hpitD.sub.2Zem cells has essentially the same drug binding
profile as do rat striatum and L-RGB2Zem-1 membranes. Therefore,
since the 29 amino acids do not affect binding, they may be
involved in other levels of receptor function. For example, the
third cytoplasmic loop of the .beta..sub.2-adrenergic receptor has
been shown to be required for appropriate G-protein coupling (21).
Therefore, one possibility is that this sequence may influence
whether dopamine D.sub.2 receptor stimulation inhibits adenylyl
cyclase, activates potassium channel conductance or inhibits
calcium mobilization (22). Another possibility is that the 29 amino
acids differentiate post-synaptic dopamine D.sub.2 receptors from
presynaptic autoreceptors (23). Since a computer search
(VAX/Intelligenetics) failed to identify another sequence of
significant homology, we consider this sequence to be unique to the
D.sub.2 receptor.
[0289] Based on the comparison of genomic and cDNA sequences, the
human dopamine D.sub.2 receptor gene is divided into at least seven
exons. It is possible that one or more additional exons remain to
be identified at the 5' end of the gene, as was shown to be the
case with muscarinic receptor genes (24).
[0290] The interruption of coding sequence by introns distinguishes
the human dopamine D.sub.2 receptor gene from most other members of
the G-protein coupled receptor gene family with the exception of
the opsin genes (25). One significant observation is that the
placement of two introns (Nos. 3 and 5) in this human gene
corresponds almost precisely to intron positions conserved in
bovine and Drosophila opsin genes (26, 27). The simplest
interpretation of this finding is that their common ancestor, a
gene rougly one billion years old (28), contained these introns.
Our characterization of the gene structure also provides evidence
that the exons encode recognizable elements of protein structure
(29). That introns are found following transmembrane segments II,
III, and IV (See FIGS. 18 and 21) argues that the repeated
structural motifs characteristic of these receptors may have
evolved by internal duplication. Furthermore, the presence of
several introns within the third cytoplasmic loop provides an
explanation of the substantial variation in length observed across
the family (30).
[0291] The possibility of alternatively spliced dopamine D.sub.2
receptor mRNAs giving rise to structurally distinct forms is
exciting. The expression of one form of the dopamine D.sub.2
receptor mRNA or another represents a level of control which may
have implications with respect to human disease.
Acknowledgments
[0292] We would like to thank Howard Goodman for discussion and
review of the manuscript, Dee Yarozeski for manuscript preparation,
and Vicky Robertson, Nancy Kurkinen, and June Shiigi for the
illustrations. D.K.G. holds a fellowship from NIH. This work was
supported by NIH Grant Nos. Dk37231 and MH45614 and a grant from
Cambridge NeuroScience Research, Inc., Cambridge, Mass., to
O.C.
REFERENCES
[0293] 1. Lee, T., Seeman, P., Rajput, A., Farley, I. J. and
Hornykiewicz, 0. (1978) Nature 273, 59-61.
[0294] 2. Seeman, P., Ulpian, G., Bergeron, C., Riederer, P.,
Jellinger, K., Gabriel, E., Reynolds, G. P. and Tourtellotte, W. W.
(1984) Science 225, 728-730.
[0295] 3. Kebabian, J. W. (1978) Adv. Biochem. Psychopharmacol. 19,
131-154.
[0296] 4. DeCamilli, P., Maconi, D. and Spada, A. (1979) Nature
(London) 278, 252-255.
[0297] 5. Clark, D. and White, F. J. (1987) Synapse 1, 347-388.
[0298] 6. Weiner, R. I. and Ganong, W. (1978) Physiol. Rev. 58,
905-976.
[0299] 7. Seeman, P. and Lee, T. (1975) Science 188, 1217-1219.
[0300] 8. Creese, I., Burt, D. R., and Snyder, S. H. (1976) Science
192, 481-483.
[0301] 9. Bunzow, J. R., Van Tol, H. H. M., Grandy, D. K., Albert,
P. R., Salon, J., Christie, M., Machida, C. A., Neve, K., and
Civelli, O. (1988) Nature 336, 783-787.
[0302] 10. Gorman, C., Padmanabhan, R. and Howard, B. H. (1983)
Science 221, 551-553.
[0303] 11. Albert, P. R., Neve, K., Bunzow, J. R. and Civelli, O.
(1989) submitted.
[0304] 12. Grigoriadis, D. and Seeman, P. (1986)
Naunyn-Schmiederberg Arch. Pharmacol. 321, 21-25.
[0305] 13. Baudry, M., Martres, M. P. and Schwartz, J. C. (1979)
Naunyn-Schiederberg Arch. Pharmacol. 308, 231-237.
[0306] 14. Fischer, J. B. and Schonbrunn, A. (1988) J. Biol. Chem.
263 2808-2816
[0307] 15. Grandy, D. K. and Dodgson, J. B. (1987) Nuc. Acids Res.
15, 1063-1080.
[0308] 16. Church, G. M. and Gilbert, W. (1984) Proc. Natl. Acad.
Sci. USA 81, 1991-1995.
[0309] 17. Marchionni, M. and Gilbert, M. (1986) Cell 46,
133-141.
[0310] 18. O'Dowd, B. F., Hnatowich, M., M. C. G., Lefkowitz, R. J.
and Bouvier, M. (1989) J. Biol. Chem. 264, 7564-7569.
[0311] 19. Grandy, D. K., Litt, M., Allen, L., Bunzow, J. R.,
Marchionni, M. A., Makam, H., Frothingham, L., Magenis, R. E. and
Civelli, O. (1989) Am. J. Hum. Genet. accepted.
[0312] 20. Mount, S. M. (1982) Nuc. Acids Res. 10, 461-472.
[0313] 21. Strader, C. D., Dixon, R. A. F., Cheung, A. H.,
Candelore, M. R., Blake, A. D. and Sigal, I. S. (1987) J. Biol.
Chem. 262, 16439-16443.
[0314] 22. Vallar, L. and Meldolesi, J. (1989) TiPS 10, 74-77.
[0315] 23. Tepper, J. M., Gariano, R. F. and Groves, P.M. (1987) in
Neurophysiology of Dopaminergic Systems: Current Status and
Clinical Perspectives, eds. Chiodo, L. A. and Freeman, A. S.
(Lakeshore Publishing Co., Michigan), pp. 93-127.
[0316] 24. Peralta, E. G., Winslow, J. W., Peterson, F. L., Smith,
D. H., Ashkenazi, Avi, Ramachandran, J., Schimerlik, M. I. and
Capon, D. J. (1987) Science 236, 600-605.
[0317] 25. O'Dowd, B. F., Lefkowitz, R. J. and Caron, M. G. (1989)
Ann. Rev. Neurosci. 12, 67-83.
[0318] 26. Nathans, J. and Hogness, D. S. (1983) Cell 32,
807-814.
[0319] 27. O'Tousa, J. E., Baehr, W., Martin, R. L., Hirsch, J.,
Pak, W. L. and Applebury, M. L. (1985) Cell 40, 839-850.
[0320] 28. Doolittle, R. F. (1987) Of URFS and ORFS (University
Science Books, Mill Valley), p. 40.
[0321] 29. Gilbert, W. (1978) Nature 271, 501.
[0322] 30. Dohlman, H. G., Caron, M. G. and Lefkowitz, R. J. (1987)
Biochem. 26, 2657-2664.
* * * * *