U.S. patent application number 09/851664 was filed with the patent office on 2003-02-27 for hiv-3 retrovirus and its use.
This patent application is currently assigned to Innogenetics N.V.. Invention is credited to De Leys, Robert, Saman, Eric, Van Heuverswyn, Hugo, Vanderborght, Bart.
Application Number | 20030039954 09/851664 |
Document ID | / |
Family ID | 8199044 |
Filed Date | 2003-02-27 |
United States Patent
Application |
20030039954 |
Kind Code |
A1 |
De Leys, Robert ; et
al. |
February 27, 2003 |
HIV-3 retrovirus and its use
Abstract
Described is a new variety of retrovirus designated HIV-3, also
known as HIV-1 subtype O, samples of which are deposited in the
European Collection of Animal Cell Cultures (ECACC) under
V88060301. Further described is a process to detect the HIV-3
retrovirus in biological liquids or tissue. One such process
involves contacting a biological sample suspected of containing
HIV-3 nucleic acids with a DNA probe corresponding to a segment of
genomic HIV-3 retrovirus RNA, such as the LTR region, and detecting
the hybridization products thereof.
Inventors: |
De Leys, Robert;
(Grimbergen, BE) ; Vanderborght, Bart; (Geel,
BE) ; Saman, Eric; (St. Niklaas, BE) ; Van
Heuverswyn, Hugo; (Laarne, BE) |
Correspondence
Address: |
Patricia A. Kammerer
HOWREY SIMON ARNOLD & WHITE, LLP
750 Bering Drive
Houston
TX
77057
US
|
Assignee: |
Innogenetics N.V.
|
Family ID: |
8199044 |
Appl. No.: |
09/851664 |
Filed: |
May 9, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09851664 |
May 9, 2001 |
|
|
|
09379270 |
Aug 23, 1999 |
|
|
|
6265200 |
|
|
|
|
09379270 |
Aug 23, 1999 |
|
|
|
08900902 |
Jul 25, 1997 |
|
|
|
6013484 |
|
|
|
|
08900902 |
Jul 25, 1997 |
|
|
|
08486836 |
Jun 7, 1995 |
|
|
|
5795743 |
|
|
|
|
08486836 |
Jun 7, 1995 |
|
|
|
08228519 |
Apr 15, 1994 |
|
|
|
5567603 |
|
|
|
|
08228519 |
Apr 15, 1994 |
|
|
|
07460913 |
Mar 23, 1990 |
|
|
|
5304466 |
|
|
|
|
Current U.S.
Class: |
435/5 ;
424/187.1; 435/235.1 |
Current CPC
Class: |
C12N 2740/16021
20130101; G01N 2333/16 20130101; C07K 16/1054 20130101; A61K
2039/505 20130101; C07K 14/005 20130101; G01N 33/56988 20130101;
C12N 2740/16122 20130101; Y10S 435/974 20130101; Y10S 530/809
20130101; Y10S 435/975 20130101; A61K 39/00 20130101; C07K 16/1045
20130101; C12N 2740/16222 20130101; C12N 7/00 20130101 |
Class at
Publication: |
435/5 ;
435/235.1; 424/187.1 |
International
Class: |
C12Q 001/70; A61K
039/21; C12N 007/01 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 9, 1988 |
EP |
88 109 200.1 |
Jun 8, 1989 |
US |
PCT/EP8900643 |
Claims
1. HIV-3 retrovirus or variants of this virus having the essential
morphological and immunological properties of any of the
retroviruses deposited at the European Collection of Animal Cell
Cultures (ECACC) under NO V88060301.
2. The purified retrovirus of claim 1, characterized in that said
essential morphological and immunological properties are as
follows: The virus exhibits a tropism for T4 lymphocytes. The virus
is cytotoxic for the lymphocytes that it infects. The virus has a
diameter of approximately 120 nm. The virus possesses a magnesium
dependent reverse transcriptase activity. It can be cultivated in
T4 receptor-bearing immortalized cell lines. Lysates of the virus
contain a p25 protein which is immunologically distinct from the
p19 protein of HTLV-I by Western blot analysis. Lysates of the
virus contain a gp120 protein which is immunologically distinct
from the gp110 protein of HTLV-I by Western blot analysis. The
lysate of the virus contains in addition a glycoprotein with a
molecular weight of 40,000-45,000. The genomic RNA of HIV-3
hybridizes neither with the sequences of HIV-1 nor with the
sequences of HIV-2 under stringent hybridization conditions.
3. The retrovirus of claim 1 or 2, characterized in that the
nucleotide sequence of its genomic RNA which comprises an R region
and an U3 region also comprises a nucleotide sequence corresponding
with the following nucleotide sequence:
4 10 20 30 40 50 60 CCCATGGATT TGAAGATACA CATAAAGAAA TACTGATGTG
GAAGTTTGAT AGATCTCTAG 70 80 90 100 110 120 GCAACACCC ATGTTGCTATG
ATAACTCACC CAGAGCTCTT CCAGAAGGAC TAAAAACTGC 130 140 150 160 170 180
TGACCTGAAG ATTGCTGACA CTGTGGAACT TTCCAGCAAA GACTGCTGAC ACTGCGGGGA
190 200 210 220 230 240 CTTTCCAGTG GGAGGGACAG GGGGCGGTTC GGGGAGTGGC
TAACCCTCAG AAGCTGCATA 250 260 270 280 290 300 TAAGCAGCCG CTTTCTGCTT
GTACCGGGTC TCGGTTAGAG GACCAGGTCT GAGCCCGGGA 310 320 330 340 350 360
GCTCCCTGGC CTCTAGCTGA ACCCGCTCGT TAACGCTCAA TAAAGCTTGC CTTGAGTGAG
A.
4. The retrovirus of any of claims 1 to 3 characterized in that its
RNA Virtually hybridizes neither with the Env gene and the LTR
close to it, in particular not with the nucleotide sequence
8352-9538 of HIV-1, nor with the sequences of the Pol region of the
HIV-1 genome under stringent conditions.
5. A composition comprising at least one antigen, in particular a
protein or glycoprotein of HIV-3 retrovirus of any of claims 1 to
4.
6. The composition of claim 5 characterized by containing a total
extract or lysate of said retrovirus.
7. The composition of claim 5, characterized by containing at least
one of the internal core proteins of said retrovirus, in particular
p12, p16 or p26 having apparent molecular weights in the order of
12,000, 16,000 and 26,000 respectively.
8. The composition of claim 5, characterized by containing at least
one of the envelope proteins of said retrovirus, in particular gp41
or gp120 having apparent molecular weights in the order of
40,000-45,000 and 120,000 respectively.
9. An antigen providing a single band in polyacrylamide gel
electrophoresis, said antigen comprising, in common with one of the
purified antigens of HIV-3 retrovirus, an epitope that is
recognized by serum of a patient carrying anti-HIV-3
antibodies.
10. A purified antigen having the immunological characteristics of
one of the following proteins or glycoproteins of HIV-3: p12, p16,
p26, gp41 and gp120.
11. The antigen of claim 10 having the aminoacid sequence, or a
part of said sequence, of the p12 protein obtained by subjecting
the protein mixture produced by HIV-3 to gel electrophoresis and
isolating the p12 protein in a manner known per se.
12. The antigen of claim 10 having the aminoacid sequence, or a
part of said sequence, of the p16 protein obtained by subjecting
the protein mixture produced by HIV-3 to gel electrophoresis and
isolating the p16 protein in a manner known per se.
13. The antigen of claim LO having the aminoacid sequence, or a
part of said sequence, of the p26 protein obtained by subjecting
the protein mixture produced by HIV-3 to gel electrophoresis and
isolating the p26 protein in a manner known per se.
14. The antigen of claim 10 having the aminoacid sequence, or a
part of said sequence, of thegp41 protein obtained by subjecting
the protein mixture produced by HIV-3 to gel electrophoresis and
isolating the gp4l protein in a manner known per se.
15. The antigen of claim 10 having the aminoacid sequence, or a
part of said sequence, of thegp120 protein obtained by subjecting
the protein mixture produced by HIV-3 to gel electrophoresis and
isolating the gp120 protein in a manner known per se.
16. A method for the detection of antibodies against HIV-3
retrovirus in a biological liquid, such as a serum or spinal fluid,
in particular for the diagnosis of a potential or existing ARC or
AIDS caused by said H-V-3 retrovirus, characterized by contacting
body fluid of a person to be diagnosed with a composition of any of
claims 5 to 8 or with an antigen of any claims 9 to 15 and
detecting the immunological conjugate formed between said
anti-HIV-3 antibodies and the antigen(s) used.
17. The method of claim16, characterized in that said detection of
said immunological conjugate is achieved by reacting said
immunological conjugate with a labeled reagent selected from
antihuman immunoglobulin-antibodies or bacterial A protein or G
protein and detecting the complex formed between said conjugate and
said reagent.
18. A kit for the detection of anti-HIV-3-antibodies in a
biological fluid, comprising a composition as defined in any of
claims 5 to 8 or an antigen as defined in any of claim 9 to 15, and
means for detecting the immunological complex formed.
19. The kit of claim 18,characterized in that said means for
detecting said immunological complex comprise antihuman
immunoglobulin(s) or protein A and means for detecting the complex
formed between the anti-HIV-3 antibodies contained in the detected
immunological conjugate.
20. An immunogenic composition containing an envelope glycoprotein
of HIV-3 retrovirus, in particular gp41 or pg120, or a part of said
glycoprotein, in combination with a pharmaceutically acceptable
vehicle suitable for the constitution of vaccines effective against
HIV-3.
21. The composition of claim 20, characterized by containing at
least part of a glycoprotein comprising the protein backbone of the
envelope protein or a part thereof, as defined in any of claims 14
to 15.
22. Monoclonal antibodies characterized by their ability to
specifically recognize one of the antigens as defined in any of
claims 11 to 15 in particular monoclonal antibodies specifically
raised against said antigens.
23. The secreting hybridomas of the monoclonal antibodies of claim
22.
24. Nucleic acids, optionally labeled, derived in part at least of
RNA of HIV-3 retrovirus or of variants thereof.
25. The nucleic acid of claim 24, characterized by containing at
least part of the cDNA corresponding with the entire genomic RNA of
HIV-3 retrovirus.
26. The nucleic acid of claim 24 containing the nucleotide sequence
as identified in claim 3.
27. The nucleic acids of claim 24 characterized by containing
nucleotide sequences coding for at least parts of the aminoacid
sequences of proteins as defined in any of claims 11 to 13.
28. The nucleic acids of claim 24, characterized by containing
nucleotide sequences coding for at least part of the aminoacid
sequences of glycoproteins as defined in any of claims 14 to
15.
29. The nucleic acids of any of claims 24 to 28. characterized by
being formed into a recombinant nucleic acid comprising a nucleic
acid from a vector having said cDNA, or a part of said cDNA,
inserted therein.
30. The recombinant nucleic acid of claim 29 characterized by being
labeled.
31. A process for the detection of HIV-3 retrovirus or of its RNA
in a biological liquid or tissue, characterized by contacting
nucleic acids contained in said biological liquid or tissue with a
probe containing a nucleic acid according to any of claims 25 to 30
under stringent hybridization conditions, washing the hybrid formed
with a solution preserving said stringent conditions, and detecting
the hybrid formed.
32. A process for the production of HIV-3 retrovirus characterized
by culturing human T4 lymphocytes, or permanent cell lines derived
therefrom carrying the T4 phenotype, with lymphocytes or cell lines
that have previously been infected with an isolate of HIV-3
retrovirus, as well as recovering and purifying the retrovirus from
the culture medium.
33. A process for the production of antigens of HIV-3 retrovirus,
characterized by lysing the retrovirus and recovering the lysate
containing said antigens.
34. A process for the production of any of the proteins or
glycoproteins p12, p16, p26, gp41 and gp120 as defined
hereinbefore, or of a part thereof, characterized by inserting the
corresponding nucleic acid sequence in an expression vector,
transforming a host with said vector, culturing the transformed
host as well as recovering and purifying the expressed protein.
35. A process for the production of a hybridization probe for the
detection of the RNA of HIV-3 retrovirus, characterized by
inserting a DNA sequence, particularly of any of claims 24 to 29 in
a cloning vector by in vitro recombination, cloning the modified
vector obtained in a suitable cellular host, and recovering the
hybridization probe.
36. A method for detecting antigen of HIV-3, characterized by
coating a surface with an imunoglobulin fraction raised against
HIV-3, bringing a body or culture fluid to be analyzed into contact
with the immunoglobulins, and detecting the complex formed between
the immunoglobulins and the antigen.
Description
[0001] Substantial progress has been made in our understanding of
the acquired immunodeficiency syndrome or AIDS. The prinicipal
causative agent has been demonstrated to be a non-transforming
retrovirus with a tropism for T4 helper/inducer lymphocytes (1, 2)
and it has been estimated that millions of people world-wide have
already been infected. Infection with this virus leads, at least in
a significant percentage of cases, to a progressive depletion of
the T4 lymphocyte population with a concomittant increasing
susceptibility to the opportunistic infections which are
characteristic of the disease.
[0002] Epidemiological studies indicate that human immunodeficiency
virus type 1 (HIV-1), the etiological agent responsible for the
majority of AIDS cases and which is currently the most widely
disseminated HIV, probably had its origins in Central Africa (3).
The discovery of this virus did not necessarily imply the existence
of other types of human immunodeficiency viruses. Nevertheless, a
second group of human immunodeficiency-associated retroviruses,
human immunodeficiency virus type 2 (HIV-2),was identified in West
Africa (4, 5). An HIV-2 virus is disclosed in EP-A-0 239 425. An
HIV-1 virus is disclosed in WO 86/02383. Other similar, but not
identical, retroviruses have also been isolated from simian sources
(simian immunodeficiency virus, SIV) such as African green monkeys
(6, 7) and macaques (8, 9). The simian isolates have been shown to
be genetically more closely related to HIV-2 than HIV-1 but are
nevertheless distinct (10).
[0003] One characteristic of human immunodeficiency viruses which
complicates their comparison is their genetic variability; genetic
variants arise spontaneously and with high frequency. A comparison
of various HIV-1 isolates revealed that some regions of the genome
are highly variable while others are reasonably well conserved
(11-16). Similar polymorphisms have also been observed for HIV-2
(17). The regions with the greatest genetic stability are
presumably those regions coding for the regions of viral proteins
which are structurally or enzymatically essential. The viral genes
with the greatest overall genetic stability are the gag and pol
genes, while some regions of the env gene and the genes coding for
regulatory proteins such as art, tat, sor and 3'orf exhibit a high
degree of variability. Some of the major structural features of the
gag and pol gene products are apparently shared not only by all of
the variants of a particular HIV type, but have, at least to some
extent, been conserved between virus types. Antiserum produced
against HIV-1 crossreacts with the gag and pol gene products of
HIV-2, albeit with a lower affinity than for the corresponding
HIV-1 gene products. However, in spite of the demonstrable
immunological crossreaction, at the nucleic acid level there is
little sequence homology and no significant hybridization between
these two viruses can be detected except under very low stringency
conditions (17).
[0004] A higher degree of relatedness can be demonstrated between
SIVagm (STLV-III agm, nearly or completely identical to Human
Lymphotropic Virus type 4 (15)) and HIV-2. Immunological
crossreaction is not limited only to the gag and pol gene products
but extends to the env gene products as well. Nevertheless, genomic
analysis of SIVagm and HIV-2 showed them to be genetically
distinguishable (19). DNA probes specific for HIV-2, although able
to hybridize to SIVagm sequences, hybridize preferentially to HIV-2
(18).
[0005] We now report the isolation and characterization of a novel
human immunodeficiency virus from a Camerounian woman and her
partner. Geographically, this virus comes from a region in Africa
located between West Africa where HIV-2 is endemic, and
East-Central Africa where HIV-1 is endemic. This isolate is shown
immunologically to be antigenically more closely related to HIV-1
than is HIV-2, yet an analysis of partial cleavage products
obtained by chemical cleavage of the gag and pol gene products
demonstrate that this isolate is neither HIV-1 nor HIV-2. This
novel isolate could represent an evolutionary link between HIV-1
and HIV-2. This novel virus will be referred to as HIV-3
hereinafter.
[0006] Accordingly, the invention relates to an HIV-3 retrovirus or
variants of this virus having the essential morphological and
immunological properties of the retrovirus deposited in the
European Collection of Animal Cell Cultures (ECACC) under V
88060301.
[0007] A virus isolation was performed from blood from an
asymptomatic Camerounian woman who is the partner of an
HIV-seropositive man with generalized lymphadenopathy. Serum from
the woman was moderately positive (ratio O.D./cut-off of 4.5) in
the enzyme-linked immunosorbent assay (EIA, Organon Teknika) and
had a low titer (1/40) in the immunofluorescent antibody assay for
HIV-1 but gave ambiguous results in the HIV-1 Western blot assay
with clear bands at p33, P53/55 and p64 but very weak bands at p24,
gp41 and gp120. The virus was isolated by co-cultivation of the
woman's lymphocytes with PHA-stimulated lymphocytes from healthy
uninfected donors in a medium consisting of RPMI 1640 buffered with
20 mM HEPES (hydroxyethylpiperazine ethanesulfonate) and
supplemented with 15% fetal calf serum, 5 g/ml hydrocortisone, 75
u/ml interleukin-2 (IL-2) and 2 g/ml polybrene.
[0008] After 52 days in culture, virus was detected in the culture
as judged by the presence of syncytia and on the basis of positive
immunofluorescence observed when a laboratory reference anti-HIV
antiserum was incubated with acetone-fixed cells from the culture.
The presence of reverse transcriptase was also detected in the
culture supernatant (10 4 cpm/ml, 27 X background). Cell-free
culture supernatant was used to passage the virus on fresh
lymphocytes. After 15 days, CPE was again observed and reverse
transcriptase detected in the supernatant. The virus was further
propagated in PHA-stimulated lymphocytes from healthy blood donors
and was transferred to continuous cell lines of leukemic origin.
Virus-containing supernatant was tested in parallel with culture
supernatants known to contain HIV-1 in the differential antigen
capturing test which is described in detail below. The results of
this comparison indicated that the new isolate was not HIV-1.
[0009] The new virus was then characterized with respect to its
protein antigens and nucleic acids. The cell lines used for
propagating the virus can be, depending on the case, lines of the
CEM, HUT, Molt-4, or MT4 type, or any other immortalized cell line
which bears the T4 receptor on its cell surface.
[0010] A preferred cell line for the continuous propagation of
HIV-3 is Molt-4. Molt-4 cells infected with HIV-3 were deposited
with the ECACC on Jun. 3, 1988 under number V 88060301.
Establishment of a chronically-infected cell line can, for example,
be carried out as follows:
[0011] Molt-4 cells (10 8/ml) and preferably Molt-4 clone 8 cells
(obtained from N. Yamamoto, Yamaguchi, Japan) are cocultured with
infected human lymphocytes (10 6/ml) in RPMI 1640 culture medium
buffered with 20 mM HEPES and containing 10% fetal calf serum.
Within one to two weeks, a cytopathic effect is observed in the
culture which is followed by cell death. A fraction of the cells in
the culture survive the infection and produce virus continuously.
With continued culturing, these cells increase in number and can be
passaged. Supernatants from these cells can be used a a source of
virus.
[0012] Furthermore, the invention relates to a purified retrovirus
having the essential morphological and immunological properties
described below. In many cases, the unique characteristics of HIV-3
can best be appreciated by comparison with the same type of
characteristics relating to the other human immunideficiency
viruses, HIV-1 and HIV-2.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] In FIGS. 1 to 16 the designations HIV-3 (ANT 70) and HIV-3
(ANT 70 NA) refer to two strains of a new HIV-3 virus isolated from
a Camerounian woman and her partner from which HIV-3 (ANT 70) has
been deposited under ECACC V88060301.
[0014] FIG. 1 shows a procedure for preparing cleavage maps of
viral proteins.
[0015] FIG. 2 shows differential antigen capturing on
virus-containing culture supernatants.
[0016] Differential antigen capturing is performed as described
hereinafter. The solid line represents the results obtained using a
broad-spectrum anti-HIV-1 IgG while the broken line depicts the
results obtained using an IgG which was rather specific for HIV-1.
The titrations shown in panels A-E are typical for HIV-1. Panel F
shows the result obtained with HIV-3 (ANT 70) containing
supernatant.
[0017] FIG. 3 shows differential antigen capturing on HIV-1 and
HIV-3 (ANT 70 NA) supernatants.
[0018] Differential antigen capturing was performed as described
hereinafter. The solid line depicts the results obtained on plates
coated with the broad spectrum anti-HIV IgG while the broken line
represents the results obtained on plates coated with IgG which
shows less crossreactivity with HIV types other then HIV-1.
[0019] FIG. 4 shows the reactivity of anti-HIV sera on HIV-1 and
HIV-2 Western Blot strips.
[0020] The reactivities of 3 different sera on HIV-1 and HIV-2
Western blot strips are shown. Sera: 1. anti-HIV-1, 2. anti-HIV-3
(ANT 70), 3. anti-HIV-2 (isolate 53). The molecular weights
indicated are those given by the manufacturer (Dupont Biotech).
[0021] FIG. 5 relates to the comparison of gag and pol proteins of
several HIV-1 isolates, HIV-2rod and HIV-3 (ANT 70).
[0022] Proteins were separated electrophoretically and blotted as
described later. The blot was incubated with a broad-spectrum
anti-HIV antiserum followed by (anti-human IgG)/alkaline
phosphatase-labeled conjugate to visualize the proteins.
[0023] A. HIV-2rod, B. an HIV-1 laboratory isolate, C. HIV-3 (ANT
70), D. an HIV-1 laboratory isolate, E. HIV-1 (SF4).
[0024] FIG. 6 shows a comparison of HIV-3 (ANT 70) and HIV-3 (ANT
70 NA) proteins.
[0025] Proteins were separated electrophoretically and blotted as
described later The blot was incubated with the BSR antiserum
followed by (alkaline phosphatase)/anti-human IgG conjugate to
visualize the proteins. Lane 1: HIV-3 (ANT 70 NA), lane 2: HIV-3
(ANT 70), lane 3: HIV-1 (SF4). The apparent intensity difference
between lanes 1 and 2 is caused by the difference in the amount of
material loaded.
[0026] FIG. 7 relates to the ability of various human anti-HIV-1
sera to capture viral antigens.
[0027] A number of human sera were diluted 1:1000 and coated
directly on microwell plates. Detergent-treated culture
supernatants containing HIV-1 (SF4), HIV-3 (ANT 70), HIV-2rod or
HIV-2 (isolate 53) were incubated and the bound antigen was
detected using a broadspectrum (anti-HIV)/horseradish peroxidase
conjugate. Sera 1-7 were of African origin while sera 8-11 were
from Europeans. The greater ability of African sera to capture
non-HIV-1 antigen can, in part, be explained by their higher
anti-p24 titers (data not shown).
[0028] FIG. 8 shows the effect of coating IgG dilution on the
binding of HIV isolates.
[0029] Succesive 2-fold dilutions were made of four different sera,
beginning at a dilution of 1:1000 and were used to coat microwell
plates. Detergent-treated supernatants of HIV-1 (SF4), HIV-3 (ANT
70), HIV-2rod and HIV-2 (isolate 53) were diluted to give
approximately the same optical density on plates coated with the
antiserum shown in panel B at a dilution of 1:1000. Bound antigen
was detected using the broad-spectrum (anti-HIV IgG) /horseradish
peroxidase conjugate.
[0030] FIG. 9 shows antigen capturing of virus isolates using human
polyclonal and mouse anti-HIV-1 monoclonal antibodies.
[0031] Wells were coated and incubated as described in the text.
The IgGs used are as follows:
[0032] 1. human polyclonal anti-HIV IgG , 2. MAb CLB 59, 3. MAb CLB
21, 4. MAb CLB 64, 5. MAb CLB 14, 6. MAb CLB 16, 7. MAb CLB 47, S.
MAh CLB 13.6 (anti-p18), 9. MAb CLB 19.7, 10. Mab CLB 13.4
(anti-p18).
[0033] FIG. 10 is a comparison of the reactivity of human anti-HIV
antisera to different HIV types.
[0034] Lysates of HIV-1 (SF4), HIV-3 (ANT 70), HIV-2rod and HIV-2
(isolate 53) were separated electrophoretically on
SDS-polyacrylamide gels, blotted onto nitrocellulose, and incubated
with a high titer anti-HIV-1 antiserum (panel A), a lower titer
anti-HIV-1 antiserum (panel B), serum from the woman from whom
HIV-3 (ANT 70) was isolated (panel C), her partner from which HIV-3
(ANT 70 NA) was isolated (panel D) and anti-HIV-2 antiserum from
the person from whom HIV-2 (isolate 53) was isolated (panel E).
[0035] FIG. 11 shows titrations of anti-HIV sera by enzyme
immunoassay.
[0036] Microwell plates were coated with lysates of HIV-1 (SF4),
HIV-3 (ANT 70) and HIV-2 (isolate 53). Serum from an HIV-1-infected
European (left panel), antiserum to HIV-3 (ANT 70 NA) (center
panel) and antiserum to HIV-2 (isolate 53) (right panel) were
titrated in 2-fold dilutions beginning at a dilution of 1:100 on
all three coated plates.
[0037] FIG. 12 shows the positions of methionine and tryptophan
residues in viral gag and pol gene products.
[0038] Amino acid positions for the p17 gag proteins are given
starting from the first methionine in the coding sequence.
Positions for the p24 gag protein are given starting at the p17/p24
proteolytic cleavage site. Positions for the pol gene are shown
after alignment with the highly conserved tryptophan doublet in the
HIV-1 sequence at positions 556 and 557. The positions of a
conserved protease sequence, the protease/reverse transcriptase
cleavage site and the reverse transcriptase/endonuclease cleavage
site are indicated. In this case, the terms p24 and p17 are used in
the genetic sense to refer to the largest and second largest viral
core proteins respectively. The term "HIV-2 (LAV-2)" is a synonymum
for HIV-2 rod.
[0039] FIG. 13 is a comparison of partial cleavage products of gag
and pol gene products of HIV-1 (SF4) [HIV-1 in the figure], HIV-3
(ANT 70) [isolate 70 in the figure], HIV-2rod [HIV-2 (LAV-2) in the
figure] and HIV-2 (isolate 53) [isolate 53 in the figure]. The
terms p24 and p17 are used in the genetic sense to indicate the
largest and second largest viral core proteins, respectively.
[0040] FIG. 14 shows hybridization of cDNA probes to viral RNA.
[0041] Viral RNA from HIV-1 (SF4), HIV-2rod, and HIV-3 (ANT 70)
were spotted onto a membrane filter as described in Materials and
Methods. The filters were hybridized under either nonstringent (A)
or stringent conditions and autoradiographed.
[0042] 1. Morphology
[0043] Electron microscopy of HIV-3-infected MT4 cells revealed the
presence of extracellular virus particles having a diameter of
approximately 120 nm and consisting of an outer envelope which
surrounds an inner elongated core which has a diameter of
approximately 20 to 40 nm and which appears in some thin sections
to be slightly cone-shaped in contrast to the more or less
cylindrical appearance of the HIV-1 core. Nevertheless, HIV-3 is
morphologically very similar to HIV-1 and HIV-2 but is readily
distinguished from other human retroviruses such as HTLV-I and
HTLV-II.
[0044] 2. Protein and Glycoprotein Antigens.
[0045] The virus present in the culture supernatant of
HIV-3-infected Molt-4 cells was concentrated by precipitation with
polyethyleneglycol (average molecular weight 6000) followed by
centrifugation. The resulting pellet was resuspended in phosphate
buffered saline, layered on top of a 20% sucrose cushion and
pelleted at 100,000 g for 1.5 hours. The pelleted virus was then
dissociated in 62.5 mM Tris, pH 6.7, containing 2%
2-mercaptoethanol, 1% sodium dodecyl sulfate and 10% glycerol and
the principle viral antigens were separated by electrophoresis on a
polyacrylamide gel (12, 5%) under denaturing-conditions. Molecular
weight markers were included on the same gel so as to provide a
basis for estimating molecular weights. Once separated, the
proteins were electrophoretically transferred to nitrocellulose
paper (Western blot) which was then incubated with an antiserum
derived from a person infected with an HIV. In the initial
experiments, a high titer antiserum was used from an individual who
was infected with HIV-1 and which had been previously shown to
crossreact with HIV-2 gag- and pol-derived proteins. In this
manner, the molecular weights of the HIV-3 gag and pol gene
products could be compared with those of HIV-1 and HIV-2. The
apparent molecular weights observed for the HIV-3 proteins are
close to those observed for both HIV-1 and HIV-2. Nevertheless,
small yet reproducible molecular weight differences between HIV-3,
and HIV-1 and HIV-2 proteins are also evident.
[0046] The protein blots revealed that HIV-3, like HIV-1 and HIV-2,
possesses three core proteins. In the case of HIV-3, these proteins
were found to have molecular weights of approximately 12,000,
16,500 and 25,000 respectively. By convention, proteins are
frequently referred to by a "p" for protein or "gp" for
glycoprotein, followed by a number which, when multiplied by 1,000,
gives the approximate molecular weight of the polypeptide. The
three major core proteins of HIV-3 will be referred to hereafter as
p12, p16, and p25 respectively.
[0047] The molecular weight values as determined are expected to be
correct to within 10% of the true values. Nevertheless, much
confusion exists with regards to molecular weight values of
proteins since the construction of the electrophoresis apparatus
used and the source of the buffer components varies from laboratory
to laboratory. It is therefore necessary when comparing the
apparent molecular weights of the protein antigens of HIV-3 with
respect to those of HIV-1 or HIV-2, to subject all samples to
electrophoresis on the same gel. Such a gel can, for example, be
seen in FIG. 5. In particular, it is evident that while, in the
case of the major core protein, the molecular weight values of the
homologous proteins of the three HIVs are very close, the protein
derived from HIV-1 is the smallest. The major core protein of HIV-2
is somewhat larger then that of HIV-1, as has been previously
reported. The homologous protein from HIV-3 is slightly larger than
the major core protein of HIV-2. The calculated molecular weights
of these proteins are given in Table 1.
1TABLE 1 Comparison of molecular weights of gag and pol gene
products. pol env REVERSE TRANS OUTER TRANSCRIP- MEMBRANE MEMBRANE
gag ENDO TASE** PROTEIN PROTEIN HIV-1 12 KD 17* KD, 24 KD 31 KD 49
KD/65 KD gp41 gp120 ANT 70 12 KD 16.5 KD, 24.8 KD 31 KD 48.5 KD/62
KD gp41 gp120 HIV-2 12 KD 16 KD, 24.3 KD 31 KD 53 KD/69 KD gp41
gp120 *Some strain to strain variation in molecular weight has been
observed for this protein. **Molecular weights are given for both
species of reverse transcriptase.
[0048] Similarly, molecular weight differences are also apparent
between the three HIVs with respect to the second core protein
which has, in most HIV-1 strains, a molecular weight of 18,000.
Strain to strain differences in the molecular weight of this
protein have, however, been documented in the case of HIV-1, and
the molecular weight of this protein may be 17,000 in some
isolates. The homologous protein from HIV-2 has a molecular weight
of approximately 16,000 while the HIV-3 protein has an intermediate
molecular weight of approximately 16,500.
[0049] By analogy with HIV-1 and HIV-2, HIV-3 also possesses two
forms of the virally encoded enzyme reverse transcriptase. These
two species also differ slightly in molecular weight from the
corresponding species in HIV-1 and HIV-2 and are characteristic for
HIV-3. These molecular weights are also summarized in Table 1.
[0050] HIV-3 possesses an additional pol gene-derived polypeptide
which is an endonuclease with apparent molecular weight of 31,000
and which does not differ significantly in molecular weight from
the homologous proteins from HIV-1 or HIV-2.
[0051] When protein blots containing HIV-3 proteins are incubated
with serum obtained from an individual infected with this virus,
two additional proteins can be seen. These proteins are derived
from the env gene and are the viral envelope glycoproteins. The
smallest protein, which is the transmembrane protein, migrates as a
broad band with an apparent molecular weight of between 40,000 and
45,000. This protein will henceforth be referred to as gp41, with
the understanding that the protein exhibits some intrinsic
heterogeneity with respect to its apparent molecular weight and
migration on polyacrylamide gels. The larger protein, which is the
outer membrane protein, is similarly somewhat diffuse on
polyacrylamide gels and has a molecular weight of approximately
120,000. This protein will henceforth be referred to as gp120. It
should be noted that the apparent heterogeneous migration of these
two species on polyacrylamide gel is not due to hetergeneity in the
polypeptide chain but rather in posttranslational glycosylation. In
particular, the gp120 is heavily glycosylated and the apparent
molecular weight which one observes is to some degree influenced by
the cell line used to produce the virus.
[0052] In addition to the Western blot, viral protein antigens can
also be visualized by radioimmunoprecipitation assay (RIPA). For
this purpose, viral proteins can be radioactively labeled
metabolically in vivo by culturing HIV-3-infected cells in the
presence of 355-cysteine and 35S-methionine (200 Ci/ml) in RPMI
1640 medium devoid of these two amino acids and supplemented with
dialyzed fetal calf serum. After 16 hours, the labeled virus is
harvested from the culture supernatant by centrifugation over a 20%
sucrose cushion at 100,000 g for 1, 5 hours. The resulting pelleted
virus is then resuspended in RIPA buffer (20 mM triethanolamine, pH
8.0, 0.5 M NaCl, 0.5% Nonidet P40, 0.1% sodium deoxycholate, and 1
mM phenylmethylsulfonylfluoride).
[0053] Alternatively, the virus may be radioactivly labeled with
125 I using chloramine T by the technique familiar to persons
versed in the art. In this case, virus is purified from the
supernatant of infected cells by pelleting the virus through a
cushion of 20% sucrose, resuspending the virus in phosphate
buffered saline and banding the virus by ultracentrifugation on a
20 to 50% sucrose gradient at 60,000 g for 12 hours. The banded
virus can be located in the fractionated gradient either by reverse
transcriptase assay or by an antigen capturing assay. The fractions
containing virus are pooled and Triton X-100 is added to a
concentration of 0.5%. The Triton X-100-lysed virus may then be
iodinated.
[0054] For immunoprecipitations, 100,000-200,000 cpm of labeled
viral protein in RIPA buffer is reacted with 5 microliters of a
test serum in a volume of 200 microliters for 16 hours at 4.degree.
C. The resulting immune complexes are then bound to Protein
A-Sepharose (Pharmacia), washed extensively, and the bound proteins
eluted with electrophoresis sample buffer containing 1% SDS. The
antigens are subsequently analyzed by electrophoresis followed by
autoradiography.
[0055] The protein antigens of HIV-3 can be characterized with
respect to those of HIV-1 and HIV-2 using two different but related
approaches. On one hand, the antigens may be characterized on the
basis of their ability to crossreact with antisera from persons
infected with HIV-1 and HIV-2. On the other hand, antisera from
persons infected with HIV-3, which contain antibodies produced in
response to HIV-3 antigens, can be used to test crossreactivity to
HIV-1 and HIV-2 proteins. The antigenic relationships between
HIV-3, and HIV-1 and HIV-2 are substantially illustrated in the
examples given below.
[0056] The results of these experiments indicate that HIV-3 is only
distantly related to HIV-2 since crossreactivity is only observed
with respect to the viral core proteins and pol gene products. No
crossreactivity of the env gene products was observed when
anti-HIV-2 antiserum was incubated with HIV-3 proteins or when
anti-HIV-3 antiserum was incubated with HIV-2 proteins.
[0057] In contrast, HIV-3 is more closely related to HIV-1 since
anti-HIV-3 antiserum crossreacts not only with the gag and pol gene
products of HIV-1 but also to some extent with the gp41 and gp120
env gene products, albeit with a lower affinity. Anti-HIV-1
antiserum similarly crossreacts with all of the protein antigens of
HIV-3, but with a lower affinity than for the proteins of
HIV-1.
[0058] In the examples which follow, it is demonstrated that HIV-3
is antigenically substantially different from HIV-1 on the basis of
1.) a different pattern of reactivity with anti-HIV-1 antiserum
than that observed for HIV-1, 2.) a drastically reduced ability to
be recognized by mouse monoclonal antibodies raised against the
HIV-1 p24 and p17 core proteins, and 3.) preferential recognition
of HIV-3 proteins, including the envelope proteins, over HIV-1
proteins by antisera from HIV-3-infected individuals.
[0059] In spite of the genetic variation characteristic of human
immunodeficiency viruses, a test based, for example, on HIV-1
proteins derived from a particular strain will function
satisfactorily for detecting antibodies raised in response to other
HIV-1 variants. This can, in particular, also be seen in the
example in which monoclonal antibodies were tested for their
ability to react with antigens derived from HIV-1, HIV-2 and HIV-3
isolates. In this case, the monoclonal antibodies were raised
against the core proteins from the HIV-1 IIIB strain, yet react
very strongly to proteins derived from HIV-1 strain SF4. In
contrast, these same monoclonal antibodies react only weakly or not
at all with HIV-3 core proteins. This indicates that the antigenic
differences between HIV-1 and HIV-3 are of such a magnitude that
immunological assays based on the use of HIV-1 proteins will not be
suitable for testing sera from individuals infected with HIV-3.
[0060] Finally, in the examples given below, differences have been
shown in the number and/or positions of methionine and tryptophan
residues in the most highly conserved gag and pol gene
products.
[0061] 3. HIV-3 Nucleic Acids
[0062] A. HIV-3 Viral RNA.
[0063] The RNA of HIV-3 when deposited on a Hybond-H (Amersham)
filter according to the "dot blot" technique, did not hybridize to
HIV-1 DNA under stringent hybridization conditions.
[0064] By "stringent conditions" or "nonstringent conditions" are
meant the conditions under which the actual hybridization and/or
the subsequent wash steps are performed. Dot blot hybridizations
were performed by spotting dilutions of viral RNA from HIV-1 strain
SF4, HIV-2 rod and HIV-3 strain ANT 70 onto Hybond-H filters.
[0065] The dilution series for each virus corresponded to viral RNA
pelleted from the equivalent of 5, 2.5, 1.25 and 0.62 milliliters
of culture supernatant. The RNA was fixed onto the filter by U.V.
irradiation for 2 min and subjected to hybridization by bringing
the filter into contact with a 32P-labeled DNA probe. The probe
chosen was derived from the HIV-1 sequence spanning nucleotides
487-4652 (Sac I--Eco R1) and includes a portion of the 5'long
terminal repeat, the entire gag region and most of the pol gene,
subcloned in the vector puC 13. Hybridization of the 32P-labeled
probe with the filter was carried out under stringent conditions in
3 X SSC, 0, 5% milk powder, 1% SDS, 10% dextran sulfate, 50%
formamide (volume/volume) at 42.degree. C. for 18 hrs (1.times.SSC
corresponds to 0.15 M NaCl, 0.015 M sodium citrate). The subsequent
wash steps were carried out under stringent conditions in
0.1.times.SSC and 0.1% SDS at 65.degree. C. (2-30 minute washes).
The filter was then dried and autoradiographed with enhancing
screens at -70.degree. C. Following autoradiography, only spots
were visible which corresponded to HIV-1 viral RNA. No
hybridization was observed to HIV-2 or either of the two HIV-3
strains. HIV-3 therefore appears to be only distantly related to
HIV-1.
[0066] B. cDNA and Subclones of cDNA Derived from HIV-3.
[0067] The conditions under which cDNA corresponding to HIV-3
sequences was synthesized and cloned are described below. HIV-3
(strain ANT 70) from 1 liter of culture was precipitated with
polyethylene glycol 6000, redissolved in phosphate buffered saline,
and pelleted through a 20% sucrose cushion. The resulting virus
pellet was dissolved in 6 M guanidinium chloride in 20 mM
dithiothreitol and 0.5% Nonidet P-40. CsCl was added to a
concentration of 2 molar and the solution containing disrupted
virus was layered onto a 1.2 milliliter cushion of 5.7 M CsCl
containing 0.1 EDTA. Viral RNA was pelleted by centrifuging for 20
hrs. at 25,000 rpm in a Beckman SW28 rotor at 15.degree. C. The
pelleted RNA was redissolved, extracted with phenol and
precipitated with ethanol and 2 M LiCl.
[0068] One-fifth of the viral RNA, prepared as described above, was
used to direct the first step in the synthesis of cDNA which made
use of an oligo (dT) primer which served to prime the synthesis of
the first cDNA strand.
[0069] A commercially available kit supplied by Amersham was used
for preparation of HIV-3 cDNA and made use of an exogenously added
reverse transcriptase to synthesize the first strand. The synthesis
of the second strand was performed using E. coli DNA polymerase I
in the presence of RNase H to digest away the RNA strand of the
RNA/DNA hybrid.
[0070] Second strand synthesis was performed in the presence of
32p-dCTP to label the cDNA. The resulting cDNA was treated with T4
DNA polymerase to create blunt ends, the cDNA was methylated to
protect possible internal EcoRI cleavage sites, and was then
coupled to EcoRI linkers, also supplied by Amersham. The EcoRI
restriction sites were then cleaved and the cDNA was sized on a
1.2% agarose gel. The region in the gel corresponding to a cDNA
length of 500 to 2000 base pairs was excised and the cDNA was
eluted and cloned in the vector pUC13 which had been cleaved with
EcoRI and dephosphorylated. The DNA was then used to transform
competent cells of E. coli MC1016 (lambda). The resulting colonies
were transferred to Pall membranes (Pall Biodyne), lysed and
denatured with 1.5 M NaCl, 0.5 M NaOH and neutralized with 3 M
NaOAc, pH 5.5. Screening of colonies harboring an insert of HIV-3
was performed under moderately stringent conditions in a buffer
containing 5.times.SSC, 5.times.Denhardts solution, 0.2% SDS, 250
mg/ml denatured salmon sperm DNA, overnight at 65.degree. C., using
32P-labeled plasmid containing the SacI--EcoRI fragment of HIV-1
discussed above. Following hybridization, filters were washed as
follows:
[0071] 1. 1 hour in 2.times.SSC, 0.1% SDS at room temperature.
[0072] 2. 30 minutes in 0.1.times.SSC, 0.1% SOS at room
temperature.
[0073] 3. 20 minutes in 2.times.SSC, 0.1 SDS at 42.degree. C.
[0074] 4. 20 minutes in 0.1.times.SSC, 0.1% SDS at 42.degree.
C.
[0075] Following autoradiography of the filter, several weakly
positive colonies were identified which were then grown for
analysis. It was expected that the positive signal would either be
due to weak homology with the gag or pol regions of HIV-1, or due
to some sequence homology with the R region of the LTR.
[0076] C. Sequences Contained in HIV-3 cDNA.
[0077] A clone carrying the largest insert, which was found to be
906 base pairs in length and is referred to as iso 70-11, was
selected for sequence analysis. A number of subclones of the insert
were prepared by digesting the insert with various restriction
enzymes and subcloning the resulting fragments in the pUC 13
vector. Sequence determinations were performed according to the
dideoxy-method, described by Sanger, (Proc. Natl. Acad. Sci. USA
74: 5463-5467, 1977), using a kit purchased from Boehringer which
makes use of 17-mer M13 primers. Sequence analysis of cDNA clone
iso 70-11 revealed that the insert corresponded to the 3' end of
the viral genome which possessed a poly (A) chain at the 3'
end.
[0078] The HIV-3 retrovirus contains a 3' LTR which is composed of
a U3 region as well as an R region. Like the 3' LTR region of HIV-1
, clone iso 70-l1 contains an AATAAA polyadenylation signal located
approximately 23 nucleotides from the 3' end of the R region.
Analysis of the HIV-3 sequence revealed approximately 70% homology
with the corresponding 3' LTR sequence of HIV-1 and less than 55%
homology with the corresponding sequence of HIV-2.
[0079] Conversely, hybridizations using HIV-1 gag--pol sequences as
the labeled probe to detect crosshybridization with HIV-3 RNA
revealed no detectable hybridization when the hybridization was
carried out under stringent conditions. This again indicates that
the viruses are only distantly related and that a distinction can
be made between HIV-1 and HIV-3 at the nucleic acid level in the
region of the genome encompassing the gag and pol genes. This same
labeled probe did, however, hybridize to RNA derived from HIV-1
strain SF4.
[0080] In addition, the invention relates to a composition
comprising at least one antigen, in particular, a protein or
glycoprotein of HIV-3 retrovirus. Such a composition can be used in
methods for detecting antibodies and in kits for carrying out such
methods.
[0081] The HIV-3 virus has proven to be a usable as a source of
antigen for detecting antibodies in people who have come into
contact with HIV-3. As such, the virus may be grown and
concentrated by the methods already described and a lysate prepared
by treating the virus with a suitable detergent. A preferred
detergent for preparing a total viral lysate is Triton X-100, used
at a concentration of 0.5%. Another preferred detergent is Nonidet
P-40 (NP-40), also used at a concentration of 0.5%.
[0082] Alternatively, viral protein may be purified from lysates of
the virus. A preferred method for purifying these proteins is
affinity chromatography. For example, the viral antigens may be
separated on a preparative polyacrylamide gel and the individual
antigens eluted in purified form. These may further be used to
raise antisera in, for example, rabbits which are specific for the
individual viral proteins. The IgG fraction derived from immune
rabbit serum can be coupled to a solid phase such as CNBr-activated
Sepharose 4B (Pharmacia) and used to selectively remove individual
viral antigens from viral lysates. These proteins may then be
eluted from the affinity support using a low pH buffer and further
purified using standard chromatographic techniques of which an
example is given by Montelaro et al., J. of Virology (1982) 42:
1029-1030.
[0083] The invention relates generally to any composition which can
be used for the diagnosis of HIV-3 infection or for tests which
have a prognostic value. These diagnostic procedures involve the
detection of antibody in serum or other body fluid, which are
directed against at least one of the antigens of HIV-3.
[0084] Preferred compositions are viral lysates or purified
antigens which contain at least one of the viral core proteins,
p12, p16, and p25 or envelope proteins gp41 or gp120, or pol
gene-derived proteins, such as p31. Especially preferred
compositions are those which simultaneously contain, by way of
example, the following proteins,
[0085] p25 and gp120
[0086] p25 and gp41
[0087] p25, gp41 and gp120
[0088] p12, p16 and p25
[0089] p25, p31 and gp120
[0090] It should be understood however, that the above mentioned
compositions are only meant to serve as examples and that the
invention relates to all lysates or protein preparations containing
one or more of the above mentioned proteins or glycoproteins.
[0091] The invention also relates to any composition in which
either HIV-3 viral lysate is used in combination with similarly
prepared proteins derived from HIV-1 and/or HIV-2 for the general
diagnosis of infection or contact with human immunodeficiency virus
without regard to the absolute identity of the virus being
detected. For example, such compositions could consist of a mixture
of lysates of HIV-1 , HIV-2 and HIV-3 or could consist of the
following:
[0092] core proteins of HIV-1, HIV-2 and HIV-3, and in particular
the major core protein of each virus type, homologous to the HIV-3
p25 protein.
[0093] envelope glycoproteins of HIV-1 , HIV-2 and HIV-3 and in
particular the outer envelope glycoproteins of each virus type,
homologous to HIV-3 gp120.
[0094] core proteins of HIV-1 , HIV-2 and HIV-3 together with the
envelope glycoproteins of HIV-1, HIV-2 and HIV-3, in particular the
major core protein of each virus type, homologous to the HIV-3 p25
protein, together with the major outer envelope protein of each
virus, homologous to HIV-3 gp120.
[0095] a combination of the core proteins and envelope proteins of
HIV-1 , HIV-2 and HIV-3 and in particular homologous to the HIV-3
proteins p25 and gp120 respectively and a protein derived from the
pol gene of HIV-1, HIV-2 and HIV-3, in particular the proteins of
each virus type homologous to the p3l endonuclease protein of
HIV-3.
[0096] Furthermore, the invention relates to an antigen providing a
single band in polyacrylamide gel electrophoresis, said antigen
comprising, in common with one of the purified antigens of HIV-3
retrovirus, an epitope that is recognized by serum of persons
carrying anti-HIV-3 antibodies. The amino acid sequences
corresponding to these epitopes can readily be determined by
isolating the individual proteins either by preparative
electrophoresis or by affinity chromatography and determining the
amino acid sequence of either the entire protein or the fragments
produced enzymatically by trypsin or chymotrypsin digestion or
chemically by the procedures described in detail below. The
resulting peptide or polypeptides can subsequently be sequenced by
Edman degradation. The invention relates therefore to any protein,
glycoprotein op peptide, either derived directly from the virus or
produced by cloning any cDNA fragments of the virus in bacterial
expression vectors, or viral expression vectors for the expression
of inserted DNA in mammalian or insect cells, and purifying the
expressed protein by the methods described above. Furthermore, the
invention also relates to synthetic peptides, produced either by
Merrifield synthesis or Fmoc chemistry, which may be subsequently
purified to homogeneity and which contain in their sequences
epitopes which are shared by the natural HIV-3 antigens.
[0097] Antigens which share epitopes with viral proteins may easily
be recognized by their reaction with antibodies present in the
serum of individuals infected with HIV-3, either by Western
blotting, or radi immunoprecipitation. In the case of small
peptides which are not able to bind to nitrocellulose, these
peptides can be detected by binding to nylon membranes (Pall
Biodyne or Amersham) and reacting the membrane with anti-HIV-3
antiserum. In particular, the invention relates to epitopes
contained in any of the HIV-3 core proteins, p12, p16 and p25 or in
a protein which may contain as part of its polypeptide chain
epitopes derived from a combination of the core proteins.
Furthermore, the invention relates to epitopes contained in either
of the two HIV-3 envelope glycoproteins, gp4l and gp120 as well as
any protein which contains, as part of its polypeptide chain,
epitopes derived from a combination of the HIV-3 envelope
glycoprotein or a combination of the HIV-3 envelope glycoproteins
and HIV-3 core protein. The invention additionally relates to
polypeptides whose synthesis is directed by expression vectors
constructed by recombinant DNA methods which incorporate epitopes
derived from HIV-3 proteins or glycoproteins together with epitopes
derived from the proteins or glycoproteins of either HIV-1 and/or
HIV-2 into a single polypeptide chain. Preparing such a
construction would involve excising the relevant coding regions
from cDNA of HIV-3 as well as HIV-1 and HIV-2, and coupling the DNA
in phase so as to form a coding sequence which, when inserted into
an expression vector possessing the necessary signal sequences,
directs the synthesis of a hybrid protein in which epitopes of the
HIV-3, HIV-1 and HIV-2 are contained.
[0098] Furthermore, the invention relates to methods for the
detection of antibodies against HIV-3 retrovirus in a biological
fluid, in particular for the diagnosis of a potential or existing
ARC or AIDS caused by HIV-3 retrovirus, characterized by contacting
body fluid of a person to be diagnosed with a composition
containing one or more of the proteins or glycoproteins of HIV-3 or
with a lysate of the virus, or with an antigen possessing epitopes
common to HIV-3, and detecting the immunological conjugate formed
between the anti-HIV-3 antibodies and the antigen(s) used.
[0099] Preferred methods include, for example, immunofluorescence
assays or immunoenzymatic assays.
[0100] Immunofluorescence assays typically involve incubating, for
example, serum from the person to be tested with cells infected
with HIV-3 and which have been fixed and permeabilized with cold
acetone. Immune complexes formed are detected using either direct
or indirect methods and involve the use of antibodies which
specifically react to human immunoglobulins. Detection is achieved
by using antibodies to which have been coupled fluorescent labels,
such as fluorsecein or rhodamine.
[0101] Immunoenzymatic assays may be performed, for example, as
follows:
[0102] a specific quantity of HIV-3 virus extract or of a
composition referred to according to the invention is deposited in
the wells of a microtitration plate.
[0103] the excess unbound material is removed after a suitable
incubation period by washing.
[0104] a suitable dilution or dilutions of serum of other body
fluid which is to be tested for the presence of antibodies directed
against one or more of the protein or glycoprotein antigen of HIV-3
is introduced into the well.
[0105] the microtitration plate is incubated for a period of time
necessary for the binding reaction to occur.
[0106] the plate is washed thoroughly.
[0107] the presence of immune complexes is detected using
antibodies which specifically bind to human immunoglobulins, and
which have been labeled with an enzyme, preferably but not limited
to either horseradish peroxidase, alkaline phosphatase, or
beta-galactosidase, which is capable of converting a colorless or
nearly colorless substrate into a highly colored product.
Alternatively, the detection system may employ an enzyme which, in
the presence of the proper substrates), emits light.
[0108] the amount of product formed is detected either visually,
spectrophotometrically, or luminometrically, and is compared to a
similarly treated control.
[0109] Other detection systems which may also be used include those
based on the use of protein A derived from Staphylococcus aureus
Cowan strain I, protein G from group C Streptococcus sp. (strain
26RP66), or systems which employ the use of the biotin-avidin
binding reaction.
[0110] Another method of immunoenzymatic detection of the presence
of antibodies directed against one or more of the HIV-3 antigens is
the Western blot. The viral antigens are separated
electrophoretically and transferred to a nitrocellulose membrane or
other suitable support. The body fluid to be tested is then brought
into contact with the membrane and the presence of the immune
complexes formed is detected by the method already described. In a
variation on this methods, purified viral antigen is applied in
lines or spots on a membrane and allowed to bind. The membrane is
subsequently brought into contact with the body fluid to be tested
and the immune complexes formed are detected using the previously
described techniques.
[0111] The presence of antibodies in body fluid may also be
detected by agglutination. HIV-3 lysates or a HIV-3 lysate, antigen
or purified antigen composition referred to according to this
invention, is used to coat, for example, latex particles which form
an uniform suspension. When mixed with serum containing antibodies
to the antigen present, the latex particles are caused to
agglutinate and the presence of large aggregates can be detected
visually.
[0112] The present invention also relates to labeled extracts of
HIV-3 or compositions as previously described. The labeling can be
of any type, such as enzymatic, chemical, fluorescent or
radioactive.
[0113] Furthermore, the invention relates to a method for detecting
the presence of HIV-3 antigens in body fluids. This may, for
example, be accomplished in the following manner:
[0114] the IgG fraction of antiserum, derived either from humans
infected with HIV-3 or from animals injected with an HIV-3 lysate
or composition already described, is placed in the wells of a
microtitration plate.
[0115] after a suitable period to allow adsorption, the excess
unbound material is washed away.
[0116] a body fluid containing the antigen to be detected is placed
in the well.
[0117] the microtitration plate is allowed to incubate for a
suitable period of time to allow binding to occur.
[0118] the plate is then thoroughly washed with a suitable
buffer.
[0119] the presence of bound antigen is detected either directly or
indirectly, for example, by using immunoglobulins which are
similarly specific for the antigen(s) to be detected and which have
been labeled, preferably with one of the aforementioned
enzymes.
[0120] an appropriate substrate is then added and the extent of
reaction is compared to a control in order to measure the amount of
antigen present.
[0121] Furthermore, the invention relates to a kit for the
detection of anti-HIV-3 antibodies in biological fluids, comprising
an HIV-3 lysate or a composition as referred to above and a means
for detecting the immunological complexes formed.
[0122] In the case of kits designed to detect specific antibodies
by immunoenzymatic methods such a kit would include:
[0123] an HIV-3 lysate or composition of one of the types already
described, preferably in a purified form, and preferably attached
to a solid support such as a microtitration plate.
[0124] a conjugate between an enzyme and an immunoglobulin fraction
which is capable of binding to the antibodies to be detected, or a
conjugate between an enzyme and bacterial protein A or protein
G.
[0125] a control antigen which possesses no epitopes which are
shared by any human immunodeficiency virus.
[0126] appropriate buffers for performing the assay.
[0127] an appropriate substrate for the enzyme.
[0128] Kits for the detection of specific antibodies which make use
of labeled antigen would include:
[0129] an appropriately labeled antigen or combination of antigens
of the types already described.
[0130] rotein A or anti-human immunoglobulins, preferably coupled
to an insoluble support, such as Protein A-Sepharose 4B (Pharmacia)
or an equivalent support.
[0131] control antigen, which is not recognized by anti-HIV-3
antisera.
[0132] appropriate buffers for performing the assay.
[0133] if appropriate, substrates for the detection of
enzymatically labeled antigen.
[0134] The invention further relates to kits, developed for the
detection of HIV-3 antigens in biological fluids, which
comprise:
[0135] anti-HIV-3 immunoglobulins, preferably coupled to a solid
support such as a microtitration plate.
[0136] anti-HIV-3 immunoglobulins conjugated to an enzyme.
[0137] negative control antigen, which would not be recognized by
anti-HIV-3 immunoglobulins.
[0138] positive control antigen which consists of one of the HIV-3
antigens or compositions already described.
[0139] appropriate buffers for conducting the test.
[0140] an appropriate substrate for detection of bound enzyme.
[0141] Furthermore, the invention relates to an immunogenic
composition containing an envelope glycoprotein of HIV-3
retrovirus, in particular, gp41 or gp 120, or a part of said
glycoprotein, in combination with a pharmaceutically acceptable
vehicle suitable for the constitution of vaccines effective against
HIV-3. The invention additionally relates to any peptide or
polypeptide which contains within its sequence all or part of the
protein backbone of the HIV-3 retrovirus, as well as peptides which
result from addition, substitution, or deletion of amino acids
which do not affect the general immunological properties of said
peptides.
[0142] The invention further relates to monoclonal antibodies
characterized by their ability to specifically recognize epitopes
contained in the HIV-3 antigens or compositions as previously
defined, and in particular, monoclonal antibodies raised
specifically against said antigens and produced by traditional
techniques. The invention also relates to monoclonal antibodies of
human origin produced by immortalizing B-cells derived from persons
infected with HIV-3, for example, by transforming the B-cells with
Epstein-Barr virus and subcloning the transformants.
[0143] The invention likewise relates to the production of
polyclonal antisera in animals which recognize one or more HIV-3
antigens and which is produced by infecting animals with purified
HIV-3 or an HIV-3 antigen or combination of antigens, and in
particular the proteins or glycoproteins of HIV-3.
[0144] The antibodies, either polyclonal or monoclonal, can be used
for a wide variety of purposes which include neutralization of
HIV-3 infectivity, the detection of HIV-3 antigens in biological
fluids or in infected cells, and the purification of HIV-3 protein
and glycoprotein antigens.
[0145] The invention further relates to nucleic acids, optionally
labeled which are derived in part, at least, from RNA of HIV-3
retrovirus or of variants of this virus.
[0146] The invention relates likewise to the use of cDNA or parts
of the cDNA or the recombinants containing them, which are
characterized by containing at least a portion of the cDNA
corresponding to the entire genomic RNA of the HIV-3 retrovirus.
Such cDNAs may be used as probes for the specific detection of
HIV-3 sequences in biological fluids, tissues and cells. The probes
are preferably also labeled, either radioactively or chemically,
alternatively using enzymatic, fluorescent or chemiluminescent
labels which enable the probes to be detected. Preferred probes for
the specific detection of HIV-3 and diagnosis of HIV-3 infection
are probes that contain all or a portion of the cDNA complementary
to the HIV-3 genome. In this context, an especially advantageous
probe can be characterized as one which contains, in particular,
the nucleic acid sequence contained in clone iso 70-11 and which
includes the viral LTR-R sequence which is located at both the 5'
and 3' ends of viral genomic RNA and at both the 5' and 3' ends of
integrated proviral DNA.
[0147] It is nevertheless understood that the probes which can be
used for the diagnosis of HIV-3 infection are in no way limited to
the probes described above, and that the invention incorporates all
sequences which originate from the HIV-3 genome or its naturally
occurring variants and includes sequences encoding the viral core
proteins gag gene), the two forms of reverse trancriptase and the
endonuclease (pol gene), as well as the two viral envelope
glycoproteins (env gene).
[0148] The invention also relates to HIV-3 nucleic acid sequences
which have been incorporated into a recombinant nucleic acid
comprising a nucleic acid from a vector, and having said cDNA or
part of said cDNA inserted therein. Such a construction could be
used for replicating the viral cDNA or its fragments in an organism
or cell other than the natural host so as to provide sufficient
quantities of the probe to be used for diagnostic purposes.
[0149] A probe generated in such a manner can be employed in a
diagnostic test for specific detection of HIV-3 which incorporates
the following essential step:
[0150] labeling of the probe generated as described above by the
methods previously described.
[0151] bringing the probe into contact under stringent
hybridization conditions with DNA from infected cells or viral RNA
from infected cells or biological fluids, once said DNA or RNA has
been, preferably, applied to a membrane and has been rendered
accessible to the probe.
[0152] washing the membrane with a buffer under circumstances in
which stringent conditions are maintained.
[0153] detection of the labeled probe, preferably by
autoradiography in cases in which the probe has been radioactively
labeled, or by a suitable immunodetection technique in case the
probe has been labeled chemically.
[0154] The invention further relates to a process for the
production of HIV-3 retrovirus characterized by culturing human T4
lymphocytes or human lymphocytic cell lines of leukemic origin
which carry the T4+ phenotype with lymphocytes or cell lines that
have previously been infected with an isolate of HIV-3 retrovirus,
as well as recovering and purifying the retrovirus from the culture
medium. The invention likewise relates to a process for the
production of antigens of HIV-3 retrovirus, characterized by lysing
the retrovirus, preferably with a detergent, and recovering the
lysate containing said antigens.
[0155] The invention additionally relates to a process for the
production of any of the HIV-3 proteins or glycoproteins p12, p16,
p25, p31, gp41, gp 120 or reverse trancriptase as previously
defined, or a part thereof, characterized by inserting the nucleic
acid encoding the proteins or glycoproteins in an expression
vector, transforming a host with said vector, culturing the
transformed host as well as recovering and purifying the expressed
protein. The process includes vectors which may or may not direct
the synthesis of fusion proteins and includes but is not limited to
bacterial expression vectors, mammalian expression vectors such as
vaccinia virus, and vectors based on baculovirus for the expression
of cloned genes in insect cells.
EXAMPLES
Materials and Methods
Virus and Cell Culture
[0156] a. Virus Strains and Cell Lines.
[0157] HUT-78 cells chronically infected with ARV-4 (HIV-1 SF4),
originally isolated by J. Levy, San Francisco, U.S.A. (20) and
[0158] uninfected HUT-78 cells were kindly provided by S. Sprecher,
Brussels, Belgium. LAV-2rod originally from L. Montagnier, Paris,
and CEM cells were obtained from J. De Smeyter, Leuven, Belgium.
Isolate 53, an HIV-2 isolate, was isolated in this laboratory
(21).
[0159] b. Virus Isolations.
[0160] Virus isolations were performed in a manner similar to that
described by Levy and Shimabukuro (22), with modifications.
Lymphocytes from patients as well as from healthy donors were
isolated from heparinized whole blood on Lymphoprep (Nyegaard and
Co., Oslo, Norway) and were cultured in RPMI 1640 containing 20 mM
HEPES, 15 percent fetal calf serum (Gibco), 5 g/ml hydrocortisone
(Merck), 75 U/ml IL-2 and 2 g/ml polybrene (Aldrich).
[0161] Lymphocytes from healthy donors were stimulated with 2 g/ml
phytohemagglutinin (PHA, Wellcome) for 3 days prior to use. Fresh
PHA-stimulated lymphocytes were added to the virus isolation
cultures every 3% to 4 days. Cultures were monitored for cytopathic
effect, immunofluorescence, using a broad specificity, polyclonal
reference antiserum (23), and the presence of antigen in the
culture supernatants (Innotest VcA-HIV, Innogenetics). The broad
specificity reference (BSR) anti-serum used was derived from an
HIV-1-infected donor and was shown experimentally to have an
exceptionally high titer (.gtoreq.1,000,000 in an enzyme
immunoassay based on recombinant HIV-1 p24 protein) and to
crossreact strongly with the gag and pol gene products of other HIV
types, in particular, HIV-2. Reverse transcriptase was also assayed
essentially as described (24).
[0162] In order to establish chronically infected, permanent cell
lines, virus-infected primary lymphocytes were co-cultured with
Molt 4 clone 8 cells (25), kindly provided by N. Yamamoto,
Yamaguchi, Japan, and monitored for cell growth. Virus production
was monitored by the reverse trancriptase assay as well as antigen
capturing.
[0163] Differential Antigen Capturing.
[0164] A test system was developed whereby a distinction can be
made between HIV-1 and other related human immunodeficiency
viruses. The system is based on a comparison of the ability of two
different polyclonal IgG preparations, one with a broad anti-HIV
specificity which is due its exceptionally high titer, particularly
against the major core protein, and one with a lower titer which
reacts preferentially with HIV-1% to capture detergent-treated
virus in culture supernatants. Detection of captured antigen is
achieved by using a (broad specificity IgG)/horseradish peroxidase
conjugate.
[0165] The test detects primarily but not exclusively the p24 core
protein.
[0166] Monoclonal Antibodies to HIV-1
[0167] The panel of monoclonal antibodies used has been described
(26). The antibodies were prepared against native viral proteins in
Triton X-100-disrupted HIV-1 preparations.
[0168] Protein Analysis
[0169] a. Electrophoresis.
[0170] Polyacrylamide gel electrophoresis of viral proteins was
performed essentially as described by Maizel (27).
[0171] b. Protein Blotting.
[0172] Blotting was performed either in a Bio-Rad transblot cell at
400 mA for 4 hours using the carbonate buffer described by Dunn
(28) or using the LKB semi-dry blotting apparatus at 0.8 mA/cm2 for
1 hour in 48 mM Tris, 39 mM glycine, 0.0375% sodium dodecylsulfate
(SDS) and 20% methanol.
[0173] c. Generation of Partial Cleavage Products.
[0174] Viral proteins were analyzed by the technique shown in FIG.
1. Advantage was taken of the fact that corresponding proteins from
the various isolates have similar molecular weights. Proteins were
separated on 12.5 percent SDS-polyacrylamide gels together with a
marker lane of ARV-4 proteins which was excised following
electrophoresis, blotted and incubated with an anti-HIV antiserum
to reveal the positions of the viral proteins. The marker blot was
in turn used to locate the approximate positions in the Coomassie
blue stained portion of the gel of the viral proteins to be
cleaved. Horizontal gel slices containing the proteins were
excised, transferred to glass tubes and subjected to chemical
cleavage.
[0175] 1. Cyanogen Bromide Cleavage
[0176] The gel slice was incubated with 10 ml of a freshly prepared
40 mg/ml solution of CNBr (Merck) in 0.3 N HCl for 3 hours at room
temperature in a fume hood. Following the incubation, the gel slice
was equilibrated with SDS-sample buffer for electrophoresis in the
second dimension.
[0177] 2. BNPS-Skatole Cleavage.
[0178] The gel slice was incubated with 10 ml of a freshly prepared
saturated solution of
2-(-2'-nitrophenylsulfenyl)-3-methyl-3'-bromoindoli- nine
(BNPS-Skatole, Pierce) in 70 percent acetic acid; 30% H.sub.2O
containing 0.1% phenol, for 3 hours at room temperature, protected
from light. Following the incubation, the gel slice was
equilibrated by repeated washing in SDS-electrophoresis sample
buffer.
[0179] Following cleavage, the individual lanes were excised from
the gel slices, rotated 90.degree. and placed on top of a 10 to 20
percent SDS-polyacrylamide gradient gel. On completion of
electrophoresis, the gel was blotted onto nitrocellulose
(Schleicher and Schuell) and blocked with PBS containing 1 mg/ml
casein (Merck). only cleavage products with molecular weights in
excess of 10 kD are able to be visualized since peptides with lower
molecular weights do not bind efficiently to nitrocellulose. Blots
were incubated with a broad spectrum anti-HIV antiserum followed by
goat anti-human IgG: alkaline phosphatase conjugate (Promega).
Partial cleavage products were then visualized by reaction with
5-bromo-4-chloro-3-indolylphosphate and nitro blue tetrazolium
(Sigma).
[0180] Viral Nucleic Acids
[0181] a. Hybridization to Viral RNA.
[0182] Virus from culture supernatants was harvested by pelleting
through cushions of 20% sucrose by centrifucation at 26,500 rpm for
1, 5 hrs. at 4.degree. C. and was disrupted in 10 mM Tris, pH 7.4,
10 mM NaCl, 10 mM EDTA containing 0, 5% sodium dodecylsulfate.
Aliquots of the disrupted virus were spotted onto a membrane of
Hybond H (Amersham) in amounts corresponding to 5, 2.5, 1.25 and
0.62 milliliters of original culture supernatants. The RNA
deposited onto the filter was fixed to the membrane by irradiation
with ultraviolet light for 2 hrs. The RNA bound to the filter was
then subjected to hybridization with an HIV-1 cDNA probe which had
been labeled by nick translation with 32p-dCTP. The hybridization
was carried out under stringent conditions in 3.times.SSC, 0, 5%
milk powder, 1% SDS, 10% dextran sulfate and 50% formamide at
42.degree. C. for 18 hrs. Following hybridization, the filter was
washed twice under stringent conditions in 0.1.times.SSC and 0.1%
SDS for 30 minutes. Hybridization was detected by autoradiography
at -70.degree. C. with enhancing screens. Hybridizations were
similarly performed using a probe derived from the env region of
HIV-2.
[0183] Hybridizations were also performed under nonstringent
conditions in 5.times.SSC, 25% formamide, 5.times.Denhardts
solution, 10% dextran sulfate, and 100 g/ml denatured salmon sperm
DNA at 37.degree. C. overnight. The filter was subsequently washed
4 times for 15 minutes in 5.times.SSC, 0.1% SDS at room temperature
and autoradiographed.
[0184] b. Preparation of ANT 70 cDNA
[0185] virus was pelleted from 1 liter of culture supernatant using
polyethylene glycol 6000, redissolved in PBS and pelleted through a
20% sucrose cushion. The resulting pellet of virus was disrupted in
6 M guanidinium chloride in 20 mM sodium phosphate buffer, pH 6. 5,
containing 20 mM dithiotreitol and 0.5% NP-40. Solid CsCl was added
to a concentration of 2 molar. The solution containing disrupted
virus was layered onto a cushion of 5.7 M CsCl containing 0.1 M
EDTA and the viral RNA was pelleted by centrifugation at 25,000 in
a Beckman SW 28 rotor at 15.degree. C. for 20 hrs. Following
centrifugation, the RNA was redissolved, extracted with phenol and
precipitated with ethanol and 2 M LiCl.
[0186] One-fifth of the viral RNA prepared was used to direct the
first step in the synthesis of cDNA using a kit supplied by
Amersham. cDNA synthesis was primed using oligo (dT) the synthesis
was carried out using the reverse trancriptase supplied with the
kit. Second strand synthesis was performed using E. coli DNA
polymerase I in the presence of RNase H to digest away the RNA
strand of the RNA/DNA hybrid. The synthesis of the second strand
was performed in the presence of 32P-dCTP to label the cDNA. The
resulting cDNA was treated with T4 DNA polylmerase to create blunt
ends, the cDNA was methylated to protect possible internal EcoRI
cleavage sites, and was then coupled to EcoRI linkers (Amersham).
The EcoRI sites in the linkers were then cleaved and the cDNA was
sized on a 1.2% agarose gel. The region of the gel corresponding to
a cDNA length of 500 to 2000 base pairs was excised, and the cDNA
was eluted and cloned in the vector pUC13 which had previously been
cleaved with EcoRI and dephosphorylated. After ligation, the DNA
was used to transform competent cells of E. coli MC1016 (lambda).
The resulting colonies were transferred to Pall membrane filters
(Pall Biodyne), lysed and denatured with 1.5.times.NaCl, 0.5 M NAOH
and neutralized with 3 N NaOAc, pH 5.5. Screening of colonies
harboring an insert of HIV-3 was carried out by hybridization under
moderately stringent conditions in 5.times.SSC, 5.times.Denhardts
solution, 0.2% SDS, 250 mg/ml denatured salmon sperm DNA overnight
at 65.degree. C. Hybridization was performed using the HIV-1
SacI-EcoRI fragment. Following hybridization, the filters were
washed as follows:
[0187] 1. 1 h. in 2.times.SSC, 0.1% SDS at room temperature.
[0188] 2. 30 minutes in 0.1.times.SSC, 0.1% SOS at room
temperature.
[0189] 3. 20 minutes in 2.times.SSC, 0.1 a SDS at 42.degree. C.
[0190] 4. 20 minutes in 0.1.times.SSC, 0.1% SDS at 42.degree.
C.
[0191] After washing, the filters were autoradiographed at
-70.degree. C. using intensifying screens.
[0192] Hybridizations were also performed under the nonstringent
conditions used for nonstringent hybridization of the HIV-1 and
HIV-2 probe.
[0193] c. Analysis of cDNA Clones.
[0194] Colonies giving a positive hybridization signal were grown
for analysis. Plasmids were isolated, cleaved with EcoRI and
subjected to agarose gel electrophoresis to confirm the presence of
an insert and to determine its size. Of 96 colonies analyzed 17
were found to contain inserts. Five were taken for further analysis
and ranged in size from approximately 800 to 1600 base pairs in
length.
[0195] d. Sequence Determinations.
[0196] Nucleotide sequence determinations were performed according
to the dideoxynucleotide method of Sanger (Proc. Natl. Acad. Sci.
USA 74: 5463-6467, 1977), using a kit supplied by Boehringer.
Sequencing was carried out using 17-mer M13 primers.
[0197] e. Hybridizations of ANT 70 cDNA to HIV-1 and HIV-2 Viral
RNA.
[0198] The ANT 70 cDNA clone containing the largest insert (iso
70-11) was used for hybridization to the filter onto which viral
RNAs had been deposited.
[0199] Hybridization was performed under stringent conditions in 3X
SSC, 0.5% milk powder, 1% SDS, 10% dextran sulfate, and 50%
formamide at 42.degree. C for 18 hrs. Following hybridization, the
filter was washed with 0.1.times.SSC, 0.1% SDS at 65.degree. C.
(2-30 minute washes) after which the filter was autoradiographed at
-70.degree. C. with an intensifying screen.
[0200] Results
[0201] Virus Isolation
[0202] As part of a continuing study on heterosexual transmission
of HIV, a virus isolation was performed from blood from a
Camerounian woman and her partner. As before, the two isolated
strains will be named HIV-3 (ANT 70) (woman) and HIV-3 (ANT 70 NA)
(man), respectively. For convenience, the shorter terms ANT 70 and
ANT 70 NA will also be used. The woman is the partner of an
HIV-seropositive man with generalized lymphadenopathy. Serum from
the woman was moderately positive (ratio O.D./cut-off of 4.5) in
the enzyme-linked immunosorbent assay (EIA, Organon Teknika) and
had a low titer (1/40) in the immunofluorescent antibody assay for
HIV-1 but gave ambiguous results in the HIV-1 Western blot assay
with clear bands at p33, P53/55 and p64 but very weak bands at p24,
gp41 and gp120. The woman had elevated serum IgG and IgM levels and
a CD4/CD8 ratio of 0.46. Virus was isolated by co-cultivation of
the woman's lymphocytes with PHA-stimulated lymphocytes from
healthy uninfected donors. After 52 days in culture, virus was
detected in the culture as judged by the presence of syncytia and
on the basis of positive immunofluorescence observed when a
laboratory reference anti-HIV antiserum was incubated with
acetone-fixed cells from the culture. The presence of reverse
transcriptase was also detected in the culture supernatant (10 4
cpm/ml, 27.times.background). Cell-free culture supernatant was
used to passage the virus on fresh lymphocytes. After 15 days, CPE
was again observed and reverse transcriptase detected in the
supernatant. A comparison of detergent-treated culture supernatant
from this isolate (ANT 70) with other isolates by differential
antigen capturing revealed, however, that this isolate was not
HIV-1.
[0203] These results are illustrated in FIG. 2. It is evident by
the lower O.D. values that the isolate (ANT 70) is, in contrast to
the other isolates, poorly recognized by the HIV-1 specific IgG
but, like the other isolates, was readily captured by the broad
specificity IgG (panel F). The other isolates, which were
subsequently all shown to be HIV-1 strains using an HIV-1 specific
M (CLB MAb 14), all gave higher O.D. values on the plates coated
with specific IgG than on plates coated with the broad specificity
reference IgG.
[0204] An attempt was made to transfer the virus to a permanent
cell line by co-cultivating isolate (ANT 70)-infected primary
lymphocytes with Molt-4 clone 8 cells. In the initial phase of the
infection, extensive cytopathic effect was observed with syncytium
formation and cell death. Within several weeks, cell growth was
detected. The cells gave a positive imunofluorescence when tested
using a broad spectrum anti-HIV antiserum and the presence of
antigen and reverse transcriptase was easily detectable in the
culture supernatant.
[0205] Virus was similarly isolated from the partner of the woman
from whom isolate (ANT 70) was isolated (strain ANT 70 NA) The man
was suffering from lymphadenopathy and was classified as class 3
according to the CDC classification system. The man also had
elevated serum IgM and IgG levels and a CD4/CD8 ratio of 0.4. Virus
was detected in the supernatant of the culture on day 18.
Detergent-treated supernatant containing this virus was also
analyzed by differential antigen capturing and found to react in a
manner similar to isolate (ANT 70) (FIG. 3). The binding of antigen
derived from this isolate was again less with HIV-1 specific IgG
than with the broad specificity IgG.
[0206] Serum from the person from whom the isolate (ANT 70 NA) was
derived was incubated with HIV-1 and HIV-2 Western blot strips
(Biotech) Additional strips were also incubated with serum from a
donor infected with HIV-1 as well as serum from the person from
whom HIV-2 (isolate 53) was isolated. These results are shown in
FIG. 4. Serum from the person infected with ANT 70 NA crossreacted
to a significant extent with virtually all HIV-1 proteins,
including the envelope proteins. In contrast, serum from the
HIV-2-infected individual crossreacted only with the gag p24
protein, p34 endonuclease and p68 reverse transcriptase. The
anti-HIV-1 serum recognized only the p26 gag protein of HIV-2,
while serum from the carrier of ANT 70 NA recognizes this protein
and the HIV-2 reverse transcriptase.
[0207] Characterization of Viral Proteins.
[0208] Virus in the culture supernatant was precipitated using
polyethylene glycol 6000 (Merck) and the resulting material was
redissolved and pelleted through a 15 percent sucrose cushion. The
pelleted virus was dissociated in SOS-sample buffer and analyzed by
polyacrylamide gel electrophoresis followed by protein blotting.
The blot, shown in FIG. 5, was incubated with a broad specificity
anti-HIV serum to reveal the viral proteins.
[0209] In addition to reacting with all of the HIV-1 viral
proteins, the BSR antiserum also crossreacts with the gag and pol
gene products of HIV-2. This antiserum clearly recognizes the gag
and pol gene products of ANT 70 as well. It is evident that the
molecular weights of the ANT 70 gene products differ from those of
either HIV-1 or HIV-2. The molecular weights of the various viral
proteins are summarized in table 1. The variability in the HIV-1
p17/p18 protein is due to a 6 amino acid insertion which is present
in some strains between positions 120 and 121 in the HIV-1 HXB2
sequence. A comparison of the proteins from ANT 70 and ANT 70 NA
are shown in FIG. 6. The molecular weights of all of the proteins
of ANT 70 NA are identical to those of ANT 70.
[0210] In order to investigate further the antigenic relationship
between HIV-1, HIV-2 and ANT 70, a series of African and European
anti-HIV-1 sera were diluted 1:1000 and used to coat microwell
plates for antigen capturing.
[0211] Detergent-treated culture supernatant containing HIV-1, ANT
70, HIV-2 (LAV-2rod) and HIV-2 (isolate 53) were diluted and the
ability of each antiserum to capture the four different isolates
was analyzed. Representative results are shown in FIG. 7. It can be
seen from this experiment that the ability of the various sera to
capture HIV-1 is in no way related to their ability to capture
either HIV-2 or ANT 70. In contrast, the ability of these sera to
capture LAV-2rod, the prototype HIV-2 strain, is strongly
correlated with the ability of these sera to capture isolate 53,
which is also an HIV-2 strain but an independent isolate. These
data indicate that ANT 70 is neither HIV-1 nor HIV-2.
[0212] In a series of related antigen capturing experiments, four
African anti-HIV-1 sera were chosen in order to access their
ability to bind HIV-1, ANT 70, HIV-2 (LAV-2rod) and HIV-2 (isolate
53) when the IgGs were coated at different dilutions. Culture
supernatants were diluted so as to give approximately the same
optical density when captured on plates coated with the IgG used in
panel B of FIG. 8. Dilutions of the four sera were coated and
virus-containing supernatant was added. The assumption was made
that similar viruses should give rise to similar titration curves.
Indeed, in FIG. 5, LAV-2rod and isolate 53 both react similarly
with the coated IqGs. On the other hand, ANT 70 gave more intense
signals at higher IgG dilutions than did either of the HIV-2
isolates and the shapes of the curves obtained with ANT 70 resemble
more closely the curves obtained for HIV-1, except that the optical
densities are consistently lower.
[0213] Cross Reactivity of Mouse Monoclonal Antibodies Directed
Against HIV-1 p24 Core Protein.
[0214] A panel of mouse monoclonal antibodies (MAbs) prepared
against the HIV-1 p24 core protein was tested for their ability to
crossreact with ANT 70 and HIV-2 isolates. In principle, any panel
of anti-HIV-1 p24 monoclonal antibodies can be used, as long as the
series includes monoclonal antibodies which react with different
epitopes on the HIV-1 p24 molecule. Ascites fluid containing the
antibodies was diluted and used to coat microwell plates.
Detergent-treated, virus-containing supernatants were then added to
the coated wells. Bound antigen was detected using BSR-HIV IgGs
conjugated to horseradish peroxidase. The results obtained are
shown in FIG. 9.
[0215] In control wells coated with polyclonal broad spectrum IgGs,
all virus-containing supernatants gave optical densities which
exceeded the limits of the microwell plate reader. However, when
tested in wells coated with the various monoclonal antibodies,
quite a different pattern emerged. Previous studies indicated that
all of the MAbs tested react against different epitopes on the p24
molecule with the exception of MAbs CLB 59 and CAB 21 which have
been shown to recognize the same epitope. Both of these two MAbs
react strongly with HIV-1 as expected and also give a measurable
signal with ANT 70 but fail to react with either of the HIV-2
strains. Two other MAbs, CLB 64 and CLB 14, bound HIV-1 well and
showed a weak affinity for ANT 70 as well as the two HIV-2
isolates. In particular, MAb CLB 14 has been shown to recognize all
HIV-1 isolates well (>150 tested). This MAb must therefore bind
to a very highly conserved epitope, remnants of which can also be
detected in other human immunodeficiency viruses. The other MAbs to
p24 (CLB 16, 47 and 19.7) and two others which were raised against
the HIV-1 p18 protein (CLB 13.4 and CLB 13.6), failed to recognize
either ANT 70 or the two HIV-2 isolates but did capture the
corresponding HIV-1 antigens.
[0216] Reaction of Human Anti-HIV Antisera to Viral Proteins.
[0217] Protein blots of viral proteins from HIV-1 (ARV 4), ANT 70
and HIV-2 (LAV2rod) were prepared after electrophoresis of
detergent-solubilized extracts and incubated with various human
sera (FIG. 10). Panel A shows the reaction of the broad specificity
laboratory reference serum with the three virus isolates. In panel
B, an anti-HIV-1 antiserum was incubated with the blot and
recognizes preferentially HIV-1 proteins. Serum from the woman from
whom ANT 70 was isolated (panel C) and her partner from whom ANT 70
NA was isolated (panel D) were tested for their ability to
recognize other viral isolates. Both of these sera preferentially
recognize ANT 70 including the gp120 envelope protein of this
virus. Serum from the partner has a higher titer than serum from
the woman from whom ANT 70 was isolated and recognizes the gp41 of
HIV-1. Both of these sera have a higher affinity for ANT 70 than
for HIV-1 or the HIV-2 isolates. In contrast, serum from the person
from whom HIV-2 isolate 53 was isolated binds preferentially to
HIV-2 proteins and recognizes the HIV-2 gp120 envelope protein of
this virus as well as the gp41% transmembrane protein (panel E). It
does not react with glycoproteins of HIV-1 or ANT 70. These results
further indicate that ANT 70 is different from either HIV-1 or
HIV-2.
[0218] Enzyme immunosorbent assays using coated viral proteins
titrations of anti-HIV-1 , anti-ANT 70 and anti-HIV-2 sera were
performed in microwell plates coated with HIV-1 (ARV-4), ANT 70 and
HIV-2 (isolate 53) viral lysates. Two-fold dilutions of each sera,
beginning at an initial dilution of 1:100, were tested for their
ability to bind to the coated antigen. Bound antibody was detected
using a horseradish peroxidase-labeled goat anti-human IgG
conjugate. These results are shown in FIG. 11. The anti-HIV-1 serum
recognized preferentially the HIV-1 proteins but shows a
significant amount of crossreaction with ANT 70 proteins. The HIV-2
proteins were barely detected. In contrast, anti-ANT 70 serum
preferentially recognized ANT 70 proteins, showed crossreactivity
toward HIV-1 proteins, and reacted better with the HIV-2 coated
wells than did the anti-HIV-1 serum as evidenced by the higher
optical density values obtained. The anti-HIV-2 serum had a very
low titer but nevertheless reacted best with HIV-2 proteins. No
detectable signal was observed on HIV-1 or ANT 70 coated wells. The
inability to detect crossreaction in this instance is undoubtedly
related to the low anti-HIV titer of this serum.
[0219] Analysis of Partial Chemical Cleavage Products of Viral
Proteins.
[0220] The two reagents used for chemical cleavage, cyanogen
bromide and BNPS-skatole, were chosen because of their high
specificities for methionone (29) and tryptophan (30),
respectively. These two amino acids are also rather hydrophobic and
are therefore also less likely to found located in epitopes on the
outer surfaces of protein molecules (31). Examination of published
amino sequences of the gag and pol gene products of HIV-1 (32-36),
HIV-2 (19), SIVagm (10), SIVmac (9), equine infectious anemia virus
(EIAV,37) and Visna (38) reveals that while there is little amino
acid homology between some of these diverse isolates, many of the
positions of the methionine residues in these proteins and, to an
even greater extent, the tryptophan residues, are strikingly
conserved (FIG. 12). Futhermore, intraspecies variation in these
residues is minimal or absent, at least in the case of HIV-1 (36)
and probably holds true for all of the human and simian
immunodeficiency retroviruses.
[0221] The partial digestion patterns of the gag and Sol gene
products of HIV-1, ANT 70, HIV-2 (LAVrod) and HIV-2 (isolate 53)
are shown in FIG. 13.
[0222] Inspection of the CNBr cleavage patterns of the p24 protein
from the four isolates reveals that the patterns generated for
HIV-2 (LAV-2rod) and HIV-2 (isolate 53) are identical. Different
patterns, however, are observed for HIV-1 and for ANT 70. Thus,
significant differences exist in the locations of the methionine
residues in the major core protein of HIV-1, ANT 70 and HIV-2. In
the case of the p17 core protein, differences are observed between
the two HIV-2 isolates. Inspection of the published sequence for
HIV-2rod indicates that there is a methionine located 18 amino
acids from the carboxyl terminus of this protein. We conclude that
this methionine must be absent in the corresponding protein from
isolate 53. From the cleavage pattern it is also possible to deduce
the presence of a methionine near (10-15 amino acids) one of the
termini of the p16 from ANT 70. CNBr cleavage of the retroviral
reverse transcriptase reveals that again, the proteins from the two
HIV-2 isolates are identical, while different patterns are observed
for both HIV-1 and ANT 70 proteins. In the case of the p31
endonuclease derived from the 3'-portion of the pol gene,
similarities can be deduced between all of the isolates although
some minor differences are apparent.
[0223] BNPS-skatole cleavage of the p24 proteins from the four
isolates results in strikingly similar patterns. It is evident from
FIG. 8 that this is to be expected since the tryptophan positions
in this protein are very highly conserved, particularly for the
retroviruses of human and simian origin. We conclude that the
tryptophan positions in the ANT 70 p25 protein also conform to this
pattern. Inspection of the patterns reveals, however, that minor
differences can be observed, not in the overall appearance of the
pattern but rather in the apparent molecular weights of the species
generalized by cleavage. In particular, differences are detected in
the apparent molecular weights of the central spots in each
pattern. As expected, the patterns for HIV-2 (LAV-2rod) and HIV-2
(isolate 53) are identical. The central spot in the pattern for ANT
70 has however, a larger apparent molecular weight while the
central spot for HIV-1 (ARV-4) has a lower molecular weight. In
regard to the p16,the positions of the tryptophans in the ANT 70
protein appear to resemble more closely the positions of the
tryptophans found in the HIV-2 protein. The HIV-1 p17 has a
tryptophan located 16 amino acids from the amino terminus of the
protein and gives rise to an additional spot not seen in the ANT 70
and HIV-2 patterns following BNPS-skatole cleavage. The tryptophan
corresponding to the one at position 36 in the HIV-1 p17 sequence
is conserved in all isolates.
[0224] The patterns generated by cleavage of the reverse
transcriptase from the four isolates are complex but is is once
again apparent that the two HIV-2 isolates are identical. Patterns
are obtained for ANT 70 which corresponds neither to the pattern
obtained for HIV-1 nor to the HIV-2 pattern. Differences in
apparent molecular weights of the cleavage products of the p31
endonuclease are also observed but the patterns generated from the
corresponding proteins from HIV-1, ANT 70, and HIV-2 also show
common features which suggests a conserved structure.
[0225] Results
[0226] Viral Nucleic Acids
[0227] a. Hybridization of HIV-1 and HIV-2 cDNA to Viral RNAs.
[0228] Nucleicacids crosshybridization between HIV-1 and RNA from
the viruses HIV-2 and ANT 70 was evaluated by performing the
hybridization with the SacI-BglII HIV-1 restriction fragment which
had been inserted into the vector pUC13. This fragment contains a
portion of the 5' LTR, including the R region, the entire gag gene
and most of the pol gene of HIV-1. Under stringent hybridization
conditions, hybridization was only observed between this probe and
the RNA derived from HIV-1 (SF4). No hybridization was observed
between the probe and either HIV-2 or ANT 70 (FIG. 14). This
indicates that the gag and pol regions of HIV-2 and ANT 70 are
significantly different from the corresponding region of HIV-1.
[0229] The HIV-2 probe used contains a sequence of approximately
1000 base pairs derived from the env gene of HIV-2. This probe
hybridized only to HIV-2 RNA under stringent hybridization
conditions and no hybridization was observed with either HIV-1 or
HIV-3.
[0230] b. Homology Between ANT 70 cDNA and Sequences of HIV-1 and
HIV-2.
[0231] The cDNA cloneiso 70-11 was used as a probe to assess the
degree of nucleic acid homology between the various virus isolates.
The filter onto which aliquots of HIV-1 , HIV-2 and ANT 70 had been
deposited was subjected to hybridization under stringent
conditions. The results are also shown in FIG. 14. The experiment
demonstrates that under stringent hybridization conditions, no
crosshybridization can be detected between any of the virus
isolates. The ANT 70 derived probe hybridizes only to ANT 70.
[0232] c. Sequence Analysis of Clone Iso 70-11.
[0233] Subclones of the insert were made in pUC13 and sequenced
using the dideoxynucleotide method:
[0234] The presence of a poly A tail confirmed that the iso 70-11
insert is derived from the 3' end of the viral RNA. Adjacent to the
poly A tail is the sequence corresponding to the R region of the
viral 3' LTR. Sequence contained in the ANT 70 cDNA and the viral
sequences to which they correspond are shown below:
2 10 20 30 40 50 60 CCCATGGATT TGAAGATACA CATAAAGAAA TACTGATGTG
GAAGTTTGAT AGATCTCTAG 70 80 90 100 110 120 GCAACACCCA TGTTGCTATG
ATAACTCACC CAGAGCTCTT CCAGAAGGAC TAAAAACTGC 130 140 150 160 170 180
TGACCTGAAG ATTGCTGACA CTGTGGAACT TTCCAGCAAA GACTGCTGAC ACTGCGGGGA
190 200 210 220 230 240 CTTTCCAGTG GGAGGGACAG GGGGCGGTTC GGGGAGTGGC
TAACCCTCAG AAGCTGCATA 250 260 270 280 290 300 TAAGCAGCCG CTTTCTGCTT
GTACCGGGTC TCGGTTAGAG GACCAGGTCT GAGCCCGGGA .vertline. U3
.rarw..vertline..fwdarw. R 310 320 330 340 350 360 GCTCCCTGGC
CTCTAGCTGA ACCCGCTCGT TAACGCTCAA TAAAGCTTGC CTTGAGTGAG
Polyadenylation signal A - POLY A .rarw..vertline.
[0235]
3 10 20 30 40 50 60
AACATGGGAAACGCATTGAGAAAAGGTAAATTTGAGGGATGGGCAGCAGTAAGAGAAAGA
AsnMetGlyAsnAlaLeuArgLysGlyLysPheGluGlyTrpAlaAlaValArgGluArg 70 80
90 100 110 120
ATGAGAAGAACTAGAACTTTCCCTGAGTCTGAACCATGCGCACCTGGAGTAGGACAGATC
SerArgGluLeuAlaAlaArgGlyGlyIleProSerSerHisThrProGlnAsnAsnAla 130
140 150 160 170 180
TCCAGGGAATTAGCAGCTAGAGGAGGGATACCAAGTTCCCATACTCCTCAAAACAATGCA
SerArgGluLeuAlaAlaArgGlyGlyIleProSerSerHisThrProGlnAsnAsnAla 190
200 210 220 230 240
GCCCTTGCATTCCTAGAAAGTCACCAAGAGGAAGAAGTAGGTTTCCAGTAGCACCTCAA
ValProLeuArgProMetThrTyrLysGlyAlaPheAspLeuSerPhePheLeuLysGlu 250
260 270 280 290 300
GTGCCTCTAAGGCCAATGACCTATAAAGGAGCATTTGACCTCAGCTTCTTTTTAAAAGAA
ValProLeuArgProMetThrTyrLysGlyAlaPheAspLeuSerPhePheLeuLysGlu 310
320 330 340 350 360
AAGGGAGGACTGGAAGGGTTAATTTACTCCCATAAAAGAGCAGAAATCCTGGATCTTTGG
LysGlyGlyLeuGluGlyLeuIleTyrSerHisLysArgAlaGluIleLeuAspLeuTrp
GTGTATAA ValTyr
[0236] Discussion
[0237] We have isolated a novel human immunodeficiency-associated
retrovirus from a Camerounian woman (ANT 70) and her partner (ANT
70 NA). At the time the original virus isolation was performed, the
woman was only slightly seropositive, gave ambiguous results in the
western blot test and was clinically asymptomatic. Since that time,
the woman has begun to develop some of the symptoms of AIDS-related
complex (ARC). In contrast, her partner, from whom we were also
able to isolate a virus with the same characteristics as the
original isolate, was suffering from lymphadenopathy and has since
developed other symptoms characteristic of AIDS. This novel isolate
may therefore be considered to be a human immunodeficiency virus.
The fact that this same virus could be isolated from sexual
partners also suggests a mode of transmission which is similar to
that of human retroviruses.
[0238] The virus was first recognized as being different from HIV-1
on the basis of its altered ability to be captured in a
differential antigen capturing assay. This has proven to be a
highly reliable test which is able to distinguish between HIV-1 and
non-HIV-1 strains. That this isolate is not HIV-1 is borne out at
the protein level by 1.) the differing molecular weights of the
viral proteins, 2.) a different pattern of crossreactivity with
anti-HIV-1 antiserum than HIV-1, 3.) a drastically reduced ability
to be recognized by mouse monoclonal antibodies raised against
HIV-1 p24 and p17 core proteins, 4.) preferential recognition of
ANT 70 proteins over HIV-1 proteins by antisera from the virus
carrier, and 5.) patterns of partial cleavage of four of the most
highly conserved viral proteins which do not match the patterns
obtained when HIV-1 proteins are subjected to the same treatment.
Nevertheless, sera from the two individuals infected with this
virus recognize the HIV-1 gp41 envelope protein. By the same
criteria listed above, it is also clear that ANT 70 is not HIV-2.
Indeed, the antigenic differences between ANT 70 and HIV-1 are
smaller than those between HIV-2 and HIV-1. This is particularly
evident from the results presented in FIGS. 8 and 10.
[0239] Additional compelling evidence that ANT 70 is a unique virus
different from HIV-1 and HIV-2 comes from the partial peptide maps.
We have shown that there are significant differences in the most
highly conserved viral proteins. The two HIV-2 isolates which were
used for comparison gave essentially identical cleavage patterns
except in the case of CNBr cleavage of the p17 core protein. It
should be noted, however, that the p17 core protein exhibits more
variability than the p24 protein, at least in HIV-1 strains (34).
Whether or not this also holds true for HIV-2 awaits sequence
determination on more strains than have been analyzed to date.
[0240] In light of the fact that ANT 70 is antigenically more
closely related to HIV-1 than is HIV-2, as evidenced by a higher
degree of crossreactivity which extends even to the gp41 envelope
protein, was essential to establish that ANT 70 was more than
simply a genetic variant of HIV-1. This was possible by
investigating the locations of some of the most highly conserved
amino acids in a number of viral proteins which are least subject
to genetic variation. That major differences were noted in the
cleavage patterns indicates that HIV-1, HIV-2 and ANT 70 are three
genetically distinct viruses. On the other hand, the same series of
experiments also revealed similarities between the viruses which
may indicate that all three arose from a common progenitor.
[0241] The hybridization data also support the notion that ANT 70
is fundamentally different from either HIV-1 and HIV-2. As long as
the conditions under which the hybridization is performed are
stringent, a distinction can easily be made between the three virus
types.
[0242] Analysis of the cDNA sequences revealed that the insert is
derived from the 3' end of the viral genome. An analysis of the
homology between these sequences and the sequence of HIV-1 and
HIV-2 reveal that ANT 70 is somewhat more closely related to HIV-1,
particularly in the LTR sequences (approx. 70% homology). The
differences are nevertheless of such magnitude as to rule out the
possibility that ANT 70 is simply a genetic variant of HIV-1. The
ANT 70 3'LTR also contains the signal sequences which are typical
of retroviral LTRs.
[0243] The existence of a third type of human immunodeficiency
virus has immediate epidemiological implications and consequences
for blood bank testing. As has been shown, antibodies from people
infected with this virus react preferentially with this virus,
although these antibodies also crossreact with HIV-1 proteins.
While it was possible to detect a positive reaction of ANT 70 NA
serum in enzyme immunoassays, immunofluorescence assays and Western
Blot assays based on HIV-1 proteins, the fact that the positive
signal was due to a crossreaction inevitably implies that the
sensitivity of such tests will be less for antibodies produced in
response to this virus. This was amply demonstrated by the enzyme
immunoassay results (FIG. 11). Furthermore, one criterion for
seropositivity in the Western blot assay is the presence of
detectable antibodies to both gag and/or pol protein and one of the
envelope proteins. Since in the case of the two individuals
infected with ANT 70 and ANT 70 NA, respectively, crossreaction was
observed to both HIV-1 p24 and the envelope proteins, the
conclusion which is invariably drawn is that these individuals are
infected with HIV-1 but for some reason fail to develop high titers
against HIV-1. It is possible therefore, that this virus is more
widespread than is currently realized. From an epidemiological
standpoint, it is essential to develop specific diagnostic tests
for this virus in order to evaluate the limits of the geographical
area in Africa in which the virus can be found, and to evaluate the
extent to which this virus has been disseminated.
[0244] REFERENCES
[0245] 1. Dalgleish, A. G., Beverly, P. C. L., Clapham, P. R.,
Crawford, D. H., Greaves, M. F. and Weiss, R. A. (1984).
[0246] The CD4 (T4) antigen is an essential component of the
receptor for the AIDS retrovirus.
[0247] Nature 312: 763-766.
[0248] 2. Maddon, P. J., Dalgleish, A. G., McDougal, J. S.,
Clapham, P. R., Weiss, T. A. and Axel, R. (1986).
[0249] The T4 gene encodes the AIDS virus receptor and is expressed
in the immune system and the brain.
[0250] Cell 47: 333-348.
[0251] 3. Wong-Staal, F. and Gallo, R. C. (1985).
[0252] Human T-lymphotropic retroviruses.
[0253] Nature 317: 395-403.
[0254] 4. Clavel, F., Guetard, D., Brun-Vezinet, F., Chamaret, S.,
Rey, M. A., Santos-Ferriera, M. D., Laurent, A. G., Dauguet, C.,
Katlama, C., Rouzioux, C., Klatzmann, D., Champalimaud, J. L. and
Montagnier, L. (1986).
[0255] Isolation of a new human retrovirus from West-African
patients with AIDS.
[0256] Science 233: 343-346.
[0257] 5. Albert, J., Bredberg, U., Chiddi, F., Bottinger, B.,
Fenyo, E. M., Norrby, E. and Biberfeld, G. (1987).
[0258] New pathogenic human retrovirus of West-African origin (SBL
6669) and its relationship to HTLV-IV, LAV-II and HTLV-III3.
[0259] AIDS Res.
[0260] 6. Kanki, P. J., Kurth, R., Becker, W., Dreesman, G.,
McLane, M. F. and Essex, M.
[0261] Antibodies to simian T-lymphotropic virus type III in
African green monkeys and recognition of STLV-1Z1 viral protein by
AIDS and related sera.
[0262] Lancet 1985, i: 1330-1332.
[0263] 7. Kanki, P. J., Alroy, J. and Essex, M. (1985).
[0264] Isolation of T-lymphotropic retrovirus related to
HTLV-III/LAV from wild-caught African green monkeys.
[0265] Science 230: 951-954.
[0266] 8. Daniel, M. D., Letvin, N. L., King, N. W., Kannagi, M.,
Sehgal, P. K., Hunt, R. D., Kanki, P. J., Essex, M. and Desrosiers,
R. C. (1985).
[0267] Isolation of T-cell tropic HTLV-III-like retrovirus from
macaques.
[0268] Science 228: 1201-1204.
[0269] 9. Chakrabarti, L., Guyader, M., Alizon, M., Daniel, M. D.,
Desrosiers, R. C., Tiollais, P., and Sonigo, P. (1987).
[0270] Sequence of simian immunodeficiency virus from macaque and
its relationship to other human and simian retroviruses.
[0271] Nature 328: 543-547.
[0272] 10. Franchini, G., Gurgo, C., Guo, H. G., Gallo, R. C.,
Collati, E., Fargnoli, K. A., Hall, L. F., Wong-Staal, F. and
Reitz, M. S. Jr. (1987).
[0273] Sequence of simian immunodeficiency virus and its
relationship to the human immunodeficiency viruses.
[0274] Nature 328: 539-543.
[0275] 11. Benn, S., Rutledge, R., Folks, T., Gold, J., Baker, L.,
McCormick, J., Feorino, P., Piot, P., Quinn, T., and Martin, M.
(1985)
[0276] Genomic heterogeneity of AIDS retroviral isolates from North
America and Zaire.
[0277] Science 230: 949-951.
[0278] 12. Hahn, B. H., Shaw, G. M., Taylor, M. E., Redfield, R R.,
Markham, P. D., Salahuddin, S. Z., Wong-Staal, F., Gallo, R. C.,
Parks, E. S. and Parks, W. P. (1986).
[0279] Genetic variation in HTLV-III/LAV over time in patients with
AIDS or at risk for AIDS.
[0280] Science 232: 1548-1553.
[0281] 13. Magasiny, S., Spire, B., Barre-Sinoussi, F. and
Chermann, J.-C. (1986).
[0282] Genomic varaibility of selected LAV-related AIDS
retroviruses.
[0283] AIDS Res. 2: 19-30.
[0284] 14. Alizon, M., Wain-Hobson, S., Motagnier, L. and Sonigo,
P. (1985).
[0285] Genetic variability of the AIDS virus: nucleotide sequence
analysis of two isolates from African patients.
[0286] Cell 46: 63-74.
[0287] 15. Starcich, B. R., Hahn, B. H., Shaw, G. M., McNeely, P.
D., Modrow, S., Wolf, H., Parks, E. S., Parks, W. P., Josephs, S.
F., Gallo, R. C., Wong-Staal, F. (1986).
[0288] Identification and characterization of conserved and
variable regions in the envelope gene of HTLV-III/LAV, the
retrovirus of AIDS. Cell 45: 637-648.
[0289] 16. Willey, R. L., Rutledge, R. A., Dias, S., Folks, T.,
Theodore, T., Buckler, C. E. and MArtin, M. A. (1986).
[0290] Identification of conserved and divergent domains within the
envelope gene of the ecquired immunodeficiency syndrome
retrovirus.
[0291] Proc. Natl. Acad. Sci. USA 83: 5038-5042.
[0292] 17. Clavel, F., Guyader, M., Guetard, D., Sall, M.,
Montagnier, L. and Alizon, M. (1986).
[0293] Molecular cloning and polymorphism of the human immune
deficiency virus type 2.
[0294] Nature 324: 691-695.
[0295] 18. Hahn, B. H., Kong, L. I., Lee, S.-W., Kumar, P., Taylor,
M. E., Arya, S. K. and Shaw, G. M. (1987).
[0296] Relationship of HTLV-4to simian and human
immunodeficiency-associat- ed viruses.
[0297] Nature 300: 184-186.
[0298] 19. Guyader, M., Emerman, M., Sonigo, P., Clavel, F.,
Montagnier, L. and Alizon, M. (1987).
[0299] Genome organization and transactivation of the human
immunodeficiency virus type 2.
[0300] Nature 326: 662-669.
[0301] 20. Levy, J. A., Hoffman, A. D., Kramer, S. M., Landis, J.
A., Shimabukuro, J. M. and Oshiro, L. S. (1984).
[0302] Isolation of lymphocytopathic retroviruses from San
Francisco patients with AIDS.
[0303] Science 225: 840-842.
[0304] 21. Vanderborght, B., De Leys, R. J., Van Heuverswyn, H.,
Merregaert, J., Prinsen, H., Nijs, P. Vercauteren, G., and van der
Groen, G. (1988).
[0305] Submitted for publication.
[0306] 22. Levy, J. A. and Shimabukuro, J. (1985).
[0307] Recovery of AIDS-associated retroviruses from patients with
AIDS or AIDS-related conditions and from clinically healthy
individuals.
[0308] J. Infect. Dis. 152: 734-738.
[0309] 23. van der Groen, G., Vercauteren, G. and Piot, P.
(1987).
[0310] Immunofluorescence tests for HIV antibody and their value as
confirmatory tests.
[0311] J. Virol. Seth. 17: 35-43.
[0312] 24. Hoffman, A. D., Banapour, B. and Levy; J. A. (1985).
[0313] Characterization of the AIDS-associated retrovirus reverse
transcriptase and optimal conditions for its detection in
virions.
[0314] Virology 147: 326-335.
[0315] 25. Kikukawa, R., Koyanagi, Y., Harada, S., Kobayashi, N.,
Hatanaka, M. and Yamamoto, U. (1986).
[0316] Differential susceptibility to the acquired immunodeficiency
syndrome retrovirus in cloned cells of human leukemic T-cell line
Molt-4.
[0317] J. Virol. 57: 1159-1162.
[0318] 26. Winkel, I. N., Tersmette, M., Miedema, F. and Huisman,
J. G. (1987).
[0319] Identification of gag-epitopes by a panel of MAb in a series
of HIV isolates.
[0320] Abstracts of the Third International Conference on AIDS,
Washington D.C., USA, p. 116.
[0321] 27. Maizel, J. V. (1971).
[0322] Polyacrylamide gel electrophoresis of viral proteins; in
Methods in Virology, Vol. 5, pp: 180-246, K. Maramorusch and H.
Koprowski, Editor, Academic Press, New York, London.
[0323] 28. Dunn, S.D. (1986)
[0324] Effects of the modification of transfer buffer composition
and the renaturation of proteins in gels on the recognition of
proteins on Western blots by monoclonal antibodies.
[0325] Anal. Siochem. 157: 144-153.
[0326] 29. Gross, E. and Witkop, B. (1961).
[0327] Selective cleavage of methionyl peptide bonds in RNAase with
CNBr.
[0328] J. Am. Chem. Soc. 83: 1510-1511.
[0329] 30. Fontana, T. P. and woods, K. R. (1981).
[0330] Modification of tryptophanyl residues with BNPS-Skatole.
[0331] Meth. Enzymol. 25/ 419-423.
[0332] 31. Hopp, T. P. and Woods, K. R. (1981).
[0333] Prediction of protein antigenic determinants from amino acid
sequence.
[0334] Proc. Natl. Acad. Sci. USA 78: 3824-3828.
[0335] 32. Wain-Hobson, S., Sonigo, P., Danos, O., Cole, S. and
Alizon, M. (1985).
[0336] Nucleotide sequence of the AIDS virus, LAV.
[0337] Cell 40: 9-17.
[0338] 33. Ratner, L., Haseltine, W., Patarca, R., Livak, K. J.,
Starcicti, B., Josephs, S. F., Doran, E. R., Rafalski, J. A.,
Whitehorn, E. A., Baumeister, K., Ivanoff, L., Petteway, S. R. Jr.,
Pearson, M. L., Lautenberger, J. A., Papas, T. S., Ghrayes, J.,
Chang, N. T., Gallo, R. C. and Wong-Staal, F. (1985)
[0339] Complete nucleotide sequence of the AIDS virus,
HTLV-III.
[0340] Nature 313: 277-284.
[0341] 34. Sanchez-Pescador, R., Power, M.D., Barr, P. J., Steimer,
K. S., Stempien, M. M., Brown-Shimer, S. L., Gee, W. W., Renard,
A., Randolph, A., Levy, J. A., Dina, D. and Luciw, P. (1985).
[0342] Nucleotide sequence and expression of an AIDS-associated
retrovirus (ARV-2)
[0343] Science 227: 484-492.
[0344] 35. Muesing, M. A., Smith, D. H., Cabradillo, C. D., Benton,
C. V., Laskey, L A. A and Capon, D. J. (1985).
[0345] Nucleic acid structure and expression of the human
AIDS/lymphadenopathy retrovirus.
[0346] Nature 313: 450-458.
[0347] 36. Human retroviruses and AIDS. (1987).
[0348] G. Meyers, A. B. Rabson, S. F. Josephs, T. F. Smith and F.
Wong-Staal, Editors.
[0349] Los Alamos National Laboratory, Los Alamos, New Mexico,
USA.
[0350] 37. Kawakami, T., Sherman, L., Dahlberg, J., Gazit, A.,
Yaniv, A., Tronick, S. and Aarsonson, S. A. (1987).
[0351] Nucleotide sequence analysis of Equine Infectious Anemia
Virus proviral DNA.
[0352] Virology 158: 300-312.
[0353] 38. Sonigo, P., Alizon, M., Staskus, K., Klatzmann, D.,
Cole, S., Danos, O. Retzel, E., Tiollais, P., Haase, A. and
Wain-Hobson, S. (1985).
[0354] Nucleotide sequence of the Visna lentivirus: relationship to
the AIDS virus.
[0355] Cell 42: 369-382.
* * * * *